The analysis of APOL1 genetic variation and haplotype diversity provided by 1000 Genomes project.
Peng, Ting; Wang, Li; Li, Guisen
2017-08-11
The APOL1 gene variants has been shown to be associated with an increased risk of multiple kinds of diseases, particularly in African Americans, but not in Caucasians and Asians. In this study, we explored the single nucleotide polymorphism (SNP) and haplotype diversity of APOL1 gene in different races provided by 1000 Genomes project. Variants of APOL1 gene in 1000 Genome Project were obtained and SNPs located in the regulatory region or coding region were selected for genetic variation analysis. Total 2504 individuals from 26 populations were classified as four groups that included Africa, Europe, Asia and Admixed populations. Tag SNPs were selected to evaluate the haplotype diversities in the four populations by HaploStats software. APOL1 gene was surrounded by some of the most polymorphic genes in the human genome, variation of APOL1 gene was common, with up to 613 SNP (1000 Genome Project reported) and 99 of them (16.2%) with MAF ≥ 1%. There were 79 SNPs in the URR and 92 SNPs in 3'UTR. Total 12 SNPs in URR and 24 SNPs in 3'UTR were considered as common variants with MAF ≥ 1%. It is worth noting that URR-1 was presents lower frequencies in European populations, while other three haplotypes taken an opposite pattern; 3'UTR presents several high-frequency variation sites in a short segment, and the differences of its haplotypes among different population were significant (P < 0.01), UTR-1 and UTR-5 presented much higher frequency in African population, while UTR-2, UTR-3 and UTR-4 were much lower. APOL1 coding region showed that two SNP of G1 with higher frequency are actually pull down the haplotype H-1 frequency when considering all populations pooled together, and the diversity among the four populations be widen by the G1 two mutation (P 1 = 3.33E-4 vs P 2 = 3.61E-30). The distributions of APOL1 gene variants and haplotypes were significantly different among the different populations, in either regulatory or coding regions. It could provide
Haplotype diversity in 11 candidate genes across four populations.
Beaty, T H; Fallin, M D; Hetmanski, J B; McIntosh, I; Chong, S S; Ingersoll, R; Sheng, X; Chakraborty, R; Scott, A F
2005-09-01
Analysis of haplotypes based on multiple single-nucleotide polymorphisms (SNP) is becoming common for both candidate gene and fine-mapping studies. Before embarking on studies of haplotypes from genetically distinct populations, however, it is important to consider variation both in linkage disequilibrium (LD) and in haplotype frequencies within and across populations, as both vary. Such diversity will influence the choice of "tagging" SNPs for candidate gene or whole-genome association studies because some markers will not be polymorphic in all samples and some haplotypes will be poorly represented or completely absent. Here we analyze 11 genes, originally chosen as candidate genes for oral clefts, where multiple markers were genotyped on individuals from four populations. Estimated haplotype frequencies, measures of pairwise LD, and genetic diversity were computed for 135 European-Americans, 57 Chinese-Singaporeans, 45 Malay-Singaporeans, and 46 Indian-Singaporeans. Patterns of pairwise LD were compared across these four populations and haplotype frequencies were used to assess genetic variation. Although these populations are fairly similar in allele frequencies and overall patterns of LD, both haplotype frequencies and genetic diversity varied significantly across populations. Such haplotype diversity has implications for designing studies of association involving samples from genetically distinct populations.
Sperschneider, Jana; Garnica, Diana P.; Miller, Marisa E.; Taylor, Jennifer M.; Dodds, Peter N.; Park, Robert F.
2018-01-01
ABSTRACT A long-standing biological question is how evolution has shaped the genomic architecture of dikaryotic fungi. To answer this, high-quality genomic resources that enable haplotype comparisons are essential. Short-read genome assemblies for dikaryotic fungi are highly fragmented and lack haplotype-specific information due to the high heterozygosity and repeat content of these genomes. Here, we present a diploid-aware assembly of the wheat stripe rust fungus Puccinia striiformis f. sp. tritici based on long reads using the FALCON-Unzip assembler. Transcriptome sequencing data sets were used to infer high-quality gene models and identify virulence genes involved in plant infection referred to as effectors. This represents the most complete Puccinia striiformis f. sp. tritici genome assembly to date (83 Mb, 156 contigs, N50 of 1.5 Mb) and provides phased haplotype information for over 92% of the genome. Comparisons of the phase blocks revealed high interhaplotype diversity of over 6%. More than 25% of all genes lack a clear allelic counterpart. When we investigated genome features that potentially promote the rapid evolution of virulence, we found that candidate effector genes are spatially associated with conserved genes commonly found in basidiomycetes. Yet, candidate effectors that lack an allelic counterpart are more distant from conserved genes than allelic candidate effectors and are less likely to be evolutionarily conserved within the P. striiformis species complex and Pucciniales. In summary, this haplotype-phased assembly enabled us to discover novel genome features of a dikaryotic plant-pathogenic fungus previously hidden in collapsed and fragmented genome assemblies. PMID:29463659
Kaiser, Kristine; Pollinger, John
2012-01-01
The amphibian pathogen Batrachochytrium dendrobatidis (Bd) has been implicated in amphibian declines around the globe. Although it has been found in most countries in Central America, its presence has never been assessed in Belize. We set out to determine the range, prevalence, and diversity of Bd using quantitative PCR (qPCR) and sequencing of a portion of the 5.8 s and ITS1-2 regions. Swabs were collected from 524 amphibians of at least 26 species in the protected areas of the Maya Mountains of Belize. We sequenced a subset of 72 samples that had tested positive for Bd by qPCR at least once; 30 samples were verified as Bd. Eight unique Bd haplotypes were identified in the Maya Mountains, five of which were previously undescribed. We identified unique ecological niches for the two most broadly distributed haplotypes. Combined with data showing differing virulence shown in different strains in other studies, the 5.8 s - ITS1-2 region diversity found in this study suggests that there may be substantial differences among populations or haplotypes. Future work should focus on whether specific haplotypes for other genomic regions and possibly pathogenicity can be associated with haplotypes at this locus, as well as the integration of molecular tools with other ecological tools to elucidate the ecology and pathogenicity of Bd. PMID:22389681
Ultraaccurate genome sequencing and haplotyping of single human cells.
Chu, Wai Keung; Edge, Peter; Lee, Ho Suk; Bansal, Vikas; Bafna, Vineet; Huang, Xiaohua; Zhang, Kun
2017-11-21
Accurate detection of variants and long-range haplotypes in genomes of single human cells remains very challenging. Common approaches require extensive in vitro amplification of genomes of individual cells using DNA polymerases and high-throughput short-read DNA sequencing. These approaches have two notable drawbacks. First, polymerase replication errors could generate tens of thousands of false-positive calls per genome. Second, relatively short sequence reads contain little to no haplotype information. Here we report a method, which is dubbed SISSOR (single-stranded sequencing using microfluidic reactors), for accurate single-cell genome sequencing and haplotyping. A microfluidic processor is used to separate the Watson and Crick strands of the double-stranded chromosomal DNA in a single cell and to randomly partition megabase-size DNA strands into multiple nanoliter compartments for amplification and construction of barcoded libraries for sequencing. The separation and partitioning of large single-stranded DNA fragments of the homologous chromosome pairs allows for the independent sequencing of each of the complementary and homologous strands. This enables the assembly of long haplotypes and reduction of sequence errors by using the redundant sequence information and haplotype-based error removal. We demonstrated the ability to sequence single-cell genomes with error rates as low as 10 -8 and average 500-kb-long DNA fragments that can be assembled into haplotype contigs with N50 greater than 7 Mb. The performance could be further improved with more uniform amplification and more accurate sequence alignment. The ability to obtain accurate genome sequences and haplotype information from single cells will enable applications of genome sequencing for diverse clinical needs. Copyright © 2017 the Author(s). Published by PNAS.
TUMOR HAPLOTYPE ASSEMBLY ALGORITHMS FOR CANCER GENOMICS
AGUIAR, DEREK; WONG, WENDY S.W.; ISTRAIL, SORIN
2014-01-01
The growing availability of inexpensive high-throughput sequence data is enabling researchers to sequence tumor populations within a single individual at high coverage. But, cancer genome sequence evolution and mutational phenomena like driver mutations and gene fusions are difficult to investigate without first reconstructing tumor haplotype sequences. Haplotype assembly of single individual tumor populations is an exceedingly difficult task complicated by tumor haplotype heterogeneity, tumor or normal cell sequence contamination, polyploidy, and complex patterns of variation. While computational and experimental haplotype phasing of diploid genomes has seen much progress in recent years, haplotype assembly in cancer genomes remains uncharted territory. In this work, we describe HapCompass-Tumor a computational modeling and algorithmic framework for haplotype assembly of copy number variable cancer genomes containing haplotypes at different frequencies and complex variation. We extend our polyploid haplotype assembly model and present novel algorithms for (1) complex variations, including copy number changes, as varying numbers of disjoint paths in an associated graph, (2) variable haplotype frequencies and contamination, and (3) computation of tumor haplotypes using simple cycles of the compass graph which constrain the space of haplotype assembly solutions. The model and algorithm are implemented in the software package HapCompass-Tumor which is available for download from http://www.brown.edu/Research/Istrail_Lab/. PMID:24297529
Y-SNPs haplotype diversity in four Chinese cattle breeds.
Zhang, Runfeng; Cheng, Ming; Li, Xiaofeng; Chen, Fuying; Zheng, Jing; Wang, Xiaofei; Meng, Quanke
2013-01-01
To investigate the genetic diversity of Chinese cattle, 96 male samples of 4 Chinese native cattle breeds were investigated using 5 single nucleotide polymorphisms specific to the bovine Y chromosome. Two previously described haplotypes (taurine Y2 and indicine Y3) were detected in 74 and 22 animals, respectively. The haplotype frequencies varied amongst the four native breeds. The taurine Y2 haplotype dominated in the Qinchuan, Dabieshan, and Yunba breeds. However, the indicine Y3 haplotype occurred in high frequency in the Enshi breed. Among the four native breeds, Yunba had the highest haplotype diversity (0.4330 ± 0.0750), followed by Qinchuan (0.2899 ± 0.1028) and Enshi (0.2222 ± 0.1662), Dabieshan was the least differentiated (0.1079 ± 0.0680). Compared with some foreign cattle breeds, the low level of haplotype diversity was detected in our breeds (0.2633 ± 0.1030).
Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes
USDA-ARS?s Scientific Manuscript database
Technical Abstract: 20-75 CHARACTER LINES A strategy for a genome-wide assessment of nucleotide diversity in a polyploid species must minimize the inclusion of homoeologous sequences into diversity estimates and reliably allocate individual haplotypes into respective genomes. In this study, nucle...
HLA Diversity in the 1000 Genomes Dataset
Gourraud, Pierre-Antoine; Khankhanian, Pouya; Cereb, Nezih; Yang, Soo Young; Feolo, Michael; Maiers, Martin; D. Rioux, John; Hauser, Stephen; Oksenberg, Jorge
2014-01-01
The 1000 Genomes Project aims to provide a deep characterization of human genome sequence variation by sequencing at a level that should allow the genome-wide detection of most variants with frequencies as low as 1%. However, in the major histocompatibility complex (MHC), only the top 10 most frequent haplotypes are in the 1% frequency range whereas thousands of haplotypes are present at lower frequencies. Given the limitation of both the coverage and the read length of the sequences generated by the 1000 Genomes Project, the highly variable positions that define HLA alleles may be difficult to identify. We used classical Sanger sequencing techniques to type the HLA-A, HLA-B, HLA-C, HLA-DRB1 and HLA-DQB1 genes in the available 1000 Genomes samples and combined the results with the 103,310 variants in the MHC region genotyped by the 1000 Genomes Project. Using pairwise identity-by-descent distances between individuals and principal component analysis, we established the relationship between ancestry and genetic diversity in the MHC region. As expected, both the MHC variants and the HLA phenotype can identify the major ancestry lineage, informed mainly by the most frequent HLA haplotypes. To some extent, regions of the genome with similar genetic or similar recombination rate have similar properties. An MHC-centric analysis underlines departures between the ancestral background of the MHC and the genome-wide picture. Our analysis of linkage disequilibrium (LD) decay in these samples suggests that overestimation of pairwise LD occurs due to a limited sampling of the MHC diversity. This collection of HLA-specific MHC variants, available on the dbMHC portal, is a valuable resource for future analyses of the role of MHC in population and disease studies. PMID:24988075
HLA diversity in the 1000 genomes dataset.
Gourraud, Pierre-Antoine; Khankhanian, Pouya; Cereb, Nezih; Yang, Soo Young; Feolo, Michael; Maiers, Martin; Rioux, John D; Hauser, Stephen; Oksenberg, Jorge
2014-01-01
The 1000 Genomes Project aims to provide a deep characterization of human genome sequence variation by sequencing at a level that should allow the genome-wide detection of most variants with frequencies as low as 1%. However, in the major histocompatibility complex (MHC), only the top 10 most frequent haplotypes are in the 1% frequency range whereas thousands of haplotypes are present at lower frequencies. Given the limitation of both the coverage and the read length of the sequences generated by the 1000 Genomes Project, the highly variable positions that define HLA alleles may be difficult to identify. We used classical Sanger sequencing techniques to type the HLA-A, HLA-B, HLA-C, HLA-DRB1 and HLA-DQB1 genes in the available 1000 Genomes samples and combined the results with the 103,310 variants in the MHC region genotyped by the 1000 Genomes Project. Using pairwise identity-by-descent distances between individuals and principal component analysis, we established the relationship between ancestry and genetic diversity in the MHC region. As expected, both the MHC variants and the HLA phenotype can identify the major ancestry lineage, informed mainly by the most frequent HLA haplotypes. To some extent, regions of the genome with similar genetic or similar recombination rate have similar properties. An MHC-centric analysis underlines departures between the ancestral background of the MHC and the genome-wide picture. Our analysis of linkage disequilibrium (LD) decay in these samples suggests that overestimation of pairwise LD occurs due to a limited sampling of the MHC diversity. This collection of HLA-specific MHC variants, available on the dbMHC portal, is a valuable resource for future analyses of the role of MHC in population and disease studies.
Reddy, Umesh K.; Nimmakayala, Padma; Abburi, Venkata Lakshmi; Reddy, C. V. C. M.; Saminathan, Thangasamy; Percy, Richard G.; Yu, John Z.; Frelichowski, James; Udall, Joshua A.; Page, Justin T.; Zhang, Dong; Shehzad, Tariq; Paterson, Andrew H.
2017-01-01
Use of 10,129 singleton SNPs of known genomic location in tetraploid cotton provided unique opportunities to characterize genome-wide diversity among 440 Gossypium hirsutum and 219 G. barbadense cultivars and landrace accessions of widespread origin. Using the SNPs distributed genome-wide, we examined genetic diversity, haplotype distribution and linkage disequilibrium patterns in the G. hirsutum and G. barbadense genomes to clarify population demographic history. Diversity and identity-by-state analyses have revealed little sharing of alleles between the two cultivated allotetraploid genomes, with a few exceptions that indicated sporadic gene flow. We found a high number of new alleles, representing increased nucleotide diversity, on chromosomes 1 and 2 in cultivated G. hirsutum as compared with low nucleotide diversity on these chromosomes in landrace G. hirsutum. In contrast, G. barbadense chromosomes showed negative Tajima’s D on several chromosomes for both cultivated and landrace types, which indicate that speciation of G. barbadense itself, might have occurred with relatively narrow genetic diversity. The presence of conserved linkage disequilibrium (LD) blocks and haplotypes between G. hirsutum and G. barbadense provides strong evidence for comparable patterns of evolution in their domestication processes. Our study illustrates the potential use of population genetic techniques to identify genomic regions for domestication. PMID:28128280
De novo assembly of a haplotype-resolved human genome.
Cao, Hongzhi; Wu, Honglong; Luo, Ruibang; Huang, Shujia; Sun, Yuhui; Tong, Xin; Xie, Yinlong; Liu, Binghang; Yang, Hailong; Zheng, Hancheng; Li, Jian; Li, Bo; Wang, Yu; Yang, Fang; Sun, Peng; Liu, Siyang; Gao, Peng; Huang, Haodong; Sun, Jing; Chen, Dan; He, Guangzhu; Huang, Weihua; Huang, Zheng; Li, Yue; Tellier, Laurent C A M; Liu, Xiao; Feng, Qiang; Xu, Xun; Zhang, Xiuqing; Bolund, Lars; Krogh, Anders; Kristiansen, Karsten; Drmanac, Radoje; Drmanac, Snezana; Nielsen, Rasmus; Li, Songgang; Wang, Jian; Yang, Huanming; Li, Yingrui; Wong, Gane Ka-Shu; Wang, Jun
2015-06-01
The human genome is diploid, and knowledge of the variants on each chromosome is important for the interpretation of genomic information. Here we report the assembly of a haplotype-resolved diploid genome without using a reference genome. Our pipeline relies on fosmid pooling together with whole-genome shotgun strategies, based solely on next-generation sequencing and hierarchical assembly methods. We applied our sequencing method to the genome of an Asian individual and generated a 5.15-Gb assembled genome with a haplotype N50 of 484 kb. Our analysis identified previously undetected indels and 7.49 Mb of novel coding sequences that could not be aligned to the human reference genome, which include at least six predicted genes. This haplotype-resolved genome represents the most complete de novo human genome assembly to date. Application of our approach to identify individual haplotype differences should aid in translating genotypes to phenotypes for the development of personalized medicine.
The effect of using genealogy-based haplotypes for genomic prediction.
Edriss, Vahid; Fernando, Rohan L; Su, Guosheng; Lund, Mogens S; Guldbrandtsen, Bernt
2013-03-06
Genomic prediction uses two sources of information: linkage disequilibrium between markers and quantitative trait loci, and additive genetic relationships between individuals. One way to increase the accuracy of genomic prediction is to capture more linkage disequilibrium by regression on haplotypes instead of regression on individual markers. The aim of this study was to investigate the accuracy of genomic prediction using haplotypes based on local genealogy information. A total of 4429 Danish Holstein bulls were genotyped with the 50K SNP chip. Haplotypes were constructed using local genealogical trees. Effects of haplotype covariates were estimated with two types of prediction models: (1) assuming that effects had the same distribution for all haplotype covariates, i.e. the GBLUP method and (2) assuming that a large proportion (π) of the haplotype covariates had zero effect, i.e. a Bayesian mixture method. About 7.5 times more covariate effects were estimated when fitting haplotypes based on local genealogical trees compared to fitting individuals markers. Genealogy-based haplotype clustering slightly increased the accuracy of genomic prediction and, in some cases, decreased the bias of prediction. With the Bayesian method, accuracy of prediction was less sensitive to parameter π when fitting haplotypes compared to fitting markers. Use of haplotypes based on genealogy can slightly increase the accuracy of genomic prediction. Improved methods to cluster the haplotypes constructed from local genealogy could lead to additional gains in accuracy.
Kay, Chris; Collins, Jennifer A; Skotte, Niels H; Southwell, Amber L; Warby, Simon C; Caron, Nicholas S; Doty, Crystal N; Nguyen, Betty; Griguoli, Annamaria; Ross, Colin J; Squitieri, Ferdinando; Hayden, Michael R
2015-01-01
Huntington disease (HD) is a dominant neurodegenerative disorder caused by a CAG repeat expansion in the Huntingtin gene (HTT). Heterozygous polymorphisms in cis with the mutation allow for allele-specific suppression of the pathogenic HTT transcript as a therapeutic strategy. To prioritize target selection, precise heterozygosity estimates are needed across diverse HD patient populations. Here we present the first comprehensive investigation of all common target alleles across the HTT gene, using 738 reference haplotypes from the 1000 Genomes Project and 2364 haplotypes from HD patients and relatives in Canada, Sweden, France, and Italy. The most common HD haplotypes (A1, A2, and A3a) define mutually exclusive sets of polymorphisms for allele-specific therapy in the greatest number of patients. Across all four populations, a maximum of 80% are treatable using these three target haplotypes. We identify a novel deletion found exclusively on the A1 haplotype, enabling potent and selective silencing of mutant HTT in approximately 40% of the patients. Antisense oligonucleotides complementary to the deletion reduce mutant A1 HTT mRNA by 78% in patient cells while sparing wild-type HTT expression. By suppressing specific haplotypes on which expanded CAG occurs, we demonstrate a rational approach to the development of allele-specific therapy for a monogenic disorder. PMID:26201449
The effect of using genealogy-based haplotypes for genomic prediction
2013-01-01
Background Genomic prediction uses two sources of information: linkage disequilibrium between markers and quantitative trait loci, and additive genetic relationships between individuals. One way to increase the accuracy of genomic prediction is to capture more linkage disequilibrium by regression on haplotypes instead of regression on individual markers. The aim of this study was to investigate the accuracy of genomic prediction using haplotypes based on local genealogy information. Methods A total of 4429 Danish Holstein bulls were genotyped with the 50K SNP chip. Haplotypes were constructed using local genealogical trees. Effects of haplotype covariates were estimated with two types of prediction models: (1) assuming that effects had the same distribution for all haplotype covariates, i.e. the GBLUP method and (2) assuming that a large proportion (π) of the haplotype covariates had zero effect, i.e. a Bayesian mixture method. Results About 7.5 times more covariate effects were estimated when fitting haplotypes based on local genealogical trees compared to fitting individuals markers. Genealogy-based haplotype clustering slightly increased the accuracy of genomic prediction and, in some cases, decreased the bias of prediction. With the Bayesian method, accuracy of prediction was less sensitive to parameter π when fitting haplotypes compared to fitting markers. Conclusions Use of haplotypes based on genealogy can slightly increase the accuracy of genomic prediction. Improved methods to cluster the haplotypes constructed from local genealogy could lead to additional gains in accuracy. PMID:23496971
Genome-wide SNP and haplotype analyses reveal a rich history underlying dog domestication
vonHoldt, Bridgett M.; Pollinger, John P.; Lohmueller, Kirk E.; Han, Eunjung; Parker, Heidi G.; Quignon, Pascale; Degenhardt, Jeremiah D.; Boyko, Adam R.; Earl, Dent A.; Auton, Adam; Reynolds, Andy; Bryc, Kasia; Brisbin, Abra; Knowles, James C.; Mosher, Dana S.; Spady, Tyrone C.; Elkahloun, Abdel; Geffen, Eli; Pilot, Malgorzata; Jedrzejewski, Wlodzimierz; Greco, Claudia; Randi, Ettore; Bannasch, Danika; Wilton, Alan; Shearman, Jeremy; Musiani, Marco; Cargill, Michelle; Jones, Paul G.; Qian, Zuwei; Huang, Wei; Ding, Zhao-Li; Zhang, Ya-ping; Bustamante, Carlos D.; Ostrander, Elaine A.; Novembre, John; Wayne, Robert K.
2010-01-01
Advances in genome technology have facilitated a new understanding of the historical and genetic processes crucial to rapid phenotypic evolution under domestication1,2. To understand the process of dog diversification better, we conducted an extensive genome-wide survey of more than 48,000 single nucleotide polymorphisms in dogs and their wild progenitor, the grey wolf. Here we show that dog breeds share a higher proportion of multi-locus haplotypes unique to grey wolves from the Middle East, indicating that they are a dominant source of genetic diversity for dogs rather than wolves from east Asia, as suggested by mitochondrial DNA sequence data3. Furthermore, we find a surprising correspondence between genetic and phenotypic/functional breed groupings but there are exceptions that suggest phenotypic diversification depended in part on the repeated crossing of individuals with novel phenotypes. Our results show that Middle Eastern wolves were a critical source of genome diversity, although interbreeding with local wolf populations clearly occurred elsewhere in the early history of specific lineages. More recently, the evolution of modern dog breeds seems to have been an iterative process that drew on a limited genetic toolkit to create remarkable phenotypic diversity. PMID:20237475
Genome-wide SNP and haplotype analyses reveal a rich history underlying dog domestication.
Vonholdt, Bridgett M; Pollinger, John P; Lohmueller, Kirk E; Han, Eunjung; Parker, Heidi G; Quignon, Pascale; Degenhardt, Jeremiah D; Boyko, Adam R; Earl, Dent A; Auton, Adam; Reynolds, Andy; Bryc, Kasia; Brisbin, Abra; Knowles, James C; Mosher, Dana S; Spady, Tyrone C; Elkahloun, Abdel; Geffen, Eli; Pilot, Malgorzata; Jedrzejewski, Wlodzimierz; Greco, Claudia; Randi, Ettore; Bannasch, Danika; Wilton, Alan; Shearman, Jeremy; Musiani, Marco; Cargill, Michelle; Jones, Paul G; Qian, Zuwei; Huang, Wei; Ding, Zhao-Li; Zhang, Ya-Ping; Bustamante, Carlos D; Ostrander, Elaine A; Novembre, John; Wayne, Robert K
2010-04-08
Advances in genome technology have facilitated a new understanding of the historical and genetic processes crucial to rapid phenotypic evolution under domestication. To understand the process of dog diversification better, we conducted an extensive genome-wide survey of more than 48,000 single nucleotide polymorphisms in dogs and their wild progenitor, the grey wolf. Here we show that dog breeds share a higher proportion of multi-locus haplotypes unique to grey wolves from the Middle East, indicating that they are a dominant source of genetic diversity for dogs rather than wolves from east Asia, as suggested by mitochondrial DNA sequence data. Furthermore, we find a surprising correspondence between genetic and phenotypic/functional breed groupings but there are exceptions that suggest phenotypic diversification depended in part on the repeated crossing of individuals with novel phenotypes. Our results show that Middle Eastern wolves were a critical source of genome diversity, although interbreeding with local wolf populations clearly occurred elsewhere in the early history of specific lineages. More recently, the evolution of modern dog breeds seems to have been an iterative process that drew on a limited genetic toolkit to create remarkable phenotypic diversity.
Geographic distribution of haplotype diversity at the bovine casein locus
Jann, Oliver C; Ibeagha-Awemu, Eveline M; Özbeyaz, Ceyhan; Zaragoza, Pilar; Williams, John L; Ajmone-Marsan, Paolo; Lenstra, Johannes A; Moazami-Goudarzi, Katy; Erhardt, Georg
2004-01-01
The genetic diversity of the casein locus in cattle was studied on the basis of haplotype analysis. Consideration of recently described genetic variants of the casein genes which to date have not been the subject of diversity studies, allowed the identification of new haplotypes. Genotyping of 30 cattle breeds from four continents revealed a geographically associated distribution of haplotypes, mainly defined by frequencies of alleles at CSN1S1 and CSN3. The genetic diversity within taurine breeds in Europe was found to decrease significantly from the south to the north and from the east to the west. Such geographic patterns of cattle genetic variation at the casein locus may be a result of the domestication process of modern cattle as well as geographically differentiated natural or artificial selection. The comparison of African Bos taurus and Bos indicus breeds allowed the identification of several Bos indicus specific haplotypes (CSN1S1*C-CSN2*A2-CSN3*AI/CSN3*H) that are not found in pure taurine breeds. The occurrence of such haplotypes in southern European breeds also suggests that an introgression of indicine genes into taurine breeds could have contributed to the distribution of the genetic variation observed. PMID:15040901
Haplotype assembly in polyploid genomes and identical by descent shared tracts.
Aguiar, Derek; Istrail, Sorin
2013-07-01
Genome-wide haplotype reconstruction from sequence data, or haplotype assembly, is at the center of major challenges in molecular biology and life sciences. For complex eukaryotic organisms like humans, the genome is vast and the population samples are growing so rapidly that algorithms processing high-throughput sequencing data must scale favorably in terms of both accuracy and computational efficiency. Furthermore, current models and methodologies for haplotype assembly (i) do not consider individuals sharing haplotypes jointly, which reduces the size and accuracy of assembled haplotypes, and (ii) are unable to model genomes having more than two sets of homologous chromosomes (polyploidy). Polyploid organisms are increasingly becoming the target of many research groups interested in the genomics of disease, phylogenetics, botany and evolution but there is an absence of theory and methods for polyploid haplotype reconstruction. In this work, we present a number of results, extensions and generalizations of compass graphs and our HapCompass framework. We prove the theoretical complexity of two haplotype assembly optimizations, thereby motivating the use of heuristics. Furthermore, we present graph theory-based algorithms for the problem of haplotype assembly using our previously developed HapCompass framework for (i) novel implementations of haplotype assembly optimizations (minimum error correction), (ii) assembly of a pair of individuals sharing a haplotype tract identical by descent and (iii) assembly of polyploid genomes. We evaluate our methods on 1000 Genomes Project, Pacific Biosciences and simulated sequence data. HapCompass is available for download at http://www.brown.edu/Research/Istrail_Lab/. Supplementary data are available at Bioinformatics online.
Genome sequence, comparative analysis and haplotype structure of the domestic dog.
Lindblad-Toh, Kerstin; Wade, Claire M; Mikkelsen, Tarjei S; Karlsson, Elinor K; Jaffe, David B; Kamal, Michael; Clamp, Michele; Chang, Jean L; Kulbokas, Edward J; Zody, Michael C; Mauceli, Evan; Xie, Xiaohui; Breen, Matthew; Wayne, Robert K; Ostrander, Elaine A; Ponting, Chris P; Galibert, Francis; Smith, Douglas R; DeJong, Pieter J; Kirkness, Ewen; Alvarez, Pablo; Biagi, Tara; Brockman, William; Butler, Jonathan; Chin, Chee-Wye; Cook, April; Cuff, James; Daly, Mark J; DeCaprio, David; Gnerre, Sante; Grabherr, Manfred; Kellis, Manolis; Kleber, Michael; Bardeleben, Carolyne; Goodstadt, Leo; Heger, Andreas; Hitte, Christophe; Kim, Lisa; Koepfli, Klaus-Peter; Parker, Heidi G; Pollinger, John P; Searle, Stephen M J; Sutter, Nathan B; Thomas, Rachael; Webber, Caleb; Baldwin, Jennifer; Abebe, Adal; Abouelleil, Amr; Aftuck, Lynne; Ait-Zahra, Mostafa; Aldredge, Tyler; Allen, Nicole; An, Peter; Anderson, Scott; Antoine, Claudel; Arachchi, Harindra; Aslam, Ali; Ayotte, Laura; Bachantsang, Pasang; Barry, Andrew; Bayul, Tashi; Benamara, Mostafa; Berlin, Aaron; Bessette, Daniel; Blitshteyn, Berta; Bloom, Toby; Blye, Jason; Boguslavskiy, Leonid; Bonnet, Claude; Boukhgalter, Boris; Brown, Adam; Cahill, Patrick; Calixte, Nadia; Camarata, Jody; Cheshatsang, Yama; Chu, Jeffrey; Citroen, Mieke; Collymore, Alville; Cooke, Patrick; Dawoe, Tenzin; Daza, Riza; Decktor, Karin; DeGray, Stuart; Dhargay, Norbu; Dooley, Kimberly; Dooley, Kathleen; Dorje, Passang; Dorjee, Kunsang; Dorris, Lester; Duffey, Noah; Dupes, Alan; Egbiremolen, Osebhajajeme; Elong, Richard; Falk, Jill; Farina, Abderrahim; Faro, Susan; Ferguson, Diallo; Ferreira, Patricia; Fisher, Sheila; FitzGerald, Mike; Foley, Karen; Foley, Chelsea; Franke, Alicia; Friedrich, Dennis; Gage, Diane; Garber, Manuel; Gearin, Gary; Giannoukos, Georgia; Goode, Tina; Goyette, Audra; Graham, Joseph; Grandbois, Edward; Gyaltsen, Kunsang; Hafez, Nabil; Hagopian, Daniel; Hagos, Birhane; Hall, Jennifer; Healy, Claire; Hegarty, Ryan; Honan, Tracey; Horn, Andrea; Houde, Nathan; Hughes, Leanne; Hunnicutt, Leigh; Husby, M; Jester, Benjamin; Jones, Charlien; Kamat, Asha; Kanga, Ben; Kells, Cristyn; Khazanovich, Dmitry; Kieu, Alix Chinh; Kisner, Peter; Kumar, Mayank; Lance, Krista; Landers, Thomas; Lara, Marcia; Lee, William; Leger, Jean-Pierre; Lennon, Niall; Leuper, Lisa; LeVine, Sarah; Liu, Jinlei; Liu, Xiaohong; Lokyitsang, Yeshi; Lokyitsang, Tashi; Lui, Annie; Macdonald, Jan; Major, John; Marabella, Richard; Maru, Kebede; Matthews, Charles; McDonough, Susan; Mehta, Teena; Meldrim, James; Melnikov, Alexandre; Meneus, Louis; Mihalev, Atanas; Mihova, Tanya; Miller, Karen; Mittelman, Rachel; Mlenga, Valentine; Mulrain, Leonidas; Munson, Glen; Navidi, Adam; Naylor, Jerome; Nguyen, Tuyen; Nguyen, Nga; Nguyen, Cindy; Nguyen, Thu; Nicol, Robert; Norbu, Nyima; Norbu, Choe; Novod, Nathaniel; Nyima, Tenchoe; Olandt, Peter; O'Neill, Barry; O'Neill, Keith; Osman, Sahal; Oyono, Lucien; Patti, Christopher; Perrin, Danielle; Phunkhang, Pema; Pierre, Fritz; Priest, Margaret; Rachupka, Anthony; Raghuraman, Sujaa; Rameau, Rayale; Ray, Verneda; Raymond, Christina; Rege, Filip; Rise, Cecil; Rogers, Julie; Rogov, Peter; Sahalie, Julie; Settipalli, Sampath; Sharpe, Theodore; Shea, Terrance; Sheehan, Mechele; Sherpa, Ngawang; Shi, Jianying; Shih, Diana; Sloan, Jessie; Smith, Cherylyn; Sparrow, Todd; Stalker, John; Stange-Thomann, Nicole; Stavropoulos, Sharon; Stone, Catherine; Stone, Sabrina; Sykes, Sean; Tchuinga, Pierre; Tenzing, Pema; Tesfaye, Senait; Thoulutsang, Dawa; Thoulutsang, Yama; Topham, Kerri; Topping, Ira; Tsamla, Tsamla; Vassiliev, Helen; Venkataraman, Vijay; Vo, Andy; Wangchuk, Tsering; Wangdi, Tsering; Weiand, Michael; Wilkinson, Jane; Wilson, Adam; Yadav, Shailendra; Yang, Shuli; Yang, Xiaoping; Young, Geneva; Yu, Qing; Zainoun, Joanne; Zembek, Lisa; Zimmer, Andrew; Lander, Eric S
2005-12-08
Here we report a high-quality draft genome sequence of the domestic dog (Canis familiaris), together with a dense map of single nucleotide polymorphisms (SNPs) across breeds. The dog is of particular interest because it provides important evolutionary information and because existing breeds show great phenotypic diversity for morphological, physiological and behavioural traits. We use sequence comparison with the primate and rodent lineages to shed light on the structure and evolution of genomes and genes. Notably, the majority of the most highly conserved non-coding sequences in mammalian genomes are clustered near a small subset of genes with important roles in development. Analysis of SNPs reveals long-range haplotypes across the entire dog genome, and defines the nature of genetic diversity within and across breeds. The current SNP map now makes it possible for genome-wide association studies to identify genes responsible for diseases and traits, with important consequences for human and companion animal health.
Exploring and Harnessing Haplotype Diversity to Improve Yield Stability in Crops.
Qian, Lunwen; Hickey, Lee T; Stahl, Andreas; Werner, Christian R; Hayes, Ben; Snowdon, Rod J; Voss-Fels, Kai P
2017-01-01
In order to meet future food, feed, fiber, and bioenergy demands, global yields of all major crops need to be increased significantly. At the same time, the increasing frequency of extreme weather events such as heat and drought necessitates improvements in the environmental resilience of modern crop cultivars. Achieving sustainably increase yields implies rapid improvement of quantitative traits with a very complex genetic architecture and strong environmental interaction. Latest advances in genome analysis technologies today provide molecular information at an ultrahigh resolution, revolutionizing crop genomic research, and paving the way for advanced quantitative genetic approaches. These include highly detailed assessment of population structure and genotypic diversity, facilitating the identification of selective sweeps and signatures of directional selection, dissection of genetic variants that underlie important agronomic traits, and genomic selection (GS) strategies that not only consider major-effect genes. Single-nucleotide polymorphism (SNP) markers today represent the genotyping system of choice for crop genetic studies because they occur abundantly in plant genomes and are easy to detect. SNPs are typically biallelic, however, hence their information content compared to multiallelic markers is low, limiting the resolution at which SNP-trait relationships can be delineated. An efficient way to overcome this limitation is to construct haplotypes based on linkage disequilibrium, one of the most important features influencing genetic analyses of crop genomes. Here, we give an overview of the latest advances in genomics-based haplotype analyses in crops, highlighting their importance in the context of polyploidy and genome evolution, linkage drag, and co-selection. We provide examples of how haplotype analyses can complement well-established quantitative genetics frameworks, such as quantitative trait analysis and GS, ultimately providing an effective tool
Further insight into genetic variation and haplotype diversity of Cherry virus A from China
Candresse, Thierry; He, Zhen; Li, Shifang; Ma, Yuxin
2017-01-01
Cherry virus A (CVA) infection appears to be prevalent in cherry plantations worldwide. In this study, the diversity of CVA isolates from 31 cherry samples collected from different orchards around Bohai Bay in northeastern China was analyzed. The complete genome of one of these isolates, ChYT52, was found to be 7,434 nt in length excluding the poly (A) tail. It shares between 79.9–98.7% identity with CVA genome sequences in GenBank, while its RdRp core is more divergent (79.1–90.7% nt identity), likely as a consequence of a recombination event. Phylogenetic analysis of ChYT52 genome with CVA genomes in Genbank resulted in at least 7 major clusters plus additional 5 isolates alone at the end of long branches suggesting the existence of further phylogroups diversity in CVA. The genetic diversity of Chinese CVA isolates from 31 samples and GenBank sequences were analyzed in three genomic regions that correspond to the coat protein, the RNA-dependent RNA polymerase core region, and the movement protein genes. With few exceptions likely representing further recombination impact, the trees various trees are largely congruent, indicating that each region provides valuable phylogenetic information. In all cases, the majority of the Chinese CVA isolates clustering in phylogroup I, together with the X82547 reference sequence from Germany. Statistically significant negative values were obtained for Tajima’s D in the three genes for phylogroup I, suggesting that it may be undergoing a period of expansion. There was considerable haplotype diversity in the individual samples and more than half samples contained genetically diverse haplotypes belonging to different phylogroups. In addition, a number of statistically significant recombination events were detected in CVA genomes or in the partial genomic sequences indicating an important contribution of recombination to CVA evolution. This work provides a foundation for elucidation of the epidemiological characteristics and
Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes
2010-01-01
Background A genome-wide assessment of nucleotide diversity in a polyploid species must minimize the inclusion of homoeologous sequences into diversity estimates and reliably allocate individual haplotypes into their respective genomes. The same requirements complicate the development and deployment of single nucleotide polymorphism (SNP) markers in polyploid species. We report here a strategy that satisfies these requirements and deploy it in the sequencing of genes in cultivated hexaploid wheat (Triticum aestivum, genomes AABBDD) and wild tetraploid wheat (Triticum turgidum ssp. dicoccoides, genomes AABB) from the putative site of wheat domestication in Turkey. Data are used to assess the distribution of diversity among and within wheat genomes and to develop a panel of SNP markers for polyploid wheat. Results Nucleotide diversity was estimated in 2114 wheat genes and was similar between the A and B genomes and reduced in the D genome. Within a genome, diversity was diminished on some chromosomes. Low diversity was always accompanied by an excess of rare alleles. A total of 5,471 SNPs was discovered in 1791 wheat genes. Totals of 1,271, 1,218, and 2,203 SNPs were discovered in 488, 463, and 641 genes of wheat putative diploid ancestors, T. urartu, Aegilops speltoides, and Ae. tauschii, respectively. A public database containing genome-specific primers, SNPs, and other information was constructed. A total of 987 genes with nucleotide diversity estimated in one or more of the wheat genomes was placed on an Ae. tauschii genetic map, and the map was superimposed on wheat deletion-bin maps. The agreement between the maps was assessed. Conclusions In a young polyploid, exemplified by T. aestivum, ancestral species are the primary source of genetic diversity. Low effective recombination due to self-pollination and a genetic mechanism precluding homoeologous chromosome pairing during polyploid meiosis can lead to the loss of diversity from large chromosomal regions. The
Haplotype-Based Genome-Wide Prediction Models Exploit Local Epistatic Interactions Among Markers
Jiang, Yong; Schmidt, Renate H.; Reif, Jochen C.
2018-01-01
Genome-wide prediction approaches represent versatile tools for the analysis and prediction of complex traits. Mostly they rely on marker-based information, but scenarios have been reported in which models capitalizing on closely-linked markers that were combined into haplotypes outperformed marker-based models. Detailed comparisons were undertaken to reveal under which circumstances haplotype-based genome-wide prediction models are superior to marker-based models. Specifically, it was of interest to analyze whether and how haplotype-based models may take local epistatic effects between markers into account. Assuming that populations consisted of fully homozygous individuals, a marker-based model in which local epistatic effects inside haplotype blocks were exploited (LEGBLUP) was linearly transformable into a haplotype-based model (HGBLUP). This theoretical derivation formally revealed that haplotype-based genome-wide prediction models capitalize on local epistatic effects among markers. Simulation studies corroborated this finding. Due to its computational efficiency the HGBLUP model promises to be an interesting tool for studies in which ultra-high-density SNP data sets are studied. Applying the HGBLUP model to empirical data sets revealed higher prediction accuracies than for marker-based models for both traits studied using a mouse panel. In contrast, only a small subset of the traits analyzed in crop populations showed such a benefit. Cases in which higher prediction accuracies are observed for HGBLUP than for marker-based models are expected to be of immediate relevance for breeders, due to the tight linkage a beneficial haplotype will be preserved for many generations. In this respect the inheritance of local epistatic effects very much resembles the one of additive effects. PMID:29549092
Haplotype-Based Genome-Wide Prediction Models Exploit Local Epistatic Interactions Among Markers.
Jiang, Yong; Schmidt, Renate H; Reif, Jochen C
2018-05-04
Genome-wide prediction approaches represent versatile tools for the analysis and prediction of complex traits. Mostly they rely on marker-based information, but scenarios have been reported in which models capitalizing on closely-linked markers that were combined into haplotypes outperformed marker-based models. Detailed comparisons were undertaken to reveal under which circumstances haplotype-based genome-wide prediction models are superior to marker-based models. Specifically, it was of interest to analyze whether and how haplotype-based models may take local epistatic effects between markers into account. Assuming that populations consisted of fully homozygous individuals, a marker-based model in which local epistatic effects inside haplotype blocks were exploited (LEGBLUP) was linearly transformable into a haplotype-based model (HGBLUP). This theoretical derivation formally revealed that haplotype-based genome-wide prediction models capitalize on local epistatic effects among markers. Simulation studies corroborated this finding. Due to its computational efficiency the HGBLUP model promises to be an interesting tool for studies in which ultra-high-density SNP data sets are studied. Applying the HGBLUP model to empirical data sets revealed higher prediction accuracies than for marker-based models for both traits studied using a mouse panel. In contrast, only a small subset of the traits analyzed in crop populations showed such a benefit. Cases in which higher prediction accuracies are observed for HGBLUP than for marker-based models are expected to be of immediate relevance for breeders, due to the tight linkage a beneficial haplotype will be preserved for many generations. In this respect the inheritance of local epistatic effects very much resembles the one of additive effects. Copyright © 2018 Jiang et al.
Bomba, Lorenzo; Nicolazzi, Ezequiel L; Milanesi, Marco; Negrini, Riccardo; Mancini, Giordano; Biscarini, Filippo; Stella, Alessandra; Valentini, Alessio; Ajmone-Marsan, Paolo
2015-04-02
A number of methods are available to scan a genome for selection signatures by evaluating patterns of diversity within and between breeds. Among these, "extended haplotype homozygosity" (EHH) is a reliable approach to detect genome regions under recent selective pressure. The objective of this study was to use this approach to identify regions that are under recent positive selection and shared by the most representative Italian dairy and beef cattle breeds. A total of 3220 animals from Italian Holstein (2179), Italian Brown (775), Simmental (493), Marchigiana (485) and Piedmontese (379) breeds were genotyped with the Illumina BovineSNP50 BeadChip v.1. After standard quality control procedures, genotypes were phased and core haplotypes were identified. The decay of linkage disequilibrium (LD) for each core haplotype was assessed by measuring the EHH. Since accurate estimates of local recombination rates were not available, relative EHH (rEHH) was calculated for each core haplotype. Genomic regions that carry frequent core haplotypes and with significant rEHH values were considered as candidates for recent positive selection. Candidate regions were aligned across to identify signals shared by dairy or beef cattle breeds. Overall, 82 and 87 common regions were detected among dairy and beef cattle breeds, respectively. Bioinformatic analysis identified 244 and 232 genes in these common genomic regions. Gene annotation and pathway analysis showed that these genes are involved in molecular functions that are biologically related to milk or meat production. Our results suggest that a multi-breed approach can lead to the identification of genomic signatures in breeds of cattle that are selected for the same production goal and thus to the localisation of genomic regions of interest in dairy and beef production.
The whole genome sequences and experimentally phased haplotypes of over 100 personal genomes.
Mao, Qing; Ciotlos, Serban; Zhang, Rebecca Yu; Ball, Madeleine P; Chin, Robert; Carnevali, Paolo; Barua, Nina; Nguyen, Staci; Agarwal, Misha R; Clegg, Tom; Connelly, Abram; Vandewege, Ward; Zaranek, Alexander Wait; Estep, Preston W; Church, George M; Drmanac, Radoje; Peters, Brock A
2016-10-11
Since the completion of the Human Genome Project in 2003, it is estimated that more than 200,000 individual whole human genomes have been sequenced. A stunning accomplishment in such a short period of time. However, most of these were sequenced without experimental haplotype data and are therefore missing an important aspect of genome biology. In addition, much of the genomic data is not available to the public and lacks phenotypic information. As part of the Personal Genome Project, blood samples from 184 participants were collected and processed using Complete Genomics' Long Fragment Read technology. Here, we present the experimental whole genome haplotyping and sequencing of these samples to an average read coverage depth of 100X. This is approximately three-fold higher than the read coverage applied to most whole human genome assemblies and ensures the highest quality results. Currently, 114 genomes from this dataset are freely available in the GigaDB repository and are associated with rich phenotypic data; the remaining 70 should be added in the near future as they are approved through the PGP data release process. For reproducibility analyses, 20 genomes were sequenced at least twice using independent LFR barcoded libraries. Seven genomes were also sequenced using Complete Genomics' standard non-barcoded library process. In addition, we report 2.6 million high-quality, rare variants not previously identified in the Single Nucleotide Polymorphisms database or the 1000 Genomes Project Phase 3 data. These genomes represent a unique source of haplotype and phenotype data for the scientific community and should help to expand our understanding of human genome evolution and function.
A comprehensively molecular haplotype-resolved genome of a European individual
Suk, Eun-Kyung; McEwen, Gayle K.; Duitama, Jorge; Nowick, Katja; Schulz, Sabrina; Palczewski, Stefanie; Schreiber, Stefan; Holloway, Dustin T.; McLaughlin, Stephen; Peckham, Heather; Lee, Clarence; Huebsch, Thomas; Hoehe, Margret R.
2011-01-01
Independent determination of both haplotype sequences of an individual genome is essential to relate genetic variation to genome function, phenotype, and disease. To address the importance of phase, we have generated the most complete haplotype-resolved genome to date, “Max Planck One” (MP1), by fosmid pool-based next generation sequencing. Virtually all SNPs (>99%) and 80,000 indels were phased into haploid sequences of up to 6.3 Mb (N50 ∼1 Mb). The completeness of phasing allowed determination of the concrete molecular haplotype pairs for the vast majority of genes (81%) including potential regulatory sequences, of which >90% were found to be constituted by two different molecular forms. A subset of 159 genes with potentially severe mutations in either cis or trans configurations exemplified in particular the role of phase for gene function, disease, and clinical interpretation of personal genomes (e.g., BRCA1). Extended genomic regions harboring manifold combinations of physically and/or functionally related genes and regulatory elements were resolved into their underlying “haploid landscapes,” which may define the functional genome. Moreover, the majority of genes and functional sequences were found to contain individual or rare SNPs, which cannot be phased from population data alone, emphasizing the importance of molecular phasing for characterizing a genome in its molecular individuality. Our work provides the foundation to understand that the distinction of molecular haplotypes is essential to resolve the (inherently individual) biology of genes, genomes, and disease, establishing a reference point for “phase-sensitive” personal genomics. MP1's annotated haploid genomes are available as a public resource. PMID:21813624
Beaudet, Denis; Terrat, Yves; Halary, Sébastien; de la Providencia, Ivan Enrique; Hijri, Mohamed
2013-01-01
Comparative mitochondrial genomics of arbuscular mycorrhizal fungi (AMF) provide new avenues to overcome long-lasting obstacles that have hampered studies aimed at understanding the community structure, diversity, and evolution of these multinucleated and genetically polymorphic organisms. AMF mitochondrial (mt) genomes are homogeneous within isolates, and their intergenic regions harbor numerous mobile elements that have rapidly diverged, including homing endonuclease genes, small inverted repeats, and plasmid-related DNA polymerase genes (dpo), making them suitable targets for the development of reliable strain-specific markers. However, these elements may also lead to genome rearrangements through homologous recombination, although this has never previously been reported in this group of obligate symbiotic fungi. To investigate whether such rearrangements are present and caused by mobile elements in AMF, the mitochondrial genomes from two Glomeraceae members (i.e., Glomus cerebriforme and Glomus sp.) with substantial mtDNA synteny divergence, were sequenced and compared with available glomeromycotan mitochondrial genomes. We used an extensive nucleotide/protein similarity network-based approach to investigate dpo diversity in AMF as well as in other organisms for which sequences are publicly available. We provide strong evidence of dpo-induced inter-haplotype recombination, leading to a reshuffled mitochondrial genome in Glomus sp. These findings raise questions as to whether AMF single spore cultivations artificially underestimate mtDNA genetic diversity. We assessed potential dpo dispersal mechanisms in AMF and inferred a robust phylogenetic relationship with plant mitochondrial plasmids. Along with other indirect evidence, our analyses indicate that members of the Glomeromycota phylum are potential donors of mitochondrial plasmids to plants. PMID:23925788
Lumkul, Lalita; Sawaswong, Vorthon; Simpalipan, Phumin; Kaewthamasorn, Morakot; Harnyuttanakorn, Pongchai; Pattaradilokrat, Sittiporn
2018-01-01
Development of an effective vaccine is critically needed for the prevention of malaria. One of the key antigens for malaria vaccines is the apical membrane antigen 1 (AMA-1) of the human malaria parasite Plasmodium falciparum, the surface protein for erythrocyte invasion of the parasite. The gene encoding AMA-1 has been sequenced from populations of P. falciparum worldwide, but the haplotype diversity of the gene in P. falciparum populations in the Greater Mekong Subregion (GMS), including Thailand, remains to be characterized. In the present study, the AMA-1 gene was PCR amplified and sequenced from the genomic DNA of 65 P. falciparum isolates from 5 endemic areas in Thailand. The nearly full-length 1,848 nucleotide sequence of AMA-1 was subjected to molecular analyses, including nucleotide sequence diversity, haplotype diversity and deduced amino acid sequence diversity and neutrality tests. Phylogenetic analysis and pairwise population differentiation (Fst indices) were performed to infer the population structure. The analyses identified 60 single nucleotide polymorphic loci, predominately located in domain I of AMA-1. A total of 31 unique AMA-1 haplotypes were identified, which included 11 novel ones. The phylogenetic tree of the AMA-1 haplotypes revealed multiple clades of AMA-1, each of which contained parasites of multiple geographical origins, consistent with the Fst indices indicating genetic homogeneity or gene flow among geographically distinct populations of P. falciparum in Thailand’s borders with Myanmar, Laos and Cambodia. In summary, the study revealed novel haplotypes and population structure needed for the further advancement of AMA-1-based malaria vaccines in the GMS. PMID:29742870
Gómez-Romano, Fernando; Villanueva, Beatriz; Fernández, Jesús; Woolliams, John A; Pong-Wong, Ricardo
2016-01-13
Optimal contribution methods have proved to be very efficient for controlling the rates at which coancestry and inbreeding increase and therefore, for maintaining genetic diversity. These methods have usually relied on pedigree information for estimating genetic relationships between animals. However, with the large amount of genomic information now available such as high-density single nucleotide polymorphism (SNP) chips that contain thousands of SNPs, it becomes possible to calculate more accurate estimates of relationships and to target specific regions in the genome where there is a particular interest in maximising genetic diversity. The objective of this study was to investigate the effectiveness of using genomic coancestry matrices for: (1) minimising the loss of genetic variability at specific genomic regions while restricting the overall loss in the rest of the genome; or (2) maximising the overall genetic diversity while restricting the loss of diversity at specific genomic regions. Our study shows that the use of genomic coancestry was very successful at minimising the loss of diversity and outperformed the use of pedigree-based coancestry (genetic diversity even increased in some scenarios). The results also show that genomic information allows a targeted optimisation to maintain diversity at specific genomic regions, whether they are linked or not. The level of variability maintained increased when the targeted regions were closely linked. However, such targeted management leads to an important loss of diversity in the rest of the genome and, thus, it is necessary to take further actions to constrain this loss. Optimal contribution methods also proved to be effective at restricting the loss of diversity in the rest of the genome, although the resulting rate of coancestry was higher than the constraint imposed. The use of genomic matrices when optimising contributions permits the control of genetic diversity and inbreeding at specific regions of the
Curk, Franck; Ancillo, Gema; Garcia-Lor, Andres; Luro, François; Perrier, Xavier; Jacquemoud-Collet, Jean-Pierre; Navarro, Luis; Ollitrault, Patrick
2014-12-29
The most economically important Citrus species originated by natural interspecific hybridization between four ancestral taxa (Citrus reticulata, Citrus maxima, Citrus medica, and Citrus micrantha) and from limited subsequent interspecific recombination as a result of apomixis and vegetative propagation. Such reticulate evolution coupled with vegetative propagation results in mosaic genomes with large chromosome fragments from the basic taxa in frequent interspecific heterozygosity. Modern breeding of these species is hampered by their complex heterozygous genomic structures that determine species phenotype and are broken by sexual hybridisation. Nevertheless, a large amount of diversity is present in the citrus gene pool, and breeding to allow inclusion of desirable traits is of paramount importance. However, the efficient mobilization of citrus biodiversity in innovative breeding schemes requires previous understanding of Citrus origins and genomic structures. Haplotyping of multiple gene fragments along the whole genome is a powerful approach to reveal the admixture genomic structure of current species and to resolve the evolutionary history of the gene pools. In this study, the efficiency of parallel sequencing with 454 methodology to decipher the hybrid structure of modern citrus species was assessed by analysis of 16 gene fragments on chromosome 2. 454 amplicon libraries were established using the Fluidigm array system for 48 genotypes and 16 gene fragments from chromosome 2. Haplotypes were established from the reads of each accession and phylogenetic analyses were performed using the haplotypic data for each gene fragment. The length of 454 reads and the level of differentiation between the ancestral taxa of modern citrus allowed efficient haplotype phylogenetic assignations for 12 of the 16 gene fragments. The analysis of the mixed genomic structure of modern species and cultivars (i) revealed C. maxima introgressions in modern mandarins, (ii) was
A Genome-Wide Scan for Breast Cancer Risk Haplotypes among African American Women
Song, Chi; Chen, Gary K.; Millikan, Robert C.; Ambrosone, Christine B.; John, Esther M.; Bernstein, Leslie; Zheng, Wei; Hu, Jennifer J.; Ziegler, Regina G.; Nyante, Sarah; Bandera, Elisa V.; Ingles, Sue A.; Press, Michael F.; Deming, Sandra L.; Rodriguez-Gil, Jorge L.; Chanock, Stephen J.; Wan, Peggy; Sheng, Xin; Pooler, Loreall C.; Van Den Berg, David J.; Le Marchand, Loic; Kolonel, Laurence N.; Henderson, Brian E.; Haiman, Chris A.; Stram, Daniel O.
2013-01-01
Genome-wide association studies (GWAS) simultaneously investigating hundreds of thousands of single nucleotide polymorphisms (SNP) have become a powerful tool in the investigation of new disease susceptibility loci. Haplotypes are sometimes thought to be superior to SNPs and are promising in genetic association analyses. The application of genome-wide haplotype analysis, however, is hindered by the complexity of haplotypes themselves and sophistication in computation. We systematically analyzed the haplotype effects for breast cancer risk among 5,761 African American women (3,016 cases and 2,745 controls) using a sliding window approach on the genome-wide scale. Three regions on chromosomes 1, 4 and 18 exhibited moderate haplotype effects. Furthermore, among 21 breast cancer susceptibility loci previously established in European populations, 10p15 and 14q24 are likely to harbor novel haplotype effects. We also proposed a heuristic of determining the significance level and the effective number of independent tests by the permutation analysis on chromosome 22 data. It suggests that the effective number was approximately half of the total (7,794 out of 15,645), thus the half number could serve as a quick reference to evaluating genome-wide significance if a similar sliding window approach of haplotype analysis is adopted in similar populations using similar genotype density. PMID:23468962
Haplotype-Based Genotyping in Polyploids.
Clevenger, Josh P; Korani, Walid; Ozias-Akins, Peggy; Jackson, Scott
2018-01-01
Accurate identification of polymorphisms from sequence data is crucial to unlocking the potential of high throughput sequencing for genomics. Single nucleotide polymorphisms (SNPs) are difficult to accurately identify in polyploid crops due to the duplicative nature of polyploid genomes leading to low confidence in the true alignment of short reads. Implementing a haplotype-based method in contrasting subgenome-specific sequences leads to higher accuracy of SNP identification in polyploids. To test this method, a large-scale 48K SNP array (Axiom Arachis2) was developed for Arachis hypogaea (peanut), an allotetraploid, in which 1,674 haplotype-based SNPs were included. Results of the array show that 74% of the haplotype-based SNP markers could be validated, which is considerably higher than previous methods used for peanut. The haplotype method has been implemented in a standalone program, HAPLOSWEEP, which takes as input bam files and a vcf file and identifies haplotype-based markers. Haplotype discovery can be made within single reads or span paired reads, and can leverage long read technology by targeting any length of haplotype. Haplotype-based genotyping is applicable in all allopolyploid genomes and provides confidence in marker identification and in silico-based genotyping for polyploid genomics.
Population Structure With Localized Haplotype Clusters
Browning, Sharon R.; Weir, Bruce S.
2010-01-01
We propose a multilocus version of FST and a measure of haplotype diversity using localized haplotype clusters. Specifically, we use haplotype clusters identified with BEAGLE, which is a program implementing a hidden Markov model for localized haplotype clustering and performing several functions including inference of haplotype phase. We apply this methodology to HapMap phase 3 data. With this haplotype-cluster approach, African populations have highest diversity and lowest divergence from the ancestral population, East Asian populations have lowest diversity and highest divergence, and other populations (European, Indian, and Mexican) have intermediate levels of diversity and divergence. These relationships accord with expectation based on other studies and accepted models of human history. In contrast, the population-specific FST estimates obtained directly from single-nucleotide polymorphisms (SNPs) do not reflect such expected relationships. We show that ascertainment bias of SNPs has less impact on the proposed haplotype-cluster-based FST than on the SNP-based version, which provides a potential explanation for these results. Thus, these new measures of FST and haplotype-cluster diversity provide an important new tool for population genetic analysis of high-density SNP data. PMID:20457877
Chimusa, Emile R; Meintjies, Ayton; Tchanga, Milaine; Mulder, Nicola; Seoighe, Cathal; Seioghe, Cathal; Soodyall, Himla; Ramesar, Rajkumar
2015-03-01
We report a study of genome-wide, dense SNP (∼ 900K) and copy number polymorphism data of indigenous southern Africans. We demonstrate the genetic contribution to southern and eastern African populations, which involved admixture between indigenous San, Niger-Congo-speaking and populations of Eurasian ancestry. This finding illustrates the need to account for stratification in genome-wide association studies, and that admixture mapping would likely be a successful approach in these populations. We developed a strategy to detect the signature of selection prior to and following putative admixture events. Several genomic regions show an unusual excess of Niger-Kordofanian, and unusual deficiency of both San and Eurasian ancestry, which were considered the footprints of selection after population admixture. Several SNPs with strong allele frequency differences were observed predominantly between the admixed indigenous southern African populations, and their ancestral Eurasian populations. Interestingly, many candidate genes, which were identified within the genomic regions showing signals for selection, were associated with southern African-specific high-risk, mostly communicable diseases, such as malaria, influenza, tuberculosis, and human immunodeficiency virus/AIDs. This observation suggests a potentially important role that these genes might have played in adapting to the environment. Additionally, our analyses of haplotype structure, linkage disequilibrium, recombination, copy number variation and genome-wide admixture highlight, and support the unique position of San relative to both African and non-African populations. This study contributes to a better understanding of population ancestry and selection in south-eastern African populations; and the data and results obtained will support research into the genetic contributions to infectious as well as non-communicable diseases in the region.
Chimusa, Emile R.; Meintjies, Ayton; Tchanga, Milaine; Mulder, Nicola; Seoighe, Cathal; Soodyall, Himla; Ramesar, Rajkumar
2015-01-01
We report a study of genome-wide, dense SNP (∼900K) and copy number polymorphism data of indigenous southern Africans. We demonstrate the genetic contribution to southern and eastern African populations, which involved admixture between indigenous San, Niger-Congo-speaking and populations of Eurasian ancestry. This finding illustrates the need to account for stratification in genome-wide association studies, and that admixture mapping would likely be a successful approach in these populations. We developed a strategy to detect the signature of selection prior to and following putative admixture events. Several genomic regions show an unusual excess of Niger-Kordofanian, and unusual deficiency of both San and Eurasian ancestry, which were considered the footprints of selection after population admixture. Several SNPs with strong allele frequency differences were observed predominantly between the admixed indigenous southern African populations, and their ancestral Eurasian populations. Interestingly, many candidate genes, which were identified within the genomic regions showing signals for selection, were associated with southern African-specific high-risk, mostly communicable diseases, such as malaria, influenza, tuberculosis, and human immunodeficiency virus/AIDs. This observation suggests a potentially important role that these genes might have played in adapting to the environment. Additionally, our analyses of haplotype structure, linkage disequilibrium, recombination, copy number variation and genome-wide admixture highlight, and support the unique position of San relative to both African and non-African populations. This study contributes to a better understanding of population ancestry and selection in south-eastern African populations; and the data and results obtained will support research into the genetic contributions to infectious as well as non-communicable diseases in the region. PMID:25811879
Saraswathy, Kallur Nava; Mukhopadhyay, Rupak; Shukla, Deepti; Kaur, Harpreet; Sachdeva, Mohinder Pal; Rao, A P; Saksena, Deepti; Kalla, Aloke Kumar
2009-02-01
Dopamine receptor D2 (DRD2) is expressed in the central nervous system and has a high affinity for many antipsychotic drugs. Besides several epidemiological investigations on association of DRD2 locus polymorphism(s) with neuropsychiatric problems and addictive behavior, a few polymorphisms in this locus have also been used to understand genomic diversity and population migratory histories globally. The present study attempts to understand the genomic diversity/affinity among four endogamous groups of Andhra Pradesh (India) against the backdrop of diversity studies from other parts of India and the rest of the world, with special reference to DRD2 locus. The four population groups from Adilabad District of Andhra Pradesh, namely, Brahmin (n=50), Nayakpod (n=49), Thoti (n=52), and Kolam (n=53), were included in the study. The DRD2 markers typed for the present study are three biallelic restriction fragments, that is, TaqI A (rs1800497), TaqI B (rs1079597), and TaqI D (rs1800498). Scoring of DRD2 haplotypes with respect to the three TaqI sites shows that five out of eight possible haplotypes are shared by the four populations. Ancestral haplotype B2D2A1 is most frequent among Thotis (0.359). The results of the present study indicate a differential gene flow into South India followed by certain important demographic events resulting in diversified peopling of India.
Insights into HLA-G Genetics Provided by Worldwide Haplotype Diversity
Castelli, Erick C.; Ramalho, Jaqueline; Porto, Iane O. P.; Lima, Thálitta H. A.; Felício, Leandro P.; Sabbagh, Audrey; Donadi, Eduardo A.; Mendes-Junior, Celso T.
2014-01-01
Human leukocyte antigen G (HLA-G) belongs to the family of non-classical HLA class I genes, located within the major histocompatibility complex (MHC). HLA-G has been the target of most recent research regarding the function of class I non-classical genes. The main features that distinguish HLA-G from classical class I genes are (a) limited protein variability, (b) alternative splicing generating several membrane bound and soluble isoforms, (c) short cytoplasmic tail, (d) modulation of immune response (immune tolerance), and (e) restricted expression to certain tissues. In the present work, we describe the HLA-G gene structure and address the HLA-G variability and haplotype diversity among several populations around the world, considering each of its major segments [promoter, coding, and 3′ untranslated region (UTR)]. For this purpose, we developed a pipeline to reevaluate the 1000Genomes data and recover miscalled or missing genotypes and haplotypes. It became clear that the overall structure of the HLA-G molecule has been maintained during the evolutionary process and that most of the variation sites found in the HLA-G coding region are either coding synonymous or intronic mutations. In addition, only a few frequent and divergent extended haplotypes are found when the promoter, coding, and 3′UTRs are evaluated together. The divergence is particularly evident for the regulatory regions. The population comparisons confirmed that most of the HLA-G variability has originated before human dispersion from Africa and that the allele and haplotype frequencies have probably been shaped by strong selective pressures. PMID:25339953
Beaudet, Denis; Terrat, Yves; Halary, Sébastien; de la Providencia, Ivan Enrique; Hijri, Mohamed
2013-01-01
Comparative mitochondrial genomics of arbuscular mycorrhizal fungi (AMF) provide new avenues to overcome long-lasting obstacles that have hampered studies aimed at understanding the community structure, diversity, and evolution of these multinucleated and genetically polymorphic organisms.AMF mitochondrial (mt) genomes are homogeneous within isolates, and their intergenic regions harbor numerous mobile elements that have rapidly diverged, including homing endonuclease genes, small inverted repeats, and plasmid-related DNA polymerase genes (dpo), making them suitable targets for the development of reliable strain-specific markers. However, these elements may also lead to genome rearrangements through homologous recombination, although this has never previously been reported in this group of obligate symbiotic fungi. To investigate whether such rearrangements are present and caused by mobile elements in AMF, the mitochondrial genomes from two Glomeraceae members (i.e., Glomus cerebriforme and Glomus sp.) with substantial mtDNA synteny divergence,were sequenced and compared with available glomeromycotan mitochondrial genomes. We used an extensive nucleotide/protein similarity network-based approach to investigated podiversity in AMF as well as in other organisms for which sequences are publicly available. We provide strong evidence of dpo-induced inter-haplotype recombination, leading to a reshuffled mitochondrial genome in Glomus sp. These findings raise questions as to whether AMF single spore cultivations artificially underestimate mtDNA genetic diversity.We assessed potential dpo dispersal mechanisms in AMF and inferred a robust phylogenetic relationship with plant mitochondrial plasmids. Along with other indirect evidence, our analyses indicate that members of the Glomeromycota phylum are potential donors of mitochondrial plasmids to plants.
Mapping the genetic diversity of HLA haplotypes in the Japanese populations
Saw, Woei-Yuh; Liu, Xuanyao; Khor, Chiea-Chuen; Takeuchi, Fumihiko; Katsuya, Tomohiro; Kimura, Ryosuke; Nabika, Toru; Ohkubo, Takayoshi; Tabara, Yasuharu; Yamamoto, Ken; Yokota, Mitsuhiro; Akiyama, Koichi; Asano, Hiroyuki; Asayama, Kei; Haga, Toshikazu; Hara, Azusa; Hirose, Takuo; Hosaka, Miki; Ichihara, Sahoko; Imai, Yutaka; Inoue, Ryusuke; Ishiguro, Aya; Isomura, Minoru; Isono, Masato; Kamide, Kei; Kato, Norihiro; Katsuya, Tomohiro; Kikuya, Masahiro; Kohara, Katsuhiko; Matsubara, Tatsuaki; Matsuda, Ayako; Metoki, Hirohito; Miki, Tetsuro; Murakami, Keiko; Nabika, Toru; Nakatochi, Masahiro; Ogihara, Toshio; Ohnaka, Keizo; Ohkubo, Takayoshi; Rakugi, Hiromi; Satoh, Michihiro; Shiwaku, Kunihiro; Sugimoto, Ken; Tabara, Yasuharu; Takami, Yoichi; Takayanagi, Ryoichi; Takeuchi, Fumihiko; Tsubota-Utsugi, Megumi; Yamamoto, Ken; Yamamoto, Koichi; Yamasaki, Masayuki; Yasui, Daisaku; Yokota, Mitsuhiro; Teo, Yik-Ying; Kato, Norihiro
2015-01-01
Japan has often been viewed as an Asian country that possesses a genetically homogenous community. The basis for partitioning the country into prefectures has largely been geographical, although cultural and linguistic differences still exist between some of the districts/prefectures, especially between Okinawa and the mainland prefectures. The Major Histocompatibility Complex (MHC) region has consistently emerged as the most polymorphic region in the human genome, harbouring numerous biologically important variants; nevertheless the presence of population-specific long haplotypes hinders the imputation of SNPs and classical HLA alleles. Here, we examined the extent of genetic variation at the MHC between eight Japanese populations sampled from Okinawa, and six other prefectures located in or close to the mainland of Japan, specifically focusing at the haplotypes observed within each population, and what the impact of any variation has on imputation. Our results indicated that Okinawa was genetically farther to the mainland Japanese than were Gujarati Indians from Tamil Indians, while the mainland Japanese from six prefectures were more homogeneous than between northern and southern Han Chinese. The distribution of haplotypes across Japan was similar, although imputation was most accurate for Okinawa and several mainland prefectures when population-specific panels were used as reference. PMID:26648100
Singapore Genome Variation Project: a haplotype map of three Southeast Asian populations.
Teo, Yik-Ying; Sim, Xueling; Ong, Rick T H; Tan, Adrian K S; Chen, Jieming; Tantoso, Erwin; Small, Kerrin S; Ku, Chee-Seng; Lee, Edmund J D; Seielstad, Mark; Chia, Kee-Seng
2009-11-01
The Singapore Genome Variation Project (SGVP) provides a publicly available resource of 1.6 million single nucleotide polymorphisms (SNPs) genotyped in 268 individuals from the Chinese, Malay, and Indian population groups in Southeast Asia. This online database catalogs information and summaries on genotype and phased haplotype data, including allele frequencies, assessment of linkage disequilibrium (LD), and recombination rates in a format similar to the International HapMap Project. Here, we introduce this resource and describe the analysis of human genomic variation upon agglomerating data from the HapMap and the Human Genome Diversity Project, providing useful insights into the population structure of the three major population groups in Asia. In addition, this resource also surveyed across the genome for variation in regional patterns of LD between the HapMap and SGVP populations, and for signatures of positive natural selection using two well-established metrics: iHS and XP-EHH. The raw and processed genetic data, together with all population genetic summaries, are publicly available for download and browsing through a web browser modeled with the Generic Genome Browser.
Singapore Genome Variation Project: A haplotype map of three Southeast Asian populations
Teo, Yik-Ying; Sim, Xueling; Ong, Rick T.H.; Tan, Adrian K.S.; Chen, Jieming; Tantoso, Erwin; Small, Kerrin S.; Ku, Chee-Seng; Lee, Edmund J.D.; Seielstad, Mark; Chia, Kee-Seng
2009-01-01
The Singapore Genome Variation Project (SGVP) provides a publicly available resource of 1.6 million single nucleotide polymorphisms (SNPs) genotyped in 268 individuals from the Chinese, Malay, and Indian population groups in Southeast Asia. This online database catalogs information and summaries on genotype and phased haplotype data, including allele frequencies, assessment of linkage disequilibrium (LD), and recombination rates in a format similar to the International HapMap Project. Here, we introduce this resource and describe the analysis of human genomic variation upon agglomerating data from the HapMap and the Human Genome Diversity Project, providing useful insights into the population structure of the three major population groups in Asia. In addition, this resource also surveyed across the genome for variation in regional patterns of LD between the HapMap and SGVP populations, and for signatures of positive natural selection using two well-established metrics: iHS and XP-EHH. The raw and processed genetic data, together with all population genetic summaries, are publicly available for download and browsing through a web browser modeled with the Generic Genome Browser. PMID:19700652
Da, Yang
2015-12-18
The amount of functional genomic information has been growing rapidly but remains largely unused in genomic selection. Genomic prediction and estimation using haplotypes in genome regions with functional elements such as all genes of the genome can be an approach to integrate functional and structural genomic information for genomic selection. Towards this goal, this article develops a new haplotype approach for genomic prediction and estimation. A multi-allelic haplotype model treating each haplotype as an 'allele' was developed for genomic prediction and estimation based on the partition of a multi-allelic genotypic value into additive and dominance values. Each additive value is expressed as a function of h - 1 additive effects, where h = number of alleles or haplotypes, and each dominance value is expressed as a function of h(h - 1)/2 dominance effects. For a sample of q individuals, the limit number of effects is 2q - 1 for additive effects and is the number of heterozygous genotypes for dominance effects. Additive values are factorized as a product between the additive model matrix and the h - 1 additive effects, and dominance values are factorized as a product between the dominance model matrix and the h(h - 1)/2 dominance effects. Genomic additive relationship matrix is defined as a function of the haplotype model matrix for additive effects, and genomic dominance relationship matrix is defined as a function of the haplotype model matrix for dominance effects. Based on these results, a mixed model implementation for genomic prediction and variance component estimation that jointly use haplotypes and single markers is established, including two computing strategies for genomic prediction and variance component estimation with identical results. The multi-allelic genetic partition fills a theoretical gap in genetic partition by providing general formulations for partitioning multi-allelic genotypic values and provides a haplotype
Yamamoto, Toshio; Nagasaki, Hideki; Yonemaru, Jun-ichi; Ebana, Kaworu; Nakajima, Maiko; Shibaya, Taeko; Yano, Masahiro
2010-04-27
To create useful gene combinations in crop breeding, it is necessary to clarify the dynamics of the genome composition created by breeding practices. A large quantity of single-nucleotide polymorphism (SNP) data is required to permit discrimination of chromosome segments among modern cultivars, which are genetically related. Here, we used a high-throughput sequencer to conduct whole-genome sequencing of an elite Japanese rice cultivar, Koshihikari, which is closely related to Nipponbare, whose genome sequencing has been completed. Then we designed a high-throughput typing array based on the SNP information by comparison of the two sequences. Finally, we applied this array to analyze historical representative rice cultivars to understand the dynamics of their genome composition. The total 5.89-Gb sequence for Koshihikari, equivalent to 15.7 x the entire rice genome, was mapped using the Pseudomolecules 4.0 database for Nipponbare. The resultant Koshihikari genome sequence corresponded to 80.1% of the Nipponbare sequence and led to the identification of 67,051 SNPs. A high-throughput typing array consisting of 1917 SNP sites distributed throughout the genome was designed to genotype 151 representative Japanese cultivars that have been grown during the past 150 years. We could identify the ancestral origin of the pedigree haplotypes in 60.9% of the Koshihikari genome and 18 consensus haplotype blocks which are inherited from traditional landraces to current improved varieties. Moreover, it was predicted that modern breeding practices have generally decreased genetic diversity Detection of genome-wide SNPs by both high-throughput sequencer and typing array made it possible to evaluate genomic composition of genetically related rice varieties. With the aid of their pedigree information, we clarified the dynamics of chromosome recombination during the historical rice breeding process. We also found several genomic regions decreasing genetic diversity which might be
The haplotype-resolved genome and epigenome of the aneuploid HeLa cancer cell line.
Adey, Andrew; Burton, Joshua N; Kitzman, Jacob O; Hiatt, Joseph B; Lewis, Alexandra P; Martin, Beth K; Qiu, Ruolan; Lee, Choli; Shendure, Jay
2013-08-08
The HeLa cell line was established in 1951 from cervical cancer cells taken from a patient, Henrietta Lacks. This was the first successful attempt to immortalize human-derived cells in vitro. The robust growth and unrestricted distribution of HeLa cells resulted in its broad adoption--both intentionally and through widespread cross-contamination--and for the past 60 years it has served a role analogous to that of a model organism. The cumulative impact of the HeLa cell line on research is demonstrated by its occurrence in more than 74,000 PubMed abstracts (approximately 0.3%). The genomic architecture of HeLa remains largely unexplored beyond its karyotype, partly because like many cancers, its extensive aneuploidy renders such analyses challenging. We carried out haplotype-resolved whole-genome sequencing of the HeLa CCL-2 strain, examined point- and indel-mutation variations, mapped copy-number variations and loss of heterozygosity regions, and phased variants across full chromosome arms. We also investigated variation and copy-number profiles for HeLa S3 and eight additional strains. We find that HeLa is relatively stable in terms of point variation, with few new mutations accumulating after early passaging. Haplotype resolution facilitated reconstruction of an amplified, highly rearranged region of chromosome 8q24.21 at which integration of the human papilloma virus type 18 (HPV-18) genome occurred and that is likely to be the event that initiated tumorigenesis. We combined these maps with RNA-seq and ENCODE Project data sets to phase the HeLa epigenome. This revealed strong, haplotype-specific activation of the proto-oncogene MYC by the integrated HPV-18 genome approximately 500 kilobases upstream, and enabled global analyses of the relationship between gene dosage and expression. These data provide an extensively phased, high-quality reference genome for past and future experiments relying on HeLa, and demonstrate the value of haplotype resolution for
Variation analysis and gene annotation of eight MHC haplotypes: The MHC Haplotype Project
Horton, Roger; Gibson, Richard; Coggill, Penny; Miretti, Marcos; Allcock, Richard J.; Almeida, Jeff; Forbes, Simon; Gilbert, James G. R.; Halls, Karen; Harrow, Jennifer L.; Hart, Elizabeth; Howe, Kevin; Jackson, David K.; Palmer, Sophie; Roberts, Anne N.; Sims, Sarah; Stewart, C. Andrew; Traherne, James A.; Trevanion, Steve; Wilming, Laurens; Rogers, Jane; de Jong, Pieter J.; Elliott, John F.; Sawcer, Stephen; Todd, John A.; Trowsdale, John
2008-01-01
The human major histocompatibility complex (MHC) is contained within about 4 Mb on the short arm of chromosome 6 and is recognised as the most variable region in the human genome. The primary aim of the MHC Haplotype Project was to provide a comprehensively annotated reference sequence of a single, human leukocyte antigen-homozygous MHC haplotype and to use it as a basis against which variations could be assessed from seven other similarly homozygous cell lines, representative of the most common MHC haplotypes in the European population. Comparison of the haplotype sequences, including four haplotypes not previously analysed, resulted in the identification of >44,000 variations, both substitutions and indels (insertions and deletions), which have been submitted to the dbSNP database. The gene annotation uncovered haplotype-specific differences and confirmed the presence of more than 300 loci, including over 160 protein-coding genes. Combined analysis of the variation and annotation datasets revealed 122 gene loci with coding substitutions of which 97 were non-synonymous. The haplotype (A3-B7-DR15; PGF cell line) designated as the new MHC reference sequence, has been incorporated into the human genome assembly (NCBI35 and subsequent builds), and constitutes the largest single-haplotype sequence of the human genome to date. The extensive variation and annotation data derived from the analysis of seven further haplotypes have been made publicly available and provide a framework and resource for future association studies of all MHC-associated diseases and transplant medicine. PMID:18193213
Whole genome SNP discovery and analysis of genetic diversity in Turkey (Meleagris gallopavo)
2012-01-01
study in turkey resulted in the detection of 5.49 million putative SNPs compared to the reference genome. All commercial lines appear to share a common origin. Presence of different alleles/haplotypes in the SM population highlights that specific haplotypes have been selected in the modern domesticated turkey. PMID:22891612
Staubach, Fabian; Lorenc, Anna; Messer, Philipp W.; Tang, Kun; Petrov, Dmitri A.; Tautz, Diethard
2012-01-01
General parameters of selection, such as the frequency and strength of positive selection in natural populations or the role of introgression, are still insufficiently understood. The house mouse (Mus musculus) is a particularly well-suited model system to approach such questions, since it has a defined history of splits into subspecies and populations and since extensive genome information is available. We have used high-density single-nucleotide polymorphism (SNP) typing arrays to assess genomic patterns of positive selection and introgression of alleles in two natural populations of each of the subspecies M. m. domesticus and M. m. musculus. Applying different statistical procedures, we find a large number of regions subject to apparent selective sweeps, indicating frequent positive selection on rare alleles or novel mutations. Genes in the regions include well-studied imprinted loci (e.g. Plagl1/Zac1), homologues of human genes involved in adaptations (e.g. alpha-amylase genes) or in genetic diseases (e.g. Huntingtin and Parkin). Haplotype matching between the two subspecies reveals a large number of haplotypes that show patterns of introgression from specific populations of the respective other subspecies, with at least 10% of the genome being affected by partial or full introgression. Using neutral simulations for comparison, we find that the size and the fraction of introgressed haplotypes are not compatible with a pure migration or incomplete lineage sorting model. Hence, it appears that introgressed haplotypes can rise in frequency due to positive selection and thus can contribute to the adaptive genomic landscape of natural populations. Our data support the notion that natural genomes are subject to complex adaptive processes, including the introgression of haplotypes from other differentiated populations or species at a larger scale than previously assumed for animals. This implies that some of the admixture found in inbred strains of mice may also have
Zhu, Xiaofeng; Yan, Denise; Cooper, Richard S.; Luke, Amy; Ikeda, Morna A.; Chang, Yen-Pei C.; Weder, Alan; Chakravarti, Aravinda
2003-01-01
Association studies of candidate genes with complex traits have generally used one or a few single nucleotide polymorphisms (SNPs), although variation in the extent of linkage disequilibrium (LD) within genes markedly influences the sensitivity and precision of association studies. The extent of LD and the underlying haplotype structure for most candidate genes are still unavailable. We sampled 193 blacks (African-Americans) and 160 whites (European-Americans) and estimated the intragenic LD and the haplotype structure in four genes of the renin–angiotensin system. We genotyped 25 SNPs, with all but one of the pairs spaced between 1 and 20 kb, thus providing resolution at small scale. The pattern of LD within a gene was very heterogeneous. Using a robust method to define haplotype blocks, blocks of limited haplotype diversity were identified at each locus; between these blocks, LD was lost owing to the history of recombination events. As anticipated, there was less LD among blacks, the number of haplotypes was substantially larger, and shorter haplotype segments were found, compared with whites. These findings have implications for candidate-gene association studies and indicate that variation between populations of European and African origin in haplotype diversity is characteristic of most genes. [The sequence data described in this paper are available in GenBank under the following accession nos: AGT, MIM 106150; Renin, MIM 179820; ACE, MIM 106180; Angiotensin receptor I, MIM 106165. Supplementary material is available online at http://www.genome.org.] PMID:12566395
Deonovic, Benjamin; Wang, Yunhao; Weirather, Jason; Wang, Xiu-Jie; Au, Kin Fai
2017-01-01
Abstract Allele-specific expression (ASE) is a fundamental problem in studying gene regulation and diploid transcriptome profiles, with two key challenges: (i) haplotyping and (ii) estimation of ASE at the gene isoform level. Existing ASE analysis methods are limited by a dependence on haplotyping from laborious experiments or extra genome/family trio data. In addition, there is a lack of methods for gene isoform level ASE analysis. We developed a tool, IDP-ASE, for full ASE analysis. By innovative integration of Third Generation Sequencing (TGS) long reads with Second Generation Sequencing (SGS) short reads, the accuracy of haplotyping and ASE quantification at the gene and gene isoform level was greatly improved as demonstrated by the gold standard data GM12878 data and semi-simulation data. In addition to methodology development, applications of IDP-ASE to human embryonic stem cells and breast cancer cells indicate that the imbalance of ASE and non-uniformity of gene isoform ASE is widespread, including tumorigenesis relevant genes and pluripotency markers. These results show that gene isoform expression and allele-specific expression cooperate to provide high diversity and complexity of gene regulation and expression, highlighting the importance of studying ASE at the gene isoform level. Our study provides a robust bioinformatics solution to understand ASE using RNA sequencing data only. PMID:27899656
Recent Advances in Experimental Whole Genome Haplotyping Methods
Huang, Mengting; Lu, Zuhong
2017-01-01
Haplotype plays a vital role in diverse fields; however, the sequencing technologies cannot resolve haplotype directly. Pioneers demonstrated several approaches to resolve haplotype in the early years, which was extensively reviewed. Since then, numerous methods have been developed recently that have significantly improved phasing performance. Here, we review experimental methods that have emerged mainly over the past five years, and categorize them into five classes according to their maximum scale of contiguity: (i) encapsulation, (ii) 3D structure capture and construction, (iii) compartmentalization, (iv) fluorography, (v) long-read sequencing. Several subsections of certain methods are attached to each class as instances. We also discuss the relative advantages and disadvantages of different classes and make comparisons among representative methods of each class. PMID:28891974
Jia, Guanqing; Huang, Xuehui; Zhi, Hui; Zhao, Yan; Zhao, Qiang; Li, Wenjun; Chai, Yang; Yang, Lifang; Liu, Kunyan; Lu, Hengyun; Zhu, Chuanrang; Lu, Yiqi; Zhou, Congcong; Fan, Danlin; Weng, Qijun; Guo, Yunli; Huang, Tao; Zhang, Lei; Lu, Tingting; Feng, Qi; Hao, Hangfei; Liu, Hongkuan; Lu, Ping; Zhang, Ning; Li, Yuhui; Guo, Erhu; Wang, Shujun; Wang, Suying; Liu, Jinrong; Zhang, Wenfei; Chen, Guoqiu; Zhang, Baojin; Li, Wei; Wang, Yongfang; Li, Haiquan; Zhao, Baohua; Li, Jiayang; Diao, Xianmin; Han, Bin
2013-08-01
Foxtail millet (Setaria italica) is an important grain crop that is grown in arid regions. Here we sequenced 916 diverse foxtail millet varieties, identified 2.58 million SNPs and used 0.8 million common SNPs to construct a haplotype map of the foxtail millet genome. We classified the foxtail millet varieties into two divergent groups that are strongly correlated with early and late flowering times. We phenotyped the 916 varieties under five different environments and identified 512 loci associated with 47 agronomic traits by genome-wide association studies. We performed a de novo assembly of deeply sequenced genomes of a Setaria viridis accession (the wild progenitor of S. italica) and an S. italica variety and identified complex interspecies and intraspecies variants. We also identified 36 selective sweeps that seem to have occurred during modern breeding. This study provides fundamental resources for genetics research and genetic improvement in foxtail millet.
D-loop haplotype diversity in Brazilian horse breeds
Ianella, Patrícia; Albuquerque, Maria do Socorro Maués; Paiva, Samuel Rezende; do Egito, Andréa Alves; Almeida, Leonardo Daniel; Sereno, Fabiana T. P. S.; Carvalho, Luiz Felipe Ramos; Mariante, Arthur da Silva; McManus, Concepta Margaret
2017-01-01
Abstract The first horses were brought to Brazil by the colonizers after 1534. Over the centuries, these animals evolved and adapted to local environmental conditions usually unsuitable for exotic breeds, thereby originating locally adapted Brazilian breeds. The present work represents the first description of maternal genetic diversity in these horse breeds based on D-loop sequences. A D-Loop HSV-I fragment of 252 bp, from 141 horses belonging to ten Brazilian breeds / genetic groups (locally adapted and specialized breeds) were analysed. Thirty-five different haplotypes belonging to 18 haplogroups were identified with 33 polymorphic sites. Haplotype diversity (varying from 0.20 to 0.96) and nucleotide diversity (varying from 0.0039 to 0.0239) was lower for locally adapted than for specialized breeds, with the same pattern observed for FST values. Haplogroups identified in Brazilian breeds are in agreement with previous findings in South American samples. The low variability observed mainly in locally adapted breeds, indicates that, to ensure conservation of these breeds, careful reproductive management is needed. Additional genetic characterization studies are required to support accurate decision-making. PMID:28863209
Mitchell, R J; Earl, L; Fricke, B
1997-10-01
Variation on the Y chromosome may permit our understanding the evolution of the human paternal lineage and male gene flow. This study reports upon the distribution and non random association of alleles at four Y-chromosome specific loci in four populations, three Caucasoid (Italian, Greek and Slav) and one Asian. The markers include insertion/deletion (p12f), point mutation (92R7 and pY alpha I), and repeat sequence (p21A1) polymorphisms. Our data confirm that the p12f/TaqI 8 kb allele is a Caucasoid marker and that Asians are monomorphic at three of the loci (p12f, 92R7, and pY alpha I). The alleles at 92R7 and pY alpha I were found to be in complete disequilibrium in Europeans. Y-haplotype diversity was highly significant between Asians and all three European groups (P < 0.001), but the Greeks and Italians were also significantly different with respect to some alleles and haplotypes (P < 0.02). We find strong evidence that the p12f/TaqI 8 kb allele may have arisen only once, as a deletion event, and, additionally, that the present-day frequency distribution of Y chromosomes carrying the p12f/8 kb allele suggests that it may have been spread by colonising sea-faring peoples from the Near East, possibly the Phoenicians, rather than by expansion of Neolithic farmers into continental Europe. The p12f deletion is the key marker of a unique Y chromosome, found only in Caucasians to date, labelled 'Mediterranean' and this further increases the level of Y-chromosome diversity seen among Caucasoids when compared to the other major population groups.
Prion gene haplotypes of U.S. cattle
Clawson, Michael L; Heaton, Michael P; Keele, John W; Smith, Timothy PL; Harhay, Gregory P; Laegreid, William W
2006-01-01
Background Bovine spongiform encephalopathy (BSE) is a fatal neurological disorder characterized by abnormal deposits of a protease-resistant isoform of the prion protein. Characterizing linkage disequilibrium (LD) and haplotype networks within the bovine prion gene (PRNP) is important for 1) testing rare or common PRNP variation for an association with BSE and 2) interpreting any association of PRNP alleles with BSE susceptibility. The objective of this study was to identify polymorphisms and haplotypes within PRNP from the promoter region through the 3'UTR in a diverse sample of U.S. cattle genomes. Results A 25.2-kb genomic region containing PRNP was sequenced from 192 diverse U.S. beef and dairy cattle. Sequence analyses identified 388 total polymorphisms, of which 287 have not previously been reported. The polymorphism alleles define PRNP by regions of high and low LD. High LD is present between alleles in the promoter region through exon 2 (6.7 kb). PRNP alleles within the majority of intron 2, the entire coding sequence and the untranslated region of exon 3 are in low LD (18.0 kb). Two haplotype networks, one representing the region of high LD and the other the region of low LD yielded nineteen different combinations that represent haplotypes spanning PRNP. The haplotype combinations are tagged by 19 polymorphisms (htSNPS) which characterize variation within and across PRNP. Conclusion The number of polymorphisms in the prion gene region of U.S. cattle is nearly four times greater than previously described. These polymorphisms define PRNP haplotypes that may influence BSE susceptibility in cattle. PMID:17092337
Two Orangutan Species Have Evolved Different KIR Alleles and Haplotypes1
Guethlein, Lisbeth A.; Norman, Paul J.; Heijmans, Corinne M. C.; de Groot, Natasja G.; Hilton, Hugo G.; Babrzadeh, Farbod; Abi-Rached, Laurent; Bontrop, Ronald E.; Parham, Peter
2017-01-01
The immune and reproductive functions of human Natural Killer (NK) cells are regulated by interactions of the C1 and C2 epitopes of HLA-C with C1-specific and C2-specific lineage III killer cell immunoglobulin-like receptors (KIR). This rapidly evolving and diverse system of ligands and receptors is restricted to humans and great apes. In this context, the orangutan has particular relevance because it represents an evolutionary intermediate, one having the C1 epitope and corresponding KIR, but lacking the C2 epitope. Through a combination of direct sequencing, KIR genotyping and data mining from the Great Ape Genome Project (GAGP) we characterized the KIR alleles and haplotypes for panels of ten Bornean orangutans and 19 Sumatran orangutans. The orangutan KIR haplotypes have between five and ten KIR genes. The seven orangutan lineage III KIR genes all locate to the centromeric region of the KIR locus, whereas their human counterparts also populate the telomeric region. One lineage III KIR gene is Bornean-specific, one is Sumatran-specific and five are shared. Of twelve KIR gene-content haplotypes five are Bornean-specific, five are Sumatran-specific and two are shared. The haplotypes have different combinations of genes encoding activating and inhibitory C1 receptors that can be of higher or lower affinity. All haplotypes encode an inhibitory C1 receptor, but only some haplotypes encode an activating C1 receptor. Of 130 KIR alleles, 55 are Bornean-specific, 65 are Sumatran specific and ten are shared. PMID:28264973
Bacillus subtilis genome diversity.
Earl, Ashlee M; Losick, Richard; Kolter, Roberto
2007-02-01
Microarray-based comparative genomic hybridization (M-CGH) is a powerful method for rapidly identifying regions of genome diversity among closely related organisms. We used M-CGH to examine the genome diversity of 17 strains belonging to the nonpathogenic species Bacillus subtilis. Our M-CGH results indicate that there is considerable genetic heterogeneity among members of this species; nearly one-third of Bsu168-specific genes exhibited variability, as measured by the microarray hybridization intensities. The variable loci include those encoding proteins involved in antibiotic production, cell wall synthesis, sporulation, and germination. The diversity in these genes may reflect this organism's ability to survive in diverse natural settings.
Missing data imputation and haplotype phase inference for genome-wide association studies
Browning, Sharon R.
2009-01-01
Imputation of missing data and the use of haplotype-based association tests can improve the power of genome-wide association studies (GWAS). In this article, I review methods for haplotype inference and missing data imputation, and discuss their application to GWAS. I discuss common features of the best algorithms for haplotype phase inference and missing data imputation in large-scale data sets, as well as some important differences between classes of methods, and highlight the methods that provide the highest accuracy and fastest computational performance. PMID:18850115
Congruence as a measurement of extended haplotype structure across the genome
2012-01-01
Background Historically, extended haplotypes have been defined using only a few data points, such as alleles for several HLA genes in the MHC. High-density SNP data, and the increasing affordability of whole genome SNP typing, creates the opportunity to define higher resolution extended haplotypes. This drives the need for new tools that support quantification and visualization of extended haplotypes as defined by as many as 2000 SNPs. Confronted with high-density SNP data across the major histocompatibility complex (MHC) for 2,300 complete families, compiled by the Type 1 Diabetes Genetics Consortium (T1DGC), we developed software for studying extended haplotypes. Methods The software, called ExHap (Extended Haplotype), uses a similarity measurement we term congruence to identify and quantify long-range allele identity. Using ExHap, we analyzed congruence in both the T1DGC data and family-phased data from the International HapMap Project. Results Congruent chromosomes from the T1DGC data have between 96.5% and 99.9% allele identity over 1,818 SNPs spanning 2.64 megabases of the MHC (HLA-DRB1 to HLA-A). Thirty-three of 132 DQ-DR-B-A defined haplotype groups have > 50% congruent chromosomes in this region. For example, 92% of chromosomes within the DR3-B8-A1 haplotype are congruent from HLA-DRB1 to HLA-A (99.8% allele identity). We also applied ExHap to all 22 autosomes for both CEU and YRI cohorts from the International HapMap Project, identifying multiple candidate extended haplotypes. Conclusions Long-range congruence is not unique to the MHC region. Patterns of allele identity on phased chromosomes provide a simple, straightforward approach to visually and quantitatively inspect complex long-range structural patterns in the genome. Such patterns aid the biologist in appreciating genetic similarities and differences across cohorts, and can lead to hypothesis generation for subsequent studies. PMID:22369243
Delaneau, Olivier; Marchini, Jonathan
2014-06-13
A major use of the 1000 Genomes Project (1000 GP) data is genotype imputation in genome-wide association studies (GWAS). Here we develop a method to estimate haplotypes from low-coverage sequencing data that can take advantage of single-nucleotide polymorphism (SNP) microarray genotypes on the same samples. First the SNP array data are phased to build a backbone (or 'scaffold') of haplotypes across each chromosome. We then phase the sequence data 'onto' this haplotype scaffold. This approach can take advantage of relatedness between sequenced and non-sequenced samples to improve accuracy. We use this method to create a new 1000 GP haplotype reference set for use by the human genetic community. Using a set of validation genotypes at SNP and bi-allelic indels we show that these haplotypes have lower genotype discordance and improved imputation performance into downstream GWAS samples, especially at low-frequency variants.
Baurens, Franc-Christophe; Bocs, Stéphanie; Rouard, Mathieu; Matsumoto, Takashi; Miller, Robert N G; Rodier-Goud, Marguerite; MBéguié-A-MBéguié, Didier; Yahiaoui, Nabila
2010-07-16
Comparative sequence analysis of complex loci such as resistance gene analog clusters allows estimating the degree of sequence conservation and mechanisms of divergence at the intraspecies level. In banana (Musa sp.), two diploid wild species Musa acuminata (A genome) and Musa balbisiana (B genome) contribute to the polyploid genome of many cultivars. The M. balbisiana species is associated with vigour and tolerance to pests and disease and little is known on the genome structure and haplotype diversity within this species. Here, we compare two genomic sequences of 253 and 223 kb corresponding to two haplotypes of the RGA08 resistance gene analog locus in M. balbisiana "Pisang Klutuk Wulung" (PKW). Sequence comparison revealed two regions of contrasting features. The first is a highly colinear gene-rich region where the two haplotypes diverge only by single nucleotide polymorphisms and two repetitive element insertions. The second corresponds to a large cluster of RGA08 genes, with 13 and 18 predicted RGA genes and pseudogenes spread over 131 and 152 kb respectively on each haplotype. The RGA08 cluster is enriched in repetitive element insertions, in duplicated non-coding intergenic sequences including low complexity regions and shows structural variations between haplotypes. Although some allelic relationships are retained, a large diversity of RGA08 genes occurs in this single M. balbisiana genotype, with several RGA08 paralogs specific to each haplotype. The RGA08 gene family has evolved by mechanisms of unequal recombination, intragenic sequence exchange and diversifying selection. An unequal recombination event taking place between duplicated non-coding intergenic sequences resulted in a different RGA08 gene content between haplotypes pointing out the role of such duplicated regions in the evolution of RGA clusters. Based on the synonymous substitution rate in coding sequences, we estimated a 1 million year divergence time for these M. balbisiana haplotypes. A
2010-01-01
Background Comparative sequence analysis of complex loci such as resistance gene analog clusters allows estimating the degree of sequence conservation and mechanisms of divergence at the intraspecies level. In banana (Musa sp.), two diploid wild species Musa acuminata (A genome) and Musa balbisiana (B genome) contribute to the polyploid genome of many cultivars. The M. balbisiana species is associated with vigour and tolerance to pests and disease and little is known on the genome structure and haplotype diversity within this species. Here, we compare two genomic sequences of 253 and 223 kb corresponding to two haplotypes of the RGA08 resistance gene analog locus in M. balbisiana "Pisang Klutuk Wulung" (PKW). Results Sequence comparison revealed two regions of contrasting features. The first is a highly colinear gene-rich region where the two haplotypes diverge only by single nucleotide polymorphisms and two repetitive element insertions. The second corresponds to a large cluster of RGA08 genes, with 13 and 18 predicted RGA genes and pseudogenes spread over 131 and 152 kb respectively on each haplotype. The RGA08 cluster is enriched in repetitive element insertions, in duplicated non-coding intergenic sequences including low complexity regions and shows structural variations between haplotypes. Although some allelic relationships are retained, a large diversity of RGA08 genes occurs in this single M. balbisiana genotype, with several RGA08 paralogs specific to each haplotype. The RGA08 gene family has evolved by mechanisms of unequal recombination, intragenic sequence exchange and diversifying selection. An unequal recombination event taking place between duplicated non-coding intergenic sequences resulted in a different RGA08 gene content between haplotypes pointing out the role of such duplicated regions in the evolution of RGA clusters. Based on the synonymous substitution rate in coding sequences, we estimated a 1 million year divergence time for these M
17 Y-STR haplotype diversity in São Paulo state (southeast of Brazil).
de Souza, Leandro Fonseca; da Motta, Carlos Henrique Ares Silveira; Moura-Neto, Rodrigo Soares
2018-03-12
A sample of 158 Brazilian males from São Paulo (SP), Brazilian southeast, was typed for 17 Y-STR loci (DYS19, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS437, DYS438, DYS439, DYS448, DYS456, DYS458, DYS635, YGATA_H4.1, and DYS385ab). A total of 158 haplotypes were identified, of which all were unique. The haplotype diversity and discrimination capacity were calculated in 1.0 and the genetic diversity was 67.4%. Pairwise haplotype distances showed that the São Paulo population is not significantly different from Rio de Janeiro and Portugal, but is different from African and Native American.
Gu, Ming-liang; Chu, Jia-you
2007-12-01
Human genome has structures of haplotype and haplotype block which provide valuable information on human evolutionary history and may lead to the development of more efficient strategies to identify genetic variants that increase susceptibility to complex diseases. Haplotype block can be divided into discrete blocks of limited haplotype diversity. In each block, a small fraction of ptag SNPsq can be used to distinguish a large fraction of the haplotypes. These tag SNPs can be potentially useful for construction of haplotype and haplotype block, and association studies in complex diseases. There are two general classes of methods to construct haplotype and haplotype blocks based on genotypes on large pedigrees and statistical algorithms respectively. The author evaluate several construction methods to assess the power of different association tests with a variety of disease models and block-partitioning criteria. The advantages, limitations and applications of each method and the application in the association studies are discussed equitably. With the completion of the HapMap and development of statistical algorithms for addressing haplotype reconstruction, ideas of construction of haplotype based on combination of mathematics, physics, and computer science etc will have profound impacts on population genetics, location and cloning for susceptible genes in complex diseases, and related domain with life science etc.
Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR.
Tyson, Jess; Armour, John A L
2012-12-11
Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in) regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example.
Determination of haplotypes at structurally complex regions using emulsion haplotype fusion PCR
2012-01-01
Background Genotyping and massively-parallel sequencing projects result in a vast amount of diploid data that is only rarely resolved into its constituent haplotypes. It is nevertheless this phased information that is transmitted from one generation to the next and is most directly associated with biological function and the genetic causes of biological effects. Despite progress made in genome-wide sequencing and phasing algorithms and methods, problems assembling (and reconstructing linear haplotypes in) regions of repetitive DNA and structural variation remain. These dynamic and structurally complex regions are often poorly understood from a sequence point of view. Regions such as these that are highly similar in their sequence tend to be collapsed onto the genome assembly. This is turn means downstream determination of the true sequence haplotype in these regions poses a particular challenge. For structurally complex regions, a more focussed approach to assembling haplotypes may be required. Results In order to investigate reconstruction of spatial information at structurally complex regions, we have used an emulsion haplotype fusion PCR approach to reproducibly link sequences of up to 1kb in length to allow phasing of multiple variants from neighbouring loci, using allele-specific PCR and sequencing to detect the phase. By using emulsion systems linking flanking regions to amplicons within the CNV, this led to the reconstruction of a 59kb haplotype across the DEFA1A3 CNV in HapMap individuals. Conclusion This study has demonstrated a novel use for emulsion haplotype fusion PCR in addressing the issue of reconstructing structural haplotypes at multiallelic copy variable regions, using the DEFA1A3 locus as an example. PMID:23231411
A genome-wide SNP scan accelerates trait-regulatory genomic loci identification in chickpea
Kujur, Alice; Bajaj, Deepak; Upadhyaya, Hari D.; Das, Shouvik; Ranjan, Rajeev; Shree, Tanima; Saxena, Maneesha S.; Badoni, Saurabh; Kumar, Vinod; Tripathi, Shailesh; Gowda, C.L.L.; Sharma, Shivali; Singh, Sube; Tyagi, Akhilesh K.; Parida, Swarup K.
2015-01-01
We identified 44844 high-quality SNPs by sequencing 92 diverse chickpea accessions belonging to a seed and pod trait-specific association panel using reference genome- and de novo-based GBS (genotyping-by-sequencing) assays. A GWAS (genome-wide association study) in an association panel of 211, including the 92 sequenced accessions, identified 22 major genomic loci showing significant association (explaining 23–47% phenotypic variation) with pod and seed number/plant and 100-seed weight. Eighteen trait-regulatory major genomic loci underlying 13 robust QTLs were validated and mapped on an intra-specific genetic linkage map by QTL mapping. A combinatorial approach of GWAS, QTL mapping and gene haplotype-specific LD mapping and transcript profiling uncovered one superior haplotype and favourable natural allelic variants in the upstream regulatory region of a CesA-type cellulose synthase (Ca_Kabuli_CesA3) gene regulating high pod and seed number/plant (explaining 47% phenotypic variation) in chickpea. The up-regulation of this superior gene haplotype correlated with increased transcript expression of Ca_Kabuli_CesA3 gene in the pollen and pod of high pod/seed number accession, resulting in higher cellulose accumulation for normal pollen and pollen tube growth. A rapid combinatorial genome-wide SNP genotyping-based approach has potential to dissect complex quantitative agronomic traits and delineate trait-regulatory genomic loci (candidate genes) for genetic enhancement in crop plants, including chickpea. PMID:26058368
Modeling haplotype block variation using Markov chains.
Greenspan, G; Geiger, D
2006-04-01
Models of background variation in genomic regions form the basis of linkage disequilibrium mapping methods. In this work we analyze a background model that groups SNPs into haplotype blocks and represents the dependencies between blocks by a Markov chain. We develop an error measure to compare the performance of this model against the common model that assumes that blocks are independent. By examining data from the International Haplotype Mapping project, we show how the Markov model over haplotype blocks is most accurate when representing blocks in strong linkage disequilibrium. This contrasts with the independent model, which is rendered less accurate by linkage disequilibrium. We provide a theoretical explanation for this surprising property of the Markov model and relate its behavior to allele diversity.
Modeling Haplotype Block Variation Using Markov Chains
Greenspan, G.; Geiger, D.
2006-01-01
Models of background variation in genomic regions form the basis of linkage disequilibrium mapping methods. In this work we analyze a background model that groups SNPs into haplotype blocks and represents the dependencies between blocks by a Markov chain. We develop an error measure to compare the performance of this model against the common model that assumes that blocks are independent. By examining data from the International Haplotype Mapping project, we show how the Markov model over haplotype blocks is most accurate when representing blocks in strong linkage disequilibrium. This contrasts with the independent model, which is rendered less accurate by linkage disequilibrium. We provide a theoretical explanation for this surprising property of the Markov model and relate its behavior to allele diversity. PMID:16361244
Blocks of limited haplotype diversity revealed by high-resolution scanning of human chromosome 21.
Patil, N; Berno, A J; Hinds, D A; Barrett, W A; Doshi, J M; Hacker, C R; Kautzer, C R; Lee, D H; Marjoribanks, C; McDonough, D P; Nguyen, B T; Norris, M C; Sheehan, J B; Shen, N; Stern, D; Stokowski, R P; Thomas, D J; Trulson, M O; Vyas, K R; Frazer, K A; Fodor, S P; Cox, D R
2001-11-23
Global patterns of human DNA sequence variation (haplotypes) defined by common single nucleotide polymorphisms (SNPs) have important implications for identifying disease associations and human traits. We have used high-density oligonucleotide arrays, in combination with somatic cell genetics, to identify a large fraction of all common human chromosome 21 SNPs and to directly observe the haplotype structure defined by these SNPs. This structure reveals blocks of limited haplotype diversity in which more than 80% of a global human sample can typically be characterized by only three common haplotypes.
Hsueh, Wen-Chi; He, Qimei; Willcox, D. Craig; Nievergelt, Caroline M.; Donlon, Timothy A.; Kwok, Pui-Yan; Suzuki, Makoto; Willcox, Bradley J.
2014-01-01
Isolated populations have advantages for genetic studies of longevity from decreased haplotype diversity and long-range linkage disequilibrium. This permits smaller sample sizes without loss of power, among other utilities. Little is known about the genome of the Okinawans, a potential population isolate, recognized for longevity. Therefore, we assessed genetic diversity, structure, and admixture in Okinawans, and compared this with Caucasians, Chinese, Japanese, and Africans from HapMap II, genotyped on the same Affymetrix GeneChip Human Mapping 500K array. Principal component analysis, haplotype coverage, and linkage disequilibrium decay revealed a distinct Okinawan genome—more homogeneity, less haplotype diversity, and longer range linkage disequilibrium. Population structure and admixture analyses utilizing 52 global reference populations from the Human Genome Diversity Cell Line Panel demonstrated that Okinawans clustered almost exclusively with East Asians. Sibling relative risk (λs) analysis revealed that siblings of Okinawan centenarians have 3.11 times (females) and 3.77 times (males) more likelihood of centenarianism. These findings suggest that Okinawans are genetically distinct and share several characteristics of a population isolate, which are prone to develop extreme phenotypes (eg, longevity) from genetic drift, natural selection, and population bottlenecks. These data support further exploration of genetic influence on longevity in the Okinawans. PMID:24444611
Yamaguchi-Kabata, Yumi; Tsunoda, Tatsuhiko; Kumasaka, Natsuhiko; Takahashi, Atsushi; Hosono, Naoya; Kubo, Michiaki; Nakamura, Yusuke; Kamatani, Naoyuki
2012-05-01
Although the Japanese population has a rather low genetic diversity, we recently confirmed the presence of two main clusters (the Hondo and Ryukyu clusters) through principal component analysis of genome-wide single-nucleotide polymorphism (SNP) genotypes. Understanding the genetic differences between the two main clusters requires further genome-wide analyses based on a dense SNP set and comparison of haplotype frequencies. In the present study, we determined haplotypes for the Hondo cluster of the Japanese population by detecting SNP homozygotes with 388,591 autosomal SNPs from 18,379 individuals and estimated the haplotype frequencies. Haplotypes for the Ryukyu cluster were inferred by a statistical approach using the genotype data from 504 individuals. We then compared the haplotype frequencies between the Hondo and Ryukyu clusters. In most genomic regions, the haplotype frequencies in the Hondo and Ryukyu clusters were very similar. However, in addition to the human leukocyte antigen region on chromosome 6, other genomic regions (chromosomes 3, 4, 5, 7, 10 and 12) showed dissimilarities in haplotype frequency. These regions were enriched for genes involved in the immune system, cell-cell adhesion and the intracellular signaling cascade. These differentiated genomic regions between the Hondo and Ryukyu clusters are of interest because they (1) should be examined carefully in association studies and (2) likely contain genes responsible for morphological or physiological differences between the two groups.
Ilkilic, Ilhan; Paul, Norbert W
2009-03-01
The goal of the Human Genome Diversity Project (HGDP) was to reconstruct the history of human evolution and the historical and geographical distribution of populations with the help of scientific research. Through this kind of research, the entire spectrum of genetic diversity to be found in the human species was to be explored with the hope of generating a better understanding of the history of humankind. An important part of this genome diversity research consists in taking blood and tissue samples from indigenous populations. For various reasons, it has not been possible to execute this project in the planned scope and form to date. Nevertheless, genomic diversity research addresses complex issues which prove to be highly relevant from the perspective of research ethics, transcultural medical ethics, and cultural philosophy. In the article at hand, we discuss these ethical issues as illustrated by the HGDP. This investigation focuses on the confrontation of culturally diverse images of humans and their cosmologies within the framework of genome diversity research and the ethical questions it raises. We argue that in addition to complex questions pertaining to research ethics such as informed consent and autonomy of probands, genome diversity research also has a cultural-philosophical, meta-ethical, and phenomenological dimension which must be taken into account in ethical discourses. Acknowledging this fact, we attempt to show the limits of current guidelines used in international genome diversity studies, following this up by a formulation of theses designed to facilitate an appropriate inquiry and ethical evaluation of intercultural dimensions of genome research.
Saville, Amanda; Charles, Melodi; Chavan, Suchitra; Muñoz, Miguel; Gómez-Alpizar, Luis; Ristaino, Jean Beagle
2017-12-01
Pseudocercospora fijiensis is the causal pathogen of black Sigatoka, a devastating disease of banana that can cause 20 to 80% yield loss in the absence of fungicides in banana crops. The genetic structure of populations of P. fijiensis in Costa Rica was examined and compared with Honduran and global populations to better understand migration patterns and inform management strategies. In total, 118 isolates of P. fijiensis collected from Costa Rica and Honduras from 2010 to 2014 were analyzed using multilocus genotyping of six loci and compared with a previously published global dataset of populations of P. fijiensis. The Costa Rican and Honduran populations shared haplotype diversity with haplotypes from Southeast Asia, Oceania, and the Americas but not Africa for all but one of the six loci studied. Gene flow and shared haplotype diversity was found in Honduran and Costa Rican populations of the pathogen. The data indicate that the haplotypic diversity observed in Costa Rican populations of P. fijiensis is derived from dispersal from initial outbreak sources in Honduras and admixtures between genetically differentiated sources from Southeast Asia, Oceania, and the Americas.
Diversity of HLA-B61 alleles and haplotypes in East Asians and Spanish Gypsies.
Ogawa, A; Tokunaga, K; Lin, L; Kashiwase, K; Tanaka, H; Herrero, M J; Vilches, C; Park, M H; Jia, G J; Chimge, N O; Sideltseva, E W; Ishikawa, Y; Akaza, T; Tadokoro, K; Juji, T
1998-04-01
The distribution of HLA-B61 alleles and their association with HLA-C and DRB1 alleles were investigated in six East Asian populations (South Korean, Chinese Korean, Man (Manchu), Northern Han, Mongolian and Buryat) and Spanish Gypsies and compared to our previous report on the Japanese population. The alleles were identified using a group-specific polymerase chain reaction (PCR) and genomic DNA followed by hybridization with sequence-specific oligonucleotide probes (SSOP). Both HLA-B*4002 and B*4006 were commonly detected in the South Korean, Chinese Korean, Man, Northern Han and Japanese populations, while HLA-B*4002 was predominant in the Mongolian and Buryat populations. Strong associations of B*4002 with Cw*0304 and of B*4006 with Cw*0801 were commonly observed in these East Asian populations. In contrast, in Spanish Gypsies, only HLA-B*4006 was found and the allele exhibited a strong association with Cw*1502. HLA-B*4003 was also identified in the South Korean, Chinese Korean, Northern Han, Mongolian and Japanese populations at relatively low frequencies, and exhibited an association with Cw*0304. Moreover, the association of these B61 alleles with the DRB1 alleles revealed considerable diversity among the different populations. HLA-B*4004 and B*4009 were not observed in these populations. Consequently, the frequencies of the B61 alleles varied among the different East Asian populations, but the individual B61 alleles were carried by specific haplotypes often regardless of the ethnic differences.
Haplotag: Software for Haplotype-Based Genotyping-by-Sequencing Analysis
Tinker, Nicholas A.; Bekele, Wubishet A.; Hattori, Jiro
2016-01-01
Genotyping-by-sequencing (GBS), and related methods, are based on high-throughput short-read sequencing of genomic complexity reductions followed by discovery of single nucleotide polymorphisms (SNPs) within sequence tags. This provides a powerful and economical approach to whole-genome genotyping, facilitating applications in genomics, diversity analysis, and molecular breeding. However, due to the complexity of analyzing large data sets, applications of GBS may require substantial time, expertise, and computational resources. Haplotag, the novel GBS software described here, is freely available, and operates with minimal user-investment on widely available computer platforms. Haplotag is unique in fulfilling the following set of criteria: (1) operates without a reference genome; (2) can be used in a polyploid species; (3) provides a discovery mode, and a production mode; (4) discovers polymorphisms based on a model of tag-level haplotypes within sequenced tags; (5) reports SNPs as well as haplotype-based genotypes; and (6) provides an intuitive visual “passport” for each inferred locus. Haplotag is optimized for use in a self-pollinating plant species. PMID:26818073
Nakano, Michiharu; Shimada, Takehiko; Endo, Tomoko; Fujii, Hiroshi; Nesumi, Hirohisa; Kita, Masayuki; Ebina, Masumi; Shimizu, Tokurou; Omura, Mitsuo
2012-02-01
Polyembryony, in which multiple somatic nucellar cell-derived embryos develop in addition to the zygotic embryo in a seed, is common in the genus Citrus. Previous genetic studies indicated polyembryony is mainly determined by a single locus, but the underlying molecular mechanism is still unclear. As a step towards identification and characterization of the gene or genes responsible for nucellar embryogenesis in Citrus, haplotype-specific physical maps around the polyembryony locus were constructed. By sequencing three BAC clones aligned on the polyembryony haplotype, a single contiguous draft sequence consisting of 380 kb containing 70 predicted open reading frames (ORFs) was reconstructed. Single nucleotide polymorphism genotypes detected in the sequenced genomic region showed strong association with embryo type in Citrus, indicating a common polyembryony locus is shared among widely diverse Citrus cultivars and species. The arrangement of the predicted ORFs in the characterized genomic region showed high collinearity to the genomic sequence of chromosome 4 of Vitis vinifera and linkage group VI of Populus trichocarpa, suggesting that the syntenic relationship among these species is conserved even though V. vinifera and P. trichocarpa are non-apomictic species. This is the first study to characterize in detail the genomic structure of an apomixis locus determining adventitious embryony. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Zhang, Jie; Li, Yongxiang; Zheng, Jun; Zhang, Hongwei; Yang, Xiaohong; Wang, Jianhua; Wang, Guoying
2017-01-01
The extensive genetic variation present in maize (Zea mays) germplasm makes it possible to detect signatures of positive artificial selection that occurred during temperate and tropical maize improvement. Here we report an analysis of 532,815 polymorphisms from a maize association panel consisting of 368 diverse temperate and tropical inbred lines. We developed a gene-oriented approach adapting exonic polymorphisms to identify recently selected alleles by comparing haplotypes across the maize genome. This analysis revealed evidence of selection for more than 1100 genomic regions during recent improvement, and included regulatory genes and key genes with visible mutant phenotypes. We find that selected candidate target genes in temperate maize are enriched in biosynthetic processes, and further examination of these candidates highlights two cases, sucrose flux and oil storage, in which multiple genes in a common pathway can be cooperatively selected. Finally, based on available parallel gene expression data, we hypothesize that some genes were selected for regulatory variations, resulting in altered gene expression. PMID:28099470
Cavanagh, Colin R; Chao, Shiaoman; Wang, Shichen; Huang, Bevan Emma; Stephen, Stuart; Kiani, Seifollah; Forrest, Kerrie; Saintenac, Cyrille; Brown-Guedira, Gina L; Akhunova, Alina; See, Deven; Bai, Guihua; Pumphrey, Michael; Tomar, Luxmi; Wong, Debbie; Kong, Stephan; Reynolds, Matthew; da Silva, Marta Lopez; Bockelman, Harold; Talbert, Luther; Anderson, James A; Dreisigacker, Susanne; Baenziger, Stephen; Carter, Arron; Korzun, Viktor; Morrell, Peter Laurent; Dubcovsky, Jorge; Morell, Matthew K; Sorrells, Mark E; Hayden, Matthew J; Akhunov, Eduard
2013-05-14
Domesticated crops experience strong human-mediated selection aimed at developing high-yielding varieties adapted to local conditions. To detect regions of the wheat genome subject to selection during improvement, we developed a high-throughput array to interrogate 9,000 gene-associated single-nucleotide polymorphisms (SNP) in a worldwide sample of 2,994 accessions of hexaploid wheat including landraces and modern cultivars. Using a SNP-based diversity map we characterized the impact of crop improvement on genomic and geographic patterns of genetic diversity. We found evidence of a small population bottleneck and extensive use of ancestral variation often traceable to founders of cultivars from diverse geographic regions. Analyzing genetic differentiation among populations and the extent of haplotype sharing, we identified allelic variants subjected to selection during improvement. Selective sweeps were found around genes involved in the regulation of flowering time and phenology. An introgression of a wild relative-derived gene conferring resistance to a fungal pathogen was detected by haplotype-based analysis. Comparing selective sweeps identified in different populations, we show that selection likely acts on distinct targets or multiple functionally equivalent alleles in different portions of the geographic range of wheat. The majority of the selected alleles were present at low frequency in local populations, suggesting either weak selection pressure or temporal variation in the targets of directional selection during breeding probably associated with changing agricultural practices or environmental conditions. The developed SNP chip and map of genetic variation provide a resource for advancing wheat breeding and supporting future population genomic and genome-wide association studies in wheat.
Cavanagh, Colin R.; Chao, Shiaoman; Wang, Shichen; Huang, Bevan Emma; Stephen, Stuart; Kiani, Seifollah; Forrest, Kerrie; Saintenac, Cyrille; Brown-Guedira, Gina L.; Akhunova, Alina; See, Deven; Bai, Guihua; Pumphrey, Michael; Tomar, Luxmi; Wong, Debbie; Kong, Stephan; Reynolds, Matthew; da Silva, Marta Lopez; Bockelman, Harold; Talbert, Luther; Anderson, James A.; Dreisigacker, Susanne; Baenziger, Stephen; Carter, Arron; Korzun, Viktor; Morrell, Peter Laurent; Dubcovsky, Jorge; Morell, Matthew K.; Sorrells, Mark E.; Hayden, Matthew J.; Akhunov, Eduard
2013-01-01
Domesticated crops experience strong human-mediated selection aimed at developing high-yielding varieties adapted to local conditions. To detect regions of the wheat genome subject to selection during improvement, we developed a high-throughput array to interrogate 9,000 gene-associated single-nucleotide polymorphisms (SNP) in a worldwide sample of 2,994 accessions of hexaploid wheat including landraces and modern cultivars. Using a SNP-based diversity map we characterized the impact of crop improvement on genomic and geographic patterns of genetic diversity. We found evidence of a small population bottleneck and extensive use of ancestral variation often traceable to founders of cultivars from diverse geographic regions. Analyzing genetic differentiation among populations and the extent of haplotype sharing, we identified allelic variants subjected to selection during improvement. Selective sweeps were found around genes involved in the regulation of flowering time and phenology. An introgression of a wild relative-derived gene conferring resistance to a fungal pathogen was detected by haplotype-based analysis. Comparing selective sweeps identified in different populations, we show that selection likely acts on distinct targets or multiple functionally equivalent alleles in different portions of the geographic range of wheat. The majority of the selected alleles were present at low frequency in local populations, suggesting either weak selection pressure or temporal variation in the targets of directional selection during breeding probably associated with changing agricultural practices or environmental conditions. The developed SNP chip and map of genetic variation provide a resource for advancing wheat breeding and supporting future population genomic and genome-wide association studies in wheat. PMID:23630259
Curry, Caitlin J.; White, Paula A.; Derr, James N.
2015-01-01
Analysis of DNA sequence diversity at the 12S to 16S mitochondrial genes of 165 African lions (Panthera leo) from five main areas in Zambia has uncovered haplotypes which link Southern Africa with East Africa. Phylogenetic analysis suggests Zambia may serve as a bridge connecting the lion populations in southern Africa to eastern Africa, supporting earlier hypotheses that eastern-southern Africa may represent the evolutionary cradle for the species. Overall gene diversity throughout the Zambian lion population was 0.7319 +/- 0.0174 with eight haplotypes found; three haplotypes previously described and the remaining five novel. The addition of these five novel haplotypes, so far only found within Zambia, nearly doubles the number of haplotypes previously reported for any given geographic location of wild lions. However, based on an AMOVA analysis of these haplotypes, there is little to no matrilineal gene flow (Fst = 0.47) when the eastern and western regions of Zambia are considered as two regional sub-populations. Crossover haplotypes (H9, H11, and Z1) appear in both populations as rare in one but common in the other. This pattern is a possible result of the lion mating system in which predominately males disperse, as all individuals with crossover haplotypes were male. The determination and characterization of lion sub-populations, such as done in this study for Zambia, represent a higher-resolution of knowledge regarding both the genetic health and connectivity of lion populations, which can serve to inform conservation and management of this iconic species. PMID:26674533
Curry, Caitlin J; White, Paula A; Derr, James N
2015-01-01
Analysis of DNA sequence diversity at the 12S to 16S mitochondrial genes of 165 African lions (Panthera leo) from five main areas in Zambia has uncovered haplotypes which link Southern Africa with East Africa. Phylogenetic analysis suggests Zambia may serve as a bridge connecting the lion populations in southern Africa to eastern Africa, supporting earlier hypotheses that eastern-southern Africa may represent the evolutionary cradle for the species. Overall gene diversity throughout the Zambian lion population was 0.7319 +/- 0.0174 with eight haplotypes found; three haplotypes previously described and the remaining five novel. The addition of these five novel haplotypes, so far only found within Zambia, nearly doubles the number of haplotypes previously reported for any given geographic location of wild lions. However, based on an AMOVA analysis of these haplotypes, there is little to no matrilineal gene flow (Fst = 0.47) when the eastern and western regions of Zambia are considered as two regional sub-populations. Crossover haplotypes (H9, H11, and Z1) appear in both populations as rare in one but common in the other. This pattern is a possible result of the lion mating system in which predominately males disperse, as all individuals with crossover haplotypes were male. The determination and characterization of lion sub-populations, such as done in this study for Zambia, represent a higher-resolution of knowledge regarding both the genetic health and connectivity of lion populations, which can serve to inform conservation and management of this iconic species.
Simčič, Mojca; Smetko, Anamarija; Sölkner, Johann; Seichter, Doris; Gorjanc, Gregor; Kompan, Dragomir; Medugorac, Ivica
2015-01-01
The aim of this study was to obtain unbiased estimates of the diversity parameters, the population history, and the degree of admixture in Cika cattle which represents the local admixed breeds at risk of extinction undergoing challenging conservation programs. Genetic analyses were performed on the genome-wide Single Nucleotide Polymorphism (SNP) Illumina Bovine SNP50 array data of 76 Cika animals and 531 animals from 14 reference populations. To obtain unbiased estimates we used short haplotypes spanning four markers instead of single SNPs to avoid an ascertainment bias of the BovineSNP50 array. Genome-wide haplotypes combined with partial pedigree and type trait classification show the potential to improve identification of purebred animals with a low degree of admixture. Phylogenetic analyses demonstrated unique genetic identity of Cika animals. Genetic distance matrix presented by rooted Neighbour-Net suggested long and broad phylogenetic connection between Cika and Pinzgauer. Unsupervised clustering performed by the admixture analysis and two-dimensional presentation of the genetic distances between individuals also suggest Cika is a distinct breed despite being similar in appearance to Pinzgauer. Animals identified as the most purebred could be used as a nucleus for a recovery of the native genetic background in the current admixed population. The results show that local well-adapted strains, which have never been intensively managed and differentiated into specific breeds, exhibit large haplotype diversity. They suggest a conservation and recovery approach that does not rely exclusively on the search for the original native genetic background but rather on the identification and removal of common introgressed haplotypes would be more powerful. Successful implementation of such an approach should be based on combining phenotype, pedigree, and genome-wide haplotype data of the breed of interest and a spectrum of reference breeds which potentially have had
Kunihisa, Miyuki; Moriya, Shigeki; Abe, Kazuyuki; Okada, Kazuma; Haji, Takashi; Hayashi, Takeshi; Kawahara, Yoshihiro; Itoh, Ryutaro; Itoh, Takeshi; Katayose, Yuichi; Kanamori, Hiroyuki; Matsumoto, Toshimi; Mori, Satomi; Sasaki, Harumi; Matsumoto, Takashi; Nishitani, Chikako; Terakami, Shingo; Yamamoto, Toshiya
2016-01-01
‘Fuji’ is one of the most popular and highly-produced apple cultivars worldwide, and has been frequently used in breeding programs. The development of genotypic markers for the preferable phenotypes of ‘Fuji’ is required. Here, we aimed to define the haplotypes of ‘Fuji’ and find associations between haplotypes and phenotypes of five traits (harvest day, fruit weight, acidity, degree of watercore, and flesh mealiness) by using 115 accessions related to ‘Fuji’. Through the re-sequencing of ‘Fuji’ genome, total of 2,820,759 variants, including single nucleotide polymorphisms (SNPs) and insertions or deletions (indels) were detected between ‘Fuji’ and ‘Golden Delicious’ reference genome. We selected mapping-validated 1,014 SNPs, most of which were heterozygous in ‘Fuji’ and capable of distinguishing alleles inherited from the parents of ‘Fuji’ (i.e., ‘Ralls Janet’ and ‘Delicious’). We used these SNPs to define the haplotypes of ‘Fuji’ and trace their inheritance in relatives, which were shown to have an average of 27% of ‘Fuji’ genome. Analysis of variance (ANOVA) based on ‘Fuji’ haplotypes identified one quantitative trait loci (QTL) each for harvest time, acidity, degree of watercore, and mealiness. A haplotype from ‘Delicious’ chr14 was considered to dominantly cause watercore, and one from ‘Ralls Janet’ chr1 was related to low-mealiness. PMID:27795675
Jannink, Jean-Luc
2010-01-01
Genome-wide association studies (GWAS) may benefit from utilizing haplotype information for making marker-phenotype associations. Several rationales for grouping single nucleotide polymorphisms (SNPs) into haplotype blocks exist, but any advantage may depend on such factors as genetic architecture of traits, patterns of linkage disequilibrium in the study population, and marker density. The objective of this study was to explore the utility of haplotypes for GWAS in barley (Hordeum vulgare) to offer a first detailed look at this approach for identifying agronomically important genes in crops. To accomplish this, we used genotype and phenotype data from the Barley Coordinated Agricultural Project and constructed haplotypes using three different methods. Marker-trait associations were tested by the efficient mixed-model association algorithm (EMMA). When QTL were simulated using single SNPs dropped from the marker dataset, a simple sliding window performed as well or better than single SNPs or the more sophisticated methods of blocking SNPs into haplotypes. Moreover, the haplotype analyses performed better 1) when QTL were simulated as polymorphisms that arose subsequent to marker variants, and 2) in analysis of empirical heading date data. These results demonstrate that the information content of haplotypes is dependent on the particular mutational and recombinational history of the QTL and nearby markers. Analysis of the empirical data also confirmed our intuition that the distribution of QTL alleles in nature is often unlike the distribution of marker variants, and hence utilizing haplotype information could capture associations that would elude single SNPs. We recommend routine use of both single SNP and haplotype markers for GWAS to take advantage of the full information content of the genotype data. PMID:21124933
Norman, Paul J.; Norberg, Steven J.; Guethlein, Lisbeth A.; Nemat-Gorgani, Neda; Royce, Thomas; Wroblewski, Emily E.; Dunn, Tamsen; Mann, Tobias; Alicata, Claudia; Hollenbach, Jill A.; Chang, Weihua; Shults Won, Melissa; Gunderson, Kevin L.; Abi-Rached, Laurent; Ronaghi, Mostafa; Parham, Peter
2017-01-01
The most polymorphic part of the human genome, the MHC, encodes over 160 proteins of diverse function. Half of them, including the HLA class I and II genes, are directly involved in immune responses. Consequently, the MHC region strongly associates with numerous diseases and clinical therapies. Notoriously, the MHC region has been intractable to high-throughput analysis at complete sequence resolution, and current reference haplotypes are inadequate for large-scale studies. To address these challenges, we developed a method that specifically captures and sequences the 4.8-Mbp MHC region from genomic DNA. For 95 MHC homozygous cell lines we assembled, de novo, a set of high-fidelity contigs and a sequence scaffold, representing a mean 98% of the target region. Included are six alternative MHC reference sequences of the human genome that we completed and refined. Characterization of the sequence and structural diversity of the MHC region shows the approach accurately determines the sequences of the highly polymorphic HLA class I and HLA class II genes and the complex structural diversity of complement factor C4A/C4B. It has also uncovered extensive and unexpected diversity in other MHC genes; an example is MUC22, which encodes a lung mucin and exhibits more coding sequence alleles than any HLA class I or II gene studied here. More than 60% of the coding sequence alleles analyzed were previously uncharacterized. We have created a substantial database of robust reference MHC haplotype sequences that will enable future population scale studies of this complicated and clinically important region of the human genome. PMID:28360230
Hudson, Nicholas J; Naval-Sánchez, Marina; Porto-Neto, Laercio; Pérez-Enciso, Miguel; Reverter, Antonio
2018-06-05
Asian and European wild boars were independently domesticated ca. 10,000 years ago. Since the 17th century, Chinese breeds have been imported to Europe to improve the genetics of European animals by introgression of favourable alleles, resulting in a complex mosaic of haplotypes. To interrogate the structure of these haplotypes further, we have run a new haplotype segregation analysis based on information theory, namely compression efficiency (CE). We applied the approach to sequence data from individuals from each phylogeographic region (n = 23 from Asia and Europe) including a number of major pig breeds. Our genome-wide CE is able to discriminate the breeds in a manner reflecting phylogeography. Furthermore, 24,956 non-overlapping sliding windows (each comprising 1,000 consecutive SNP) were quantified for extent of haplotype sharing within and between Asia and Europe. The genome-wide distribution of extent of haplotype sharing was quite different between groups. Unlike European pigs, Asian pigs haplotype sharing approximates a normal distribution. In line with this, we found the European breeds possessed a number of genomic windows of dramatically higher haplotype sharing than the Asian breeds. Our CE analysis of sliding windows capture some of the genomic regions reported to contain signatures of selection in domestic pigs. Prominent among these regions, we highlight the role of a gene encoding the mitochondrial enzyme LACTB which has been associated with obesity, and the gene encoding MYOG a fundamental transcriptional regulator of myogenesis. The origin of these regions likely reflects either a population bottleneck in European animals, or selective targets on commercial phenotypes reducing allelic diversity in particular genes and/or regulatory regions.
Functional and genetic analysis of haplotypic sequence variation at the nicastrin genomic locus
Hamilton, Gillian; Killick, Richard; Lambert, Jean-Charles; Amouyel, Philippe; Carrasquillo, Minerva M.; Pankratz, V. Shane; Graff-Radford, Neill R.; Dickson, Dennis W.; Petersen, Ronald C.; Younkin, Steven G.; Powell, John F.; Wade-Martins, Richard
2013-01-01
Nicastrin (NCSTN) is a component of the γ-secretase complex and therefore potentially a candidate risk gene for Alzheimer's disease. Here, we have developed a novel functional genomics methodology to express common locus haplotypes to assess functional differences. DNA recombination was used to engineer 5 bacterial artificial chromosomes (BACs) to each express a different haplotype of the NCSTN locus. Each NCSTN-BAC was delivered to knockout nicastrin (Ncstn−/−) cells and clonal NCSTN-BAC+/Ncstn−/− cell lines were created for functional analyses. We showed that all NCSTN-BAC haplotypes expressed nicastrin protein and rescued γ-secretase activity and amyloid beta (Aβ) production in NCSTN-BAC+/Ncstn−/− lines. We then showed that genetic variation at the NCSTN locus affected alternative splicing in human postmortem brain tissue. However, there was no robust functional difference between clonal cell lines rescued by each of the 5 different haplotypes. Finally, there was no statistically significant association of NCSTN with disease risk in the 4 cohorts. We therefore conclude that it is unlikely that common variation at the NCSTN locus is a risk factor for Alzheimer's disease. PMID:22405046
2014-01-01
Background Numerous quantitative trait loci (QTL) have been detected in pigs over the past 20 years using microsatellite markers. However, due to the low density of these markers, the accuracy of QTL location has generally been poor. Since 2009, the dense genome coverage provided by the Illumina PorcineSNP60 BeadChip has made it possible to more accurately map QTL using genome-wide association studies (GWAS). Our objective was to perform high-density GWAS in order to identify genomic regions and corresponding haplotypes associated with production traits in a French Large White population of pigs. Methods Animals (385 Large White pigs from 106 sires) were genotyped using the PorcineSNP60 BeadChip and evaluated for 19 traits related to feed intake, growth, carcass composition and meat quality. Of the 64 432 SNPs on the chip, 44 412 were used for GWAS with an animal mixed model that included a regression coefficient for the tested SNPs and a genomic kinship matrix. SNP haplotype effects in QTL regions were then tested for association with phenotypes following phase reconstruction based on the Sscrofa10.2 pig genome assembly. Results Twenty-three QTL regions were identified on autosomes and their effects ranged from 0.25 to 0.75 phenotypic standard deviation units for feed intake and feed efficiency (four QTL), carcass (12 QTL) and meat quality traits (seven QTL). The 10 most significant QTL regions had effects on carcass (chromosomes 7, 10, 16, 17 and 18) and meat quality traits (two regions on chromosome 1 and one region on chromosomes 8, 9 and 13). Thirteen of the 23 QTL regions had not been previously described. A haplotype block of 183 kb on chromosome 1 (six SNPs) was identified and displayed three distinct haplotypes with significant (0.0001 < P < 0.03) associations with all evaluated meat quality traits. Conclusions GWAS analyses with the PorcineSNP60 BeadChip enabled the detection of 23 QTL regions that affect feed consumption, carcass and meat
Norman, Paul J.; Parham, Peter
2012-01-01
Pinnipeds, marine carnivores, diverged from terrestrial carnivores ~45 million years ago, before their adaptation to marine environments. This lifestyle change exposed pinnipeds to different microbiota and pathogens, with probable impact on their MHC class I genes. Investigating this question, genomic sequences were determined for 71 MHC class I variants: 27 from harbor seal and 44 from gray seal. These variants form three MHC class I gene lineages, one comprising a pseudogene. The second, a candidate nonclassical MHC class I gene, comprises a nonpolymorphic transcribed gene related to dog DLA-79 and giant panda Aime-1906. The third is the diversity lineage, which includes 62 of the 71 seal MHC class I variants. All are transcribed, and they minimally represent six harbor and 12 gray seal MHC class I genes. Besides species-specific differences in gene number, seal MHC class I haplotypes exhibit gene content variation and allelic polymorphism. Patterns of sequence variation, and of positions for positively selected sites, indicate the diversity lineage genes are the seals’ classical MHC class I genes. Evidence that expansion of diversity lineage genes began before gray and harbor seals diverged is the presence in both species of two distinctive sublineages of diversity lineage genes. Pointing to further expansion following the divergence are the presence of species-specific genes and greater MHC class I diversity in gray seals than harbor seals. The elaboration of a complex variable family of classical MHC class I genes in pinnipeds contrasts with the single, highly polymorphic classical MHC class I gene of dog and giant panda, terrestrial carnivores. PMID:23001684
Kurata, Kaoruko; Jaffré, Tanguy; Setoguchi, Hiroaki
2008-12-01
Among the many species that grow in New Caledonia, the pitcher plant Nepenthes vieillardii (Nepenthaceae) has a high degree of morphological variation. In this study, we present the patterns of genetic differentiation of pitcher plant populations based on chloroplast DNA haplotype analysis using the sequences of five spacers. We analyzed 294 samples from 16 populations covering the entire range of the species, using 4660 bp of sequence. Our analysis identified 17 haplotypes, including one that is widely distributed across the islands, as well as regional and private haplotypes. The greatest haplotype diversity was detected on the eastern coast of the largest island and included several private haplotypes, while haplotype diversity was low in the southern plains region. The parsimony network analysis of the 17 haplotypes suggested that the genetic divergence is the result of long-term isolation of individual populations. Results from a spatial analysis of molecular variance and a cluster analysis suggest that the plants once covered the entire serpentine area of New Caledonia and that subsequent regional fragmentation resulted in the isolation of each population and significantly restricted seed flow. This isolation may have been an important factor in the development of the morphological and genetic variation among pitcher plants in New Caledonia.
Ahmad, Meraj; Sinha, Anubhav; Ghosh, Sreya; Kumar, Vikrant; Davila, Sonia; Yajnik, Chittaranjan S; Chandak, Giriraj R
2017-07-27
Imputation is a computational method based on the principle of haplotype sharing allowing enrichment of genome-wide association study datasets. It depends on the haplotype structure of the population and density of the genotype data. The 1000 Genomes Project led to the generation of imputation reference panels which have been used globally. However, recent studies have shown that population-specific panels provide better enrichment of genome-wide variants. We compared the imputation accuracy using 1000 Genomes phase 3 reference panel and a panel generated from genome-wide data on 407 individuals from Western India (WIP). The concordance of imputed variants was cross-checked with next-generation re-sequencing data on a subset of genomic regions. Further, using the genome-wide data from 1880 individuals, we demonstrate that WIP works better than the 1000 Genomes phase 3 panel and when merged with it, significantly improves the imputation accuracy throughout the minor allele frequency range. We also show that imputation using only South Asian component of the 1000 Genomes phase 3 panel works as good as the merged panel, making it computationally less intensive job. Thus, our study stresses that imputation accuracy using 1000 Genomes phase 3 panel can be further improved by including population-specific reference panels from South Asia.
Rouse, Matthew N.; Saleh, Amgad A.; Seck, Amadou; Keeler, Kathleen H.; Travers, Steven E.; Hulbert, Scot H.; Garrett, Karen A.
2011-01-01
Background Environmental variables such as moisture availability are often important in determining species prevalence and intraspecific diversity. The population genetic structure of dominant plant species in response to a cline of these variables has rarely been addressed. We evaluated the spatial genetic structure and diversity of Andropogon gerardii populations across the U.S. Great Plains precipitation gradient, ranging from approximately 48 cm/year to 105 cm/year. Methodology/Principal Findings Genomic diversity was evaluated with AFLP markers and diversity of a disease resistance gene homolog was evaluated by PCR-amplification and digestion with restriction enzymes. We determined the degree of spatial genetic structure using Mantel tests. Genomic and resistance gene homolog diversity were evaluated across prairies using Shannon's index and by averaging haplotype dissimilarity. Trends in diversity across prairies were determined using linear regression of diversity on average precipitation for each prairie. We identified significant spatial genetic structure, with genomic similarity decreasing as a function of distance between samples. However, our data indicated that genome-wide diversity did not vary consistently across the precipitation gradient. In contrast, we found that disease resistance gene homolog diversity was positively correlated with precipitation. Significance Prairie remnants differ in the genetic resources they maintain. Selection and evolution in this disease resistance homolog is environmentally dependent. Overall, we found that, though this environmental gradient may not predict genomic diversity, individual traits such as disease resistance genes may vary significantly. PMID:21532756
Machiela, Mitchell J; Chanock, Stephen J
2015-11-01
Assessing linkage disequilibrium (LD) across ancestral populations is a powerful approach for investigating population-specific genetic structure as well as functionally mapping regions of disease susceptibility. Here, we present LDlink, a web-based collection of bioinformatic modules that query single nucleotide polymorphisms (SNPs) in population groups of interest to generate haplotype tables and interactive plots. Modules are designed with an emphasis on ease of use, query flexibility, and interactive visualization of results. Phase 3 haplotype data from the 1000 Genomes Project are referenced for calculating pairwise metrics of LD, searching for proxies in high LD, and enumerating all observed haplotypes. LDlink is tailored for investigators interested in mapping common and uncommon disease susceptibility loci by focusing on output linking correlated alleles and highlighting putative functional variants. LDlink is a free and publically available web tool which can be accessed at http://analysistools.nci.nih.gov/LDlink/. mitchell.machiela@nih.gov. Published by Oxford University Press 2015. This work is written by US Government employees and is in the public domain in the US.
Park, Seonmi; Gianotti-Sommer, Andreia; Molina-Estevez, Francisco Javier; Vanuytsel, Kim; Skvir, Nick; Leung, Amy; Rozelle, Sarah S; Shaikho, Elmutaz Mohammed; Weir, Isabelle; Jiang, Zhihua; Luo, Hong-Yuan; Chui, David H K; Figueiredo, Maria Stella; Alsultan, Abdulraham; Al-Ali, Amein; Sebastiani, Paola; Steinberg, Martin H; Mostoslavsky, Gustavo; Murphy, George J
2017-04-11
Sickle cell anemia affects millions of people worldwide and is an emerging global health burden. As part of a large NIH-funded NextGen Consortium, we generated a diverse, comprehensive, and fully characterized library of sickle-cell-disease-specific induced pluripotent stem cells (iPSCs) from patients of different ethnicities, β-globin gene (HBB) haplotypes, and fetal hemoglobin (HbF) levels. iPSCs stand to revolutionize the way we study human development, model disease, and perhaps eventually, treat patients. Here, we describe this unique resource for the study of sickle cell disease, including novel haplotype-specific polymorphisms that affect disease severity, as well as for the development of patient-specific therapeutics for this phenotypically diverse disorder. As a complement to this library, and as proof of principle for future cell- and gene-based therapies, we also designed and employed CRISPR/Cas gene editing tools to correct the sickle hemoglobin (HbS) mutation. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Baine, Fiona K; Kay, Chris; Ketelaar, Maria E; Collins, Jennifer A; Semaka, Alicia; Doty, Crystal N; Krause, Amanda; Jacquie Greenberg, L; Hayden, Michael R
2013-01-01
Huntington disease (HD) is a neurodegenerative disorder resulting from the expansion of a CAG trinucleotide repeat in the huntingtin (HTT) gene. Worldwide prevalence varies geographically with the highest figures reported in populations of European ancestry. HD in South Africa has been reported in Caucasian, black and mixed subpopulations, with similar estimated prevalence in the Caucasian and mixed groups and a lower estimate in the black subpopulation. Recent studies have associated specific HTT haplotypes with HD in distinct populations. Expanded HD alleles in Europe occur predominantly on haplogroup A (specifically high-risk variants A1/A2), whereas in East Asian populations, HD alleles are associated with haplogroup C. Whether specific HTT haplotypes associate with HD in black Africans and how these compare with haplotypes found in European and East Asian populations remains unknown. The current study genotyped the HTT region in unaffected individuals and HD patients from each of the South African subpopulations, and haplotypes were constructed. CAG repeat sizes were determined and phased to haplotype. Results indicate that HD alleles from Caucasian and mixed patients are predominantly associated with haplogroup A, signifying a similar European origin for HD. However, in black patients, HD occurs predominantly on haplogroup B, suggesting several distinct origins of the mutation in South Africa. The absence of high-risk variants (A1/A2) in the black subpopulation may also explain the reported low prevalence of HD. Identification of haplotypes associated with HD-expanded alleles is particularly relevant to the development of population-specific therapeutic targets for selective suppression of the expanded HTT transcript. PMID:23463025
Restricted dog leucocyte antigen (DLA) class II haplotypes and genotypes in Beagles.
Soutter, Francesca; Kennedy, Lorna J; Ollier, William E R; Solano-Gallego, Laia; Catchpole, Brian
2015-03-01
Beagles are commonly used in vaccine trials as part of the regulatory approval process. Genetic restriction within this breed and the impact this might have on vaccine responses are rarely considered. This study was designed to characterise diversity of dog leucocyte antigen (DLA) class II genes in a breeding colony of laboratory Beagles, whose offspring are used in vaccine studies. DLA haplotypes were determined by PCR and sequence-based typing from genomic DNA extracted from blood. Breeding colony Beagles had significantly different DLA haplotype frequencies in comparison with pet Beagles and both groups showed limited DLA diversity. Restricted DLA class II genetic variability within Beagles might result in selective antigen presentation and vaccine responses that are not necessarily representative of those seen in other dog breeds. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
The Simons Genome Diversity Project: 300 genomes from 142 diverse populations.
Mallick, Swapan; Li, Heng; Lipson, Mark; Mathieson, Iain; Gymrek, Melissa; Racimo, Fernando; Zhao, Mengyao; Chennagiri, Niru; Nordenfelt, Susanne; Tandon, Arti; Skoglund, Pontus; Lazaridis, Iosif; Sankararaman, Sriram; Fu, Qiaomei; Rohland, Nadin; Renaud, Gabriel; Erlich, Yaniv; Willems, Thomas; Gallo, Carla; Spence, Jeffrey P; Song, Yun S; Poletti, Giovanni; Balloux, Francois; van Driem, George; de Knijff, Peter; Romero, Irene Gallego; Jha, Aashish R; Behar, Doron M; Bravi, Claudio M; Capelli, Cristian; Hervig, Tor; Moreno-Estrada, Andres; Posukh, Olga L; Balanovska, Elena; Balanovsky, Oleg; Karachanak-Yankova, Sena; Sahakyan, Hovhannes; Toncheva, Draga; Yepiskoposyan, Levon; Tyler-Smith, Chris; Xue, Yali; Abdullah, M Syafiq; Ruiz-Linares, Andres; Beall, Cynthia M; Di Rienzo, Anna; Jeong, Choongwon; Starikovskaya, Elena B; Metspalu, Ene; Parik, Jüri; Villems, Richard; Henn, Brenna M; Hodoglugil, Ugur; Mahley, Robert; Sajantila, Antti; Stamatoyannopoulos, George; Wee, Joseph T S; Khusainova, Rita; Khusnutdinova, Elza; Litvinov, Sergey; Ayodo, George; Comas, David; Hammer, Michael F; Kivisild, Toomas; Klitz, William; Winkler, Cheryl A; Labuda, Damian; Bamshad, Michael; Jorde, Lynn B; Tishkoff, Sarah A; Watkins, W Scott; Metspalu, Mait; Dryomov, Stanislav; Sukernik, Rem; Singh, Lalji; Thangaraj, Kumarasamy; Pääbo, Svante; Kelso, Janet; Patterson, Nick; Reich, David
2016-10-13
Here we report the Simons Genome Diversity Project data set: high quality genomes from 300 individuals from 142 diverse populations. These genomes include at least 5.8 million base pairs that are not present in the human reference genome. Our analysis reveals key features of the landscape of human genome variation, including that the rate of accumulation of mutations has accelerated by about 5% in non-Africans compared to Africans since divergence. We show that the ancestors of some pairs of present-day human populations were substantially separated by 100,000 years ago, well before the archaeologically attested onset of behavioural modernity. We also demonstrate that indigenous Australians, New Guineans and Andamanese do not derive substantial ancestry from an early dispersal of modern humans; instead, their modern human ancestry is consistent with coming from the same source as that of other non-Africans.
Vitamin K epoxide reductase complex subunit 1 (Vkorc1) haplotype diversity in mouse priority strains
Song, Ying; Vera, Nicole; Kohn, Michael H
2008-01-01
Background Polymorphisms in the vitamin K-epoxide reductase complex subunit 1 gene, Vkorc1, could affect blood coagulation and other vitamin K-dependent proteins, such as osteocalcin (bone Gla protein, BGP). Here we sequenced the Vkorc1 gene in 40 mouse priority strains. We analyzed Vkorc1 haplotypes with respect to prothrombin time (PT) and bone mineral density and composition (BMD and BMC); phenotypes expected to be vitamin K-dependent and represented by data in the Mouse Phenome Database (MPD). Findings In the commonly used laboratory strains of Mus musculus domesticus we identified only four haplotypes differing in the intron or 5' region sequence of the Vkorc1. Six haplotypes differing by coding and non-coding polymorphisms were identified in the other subspecies of Mus. We detected no significant association of Vkorc1 haplotypes with PT, BMD and BMC within each subspecies of Mus. Vkorc1 haplotype sequences divergence between subspecies was associated with PT, BMD and BMC. Conclusion Phenotypic variation in PT, BMD and BMC within subspecies of Mus, while substantial, appears to be dominated by genetic variation in genes other than the Vkorc1. This was particularly evident for M. m. domesticus, where a single haplotype was observed in conjunction with virtually the entire range of PT, BMD and BMC values of all 5 subspecies of Mus included in this study. Differences in these phenotypes between subspecies also should not be attributed to Vkorc1 variants, but should be viewed as a result of genome wide genetic divergence. PMID:19046458
Le Cunff, Loïc; Garsmeur, Olivier; Raboin, Louis Marie; Pauquet, Jérome; Telismart, Hugues; Selvi, Athiappan; Grivet, Laurent; Philippe, Romain; Begum, Dilara; Deu, Monique; Costet, Laurent; Wing, Rod; Glaszmann, Jean Christophe; D'Hont, Angélique
2008-01-01
The genome of modern sugarcane cultivars is highly polyploid (∼12x), aneuploid, of interspecific origin, and contains 10 Gb of DNA. Its size and complexity represent a major challenge for the isolation of agronomically important genes. Here we report on the first attempt to isolate a gene from sugarcane by map-based cloning, targeting a durable major rust resistance gene (Bru1). We describe the genomic strategies that we have developed to overcome constraints associated with high polyploidy in the successive steps of map-based cloning approaches, including diploid/polyploid syntenic shuttle mapping with two model diploid species (sorghum and rice) and haplotype-specific chromosome walking. Their applications allowed us (i) to develop a high-resolution map including markers at 0.28 and 0.14 cM on both sides and 13 markers cosegregating with Bru1 and (ii) to develop a physical map of the target haplotype that still includes two gaps at this stage due to the discovery of an insertion specific to this haplotype. These approaches will pave the way for the development of future map-based cloning approaches for sugarcane and other complex polyploid species. PMID:18757946
The Simons Genome Diversity Project: 300 genomes from 142 diverse populations
Mallick, Swapan; Li, Heng; Lipson, Mark; Mathieson, Iain; Gymrek, Melissa; Racimo, Fernando; Zhao, Mengyao; Chennagiri, Niru; Nordenfelt, Susanne; Tandon, Arti; Skoglund, Pontus; Lazaridis, Iosif; Sankararaman, Sriram; Fu, Qiaomei; Rohland, Nadin; Renaud, Gabriel; Erlich, Yaniv; Willems, Thomas; Gallo, Carla; Spence, Jeffrey P.; Song, Yun S.; Poletti, Giovanni; Balloux, Francois; van Driem, George; de Knijff, Peter; Romero, Irene Gallego; Jha, Aashish R.; Behar, Doron M.; Bravi, Claudio M.; Capelli, Cristian; Hervig, Tor; Moreno-Estrada, Andres; Posukh, Olga L.; Balanovska, Elena; Balanovsky, Oleg; Karachanak-Yankova, Sena; Sahakyan, Hovhannes; Toncheva, Draga; Yepiskoposyan, Levon; Tyler-Smith, Chris; Xue, Yali; Abdullah, M. Syafiq; Ruiz-Linares, Andres; Beall, Cynthia M.; Di Rienzo, Anna; Jeong, Choongwon; Starikovskaya, Elena B.; Metspalu, Ene; Parik, Jüri; Villems, Richard; Henn, Brenna M.; Hodoglugil, Ugur; Mahley, Robert; Sajantila, Antti; Stamatoyannopoulos, George; Wee, Joseph T. S.; Khusainova, Rita; Khusnutdinova, Elza; Litvinov, Sergey; Ayodo, George; Comas, David; Hammer, Michael; Kivisild, Toomas; Klitz, William; Winkler, Cheryl; Labuda, Damian; Bamshad, Michael; Jorde, Lynn B.; Tishkoff, Sarah A.; Watkins, W. Scott; Metspalu, Mait; Dryomov, Stanislav; Sukernik, Rem; Singh, Lalji; Thangaraj, Kumarasamy; Pääbo, Svante; Kelso, Janet; Patterson, Nick; Reich, David
2016-01-01
We report the Simons Genome Diversity Project (SGDP) dataset: high quality genomes from 300 individuals from 142 diverse populations. These genomes include at least 5.8 million base pairs that are not present in the human reference genome. Our analysis reveals key features of the landscape of human genome variation, including that the rate of accumulation of mutations has accelerated by about 5% in non-Africans compared to Africans since divergence. We show that the ancestors of some pairs of present-day human populations were substantially separated by 100,000 years ago, well before the archaeologically attested onset of behavioral modernity. We also demonstrate that indigenous Australians, New Guineans and Andamanese do not derive substantial ancestry from an early dispersal of modern humans; instead, their modern human ancestry is consistent with coming from the same source as that in other non-Africans. PMID:27654912
A spatial haplotype copying model with applications to genotype imputation.
Yang, Wen-Yun; Hormozdiari, Farhad; Eskin, Eleazar; Pasaniuc, Bogdan
2015-05-01
Ever since its introduction, the haplotype copy model has proven to be one of the most successful approaches for modeling genetic variation in human populations, with applications ranging from ancestry inference to genotype phasing and imputation. Motivated by coalescent theory, this approach assumes that any chromosome (haplotype) can be modeled as a mosaic of segments copied from a set of chromosomes sampled from the same population. At the core of the model is the assumption that any chromosome from the sample is equally likely to contribute a priori to the copying process. Motivated by recent works that model genetic variation in a geographic continuum, we propose a new spatial-aware haplotype copy model that jointly models geography and the haplotype copying process. We extend hidden Markov models of haplotype diversity such that at any given location, haplotypes that are closest in the genetic-geographic continuum map are a priori more likely to contribute to the copying process than distant ones. Through simulations starting from the 1000 Genomes data, we show that our model achieves superior accuracy in genotype imputation over the standard spatial-unaware haplotype copy model. In addition, we show the utility of our model in selecting a small personalized reference panel for imputation that leads to both improved accuracy as well as to a lower computational runtime than the standard approach. Finally, we show our proposed model can be used to localize individuals on the genetic-geographical map on the basis of their genotype data.
Salas, Antonio; Amigo, Jorge
2010-05-03
The high levels of variation characterising the mitochondrial DNA (mtDNA) molecule are due ultimately to its high average mutation rate; moreover, mtDNA variation is deeply structured in different populations and ethnic groups. There is growing interest in selecting a reduced number of mtDNA single nucleotide polymorphisms (mtSNPs) that account for the maximum level of discrimination power in a given population. Applications of the selected mtSNP panel range from anthropologic and medical studies to forensic genetic casework. This study proposes a new simulation-based method that explores the ability of different mtSNP panels to yield the maximum levels of discrimination power. The method explores subsets of mtSNPs of different sizes randomly chosen from a preselected panel of mtSNPs based on frequency. More than 2,000 complete genomes representing three main continental human population groups (Africa, Europe, and Asia) and two admixed populations ("African-Americans" and "Hispanics") were collected from GenBank and the literature, and were used as training sets. Haplotype diversity was measured for each combination of mtSNP and compared with existing mtSNP panels available in the literature. The data indicates that only a reduced number of mtSNPs ranging from six to 22 are needed to account for 95% of the maximum haplotype diversity of a given population sample. However, only a small proportion of the best mtSNPs are shared between populations, indicating that there is not a perfect set of "universal" mtSNPs suitable for all population contexts. The discrimination power provided by these mtSNPs is much higher than the power of the mtSNP panels proposed in the literature to date. Some mtSNP combinations also yield high diversity values in admixed populations. The proposed computational approach for exploring combinations of mtSNPs that optimise the discrimination power of a given set of mtSNPs is more efficient than previous empirical approaches. In contrast to
Salas, Antonio; Amigo, Jorge
2010-01-01
Background The high levels of variation characterising the mitochondrial DNA (mtDNA) molecule are due ultimately to its high average mutation rate; moreover, mtDNA variation is deeply structured in different populations and ethnic groups. There is growing interest in selecting a reduced number of mtDNA single nucleotide polymorphisms (mtSNPs) that account for the maximum level of discrimination power in a given population. Applications of the selected mtSNP panel range from anthropologic and medical studies to forensic genetic casework. Methodology/Principal Findings This study proposes a new simulation-based method that explores the ability of different mtSNP panels to yield the maximum levels of discrimination power. The method explores subsets of mtSNPs of different sizes randomly chosen from a preselected panel of mtSNPs based on frequency. More than 2,000 complete genomes representing three main continental human population groups (Africa, Europe, and Asia) and two admixed populations (“African-Americans” and “Hispanics”) were collected from GenBank and the literature, and were used as training sets. Haplotype diversity was measured for each combination of mtSNP and compared with existing mtSNP panels available in the literature. The data indicates that only a reduced number of mtSNPs ranging from six to 22 are needed to account for 95% of the maximum haplotype diversity of a given population sample. However, only a small proportion of the best mtSNPs are shared between populations, indicating that there is not a perfect set of “universal” mtSNPs suitable for all population contexts. The discrimination power provided by these mtSNPs is much higher than the power of the mtSNP panels proposed in the literature to date. Some mtSNP combinations also yield high diversity values in admixed populations. Conclusions/Significance The proposed computational approach for exploring combinations of mtSNPs that optimise the discrimination power of a given set of
Warren, Ian A; Naville, Magali; Chalopin, Domitille; Levin, Perrine; Berger, Chloé Suzanne; Galiana, Delphine; Volff, Jean-Nicolas
2015-09-01
Since their discovery, a growing body of evidence has emerged demonstrating that transposable elements are important drivers of species diversity. These mobile elements exhibit a great variety in structure, size and mechanisms of transposition, making them important putative actors in organism evolution. The vertebrates represent a highly diverse and successful lineage that has adapted to a wide range of different environments. These animals also possess a rich repertoire of transposable elements, with highly diverse content between lineages and even between species. Here, we review how transposable elements are driving genomic diversity and lineage-specific innovation within vertebrates. We discuss the large differences in TE content between different vertebrate groups and then go on to look at how they affect organisms at a variety of levels: from the structure of chromosomes to their involvement in the regulation of gene expression, as well as in the formation and evolution of non-coding RNAs and protein-coding genes. In the process of doing this, we highlight how transposable elements have been involved in the evolution of some of the key innovations observed within the vertebrate lineage, driving the group's diversity and success.
A high-throughput Sanger strategy for human mitochondrial genome sequencing
2013-01-01
Background A population reference database of complete human mitochondrial genome (mtGenome) sequences is needed to enable the use of mitochondrial DNA (mtDNA) coding region data in forensic casework applications. However, the development of entire mtGenome haplotypes to forensic data quality standards is difficult and laborious. A Sanger-based amplification and sequencing strategy that is designed for automated processing, yet routinely produces high quality sequences, is needed to facilitate high-volume production of these mtGenome data sets. Results We developed a robust 8-amplicon Sanger sequencing strategy that regularly produces complete, forensic-quality mtGenome haplotypes in the first pass of data generation. The protocol works equally well on samples representing diverse mtDNA haplogroups and DNA input quantities ranging from 50 pg to 1 ng, and can be applied to specimens of varying DNA quality. The complete workflow was specifically designed for implementation on robotic instrumentation, which increases throughput and reduces both the opportunities for error inherent to manual processing and the cost of generating full mtGenome sequences. Conclusions The described strategy will assist efforts to generate complete mtGenome haplotypes which meet the highest data quality expectations for forensic genetic and other applications. Additionally, high-quality data produced using this protocol can be used to assess mtDNA data developed using newer technologies and chemistries. Further, the amplification strategy can be used to enrich for mtDNA as a first step in sample preparation for targeted next-generation sequencing. PMID:24341507
Forró, László; Nédli, Judit; Csata, Enikő; Krízsik, Virág; Balogh, Csilla; G-Tóth, László
2017-09-01
Arctodiaptomus spinosus (Daday, 1891) is a characteristic species of the soda pan zooplankton in the Great Hungarian Plain. The biogeographical distribution of the species is interesting, since its range expands from the Pannonian Biogeographic region to the other side of the Carpathians, occurring in saline lakes in Eastern Anatolia, Armenia, Iran and in temporary waters in Ukraine. Our investigations focused on the morphometric characteristics and the COI haplotype diversity of four Hungarian populations in the Kiskunság area. We detected substantial morphological differences between the Böddi-szék population and the rest of the sampling sites, however considerable differences were not observable in the COI haplotypes in the populations. The 20 animals investigated for COI haplotypes belonged to the same haplotype network. Tajima's D indicated departures from the neutral Wright - Fisher population model and suggested population expansion. The genetic composition of Arctodiaptomus spinosus populations in the Kiskunság area is rather uniform.
Doekes, Harmen P; Veerkamp, Roel F; Bijma, Piter; Hiemstra, Sipke J; Windig, Jack J
2018-04-11
In recent decades, Holstein-Friesian (HF) selection schemes have undergone profound changes, including the introduction of optimal contribution selection (OCS; around 2000), a major shift in breeding goal composition (around 2000) and the implementation of genomic selection (GS; around 2010). These changes are expected to have influenced genetic diversity trends. Our aim was to evaluate genome-wide and region-specific diversity in HF artificial insemination (AI) bulls in the Dutch-Flemish breeding program from 1986 to 2015. Pedigree and genotype data (~ 75.5 k) of 6280 AI-bulls were used to estimate rates of genome-wide inbreeding and kinship and corresponding effective population sizes. Region-specific inbreeding trends were evaluated using regions of homozygosity (ROH). Changes in observed allele frequencies were compared to those expected under pure drift to identify putative regions under selection. We also investigated the direction of changes in allele frequency over time. Effective population size estimates for the 1986-2015 period ranged from 69 to 102. Two major breakpoints were observed in genome-wide inbreeding and kinship trends. Around 2000, inbreeding and kinship levels temporarily dropped. From 2010 onwards, they steeply increased, with pedigree-based, ROH-based and marker-based inbreeding rates as high as 1.8, 2.1 and 2.8% per generation, respectively. Accumulation of inbreeding varied substantially across the genome. A considerable fraction of markers showed changes in allele frequency that were greater than expected under pure drift. Putative selected regions harboured many quantitative trait loci (QTL) associated to a wide range of traits. In consecutive 5-year periods, allele frequencies changed more often in the same direction than in opposite directions, except when comparing the 1996-2000 and 2001-2005 periods. Genome-wide and region-specific diversity trends reflect major changes in the Dutch-Flemish HF breeding program. Introduction of
Tomé, Beatriz; Pereira, Ana; Jorge, Fátima; Carretero, Miguel A; Harris, D James; Perera, Ana
2018-03-19
Host-parasite relationships are expected to be strongly shaped by host specificity, a crucial factor in parasite adaptability and diversification. Because whole host communities have to be considered to assess host specificity, oceanic islands are ideal study systems given their simplified biotic assemblages. Previous studies on insular parasites suggest host range broadening during colonization. Here, we investigate the association between one parasite group (haemogregarines) and multiple sympatric hosts (of three lizard genera: Gallotia, Chalcides and Tarentola) in the Canary Islands. Given haemogregarine characteristics and insular conditions, we hypothesized low host specificity and/or occurrence of host-switching events. A total of 825 samples were collected from the three host taxa inhabiting the seven main islands of the Canarian Archipelago, including locations where the different lizards occurred in sympatry. Blood slides were screened to assess prevalence and parasitaemia, while parasite genetic diversity and phylogenetic relationships were inferred from 18S rRNA gene sequences. Infection levels and diversity of haplotypes varied geographically and across host groups. Infections were found in all species of Gallotia across the seven islands, in Tarentola from Tenerife, La Gomera and La Palma, and in Chalcides from Tenerife, La Gomera and El Hierro. Gallotia lizards presented the highest parasite prevalence, parasitaemia and diversity (seven haplotypes), while the other two host groups (Chalcides and Tarentola) harbored one haplotype each, with low prevalence and parasitaemia levels, and very restricted geographical ranges. Host-sharing of the same haemogregarine haplotype was only detected twice, but these rare instances likely represent occasional cross-infections. Our results suggest that: (i) Canarian haemogregarine haplotypes are highly host-specific, which might have restricted parasite host expansion; (ii) haemogregarines most probably reached the
Patil, Gunvant; Do, Tuyen; Vuong, Tri D.; Valliyodan, Babu; Lee, Jeong-Dong; Chaudhary, Juhi; Shannon, J. Grover; Nguyen, Henry T.
2016-01-01
Soil salinity is a limiting factor of crop yield. The soybean is sensitive to soil salinity, and a dominant gene, Glyma03g32900 is primarily responsible for salt-tolerance. The identification of high throughput and robust markers as well as the deployment of salt-tolerant cultivars are effective approaches to minimize yield loss under saline conditions. We utilized high quality (15x) whole-genome resequencing (WGRS) on 106 diverse soybean lines and identified three major structural variants and allelic variation in the promoter and genic regions of the GmCHX1 gene. The discovery of single nucleotide polymorphisms (SNPs) associated with structural variants facilitated the design of six KASPar assays. Additionally, haplotype analysis and pedigree tracking of 93 U.S. ancestral lines were performed using publically available WGRS datasets. Identified SNP markers were validated, and a strong correlation was observed between the genotype and salt treatment phenotype (leaf scorch, chlorophyll content and Na+ accumulation) using a panel of 104 soybean lines and, an interspecific bi-parental population (F8) from PI483463 x Hutcheson. These markers precisely identified salt-tolerant/sensitive genotypes (>91%), and different structural-variants (>98%). These SNP assays, supported by accurate phenotyping, haplotype analyses and pedigree tracking information, will accelerate marker-assisted selection programs to enhance the development of salt-tolerant soybean cultivars. PMID:26781337
Polymorphism at Expressed DQ and DR Loci in Five Common Equine MHC Haplotypes
Miller, Donald; Tallmadge, Rebecca L.; Binns, Matthew; Zhu, Baoli; Mohamoud, Yasmin Ali; Ahmed, Ayeda; Brooks, Samantha A.; Antczak, Douglas F.
2016-01-01
The polymorphism of Major Histocompatibility Complex (MHC) class II DQ and DR genes in five common Equine Leukocyte Antigen (ELA) haplotypes was determined through sequencing of mRNA transcripts isolated from lymphocytes of eight ELA homozygous horses. Ten expressed MHC class II genes were detected in horses of the ELA-A3 haplotype carried by the donor horses of the equine Bacterial Artificial Chromosome (BAC) library and the reference genome sequence: four DR genes and six DQ genes. The other four ELA haplotypes contained at least eight expressed polymorphic MHC class II loci. Next Generation Sequencing (NGS) of genomic DNA of these four MHC haplotypes revealed stop codons in the DQA3 gene in the ELA-A2, ELA-A5, and ELA-A9 haplotypes. Few NGS reads were obtained for the other MHC class II genes that were not amplified in these horses. The amino acid sequences across haplotypes contained locus-specific residues, and the locus clusters produced by phylogenetic analysis were well supported. The MHC class II alleles within the five tested haplotypes were largely non-overlapping between haplotypes. The complement of equine MHC class II DQ and DR genes appears to be well conserved between haplotypes, in contrast to the recently described variation in class I gene loci between equine MHC haplotypes. The identification of allelic series of equine MHC class II loci will aid comparative studies of mammalian MHC conservation and evolution and may also help to interpret associations between the equine MHC class II region and diseases of the horse. PMID:27889800
Comparative Study on the Genetic Diversity of GHR Gene in Tibetan Cattle and Holstein Cows.
Deng, Feilong; Xia, Chenyang; Jia, Xianbo; Song, Tianzeng; Liu, Jianzhi; Lai, Song-Jia; Chen, Shi-Yi
2015-01-01
Due to the phenotype-based artificial selection in domestic cattle, the underlying functional genes may be indirectly selected and show decreasing diversity in theory. The growth hormone receptor (GHR) gene has been widely proposed to significantly associate with critical economic traits in cattle. In the present study, we comparatively studied the genetic diversity of GHR in Tibetan cattle (a traditional unselected breed, n = 93) and Chinese Holstein cow (the intensively selected breed, n = 94). The Tibetan yak (n = 38) was also included as an outgroup breed. A total of 21 variants were detected by sequencing 1279 bp genomic fragments encompassing the largest exon 9. Twelve haplotypes (H1∼H12) constructed by 15 coding SNPs were presented as a star-like network profile, in which haplotype H2 was located at the central position and almost occupied by Tibetan yaks. Furthermore, H2 was also identical to the formerly reported sequence specific to African cattle. Only haplotype H5 was simultaneously shared by all three breeds. Tibetan cattle showed higher nucleotide diversity (0.00215 ± 0.00015) and haplotype diversity (0.678 ± 0.026) than Holstein cow. Conclusively, we found Tibetan cattle have retained relatively high genetic variation of GHR. The predominant presence of African cattle specific H2 in the outgroup yak breed would highlight its ancestral relationship, which may be used as one informative molecular marker in the phylogenetic studies.
Genomic and Genetic Diversity within the Pseudomonas fluorescens Complex
Garrido-Sanz, Daniel; Meier-Kolthoff, Jan P.; Göker, Markus; Martín, Marta; Rivilla, Rafael; Redondo-Nieto, Miguel
2016-01-01
The Pseudomonas fluorescens complex includes Pseudomonas strains that have been taxonomically assigned to more than fifty different species, many of which have been described as plant growth-promoting rhizobacteria (PGPR) with potential applications in biocontrol and biofertilization. So far the phylogeny of this complex has been analyzed according to phenotypic traits, 16S rDNA, MLSA and inferred by whole-genome analysis. However, since most of the type strains have not been fully sequenced and new species are frequently described, correlation between taxonomy and phylogenomic analysis is missing. In recent years, the genomes of a large number of strains have been sequenced, showing important genomic heterogeneity and providing information suitable for genomic studies that are important to understand the genomic and genetic diversity shown by strains of this complex. Based on MLSA and several whole-genome sequence-based analyses of 93 sequenced strains, we have divided the P. fluorescens complex into eight phylogenomic groups that agree with previous works based on type strains. Digital DDH (dDDH) identified 69 species and 75 subspecies within the 93 genomes. The eight groups corresponded to clustering with a threshold of 31.8% dDDH, in full agreement with our MLSA. The Average Nucleotide Identity (ANI) approach showed inconsistencies regarding the assignment to species and to the eight groups. The small core genome of 1,334 CDSs and the large pan-genome of 30,848 CDSs, show the large diversity and genetic heterogeneity of the P. fluorescens complex. However, a low number of strains were enough to explain most of the CDSs diversity at core and strain-specific genomic fractions. Finally, the identification and analysis of group-specific genome and the screening for distinctive characters revealed a phylogenomic distribution of traits among the groups that provided insights into biocontrol and bioremediation applications as well as their role as PGPR. PMID:26915094
Discovery, evaluation and distribution of haplotypes of the wheat Ppd-D1 gene.
Guo, Zhiai; Song, Yanxia; Zhou, Ronghua; Ren, Zhenglong; Jia, Jizeng
2010-02-01
Ppd-D1 is one of the most potent genes affecting the photoperiod response of wheat (Triticum aestivum). Only two alleles, insensitive Ppd-D1a and sensitive Ppd-D1b, were known previously, and these did not adequately explain the broad adaptation of wheat to photoperiod variation. In this study, five diagnostic molecular markers were employed to identify Ppd-D1 haplotypes in 492 wheat varieties from diverse geographic locations and 55 accessions of Aegilops tauschii, the D genome donor species of wheat. Six Ppd-D1 haplotypes, designated I-VI, were identified. Types II, V and VI were considered to be more ancient and types I, III and IV were considered to be derived from type II. The transcript abundances of the Ppd-D1 haplotypes showed continuous variation, being highest for haplotype I, lowest for haplotype III, and correlating negatively with varietal differences in heading time. These haplotypes also significantly affected other agronomic traits. The distribution frequency of Ppd-D1 haplotypes showed partial correlations with both latitudes and altitudes of wheat cultivation regions. The evolution, expression and distribution of Ppd-D1 haplotypes were consistent evidentially with each other. What was regarded as a pair of alleles in the past can now be considered a series of alleles leading to continuous variation.
Genome Surfing As Driver of Microbial Genomic Diversity.
Choudoir, Mallory J; Panke-Buisse, Kevin; Andam, Cheryl P; Buckley, Daniel H
2017-08-01
Historical changes in population size, such as those caused by demographic range expansions, can produce nonadaptive changes in genomic diversity through mechanisms such as gene surfing. We propose that demographic range expansion of a microbial population capable of horizontal gene exchange can result in genome surfing, a mechanism that can cause widespread increase in the pan-genome frequency of genes acquired by horizontal gene exchange. We explain that patterns of genetic diversity within Streptomyces are consistent with genome surfing, and we describe several predictions for testing this hypothesis both in Streptomyces and in other microorganisms. Copyright © 2017 Elsevier Ltd. All rights reserved.
Martiniano, Rui; McLaughlin, Russell; Silva, Nuno M.; Manco, Licinio; Pereira, Tania; Coelho, Maria J.; Serra, Miguel; Burger, Joachim; Parreira, Rui; Moran, Elena; Valera, Antonio C.; Silva, Ana M.
2017-01-01
We analyse new genomic data (0.05–2.95x) from 14 ancient individuals from Portugal distributed from the Middle Neolithic (4200–3500 BC) to the Middle Bronze Age (1740–1430 BC) and impute genomewide diploid genotypes in these together with published ancient Eurasians. While discontinuity is evident in the transition to agriculture across the region, sensitive haplotype-based analyses suggest a significant degree of local hunter-gatherer contribution to later Iberian Neolithic populations. A more subtle genetic influx is also apparent in the Bronze Age, detectable from analyses including haplotype sharing with both ancient and modern genomes, D-statistics and Y-chromosome lineages. However, the limited nature of this introgression contrasts with the major Steppe migration turnovers within third Millennium northern Europe and echoes the survival of non-Indo-European language in Iberia. Changes in genomic estimates of individual height across Europe are also associated with these major cultural transitions, and ancestral components continue to correlate with modern differences in stature. PMID:28749934
Global biogeography of Prochlorococcus genome diversity in the surface ocean.
Kent, Alyssa G; Dupont, Chris L; Yooseph, Shibu; Martiny, Adam C
2016-08-01
Prochlorococcus, the smallest known photosynthetic bacterium, is abundant in the ocean's surface layer despite large variation in environmental conditions. There are several genetically divergent lineages within Prochlorococcus and superimposed on this phylogenetic diversity is extensive gene gain and loss. The environmental role in shaping the global ocean distribution of genome diversity in Prochlorococcus is largely unknown, particularly in a framework that considers the vertical and lateral mechanisms of evolution. Here we show that Prochlorococcus field populations from a global circumnavigation harbor extensive genome diversity across the surface ocean, but this diversity is not randomly distributed. We observed a significant correspondence between phylogenetic and gene content diversity, including regional differences in both phylogenetic composition and gene content that were related to environmental factors. Several gene families were strongly associated with specific regions and environmental factors, including the identification of a set of genes related to lower nutrient and temperature regions. Metagenomic assemblies of natural Prochlorococcus genomes reinforced this association by providing linkage of genes across genomic backbones. Overall, our results show that the phylogeography in Prochlorococcus taxonomy is echoed in its genome content. Thus environmental variation shapes the functional capabilities and associated ecosystem role of the globally abundant Prochlorococcus.
A phased SNP-based classification of sickle cell anemia HBB haplotypes.
Shaikho, Elmutaz M; Farrell, John J; Alsultan, Abdulrahman; Qutub, Hatem; Al-Ali, Amein K; Figueiredo, Maria Stella; Chui, David H K; Farrer, Lindsay A; Murphy, George J; Mostoslavsky, Gustavo; Sebastiani, Paola; Steinberg, Martin H
2017-08-11
Sickle cell anemia causes severe complications and premature death. Five common β-globin gene cluster haplotypes are each associated with characteristic fetal hemoglobin (HbF) levels. As HbF is the major modulator of disease severity, classifying patients according to haplotype is useful. The first method of haplotype classification used restriction fragment length polymorphisms (RFLPs) to detect single nucleotide polymorphisms (SNPs) in the β-globin gene cluster. This is labor intensive, and error prone. We used genome-wide SNP data imputed to the 1000 Genomes reference panel to obtain phased data distinguishing parental alleles. We successfully haplotyped 813 sickle cell anemia patients previously classified by RFLPs with a concordance >98%. Four SNPs (rs3834466, rs28440105, rs10128556, and rs968857) marking four different restriction enzyme sites unequivocally defined most haplotypes. We were able to assign a haplotype to 86% of samples that were either partially or misclassified using RFLPs. Phased data using only four SNPs allowed unequivocal assignment of a haplotype that was not always possible using a larger number of RFLPs. Given the availability of genome-wide SNP data, our method is rapid and does not require high computational resources.
Futami, K; Valderrama, A; Baldi, M; Minakawa, N; Marín Rodríguez, R; Chaves, L F
2015-04-01
The Asian tiger mosquito, Aedes albopictus (Skuse) (Diptera: Culicidae), is a vector of several human pathogens. Ae. albopictus is also an invasive species that, over recent years, has expanded its range out of its native Asia. Ae. albopictus was suspected to be present in Central America since the 1990s, and its presence was confirmed by most Central American nations by 2010. Recently, this species has been regularly found, yet in low numbers, in limited areas of Panamá and Costa Rica (CR). Here, we report that short sequences (∼558 bp) of the mitochondrial cytochrome oxidase subunit 1 (COI) and NADH dehydrogenase subunit 5 genes of Ae. albopictus, had no haplotype diversity. Instead, there was a common haplotype for each gene in both CR and Panamá. In contrast, a long COI sequence (∼1,390 bp) revealed that haplotype diversity (±SD) was relatively high in CR (0.72±0.04) when compared with Panamá (0.33±0.13), below the global estimate for reported samples (0.89±0.01). The long COI sequence allowed us to identify seven (five new) haplotypes in CR and two (one new) in Panamá. A haplotype network for the long COI gene sequence showed that samples from CR and Panamá belong to a single large group. The long COI gene sequences suggest that haplotypes in Panamá and CR, although similar to each other, had a significant geographic differentiation (Kst=1.33; P<0.001). Thus, most of our results suggest a recent range expansion in CR and Panamá. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Metspalu, Mait; Romero, Irene Gallego; Yunusbayev, Bayazit; Chaubey, Gyaneshwer; Mallick, Chandana Basu; Hudjashov, Georgi; Nelis, Mari; Mägi, Reedik; Metspalu, Ene; Remm, Maido; Pitchappan, Ramasamy; Singh, Lalji; Thangaraj, Kumarasamy; Villems, Richard; Kivisild, Toomas
2011-01-01
South Asia harbors one of the highest levels genetic diversity in Eurasia, which could be interpreted as a result of its long-term large effective population size and of admixture during its complex demographic history. In contrast to Pakistani populations, populations of Indian origin have been underrepresented in previous genomic scans of positive selection and population structure. Here we report data for more than 600,000 SNP markers genotyped in 142 samples from 30 ethnic groups in India. Combining our results with other available genome-wide data, we show that Indian populations are characterized by two major ancestry components, one of which is spread at comparable frequency and haplotype diversity in populations of South and West Asia and the Caucasus. The second component is more restricted to South Asia and accounts for more than 50% of the ancestry in Indian populations. Haplotype diversity associated with these South Asian ancestry components is significantly higher than that of the components dominating the West Eurasian ancestry palette. Modeling of the observed haplotype diversities suggests that both Indian ancestry components are older than the purported Indo-Aryan invasion 3,500 YBP. Consistent with the results of pairwise genetic distances among world regions, Indians share more ancestry signals with West than with East Eurasians. However, compared to Pakistani populations, a higher proportion of their genes show regionally specific signals of high haplotype homozygosity. Among such candidates of positive selection in India are MSTN and DOK5, both of which have potential implications in lipid metabolism and the etiology of type 2 diabetes. PMID:22152676
McConnell, Sean C.; Hernandez, Kyle M.; Wcisel, Dustin J.; Kettleborough, Ross N.; Stemple, Derek L.; Andrade, Jorge; de Jong, Jill L. O.
2016-01-01
Antigen processing and presentation genes found within the MHC are among the most highly polymorphic genes of vertebrate genomes, providing populations with diverse immune responses to a wide array of pathogens. Here, we describe transcriptome, exome, and whole-genome sequencing of clonal zebrafish, uncovering the most extensive diversity within the antigen processing and presentation genes of any species yet examined. Our CG2 clonal zebrafish assembly provides genomic context within a remarkably divergent haplotype of the core MHC region on chromosome 19 for six expressed genes not found in the zebrafish reference genome: mhc1uga, proteasome-β 9b (psmb9b), psmb8f, and previously unknown genes psmb13b, tap2d, and tap2e. We identify ancient lineages for Psmb13 within a proteasome branch previously thought to be monomorphic and provide evidence of substantial lineage diversity within each of three major trifurcations of catalytic-type proteasome subunits in vertebrates: Psmb5/Psmb8/Psmb11, Psmb6/Psmb9/Psmb12, and Psmb7/Psmb10/Psmb13. Strikingly, nearby tap2 and MHC class I genes also retain ancient sequence lineages, indicating that alternative lineages may have been preserved throughout the entire MHC pathway since early diversification of the adaptive immune system ∼500 Mya. Furthermore, polymorphisms within the three MHC pathway steps (antigen cleavage, transport, and presentation) are each predicted to alter peptide specificity. Lastly, comparative analysis shows that antigen processing gene diversity is far more extensive than previously realized (with ancient coelacanth psmb8 lineages, shark psmb13, and tap2t and psmb10 outside the teleost MHC), implying distinct immune functions and conserved roles in shaping MHC pathway evolution throughout vertebrates. PMID:27493218
Y chromosome haplotype diversity of domestic sheep (Ovis aries) in northern Eurasia.
Zhang, Min; Peng, Wei-Feng; Yang, Guang-Li; Lv, Feng-Hua; Liu, Ming-Jun; Li, Wen-Rong; Liu, Yong-Gang; Li, Jin-Quan; Wang, Feng; Shen, Zhi-Qiang; Zhao, Sheng-Guo; Hehua, Eer; Marzanov, Nurbiy; Murawski, Maziek; Kantanen, Juha; Li, Meng-Hua
2014-12-01
Variation in two SNPs and one microsatellite on the Y chromosome was analyzed in a total of 663 rams representing 59 breeds from a large geographic range in northern Eurasia. SNPA-oY1 showed the highest allele frequency (91.55%) across the breeds, whereas SNPG-oY1 was present in only 56 samples. Combined genotypes established seven haplotypes (H4, H5, H6, H7, H8, H12 and H19). H6 dominated in northern Eurasia, and H8 showed the second-highest frequency. H4, which had been earlier reported to be absent in European breeds, was detected in one European breed (Swiniarka), whereas H7, which had been previously identified to be unique to European breeds, was present in two Chinese breeds (Ninglang Black and Large-tailed Han), one Buryatian (Transbaikal Finewool) and two Russian breeds (North Caucasus Mutton-Wool and Kuibyshev). H12, which had been detected only in Turkish breeds, was also found in Chinese breeds in this work. An overall low level of haplotype diversity (median h = 0.1288) was observed across the breeds with relatively higher median values in breeds from the regions neighboring the Near Eastern domestication center of sheep. H6 is the dominant haplotype in northwestern and eastern China, in which the haplotype distribution could be explained by the historical translocations of the H4 and H8 Y chromosomes to China via the Mongol invasions followed by expansions to northwestern and eastern China. Our findings extend previous results of sheep Y chromosomal genetic variability and indicate probably recent paternal gene flows between sheep breeds from distinct major geographic regions. © 2014 Stichting International Foundation for Animal Genetics.
PWHATSHAP: efficient haplotyping for future generation sequencing.
Bracciali, Andrea; Aldinucci, Marco; Patterson, Murray; Marschall, Tobias; Pisanti, Nadia; Merelli, Ivan; Torquati, Massimo
2016-09-22
Haplotype phasing is an important problem in the analysis of genomics information. Given a set of DNA fragments of an individual, it consists of determining which one of the possible alleles (alternative forms of a gene) each fragment comes from. Haplotype information is relevant to gene regulation, epigenetics, genome-wide association studies, evolutionary and population studies, and the study of mutations. Haplotyping is currently addressed as an optimisation problem aiming at solutions that minimise, for instance, error correction costs, where costs are a measure of the confidence in the accuracy of the information acquired from DNA sequencing. Solutions have typically an exponential computational complexity. WHATSHAP is a recent optimal approach which moves computational complexity from DNA fragment length to fragment overlap, i.e., coverage, and is hence of particular interest when considering sequencing technology's current trends that are producing longer fragments. Given the potential relevance of efficient haplotyping in several analysis pipelines, we have designed and engineered PWHATSHAP, a parallel, high-performance version of WHATSHAP. PWHATSHAP is embedded in a toolkit developed in Python and supports genomics datasets in standard file formats. Building on WHATSHAP, PWHATSHAP exhibits the same complexity exploring a number of possible solutions which is exponential in the coverage of the dataset. The parallel implementation on multi-core architectures allows for a relevant reduction of the execution time for haplotyping, while the provided results enjoy the same high accuracy as that provided by WHATSHAP, which increases with coverage. Due to its structure and management of the large datasets, the parallelisation of WHATSHAP posed demanding technical challenges, which have been addressed exploiting a high-level parallel programming framework. The result, PWHATSHAP, is a freely available toolkit that improves the efficiency of the analysis of genomics
Baker, Christopher L.; Kajita, Shimpei; Walker, Michael; Saxl, Ruth L.; Raghupathy, Narayanan; Choi, Kwangbom; Petkov, Petko M.; Paigen, Kenneth
2015-01-01
Meiotic recombination generates new genetic variation and assures the proper segregation of chromosomes in gametes. PRDM9, a zinc finger protein with histone methyltransferase activity, initiates meiotic recombination by binding DNA at recombination hotspots and directing the position of DNA double-strand breaks (DSB). The DSB repair mechanism suggests that hotspots should eventually self-destruct, yet genome-wide recombination levels remain constant, a conundrum known as the hotspot paradox. To test if PRDM9 drives this evolutionary erosion, we measured activity of the Prdm9 Cst allele in two Mus musculus subspecies, M.m. castaneus, in which Prdm9Cst arose, and M.m. domesticus, into which Prdm9Cst was introduced experimentally. Comparing these two strains, we find that haplotype differences at hotspots lead to qualitative and quantitative changes in PRDM9 binding and activity. Using Mus spretus as an outlier, we found most variants affecting PRDM9Cst binding arose and were fixed in M.m. castaneus, suppressing hotspot activity. Furthermore, M.m. castaneus×M.m. domesticus F1 hybrids exhibit novel hotspots, with large haplotype biases in both PRDM9 binding and chromatin modification. These novel hotspots represent sites of historic evolutionary erosion that become activated in hybrids due to crosstalk between one parent's Prdm9 allele and the opposite parent's chromosome. Together these data support a model where haplotype-specific PRDM9 binding directs biased gene conversion at hotspots, ultimately leading to hotspot erosion. PMID:25568937
Baker, Christopher L; Kajita, Shimpei; Walker, Michael; Saxl, Ruth L; Raghupathy, Narayanan; Choi, Kwangbom; Petkov, Petko M; Paigen, Kenneth
2015-01-01
Meiotic recombination generates new genetic variation and assures the proper segregation of chromosomes in gametes. PRDM9, a zinc finger protein with histone methyltransferase activity, initiates meiotic recombination by binding DNA at recombination hotspots and directing the position of DNA double-strand breaks (DSB). The DSB repair mechanism suggests that hotspots should eventually self-destruct, yet genome-wide recombination levels remain constant, a conundrum known as the hotspot paradox. To test if PRDM9 drives this evolutionary erosion, we measured activity of the Prdm9Cst allele in two Mus musculus subspecies, M.m. castaneus, in which Prdm9Cst arose, and M.m. domesticus, into which Prdm9Cst was introduced experimentally. Comparing these two strains, we find that haplotype differences at hotspots lead to qualitative and quantitative changes in PRDM9 binding and activity. Using Mus spretus as an outlier, we found most variants affecting PRDM9Cst binding arose and were fixed in M.m. castaneus, suppressing hotspot activity. Furthermore, M.m. castaneus×M.m. domesticus F1 hybrids exhibit novel hotspots, with large haplotype biases in both PRDM9 binding and chromatin modification. These novel hotspots represent sites of historic evolutionary erosion that become activated in hybrids due to crosstalk between one parent's Prdm9 allele and the opposite parent's chromosome. Together these data support a model where haplotype-specific PRDM9 binding directs biased gene conversion at hotspots, ultimately leading to hotspot erosion.
Hao, Chenyang; Wang, Yuquan; Chao, Shiaoman; Li, Tian; Liu, Hongxia; Wang, Lanfen; Zhang, Xueyong
2017-01-30
A Chinese wheat mini core collection was genotyped using the wheat 9 K iSelect SNP array. Total 2420 and 2396 polymorphic SNPs were detected on the A and the B genome chromosomes, which formed 878 haplotype blocks. There were more blocks in the B genome, but the average block size was significantly (P < 0.05) smaller than those in the A genome. Intense selection (domestication and breeding) had a stronger effect on the A than on the B genome chromosomes. Based on the genetic pedigrees, many blocks can be traced back to a well-known Strampelli cross, which was made one century ago. Furthermore, polyploidization of wheat (both tetraploidization and hexaploidization) induced revolutionary changes in both the A and the B genomes, with a greater increase of gene diversity compared to their diploid ancestors. Modern breeding has dramatically increased diversity in the gene coding regions, though obvious blocks were formed on most of the chromosomes in both tetraploid and hexaploid wheats. Tag-SNP markers identified in this study can be used for marker assisted selection using haplotype blocks as a wheat breeding strategy. This strategy can also be employed to facilitate genome selection in other self-pollinating crop species.
Miller, Frederick W.; Chen, Wei; O’Hanlon, Terrance P.; Cooper, Robert G.; Vencovsky, Jiri; Rider, Lisa G.; Danko, Katalin; Wedderburn, Lucy R.; Lundberg, Ingrid E.; Pachman, Lauren M.; Reed, Ann M.; Ytterberg, Steven R.; Padyukov, Leonid; Selva-O’Callaghan, Albert; Radstake, Timothy R.; Isenberg, David A.; Chinoy, Hector; Ollier, William E.R.; Scheet, Paul; Peng, Bo; Lee, Annette; Byun, Jinyoung; Lamb, Janine A.; Gregersen, Peter K.; Amos, Christopher I.
2016-01-01
Autoimmune muscle diseases (myositis) comprise a group of complex phenotypes influenced by genetic and environmental factors. To identify genetic risk factors in patients of European ancestry, we conducted a genome-wide association study (GWAS) of the major myositis phenotypes in a total of 1710 cases, which included 705 adult dermatomyositis; 473 juvenile dermatomyositis; 532 polymyositis; and 202 adult dermatomyositis, juvenile dermatomyositis or polymyositis patients with anti-histidyl tRNA synthetase (anti-Jo-1) autoantibodies, and compared them with 4724 controls. Single-nucleotide polymorphisms showing strong associations (P < 5 × 10−8) in GWAS were identified in the major histocompatibility complex (MHC) region for all myositis phenotypes together, as well as for the four clinical and autoantibody phenotypes studied separately. Imputation and regression analyses found that alleles comprising the human leukocyte antigen (HLA) 8.1 ancestral haplotype (AH8.1) defined essentially all the genetic risk in the phenotypes studied. Although the HLA DRB1*03:01 allele showed slightly stronger associations with adult and juvenile dermatomyositis, and HLA B*08:01 with polymyositis and anti-Jo-1 autoantibody-positive myositis, multiple alleles of AH8.1 were required for the full risk effects. Our findings establish that alleles of the AH8.1haplotype comprise the primary genetic risk factors associated with the major myositis phenotypes in geographically diverse Caucasian populations. PMID:26291516
Analysis of MHC class I genes across horse MHC haplotypes
Tallmadge, Rebecca L.; Campbell, Julie A.; Miller, Donald C.; Antczak, Douglas F.
2010-01-01
The genomic sequences of 15 horse Major Histocompatibility Complex (MHC) class I genes and a collection of MHC class I homozygous horses of five different haplotypes were used to investigate the genomic structure and polymorphism of the equine MHC. A combination of conserved and locus-specific primers was used to amplify horse MHC class I genes with classical and non-classical characteristics. Multiple clones from each haplotype identified three to five classical sequences per homozygous animal, and two to three non-classical sequences. Phylogenetic analysis was applied to these sequences and groups were identified which appear to be allelic series, but some sequences were left ungrouped. Sequences determined from MHC class I heterozygous horses and previously described MHC class I sequences were then added, representing a total of ten horse MHC haplotypes. These results were consistent with those obtained from the MHC homozygous horses alone, and 30 classical sequences were assigned to four previously confirmed loci and three new provisional loci. The non-classical genes had few alleles and the classical genes had higher levels of allelic polymorphism. Alleles for two classical loci with the expected pattern of polymorphism were found in the majority of haplotypes tested, but alleles at two other commonly detected loci had more variation outside of the hypervariable region than within. Our data indicate that the equine Major Histocompatibility Complex is characterized by variation in the complement of class I genes expressed in different haplotypes in addition to the expected allelic polymorphism within loci. PMID:20099063
Makki-Rmida, Faten; Kammoun, Arwa; Mahfoudh, Nadia; Ayadi, Adnene; Gibriel, Abdullah Ahmed; Mallek, Bakhta; Maalej, Leila; Hammami, Zouheir; Maatoug, Samir; Makni, Hafedh; Masmoudi, Saber
2015-12-01
Y chromosome STRs (Y-STRs) are being used frequently in forensic laboratories. Previous studies of Y-STR polymorphisms in different groups of the Tunisian population identified low levels of diversity and discrimination capacity (DC) using various commercial marker sets. This definitely limits the use of such systems for Y-STRs genotyping in Tunisia. In our investigation on South Tunisia, 200 unrelated males were typed for the 12 conventional Y-STRs included in the PowerPlex® Y System. Additional set of nine noncore Y-STRs including DYS446, DYS456, DYS458, DYS388, DYS444, DYS445, DYS449, DYS710, and DYS464 markers were genotyped and evaluated for their potential in improving DC. Allele frequency, gene diversity, haplotype diversity (HD), and DC calculation revealed that DYS464 was the most diverse marker followed by DYS710 and DYS449 markers. The standard panel of 12 Y-STRs (DC = 80.5%) and the nine markers were combined to obtain DC of 99%. Among the 198 different haplotypes observed, 196 haplotypes were unique (HD = 99.999). Out of the nine noncore set, six Y-STRs (DYS458, DYS456, DYS449, DYS710, DYS444, and DYS464) had the greatest impact on enhancing DC. Our data provided putative Y-STRs combination to be used for genetic and forensic applications. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Mitochondrial pathogenic mutations are population-specific.
Breen, Michael S; Kondrashov, Fyodor A
2010-12-31
Surveying deleterious variation in human populations is crucial for our understanding, diagnosis and potential treatment of human genetic pathologies. A number of recent genome-wide analyses focused on the prevalence of segregating deleterious alleles in the nuclear genome. However, such studies have not been conducted for the mitochondrial genome. We present a systematic survey of polymorphisms in the human mitochondrial genome, including those predicted to be deleterious and those that correspond to known pathogenic mutations. Analyzing 4458 completely sequenced mitochondrial genomes we characterize the genetic diversity of different types of single nucleotide polymorphisms (SNPs) in African (L haplotypes) and non-African (M and N haplotypes) populations. We find that the overall level of polymorphism is higher in the mitochondrial compared to the nuclear genome, although the mitochondrial genome appears to be under stronger selection as indicated by proportionally fewer nonsynonymous than synonymous substitutions. The African mitochondrial genomes show higher heterozygosity, a greater number of polymorphic sites and higher frequencies of polymorphisms for synonymous, benign and damaging polymorphism than non-African genomes. However, African genomes carry significantly fewer SNPs that have been previously characterized as pathogenic compared to non-African genomes. Finding SNPs classified as pathogenic to be the only category of polymorphisms that are more abundant in non-African genomes is best explained by a systematic ascertainment bias that favours the discovery of pathogenic polymorphisms segregating in non-African populations. This further suggests that, contrary to the common disease-common variant hypothesis, pathogenic mutations are largely population-specific and different SNPs may be associated with the same disease in different populations. Therefore, to obtain a comprehensive picture of the deleterious variability in the human population, as well as
Mechanisms and Disease Associations of Haplotype-Dependent Allele-Specific DNA Methylation
Do, Catherine; Lang, Charles F.; Lin, John; Darbary, Huferesh; Krupska, Izabela; Gaba, Aulona; Petukhova, Lynn; Vonsattel, Jean-Paul; Gallagher, Mary P.; Goland, Robin S.; Clynes, Raphael A.; Dwork, Andrew; Kral, John G.; Monk, Catherine; Christiano, Angela M.; Tycko, Benjamin
2016-01-01
Haplotype-dependent allele-specific methylation (hap-ASM) can impact disease susceptibility, but maps of this phenomenon using stringent criteria in disease-relevant tissues remain sparse. Here we apply array-based and Methyl-Seq approaches to multiple human tissues and cell types, including brain, purified neurons and glia, T lymphocytes, and placenta, and identify 795 hap-ASM differentially methylated regions (DMRs) and 3,082 strong methylation quantitative trait loci (mQTLs), most not previously reported. More than half of these DMRs have cell type-restricted ASM, and among them are 188 hap-ASM DMRs and 933 mQTLs located near GWAS signals for immune and neurological disorders. Targeted bis-seq confirmed hap-ASM in 12/13 loci tested, including CCDC155, CD69, FRMD1, IRF1, KBTBD11, and S100A∗-ILF2, associated with immune phenotypes, MYT1L, PTPRN2, CMTM8 and CELF2, associated with neurological disorders, NGFR and HLA-DRB6, associated with both immunological and brain disorders, and ZFP57, a trans-acting regulator of genomic imprinting. Polymorphic CTCF and transcription factor (TF) binding sites were over-represented among hap-ASM DMRs and mQTLs, and analysis of the human data, supplemented by cross-species comparisons to macaques, indicated that CTCF and TF binding likelihood predicts the strength and direction of the allelic methylation asymmetry. These results show that hap-ASM is highly tissue specific; an important trans-acting regulator of genomic imprinting is regulated by this phenomenon; and variation in CTCF and TF binding sites is an underlying mechanism, and maps of hap-ASM and mQTLs reveal regulatory sequences underlying supra- and sub-threshold GWAS peaks in immunological and neurological disorders. PMID:27153397
Cuyabano, B C D; Su, G; Rosa, G J M; Lund, M S; Gianola, D
2015-10-01
This study compared the accuracy of genome-enabled prediction models using individual single nucleotide polymorphisms (SNP) or haplotype blocks as covariates when using either a single breed or a combined population of Nordic Red cattle. The main objective was to compare predictions of breeding values of complex traits using a combined training population with haplotype blocks, with predictions using a single breed as training population and individual SNP as predictors. To compare the prediction reliabilities, bootstrap samples were taken from the test data set. With the bootstrapped samples of prediction reliabilities, we built and graphed confidence ellipses to allow comparisons. Finally, measures of statistical distances were used to calculate the gain in predictive ability. Our analyses are innovative in the context of assessment of predictive models, allowing a better understanding of prediction reliabilities and providing a statistical basis to effectively calibrate whether one prediction scenario is indeed more accurate than another. An ANOVA indicated that use of haplotype blocks produced significant gains mainly when Bayesian mixture models were used but not when Bayesian BLUP was fitted to the data. Furthermore, when haplotype blocks were used to train prediction models in a combined Nordic Red cattle population, we obtained up to a statistically significant 5.5% average gain in prediction accuracy, over predictions using individual SNP and training the model with a single breed. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Genomic evolution in domestic cattle: ancestral haplotypes and healthy beef.
Williamson, Joseph F; Steele, Edward J; Lester, Susan; Kalai, Oscar; Millman, John A; Wolrige, Lindsay; Bayard, Dominic; McLure, Craig; Dawkins, Roger L
2011-05-01
We have identified numerous Ancestral Haplotypes encoding a 14-Mb region of Bota C19. Three are frequent in Simmental, Angus and Wagyu and have been conserved since common progenitor populations. Others are more relevant to the differences between these 3 breeds including fat content and distribution in muscle. SREBF1 and Growth Hormone, which have been implicated in the production of healthy beef, are included within these haplotypes. However, we conclude that alleles at these 2 loci are less important than other sequences within the haplotypes. Identification of breeds and hybrids is improved by using haplotypes rather than individual alleles. Copyright © 2010 Elsevier Inc. All rights reserved.
Genomic diversity of bacteriophages infecting the fish pathogen Flavobacterium psychrophilum.
Castillo, Daniel; Middelboe, Mathias
2016-12-01
Bacteriophages infecting the fish pathogen Flavobacterium psychrophilum can potentially be used to prevent and control outbreaks of this bacterium in salmonid aquaculture. However, the application of bacteriophages in disease control requires detailed knowledge on their genetic composition. To explore the diversity of F. pyschrophilum bacteriophages, we have analyzed the complete genome sequences of 17 phages isolated from two distant geographic areas (Denmark and Chile), including the previously characterized temperate bacteriophage 6H. Phage genome size ranged from 39 302 to 89 010 bp with a G+C content of 27%-32%. None of the bacteriophages isolated in Denmark contained genes associated with lysogeny, whereas the Chilean isolates were all putative temperate phages and similar to bacteriophage 6H. Comparative genome analysis showed that phages grouped in three different genetic clusters based on genetic composition and gene content, indicating a limited genetic diversity of F. psychrophilum-specific bacteriophages. However, amino acid sequence dissimilarity (25%) was found in putative structural proteins, which could be related to the host specificity determinants. This study represents the first analysis of genomic diversity and composition among bacteriophages infecting the fish pathogen F. psychrophilum and discusses the implications for the application of phages in disease control. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Metspalu, Mait; Romero, Irene Gallego; Yunusbayev, Bayazit; Chaubey, Gyaneshwer; Mallick, Chandana Basu; Hudjashov, Georgi; Nelis, Mari; Mägi, Reedik; Metspalu, Ene; Remm, Maido; Pitchappan, Ramasamy; Singh, Lalji; Thangaraj, Kumarasamy; Villems, Richard; Kivisild, Toomas
2011-12-09
South Asia harbors one of the highest levels genetic diversity in Eurasia, which could be interpreted as a result of its long-term large effective population size and of admixture during its complex demographic history. In contrast to Pakistani populations, populations of Indian origin have been underrepresented in previous genomic scans of positive selection and population structure. Here we report data for more than 600,000 SNP markers genotyped in 142 samples from 30 ethnic groups in India. Combining our results with other available genome-wide data, we show that Indian populations are characterized by two major ancestry components, one of which is spread at comparable frequency and haplotype diversity in populations of South and West Asia and the Caucasus. The second component is more restricted to South Asia and accounts for more than 50% of the ancestry in Indian populations. Haplotype diversity associated with these South Asian ancestry components is significantly higher than that of the components dominating the West Eurasian ancestry palette. Modeling of the observed haplotype diversities suggests that both Indian ancestry components are older than the purported Indo-Aryan invasion 3,500 YBP. Consistent with the results of pairwise genetic distances among world regions, Indians share more ancestry signals with West than with East Eurasians. However, compared to Pakistani populations, a higher proportion of their genes show regionally specific signals of high haplotype homozygosity. Among such candidates of positive selection in India are MSTN and DOK5, both of which have potential implications in lipid metabolism and the etiology of type 2 diabetes. Copyright © 2011 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Evolution and Diversity in Human Herpes Simplex Virus Genomes
Gatherer, Derek; Ochoa, Alejandro; Greenbaum, Benjamin; Dolan, Aidan; Bowden, Rory J.; Enquist, Lynn W.; Legendre, Matthieu; Davison, Andrew J.
2014-01-01
Herpes simplex virus 1 (HSV-1) causes a chronic, lifelong infection in >60% of adults. Multiple recent vaccine trials have failed, with viral diversity likely contributing to these failures. To understand HSV-1 diversity better, we comprehensively compared 20 newly sequenced viral genomes from China, Japan, Kenya, and South Korea with six previously sequenced genomes from the United States, Europe, and Japan. In this diverse collection of passaged strains, we found that one-fifth of the newly sequenced members share a gene deletion and one-third exhibit homopolymeric frameshift mutations (HFMs). Individual strains exhibit genotypic and potential phenotypic variation via HFMs, deletions, short sequence repeats, and single-nucleotide polymorphisms, although the protein sequence identity between strains exceeds 90% on average. In the first genome-scale analysis of positive selection in HSV-1, we found signs of selection in specific proteins and residues, including the fusion protein glycoprotein H. We also confirmed previous results suggesting that recombination has occurred with high frequency throughout the HSV-1 genome. Despite this, the HSV-1 strains analyzed clustered by geographic origin during whole-genome distance analysis. These data shed light on likely routes of HSV-1 adaptation to changing environments and will aid in the selection of vaccine antigens that are invariant worldwide. PMID:24227835
Kullback-Leibler divergence for detection of rare haplotype common disease association.
Lin, Shili
2015-11-01
Rare haplotypes may tag rare causal variants of common diseases; hence, detection of such rare haplotypes may also contribute to our understanding of complex disease etiology. Because rare haplotypes frequently result from common single-nucleotide polymorphisms (SNPs), focusing on rare haplotypes is much more economical compared with using rare single-nucleotide variants (SNVs) from sequencing, as SNPs are available and 'free' from already amassed genome-wide studies. Further, associated haplotypes may shed light on the underlying disease causal mechanism, a feat unmatched by SNV-based collapsing methods. In recent years, data mining approaches have been adapted to detect rare haplotype association. However, as they rely on an assumed underlying disease model and require the specification of a null haplotype, results can be erroneous if such assumptions are violated. In this paper, we present a haplotype association method based on Kullback-Leibler divergence (hapKL) for case-control samples. The idea is to compare haplotype frequencies for the cases versus the controls by computing symmetrical divergence measures. An important property of such measures is that both the frequencies and logarithms of the frequencies contribute in parallel, thus balancing the contributions from rare and common, and accommodating both deleterious and protective, haplotypes. A simulation study under various scenarios shows that hapKL has well-controlled type I error rates and good power compared with existing data mining methods. Application of hapKL to age-related macular degeneration (AMD) shows a strong association of the complement factor H (CFH) gene with AMD, identifying several individual rare haplotypes with strong signals.
Comparative Genomics Reveals High Genomic Diversity in the Genus Photobacterium.
Machado, Henrique; Gram, Lone
2017-01-01
Vibrionaceae is a large marine bacterial family, which can constitute up to 50% of the prokaryotic population in marine waters. Photobacterium is the second largest genus in the family and we used comparative genomics on 35 strains representing 16 of the 28 species described so far, to understand the genomic diversity present in the Photobacterium genus. Such understanding is important for ecophysiology studies of the genus. We used whole genome sequences to evaluate phylogenetic relationships using several analyses (16S rRNA, MLSA, fur , amino-acid usage, ANI), which allowed us to identify two misidentified strains. Genome analyses also revealed occurrence of higher and lower GC content clades, correlating with phylogenetic clusters. Pan- and core-genome analysis revealed the conservation of 25% of the genome throughout the genus, with a large and open pan-genome. The major source of genomic diversity could be traced to the smaller chromosome and plasmids. Several of the physiological traits studied in the genus did not correlate with phylogenetic data. Since horizontal gene transfer (HGT) is often suggested as a source of genetic diversity and a potential driver of genomic evolution in bacterial species, we looked into evidence of such in Photobacterium genomes. Genomic islands were the source of genomic differences between strains of the same species. Also, we found transposase genes and CRISPR arrays that suggest multiple encounters with foreign DNA. Presence of genomic exchange traits was widespread and abundant in the genus, suggesting a role in genomic evolution. The high genetic variability and indications of genetic exchange make it difficult to elucidate genome evolutionary paths and raise the awareness of the roles of foreign DNA in the genomic evolution of environmental organisms.
Haplotypes in the APOA1-C3-A4-A5 gene cluster affect plasma lipids in both humans and baboons
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Qian-fei; Liu, Xin; O'Connell, Jeff
2003-09-15
Genetic studies in non-human primates serve as a potential strategy for identifying genomic intervals where polymorphisms impact upon human disease-related phenotypes. It remains unclear, however, whether independently arising polymorphisms in orthologous regions of non-human primates leads to similar variation in a quantitative trait found in both species. To explore this paradigm, we studied a baboon apolipoprotein gene cluster (APOA1/C3/A4/A5) for which the human gene orthologs have well established roles in influencing plasma HDL-cholesterol and triglyceride concentrations. Our extensive polymorphism analysis of this 68 kb gene cluster in 96 pedigreed baboons identified several haplotype blocks each with limited diversity, consistent withmore » haplotype findings in humans. To determine whether baboons, like humans, also have particular haplotypes associated with lipid phenotypes, we genotyped 634 well characterized baboons using 16 haplotype tagging SNPs. Genetic analysis of single SNPs, as well as haplotypes, revealed an association of APOA5 and APOC3 variants with HDL cholesterol and triglyceride concentrations, respectively. Thus, independent variation in orthologous genomic intervals does associate with similar quantitative lipid traits in both species, supporting the possibility of uncovering human QTL genes in a highly controlled non-human primate model.« less
Haplotype analysis of the 185delAG BRCA1 mutation in ethnically diverse populations
Laitman, Yael; Feng, Bing-Jian; Zamir, Itay M; Weitzel, Jeffrey N; Duncan, Paul; Port, Danielle; Thirthagiri, Eswary; Teo, Soo-Hwang; Evans, Gareth; Latif, Ayse; Newman, William G; Gershoni-Baruch, Ruth; Zidan, Jamal; Shimon-Paluch, Shani; Goldgar, David; Friedman, Eitan
2013-01-01
The 185delAG* BRCA1 mutation is encountered primarily in Jewish Ashkenazi and Iraqi individuals, and sporadically in non-Jews. Previous studies estimated that this is a founder mutation in Jewish mutation carriers that arose before the dispersion of Jews in the Diaspora ∼2500 years ago. The aim of this study was to assess the haplotype in ethnically diverse 185delAG* BRCA1 mutation carriers, and to estimate the age at which the mutation arose. Ethnically diverse Jewish and non-Jewish 185delAG*BRCA1 mutation carriers and their relatives were genotyped using 15 microsatellite markers and three SNPs spanning 12.5 MB, encompassing the BRCA1 gene locus. Estimation of mutation age was based on a subset of 11 markers spanning a region of ∼5 MB, using a previously developed algorithm applying the maximum likelihood method. Overall, 188 participants (154 carriers and 34 noncarriers) from 115 families were included: Ashkenazi, Iraq, Kuchin-Indians, Syria, Turkey, Iran, Tunisia, Bulgaria, non-Jewish English, non-Jewish Malaysian, and Hispanics. Haplotype analysis indicated that the 185delAG mutation arose 750–1500 years ago. In Ashkenazim, it is a founder mutation that arose 61 generations ago, and with a small group of founder mutations was introduced into the Hispanic population (conversos) ∼650 years ago, and into the Iraqi–Jewish community ∼450 years ago. The 185delAG mutation in the non-Jewish populations in Malaysia and the UK arose at least twice independently. We conclude that the 185delAG* BRCA1 mutation resides on a common haplotype among Ashkenazi Jews, and arose about 61 generations ago and arose independently at least twice in non-Jews. PMID:22763381
Very long haplotype tracts characterized at high resolution from HLA homozygous cell lines
Norman, Paul J.; Norberg, Steve; Nemat-Gorgani, Neda; Royce, Thomas; Hollenbach, Jill A.; Won, Melissa Shults; Guethlein, Lisbeth A.; Gunderson, Kevin L.; Ronaghi, Mostafa; Parham, Peter
2015-01-01
The HLA region of chromosome 6 contains the most polymorphic genes in humans. Spanning ~5Mbp the densely packed region encompasses approximately 175 expressed genes including the highly polymorphic HLA class I and II loci. Most of the other genes and functional elements are also polymorphic, and many of them are directly implicated in immune function or immune-related disease. For these reasons this complex genomic region is subject to intense scrutiny by researchers with the common goal of aiding further understanding and diagnoses of multiple immune-related diseases and syndromes. To aid assay development and characterization of the classical loci, a panel of cell lines partially or fully homozygous for HLA class I and II was assembled over time by the International Histocompatibility Working Group (IHWG). Containing a minimum of 88 unique HLA haplotypes, we show this panel represents a significant proportion of European HLA allelic and haplotype diversity (60–95%). Using a high-density whole genome array that includes 13,331 HLA region SNPs, we analyzed 99 IHWG cells to map the coordinates of the homozygous tracts at a fine scale. The mean homozygous tract length within chromosome 6 from these individuals is 21Mbp. Within HLA the mean haplotype length is 4.3Mbp, and 65% of the cell lines were shown to be homozygous throughout the entire region. In addition, four cell lines are homozygous throughout the complex KIR region of chromosome 19 (~250kbp). The data we describe will provide a valuable resource for characterizing haplotypes, designing and refining imputation algorithms and developing assay controls. PMID:26198775
Carnivore-specific SINEs (Can-SINEs): distribution, evolution, and genomic impact.
Walters-Conte, Kathryn B; Johnson, Diana L E; Allard, Marc W; Pecon-Slattery, Jill
2011-01-01
Short interspersed nuclear elements (SINEs) are a type of class 1 transposable element (retrotransposon) with features that allow investigators to resolve evolutionary relationships between populations and species while providing insight into genome composition and function. Characterization of a Carnivora-specific SINE family, Can-SINEs, has, has aided comparative genomic studies by providing rare genomic changes, and neutral sequence variants often needed to resolve difficult evolutionary questions. In addition, Can-SINEs constitute a significant source of functional diversity with Carnivora. Publication of the whole-genome sequence of domestic dog, domestic cat, and giant panda serves as a valuable resource in comparative genomic inferences gleaned from Can-SINEs. In anticipation of forthcoming studies bolstered by new genomic data, this review describes the discovery and characterization of Can-SINE motifs as well as describes composition, distribution, and effect on genome function. As the contribution of noncoding sequences to genomic diversity becomes more apparent, SINEs and other transposable elements will play an increasingly large role in mammalian comparative genomics.
Carnivore-Specific SINEs (Can-SINEs): Distribution, Evolution, and Genomic Impact
Johnson, Diana L.E.; Allard, Marc W.; Pecon-Slattery, Jill
2011-01-01
Short interspersed nuclear elements (SINEs) are a type of class 1 transposable element (retrotransposon) with features that allow investigators to resolve evolutionary relationships between populations and species while providing insight into genome composition and function. Characterization of a Carnivora-specific SINE family, Can-SINEs, has, has aided comparative genomic studies by providing rare genomic changes, and neutral sequence variants often needed to resolve difficult evolutionary questions. In addition, Can-SINEs constitute a significant source of functional diversity with Carnivora. Publication of the whole-genome sequence of domestic dog, domestic cat, and giant panda serves as a valuable resource in comparative genomic inferences gleaned from Can-SINEs. In anticipation of forthcoming studies bolstered by new genomic data, this review describes the discovery and characterization of Can-SINE motifs as well as describes composition, distribution, and effect on genome function. As the contribution of noncoding sequences to genomic diversity becomes more apparent, SINEs and other transposable elements will play an increasingly large role in mammalian comparative genomics. PMID:21846743
Globally dispersed Y chromosomal haplotypes in wild and domestic sheep.
Meadows, J R S; Hanotte, O; Drögemüller, C; Calvo, J; Godfrey, R; Coltman, D; Maddox, J F; Marzanov, N; Kantanen, J; Kijas, J W
2006-10-01
To date, investigations of genetic diversity and the origins of domestication in sheep have utilised autosomal microsatellites and variation in the mitochondrial genome. We present the first analysis of both domestic and wild sheep using genetic markers residing on the ovine Y chromosome. Analysis of a single nucleotide polymorphism (oY1) in the SRY promoter region revealed that allele A-oY1 was present in all wild bighorn sheep (Ovis canadensis), two subspecies of thinhorn sheep (Ovis dalli), European Mouflon (Ovis musimon) and the Barbary (Ammontragis lervia). A-oY1 also had the highest frequency (71.4%) within 458 domestic sheep drawn from 65 breeds sampled from Africa, Asia, Australia, the Caribbean, Europe, the Middle East and Central Asia. Sequence analysis of a second locus, microsatellite SRYM18, revealed a compound repeat array displaying fixed differences, which identified bighorn and thinhorn sheep as distinct from the European Mouflon and domestic animals. Combined genotypic data identified 11 male-specific haplotypes that represented at least two separate lineages. Investigation of the geographical distribution of each haplotype revealed that one (H6) was both very common and widespread in the global sample of domestic breeds. The remaining haplotypes each displayed more restricted and informative distributions. For example, H5 was likely founded following the domestication of European breeds and was used to trace the recent transportation of animals to both the Caribbean and Australia. A high rate of Y chromosomal dispersal appears to have taken place during the development of domestic sheep as only 12.9% of the total observed variation was partitioned between major geographical regions.
Comparative Genomics Reveals High Genomic Diversity in the Genus Photobacterium
Machado, Henrique; Gram, Lone
2017-01-01
Vibrionaceae is a large marine bacterial family, which can constitute up to 50% of the prokaryotic population in marine waters. Photobacterium is the second largest genus in the family and we used comparative genomics on 35 strains representing 16 of the 28 species described so far, to understand the genomic diversity present in the Photobacterium genus. Such understanding is important for ecophysiology studies of the genus. We used whole genome sequences to evaluate phylogenetic relationships using several analyses (16S rRNA, MLSA, fur, amino-acid usage, ANI), which allowed us to identify two misidentified strains. Genome analyses also revealed occurrence of higher and lower GC content clades, correlating with phylogenetic clusters. Pan- and core-genome analysis revealed the conservation of 25% of the genome throughout the genus, with a large and open pan-genome. The major source of genomic diversity could be traced to the smaller chromosome and plasmids. Several of the physiological traits studied in the genus did not correlate with phylogenetic data. Since horizontal gene transfer (HGT) is often suggested as a source of genetic diversity and a potential driver of genomic evolution in bacterial species, we looked into evidence of such in Photobacterium genomes. Genomic islands were the source of genomic differences between strains of the same species. Also, we found transposase genes and CRISPR arrays that suggest multiple encounters with foreign DNA. Presence of genomic exchange traits was widespread and abundant in the genus, suggesting a role in genomic evolution. The high genetic variability and indications of genetic exchange make it difficult to elucidate genome evolutionary paths and raise the awareness of the roles of foreign DNA in the genomic evolution of environmental organisms. PMID:28706512
Chen, Fuqiang; Ding, Xiao; Feng, Yongmei; Seebeck, Timothy; Jiang, Yanfang; Davis, Gregory D
2017-04-07
Bacterial CRISPR-Cas systems comprise diverse effector endonucleases with different targeting ranges, specificities and enzymatic properties, but many of them are inactive in mammalian cells and are thus precluded from genome-editing applications. Here we show that the type II-B FnCas9 from Francisella novicida possesses novel properties, but its nuclease function is frequently inhibited at many genomic loci in living human cells. Moreover, we develop a proximal CRISPR (termed proxy-CRISPR) targeting method that restores FnCas9 nuclease activity in a target-specific manner. We further demonstrate that this proxy-CRISPR strategy is applicable to diverse CRISPR-Cas systems, including type II-C Cas9 and type V Cpf1 systems, and can facilitate precise gene editing even between identical genomic sites within the same genome. Our findings provide a novel strategy to enable use of diverse otherwise inactive CRISPR-Cas systems for genome-editing applications and a potential path to modulate the impact of chromatin microenvironments on genome modification.
Chen, Fuqiang; Ding, Xiao; Feng, Yongmei; Seebeck, Timothy; Jiang, Yanfang; Davis, Gregory D.
2017-01-01
Bacterial CRISPR–Cas systems comprise diverse effector endonucleases with different targeting ranges, specificities and enzymatic properties, but many of them are inactive in mammalian cells and are thus precluded from genome-editing applications. Here we show that the type II-B FnCas9 from Francisella novicida possesses novel properties, but its nuclease function is frequently inhibited at many genomic loci in living human cells. Moreover, we develop a proximal CRISPR (termed proxy-CRISPR) targeting method that restores FnCas9 nuclease activity in a target-specific manner. We further demonstrate that this proxy-CRISPR strategy is applicable to diverse CRISPR–Cas systems, including type II-C Cas9 and type V Cpf1 systems, and can facilitate precise gene editing even between identical genomic sites within the same genome. Our findings provide a novel strategy to enable use of diverse otherwise inactive CRISPR–Cas systems for genome-editing applications and a potential path to modulate the impact of chromatin microenvironments on genome modification. PMID:28387220
Reeves, Andrew B.; Smith, Matthew M.; Meixell, Brandt W.; Fleskes, Joseph P.; Ramey, Andrew M.
2015-01-01
Birds of the order Anseriformes, commonly referred to as waterfowl, are frequently infected by Haemosporidia of the genera Haemoproteus, Plasmodium, and Leucocytozoon via dipteran vectors. We analyzed nucleotide sequences of the Cytochrome b (Cytb) gene from parasites of these genera detected in six species of ducks from Alaska and California, USA to characterize the genetic diversity of Haemosporidia infecting waterfowl at two ends of the Pacific Americas Flyway. In addition, parasite Cytb sequences were compared to those available on a public database to investigate specificity of genetic lineages to hosts of the order Anseriformes. Haplotype and nucleotide diversity of Haemoproteus Cytb sequences was lower than was detected for Plasmodium and Leucocytozoon parasites. Although waterfowl are presumed to be infected by only a single species of Leucocytozoon, L. simondi, diversity indices were highest for haplotypes from this genus and sequences formed five distinct clades separated by genetic distances of 4.9%–7.6%, suggesting potential cryptic speciation. All Haemoproteus andLeucocytozoon haplotypes derived from waterfowl samples formed monophyletic clades in phylogenetic analyses and were unique to the order Anseriformes with few exceptions. In contrast, waterfowl-origin Plasmodium haplotypes were identical or closely related to lineages found in other avian orders. Our results suggest a more generalist strategy for Plasmodiumparasites infecting North American waterfowl as compared to those of the generaHaemoproteus and Leucocytozoon.
Reeves, Andrew B.; Smith, Mathew M.; Meixell, Brandt W.; Fleskes, Joseph P; Ramey, Andrew M.
2015-01-01
Birds of the order Anseriformes, commonly referred to as waterfowl, are frequently infected by Haemosporidia of the genera Haemoproteus, Plasmodium, and Leucocytozoon via dipteran vectors. We analyzed nucleotide sequences of the Cytochrome b (Cytb) gene from parasites of these genera detected in six species of ducks from Alaska and California, USA to characterize the genetic diversity of Haemosporidia infecting waterfowl at two ends of the Pacific Americas Flyway. In addition, parasite Cytb sequences were compared to those available on a public database to investigate specificity of genetic lineages to hosts of the order Anseriformes. Haplotype and nucleotide diversity of Haemoproteus Cytb sequences was lower than was detected for Plasmodium and Leucocytozoon parasites. Although waterfowl are presumed to be infected by only a single species of Leucocytozoon, L. simondi, diversity indices were highest for haplotypes from this genus and sequences formed five distinct clades separated by genetic distances of 4.9%–7.6%, suggesting potential cryptic speciation. All Haemoproteus and Leucocytozoon haplotypes derived from waterfowl samples formed monophyletic clades in phylogenetic analyses and were unique to the order Anseriformes with few exceptions. In contrast, waterfowl-origin Plasmodium haplotypes were identical or closely related to lineages found in other avian orders. Our results suggest a more generalist strategy for Plasmodium parasites infecting North American waterfowl as compared to those of the genera Haemoproteus and Leucocytozoon. PMID:25710468
Fong, Mun Yik; Rashdi, Sarah A. A.; Yusof, Ruhani; Lau, Yee Ling
2016-01-01
Background Plasmodium knowlesi is a simian malaria parasite that has been reported to cause malaria in humans in Southeast Asia. This parasite invades the erythrocytes of humans and of its natural host, the macaque Macaca fascicularis, via interaction between the Duffy binding protein region II (PkDBPαRII) and the Duffy antigen receptor on the host erythrocytes. In contrast, the P. knowlesi gamma protein region II (PkγRII) is not involved in the invasion of P. knowlesi into humans. PkγRII, however, mediates the invasion of P. knowlesi into the erythrocytes of M. mulata, a non-natural host of P. knowlesi via a hitherto unknown receptor. The haplotypes of PkDBPαRII in P. knowlesi isolates from Peninsular Malaysia and North Borneo have been shown to be genetically distinct and geographically clustered. Also, the PkDBPαRII was observed to be undergoing purifying (negative) selection. The present study aimed to determine whether similar phenomena occur in PkγRII. Methods Blood samples from 78 knowlesi malaria patients were used. Forty-eight of the samples were from Peninsular Malaysia, and 30 were from Malaysia Borneo. The genomic DNA of the samples was extracted and used as template for the PCR amplification of the PkγRII. The PCR product was cloned and sequenced. The sequences obtained were analysed for genetic diversity and natural selection using MEGA6 and DnaSP (version 5.10.00) programmes. Genetic differentiation between the PkγRII of Peninsular Malaysia and North Borneo isolates was estimated using the Wright’s FST fixation index in DnaSP (version 5.10.00). Haplotype analysis was carried out using the Median-Joining approach in NETWORK (version 4.6.1.3). Results A total of 78 PkγRII sequences was obtained. Comparative analysis showed that the PkγRII have similar range of haplotype (Hd) and nucleotide diversity (π) with that of PkDBPαRII. Other similarities between PkγRII and PkDBPαRII include undergoing purifying (negative) selection, geographical
Genomic Diversity of Lactobacillus salivarius▿ †
Raftis, Emma J.; Salvetti, Elisa; Torriani, Sandra; Felis, Giovanna E.; O'Toole, Paul W.
2011-01-01
Strains of Lactobacillus salivarius are increasingly employed as probiotic agents for humans or animals. Despite the diversity of environmental sources from which they have been isolated, the genomic diversity of L. salivarius has been poorly characterized, and the implications of this diversity for strain selection have not been examined. To tackle this, we applied comparative genomic hybridization (CGH) and multilocus sequence typing (MLST) to 33 strains derived from humans, animals, or food. The CGH, based on total genome content, including small plasmids, identified 18 major regions of genomic variation, or hot spots for variation. Three major divisions were thus identified, with only a subset of the human isolates constituting an ecologically discernible group. Omission of the small plasmids from the CGH or analysis by MLST provided broadly concordant fine divisions and separated human-derived and animal-derived strains more clearly. The two gene clusters for exopolysaccharide (EPS) biosynthesis corresponded to regions of significant genomic diversity. The CGH-based groupings of these regions did not correlate with levels of production of bound or released EPS. Furthermore, EPS production was significantly modulated by available carbohydrate. In addition to proving difficult to predict from the gene content, EPS production levels correlated inversely with production of biofilms, a trait considered desirable in probiotic commensals. L. salivarius displays a high level of genomic diversity, and while selection of L. salivarius strains for probiotic use can be informed by CGH or MLST, it also requires pragmatic experimental validation of desired phenotypic traits. PMID:21131523
Lee, Hong Jo; Lee, Hyung Chul; Kim, Young Min; Hwang, Young Sun; Park, Young Hyun; Park, Tae Sub; Han, Jae Yong
2016-02-01
Targeted genome recombination has been applied in diverse research fields and has a wide range of possible applications. In particular, the discovery of specific loci in the genome that support robust and ubiquitous expression of integrated genes and the development of genome-editing technology have facilitated rapid advances in various scientific areas. In this study, we produced transgenic (TG) chickens that can induce recombinase-mediated gene cassette exchange (RMCE), one of the site-specific recombination technologies, and confirmed RMCE in TG chicken-derived cells. As a result, we established TG chicken lines that have, Flipase (Flp) recognition target (FRT) pairs in the chicken genome, mediated by piggyBac transposition. The transgene integration patterns were diverse in each TG chicken line, and the integration diversity resulted in diverse levels of expression of exogenous genes in each tissue of the TG chickens. In addition, the replaced gene cassette was expressed successfully and maintained by RMCE in the FRT predominant loci of TG chicken-derived cells. These results indicate that targeted genome recombination technology with RMCE could be adaptable to TG chicken models and that the technology would be applicable to specific gene regulation by cis-element insertion and customized expression of functional proteins at predicted levels without epigenetic influence. © FASEB.
Expanding the Diversity of Mycobacteriophages: Insights into Genome Architecture and Evolution
Pope, Welkin H.; Jacobs-Sera, Deborah; Russell, Daniel A.; Peebles, Craig L.; Al-Atrache, Zein; Alcoser, Turi A.; Alexander, Lisa M.; Alfano, Matthew B.; Alford, Samantha T.; Amy, Nichols E.; Anderson, Marie D.; Anderson, Alexander G.; Ang, Andrew A. S.; Ares, Manuel; Barber, Amanda J.; Barker, Lucia P.; Barrett, Jonathan M.; Barshop, William D.; Bauerle, Cynthia M.; Bayles, Ian M.; Belfield, Katherine L.; Best, Aaron A.; Borjon, Agustin; Bowman, Charles A.; Boyer, Christine A.; Bradley, Kevin W.; Bradley, Victoria A.; Broadway, Lauren N.; Budwal, Keshav; Busby, Kayla N.; Campbell, Ian W.; Campbell, Anne M.; Carey, Alyssa; Caruso, Steven M.; Chew, Rebekah D.; Cockburn, Chelsea L.; Cohen, Lianne B.; Corajod, Jeffrey M.; Cresawn, Steven G.; Davis, Kimberly R.; Deng, Lisa; Denver, Dee R.; Dixon, Breyon R.; Ekram, Sahrish; Elgin, Sarah C. R.; Engelsen, Angela E.; English, Belle E. V.; Erb, Marcella L.; Estrada, Crystal; Filliger, Laura Z.; Findley, Ann M.; Forbes, Lauren; Forsyth, Mark H.; Fox, Tyler M.; Fritz, Melissa J.; Garcia, Roberto; George, Zindzi D.; Georges, Anne E.; Gissendanner, Christopher R.; Goff, Shannon; Goldstein, Rebecca; Gordon, Kobie C.; Green, Russell D.; Guerra, Stephanie L.; Guiney-Olsen, Krysta R.; Guiza, Bridget G.; Haghighat, Leila; Hagopian, Garrett V.; Harmon, Catherine J.; Harmson, Jeremy S.; Hartzog, Grant A.; Harvey, Samuel E.; He, Siping; He, Kevin J.; Healy, Kaitlin E.; Higinbotham, Ellen R.; Hildebrandt, Erin N.; Ho, Jason H.; Hogan, Gina M.; Hohenstein, Victoria G.; Holz, Nathan A.; Huang, Vincent J.; Hufford, Ericka L.; Hynes, Peter M.; Jackson, Arrykka S.; Jansen, Erica C.; Jarvik, Jonathan; Jasinto, Paul G.; Jordan, Tuajuanda C.; Kasza, Tomas; Katelyn, Murray A.; Kelsey, Jessica S.; Kerrigan, Larisa A.; Khaw, Daryl; Kim, Junghee; Knutter, Justin Z.; Ko, Ching-Chung; Larkin, Gail V.; Laroche, Jennifer R.; Latif, Asma; Leuba, Kohana D.; Leuba, Sequoia I.; Lewis, Lynn O.; Loesser-Casey, Kathryn E.; Long, Courtney A.; Lopez, A. Javier; Lowery, Nicholas; Lu, Tina Q.; Mac, Victor; Masters, Isaac R.; McCloud, Jazmyn J.; McDonough, Molly J.; Medenbach, Andrew J.; Menon, Anjali; Miller, Rachel; Morgan, Brandon K.; Ng, Patrick C.; Nguyen, Elvis; Nguyen, Katrina T.; Nguyen, Emilie T.; Nicholson, Kaylee M.; Parnell, Lindsay A.; Peirce, Caitlin E.; Perz, Allison M.; Peterson, Luke J.; Pferdehirt, Rachel E.; Philip, Seegren V.; Pogliano, Kit; Pogliano, Joe; Polley, Tamsen; Puopolo, Erica J.; Rabinowitz, Hannah S.; Resiss, Michael J.; Rhyan, Corwin N.; Robinson, Yetta M.; Rodriguez, Lauren L.; Rose, Andrew C.; Rubin, Jeffrey D.; Ruby, Jessica A.; Saha, Margaret S.; Sandoz, James W.; Savitskaya, Judith; Schipper, Dale J.; Schnitzler, Christine E.; Schott, Amanda R.; Segal, J. Bradley; Shaffer, Christopher D.; Sheldon, Kathryn E.; Shepard, Erica M.; Shepardson, Jonathan W.; Shroff, Madav K.; Simmons, Jessica M.; Simms, Erika F.; Simpson, Brandy M.; Sinclair, Kathryn M.; Sjoholm, Robert L.; Slette, Ingrid J.; Spaulding, Blaire C.; Straub, Clark L.; Stukey, Joseph; Sughrue, Trevor; Tang, Tin-Yun; Tatyana, Lyons M.; Taylor, Stephen B.; Taylor, Barbara J.; Temple, Louise M.; Thompson, Jasper V.; Tokarz, Michael P.; Trapani, Stephanie E.; Troum, Alexander P.; Tsay, Jonathan; Tubbs, Anthony T.; Walton, Jillian M.; Wang, Danielle H.; Wang, Hannah; Warner, John R.; Weisser, Emilie G.; Wendler, Samantha C.; Weston-Hafer, Kathleen A.; Whelan, Hilary M.; Williamson, Kurt E.; Willis, Angelica N.; Wirtshafter, Hannah S.; Wong, Theresa W.; Wu, Phillip; Yang, Yun jeong; Yee, Brandon C.; Zaidins, David A.; Zhang, Bo; Zúniga, Melina Y.; Hendrix, Roger W.; Hatfull, Graham F.
2011-01-01
Mycobacteriophages are viruses that infect mycobacterial hosts such as Mycobacterium smegmatis and Mycobacterium tuberculosis. All mycobacteriophages characterized to date are dsDNA tailed phages, and have either siphoviral or myoviral morphotypes. However, their genetic diversity is considerable, and although sixty-two genomes have been sequenced and comparatively analyzed, these likely represent only a small portion of the diversity of the mycobacteriophage population at large. Here we report the isolation, sequencing and comparative genomic analysis of 18 new mycobacteriophages isolated from geographically distinct locations within the United States. Although no clear correlation between location and genome type can be discerned, these genomes expand our knowledge of mycobacteriophage diversity and enhance our understanding of the roles of mobile elements in viral evolution. Expansion of the number of mycobacteriophages grouped within Cluster A provides insights into the basis of immune specificity in these temperate phages, and we also describe a novel example of apparent immunity theft. The isolation and genomic analysis of bacteriophages by freshman college students provides an example of an authentic research experience for novice scientists. PMID:21298013
Expanding the diversity of mycobacteriophages: insights into genome architecture and evolution.
Pope, Welkin H; Jacobs-Sera, Deborah; Russell, Daniel A; Peebles, Craig L; Al-Atrache, Zein; Alcoser, Turi A; Alexander, Lisa M; Alfano, Matthew B; Alford, Samantha T; Amy, Nichols E; Anderson, Marie D; Anderson, Alexander G; Ang, Andrew A S; Ares, Manuel; Barber, Amanda J; Barker, Lucia P; Barrett, Jonathan M; Barshop, William D; Bauerle, Cynthia M; Bayles, Ian M; Belfield, Katherine L; Best, Aaron A; Borjon, Agustin; Bowman, Charles A; Boyer, Christine A; Bradley, Kevin W; Bradley, Victoria A; Broadway, Lauren N; Budwal, Keshav; Busby, Kayla N; Campbell, Ian W; Campbell, Anne M; Carey, Alyssa; Caruso, Steven M; Chew, Rebekah D; Cockburn, Chelsea L; Cohen, Lianne B; Corajod, Jeffrey M; Cresawn, Steven G; Davis, Kimberly R; Deng, Lisa; Denver, Dee R; Dixon, Breyon R; Ekram, Sahrish; Elgin, Sarah C R; Engelsen, Angela E; English, Belle E V; Erb, Marcella L; Estrada, Crystal; Filliger, Laura Z; Findley, Ann M; Forbes, Lauren; Forsyth, Mark H; Fox, Tyler M; Fritz, Melissa J; Garcia, Roberto; George, Zindzi D; Georges, Anne E; Gissendanner, Christopher R; Goff, Shannon; Goldstein, Rebecca; Gordon, Kobie C; Green, Russell D; Guerra, Stephanie L; Guiney-Olsen, Krysta R; Guiza, Bridget G; Haghighat, Leila; Hagopian, Garrett V; Harmon, Catherine J; Harmson, Jeremy S; Hartzog, Grant A; Harvey, Samuel E; He, Siping; He, Kevin J; Healy, Kaitlin E; Higinbotham, Ellen R; Hildebrandt, Erin N; Ho, Jason H; Hogan, Gina M; Hohenstein, Victoria G; Holz, Nathan A; Huang, Vincent J; Hufford, Ericka L; Hynes, Peter M; Jackson, Arrykka S; Jansen, Erica C; Jarvik, Jonathan; Jasinto, Paul G; Jordan, Tuajuanda C; Kasza, Tomas; Katelyn, Murray A; Kelsey, Jessica S; Kerrigan, Larisa A; Khaw, Daryl; Kim, Junghee; Knutter, Justin Z; Ko, Ching-Chung; Larkin, Gail V; Laroche, Jennifer R; Latif, Asma; Leuba, Kohana D; Leuba, Sequoia I; Lewis, Lynn O; Loesser-Casey, Kathryn E; Long, Courtney A; Lopez, A Javier; Lowery, Nicholas; Lu, Tina Q; Mac, Victor; Masters, Isaac R; McCloud, Jazmyn J; McDonough, Molly J; Medenbach, Andrew J; Menon, Anjali; Miller, Rachel; Morgan, Brandon K; Ng, Patrick C; Nguyen, Elvis; Nguyen, Katrina T; Nguyen, Emilie T; Nicholson, Kaylee M; Parnell, Lindsay A; Peirce, Caitlin E; Perz, Allison M; Peterson, Luke J; Pferdehirt, Rachel E; Philip, Seegren V; Pogliano, Kit; Pogliano, Joe; Polley, Tamsen; Puopolo, Erica J; Rabinowitz, Hannah S; Resiss, Michael J; Rhyan, Corwin N; Robinson, Yetta M; Rodriguez, Lauren L; Rose, Andrew C; Rubin, Jeffrey D; Ruby, Jessica A; Saha, Margaret S; Sandoz, James W; Savitskaya, Judith; Schipper, Dale J; Schnitzler, Christine E; Schott, Amanda R; Segal, J Bradley; Shaffer, Christopher D; Sheldon, Kathryn E; Shepard, Erica M; Shepardson, Jonathan W; Shroff, Madav K; Simmons, Jessica M; Simms, Erika F; Simpson, Brandy M; Sinclair, Kathryn M; Sjoholm, Robert L; Slette, Ingrid J; Spaulding, Blaire C; Straub, Clark L; Stukey, Joseph; Sughrue, Trevor; Tang, Tin-Yun; Tatyana, Lyons M; Taylor, Stephen B; Taylor, Barbara J; Temple, Louise M; Thompson, Jasper V; Tokarz, Michael P; Trapani, Stephanie E; Troum, Alexander P; Tsay, Jonathan; Tubbs, Anthony T; Walton, Jillian M; Wang, Danielle H; Wang, Hannah; Warner, John R; Weisser, Emilie G; Wendler, Samantha C; Weston-Hafer, Kathleen A; Whelan, Hilary M; Williamson, Kurt E; Willis, Angelica N; Wirtshafter, Hannah S; Wong, Theresa W; Wu, Phillip; Yang, Yun jeong; Yee, Brandon C; Zaidins, David A; Zhang, Bo; Zúniga, Melina Y; Hendrix, Roger W; Hatfull, Graham F
2011-01-27
Mycobacteriophages are viruses that infect mycobacterial hosts such as Mycobacterium smegmatis and Mycobacterium tuberculosis. All mycobacteriophages characterized to date are dsDNA tailed phages, and have either siphoviral or myoviral morphotypes. However, their genetic diversity is considerable, and although sixty-two genomes have been sequenced and comparatively analyzed, these likely represent only a small portion of the diversity of the mycobacteriophage population at large. Here we report the isolation, sequencing and comparative genomic analysis of 18 new mycobacteriophages isolated from geographically distinct locations within the United States. Although no clear correlation between location and genome type can be discerned, these genomes expand our knowledge of mycobacteriophage diversity and enhance our understanding of the roles of mobile elements in viral evolution. Expansion of the number of mycobacteriophages grouped within Cluster A provides insights into the basis of immune specificity in these temperate phages, and we also describe a novel example of apparent immunity theft. The isolation and genomic analysis of bacteriophages by freshman college students provides an example of an authentic research experience for novice scientists.
Maia, João P; Harris, D James; Carranza, Salvador; Goméz-Díaz, Elena
2016-11-01
Understanding the processes that shape parasite diversification, their distribution and abundance provides valuable information on the dynamics and evolution of disease. In this study, we assessed the diversity, distribution, host-specificity and infection patterns of apicomplexan parasites in amphibians and reptiles from Oman, Arabia. Using a quantitative PCR approach we detected three apicomplexan parasites (haemogregarines, lankesterellids and sarcocystids). A total of 13 haemogregarine haplotypes were identified, which fell into four main clades in a phylogenetic framework. Phylogenetic analysis of six new lankesterellid haplotypes revealed that these parasites were distinct from, but phylogenetically related to, known Lankesterella species and might represent new taxa. The percentage of infected hosts (prevalence) and the number of haemogregarines in the blood (parasitaemia) varied significantly between gecko species. We also found significant differences in parasitaemia between haemogregarine parasite lineages (defined by phylogenetic clustering of haplotypes), suggesting differences in host-parasite compatibility between these lineages. For Pristurus rupestris, we found significant differences in haemogregarine prevalence between geographical areas. Our results suggest that host ecology and host relatedness may influence haemogregarine distributions and, more generally, highlight the importance of screening wild hosts from remote regions to provide new insights into parasite diversity.
Hybrid origin of European commercial pigs examined by an in-depth haplotype analysis on chromosome 1
Bosse, Mirte; Madsen, Ole; Megens, Hendrik-Jan; Frantz, Laurent A. F.; Paudel, Yogesh; Crooijmans, Richard P. M. A.; Groenen, Martien A. M.
2014-01-01
Although all farm animals have an original source of domestication, a large variety of modern breeds exist that are phenotypically highly distinct from the ancestral wild population. This phenomenon can be the result of artificial selection or gene flow from other sources into the domesticated population. The Eurasian wild boar (Sus scrofa) has been domesticated at least twice in two geographically distinct regions during the Neolithic revolution when hunting shifted to farming. Prior to the establishment of the commercial European pig breeds we know today, some 200 years ago Chinese pigs were imported into Europe to improve local European pigs. Commercial European domesticated pigs are genetically more diverse than European wild boars, although historically the latter represents the source population for domestication. In this study we examine the cause of the higher diversity within the genomes of European commercial pigs compared to their wild ancestors by testing two different hypotheses. In the first hypothesis we consider that European commercial pigs are a mix of different European wild populations as a result of movement throughout Europe, hereby acquiring haplotypes from all over the European continent. As an alternative hypothesis, we examine whether the introgression of Asian haplotypes into European breeds during the Industrial Revolution caused the observed increase in diversity. By using re-sequence data for chromosome 1 of 136 pigs and wild boars, we show that an Asian introgression of about 20% into the genome of European commercial pigs explains the majority of the increase in genetic diversity. These findings confirm that the Asian hybridization, that was used to improve production traits of local breeds, left its signature in the genome of the commercial pigs we know today. PMID:25601878
Parson, Walther; Strobl, Christina; Huber, Gabriela; Zimmermann, Bettina; Gomes, Sibylle M.; Souto, Luis; Fendt, Liane; Delport, Rhena; Langit, Reina; Wootton, Sharon; Lagacé, Robert; Irwin, Jodi
2013-01-01
Insights into the human mitochondrial phylogeny have been primarily achieved by sequencing full mitochondrial genomes (mtGenomes). In forensic genetics (partial) mtGenome information can be used to assign haplotypes to their phylogenetic backgrounds, which may, in turn, have characteristic geographic distributions that would offer useful information in a forensic case. In addition and perhaps even more relevant in the forensic context, haplogroup-specific patterns of mutations form the basis for quality control of mtDNA sequences. The current method for establishing (partial) mtDNA haplotypes is Sanger-type sequencing (STS), which is laborious, time-consuming, and expensive. With the emergence of Next Generation Sequencing (NGS) technologies, the body of available mtDNA data can potentially be extended much more quickly and cost-efficiently. Customized chemistries, laboratory workflows and data analysis packages could support the community and increase the utility of mtDNA analysis in forensics. We have evaluated the performance of mtGenome sequencing using the Personal Genome Machine (PGM) and compared the resulting haplotypes directly with conventional Sanger-type sequencing. A total of 64 mtGenomes (>1 million bases) were established that yielded high concordance with the corresponding STS haplotypes (<0.02% differences). About two-thirds of the differences were observed in or around homopolymeric sequence stretches. In addition, the sequence alignment algorithm employed to align NGS reads played a significant role in the analysis of the data and the resulting mtDNA haplotypes. Further development of alignment software would be desirable to facilitate the application of NGS in mtDNA forensic genetics. PMID:23948325
Haplotype-based approach to known MS-associated regions increases the amount of explained risk
Khankhanian, Pouya; Gourraud, Pierre-Antoine; Lizee, Antoine; Goodin, Douglas S
2015-01-01
Genome-wide association studies (GWAS), using single nucleotide polymorphisms (SNPs), have yielded 110 non-human leucocyte antigen genomic regions that are associated with multiple sclerosis (MS). Despite this large number of associations, however, only 28% of MS-heritability can currently be explained. Here we compare the use of multi-SNP-haplotypes to the use of single-SNPs as alternative methods to describe MS genetic risk. SNP-haplotypes (of various lengths from 1 up to 15 contiguous SNPs) were constructed at each of the 110 previously identified, MS-associated, genomic regions. Even after correcting for the larger number of statistical comparisons made when using the haplotype-method, in 32 of the regions, the SNP-haplotype based model was markedly more significant than the single-SNP based model. By contrast, in no region was the single-SNP based model similarly more significant than the SNP-haplotype based model. Moreover, when we included the 932 MS-associated SNP-haplotypes (that we identified from 102 regions) as independent variables into a logistic linear model, the amount of MS-heritability, as assessed by Nagelkerke's R-squared, was 38%, which was considerably better than 29%, which was obtained by using only single-SNPs. This study demonstrates that SNP-haplotypes can be used to fine-map the genetic associations within regions of interest previously identified by single-SNP GWAS. Moreover, the amount of the MS genetic risk explained by the SNP-haplotype associations in the 110 MS-associated genomic regions was considerably greater when using SNP-haplotypes than when using single-SNPs. Also, the use of SNP-haplotypes can lead to the discovery of new regions of interest, which have not been identified by a single-SNP GWAS. PMID:26185143
Genetic Competence Drives Genome Diversity in Bacillus subtilis
Chevreux, Bastien; Serra, Cláudia R; Schyns, Ghislain; Henriques, Adriano O
2018-01-01
Abstract Prokaryote genomes are the result of a dynamic flux of genes, with increases achieved via horizontal gene transfer and reductions occurring through gene loss. The ecological and selective forces that drive this genomic flexibility vary across species. Bacillus subtilis is a naturally competent bacterium that occupies various environments, including plant-associated, soil, and marine niches, and the gut of both invertebrates and vertebrates. Here, we quantify the genomic diversity of B. subtilis and infer the genome dynamics that explain the high genetic and phenotypic diversity observed. Phylogenomic and comparative genomic analyses of 42 B. subtilis genomes uncover a remarkable genome diversity that translates into a core genome of 1,659 genes and an asymptotic pangenome growth rate of 57 new genes per new genome added. This diversity is due to a large proportion of low-frequency genes that are acquired from closely related species. We find no gene-loss bias among wild isolates, which explains why the cloud genome, 43% of the species pangenome, represents only a small proportion of each genome. We show that B. subtilis can acquire xenologous copies of core genes that propagate laterally among strains within a niche. While not excluding the contributions of other mechanisms, our results strongly suggest a process of gene acquisition that is largely driven by competence, where the long-term maintenance of acquired genes depends on local and global fitness effects. This competence-driven genomic diversity provides B. subtilis with its generalist character, enabling it to occupy a wide range of ecological niches and cycle through them. PMID:29272410
HERC1 polymorphisms: population-specific variations in haplotype composition.
Yuasa, Isao; Umetsu, Kazuo; Nishimukai, Hiroaki; Fukumori, Yasuo; Harihara, Shinji; Saitou, Naruya; Jin, Feng; Chattopadhyay, Prasanta K; Henke, Lotte; Henke, Jürgen
2009-08-01
Human HERC1 is one of six HERC proteins and may play an important role in intracellular membrane trafficking. The human HERC1 gene is suggested to have been affected by local positive selection. To assess the global frequency distributions of coding and non-coding single nucleotide polymorphisms (SNPs) in the HERC1 gene, we developed a new simultaneous genotyping method for four SNPs, and applied this method to investigate 1213 individuals from 12 global populations. The results confirmed remarked differences in the allele and haplotype frequencies between East Asian and non-East Asian populations. One of the three common haplotypes observed was found to be characteristic of East Asians, who showed a relatively uniform distribution of haplotypes. Information on haplotypes would be useful for testing the function of polymorphisms in the HERC1 gene. This is the first study to investigate the distribution of HERC1 polymorphisms in various populations. (c) 2009 John Wiley & Sons, Ltd.
de Vries, Ronald P; Riley, Robert; Wiebenga, Ad; Aguilar-Osorio, Guillermo; Amillis, Sotiris; Uchima, Cristiane Akemi; Anderluh, Gregor; Asadollahi, Mojtaba; Askin, Marion; Barry, Kerrie; Battaglia, Evy; Bayram, Özgür; Benocci, Tiziano; Braus-Stromeyer, Susanna A; Caldana, Camila; Cánovas, David; Cerqueira, Gustavo C; Chen, Fusheng; Chen, Wanping; Choi, Cindy; Clum, Alicia; Dos Santos, Renato Augusto Corrêa; Damásio, André Ricardo de Lima; Diallinas, George; Emri, Tamás; Fekete, Erzsébet; Flipphi, Michel; Freyberg, Susanne; Gallo, Antonia; Gournas, Christos; Habgood, Rob; Hainaut, Matthieu; Harispe, María Laura; Henrissat, Bernard; Hildén, Kristiina S; Hope, Ryan; Hossain, Abeer; Karabika, Eugenia; Karaffa, Levente; Karányi, Zsolt; Kraševec, Nada; Kuo, Alan; Kusch, Harald; LaButti, Kurt; Lagendijk, Ellen L; Lapidus, Alla; Levasseur, Anthony; Lindquist, Erika; Lipzen, Anna; Logrieco, Antonio F; MacCabe, Andrew; Mäkelä, Miia R; Malavazi, Iran; Melin, Petter; Meyer, Vera; Mielnichuk, Natalia; Miskei, Márton; Molnár, Ákos P; Mulé, Giuseppina; Ngan, Chew Yee; Orejas, Margarita; Orosz, Erzsébet; Ouedraogo, Jean Paul; Overkamp, Karin M; Park, Hee-Soo; Perrone, Giancarlo; Piumi, Francois; Punt, Peter J; Ram, Arthur F J; Ramón, Ana; Rauscher, Stefan; Record, Eric; Riaño-Pachón, Diego Mauricio; Robert, Vincent; Röhrig, Julian; Ruller, Roberto; Salamov, Asaf; Salih, Nadhira S; Samson, Rob A; Sándor, Erzsébet; Sanguinetti, Manuel; Schütze, Tabea; Sepčić, Kristina; Shelest, Ekaterina; Sherlock, Gavin; Sophianopoulou, Vicky; Squina, Fabio M; Sun, Hui; Susca, Antonia; Todd, Richard B; Tsang, Adrian; Unkles, Shiela E; van de Wiele, Nathalie; van Rossen-Uffink, Diana; Oliveira, Juliana Velasco de Castro; Vesth, Tammi C; Visser, Jaap; Yu, Jae-Hyuk; Zhou, Miaomiao; Andersen, Mikael R; Archer, David B; Baker, Scott E; Benoit, Isabelle; Brakhage, Axel A; Braus, Gerhard H; Fischer, Reinhard; Frisvad, Jens C; Goldman, Gustavo H; Houbraken, Jos; Oakley, Berl; Pócsi, István; Scazzocchio, Claudio; Seiboth, Bernhard; vanKuyk, Patricia A; Wortman, Jennifer; Dyer, Paul S; Grigoriev, Igor V
2017-02-14
The fungal genus Aspergillus is of critical importance to humankind. Species include those with industrial applications, important pathogens of humans, animals and crops, a source of potent carcinogenic contaminants of food, and an important genetic model. The genome sequences of eight aspergilli have already been explored to investigate aspects of fungal biology, raising questions about evolution and specialization within this genus. We have generated genome sequences for ten novel, highly diverse Aspergillus species and compared these in detail to sister and more distant genera. Comparative studies of key aspects of fungal biology, including primary and secondary metabolism, stress response, biomass degradation, and signal transduction, revealed both conservation and diversity among the species. Observed genomic differences were validated with experimental studies. This revealed several highlights, such as the potential for sex in asexual species, organic acid production genes being a key feature of black aspergilli, alternative approaches for degrading plant biomass, and indications for the genetic basis of stress response. A genome-wide phylogenetic analysis demonstrated in detail the relationship of the newly genome sequenced species with other aspergilli. Many aspects of biological differences between fungal species cannot be explained by current knowledge obtained from genome sequences. The comparative genomics and experimental study, presented here, allows for the first time a genus-wide view of the biological diversity of the aspergilli and in many, but not all, cases linked genome differences to phenotype. Insights gained could be exploited for biotechnological and medical applications of fungi.
An unusual haplotype structure on human chromosome 8p23 derived from the inversion polymorphism.
Deng, Libin; Zhang, Yuezheng; Kang, Jian; Liu, Tao; Zhao, Hongbin; Gao, Yang; Li, Chaohua; Pan, Hao; Tang, Xiaoli; Wang, Dunmei; Niu, Tianhua; Yang, Huanming; Zeng, Changqing
2008-10-01
Chromosomal inversion is an important type of genomic variations involved in both evolution and disease pathogenesis. Here, we describe the refined genetic structure of a 3.8-Mb inversion polymorphism at chromosome 8p23. Using HapMap data of 1,073 SNPs generated from 209 unrelated samples from CEPH-Utah residents with ancestry from northern and western Europe (CEU); Yoruba in Ibadan, Nigeria (YRI); and Asian (ASN) samples, which were comprised of Han Chinese from Beijing, China (CHB) and Japanese from Tokyo, Japan (JPT)-we successfully deduced the inversion orientations of all their 418 haplotypes. In particular, distinct haplotype subgroups were identified based on principal component analysis (PCA). Such genetic substructures were consistent with clustering patterns based on neighbor-joining tree reconstruction, which revealed a total of four haplotype clades across all samples. Metaphase fluorescence in situ hybridization (FISH) in a subset of 10 HapMap samples verified their inversion orientations predicted by PCA or phylogenetic tree reconstruction. Positioning of the outgroup haplotype within one of YRI clades suggested that Human NCBI Build 36-inverted order is most likely the ancestral orientation. Furthermore, the population differentiation test and the relative extended haplotype homozygosity (REHH) analysis in this region discovered multiple selection signals, also in a population-specific manner. A positive selection signal was detected at XKR6 in the ASN population. These results revealed the correlation of inversion polymorphisms to population-specific genetic structures, and various selection patterns as possible mechanisms for the maintenance of a large chromosomal rearrangement at 8p23 region during evolution. In addition, our study also showed that haplotype-based clustering methods, such as PCA, can be applied in scanning for cryptic inversion polymorphisms at a genome-wide scale.
Reduced representation approaches to interrogate genome diversity in large repetitive plant genomes.
Hirsch, Cory D; Evans, Joseph; Buell, C Robin; Hirsch, Candice N
2014-07-01
Technology and software improvements in the last decade now provide methodologies to access the genome sequence of not only a single accession, but also multiple accessions of plant species. This provides a means to interrogate species diversity at the genome level. Ample diversity among accessions in a collection of species can be found, including single-nucleotide polymorphisms, insertions and deletions, copy number variation and presence/absence variation. For species with small, non-repetitive rich genomes, re-sequencing of query accessions is robust, highly informative, and economically feasible. However, for species with moderate to large sized repetitive-rich genomes, technical and economic barriers prevent en masse genome re-sequencing of accessions. Multiple approaches to access a focused subset of loci in species with larger genomes have been developed, including reduced representation sequencing, exome capture and transcriptome sequencing. Collectively, these approaches have enabled interrogation of diversity on a genome scale for large plant genomes, including crop species important to worldwide food security. © The Author 2014. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Chang, Yuet Meng; Perumal, Revathi; Keat, Phoon Yoong; Kuehn, Daniel L C
2007-03-22
We have analyzed 16 Y-STR loci (DYS456, DYS389I, DYS390, DYS389II, DYS458, DYS19, DYS385a/b, DYS393, DYS391, DYS439, DYS635 or Y-GATA C4, DYS392, Y-GATA H4, DYS437, DYS438 and DYS448) from the non-recombining region of the human Y-chromosome in 980 male individuals from three main ethnic populations in Malaysia (Malay, Chinese, Indian) using the AmpFlSTR((R)) Y-filertrade mark (Applied Biosystems, Foster City, CA). The observed 17-loci haplotypes and the individual allele frequencies for each locus were estimated, whilst the locus diversity, haplotype diversity and discrimination capacity were calculated in the three ethnic populations. Analysis of molecular variance indicated that 88.7% of the haplotypic variation is found within population and 11.3% is between populations (fixation index F(ST)=0.113, p=0.000). This study has revealed Y-chromosomes with null alleles at several Y-loci, namely DYS458, DYS392, DYS389I, DYS389II, DYS439, DYS448 and Y-GATA H4; and several occurrences of duplications at the highly polymorphic DYS385 loci. Some of these deleted loci were in regions of the Y(q) arm that have been implicated in the occurrence of male infertility.
Yuan, Bo; Liu, Pengfei; Gupta, Aditya; Beck, Christine R.; Tejomurtula, Anusha; Campbell, Ian M.; Gambin, Tomasz; Simmons, Alexandra D.; Withers, Marjorie A.; Harris, R. Alan; Rogers, Jeffrey; Schwartz, David C.; Lupski, James R.
2015-01-01
Many loci in the human genome harbor complex genomic structures that can result in susceptibility to genomic rearrangements leading to various genomic disorders. Nephronophthisis 1 (NPHP1, MIM# 256100) is an autosomal recessive disorder that can be caused by defects of NPHP1; the gene maps within the human 2q13 region where low copy repeats (LCRs) are abundant. Loss of function of NPHP1 is responsible for approximately 85% of the NPHP1 cases—about 80% of such individuals carry a large recurrent homozygous NPHP1 deletion that occurs via nonallelic homologous recombination (NAHR) between two flanking directly oriented ~45 kb LCRs. Published data revealed a non-pathogenic inversion polymorphism involving the NPHP1 gene flanked by two inverted ~358 kb LCRs. Using optical mapping and array-comparative genomic hybridization, we identified three potential novel structural variant (SV) haplotypes at the NPHP1 locus that may protect a haploid genome from the NPHP1 deletion. Inter-species comparative genomic analyses among primate genomes revealed massive genomic changes during evolution. The aggregated data suggest that dynamic genomic rearrangements occurred historically within the NPHP1 locus and generated SV haplotypes observed in the human population today, which may confer differential susceptibility to genomic instability and the NPHP1 deletion within a personal genome. Our study documents diverse SV haplotypes at a complex LCR-laden human genomic region. Comparative analyses provide a model for how this complex region arose during primate evolution, and studies among humans suggest that intra-species polymorphism may potentially modulate an individual’s susceptibility to acquiring disease-associated alleles. PMID:26641089
Swine Leukocyte Antigen Diversity in Canadian Specific Pathogen-Free Yorkshire and Landrace Pigs
Gao, Caixia; Quan, Jinqiang; Jiang, Xinjie; Li, Changwen; Lu, Xiaoye; Chen, Hongyan
2017-01-01
The highly polymorphic swine major histocompatibility complex (MHC), termed swine leukocyte antigen (SLA), is associated with different levels of immunologic responses to infectious diseases, vaccines, and transplantation. Pig breeds with known SLA haplotypes are important genetic resources for biomedical research. Canadian Yorkshire and Landrace pigs represent the current specific pathogen-free (SPF) breeding stock maintained in the isolation environment at the Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences. In this study, we identified 61 alleles at five polymorphic SLA loci (SLA-1, SLA-2, SLA-3, DRB1, and DQB1) representing 17 class I haplotypes and 11 class II haplotypes using reverse transcription-polymerase chain reaction (RT-PCR) sequence-based typing and PCR-sequence specific primers methods in 367 Canadian SPF Yorkshire and Landrace pigs. The official designation of the alleles has been assigned by the SLA Nomenclature Committee of the International Society for Animal Genetics and released in updated Immuno Polymorphism Database-MHC SLA sequence database [Release 2.0.0.3 (2016-11-03)]. The submissions confirmed some unassigned alleles and standardized nomenclatures of many previously unconfirmed alleles in the GenBank database. Three class I haplotypes, Hp-37.0, 63.0, and 73.0, appeared to be novel and have not previously been reported in other pig populations. One crossover within the class I region and two between class I and class II regions were observed, resulting in three new recombinant haplotypes. The presence of the duplicated SLA-1 locus was confirmed in three class I haplotypes Hp-28.0, Hp-35.0, and Hp-63.0. Furthermore, we also analyzed the functional diversities of 19 identified frequent SLA class I molecules in this study and confirmed the existence of four supertypes using the MHCcluster method. These results will be useful for studying the adaptive immune response and immunological phenotypic differences in
Arrieta-Bolaños, E; Madrigal-Sánchez, J J; Stein, J E; Órlich-Pérez, P; Moreira-Espinoza, M J; Paredes-Carias, E; Vanegas-Padilla, Y; Salazar-Sánchez, L; Madrigal, J A; Marsh, S G E; Shaw, B E
2018-06-01
The HLA system shows the most extensive polymorphism in the human genome. Allelic and haplotypic frequencies of HLA genes vary dramatically across human populations. Due to a complex history of migration, populations in Latin America show a broad variety of admixture proportions, usually varying not only between countries, but also within countries. Knowledge of HLA allele and haplotype frequencies is essential for medical fields such as transplantation, but also serves as a means to assess genetic diversity and ancestry in human populations. Here, we have determined high-resolution HLA-A, -B, -C, and -DRB1 allele and haplotype frequencies in a sample of 713 healthy subjects from three Mestizo populations, one population of African descent, and Amerindians of five different groups from Costa Rica and Nicaragua and compared their profiles to a large set of indigenous populations from Iberia, Sub-Saharan Africa, and the Americas. Our results show a great degree of allelic and haplotypic diversity within and across these populations, with most extended haplotypes being private. Mestizo populations show alleles and haplotypes of putative European, Amerindian, and Sub-Saharan African origin, albeit with differential proportions. Despite some degree of gene flow, Amerindians and Afro-descendants show great similarity to other Amerindian and West African populations, respectively. This is the first comprehensive study reporting high-resolution HLA diversity in Central America, and its results will shed light into the genetic history of this region while also supporting the development of medical programs for organ and stem cell transplantation. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Genetic diversity of the human immunoglobulin heavy chain VH region.
Li, Honghua; Cui, Xiangfeng; Pramanik, Sreemanta; Chimge, Nyam-Osor
2002-12-01
The human immunoglobulin heavy chain VH region is one of the most complex regions in the human genome. The high level of diversity of this region has been shown by a number of studies. However, because of the limitations of the conventional experimental methods, it has been difficult to learn the extent of the diversity and the underlying mechanisms. This review describes a number of new genetic approaches developed in the authors' laboratory. By using these approaches, significant progress has been made in assigning different VH sequences to their respective loci, in learning the diversity of gene segment number and composition among the VH haplotypes, and in learning VH gene segment organization in individual haplotypes. Information obtained toward this direction could help in understanding the mechanisms underlying VH region diversity and the biological impact of the VH region diversity.
Genomic and genetic analyses of diversity and plant interactions of Pseudomonas fluorescens
Silby, Mark W; Cerdeño-Tárraga, Ana M; Vernikos, Georgios S; Giddens, Stephen R; Jackson, Robert W; Preston, Gail M; Zhang, Xue-Xian; Moon, Christina D; Gehrig, Stefanie M; Godfrey, Scott AC; Knight, Christopher G; Malone, Jacob G; Robinson, Zena; Spiers, Andrew J; Harris, Simon; Challis, Gregory L; Yaxley, Alice M; Harris, David; Seeger, Kathy; Murphy, Lee; Rutter, Simon; Squares, Rob; Quail, Michael A; Saunders, Elizabeth; Mavromatis, Konstantinos; Brettin, Thomas S; Bentley, Stephen D; Hothersall, Joanne; Stephens, Elton; Thomas, Christopher M; Parkhill, Julian; Levy, Stuart B; Rainey, Paul B; Thomson, Nicholas R
2009-01-01
Background Pseudomonas fluorescens are common soil bacteria that can improve plant health through nutrient cycling, pathogen antagonism and induction of plant defenses. The genome sequences of strains SBW25 and Pf0-1 were determined and compared to each other and with P. fluorescens Pf-5. A functional genomic in vivo expression technology (IVET) screen provided insight into genes used by P. fluorescens in its natural environment and an improved understanding of the ecological significance of diversity within this species. Results Comparisons of three P. fluorescens genomes (SBW25, Pf0-1, Pf-5) revealed considerable divergence: 61% of genes are shared, the majority located near the replication origin. Phylogenetic and average amino acid identity analyses showed a low overall relationship. A functional screen of SBW25 defined 125 plant-induced genes including a range of functions specific to the plant environment. Orthologues of 83 of these exist in Pf0-1 and Pf-5, with 73 shared by both strains. The P. fluorescens genomes carry numerous complex repetitive DNA sequences, some resembling Miniature Inverted-repeat Transposable Elements (MITEs). In SBW25, repeat density and distribution revealed 'repeat deserts' lacking repeats, covering approximately 40% of the genome. Conclusions P. fluorescens genomes are highly diverse. Strain-specific regions around the replication terminus suggest genome compartmentalization. The genomic heterogeneity among the three strains is reminiscent of a species complex rather than a single species. That 42% of plant-inducible genes were not shared by all strains reinforces this conclusion and shows that ecological success requires specialized and core functions. The diversity also indicates the significant size of genetic information within the Pseudomonas pan genome. PMID:19432983
Nimmakayala, Padma; Abburi, Venkata L.; Saminathan, Thangasamy; Alaparthi, Suresh B.; Almeida, Aldo; Davenport, Brittany; Nadimi, Marjan; Davidson, Joshua; Tonapi, Krittika; Yadav, Lav; Malkaram, Sridhar; Vajja, Gopinath; Hankins, Gerald; Harris, Robert; Park, Minkyu; Choi, Doil; Stommel, John; Reddy, Umesh K.
2016-01-01
Accumulated capsaicinoid content and increased fruit size are traits resulting from Capsicum annuum domestication. In this study, we used a diverse collection of C. annuum to generate 66,960 SNPs using genotyping by sequencing. The study identified 1189 haplotypes containing 3413 SNPs. Length of individual linkage disequilibrium (LD) blocks varied along chromosomes, with regions of high and low LD interspersed with an average LD of 139 kb. Principal component analysis (PCA), Bayesian model based population structure analysis and an Euclidean tree built based on identity by state (IBS) indices revealed that the clustering pattern of diverse accessions are in agreement with capsaicin content (CA) and fruit weight (FW) classifications indicating the importance of these traits in shaping modern pepper genome. PCA and IBS were used in a mixed linear model of capsaicin and dihydrocapsaicin content and fruit weight to reduce spurious associations because of confounding effects of subpopulations in genome-wide association study (GWAS). Our GWAS results showed SNPs in Ankyrin-like protein, IKI3 family protein, ABC transporter G family and pentatricopeptide repeat protein are the major markers for capsaicinoids and of 16 SNPs strongly associated with FW in both years of the study, 7 are located in known fruit weight controlling genes. PMID:27901114
Nimmakayala, Padma; Abburi, Venkata L; Saminathan, Thangasamy; Alaparthi, Suresh B; Almeida, Aldo; Davenport, Brittany; Nadimi, Marjan; Davidson, Joshua; Tonapi, Krittika; Yadav, Lav; Malkaram, Sridhar; Vajja, Gopinath; Hankins, Gerald; Harris, Robert; Park, Minkyu; Choi, Doil; Stommel, John; Reddy, Umesh K
2016-11-30
Accumulated capsaicinoid content and increased fruit size are traits resulting from Capsicum annuum domestication. In this study, we used a diverse collection of C. annuum to generate 66,960 SNPs using genotyping by sequencing. The study identified 1189 haplotypes containing 3413 SNPs. Length of individual linkage disequilibrium (LD) blocks varied along chromosomes, with regions of high and low LD interspersed with an average LD of 139 kb. Principal component analysis (PCA), Bayesian model based population structure analysis and an Euclidean tree built based on identity by state (IBS) indices revealed that the clustering pattern of diverse accessions are in agreement with capsaicin content (CA) and fruit weight (FW) classifications indicating the importance of these traits in shaping modern pepper genome. PCA and IBS were used in a mixed linear model of capsaicin and dihydrocapsaicin content and fruit weight to reduce spurious associations because of confounding effects of subpopulations in genome-wide association study (GWAS). Our GWAS results showed SNPs in Ankyrin-like protein, IKI3 family protein, ABC transporter G family and pentatricopeptide repeat protein are the major markers for capsaicinoids and of 16 SNPs strongly associated with FW in both years of the study, 7 are located in known fruit weight controlling genes.
Jordan, Rebecca; Dillon, Shannon K; Prober, Suzanne M; Hoffmann, Ary A
2016-12-01
In order to contribute to evolutionary resilience and adaptive potential in highly modified landscapes, revegetated areas should ideally reflect levels of genetic diversity within and across natural stands. Landscape genomic analyses enable such diversity patterns to be characterized at genome and chromosomal levels. Landscape-wide patterns of genomic diversity were assessed in Eucalyptus microcarpa, a dominant tree species widely used in revegetation in Southeastern Australia. Trees from small and large patches within large remnants, small isolated remnants and revegetation sites were assessed across the now highly fragmented distribution of this species using the DArTseq genomic approach. Genomic diversity was similar within all three types of remnant patches analysed, although often significantly but only slightly lower in revegetation sites compared with natural remnants. Differences in diversity between stand types varied across chromosomes. Genomic differentiation was higher between small, isolated remnants, and among revegetated sites compared with natural stands. We conclude that small remnants and revegetated sites of our E. microcarpa samples largely but not completely capture patterns in genomic diversity across the landscape. Genomic approaches provide a powerful tool for assessing restoration efforts across the landscape. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.
Genomic patterns of species diversity and divergence in Eucalyptus.
Hudson, Corey J; Freeman, Jules S; Myburg, Alexander A; Potts, Brad M; Vaillancourt, René E
2015-06-01
We examined genome-wide patterns of DNA sequence diversity and divergence among six species of the important tree genus Eucalyptus and investigated their relationship with genomic architecture. Using c. 90 range-wide individuals of each Eucalyptus species (E. grandis, E. urophylla, E. globulus, E. nitens, E. dunnii and E. camaldulensis), genetic diversity and divergence were estimated from 2840 polymorphic diversity arrays technology markers covering the 11 chromosomes. Species differentiating markers (SDMs) identified in each of 15 pairwise species comparisons, along with species diversity (HHW ) and divergence (FST ), were projected onto the E. grandis reference genome. Across all species comparisons, SDMs totalled 1.1-5.3% of markers and were widely distributed throughout the genome. Marker divergence (FST and SDMs) and diversity differed among and within chromosomes. Patterns of diversity and divergence were broadly conserved across species and significantly associated with genomic features, including the proximity of markers to genes, the relative number of clusters of tandem duplications, and gene density within or among chromosomes. These results suggest that genomic architecture influences patterns of species diversity and divergence in the genus. This influence is evident across the six species, encompassing diverse phylogenetic lineages, geography and ecology. © 2015 University of Tasmania New Phytologist © 2015 New Phytologist Trust.
Extended diversity analysis of cultivated grapevine Vitis vinifera with 10K genome-wide SNPs.
Laucou, Valérie; Launay, Amandine; Bacilieri, Roberto; Lacombe, Thierry; Adam-Blondon, Anne-Françoise; Bérard, Aurélie; Chauveau, Aurélie; de Andrés, Maria Teresa; Hausmann, Ludger; Ibáñez, Javier; Le Paslier, Marie-Christine; Maghradze, David; Martinez-Zapater, José Miguel; Maul, Erika; Ponnaiah, Maharajah; Töpfer, Reinhard; Péros, Jean-Pierre; Boursiquot, Jean-Michel
2018-01-01
Grapevine is a very important crop species that is mainly cultivated worldwide for fruits, wine and juice. Identification of the genetic bases of performance traits through association mapping studies requires a precise knowledge of the available diversity and how this diversity is structured and varies across the whole genome. An 18k SNP genotyping array was evaluated on a panel of Vitis vinifera cultivars and we obtained a data set with no missing values for a total of 10207 SNPs and 783 different genotypes. The average inter-SNP spacing was ~47 kbp, the mean minor allele frequency (MAF) was 0.23 and the genetic diversity in the sample was high (He = 0.32). Fourteen SNPs, chosen from those with the highest MAF values, were sufficient to identify each genotype in the sample. Parentage analysis revealed 118 full parentages and 490 parent-offspring duos, thus confirming the close pedigree relationships within the cultivated grapevine. Structure analyses also confirmed the main divisions due to an eastern-western gradient and human usage (table vs. wine). Using a multivariate approach, we refined the structure and identified a total of eight clusters. Both the genetic diversity (He, 0.26-0.32) and linkage disequilibrium (LD, 28.8-58.2 kbp) varied between clusters. Despite the short span LD, we also identified some non-recombining haplotype blocks that may complicate association mapping. Finally, we performed a genome-wide association study that confirmed previous works and also identified new regions for important performance traits such as acidity. Taken together, all the results contribute to a better knowledge of the genetics of the cultivated grapevine.
Extended diversity analysis of cultivated grapevine Vitis vinifera with 10K genome-wide SNPs
Launay, Amandine; Bacilieri, Roberto; Lacombe, Thierry; Adam-Blondon, Anne-Françoise; Bérard, Aurélie; Chauveau, Aurélie; de Andrés, Maria Teresa; Maghradze, David; Maul, Erika; Ponnaiah, Maharajah; Töpfer, Reinhard; Péros, Jean-Pierre; Boursiquot, Jean-Michel
2018-01-01
Grapevine is a very important crop species that is mainly cultivated worldwide for fruits, wine and juice. Identification of the genetic bases of performance traits through association mapping studies requires a precise knowledge of the available diversity and how this diversity is structured and varies across the whole genome. An 18k SNP genotyping array was evaluated on a panel of Vitis vinifera cultivars and we obtained a data set with no missing values for a total of 10207 SNPs and 783 different genotypes. The average inter-SNP spacing was ~47 kbp, the mean minor allele frequency (MAF) was 0.23 and the genetic diversity in the sample was high (He = 0.32). Fourteen SNPs, chosen from those with the highest MAF values, were sufficient to identify each genotype in the sample. Parentage analysis revealed 118 full parentages and 490 parent-offspring duos, thus confirming the close pedigree relationships within the cultivated grapevine. Structure analyses also confirmed the main divisions due to an eastern-western gradient and human usage (table vs. wine). Using a multivariate approach, we refined the structure and identified a total of eight clusters. Both the genetic diversity (He, 0.26–0.32) and linkage disequilibrium (LD, 28.8–58.2 kbp) varied between clusters. Despite the short span LD, we also identified some non-recombining haplotype blocks that may complicate association mapping. Finally, we performed a genome-wide association study that confirmed previous works and also identified new regions for important performance traits such as acidity. Taken together, all the results contribute to a better knowledge of the genetics of the cultivated grapevine. PMID:29420602
Single haplotype assembly of the human genome from a hydatidiform mole
Steinberg, Karyn Meltz; Schneider, Valerie A.; Graves-Lindsay, Tina A.; Fulton, Robert S.; Agarwala, Richa; Huddleston, John; Shiryev, Sergey A.; Morgulis, Aleksandr; Surti, Urvashi; Warren, Wesley C.; Church, Deanna M.; Eichler, Evan E.; Wilson, Richard K.
2014-01-01
A complete reference assembly is essential for accurately interpreting individual genomes and associating variation with phenotypes. While the current human reference genome sequence is of very high quality, gaps and misassemblies remain due to biological and technical complexities. Large repetitive sequences and complex allelic diversity are the two main drivers of assembly error. Although increasing the length of sequence reads and library fragments can improve assembly, even the longest available reads do not resolve all regions. In order to overcome the issue of allelic diversity, we used genomic DNA from an essentially haploid hydatidiform mole, CHM1. We utilized several resources from this DNA including a set of end-sequenced and indexed BAC clones and 100× Illumina whole-genome shotgun (WGS) sequence coverage. We used the WGS sequence and the GRCh37 reference assembly to create an assembly of the CHM1 genome. We subsequently incorporated 382 finished BAC clone sequences to generate a draft assembly, CHM1_1.1 (NCBI AssemblyDB GCA_000306695.2). Analysis of gene, repetitive element, and segmental duplication content show this assembly to be of excellent quality and contiguity. However, comparison to assembly-independent resources, such as BAC clone end sequences and PacBio long reads, indicate misassembled regions. Most of these regions are enriched for structural variation and segmental duplication, and can be resolved in the future. This publicly available assembly will be integrated into the Genome Reference Consortium curation framework for further improvement, with the ultimate goal being a completely finished gap-free assembly. PMID:25373144
Guo, Shicheng; Diep, Dinh; Plongthongkum, Nongluk; Fung, Ho-Lim; Zhang, Kang; Zhang, Kun
2017-04-01
Adjacent CpG sites in mammalian genomes can be co-methylated owing to the processivity of methyltransferases or demethylases, yet discordant methylation patterns have also been observed, which are related to stochastic or uncoordinated molecular processes. We focused on a systematic search and investigation of regions in the full human genome that show highly coordinated methylation. We defined 147,888 blocks of tightly coupled CpG sites, called methylation haplotype blocks, after analysis of 61 whole-genome bisulfite sequencing data sets and validation with 101 reduced-representation bisulfite sequencing data sets and 637 methylation array data sets. Using a metric called methylation haplotype load, we performed tissue-specific methylation analysis at the block level. Subsets of informative blocks were further identified for deconvolution of heterogeneous samples. Finally, using methylation haplotypes we demonstrated quantitative estimation of tumor load and tissue-of-origin mapping in the circulating cell-free DNA of 59 patients with lung or colorectal cancer.
Genetic diversity and paternal origin of domestic donkeys.
Han, H; Chen, N; Jordana, J; Li, C; Sun, T; Xia, X; Zhao, X; Ji, C; Shen, S; Yu, J; Ainhoa, F; Chen, H; Lei, C; Dang, R
2017-12-01
Numerous studies have been conducted to investigate genetic diversity, origins and domestication of donkey using autosomal microsatellites and the mitochondrial genome, whereas the male-specific region of the Y chromosome of modern donkeys is largely uncharacterized. In the current study, 14 published equine Y chromosome-specific microsatellites (Y-STR) were investigated in 395 male donkey samples from China, Egypt, Spain and Peru using fluorescent labeled microsatellite markers. The results showed that seven Y-STRs-EcaYP9, EcaYM2, EcaYE2, EcaYE3, EcaYNO1, EcaYNO2 and EcaYNO4-were male specific and polymorphic, showing two to eight alleles in the donkeys studied. A total of 21 haplotypes corresponding to three haplogroups were identified, indicating three independent patrilines in domestic donkey. These markers are useful for the study the Y-chromosome diversity and population genetics of donkeys in Africa, Europe, South America and China. © 2017 Stichting International Foundation for Animal Genetics.
Chang, Yuet Meng; Swaran, Yuvaneswari; Phoon, Yoong Keat; Sothirasan, Kavin; Sim, Hang Thiew; Lim, Kong Boon; Kuehn, Daniel
2009-06-01
17 Y-STRs (DYS456, DYS389I, DYS390, DYS389II, DYS458, DYS19, DYS385a/b, DYS393, DYS391, DYS439, DYS635 or Y-GATA C4, DYS392, Y-GATA H4, DYS437, DYS438 and DYS448) have been analyzed in 320 male individuals from Sarawak, an eastern state of Malaysia on the Borneo island using the AmpFlSTR Y-filer (Applied Biosystems, Foster City, CA). These individuals were from three indigenous ethnic groups in Sarawak comprising of 103 Ibans, 113 Bidayuhs and 104 Melanaus. The observed 17-loci haplotypes and the individual allele frequencies for each locus were estimated, whilst the locus diversity, haplotype diversity and discrimination capacity were calculated in the three groups. Analysis of molecular variance (AMOVA) indicated that 87.6% of the haplotypic variation was found within population and 12.4% between populations (fixation index F(ST)=0.124, p=0.000). This study has revealed that the indigenous populations in Sarawak are distinctly different to each other, and to the three major ethnic groups in Malaysia (Malays, Chinese and Indians), with the Melanaus having a strikingly high degree of shared haplotypes within. There are rare unusual variants and microvariants that were not present in Malaysian Malay, Chinese or Indian groups. In addition, occurrences of DYS385 duplications which were only noticeably present in Chinese group previously was also observed in the Iban group whilst null alleles were detected at several Y-loci (namely DYS19, DYS392, DYS389II and DYS448) in the Iban and Melanau groups.
Novel Harmful Recessive Haplotypes Identified for Fertility Traits in Nordic Holstein Cattle
Sahana, Goutam; Nielsen, Ulrik Sander; Aamand, Gert Pedersen; Lund, Mogens Sandø; Guldbrandtsen, Bernt
2013-01-01
Using genomic data, lethal recessives may be discovered from haplotypes that are common in the population but never occur in the homozygote state in live animals. This approach only requires genotype data from phenotypically normal (i.e. live) individuals and not from the affected embryos that die. A total of 7,937 Nordic Holstein animals were genotyped with BovineSNP50 BeadChip and haplotypes including 25 consecutive markers were constructed and tested for absence of homozygotes states. We have identified 17 homozygote deficient haplotypes which could be loosely clustered into eight genomic regions harboring possible recessive lethal alleles. Effects of the identified haplotypes were estimated on two fertility traits: non-return rates and calving interval. Out of the eight identified genomic regions, six regions were confirmed as having an effect on fertility. The information can be used to avoid carrier-by-carrier mattings in practical animal breeding. Further, identification of causative genes/polymorphisms responsible for lethal effects will lead to accurate testing of the individuals carrying a lethal allele. PMID:24376603
Mitt, Mario; Kals, Mart; Pärn, Kalle; Gabriel, Stacey B; Lander, Eric S; Palotie, Aarno; Ripatti, Samuli; Morris, Andrew P; Metspalu, Andres; Esko, Tõnu; Mägi, Reedik; Palta, Priit
2017-06-01
Genetic imputation is a cost-efficient way to improve the power and resolution of genome-wide association (GWA) studies. Current publicly accessible imputation reference panels accurately predict genotypes for common variants with minor allele frequency (MAF)≥5% and low-frequency variants (0.5≤MAF<5%) across diverse populations, but the imputation of rare variation (MAF<0.5%) is still rather limited. In the current study, we evaluate imputation accuracy achieved with reference panels from diverse populations with a population-specific high-coverage (30 ×) whole-genome sequencing (WGS) based reference panel, comprising of 2244 Estonian individuals (0.25% of adult Estonians). Although the Estonian-specific panel contains fewer haplotypes and variants, the imputation confidence and accuracy of imputed low-frequency and rare variants was significantly higher. The results indicate the utility of population-specific reference panels for human genetic studies.
Das, Manuj K; Chetry, Sumi; Kalita, Mohan C; Dutta, Prafulla
2016-12-01
North-east region of India has consistent role in the spread of multi drug resistant Plasmodium (P.) falciparum to other parts of Southeast Asia. After rapid clinical treatment failure of Artemisinin based combination therapy-Sulphadoxine/Pyrimethamine (ACT-SP) chemoprophylaxis, Artemether-Lumefantrine (ACT-AL) combination therapy was introduced in the year 2012 in this region for the treatment of uncomplicated P. falciparum malaria. In a DNA sequencing based polymorphism analysis, seven codons of P. falciparum dihydropteroate synthetase ( Pf dhps) gene were screened in a total of 127 P. falciparum isolates collected from Assam, Arunachal Pradesh and Tripura of North-east India during the year 2014 and 2015 to document current sulfadoxine resistant haplotypes. Sequences were analyzed to rearrange both nucleotide and protein haplotypes. Molecular diversity indices were analyzed in DNA Sequence Polymorphism software (DnaSP) on the basis of Pf dhps gene sequences. Disappearance from selective neutrality was assessed based on the ratio of non-synonomous to synonomous nucleotide substitutions [dN/dS ratio]. Moreover, two-tailed Z test was performed in search of the significance for probability of rejecting null hypothesis of strict neutrality [dN = dS]. Presence of mutant P. falciparum multidrug resistance protein1 ( Pf mdr1) was also checked in those isolates that were present with new Pf dhps haplotypes. Phylogenetic relationship based on Pf dhps gene was reconstructed in Molecular Evolutionary Genetics Analysis (MEGA). Among eight different sulfadoxine resistant haplotypes found, IS GNG A haplotype was documented in a total of five isolates from Tripura with association of a new mutant M538 R allele. Sequence analysis of Pf mdr1 gene in these five isolates came to notice that not all but only one isolate was mutant at codon 86 (N86 Y ; Y YSND) in the multidrug resistance protein. Molecular diversity based on Pf dhps haplotypes revealed that P. falciparum
A functional haplotype of UBE2L3 confers risk for Systemic Lupus Erythematosus
Wang, Shaofeng; Adrianto, Indra; Wiley, Graham B.; Lessard, Christopher J.; Kelly, Jennifer A.; Adler, Adam J.; Glenn, Stuart B.; Williams, Adrienne H.; Ziegler, Julie T.; Comeau, Mary E.; Marion, Miranda C.; Wakeland, Benjamin E.; Liang, Chaoying; Kaufman, Kenneth M.; Guthridge, Joel M.; Alarcón-Riquelme, Marta E.; Alarcón, Graciela S.; Anaya, Juan-Manuel; Bae, Sang-Cheol; Kim, Jae-Hoon; Joo, Young Bin; Boackle, Susan A.; Brown, Elizabeth E.; Petri, Michelle A.; Ramsey-Goldman, Rosalind; Reveille, John D.; Vilá, Luis M.; Criswell, Lindsey A.; Edberg, Jeffrey C.; Freedman, Barry I.; Gilkeson, Gary S.; Jacob, Chaim O.; James, Judith A.; Kamen, Diane L.; Kimberly, Robert P.; Martin, Javier; Merrill, Joan T.; Niewold, Timothy B.; Pons-Estel, Bernardo A.; Scofield, R. Hal; Stevens, Anne M.; Tsao, Betty P.; Vyse, Timothy J.; Langefeld, Carl D.; Harley, John B.; Wakeland, Edward K.; Moser, Kathy L.; Montgomery, Courtney G.; Gaffney, Patrick M.
2012-01-01
Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical manifestations characterized by the development of pathogenic autoantibodies manifesting in inflammation of target organs such as the kidneys, skin and joints. Genome-wide association studies have identified genetic variants in the UBE2L3 region that are associated with SLE in subjects of European and Asian ancestry. UBE2L3 encodes an ubiquitin-conjugating enzyme, UBCH7, involved in cell proliferation and immune function. In this study, we sought to further characterize the genetic association in the region of UBE2L3 and use molecular methods to determine the functional effect of the risk haplotype. We identified significant associations between variants in the region of UBE2L3 and SLE in individuals of European and Asian ancestry that exceeded a Bonferroni corrected threshold (P < 1 × 10−4). A single risk haplotype was observed in all associated populations. Individuals harboring the risk haplotype display a significant increase in both UBE2L3 mRNA expression (P = 0.0004) and UBCH7 protein expression (P = 0.0068). The results suggest that variants carried on the SLE associated UBE2L3 risk haplotype influence autoimmunity by modulating UBCH7 expression. PMID:22476155
Wang, Shichen; Wong, Debbie; Forrest, Kerrie; Allen, Alexandra; Chao, Shiaoman; Huang, Bevan E; Maccaferri, Marco; Salvi, Silvio; Milner, Sara G; Cattivelli, Luigi; Mastrangelo, Anna M; Whan, Alex; Stephen, Stuart; Barker, Gary; Wieseke, Ralf; Plieske, Joerg; International Wheat Genome Sequencing Consortium; Lillemo, Morten; Mather, Diane; Appels, Rudi; Dolferus, Rudy; Brown-Guedira, Gina; Korol, Abraham; Akhunova, Alina R; Feuillet, Catherine; Salse, Jerome; Morgante, Michele; Pozniak, Curtis; Luo, Ming-Cheng; Dvorak, Jan; Morell, Matthew; Dubcovsky, Jorge; Ganal, Martin; Tuberosa, Roberto; Lawley, Cindy; Mikoulitch, Ivan; Cavanagh, Colin; Edwards, Keith J; Hayden, Matthew; Akhunov, Eduard
2014-01-01
High-density single nucleotide polymorphism (SNP) genotyping arrays are a powerful tool for studying genomic patterns of diversity, inferring ancestral relationships between individuals in populations and studying marker–trait associations in mapping experiments. We developed a genotyping array including about 90 000 gene-associated SNPs and used it to characterize genetic variation in allohexaploid and allotetraploid wheat populations. The array includes a significant fraction of common genome-wide distributed SNPs that are represented in populations of diverse geographical origin. We used density-based spatial clustering algorithms to enable high-throughput genotype calling in complex data sets obtained for polyploid wheat. We show that these model-free clustering algorithms provide accurate genotype calling in the presence of multiple clusters including clusters with low signal intensity resulting from significant sequence divergence at the target SNP site or gene deletions. Assays that detect low-intensity clusters can provide insight into the distribution of presence–absence variation (PAV) in wheat populations. A total of 46 977 SNPs from the wheat 90K array were genetically mapped using a combination of eight mapping populations. The developed array and cluster identification algorithms provide an opportunity to infer detailed haplotype structure in polyploid wheat and will serve as an invaluable resource for diversity studies and investigating the genetic basis of trait variation in wheat. PMID:24646323
Barbero, Marina M. D.; Oliveira, Henrique N.; de Camargo, Gregório M. F.; Fernandes Júnior, Gerardo A.; Aspilcueta-Borquis, Rusbel R.; Souza, Fabio R. P.; Boligon, Arione A.; Melo, Thaise P.; Regatieri, Inaê C.; Feitosa, Fabieli L. B.; Fonseca, Larissa F. S.; Magalhães, Ana F. B.; Costa, Raphael B.; Albuquerque, Lucia G.
2018-01-01
Reproductive traits are of the utmost importance for any livestock farming, but are difficult to measure and to interpret since they are influenced by various factors. The objective of this study was to detect associations between known polymorphisms in candidate genes related to sexual precocity in Nellore heifers, which could be used in breeding programs. Records of 1,689 precocious and non-precocious heifers from farms participating in the Conexão Delta G breeding program were analyzed. A subset of single nucleotide polymorphisms (SNP) located in the region of the candidate genes at a distance of up to 5 kb from the boundaries of each gene, were selected from the panel of 777,000 SNPs of the High-Density Bovine SNP BeadChip. Linear mixed models were used for statistical analysis of early heifer pregnancy, relating the trait with isolated SNPs or with haplotype groups. The model included the contemporary group (year and month of birth) as fixed effect and parent of the animal (sire effect) as random effect. The fastPHASE® and GenomeStudio® were used for reconstruction of the haplotypes and for analysis of linkage disequilibrium based on r2 statistics. A total of 125 candidate genes and 2,024 SNPs forming haplotypes were analyzed. Statistical analysis after Bonferroni correction showed that nine haplotypes exerted a significant effect (p<0.05) on sexual precocity. Four of these haplotypes were located in the Pregnancy-associated plasma protein-A2 gene (PAPP-A2), two in the Estrogen-related receptor gamma gene (ESRRG), and one each in the Pregnancy-associated plasma protein-A gene (PAPP-A), Kell blood group complex subunit-related family (XKR4) and mannose-binding lectin genes (MBL-1) genes. Although the present results indicate that the PAPP-A2, PAPP-A, XKR4, MBL-1 and ESRRG genes influence sexual precocity in Nellore heifers, further studies are needed to evaluate their possible use in breeding programs. PMID:29293544
Takada, Luciana; Barbero, Marina M D; Oliveira, Henrique N; de Camargo, Gregório M F; Fernandes Júnior, Gerardo A; Aspilcueta-Borquis, Rusbel R; Souza, Fabio R P; Boligon, Arione A; Melo, Thaise P; Regatieri, Inaê C; Feitosa, Fabieli L B; Fonseca, Larissa F S; Magalhães, Ana F B; Costa, Raphael B; Albuquerque, Lucia G
2018-01-01
Reproductive traits are of the utmost importance for any livestock farming, but are difficult to measure and to interpret since they are influenced by various factors. The objective of this study was to detect associations between known polymorphisms in candidate genes related to sexual precocity in Nellore heifers, which could be used in breeding programs. Records of 1,689 precocious and non-precocious heifers from farms participating in the Conexão Delta G breeding program were analyzed. A subset of single nucleotide polymorphisms (SNP) located in the region of the candidate genes at a distance of up to 5 kb from the boundaries of each gene, were selected from the panel of 777,000 SNPs of the High-Density Bovine SNP BeadChip. Linear mixed models were used for statistical analysis of early heifer pregnancy, relating the trait with isolated SNPs or with haplotype groups. The model included the contemporary group (year and month of birth) as fixed effect and parent of the animal (sire effect) as random effect. The fastPHASE® and GenomeStudio® were used for reconstruction of the haplotypes and for analysis of linkage disequilibrium based on r2 statistics. A total of 125 candidate genes and 2,024 SNPs forming haplotypes were analyzed. Statistical analysis after Bonferroni correction showed that nine haplotypes exerted a significant effect (p<0.05) on sexual precocity. Four of these haplotypes were located in the Pregnancy-associated plasma protein-A2 gene (PAPP-A2), two in the Estrogen-related receptor gamma gene (ESRRG), and one each in the Pregnancy-associated plasma protein-A gene (PAPP-A), Kell blood group complex subunit-related family (XKR4) and mannose-binding lectin genes (MBL-1) genes. Although the present results indicate that the PAPP-A2, PAPP-A, XKR4, MBL-1 and ESRRG genes influence sexual precocity in Nellore heifers, further studies are needed to evaluate their possible use in breeding programs.
Mice, humans and haplotypes--the hunt for disease genes in SLE.
Rigby, R J; Fernando, M M A; Vyse, T J
2006-09-01
Defining the polymorphisms that contribute to the development of complex genetic disease traits is a challenging, although increasingly tractable problem. Historically, the technical difficulties in conducting association studies across the entire human genome are such that murine models have been used to generate candidate genes for analysis in human complex diseases, such as SLE. In this article we discuss the advantages and disadvantages of this approach and specifically address some assumptions made in the transition from studying one species to another, using lupus as an example. These issues include differences in genetic structure and genetic organisation which are a reflection on the population history. Clearly there are major differences in the histories of the human population and inbred laboratory strains of mice. Both human and murine genomes do exhibit structure at the genetic level. That is to say, they comprise haplotypes which are genomic regions that carry runs of polymorphisms that are not independently inherited. Haplotypes therefore reduce the number of combinations of the polymorphisms in the DNA in that region and facilitate the identification of disease susceptibility genes in both mice and humans. There are now novel means of generating candidate genes in SLE using mutagenesis (with ENU) in mice and identifying mice that generate antinuclear autoimmunity. In addition, murine models still provide a valuable means of exploring the functional consequences of genetic variation. However, advances in technology are such that human geneticists can now screen large fractions of the human genome for disease associations using microchip technologies that provide information on upwards of 100,000 different polymorphisms. These approaches are aimed at identifying haplotypes that carry disease susceptibility mutations and rely less on the generation of candidate genes.
Single haplotype assembly of the human genome from a hydatidiform mole.
Steinberg, Karyn Meltz; Schneider, Valerie A; Graves-Lindsay, Tina A; Fulton, Robert S; Agarwala, Richa; Huddleston, John; Shiryev, Sergey A; Morgulis, Aleksandr; Surti, Urvashi; Warren, Wesley C; Church, Deanna M; Eichler, Evan E; Wilson, Richard K
2014-12-01
A complete reference assembly is essential for accurately interpreting individual genomes and associating variation with phenotypes. While the current human reference genome sequence is of very high quality, gaps and misassemblies remain due to biological and technical complexities. Large repetitive sequences and complex allelic diversity are the two main drivers of assembly error. Although increasing the length of sequence reads and library fragments can improve assembly, even the longest available reads do not resolve all regions. In order to overcome the issue of allelic diversity, we used genomic DNA from an essentially haploid hydatidiform mole, CHM1. We utilized several resources from this DNA including a set of end-sequenced and indexed BAC clones and 100× Illumina whole-genome shotgun (WGS) sequence coverage. We used the WGS sequence and the GRCh37 reference assembly to create an assembly of the CHM1 genome. We subsequently incorporated 382 finished BAC clone sequences to generate a draft assembly, CHM1_1.1 (NCBI AssemblyDB GCA_000306695.2). Analysis of gene, repetitive element, and segmental duplication content show this assembly to be of excellent quality and contiguity. However, comparison to assembly-independent resources, such as BAC clone end sequences and PacBio long reads, indicate misassembled regions. Most of these regions are enriched for structural variation and segmental duplication, and can be resolved in the future. This publicly available assembly will be integrated into the Genome Reference Consortium curation framework for further improvement, with the ultimate goal being a completely finished gap-free assembly. © 2014 Steinberg et al.; Published by Cold Spring Harbor Laboratory Press.
Construction of the third-generation Zea mays haplotype map.
Bukowski, Robert; Guo, Xiaosen; Lu, Yanli; Zou, Cheng; He, Bing; Rong, Zhengqin; Wang, Bo; Xu, Dawen; Yang, Bicheng; Xie, Chuanxiao; Fan, Longjiang; Gao, Shibin; Xu, Xun; Zhang, Gengyun; Li, Yingrui; Jiao, Yinping; Doebley, John F; Ross-Ibarra, Jeffrey; Lorant, Anne; Buffalo, Vince; Romay, M Cinta; Buckler, Edward S; Ware, Doreen; Lai, Jinsheng; Sun, Qi; Xu, Yunbi
2018-04-01
Characterization of genetic variations in maize has been challenging, mainly due to deterioration of collinearity between individual genomes in the species. An international consortium of maize research groups combined resources to develop the maize haplotype version 3 (HapMap 3), built from whole-genome sequencing data from 1218 maize lines, covering predomestication and domesticated Zea mays varieties across the world. A new computational pipeline was set up to process more than 12 trillion bp of sequencing data, and a set of population genetics filters was applied to identify more than 83 million variant sites. We identified polymorphisms in regions where collinearity is largely preserved in the maize species. However, the fact that the B73 genome used as the reference only represents a fraction of all haplotypes is still an important limiting factor.
Molecular definition of red cell Rh haplotypes by tightly linked SphI RFLPs.
Huang, C H; Reid, M E; Chen, Y; Coghlan, G; Okubo, Y
1996-01-01
The Rh blood group system of human red cells contains five major antigens D, C/c, and E/e (the latter four designated "non-D") that are specified by eight gene complexes known as Rh haplotypes. In this paper, we report on the mapping of RH locus and identification of a set of SphI RFLPs that are tightly linked with the Rh structural genes. Using exon-specific probes, we have localized the SphI cleavage sites resulting in these DNA markers and derived a comprehensive map for the RH locus. It was found that the SphI fragments encompassing exons 4-7 of the Rh genes occur in four banding patterns or frameworks that correspond to the distribution and segregation of the common Rh haplotypes. This linkage disequilibrium allowed a genotype-phenotype correlation and direct determination of Rh zygosity related to the Rh-positive or Rh-negative status (D/D, D/d, and d/d). Studies on the occurrence of SphI RFLPs in a number of rare Rh variants indicated that Rh phenotypic diversity has taken place on different haplotype backgrounds and has arisen by diverse genetic mechanisms. The molecular definition of Rh haplotypes by SphI RFLP frameworks should provide a useful procedure for genetic counseling and prenatal assessment of Rh alloimmunization.
Genomic adaptation of admixed dairy cattle in East Africa
Kim, Eui-Soo; Rothschild, Max F.
2014-01-01
Dairy cattle in East Africa imported from the U.S. and Europe have been adapted to new environments. In small local farms, cattle have generally been maintained by crossbreeding that could increase survivability under a severe environment. Eventually, genomic ancestry of a specific breed will be nearly fixed in genomic regions of local breeds or crossbreds when it is advantageous for survival or production in harsh environments. To examine this situation, 25 Friesians and 162 local cattle produced by crossbreeding of dairy breeds in Kenya were sampled and genotyped using 50K SNPs. Using principal component analysis (PCA), the admixed local cattle were found to consist of several imported breeds, including Guernsey, Norwegian Red, and Holstein. To infer the influence of parental breeds on genomic regions, local ancestry mapping was performed based on the similarity of haplotypes. As a consequence, it appears that no genomic region has been under the complete influence of a specific parental breed. Nonetheless, the ancestry of Holstein-Friesians was substantial in most genomic regions (>80%). Furthermore, we examined the frequency of the most common haplotypes from parental breeds that have changed substantially in Kenyan crossbreds during admixture. The frequency of these haplotypes from parental breeds, which were likely to be selected in temperate regions, has deviated considerably from expected frequency in 11 genomic regions. Additionally, extended haplotype homozygosity (EHH) based methods were applied to identify the regions responding to recent selection in crossbreds, called candidate regions, resulting in seven regions that appeared to be affected by Holstein-Friesians. However, some signatures of selection were less dependent on Holsteins-Friesians, suggesting evidence of adaptation in East Africa. The analysis of local ancestry is a useful approach to understand the detailed genomic structure and may reveal regions of the genome required for specialized
A comprehensive study of the genomic differentiation between temperate Dent and Flint maize.
Unterseer, Sandra; Pophaly, Saurabh D; Peis, Regina; Westermeier, Peter; Mayer, Manfred; Seidel, Michael A; Haberer, Georg; Mayer, Klaus F X; Ordas, Bernardo; Pausch, Hubert; Tellier, Aurélien; Bauer, Eva; Schön, Chris-Carolin
2016-07-08
Dent and Flint represent two major germplasm pools exploited in maize breeding. Several traits differentiate the two pools, like cold tolerance, early vigor, and flowering time. A comparative investigation of their genomic architecture relevant for quantitative trait expression has not been reported so far. Understanding the genomic differences between germplasm pools may contribute to a better understanding of the complementarity in heterotic patterns exploited in hybrid breeding and of mechanisms involved in adaptation to different environments. We perform whole-genome screens for signatures of selection specific to temperate Dent and Flint maize by comparing high-density genotyping data of 70 American and European Dent and 66 European Flint inbred lines. We find 2.2 % and 1.4 % of the genes are under selective pressure, respectively, and identify candidate genes associated with agronomic traits known to differ between the two pools. Taking flowering time as an example for the differentiation between Dent and Flint, we investigate candidate genes involved in the flowering network by phenotypic analyses in a Dent-Flint introgression library and find that the Flint haplotypes of the candidates promote earlier flowering. Within the flowering network, the majority of Flint candidates are associated with endogenous pathways in contrast to Dent candidate genes, which are mainly involved in response to environmental factors like light and photoperiod. The diversity patterns of the candidates in a unique panel of more than 900 individuals from 38 European landraces indicate a major contribution of landraces from France, Germany, and Spain to the candidate gene diversity of the Flint elite lines. In this study, we report the investigation of pool-specific differences between temperate Dent and Flint on a genome-wide scale. The identified candidate genes represent a promising source for the functional investigation of pool-specific haplotypes in different genetic
Genotype Imputation with Thousands of Genomes
Howie, Bryan; Marchini, Jonathan; Stephens, Matthew
2011-01-01
Genotype imputation is a statistical technique that is often used to increase the power and resolution of genetic association studies. Imputation methods work by using haplotype patterns in a reference panel to predict unobserved genotypes in a study dataset, and a number of approaches have been proposed for choosing subsets of reference haplotypes that will maximize accuracy in a given study population. These panel selection strategies become harder to apply and interpret as sequencing efforts like the 1000 Genomes Project produce larger and more diverse reference sets, which led us to develop an alternative framework. Our approach is built around a new approximation that uses local sequence similarity to choose a custom reference panel for each study haplotype in each region of the genome. This approximation makes it computationally efficient to use all available reference haplotypes, which allows us to bypass the panel selection step and to improve accuracy at low-frequency variants by capturing unexpected allele sharing among populations. Using data from HapMap 3, we show that our framework produces accurate results in a wide range of human populations. We also use data from the Malaria Genetic Epidemiology Network (MalariaGEN) to provide recommendations for imputation-based studies in Africa. We demonstrate that our approximation improves efficiency in large, sequence-based reference panels, and we discuss general computational strategies for modern reference datasets. Genome-wide association studies will soon be able to harness the power of thousands of reference genomes, and our work provides a practical way for investigators to use this rich information. New methodology from this study is implemented in the IMPUTE2 software package. PMID:22384356
Börstler, Boris; Thiéry, Odile; Sýkorová, Zuzana; Berner, Alfred; Redecker, Dirk
2010-04-01
Glomus intraradices, an arbuscular mycorrhizal fungus (AMF), is frequently found in a surprisingly wide range of ecosystems all over the world. It is used as model organism for AMF and its genome is being sequenced. Despite the ecological importance of AMF, little has been known about their population structure, because no adequate molecular markers have been available. In the present study we analyse for the first time the intraspecific genetic structure of an AMF directly from colonized roots in the field. A recently developed PCR-RFLP approach for the mitochondrial rRNA large subunit gene (mtLSU) of these obligate symbionts was used and complemented by sequencing and primers specific for a particularly frequent mtLSU haplotype. We analysed root samples from two agricultural field experiments in Switzerland and two semi-natural grasslands in France and Switzerland. RFLP type composition of G. intraradices (phylogroup GLOM A-1) differed strongly between agricultural and semi-natural sites and the G. intraradices populations of the two agricultural sites were significantly differentiated. RFLP type richness was higher in the agricultural sites compared with the grasslands. Detailed sequence analyses which resolved multiple sequence haplotypes within some RFLP types even revealed that there was no overlap of haplotypes among any of the study sites except between the two grasslands. Our results demonstrate a surprisingly high differentiation among semi-natural and agricultural field sites for G. intraradices. These findings will have major implications on our views of processes of adaptation and specialization in these plant/fungus associations.
Genomic Diversity and Evolution of the Lyssaviruses
Delmas, Olivier; Holmes, Edward C.; Talbi, Chiraz; Larrous, Florence; Dacheux, Laurent; Bouchier, Christiane; Bourhy, Hervé
2008-01-01
Lyssaviruses are RNA viruses with single-strand, negative-sense genomes responsible for rabies-like diseases in mammals. To date, genomic and evolutionary studies have most often utilized partial genome sequences, particularly of the nucleoprotein and glycoprotein genes, with little consideration of genome-scale evolution. Herein, we report the first genomic and evolutionary analysis using complete genome sequences of all recognised lyssavirus genotypes, including 14 new complete genomes of field isolates from 6 genotypes and one genotype that is completely sequenced for the first time. In doing so we significantly increase the extent of genome sequence data available for these important viruses. Our analysis of these genome sequence data reveals that all lyssaviruses have the same genomic organization. A phylogenetic analysis reveals strong geographical structuring, with the greatest genetic diversity in Africa, and an independent origin for the two known genotypes that infect European bats. We also suggest that multiple genotypes may exist within the diversity of viruses currently classified as ‘Lagos Bat’. In sum, we show that rigorous phylogenetic techniques based on full length genome sequence provide the best discriminatory power for genotype classification within the lyssaviruses. PMID:18446239
Submegabase Clusters of Unstable Tandem Repeats Unique to the Tla Region of Mouse T Haplotypes
Uehara, H.; Ebersole, T.; Bennett, D.; Artzt, K.
1990-01-01
We describe here the identification and genomic organization of mouse t haplotype-specific elements (TSEs) 7.8 and 5.8 kb in length. The TSEs exist as submegabase-long clusters of tandem repeats localized in the Tla region of the major histocompatibility complex of all t haplotype chromosomes examined. In contrast, no such clusters were detected among 12 inbred strains of Mus musculus and other Mus species; thus, clusters of TSEs represent the first absolutely qualitative difference between t haplotypes and wild-type chromosomes. Pulsed field gel electrophoresis shows that the number of clusters, and the number of repeats in each cluster are extremely variable. Dramatic quantitative differences of TSEs uniquely distinguish every independent t haplotype from any other. The complete nucleotide sequence of one 7.8-kb TSE reveals significant homology to the ETn (a major transcript in the early embryo of the mouse), and some homologies to intracisternal A-particles and the mammary tumor virus env gene. Apart from the diagnostic relevance to t haplotypes, evolutionary and functional significances are discussed with respect to chromosome structure and genetic recombination. PMID:2076812
Ezzidi, Intissar; Mtiraoui, Nabil; Kacem, Maha; Chaieb, Molka; Mahjoub, Touhami; Almawi, Wassim Y
2009-11-01
Cross-sectional and family studies identified angiotensin-converting enzyme (ACE) gene as a risk factor for diabetic nephropathy (DN). The contribution of ACE gene variants to DN development and progression is controversial and varies among different ethnic/racial groups. We investigated the association of three ACE gene variants with DN, rs1799752 insertion/deletion (I/D), rs1800764T/C and rs12449782A/G in 917 Tunisian type 2 diabetic (T2DM) patients: 515 with (DN) and 402 without (DWN) nephropathy. ACE genotyping was done by PCR-based assays; haplotype estimation was performed using H-Plus software (chi(2)-test based). Genotype frequency distributions of the three studied variants were in Hardy-Weinberg equilibrium. Minor allele frequency of rs1800764 was higher in DN patients than DWN patients or healthy controls, and minor allele frequency of rs1799752 was higher in DN than DWN patients. Higher frequency of rs1799752 and rs1800764 homozygous mutant genotypes was seen in DN compared to DWN patients. Of the three variants, only rs1799752 deletion/deletion (D/D) genotype was associated with a significant increase in albumin to creatinine ratios levels, and D/D carriers had elevated low-density lipoprotein, total cholesterol and urea. Three locus haplotype [rs1799752(I/D)/rs1800764(T/C)/rs12449782(A/G)] analysis revealed that the frequency of DCG haplotype was higher, while that of ITG and ICA haplotypes were lower among unselected type 2 diabetic patients. Taking ITA haplotype as reference, multivariate regression analysis confirmed the negative (ITG), and positive (DCG, DTG, DCA and DTA) association of specific ACE haplotypes with DN, after adjusting for potential nephropathy-linked covariates. Our results support the involvement of specific ACE variants in DN pathogenesis and demonstrate the presence of DN-specific haplotypes at the ACE locus.
Comparative genomics of wild type yeast strains unveils important genome diversity
Carreto, Laura; Eiriz, Maria F; Gomes, Ana C; Pereira, Patrícia M; Schuller, Dorit; Santos, Manuel AS
2008-01-01
Background Genome variability generates phenotypic heterogeneity and is of relevance for adaptation to environmental change, but the extent of such variability in natural populations is still poorly understood. For example, selected Saccharomyces cerevisiae strains are variable at the ploidy level, have gene amplifications, changes in chromosome copy number, and gross chromosomal rearrangements. This suggests that genome plasticity provides important genetic diversity upon which natural selection mechanisms can operate. Results In this study, we have used wild-type S. cerevisiae (yeast) strains to investigate genome variation in natural and artificial environments. We have used comparative genome hybridization on array (aCGH) to characterize the genome variability of 16 yeast strains, of laboratory and commercial origin, isolated from vineyards and wine cellars, and from opportunistic human infections. Interestingly, sub-telomeric instability was associated with the clinical phenotype, while Ty element insertion regions determined genomic differences of natural wine fermentation strains. Copy number depletion of ASP3 and YRF1 genes was found in all wild-type strains. Other gene families involved in transmembrane transport, sugar and alcohol metabolism or drug resistance had copy number changes, which also distinguished wine from clinical isolates. Conclusion We have isolated and genotyped more than 1000 yeast strains from natural environments and carried out an aCGH analysis of 16 strains representative of distinct genotype clusters. Important genomic variability was identified between these strains, in particular in sub-telomeric regions and in Ty-element insertion sites, suggesting that this type of genome variability is the main source of genetic diversity in natural populations of yeast. The data highlights the usefulness of yeast as a model system to unravel intraspecific natural genome diversity and to elucidate how natural selection shapes the yeast genome
Kelemen, Arpad; Vasilakos, Athanasios V; Liang, Yulan
2009-09-01
Comprehensive evaluation of common genetic variations through association of single-nucleotide polymorphism (SNP) structure with common complex disease in the genome-wide scale is currently a hot area in human genome research due to the recent development of the Human Genome Project and HapMap Project. Computational science, which includes computational intelligence (CI), has recently become the third method of scientific enquiry besides theory and experimentation. There have been fast growing interests in developing and applying CI in disease mapping using SNP and haplotype data. Some of the recent studies have demonstrated the promise and importance of CI for common complex diseases in genomic association study using SNP/haplotype data, especially for tackling challenges, such as gene-gene and gene-environment interactions, and the notorious "curse of dimensionality" problem. This review provides coverage of recent developments of CI approaches for complex diseases in genetic association study with SNP/haplotype data.
Detecting and Characterizing Genomic Signatures of Positive Selection in Global Populations
Liu, Xuanyao; Ong, Rick Twee-Hee; Pillai, Esakimuthu Nisha; Elzein, Abier M.; Small, Kerrin S.; Clark, Taane G.; Kwiatkowski, Dominic P.; Teo, Yik-Ying
2013-01-01
Natural selection is a significant force that shapes the architecture of the human genome and introduces diversity across global populations. The question of whether advantageous mutations have arisen in the human genome as a result of single or multiple mutation events remains unanswered except for the fact that there exist a handful of genes such as those that confer lactase persistence, affect skin pigmentation, or cause sickle cell anemia. We have developed a long-range-haplotype method for identifying genomic signatures of positive selection to complement existing methods, such as the integrated haplotype score (iHS) or cross-population extended haplotype homozygosity (XP-EHH), for locating signals across the entire allele frequency spectrum. Our method also locates the founder haplotypes that carry the advantageous variants and infers their corresponding population frequencies. This presents an opportunity to systematically interrogate the whole human genome whether a selection signal shared across different populations is the consequence of a single mutation process followed subsequently by gene flow between populations or of convergent evolution due to the occurrence of multiple independent mutation events either at the same variant or within the same gene. The application of our method to data from 14 populations across the world revealed that positive-selection events tend to cluster in populations of the same ancestry. Comparing the founder haplotypes for events that are present across different populations revealed that convergent evolution is a rare occurrence and that the majority of shared signals stem from the same evolutionary event. PMID:23731540
Ayyagari, Vijaya Sai; Sreerama, Krupanidhi
2017-08-01
Achatina fulica (Lissachatina fulica) is one of the most invasive species found across the globe causing a significant damage to crops, vegetables, and horticultural plants. This terrestrial snail is native to east Africa and spread to different parts of the world by introductions. India, a hot spot for biodiversity of several endemic gastropods, has witnessed an outburst of this snail population in several parts of the country posing a serious threat to crop loss and also to human health. With an objective to evaluate the genetic diversity of this snail, we have sampled this snail from different parts of India and analyzed its haplotype diversity by means of 16S rDNA sequence information. Apart from this, we have studied the phylogenetic relationships of the isolates sequenced in the present study in relation with other global populations by Bayesian and Maximum-likelihood approaches. Of the isolates sequenced, haplotype 'C' is the predominant one. A new haplotype 'S' from the state of Odisha was observed. The isolates sequenced in the present study clustered with its conspecifics from the Indian sub-continent. Haplotype network analyses were also carried out for studying the evolution of different haplotypes. It was observed that haplotype 'S' was associated with a Mauritius haplotype 'H', indicating the possibility of multiple introductions of A. fulica to India.
Kashtan, Nadav; Roggensack, Sara E; Berta-Thompson, Jessie W; Grinberg, Maor; Stepanauskas, Ramunas; Chisholm, Sallie W
2017-09-01
The Atlantic and Pacific Oceans represent different biogeochemical regimes in which the abundant marine cyanobacterium Prochlorococcus thrives. We have shown that Prochlorococcus populations in the Atlantic are composed of hundreds of genomically, and likely ecologically, distinct coexisting subpopulations with distinct genomic backbones. Here we ask if differences in the ecology and selection pressures between the Atlantic and Pacific are reflected in the diversity and genomic composition of their indigenous Prochlorococcus populations. We applied large-scale single-cell genomics and compared the cell-by-cell genomic composition of wild populations of co-occurring cells from samples from Station ALOHA off Hawaii, and from Bermuda Atlantic Time Series Station off Bermuda. We reveal fundamental differences in diversity and genomic structure of populations between the sites. The Pacific populations are more diverse than those in the Atlantic, composed of significantly more coexisting subpopulations and lacking dominant subpopulations. Prochlorococcus from the two sites seem to be composed of mostly non-overlapping distinct sets of subpopulations with different genomic backbones-likely reflecting different sets of ocean-specific micro-niches. Furthermore, phylogenetically closely related strains carry ocean-associated nutrient acquisition genes likely reflecting differences in major selection pressures between the oceans. This differential selection, along with geographic separation, clearly has a significant role in shaping these populations.
Mitt, Mario; Kals, Mart; Pärn, Kalle; Gabriel, Stacey B; Lander, Eric S; Palotie, Aarno; Ripatti, Samuli; Morris, Andrew P; Metspalu, Andres; Esko, Tõnu; Mägi, Reedik; Palta, Priit
2017-01-01
Genetic imputation is a cost-efficient way to improve the power and resolution of genome-wide association (GWA) studies. Current publicly accessible imputation reference panels accurately predict genotypes for common variants with minor allele frequency (MAF)≥5% and low-frequency variants (0.5≤MAF<5%) across diverse populations, but the imputation of rare variation (MAF<0.5%) is still rather limited. In the current study, we evaluate imputation accuracy achieved with reference panels from diverse populations with a population-specific high-coverage (30 ×) whole-genome sequencing (WGS) based reference panel, comprising of 2244 Estonian individuals (0.25% of adult Estonians). Although the Estonian-specific panel contains fewer haplotypes and variants, the imputation confidence and accuracy of imputed low-frequency and rare variants was significantly higher. The results indicate the utility of population-specific reference panels for human genetic studies. PMID:28401899
Construction of the third-generation Zea mays haplotype map
Bukowski, Robert; Guo, Xiaosen; Lu, Yanli; Zou, Cheng; He, Bing; Rong, Zhengqin; Wang, Bo; Xu, Dawen; Yang, Bicheng; Xie, Chuanxiao; Fan, Longjiang; Gao, Shibin; Xu, Xun; Zhang, Gengyun; Li, Yingrui; Jiao, Yinping; Doebley, John F; Ross-Ibarra, Jeffrey; Lorant, Anne; Buffalo, Vince; Romay, M Cinta; Buckler, Edward S; Ware, Doreen; Lai, Jinsheng; Sun, Qi
2017-01-01
Abstract Background Characterization of genetic variations in maize has been challenging, mainly due to deterioration of collinearity between individual genomes in the species. An international consortium of maize research groups combined resources to develop the maize haplotype version 3 (HapMap 3), built from whole-genome sequencing data from 1218 maize lines, covering predomestication and domesticated Zea mays varieties across the world. Results A new computational pipeline was set up to process more than 12 trillion bp of sequencing data, and a set of population genetics filters was applied to identify more than 83 million variant sites. Conclusions We identified polymorphisms in regions where collinearity is largely preserved in the maize species. However, the fact that the B73 genome used as the reference only represents a fraction of all haplotypes is still an important limiting factor. PMID:29300887
Sakai, Satoki
2016-08-01
I developed a gametophytic self-incompatibility (SI) model to study the conditions leading to diversification in SI haplotypes. In the model, the SI system is assumed to be incomplete, and the pollen expressing a given specificity is not fully rejected by the pistils expressing the same specificity. I also assumed that mutations can occur that enhance the rejection of pollen by pistils with the same haplotype variant and reduce rejection by pistils with other variants in the same haplotype. I found that if such mutations occur, the new haplotypes (mutant variants) can stably coexist with the ancestral haplotype in which the mutant arose. This is because pollen bearing the new haplotype is most strongly rejected by pistils bearing the same new haplotype among the pistils in the population; hence, negative frequency-dependent selection prevents their fixation. I also performed simulations and found that the nearly complete SI system evolves from completely self-compatible populations and that SI haplotypes can increase to about 40-50 within a few thousand generations. On the basis of my findings, I propose that diversification of SI haplotypes occurred during the evolution of SI from self-compatibility.
Kujur, Alice; Bajaj, Deepak; Upadhyaya, Hari D.; Das, Shouvik; Ranjan, Rajeev; Shree, Tanima; Saxena, Maneesha S.; Badoni, Saurabh; Kumar, Vinod; Tripathi, Shailesh; Gowda, C. L. L.; Sharma, Shivali; Singh, Sube; Tyagi, Akhilesh K.; Parida, Swarup K.
2015-01-01
The genome-wide discovery and high-throughput genotyping of SNPs in chickpea natural germplasm lines is indispensable to extrapolate their natural allelic diversity, domestication, and linkage disequilibrium (LD) patterns leading to the genetic enhancement of this vital legume crop. We discovered 44,844 high-quality SNPs by sequencing of 93 diverse cultivated desi, kabuli, and wild chickpea accessions using reference genome- and de novo-based GBS (genotyping-by-sequencing) assays that were physically mapped across eight chromosomes of desi and kabuli. Of these, 22,542 SNPs were structurally annotated in different coding and non-coding sequence components of genes. Genes with 3296 non-synonymous and 269 regulatory SNPs could functionally differentiate accessions based on their contrasting agronomic traits. A high experimental validation success rate (92%) and reproducibility (100%) along with strong sensitivity (93–96%) and specificity (99%) of GBS-based SNPs was observed. This infers the robustness of GBS as a high-throughput assay for rapid large-scale mining and genotyping of genome-wide SNPs in chickpea with sub-optimal use of resources. With 23,798 genome-wide SNPs, a relatively high intra-specific polymorphic potential (49.5%) and broader molecular diversity (13–89%)/functional allelic diversity (18–77%) was apparent among 93 chickpea accessions, suggesting their tremendous applicability in rapid selection of desirable diverse accessions/inter-specific hybrids in chickpea crossbred varietal improvement program. The genome-wide SNPs revealed complex admixed domestication pattern, extensive LD estimates (0.54–0.68) and extended LD decay (400–500 kb) in a structured population inclusive of 93 accessions. These findings reflect the utility of our identified SNPs for subsequent genome-wide association study (GWAS) and selective sweep-based domestication trait dissection analysis to identify potential genomic loci (gene-associated targets) specifically
Genomic diversity of the human intestinal parasite Entamoeba histolytica
2012-01-01
Background Entamoeba histolytica is a significant cause of disease worldwide. However, little is known about the genetic diversity of the parasite. We re-sequenced the genomes of ten laboratory cultured lines of the eukaryotic pathogen Entamoeba histolytica in order to develop a picture of genetic diversity across the genome. Results The extreme nucleotide composition bias and repetitiveness of the E. histolytica genome provide a challenge for short-read mapping, yet we were able to define putative single nucleotide polymorphisms in a large portion of the genome. The results suggest a rather low level of single nucleotide diversity, although genes and gene families with putative roles in virulence are among the more polymorphic genes. We did observe large differences in coverage depth among genes, indicating differences in gene copy number between genomes. We found evidence indicating that recombination has occurred in the history of the sequenced genomes, suggesting that E. histolytica may reproduce sexually. Conclusions E. histolytica displays a relatively low level of nucleotide diversity across its genome. However, large differences in gene family content and gene copy number are seen among the sequenced genomes. The pattern of polymorphism indicates that E. histolytica reproduces sexually, or has done so in the past, which has previously been suggested but not proven. PMID:22630046
Khan, Asis; Miller, Natalie; Roos, David S.; Dubey, J. P.; Ajzenberg, Daniel; Dardé, Marie Laure; Ajioka, James W.; Rosenthal, Benjamin; Sibley, L. David
2011-01-01
ABSTRACT Toxoplasma gondii is a common parasite of animals that also causes a zoonotic infection in humans. Previous studies have revealed a strongly clonal population structure that is shared between North America and Europe, while South American strains show greater genetic diversity and evidence of sexual recombination. The common inheritance of a monomorphic version of chromosome Ia (referred to as ChrIa*) among three clonal lineages from North America and Europe suggests that inheritance of this chromosome might underlie their recent clonal expansion. To further examine the diversity and distribution of ChrIa, we have analyzed additional strains with greater geographic diversity. Our findings reveal that the same haplotype of ChrIa* is found in the clonal lineages from North America and Europe and in older lineages in South America, where sexual recombination is more common. Although lineages from all three continents harbor the same conserved ChrIa* haplotype, strains from North America and Europe are genetically separate from those in South America, and these respective geographic regions show limited evidence of recent mixing. Genome-wide, array-based profiling of polymorphisms provided evidence for an ancestral flow from particular older southern lineages that gave rise to the clonal lineages now dominant in the north. Collectively, these data indicate that ChrIa* is widespread among nonclonal strains in South America and has more recently been associated with clonal expansion of specific lineages in North America and Europe. These findings have significant implications for the spread of genetic loci influencing transmission and virulence in pathogen populations. PMID:22068979
Intricacies in arrangement of SNP haplotypes suggest "Great Admixture" that created modern humans.
Dutta, Rajib; Mainsah, Joseph; Yatskiv, Yuriy; Chakrabortty, Sharmistha; Brennan, Patrick; Khuder, Basil; Qiu, Shuhao; Fedorova, Larisa; Fedorov, Alexei
2017-06-05
Inferring history from genomic sequences is challenging and problematic because chromosomes are mosaics of thousands of small Identicalby-descent (IBD) fragments, each of them having their own unique story. However, the main events in recent evolution might be deciphered from comparative analysis of numerous loci. A paradox of why humans, whose effective population size is only 10 4 , have nearly three million frequent SNPs is formulated and examined. We studied 5398 loci evenly covering all human autosomes. Common haplotypes built from frequent SNPs that are present in people from various populations have been examined. We demonstrated highly non-random arrangement of alleles in common haplotypes. Abundance of mutually exclusive pairs of common haplotypes that have different alleles at every polymorphic position (so-called Yin/Yang haplotypes) was found in 56% of loci. A novel widely spread category of common haplotypes named Mosaic has been described. Mosaic consists of numerous pieces of Yin/Yang haplotypes and represents an ancestral stage of one of them. Scenarios of possible appearance of large number of frequent human SNPs and their habitual arrangement in Yin/Yang common haplotypes have been evaluated with an advanced genomic simulation algorithm. Computer modeling demonstrated that the observed arrangement of 2.9 million frequent SNPs could not originate from a sole stand-alone population. A "Great Admixture" event has been proposed that can explain peculiarities with frequent SNP distributions. This Great Admixture presumably occurred 100-300 thousand years ago between two ancestral populations that had been separated from each other about a million years ago. Our programs and algorithms can be applied to other species to perform evolutionary and comparative genomics.
Nimmakayala, Padma; Abburi, Venkata L.; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C. V. Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K.
2016-01-01
Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum, indicating a population bottleneck during domestication of C. baccatum. In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum, 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index (FST) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9–2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers. PMID:27857720
Nimmakayala, Padma; Abburi, Venkata L; Saminathan, Thangasamy; Almeida, Aldo; Davenport, Brittany; Davidson, Joshua; Reddy, C V Chandra Mohan; Hankins, Gerald; Ebert, Andreas; Choi, Doil; Stommel, John; Reddy, Umesh K
2016-01-01
Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to characterize population structure and species domestication of these two important incompatible cultivated pepper species. Estimated mean nucleotide diversity (π) and Tajima's D across various chromosomes revealed biased distribution toward negative values on all chromosomes (except for chromosome 4) in cultivated C. baccatum , indicating a population bottleneck during domestication of C. baccatum . In contrast, C. annuum chromosomes showed positive π and Tajima's D on all chromosomes except chromosome 8, which may be because of domestication at multiple sites contributing to wider genetic diversity. For C. baccatum , 13,129 SNPs were available, with minor allele frequency (MAF) ≥0.05; PCA of the SNPs revealed 283 C. baccatum accessions grouped into 3 distinct clusters, for strong population structure. The fixation index ( F ST ) between domesticated C. annuum and C. baccatum was 0.78, which indicates genome-wide divergence. We conducted extensive linkage disequilibrium (LD) analysis of C. baccatum var. pendulum cultivars on all adjacent SNP pairs within a chromosome to identify regions of high and low LD interspersed with a genome-wide average LD block size of 99.1 kb. We characterized 1742 haplotypes containing 4420 SNPs (range 9-2 SNPs per haplotype). Genome-wide association study (GWAS) of peduncle length, a trait that differentiates wild and domesticated C. baccatum types, revealed 36 significantly associated genome-wide SNPs. Population structure, identity by state (IBS) and LD patterns across the genome will be of potential use for future GWAS of economically important traits in C. baccatum peppers.
Molecular definition of red cell Rh haplotypes by tightly linked SphI RFLPs
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, C.H.; Reid, M.E.; Chen, Y.
The Rh blood group system of human red cells contains five major antigens D, C/c, and E/e (the latter four designated {open_quotes}non-D{close_quotes}) that are specified by eight gene complexes known as Rh haplotypes. In this paper, we report on the mapping of the RH locus and identification of a set of SphI RFLPs that are tightly linked with the Rh structural genes. Using exon-specific probes, we have localized the SphI cleavage sites resulting in these DNA markers and derived a comprehensive map for the RH locus. It was found that the SphI fragments encompassing exons 4-7 of the Rh genesmore » occur in four banding patterns or frameworks that correspond to the distribution and segregation of the common Rh haplotypes. This linkage disequilibrium allowed a genotype-phenotype correlation and direct determination of Rh zygosity related to the Rh-positive or Rh-negative status (D/D, D/d, and d/d). Studies on the occurrence of SphI RFLPs in a number of rare Rh variants indicated that Rh phenotypic diversity has taken place on different haplotype backgrounds and has arisen by diverse genetic mechanisms. The molecular definition of Rh haplotypes by SphI RFLP frameworks should provide a useful procedure for genetic counseling and prenatal assessment of Rh alloimmunization. 32 refs., 7 figs., 3 tabs.« less
A global analysis of Y-chromosomal haplotype diversity for 23 STR loci
Purps, Josephine; Siegert, Sabine; Willuweit, Sascha; Nagy, Marion; Alves, Cíntia; Salazar, Renato; Angustia, Sheila M.T.; Santos, Lorna H.; Anslinger, Katja; Bayer, Birgit; Ayub, Qasim; Wei, Wei; Xue, Yali; Tyler-Smith, Chris; Bafalluy, Miriam Baeta; Martínez-Jarreta, Begoña; Egyed, Balazs; Balitzki, Beate; Tschumi, Sibylle; Ballard, David; Court, Denise Syndercombe; Barrantes, Xinia; Bäßler, Gerhard; Wiest, Tina; Berger, Burkhard; Niederstätter, Harald; Parson, Walther; Davis, Carey; Budowle, Bruce; Burri, Helen; Borer, Urs; Koller, Christoph; Carvalho, Elizeu F.; Domingues, Patricia M.; Chamoun, Wafaa Takash; Coble, Michael D.; Hill, Carolyn R.; Corach, Daniel; Caputo, Mariela; D’Amato, Maria E.; Davison, Sean; Decorte, Ronny; Larmuseau, Maarten H.D.; Ottoni, Claudio; Rickards, Olga; Lu, Di; Jiang, Chengtao; Dobosz, Tadeusz; Jonkisz, Anna; Frank, William E.; Furac, Ivana; Gehrig, Christian; Castella, Vincent; Grskovic, Branka; Haas, Cordula; Wobst, Jana; Hadzic, Gavrilo; Drobnic, Katja; Honda, Katsuya; Hou, Yiping; Zhou, Di; Li, Yan; Hu, Shengping; Chen, Shenglan; Immel, Uta-Dorothee; Lessig, Rüdiger; Jakovski, Zlatko; Ilievska, Tanja; Klann, Anja E.; García, Cristina Cano; de Knijff, Peter; Kraaijenbrink, Thirsa; Kondili, Aikaterini; Miniati, Penelope; Vouropoulou, Maria; Kovacevic, Lejla; Marjanovic, Damir; Lindner, Iris; Mansour, Issam; Al-Azem, Mouayyad; Andari, Ansar El; Marino, Miguel; Furfuro, Sandra; Locarno, Laura; Martín, Pablo; Luque, Gracia M.; Alonso, Antonio; Miranda, Luís Souto; Moreira, Helena; Mizuno, Natsuko; Iwashima, Yasuki; Neto, Rodrigo S. Moura; Nogueira, Tatiana L.S.; Silva, Rosane; Nastainczyk-Wulf, Marina; Edelmann, Jeanett; Kohl, Michael; Nie, Shengjie; Wang, Xianping; Cheng, Baowen; Núñez, Carolina; Pancorbo, Marian Martínez de; Olofsson, Jill K.; Morling, Niels; Onofri, Valerio; Tagliabracci, Adriano; Pamjav, Horolma; Volgyi, Antonia; Barany, Gusztav; Pawlowski, Ryszard; Maciejewska, Agnieszka; Pelotti, Susi; Pepinski, Witold; Abreu-Glowacka, Monica; Phillips, Christopher; Cárdenas, Jorge; Rey-Gonzalez, Danel; Salas, Antonio; Brisighelli, Francesca; Capelli, Cristian; Toscanini, Ulises; Piccinini, Andrea; Piglionica, Marilidia; Baldassarra, Stefania L.; Ploski, Rafal; Konarzewska, Magdalena; Jastrzebska, Emila; Robino, Carlo; Sajantila, Antti; Palo, Jukka U.; Guevara, Evelyn; Salvador, Jazelyn; Ungria, Maria Corazon De; Rodriguez, Jae Joseph Russell; Schmidt, Ulrike; Schlauderer, Nicola; Saukko, Pekka; Schneider, Peter M.; Sirker, Miriam; Shin, Kyoung-Jin; Oh, Yu Na; Skitsa, Iulia; Ampati, Alexandra; Smith, Tobi-Gail; Calvit, Lina Solis de; Stenzl, Vlastimil; Capal, Thomas; Tillmar, Andreas; Nilsson, Helena; Turrina, Stefania; De Leo, Domenico; Verzeletti, Andrea; Cortellini, Venusia; Wetton, Jon H.; Gwynne, Gareth M.; Jobling, Mark A.; Whittle, Martin R.; Sumita, Denilce R.; Wolańska-Nowak, Paulina; Yong, Rita Y.Y.; Krawczak, Michael; Nothnagel, Michael; Roewer, Lutz
2014-01-01
In a worldwide collaborative effort, 19,630 Y-chromosomes were sampled from 129 different populations in 51 countries. These chromosomes were typed for 23 short-tandem repeat (STR) loci (DYS19, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS385ab, DYS437, DYS438, DYS439, DYS448, DYS456, DYS458, DYS635, GATAH4, DYS481, DYS533, DYS549, DYS570, DYS576, and DYS643) and using the PowerPlex Y23 System (PPY23, Promega Corporation, Madison, WI). Locus-specific allelic spectra of these markers were determined and a consistently high level of allelic diversity was observed. A considerable number of null, duplicate and off-ladder alleles were revealed. Standard single-locus and haplotype-based parameters were calculated and compared between subsets of Y-STR markers established for forensic casework. The PPY23 marker set provides substantially stronger discriminatory power than other available kits but at the same time reveals the same general patterns of population structure as other marker sets. A strong correlation was observed between the number of Y-STRs included in a marker set and some of the forensic parameters under study. Interestingly a weak but consistent trend toward smaller genetic distances resulting from larger numbers of markers became apparent. PMID:24854874
A global analysis of Y-chromosomal haplotype diversity for 23 STR loci.
Purps, Josephine; Siegert, Sabine; Willuweit, Sascha; Nagy, Marion; Alves, Cíntia; Salazar, Renato; Angustia, Sheila M T; Santos, Lorna H; Anslinger, Katja; Bayer, Birgit; Ayub, Qasim; Wei, Wei; Xue, Yali; Tyler-Smith, Chris; Bafalluy, Miriam Baeta; Martínez-Jarreta, Begoña; Egyed, Balazs; Balitzki, Beate; Tschumi, Sibylle; Ballard, David; Court, Denise Syndercombe; Barrantes, Xinia; Bäßler, Gerhard; Wiest, Tina; Berger, Burkhard; Niederstätter, Harald; Parson, Walther; Davis, Carey; Budowle, Bruce; Burri, Helen; Borer, Urs; Koller, Christoph; Carvalho, Elizeu F; Domingues, Patricia M; Chamoun, Wafaa Takash; Coble, Michael D; Hill, Carolyn R; Corach, Daniel; Caputo, Mariela; D'Amato, Maria E; Davison, Sean; Decorte, Ronny; Larmuseau, Maarten H D; Ottoni, Claudio; Rickards, Olga; Lu, Di; Jiang, Chengtao; Dobosz, Tadeusz; Jonkisz, Anna; Frank, William E; Furac, Ivana; Gehrig, Christian; Castella, Vincent; Grskovic, Branka; Haas, Cordula; Wobst, Jana; Hadzic, Gavrilo; Drobnic, Katja; Honda, Katsuya; Hou, Yiping; Zhou, Di; Li, Yan; Hu, Shengping; Chen, Shenglan; Immel, Uta-Dorothee; Lessig, Rüdiger; Jakovski, Zlatko; Ilievska, Tanja; Klann, Anja E; García, Cristina Cano; de Knijff, Peter; Kraaijenbrink, Thirsa; Kondili, Aikaterini; Miniati, Penelope; Vouropoulou, Maria; Kovacevic, Lejla; Marjanovic, Damir; Lindner, Iris; Mansour, Issam; Al-Azem, Mouayyad; Andari, Ansar El; Marino, Miguel; Furfuro, Sandra; Locarno, Laura; Martín, Pablo; Luque, Gracia M; Alonso, Antonio; Miranda, Luís Souto; Moreira, Helena; Mizuno, Natsuko; Iwashima, Yasuki; Neto, Rodrigo S Moura; Nogueira, Tatiana L S; Silva, Rosane; Nastainczyk-Wulf, Marina; Edelmann, Jeanett; Kohl, Michael; Nie, Shengjie; Wang, Xianping; Cheng, Baowen; Núñez, Carolina; Pancorbo, Marian Martínez de; Olofsson, Jill K; Morling, Niels; Onofri, Valerio; Tagliabracci, Adriano; Pamjav, Horolma; Volgyi, Antonia; Barany, Gusztav; Pawlowski, Ryszard; Maciejewska, Agnieszka; Pelotti, Susi; Pepinski, Witold; Abreu-Glowacka, Monica; Phillips, Christopher; Cárdenas, Jorge; Rey-Gonzalez, Danel; Salas, Antonio; Brisighelli, Francesca; Capelli, Cristian; Toscanini, Ulises; Piccinini, Andrea; Piglionica, Marilidia; Baldassarra, Stefania L; Ploski, Rafal; Konarzewska, Magdalena; Jastrzebska, Emila; Robino, Carlo; Sajantila, Antti; Palo, Jukka U; Guevara, Evelyn; Salvador, Jazelyn; Ungria, Maria Corazon De; Rodriguez, Jae Joseph Russell; Schmidt, Ulrike; Schlauderer, Nicola; Saukko, Pekka; Schneider, Peter M; Sirker, Miriam; Shin, Kyoung-Jin; Oh, Yu Na; Skitsa, Iulia; Ampati, Alexandra; Smith, Tobi-Gail; Calvit, Lina Solis de; Stenzl, Vlastimil; Capal, Thomas; Tillmar, Andreas; Nilsson, Helena; Turrina, Stefania; De Leo, Domenico; Verzeletti, Andrea; Cortellini, Venusia; Wetton, Jon H; Gwynne, Gareth M; Jobling, Mark A; Whittle, Martin R; Sumita, Denilce R; Wolańska-Nowak, Paulina; Yong, Rita Y Y; Krawczak, Michael; Nothnagel, Michael; Roewer, Lutz
2014-09-01
In a worldwide collaborative effort, 19,630 Y-chromosomes were sampled from 129 different populations in 51 countries. These chromosomes were typed for 23 short-tandem repeat (STR) loci (DYS19, DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393, DYS385ab, DYS437, DYS438, DYS439, DYS448, DYS456, DYS458, DYS635, GATAH4, DYS481, DYS533, DYS549, DYS570, DYS576, and DYS643) and using the PowerPlex Y23 System (PPY23, Promega Corporation, Madison, WI). Locus-specific allelic spectra of these markers were determined and a consistently high level of allelic diversity was observed. A considerable number of null, duplicate and off-ladder alleles were revealed. Standard single-locus and haplotype-based parameters were calculated and compared between subsets of Y-STR markers established for forensic casework. The PPY23 marker set provides substantially stronger discriminatory power than other available kits but at the same time reveals the same general patterns of population structure as other marker sets. A strong correlation was observed between the number of Y-STRs included in a marker set and some of the forensic parameters under study. Interestingly a weak but consistent trend toward smaller genetic distances resulting from larger numbers of markers became apparent. Copyright © 2014 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.
Tyagi, Suchi; Das, Aparup
2015-09-01
Inference on the genetic diversity of Plasmodium falciparum populations could help in better management of malaria. A very recent study with mitochondrial (mt) genomes in global P. falciparum had revealed interesting evolutionary genetic patterns of Indian isolates in comparison to global ones. However, no population genetic study using the whole mt genome sequences of P. falciparum isolates collected in the entire distribution range in India has yet been performed. We herewith have analyzed 85 whole mt genomes (48 already published and 37 entirely new) sampled from eight differentially endemic Indian locations to estimate genetic diversity and infer population structure and historical demography of Indian P. falciparum. We found 19 novel Indian-specific Single Nucleotide Polymorphisms (SNPs) and 22 novel haplotypes segregating in Indian P. falciparum. Accordingly, high haplotype and nucleotide diversities were detected in Indian P. falciparum in comparison to many other global isolates. Indian P. falciparum populations were found to be moderately sub-structured with four different genetic clusters. Interestingly, group of local populations aggregate to form each cluster; while samples from Jharkhand and Odisha formed a single cluster, P. falciparum isolates from Asom formed an independent one. Similarly, Surat, Bilaspur and Betul formed a single cluster and Goa and Mangalore formed another. Interestingly, P. falciparum isolates from the two later populations were significantly genetically differentiated from isolates collected in other six Indian locations. Signature of historical population expansion was evident in five population samples, and the onset of expansion event was found to be very similar to African P. falciparum. In agreement with the previous finding, the estimated Time to Most Recent Common Ancestor (TMRCA) and the effective population size were high in Indian P. falciparum. All these genetic features of Indian P. falciparum with high mt genome
Three Novel Haplotypes of Theileria bicornis in Black and White Rhinoceros in Kenya.
Otiende, M Y; Kivata, M W; Jowers, M J; Makumi, J N; Runo, S; Obanda, V; Gakuya, F; Mutinda, M; Kariuki, L; Alasaad, S
2016-02-01
Piroplasms, especially those in the genera Babesia and Theileria, have been found to naturally infect rhinoceros. Due to natural or human-induced stress factors such as capture and translocations, animals often develop fatal clinical piroplasmosis, which causes death if not treated. This study examines the genetic diversity and occurrence of novel Theileria species infecting both black and white rhinoceros in Kenya. Samples collected opportunistically during routine translocations and clinical interventions from 15 rhinoceros were analysed by polymerase chain reaction (PCR) using a nested amplification of the small subunit ribosomal RNA (18S rRNA) gene fragments of Babesia and Theileria. Our study revealed for the first time in Kenya the presence of Theileria bicornis in white (Ceratotherium simum simum) and black (Diceros bicornis michaeli) rhinoceros and the existence of three new haplotypes: haplotypes H1 and H3 were present in white rhinoceros, while H2 was present in black rhinoceros. No specific haplotype was correlated to any specific geographical location. The Bayesian inference 50% consensus phylogram recovered the three haplotypes monophyleticly, and Theileria bicornis had very high support (BPP: 0.98). Furthermore, the genetic p-uncorrected distances and substitutions between T. bicornis and the three haplotypes were the same in all three haplotypes, indicating a very close genetic affinity. This is the first report of the occurrence of Theileria species in white and black rhinoceros from Kenya. The three new haplotypes reported here for the first time have important ecological and conservational implications, especially for population management and translocation programs and as a means of avoiding the transport of infected animals into non-affected areas. © 2014 Blackwell Verlag GmbH.
In Vivo Characterization of Human APOA5 Haplotypes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahituv, Nadav; Akiyama, Jennifer; Chapman-Helleboid, Audrey
2006-10-01
Increased plasma triglycerides concentrations are an independent risk factor for cardiovascular disease. Numerous studies support a reproducible genetic association between two minor haplotypes in the human apolipoprotein A5 gene (APOA5) and increased plasma triglyceride concentrations. We thus sought to investigate the effect of these minor haplotypes (APOA5*2 and APOA5*3) on ApoAV plasma levels through the precise insertion of single-copy intact APOA5 haplotypes at a targeted location in the mouse genome. While we found no difference in the amount of human plasma ApoAV in mice containing the common APOA5*1 and minor APOA5*2 haplotype, the introduction of the single APOA5*3 defining allelemore » (19W) resulted in 3-fold lower ApoAV plasma levels consistent with existing genetic association studies. These results indicate that S19W polymorphism is likely to be functional and explain the strong association of this variant with plasma triglycerides supporting the value of sensitive in vivo assays to define the functional nature of human haplotypes.« less
Mofiz, Ehtesham; Seemann, Torsten; Bahlo, Melanie; Holt, Deborah; Currie, Bart J; Fischer, Katja; Papenfuss, Anthony T
2016-02-01
The scabies mite, Sarcoptes scabiei, is an obligate parasite of the skin that infects humans and other animal species, causing scabies, a contagious disease characterized by extreme itching. Scabies infections are a major health problem, particularly in remote Indigenous communities in Australia, where co-infection of epidermal scabies lesions by Group A Streptococci or Staphylococcus aureus is thought to be responsible for the high rate of rheumatic heart disease and chronic kidney disease. We collected and separately sequenced mite DNA from several pools of thousands of whole mites from a porcine model of scabies (S. scabiei var. suis) and two human patients (S. scabiei var. hominis) living in different regions of northern Australia. Our sequencing samples the mite and its metagenome, including the mite gut flora and the wound micro-environment. Here, we describe the mitochondrial genome of the scabies mite. We developed a new de novo assembly pipeline based on a bait-and-reassemble strategy, which produced a 14 kilobase mitochondrial genome sequence assembly. We also annotated 35 genes and have compared these to other Acari mites. We identified single nucleotide polymorphisms (SNPs) and used these to infer the presence of six haplogroups in our samples, Remarkably, these fall into two closely-related clades with one clade including both human and pig varieties. This supports earlier findings that only limited genetic differences may separate some human and animal varieties, and raises the possibility of cross-host infections. Finally, we used these mitochondrial haplotypes to show that the genetic diversity of individual infections is typically small with 1-3 distinct haplotypes per infestation.
Haplotype diversity of the myostatin gene among beef cattle breeds
Dunner, Susana; Miranda, M Eugenia; Amigues, Yves; Cañón, Javier; Georges, Michel; Hanset, Roger; Williams, John; Ménissier, François
2003-01-01
A total of 678 individuals from 28 European bovine breeds were both phenotyped and analysed at the myostatin locus by the Single Strand Conformation Polymorphism (SSCP) method. Seven new mutations were identified which contribute to the high polymorphism (1 SNP every 100 bp) present in this small gene; twenty haplotypes were described and a genotyping method was set up using the Oligonucleotide Ligation Assay (OLA) method. Some haplotypes appeared to be exclusive to a particular breed; this was the case for 5 in the Charolaise (involving mutation Q204X) and 7 in the Maine-Anjou (involving mutation E226X). The relationships between the different haplotypes were studied, thus allowing to test the earlier hypothesis on the origin of muscular hypertrophy in Europe: muscular hypertrophy (namely nt821(del11)) was mainly spread in different waves from northern Europe milk purpose populations in most breeds; however, other mutations (mostly disruptive) arose in a single breed, were highly selected and have since scarcely evolved to other populations. PMID:12605853
Pool, John E.; Corbett-Detig, Russell B.; Sugino, Ryuichi P.; Stevens, Kristian A.; Cardeno, Charis M.; Crepeau, Marc W.; Duchen, Pablo; Emerson, J. J.; Saelao, Perot; Begun, David J.; Langley, Charles H.
2012-01-01
Drosophila melanogaster has played a pivotal role in the development of modern population genetics. However, many basic questions regarding the demographic and adaptive history of this species remain unresolved. We report the genome sequencing of 139 wild-derived strains of D. melanogaster, representing 22 population samples from the sub-Saharan ancestral range of this species, along with one European population. Most genomes were sequenced above 25X depth from haploid embryos. Results indicated a pervasive influence of non-African admixture in many African populations, motivating the development and application of a novel admixture detection method. Admixture proportions varied among populations, with greater admixture in urban locations. Admixture levels also varied across the genome, with localized peaks and valleys suggestive of a non-neutral introgression process. Genomes from the same location differed starkly in ancestry, suggesting that isolation mechanisms may exist within African populations. After removing putatively admixed genomic segments, the greatest genetic diversity was observed in southern Africa (e.g. Zambia), while diversity in other populations was largely consistent with a geographic expansion from this potentially ancestral region. The European population showed different levels of diversity reduction on each chromosome arm, and some African populations displayed chromosome arm-specific diversity reductions. Inversions in the European sample were associated with strong elevations in diversity across chromosome arms. Genomic scans were conducted to identify loci that may represent targets of positive selection within an African population, between African populations, and between European and African populations. A disproportionate number of candidate selective sweep regions were located near genes with varied roles in gene regulation. Outliers for Europe-Africa FST were found to be enriched in genomic regions of locally elevated cosmopolitan
Detecting and characterizing genomic signatures of positive selection in global populations.
Liu, Xuanyao; Ong, Rick Twee-Hee; Pillai, Esakimuthu Nisha; Elzein, Abier M; Small, Kerrin S; Clark, Taane G; Kwiatkowski, Dominic P; Teo, Yik-Ying
2013-06-06
Natural selection is a significant force that shapes the architecture of the human genome and introduces diversity across global populations. The question of whether advantageous mutations have arisen in the human genome as a result of single or multiple mutation events remains unanswered except for the fact that there exist a handful of genes such as those that confer lactase persistence, affect skin pigmentation, or cause sickle cell anemia. We have developed a long-range-haplotype method for identifying genomic signatures of positive selection to complement existing methods, such as the integrated haplotype score (iHS) or cross-population extended haplotype homozygosity (XP-EHH), for locating signals across the entire allele frequency spectrum. Our method also locates the founder haplotypes that carry the advantageous variants and infers their corresponding population frequencies. This presents an opportunity to systematically interrogate the whole human genome whether a selection signal shared across different populations is the consequence of a single mutation process followed subsequently by gene flow between populations or of convergent evolution due to the occurrence of multiple independent mutation events either at the same variant or within the same gene. The application of our method to data from 14 populations across the world revealed that positive-selection events tend to cluster in populations of the same ancestry. Comparing the founder haplotypes for events that are present across different populations revealed that convergent evolution is a rare occurrence and that the majority of shared signals stem from the same evolutionary event. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Qin, Qi-Long; Xie, Bin-Bin; Yu, Yong; Shu, Yan-Li; Rong, Jin-Cheng; Zhang, Yan-Jiao; Zhao, Dian-Li; Chen, Xiu-Lan; Zhang, Xi-Ying; Chen, Bo; Zhou, Bai-Cheng; Zhang, Yu-Zhong
2014-06-01
To what extent the genomes of different species belonging to one genus can be diverse and the relationship between genomic differentiation and environmental factor remain unclear for oceanic bacteria. With many new bacterial genera and species being isolated from marine environments, this question warrants attention. In this study, we sequenced all the type strains of the published species of Glaciecola, a recently defined cold-adapted genus with species from diverse marine locations, to study the genomic diversity and cold-adaptation strategy in this genus.The genome size diverged widely from 3.08 to 5.96 Mb, which can be explained by massive gene gain and loss events. Horizontal gene transfer and new gene emergence contributed substantially to the genome size expansion. The genus Glaciecola had an open pan-genome. Comparative genomic research indicated that species of the genus Glaciecola had high diversity in genome size, gene content and genetic relatedness. This may be prevalent in marine bacterial genera considering the dynamic and complex environments of the ocean. Species of Glaciecola had some common genomic features related to cold adaptation, which enable them to thrive and play a role in biogeochemical cycle in the cold marine environments.
Weiss, Eric R; Lamers, Susanna L; Henderson, Jennifer L; Melnikov, Alexandre; Somasundaran, Mohan; Garber, Manuel; Selin, Liisa; Nusbaum, Chad; Luzuriaga, Katherine
2018-01-15
Over 90% of the world's population is persistently infected with Epstein-Barr virus. While EBV does not cause disease in most individuals, it is the common cause of acute infectious mononucleosis (AIM) and has been associated with several cancers and autoimmune diseases, highlighting a need for a preventive vaccine. At present, very few primary, circulating EBV genomes have been sequenced directly from infected individuals. While low levels of diversity and low viral evolution rates have been predicted for double-stranded DNA (dsDNA) viruses, recent studies have demonstrated appreciable diversity in common dsDNA pathogens (e.g., cytomegalovirus). Here, we report 40 full-length EBV genome sequences obtained from matched oral wash and B cell fractions from a cohort of 10 AIM patients. Both intra- and interpatient diversity were observed across the length of the entire viral genome. Diversity was most pronounced in viral genes required for establishing latent infection and persistence, with appreciable levels of diversity also detected in structural genes, including envelope glycoproteins. Interestingly, intrapatient diversity declined significantly over time ( P < 0.01), and this was particularly evident on comparison of viral genomes sequenced from B cell fractions in early primary infection and convalescence ( P < 0.001). B cell-associated viral genomes were observed to converge, becoming nearly identical to the B95.8 reference genome over time (Spearman rank-order correlation test; r = -0.5589, P = 0.0264). The reduction in diversity was most marked in the EBV latency genes. In summary, our data suggest independent convergence of diverse viral genome sequences toward a reference-like strain within a relatively short period following primary EBV infection. IMPORTANCE Identification of viral proteins with low variability and high immunogenicity is important for the development of a protective vaccine. Knowledge of genome diversity within circulating viral
Genome surfing as driver of microbial genomic diversity
USDA-ARS?s Scientific Manuscript database
Historical changes in population size, such as those caused by demographic range expansions, can produce nonadaptive changes in genomic diversity through mechanisms such as gene surfing. We propose that demographic range expansion of a microbial population capable of horizontal gene exchange can res...
Compound haplotypes at Xp11.23 and human population growth in Eurasia.
Alonso, S; Armour, J A L
2004-09-01
To investigate patterns of diversity and the evolutionary history of Eurasians, we have sequenced a 2.8 kb region at Xp11.23 in a sample of African and Eurasian chromosomes. This region is in a long intron of CLCN5 and is immediately flanked by a highly variable minisatellite, DXS255, and a human-specific Ta0 LINE. Compared to Africans, Eurasians showed a marked reduction in sequence diversity. The main Euro-Asiatic haplotype seems to be the ancestral haplotype for the whole sample. Coalescent simulations, including recombination and exponential growth, indicate a median length of strong linkage disequilibrium, up to approximately 9 kb for this area. The Ka/Ks ratio between the coding sequence of human CLCN5 and its mouse orthologue is much less than 1. This implies that the region sequenced is unlikely to be under the strong influence of positive selective processes on CLCN5, mutations in which have been associated with disorders such as Dent's disease. In contrast, a scenario based on a population bottleneck and exponential growth seems a more likely explanation for the reduced diversity observed in Eurasians. Coalescent analysis and linked minisatellite diversity (which reaches a gene diversity value greater than 98% in Eurasians) suggest an estimated age of origin of the Euro-Asiatic diversity compatible with a recent out-of-Africa model for colonization of Eurasia by modern Homo sapiens.
Ahmed, Md Atique; Fauzi, Muh; Han, Eun-Taek
2018-03-14
Human infections due to the monkey malaria parasite Plasmodium knowlesi is on the rise in most Southeast Asian countries specifically Malaysia. The C-terminal 19 kDa domain of PvMSP1P is a potential vaccine candidate, however, no study has been conducted in the orthologous gene of P. knowlesi. This study investigates level of polymorphisms, haplotypes and natural selection of full-length pkmsp1p in clinical samples from Malaysia. A total of 36 full-length pkmsp1p sequences along with the reference H-strain and 40 C-terminal pkmsp1p sequences from clinical isolates of Malaysia were downloaded from published genomes. Genetic diversity, polymorphism, haplotype and natural selection were determined using DnaSP 5.10 and MEGA 5.0 software. Genealogical relationships were determined using haplotype network tree in NETWORK software v5.0. Population genetic differentiation index (F ST ) and population structure of parasite was determined using Arlequin v3.5 and STRUCTURE v2.3.4 software. Comparison of 36 full-length pkmsp1p sequences along with the H-strain identified 339 SNPs (175 non-synonymous and 164 synonymous substitutions). The nucleotide diversity across the full-length gene was low compared to its ortholog pvmsp1p. The nucleotide diversity was higher toward the N-terminal domains (pkmsp1p-83 and 30) compared to the C-terminal domains (pkmsp1p-38, 33 and 19). Phylogenetic analysis of full-length genes identified 2 distinct clusters of P. knowlesi from Malaysian Borneo. The 40 pkmsp1p-19 sequences showed low polymorphisms with 16 polymorphisms leading to 18 haplotypes. In total there were 10 synonymous and 6 non-synonymous substitutions and 12 cysteine residues were intact within the two EGF domains. Evidence of strong purifying selection was observed within the full-length sequences as well in all the domains. Shared haplotypes of 40 pkmsp1p-19 were identified within Malaysian Borneo haplotypes. This study is the first to report on the genetic diversity and natural
Seeleuthner, Yoann; Mondy, Samuel; Lombard, Vincent; Carradec, Quentin; Pelletier, Eric; Wessner, Marc; Leconte, Jade; Mangot, Jean-François; Poulain, Julie; Labadie, Karine; Logares, Ramiro; Sunagawa, Shinichi; de Berardinis, Véronique; Salanoubat, Marcel; Dimier, Céline; Kandels-Lewis, Stefanie; Picheral, Marc; Searson, Sarah; Pesant, Stephane; Poulton, Nicole; Stepanauskas, Ramunas; Bork, Peer; Bowler, Chris; Hingamp, Pascal; Sullivan, Matthew B; Iudicone, Daniele; Massana, Ramon; Aury, Jean-Marc; Henrissat, Bernard; Karsenti, Eric; Jaillon, Olivier; Sieracki, Mike; de Vargas, Colomban; Wincker, Patrick
2018-01-22
Single-celled eukaryotes (protists) are critical players in global biogeochemical cycling of nutrients and energy in the oceans. While their roles as primary producers and grazers are well appreciated, other aspects of their life histories remain obscure due to challenges in culturing and sequencing their natural diversity. Here, we exploit single-cell genomics and metagenomics data from the circumglobal Tara Oceans expedition to analyze the genome content and apparent oceanic distribution of seven prevalent lineages of uncultured heterotrophic stramenopiles. Based on the available data, each sequenced genome or genotype appears to have a specific oceanic distribution, principally correlated with water temperature and depth. The genome content provides hypotheses for specialization in terms of cell motility, food spectra, and trophic stages, including the potential impact on their lifestyles of horizontal gene transfer from prokaryotes. Our results support the idea that prominent heterotrophic marine protists perform diverse functions in ocean ecology.
Morin, Phillip A; Foote, Andrew D; Baker, Charles Scott; Hancock-Hanser, Brittany L; Kaschner, Kristin; Mate, Bruce R; Mesnick, Sarah L; Pease, Victoria L; Rosel, Patricia E; Alexander, Alana
2018-06-01
Mitochondrial DNA has been heavily utilized in phylogeography studies for several decades. However, underlying patterns of demography and phylogeography may be misrepresented due to coalescence stochasticity, selection, variation in mutation rates and cultural hitchhiking (linkage of genetic variation to culturally-transmitted traits affecting fitness). Cultural hitchhiking has been suggested as an explanation for low genetic diversity in species with strong social structures, counteracting even high mobility, abundance and limited barriers to dispersal. One such species is the sperm whale, which shows very limited phylogeographic structure and low mtDNA diversity despite a worldwide distribution and large population. Here, we use analyses of 175 globally distributed mitogenomes and three nuclear genomes to evaluate hypotheses of a population bottleneck/expansion vs. a selective sweep due to cultural hitchhiking or selection on mtDNA as the mechanism contributing to low worldwide mitochondrial diversity in sperm whales. In contrast to mtDNA control region (CR) data, mitogenome haplotypes are largely ocean-specific, with only one of 80 shared between the Atlantic and Pacific. Demographic analyses of nuclear genomes suggest low mtDNA diversity is consistent with a global reduction in population size that ended approximately 125,000 years ago, correlated with the Eemian interglacial. Phylogeographic analysis suggests that extant sperm whales descend from maternal lineages endemic to the Pacific during the period of reduced abundance and have subsequently colonized the Atlantic several times. Results highlight the apparent impact of past climate change, and suggest selection and hitchhiking are not the sole processes responsible for low mtDNA diversity in this highly social species. © 2018 John Wiley & Sons Ltd.
Occurrence of 15 Haplotypes of Linepithema micans (Hymenoptera: Formicidae) in Southern Brazil.
Ramalho, Manuela Oliveira; Martins, C; Campos, T; Nondillo, A; Botton, M; Bueno, O C
2017-08-01
The ant genus Linepithema is widely known, thanks to the pest species Linepithema humile (Mayr), which is easily mistaken for Linepithema micans (Forel) due to their morphological similarity. Like L. humile, L. micans is associated to the main grapevine pest in Brazil, Eurhizococcus brasiliensis (Wille), also known as ground pearl. Therefore, the present study uses mtDNA fragments to expand the knowledge of haplotype diversity and distribution of L. micans in the state of Rio Grande do Sul (Brazil), to understand the genetic differences of the populations identified in this study. We identified 15 haplotypes of L. micans spread across different localities. Twelve of these haplotypes were new for the species. The high haplotype diversity uncovered in Rio Grande do Sul (Brazil) for this species was predictable, as L. micans is in its native environment. Additional studies that take gene flow into account may reveal interesting aspects of diversity in these populations. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Potter, Kevin M; Hipkins, Valerie D; Mahalovich, Mary F; Means, Robert E
2013-08-01
Ponderosa pine (Pinus ponderosa Douglas ex P. Lawson & C. Lawson) exhibits complicated patterns of morphological and genetic variation across its range in western North America. This study aims to clarify P. ponderosa evolutionary history and phylogeography using a highly polymorphic mitochondrial DNA marker, with results offering insights into how geographical and climatological processes drove the modern evolutionary structure of tree species in the region. We amplified the mtDNA nad1 second intron minisatellite region for 3,100 trees representing 104 populations, and sequenced all length variants. We estimated population-level haplotypic diversity and determined diversity partitioning among varieties, races and populations. After aligning sequences of minisatellite repeat motifs, we evaluated evolutionary relationships among haplotypes. The geographical structuring of the 10 haplotypes corresponded with division between Pacific and Rocky Mountain varieties. Pacific haplotypes clustered with high bootstrap support, and appear to have descended from Rocky Mountain haplotypes. A greater proportion of diversity was partitioned between Rocky Mountain races than between Pacific races. Areas of highest haplotypic diversity were the southern Sierra Nevada mountain range in California, northwestern California, and southern Nevada. Pinus ponderosa haplotype distribution patterns suggest a complex phylogeographic history not revealed by other genetic and morphological data, or by the sparse paleoecological record. The results appear consistent with long-term divergence between the Pacific and Rocky Mountain varieties, along with more recent divergences not well-associated with race. Pleistocene refugia may have existed in areas of high haplotypic diversity, as well as the Great Basin, Southwestern United States/northern Mexico, and the High Plains.
Development of forensic-quality full mtGenome haplotypes: success rates with low template specimens.
Just, Rebecca S; Scheible, Melissa K; Fast, Spence A; Sturk-Andreaggi, Kimberly; Higginbotham, Jennifer L; Lyons, Elizabeth A; Bush, Jocelyn M; Peck, Michelle A; Ring, Joseph D; Diegoli, Toni M; Röck, Alexander W; Huber, Gabriela E; Nagl, Simone; Strobl, Christina; Zimmermann, Bettina; Parson, Walther; Irwin, Jodi A
2014-05-01
Forensic mitochondrial DNA (mtDNA) testing requires appropriate, high quality reference population data for estimating the rarity of questioned haplotypes and, in turn, the strength of the mtDNA evidence. Available reference databases (SWGDAM, EMPOP) currently include information from the mtDNA control region; however, novel methods that quickly and easily recover mtDNA coding region data are becoming increasingly available. Though these assays promise to both facilitate the acquisition of mitochondrial genome (mtGenome) data and maximize the general utility of mtDNA testing in forensics, the appropriate reference data and database tools required for their routine application in forensic casework are lacking. To address this deficiency, we have undertaken an effort to: (1) increase the large-scale availability of high-quality entire mtGenome reference population data, and (2) improve the information technology infrastructure required to access/search mtGenome data and employ them in forensic casework. Here, we describe the application of a data generation and analysis workflow to the development of more than 400 complete, forensic-quality mtGenomes from low DNA quantity blood serum specimens as part of a U.S. National Institute of Justice funded reference population databasing initiative. We discuss the minor modifications made to a published mtGenome Sanger sequencing protocol to maintain a high rate of throughput while minimizing manual reprocessing with these low template samples. The successful use of this semi-automated strategy on forensic-like samples provides practical insight into the feasibility of producing complete mtGenome data in a routine casework environment, and demonstrates that large (>2kb) mtDNA fragments can regularly be recovered from high quality but very low DNA quantity specimens. Further, the detailed empirical data we provide on the amplification success rates across a range of DNA input quantities will be useful moving forward as PCR
Allelic and haplotypic diversity of HLA-A, -B, -C, -DRB1, and -DQB1 genes in the Korean population.
Lee, K W; Oh, D H; Lee, C; Yang, S Y
2005-05-01
High-resolution human leukocyte antigen (HLA) typing exposes the unique patterns of HLA allele and haplotype frequencies in each population. In this study, HLA-A, -B, -C, -DRB1, and -DQB1 genotypes were analyzed in 485 apparently unrelated healthy Korean individuals. A total of 20 HLA-A, 43 HLA-B, 21 HLA-C, 31 HLA-DRB1, and 14 HLA-DQB1 alleles were identified. Eleven alleles (A*0201, A*1101, A*2402, A*3303, B*1501, Cw*0102, Cw*0302, Cw*0303, DQB1*0301, DQB1*0302, and DQB1*0303) were found in more than 10% of the population. In each serologic group, a maximum of three alleles were found with several exceptions (A2, B62, DR4, DR14, and DQ6). In each serologic group exhibiting multiple alleles, two major alleles were present at 62-96% (i.e. A*0201 and A*0206 comprise 85% of A2-positive alleles). Multiple-locus haplotypes estimated by the maximum likelihood method revealed 51 A-C, 43 C-B, 52 B-DRB1, 34 DRB1-DQB1, 48 A-C-B, 42 C-B-DRB1, 46 B-DRB1-DQB1, and 30 A-C-B-DRB1-DQB1 haplotypes with frequencies of more than 0.5%. In spite of their high polymorphism in B and DRB1, identification of relatively small numbers of two-locus (B-C and DRB1-DQB1) haplotypes suggested strong associations of those two loci, respectively. Five-locus haplotypes defined by high-resolution DNA typing correlated well with previously identified serology-based haplotypes in the population. The five most frequent haplotypes were: A*3303-Cw*1403-B*4403-DRB1*1302-DQB1*0604 (4.2%), A*3303-Cw*0701/6-B*4403-DRB1*0701-DQB1*0201/2 (3.0%), A*3303-Cw*0302-B*5801-DRB1*1302-DQB1*0609 (3.0%), A*2402-Cw*0702-B*0702-DRB1*0101-DQB1*0501 (2.9%), and A*3001-Cw*0602-B*1302-DRB1*0701-DQB1*0201/2 (2.7%). Several sets of allele level haplotypes that could not be discriminated by routine HLA-A, -B, and -DRB1 low-resolution typing originated from allelic diversity of A2, B61, DR4, and DR8 serologic groups. Information obtained in this study will be useful for medical and forensic applications as well as in anthropology.
Inference of Population Structure using Dense Haplotype Data
Lawson, Daniel John; Hellenthal, Garrett
2012-01-01
The advent of genome-wide dense variation data provides an opportunity to investigate ancestry in unprecedented detail, but presents new statistical challenges. We propose a novel inference framework that aims to efficiently capture information on population structure provided by patterns of haplotype similarity. Each individual in a sample is considered in turn as a recipient, whose chromosomes are reconstructed using chunks of DNA donated by the other individuals. Results of this “chromosome painting” can be summarized as a “coancestry matrix,” which directly reveals key information about ancestral relationships among individuals. If markers are viewed as independent, we show that this matrix almost completely captures the information used by both standard Principal Components Analysis (PCA) and model-based approaches such as STRUCTURE in a unified manner. Furthermore, when markers are in linkage disequilibrium, the matrix combines information across successive markers to increase the ability to discern fine-scale population structure using PCA. In parallel, we have developed an efficient model-based approach to identify discrete populations using this matrix, which offers advantages over PCA in terms of interpretability and over existing clustering algorithms in terms of speed, number of separable populations, and sensitivity to subtle population structure. We analyse Human Genome Diversity Panel data for 938 individuals and 641,000 markers, and we identify 226 populations reflecting differences on continental, regional, local, and family scales. We present multiple lines of evidence that, while many methods capture similar information among strongly differentiated groups, more subtle population structure in human populations is consistently present at a much finer level than currently available geographic labels and is only captured by the haplotype-based approach. The software used for this article, ChromoPainter and fineSTRUCTURE, is available from
Detecting local haplotype sharing and haplotype association
USDA-ARS?s Scientific Manuscript database
A novel haplotype association method is presented, and its power is demonstrated. Relying on a statistical model for linkage disequilibrium (LD), the method first infers ancestral haplotypes and their loadings at each marker for each individual. The loadings are then used to quantify local haplotype...
Diverse Class 2 CRISPR-Cas Effector Proteins for Genome Engineering Applications.
Pyzocha, Neena K; Chen, Sidi
2018-02-16
CRISPR-Cas genome editing technologies have revolutionized modern molecular biology by making targeted DNA edits simple and scalable. These technologies are developed by domesticating naturally occurring microbial adaptive immune systems that display wide diversity of functionality for targeted nucleic acid cleavage. Several CRISPR-Cas single effector enzymes have been characterized and engineered for use in mammalian cells. The unique properties of the single effector enzymes can make a critical difference in experimental use or targeting specificity. This review describes known single effector enzymes and discusses their use in genome engineering applications.
Mofiz, Ehtesham; Seemann, Torsten; Bahlo, Melanie; Holt, Deborah; Currie, Bart J.
2016-01-01
The scabies mite, Sarcoptes scabiei, is an obligate parasite of the skin that infects humans and other animal species, causing scabies, a contagious disease characterized by extreme itching. Scabies infections are a major health problem, particularly in remote Indigenous communities in Australia, where co-infection of epidermal scabies lesions by Group A Streptococci or Staphylococcus aureus is thought to be responsible for the high rate of rheumatic heart disease and chronic kidney disease. We collected and separately sequenced mite DNA from several pools of thousands of whole mites from a porcine model of scabies (S. scabiei var. suis) and two human patients (S. scabiei var. hominis) living in different regions of northern Australia. Our sequencing samples the mite and its metagenome, including the mite gut flora and the wound micro-environment. Here, we describe the mitochondrial genome of the scabies mite. We developed a new de novo assembly pipeline based on a bait-and-reassemble strategy, which produced a 14 kilobase mitochondrial genome sequence assembly. We also annotated 35 genes and have compared these to other Acari mites. We identified single nucleotide polymorphisms (SNPs) and used these to infer the presence of six haplogroups in our samples, Remarkably, these fall into two closely-related clades with one clade including both human and pig varieties. This supports earlier findings that only limited genetic differences may separate some human and animal varieties, and raises the possibility of cross-host infections. Finally, we used these mitochondrial haplotypes to show that the genetic diversity of individual infections is typically small with 1–3 distinct haplotypes per infestation. PMID:26872064
Genomic diversity and versatility of Lactobacillus plantarum, a natural metabolic engineer.
Siezen, Roland J; van Hylckama Vlieg, Johan E T
2011-08-30
In the past decade it has become clear that the lactic acid bacterium Lactobacillus plantarum occupies a diverse range of environmental niches and has an enormous diversity in phenotypic properties, metabolic capacity and industrial applications. In this review, we describe how genome sequencing, comparative genome hybridization and comparative genomics has provided insight into the underlying genomic diversity and versatility of L. plantarum. One of the main features appears to be genomic life-style islands consisting of numerous functional gene cassettes, in particular for carbohydrates utilization, which can be acquired, shuffled, substituted or deleted in response to niche requirements. In this sense, L. plantarum can be considered a "natural metabolic engineer".
Intrahaplotypic Variants Differentiate Complex Linkage Disequilibrium within Human MHC Haplotypes
Lam, Tze Hau; Tay, Matthew Zirui; Wang, Bei; Xiao, Ziwei; Ren, Ee Chee
2015-01-01
Distinct regions of long-range genetic fixation in the human MHC region, known as conserved extended haplotypes (CEHs), possess unique genomic characteristics and are strongly associated with numerous diseases. While CEHs appear to be homogeneous by SNP analysis, the nature of fine variations within their genomic structure is unknown. Using multiple, MHC-homozygous cell lines, we demonstrate extensive sequence conservation in two common Asian MHC haplotypes: A33-B58-DR3 and A2-B46-DR9. However, characterization of phase-resolved MHC haplotypes revealed unique intra-CEH patterns of variation and uncovered 127 single nucleotide variants (SNVs) which are missing from public databases. We further show that the strong linkage disequilibrium structure within the human MHC that typically confounds precise identification of genetic features can be resolved using intra-CEH variants, as evidenced by rs3129063 and rs448489, which affect expression of ZFP57, a gene important in methylation and epigenetic regulation. This study demonstrates an improved strategy that can be used towards genetic dissection of diseases. PMID:26593880
Ozturk, Onur; Arikan, Sanem; Atalay, Ayfer; Atalay, Erol O
2018-05-01
Hb G-Coushatta variant was reported from various populations' parts of the world such as Thai, Korea, Algeria, Thailand, China, Japan and Turkey. In our study, we aimed to discuss the possible historical relationships of the Hb G-Coushatta mutation with the possible migration routes of the world. For this purpose, associated haplotypes were determined using polymorphic loci in the beta globin gene cluster of hemoglobin G-Coushatta and normal populations in Denizli, Turkey. We performed statistical analysis such as haplotype analysis, Hardy-Weinberg equilibrium, measurement of genetic diversity and population differentiation parameters, analysis of molecular variance using F-statistics, historical-demographic analyses, mismatch distribution analysis of both populations and applied the test statistics in Arlequin ver. 3.5 software program. The diversity of haplotypes has been shown to indicate different genetic origins for two populations. However, AMOVA results, molecular diversity parameters and population demographic expansion times showed that the Hb G-Coushatta mutation develops on the normal population gene pool. Our estimated τ values showed the average time since the demographic expansion for normal and Hb G-Coushatta populations ranged from approximately 42,000 to 38,000 ybp, respectively. Our data suggest that Hb G-Coushatta population originate in normal population in Denizli, Turkey. These results support the hypothesis that the multiple origin of Hb G-Coushatta and indicate that mutation may have been triggered the formation of new variants on beta globin haplotypes. © 2018 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.
Nandi, Tannistha; Holden, Matthew T.G.; Didelot, Xavier; Mehershahi, Kurosh; Boddey, Justin A.; Beacham, Ifor; Peak, Ian; Harting, John; Baybayan, Primo; Guo, Yan; Wang, Susana; How, Lee Chee; Sim, Bernice; Essex-Lopresti, Angela; Sarkar-Tyson, Mitali; Nelson, Michelle; Smither, Sophie; Ong, Catherine; Aw, Lay Tin; Hoon, Chua Hui; Michell, Stephen; Studholme, David J.; Titball, Richard; Chen, Swaine L.; Parkhill, Julian
2015-01-01
Burkholderia pseudomallei (Bp) is the causative agent of the infectious disease melioidosis. To investigate population diversity, recombination, and horizontal gene transfer in closely related Bp isolates, we performed whole-genome sequencing (WGS) on 106 clinical, animal, and environmental strains from a restricted Asian locale. Whole-genome phylogenies resolved multiple genomic clades of Bp, largely congruent with multilocus sequence typing (MLST). We discovered widespread recombination in the Bp core genome, involving hundreds of regions associated with multiple haplotypes. Highly recombinant regions exhibited functional enrichments that may contribute to virulence. We observed clade-specific patterns of recombination and accessory gene exchange, and provide evidence that this is likely due to ongoing recombination between clade members. Reciprocally, interclade exchanges were rarely observed, suggesting mechanisms restricting gene flow between clades. Interrogation of accessory elements revealed that each clade harbored a distinct complement of restriction-modification (RM) systems, predicted to cause clade-specific patterns of DNA methylation. Using methylome sequencing, we confirmed that representative strains from separate clades indeed exhibit distinct methylation profiles. Finally, using an E. coli system, we demonstrate that Bp RM systems can inhibit uptake of non-self DNA. Our data suggest that RM systems borne on mobile elements, besides preventing foreign DNA invasion, may also contribute to limiting exchanges of genetic material between individuals of the same species. Genomic clades may thus represent functional units of genetic isolation in Bp, modulating intraspecies genetic diversity. PMID:25236617
Haplotype structure in Ashkenazi Jewish BRCA1 and BRCA2 mutation carriers
Im, Kate M.; Kirchhoff, Tomas; Wang, Xianshu; Green, Todd; Chow, Clement Y.; Vijai, Joseph; Korn, Joshua; Gaudet, Mia M.; Fredericksen, Zachary; Pankratz, V. Shane; Guiducci, Candace; Crenshaw, Andrew; McGuffog, Lesley; Kartsonaki, Christiana; Morrison, Jonathan; Healey, Sue; Sinilnikova, Olga M.; Mai, Phuong L.; Greene, Mark H.; Piedmonte, Marion; Rubinstein, Wendy S.; Hogervorst, Frans B.; Rookus, Matti A.; Collée, J. Margriet; Hoogerbrugge, Nicoline; van Asperen, Christi J.; Meijers-Heijboer, Hanne E. J.; Van Roozendaal, Cees E.; Caldes, Trinidad; Perez-Segura, Pedro; Jakubowska, Anna; Lubinski, Jan; Huzarski, Tomasz; Blecharz, Paweł; Nevanlinna, Heli; Aittomäki, Kristiina; Lazaro, Conxi; Blanco, Ignacio; Barkardottir, Rosa B.; Montagna, Marco; D'Andrea, Emma; Devilee, Peter; Olopade, Olufunmilayo I.; Neuhausen, Susan L.; Peissel, Bernard; Bonanni, Bernardo; Peterlongo, Paolo; Singer, Christian F.; Rennert, Gad; Lejbkowicz, Flavio; Andrulis, Irene L.; Glendon, Gord; Ozcelik, Hilmi; Toland, Amanda Ewart; Caligo, Maria Adelaide; Beattie, Mary S.; Chan, Salina; Domchek, Susan M.; Nathanson, Katherine L.; Rebbeck, Timothy R.; Phelan, Catherine; Narod, Steven; John, Esther M.; Hopper, John L.; Buys, Saundra S.; Daly, Mary B.; Southey, Melissa C.; Terry, Mary-Beth; Tung, Nadine; Hansen, Thomas v. O.; Osorio, Ana; Benitez, Javier; Durán, Mercedes; Weitzel, Jeffrey N.; Garber, Judy; Hamann, Ute; Peock, Susan; Cook, Margaret; Oliver, Clare T.; Frost, Debra; Platte, Radka; Evans, D. Gareth; Eeles, Ros; Izatt, Louise; Paterson, Joan; Brewer, Carole; Hodgson, Shirley; Morrison, Patrick J.; Porteous, Mary; Walker, Lisa; Rogers, Mark T.; Side, Lucy E.; Godwin, Andrew K.; Schmutzler, Rita K.; Wappenschmidt, Barbara; Laitman, Yael; Meindl, Alfons; Deissler, Helmut; Varon-Mateeva, Raymonda; Preisler-Adams, Sabine; Kast, Karin; Venat-Bouvet, Laurence; Stoppa-Lyonnet, Dominique; Chenevix-Trench, Georgia; Easton, Douglas F.; Klein, Robert J.; Daly, Mark J.; Friedman, Eitan; Dean, Michael; Clark, Andrew G.; Altshuler, David M.; Antoniou, Antonis C.; Couch, Fergus J.; Offit, Kenneth; Gold, Bert
2011-01-01
Abstract Three founder mutations in BRCA1 and BRCA2 contribute to the risk of hereditary breast and ovarian cancer in Ashkenazi Jews (AJ). They are observed at increased frequency in the AJ compared to other BRCA mutations in Caucasian non-Jews (CNJ). Several authors have proposed that elevated allele frequencies in the surrounding genomic regions reflect adaptive or balancing selection. Such proposals predict long-range linkage dis-equilibrium (LD) resulting from a selective sweep, although genetic drift in a founder population may also act to create long-distance LD. To date, few studies have used the tools of statistical genomics to examine the likelihood of long-range LD at a deleterious locus in a population that faced a genetic bottleneck. We studied the genotypes of hundreds of women from a large international consortium of BRCA1 and BRCA2 mutation carriers and found that AJ women exhibited long-range haplotypes compared to CNJ women. More than 50% of the AJ chromosomes with the BRCA1 185delAG mutation share an identical 2.1 Mb haplotype and nearly 16% of AJ chromosomes carrying the BRCA2 6174delT mutation share a 1.4 Mb haplotype. Simulations based on the best inference of Ashkenazi population demography indicate that long-range haplotypes are expected in the context of a genome-wide survey. Our results are consistent with the hypothesis that a local bottleneck effect from population size constriction events could by chance have resulted in the large haplotype blocks observed at high frequency in the BRCA1 and BRCA2 regions of Ashkenazi Jews. PMID:21597964
β-globin gene cluster haplotypes in ethnic minority populations of southwest China
Sun, Hao; Liu, Hongxian; Huang, Kai; Lin, Keqin; Huang, Xiaoqin; Chu, Jiayou; Ma, Shaohui; Yang, Zhaoqing
2017-01-01
The genetic diversity and relationships among ethnic minority populations of southwest China were investigated using seven polymorphic restriction enzyme sites in the β-globin gene cluster. The haplotypes of 1392 chromosomes from ten ethnic populations living in southwest China were determined. Linkage equilibrium and recombination hotspot were found between the 5′ sites and 3′ sites of the β-globin gene cluster. 5′ haplotypes 2 (+−−−), 6 (−++−+), 9 (−++++) and 3′ haplotype FW3 (−+) were the predominant haplotypes. Notably, haplotype 9 frequency was significantly high in the southwest populations, indicating their difference with other Chinese. The interpopulation differentiation of southwest Chinese minority populations is less than those in populations of northern China and other continents. Phylogenetic analysis shows that populations sharing same ethnic origin or language clustered to each other, indicating current β-globin cluster diversity in the Chinese populations reflects their ethnic origin and linguistic affiliations to a great extent. This study characterizes β-globin gene cluster haplotypes in southwest Chinese minorities for the first time, and reveals the genetic variability and affinity of these populations using β-globin cluster haplotype frequencies. The results suggest that ethnic origin plays an important role in shaping variations of the β-globin gene cluster in the southwestern ethnic populations of China. PMID:28205625
Simpalipan, Phumin; Pattaradilokrat, Sittiporn; Siripoon, Napaporn; Seugorn, Aree; Kaewthamasorn, Morakot; Butcher, Robert D J; Harnyuttanakorn, Pongchai
2014-02-12
The 19-kDa C-terminal region of the merozoite surface protein-1 of the human malaria parasite Plasmodium falciparum (PfMSP-119) constitutes the major component on the surface of merozoites and is considered as one of the leading candidates for asexual blood stage vaccines. Because the protein exhibits a level of sequence variation that may compromise the effectiveness of a vaccine, the global sequence diversity of PfMSP-119 has been subjected to extensive research, especially in malaria endemic areas. In Thailand, PfMSP-119 sequences have been derived from a single parasite population in Tak province, located along the Thailand-Myanmar border, since 1995. However, the extent of sequence variation and the spatiotemporal patterns of the MSP-119 haplotypes along the Thai borders with Laos and Cambodia are unknown. Sixty-three isolates of P. falciparum from five geographically isolated populations along the Thai borders with Myanmar, Laos and Cambodia in three transmission seasons between 2002 and 2008 were collected and culture-adapted. The msp-1 gene block 17 was sequenced and analysed for the allelic diversity, frequency and distribution patterns of PfMSP-119 haplotypes in individual populations. The PfMSP-119 haplotype patterns were then compared between parasite populations to infer the population structure and genetic differentiation of the malaria parasite. Five conserved polymorphic positions, which accounted for five distinct haplotypes, of PfMSP-119 were identified. Differences in the prevalence of PfMSP-119 haplotypes were detected in different geographical regions, with the highest levels of genetic diversity being found in the Kanchanaburi and Ranong provinces along the Thailand-Myanmar border and Trat province located at the Thailand-Cambodia border. Despite this variability, the distribution patterns of individual PfMSP-119 haplotypes seemed to be very similar across the country and over the three malarial transmission seasons, suggesting that gene flow
Taylor, Jesse E; Pacheco, M Andreína; Bacon, David J; Beg, Mohammad A; Machado, Ricardo Luiz; Fairhurst, Rick M; Herrera, Socrates; Kim, Jung-Yeon; Menard, Didier; Póvoa, Marinete Marins; Villegas, Leopoldo; Mulyanto; Snounou, Georges; Cui, Liwang; Zeyrek, Fadile Yildiz; Escalante, Ananias A
2013-09-01
Plasmodium vivax is the most prevalent human malaria parasite in the Americas. Previous studies have contrasted the genetic diversity of parasite populations in the Americas with those in Asia and Oceania, concluding that New World populations exhibit low genetic diversity consistent with a recent introduction. Here we used an expanded sample of complete mitochondrial genome sequences to investigate the diversity of P. vivax in the Americas as well as in other continental populations. We show that the diversity of P. vivax in the Americas is comparable to that in Asia and Oceania, and we identify several divergent clades circulating in South America that may have resulted from independent introductions. In particular, we show that several haplotypes sampled in Venezuela and northeastern Brazil belong to a clade that diverged from the other P. vivax lineages at least 30,000 years ago, albeit not necessarily in the Americas. We propose that, unlike in Asia where human migration increases local genetic diversity, the combined effects of the geographical structure and the low incidence of vivax malaria in the Americas has resulted in patterns of low local but high regional genetic diversity. This could explain previous views that P. vivax in the Americas has low genetic diversity because these were based on studies carried out in limited areas. Further elucidation of the complex geographical pattern of P. vivax variation will be important both for diversity assessments of genes encoding candidate vaccine antigens and in the formulation of control and surveillance measures aimed at malaria elimination.
Taylor, Jesse E.; Pacheco, M. Andreína; Bacon, David J.; Beg, Mohammad A.; Machado, Ricardo Luiz; Fairhurst, Rick M.; Herrera, Socrates; Kim, Jung-Yeon; Menard, Didier; Póvoa, Marinete Marins; Villegas, Leopoldo; Mulyanto; Snounou, Georges; Cui, Liwang; Zeyrek, Fadile Yildiz; Escalante, Ananias A.
2013-01-01
Plasmodium vivax is the most prevalent human malaria parasite in the Americas. Previous studies have contrasted the genetic diversity of parasite populations in the Americas with those in Asia and Oceania, concluding that New World populations exhibit low genetic diversity consistent with a recent introduction. Here we used an expanded sample of complete mitochondrial genome sequences to investigate the diversity of P. vivax in the Americas as well as in other continental populations. We show that the diversity of P. vivax in the Americas is comparable to that in Asia and Oceania, and we identify several divergent clades circulating in South America that may have resulted from independent introductions. In particular, we show that several haplotypes sampled in Venezuela and northeastern Brazil belong to a clade that diverged from the other P. vivax lineages at least 30,000 years ago, albeit not necessarily in the Americas. We propose that, unlike in Asia where human migration increases local genetic diversity, the combined effects of the geographical structure and the low incidence of vivax malaria in the Americas has resulted in patterns of low local but high regional genetic diversity. This could explain previous views that P. vivax in the Americas has low genetic diversity because these were based on studies carried out in limited areas. Further elucidation of the complex geographical pattern of P. vivax variation will be important both for diversity assessments of genes encoding candidate vaccine antigens and in the formulation of control and surveillance measures aimed at malaria elimination. PMID:23733143
Genomic diversity and versatility of Lactobacillus plantarum, a natural metabolic engineer
2011-01-01
In the past decade it has become clear that the lactic acid bacterium Lactobacillus plantarum occupies a diverse range of environmental niches and has an enormous diversity in phenotypic properties, metabolic capacity and industrial applications. In this review, we describe how genome sequencing, comparative genome hybridization and comparative genomics has provided insight into the underlying genomic diversity and versatility of L. plantarum. One of the main features appears to be genomic life-style islands consisting of numerous functional gene cassettes, in particular for carbohydrates utilization, which can be acquired, shuffled, substituted or deleted in response to niche requirements. In this sense, L. plantarum can be considered a “natural metabolic engineer”. PMID:21995294
Halász, Júlia; Kodad, Ossama; Hegedűs, Attila
2014-07-01
Miniature inverted-repeat transposable elements (MITEs) are known to contribute to the evolution of plants, but only limited information is available for MITEs in the Prunus genome. We identified a MITE that has been named Falling Stones, FaSt. All structural features (349-bp size, 82-bp terminal inverted repeats and 9-bp target site duplications) are consistent with this MITE being a putative member of the Mutator transposase superfamily. FaSt showed a preferential accumulation in the short AT-rich segments of the euchromatin region of the peach genome. DNA sequencing and pollination experiments have been performed to confirm that the nested insertion of FaSt into the S-haplotype-specific F-box gene of apricot resulted in the breakdown of self-incompatibility (SI). A bioinformatics-based survey of the known Rosaceae and other genomes and a newly designed polymerase chain reaction (PCR) assay verified the Prunoideae-specific occurrence of FaSt elements. Phylogenetic analysis suggested a recent activity of FaSt in the Prunus genome. The occurrence of a nested insertion in the apricot genome further supports the recent activity of FaSt in response to abiotic stress conditions. This study reports on a presumably active non-autonomous Mutator element in Prunus that exhibits a major indirect genome shaping force through inducing loss-of-function mutation in the SI locus. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.
Bailey, Jeffrey A; Mvalo, Tisungane; Aragam, Nagesh; Weiser, Matthew; Congdon, Seth; Kamwendo, Debbie; Martinson, Francis; Hoffman, Irving; Meshnick, Steven R; Juliano, Jonathan J
2012-08-15
The development of an effective malaria vaccine has been hampered by the genetic diversity of commonly used target antigens. This diversity has led to concerns about allele-specific immunity limiting the effectiveness of vaccines. Despite extensive genetic diversity of circumsporozoite protein (CS), the most successful malaria vaccine is RTS/S, a monovalent CS vaccine. By use of massively parallel pyrosequencing, we evaluated the diversity of CS haplotypes across the T-cell epitopes in parasites from Lilongwe, Malawi. We identified 57 unique parasite haplotypes from 100 participants. By use of ecological and molecular indexes of diversity, we saw no difference in the diversity of CS haplotypes between adults and children. We saw evidence of weak variant-specific selection within this region of CS, suggesting naturally acquired immunity does induce variant-specific selection on CS. Therefore, the impact of CS vaccines on variant frequencies with widespread implementation of vaccination requires further study.
Fast and accurate genotype imputation in genome-wide association studies through pre-phasing
Howie, Bryan; Fuchsberger, Christian; Stephens, Matthew; Marchini, Jonathan; Abecasis, Gonçalo R.
2013-01-01
Sequencing efforts, including the 1000 Genomes Project and disease-specific efforts, are producing large collections of haplotypes that can be used for genotype imputation in genome-wide association studies (GWAS). Imputing from these reference panels can help identify new risk alleles, but the use of large panels with existing methods imposes a high computational burden. To keep imputation broadly accessible, we introduce a strategy called “pre-phasing” that maintains the accuracy of leading methods while cutting computational costs by orders of magnitude. In brief, we first statistically estimate the haplotypes for each GWAS individual (“pre-phasing”) and then impute missing genotypes into these estimated haplotypes. This reduces the computational cost because: (i) the GWAS samples must be phased only once, whereas standard methods would implicitly re-phase with each reference panel update; (ii) it is much faster to match a phased GWAS haplotype to one reference haplotype than to match unphased GWAS genotypes to a pair of reference haplotypes. This strategy will be particularly valuable for repeated imputation as reference panels evolve. PMID:22820512
Haplotype analysis of sucrose synthase gene family in three Saccharum species
2013-01-01
Background Sugarcane is an economically important crop contributing about 80% and 40% to the world sugar and ethanol production, respectively. The complicated genetics consequential to its complex polyploid genome, however, have impeded efforts to improve sugar yield and related important agronomic traits. Modern sugarcane cultivars are complex hybrids derived mainly from crosses among its progenitor species, S. officinarum and S. spontanuem, and to a lesser degree, S. robustom. Atypical of higher plants, sugarcane stores its photoassimilates as sucrose rather than as starch in its parenchymous stalk cells. In the sugar biosynthesis pathway, sucrose synthase (SuSy, UDP-glucose: D-fructose 2-a-D-glucosyltransferase, EC 2.4.1.13) is a key enzyme in the regulation of sucrose accumulation and partitioning by catalyzing the reversible conversion of sucrose and UDP into UDP-glucose and fructose. However, little is known about the sugarcane SuSy gene family members and hence no definitive studies have been reported regarding allelic diversity of SuSy gene families in Saccharum species. Results We identified and characterized a total of five sucrose synthase genes in the three sugarcane progenitor species through gene annotation and PCR haplotype analysis by analyzing 70 to 119 PCR fragments amplified from intron-containing target regions. We detected all but one (i.e. ScSuSy5) of ScSuSy transcripts in five tissue types of three Saccharum species. The average SNP frequency was one SNP per 108 bp, 81 bp, and 72 bp in S. officinarum, S. robustom, and S. spontanuem respectively. The average shared SNP is 15 between S. officinarum and S. robustom, 7 between S. officinarum and S. spontanuem , and 11 between S. robustom and S. spontanuem. We identified 27, 35, and 32 haplotypes from the five ScSuSy genes in S. officinarum, S. robustom, and S. spontanuem respectively. Also, 12, 11, and 9 protein sequences were translated from the haplotypes in S. officinarum, S. robustom, S
Haplotype analysis of sucrose synthase gene family in three Saccharum species.
Zhang, Jisen; Arro, Jie; Chen, Youqiang; Ming, Ray
2013-05-10
Sugarcane is an economically important crop contributing about 80% and 40% to the world sugar and ethanol production, respectively. The complicated genetics consequential to its complex polyploid genome, however, have impeded efforts to improve sugar yield and related important agronomic traits. Modern sugarcane cultivars are complex hybrids derived mainly from crosses among its progenitor species, S. officinarum and S. spontanuem, and to a lesser degree, S. robustom. Atypical of higher plants, sugarcane stores its photoassimilates as sucrose rather than as starch in its parenchymous stalk cells. In the sugar biosynthesis pathway, sucrose synthase (SuSy, UDP-glucose: D-fructose 2-a-D-glucosyltransferase, EC 2.4.1.13) is a key enzyme in the regulation of sucrose accumulation and partitioning by catalyzing the reversible conversion of sucrose and UDP into UDP-glucose and fructose. However, little is known about the sugarcane SuSy gene family members and hence no definitive studies have been reported regarding allelic diversity of SuSy gene families in Saccharum species. We identified and characterized a total of five sucrose synthase genes in the three sugarcane progenitor species through gene annotation and PCR haplotype analysis by analyzing 70 to 119 PCR fragments amplified from intron-containing target regions. We detected all but one (i.e. ScSuSy5) of ScSuSy transcripts in five tissue types of three Saccharum species. The average SNP frequency was one SNP per 108 bp, 81 bp, and 72 bp in S. officinarum, S. robustom, and S. spontanuem respectively. The average shared SNP is 15 between S. officinarum and S. robustom, 7 between S. officinarum and S. spontanuem , and 11 between S. robustom and S. spontanuem. We identified 27, 35, and 32 haplotypes from the five ScSuSy genes in S. officinarum, S. robustom, and S. spontanuem respectively. Also, 12, 11, and 9 protein sequences were translated from the haplotypes in S. officinarum, S. robustom, S. spontanuem
Nakajima, T; Sano, R; Takahashi, Y; Watanabe, K; Kubo, R; Kobayashi, M; Takahashi, K; Takeshita, H; Kominato, Y
2016-01-01
Recent investigation of transcriptional regulation of the ABO genes has identified a candidate erythroid cell-specific regulatory element, named the +5·8-kb site, in the first intron of ABO. Six haplotypes of the site have been reported previously. The present genetic population study demonstrated that each haplotype was mostly linked with specific ABO alleles with a few exceptions, possibly as a result of hybrid formation between common ABO alleles. Thus, investigation of these haplotypes could provide a clue to further elucidation of ABO alleles. © 2015 International Society of Blood Transfusion.
Chromosome-scale selective sweeps shape Caenorhabditis elegans genomic diversity
Andersen, Erik C.; Gerke, Justin P.; Shapiro, Joshua A.; Crissman, Jonathan R.; Ghosh, Rajarshi; Bloom, Joshua S.; Félix, Marie-Anne; Kruglyak, Leonid
2011-01-01
The nematode Caenorhabditis elegans is central to research in molecular, cell, and developmental biology, but nearly all of this research has been conducted on a single strain. Comparatively little is known about the population genomic and evolutionary history of this species. We characterized C. elegans genetic variation by high-throughput selective sequencing of a worldwide collection of 200 wild strains, identifying 41,188 single nucleotide polymorphisms. Unexpectedly, C. elegans genome variation is dominated by a set of commonly shared haplotypes on four of the six chromosomes, each spanning many megabases. Population-genetic modeling shows that this pattern was generated by chromosome-scale selective sweeps that have reduced variation worldwide; at least one of these sweeps likely occurred in the past few hundred years. These sweeps, which we hypothesize to be a result of human activity, have dramatically reshaped the global C. elegans population in the recent past. PMID:22286215
Contu, L; Carcassi, C; Dausset, J
1989-01-01
The C4 and 21-OH loci of the class III HLA have been studied by specific DNA probes and the restriction enzyme Taq 1 in 24 unrelated Sardinian individuals selected from completely HLA-typed families. All 24 individuals had the HLA extended haplotype A30,Cw5,B18, BfF1,DR3,DRw52,DQw2, named "Sardinian" in the present paper because of its frequency of 15% in the Sardinian population. Eighteen of these were homozygous for the entire haplotype, and six were heterozygous at the A locus and blank (or homozygous) at all the other loci. In all completely homozygous cells and in four heterozygous cells at the A locus, the restriction fragments of the 21-OHA (3.2 kb) and C4B (5.8 kb or 5.4 kb) genes were absent, and the fragments of the C4A (7.0 kb) and 21-OHB (3.7 kb) genes were present. It is suggested that the "Sardinian" haplotype is an ancestral haplotype without duplication of the C4 and 21-OH genes, practically always identical in its structure, also in unrelated individuals. The diversity of this haplotype in the class III region (about 30 kb less) may be at least partially responsible for its misalignment with most haplotypes, which have duplicated C4 and 21-OH genes, and therefore also for its decreased probability to recombine. This can help explain its high stability and frequency in the Sardinian population. The same conclusion can be suggested for the Caucasian extended haplotype A1,B8,DR3 that always seems to lack the C4A and 21-OHA genes.
The Genomic Impacts of Drift and Selection for Hybrid Performance in Maize
Gerke, Justin P.; Edwards, Jode W.; Guill, Katherine E.; Ross-Ibarra, Jeffrey; McMullen, Michael D.
2015-01-01
Although maize is naturally an outcrossing organism, modern breeding utilizes highly inbred lines in controlled crosses to produce hybrids. The U.S. Department of Agriculture’s reciprocal recurrent selection experiment between the Iowa Stiff Stalk Synthetic (BSSS) and the Iowa Corn Borer Synthetic No. 1 (BSCB1) populations represents one of the longest running experiments to understand the response to selection for hybrid performance. To investigate the genomic impact of this selection program, we genotyped the progenitor lines and >600 individuals across multiple cycles of selection using a genome-wide panel of ∼40,000 SNPs. We confirmed previous results showing a steady temporal decrease in genetic diversity within populations and a corresponding increase in differentiation between populations. Thanks to detailed historical information on experimental design, we were able to perform extensive simulations using founder haplotypes to replicate the experiment in the absence of selection. These simulations demonstrate that while most of the observed reduction in genetic diversity can be attributed to genetic drift, heterozygosity in each population has fallen more than expected. We then took advantage of our high-density genotype data to identify extensive regions of haplotype fixation and trace haplotype ancestry to single founder inbred lines. The vast majority of regions showing such evidence of selection differ between the two populations, providing evidence for the dominance model of heterosis. We discuss how this pattern is likely to occur during selection for hybrid performance and how it poses challenges for dissecting the impacts of modern breeding and selection on the maize genome. PMID:26385980
Li, Ci-Xiu; Shi, Mang; Tian, Jun-Hua; Lin, Xian-Dan; Kang, Yan-Jun; Chen, Liang-Jun; Qin, Xin-Cheng; Xu, Jianguo; Holmes, Edward C; Zhang, Yong-Zhen
2015-01-01
Although arthropods are important viral vectors, the biodiversity of arthropod viruses, as well as the role that arthropods have played in viral origins and evolution, is unclear. Through RNA sequencing of 70 arthropod species we discovered 112 novel viruses that appear to be ancestral to much of the documented genetic diversity of negative-sense RNA viruses, a number of which are also present as endogenous genomic copies. With this greatly enriched diversity we revealed that arthropods contain viruses that fall basal to major virus groups, including the vertebrate-specific arenaviruses, filoviruses, hantaviruses, influenza viruses, lyssaviruses, and paramyxoviruses. We similarly documented a remarkable diversity of genome structures in arthropod viruses, including a putative circular form, that sheds new light on the evolution of genome organization. Hence, arthropods are a major reservoir of viral genetic diversity and have likely been central to viral evolution. DOI: http://dx.doi.org/10.7554/eLife.05378.001 PMID:25633976
Evolution and Diversity of Transposable Elements in Vertebrate Genomes.
Sotero-Caio, Cibele G; Platt, Roy N; Suh, Alexander; Ray, David A
2017-01-01
Transposable elements (TEs) are selfish genetic elements that mobilize in genomes via transposition or retrotransposition and often make up large fractions of vertebrate genomes. Here, we review the current understanding of vertebrate TE diversity and evolution in the context of recent advances in genome sequencing and assembly techniques. TEs make up 4-60% of assembled vertebrate genomes, and deeply branching lineages such as ray-finned fishes and amphibians generally exhibit a higher TE diversity than the more recent radiations of birds and mammals. Furthermore, the list of taxa with exceptional TE landscapes is growing. We emphasize that the current bottleneck in genome analyses lies in the proper annotation of TEs and provide examples where superficial analyses led to misleading conclusions about genome evolution. Finally, recent advances in long-read sequencing will soon permit access to TE-rich genomic regions that previously resisted assembly including the gigantic, TE-rich genomes of salamanders and lungfishes. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Consequences of genomic diversity in Mycobacterium tuberculosis
Coscolla, Mireia; Gagneux, Sebastien
2014-01-01
The causative agent of human tuberculosis, Mycobacterium tuberculosis complex (MTBC), comprises seven phylogenetically distinct lineages associated with different geographical regions. Here we review the latest findings on the nature and amount of genomic diversity within and between MTBC lineages. We then review recent evidence for the effect of this genomic diversity on mycobacterial phenotypes measured experimentally and in clinical settings. We conclude that overall, the most geographically widespread Lineage 2 (includes Beijing) and Lineage 4 (also known as Euro-American) are more virulent than other lineages that are more geographically restricted. This increased virulence is associated with delayed or reduced pro-inflammatory host immune responses, greater severity of disease, and enhanced transmission. Future work should focus on the interaction between MTBC and human genetic diversity, as well as on the environmental factors that modulate these interactions. PMID:25453224
Site-Specific Integration of Exogenous Genes Using Genome Editing Technologies in Zebrafish.
Kawahara, Atsuo; Hisano, Yu; Ota, Satoshi; Taimatsu, Kiyohito
2016-05-13
The zebrafish (Danio rerio) is an ideal vertebrate model to investigate the developmental molecular mechanism of organogenesis and regeneration. Recent innovation in genome editing technologies, such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR associated protein 9 (Cas9) system, have allowed researchers to generate diverse genomic modifications in whole animals and in cultured cells. The CRISPR/Cas9 and TALEN techniques frequently induce DNA double-strand breaks (DSBs) at the targeted gene, resulting in frameshift-mediated gene disruption. As a useful application of genome editing technology, several groups have recently reported efficient site-specific integration of exogenous genes into targeted genomic loci. In this review, we provide an overview of TALEN- and CRISPR/Cas9-mediated site-specific integration of exogenous genes in zebrafish.
The Diversity Present in 5140 Human Mitochondrial Genomes
Pereira, Luísa; Freitas, Fernando; Fernandes, Verónica; Pereira, Joana B.; Costa, Marta D.; Costa, Stephanie; Máximo, Valdemar; Macaulay, Vincent; Rocha, Ricardo; Samuels, David C.
2009-01-01
We analyzed the current status (as of the end of August 2008) of human mitochondrial genomes deposited in GenBank, amounting to 5140 complete or coding-region sequences, in order to present an overall picture of the diversity present in the mitochondrial DNA of the global human population. To perform this task, we developed mtDNA-GeneSyn, a computer tool that identifies and exhaustedly classifies the diversity present in large genetic data sets. The diversity observed in the 5140 human mitochondrial genomes was compared with all possible transitions and transversions from the standard human mitochondrial reference genome. This comparison showed that tRNA and rRNA secondary structures have a large effect in limiting the diversity of the human mitochondrial sequences, whereas for the protein-coding genes there is a bias toward less variation at the second codon positions. The analysis of the observed amino acid variations showed a tolerance of variations that convert between the amino acids V, I, A, M, and T. This defines a group of amino acids with similar chemical properties that can interconvert by a single transition. PMID:19426953
USDA-ARS?s Scientific Manuscript database
The Maize Genetics and Genomics Database (MaizeGDB) team prepared a survey to identify breeders’ needs for visualizing pedigrees, diversity data, and haplotypes in order to prioritize tool development and curation efforts at MaizeGDB. The survey was distributed to the maize research community on beh...
Schlumbaum, A; Turgay, M; Schibler, J
2006-08-01
Typical Near East mitochondrial haplotypes of the T2 lineage were found in one cattle metacarpus sample from the Roman period and in two present-day Evolène cattle in Switzerland. Sequences from eight additional Evolène and four Raetian Grey aligned to the European haplotype T3. Analysis of nucleotide diversity within the mitochondrial D-loop of both studied Swiss cattle breeds revealed high haplotype diversity and similar diversity to a European cattle reference group. Mitochondrial T3 haplotypes radiated star-like from two similarly frequent haplotypes, possibly indicating two different expansion routes. The breed structure of Evolène cattle can be explained either by an introduction of diverse female lineages from the domestication centre or by later admixture. The introduction of the Near East lineage to Switzerland must have happened during the Roman time or earlier.
Genome-wide diversity and selective pressure in the human rhinovirus
Kistler, Amy L; Webster, Dale R; Rouskin, Silvi; Magrini, Vince; Credle, Joel J; Schnurr, David P; Boushey, Homer A; Mardis, Elaine R; Li, Hao; DeRisi, Joseph L
2007-01-01
Background The human rhinoviruses (HRV) are one of the most common and diverse respiratory pathogens of humans. Over 100 distinct HRV serotypes are known, yet only 6 genomes are available. Due to the paucity of HRV genome sequence, little is known about the genetic diversity within HRV or the forces driving this diversity. Previous comparative genome sequence analyses indicate that recombination drives diversification in multiple genera of the picornavirus family, yet it remains unclear if this holds for HRV. Results To resolve this and gain insight into the forces driving diversification in HRV, we generated a representative set of 34 fully sequenced HRVs. Analysis of these genomes shows consistent phylogenies across the genome, conserved non-coding elements, and only limited recombination. However, spikes of genetic diversity at both the nucleotide and amino acid level are detectable within every locus of the genome. Despite this, the HRV genome as a whole is under purifying selective pressure, with islands of diversifying pressure in the VP1, VP2, and VP3 structural genes and two non-structural genes, the 3C protease and 3D polymerase. Mapping diversifying residues in these factors onto available 3-dimensional structures revealed the diversifying capsid residues partition to the external surface of the viral particle in statistically significant proximity to antigenic sites. Diversifying pressure in the pleconaril binding site is confined to a single residue known to confer drug resistance (VP1 191). In contrast, diversifying pressure in the non-structural genes is less clear, mapping both nearby and beyond characterized functional domains of these factors. Conclusion This work provides a foundation for understanding HRV genetic diversity and insight into the underlying biology driving evolution in HRV. It expands our knowledge of the genome sequence space that HRV reference serotypes occupy and how the pattern of genetic diversity across HRV genomes differs
Genome size diversity in orchids: consequences and evolution
Leitch, I. J.; Kahandawala, I.; Suda, J.; Hanson, L.; Ingrouille, M. J.; Chase, M. W.; Fay, M. F.
2009-01-01
Background The amount of DNA comprising the genome of an organism (its genome size) varies a remarkable 40 000-fold across eukaryotes, yet most groups are characterized by much narrower ranges (e.g. 14-fold in gymnosperms, 3- to 4-fold in mammals). Angiosperms stand out as one of the most variable groups with genome sizes varying nearly 2000-fold. Nevertheless within angiosperms the majority of families are characterized by genomes which are small and vary little. Species with large genomes are mostly restricted to a few monocots families including Orchidaceae. Scope A survey of the literature revealed that genome size data for Orchidaceae are comparatively rare representing just 327 species. Nevertheless they reveal that Orchidaceae are currently the most variable angiosperm family with genome sizes ranging 168-fold (1C = 0·33–55·4 pg). Analysing the data provided insights into the distribution, evolution and possible consequences to the plant of this genome size diversity. Conclusions Superimposing the data onto the increasingly robust phylogenetic tree of Orchidaceae revealed how different subfamilies were characterized by distinct genome size profiles. Epidendroideae possessed the greatest range of genome sizes, although the majority of species had small genomes. In contrast, the largest genomes were found in subfamilies Cypripedioideae and Vanilloideae. Genome size evolution within this subfamily was analysed as this is the only one with reasonable representation of data. This approach highlighted striking differences in genome size and karyotype evolution between the closely related Cypripedium, Paphiopedilum and Phragmipedium. As to the consequences of genome size diversity, various studies revealed that this has both practical (e.g. application of genetic fingerprinting techniques) and biological consequences (e.g. affecting where and when an orchid may grow) and emphasizes the importance of obtaining further genome size data given the considerable
Comparative Analysis of Genome Diversity in Bullmastiff Dogs
Mortlock, Sally-Anne; Khatkar, Mehar S.; Williamson, Peter
2016-01-01
Management and preservation of genomic diversity in dog breeds is a major objective for maintaining health. The present study was undertaken to characterise genomic diversity in Bullmastiff dogs using both genealogical and molecular analysis. Genealogical analysis of diversity was conducted using a database consisting of 16,378 Bullmastiff pedigrees from year 1980 to 2013. Additionally, a total of 188 Bullmastiff dogs were genotyped using the 170,000 SNP Illumina CanineHD Beadchip. Genealogical parameters revealed a mean inbreeding coefficient of 0.047; 142 total founders (f); an effective number of founders (fe) of 79; an effective number of ancestors (fa) of 62; and an effective population size of the reference population of 41. Genetic diversity and the degree of genome-wide homogeneity within the breed were also investigated using molecular data. Multiple-locus heterozygosity (MLH) was equal to 0.206; runs of homozygosity (ROH) as proportion of the genome, averaged 16.44%; effective population size was 29.1, with an average inbreeding coefficient of 0.035, all estimated using SNP Data. Fine-scale population structure was analysed using NETVIEW, a population analysis pipeline. Visualisation of the high definition network captured relationships among individuals within and between subpopulations. Effects of unequal founder use, and ancestral inbreeding and selection, were evident. While current levels of Bullmastiff heterozygosity, inbreeding and homozygosity are not unusual, a relatively small effective population size indicates that a breeding strategy to reduce the inbreeding rate may be beneficial. PMID:26824579
MOHANTY, APARAJITA; MARTÍN, JUAN PEDRO; GONZÁLEZ, LUIS MIGUEL; AGUINAGALDE, ITZIAR
2003-01-01
Chloroplast DNA (cpDNA) and mitochondrial DNA (mtDNA) were studied in 24 populations of Prunus spinosa sampled across Europe. The cpDNA and mtDNA fragments were amplified using universal primers and subsequently digested with restriction enzymes to obtain the polymorphisms. Combinations of all the polymorphisms resulted in 33 cpDNA haplotypes and two mtDNA haplotypes. Strict association between the cpDNA haplotypes and the mtDNA haplotypes was detected in most cases, indicating conjoint inheritance of the two genomes. The most frequent and abundant cpDNA haplotype (C20; frequency, 51 %) is always associated with the more frequent and abundant mtDNA haplotype (M1; frequency, 84 %). All but two of the cpDNA haplotypes associated with the less frequent mtDNA haplotype (M2) are private haplotypes. These private haplotypes are phylogenetically related but geographically unrelated. They form a separate cluster on the minimum‐length spanning tree. PMID:14534199
David, Sean P; Mezuk, Briana; Zandi, Peter P; Strong, David; Anthony, James C; Niaura, Raymond; Uhl, George R; Eaton, William W
2010-03-01
The 11q23.1 genomic region has been associated with nicotine dependence in Black and White Americans. By conducting linkage disequilibrium analyses of 7 informative single nucleotide polymorphisms (SNPs) within the tetratricopeptide repeat domain 12 (TTC12)/ankyrin repeat and kinase containing 1 (ANKK1)/dopamine (D2) receptor gene cluster, we identified haplotype block structures in 270 Black and 368 White (n = 638) participants, from the Baltimore Epidemiologic Catchment Area cohort study, spanning the TTC12 and ANKK1 genes consisting of three SNPs (rs2303380-rs4938015-rs11604671). Informative haplotypes were examined for sex-specific associations with daily tobacco smoking initiation and cessation using longitudinal data from 1993-1994 and 2004-2005 interviews. There was a Haplotype x Sex interaction such that Black men possessing the GTG haplotype who were smokers in 1993-2004 were more likely to have stopped smoking by 2004-2005 (55.6% GTG vs. 22.0% other haplotypes), while Black women were less likely to have quit smoking if they possessed the GTG (20.8%) versus other haplotypes (24.0%; p = .028). In Whites, the GTG haplotype (vs. other haplotypes) was associated with lifetime history of daily smoking (smoking initiation; odds ratio = 1.6; 95% CI = 1.1-2.4; p = .013). Moreover, there was a Haplotype x Sex interaction such that there was higher prevalence of smoking initiation with GTG (77.6%) versus other haplotypes (57.0%; p = .043). In 2 different ethnic American populations, we observed man-woman variation in the influence of the rs2303380-rs4938015-rs11604671 GTG haplotype on smoking initiation and cessation. These results should be replicated in larger cohorts to establish the relationship among the rs2303380-rs4938015-rs11604671 haplotype block, sex, and smoking behavior.
Genetics, Genomics and Evolution of Ergot Alkaloid Diversity
Young, Carolyn A.; Schardl, Christopher L.; Panaccione, Daniel G.; Florea, Simona; Takach, Johanna E.; Charlton, Nikki D.; Moore, Neil; Webb, Jennifer S.; Jaromczyk, Jolanta
2015-01-01
The ergot alkaloid biosynthesis system has become an excellent model to study evolutionary diversification of specialized (secondary) metabolites. This is a very diverse class of alkaloids with various neurotropic activities, produced by fungi in several orders of the phylum Ascomycota, including plant pathogens and protective plant symbionts in the family Clavicipitaceae. Results of comparative genomics and phylogenomic analyses reveal multiple examples of three evolutionary processes that have generated ergot-alkaloid diversity: gene gains, gene losses, and gene sequence changes that have led to altered substrates or product specificities of the enzymes that they encode (neofunctionalization). The chromosome ends appear to be particularly effective engines for gene gains, losses and rearrangements, but not necessarily for neofunctionalization. Changes in gene expression could lead to accumulation of various pathway intermediates and affect levels of different ergot alkaloids. Genetic alterations associated with interspecific hybrids of Epichloë species suggest that such variation is also selectively favored. The huge structural diversity of ergot alkaloids probably represents adaptations to a wide variety of ecological situations by affecting the biological spectra and mechanisms of defense against herbivores, as evidenced by the diverse pharmacological effects of ergot alkaloids used in medicine. PMID:25875294
Exact algorithms for haplotype assembly from whole-genome sequence data.
Chen, Zhi-Zhong; Deng, Fei; Wang, Lusheng
2013-08-15
Haplotypes play a crucial role in genetic analysis and have many applications such as gene disease diagnoses, association studies, ancestry inference and so forth. The development of DNA sequencing technologies makes it possible to obtain haplotypes from a set of aligned reads originated from both copies of a chromosome of a single individual. This approach is often known as haplotype assembly. Exact algorithms that can give optimal solutions to the haplotype assembly problem are highly demanded. Unfortunately, previous algorithms for this problem either fail to output optimal solutions or take too long time even executed on a PC cluster. We develop an approach to finding optimal solutions for the haplotype assembly problem under the minimum-error-correction (MEC) model. Most of the previous approaches assume that the columns in the input matrix correspond to (putative) heterozygous sites. This all-heterozygous assumption is correct for most columns, but it may be incorrect for a small number of columns. In this article, we consider the MEC model with or without the all-heterozygous assumption. In our approach, we first use new methods to decompose the input read matrix into small independent blocks and then model the problem for each block as an integer linear programming problem, which is then solved by an integer linear programming solver. We have tested our program on a single PC [a Linux (x64) desktop PC with i7-3960X CPU], using the filtered HuRef and the NA 12878 datasets (after applying some variant calling methods). With the all-heterozygous assumption, our approach can optimally solve the whole HuRef data set within a total time of 31 h (26 h for the most difficult block of the 15th chromosome and only 5 h for the other blocks). To our knowledge, this is the first time that MEC optimal solutions are completely obtained for the filtered HuRef dataset. Moreover, in the general case (without the all-heterozygous assumption), for the HuRef dataset our
Cancer Genomics: Diversity and Disparity Across Ethnicity and Geography.
Tan, Daniel S W; Mok, Tony S K; Rebbeck, Timothy R
2016-01-01
Ethnic and geographic differences in cancer incidence, prognosis, and treatment outcomes can be attributed to diversity in the inherited (germline) and somatic genome. Although international large-scale sequencing efforts are beginning to unravel the genomic underpinnings of cancer traits, much remains to be known about the underlying mechanisms and determinants of genomic diversity. Carcinogenesis is a dynamic, complex phenomenon representing the interplay between genetic and environmental factors that results in divergent phenotypes across ethnicities and geography. For example, compared with whites, there is a higher incidence of prostate cancer among Africans and African Americans, and the disease is generally more aggressive and fatal. Genome-wide association studies have identified germline susceptibility loci that may account for differences between the African and non-African patients, but the lack of availability of appropriate cohorts for replication studies and the incomplete understanding of genomic architecture across populations pose major limitations. We further discuss the transformative potential of routine diagnostic evaluation for actionable somatic alterations, using lung cancer as an example, highlighting implications of population disparities, current hurdles in implementation, and the far-reaching potential of clinical genomics in enhancing cancer prevention, diagnosis, and treatment. As we enter the era of precision cancer medicine, a concerted multinational effort is key to addressing population and genomic diversity as well as overcoming barriers and geographical disparities in research and health care delivery. © 2015 by American Society of Clinical Oncology.
Mottawea, Walid; Duceppe, Marc-Olivier; Dupras, Andrée A; Usongo, Valentine; Jeukens, Julie; Freschi, Luca; Emond-Rheault, Jean-Guillaume; Hamel, Jeremie; Kukavica-Ibrulj, Irena; Boyle, Brian; Gill, Alexander; Burnett, Elton; Franz, Eelco; Arya, Gitanjali; Weadge, Joel T; Gruenheid, Samantha; Wiedmann, Martin; Huang, Hongsheng; Daigle, France; Moineau, Sylvain; Bekal, Sadjia; Levesque, Roger C; Goodridge, Lawrence D; Ogunremi, Dele
2018-01-01
Non-typhoidal Salmonella is a leading cause of foodborne illness worldwide. Prompt and accurate identification of the sources of Salmonella responsible for disease outbreaks is crucial to minimize infections and eliminate ongoing sources of contamination. Current subtyping tools including single nucleotide polymorphism (SNP) typing may be inadequate, in some instances, to provide the required discrimination among epidemiologically unrelated Salmonella strains. Prophage genes represent the majority of the accessory genes in bacteria genomes and have potential to be used as high discrimination markers in Salmonella . In this study, the prophage sequence diversity in different Salmonella serovars and genetically related strains was investigated. Using whole genome sequences of 1,760 isolates of S. enterica representing 151 Salmonella serovars and 66 closely related bacteria, prophage sequences were identified from assembled contigs using PHASTER. We detected 154 different prophages in S. enterica genomes. Prophage sequences were highly variable among S. enterica serovars with a median ± interquartile range (IQR) of 5 ± 3 prophage regions per genome. While some prophage sequences were highly conserved among the strains of specific serovars, few regions were lineage specific. Therefore, strains belonging to each serovar could be clustered separately based on their prophage content. Analysis of S . Enteritidis isolates from seven outbreaks generated distinct prophage profiles for each outbreak. Taken altogether, the diversity of the prophage sequences correlates with genome diversity. Prophage repertoires provide an additional marker for differentiating S. enterica subtypes during foodborne outbreaks.
Browning, Brian L.; Yu, Zhaoxia
2009-01-01
We present a novel method for simultaneous genotype calling and haplotype-phase inference. Our method employs the computationally efficient BEAGLE haplotype-frequency model, which can be applied to large-scale studies with millions of markers and thousands of samples. We compare genotype calls made with our method to genotype calls made with the BIRDSEED, CHIAMO, GenCall, and ILLUMINUS genotype-calling methods, using genotype data from the Illumina 550K and Affymetrix 500K arrays. We show that our method has higher genotype-call accuracy and yields fewer uncalled genotypes than competing methods. We perform single-marker analysis of data from the Wellcome Trust Case Control Consortium bipolar disorder and type 2 diabetes studies. For bipolar disorder, the genotype calls in the original study yield 25 markers with apparent false-positive association with bipolar disorder at a p < 10−7 significance level, whereas genotype calls made with our method yield no associated markers at this significance threshold. Conversely, for markers with replicated association with type 2 diabetes, there is good concordance between genotype calls used in the original study and calls made by our method. Results from single-marker and haplotypic analysis of our method's genotype calls for the bipolar disorder study indicate that our method is highly effective at eliminating genotyping artifacts that cause false-positive associations in genome-wide association studies. Our new genotype-calling methods are implemented in the BEAGLE and BEAGLECALL software packages. PMID:19931040
USDA-ARS?s Scientific Manuscript database
Genome signatures of artificial selection in U.S. Jersey cattle were identified by examining changes in haplotype homozygosity for a resource population of animals born between 1962 and 2005. Genetic merit of this population changed dramatically during this period for a number of traits, especially ...
Rubio, Justin P.; Bahlo, Melanie; Butzkueven, Helmut; van der Mei, Ingrid A. F.; Sale, Michèle M.; Dickinson, Joanne L.; Groom, Patricia; Johnson, Laura J.; Simmons, Rex D.; Tait, Brian; Varney, Mike; Taylor, Bruce; Dwyer, Terence; Williamson, Robert; Gough, Nicholas M.; Kilpatrick, Trevor J.; Speed, Terence P.; Foote, Simon J.
2002-01-01
Association of multiple sclerosis (MS) with the human leukocyte antigen (HLA) class II haplotype DRB1*1501-DQB1*0602 is the most consistently replicated finding of genetic studies of the disease. However, the high level of linkage disequilibrium (LD) in the HLA region has hindered the identification of other loci that single-marker tests for association are unlikely to resolve. In order to address this issue, we generated haplotypes spanning 14.754 Mb (5 cM) across the entire HLA region. The haplotypes, which were inferred by genotyping relatives of 152 patients with MS and 105 unaffected control subjects of Tasmanian ancestry, define a genomic segment from D6S276 to D6S291, including 13 microsatellite markers integrated with allele-typing data for DRB1 and DQB1. Association to the DRB1*1501-DQB1*0602 haplotype was replicated. In addition, we found that the class I/extended class I region, defined by a genomic segment of ∼400 kb between MOGCA and D6S265, harbors genes that independently increase risk of, or provide protection from, MS. Log-linear modeling analysis of constituent haplotypes that represent genomic regions containing class I (MOGCA-D6S265), class III (TNFa-TNFd-D6S273), and class II (DRB1-DQB1) genes indicated that having class I and class II susceptibility variants on the same haplotype provides an additive effect on risk. Moreover, we found no evidence for a disease locus in the class III region defined by a 150-kb genomic segment containing the TNF locus and 14 other genes. A global overview of LD performed using GOLD identified two discrete blocks of LD in the HLA region that correspond well with previous findings. We propose that the analysis of haplotypes, by use of the types of approaches outlined in the present article, should make it possible to more accurately define the contribution of the HLA to MS. PMID:11923913
Y-STR haplotypes of Native American populations from the Brazilian Amazon region.
Palha, Teresinha Jesus Brabo Ferreira; Rodrigues, Elzemar Martins Ribeiro; dos Santos, Sidney Emanuel Batista
2010-10-01
The allele and haplotype frequencies of nine Y-STRs (DYS19, DYS389 I, DYS389 II, DYS390, DYS391, DYS392, DYS393, DYS385 I/II) were determined in a sample of six native tribes from the Brazilian Amazon (Tiriyó, Awa-Guajá, Waiãpi, Urubu-Kaapor, Zoé and Parakanã). Forty-eight different haplotypes were identified, 28 of which unique. Five haplotypes are very frequent and were shared by over 10 individuals. The estimated haplotype diversity (0.9114) was very low compared to other geographic groups, including Africans, Europeans and Asians. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Single nucleotide polymorphisms and haplotypes associated with feed efficiency in beef cattle
2013-01-01
Background General, breed- and diet-dependent associations between feed efficiency in beef cattle and single nucleotide polymorphisms (SNPs) or haplotypes were identified on a population of 1321 steers using a 50 K SNP panel. Genomic associations with traditional two-step indicators of feed efficiency – residual feed intake (RFI), residual average daily gain (RADG), and residual intake gain (RIG) – were compared to associations with two complementary one-step indicators of feed efficiency: efficiency of intake (EI) and efficiency of gain (EG). Associations uncovered in a training data set were evaluated on independent validation data set. A multi-SNP model was developed to predict feed efficiency. Functional analysis of genes harboring SNPs significantly associated with feed efficiency and network visualization aided in the interpretation of the results. Results For the five feed efficiency indicators, the numbers of general, breed-dependent, and diet-dependent associations with SNPs (P-value < 0.0001) were 31, 40, and 25, and with haplotypes were six, ten, and nine, respectively. Of these, 20 SNP and six haplotype associations overlapped between RFI and EI, and five SNP and one haplotype associations overlapped between RADG and EG. This result confirms the complementary value of the one and two-step indicators. The multi-SNP models included 89 SNPs and offered a precise prediction of the five feed efficiency indicators. The associations of 17 SNPs and 7 haplotypes with feed efficiency were confirmed on the validation data set. Nine clusters of Gene Ontology and KEGG pathway categories (mean P-value < 0.001) including, 9nucleotide binding; ion transport, phosphorous metabolic process, and the MAPK signaling pathway were overrepresented among the genes harboring the SNPs associated with feed efficiency. Conclusions The general SNP associations suggest that a single panel of genomic variants can be used regardless of breed and diet. The breed- and diet
OryzaGenome: Genome Diversity Database of Wild Oryza Species.
Ohyanagi, Hajime; Ebata, Toshinobu; Huang, Xuehui; Gong, Hao; Fujita, Masahiro; Mochizuki, Takako; Toyoda, Atsushi; Fujiyama, Asao; Kaminuma, Eli; Nakamura, Yasukazu; Feng, Qi; Wang, Zi-Xuan; Han, Bin; Kurata, Nori
2016-01-01
The species in the genus Oryza, encompassing nine genome types and 23 species, are a rich genetic resource and may have applications in deeper genomic analyses aiming to understand the evolution of plant genomes. With the advancement of next-generation sequencing (NGS) technology, a flood of Oryza species reference genomes and genomic variation information has become available in recent years. This genomic information, combined with the comprehensive phenotypic information that we are accumulating in our Oryzabase, can serve as an excellent genotype-phenotype association resource for analyzing rice functional and structural evolution, and the associated diversity of the Oryza genus. Here we integrate our previous and future phenotypic/habitat information and newly determined genotype information into a united repository, named OryzaGenome, providing the variant information with hyperlinks to Oryzabase. The current version of OryzaGenome includes genotype information of 446 O. rufipogon accessions derived by imputation and of 17 accessions derived by imputation-free deep sequencing. Two variant viewers are implemented: SNP Viewer as a conventional genome browser interface and Variant Table as a text-based browser for precise inspection of each variant one by one. Portable VCF (variant call format) file or tab-delimited file download is also available. Following these SNP (single nucleotide polymorphism) data, reference pseudomolecules/scaffolds/contigs and genome-wide variation information for almost all of the closely and distantly related wild Oryza species from the NIG Wild Rice Collection will be available in future releases. All of the resources can be accessed through http://viewer.shigen.info/oryzagenome/. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.
Evolutionary genomics of dog domestication.
Wayne, Robert K; vonHoldt, Bridgett M
2012-02-01
We review the underlying principles and tools used in genomic studies of domestic dogs aimed at understanding the genetic changes that have occurred during domestication. We show that there are two principle modes of evolution within dogs. One primary mode that accounts for much of the remarkable diversity of dog breeds is the fixation of discrete mutations of large effect in individual lineages that are then crossed to various breed groupings. This transfer of mutations across the dog evolutionary tree leads to the appearance of high phenotypic diversity that in actuality reflects a small number of major genes. A second mechanism causing diversification involves the selective breeding of dogs within distinct phenotypic or functional groups, which enhances specific group attributes such as heading or tracking. Such progressive selection leads to a distinct genetic structure in evolutionary trees such that functional and phenotypic groups cluster genetically. We trace the origin of the nuclear genome in dogs based on haplotype-sharing analyses between dogs and gray wolves and show that contrary to previous mtDNA analyses, the nuclear genome of dogs derives primarily from Middle Eastern or European wolves, a result more consistent with the archeological record. Sequencing analysis of the IGF1 gene, which has been the target of size selection in small breeds, further supports this conclusion. Finally, we discuss how a black coat color mutation that evolved in dogs has transformed North American gray wolf populations, providing a first example of a mutation that appeared under domestication and selectively swept through a wild relative.
Artico, L O; Bianchini, A; Grubel, K S; Monteiro, D S; Estima, S C; Oliveira, L R de; Bonatto, S L; Marins, L F
2010-09-01
The South American sea lion, Otaria flavescens, is widely distributed along the Pacific and Atlantic coasts of South America. However, along the Brazilian coast, there are only two nonbreeding sites for the species (Refúgio de Vida Silvestre da Ilha dos Lobos and Refúgio de Vida Silvestre do Molhe Leste da Barra do Rio Grande), both in Southern Brazil. In this region, the species is continuously under the effect of anthropic activities, mainly those related to environmental contamination with organic and inorganic chemicals and fishery interactions. This paper reports, for the first time, the genetic diversity of O. flavescens found along the Southern Brazilian coast. A 287-bp fragment of the mitochondrial DNA control region (D-loop) was analyzed. Seven novel haplotypes were found in 56 individuals (OFA1-OFA7), with OFA1 being the most frequent (47.54%). Nucleotide diversity was moderate (π = 0.62%) and haplotype diversity was relatively low (67%). Furthermore, the median joining network analysis indicated that Brazilian haplotypes formed a reciprocal monophyletic clade when compared to the haplotypes from the Peruvian population on the Pacific coast. These two populations do not share haplotypes and may have become isolated some time back. Further genetic studies covering the entire species distribution are necessary to better understand the biological implications of the results reported here for the management and conservation of South American sea lions.
Genomic diversity within the haloalkaliphilic genus Thioalkalivibrio
Ahn, Anne-Catherine; Meier-Kolthoff, Jan P.; Overmars, Lex; ...
2017-03-10
Thioalkalivibrio is a genus of obligate chemolithoautotrophic haloalkaliphilic sulfur-oxidizing bacteria. Their habitat are soda lakes which are dual extreme environments with a pH range from 9.5 to 11 and salt concentrations up to saturation. More than 100 strains of this genus have been isolated from various soda lakes all over the world, but only ten species have been effectively described yet. Therefore, the assignment of the remaining strains to either existing or novel species is important and will further elucidate their genomic diversity as well as give a better general understanding of this genus. Recently, the genomes of 76 Thioalkalivibriomore » strains were sequenced. On these, we applied different methods including (i) 16S rRNA gene sequence analysis, (ii) Multilocus Sequence Analysis (MLSA) based on eight housekeeping genes, (iii) Average Nucleotide Identity based on BLAST (ANI b) and MUMmer (ANI m ), (iv) Tetranucleotide frequency correlation coefficients (TETRA), (v) digital DNA:DNA hybridization (dDDH) as well as (vi) nucleotide- and amino acid-based Genome BLAST Distance Phylogeny (GBDP) analyses. We detected a high genomic diversity by revealing 15 new "genomic" species and 16 new "genomic" subspecies in addition to the ten already described species. Phylogenetic and phylogenomic analyses showed that the genus is not monophyletic, because four strains were clearly separated from the other Thioalkalivibrio by type strains from other genera. Therefore, it is recommended to classify the latter group as a novel genus. The biogeographic distribution of Thioalkalivibrio suggested that the different "genomic" species can be classified as candidate disjunct or candidate endemic species. This study is a detailed genome-based classification and identification of members within the genus Thioalkalivibrio. However, future phenotypical and chemotaxonomical studies will be needed for a full species description of this genus.« less
Miller, F W; Chen, W; O'Hanlon, T P; Cooper, R G; Vencovsky, J; Rider, L G; Danko, K; Wedderburn, L R; Lundberg, I E; Pachman, L M; Reed, A M; Ytterberg, S R; Padyukov, L; Selva-O'Callaghan, A; Radstake, T R; Isenberg, D A; Chinoy, H; Ollier, W E R; Scheet, P; Peng, B; Lee, A; Byun, J; Lamb, J A; Gregersen, P K; Amos, C I
2015-10-01
Autoimmune muscle diseases (myositis) comprise a group of complex phenotypes influenced by genetic and environmental factors. To identify genetic risk factors in patients of European ancestry, we conducted a genome-wide association study (GWAS) of the major myositis phenotypes in a total of 1710 cases, which included 705 adult dermatomyositis, 473 juvenile dermatomyositis, 532 polymyositis and 202 adult dermatomyositis, juvenile dermatomyositis or polymyositis patients with anti-histidyl-tRNA synthetase (anti-Jo-1) autoantibodies, and compared them with 4724 controls. Single-nucleotide polymorphisms showing strong associations (P<5×10(-8)) in GWAS were identified in the major histocompatibility complex (MHC) region for all myositis phenotypes together, as well as for the four clinical and autoantibody phenotypes studied separately. Imputation and regression analyses found that alleles comprising the human leukocyte antigen (HLA) 8.1 ancestral haplotype (AH8.1) defined essentially all the genetic risk in the phenotypes studied. Although the HLA DRB1*03:01 allele showed slightly stronger associations with adult and juvenile dermatomyositis, and HLA B*08:01 with polymyositis and anti-Jo-1 autoantibody-positive myositis, multiple alleles of AH8.1 were required for the full risk effects. Our findings establish that alleles of the AH8.1 comprise the primary genetic risk factors associated with the major myositis phenotypes in geographically diverse Caucasian populations.
Visualization of Genome Diversity in German Shepherd Dogs.
Mortlock, Sally-Anne; Booth, Rachel; Mazrier, Hamutal; Khatkar, Mehar S; Williamson, Peter
2015-01-01
A loss of genetic diversity may lead to increased disease risks in subpopulations of dogs. The canine breed structure has contributed to relatively small effective population size in many breeds and can limit the options for selective breeding strategies to maintain diversity. With the completion of the canine genome sequencing project, and the subsequent reduction in the cost of genotyping on a genomic scale, evaluating diversity in dogs has become much more accurate and accessible. This provides a potential tool for advising dog breeders and developing breeding programs within a breed. A challenge in doing this is to present complex relationship data in a form that can be readily utilized. Here, we demonstrate the use of a pipeline, known as NetView, to visualize the network of relationships in a subpopulation of German Shepherd Dogs.
Dutoit, Ludovic; Burri, Reto; Nater, Alexander; Mugal, Carina F; Ellegren, Hans
2017-07-01
Properly estimating genetic diversity in populations of nonmodel species requires a basic understanding of how diversity is distributed across the genome and among individuals. To this end, we analysed whole-genome resequencing data from 20 collared flycatchers (genome size ≈1.1 Gb; 10.13 million single nucleotide polymorphisms detected). Genomewide nucleotide diversity was almost identical among individuals (mean = 0.00394, range = 0.00384-0.00401), but diversity levels varied extensively across the genome (95% confidence interval for 200-kb windows = 0.0013-0.0053). Diversity was related to selective constraint such that in comparison with intergenic DNA, diversity at fourfold degenerate sites was reduced to 85%, 3' UTRs to 82%, 5' UTRs to 70% and nondegenerate sites to 12%. There was a strong positive correlation between diversity and chromosome size, probably driven by a higher density of targets for selection on smaller chromosomes increasing the diversity-reducing effect of linked selection. Simulations exploring the ability of sequence data from a small number of genetic markers to capture the observed diversity clearly demonstrated that diversity estimation from finite sampling of such data is bound to be associated with large confidence intervals. Nevertheless, we show that precision in diversity estimation in large outbred population benefits from increasing the number of loci rather than the number of individuals. Simulations mimicking RAD sequencing showed that this approach gives accurate estimates of genomewide diversity. Based on the patterns of observed diversity and the performed simulations, we provide broad recommendations for how genetic diversity should be estimated in natural populations. © 2016 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.
Identifying tagging SNPs for African specific genetic variation from the African Diaspora Genome
Johnston, Henry Richard; Hu, Yi-Juan; Gao, Jingjing; O’Connor, Timothy D.; Abecasis, Gonçalo R.; Wojcik, Genevieve L; Gignoux, Christopher R.; Gourraud, Pierre-Antoine; Lizee, Antoine; Hansen, Mark; Genuario, Rob; Bullis, Dave; Lawley, Cindy; Kenny, Eimear E.; Bustamante, Carlos; Beaty, Terri H.; Mathias, Rasika A.; Barnes, Kathleen C.; Qin, Zhaohui S.; Preethi Boorgula, Meher; Campbell, Monica; Chavan, Sameer; Ford, Jean G.; Foster, Cassandra; Gao, Li; Hansel, Nadia N.; Horowitz, Edward; Huang, Lili; Ortiz, Romina; Potee, Joseph; Rafaels, Nicholas; Ruczinski, Ingo; Scott, Alan F.; Taub, Margaret A.; Vergara, Candelaria; Levin, Albert M.; Padhukasahasram, Badri; Williams, L. Keoki; Dunston, Georgia M.; Faruque, Mezbah U.; Gietzen, Kimberly; Deshpande, Aniket; Grus, Wendy E.; Locke, Devin P.; Foreman, Marilyn G.; Avila, Pedro C.; Grammer, Leslie; Kim, Kwang-Youn A.; Kumar, Rajesh; Schleimer, Robert; De La Vega, Francisco M.; Shringarpure, Suyash S.; Musharoff, Shaila; Burchard, Esteban G.; Eng, Celeste; Hernandez, Ryan D.; Pino-Yanes, Maria; Torgerson, Dara G.; Szpiech, Zachary A.; Torres, Raul; Nicolae, Dan L.; Ober, Carole; Olopade, Christopher O; Olopade, Olufunmilayo; Oluwole, Oluwafemi; Arinola, Ganiyu; Song, Wei; Correa, Adolfo; Musani, Solomon; Wilson, James G.; Lange, Leslie A.; Akey, Joshua; Bamshad, Michael; Chong, Jessica; Fu, Wenqing; Nickerson, Deborah; Reiner, Alexander; Hartert, Tina; Ware, Lorraine B.; Bleecker, Eugene; Meyers, Deborah; Ortega, Victor E.; Maul, Pissamai; Maul, Trevor; Watson, Harold; Ilma Araujo, Maria; Riccio Oliveira, Ricardo; Caraballo, Luis; Marrugo, Javier; Martinez, Beatriz; Meza, Catherine; Ayestas, Gerardo; Francisco Herrera-Paz, Edwin; Landaverde-Torres, Pamela; Erazo, Said Omar Leiva; Martinez, Rosella; Mayorga, Alvaro; Mayorga, Luis F.; Mejia-Mejia, Delmy-Aracely; Ramos, Hector; Saenz, Allan; Varela, Gloria; Marina Vasquez, Olga; Ferguson, Trevor; Knight-Madden, Jennifer; Samms-Vaughan, Maureen; Wilks, Rainford J.; Adegnika, Akim; Ateba-Ngoa, Ulysse; Yazdanbakhsh, Maria
2017-01-01
A primary goal of The Consortium on Asthma among African-ancestry Populations in the Americas (CAAPA) is to develop an ‘African Diaspora Power Chip’ (ADPC), a genotyping array consisting of tagging SNPs, useful in comprehensively identifying African specific genetic variation. This array is designed based on the novel variation identified in 642 CAAPA samples of African ancestry with high coverage whole genome sequence data (~30× depth). This novel variation extends the pattern of variation catalogued in the 1000 Genomes and Exome Sequencing Projects to a spectrum of populations representing the wide range of West African genomic diversity. These individuals from CAAPA also comprise a large swath of the African Diaspora population and incorporate historical genetic diversity covering nearly the entire Atlantic coast of the Americas. Here we show the results of designing and producing such a microchip array. This novel array covers African specific variation far better than other commercially available arrays, and will enable better GWAS analyses for researchers with individuals of African descent in their study populations. A recent study cataloging variation in continental African populations suggests this type of African-specific genotyping array is both necessary and valuable for facilitating large-scale GWAS in populations of African ancestry. PMID:28429804
Review: can diet influence the selective advantage of mitochondrial DNA haplotypes?
Ballard, J William O; Youngson, Neil A
2015-11-05
This review explores the potential for changes in dietary macronutrients to differentially influence mitochondrial bioenergetics and thereby the frequency of mtDNA haplotypes in natural populations. Such dietary modification may be seasonal or result from biogeographic or demographic shifts. Mechanistically, mtDNA haplotypes may influence the activity of the electron transport system (ETS), retrograde signalling to the nuclear genome and affect epigenetic modifications. Thus, differential provisioning by macronutrients may lead to selection through changes in the levels of ATP production, modulation of metabolites (including AMP, reactive oxygen species (ROS) and the NAD(+)/NADH ratio) and potentially complex epigenetic effects. The exquisite complexity of dietary influence on haplotype frequency is further illustrated by the fact that macronutrients may differentially influence the selective advantage of specific mutations in different life-history stages. In Drosophila, complex I mutations may affect larval growth because dietary nutrients are fed through this complex in immaturity. In contrast, the majority of electrons are provided to complex III in adult flies. We conclude the review with a case study that considers specific interactions between diet and complex I of the ETS. Complex I is the first enzyme of the mitochondrial ETS and co-ordinates in the oxidation of NADH and transfer of electrons to ubiquinone. Although the supposition that mtDNA variants may be selected upon by dietary macronutrients could be intuitively consistent to some and counter intuitive to others, it must face a multitude of scientific hurdles before it can be recognized. © 2015 Authors.
Genome-wide detection of conservative site-specific recombination in bacteria
Mathias Garrett, Elizabeth; Camilli, Andrew
2018-01-01
The ability of clonal bacterial populations to generate genomic and phenotypic heterogeneity is thought to be of great importance for many commensal and pathogenic bacteria. One common mechanism contributing to diversity formation relies on the inversion of small genomic DNA segments in a process commonly referred to as conservative site-specific recombination. This phenomenon is known to occur in several bacterial lineages, however it remains notoriously difficult to identify due to the lack of conserved features. Here, we report an easy-to-implement method based on high-throughput paired-end sequencing for genome-wide detection of conservative site-specific recombination on a single-nucleotide level. We demonstrate the effectiveness of the method by successfully detecting several novel inversion sites in an epidemic isolate of the enteric pathogen Clostridium difficile. Using an experimental approach, we validate the inversion potential of all detected sites in C. difficile and quantify their prevalence during exponential and stationary growth in vitro. In addition, we demonstrate that the master recombinase RecV is responsible for the inversion of some but not all invertible sites. Using a fluorescent gene-reporter system, we show that at least one gene from a two-component system located next to an invertible site is expressed in an on-off mode reminiscent of phase variation. We further demonstrate the applicability of our method by mining 209 publicly available sequencing datasets and show that conservative site-specific recombination is common in the bacterial realm but appears to be absent in some lineages. Finally, we show that the gene content associated with the inversion sites is diverse and goes beyond traditionally described surface components. Overall, our method provides a robust platform for detection of conservative site-specific recombination in bacteria and opens a new avenue for global exploration of this important phenomenon. PMID:29621238
Genomic profiling of plastid DNA variation in the Mediterranean olive tree
2011-01-01
Background Characterisation of plastid genome (or cpDNA) polymorphisms is commonly used for phylogeographic, population genetic and forensic analyses in plants, but detecting cpDNA variation is sometimes challenging, limiting the applications of such an approach. In the present study, we screened cpDNA polymorphism in the olive tree (Olea europaea L.) by sequencing the complete plastid genome of trees with a distinct cpDNA lineage. Our objective was to develop new markers for a rapid genomic profiling (by Multiplex PCRs) of cpDNA haplotypes in the Mediterranean olive tree. Results Eight complete cpDNA genomes of Olea were sequenced de novo. The nucleotide divergence between olive cpDNA lineages was low and not exceeding 0.07%. Based on these sequences, markers were developed for studying two single nucleotide substitutions and length polymorphism of 62 regions (with variable microsatellite motifs or other indels). They were then used to genotype the cpDNA variation in cultivated and wild Mediterranean olive trees (315 individuals). Forty polymorphic loci were detected on this sample, allowing the distinction of 22 haplotypes belonging to the three Mediterranean cpDNA lineages known as E1, E2 and E3. The discriminating power of cpDNA variation was particularly low for the cultivated olive tree with one predominating haplotype, but more diversity was detected in wild populations. Conclusions We propose a method for a rapid characterisation of the Mediterranean olive germplasm. The low variation in the cultivated olive tree indicated that the utility of cpDNA variation for forensic analyses is limited to rare haplotypes. In contrast, the high cpDNA variation in wild populations demonstrated that our markers may be useful for phylogeographic and populations genetic studies in O. europaea. PMID:21569271
Black, F L
1984-11-01
HLA B-C haplotypes exhibit common disequilibria in populations drawn from four continents, indicating that they are subject to broadly active selective forces. However, the A-B and A-C associations we have examined show no consistent disequilibrium pattern, leaving open the possibility that these disequilibria are due to descent from common progenitors. By examining HLA haplotype distributions, I have explored the implications that would follow from the hypothesis that biological selection played no role in determining A-C disequilibria in 10 diverse tribes of the lower Amazon Basin. Certain haplotypes are in strong positive disequilibria across a broad geographic area, suggesting that members of diverse tribes descend from common ancestors. On the basis of the extent of diffusion of the components of these haplotypes, one can estimate that the progenitors lived less than 6,000 years ago. One widely encountered lineage entered the area within the last 1,200 years. When haplotype frequencies are used in genetic distance measurements, they give a pattern of relationships very similar to that obtained by conventional chord measurements based on several genetic markers; but more than that, when individual haplotype disequilibria in the several tribes are compared, multiple origins of a single tribe are discernible and relationships are revealed that correlate more closely to geographic and linguistic patterns than do the genetic distance measurements.
Evolution of floral diversity: genomics, genes and gamma
Berger, Brent A.; Howarth, Dianella G.; Soltis, Douglas E.
2017-01-01
A salient feature of flowering plant diversification is the emergence of a novel suite of floral features coinciding with the origin of the most species-rich lineage, Pentapetalae. Advances in phylogenetics, developmental genetics and genomics, including new analyses presented here, are helping to reconstruct the specific evolutionary steps involved in the evolution of this clade. The enormous floral diversity among Pentapetalae appears to be built on a highly conserved ground plan of five-parted (pentamerous) flowers with whorled phyllotaxis. By contrast, lability in the number and arrangement of component parts of the flower characterize the early-diverging eudicot lineages subtending Pentapetalae. The diversification of Pentapetalae also coincides closely with ancient hexaploidy, referred to as the gamma whole-genome triplication, for which the phylogenetic timing, mechanistic details and molecular evolutionary consequences are as yet not fully resolved. Transcription factors regulating floral development often persist in duplicate or triplicate in gamma-derived genomes, and both individual genes and whole transcriptional programmes exhibit a shift from broadly overlapping to tightly defined expression domains in Pentapetalae flowers. Investigations of these changes associated with the origin of Pentapetalae can lead to a more comprehensive understanding of what is arguably one of the most important evolutionary diversification events within terrestrial plants. This article is part of the themed issue ‘Evo-devo in the genomics era, and the origins of morphological diversity’. PMID:27994132
2013-01-01
Background Lyme disease is caused by spirochete bacteria from the Borrelia burgdorferi sensu lato (B. burgdorferi s.l.) species complex. To reconstruct the evolution of B. burgdorferi s.l. and identify the genomic basis of its human virulence, we compared the genomes of 23 B. burgdorferi s.l. isolates from Europe and the United States, including B. burgdorferi sensu stricto (B. burgdorferi s.s., 14 isolates), B. afzelii (2), B. garinii (2), B. “bavariensis” (1), B. spielmanii (1), B. valaisiana (1), B. bissettii (1), and B. “finlandensis” (1). Results Robust B. burgdorferi s.s. and B. burgdorferi s.l. phylogenies were obtained using genome-wide single-nucleotide polymorphisms, despite recombination. Phylogeny-based pan-genome analysis showed that the rate of gene acquisition was higher between species than within species, suggesting adaptive speciation. Strong positive natural selection drives the sequence evolution of lipoproteins, including chromosomally-encoded genes 0102 and 0404, cp26-encoded ospC and b08, and lp54-encoded dbpA, a07, a22, a33, a53, a65. Computer simulations predicted rapid adaptive radiation of genomic groups as population size increases. Conclusions Intra- and inter-specific pan-genome sizes of B. burgdorferi s.l. expand linearly with phylogenetic diversity. Yet gene-acquisition rates in B. burgdorferi s.l. are among the lowest in bacterial pathogens, resulting in high genome stability and few lineage-specific genes. Genome adaptation of B. burgdorferi s.l. is driven predominantly by copy-number and sequence variations of lipoprotein genes. New genomic groups are likely to emerge if the current trend of B. burgdorferi s.l. population expansion continues. PMID:24112474
Li, Ying-hui; Zhou, Guangyu; Ma, Jianxin; Jiang, Wenkai; Jin, Long-guo; Zhang, Zhouhao; Guo, Yong; Zhang, Jinbo; Sui, Yi; Zheng, Liangtao; Zhang, Shan-shan; Zuo, Qiyang; Shi, Xue-hui; Li, Yan-fei; Zhang, Wan-ke; Hu, Yiyao; Kong, Guanyi; Hong, Hui-long; Tan, Bing; Song, Jian; Liu, Zhang-xiong; Wang, Yaoshen; Ruan, Hang; Yeung, Carol K L; Liu, Jian; Wang, Hailong; Zhang, Li-juan; Guan, Rong-xia; Wang, Ke-jing; Li, Wen-bin; Chen, Shou-yi; Chang, Ru-zhen; Jiang, Zhi; Jackson, Scott A; Li, Ruiqiang; Qiu, Li-juan
2014-10-01
Wild relatives of crops are an important source of genetic diversity for agriculture, but their gene repertoire remains largely unexplored. We report the establishment and analysis of a pan-genome of Glycine soja, the wild relative of cultivated soybean Glycine max, by sequencing and de novo assembly of seven phylogenetically and geographically representative accessions. Intergenomic comparisons identified lineage-specific genes and genes with copy number variation or large-effect mutations, some of which show evidence of positive selection and may contribute to variation of agronomic traits such as biotic resistance, seed composition, flowering and maturity time, organ size and final biomass. Approximately 80% of the pan-genome was present in all seven accessions (core), whereas the rest was dispensable and exhibited greater variation than the core genome, perhaps reflecting a role in adaptation to diverse environments. This work will facilitate the harnessing of untapped genetic diversity from wild soybean for enhancement of elite cultivars.
The African Genome Variation Project shapes medical genetics in Africa
NASA Astrophysics Data System (ADS)
Gurdasani, Deepti; Carstensen, Tommy; Tekola-Ayele, Fasil; Pagani, Luca; Tachmazidou, Ioanna; Hatzikotoulas, Konstantinos; Karthikeyan, Savita; Iles, Louise; Pollard, Martin O.; Choudhury, Ananyo; Ritchie, Graham R. S.; Xue, Yali; Asimit, Jennifer; Nsubuga, Rebecca N.; Young, Elizabeth H.; Pomilla, Cristina; Kivinen, Katja; Rockett, Kirk; Kamali, Anatoli; Doumatey, Ayo P.; Asiki, Gershim; Seeley, Janet; Sisay-Joof, Fatoumatta; Jallow, Muminatou; Tollman, Stephen; Mekonnen, Ephrem; Ekong, Rosemary; Oljira, Tamiru; Bradman, Neil; Bojang, Kalifa; Ramsay, Michele; Adeyemo, Adebowale; Bekele, Endashaw; Motala, Ayesha; Norris, Shane A.; Pirie, Fraser; Kaleebu, Pontiano; Kwiatkowski, Dominic; Tyler-Smith, Chris; Rotimi, Charles; Zeggini, Eleftheria; Sandhu, Manjinder S.
2015-01-01
Given the importance of Africa to studies of human origins and disease susceptibility, detailed characterization of African genetic diversity is needed. The African Genome Variation Project provides a resource with which to design, implement and interpret genomic studies in sub-Saharan Africa and worldwide. The African Genome Variation Project represents dense genotypes from 1,481 individuals and whole-genome sequences from 320 individuals across sub-Saharan Africa. Using this resource, we find novel evidence of complex, regionally distinct hunter-gatherer and Eurasian admixture across sub-Saharan Africa. We identify new loci under selection, including loci related to malaria susceptibility and hypertension. We show that modern imputation panels (sets of reference genotypes from which unobserved or missing genotypes in study sets can be inferred) can identify association signals at highly differentiated loci across populations in sub-Saharan Africa. Using whole-genome sequencing, we demonstrate further improvements in imputation accuracy, strengthening the case for large-scale sequencing efforts of diverse African haplotypes. Finally, we present an efficient genotype array design capturing common genetic variation in Africa.
The African Genome Variation Project shapes medical genetics in Africa.
Gurdasani, Deepti; Carstensen, Tommy; Tekola-Ayele, Fasil; Pagani, Luca; Tachmazidou, Ioanna; Hatzikotoulas, Konstantinos; Karthikeyan, Savita; Iles, Louise; Pollard, Martin O; Choudhury, Ananyo; Ritchie, Graham R S; Xue, Yali; Asimit, Jennifer; Nsubuga, Rebecca N; Young, Elizabeth H; Pomilla, Cristina; Kivinen, Katja; Rockett, Kirk; Kamali, Anatoli; Doumatey, Ayo P; Asiki, Gershim; Seeley, Janet; Sisay-Joof, Fatoumatta; Jallow, Muminatou; Tollman, Stephen; Mekonnen, Ephrem; Ekong, Rosemary; Oljira, Tamiru; Bradman, Neil; Bojang, Kalifa; Ramsay, Michele; Adeyemo, Adebowale; Bekele, Endashaw; Motala, Ayesha; Norris, Shane A; Pirie, Fraser; Kaleebu, Pontiano; Kwiatkowski, Dominic; Tyler-Smith, Chris; Rotimi, Charles; Zeggini, Eleftheria; Sandhu, Manjinder S
2015-01-15
Given the importance of Africa to studies of human origins and disease susceptibility, detailed characterization of African genetic diversity is needed. The African Genome Variation Project provides a resource with which to design, implement and interpret genomic studies in sub-Saharan Africa and worldwide. The African Genome Variation Project represents dense genotypes from 1,481 individuals and whole-genome sequences from 320 individuals across sub-Saharan Africa. Using this resource, we find novel evidence of complex, regionally distinct hunter-gatherer and Eurasian admixture across sub-Saharan Africa. We identify new loci under selection, including loci related to malaria susceptibility and hypertension. We show that modern imputation panels (sets of reference genotypes from which unobserved or missing genotypes in study sets can be inferred) can identify association signals at highly differentiated loci across populations in sub-Saharan Africa. Using whole-genome sequencing, we demonstrate further improvements in imputation accuracy, strengthening the case for large-scale sequencing efforts of diverse African haplotypes. Finally, we present an efficient genotype array design capturing common genetic variation in Africa.
Specific CAPN10 gene haplotypes influence the clinical profile of polycystic ovary patients.
Gonzalez, Alejandro; Abril, Eduardo; Roca, Alfredo; Aragón, Maria José; Figueroa, Maria José; Velarde, Pilar; Ruiz, Rocío; Fayez, Omar; Galán, José Jorge; Herreros, José Antonio; Real, Luis Miguel; Ruiz, Agustín
2003-11-01
Recently, several research groups have evaluated CAPN10 gene in polycystic ovarian syndrome (PCOS) patients and other phenotypes, including hirsutism or intermediate phenotypes of PCOS. Molecular genetic analysis of CAPN10 gene indicates that different alleles may play a role in PCOS susceptibility and could be associated with idiopathic hirsutism. However, these observations are not exempt from controversy, because independent studies cannot replicate these preliminary findings. We present a haplotype-phenotype correlation study of CAPN10 haplotypes in 148 women showing ecographically detected polycystic ovaries (PCO) combined with one or more of these clinical symptoms: amenorrhea or severe oligomenorrhea, hyperandrogenism, and anovulatory infertility, as well as 93 unrelated controls. We have reconstructed and analyzed 482 CAPN10 haplotypes in patients and controls. We detected the association of UCSNP-44 allele with PCO phenotype in the Spanish population (P = 0.02). In addition, we identified several CAPN10 alleles associated to phenotypic differences observed between PCO patients, such as the presence of hypercholesterolemia (haplotype 1121, P = 0.005), presence of hyperandrogenic features (P = 0.05), and familial cancer incidence (haplotype 1111, P = 0.0005). Our results confirm the association of UCSNP-44 allele with PCO phenotype in the Spanish population. Moreover, we have identified novel candidate risk alleles and genotypes, within CAPN10 gene, that could be associated with important phenotypic and prognosis differences observed in PCOS patients.
USDA-ARS?s Scientific Manuscript database
Initial genomic test results for US Ayrshire dairy cattle became available in January of 2013. Several haplotypes that showed a deficiency of homozygotes were investigated to determine if they had an effect on fertility. A haplotype on chromosome 17 was determined to affect fertility, indicating tha...
Bajaj, Deepak; Das, Shouvik; Badoni, Saurabh; Kumar, Vinod; Singh, Mohar; Bansal, Kailash C.; Tyagi, Akhilesh K.; Parida, Swarup K.
2015-01-01
We identified 82489 high-quality genome-wide SNPs from 93 wild and cultivated Cicer accessions through integrated reference genome- and de novo-based GBS assays. High intra- and inter-specific polymorphic potential (66–85%) and broader natural allelic diversity (6–64%) detected by genome-wide SNPs among accessions signify their efficacy for monitoring introgression and transferring target trait-regulating genomic (gene) regions/allelic variants from wild to cultivated Cicer gene pools for genetic improvement. The population-specific assignment of wild Cicer accessions pertaining to the primary gene pool are more influenced by geographical origin/phenotypic characteristics than species/gene-pools of origination. The functional significance of allelic variants (non-synonymous and regulatory SNPs) scanned from transcription factors and stress-responsive genes in differentiating wild accessions (with potential known sources of yield-contributing and stress tolerance traits) from cultivated desi and kabuli accessions, fine-mapping/map-based cloning of QTLs and determination of LD patterns across wild and cultivated gene-pools are suitably elucidated. The correlation between phenotypic (agromorphological traits) and molecular diversity-based admixed domestication patterns within six structured populations of wild and cultivated accessions via genome-wide SNPs was apparent. This suggests utility of whole genome SNPs as a potential resource for identifying naturally selected trait-regulating genomic targets/functional allelic variants adaptive to diverse agroclimatic regions for genetic enhancement of cultivated gene-pools. PMID:26208313
Systematic, genome-wide, sex-specific linkage of cardiovascular traits in French Canadians.
Seda, Ondrej; Tremblay, Johanne; Gaudet, Daniel; Brunelle, Pierre-Luc; Gurau, Alexandru; Merlo, Ettore; Pilote, Louise; Orlov, Sergei N; Boulva, Francis; Petrovich, Milan; Kotchen, Theodore A; Cowley, Allen W; Hamet, Pavel
2008-04-01
The sexual dimorphism of cardiovascular traits, as well as susceptibility to a variety of related diseases, has long been recognized, yet their sex-specific genomic determinants are largely unknown. We systematically assessed the sex-specific heritability and linkage of 539 hemodynamic, metabolic, anthropometric, and humoral traits in 120 French-Canadian families from the Saguenay-Lac-St-Jean region of Quebec, Canada. We performed multipoint linkage analysis using microsatellite markers followed by peak-wide linkage scan based on Affymetrix Human Mapping 50K Array Xba240 single nucleotide polymorphism genotypes in 3 settings, including the entire sample and then separately in men and women. Nearly one half of the traits were age and sex independent, one quarter were both age and sex dependent, and one eighth were exclusively age or sex dependent. Sex-specific phenotypes are most frequent in heart rate and blood pressure categories, whereas sex- and age-independent determinants are predominant among humoral and biochemical parameters. Twenty sex-specific loci passing multiple testing criteria were corroborated by 2-point single nucleotide polymorphism linkage. Several resting systolic blood pressure measurements showed significant genotype-by-sex interaction, eg, male-specific locus at chromosome 12 (male-female logarithm of odds difference: 4.16; interaction P=0.0002), which was undetectable in the entire population, even after adjustment for sex. Detailed interrogation of this locus revealed a 220-kb block overlapping parts of TAO-kinase 3 and SUDS3 genes. In summary, a large number of complex cardiovascular traits display significant sexual dimorphism, for which we have demonstrated genomic determinants at the haplotype level. Many of these would have been missed in a traditional, sex-adjusted setting.
Kortenhoeven, Cornell; Joubert, Fourie; Bastos, Armanda D S; Abolnik, Celia
2015-02-22
Extensive focus is placed on the comparative analyses of consensus genotypes in the study of West Nile virus (WNV) emergence. Few studies account for genetic change in the underlying WNV quasispecies population variants. These variants are not discernable in the consensus genome at the time of emergence, and the maintenance of mutation-selection equilibria of population variants is greatly underestimated. The emergence of lineage 1 WNV strains has been studied extensively, but recent epidemics caused by lineage 2 WNV strains in Hungary, Austria, Greece and Italy emphasizes the increasing importance of this lineage to public health. In this study we explored the quasispecies dynamics of minority variants that contribute to cell-tropism and host determination, i.e. the ability to infect different cell types or cells from different species from Next Generation Sequencing (NGS) data of a historic lineage 2 WNV strain. Minority variants contributing to host cell membrane association persist in the viral population without contributing to the genetic change in the consensus genome. Minority variants are shown to maintain a stable mutation-selection equilibrium under positive selection, particularly in the capsid gene region. This study is the first to infer positive selection and the persistence of WNV haplotype variants that contribute to viral fitness without accompanying genetic change in the consensus genotype, documented solely from NGS sequence data. The approach used in this study streamlines the experimental design seeking viral minority variants accurately from NGS data whilst minimizing the influence of associated sequence error.
Genomic landscape of human diversity across Madagascar
Pierron, Denis; Heiske, Margit; Razafindrazaka, Harilanto; Rakoto, Ignace; Rabetokotany, Nelly; Ravololomanga, Bodo; Rakotozafy, Lucien M.-A.; Rakotomalala, Mireille Mialy; Razafiarivony, Michel; Rasoarifetra, Bako; Raharijesy, Miakabola Andriamampianina; Razafindralambo, Lolona; Ramilisonina; Fanony, Fulgence; Lejamble, Sendra; Thomas, Olivier; Mohamed Abdallah, Ahmed; Rocher, Christophe; Arachiche, Amal; Tonaso, Laure; Pereda-loth, Veronica; Schiavinato, Stéphanie; Brucato, Nicolas; Ricaut, Francois-Xavier; Kusuma, Pradiptajati; Sudoyo, Herawati; Ni, Shengyu; Boland, Anne; Deleuze, Jean-Francois; Beaujard, Philippe; Grange, Philippe; Adelaar, Sander; Stoneking, Mark; Rakotoarisoa, Jean-Aimé; Radimilahy, Chantal; Letellier, Thierry
2017-01-01
Although situated ∼400 km from the east coast of Africa, Madagascar exhibits cultural, linguistic, and genetic traits from both Southeast Asia and Eastern Africa. The settlement history remains contentious; we therefore used a grid-based approach to sample at high resolution the genomic diversity (including maternal lineages, paternal lineages, and genome-wide data) across 257 villages and 2,704 Malagasy individuals. We find a common Bantu and Austronesian descent for all Malagasy individuals with a limited paternal contribution from Europe and the Middle East. Admixture and demographic growth happened recently, suggesting a rapid settlement of Madagascar during the last millennium. However, the distribution of African and Asian ancestry across the island reveals that the admixture was sex biased and happened heterogeneously across Madagascar, suggesting independent colonization of Madagascar from Africa and Asia rather than settlement by an already admixed population. In addition, there are geographic influences on the present genomic diversity, independent of the admixture, showing that a few centuries is sufficient to produce detectable genetic structure in human populations. PMID:28716916
Haplotype Sharing Provides Insights into Fine-Scale Population History and Disease in Finland.
Martin, Alicia R; Karczewski, Konrad J; Kerminen, Sini; Kurki, Mitja I; Sarin, Antti-Pekka; Artomov, Mykyta; Eriksson, Johan G; Esko, Tõnu; Genovese, Giulio; Havulinna, Aki S; Kaprio, Jaakko; Konradi, Alexandra; Korányi, László; Kostareva, Anna; Männikkö, Minna; Metspalu, Andres; Perola, Markus; Prasad, Rashmi B; Raitakari, Olli; Rotar, Oxana; Salomaa, Veikko; Groop, Leif; Palotie, Aarno; Neale, Benjamin M; Ripatti, Samuli; Pirinen, Matti; Daly, Mark J
2018-05-03
Finland provides unique opportunities to investigate population and medical genomics because of its adoption of unified national electronic health records, detailed historical and birth records, and serial population bottlenecks. We assembled a comprehensive view of recent population history (≤100 generations), the timespan during which most rare-disease-causing alleles arose, by comparing pairwise haplotype sharing from 43,254 Finns to that of 16,060 Swedes, Estonians, Russians, and Hungarians from geographically and linguistically adjacent countries with different population histories. We find much more extensive sharing in Finns, with at least one ≥ 5 cM tract on average between pairs of unrelated individuals. By coupling haplotype sharing with fine-scale birth records from more than 25,000 individuals, we find that although haplotype sharing broadly decays with geographical distance, there are pockets of excess haplotype sharing; individuals from northeast Finland typically share several-fold more of their genome in identity-by-descent segments than individuals from southwest regions. We estimate recent effective population-size changes through time across regions of Finland, and we find that there was more continuous gene flow as Finns migrated from southwest to northeast between the early- and late-settlement regions than was dichotomously described previously. Lastly, we show that haplotype sharing is locally enriched by an order of magnitude among pairs of individuals sharing rare alleles and especially among pairs sharing rare disease-causing variants. Our work provides a general framework for using haplotype sharing to reconstruct an integrative view of recent population history and gain insight into the evolutionary origins of rare variants contributing to disease. Copyright © 2018 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
2011-01-01
Background The bacterial pathogen Edwardsiella ictaluri is a primary cause of mortality in channel catfish raised commercially in aquaculture farms. Additional treatment and diagnostic regimes are needed for this enteric pathogen, motivating the discovery and characterization of bacteriophages specific to E. ictaluri. Results The genomes of three Edwardsiella ictaluri-specific bacteriophages isolated from geographically distant aquaculture ponds, at different times, were sequenced and analyzed. The genomes for phages eiAU, eiDWF, and eiMSLS are 42.80 kbp, 42.12 kbp, and 42.69 kbp, respectively, and are greater than 95% identical to each other at the nucleotide level. Nucleotide differences were mostly observed in non-coding regions and in structural proteins, with significant variability in the sequences of putative tail fiber proteins. The genome organization of these phages exhibit a pattern shared by other Siphoviridae. Conclusions These E. ictaluri-specific phage genomes reveal considerable conservation of genomic architecture and sequence identity, even with considerable temporal and spatial divergence in their isolation. Their genomic homogeneity is similarly observed among E. ictaluri bacterial isolates. The genomic analysis of these phages supports the conclusion that these are virulent phages, lacking the capacity for lysogeny or expression of virulence genes. This study contributes to our knowledge of phage genomic diversity and facilitates studies on the diagnostic and therapeutic applications of these phages. PMID:21214923
Stram, Daniel O; Leigh Pearce, Celeste; Bretsky, Phillip; Freedman, Matthew; Hirschhorn, Joel N; Altshuler, David; Kolonel, Laurence N; Henderson, Brian E; Thomas, Duncan C
2003-01-01
The US National Cancer Institute has recently sponsored the formation of a Cohort Consortium (http://2002.cancer.gov/scpgenes.htm) to facilitate the pooling of data on very large numbers of people, concerning the effects of genes and environment on cancer incidence. One likely goal of these efforts will be generate a large population-based case-control series for which a number of candidate genes will be investigated using SNP haplotype as well as genotype analysis. The goal of this paper is to outline the issues involved in choosing a method of estimating haplotype-specific risk estimates for such data that is technically appropriate and yet attractive to epidemiologists who are already comfortable with odds ratios and logistic regression. Our interest is to develop and evaluate extensions of methods, based on haplotype imputation, that have been recently described (Schaid et al., Am J Hum Genet, 2002, and Zaykin et al., Hum Hered, 2002) as providing score tests of the null hypothesis of no effect of SNP haplotypes upon risk, which may be used for more complex tasks, such as providing confidence intervals, and tests of equivalence of haplotype-specific risks in two or more separate populations. In order to do so we (1) develop a cohort approach towards odds ratio analysis by expanding the E-M algorithm to provide maximum likelihood estimates of haplotype-specific odds ratios as well as genotype frequencies; (2) show how to correct the cohort approach, to give essentially unbiased estimates for population-based or nested case-control studies by incorporating the probability of selection as a case or control into the likelihood, based on a simplified model of case and control selection, and (3) finally, in an example data set (CYP17 and breast cancer, from the Multiethnic Cohort Study) we compare likelihood-based confidence interval estimates from the two methods with each other, and with the use of the single-imputation approach of Zaykin et al. applied under both
Phylogeny and Haplotype Analysis of Fungi Within the Fusarium incarnatum-equiseti Species Complex.
Ramdial, H; Latchoo, R K; Hosein, F N; Rampersad, S N
2017-01-01
Fusarium spp. are ranked among the top 10 most economically and scientifically important plant-pathogenic fungi in the world and are associated with plant diseases that include fruit decay of a number of crops. Fusarium isolates infecting bell pepper in Trinidad were identified based on sequence comparisons of the translation elongation factor gene (EF-1a) with sequences of Fusarium incarnatum-equiseti species complex (FIESC) verified in the FUSARIUM-ID database. Eighty-two isolates were identified as belonging to one of four phylogenetic species within the subclades FIESC-1, FIESC-15, FIESC-16, and FIESC-26, with the majority of isolates belonging to FIESC-15. A comparison of the level of DNA polymorphism and phylogenetic inference for sequences of the internal transcribed spacer region (ITS1-5.8S-ITS2) and EF-1a sequences for Trinidad and FUSARIUM-ID type species was carried out. The ITS sequences were less informative, had lower haplotype diversity and restricted haplotype distribution, and resulted in poor resolution and taxa placement in the consensus maximum-likelihood tree. EF-1a sequences enabled strongly supported phylogenetic inference with highly resolved branching patterns of the 30 phylogenetic species within the FIESC and placement of representative Trinidad isolates. Therefore, global phylogeny was inferred from EF-1a sequences representing 11 countries, and separation into distinct Incarnatum and Equiseti clades was again evident. In total, 42 haplotypes were identified: 12 were shared and the remaining were unique haplotypes. The most diverse haplotype was represented by sequences from China, Indonesia, Malaysia, and Trinidad and consisted exclusively of F. incarnatum isolates. Spain had the highest haplotype diversity, perhaps because both F. equiseti and F. incarnatum sequences were represented; followed by the United States, which contributed both F. equiseti and F. incarnatum sequences to the data set; then by countries representing Southeast
Saxena, Maneesha S.; Bajaj, Deepak; Das, Shouvik; Kujur, Alice; Kumar, Vinod; Singh, Mohar; Bansal, Kailash C.; Tyagi, Akhilesh K.; Parida, Swarup K.
2014-01-01
The identification and fine mapping of robust quantitative trait loci (QTLs)/genes governing important agro-morphological traits in chickpea still lacks systematic efforts at a genome-wide scale involving wild Cicer accessions. In this context, an 834 simple sequence repeat and single-nucleotide polymorphism marker-based high-density genetic linkage map between cultivated and wild parental accessions (Cicer arietinum desi cv. ICC 4958 and Cicer reticulatum wild cv. ICC 17160) was constructed. This inter-specific genetic map comprising eight linkage groups spanned a map length of 949.4 cM with an average inter-marker distance of 1.14 cM. Eleven novel major genomic regions harbouring 15 robust QTLs (15.6–39.8% R2 at 4.2–15.7 logarithm of odds) associated with four agro-morphological traits (100-seed weight, pod and branch number/plant and plant hairiness) were identified and mapped on chickpea chromosomes. Most of these QTLs showed positive additive gene effects with effective allelic contribution from ICC 4958, particularly for increasing seed weight (SW) and pod and branch number. One robust SW-influencing major QTL region (qSW4.2) has been narrowed down by combining QTL mapping with high-resolution QTL region-specific association analysis, differential expression profiling and gene haplotype-based association/LD mapping. This enabled to delineate a strong SW-regulating ABI3VP1 transcription factor (TF) gene at trait-specific QTL interval and consequently identified favourable natural allelic variants and superior high seed weight-specific haplotypes in the upstream regulatory region of this gene showing increased transcript expression during seed development. The genes (TFs) harbouring diverse trait-regulating QTLs, once validated and fine-mapped by our developed rapid integrated genomic approach and through gene/QTL map-based cloning, can be utilized as potential candidates for marker-assisted genetic enhancement of chickpea. PMID:25335477
2014-01-01
Over 95% of all metazoan (animal) species comprise the “invertebrates,” but very few genomes from these organisms have been sequenced. We have, therefore, formed a “Global Invertebrate Genomics Alliance” (GIGA). Our intent is to build a collaborative network of diverse scientists to tackle major challenges (e.g., species selection, sample collection and storage, sequence assembly, annotation, analytical tools) associated with genome/transcriptome sequencing across a large taxonomic spectrum. We aim to promote standards that will facilitate comparative approaches to invertebrate genomics and collaborations across the international scientific community. Candidate study taxa include species from Porifera, Ctenophora, Cnidaria, Placozoa, Mollusca, Arthropoda, Echinodermata, Annelida, Bryozoa, and Platyhelminthes, among others. GIGA will target 7000 noninsect/nonnematode species, with an emphasis on marine taxa because of the unrivaled phyletic diversity in the oceans. Priorities for selecting invertebrates for sequencing will include, but are not restricted to, their phylogenetic placement; relevance to organismal, ecological, and conservation research; and their importance to fisheries and human health. We highlight benefits of sequencing both whole genomes (DNA) and transcriptomes and also suggest policies for genomic-level data access and sharing based on transparency and inclusiveness. The GIGA Web site (http://giga.nova.edu) has been launched to facilitate this collaborative venture. PMID:24336862
Bracken-Grissom, Heather; Collins, Allen G; Collins, Timothy; Crandall, Keith; Distel, Daniel; Dunn, Casey; Giribet, Gonzalo; Haddock, Steven; Knowlton, Nancy; Martindale, Mark; Medina, Mónica; Messing, Charles; O'Brien, Stephen J; Paulay, Gustav; Putnam, Nicolas; Ravasi, Timothy; Rouse, Greg W; Ryan, Joseph F; Schulze, Anja; Wörheide, Gert; Adamska, Maja; Bailly, Xavier; Breinholt, Jesse; Browne, William E; Diaz, M Christina; Evans, Nathaniel; Flot, Jean-François; Fogarty, Nicole; Johnston, Matthew; Kamel, Bishoy; Kawahara, Akito Y; Laberge, Tammy; Lavrov, Dennis; Michonneau, François; Moroz, Leonid L; Oakley, Todd; Osborne, Karen; Pomponi, Shirley A; Rhodes, Adelaide; Santos, Scott R; Satoh, Nori; Thacker, Robert W; Van de Peer, Yves; Voolstra, Christian R; Welch, David Mark; Winston, Judith; Zhou, Xin
2014-01-01
Over 95% of all metazoan (animal) species comprise the "invertebrates," but very few genomes from these organisms have been sequenced. We have, therefore, formed a "Global Invertebrate Genomics Alliance" (GIGA). Our intent is to build a collaborative network of diverse scientists to tackle major challenges (e.g., species selection, sample collection and storage, sequence assembly, annotation, analytical tools) associated with genome/transcriptome sequencing across a large taxonomic spectrum. We aim to promote standards that will facilitate comparative approaches to invertebrate genomics and collaborations across the international scientific community. Candidate study taxa include species from Porifera, Ctenophora, Cnidaria, Placozoa, Mollusca, Arthropoda, Echinodermata, Annelida, Bryozoa, and Platyhelminthes, among others. GIGA will target 7000 noninsect/nonnematode species, with an emphasis on marine taxa because of the unrivaled phyletic diversity in the oceans. Priorities for selecting invertebrates for sequencing will include, but are not restricted to, their phylogenetic placement; relevance to organismal, ecological, and conservation research; and their importance to fisheries and human health. We highlight benefits of sequencing both whole genomes (DNA) and transcriptomes and also suggest policies for genomic-level data access and sharing based on transparency and inclusiveness. The GIGA Web site (http://giga.nova.edu) has been launched to facilitate this collaborative venture.
Recruiting Human Microbiome Shotgun Data to Site-Specific Reference Genomes
Xie, Gary; Lo, Chien-Chi; Scholz, Matthew; Chain, Patrick S. G.
2014-01-01
The human body consists of innumerable multifaceted environments that predispose colonization by a number of distinct microbial communities, which play fundamental roles in human health and disease. In addition to community surveys and shotgun metagenomes that seek to explore the composition and diversity of these microbiomes, there are significant efforts to sequence reference microbial genomes from many body sites of healthy adults. To illustrate the utility of reference genomes when studying more complex metagenomes, we present a reference-based analysis of sequence reads generated from 55 shotgun metagenomes, selected from 5 major body sites, including 16 sub-sites. Interestingly, between 13% and 92% (62.3% average) of these shotgun reads were aligned to a then-complete list of 2780 reference genomes, including 1583 references for the human microbiome. However, no reference genome was universally found in all body sites. For any given metagenome, the body site-specific reference genomes, derived from the same body site as the sample, accounted for an average of 58.8% of the mapped reads. While different body sites did differ in abundant genera, proximal or symmetrical body sites were found to be most similar to one another. The extent of variation observed, both between individuals sampled within the same microenvironment, or at the same site within the same individual over time, calls into question comparative studies across individuals even if sampled at the same body site. This study illustrates the high utility of reference genomes and the need for further site-specific reference microbial genome sequencing, even within the already well-sampled human microbiome. PMID:24454771
Zhou, Xiao-Yang; Zhu, Fa-Ming; Li, Jian-Ping; Mao, Wei; Zhang, De-Mei; Liu, Meng-Li; Hei, Ai-Lian; Dai, Da-Peng; Jiang, Ping; Shan, Xiao-Yan; Zhang, Bo-Wei; Zhu, Chuan-Fu; Shen, Jie; Deng, Zhi-Hui; Wang, Zheng-Lei; Yu, Wei-Jian; Chen, Qiang; Qiao, Yan-Hui; Zhu, Xiang-Ming; Lv, Rong; Li, Guo-Ying; Li, Guo-Liang; Li, Heng-Cong; Zhang, Xu; Pei, Bin; Jiao, Li-Xin; Shen, Gang; Liu, Ying; Feng, Zhi-Hui; Su, Yu-Ping; Xu, Zhao-Xia; Di, Wen-Ying; Jiang, Yao-Qin; Fu, Hong-Lei; Liu, Xiang-Jun; Liu, Xiang; Zhou, Mei-Zhen; Du, Dan; Liu, Qi; Han, Ying; Zhang, Zhi-Xin; Cai, Jian-Ping
2015-01-01
Allogeneic hematopoietic stem cell transplantation is a widely used and effective therapy for hematopoietic malignant diseases and numerous other disorders. High-resolution human leukocyte antigen (HLA) haplotype frequency distributions not only facilitate individual donor searches but also determine the probability with which a particular patient can find HLA-matched donors in a registry. The frequencies of the HLA-A, -B, -C, -DRB1, and -DQB1 alleles and haplotypes were estimated among 169,995 Chinese volunteers using the sequencing-based typing (SBT) method. Totals of 191 HLA-A, 244 HLA-B, 146 HLA-C, 143 HLA-DRB1 and 47 HLA-DQB1 alleles were observed, which accounted for 6.98%, 7.06%, 6.46%, 9.11% and 7.91%, respectively, of the alleles in each locus in the world (IMGT 3.16 Release, Apr. 2014). Among the 100 most common haplotypes from the 169,995 individuals, nine distinct haplotypes displayed significant regionally specific distributions. Among these, three were predominant in the South China region (i.e., the 20th, 31st, and 81sthaplotypes), another three were predominant in the Southwest China region (i.e., the 68th, 79th, and 95th haplotypes), one was predominant in the South and Southwest China regions (the 18th haplotype), one was relatively common in the Northeast and North China regions (the 94th haplotype), and one was common in the Northeast, North and Northwest China (the 40th haplotype). In conclusion, this is the first to analyze high-resolution HLA diversities across the entire country of China, based on a detailed and complete data set that covered 31 provinces, autonomous regions, and municipalities. Specifically, we also evaluated the HLA matching probabilities within and between geographic regions and analyzed the regional differences in the HLA diversities in China. We believe that the data presented in this study might be useful for unrelated HLA-matched donor searches, donor registry planning, population genetic studies, and anthropogenesis
Malmberg, M Michelle; Shi, Fan; Spangenberg, German C; Daetwyler, Hans D; Cogan, Noel O I
2018-01-01
Intensive breeding of Brassica napus has resulted in relatively low diversity, such that B. napus would benefit from germplasm improvement schemes that sustain diversity. As such, samples representative of global germplasm pools need to be assessed for existing population structure, diversity and linkage disequilibrium (LD). Complexity reduction genotyping-by-sequencing (GBS) methods, including GBS-transcriptomics (GBS-t), enable cost-effective screening of a large number of samples, while whole genome re-sequencing (WGR) delivers the ability to generate large numbers of unbiased genomic single nucleotide polymorphisms (SNPs), and identify structural variants (SVs). Furthermore, the development of genomic tools based on whole genomes representative of global oilseed diversity and orientated by the reference genome has substantial industry relevance and will be highly beneficial for canola breeding. As recent studies have focused on European and Chinese varieties, a global diversity panel as well as a substantial number of Australian spring types were included in this study. Focusing on industry relevance, 633 varieties were initially genotyped using GBS-t to examine population structure using 61,037 SNPs. Subsequently, 149 samples representative of global diversity were selected for WGR and both data sets used for a side-by-side evaluation of diversity and LD. The WGR data was further used to develop genomic resources consisting of a list of 4,029,750 high-confidence SNPs annotated using SnpEff, and SVs in the form of 10,976 deletions and 2,556 insertions. These resources form the basis of a reliable and repeatable system allowing greater integration between canola genomics studies, with a strong focus on breeding germplasm and industry applicability.
Haplotype Phasing and Inheritance of Copy Number Variants in Nuclear Families
Palta, Priit; Kaplinski, Lauris; Nagirnaja, Liina; Veidenberg, Andres; Möls, Märt; Nelis, Mari; Esko, Tõnu; Metspalu, Andres; Laan, Maris; Remm, Maido
2015-01-01
DNA copy number variants (CNVs) that alter the copy number of a particular DNA segment in the genome play an important role in human phenotypic variability and disease susceptibility. A number of CNVs overlapping with genes have been shown to confer risk to a variety of human diseases thus highlighting the relevance of addressing the variability of CNVs at a higher resolution. So far, it has not been possible to deterministically infer the allelic composition of different haplotypes present within the CNV regions. We have developed a novel computational method, called PiCNV, which enables to resolve the haplotype sequence composition within CNV regions in nuclear families based on SNP genotyping microarray data. The algorithm allows to i) phase normal and CNV-carrying haplotypes in the copy number variable regions, ii) resolve the allelic copies of rearranged DNA sequence within the haplotypes and iii) infer the heritability of identified haplotypes in trios or larger nuclear families. To our knowledge this is the first program available that can deterministically phase null, mono-, di-, tri- and tetraploid genotypes in CNV loci. We applied our method to study the composition and inheritance of haplotypes in CNV regions of 30 HapMap Yoruban trios and 34 Estonian families. For 93.6% of the CNV loci, PiCNV enabled to unambiguously phase normal and CNV-carrying haplotypes and follow their transmission in the corresponding families. Furthermore, allelic composition analysis identified the co-occurrence of alternative allelic copies within 66.7% of haplotypes carrying copy number gains. We also observed less frequent transmission of CNV-carrying haplotypes from parents to children compared to normal haplotypes and identified an emergence of several de novo deletions and duplications in the offspring. PMID:25853576
Haplotype phasing and inheritance of copy number variants in nuclear families.
Palta, Priit; Kaplinski, Lauris; Nagirnaja, Liina; Veidenberg, Andres; Möls, Märt; Nelis, Mari; Esko, Tõnu; Metspalu, Andres; Laan, Maris; Remm, Maido
2015-01-01
DNA copy number variants (CNVs) that alter the copy number of a particular DNA segment in the genome play an important role in human phenotypic variability and disease susceptibility. A number of CNVs overlapping with genes have been shown to confer risk to a variety of human diseases thus highlighting the relevance of addressing the variability of CNVs at a higher resolution. So far, it has not been possible to deterministically infer the allelic composition of different haplotypes present within the CNV regions. We have developed a novel computational method, called PiCNV, which enables to resolve the haplotype sequence composition within CNV regions in nuclear families based on SNP genotyping microarray data. The algorithm allows to i) phase normal and CNV-carrying haplotypes in the copy number variable regions, ii) resolve the allelic copies of rearranged DNA sequence within the haplotypes and iii) infer the heritability of identified haplotypes in trios or larger nuclear families. To our knowledge this is the first program available that can deterministically phase null, mono-, di-, tri- and tetraploid genotypes in CNV loci. We applied our method to study the composition and inheritance of haplotypes in CNV regions of 30 HapMap Yoruban trios and 34 Estonian families. For 93.6% of the CNV loci, PiCNV enabled to unambiguously phase normal and CNV-carrying haplotypes and follow their transmission in the corresponding families. Furthermore, allelic composition analysis identified the co-occurrence of alternative allelic copies within 66.7% of haplotypes carrying copy number gains. We also observed less frequent transmission of CNV-carrying haplotypes from parents to children compared to normal haplotypes and identified an emergence of several de novo deletions and duplications in the offspring.
Neave, Matthew J.; Michell, Craig T.; Apprill, Amy; Voolstra, Christian R.
2017-01-01
Endozoicomonas bacteria are globally distributed and often abundantly associated with diverse marine hosts including reef-building corals, yet their function remains unknown. In this study we generated novel Endozoicomonas genomes from single cells and metagenomes obtained directly from the corals Stylophora pistillata, Pocillopora verrucosa, and Acropora humilis. We then compared these culture-independent genomes to existing genomes of bacterial isolates acquired from a sponge, sea slug, and coral to examine the functional landscape of this enigmatic genus. Sequencing and analysis of single cells and metagenomes resulted in four novel genomes with 60–76% and 81–90% genome completeness, respectively. These data also confirmed that Endozoicomonas genomes are large and are not streamlined for an obligate endosymbiotic lifestyle, implying that they have free-living stages. All genomes show an enrichment of genes associated with carbon sugar transport and utilization and protein secretion, potentially indicating that Endozoicomonas contribute to the cycling of carbohydrates and the provision of proteins to their respective hosts. Importantly, besides these commonalities, the genomes showed evidence for differential functional specificity and diversification, including genes for the production of amino acids. Given this metabolic diversity of Endozoicomonas we propose that different genotypes play disparate roles and have diversified in concert with their hosts. PMID:28094347
Peters, Bart D; Voineskos, Aristotle N; Szeszko, Philip R; Lett, Tristram A; DeRosse, Pamela; Guha, Saurav; Karlsgodt, Katherine H; Ikuta, Toshikazu; Felsky, Daniel; John, Majnu; Rotenberg, David J; Kennedy, James L; Lencz, Todd; Malhotra, Anil K
2014-04-30
The genetic and molecular pathways driving human brain white matter (WM) development are only beginning to be discovered. Long chain polyunsaturated fatty acids (LC-PUFAs) have been implicated in myelination in animal models and humans. The biosynthesis of LC-PUFAs is regulated by the fatty acid desaturase (FADS) genes, of which a human-specific haplotype is strongly associated with ω-3 and ω-6 LC-PUFA concentrations in blood. To investigate the relationship between LC-PUFA synthesis and human brain WM development, we examined whether this FADS haplotype is associated with age-related WM differences across the life span in healthy individuals 9-86 years of age (n = 207). Diffusion tensor imaging was performed to measure fractional anisotropy (FA), a putative measure of myelination, of the cerebral WM tracts. FADS haplotype status was determined with a single nucleotide polymorphism (rs174583) that tags this haplotype. Overall, normal age-related WM differences were observed, including higher FA values in early adulthood compared with childhood, followed by lower FA values across older age ranges. However, individuals homozygous for the minor allele (associated with lower LC-PUFA concentrations) did not display these normal age-related WM differences (significant age × genotype interactions, p(corrected) < 0.05). These findings suggest that LC-PUFAs are involved in human brain WM development from childhood into adulthood. This haplotype and LC-PUFAs may play a role in myelin-related disorders of neurodevelopmental origin.
Hardigan, Michael A.; Laimbeer, F. Parker E.; Newton, Linsey; Crisovan, Emily; Hamilton, John P.; Vaillancourt, Brieanne; Wiegert-Rininger, Krystle; Wood, Joshua C.; Douches, David S.; Farré, Eva M.; Veilleux, Richard E.; Buell, C. Robin
2017-01-01
Cultivated potatoes (Solanum tuberosum L.), domesticated from wild Solanum species native to the Andes of southern Peru, possess a diverse gene pool representing more than 100 tuber-bearing relatives (Solanum section Petota). A diversity panel of wild species, landraces, and cultivars was sequenced to assess genetic variation within tuber-bearing Solanum and the impact of domestication on genome diversity and identify key loci selected for cultivation in North and South America. Sequence diversity of diploid and tetraploid S. tuberosum exceeded any crop resequencing study to date, in part due to expanded wild introgressions following polyploidy that captured alleles outside of their geographic origin. We identified 2,622 genes as under selection, with only 14–16% shared by North American and Andean cultivars, showing that a limited gene set drove early improvement of cultivated potato, while adaptation of upland (S. tuberosum group Andigena) and lowland (S. tuberosum groups Chilotanum and Tuberosum) populations targeted distinct loci. Signatures of selection were uncovered in genes controlling carbohydrate metabolism, glycoalkaloid biosynthesis, the shikimate pathway, the cell cycle, and circadian rhythm. Reduced sexual fertility that accompanied the shift to asexual reproduction in cultivars was reflected by signatures of selection in genes regulating pollen development/gametogenesis. Exploration of haplotype diversity at potato’s maturity locus (StCDF1) revealed introgression of truncated alleles from wild species, particularly S. microdontum in long-day–adapted cultivars. This study uncovers a historic role of wild Solanum species in the diversification of long-day–adapted tetraploid potatoes, showing that extant natural populations represent an essential source of untapped adaptive potential. PMID:29087343
Mining of haplotype-based expressed sequence tag single nucleotide polymorphisms in citrus
2013-01-01
Background Single nucleotide polymorphisms (SNPs), the most abundant variations in a genome, have been widely used in various studies. Detection and characterization of citrus haplotype-based expressed sequence tag (EST) SNPs will greatly facilitate further utilization of these gene-based resources. Results In this paper, haplotype-based SNPs were mined out of publicly available citrus expressed sequence tags (ESTs) from different citrus cultivars (genotypes) individually and collectively for comparison. There were a total of 567,297 ESTs belonging to 27 cultivars in varying numbers and consequentially yielding different numbers of haplotype-based quality SNPs. Sweet orange (SO) had the most (213,830) ESTs, generating 11,182 quality SNPs in 3,327 out of 4,228 usable contigs. Summed from all the individually mining results, a total of 25,417 quality SNPs were discovered – 15,010 (59.1%) were transitions (AG and CT), 9,114 (35.9%) were transversions (AC, GT, CG, and AT), and 1,293 (5.0%) were insertion/deletions (indels). A vast majority of SNP-containing contigs consisted of only 2 haplotypes, as expected, but the percentages of 2 haplotype contigs varied widely in these citrus cultivars. BLAST of the 25,417 25-mer SNP oligos to the Clementine reference genome scaffolds revealed 2,947 SNPs had “no hits found”, 19,943 had 1 unique hit / alignment, 1,571 had one hit and 2+ alignments per hit, and 956 had 2+ hits and 1+ alignment per hit. Of the total 24,293 scaffold hits, 23,955 (98.6%) were on the main scaffolds 1 to 9, and only 338 were on 87 minor scaffolds. Most alignments had 100% (25/25) or 96% (24/25) nucleotide identities, accounting for 93% of all the alignments. Considering almost all the nucleotide discrepancies in the 24/25 alignments were at the SNP sites, it served well as in silico validation of these SNPs, in addition to and consistent with the rate (81%) validated by sequencing and SNaPshot assay. Conclusions High-quality EST-SNPs from different
Rodriguez-R, Luis M; Gunturu, Santosh; Harvey, William T; Rosselló-Mora, Ramon; Tiedje, James M; Cole, James R; Konstantinidis, Konstantinos T
2018-06-14
The small subunit ribosomal RNA gene (16S rRNA) has been successfully used to catalogue and study the diversity of prokaryotic species and communities but it offers limited resolution at the species and finer levels, and cannot represent the whole-genome diversity and fluidity. To overcome these limitations, we introduced the Microbial Genomes Atlas (MiGA), a webserver that allows the classification of an unknown query genomic sequence, complete or partial, against all taxonomically classified taxa with available genome sequences, as well as comparisons to other related genomes including uncultivated ones, based on the genome-aggregate Average Nucleotide and Amino Acid Identity (ANI/AAI) concepts. MiGA integrates best practices in sequence quality trimming and assembly and allows input to be raw reads or assemblies from isolate genomes, single-cell sequences, and metagenome-assembled genomes (MAGs). Further, MiGA can take as input hundreds of closely related genomes of the same or closely related species (a so-called 'Clade Project') to assess their gene content diversity and evolutionary relationships, and calculate important clade properties such as the pangenome and core gene sets. Therefore, MiGA is expected to facilitate a range of genome-based taxonomic and diversity studies, and quality assessment across environmental and clinical settings. MiGA is available at http://microbial-genomes.org/.
Genome-wide selective sweeps and gene-specific sweeps in natural bacterial populations
Bendall, Matthew L.; Stevens, Sarah L.R.; Chan, Leong-Keat; ...
2016-01-08
Multiple models describe the formation and evolution of distinct microbial phylogenetic groups. These evolutionary models make different predictions regarding how adaptive alleles spread through populations and how genetic diversity is maintained. Processes predicted by competing evolutionary models, for example, genome-wide selective sweeps vs gene-specific sweeps, could be captured in natural populations using time-series metagenomics if the approach were applied over a sufficiently long time frame. Direct observations of either process would help resolve how distinct microbial groups evolve. Using a 9-year metagenomic study of a freshwater lake (2005–2013), we explore changes in single-nucleotide polymorphism (SNP) frequencies and patterns of genemore » gain and loss in 30 bacterial populations. SNP analyses revealed substantial genetic heterogeneity within these populations, although the degree of heterogeneity varied by >1000-fold among populations. SNP allele frequencies also changed dramatically over time within some populations. Interestingly, nearly all SNP variants were slowly purged over several years from one population of green sulfur bacteria, while at the same time multiple genes either swept through or were lost from this population. Furthermore, these patterns were consistent with a genome-wide selective sweep in progress, a process predicted by the ‘ecotype model’ of speciation but not previously observed in nature. In contrast, other populations contained large, SNP-free genomic regions that appear to have swept independently through the populations prior to the study without purging diversity elsewhere in the genome. Finally, evidence for both genome-wide and gene-specific sweeps suggests that different models of bacterial speciation may apply to different populations coexisting in the same environment.« less
Pedersen, Niels C; Liu, Hongwei; Leonard, Angela; Griffioen, Layle
2015-01-01
Previous studies documented the problem of inbreeding among Italian Greyhounds (IG) from the USA and its possible role in a multiple autoimmune disease syndrome. The present study is an extension of these earlier experiments and had two objectives: 1) to identify pockets of additional genetic diversity that might still exist among IG from the USA and Continental Europe, and 2) to determine how loss of genetic diversity within the genome and in the dog leukocyte antigen (DLA) complex relates to the problem of autoimmune disease in IG from the USA. Genetic testing was conducted using 33 short tandem repeat (STR) loci across 25 chromosomes and 7 STR loci that associated with specific dog leukocyte antigen (DLA) class I and II haplotypes. Standard genetic assessment tests based on allele frequencies and internal relatedness (IR) were used as measures of breed-wide and individual heterozygosity. The results of these tests demonstrated that IG from the USA and Continental Europe belonged to a single breed but were genetically distinguishable by genomic allele frequencies, DLA class I and II haplotypes, and principal coordinate analysis (PCoA). In the second part of the study, 85 IG from the USA that had suffered various autoimmune disorders (case) and 104 healthy dogs (control) of comparable age were studied for genetic associations with disease. Case dogs were found to be significantly more homozygous in the DLA regions than control dogs. Principal coordinate analysis did not differentiate case from control populations. No specific STR-associated DLA-class I or II haplotype was associated with increased autoimmune disease risks. Reasons for the loss of genetic diversity and increased homozygosity among IG from the USA were studied using registration data and deep pedigrees. The breed in the USA started from a small number of founders from Europe and has remained relatively isolated and small in numbers, limiting breeding choices especially in the period before modern
APC Yin-Yang haplotype associated with colorectal cancer risk
GARRE, P.; DE LA HOYA, M.; INIESTA, P.; ROMERA, A.; LLOVET, P.; GONZALEZ, S.; PEREZ-SEGURA, P.; CAPELLA, G.; DIAZ-RUBIO, E.; CALDES, T.
2010-01-01
The Yin-Yang haplotype is defined as two mismatched haplotypes (Yin and Yang) representing the majority of the existing haplotypes in a particular genomic region. The human adenomatous polyposis coli (APC) gene shows a Yin-Yang haplotype pattern accounting for 84% of all of the haplotypes existing in the Spanish population. Several association studies have been published regarding APC gene variants (SNPs and haplotypes) and colorectal cancer (CRC) risk. However, no studies concerning diplotype structure and CRC risk have been conducted. The aim of the present study was to investigate whether the APC Yin-Yang homozygote diplotype is over-represented in patients with sporadic CRC when compared to its distribution in controls, and its association with CRC risk. TaqMan® assays were used to genotype three tagSNPs selected across the APC Yin-Yang region. Frequencies of the APC Yin-Yang tagSNP alleles, haplotype and diplotype of 378 CRC cases and 642 controls were compared. Two Spanish CRC group samples were included [Hospital Clínico San Carlos in Madrid (HCSC) and Instituto Catalán de Oncología in Barcelona (ICO)]. Analysis of 157 consecutive CRC patients and 405 control subjects from HCSC showed a significative effect for the risk of CRC (OR=1.93; 95% CI 1.32–2.81; P=0.001). However, this effect was not confirmed in 221 CRC patients and 237 control subjects from ICO (OR=0.89; 95% CI 0.61–1.28; P=0.521). We found a significant association between the APC homozygote Yin-Yang diplotype and the risk of colorectal cancer in the HCSC samples. However, we did not observe this association in the ICO samples. These observations suggest that a study with a larger Spanish cohort is necessary to confirm the effects of the APC Yin-Yang diplotype on the risk of CRC. PMID:22993613
APC Yin-Yang haplotype associated with colorectal cancer risk.
Garre, P; DE LA Hoya, M; Iniesta, P; Romera, A; Llovet, P; Gonzalez, S; Perez-Segura, P; Capella, G; Diaz-Rubio, E; Caldes, T
2010-09-01
The Yin-Yang haplotype is defined as two mismatched haplotypes (Yin and Yang) representing the majority of the existing haplotypes in a particular genomic region. The human adenomatous polyposis coli (APC) gene shows a Yin-Yang haplotype pattern accounting for 84% of all of the haplotypes existing in the Spanish population. Several association studies have been published regarding APC gene variants (SNPs and haplotypes) and colorectal cancer (CRC) risk. However, no studies concerning diplotype structure and CRC risk have been conducted. The aim of the present study was to investigate whether the APC Yin-Yang homozygote diplotype is over-represented in patients with sporadic CRC when compared to its distribution in controls, and its association with CRC risk. TaqMan(®) assays were used to genotype three tagSNPs selected across the APC Yin-Yang region. Frequencies of the APC Yin-Yang tagSNP alleles, haplotype and diplotype of 378 CRC cases and 642 controls were compared. Two Spanish CRC group samples were included [Hospital Clínico San Carlos in Madrid (HCSC) and Instituto Catalán de Oncología in Barcelona (ICO)]. Analysis of 157 consecutive CRC patients and 405 control subjects from HCSC showed a significative effect for the risk of CRC (OR=1.93; 95% CI 1.32-2.81; P=0.001). However, this effect was not confirmed in 221 CRC patients and 237 control subjects from ICO (OR=0.89; 95% CI 0.61-1.28; P=0.521). We found a significant association between the APC homozygote Yin-Yang diplotype and the risk of colorectal cancer in the HCSC samples. However, we did not observe this association in the ICO samples. These observations suggest that a study with a larger Spanish cohort is necessary to confirm the effects of the APC Yin-Yang diplotype on the risk of CRC.
The African Genome Variation Project shapes medical genetics in Africa
Gurdasani, Deepti; Carstensen, Tommy; Tekola-Ayele, Fasil; Pagani, Luca; Tachmazidou, Ioanna; Hatzikotoulas, Konstantinos; Karthikeyan, Savita; Iles, Louise; Pollard, Martin O.; Choudhury, Ananyo; Ritchie, Graham R. S.; Xue, Yali; Asimit, Jennifer; Nsubuga, Rebecca N.; Young, Elizabeth H.; Pomilla, Cristina; Kivinen, Katja; Rockett, Kirk; Kamali, Anatoli; Doumatey, Ayo P.; Asiki, Gershim; Seeley, Janet; Sisay-Joof, Fatoumatta; Jallow, Muminatou; Tollman, Stephen; Mekonnen, Ephrem; Ekong, Rosemary; Oljira, Tamiru; Bradman, Neil; Bojang, Kalifa; Ramsay, Michele; Adeyemo, Adebowale; Bekele, Endashaw; Motala, Ayesha; Norris, Shane A.; Pirie, Fraser; Kaleebu, Pontiano; Kwiatkowski, Dominic; Tyler-Smith, Chris; Rotimi, Charles; Zeggini, Eleftheria; Sandhu, Manjinder S.
2014-01-01
Given the importance of Africa to studies of human origins and disease susceptibility, detailed characterisation of African genetic diversity is needed. The African Genome Variation Project (AGVP) provides a resource to help design, implement and interpret genomic studies in sub-Saharan Africa (SSA) and worldwide. The AGVP represents dense genotypes from 1,481 and whole genome sequences (WGS) from 320 individuals across SSA. Using this resource, we find novel evidence of complex, regionally distinct hunter-gatherer and Eurasian admixture across SSA. We identify new loci under selection, including for malaria and hypertension. We show that modern imputation panels can identify association signals at highly differentiated loci across populations in SSA. Using WGS, we show further improvement in imputation accuracy supporting efforts for large-scale sequencing of diverse African haplotypes. Finally, we present an efficient genotype array design capturing common genetic variation in Africa, showing for the first time that such designs are feasible. PMID:25470054
Haplotype analysis of the polymorphic 40 Y-STR markers in Chinese populations.
Ou, Xueling; Wang, Ying; Liu, Chao; Yang, Donggui; Zhang, Chuchu; Deng, Shujiao; Sun, Hongyu
2015-11-01
Forty Y-STR loci were analyzed in 1128 males from the following six Chinese ethnic populations: Han (n=300), Hui (n=244), Korean (n=100), Mongolian (n=100), Uighur (n=284) and Tibetan (n=100), utilizing two new generation multiplex Y-STR systems, AGCU Y24 STR and GFS Y24 STR genotyping kits, which allow for the genotyping of 24 loci from a single amplification reaction in each system. The lowest estimates of genetic diversity (below 0.5) correspond to markers DYS391 (0.441658) and DYS437 (0.496977), and the greatest diversity corresponds to markers DYS385a/b (0.969919) and DYS527a/b (0.94676). A considerable number of duplicate and off-ladder alleles were also revealed. Additionally, there were 1111 different haplotypes identified from the total 1128 samples, of which 1095 were unique. Notably, no shared haplotypes between populations were observed. The estimated overall haplotype diversity (HD) was 0.999085, and its discrimination capacity (DC) was 0.970745. An MDS plot based on the genetic distances between populations showed the genetic similarity of the southern Han population to the Northern populations of Hui, Korean, Mongolian and Uighur and a clear genetic departure of the Tibetan population from other populations. For the Y STR markers, population substructure correction was considered when calculating the rarity of the Y STR profile. However, because the haplotype based Fst values are extremely small within the present data (0.000153 with 40 Y-STRs), no substructure correction is required to estimate the rarity of a haplotype comprising 40 markers. In summary, the results of our study indicate that the 40 Y-STRs have a high level of polymorphism in Chinese ethnic groups and could therefore be a powerful tool for forensic applications and population genetic studies. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Kumar, Roshan; Verma, Helianthous; Haider, Shazia; Bajaj, Abhay; Sood, Utkarsh; Ponnusamy, Kalaiarasan; Nagar, Shekhar; Shakarad, Mallikarjun N.; Negi, Ram Krishan; Singh, Yogendra; Khurana, J. P.; Gilbert, Jack A.
2017-01-01
ABSTRACT Species belonging to the genus Novosphingobium are found in many different habitats and have been identified as metabolically versatile. Through comparative genomic analysis, we identified habitat-specific genes and regulatory hubs that could determine habitat selection for Novosphingobium spp. Genomes from 27 Novosphingobium strains isolated from diverse habitats such as rhizosphere soil, plant surfaces, heavily contaminated soils, and marine and freshwater environments were analyzed. Genome size and coding potential were widely variable, differing significantly between habitats. Phylogenetic relationships between strains were less likely to describe functional genotype similarity than the habitat from which they were isolated. In this study, strains (19 out of 27) with a recorded habitat of isolation, and at least 3 representative strains per habitat, comprised four ecological groups—rhizosphere, contaminated soil, marine, and freshwater. Sulfur acquisition and metabolism were the only core genomic traits to differ significantly in proportion between these ecological groups; for example, alkane sulfonate (ssuABCD) assimilation was found exclusively in all of the rhizospheric isolates. When we examined osmolytic regulation in Novosphingobium spp. through ectoine biosynthesis, which was assumed to be marine habitat specific, we found that it was also present in isolates from contaminated soil, suggesting its relevance beyond the marine system. Novosphingobium strains were also found to harbor a wide variety of mono- and dioxygenases, responsible for the metabolism of several aromatic compounds, suggesting their potential to act as degraders of a variety of xenobiotic compounds. Protein-protein interaction analysis revealed β-barrel outer membrane proteins as habitat-specific hubs in each of the four habitats—freshwater (Saro_1868), marine water (PP1Y_AT17644), rhizosphere (PMI02_00367), and soil (V474_17210). These outer membrane proteins could play a
Derrien, Thomas; Axelsson, Erik; Rosengren Pielberg, Gerli; Sigurdsson, Snaevar; Fall, Tove; Seppälä, Eija H.; Hansen, Mark S. T.; Lawley, Cindy T.; Karlsson, Elinor K.; Bannasch, Danika; Vilà, Carles; Lohi, Hannes; Galibert, Francis; Fredholm, Merete; Häggström, Jens; Hedhammar, Åke; André, Catherine; Lindblad-Toh, Kerstin; Hitte, Christophe; Webster, Matthew T.
2011-01-01
The extraordinary phenotypic diversity of dog breeds has been sculpted by a unique population history accompanied by selection for novel and desirable traits. Here we perform a comprehensive analysis using multiple test statistics to identify regions under selection in 509 dogs from 46 diverse breeds using a newly developed high-density genotyping array consisting of >170,000 evenly spaced SNPs. We first identify 44 genomic regions exhibiting extreme differentiation across multiple breeds. Genetic variation in these regions correlates with variation in several phenotypic traits that vary between breeds, and we identify novel associations with both morphological and behavioral traits. We next scan the genome for signatures of selective sweeps in single breeds, characterized by long regions of reduced heterozygosity and fixation of extended haplotypes. These scans identify hundreds of regions, including 22 blocks of homozygosity longer than one megabase in certain breeds. Candidate selection loci are strongly enriched for developmental genes. We chose one highly differentiated region, associated with body size and ear morphology, and characterized it using high-throughput sequencing to provide a list of variants that may directly affect these traits. This study provides a catalogue of genomic regions showing extreme reduction in genetic variation or population differentiation in dogs, including many linked to phenotypic variation. The many blocks of reduced haplotype diversity observed across the genome in dog breeds are the result of both selection and genetic drift, but extended blocks of homozygosity on a megabase scale appear to be best explained by selection. Further elucidation of the variants under selection will help to uncover the genetic basis of complex traits and disease. PMID:22022279
Vaysse, Amaury; Ratnakumar, Abhirami; Derrien, Thomas; Axelsson, Erik; Rosengren Pielberg, Gerli; Sigurdsson, Snaevar; Fall, Tove; Seppälä, Eija H; Hansen, Mark S T; Lawley, Cindy T; Karlsson, Elinor K; Bannasch, Danika; Vilà, Carles; Lohi, Hannes; Galibert, Francis; Fredholm, Merete; Häggström, Jens; Hedhammar, Ake; André, Catherine; Lindblad-Toh, Kerstin; Hitte, Christophe; Webster, Matthew T
2011-10-01
The extraordinary phenotypic diversity of dog breeds has been sculpted by a unique population history accompanied by selection for novel and desirable traits. Here we perform a comprehensive analysis using multiple test statistics to identify regions under selection in 509 dogs from 46 diverse breeds using a newly developed high-density genotyping array consisting of >170,000 evenly spaced SNPs. We first identify 44 genomic regions exhibiting extreme differentiation across multiple breeds. Genetic variation in these regions correlates with variation in several phenotypic traits that vary between breeds, and we identify novel associations with both morphological and behavioral traits. We next scan the genome for signatures of selective sweeps in single breeds, characterized by long regions of reduced heterozygosity and fixation of extended haplotypes. These scans identify hundreds of regions, including 22 blocks of homozygosity longer than one megabase in certain breeds. Candidate selection loci are strongly enriched for developmental genes. We chose one highly differentiated region, associated with body size and ear morphology, and characterized it using high-throughput sequencing to provide a list of variants that may directly affect these traits. This study provides a catalogue of genomic regions showing extreme reduction in genetic variation or population differentiation in dogs, including many linked to phenotypic variation. The many blocks of reduced haplotype diversity observed across the genome in dog breeds are the result of both selection and genetic drift, but extended blocks of homozygosity on a megabase scale appear to be best explained by selection. Further elucidation of the variants under selection will help to uncover the genetic basis of complex traits and disease.
Lalusin, Antonio; Borromeo, Teresita; Gregorio, Glenn; Hernandez, Jose; Virk, Parminder; Collard, Bertrand; McCouch, Susan R.
2015-01-01
Genome-wide association mapping studies (GWAS) are frequently used to detect QTL in diverse collections of crop germplasm, based on historic recombination events and linkage disequilibrium across the genome. Generally, diversity panels genotyped with high density SNP panels are utilized in order to assay a wide range of alleles and haplotypes and to monitor recombination breakpoints across the genome. By contrast, GWAS have not generally been performed in breeding populations. In this study we performed association mapping for 19 agronomic traits including yield and yield components in a breeding population of elite irrigated tropical rice breeding lines so that the results would be more directly applicable to breeding than those from a diversity panel. The population was genotyped with 71,710 SNPs using genotyping-by-sequencing (GBS), and GWAS performed with the explicit goal of expediting selection in the breeding program. Using this breeding panel we identified 52 QTL for 11 agronomic traits, including large effect QTLs for flowering time and grain length/grain width/grain-length-breadth ratio. We also identified haplotypes that can be used to select plants in our population for short stature (plant height), early flowering time, and high yield, and thus demonstrate the utility of association mapping in breeding populations for informing breeding decisions. We conclude by exploring how the newly identified significant SNPs and insights into the genetic architecture of these quantitative traits can be leveraged to build genomic-assisted selection models. PMID:25785447
Transposable element evolution in Heliconius suggests genome diversity within Lepidoptera
2013-01-01
Background Transposable elements (TEs) have the potential to impact genome structure, function and evolution in profound ways. In order to understand the contribution of transposable elements (TEs) to Heliconius melpomene, we queried the H. melpomene draft sequence to identify repetitive sequences. Results We determined that TEs comprise ~25% of the genome. The predominant class of TEs (~12% of the genome) was the non-long terminal repeat (non-LTR) retrotransposons, including a novel SINE family. However, this was only slightly higher than content derived from DNA transposons, which are diverse, with several families having mobilized in the recent past. Compared to the only other well-studied lepidopteran genome, Bombyx mori, H. melpomene exhibits a higher DNA transposon content and a distinct repertoire of retrotransposons. We also found that H. melpomene exhibits a high rate of TE turnover with few older elements accumulating in the genome. Conclusions Our analysis represents the first complete, de novo characterization of TE content in a butterfly genome and suggests that, while TEs are able to invade and multiply, TEs have an overall deleterious effect and/or that maintaining a small genome is advantageous. Our results also hint that analysis of additional lepidopteran genomes will reveal substantial TE diversity within the group. PMID:24088337
Draye, Xavier; Lin, Yann-Rong; Qian, Xiao-yin; Bowers, John E.; Burow, Gloria B.; Morrell, Peter L.; Peterson, Daniel G.; Presting, Gernot G.; Ren, Shu-xin; Wing, Rod A.; Paterson, Andrew H.
2001-01-01
The small genome of sorghum (Sorghum bicolor L. Moench.) provides an important template for study of closely related large-genome crops such as maize (Zea mays) and sugarcane (Saccharum spp.), and is a logical complement to distantly related rice (Oryza sativa) as a “grass genome model.” Using a high-density RFLP map as a framework, a robust physical map of sorghum is being assembled by integrating hybridization and fingerprint data with comparative data from related taxa such as rice and using new methods to resolve genomic duplications into locus-specific groups. By taking advantage of allelic variation revealed by heterologous probes, the positions of corresponding loci on the wheat (Triticum aestivum), rice, maize, sugarcane, and Arabidopsis genomes are being interpolated on the sorghum physical map. Bacterial artificial chromosomes for the small genome of rice are shown to close several gaps in the sorghum contigs; the emerging rice physical map and assembled sequence will further accelerate progress. An important motivation for developing genomic tools is to relate molecular level variation to phenotypic diversity. “Diversity maps,” which depict the levels and patterns of variation in different gene pools, shed light on relationships of allelic diversity with chromosome organization, and suggest possible locations of genomic regions that are under selection due to major gene effects (some of which may be revealed by quantitative trait locus mapping). Both physical maps and diversity maps suggest interesting features that may be integrally related to the chromosomal context of DNA—progress in cytology promises to provide a means to elucidate such relationships. We seek to provide a detailed picture of the structure, function, and evolution of the genome of sorghum and its relatives, together with molecular tools such as locus-specific sequence-tagged site DNA markers and bacterial artificial chromosome contigs that will have enduring value for many
Cassava haplotype map highlights fixation of deleterious mutations during clonal propagation
USDA-ARS?s Scientific Manuscript database
Cassava (Manihot esculenta Crantz) is an important staple food crop in Africa and South America whose fitness may be severely reduced by ubiquitous deleterious variation. To evaluate these deleterious mutations in cassava genome, we constructed a cassava haplotype map by deep sequencing of 241 diver...
Low diversity, activity, and density of transposable elements in five avian genomes.
Gao, Bo; Wang, Saisai; Wang, Yali; Shen, Dan; Xue, Songlei; Chen, Cai; Cui, Hengmi; Song, Chengyi
2017-07-01
In this study, we conducted the activity, diversity, and density analysis of transposable elements (TEs) across five avian genomes (budgerigar, chicken, turkey, medium ground finch, and zebra finch) to explore the potential reason of small genome sizes of birds. We found that these avian genomes exhibited low density of TEs by about 10% of genome coverages and low diversity of TEs with the TE landscapes dominated by CR1 and ERV elements, and contrasting proliferation dynamics both between TE types and between species were observed across the five avian genomes. Phylogenetic analysis revealed that CR1 clade was more diverse in the family structure compared with R2 clade in birds; avian ERVs were classified into four clades (alpha, beta, gamma, and ERV-L) and belonged to three classes of ERV with an uneven distributed in these lineages. The activities of DNA and SINE TEs were very low in the evolution history of avian genomes; most LINEs and LTRs were ancient copies with a substantial decrease of activity in recent, with only LTRs and LINEs in chicken and zebra finch exhibiting weak activity in very recent, and very few TEs were intact; however, the recent activity may be underestimated due to the sequencing/assembly technologies in some species. Overall, this study demonstrates low diversity, activity, and density of TEs in the five avian species; highlights the differences of TEs in these lineages; and suggests that the current and recent activity of TEs in avian genomes is very limited, which may be one of the reasons of small genome sizes in birds.
Sun, Zhihong; Zhang, Wenyi; Guo, Chenyi; Yang, Xianwei; Liu, Wenjun; Wu, Yarong; Song, Yuqin; Kwok, Lai Yu; Cui, Yujun; Menghe, Bilige; Yang, Ruifu; Hu, Liangping; Zhang, Heping
2015-01-01
Bifidobacteria are well known for their human health-promoting effects and are therefore widely applied in the food industry. Members of the Bifidobacterium genus were first identified from the human gastrointestinal tract and were then found to be widely distributed across various ecological niches. Although the genetic diversity of Bifidobacterium has been determined based on several marker genes or a few genomes, the global diversity and evolution scenario for the entire genus remain unresolved. The present study comparatively analyzed the genomes of 45 type strains. We built a robust genealogy for Bifidobacterium based on 402 core genes and defined its root according to the phylogeny of the tree of bacteria. Our results support that all human isolates are of younger lineages, and although species isolated from bees dominate the more ancient lineages, the bee was not necessarily the original host for bifidobacteria. Moreover, the species isolated from different hosts are enriched with specific gene sets, suggesting host-specific adaptation. Notably, bee-specific genes are strongly associated with respiratory metabolism and are potential in helping those bacteria adapt to the oxygen-rich gut environment in bees. This study provides a snapshot of the genetic diversity and evolution of Bifidobacterium, paving the way for future studies on the taxonomy and functional genomics of the genus.
Boykin, L.M.; De Barro, P.; Hall, D.G.; Hunter, W.B.; McKenzie, C.L.; Powell, C.A.; Shatters, R.G.
2012-01-01
Relationships among worldwide collections of Diaphorina citri (Asian citrus psyllid) were analyzed using mitochondrial cytochrome oxidase I (mtCOI) haplotypes from novel primers. Sequences were produced from PCR amplicons of an 821bp portion of the mtCOI gene using D. citri specific primers, derived from an existing EST library. An alignment was constructed using 612bps of this fragment and consisted of 212 individuals from 52 collections representing 15 countries. There were a total of eight polymorphic sites that separated the sequences into eight different haplotypes (Dcit-1 through Dcit-8). Phylogenetic network analysis using the statistical parsimony software, TCS, suggests two major haplotype groups with preliminary geographic bias between southwestern Asia (SWA) and southeastern Asia (SEA). The recent (within the last 15 to 25 years) invasion into the New World originated from only the SWA group in the northern hemisphere (USA and Mexico) and from both the SEA and SWA groups in the southern hemisphere (Brazil). In only one case, Reunion Island, did haplotypes from both the SEA and SWA group appear in the same location. In Brazil, both groups were present, but in separate locations. The Dcit-1 SWA haplotype was the most frequently encountered, including ~50% of the countries sampled and 87% of the total sequences obtained from India, Pakistan and Saudi Arabia. The second most frequently encountered haplotype, Dcit-2, the basis of the SEA group, represented ~50% of the countries and contained most of the sequences from Southeast Asia and China. Interestingly, only the Caribbean collections (Puerto Rico and Guadeloupe) represented a unique haplotype not found in other countries, indicating no relationship between the USA (Florida) and Caribbean introductions. There is no evidence for cryptic speciation for D. citri based on the COI region included in this study. PMID:22717059
Vibrio cholerae genomic diversity within and between patients
Levade, Inès; Terrat, Yves; Leducq, Jean-Baptiste; Weil, Ana A.; Mayo-Smith, Leslie M.; Chowdhury, Fahima; Khan, Ashraful I.; Boncy, Jacques; Buteau, Josiane; Ivers, Louise C.; Ryan, Edward T.; Charles, Richelle C.; Calderwood, Stephen B.; Qadri, Firdausi; Harris, Jason B.; LaRocque, Regina C.
2017-01-01
Cholera is a severe, water-borne diarrhoeal disease caused by toxin-producing strains of the bacterium Vibrio cholerae. Comparative genomics has revealed ‘waves’ of cholera transmission and evolution, in which clones are successively replaced over decades and centuries. However, the extent of V. cholerae genetic diversity within an epidemic or even within an individual patient is poorly understood. Here, we characterized V. cholerae genomic diversity at a micro-epidemiological level within and between individual patients from Bangladesh and Haiti. To capture within-patient diversity, we isolated multiple (8 to 20) V. cholerae colonies from each of eight patients, sequenced their genomes and identified point mutations and gene gain/loss events. We found limited but detectable diversity at the level of point mutations within hosts (zero to three single nucleotide variants within each patient), and comparatively higher gene content variation within hosts (at least one gain/loss event per patient, and up to 103 events in one patient). Much of the gene content variation appeared to be due to gain and loss of phage and plasmids within the V. cholerae population, with occasional exchanges between V. cholerae and other members of the gut microbiota. We also show that certain intra-host variants have phenotypic consequences. For example, the acquisition of a Bacteroides plasmid and non-synonymous mutations in a sensor histidine kinase gene both reduced biofilm formation, an important trait for environmental survival. Together, our results show that V. cholerae is measurably evolving within patients, with possible implications for disease outcomes and transmission dynamics. PMID:29306353
Rothe, Jessica; Watkins, Norman E; Nagy, Marion
2012-01-01
Allele-specific extension reactions (ASERs) use 3' terminus-specific primers for the selective extension of completely annealed matches by polymerase. The ability of the polymerase to extend non-specific 3' terminal mismatches leads to a failure of the reaction, a process that is only partly understood and predictable, and often requires time-consuming assay design. In our studies we investigated haplotype-specific extraction (HSE) for the separation of male DNA mixtures. HSE is an ASER and provides the ability to distinguish between diploid chromosomes from one or more individuals. Here, we show that the success of HSE and allele-specific extension depend strongly on the concentration difference between complete match and 3' terminal mismatch. Using the oligonucleotide-modeling platform Visual Omp, we demonstrated the dependency of the discrimination power of the polymerase on match- and mismatch-target hybridization between different probe lengths. Therefore, the probe specificity in HSE could be predicted by performing a relative comparison of different probe designs with their simulated differences between the duplex concentration of target-probe match and mismatches. We tested this new model for probe design in more than 300 HSE reactions with 137 different probes and obtained an accordance of 88%.
Geesaman, Bard J.; Benson, Erica; Brewster, Stephanie J.; Kunkel, Louis M.; Blanché, Hélène; Thomas, Gilles; Perls, Thomas T.; Daly, Mark J.; Puca, Annibale A.
2003-01-01
We previously reported a genomewide linkage study for human longevity using 308 long-lived individuals (LLI) (centenarians or near-centenarians) in 137 sibships and identified statistically significant linkage within chromosome 4 near microsatellite D4S1564. This interval spans 12 million bp and contains ≈50 putative genes. To identify the specific gene and gene variants impacting lifespan, we performed a haplotype-based fine-mapping study of the interval. The resulting genetic association study identified a haplotype marker within microsomal transfer protein as a modifier of human lifespan. This same variant was tested in a second cohort of LLI from France, and although the association was not replicated, there was evidence for statistical distortion in the form of Hardy–Weinberg disequilibrium. Microsomal transfer protein has been identified as the rate-limiting step in lipoprotein synthesis and may affect longevity by subtly modulating this pathway. This study provides proof of concept for the feasibility of using the genomes of LLI to identify genes impacting longevity. PMID:14615589
Balanovskiĭ, O P; Koshel', S M; Zaporozhchenko, V V; Pshenichnov, A S; Frolova, S A; Kuznetsova, M A; Baranova, E E; Teuchezh, I E; Kuznetsova, A A; Romashkina, M V; Utevskaia, O M; Churnosov, M I; Villems, R; Balanovskaia, E V
2011-11-01
Yu. P. Altukhov suggested that heterozygosity is an indicator of the state of the gene pool. The idea and a linked concept of genetic ecological monitoring were applied to a new dataset on mtDNA variation in East European ethnic groups. Haplotype diversity (an analog of the average heterozygosity) was shown to gradually decrease northwards. Since a similar trend is known for population density, interlinked changes were assumed for a set of parameters, which were ordered to form a causative chain: latitude increases, land productivity decreases, population density decreases, effective population size decreases, isolation of subpopulations increases, genetic drift increases, and mtDNA haplotype diversity decreases. An increase in genetic drift increases the random inbreeding rate and, consequently, the genetic load. This was confirmed by a significant correlation observed between the incidence of autosomal recessive hereditary diseases and mtDNA haplotype diversity. Based on the findings, mtDNA was assumed to provide an informative genetic system for genetic ecological monitoring; e.g., analyzing the ecology-driven changes in the gene pool.
Unique haplotypes of cacao trees as revealed by trnH-psbA chloroplast DNA
Gutiérrez-López, Nidia; Ovando-Medina, Isidro; Salvador-Figueroa, Miguel; Molina-Freaner, Francisco; Avendaño-Arrazate, Carlos H.
2016-01-01
Cacao trees have been cultivated in Mesoamerica for at least 4,000 years. In this study, we analyzed sequence variation in the chloroplast DNA trnH-psbA intergenic spacer from 28 cacao trees from different farms in the Soconusco region in southern Mexico. Genetic relationships were established by two analysis approaches based on geographic origin (five populations) and genetic origin (based on a previous study). We identified six polymorphic sites, including five insertion/deletion (indels) types and one transversion. The overall nucleotide diversity was low for both approaches (geographic = 0.0032 and genetic = 0.0038). Conversely, we obtained moderate to high haplotype diversity (0.66 and 0.80) with 10 and 12 haplotypes, respectively. The common haplotype (H1) for both networks included cacao trees from all geographic locations (geographic approach) and four genetic groups (genetic approach). This common haplotype (ancient) derived a set of intermediate haplotypes and singletons interconnected by one or two mutational steps, which suggested directional selection and event purification from the expansion of narrow populations. Cacao trees from Soconusco region were grouped into one cluster without any evidence of subclustering based on AMOVA (FST = 0) and SAMOVA (FST = 0.04393) results. One population (Mazatán) showed a high haplotype frequency; thus, this population could be considered an important reservoir of genetic material. The indels located in the trnH-psbA intergenic spacer of cacao trees could be useful as markers for the development of DNA barcoding. PMID:27076998
Wild emmer genome architecture and diversity elucidate wheat evolution and domestication.
Avni, Raz; Nave, Moran; Barad, Omer; Baruch, Kobi; Twardziok, Sven O; Gundlach, Heidrun; Hale, Iago; Mascher, Martin; Spannagl, Manuel; Wiebe, Krystalee; Jordan, Katherine W; Golan, Guy; Deek, Jasline; Ben-Zvi, Batsheva; Ben-Zvi, Gil; Himmelbach, Axel; MacLachlan, Ron P; Sharpe, Andrew G; Fritz, Allan; Ben-David, Roi; Budak, Hikmet; Fahima, Tzion; Korol, Abraham; Faris, Justin D; Hernandez, Alvaro; Mikel, Mark A; Levy, Avraham A; Steffenson, Brian; Maccaferri, Marco; Tuberosa, Roberto; Cattivelli, Luigi; Faccioli, Primetta; Ceriotti, Aldo; Kashkush, Khalil; Pourkheirandish, Mohammad; Komatsuda, Takao; Eilam, Tamar; Sela, Hanan; Sharon, Amir; Ohad, Nir; Chamovitz, Daniel A; Mayer, Klaus F X; Stein, Nils; Ronen, Gil; Peleg, Zvi; Pozniak, Curtis J; Akhunov, Eduard D; Distelfeld, Assaf
2017-07-07
Wheat ( Triticum spp.) is one of the founder crops that likely drove the Neolithic transition to sedentary agrarian societies in the Fertile Crescent more than 10,000 years ago. Identifying genetic modifications underlying wheat's domestication requires knowledge about the genome of its allo-tetraploid progenitor, wild emmer ( T. turgidum ssp. dicoccoides ). We report a 10.1-gigabase assembly of the 14 chromosomes of wild tetraploid wheat, as well as analyses of gene content, genome architecture, and genetic diversity. With this fully assembled polyploid wheat genome, we identified the causal mutations in Brittle Rachis 1 ( TtBtr1 ) genes controlling shattering, a key domestication trait. A study of genomic diversity among wild and domesticated accessions revealed genomic regions bearing the signature of selection under domestication. This reference assembly will serve as a resource for accelerating the genome-assisted improvement of modern wheat varieties. Copyright © 2017, American Association for the Advancement of Science.
MBGD update 2013: the microbial genome database for exploring the diversity of microbial world.
Uchiyama, Ikuo; Mihara, Motohiro; Nishide, Hiroyo; Chiba, Hirokazu
2013-01-01
The microbial genome database for comparative analysis (MBGD, available at http://mbgd.genome.ad.jp/) is a platform for microbial genome comparison based on orthology analysis. As its unique feature, MBGD allows users to conduct orthology analysis among any specified set of organisms; this flexibility allows MBGD to adapt to a variety of microbial genomic study. Reflecting the huge diversity of microbial world, the number of microbial genome projects now becomes several thousands. To efficiently explore the diversity of the entire microbial genomic data, MBGD now provides summary pages for pre-calculated ortholog tables among various taxonomic groups. For some closely related taxa, MBGD also provides the conserved synteny information (core genome alignment) pre-calculated using the CoreAligner program. In addition, efficient incremental updating procedure can create extended ortholog table by adding additional genomes to the default ortholog table generated from the representative set of genomes. Combining with the functionalities of the dynamic orthology calculation of any specified set of organisms, MBGD is an efficient and flexible tool for exploring the microbial genome diversity.
Cheng, Lucy; Marinelli, Laura J; Grosset, Noël; Fitz-Gibbon, Sorel T; Bowman, Charles A; Dang, Brian Q; Russell, Daniel A; Jacobs-Sera, Deborah; Shi, Baochen; Pellegrini, Matteo; Miller, Jeff F; Gautier, Michel; Hatfull, Graham F; Modlin, Robert L
2018-03-01
A remarkable exception to the large genetic diversity often observed for bacteriophages infecting a specific bacterial host was found for the Cutibacterium acnes (formerly Propionibacterium acnes) phages, which are highly homogeneous. Phages infecting the related species, which is also a member of the Propionibacteriaceae family, Propionibacterium freudenreichii, a bacterium used in production of Swiss-type cheeses, have also been described and are common contaminants of the cheese manufacturing process. However, little is known about their genetic composition and diversity. We obtained seven independently isolated bacteriophages that infect P. freudenreichii from Swiss-type cheese samples, and determined their complete genome sequences. These data revealed that all seven phage isolates are of similar genomic length and GC% content, but their genomes are highly diverse, including genes encoding the capsid, tape measure, and tail proteins. In contrast to C. acnes phages, all P. freudenreichii phage genomes encode a putative integrase protein, suggesting they are capable of lysogenic growth. This is supported by the finding of related prophages in some P. freudenreichii strains. The seven phages could further be distinguished as belonging to two distinct genomic types, or 'clusters', based on nucleotide sequences, and host range analyses conducted on a collection of P. freudenreichii strains show a higher degree of host specificity than is observed for the C. acnes phages. Overall, our data demonstrate P. freudenreichii bacteriophages are distinct from C. acnes phages, as evidenced by their higher genetic diversity, potential for lysogenic growth, and more restricted host ranges. This suggests substantial differences in the evolution of these related species from the Propionibacteriaceae family and their phages, which is potentially related to their distinct environmental niches.
A first exploration of genome size diversity in sponges.
Jeffery, Nicholas W; Jardine, Catherine B; Gregory, T Ryan
2013-08-01
The phyla known as early-branching lineages of animals have become the subject of increasing interest from the perspectives of genomics and evolutionary biology. Unfortunately, data on even the most fundamental properties of their genomes, such as genome size, remain very scarce. In this study, genome size estimates are reported for 75 species of sponges (phylum Porifera) representing 33 families and 12 orders, marking the first large survey of genome size diversity for an early-branching phylum. Sponge genome sizes averaged around 0.2 pg but exhibited a 17-fold range overall (0.04-0.63 pg). In addition, the results of comparisons of two methods of genome size quantification (flow cytometry and Feulgen image analysis densitometry) are presented, thereby facilitating future work on these animals. Some particularly promising avenues for future investigation are highlighted.
Kujur, Alice; Upadhyaya, Hari D.; Shree, Tanima; Bajaj, Deepak; Das, Shouvik; Saxena, Maneesha S.; Badoni, Saurabh; Kumar, Vinod; Tripathi, Shailesh; Gowda, C. L. L.; Sharma, Shivali; Singh, Sube; Tyagi, Akhilesh K.; Parida, Swarup K.
2015-01-01
We discovered 26785 and 16573 high-quality SNPs differentiating two parental genotypes of a RIL mapping population using reference desi and kabuli genome-based GBS assay. Of these, 3625 and 2177 SNPs have been integrated into eight desi and kabuli chromosomes, respectively in order to construct ultra-high density (0.20–0.37 cM) intra-specific chickpea genetic linkage maps. One of these constructed high-resolution genetic map has potential to identify 33 major genomic regions harbouring 35 robust QTLs (PVE: 17.9–39.7%) associated with three agronomic traits, which were mapped within <1 cM mean marker intervals on desi chromosomes. The extended LD (linkage disequilibrium) decay (~15 cM) in chromosomes of genetic maps have encouraged us to use a rapid integrated approach (comparative QTL mapping, QTL-region specific haplotype/LD-based trait association analysis, expression profiling and gene haplotype-based association mapping) rather than a traditional QTL map-based cloning method to narrow-down one major seed weight (SW) robust QTL region. It delineated favourable natural allelic variants and superior haplotype-containing one seed-specific candidate embryo defective gene regulating SW in chickpea. The ultra-high-resolution genetic maps, QTLs/genes and alleles/haplotypes-related genomic information generated and integrated strategy for rapid QTL/gene identification developed have potential to expedite genomics-assisted breeding applications in crop plants, including chickpea for their genetic enhancement. PMID:25942004
Galaktionov, N K; Podgornaya, O I; Strelkov, P P; Galaktionov, K V
2016-12-01
The aim of this study was to reveal genomic diversity formed during parthenogenetic reproduction of rediae of the trematode Himasthla elongata in its molluskan host Littorina littorea. We applied amplification fragment length polymorphism (AFLP) to determine the genomic diversity of individual cercariae within the clone, that is, the infrapopulation of parthenogenetic progeny in a single molluskan host. The level of genomic diversity of particular cercariae isolates from a single clone, detected with EcoR1/Mse1 AFLP reaction, was significantly lower than the variability of cercariae from different clones. The presence of intraclonal genomic diversity indicates a nonsexual shuffle of alleles during parthenogenesis in the rediae of H. elongata. The obtained polymorphic AFLP fragments were long enough to detect the sequences that may be responsible for clonal genomic variability. Based on this, AFLP can be recommended as a tool for the study of genetic mechanisms of this variability.
Miller, Marisa E; Zhang, Ying; Omidvar, Vahid; Sperschneider, Jana; Schwessinger, Benjamin; Raley, Castle; Palmer, Jonathan M; Garnica, Diana; Upadhyaya, Narayana; Rathjen, John; Taylor, Jennifer M; Park, Robert F; Dodds, Peter N; Hirsch, Cory D; Kianian, Shahryar F; Figueroa, Melania
2018-02-20
Oat crown rust, caused by the fungus Pucinnia coronata f. sp. avenae , is a devastating disease that impacts worldwide oat production. For much of its life cycle, P. coronata f. sp. avenae is dikaryotic, with two separate haploid nuclei that may vary in virulence genotype, highlighting the importance of understanding haplotype diversity in this species. We generated highly contiguous de novo genome assemblies of two P. coronata f. sp. avenae isolates, 12SD80 and 12NC29, from long-read sequences. In total, we assembled 603 primary contigs for 12SD80, for a total assembly length of 99.16 Mbp, and 777 primary contigs for 12NC29, for a total length of 105.25 Mbp; approximately 52% of each genome was assembled into alternate haplotypes. This revealed structural variation between haplotypes in each isolate equivalent to more than 2% of the genome size, in addition to about 260,000 and 380,000 heterozygous single-nucleotide polymorphisms in 12SD80 and 12NC29, respectively. Transcript-based annotation identified 26,796 and 28,801 coding sequences for isolates 12SD80 and 12NC29, respectively, including about 7,000 allele pairs in haplotype-phased regions. Furthermore, expression profiling revealed clusters of coexpressed secreted effector candidates, and the majority of orthologous effectors between isolates showed conservation of expression patterns. However, a small subset of orthologs showed divergence in expression, which may contribute to differences in virulence between 12SD80 and 12NC29. This study provides the first haplotype-phased reference genome for a dikaryotic rust fungus as a foundation for future studies into virulence mechanisms in P. coronata f. sp. avenae IMPORTANCE Disease management strategies for oat crown rust are challenged by the rapid evolution of Puccinia coronata f. sp. avenae , which renders resistance genes in oat varieties ineffective. Despite the economic importance of understanding P. coronata f. sp. avenae , resources to study the
A TNF region haplotype offers protection from typhoid fever in Vietnamese patients
2009-01-01
The genomic region surrounding the TNF locus on human chromosome 6 has previously been associated with typhoid fever in Vietnam. We used a haplotypic approach to understand this association further. Eighty single nucleotide polymorphisms (SNPs) spanning a 150 kb region were genotyped in 95 Vietnamese individuals (typhoid case/mother/father trios). A subset of data from 33 SNPs with a minor allele frequency of >4.3% was used to construct haplotypes. Fifteen SNPs, which tagged the 42 constructed haplotypes were selected. The haplotype tagging SNPs (T1-T15) were genotyped in 380 confirmed typhoid cases and 380 Vietnamese ethnically matched controls. Allelic frequencies of seven SNPs (T1, T2, T3, T5, T6, T7, T8) were significantly different between typhoid cases and controls. Logistic regression results support the hypothesis that there is just one signal associated with disease at this locus. Haplotype-based analysis of the tag SNPs provided positive evidence of association with typhoid (posterior probability 0.821). The analysis highlighted a low-risk cluster of haplotypes that each carry the minor allele of T1 or T7, but not both, and otherwise carry the combination of alleles *12122*1111 at T1-T11, further supporting the one associated signal hypothesis. Finally, individuals that carry the typhoid fever protective haplotype *12122*1111 also produce a relatively low TNF-α response to LPS. PMID:17503085
Tales of diversity: Genomic and morphological characteristics of forty-six Arthrobacter phages
Adair, Tamarah L.; Afram, Patricia; Allen, Katherine G.; Archambault, Megan L.; Aziz, Rahat M.; Bagnasco, Filippa G.; Ball, Sarah L.; Barrett, Natalie A.; Benjamin, Robert C.; Blasi, Christopher J.; Borst, Katherine; Braun, Mary A.; Broomell, Haley; Brown, Conner B.; Brynell, Zachary S.; Bue, Ashley B.; Burke, Sydney O.; Casazza, William; Cautela, Julia A.; Chen, Kevin; Chimalakonda, Nitish S.; Chudoff, Dylan; Connor, Jade A.; Cross, Trevor S.; Curtis, Kyra N.; Dahlke, Jessica A.; Deaton, Bethany M.; Degroote, Sarah J.; DeNigris, Danielle M.; DeRuff, Katherine C.; Dolan, Milan; Dunbar, David; Egan, Marisa S.; Evans, Daniel R.; Fahnestock, Abby K.; Farooq, Amal; Finn, Garrett; Fratus, Christopher R.; Gaffney, Bobby L.; Garlena, Rebecca A.; Garrigan, Kelly E.; Gibbon, Bryan C.; Goedde, Michael A.; Guerrero Bustamante, Carlos A.; Harrison, Melinda; Hartwell, Megan C.; Heckman, Emily L.; Huang, Jennifer; Hughes, Lee E.; Hyduchak, Kathryn M.; Jacob, Aswathi E.; Kaku, Machika; Karstens, Allen W.; Kenna, Margaret A.; Khetarpal, Susheel; King, Rodney A.; Kobokovich, Amanda L.; Kolev, Hannah; Konde, Sai A.; Kriese, Elizabeth; Lamey, Morgan E.; Lantz, Carter N.; Lapin, Jonathan S.; Lawson, Temiloluwa O.; Lee, In Young; Lee, Scott M.; Lee-Soety, Julia Y.; Lehmann, Emily M.; London, Shawn C.; Lopez, A. Javier; Lynch, Kelly C.; Mageeney, Catherine M.; Martynyuk, Tetyana; Mathew, Kevin J.; Mavrich, Travis N.; McDaniel, Christopher M.; McDonald, Hannah; McManus, C. Joel; Medrano, Jessica E.; Mele, Francis E.; Menninger, Jennifer E.; Miller, Sierra N.; Minick, Josephine E.; Nabua, Courtney T.; Napoli, Caroline K.; Nkangabwa, Martha; Oates, Elizabeth A.; Ott, Cassandra T.; Pellerino, Sarah K.; Pinamont, William J.; Pirnie, Ross T.; Pizzorno, Marie C.; Plautz, Emilee J.; Pope, Welkin H.; Pruett, Katelyn M.; Rickstrew, Gabbi; Rimple, Patrick A.; Rinehart, Claire A.; Robinson, Kayla M.; Rose, Victoria A.; Russell, Daniel A.; Schick, Amelia M.; Schlossman, Julia; Schneider, Victoria M.; Sells, Chloe A.; Sieker, Jeremy W.; Silva, Morgan P.; Silvi, Marissa M.; Simon, Stephanie E.; Staples, Amanda K.; Steed, Isabelle L.; Stowe, Emily L.; Stueven, Noah A.; Swartz, Porter T.; Sweet, Emma A.; Sweetman, Abigail T.; Tender, Corrina; Terry, Katrina; Thomas, Chrystal; Thomas, Daniel S.; Thompson, Allison R.; Vanderveen, Lorianna; Varma, Rohan; Vaught, Hannah L.; Vo, Quynh D.; Vonberg, Zachary T.; Ware, Vassie C.; Warrad, Yasmene M.; Wathen, Kaitlyn E.; Weinstein, Jonathan L.; Wyper, Jacqueline F.; Yankauskas, Jakob R.; Zhang, Christine
2017-01-01
The vast bacteriophage population harbors an immense reservoir of genetic information. Almost 2000 phage genomes have been sequenced from phages infecting hosts in the phylum Actinobacteria, and analysis of these genomes reveals substantial diversity, pervasive mosaicism, and novel mechanisms for phage replication and lysogeny. Here, we describe the isolation and genomic characterization of 46 phages from environmental samples at various geographic locations in the U.S. infecting a single Arthrobacter sp. strain. These phages include representatives of all three virion morphologies, and Jasmine is the first sequenced podovirus of an actinobacterial host. The phages also span considerable sequence diversity, and can be grouped into 10 clusters according to their nucleotide diversity, and two singletons each with no close relatives. However, the clusters/singletons appear to be genomically well separated from each other, and relatively few genes are shared between clusters. Genome size varies from among the smallest of siphoviral phages (15,319 bp) to over 70 kbp, and G+C contents range from 45–68%, compared to 63.4% for the host genome. Although temperate phages are common among other actinobacterial hosts, these Arthrobacter phages are primarily lytic, and only the singleton Galaxy is likely temperate. PMID:28715480
Higuchi, Shoko; Sakamaki, Tetsuya; Hart, John A.; Hart, Terese B.; Tokuyama, Nahoko; Reinartz, Gay E.; Guislain, Patrick; Dupain, Jef; Cobden, Amy K.; Mulavwa, Mbangi N.; Yangozene, Kumugo; Darroze, Serge; Devos, Céline; Furuichi, Takeshi
2013-01-01
Bonobos (Pan paniscus) inhabit regions south of the Congo River including all areas between its southerly tributaries. To investigate the genetic diversity and evolutionary relationship among bonobo populations, we sequenced mitochondrial DNA from 376 fecal samples collected in seven study populations located within the eastern and western limits of the species’ range. In 136 effective samples from different individuals (range: 7–37 per population), we distinguished 54 haplotypes in six clades (A1, A2, B1, B2, C, D), which included a newly identified clade (D). MtDNA haplotypes were regionally clustered; 83 percent of haplotypes were locality-specific. The distribution of haplotypes across populations and the genetic diversity within populations thus showed highly geographical patterns. Using population distance measures, seven populations were categorized in three clusters: the east, central, and west cohorts. Although further elucidation of historical changes in the geological setting is required, the geographical patterns of genetic diversity seem to be shaped by paleoenvironmental changes during the Pleistocene. The present day riverine barriers appeared to have a weak effect on gene flow among populations, except for the Lomami River, which separates the TL2 population from the others. The central cohort preserves a high genetic diversity, and two unique clades of haplotypes were found in the Wamba/Iyondji populations in the central cohort and in the TL2 population in the eastern cohort respectively. This knowledge may contribute to the planning of bonobo conservation. PMID:23544084
Patterns of linkage disequilibrium and haplotype distribution in disease candidate genes.
Long, Ji-Rong; Zhao, Lan-Juan; Liu, Peng-Yuan; Lu, Yan; Dvornyk, Volodymyr; Shen, Hui; Liu, Yong-Jun; Zhang, Yuan-Yuan; Xiong, Dong-Hai; Xiao, Peng; Deng, Hong-Wen
2004-05-24
The adequacy of association studies for complex diseases depends critically on the existence of linkage disequilibrium (LD) between functional alleles and surrounding SNP markers. We examined the patterns of LD and haplotype distribution in eight candidate genes for osteoporosis and/or obesity using 31 SNPs in 1,873 subjects. These eight genes are apolipoprotein E (APOE), type I collagen alpha1 (COL1A1), estrogen receptor-alpha (ER-alpha), leptin receptor (LEPR), parathyroid hormone (PTH)/PTH-related peptide receptor type 1 (PTHR1), transforming growth factor-beta1 (TGF-beta1), uncoupling protein 3 (UCP3), and vitamin D (1,25-dihydroxyvitamin D3) receptor (VDR). Yin yang haplotypes, two high-frequency haplotypes composed of completely mismatching SNP alleles, were examined. To quantify LD patterns, two common measures of LD, D' and r2, were calculated for the SNPs within the genes. The haplotype distribution varied in the different genes. Yin yang haplotypes were observed only in PTHR1 and UCP3. D' ranged from 0.020 to 1.000 with the average of 0.475, whereas the average r2 was 0.158 (ranging from 0.000 to 0.883). A decay of LD was observed as the intermarker distance increased, however, there was a great difference in LD characteristics of different genes or even in different regions within gene. The differences in haplotype distributions and LD patterns among the genes underscore the importance of characterizing genomic regions of interest prior to association studies.
Haplotype estimation using sequencing reads.
Delaneau, Olivier; Howie, Bryan; Cox, Anthony J; Zagury, Jean-François; Marchini, Jonathan
2013-10-03
High-throughput sequencing technologies produce short sequence reads that can contain phase information if they span two or more heterozygote genotypes. This information is not routinely used by current methods that infer haplotypes from genotype data. We have extended the SHAPEIT2 method to use phase-informative sequencing reads to improve phasing accuracy. Our model incorporates the read information in a probabilistic model through base quality scores within each read. The method is primarily designed for high-coverage sequence data or data sets that already have genotypes called. One important application is phasing of single samples sequenced at high coverage for use in medical sequencing and studies of rare diseases. Our method can also use existing panels of reference haplotypes. We tested the method by using a mother-father-child trio sequenced at high-coverage by Illumina together with the low-coverage sequence data from the 1000 Genomes Project (1000GP). We found that use of phase-informative reads increases the mean distance between switch errors by 22% from 274.4 kb to 328.6 kb. We also used male chromosome X haplotypes from the 1000GP samples to simulate sequencing reads with varying insert size, read length, and base error rate. When using short 100 bp paired-end reads, we found that using mixtures of insert sizes produced the best results. When using longer reads with high error rates (5-20 kb read with 4%-15% error per base), phasing performance was substantially improved. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Ambroset, Chloé; Coluzzi, Charles; Guédon, Gérard; Devignes, Marie-Dominique; Loux, Valentin; Lacroix, Thomas; Payot, Sophie; Leblond-Bourget, Nathalie
2015-01-01
Recent genome analyses suggest that integrative and conjugative elements (ICEs) are widespread in bacterial genomes and therefore play an essential role in horizontal transfer. However, only a few of these elements are precisely characterized and correctly delineated within sequenced bacterial genomes. Even though previous analysis showed the presence of ICEs in some species of Streptococci, the global prevalence and diversity of ICEs was not analyzed in this genus. In this study, we searched for ICEs in the completely sequenced genomes of 124 strains belonging to 27 streptococcal species. These exhaustive analyses revealed 105 putative ICEs and 26 slightly decayed elements whose limits were assessed and whose insertion site was identified. These ICEs were grouped in seven distinct unrelated or distantly related families, according to their conjugation modules. Integration of these streptococcal ICEs is catalyzed either by a site-specific tyrosine integrase, a low-specificity tyrosine integrase, a site-specific single serine integrase, a triplet of site-specific serine integrases or a DDE transposase. Analysis of their integration site led to the detection of 18 target-genes for streptococcal ICE insertion including eight that had not been identified previously (ftsK, guaA, lysS, mutT, rpmG, rpsI, traG, and ebfC). It also suggests that all specificities have evolved to minimize the impact of the insertion on the host. This overall analysis of streptococcal ICEs emphasizes their prevalence and diversity and demonstrates that exchanges or acquisitions of conjugation and recombination modules are frequent.
A genomic scale map of genetic diversity in Trypanosoma cruzi
2012-01-01
Background Trypanosoma cruzi, the causal agent of Chagas Disease, affects more than 16 million people in Latin America. The clinical outcome of the disease results from a complex interplay between environmental factors and the genetic background of both the human host and the parasite. However, knowledge of the genetic diversity of the parasite, is currently limited to a number of highly studied loci. The availability of a number of genomes from different evolutionary lineages of T. cruzi provides an unprecedented opportunity to look at the genetic diversity of the parasite at a genomic scale. Results Using a bioinformatic strategy, we have clustered T. cruzi sequence data available in the public domain and obtained multiple sequence alignments in which one or two alleles from the reference CL-Brener were included. These data covers 4 major evolutionary lineages (DTUs): TcI, TcII, TcIII, and the hybrid TcVI. Using these set of alignments we have identified 288,957 high quality single nucleotide polymorphisms and 1,480 indels. In a reduced re-sequencing study we were able to validate ~ 97% of high-quality SNPs identified in 47 loci. Analysis of how these changes affect encoded protein products showed a 0.77 ratio of synonymous to non-synonymous changes in the T. cruzi genome. We observed 113 changes that introduce or remove a stop codon, some causing significant functional changes, and a number of tri-allelic and tetra-allelic SNPs that could be exploited in strain typing assays. Based on an analysis of the observed nucleotide diversity we show that the T. cruzi genome contains a core set of genes that are under apparent purifying selection. Interestingly, orthologs of known druggable targets show statistically significant lower nucleotide diversity values. Conclusions This study provides the first look at the genetic diversity of T. cruzi at a genomic scale. The analysis covers an estimated ~ 60% of the genetic diversity present in the population, providing an
CTCF-Mediated Human 3D Genome Architecture Reveals Chromatin Topology for Transcription.
Tang, Zhonghui; Luo, Oscar Junhong; Li, Xingwang; Zheng, Meizhen; Zhu, Jacqueline Jufen; Szalaj, Przemyslaw; Trzaskoma, Pawel; Magalska, Adriana; Wlodarczyk, Jakub; Ruszczycki, Blazej; Michalski, Paul; Piecuch, Emaly; Wang, Ping; Wang, Danjuan; Tian, Simon Zhongyuan; Penrad-Mobayed, May; Sachs, Laurent M; Ruan, Xiaoan; Wei, Chia-Lin; Liu, Edison T; Wilczynski, Grzegorz M; Plewczynski, Dariusz; Li, Guoliang; Ruan, Yijun
2015-12-17
Spatial genome organization and its effect on transcription remains a fundamental question. We applied an advanced chromatin interaction analysis by paired-end tag sequencing (ChIA-PET) strategy to comprehensively map higher-order chromosome folding and specific chromatin interactions mediated by CCCTC-binding factor (CTCF) and RNA polymerase II (RNAPII) with haplotype specificity and nucleotide resolution in different human cell lineages. We find that CTCF/cohesin-mediated interaction anchors serve as structural foci for spatial organization of constitutive genes concordant with CTCF-motif orientation, whereas RNAPII interacts within these structures by selectively drawing cell-type-specific genes toward CTCF foci for coordinated transcription. Furthermore, we show that haplotype variants and allelic interactions have differential effects on chromosome configuration, influencing gene expression, and may provide mechanistic insights into functions associated with disease susceptibility. 3D genome simulation suggests a model of chromatin folding around chromosomal axes, where CTCF is involved in defining the interface between condensed and open compartments for structural regulation. Our 3D genome strategy thus provides unique insights in the topological mechanism of human variations and diseases. Copyright © 2015 Elsevier Inc. All rights reserved.
Sukernik, Rem I; Volodko, Natalia V; Mazunin, Ilya O; Eltsov, Nikolai P; Dryomov, Stanislav V; Starikovskaya, Elena B
2012-05-01
To fill remaining gaps in mitochondrial DNA diversity in the least surveyed eastern and western flanks of Siberia, 391 mtDNA samples (144 Tubalar from Altai, 87 Even from northeastern Siberia, and 160 Ulchi from the Russian Far East) were characterized via high-resolution restriction fragment length polymorphism/single nucleotide polymorphisms analysis. The subhaplogroup structure was extended through complete sequencing of 67 mtDNA samples selected from these and other related native Siberians. Specifically, we have focused on the evolutionary histories of the derivatives of M and N haplogroups, putatively reflecting different phases of settling Siberia by early modern humans. Population history and phylogeography of the resulting mtDNA genomes, combined with those from previously published data sets, revealed a wide range of tribal- and region-specific mtDNA haplotypes that emerged or diversified in Siberia before or after the last glacial maximum, ∼18 kya. Spatial distribution and ages of the "east" and "west" Eurasian mtDNA haploclusters suggest that anatomically modern humans that originally colonized Altai derived from macrohaplogroup N and came from Southwest Asia around 38,000 years ago. The derivatives of macrohaplogroup M, which largely emerged or diversified within the Russian Far East, came along with subsequent migrations to West Siberia millennia later. The last glacial maximum played a critical role in the timing and character of the settlement of the Siberian subcontinent. Copyright © 2012 Wiley Periodicals, Inc.
Genome diversity in Brachypodium distachyon: deep sequencing of highly diverse inbred lines
USDA-ARS?s Scientific Manuscript database
Natural variation provides a powerful opportunity to study the genetic basis of biological traits. Brachypodium distachyon is a broadly distributed diploid model grass with a small genome and a large collection of diverse inbred lines. As a step towards understanding the genetic basis of the natura...
Indigenous peoples and the morality of the Human Genome Diversity Project.
Dodson, M; Williamson, R
1999-04-01
In addition to the aim of mapping and sequencing one human's genome, the Human Genome Project also intends to characterise the genetic diversity of the world's peoples. The Human Genome Diversity Project raises political, economic and ethical issues. These intersect clearly when the genomes under study are those of indigenous peoples who are already subject to serious economic, legal and/or social disadvantage and discrimination. The fact that some individuals associated with the project have made dismissive comments about indigenous peoples has confused rather than illuminated the deeper issues involved, as well as causing much antagonism among indigenous peoples. There are more serious ethical issues raised by the project for all geneticists, including those who are sympathetic to the problems of indigenous peoples. With particular attention to the history and attitudes of Australian indigenous peoples, we argue that the Human Genome Diversity Project can only proceed if those who further its objectives simultaneously: respect the cultural beliefs of indigenous peoples; publicly support the efforts of indigenous peoples to achieve respect and equality; express respect by a rigorous understanding of the meaning of equitable negotiation of consent, and ensure that both immediate and long term economic benefits from the research flow back to the groups taking part.
Pedersen, Niels C; Brucker, Lynn; Tessier, Natalie Green; Liu, Hongwei; Penedo, Maria Cecilia T; Hughes, Shayne; Oberbauer, Anita; Sacks, Ben
2015-01-01
Sebaceous adenitis (SA) and Addison's disease (AD) increased rapidly in incidence among Standard Poodles after the mid-twentieth century. Previous attempts to identify specific genetic causes using genome wide association studies and interrogation of the dog leukocyte antigen (DLA) region have been non-productive. However, such studies led us to hypothesize that positive selection for desired phenotypic traits that arose in the mid-twentieth century led to intense inbreeding and the inadvertent amplification of AD and SA associated traits. This hypothesis was tested with genetic studies of 761 Standard, Miniature, and Miniature/Standard Poodle crosses from the USA, Canada and Europe, coupled with extensive pedigree analysis of thousands more dogs. Genome-wide diversity across the world-wide population was measured using a panel of 33 short tandem repeat (STR) loci. Allele frequency data were also used to determine the internal relatedness of individual dogs within the population as a whole. Assays based on linkage between STR genomic loci and DLA genes were used to identify class I and II haplotypes and disease associations. Genetic diversity statistics based on genomic STR markers indicated that Standard Poodles from North America and Europe were closely related and reasonably diverse across the breed. However, genetic diversity statistics, internal relatedness, principal coordinate analysis, and DLA haplotype frequencies showed a marked imbalance with 30 % of the diversity in 70 % of the dogs. Standard Poodles with SA and AD were strongly linked to this inbred population, with dogs suffering with SA being the most inbred. No single strong association was found between STR defined DLA class I or II haplotypes and SA or AD in the breed as a whole, although certain haplotypes present in a minority of the population appeared to confer moderate degrees of risk or protection against either or both diseases. Dogs possessing minor DLA class I haplotypes were half as
Tachedjian, Mary; Wang, Lin-Fa
2010-01-01
Bats are the natural host reservoir for range of emerging and re-emerging viruses, many of which cause significant morbidity and mortality in other mammals, yet appear to result in no clinical consequences for bats. The ability of bats to coexist with a variety of viruses presents an interesting immunological problem that has not been examined in any detail but which could provide significant insights into the evolution of antiviral mechanisms in mammals. Towards a better understanding of the bat immune system, we analysed the expressed heavy chain variable (VH) regions of antibodies from the black flying fox, Pteropus alecto. The germline repertoire of the closely related Pteropid bat, Pteropus vampyrus, whose genome has been sequenced was also examined for comparative purposes. Representative VH genes were found in all three mammalian VH clans (I, II and III) in both the expressed P. alecto VH repertoire and the germline P. vampyrus VH repertoire. Evidence for the use of multiple heavy chain diversity (DH) and joining (JH) segments for the generation of diverse VDJ rearrangements was also present in the expressed antibody repertoire of P. alecto. The long period of co-evolutionary history of bats with viruses may have resulted in a variety of highly specific VH segments being hardwired into the genomes of bats and may have implications for their ability to successfully cope with a diversity of viral antigens. PMID:20162414
USDA-ARS?s Scientific Manuscript database
Many studies leverage targeted whole genome sequencing (WGS) experiments in order to identify rare and causal variants within populations. As a natural consequence of experimental design, many of these surveys tend to sequence redundant haplotype segments due to high frequency in the base population...
Lampreys as Diverse Model Organisms in the Genomics Era.
McCauley, David W; Docker, Margaret F; Whyard, Steve; Li, Weiming
2015-11-01
Lampreys, one of the two surviving groups of ancient vertebrates, have become important models for study in diverse fields of biology. Lampreys (of which there are approximately 40 species) are being studied, for example, (a) to control pest sea lamprey in the North American Great Lakes and to restore declining populations of native species elsewhere; (b) in biomedical research, focusing particularly on the regenerative capability of lampreys; and (c) by developmental biologists studying the evolution of key vertebrate characters. Although a lack of genetic resources has hindered research on the mechanisms regulating many aspects of lamprey life history and development, formerly intractable questions are now amenable to investigation following the recent publication of the sea lamprey genome. Here, we provide an overview of the ways in which genomic tools are currently being deployed to tackle diverse research questions and suggest several areas that may benefit from the availability of the sea lamprey genome.
Lampreys as Diverse Model Organisms in the Genomics Era
McCauley, David W.; Docker, Margaret F.; Whyard, Steve; Li, Weiming
2015-01-01
Lampreys, one of the two surviving groups of ancient vertebrates, have become important models for study in diverse fields of biology. Lampreys (of which there are approximately 40 species) are being studied, for example, (a) to control pest sea lamprey in the North American Great Lakes and to restore declining populations of native species elsewhere; (b) in biomedical research, focusing particularly on the regenerative capability of lampreys; and (c) by developmental biologists studying the evolution of key vertebrate characters. Although a lack of genetic resources has hindered research on the mechanisms regulating many aspects of lamprey life history and development, formerly intractable questions are now amenable to investigation following the recent publication of the sea lamprey genome. Here, we provide an overview of the ways in which genomic tools are currently being deployed to tackle diverse research questions and suggest several areas that may benefit from the availability of the sea lamprey genome. PMID:26951616
Prophage Integrase Typing Is a Useful Indicator of Genomic Diversity in Salmonella enterica
Colavecchio, Anna; D’Souza, Yasmin; Tompkins, Elizabeth; Jeukens, Julie; Freschi, Luca; Emond-Rheault, Jean-Guillaume; Kukavica-Ibrulj, Irena; Boyle, Brian; Bekal, Sadjia; Tamber, Sandeep; Levesque, Roger C.; Goodridge, Lawrence D.
2017-01-01
Salmonella enterica is a bacterial species that is a major cause of illness in humans and food-producing animals. S. enterica exhibits considerable inter-serovar diversity, as evidenced by the large number of host adapted serovars that have been identified. The development of methods to assess genome diversity in S. enterica will help to further define the limits of diversity in this foodborne pathogen. Thus, we evaluated a PCR assay, which targets prophage integrase genes, as a rapid method to investigate S. enterica genome diversity. To evaluate the PCR prophage integrase assay, 49 isolates of S. enterica were selected, including 19 clinical isolates from clonal serovars (Enteritidis and Heidelberg) that commonly cause human illness, and 30 isolates from food-associated Salmonella serovars that rarely cause human illness. The number of integrase genes identified by the PCR assay was compared to the number of integrase genes within intact prophages identified by whole genome sequencing and phage finding program PHASTER. The PCR assay identified a total of 147 prophage integrase genes within the 49 S. enterica genomes (79 integrase genes in the food-associated Salmonella isolates, 50 integrase genes in S. Enteritidis, and 18 integrase genes in S. Heidelberg). In comparison, whole genome sequencing and PHASTER identified a total of 75 prophage integrase genes within 102 intact prophages in the 49 S. enterica genomes (44 integrase genes in the food-associated Salmonella isolates, 21 integrase genes in S. Enteritidis, and 9 integrase genes in S. Heidelberg). Collectively, both the PCR assay and PHASTER identified the presence of a large diversity of prophage integrase genes in the food-associated isolates compared to the clinical isolates, thus indicating a high degree of diversity in the food-associated isolates, and confirming the clonal nature of S. Enteritidis and S. Heidelberg. Moreover, PHASTER revealed a diversity of 29 different types of prophages and 23
Prophage Integrase Typing Is a Useful Indicator of Genomic Diversity in Salmonella enterica.
Colavecchio, Anna; D'Souza, Yasmin; Tompkins, Elizabeth; Jeukens, Julie; Freschi, Luca; Emond-Rheault, Jean-Guillaume; Kukavica-Ibrulj, Irena; Boyle, Brian; Bekal, Sadjia; Tamber, Sandeep; Levesque, Roger C; Goodridge, Lawrence D
2017-01-01
Salmonella enterica is a bacterial species that is a major cause of illness in humans and food-producing animals. S. enterica exhibits considerable inter-serovar diversity, as evidenced by the large number of host adapted serovars that have been identified. The development of methods to assess genome diversity in S. enterica will help to further define the limits of diversity in this foodborne pathogen. Thus, we evaluated a PCR assay, which targets prophage integrase genes, as a rapid method to investigate S. enterica genome diversity. To evaluate the PCR prophage integrase assay, 49 isolates of S. enterica were selected, including 19 clinical isolates from clonal serovars (Enteritidis and Heidelberg) that commonly cause human illness, and 30 isolates from food-associated Salmonella serovars that rarely cause human illness. The number of integrase genes identified by the PCR assay was compared to the number of integrase genes within intact prophages identified by whole genome sequencing and phage finding program PHASTER. The PCR assay identified a total of 147 prophage integrase genes within the 49 S. enterica genomes (79 integrase genes in the food-associated Salmonella isolates, 50 integrase genes in S . Enteritidis, and 18 integrase genes in S . Heidelberg). In comparison, whole genome sequencing and PHASTER identified a total of 75 prophage integrase genes within 102 intact prophages in the 49 S. enterica genomes (44 integrase genes in the food-associated Salmonella isolates, 21 integrase genes in S . Enteritidis, and 9 integrase genes in S . Heidelberg). Collectively, both the PCR assay and PHASTER identified the presence of a large diversity of prophage integrase genes in the food-associated isolates compared to the clinical isolates, thus indicating a high degree of diversity in the food-associated isolates, and confirming the clonal nature of S . Enteritidis and S . Heidelberg. Moreover, PHASTER revealed a diversity of 29 different types of prophages and 23
Howard, R.J.; Travis, S.E.; Sikes, B.A.
2008-01-01
While numerous studies have documented patterns of invasion by non-indigenous plant species, few have considered the invasive properties of non-native genotypes of native species. Characteristics associated with specific genotypes, such as tolerance to disturbance, may mistakenly be applied to an entire species in the absence of genetic information, which consequently may affect management decisions. We report here on the incidence and growth of an introduced lineage of Phragmites australis in the Gulf of Mexico coastal zone of Louisiana. P. australis was collected from nine separate locations for inclusion in a series of growth experiments. Chloroplast DNA analysis indicated that specimens collected from four locations in the Mississippi River Delta represented the introduced Eurasian haplotype; the remainder represented the gulf coast haplotype. Three distinct genotypes, or clones, were identified within each haplotype via analysis using amplified fragment length polymorphisms, which also revealed reduced genetic diversity of the gulf coast clones compared to the Eurasian clones. Clones of each haplotype were planted along with three other native macrophytes at similar densities in a restored brackish marsh and monitored for growth. After 14 months, the Eurasian haplotype had spread vegetatively to cover about 82% of the experimental plots, more than four times the coverage (18%) of the gulf coast haplotype. Thus, the use of P. australis plantings for wetland restoration should consider the genetic lineage of plants used since our results indicate the potential of the Eurasian haplotype to grow rapidly at newly restored sites. This rapid growth may limit the establishment of more slowly growing native species. ?? 2007 Springer Science+Business Media B.V.
Rothe, Jessica; Watkins, Norman E.; Nagy, Marion
2012-01-01
Allele-specific extension reactions (ASERs) use 3′ terminus-specific primers for the selective extension of completely annealed matches by polymerase. The ability of the polymerase to extend non-specific 3′ terminal mismatches leads to a failure of the reaction, a process that is only partly understood and predictable, and often requires time-consuming assay design. In our studies we investigated haplotype-specific extraction (HSE) for the separation of male DNA mixtures. HSE is an ASER and provides the ability to distinguish between diploid chromosomes from one or more individuals. Here, we show that the success of HSE and allele-specific extension depend strongly on the concentration difference between complete match and 3′ terminal mismatch. Using the oligonucleotide-modeling platform Visual Omp, we demonstrated the dependency of the discrimination power of the polymerase on match- and mismatch-target hybridization between different probe lengths. Therefore, the probe specificity in HSE could be predicted by performing a relative comparison of different probe designs with their simulated differences between the duplex concentration of target-probe match and mismatches. We tested this new model for probe design in more than 300 HSE reactions with 137 different probes and obtained an accordance of 88%. PMID:23049901
Chen, Poyin; den Bakker, Henk C; Korlach, Jonas; Kong, Nguyet; Storey, Dylan B; Paxinos, Ellen E; Ashby, Meredith; Clark, Tyson; Luong, Khai; Wiedmann, Martin; Weimer, Bart C
2017-02-01
Listeria monocytogenes is a bacterial pathogen that is found in a wide variety of anthropogenic and natural environments. Genome sequencing technologies are rapidly becoming a powerful tool in facilitating our understanding of how genotype, classification phenotypes, and virulence phenotypes interact to predict the health risks of individual bacterial isolates. Currently, 57 closed L. monocytogenes genomes are publicly available, representing three of the four phylogenetic lineages, and they suggest that L. monocytogenes has high genomic synteny. This study contributes an additional 15 closed L. monocytogenes genomes that were used to determine the associations between the genome and methylome with host invasion magnitude. In contrast to previous findings, large chromosomal inversions and rearrangements were detected in five isolates at the chromosome terminus and within rRNA genes, including a previously undescribed inversion within rRNA-encoding regions. Each isolate's epigenome contained highly diverse methyltransferase recognition sites, even within the same serotype and methylation pattern. Eleven strains contained a single chromosomally encoded methyltransferase, one strain contained two methylation systems (one system on a plasmid), and three strains exhibited no methylation, despite the occurrence of methyltransferase genes. In three isolates a new, unknown DNA modification was observed in addition to diverse methylation patterns, accompanied by a novel methylation system. Neither chromosome rearrangement nor strain-specific patterns of epigenome modification observed within virulence genes were correlated with serotype designation, clonal complex, or in vitro infectivity. These data suggest that genome diversity is larger than previously considered in L. monocytogenes and that as more genomes are sequenced, additional structure and methylation novelty will be observed in this organism. Listeria monocytogenes is the causative agent of listeriosis, a disease
Haplotype analysis of the apolipoprotein gene cluster on human chromosome 11
Olivier, Michael; Wang, Xujing; Cole, Regina; Gau, Brian; Kim, Jessica; Rubin, Edward M.; Pennacchio, Len A.
2009-01-01
Members of the apolipoprotein gene cluster (APOA1/C3/A4/A5) on human chromosome 11q23 play an important role in lipid metabolism. Polymorphisms in both APOA5 and APOC3 are strongly associated with plasma triglyceride concentrations. The close genomic locations of these two genes as well as their functional similarity have hindered efforts to define whether each gene independently influences human triglyceride concentrations. In this study, we examined the linkage disequilibrium and haplotype structure of 49 SNPs in a 150-kb region spanning the gene cluster. We identified a total of five common APOA5 haplotypes with a frequency of greater than 8% in samples of northern European origin. The APOA5 haplotype block did not extend past the 7 SNPs in the gene and was separated from the other apolipoprotein gene in the cluster by a region of significantly increased recombination. Furthermore, one previously identified triglyceride risk haplotype of APOA5 (APOA5*3) showed no association with three APOC3 SNPs previously associated with triglyceride concentrations, in contrast to the other risk haplotype (APOA5*2), which was associated with all three minor APOC3 SNP alleles. These results highlight the complex genetic relationship between APOA5 and APOC3 and support the notion that APOA5 represents an independent risk gene affecting plasma triglyceride concentrations in humans. PMID:15081120
Bakar, Suhaili Abu; Hollox, Edward J.; Armour, John A. L.
2009-01-01
β-Defensins are small secreted antimicrobial and signaling peptides involved in the innate immune response of vertebrates. In humans, a cluster of at least 7 of these genes shows extensive copy number variation, with a diploid copy number commonly ranging between 2 and 7. Using a genetic mapping approach, we show that this cluster is at not 1 but 2 distinct genomic loci ≈5 Mb apart on chromosome band 8p23.1, contradicting the most recent genome assembly. We also demonstrate that the predominant mechanism of change in β-defensin copy number is simple allelic recombination occurring in the interval between the 2 distinct genomic loci for these genes. In 416 meiotic transmissions, we observe 3 events creating a haplotype copy number not found in the parent, equivalent to a germ-line rate of copy number change of ≈0.7% per gamete. This places it among the fastest-changing copy number variants currently known. PMID:19131514
Natural positive selection and north-south genetic diversity in East Asia.
Suo, Chen; Xu, Haiyan; Khor, Chiea-Chuen; Ong, Rick Th; Sim, Xueling; Chen, Jieming; Tay, Wan-Ting; Sim, Kar-Seng; Zeng, Yi-Xin; Zhang, Xuejun; Liu, Jianjun; Tai, E-Shyong; Wong, Tien-Yin; Chia, Kee-Seng; Teo, Yik-Ying
2012-01-01
Recent reports have identified a north-south cline in genetic variation in East and South-East Asia, but these studies have not formally explored the basis of these clinical differences. Understanding the origins of these variations may provide valuable insights in tracking down the functional variants in genomic regions identified by genetic association studies. Here we investigate the genetic basis of these differences with genome-wide data from the HapMap, the Human Genome Diversity Project and the Singapore Genome Variation Project. We implemented four bioinformatic measures to discover genomic regions that are considerably differentiated either between two Han Chinese populations in the north and south of China, or across 22 populations in East and South-East Asia. These measures prioritized genomic stretches with: (i) regional differences in the allelic spectrum for SNPs common to the two Han Chinese populations; (ii) differential evidence of positive selection between the two populations as quantified by integrated haplotype score (iHS) and cross-population extended haplotype homozygosity (XP-EHH); (iii) significant correlation between allele frequencies and geographical latitudes of the 22 populations. We also explored the extent of linkage disequilibrium variations in these regions, which is important in combining genetic association studies from North and South Chinese. Two of the regions that emerged are found in HLA class I and II, suggesting that the HLA imputation panel from the HapMap may not be directly applicable to every Chinese sample. This has important implications to autoimmune studies that plan to impute the classical HLA alleles to fine map the SNP association signals.
Natural positive selection and north–south genetic diversity in East Asia
Suo, Chen; Xu, Haiyan; Khor, Chiea-Chuen; Ong, Rick TH; Sim, Xueling; Chen, Jieming; Tay, Wan-Ting; Sim, Kar-Seng; Zeng, Yi-Xin; Zhang, Xuejun; Liu, Jianjun; Tai, E-Shyong; Wong, Tien-Yin; Chia, Kee-Seng; Teo, Yik-Ying
2012-01-01
Recent reports have identified a north–south cline in genetic variation in East and South-East Asia, but these studies have not formally explored the basis of these clinical differences. Understanding the origins of these variations may provide valuable insights in tracking down the functional variants in genomic regions identified by genetic association studies. Here we investigate the genetic basis of these differences with genome-wide data from the HapMap, the Human Genome Diversity Project and the Singapore Genome Variation Project. We implemented four bioinformatic measures to discover genomic regions that are considerably differentiated either between two Han Chinese populations in the north and south of China, or across 22 populations in East and South-East Asia. These measures prioritized genomic stretches with: (i) regional differences in the allelic spectrum for SNPs common to the two Han Chinese populations; (ii) differential evidence of positive selection between the two populations as quantified by integrated haplotype score (iHS) and cross-population extended haplotype homozygosity (XP-EHH); (iii) significant correlation between allele frequencies and geographical latitudes of the 22 populations. We also explored the extent of linkage disequilibrium variations in these regions, which is important in combining genetic association studies from North and South Chinese. Two of the regions that emerged are found in HLA class I and II, suggesting that the HLA imputation panel from the HapMap may not be directly applicable to every Chinese sample. This has important implications to autoimmune studies that plan to impute the classical HLA alleles to fine map the SNP association signals. PMID:21792231
Pedersen, N; Liu, H; Theilen, G; Sacks, B
2013-06-01
Genetic diversity was compared among eight dog breeds selected primarily for conformation (Standard Poodle, Italian Greyhound and show English Setter), conformation and performance (Brittany), predominantly performance (German Shorthaired and Wirehaired Pointers) or solely performance (field English Setter and Red Setter). Modern village dogs, which better reflect ancestral genetic diversity, were used as the standard. Four to seven maternal and one to two Y haplotypes were found per breed, with one usually dominant. Diversity of maternal haplotypes was greatest in village dogs, intermediate in performance breeds and lowest in conformation breeds. Maternal haplotype sharing occurred across all breeds, while Y haplotypes were more breed specific. Almost all paternal haplotypes were identified among village dogs, with the exception of the dominant Y haplotype in Brittanys, which has not been identified heretofore. The highest heterozygosity based on 24 autosomal microsatellites was found in village dogs and the lowest in conformation (show) breeds. Principal coordinate analysis indicated that conformation-type breeds were distinct from breeds heavily used for performance, the latter clustering more closely with village dogs. The Brittany, a well-established dual show and field breed, was also genetically intermediate between the conformation and performance breeds. The number of DLA-DRB1 alleles varied from 3 to 10 per breed with extensive sharing. SNPs across the wider DLA region were more frequently homozygous in all pure breeds than in village dogs. Compared with their village dog relatives, all modern breed dogs exhibit reduced genetic diversity. Genetic diversity was even more reduced among breeds under selection for show/conformation. © 2012 Blackwell Verlag GmbH.
Kis-Papo, Tamar; Kirzhner, Valery; Wasser, Solomon P.; Nevo, Eviatar
2003-01-01
We have found that genomic diversity is generally positively correlated with abiotic and biotic stress levels (1–3). However, beyond a high-threshold level of stress, the diversity declines to a few adapted genotypes. The Dead Sea is the harshest planetary hypersaline environment (340 g·liter–1 total dissolved salts, ≈10 times sea water). Hence, the Dead Sea is an excellent natural laboratory for testing the “rise and fall” pattern of genetic diversity with stress proposed in this article. Here, we examined genomic diversity of the ascomycete fungus Aspergillus versicolor from saline, nonsaline, and hypersaline Dead Sea environments. We screened the coding and noncoding genomes of A. versicolor isolates by using >600 AFLP (amplified fragment length polymorphism) markers (equal to loci). Genomic diversity was positively correlated with stress, culminating in the Dead Sea surface but dropped drastically in 50- to 280-m-deep seawater. The genomic diversity pattern paralleled the pattern of sexual reproduction of fungal species across the same southward gradient of increasing stress in Israel. This parallel may suggest that diversity and sex are intertwined intimately according to the rise and fall pattern and adaptively selected by natural selection in fungal genome evolution. Future large-scale verification in micromycetes will define further the trajectories of diversity and sex in the rise and fall pattern. PMID:14645702
Conifer genomics and adaptation: at the crossroads of genetic diversity and genome function.
Prunier, Julien; Verta, Jukka-Pekka; MacKay, John J
2016-01-01
Conifers have been understudied at the genomic level despite their worldwide ecological and economic importance but the situation is rapidly changing with the development of next generation sequencing (NGS) technologies. With NGS, genomics research has simultaneously gained in speed, magnitude and scope. In just a few years, genomes of 20-24 gigabases have been sequenced for several conifers, with several others expected in the near future. Biological insights have resulted from recent sequencing initiatives as well as genetic mapping, gene expression profiling and gene discovery research over nearly two decades. We review the knowledge arising from conifer genomics research emphasizing genome evolution and the genomic basis of adaptation, and outline emerging questions and knowledge gaps. We discuss future directions in three areas with potential inputs from NGS technologies: the evolutionary impacts of adaptation in conifers based on the adaptation-by-speciation model; the contributions of genetic variability of gene expression in adaptation; and the development of a broader understanding of genetic diversity and its impacts on genome function. These research directions promise to sustain research aimed at addressing the emerging challenges of adaptation that face conifer trees. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.
Ambroset, Chloé; Coluzzi, Charles; Guédon, Gérard; Devignes, Marie-Dominique; Loux, Valentin; Lacroix, Thomas; Payot, Sophie; Leblond-Bourget, Nathalie
2016-01-01
Recent genome analyses suggest that integrative and conjugative elements (ICEs) are widespread in bacterial genomes and therefore play an essential role in horizontal transfer. However, only a few of these elements are precisely characterized and correctly delineated within sequenced bacterial genomes. Even though previous analysis showed the presence of ICEs in some species of Streptococci, the global prevalence and diversity of ICEs was not analyzed in this genus. In this study, we searched for ICEs in the completely sequenced genomes of 124 strains belonging to 27 streptococcal species. These exhaustive analyses revealed 105 putative ICEs and 26 slightly decayed elements whose limits were assessed and whose insertion site was identified. These ICEs were grouped in seven distinct unrelated or distantly related families, according to their conjugation modules. Integration of these streptococcal ICEs is catalyzed either by a site-specific tyrosine integrase, a low-specificity tyrosine integrase, a site-specific single serine integrase, a triplet of site-specific serine integrases or a DDE transposase. Analysis of their integration site led to the detection of 18 target-genes for streptococcal ICE insertion including eight that had not been identified previously (ftsK, guaA, lysS, mutT, rpmG, rpsI, traG, and ebfC). It also suggests that all specificities have evolved to minimize the impact of the insertion on the host. This overall analysis of streptococcal ICEs emphasizes their prevalence and diversity and demonstrates that exchanges or acquisitions of conjugation and recombination modules are frequent. PMID:26779141
Genomes of diverse isolates of the marine cyanobacterium Prochlorococcus
Biller, Steven J.; Berube, Paul M.; Berta-Thompson, Jessie W.; Kelly, Libusha; Roggensack, Sara E.; Awad, Lana; Roache-Johnson, Kathryn H.; Ding, Huiming; Giovannoni, Stephen J.; Rocap, Gabrielle; Moore, Lisa R.; Chisholm, Sallie W.
2014-01-01
The marine cyanobacterium Prochlorococcus is the numerically dominant photosynthetic organism in the oligotrophic oceans, and a model system in marine microbial ecology. Here we report 27 new whole genome sequences (2 complete and closed; 25 of draft quality) of cultured isolates, representing five major phylogenetic clades of Prochlorococcus. The sequenced strains were isolated from diverse regions of the oceans, facilitating studies of the drivers of microbial diversity—both in the lab and in the field. To improve the utility of these genomes for comparative genomics, we also define pre-computed clusters of orthologous groups of proteins (COGs), indicating how genes are distributed among these and other publicly available Prochlorococcus genomes. These data represent a significant expansion of Prochlorococcus reference genomes that are useful for numerous applications in microbial ecology, evolution and oceanography. PMID:25977791
Genomic Signatures Reveal New Evidences for Selection of Important Traits in Domestic Cattle
Xu, Lingyang; Bickhart, Derek M.; Cole, John B.; Schroeder, Steven G.; Song, Jiuzhou; Tassell, Curtis P. Van; Sonstegard, Tad S.; Liu, George E.
2015-01-01
We investigated diverse genomic selections using high-density single nucleotide polymorphism data of five distinct cattle breeds. Based on allele frequency differences, we detected hundreds of candidate regions under positive selection across Holstein, Angus, Charolais, Brahman, and N'Dama. In addition to well-known genes such as KIT, MC1R, ASIP, GHR, LCORL, NCAPG, WIF1, and ABCA12, we found evidence for a variety of novel and less-known genes under selection in cattle, such as LAP3, SAR1B, LRIG3, FGF5, and NUDCD3. Selective sweeps near LAP3 were then validated by next-generation sequencing. Genome-wide association analysis involving 26,362 Holsteins confirmed that LAP3 and SAR1B were related to milk production traits, suggesting that our candidate regions were likely functional. In addition, haplotype network analyses further revealed distinct selective pressures and evolution patterns across these five cattle breeds. Our results provided a glimpse into diverse genomic selection during cattle domestication, breed formation, and recent genetic improvement. These findings will facilitate genome-assisted breeding to improve animal production and health. PMID:25431480
Verde, Ignazio; Abbott, Albert G; Scalabrin, Simone; Jung, Sook; Shu, Shengqiang; Marroni, Fabio; Zhebentyayeva, Tatyana; Dettori, Maria Teresa; Grimwood, Jane; Cattonaro, Federica; Zuccolo, Andrea; Rossini, Laura; Jenkins, Jerry; Vendramin, Elisa; Meisel, Lee A; Decroocq, Veronique; Sosinski, Bryon; Prochnik, Simon; Mitros, Therese; Policriti, Alberto; Cipriani, Guido; Dondini, Luca; Ficklin, Stephen; Goodstein, David M; Xuan, Pengfei; Del Fabbro, Cristian; Aramini, Valeria; Copetti, Dario; Gonzalez, Susana; Horner, David S; Falchi, Rachele; Lucas, Susan; Mica, Erica; Maldonado, Jonathan; Lazzari, Barbara; Bielenberg, Douglas; Pirona, Raul; Miculan, Mara; Barakat, Abdelali; Testolin, Raffaele; Stella, Alessandra; Tartarini, Stefano; Tonutti, Pietro; Arús, Pere; Orellana, Ariel; Wells, Christina; Main, Dorrie; Vizzotto, Giannina; Silva, Herman; Salamini, Francesco; Schmutz, Jeremy; Morgante, Michele; Rokhsar, Daniel S
2013-05-01
Rosaceae is the most important fruit-producing clade, and its key commercially relevant genera (Fragaria, Rosa, Rubus and Prunus) show broadly diverse growth habits, fruit types and compact diploid genomes. Peach, a diploid Prunus species, is one of the best genetically characterized deciduous trees. Here we describe the high-quality genome sequence of peach obtained from a completely homozygous genotype. We obtained a complete chromosome-scale assembly using Sanger whole-genome shotgun methods. We predicted 27,852 protein-coding genes, as well as noncoding RNAs. We investigated the path of peach domestication through whole-genome resequencing of 14 Prunus accessions. The analyses suggest major genetic bottlenecks that have substantially shaped peach genome diversity. Furthermore, comparative analyses showed that peach has not undergone recent whole-genome duplication, and even though the ancestral triplicated blocks in peach are fragmentary compared to those in grape, all seven paleosets of paralogs from the putative paleoancestor are detectable.
Efficient algorithms for polyploid haplotype phasing.
He, Dan; Saha, Subrata; Finkers, Richard; Parida, Laxmi
2018-05-09
Inference of haplotypes, or the sequence of alleles along the same chromosomes, is a fundamental problem in genetics and is a key component for many analyses including admixture mapping, identifying regions of identity by descent and imputation. Haplotype phasing based on sequencing reads has attracted lots of attentions. Diploid haplotype phasing where the two haplotypes are complimentary have been studied extensively. In this work, we focused on Polyploid haplotype phasing where we aim to phase more than two haplotypes at the same time from sequencing data. The problem is much more complicated as the search space becomes much larger and the haplotypes do not need to be complimentary any more. We proposed two algorithms, (1) Poly-Harsh, a Gibbs Sampling based algorithm which alternatively samples haplotypes and the read assignments to minimize the mismatches between the reads and the phased haplotypes, (2) An efficient algorithm to concatenate haplotype blocks into contiguous haplotypes. Our experiments showed that our method is able to improve the quality of the phased haplotypes over the state-of-the-art methods. To our knowledge, our algorithm for haplotype blocks concatenation is the first algorithm that leverages the shared information across multiple individuals to construct contiguous haplotypes. Our experiments showed that it is both efficient and effective.
Absence of genome reduction in diverse, facultative endohyphal bacteria
DOE Office of Scientific and Technical Information (OSTI.GOV)
Baltrus, David A.; Dougherty, Kevin; Arendt, Kayla R.
Fungi interact closely with bacteria, both on the surfaces of the hyphae and within their living tissues (i.e. endohyphal bacteria, EHB). These EHB can be obligate or facultative symbionts and can mediate diverse phenotypic traits in their hosts. Although EHB have been observed in many lineages of fungi, it remains unclear how widespread and general these associations are, and whether there are unifying ecological and genomic features can be found across EHB strains as a whole. We cultured 11 bacterial strains after they emerged from the hyphae of diverse Ascomycota that were isolated as foliar endophytes of cupressaceous trees, andmore » generated nearly complete genome sequences for all. Unlike the genomes of largely obligate EHB, the genomes of these facultative EHB resembled those of closely related strains isolated from environmental sources. Although all analysed genomes encoded structures that could be used to interact with eukaryotic hosts, pathways previously implicated in maintenance and establishment of EHB symbiosis were not universally present across all strains. Independent isolation of two nearly identical pairs of strains from different classes of fungi, coupled with recent experimental evidence, suggests horizontal transfer of EHB across endophytic hosts. Given the potential for EHB to influence fungal phenotypes, these genomes could shed light on the mechanisms of plant growth promotion or stress mitigation by fungal endophytes during the symbiotic phase, as well as degradation of plant material during the saprotrophic phase. As such, these findings contribute to the illumination of a new dimension of functional biodiversity in fungi.« less
Absence of genome reduction in diverse, facultative endohyphal bacteria
Baltrus, David A.; Dougherty, Kevin; Arendt, Kayla R.; ...
2017-02-28
Fungi interact closely with bacteria, both on the surfaces of the hyphae and within their living tissues (i.e. endohyphal bacteria, EHB). These EHB can be obligate or facultative symbionts and can mediate diverse phenotypic traits in their hosts. Although EHB have been observed in many lineages of fungi, it remains unclear how widespread and general these associations are, and whether there are unifying ecological and genomic features can be found across EHB strains as a whole. We cultured 11 bacterial strains after they emerged from the hyphae of diverse Ascomycota that were isolated as foliar endophytes of cupressaceous trees, andmore » generated nearly complete genome sequences for all. Unlike the genomes of largely obligate EHB, the genomes of these facultative EHB resembled those of closely related strains isolated from environmental sources. Although all analysed genomes encoded structures that could be used to interact with eukaryotic hosts, pathways previously implicated in maintenance and establishment of EHB symbiosis were not universally present across all strains. Independent isolation of two nearly identical pairs of strains from different classes of fungi, coupled with recent experimental evidence, suggests horizontal transfer of EHB across endophytic hosts. Given the potential for EHB to influence fungal phenotypes, these genomes could shed light on the mechanisms of plant growth promotion or stress mitigation by fungal endophytes during the symbiotic phase, as well as degradation of plant material during the saprotrophic phase. As such, these findings contribute to the illumination of a new dimension of functional biodiversity in fungi.« less
Genome Diversity and Evolution in the Budding Yeasts (Saccharomycotina)
Dujon, Bernard A.; Louis, Edward J.
2017-01-01
Considerable progress in our understanding of yeast genomes and their evolution has been made over the last decade with the sequencing, analysis, and comparisons of numerous species, strains, or isolates of diverse origins. The role played by yeasts in natural environments as well as in artificial manufactures, combined with the importance of some species as model experimental systems sustained this effort. At the same time, their enormous evolutionary diversity (there are yeast species in every subphylum of Dikarya) sparked curiosity but necessitated further efforts to obtain appropriate reference genomes. Today, yeast genomes have been very informative about basic mechanisms of evolution, speciation, hybridization, domestication, as well as about the molecular machineries underlying them. They are also irreplaceable to investigate in detail the complex relationship between genotypes and phenotypes with both theoretical and practical implications. This review examines these questions at two distinct levels offered by the broad evolutionary range of yeasts: inside the best-studied Saccharomyces species complex, and across the entire and diversified subphylum of Saccharomycotina. While obviously revealing evolutionary histories at different scales, data converge to a remarkably coherent picture in which one can estimate the relative importance of intrinsic genome dynamics, including gene birth and loss, vs. horizontal genetic accidents in the making of populations. The facility with which novel yeast genomes can now be studied, combined with the already numerous available reference genomes, offer privileged perspectives to further examine these fundamental biological questions using yeasts both as eukaryotic models and as fungi of practical importance. PMID:28592505
Yan, Honghai; Bekele, Wubishet A; Wight, Charlene P; Peng, Yuanying; Langdon, Tim; Latta, Robert G; Fu, Yong-Bi; Diederichsen, Axel; Howarth, Catherine J; Jellen, Eric N; Boyle, Brian; Wei, Yuming; Tinker, Nicholas A
2016-11-01
Genome analysis of 27 oat species identifies ancestral groups, delineates the D genome, and identifies ancestral origin of 21 mapped chromosomes in hexaploid oat. We investigated genomic relationships among 27 species of the genus Avena using high-density genetic markers revealed by genotyping-by-sequencing (GBS). Two methods of GBS analysis were used: one based on tag-level haplotypes that were previously mapped in cultivated hexaploid oat (A. sativa), and one intended to sample and enumerate tag-level haplotypes originating from all species under investigation. Qualitatively, both methods gave similar predictions regarding the clustering of species and shared ancestral genomes. Furthermore, results were consistent with previous phylogenies of the genus obtained with conventional approaches, supporting the robustness of whole genome GBS analysis. Evidence is presented to justify the final and definitive classification of the tetraploids A. insularis, A. maroccana (=A. magna), and A. murphyi as containing D-plus-C genomes, and not A-plus-C genomes, as is most often specified in past literature. Through electronic painting of the 21 chromosome representations in the hexaploid oat consensus map, we show how the relative frequency of matches between mapped hexaploid-derived haplotypes and AC (DC)-genome tetraploids vs. A- and C-genome diploids can accurately reveal the genome origin of all hexaploid chromosomes, including the approximate positions of inter-genome translocations. Evidence is provided that supports the continued classification of a diverged B genome in AB tetraploids, and it is confirmed that no extant A-genome diploids, including A. canariensis, are similar enough to the D genome of tetraploid and hexaploid oat to warrant consideration as a D-genome diploid.
Improved imputation of low-frequency and rare variants using the UK10K haplotype reference panel.
Huang, Jie; Howie, Bryan; McCarthy, Shane; Memari, Yasin; Walter, Klaudia; Min, Josine L; Danecek, Petr; Malerba, Giovanni; Trabetti, Elisabetta; Zheng, Hou-Feng; Gambaro, Giovanni; Richards, J Brent; Durbin, Richard; Timpson, Nicholas J; Marchini, Jonathan; Soranzo, Nicole
2015-09-14
Imputing genotypes from reference panels created by whole-genome sequencing (WGS) provides a cost-effective strategy for augmenting the single-nucleotide polymorphism (SNP) content of genome-wide arrays. The UK10K Cohorts project has generated a data set of 3,781 whole genomes sequenced at low depth (average 7x), aiming to exhaustively characterize genetic variation down to 0.1% minor allele frequency in the British population. Here we demonstrate the value of this resource for improving imputation accuracy at rare and low-frequency variants in both a UK and an Italian population. We show that large increases in imputation accuracy can be achieved by re-phasing WGS reference panels after initial genotype calling. We also present a method for combining WGS panels to improve variant coverage and downstream imputation accuracy, which we illustrate by integrating 7,562 WGS haplotypes from the UK10K project with 2,184 haplotypes from the 1000 Genomes Project. Finally, we introduce a novel approximation that maintains speed without sacrificing imputation accuracy for rare variants.
Bodea, Corneliu A; Middleton, Frank A; Melhem, Nadine M; Klei, Lambertus; Song, Youeun; Tiobech, Josepha; Marumoto, Pearl; Yano, Victor; Faraone, Stephen V; Roeder, Kathryn; Myles-Worsley, Marina; Devlin, Bernie; Byerley, William
2017-02-01
To localize genetic variation affecting risk for psychotic disorders in the population of Palau, we genotyped DNA samples from 203 Palauan individuals diagnosed with psychotic disorders, broadly defined, and 125 control subjects using a genome-wide single nucleotide polymorphism array. Palau has unique features advantageous for this study: due to its population history, Palauans are substantially interrelated; affected individuals often, but not always, cluster in families; and we have essentially complete ascertainment of affected individuals. To localize risk variants to genomic regions, we evaluated long-shared haplotypes, ≥10 Mb, identifying clusters of affected individuals who share such haplotypes. This extensive sharing, typically identical by descent, was significantly greater in cases than population controls, even after controlling for relatedness. Several regions of the genome exhibited substantial excess of shared haplotypes for affected individuals, including 3p21, 3p12, 4q28, and 5q23-q31. Two of these regions, 4q28 and 5q23-q31, showed significant linkage by traditional LOD score analysis and could harbor variants of more sizeable risk for psychosis or a multiplicity of risk variants. The pattern of haplotype sharing in 4q28 highlights PCDH10 , encoding a cadherin-related neuronal receptor, as possibly involved in risk.
Genomes of the Mouse Collaborative Cross.
Srivastava, Anuj; Morgan, Andrew P; Najarian, Maya L; Sarsani, Vishal Kumar; Sigmon, J Sebastian; Shorter, John R; Kashfeen, Anwica; McMullan, Rachel C; Williams, Lucy H; Giusti-Rodríguez, Paola; Ferris, Martin T; Sullivan, Patrick; Hock, Pablo; Miller, Darla R; Bell, Timothy A; McMillan, Leonard; Churchill, Gary A; de Villena, Fernando Pardo-Manuel
2017-06-01
The Collaborative Cross (CC) is a multiparent panel of recombinant inbred (RI) mouse strains derived from eight founder laboratory strains. RI panels are popular because of their long-term genetic stability, which enhances reproducibility and integration of data collected across time and conditions. Characterization of their genomes can be a community effort, reducing the burden on individual users. Here we present the genomes of the CC strains using two complementary approaches as a resource to improve power and interpretation of genetic experiments. Our study also provides a cautionary tale regarding the limitations imposed by such basic biological processes as mutation and selection. A distinct advantage of inbred panels is that genotyping only needs to be performed on the panel, not on each individual mouse. The initial CC genome data were haplotype reconstructions based on dense genotyping of the most recent common ancestors (MRCAs) of each strain followed by imputation from the genome sequence of the corresponding founder inbred strain. The MRCA resource captured segregating regions in strains that were not fully inbred, but it had limited resolution in the transition regions between founder haplotypes, and there was uncertainty about founder assignment in regions of limited diversity. Here we report the whole genome sequence of 69 CC strains generated by paired-end short reads at 30× coverage of a single male per strain. Sequencing leads to a substantial improvement in the fine structure and completeness of the genomes of the CC. Both MRCAs and sequenced samples show a significant reduction in the genome-wide haplotype frequencies from two wild-derived strains, CAST/EiJ and PWK/PhJ. In addition, analysis of the evolution of the patterns of heterozygosity indicates that selection against three wild-derived founder strains played a significant role in shaping the genomes of the CC. The sequencing resource provides the first description of tens of thousands of
Genomes of the Mouse Collaborative Cross
Srivastava, Anuj; Morgan, Andrew P.; Najarian, Maya L.; Sarsani, Vishal Kumar; Sigmon, J. Sebastian; Shorter, John R.; Kashfeen, Anwica; McMullan, Rachel C.; Williams, Lucy H.; Giusti-Rodríguez, Paola; Ferris, Martin T.; Sullivan, Patrick; Hock, Pablo; Miller, Darla R.; Bell, Timothy A.; McMillan, Leonard; Churchill, Gary A.; de Villena, Fernando Pardo-Manuel
2017-01-01
The Collaborative Cross (CC) is a multiparent panel of recombinant inbred (RI) mouse strains derived from eight founder laboratory strains. RI panels are popular because of their long-term genetic stability, which enhances reproducibility and integration of data collected across time and conditions. Characterization of their genomes can be a community effort, reducing the burden on individual users. Here we present the genomes of the CC strains using two complementary approaches as a resource to improve power and interpretation of genetic experiments. Our study also provides a cautionary tale regarding the limitations imposed by such basic biological processes as mutation and selection. A distinct advantage of inbred panels is that genotyping only needs to be performed on the panel, not on each individual mouse. The initial CC genome data were haplotype reconstructions based on dense genotyping of the most recent common ancestors (MRCAs) of each strain followed by imputation from the genome sequence of the corresponding founder inbred strain. The MRCA resource captured segregating regions in strains that were not fully inbred, but it had limited resolution in the transition regions between founder haplotypes, and there was uncertainty about founder assignment in regions of limited diversity. Here we report the whole genome sequence of 69 CC strains generated by paired-end short reads at 30× coverage of a single male per strain. Sequencing leads to a substantial improvement in the fine structure and completeness of the genomes of the CC. Both MRCAs and sequenced samples show a significant reduction in the genome-wide haplotype frequencies from two wild-derived strains, CAST/EiJ and PWK/PhJ. In addition, analysis of the evolution of the patterns of heterozygosity indicates that selection against three wild-derived founder strains played a significant role in shaping the genomes of the CC. The sequencing resource provides the first description of tens of thousands of
Huang, Jian; Zhang, Chunmei; Zhao, Xing; Fei, Zhangjun; Wan, KangKang; Zhang, Zhong; Pang, Xiaoming; Yin, Xiao; Bai, Yang; Sun, Xiaoqing; Gao, Lizhi; Li, Ruiqiang; Zhang, Jinbo; Li, Xingang
2016-12-01
Jujube (Ziziphus jujuba Mill.) belongs to the Rhamnaceae family and is a popular fruit tree species with immense economic and nutritional value. Here, we report a draft genome of the dry jujube cultivar 'Junzao' and the genome resequencing of 31 geographically diverse accessions of cultivated and wild jujubes (Ziziphus jujuba var. spinosa). Comparative analysis revealed that the genome of 'Dongzao', a fresh jujube, was ~86.5 Mb larger than that of the 'Junzao', partially due to the recent insertions of transposable elements in the 'Dongzao' genome. We constructed eight proto-chromosomes of the common ancestor of Rhamnaceae and Rosaceae, two sister families in the order Rosales, and elucidated the evolutionary processes that have shaped the genome structures of modern jujubes. Population structure analysis revealed the complex genetic background of jujubes resulting from extensive hybridizations between jujube and its wild relatives. Notably, several key genes that control fruit organic acid metabolism and sugar content were identified in the selective sweep regions. We also identified S-locus genes controlling gametophytic self-incompatibility and investigated haplotype patterns of the S locus in the jujube genomes, which would provide a guideline for parent selection for jujube crossbreeding. This study provides valuable genomic resources for jujube improvement, and offers insights into jujube genome evolution and its population structure and domestication.
Shaaf, Salar; Sharma, Rajiv; Baloch, Faheem Shehzad; Badaeva, Ekaterina D; Knüpffer, Helmut; Kilian, Benjamin; Özkan, Hakan
2016-06-01
Wheat belongs to the most important crops domesticated in the Fertile Crescent. In this region, fortunately, locally adapted wheat landraces are still present in farmers' fields. This material might be of immense value for future breeding programs. However, especially wheat germplasm adapted to the central part of the Fertile Crescent has been poorly characterized for allelic variation at key loci of agricultural importance. Grain hardness is an important trait influencing milling and baking quality of wheat. This trait is mainly determined by three tightly linked genes, namely, Puroindoline a (Pina), Puroindoline b (Pinb), and Grain softness protein-1 (Gsp-1), at the Hardness (Ha-D) locus on chromosome 5DS. To investigate genetic diversity and haplotype structure, we resequenced 96 diverse wheat lines at Pina-D1, Pinb-D1, Gsp-A1, Gsp-B1, and Gsp-D1. Three types of null alleles were identified using diagnostic primers: the first type was a multiple deletion of Pina-D1, Pinb-D1, and Gsp-D1 (Pina-D1k), the second was a Pina-D1 deletion (Pina-D1b); and the third type was a deletion of Gsp-D1, representing a novel null allele designated here as Gsp-D1k. Sequence analysis resulted in four allelic variants at Pinb-D1 and five at Gsp-A1, among them Gsp-A1-V was novel. Pina-D1, Gsp-B1 and Gsp-D1 sequences were monomorphic. Haplotype and phylogenetic analysis suggested that (1) bread wheat inherited its 5DS telomeric region probably from wild diploid Ae. tauschii subsp. tauschii found within an area from Transcaucasia to Caspian Iran; and that (2) the Ha-A and Ha-B homoeoloci were most closely related to sequences of wild tetraploid T. dicocco ides. This study provides a good overview of available genetic diversity at Pina-D1, Pinb-D1, and Gsp-1, which can be exploited to extend the range of grain texture traits in wheat.
Chloroplast genomes: diversity, evolution, and applications in genetic engineering
DOE Office of Scientific and Technical Information (OSTI.GOV)
Daniell, Henry; Lin, Choun -Sea; Yu, Ming
Chloroplasts play a crucial role in sustaining life on earth. The availability of over 800 sequenced chloroplast genomes from a variety of land plants has enhanced our understanding of chloroplast biology, intracellular gene transfer, conservation, diversity, and the genetic basis by which chloroplast transgenes can be engineered to enhance plant agronomic traits or to produce high-value agricultural or biomedical products. In this review, we discuss the impact of chloroplast genome sequences on understanding the origins of economically important cultivated species and changes that have taken place during domestication. Here, we also discuss the potential biotechnological applications of chloroplast genomes.
Chloroplast genomes: diversity, evolution, and applications in genetic engineering
Daniell, Henry; Lin, Choun -Sea; Yu, Ming; ...
2016-06-23
Chloroplasts play a crucial role in sustaining life on earth. The availability of over 800 sequenced chloroplast genomes from a variety of land plants has enhanced our understanding of chloroplast biology, intracellular gene transfer, conservation, diversity, and the genetic basis by which chloroplast transgenes can be engineered to enhance plant agronomic traits or to produce high-value agricultural or biomedical products. In this review, we discuss the impact of chloroplast genome sequences on understanding the origins of economically important cultivated species and changes that have taken place during domestication. Here, we also discuss the potential biotechnological applications of chloroplast genomes.
Petersen, Jessica L; Valberg, Stephanie J; Mickelson, James R; McCue, Molly E
2014-01-01
Summary Two variants in the equine myostatin gene (MSTN), including a T/C SNP substitution in the first intron and a 227-bp SINE insertion in the promoter, are associated with muscle fiber type proportions in the Quarter Horse (QH) and with the prediction of race distance propensity in the Thoroughbred (TB). Genotypes from these loci, along with 18 additional variants surrounding MSTN, were examined in 301 horses of 14 breeds to evaluate haplotype relationships and diversity. The C allele of intron 1 was found in 12 of 14 breeds at a frequency of 0.27; the SINE was observed in five breeds, but common in only the TB and QH (0.73 and 0.48 respectively). Haplotype data suggest the SINE insertion is contemporary to and arose upon a haplotype containing the intron 1 C allele. Gluteal muscle biopsies of TBs showed a significant association of the intron 1 C allele and SINE with a higher proportion of Type 2B and lower proportion of Type 1 fibers. However, in the Belgian horse, in which the SINE is not present, the intron 1 SNP was not associated with fiber type proportions, and evaluation of fiber type proportions across the Belgian, TB and QH breeds shows the significant effect of breed on fiber type proportions is negated when evaluating horses without the SINE variant. These data suggest the SINE, rather than the intron 1 SNP, is driving the observed muscle fiber type characteristics and is the variant targeted by selection for short-distance racing. PMID:25160752
Genomic Diversity of Type B3 Bacteriophages of Caulobacter crescentus.
Ash, Kurt T; Drake, Kristina M; Gibbs, Whitney S; Ely, Bert
2017-07-01
The genomes of the type B3 bacteriophages that infect Caulobacter crescentus are among the largest phage genomes thus far deposited into GenBank with sizes over 200 kb. In this study, we introduce six new bacteriophage genomes which were obtained from phage collected from various water systems in the southeastern United States and from tropical locations across the globe. A comparative analysis of the 12 available genomes revealed a "core genome" which accounts for roughly 1/3 of these bacteriophage genomes and is predominately localized to the head, tail, and lysis gene regions. Despite being isolated from geographically distinct locations, the genomes of these bacteriophages are highly conserved in both genome sequence and gene order. We also identified the insertions, deletions, translocations, and horizontal gene transfer events which are responsible for the genomic diversity of this group of bacteriophages and demonstrated that these changes are not consistent with the idea that modular reassortment of genomes occurs in this group of bacteriophages.
Inferring mechanisms of copy number change from haplotype structures at the human DEFA1A3 locus.
Black, Holly A; Khan, Fayeza F; Tyson, Jess; Al Armour, John
2014-07-21
The determination of structural haplotypes at copy number variable regions can indicate the mechanisms responsible for changes in copy number, as well as explain the relationship between gene copy number and expression. However, obtaining spatial information at regions displaying extensive copy number variation, such as the DEFA1A3 locus, is complex, because of the difficulty in the phasing and assembly of these regions. The DEFA1A3 locus is intriguing in that it falls within a region of high linkage disequilibrium, despite its high variability in copy number (n = 3-16); hence, the mechanisms responsible for changes in copy number at this locus are unclear. In this study, a region flanking the DEFA1A3 locus was sequenced across 120 independent haplotypes with European ancestry, identifying five common classes of DEFA1A3 haplotype. Assigning DEFA1A3 class to haplotypes within the 1000 Genomes project highlights a significant difference in DEFA1A3 class frequencies between populations with different ancestry. The features of each DEFA1A3 class, for example, the associated DEFA1A3 copy numbers, were initially assessed in a European cohort (n = 599) and replicated in the 1000 Genomes samples, showing within-class similarity, but between-class and between-population differences in the features of the DEFA1A3 locus. Emulsion haplotype fusion-PCR was used to generate 61 structural haplotypes at the DEFA1A3 locus, showing a high within-class similarity in structure. Structural haplotypes across the DEFA1A3 locus indicate that intra-allelic rearrangement is the predominant mechanism responsible for changes in DEFA1A3 copy number, explaining the conservation of linkage disequilibrium across the locus. The identification of common structural haplotypes at the DEFA1A3 locus could aid studies into how DEFA1A3 copy number influences expression, which is currently unclear.
The clinical application of single-sperm-based SNP haplotyping for PGD of osteogenesis imperfecta.
Chen, Linjun; Diao, Zhenyu; Xu, Zhipeng; Zhou, Jianjun; Yan, Guijun; Sun, Haixiang
2018-05-15
Osteogenesis imperfecta (OI) is a genetically heterogeneous disorder, presenting either autosomal dominant, autosomal recessive or X-linked inheritance patterns. The majority of OI cases are autosomal dominant and are caused by heterozygous mutations in either the COL1A1 or COL1A2 gene. In these dominant disorders, allele dropout (ADO) can lead to misdiagnosis in preimplantation genetic diagnosis (PGD). Polymorphic markers linked to the mutated genes have been used to establish haplotypes for identifying ADO and ensuring the accuracy of PGD. However, the haplotype of male patients cannot be determined without data from affected relatives. Here, we developed a method for single-sperm-based single-nucleotide polymorphism (SNP) haplotyping via next-generation sequencing (NGS) for the PGD of OI. After NGS, 10 informative polymorphic SNP markers located upstream and downstream of the COL1A1 gene and its pathogenic mutation site were linked to individual alleles in a single sperm from an affected male. After haplotyping, a normal blastocyst was transferred to the uterus for a subsequent frozen embryo transfer cycle. The accuracy of PGD was confirmed by amniocentesis at 19 weeks of gestation. A healthy infant weighing 4,250 g was born via vaginal delivery at the 40th week of gestation. Single-sperm-based SNP haplotyping can be applied for PGD of any monogenic disorders or de novo mutations in males in whom the haplotype of paternal mutations cannot be determined due to a lack of affected relatives. ADO: allele dropout; DI: dentinogenesis imperfect; ESHRE: European Society of Human Reproduction and Embryology; FET: frozen embryo transfer; gDNA: genomic DNA; ICSI: intracytoplasmic sperm injection; IVF: in vitro fertilization; MDA: multiple displacement amplification; NGS: next-generation sequencing; OI: osteogenesis imperfect; PBS: phosphate buffer saline; PCR: polymerase chain reaction; PGD: preimplantation genetic diagnosis; SNP: single-nucleotide polymorphism; STR
De novo assembly and phasing of a Korean human genome.
Seo, Jeong-Sun; Rhie, Arang; Kim, Junsoo; Lee, Sangjin; Sohn, Min-Hwan; Kim, Chang-Uk; Hastie, Alex; Cao, Han; Yun, Ji-Young; Kim, Jihye; Kuk, Junho; Park, Gun Hwa; Kim, Juhyeok; Ryu, Hanna; Kim, Jongbum; Roh, Mira; Baek, Jeonghun; Hunkapiller, Michael W; Korlach, Jonas; Shin, Jong-Yeon; Kim, Changhoon
2016-10-13
Advances in genome assembly and phasing provide an opportunity to investigate the diploid architecture of the human genome and reveal the full range of structural variation across population groups. Here we report the de novo assembly and haplotype phasing of the Korean individual AK1 (ref. 1) using single-molecule real-time sequencing, next-generation mapping, microfluidics-based linked reads, and bacterial artificial chromosome (BAC) sequencing approaches. Single-molecule sequencing coupled with next-generation mapping generated a highly contiguous assembly, with a contig N50 size of 17.9 Mb and a scaffold N50 size of 44.8 Mb, resolving 8 chromosomal arms into single scaffolds. The de novo assembly, along with local assemblies and spanning long reads, closes 105 and extends into 72 out of 190 euchromatic gaps in the reference genome, adding 1.03 Mb of previously intractable sequence. High concordance between the assembly and paired-end sequences from 62,758 BAC clones provides strong support for the robustness of the assembly. We identify 18,210 structural variants by direct comparison of the assembly with the human reference, identifying thousands of breakpoints that, to our knowledge, have not been reported before. Many of the insertions are reflected in the transcriptome and are shared across the Asian population. We performed haplotype phasing of the assembly with short reads, long reads and linked reads from whole-genome sequencing and with short reads from 31,719 BAC clones, thereby achieving phased blocks with an N50 size of 11.6 Mb. Haplotigs assembled from single-molecule real-time reads assigned to haplotypes on phased blocks covered 89% of genes. The haplotigs accurately characterized the hypervariable major histocompatability complex region as well as demonstrating allele configuration in clinically relevant genes such as CYP2D6. This work presents the most contiguous diploid human genome assembly so far, with extensive investigation of
Miller, Marisa E.; Zhang, Ying; Omidvar, Vahid; Sperschneider, Jana; Raley, Castle; Palmer, Jonathan M.; Garnica, Diana; Upadhyaya, Narayana; Rathjen, John; Taylor, Jennifer M.; Park, Robert F.; Dodds, Peter N.; Hirsch, Cory D.
2018-01-01
ABSTRACT Oat crown rust, caused by the fungus Pucinnia coronata f. sp. avenae, is a devastating disease that impacts worldwide oat production. For much of its life cycle, P. coronata f. sp. avenae is dikaryotic, with two separate haploid nuclei that may vary in virulence genotype, highlighting the importance of understanding haplotype diversity in this species. We generated highly contiguous de novo genome assemblies of two P. coronata f. sp. avenae isolates, 12SD80 and 12NC29, from long-read sequences. In total, we assembled 603 primary contigs for 12SD80, for a total assembly length of 99.16 Mbp, and 777 primary contigs for 12NC29, for a total length of 105.25 Mbp; approximately 52% of each genome was assembled into alternate haplotypes. This revealed structural variation between haplotypes in each isolate equivalent to more than 2% of the genome size, in addition to about 260,000 and 380,000 heterozygous single-nucleotide polymorphisms in 12SD80 and 12NC29, respectively. Transcript-based annotation identified 26,796 and 28,801 coding sequences for isolates 12SD80 and 12NC29, respectively, including about 7,000 allele pairs in haplotype-phased regions. Furthermore, expression profiling revealed clusters of coexpressed secreted effector candidates, and the majority of orthologous effectors between isolates showed conservation of expression patterns. However, a small subset of orthologs showed divergence in expression, which may contribute to differences in virulence between 12SD80 and 12NC29. This study provides the first haplotype-phased reference genome for a dikaryotic rust fungus as a foundation for future studies into virulence mechanisms in P. coronata f. sp. avenae. PMID:29463655
Fullerton, Heather; Hager, Kevin W; McAllister, Sean M; Moyer, Craig L
2017-08-01
The Zetaproteobacteria are ubiquitous in marine environments, yet this class of Proteobacteria is only represented by a few closely-related cultured isolates. In high-iron environments, such as diffuse hydrothermal vents, the Zetaproteobacteria are important members of the community driving its structure. Biogeography of Zetaproteobacteria has shown two ubiquitous operational taxonomic units (OTUs), yet much is unknown about their genomic diversity. Genome-resolved metagenomics allows for the specific binning of microbial genomes based on genomic signatures present in composite metagenome assemblies. This resulted in the recovery of 93 genome bins, of which 34 were classified as Zetaproteobacteria. Form II ribulose 1,5-bisphosphate carboxylase genes were recovered from nearly all the Zetaproteobacteria genome bins. In addition, the Zetaproteobacteria genome bins contain genes for uptake and utilization of bioavailable nitrogen, detoxification of arsenic, and a terminal electron acceptor adapted for low oxygen concentration. Our results also support the hypothesis of a Cyc2-like protein as the site for iron oxidation, now detected across a majority of the Zetaproteobacteria genome bins. Whole genome comparisons showed a high genomic diversity across the Zetaproteobacteria OTUs and genome bins that were previously unidentified by SSU rRNA gene analysis. A single lineage of cosmopolitan Zetaproteobacteria (zOTU 2) was found to be monophyletic, based on cluster analysis of average nucleotide identity and average amino acid identity comparisons. From these data, we can begin to pinpoint genomic adaptations of the more ecologically ubiquitous Zetaproteobacteria, and further understand their environmental constraints and metabolic potential.
A LDA-based approach to promoting ranking diversity for genomics information retrieval.
Chen, Yan; Yin, Xiaoshi; Li, Zhoujun; Hu, Xiaohua; Huang, Jimmy Xiangji
2012-06-11
In the biomedical domain, there are immense data and tremendous increase of genomics and biomedical relevant publications. The wealth of information has led to an increasing amount of interest in and need for applying information retrieval techniques to access the scientific literature in genomics and related biomedical disciplines. In many cases, the desired information of a query asked by biologists is a list of a certain type of entities covering different aspects that are related to the question, such as cells, genes, diseases, proteins, mutations, etc. Hence, it is important of a biomedical IR system to be able to provide relevant and diverse answers to fulfill biologists' information needs. However traditional IR model only concerns with the relevance between retrieved documents and user query, but does not take redundancy between retrieved documents into account. This will lead to high redundancy and low diversity in the retrieval ranked lists. In this paper, we propose an approach which employs a topic generative model called Latent Dirichlet Allocation (LDA) to promoting ranking diversity for biomedical information retrieval. Different from other approaches or models which consider aspects on word level, our approach assumes that aspects should be identified by the topics of retrieved documents. We present LDA model to discover topic distribution of retrieval passages and word distribution of each topic dimension, and then re-rank retrieval results with topic distribution similarity between passages based on N-size slide window. We perform our approach on TREC 2007 Genomics collection and two distinctive IR baseline runs, which can achieve 8% improvement over the highest Aspect MAP reported in TREC 2007 Genomics track. The proposed method is the first study of adopting topic model to genomics information retrieval, and demonstrates its effectiveness in promoting ranking diversity as well as in improving relevance of ranked lists of genomics search
FamLBL: detecting rare haplotype disease association based on common SNPs using case-parent triads.
Wang, Meng; Lin, Shili
2014-09-15
In recent years, there has been an increasing interest in using common single-nucleotide polymorphisms (SNPs) amassed in genome-wide association studies to investigate rare haplotype effects on complex diseases. Evidence has suggested that rare haplotypes may tag rare causal single-nucleotide variants, making SNP-based rare haplotype analysis not only cost effective, but also more valuable for detecting causal variants. Although a number of methods for detecting rare haplotype association have been proposed in recent years, they are population based and thus susceptible to population stratification. We propose family-triad-based logistic Bayesian Lasso (famLBL) for estimating effects of haplotypes on complex diseases using SNP data. By choosing appropriate prior distribution, effect sizes of unassociated haplotypes can be shrunk toward zero, allowing for more precise estimation of associated haplotypes, especially those that are rare, thereby achieving greater detection power. We evaluate famLBL using simulation to gauge its type I error and power. Compared with its population counterpart, LBL, highlights famLBL's robustness property in the presence of population substructure. Further investigation by comparing famLBL with Family-Based Association Test (FBAT) reveals its advantage for detecting rare haplotype association. famLBL is implemented as an R-package available at http://www.stat.osu.edu/∼statgen/SOFTWARE/LBL/. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Cherif, Emira; Zehdi, Salwa; Castillo, Karina; Chabrillange, Nathalie; Abdoulkader, Sabira; Pintaud, Jean-Christophe; Santoni, Sylvain; Salhi-Hannachi, Amel; Glémin, Sylvain; Aberlenc-Bertossi, Frédérique
2013-01-01
Whether sex chromosomes are differentiated is an important aspect of our knowledge of dioecious plants, such as date palm (Phoenix dactylifera). In this crop plant, the female individuals produce dates, and are thus the more valuable sex. However, there is no way to identify the sex of date palm plants before reproductive age, and the sex-determining mechanism is still unclear. To identify sex-linked microsatellite markers, we surveyed a set of 52 male and 55 female genotypes representing the geographical diversity of the species. We found three genetically linked loci that are heterozygous only in males. Male-specific alleles allowed us to identify the gender in 100% of individuals. These results confirm the existence of an XY chromosomal system with a nonrecombining XY-like region in the date palm genome. The distribution of Y haplotypes in western and eastern haplogroups allowed us to trace two male ancestral paternal lineages that account for all known Y diversity in date palm. The very low diversity associated with Y haplotypes is consistent with clonal paternal transmission of a nonrecombining male-determining region. Our results establish the date palm as a biological model with one of the most ancient sex chromosomes in flowering plants. © 2012 IRD. New Phytologist © 2013 New Phytologist Trust.
Natural Selection and Genetic Diversity in the Butterfly Heliconius melpomene.
Martin, Simon H; Möst, Markus; Palmer, William J; Salazar, Camilo; McMillan, W Owen; Jiggins, Francis M; Jiggins, Chris D
2016-05-01
A combination of selective and neutral evolutionary forces shape patterns of genetic diversity in nature. Among the insects, most previous analyses of the roles of drift and selection in shaping variation across the genome have focused on the genus Drosophila A more complete understanding of these forces will come from analyzing other taxa that differ in population demography and other aspects of biology. We have analyzed diversity and signatures of selection in the neotropical Heliconius butterflies using resequenced genomes from 58 wild-caught individuals of Heliconius melpomene and another 21 resequenced genomes representing 11 related species. By comparing intraspecific diversity and interspecific divergence, we estimate that 31% of amino acid substitutions between Heliconius species are adaptive. Diversity at putatively neutral sites is negatively correlated with the local density of coding sites as well as nonsynonymous substitutions and positively correlated with recombination rate, indicating widespread linked selection. This process also manifests in significantly reduced diversity on longer chromosomes, consistent with lower recombination rates. Although hitchhiking around beneficial nonsynonymous mutations has significantly shaped genetic variation in H. melpomene, evidence for strong selective sweeps is limited overall. We did however identify two regions where distinct haplotypes have swept in different populations, leading to increased population differentiation. On the whole, our study suggests that positive selection is less pervasive in these butterflies as compared to fruit flies, a fact that curiously results in very similar levels of neutral diversity in these very different insects. Copyright © 2016 by the Genetics Society of America.
Specific haplotypes of the CALPAIN-5 gene are associated with polycystic ovary syndrome.
González, A; Sáez, M E; Aragón, M J; Galán, J J; Vettori, P; Molina, L; Rubio, C; Real, L M; Ruiz, Agustín; Ramírez-Lorca, R
2006-04-01
Polycystic ovary syndrome (PCOS) is a common endocrine disorder in women of reproductive age. The aim of the present study was to investigate the role of CALPAIN-5 (CAPN5) gene in PCOS susceptibility. We analysed four intronic polymorphisms of the CAPN5 gene in 148 well-characterized women with PCOS and 606 unrelated controls. We performed a case-control study and an intracohort analysis of clinical characteristics associated with PCOS. Analysis of haplotypes distribution between PCOS population compared to controls showed a strong deviation (P = 0.00029). The haplotypes GGCA and GGTG were overrepresented in PCOS patients (P = 0.009 and P = 0.001, respectively). In addition, we identified several CAPN5 haplotypes associated with phenotypic differences observed between PCOS patients, such as the presence of obesity (P = 0.02), cardiovascular complications (P = 0.02), familial antecedents of obesity (P = 0.003) and of hypertension (P = 0.007) and type 2 diabetes mellitus aggregation (P = 0.04). These results suggest a role of CAPN5 gene in PCOS susceptibility in humans. Moreover, novel candidate risk alleles have been identified, within CAPN5 gene, which could be associated with important phenotypic and prognosis differences observed in PCOS patients.
Genetic Diversity in the Modern Horse Illustrated from Genome-Wide SNP Data
Petersen, Jessica L.; Mickelson, James R.; Cothran, E. Gus; Andersson, Lisa S.; Axelsson, Jeanette; Bailey, Ernie; Bannasch, Danika; Binns, Matthew M.; Borges, Alexandre S.; Brama, Pieter; da Câmara Machado, Artur; Distl, Ottmar; Felicetti, Michela; Fox-Clipsham, Laura; Graves, Kathryn T.; Guérin, Gérard; Haase, Bianca; Hasegawa, Telhisa; Hemmann, Karin; Hill, Emmeline W.; Leeb, Tosso; Lindgren, Gabriella; Lohi, Hannes; Lopes, Maria Susana; McGivney, Beatrice A.; Mikko, Sofia; Orr, Nicholas; Penedo, M. Cecilia T; Piercy, Richard J.; Raekallio, Marja; Rieder, Stefan; Røed, Knut H.; Silvestrelli, Maurizio; Swinburne, June; Tozaki, Teruaki; Vaudin, Mark; M. Wade, Claire; McCue, Molly E.
2013-01-01
Horses were domesticated from the Eurasian steppes 5,000–6,000 years ago. Since then, the use of horses for transportation, warfare, and agriculture, as well as selection for desired traits and fitness, has resulted in diverse populations distributed across the world, many of which have become or are in the process of becoming formally organized into closed, breeding populations (breeds). This report describes the use of a genome-wide set of autosomal SNPs and 814 horses from 36 breeds to provide the first detailed description of equine breed diversity. FST calculations, parsimony, and distance analysis demonstrated relationships among the breeds that largely reflect geographic origins and known breed histories. Low levels of population divergence were observed between breeds that are relatively early on in the process of breed development, and between those with high levels of within-breed diversity, whether due to large population size, ongoing outcrossing, or large within-breed phenotypic diversity. Populations with low within-breed diversity included those which have experienced population bottlenecks, have been under intense selective pressure, or are closed populations with long breed histories. These results provide new insights into the relationships among and the diversity within breeds of horses. In addition these results will facilitate future genome-wide association studies and investigations into genomic targets of selection. PMID:23383025
Bosse, Mirte; Lopes, Marcos S; Madsen, Ole; Megens, Hendrik-Jan; Crooijmans, Richard P M A; Frantz, Laurent A F; Harlizius, Barbara; Bastiaansen, John W M; Groenen, Martien A M
2015-12-22
Early pig farmers in Europe imported Asian pigs to cross with their local breeds in order to improve traits of commercial interest. Current genomics techniques enabled genome-wide identification of these Asian introgressed haplotypes in modern European pig breeds. We propose that the Asian variants are still present because they affect phenotypes that were important for ancient traditional, as well as recent, commercial pig breeding. Genome-wide introgression levels were only weakly correlated with gene content and recombination frequency. However, regions with an excess or absence of Asian haplotypes (AS) contained genes that were previously identified as phenotypically important such as FASN, ME1, and KIT. Therefore, the Asian alleles are thought to have an effect on phenotypes that were historically under selection. We aimed to estimate the effect of AS in introgressed regions in Large White pigs on the traits of backfat (BF) and litter size. The majority of regions we tested that retained Asian deoxyribonucleic acid (DNA) showed significantly increased BF from the Asian alleles. Our results suggest that the introgression in Large White pigs has been strongly determined by the selective pressure acting upon the introgressed AS. We therefore conclude that human-driven hybridization and selection contributed to the genomic architecture of these commercial pigs. © 2015 The Author(s).
Comparison of phasing strategies for whole human genomes
Kirkness, Ewen; Schork, Nicholas J.
2018-01-01
Humans are a diploid species that inherit one set of chromosomes paternally and one homologous set of chromosomes maternally. Unfortunately, most human sequencing initiatives ignore this fact in that they do not directly delineate the nucleotide content of the maternal and paternal copies of the 23 chromosomes individuals possess (i.e., they do not ‘phase’ the genome) often because of the costs and complexities of doing so. We compared 11 different widely-used approaches to phasing human genomes using the publicly available ‘Genome-In-A-Bottle’ (GIAB) phased version of the NA12878 genome as a gold standard. The phasing strategies we compared included laboratory-based assays that prepare DNA in unique ways to facilitate phasing as well as purely computational approaches that seek to reconstruct phase information from general sequencing reads and constructs or population-level haplotype frequency information obtained through a reference panel of haplotypes. To assess the performance of the 11 approaches, we used metrics that included, among others, switch error rates, haplotype block lengths, the proportion of fully phase-resolved genes, phasing accuracy and yield between pairs of SNVs. Our comparisons suggest that a hybrid or combined approach that leverages: 1. population-based phasing using the SHAPEIT software suite, 2. either genome-wide sequencing read data or parental genotypes, and 3. a large reference panel of variant and haplotype frequencies, provides a fast and efficient way to produce highly accurate phase-resolved individual human genomes. We found that for population-based approaches, phasing performance is enhanced with the addition of genome-wide read data; e.g., whole genome shotgun and/or RNA sequencing reads. Further, we found that the inclusion of parental genotype data within a population-based phasing strategy can provide as much as a ten-fold reduction in phasing errors. We also considered a majority voting scheme for the construction
Akagi, Takashi; Henry, Isabelle M; Morimoto, Takuya; Tao, Ryutaro
2016-06-01
Self-incompatibility (SI) is an important plant reproduction mechanism that facilitates the maintenance of genetic diversity within species. Three plant families, the Solanaceae, Rosaceae and Plantaginaceae, share an S-RNase-based gametophytic SI (GSI) system that involves a single S-RNase as the pistil S determinant and several F-box genes as pollen S determinants that act via non-self-recognition. Previous evidence has suggested a specific self-recognition mechanism in Prunus (Rosaceae), raising questions about the generality of the S-RNase-based GSI system. We investigated the evolution of the pollen S determinant by comparing the sequences of the Prunus S haplotype-specific F-box gene (SFB) with those of its orthologs in other angiosperm genomes. Our results indicate that the Prunus SFB does not cluster with the pollen S of other plants and diverged early after the establishment of the Eudicots. Our results further indicate multiple F-box gene duplication events, specifically in the Rosaceae family, and suggest that the Prunus SFB gene originated in a recent Prunus-specific gene duplication event. Transcriptomic and evolutionary analyses of the Prunus S paralogs are consistent with the establishment of a Prunus-specific SI system, and the possibility of subfunctionalization differentiating the newly generated SFB from the original pollen S determinant. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Natural Product Biosynthetic Diversity and Comparative Genomics of the Cyanobacteria.
Dittmann, Elke; Gugger, Muriel; Sivonen, Kaarina; Fewer, David P
2015-10-01
Cyanobacteria are an ancient lineage of slow-growing photosynthetic bacteria and a prolific source of natural products with intricate chemical structures and potent biological activities. The bulk of these natural products are known from just a handful of genera. Recent efforts have elucidated the mechanisms underpinning the biosynthesis of a diverse array of natural products from cyanobacteria. Many of the biosynthetic mechanisms are unique to cyanobacteria or rarely described from other organisms. Advances in genome sequence technology have precipitated a deluge of genome sequences for cyanobacteria. This makes it possible to link known natural products to biosynthetic gene clusters but also accelerates the discovery of new natural products through genome mining. These studies demonstrate that cyanobacteria encode a huge variety of cryptic gene clusters for the production of natural products, and the known chemical diversity is likely to be just a fraction of the true biosynthetic capabilities of this fascinating and ancient group of organisms. Copyright © 2015. Published by Elsevier Ltd.
Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A
2015-10-01
The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.
Analysis of Multiallelic CNVs by Emulsion Haplotype Fusion PCR.
Tyson, Jess; Armour, John A L
2017-01-01
Emulsion-fusion PCR recovers long-range sequence information by combining products in cis from individual genomic DNA molecules. Emulsion droplets act as very numerous small reaction chambers in which different PCR products from a single genomic DNA molecule are condensed into short joint products, to unite sequences in cis from widely separated genomic sites. These products can therefore provide information about the arrangement of sequences and variants at a larger scale than established long-read sequencing methods. The method has been useful in defining the phase of variants in haplotypes, the typing of inversions, and determining the configuration of sequence variants in multiallelic CNVs. In this description we outline the rationale for the application of emulsion-fusion PCR methods to the analysis of multiallelic CNVs, and give practical details for our own implementation of the method in that context.
Fingerprinting Soybean Germplasm and Its Utility in Genomic Research
Song, Qijian; Hyten, David L.; Jia, Gaofeng; Quigley, Charles V.; Fickus, Edward W.; Nelson, Randall L.; Cregan, Perry B.
2015-01-01
The United States Department of Agriculture, Soybean Germplasm Collection includes 18,480 domesticated soybean and 1168 wild soybean accessions introduced from 84 countries or developed in the United States. This collection was genotyped with the SoySNP50K BeadChip containing greater than 50K single-nucleotide polymorphisms. Redundant accessions were identified in the collection, and distinct genetic backgrounds of soybean from different geographic origins were observed that could be a unique resource for soybean genetic improvement. We detected a dramatic reduction of genetic diversity based on linkage disequilibrium and haplotype structure analyses of the wild, landrace, and North American cultivar populations and identified candidate regions associated with domestication and selection imposed by North American breeding. We constructed the first soybean haplotype block maps in the wild, landrace, and North American cultivar populations and observed that most recombination events occurred in the regions between haplotype blocks. These haplotype maps are crucial for association mapping aimed at the identification of genes controlling traits of economic importance. A case-control association test delimited potential genomic regions along seven chromosomes that most likely contain genes controlling seed weight in domesticated soybean. The resulting dataset will facilitate germplasm utilization, identification of genes controlling important traits, and will accelerate the creation of soybean varieties with improved seed yield and quality. PMID:26224783
RENT+: an improved method for inferring local genealogical trees from haplotypes with recombination
Mirzaei, Sajad; Wu, Yufeng
2017-01-01
Abstract Motivation: Haplotypes from one or multiple related populations share a common genealogical history. If this shared genealogy can be inferred from haplotypes, it can be very useful for many population genetics problems. However, with the presence of recombination, the genealogical history of haplotypes is complex and cannot be represented by a single genealogical tree. Therefore, inference of genealogical history with recombination is much more challenging than the case of no recombination. Results: In this paper, we present a new approach called RENT+ for the inference of local genealogical trees from haplotypes with the presence of recombination. RENT+ builds on a previous genealogy inference approach called RENT, which infers a set of related genealogical trees at different genomic positions. RENT+ represents a significant improvement over RENT in the sense that it is more effective in extracting information contained in the haplotype data about the underlying genealogy than RENT. The key components of RENT+ are several greatly enhanced genealogy inference rules. Through simulation, we show that RENT+ is more efficient and accurate than several existing genealogy inference methods. As an application, we apply RENT+ in the inference of population demographic history from haplotypes, which outperforms several existing methods. Availability and Implementation: RENT+ is implemented in Java, and is freely available for download from: https://github.com/SajadMirzaei/RentPlus. Contacts: sajad@engr.uconn.edu or ywu@engr.uconn.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:28065901
Whole-Genome Sequencing of Pharmacogenetic Drug Response in Racially Diverse Children with Asthma.
Mak, Angel C Y; White, Marquitta J; Eckalbar, Walter L; Szpiech, Zachary A; Oh, Sam S; Pino-Yanes, Maria; Hu, Donglei; Goddard, Pagé; Huntsman, Scott; Galanter, Joshua; Wu, Ann Chen; Himes, Blanca E; Germer, Soren; Vogel, Julia M; Bunting, Karen L; Eng, Celeste; Salazar, Sandra; Keys, Kevin L; Liberto, Jennifer; Nuckton, Thomas J; Nguyen, Thomas A; Torgerson, Dara G; Kwok, Pui-Yan; Levin, Albert M; Celedón, Juan C; Forno, Erick; Hakonarson, Hakon; Sleiman, Patrick M; Dahlin, Amber; Tantisira, Kelan G; Weiss, Scott T; Serebrisky, Denise; Brigino-Buenaventura, Emerita; Farber, Harold J; Meade, Kelley; Lenoir, Michael A; Avila, Pedro C; Sen, Saunak; Thyne, Shannon M; Rodriguez-Cintron, William; Winkler, Cheryl A; Moreno-Estrada, Andrés; Sandoval, Karla; Rodriguez-Santana, Jose R; Kumar, Rajesh; Williams, L Keoki; Ahituv, Nadav; Ziv, Elad; Seibold, Max A; Darnell, Robert B; Zaitlen, Noah; Hernandez, Ryan D; Burchard, Esteban G
2018-06-15
Albuterol, a bronchodilator medication, is the first-line therapy for asthma worldwide. There are significant racial/ethnic differences in albuterol drug response. To identify genetic variants important for bronchodilator drug response (BDR) in racially diverse children. We performed the first whole-genome sequencing pharmacogenetics study from 1,441 children with asthma from the tails of the BDR distribution to identify genetic association with BDR. We identified population-specific and shared genetic variants associated with BDR, including genome-wide significant (P < 3.53 × 10 -7 ) and suggestive (P < 7.06 × 10 -6 ) loci near genes previously associated with lung capacity (DNAH5), immunity (NFKB1 and PLCB1), and β-adrenergic signaling (ADAMTS3 and COX18). Functional analyses of the BDR-associated SNP in NFKB1 revealed potential regulatory function in bronchial smooth muscle cells. The SNP is also an expression quantitative trait locus for a neighboring gene, SLC39A8. The lack of other asthma study populations with BDR and whole-genome sequencing data on minority children makes it impossible to perform replication of our rare variant associations. Minority underrepresentation also poses significant challenges to identify age-matched and population-matched cohorts of sufficient sample size for replication of our common variant findings. The lack of minority data, despite a collaboration of eight universities and 13 individual laboratories, highlights the urgent need for a dedicated national effort to prioritize diversity in research. Our study expands the understanding of pharmacogenetic analyses in racially/ethnically diverse populations and advances the foundation for precision medicine in at-risk and understudied minority populations.
Bajaj, Deepak; Das, Shouvik; Upadhyaya, Hari D.; Ranjan, Rajeev; Badoni, Saurabh; Kumar, Vinod; Tripathi, Shailesh; Gowda, C. L. Laxmipathi; Sharma, Shivali; Singh, Sube; Tyagi, Akhilesh K.; Parida, Swarup K.
2015-01-01
The study identified 9045 high-quality SNPs employing both genome-wide GBS- and candidate gene-based SNP genotyping assays in 172, including 93 cultivated (desi and kabuli) and 79 wild chickpea accessions. The GWAS in a structured population of 93 sequenced accessions detected 15 major genomic loci exhibiting significant association with seed coat color. Five seed color-associated major genomic loci underlying robust QTLs mapped on a high-density intra-specific genetic linkage map were validated by QTL mapping. The integration of association and QTL mapping with gene haplotype-specific LD mapping and transcript profiling identified novel allelic variants (non-synonymous SNPs) and haplotypes in a MATE secondary transporter gene regulating light/yellow brown and beige seed coat color differentiation in chickpea. The down-regulation and decreased transcript expression of beige seed coat color-associated MATE gene haplotype was correlated with reduced proanthocyanidins accumulation in the mature seed coats of beige than light/yellow brown seed colored desi and kabuli accessions for their coloration/pigmentation. This seed color-regulating MATE gene revealed strong purifying selection pressure primarily in LB/YB seed colored desi and wild Cicer reticulatum accessions compared with the BE seed colored kabuli accessions. The functionally relevant molecular tags identified have potential to decipher the complex transcriptional regulatory gene function of seed coat coloration and for understanding the selective sweep-based seed color trait evolutionary pattern in cultivated and wild accessions during chickpea domestication. The genome-wide integrated approach employed will expedite marker-assisted genetic enhancement for developing cultivars with desirable seed coat color types in chickpea. PMID:26635822
Guinane, Caitriona M.; Kent, Robert M.; Norberg, Sarah; Hill, Colin; Fitzgerald, Gerald F.; Stanton, Catherine; Ross, R. Paul
2011-01-01
Genetic diversity and genomic rearrangements are a driving force in bacterial evolution and niche adaptation. We sequenced and annotated the genome of Lactobacillus johnsonii DPC6026, a strain isolated from the porcine intestinal tract. Although the genome of DPC6026 is similar in size (1.97mbp) and GC content (34.8%) to the sequenced human isolate L. johnsonii NCC 533, a large symmetrical inversion of approximately 750 kb differentiated the two strains. Comparative analysis among 12 other strains of L. johnsonii including 8 porcine, 3 human and 1 poultry isolate indicated that the genome architecture found in DPC6026 is more common within the species than that of NCC 533. Furthermore a number of unique features were annotated in DPC6026, some of which are likely to have been acquired by horizontal gene transfer (HGT) and contribute to protection against phage infection. A putative type III restriction-modification system was identified, as were novel Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) elements. Interestingly, these particular elements are not widely distributed among L. johnsonii strains. Taken together these data suggest intra-species genomic rearrangements and significant genetic diversity within the L. johnsonii species and indicate towards a host-specific divergence of L. johnsonii strains with respect to genome inversion and phage exposure. PMID:21533100
Guinane, Caitriona M; Kent, Robert M; Norberg, Sarah; Hill, Colin; Fitzgerald, Gerald F; Stanton, Catherine; Ross, R Paul
2011-04-20
Genetic diversity and genomic rearrangements are a driving force in bacterial evolution and niche adaptation. We sequenced and annotated the genome of Lactobacillus johnsonii DPC6026, a strain isolated from the porcine intestinal tract. Although the genome of DPC6026 is similar in size (1.97 mbp) and GC content (34.8%) to the sequenced human isolate L. johnsonii NCC 533, a large symmetrical inversion of approximately 750 kb differentiated the two strains. Comparative analysis among 12 other strains of L. johnsonii including 8 porcine, 3 human and 1 poultry isolate indicated that the genome architecture found in DPC6026 is more common within the species than that of NCC 533. Furthermore a number of unique features were annotated in DPC6026, some of which are likely to have been acquired by horizontal gene transfer (HGT) and contribute to protection against phage infection. A putative type III restriction-modification system was identified, as were novel Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) elements. Interestingly, these particular elements are not widely distributed among L. johnsonii strains. Taken together these data suggest intra-species genomic rearrangements and significant genetic diversity within the L. johnsonii species and indicate towards a host-specific divergence of L. johnsonii strains with respect to genome inversion and phage exposure.
Tian, Xinpeng; Zhang, Zhewen; Yang, Tingting; Chen, Meili; Li, Jie; Chen, Fei; Yang, Jin; Li, Wenjie; Zhang, Bing; Zhang, Zhang; Wu, Jiayan; Zhang, Changsheng; Long, Lijuan; Xiao, Jingfa
2016-01-01
Over 200 genomes of streptomycete strains that were isolated from various environments are available from the NCBI. However, little is known about the characteristics that are linked to marine adaptation in marine-derived streptomycetes. The particularity and complexity of the marine environment suggest that marine streptomycetes are genetically diverse. Here, we sequenced nine strains from the Streptomyces genus that were isolated from different longitudes, latitudes, and depths of the South China Sea. Then we compared these strains to 22 NCBI downloaded streptomycete strains. Thirty-one streptomycete strains are clearly grouped into a marine-derived subgroup and multiple source subgroup-based phylogenetic tree. The phylogenetic analyses have revealed the dynamic process underlying streptomycete genome evolution, and lateral gene transfer is an important driving force during the process. Pan-genomics analyses have revealed that streptomycetes have an open pan-genome, which reflects the diversity of these streptomycetes and guarantees the species a quick and economical response to diverse environments. Functional and comparative genomics analyses indicate that the marine-derived streptomycetes subgroup possesses some common characteristics of marine adaptation. Our findings have expanded our knowledge of how ocean isolates of streptomycete strains adapt to marine environments. The availability of streptomycete genomes from the South China Sea will be beneficial for further analysis on marine streptomycetes and will enrich the South China Sea’s genetic data sources. PMID:27446038
BCL11A Enhancer Haplotypes and Fetal Hemoglobin in Sickle Cell Anemia
Sebastiani, P.; Farrell, J.J.; Alsultan, A.; Wang, S.; Edward, H. L.; Shappell, H.; Bae, H.; Milton, J. N.; Baldwin, C.T.; Al-Rubaish, A.M.; Naserullah, Z.; Al-Muhanna, F.; Alsuliman, A.; Patra, P. K.; Farrer, L.A.; Ngo, D.; Vathipadiekal, V.; Chui, D.H.K.; Al-Ali, A.K.; Steinberg, M.H.
2015-01-01
Background Fetal hemoglobin (HbF) levels in sickle cell anemia patients vary. We genotyped polymorphisms in the erythroid-specific enhancer of BCL11A to see if they might account for the very high HbF associated with the Arab-Indian (AI) haplotype and Benin haplotype of sickle cell anemia. Methods and Results Six BCL112A enhancer SNPs and their haplotypes were studied in Saudi Arabs from the Eastern Province and Indian patients with AI haplotype (HbF ~20%), African Americans (HbF ~7%), and Saudi Arabs from the Southwestern Province (HbF ~12%). Four SNPs (rs1427407, rs6706648, rs6738440, and rs7606173) and their haplotypes were consistently associated with HbF levels. The distributions of haplotypes differ in the 3 cohorts but not their genetic effects: the haplotype TCAG was associated with the lowest HbF level and the haplotype GTAC was associated with the highest HbF level and differences in HbF levels between carriers of these haplotypes in all cohorts was approximately 6%. Conclusions Common HbF BCL11A enhancer haplotypes in patients with African origin and AI sickle cell anemia have similar effects on HbF but they do not explain their differences in HbF. PMID:25703683
Cloud computing-based TagSNP selection algorithm for human genome data.
Hung, Che-Lun; Chen, Wen-Pei; Hua, Guan-Jie; Zheng, Huiru; Tsai, Suh-Jen Jane; Lin, Yaw-Ling
2015-01-05
Single nucleotide polymorphisms (SNPs) play a fundamental role in human genetic variation and are used in medical diagnostics, phylogeny construction, and drug design. They provide the highest-resolution genetic fingerprint for identifying disease associations and human features. Haplotypes are regions of linked genetic variants that are closely spaced on the genome and tend to be inherited together. Genetics research has revealed SNPs within certain haplotype blocks that introduce few distinct common haplotypes into most of the population. Haplotype block structures are used in association-based methods to map disease genes. In this paper, we propose an efficient algorithm for identifying haplotype blocks in the genome. In chromosomal haplotype data retrieved from the HapMap project website, the proposed algorithm identified longer haplotype blocks than an existing algorithm. To enhance its performance, we extended the proposed algorithm into a parallel algorithm that copies data in parallel via the Hadoop MapReduce framework. The proposed MapReduce-paralleled combinatorial algorithm performed well on real-world data obtained from the HapMap dataset; the improvement in computational efficiency was proportional to the number of processors used.
Impacts of Genome-Wide Analyses on Our Understanding of Human Herpesvirus Diversity and Evolution.
Renner, Daniel W; Szpara, Moriah L
2018-01-01
Until fairly recently, genome-wide evolutionary dynamics and within-host diversity were more commonly examined in the context of small viruses than in the context of large double-stranded DNA viruses such as herpesviruses. The high mutation rates and more compact genomes of RNA viruses have inspired the investigation of population dynamics for these species, and recent data now suggest that herpesviruses might also be considered candidates for population modeling. High-throughput sequencing (HTS) and bioinformatics have expanded our understanding of herpesviruses through genome-wide comparisons of sequence diversity, recombination, allele frequency, and selective pressures. Here we discuss recent data on the mechanisms that generate herpesvirus genomic diversity and underlie the evolution of these virus families. We focus on human herpesviruses, with key insights drawn from veterinary herpesviruses and other large DNA virus families. We consider the impacts of cell culture on herpesvirus genomes and how to accurately describe the viral populations under study. The need for a strong foundation of high-quality genomes is also discussed, since it underlies all secondary genomic analyses such as RNA sequencing (RNA-Seq), chromatin immunoprecipitation, and ribosome profiling. Areas where we foresee future progress, such as the linking of viral genetic differences to phenotypic or clinical outcomes, are highlighted as well. Copyright © 2017 Renner and Szpara.
High-Density SNP Genotyping to Define β-Globin Locus Haplotypes
Liu, Li; Muralidhar, Shalini; Singh, Manisha; Sylvan, Caprice; Kalra, Inderdeep S.; Quinn, Charles T.; Onyekwere, Onyinye C.; Pace, Betty S.
2014-01-01
Five major β-globin locus haplotypes have been established in individuals with sickle cell disease (SCD) from the Benin, Bantu, Senegal, Cameroon, and Arab-Indian populations. Historically, β-haplotypes were established using restriction fragment length polymorphism (RFLP) analysis across the β-locus, which consists of five functional β-like globin genes located on chromosome 11. Previous attempts to correlate these haplotypes as robust predictors of clinical phenotypes observed in SCD have not been successful. We speculate that the coverage and distribution of the RFLP sites located proximal to or within the globin genes are not sufficiently dense to accurately reflect the complexity of this region. To test our hypothesis, we performed RFLP analysis and high-density single nucleotide polymorphism (SNP) genotyping across the β-locus using DNA samples from either healthy African Americans with normal hemoglobin A (HbAA) or individuals with homozygous SS (HbSS) disease. Using the genotyping data from 88 SNPs and Haploview analysis, we generated a greater number of haplotypes than that observed with RFLP analysis alone. Furthermore, a unique pattern of long-range linkage disequilibrium between the locus control region and the β-like globin genes was observed in the HbSS group. Interestingly, we observed multiple SNPs within the HindIII restriction site located in the Gγ-globin intervening sequence II which produced the same RFLP pattern. These findings illustrated the inability of RFLP analysis to decipher the complexity of sequence variations that impacts genomic structure in this region. Our data suggest that high density SNP mapping may be required to accurately define β-haplotypes that correlate with the different clinical phenotypes observed in SCD. PMID:18829352
Schöning, Caspar
2017-01-01
Understanding the genetic basis of adaption is a central task in biology. Populations of the honey bee Apis mellifera that inhabit the mountain forests of East Africa differ in behavior and morphology from those inhabiting the surrounding lowland savannahs, which likely reflects adaptation to these habitats. We performed whole genome sequencing on 39 samples of highland and lowland bees from two pairs of populations to determine their evolutionary affinities and identify the genetic basis of these putative adaptations. We find that in general, levels of genetic differentiation between highland and lowland populations are very low, consistent with them being a single panmictic population. However, we identify two loci on chromosomes 7 and 9, each several hundred kilobases in length, which exhibit near fixation for different haplotypes between highland and lowland populations. The highland haplotypes at these loci are extremely rare in samples from the rest of the world. Patterns of segregation of genetic variants suggest that recombination between haplotypes at each locus is suppressed, indicating that they comprise independent structural variants. The haplotype on chromosome 7 harbors nearly all octopamine receptor genes in the honey bee genome. These have a role in learning and foraging behavior in honey bees and are strong candidates for adaptation to highland habitats. Molecular analysis of a putative breakpoint indicates that it may disrupt the coding sequence of one of these genes. Divergence between the highland and lowland haplotypes at both loci is extremely high suggesting that they are ancient balanced polymorphisms that greatly predate divergence between the extant honey bee subspecies. PMID:28542163
Chen, Eric C H; Morin, Emmanuelle; Beaudet, Denis; Noel, Jessica; Yildirir, Gokalp; Ndikumana, Steve; Charron, Philippe; St-Onge, Camille; Giorgi, John; Krüger, Manuela; Marton, Timea; Ropars, Jeanne; Grigoriev, Igor V; Hainaut, Matthieu; Henrissat, Bernard; Roux, Christophe; Martin, Francis; Corradi, Nicolas
2018-01-22
Arbuscular mycorrhizal fungi (AMF) are known to improve plant fitness through the establishment of mycorrhizal symbioses. Genetic and phenotypic variations among closely related AMF isolates can significantly affect plant growth, but the genomic changes underlying this variability are unclear. To address this issue, we improved the genome assembly and gene annotation of the model strain Rhizophagus irregularis DAOM197198, and compared its gene content with five isolates of R. irregularis sampled in the same field. All isolates harbor striking genome variations, with large numbers of isolate-specific genes, gene family expansions, and evidence of interisolate genetic exchange. The observed variability affects all gene ontology terms and PFAM protein domains, as well as putative mycorrhiza-induced small secreted effector-like proteins and other symbiosis differentially expressed genes. High variability is also found in active transposable elements. Overall, these findings indicate a substantial divergence in the functioning capacity of isolates harvested from the same field, and thus their genetic potential for adaptation to biotic and abiotic changes. Our data also provide a first glimpse into the genome diversity that resides within natural populations of these symbionts, and open avenues for future analyses of plant-AMF interactions that link AMF genome variation with plant phenotype and fitness. © 2018 The Authors. New Phytologist © 2018 New Phytologist Trust.
Extremely Low Genomic Diversity of Rickettsia japonica Distributed in Japan.
Akter, Arzuba; Ooka, Tadasuke; Gotoh, Yasuhiro; Yamamoto, Seigo; Fujita, Hiromi; Terasoma, Fumio; Kida, Kouji; Taira, Masakatsu; Nakadouzono, Fumiko; Gokuden, Mutsuyo; Hirano, Manabu; Miyashiro, Mamoru; Inari, Kouichi; Shimazu, Yukie; Tabara, Kenji; Toyoda, Atsushi; Yoshimura, Dai; Itoh, Takehiko; Kitano, Tomokazu; Sato, Mitsuhiko P; Katsura, Keisuke; Mondal, Shakhinur Islam; Ogura, Yoshitoshi; Ando, Shuji; Hayashi, Tetsuya
2017-01-01
Rickettsiae are obligate intracellular bacteria that have small genomes as a result of reductive evolution. Many Rickettsia species of the spotted fever group (SFG) cause tick-borne diseases known as "spotted fevers". The life cycle of SFG rickettsiae is closely associated with that of the tick, which is generally thought to act as a bacterial vector and reservoir that maintains the bacterium through transstadial and transovarial transmission. Each SFG member is thought to have adapted to a specific tick species, thus restricting the bacterial distribution to a relatively limited geographic region. These unique features of SFG rickettsiae allow investigation of how the genomes of such biologically and ecologically specialized bacteria evolve after genome reduction and the types of population structures that are generated. Here, we performed a nationwide, high-resolution phylogenetic analysis of Rickettsia japonica, an etiological agent of Japanese spotted fever that is distributed in Japan and Korea. The comparison of complete or nearly complete sequences obtained from 31 R. japonica strains isolated from various sources in Japan over the past 30 years demonstrated an extremely low level of genomic diversity. In particular, only 34 single nucleotide polymorphisms were identified among the 27 strains of the major lineage containing all clinical isolates and tick isolates from the three tick species. Our data provide novel insights into the biology and genome evolution of R. japonica, including the possibilities of recent clonal expansion and a long generation time in nature due to the long dormant phase associated with tick life cycles. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Santos, Sara; Bastos, Estela; Baptista, Cláudia S.; Sá, Daniela; Caloustian, Christophe; Guedes-Pinto, Henrique; Gärtner, Fátima; Gut, Ivo G.; Chaves, Raquel
2012-01-01
The human ERBB2 proto-oncogene is widely considered a key gene involved in human breast cancer onset and progression. Among spontaneous tumors, mammary tumors are the most frequent cause of cancer death in cats and second most frequent in humans. In fact, naturally occurring tumors in domestic animals, more particularly cat mammary tumors, have been proposed as a good model for human breast cancer, but critical genetic and molecular information is still scarce. The aims of this study include the analysis of the cat ERBB2 gene partial sequences (between exon 17 and 20) in order to characterize a normal and a mammary lesion heterogeneous populations. Cat genomic DNA was extracted from normal frozen samples (n = 16) and from frozen and formalin-fixed paraffin-embedded mammary lesion samples (n = 41). We amplified and sequenced two cat ERBB2 DNA fragments comprising exons 17 to 20. It was possible to identify five sequence variants and six haplotypes in the total population. Two sequence variants and two haplotypes show to be specific for cat mammary tumor samples. Bioinformatics analysis predicts that four of the sequence variants can produce alternative transcripts or activate cryptic splicing sites. Also, a possible association was identified between clinicopathological traits and the variant haplotypes. As far as we know, this is the first attempt to examine ERBB2 genetic variations in cat mammary genome and its possible association with the onset and progression of cat mammary tumors. The demonstration of a possible association between primary tumor size (one of the two most important prognostic factors) and the number of masses with the cat ERBB2 variant haplotypes reveal the importance of the analysis of this gene in veterinary medicine. PMID:22489125
Chao, Dai-Yin; Silva, Adriano; Baxter, Ivan; Huang, Yu S.; Nordborg, Magnus; Danku, John; Lahner, Brett; Yakubova, Elena; Salt, David E.
2012-01-01
Understanding the mechanism of cadmium (Cd) accumulation in plants is important to help reduce its potential toxicity to both plants and humans through dietary and environmental exposure. Here, we report on a study to uncover the genetic basis underlying natural variation in Cd accumulation in a world-wide collection of 349 wild collected Arabidopsis thaliana accessions. We identified a 4-fold variation (0.5–2 µg Cd g−1 dry weight) in leaf Cd accumulation when these accessions were grown in a controlled common garden. By combining genome-wide association mapping, linkage mapping in an experimental F2 population, and transgenic complementation, we reveal that HMA3 is the sole major locus responsible for the variation in leaf Cd accumulation we observe in this diverse population of A. thaliana accessions. Analysis of the predicted amino acid sequence of HMA3 from 149 A. thaliana accessions reveals the existence of 10 major natural protein haplotypes. Association of these haplotypes with leaf Cd accumulation and genetics complementation experiments indicate that 5 of these haplotypes are active and 5 are inactive, and that elevated leaf Cd accumulation is associated with the reduced function of HMA3 caused by a nonsense mutation and polymorphisms that change two specific amino acids. PMID:22969436
Boulanger, Jérôme; Muresan, Leila; Tiemann-Boege, Irene
2012-01-01
In spite of the many advances in haplotyping methods, it is still very difficult to characterize rare haplotypes in tissues and different environmental samples or to accurately assess the haplotype diversity in large mixtures. This would require a haplotyping method capable of analyzing the phase of single molecules with an unprecedented throughput. Here we describe such a haplotyping method capable of analyzing in parallel hundreds of thousands single molecules in one experiment. In this method, multiple PCR reactions amplify different polymorphic regions of a single DNA molecule on a magnetic bead compartmentalized in an emulsion drop. The allelic states of the amplified polymorphisms are identified with fluorescently labeled probes that are then decoded from images taken of the arrayed beads by a microscope. This method can evaluate the phase of up to 3 polymorphisms separated by up to 5 kilobases in hundreds of thousands single molecules. We tested the sensitivity of the method by measuring the number of mutant haplotypes synthesized by four different commercially available enzymes: Phusion, Platinum Taq, Titanium Taq, and Phire. The digital nature of the method makes it highly sensitive to detecting haplotype ratios of less than 1:10,000. We also accurately quantified chimera formation during the exponential phase of PCR by different DNA polymerases.
Boufana, Belgees; Lett, Wai San; Lahmar, Samia; Buishi, Imad; Bodell, Anthony J; Varcasia, Antonio; Casulli, Adriano; Beeching, Nicholas J; Campbell, Fiona; Terlizzo, Monica; McManus, Donald P; Craig, Philip S
2015-02-01
Cystic echinococcosis is endemic in Europe including the United Kingdom. However, information on the molecular epidemiology of Echinococcus spp. from the United Kingdom is limited. Echinococcus isolates from intermediate and definitive animal hosts as well as from human cystic echinococcosis cases were analysed to determine species and genotypes within these hosts. Echinococcus equinus was identified from horse hydatid isolates, cysts retrieved from captive UK mammals and copro-DNA of foxhounds and farm dogs. Echinococcus granulosus sensu stricto (s.s.) was identified from hydatid cysts of sheep and cattle as well as in DNA extracted from farm dog and foxhound faecal samples, and from four human cystic echinococcosis isolates, including the first known molecular confirmation of E. granulosus s.s. infection in a Welsh sheep farmer. Low genetic variability for E. equinus from various hosts and from different geographical locations was detected using the mitochondrial cytochrome c oxidase subunit 1 gene (cox1), indicating the presence of a dominant haplotype (EQUK01). In contrast, greater haplotypic variation was observed for E. granulosus s.s. cox1 sequences. The haplotype network showed a star-shaped network with a centrally placed main haplotype (EgUK01) that had been reported from other world regions. Copyright © 2014 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.
Battilana, Juri; Lorenzi, Silvia; Moreira, Flavia M; Moreno-Sanz, Paula; Failla, Osvaldo; Emanuelli, Francesco; Grando, M Stella
2013-07-01
Cultivars used for wine and table grape have self-fertile hermaphrodite flowers whereas wild European vines and American and Asian species are dioecious, having either male or female flowers. Consistent with previous studies, the flower sex trait was mapped as a single major locus on chromosome 2 based on a pure Vitis vinifera population segregating for hermaphrodite and female progeny, and a hybrid population producing all three flower sex types. The sex locus was placed between the same SSR and SNP markers on both genetic maps, although abnormal segregation hampered to fine map the genomic region. From a total of 55 possible haplotypes inferred for three SSR markers around the sex locus, in a population of 132 V. sylvestris accessions and 171 V. vinifera cultivars, one of them accounted for 66 % of the hermaphrodite individuals and may be the result of domestication. Specific size variants of the VVIB23 microsatellite sequence within the 3'-UTR of a putative YABBY1 gene were found to be statistically significantly associated with the sex alleles M, H and f; these markers can provide assistance in defining the status of wild grapevine germplasm.
Seth-Smith, H M B; Busó, Leonor Sánchez; Livingstone, M; Sait, M; Harris, S R; Aitchison, K D; Vretou, Evangelia; Siarkou, V I; Laroucau, K; Sachse, K; Longbottom, D; Thomson, N R
2017-05-04
Chlamydia abortus (formerly Chlamydophila abortus) is an economically important livestock pathogen, causing ovine enzootic abortion (OEA), and can also cause zoonotic infections in humans affecting pregnancy outcome. Large-scale genomic studies on other chlamydial species are giving insights into the biology of these organisms but have not yet been performed on C. abortus. Our aim was to investigate a broad collection of European isolates of C. abortus, using next generation sequencing methods, looking at diversity, geographic distribution and genome dynamics. Whole genome sequencing was performed on our collection of 57 C. abortus isolates originating primarily from the UK, Germany, France and Greece, but also from Tunisia, Namibia and the USA. Phylogenetic analysis of a total of 64 genomes shows a deep structural division within the C. abortus species with a major clade displaying limited diversity, in addition to a branch carrying two more distantly related Greek isolates, LLG and POS. Within the major clade, seven further phylogenetic groups can be identified, demonstrating geographical associations. The number of variable nucleotide positions across the sampled isolates is significantly lower than those published for C. trachomatis and C. psittaci. No recombination was identified within C. abortus, and no plasmid was found. Analysis of pseudogenes showed lineage specific loss of some functions, notably with several Pmp and TMH/Inc proteins predicted to be inactivated in many of the isolates studied. The diversity within C. abortus appears to be much lower compared to other species within the genus. There are strong geographical signatures within the phylogeny, indicating clonal expansion within areas of limited livestock transport. No recombination has been identified within this species, showing that different species of Chlamydia may demonstrate different evolutionary dynamics, and that the genome of C. abortus is highly stable.
Wan, KangKang; Zhang, Zhong; Pang, Xiaoming; Yin, Xiao; Bai, Yang; Sun, Xiaoqing; Gao, Lizhi; Li, Ruiqiang; Zhang, Jinbo
2016-01-01
Jujube (Ziziphus jujuba Mill.) belongs to the Rhamnaceae family and is a popular fruit tree species with immense economic and nutritional value. Here, we report a draft genome of the dry jujube cultivar ‘Junzao’ and the genome resequencing of 31 geographically diverse accessions of cultivated and wild jujubes (Ziziphus jujuba var. spinosa). Comparative analysis revealed that the genome of ‘Dongzao’, a fresh jujube, was ~86.5 Mb larger than that of the ‘Junzao’, partially due to the recent insertions of transposable elements in the ‘Dongzao’ genome. We constructed eight proto-chromosomes of the common ancestor of Rhamnaceae and Rosaceae, two sister families in the order Rosales, and elucidated the evolutionary processes that have shaped the genome structures of modern jujubes. Population structure analysis revealed the complex genetic background of jujubes resulting from extensive hybridizations between jujube and its wild relatives. Notably, several key genes that control fruit organic acid metabolism and sugar content were identified in the selective sweep regions. We also identified S-locus genes controlling gametophytic self-incompatibility and investigated haplotype patterns of the S locus in the jujube genomes, which would provide a guideline for parent selection for jujube crossbreeding. This study provides valuable genomic resources for jujube improvement, and offers insights into jujube genome evolution and its population structure and domestication. PMID:28005948
Dunham, I; Sargent, C A; Dawkins, R L; Campbell, R D
1989-11-01
The class II region of the human major histocompatibility complex in seven common HLA haplotypes has been analyzed using pulsed-field gel electrophoresis, restriction enzymes that cut genomic DNA infrequently, and Southern blotting. This analysis has revealed that there are differences in the amount of DNA present in the DQ and DR subregions dependent on the haplotype. The class II region of the DR3 haplotype spans approximately 750 kb and has the same amount of DNA as the class II region of the DR5 and DR6 haplotypes. However, the DR2 haplotype has approximately 30 kb more DNA within the DR subregion. The DR4 haplotype has an additional approximately 110 kb of DNA within the DQ or DR subregions compared to the DR3, DR5, and DR6 haplotypes. These haplotype-specific differences could have some bearing both on the analysis of disease susceptibility and on the ability of chromosomes possessing different HLA haplotypes to recombine within the DQ/DR subregions.
Excoffier, L; Smouse, P E; Quattro, J M
1992-06-01
We present here a framework for the study of molecular variation within a single species. Information on DNA haplotype divergence is incorporated into an analysis of variance format, derived from a matrix of squared-distances among all pairs of haplotypes. This analysis of molecular variance (AMOVA) produces estimates of variance components and F-statistic analogs, designated here as phi-statistics, reflecting the correlation of haplotypic diversity at different levels of hierarchical subdivision. The method is flexible enough to accommodate several alternative input matrices, corresponding to different types of molecular data, as well as different types of evolutionary assumptions, without modifying the basic structure of the analysis. The significance of the variance components and phi-statistics is tested using a permutational approach, eliminating the normality assumption that is conventional for analysis of variance but inappropriate for molecular data. Application of AMOVA to human mitochondrial DNA haplotype data shows that population subdivisions are better resolved when some measure of molecular differences among haplotypes is introduced into the analysis. At the intraspecific level, however, the additional information provided by knowing the exact phylogenetic relations among haplotypes or by a nonlinear translation of restriction-site change into nucleotide diversity does not significantly modify the inferred population genetic structure. Monte Carlo studies show that site sampling does not fundamentally affect the significance of the molecular variance components. The AMOVA treatment is easily extended in several different directions and it constitutes a coherent and flexible framework for the statistical analysis of molecular data.
Origins and Domestication of Cultivated Banana Inferred from Chloroplast and Nuclear Genes
Zhang, Cui; Wang, Xin-Feng; Shi, Feng-Xue; Chen, Wen-Na; Ge, Xue-Jun
2013-01-01
Background Cultivated bananas are large, vegetatively-propagated members of the genus Musa. More than 1,000 cultivars are grown worldwide and they are major economic and food resources in numerous developing countries. It has been suggested that cultivated bananas originated from the islands of Southeast Asia (ISEA) and have been developed through complex geodomestication pathways. However, the maternal and parental donors of most cultivars are unknown, and the pattern of nucleotide diversity in domesticated banana has not been fully resolved. Methodology/Principal Findings We studied the genetics of 16 cultivated and 18 wild Musa accessions using two single-copy nuclear (granule-bound starch synthase I, GBSS I, also known as Waxy, and alcohol dehydrogenase 1, Adh1) and two chloroplast (maturase K, matK, and the trnL-F gene cluster) genes. The results of phylogenetic analyses showed that all A-genome haplotypes of cultivated bananas were grouped together with those of ISEA subspecies of M. acuminata (A-genome). Similarly, the B- and S-genome haplotypes of cultivated bananas clustered with the wild species M. balbisiana (B-genome) and M. schizocarpa (S-genome), respectively. Notably, it has been shown that distinct haplotypes of each cultivar (A-genome group) were nested together to different ISEA subspecies M. acuminata. Analyses of nucleotide polymorphism in the Waxy and Adh1 genes revealed that, in comparison to the wild relatives, cultivated banana exhibited slightly lower nucleotide diversity both across all sites and specifically at silent sites. However, dramatically reduced nucleotide diversity was found at nonsynonymous sites for cultivated bananas. Conclusions/Significance Our study not only confirmed the origin of cultivated banana as arising from multiple intra- and inter-specific hybridization events, but also showed that cultivated banana may have not suffered a severe genetic bottleneck during the domestication process. Importantly, our findings
2014-01-01
Background To better understand the genetic determination of udder health, we performed a genome-wide association study (GWAS) on a population of 2354 German Holstein bulls for which daughter yield deviations (DYD) for somatic cell score (SCS) were available. For this study, we used genetic information of 44 576 informative single nucleotide polymorphisms (SNPs) and 11 725 inferred haplotype blocks. Results When accounting for the sub-structure of the analyzed population, 16 SNPs and 10 haplotypes in six genomic regions were significant at the Bonferroni threshold of P ≤ 1.14 × 10-6. The size of the identified regions ranged from 0.05 to 5.62 Mb. Genomic regions on chromosomes 5, 6, 18 and 19 coincided with known QTL affecting SCS, while additional genomic regions were found on chromosomes 13 and X. Of particular interest is the region on chromosome 6 between 85 and 88 Mb, where QTL for mastitis traits and significant SNPs for SCS in different Holstein populations coincide with our results. In all identified regions, except for the region on chromosome X, significant SNPs were present in significant haplotypes. The minor alleles of identified SNPs on chromosomes 18 and 19, and the major alleles of SNPs on chromosomes 6 and X were favorable for a lower SCS. Differences in somatic cell count (SCC) between alternative SNP alleles reached 14 000 cells/mL. Conclusions The results support the polygenic nature of the genetic determination of SCS, confirm the importance of previously reported QTL, and provide evidence for the segregation of additional QTL for SCS in Holstein cattle. The small size of the regions identified here will facilitate the search for causal genetic variations that affect gene functions. PMID:24898131
Vinkers, Christiaan H; Joëls, Marian; Milaneschi, Yuri; Gerritsen, Lotte; Kahn, René S; Penninx, Brenda W J H; Boks, Marco P M
2015-04-01
The MR is an important regulator of the hypothalamic-pituitary-adrenal (HPA) axis and a prime target for corticosteroids. There is increasing evidence from both clinical and preclinical studies that the MR has different effects on behavior and mood in males and females. To investigate the hypothesis that the MR sex-dependently influences the relation between childhood maltreatment and depression, we investigated three common and functional MR haplotypes (GA, CA, and CG haplotype, based on rs5522 and rs2070951) in a population-based cohort (N = 665) and an independent clinical cohort from the Netherlands Study of Depression and Anxiety (NESDA) (N = 1639). The CA haplotype sex-dependently moderated the relation between childhood maltreatment and depressive symptoms both in the population-based sample (sex × maltreatment × haplotype: β = -4.07, P = 0.029) and in the clinical sample (sex × maltreatment × haplotype, β = -2.40, P = 0.011). Specifically, female individuals in the population-based sample were protected (β = -4.58, P = 2.0 e(-5)), whereas males in the clinical sample were at increased risk (β = 2.54, P = 0.0022). In line with these results, female GA haplotype carriers displayed increased vulnerability in the population-based sample (β = 4.58, P = 7.5 e(-5)) whereas male CG-carriers showed increased resilience in the clinical sample (β = -2.71, P = 0.016). Consistently, we found a decreased lifetime MDD risk for male GA haplotype carriers following childhood maltreatment but an increased risk for male CA haplotype carriers in the clinical sample. In both samples, sex-dependent effects were observed for GA-GA diplotype carriers. In summary, sex plays an important role in determining whether functional genetic variation in MR is beneficial or detrimental, with an apparent female advantage for the CA haplotype but male advantage for the GA and CG haplotype. These sex-dependent effects of MR on depression susceptibility following childhood
Diversity Arrays Technology (DArT) for whole-genome profiling of barley
Wenzl, Peter; Carling, Jason; Kudrna, David; Jaccoud, Damian; Huttner, Eric; Kleinhofs, Andris; Kilian, Andrzej
2004-01-01
Diversity Arrays Technology (DArT) can detect and type DNA variation at several hundred genomic loci in parallel without relying on sequence information. Here we show that it can be effectively applied to genetic mapping and diversity analyses of barley, a species with a 5,000-Mbp genome. We tested several complexity reduction methods and selected two that generated the most polymorphic genomic representations. Arrays containing individual fragments from these representations generated DArT fingerprints with a genotype call rate of 98.0% and a scoring reproducibility of at least 99.8%. The fingerprints grouped barley lines according to known genetic relationships. To validate the Mendelian behavior of DArT markers, we constructed a genetic map for a cross between cultivars Steptoe and Morex. Nearly all polymorphic array features could be incorporated into one of seven linkage groups (98.8%). The resulting map comprised ≈385 unique DArT markers and spanned 1,137 centimorgans. A comparison with the restriction fragment length polymorphism-based framework map indicated that the quality of the DArT map was equivalent, if not superior, to that of the framework map. These results highlight the potential of DArT as a generic technique for genome profiling in the context of molecular breeding and genomics. PMID:15192146
Genome-wide signals of positive selection in human evolution
Enard, David; Messer, Philipp W.; Petrov, Dmitri A.
2014-01-01
The role of positive selection in human evolution remains controversial. On the one hand, scans for positive selection have identified hundreds of candidate loci, and the genome-wide patterns of polymorphism show signatures consistent with frequent positive selection. On the other hand, recent studies have argued that many of the candidate loci are false positives and that most genome-wide signatures of adaptation are in fact due to reduction of neutral diversity by linked deleterious mutations, known as background selection. Here we analyze human polymorphism data from the 1000 Genomes Project and detect signatures of positive selection once we correct for the effects of background selection. We show that levels of neutral polymorphism are lower near amino acid substitutions, with the strongest reduction observed specifically near functionally consequential amino acid substitutions. Furthermore, amino acid substitutions are associated with signatures of recent adaptation that should not be generated by background selection, such as unusually long and frequent haplotypes and specific distortions in the site frequency spectrum. We use forward simulations to argue that the observed signatures require a high rate of strongly adaptive substitutions near amino acid changes. We further demonstrate that the observed signatures of positive selection correlate better with the presence of regulatory sequences, as predicted by the ENCODE Project Consortium, than with the positions of amino acid substitutions. Our results suggest that adaptation was frequent in human evolution and provide support for the hypothesis of King and Wilson that adaptive divergence is primarily driven by regulatory changes. PMID:24619126
Dietzgen, Ralf G.; Kondo, Hideki; Goodin, Michael M.; Kurath, Gael; Vasilakis, Nikos
2017-01-01
The family Rhabdoviridae consists of mostly enveloped, bullet-shaped or bacilliform viruses with a negative-sense, single-stranded RNA genome that infect vertebrates, invertebrates or plants. This ecological diversity is reflected by the diversity and complexity of their genomes. Five canonical structural protein genes are conserved in all rhabdoviruses, but may be overprinted, overlapped or interspersed with several novel and diverse accessory genes. This review gives an overview of the characteristics and diversity of rhabdoviruses, their taxonomic classification, replication mechanism, properties of classical rhabdoviruses such as rabies virus and rhabdoviruses with complex genomes, rhabdoviruses infecting aquatic species, and plant rhabdoviruses with both mono- and bipartite genomes.
RENT+: an improved method for inferring local genealogical trees from haplotypes with recombination.
Mirzaei, Sajad; Wu, Yufeng
2017-04-01
: Haplotypes from one or multiple related populations share a common genealogical history. If this shared genealogy can be inferred from haplotypes, it can be very useful for many population genetics problems. However, with the presence of recombination, the genealogical history of haplotypes is complex and cannot be represented by a single genealogical tree. Therefore, inference of genealogical history with recombination is much more challenging than the case of no recombination. : In this paper, we present a new approach called RENT+ for the inference of local genealogical trees from haplotypes with the presence of recombination. RENT+ builds on a previous genealogy inference approach called RENT , which infers a set of related genealogical trees at different genomic positions. RENT+ represents a significant improvement over RENT in the sense that it is more effective in extracting information contained in the haplotype data about the underlying genealogy than RENT . The key components of RENT+ are several greatly enhanced genealogy inference rules. Through simulation, we show that RENT+ is more efficient and accurate than several existing genealogy inference methods. As an application, we apply RENT+ in the inference of population demographic history from haplotypes, which outperforms several existing methods. : RENT+ is implemented in Java, and is freely available for download from: https://github.com/SajadMirzaei/RentPlus . : sajad@engr.uconn.edu or ywu@engr.uconn.edu. : Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
Honey bee-inspired algorithms for SNP haplotype reconstruction problem
NASA Astrophysics Data System (ADS)
PourkamaliAnaraki, Maryam; Sadeghi, Mehdi
2016-03-01
Reconstructing haplotypes from SNP fragments is an important problem in computational biology. There have been a lot of interests in this field because haplotypes have been shown to contain promising data for disease association research. It is proved that haplotype reconstruction in Minimum Error Correction model is an NP-hard problem. Therefore, several methods such as clustering techniques, evolutionary algorithms, neural networks and swarm intelligence approaches have been proposed in order to solve this problem in appropriate time. In this paper, we have focused on various evolutionary clustering techniques and try to find an efficient technique for solving haplotype reconstruction problem. It can be referred from our experiments that the clustering methods relying on the behaviour of honey bee colony in nature, specifically bees algorithm and artificial bee colony methods, are expected to result in more efficient solutions. An application program of the methods is available at the following link. http://www.bioinf.cs.ipm.ir/software/haprs/
Park, H; Lee, Y-J; Song, E Y; Park, M H
2016-10-01
The human leucocyte antigen (HLA) system is the most polymorphic genetic system in humans, and HLA matching is crucial in organ transplantation, especially in hematopoietic stem cell transplantation. We investigated HLA-A, HLA-B and HLA-DRB1 allele and haplotype frequencies at allelic level in 10 918 Koreans from bone marrow donor registry in Korea. Intermediate resolution HLA typing was performed using Luminex technology (Wakunaga, Japan), and additional allelic level typing was performed using PCR-single-strand conformation polymorphism method and/or sequence-based typing (Abbott Molecular, USA). Allele and haplotype frequencies were calculated by direct counting and maximum likelihood methods, respectively. A total of 39 HLA-A, 66 HLA-B and 47 HLA-DRB1 alleles were identified. High-frequency alleles found at a frequency of ≥5% were 6 HLA-A (A*02:01, *02:06, *11:01, *24:02, *31:01 and *33:03), 6 HLA-B (B*15:01, *35:01, *44:03, *51:01, 54:01 and *58:01) and 8 HLA-DRB1 (DRB1*01:01, *04:05, *04:06, *07:01, *08:03, *09:01, *13:02 and *15:01) alleles. At each locus, A*02, B*15 and DRB1*14 generic groups were most diverse at allelic level, consisting of 9, 12 and 11 different alleles, respectively. A total of 366, 197 and 21 different HLA-A-B-DRB1 haplotypes were estimated with frequencies of ≥0.05%, ≥0.1% and ≥0.5%, respectively. The five most common haplotypes with frequencies of ≥2.0% were A*33:03-B*44:03-DRB1*13:02 (4.97%), A*33:03-B*58:01-DRB1*13:02, A*33:03-B*44:03-DRB1*07:01, A*24:02-B*07:02-DRB1*01:01 and A*24:02-B*52:01-DRB1*15:02. Among 34 serologic HLA-A-B-DR haplotypes with frequencies of ≥0.5%, 17 haplotypes revealed allele-level diversity and majority of the allelic variation was arising from A2, A26, B61, B62, DR4 and DR14 specificities. Haplotype diversity obtained in this study is the most comprehensive data thus far reported in Koreans, and the information will be useful for unrelated stem cell transplantation as well as for disease
Reference-based phasing using the Haplotype Reference Consortium panel.
Loh, Po-Ru; Danecek, Petr; Palamara, Pier Francesco; Fuchsberger, Christian; A Reshef, Yakir; K Finucane, Hilary; Schoenherr, Sebastian; Forer, Lukas; McCarthy, Shane; Abecasis, Goncalo R; Durbin, Richard; L Price, Alkes
2016-11-01
Haplotype phasing is a fundamental problem in medical and population genetics. Phasing is generally performed via statistical phasing in a genotyped cohort, an approach that can yield high accuracy in very large cohorts but attains lower accuracy in smaller cohorts. Here we instead explore the paradigm of reference-based phasing. We introduce a new phasing algorithm, Eagle2, that attains high accuracy across a broad range of cohort sizes by efficiently leveraging information from large external reference panels (such as the Haplotype Reference Consortium; HRC) using a new data structure based on the positional Burrows-Wheeler transform. We demonstrate that Eagle2 attains a ∼20× speedup and ∼10% increase in accuracy compared to reference-based phasing using SHAPEIT2. On European-ancestry samples, Eagle2 with the HRC panel achieves >2× the accuracy of 1000 Genomes-based phasing. Eagle2 is open source and freely available for HRC-based phasing via the Sanger Imputation Service and the Michigan Imputation Server.
Are Eimeria Genetically Diverse, and Does It Matter?
Clark, Emily L; Tomley, Fiona M; Blake, Damer P
2017-03-01
Eimeria pose a risk to all livestock species as a cause of coccidiosis, reducing productivity and compromising animal welfare. Pressure to reduce drug use in the food chain makes the development of cost-effective vaccines against Eimeria essential. For novel vaccines to be successful, understanding genetic and antigenic diversity in field populations is key. Eimeria species that infect chickens are most significant, with Eimeria tenella among the best studied and most economically important. Genome-wide single nucleotide polymorphism (SNP)-based haplotyping has been used to determine population structure, genotype distribution, and potential for cross-fertilization between E. tenella strains. Here, we discuss recent developments in our understanding of diversity for Eimeria in relation to its specialized life cycle, distribution across the globe, and the challenges posed to vaccine development. Copyright © 2016 Elsevier Ltd. All rights reserved.
BAsE-Seq: a method for obtaining long viral haplotypes from short sequence reads.
Hong, Lewis Z; Hong, Shuzhen; Wong, Han Teng; Aw, Pauline P K; Cheng, Yan; Wilm, Andreas; de Sessions, Paola F; Lim, Seng Gee; Nagarajan, Niranjan; Hibberd, Martin L; Quake, Stephen R; Burkholder, William F
2014-01-01
We present a method for obtaining long haplotypes, of over 3 kb in length, using a short-read sequencer, Barcode-directed Assembly for Extra-long Sequences (BAsE-Seq). BAsE-Seq relies on transposing a template-specific barcode onto random segments of the template molecule and assembling the barcoded short reads into complete haplotypes. We applied BAsE-Seq on mixed clones of hepatitis B virus and accurately identified haplotypes occurring at frequencies greater than or equal to 0.4%, with >99.9% specificity. Applying BAsE-Seq to a clinical sample, we obtained over 9,000 viral haplotypes, which provided an unprecedented view of hepatitis B virus population structure during chronic infection. BAsE-Seq is readily applicable for monitoring quasispecies evolution in viral diseases.
Evolution and Diversity of the Human Hepatitis D Virus Genome
Huang, Chi-Ruei; Lo, Szecheng J.
2010-01-01
Human hepatitis delta virus (HDV) is the smallest RNA virus in genome. HDV genome is divided into a viroid-like sequence and a protein-coding sequence which could have originated from different resources and the HDV genome was eventually constituted through RNA recombination. The genome subsequently diversified through accumulation of mutations selected by interactions between the mutated RNA and proteins with host factors to successfully form the infectious virions. Therefore, we propose that the conservation of HDV nucleotide sequence is highly related with its functionality. Genome analysis of known HDV isolates shows that the C-terminal coding sequences of large delta antigen (LDAg) are the highest diversity than other regions of protein-coding sequences but they still retain biological functionality to interact with the heavy chain of clathrin can be selected and maintained. Since viruses interact with many host factors, including escaping the host immune response, how to design a program to predict RNA genome evolution is a great challenging work. PMID:20204073
Chapman, Carol; Henry, Matthew; Bishop-Lilly, Kimberly A; Awosika, Joy; Briska, Adam; Ptashkin, Ryan N; Wagner, Trevor; Rajanna, Chythanya; Tsang, Hsinyi; Johnson, Shannon L; Mokashi, Vishwesh P; Chain, Patrick S G; Sozhamannan, Shanmuga
2015-01-01
Historically, cholera outbreaks have been linked to V. cholerae O1 serogroup strains or its derivatives of the O37 and O139 serogroups. A genomic study on the 2010 Haiti cholera outbreak strains highlighted the putative role of non O1/non-O139 V. cholerae in causing cholera and the lack of genomic sequences of such strains from around the world. Here we address these gaps by scanning a global collection of V. cholerae strains as a first step towards understanding the population genetic diversity and epidemic potential of non O1/non-O139 strains. Whole Genome Mapping (Optical Mapping) based bar coding produces a high resolution, ordered restriction map, depicting a complete view of the unique chromosomal architecture of an organism. To assess the genomic diversity of non-O1/non-O139 V. cholerae, we applied a Whole Genome Mapping strategy on a well-defined and geographically and temporally diverse strain collection, the Sakazaki serogroup type strains. Whole Genome Map data on 91 of the 206 serogroup type strains support the hypothesis that V. cholerae has an unprecedented genetic and genomic structural diversity. Interestingly, we discovered chromosomal fusions in two unusual strains that possess a single chromosome instead of the two chromosomes usually found in V. cholerae. We also found pervasive chromosomal rearrangements such as duplications and indels in many strains. The majority of Vibrio genome sequences currently in public databases are unfinished draft sequences. The Whole Genome Mapping approach presented here enables rapid screening of large strain collections to capture genomic complexities that would not have been otherwise revealed by unfinished draft genome sequencing and thus aids in assembling and finishing draft sequences of complex genomes. Furthermore, Whole Genome Mapping allows for prediction of novel V. cholerae non-O1/non-O139 strains that may have the potential to cause future cholera outbreaks.
Liang, Winnie S.; Chen, Kewei; Lee, Wendy; Sidhar, Kunal; Corneveaux, Jason J.; Allen, April N.; Myers, Amanda; Villa, Stephen; Meechoovet, Bessie; Pruzin, Jeremy; Bandy, Daniel; Fleisher, Adam S.; Langbaum, Jessica B.S.; Huentelman, Matthew J.; Jensen, Kendall; Dunckley, Travis; Caselli, Richard J.; Kaib, Susan; Reiman, Eric M.
2010-01-01
In a genome-wide association study (GWAS) of late-onset Alzheimer's disease (AD), we found an association between common haplotypes of the GAB2 gene and AD risk in carriers of the apolipoprotein E (APOE) ε4 allele, the major late-onset AD susceptibility gene. We previously proposed the use of fluorodeoxyglucose positron emission tomography (FDG-PET) measurements as a quantitative presymptomatic endophenotype, more closely related to disease risk than the clinical syndrome itself, to help evaluate putative genetic and non-genetic modifiers of AD risk. In this study, we examined the relationship between the presence or absence of the relatively protective GAB2 haplotype and PET measurements of regional-to-whole brain FDG uptake in several AD-affected brain regions in 158 cognitively normal late-middle-aged APOEε4 homozygotes, heterozygotes, and non-carriers. GAB2 haplotypes were characterized using Affymetrix Genome-Wide Human SNP 6.0 Array data from each of these subjects. As predicted, the possibly protective GAB2 haplotype was associated with higher regional-to-whole brain FDG uptake in AD-affected brain regions in APOEε4 carriers. While additional studies are needed, this study supports the association between the possibly protective GAB2 haplotype and the risk of late-onset AD in APOEε4 carriers. It also supports the use of brain-imaging endophenotypes to help assess possible modifiers of AD risk. PMID:20888920
Cloud Computing-Based TagSNP Selection Algorithm for Human Genome Data
Hung, Che-Lun; Chen, Wen-Pei; Hua, Guan-Jie; Zheng, Huiru; Tsai, Suh-Jen Jane; Lin, Yaw-Ling
2015-01-01
Single nucleotide polymorphisms (SNPs) play a fundamental role in human genetic variation and are used in medical diagnostics, phylogeny construction, and drug design. They provide the highest-resolution genetic fingerprint for identifying disease associations and human features. Haplotypes are regions of linked genetic variants that are closely spaced on the genome and tend to be inherited together. Genetics research has revealed SNPs within certain haplotype blocks that introduce few distinct common haplotypes into most of the population. Haplotype block structures are used in association-based methods to map disease genes. In this paper, we propose an efficient algorithm for identifying haplotype blocks in the genome. In chromosomal haplotype data retrieved from the HapMap project website, the proposed algorithm identified longer haplotype blocks than an existing algorithm. To enhance its performance, we extended the proposed algorithm into a parallel algorithm that copies data in parallel via the Hadoop MapReduce framework. The proposed MapReduce-paralleled combinatorial algorithm performed well on real-world data obtained from the HapMap dataset; the improvement in computational efficiency was proportional to the number of processors used. PMID:25569088
Duranti, Sabrina; Turroni, Francesca; Milani, Christian; Foroni, Elena; Bottacini, Francesca; Dal Bello, Fabio; Ferrarini, Alberto; Delledonne, Massimo; van Sinderen, Douwe
2013-01-01
In the current work, we describe genome diversity and core genome sequences among representatives of three bifidobacterial species, i.e., Bifidobacterium adolescentis, Bifidobacterium catenulatum, and Bifidobacterium pseudocatenulatum, by employing a polyphasic approach involving analysis of 16S rRNA gene and 16S-23S internal transcribed spacer (ITS) sequences, pulsed-field gel electrophoresis (PFGE), and comparative genomic hybridization (CGH) assays. PMID:23064340
Ferreira, Ana Cristina; Dias, Ricardo; de Sá, Maria Inácia Corrêa; Tenreiro, Rogério
2016-08-30
Optical mapping is a technology able to quickly generate high resolution ordered whole-genome restriction maps of bacteria, being a proven approach to search for diversity among bacterial isolates. In this work, optical whole-genome maps were used to compare closely-related Brucella suis biovar 2 strains. This biovar is the unique isolated in domestic pigs and wild boars in Portugal and Spain and most of the strains share specific molecular characteristics establishing an Iberian clonal lineage that can be differentiated from another lineage mainly isolated in several Central European countries. We performed the BamHI whole-genome optical maps of five B. suis biovar 2 field strains, isolated from wild boars in Portugal and Spain (three from the Iberian lineage and two from the Central European one) as well as of the reference strain B. suis biovar 2 ATCC 23445 (Central European lineage, Denmark). Each strain showed a distinct, highly individual configuration of 228-231 BamHI fragments. Nevertheless, a low divergence was globally observed in chromosome II (1.6%) relatively to chromosome I (2.4%). Optical mapping also disclosed genomic events associated with B. suis strains in chromosome I, namely one indel (3.5kb) and one large inversion (944kb). By using targeted-PCR in a set of 176 B. suis strains, including all biovars and haplotypes, the indel was found to be specific of the reference strain ATCC 23445 and the large inversion was shown to be an exclusive genomic marker of the Iberian clonal lineage of biovar 2. Copyright © 2016 Elsevier B.V. All rights reserved.
Haplotypes of CYP3A4 and their close linkage with CYP3A5 haplotypes in a Japanese population.
Fukushima-Uesaka, Hiromi; Saito, Yoshiro; Watanabe, Hidemi; Shiseki, Kisho; Saeki, Mayumi; Nakamura, Takahiro; Kurose, Kouichi; Sai, Kimie; Komamura, Kazuo; Ueno, Kazuyuki; Kamakura, Shiro; Kitakaze, Masafumi; Hanai, Sotaro; Nakajima, Toshiharu; Matsumoto, Kenji; Saito, Hirohisa; Goto, Yu-ichi; Kimura, Hideo; Katoh, Masaaki; Sugai, Kenji; Minami, Narihiro; Shirao, Kuniaki; Tamura, Tomohide; Yamamoto, Noboru; Minami, Hironobu; Ohtsu, Atsushi; Yoshida, Teruhiko; Saijo, Nagahiro; Kitamura, Yutaka; Kamatani, Naoyuki; Ozawa, Shogo; Sawada, Jun-ichi
2004-01-01
In order to identify single nucleotide polymorphisms (SNPs) and haplotype frequencies of CYP3A4 in a Japanese population, the distal enhancer and proximal promoter regions, all exons, and the surrounding introns were sequenced from genomic DNA of 416 Japanese subjects. We found 24 SNPs, including 17 novel ones: two in the distal enhancer, four in the proximal promoter, one in the 5'-untranslated region (UTR), seven in the introns, and three in the 3'-UTR. The most common SNP was c.1026+12G>A (IVS10+12G>A), with a 0.249 frequency. Four non-synonymous SNPs, c.554C>G (p.T185S, CYP3A4(*)16), c.830_831insA (p.E277fsX8, (*)6), c.878T>C (p.L293P, (*)18), and c.1088 C>T (p.T363M, (*)11) were found with frequencies of 0.014, 0.001, 0.028, and 0.002, respectively. No SNP was found in the known nuclear transcriptional factor-binding sites in the enhancer and promoter regions. Using these 24 SNPs, 16 haplotypes were unambiguously identified, and nine haplotypes were inferred by aid of an expectation-maximization-based program. In addition, using data from 186 subjects enabled a close linkage to be found between CYP3A4 and CYP3A5 SNPs, especially among the SNPs at c.1026+12 in CYP3A4 and c.219-237 (IVS3-237, a key SNP site for CYP3A5(*)3), c.865+77 (IVS9+77) and c.1523 in CYP3A5. This result suggested that CYP3A4 and CYP3A5 are within the same gene block. Haplotype analysis between CYP3A4 and CYP3A5 revealed several major haplotype combinations in the CYP3A4-CYP3A5 block. Our findings provide fundamental and useful information for genotyping CYP3A4 (and CYP3A5) in the Japanese, and probably Asian populations. Copyright 2003 Wiley-Liss, Inc.
H-PoP and H-PoPG: heuristic partitioning algorithms for single individual haplotyping of polyploids.
Xie, Minzhu; Wu, Qiong; Wang, Jianxin; Jiang, Tao
2016-12-15
Some economically important plants including wheat and cotton have more than two copies of each chromosome. With the decreasing cost and increasing read length of next-generation sequencing technologies, reconstructing the multiple haplotypes of a polyploid genome from its sequence reads becomes practical. However, the computational challenge in polyploid haplotyping is much greater than that in diploid haplotyping, and there are few related methods. This article models the polyploid haplotyping problem as an optimal poly-partition problem of the reads, called the Polyploid Balanced Optimal Partition model. For the reads sequenced from a k-ploid genome, the model tries to divide the reads into k groups such that the difference between the reads of the same group is minimized while the difference between the reads of different groups is maximized. When the genotype information is available, the model is extended to the Polyploid Balanced Optimal Partition with Genotype constraint problem. These models are all NP-hard. We propose two heuristic algorithms, H-PoP and H-PoPG, based on dynamic programming and a strategy of limiting the number of intermediate solutions at each iteration, to solve the two models, respectively. Extensive experimental results on simulated and real data show that our algorithms can solve the models effectively, and are much faster and more accurate than the recent state-of-the-art polyploid haplotyping algorithms. The experiments also show that our algorithms can deal with long reads and deep read coverage effectively and accurately. Furthermore, H-PoP might be applied to help determine the ploidy of an organism. https://github.com/MinzhuXie/H-PoPG CONTACT: xieminzhu@hotmail.comSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Genome-wide characterization of genetic diversity and population structure in Secale
2014-01-01
Background Numerous rye accessions are stored in ex situ genebanks worldwide. Little is known about the extent of genetic diversity contained in any of them and its relation to contemporary varieties, since to date rye genetic diversity studies had a very limited scope, analyzing few loci and/ or few accessions. Development of high throughput genotyping methods for rye opened the possibility for genome wide characterizations of large accessions sets. In this study we used 1054 Diversity Array Technology (DArT) markers with defined chromosomal location to characterize genetic diversity and population structure in a collection of 379 rye accessions including wild species, landraces, cultivated materials, historical and contemporary rye varieties. Results Average genetic similarity (GS) coefficients and average polymorphic information content (PIC) values varied among chromosomes. Comparison of chromosome specific average GS within and between germplasm sub-groups indicated regions of chromosomes 1R and 4R as being targeted by selection in current breeding programs. Bayesian clustering, principal coordinate analysis and Neighbor Joining clustering demonstrated that source and improvement status contributed significantly to the structure observed in the analyzed set of Secale germplasm. We revealed a relatively limited diversity in improved rye accessions, both historical and contemporary, as well as lack of correlation between clustering of improved accessions and geographic origin, suggesting common genetic background of rye accessions from diverse geographic regions and extensive germplasm exchange. Moreover, contemporary varieties were distinct from the remaining accessions. Conclusions Our results point to an influence of reproduction methods on the observed diversity patterns and indicate potential of ex situ collections for broadening the genetic diversity in rye breeding programs. Obtained data show that DArT markers provide a realistic picture of the genetic
Dietzgen, Ralf G; Kondo, Hideki; Goodin, Michael M; Kurath, Gael; Vasilakis, Nikos
2017-01-02
The family Rhabdoviridae consists of mostly enveloped, bullet-shaped or bacilliform viruses with a negative-sense, single-stranded RNA genome that infect vertebrates, invertebrates or plants. This ecological diversity is reflected by the diversity and complexity of their genomes. Five canonical structural protein genes are conserved in all rhabdoviruses, but may be overprinted, overlapped or interspersed with several novel and diverse accessory genes. This review gives an overview of the characteristics and diversity of rhabdoviruses, their taxonomic classification, replication mechanism, properties of classical rhabdoviruses such as rabies virus and rhabdoviruses with complex genomes, rhabdoviruses infecting aquatic species, and plant rhabdoviruses with both mono- and bipartite genomes. Copyright © 2016 Elsevier B.V. All rights reserved.
He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang
2015-01-01
Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.
Demographic history, selection and functional diversity of the canine genome.
Ostrander, Elaine A; Wayne, Robert K; Freedman, Adam H; Davis, Brian W
2017-12-01
The domestic dog represents one of the most dramatic long-term evolutionary experiments undertaken by humans. From a large wolf-like progenitor, unparalleled diversity in phenotype and behaviour has developed in dogs, providing a model for understanding the developmental and genomic mechanisms of diversification. We discuss pattern and process in domestication, beginning with general findings about early domestication and problems in documenting selection at the genomic level. Furthermore, we summarize genotype-phenotype studies based first on single nucleotide polymorphism (SNP) genotyping and then with whole-genome data and show how an understanding of evolution informs topics as different as human history, adaptive and deleterious variation, morphological development, ageing, cancer and behaviour.
[Frequency distribution of HLA antigens and haplotypes in newly arrived inhabitants of Magadan].
Solovenchuk, L L; Pereverzeva, V V; Nevretdinova, Z G
1994-09-01
Peculiarities of the frequency distribution of antigens and haplotypes of A, B, and Cw subloci of the HLA system in 924 Slavic inhabitants of Magadan are described. Significant differences in gene and haplotype frequencies between inhabitants of Magadan and those of Moscow, Odessa, Poles'e, Latvia, and England were revealed, which could not be attributed solely to the specificity of migration processes. On the basis of an analysis of gamete associations of the A and B subloci, an attempt was made to explain the specificity of the frequency distribution of HLA system alleles and haplotypes in the investigated sample from an ecological point of view.
Strain screen and haplotype association mapping of wheel running in inbred mouse strains.
Lightfoot, J Timothy; Leamy, Larry; Pomp, Daniel; Turner, Michael J; Fodor, Anthony A; Knab, Amy; Bowen, Robert S; Ferguson, David; Moore-Harrison, Trudy; Hamilton, Alicia
2010-09-01
Previous genetic association studies of physical activity, in both animal and human models, have been limited in number of subjects and genetically homozygous strains used as well as number of genomic markers available for analysis. Expansion of the available mouse physical activity strain screens and the recently published dense single-nucleotide polymorphism (SNP) map of the mouse genome (approximately 8.3 million SNPs) and associated statistical methods allowed us to construct a more generalizable map of the quantitative trait loci (QTL) associated with physical activity. Specifically, we measured wheel running activity in male and female mice (average age 9 wk) in 41 inbred strains and used activity data from 38 of these strains in a haplotype association mapping analysis to determine QTL associated with activity. As seen previously, there was a large range of activity patterns among the strains, with the highest and lowest strains differing significantly in daily distance run (27.4-fold), duration of activity (23.6-fold), and speed (2.9-fold). On a daily basis, female mice ran further (24%), longer (13%), and faster (11%). Twelve QTL were identified, with three (on Chr. 12, 18, and 19) in both male and female mice, five specific to males, and four specific to females. Eight of the 12 QTL, including the 3 general QTL found for both sexes, fell into intergenic areas. The results of this study further support the findings of a moderate to high heritability of physical activity and add general genomic areas applicable to a large number of mouse strains that can be further mined for candidate genes associated with regulation of physical activity. Additionally, results suggest that potential genetic mechanisms arising from traditional noncoding regions of the genome may be involved in regulation of physical activity.
Adato, A; Weil, D; Kalinski, H; Pel-Or, Y; Ayadi, H; Petit, C; Korostishevsky, M; Bonne-Tamir, B
1997-10-01
Usher syndrome types I (USH1A-USH1E) are a group of autosomal recessive diseases characterized by profound congenital hearing loss, vestibular areflexia, and progressive visual loss due to retinitis pigmentosa. The human myosin VIIA gene, located on 11q14, has been shown to be responsible for Usher syndrome type 1B (USH1B). Haplotypes were constructed in 28 USH1 families by use of the following polymorphic markers spanning the USH1B locus: D11S787, D11S527, D11S1789, D11S906, D11S4186, and OMP. Affected individuals and members of their families from 12 different ethnic origins were screened for the presence of mutations in all 49 exons of the myosin VIIA gene. In 15 families myosin VIIA mutations were detected, verifying their classification as USH1B. All these mutations are novel, including three missense mutations, one premature stop codon, two splicing mutations, one frameshift, and one deletion of >2 kb comprising exons 47 and 48, a part of exon 49, and the introns between them. Three mutations were shared by more than one family, consistent with haplotype similarities. Altogether, 16 USH1B haplotypes were observed in the 15 families; most haplotypes were population specific. Several exonic and intronic polymorphisms were also detected. None of the 20 known USH1B mutations reported so far in other world populations were identified in our families.
Lu, Jianguo; Peatman, Eric; Tang, Haibao; Lewis, Joshua; Liu, Zhanjiang
2012-06-15
Gene duplication has had a major impact on genome evolution. Localized (or tandem) duplication resulting from unequal crossing over and whole genome duplication are believed to be the two dominant mechanisms contributing to vertebrate genome evolution. While much scrutiny has been directed toward discerning patterns indicative of whole-genome duplication events in teleost species, less attention has been paid to the continuous nature of gene duplications and their impact on the size, gene content, functional diversity, and overall architecture of teleost genomes. Here, using a Markov clustering algorithm directed approach we catalogue and analyze patterns of gene duplication in the four model teleost species with chromosomal coordinates: zebrafish, medaka, stickleback, and Tetraodon. Our analyses based on set size, duplication type, synonymous substitution rate (Ks), and gene ontology emphasize shared and lineage-specific patterns of genome evolution via gene duplication. Most strikingly, our analyses highlight the extraordinary duplication and retention rate of recent duplicates in zebrafish and their likely role in the structural and functional expansion of the zebrafish genome. We find that the zebrafish genome is remarkable in its large number of duplicated genes, small duplicate set size, biased Ks distribution toward minimal mutational divergence, and proportion of tandem and intra-chromosomal duplicates when compared with the other teleost model genomes. The observed gene duplication patterns have played significant roles in shaping the architecture of teleost genomes and appear to have contributed to the recent functional diversification and divergence of important physiological processes in zebrafish. We have analyzed gene duplication patterns and duplication types among the available teleost genomes and found that a large number of genes were tandemly and intrachromosomally duplicated, suggesting their origin of independent and continuous duplication
Analysis of the mitochondrial genome of cheetahs (Acinonyx jubatus) with neurodegenerative disease.
Burger, Pamela A; Steinborn, Ralf; Walzer, Christian; Petit, Thierry; Mueller, Mathias; Schwarzenberger, Franz
2004-08-18
The complete mitochondrial genome of Acinonyx jubatus was sequenced and mitochondrial DNA (mtDNA) regions were screened for polymorphisms as candidates for the cause of a neurodegenerative demyelinating disease affecting captive cheetahs. The mtDNA reference sequences were established on the basis of the complete sequences of two diseased and two nondiseased animals as well as partial sequences of 26 further individuals. The A. jubatus mitochondrial genome is 17,047-bp long and shows a high sequence similarity (91%) to the domestic cat. Based on single nucleotide polymorphisms (SNPs) in the control region (CR) and pedigree information, the 18 myelopathic and 12 non-myelopathic cheetahs included in this study were classified into haplotypes I, II and III. In view of the phenotypic comparability of the neurodegenerative disease observed in cheetahs and human mtDNA-associated diseases, specific coding regions including the tRNAs leucine UUR, lysine, serine UCN, and partial complex I and V sequences were screened. We identified a heteroplasmic and a homoplasmic SNP at codon 507 in the subunit 5 (MTND5) of complex I. The heteroplasmic haplotype I-specific valine to methionine substitution represents a nonconservative amino acid change and was found in 11 myelopathic and eight non-myelopathic cheetahs with levels ranging from 29% to 79%. The homoplasmic conservative amino acid substitution valine to alanine was identified in two myelopathic animals of haplotype II. In addition, a synonymous SNP in the codon 76 of the MTND4L gene was found in the single haplotype III animal. The amino acid exchanges in the MTND5 gene were not associated with the occurrence of neurodegenerative disease in captive cheetahs.
Diversity and Evolution in the Genome of Clostridium difficile
Knight, Daniel R.; Elliott, Briony; Chang, Barbara J.; Perkins, Timothy T.
2015-01-01
SUMMARY Clostridium difficile infection (CDI) is the leading cause of antimicrobial and health care-associated diarrhea in humans, presenting a significant burden to global health care systems. In the last 2 decades, PCR- and sequence-based techniques, particularly whole-genome sequencing (WGS), have significantly furthered our knowledge of the genetic diversity, evolution, epidemiology, and pathogenicity of this once enigmatic pathogen. C. difficile is taxonomically distinct from many other well-known clostridia, with a diverse population structure comprising hundreds of strain types spread across at least 6 phylogenetic clades. The C. difficile species is defined by a large diverse pangenome with extreme levels of evolutionary plasticity that has been shaped over long time periods by gene flux and recombination, often between divergent lineages. These evolutionary events are in response to environmental and anthropogenic activities and have led to the rapid emergence and worldwide dissemination of virulent clonal lineages. Moreover, genome analysis of large clinically relevant data sets has improved our understanding of CDI outbreaks, transmission, and recurrence. The epidemiology of CDI has changed dramatically over the last 15 years, and CDI may have a foodborne or zoonotic etiology. The WGS era promises to continue to redefine our view of this significant pathogen. PMID:26085550
N'Diaye, Amidou; Haile, Jemanesh K; Cory, Aron T; Clarke, Fran R; Clarke, John M; Knox, Ron E; Pozniak, Curtis J
2017-01-01
Association mapping is usually performed by testing the correlation between a single marker and phenotypes. However, because patterns of variation within genomes are inherited as blocks, clustering markers into haplotypes for genome-wide scans could be a worthwhile approach to improve statistical power to detect associations. The availability of high-density molecular data allows the possibility to assess the potential of both approaches to identify marker-trait associations in durum wheat. In the present study, we used single marker- and haplotype-based approaches to identify loci associated with semolina and pasta colour in durum wheat, the main objective being to evaluate the potential benefits of haplotype-based analysis for identifying quantitative trait loci. One hundred sixty-nine durum lines were genotyped using the Illumina 90K Infinium iSelect assay, and 12,234 polymorphic single nucleotide polymorphism (SNP) markers were generated and used to assess the population structure and the linkage disequilibrium (LD) patterns. A total of 8,581 SNPs previously localized to a high-density consensus map were clustered into 406 haplotype blocks based on the average LD distance of 5.3 cM. Combining multiple SNPs into haplotype blocks increased the average polymorphism information content (PIC) from 0.27 per SNP to 0.50 per haplotype. The haplotype-based analysis identified 12 loci associated with grain pigment colour traits, including the five loci identified by the single marker-based analysis. Furthermore, the haplotype-based analysis resulted in an increase of the phenotypic variance explained (50.4% on average) and the allelic effect (33.7% on average) when compared to single marker analysis. The presence of multiple allelic combinations within each haplotype locus offers potential for screening the most favorable haplotype series and may facilitate marker-assisted selection of grain pigment colour in durum wheat. These results suggest a benefit of haplotype
Haile, Jemanesh K.; Cory, Aron T.; Clarke, Fran R.; Clarke, John M.; Knox, Ron E.; Pozniak, Curtis J.
2017-01-01
Association mapping is usually performed by testing the correlation between a single marker and phenotypes. However, because patterns of variation within genomes are inherited as blocks, clustering markers into haplotypes for genome-wide scans could be a worthwhile approach to improve statistical power to detect associations. The availability of high-density molecular data allows the possibility to assess the potential of both approaches to identify marker-trait associations in durum wheat. In the present study, we used single marker- and haplotype-based approaches to identify loci associated with semolina and pasta colour in durum wheat, the main objective being to evaluate the potential benefits of haplotype-based analysis for identifying quantitative trait loci. One hundred sixty-nine durum lines were genotyped using the Illumina 90K Infinium iSelect assay, and 12,234 polymorphic single nucleotide polymorphism (SNP) markers were generated and used to assess the population structure and the linkage disequilibrium (LD) patterns. A total of 8,581 SNPs previously localized to a high-density consensus map were clustered into 406 haplotype blocks based on the average LD distance of 5.3 cM. Combining multiple SNPs into haplotype blocks increased the average polymorphism information content (PIC) from 0.27 per SNP to 0.50 per haplotype. The haplotype-based analysis identified 12 loci associated with grain pigment colour traits, including the five loci identified by the single marker-based analysis. Furthermore, the haplotype-based analysis resulted in an increase of the phenotypic variance explained (50.4% on average) and the allelic effect (33.7% on average) when compared to single marker analysis. The presence of multiple allelic combinations within each haplotype locus offers potential for screening the most favorable haplotype series and may facilitate marker-assisted selection of grain pigment colour in durum wheat. These results suggest a benefit of haplotype
Pervasive, Genome-Wide Transcription in the Organelle Genomes of Diverse Plastid-Bearing Protists.
Sanitá Lima, Matheus; Smith, David Roy
2017-11-06
Organelle genomes are among the most sequenced kinds of chromosome. This is largely because they are small and widely used in molecular studies, but also because next-generation sequencing technologies made sequencing easier, faster, and cheaper. However, studies of organelle RNA have not kept pace with those of DNA, despite huge amounts of freely available eukaryotic RNA-sequencing (RNA-seq) data. Little is known about organelle transcription in nonmodel species, and most of the available eukaryotic RNA-seq data have not been mined for organelle transcripts. Here, we use publicly available RNA-seq experiments to investigate organelle transcription in 30 diverse plastid-bearing protists with varying organelle genomic architectures. Mapping RNA-seq data to organelle genomes revealed pervasive, genome-wide transcription, regardless of the taxonomic grouping, gene organization, or noncoding content. For every species analyzed, transcripts covered ≥85% of the mitochondrial and/or plastid genomes (all of which were ≤105 kb), indicating that most of the organelle DNA-coding and noncoding-is transcriptionally active. These results follow earlier studies of model species showing that organellar transcription is coupled and ubiquitous across the genome, requiring significant downstream processing of polycistronic transcripts. Our findings suggest that noncoding organelle DNA can be transcriptionally active, raising questions about the underlying function of these transcripts and underscoring the utility of publicly available RNA-seq data for recovering complete genome sequences. If pervasive transcription is also found in bigger organelle genomes (>105 kb) and across a broader range of eukaryotes, this could indicate that noncoding organelle RNAs are regulating fundamental processes within eukaryotic cells. Copyright © 2017 Sanitá Lima and Smith.
Brown, Susan E; Reilley, Ann A; Knudson, Dennis L; Ishimaru, Carol A
2002-02-01
Genomic fingerprints of C. michiganensis subsp. sepedonicus were generated by CHEF gel electrophoresis of restriction digested high-molecular weight DNA. Low levels of intra-subspecific variation were detected by cluster analysis of the fingerprints. Four haplotypes were identified by genomic fingerprinting with HindIII, and eight were identified with EcoRI. Haplotypes generated with HindIII were less similar than those generated by EcoRI. Haplotypes generated with HindIII formed groups that corresponded well with plant reactions of the strains, but similar types of groupings were less apparent with haplotypes generated with EcoRI. When disease severity in eggplant and potato, population size in potato, and ability to induce a hypersensitive response (HR) in tobacco were overlaid onto dendograms of genetic similarity, avirulent HR-negative strains clustered separately from virulent HR-positive strains in both EcoRI and HindIII profiles. Avirulent HR-positive strains that lack pCS1 clustered with avirulent HR-negative strains in a EcoRI dendogram, but clustered with virulent HR-positive strains in a HindIII dendogram. Genomic fingerprinting of high-molecular weight DNA fragments provided a means for detecting genomic variability associated with virulence in C. michiganensis subsp. sepedonicus.
Patterns of genome size diversity in bats (order Chiroptera).
Smith, Jillian D L; Bickham, John W; Gregory, T Ryan
2013-08-01
Despite being a group of particular interest in considering relationships between genome size and metabolic parameters, bats have not been well studied from this perspective. This study presents new estimates for 121 "microbat" species from 12 families and complements a previous study on members of the family Pteropodidae ("megabats"). The results confirm that diversity in genome size in bats is very limited even compared with other mammals, varying approximately 2-fold from 1.63 pg in Lophostoma carrikeri to 3.17 pg in Rhinopoma hardwickii and averaging only 2.35 pg ± 0.02 SE (versus 3.5 pg overall for mammals). However, contrary to some other vertebrate groups, and perhaps owing to the narrow range observed, genome size correlations were not apparent with any chromosomal, physiological, flight-related, developmental, or ecological characteristics within the order Chiroptera. Genome size is positively correlated with measures of body size in bats, though the strength of the relationships differs between pteropodids ("megabats") and nonpteropodids ("microbats").
Rapid generation of genetic diversity by multiplex CRISPR/Cas9 genome editing in rice.
Shen, Lan; Hua, Yufeng; Fu, Yaping; Li, Jian; Liu, Qing; Jiao, Xiaozhen; Xin, Gaowei; Wang, Junjie; Wang, Xingchun; Yan, Changjie; Wang, Kejian
2017-05-01
The clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease 9 (CRISPR/Cas9) system has emerged as a promising technology for specific genome editing in many species. Here we constructed one vector targeting eight agronomic genes in rice using the CRISPR/Cas9 multiplex genome editing system. By subsequent genetic transformation and DNA sequencing, we found that the eight target genes have high mutation efficiencies in the T 0 generation. Both heterozygous and homozygous mutations of all editing genes were obtained in T 0 plants. In addition, homozygous sextuple, septuple, and octuple mutants were identified. As the abundant genotypes in T 0 transgenic plants, various phenotypes related to the editing genes were observed. The findings demonstrate the potential of the CRISPR/Cas9 system for rapid introduction of genetic diversity during crop breeding.
Raspé, O; Saumitou-Laprade, P; Cuguen, J; Jacquemart, A L
2000-08-01
Intra-specific chloroplast DNA (cpDNA) variation was studied in Sorbus aucuparia L., an entomophilous, mid-or early successional tree producing fleshy fruits. Eight PCR-amplified fragments of the chloroplast genome were screened for restriction fragment length polymorphisms, using one or two 4 bp-cutter restriction endonucleases. cpDNA variation was investigated on two geographical scales: (1) among four regions in France and Belgium; and (2) within the Belgian region. A total of 150 individuals from six populations were analysed. Fourteen polymorphisms were detected in six of the cpDNA fragments. All polymorphisms probably resulted from insertions or deletions, and allowed the identification of 12 haplotypes. The level of genetic differentiation computed on the basis of haplotype frequencies was similar on the two geographical scales considered (G(STc) = 0.286 among regions, G(STc) = 0.259 among populations within the Belgian region). These values are much lower than those obtained in nine previously studied temperate tree species, which are all wind-pollinated, late-successional species producing dry fruits. These results might primarily be accounted for by the contrasting life history traits of S. aucuparia. In order to obtain insights into the relative contribution of pollen and seeds to gene flow, G(STc) was also compared with previously obtained G(ST) estimates based on allozyme data.
Yamada, Aya; Kodo, Yukihiro; Murakami, Masaru; Kuroda, Masamichi; Aoki, Takao; Fujimoto, Takafumi; Arai, Katsutoshi
2015-11-01
In a few Japanese populations of the loach Misgurnus anguillicaudatus (Teleostei: Cobitidae), clonal diploid lineages produce unreduced diploid eggs that normally undergo gynogenetic reproduction; however the origin of these clones remains elusive. Here, we show the presence of two diverse clades, A and B, within this loach species from sequence analyses of two nuclear genes RAG1 (recombination activating gene 1) and IRBP2 (interphotoreceptor retinoid-binding protein, 2) and then demonstrate heterozygous genotypes fixed at the two loci as the evidence of the hybrid nature of clonal lineages. All the clonal individuals were identified by clone-specific mitochondrial DNA haplotypes, microsatellite genotypes, and random amplified polymorphic DNA fingerprints; they commonly showed two alleles, one from clade A and another from clade B, whereas other wild-type diploids possessed alleles from either clade A or B. However, we also found wild-type diploids with clone-specific mitochondrial DNA and nuclear genes from clade B. One possible explanation is an introgression of a clone-specific mitochondrial genome from clonal to these wild-type loaches. These individuals likely arose by a cross between haploid sperm from bisexual B clade males and haploid eggs with clone-specific mtDNA and clade B nuclear genome, produced by meiotic hybridogenesis (elimination of unmatched A genome followed by meiosis after preferential pairing between two matched B genomes) in clone-origin triploid individual (ABB). © 2015 Wiley Periodicals, Inc.
Across language families: Genome diversity mirrors linguistic variation within Europe
Longobardi, Giuseppe; Ghirotto, Silvia; Guardiano, Cristina; Tassi, Francesca; Benazzo, Andrea; Ceolin, Andrea
2015-01-01
ABSTRACT Objectives: The notion that patterns of linguistic and biological variation may cast light on each other and on population histories dates back to Darwin's times; yet, turning this intuition into a proper research program has met with serious methodological difficulties, especially affecting language comparisons. This article takes advantage of two new tools of comparative linguistics: a refined list of Indo‐European cognate words, and a novel method of language comparison estimating linguistic diversity from a universal inventory of grammatical polymorphisms, and hence enabling comparison even across different families. We corroborated the method and used it to compare patterns of linguistic and genomic variation in Europe. Materials and Methods: Two sets of linguistic distances, lexical and syntactic, were inferred from these data and compared with measures of geographic and genomic distance through a series of matrix correlation tests. Linguistic and genomic trees were also estimated and compared. A method (Treemix) was used to infer migration episodes after the main population splits. Results: We observed significant correlations between genomic and linguistic diversity, the latter inferred from data on both Indo‐European and non‐Indo‐European languages. Contrary to previous observations, on the European scale, language proved a better predictor of genomic differences than geography. Inferred episodes of genetic admixture following the main population splits found convincing correlates also in the linguistic realm. Discussion: These results pave the ground for previously unfeasible cross‐disciplinary analyses at the worldwide scale, encompassing populations of distant language families. Am J Phys Anthropol 157:630–640, 2015. © 2015 Wiley Periodicals, Inc. PMID:26059462
Drake, B.M.; Goto, R.M.; Miller, M.M.; Gee, G.F.; Briles, W.E.
1999-01-01
The major histocompatibility complex (MHC) is a group of genetic loci coding for haplotypes that have been associated with fitness traits in mammals and birds. Such associations suggest that MHC diversity may be an indicator of overall genetic fitness of endangered or threatened species. The MHC haplotypes of a captive population of 12 families of northern bobwhites (Colinus virginianus) were identified using a combination of immunogenetic and molecular techniques. Alloantisera were produced within families of northern bobwhites and were then tested for differential agglutination of erythrocytes of all members of each family. The pattern of reactions determined from testing these alloantisera identified a single genetic system of alloantigens in the northern bobwhites, resulting in the assignment of a tentative genotype to each individual within the quail families. Restriction fragment patterns of the DNA of each bird were determined using the chicken MHC B-G cDNA probe bg11. The concordance between the restriction fragment patterns and the alloantisera reactions showed that the alloantisera had identified the MHC of the northern bobwhite and supported the tentative genotype assignments, identifying at least 12 northern bobwhite MHC haplotypes.
Feng, Hui; Gupta, Bhavna; Wang, Meilian; Zheng, Wenqi; Zheng, Li; Zhu, Xiaotong; Yang, Yimei; Fang, Qiang; Luo, Enjie; Fan, Qi; Tsuboi, Takafumi; Cao, Yaming; Cui, Liwang
2015-12-01
The male gamete fertilization factor P48/45 in malaria parasites is a prime transmission-blocking vaccine (TBV) candidate. Efforts to develop antimalarial vaccines are often thwarted by genetic diversity of the target antigens. Here we evaluated the genetic diversity of Pvs48/45 gene in global Plasmodium vivax populations. We determined 200 Pvs48/45 sequences collected from temperate and subtropical parasite populations in China. Population genetic and evolutionary analyses were performed to determine the levels of genetic diversity, potential signature of selection, and population differentiation. Analysis of the Pvs48/45 sequences from 200 P. vivax parasites collected in a temperate and a tropical region revealed a low level of genetic diversity (π = 0.0012) with 14 single nucleotide polymorphisms, of which 11 were nonsynonymous. Analysis of 344 Pvs48/45 sequences from nine worldwide P. vivax populations detected a total of 38 haplotypes, of which 13 haplotypes were present only once. Multiple tests for selection confirmed a signature of positive selection on Pvs48/45 with selection skewed to the second cysteine domain. Haplotype network analysis and Wright's fixation index showed large geographical differentiation with the presence of continent-or region-specific mutations in this gene. Pvs48/45 displays low levels of genetic diversity with the presence of region-specific mutations. Some of the mutations may be potential epitope targets based on their positions in the predicted structure, highlighting the need for future evaluation of these mutations in designing Pvs48/45-based TBV.
Dannemann, Michael; Andrés, Aida M.; Kelso, Janet
2016-01-01
Pathogens and the diseases they cause have been among the most important selective forces experienced by humans during their evolutionary history. Although adaptive alleles generally arise by mutation, introgression can also be a valuable source of beneficial alleles. Archaic humans, who lived in Europe and Western Asia for more than 200,000 years, were probably well adapted to this environment and its local pathogens. It is therefore conceivable that modern humans entering Europe and Western Asia who admixed with them obtained a substantial immune advantage from the introgression of archaic alleles. Here we document a cluster of three Toll-like receptors (TLR6-TLR1-TLR10) in modern humans that carries three distinct archaic haplotypes, indicating repeated introgression from archaic humans. Two of these haplotypes are most similar to the Neandertal genome, and the third haplotype is most similar to the Denisovan genome. The Toll-like receptors are key components of innate immunity and provide an important first line of immune defense against bacteria, fungi, and parasites. The unusually high allele frequencies and unexpected levels of population differentiation indicate that there has been local positive selection on multiple haplotypes at this locus. We show that the introgressed alleles have clear functional effects in modern humans; archaic-like alleles underlie differences in the expression of the TLR genes and are associated with reduced microbial resistance and increased allergic disease in large cohorts. This provides strong evidence for recurrent adaptive introgression at the TLR6-TLR1-TLR10 locus, resulting in differences in disease phenotypes in modern humans. PMID:26748514
Salem, Rany M; Wessel, Jennifer; Schork, Nicholas J
2005-03-01
Interest in the assignment and frequency analysis of haplotypes in samples of unrelated individuals has increased immeasurably as a result of the emphasis placed on haplotype analyses by, for example, the International HapMap Project and related initiatives. Although there are many available computer programs for haplotype analysis applicable to samples of unrelated individuals, many of these programs have limitations and/or very specific uses. In this paper, the key features of available haplotype analysis software for use with unrelated individuals, as well as pooled DNA samples from unrelated individuals, are summarised. Programs for haplotype analysis were identified through keyword searches on PUBMED and various internet search engines, a review of citations from retrieved papers and personal communications, up to June 2004. Priority was given to functioning computer programs, rather than theoretical models and methods. The available software was considered in light of a number of factors: the algorithm(s) used, algorithm accuracy, assumptions, the accommodation of genotyping error, implementation of hypothesis testing, handling of missing data, software characteristics and web-based implementations. Review papers comparing specific methods and programs are also summarised. Forty-six haplotyping programs were identified and reviewed. The programs were divided into two groups: those designed for individual genotype data (a total of 43 programs) and those designed for use with pooled DNA samples (a total of three programs). The accuracy of programs using various criteria are assessed and the programs are categorised and discussed in light of: algorithm and method, accuracy, assumptions, genotyping error, hypothesis testing, missing data, software characteristics and web implementation. Many available programs have limitations (eg some cannot accommodate missing data) and/or are designed with specific tasks in mind (eg estimating haplotype frequencies rather than
Itokawa, Kentaro; Komagata, Osamu; Kasai, Shinji; Masada, Masahiro; Tomita, Takashi
2011-07-01
A cytochrome P450 gene, Cyp9m10, is more than 200-fold overexpressed in a pyrethroid resistant strain of Culex quinquefasciatus, JPal-per. The haplotype of this strain contains two copies of Cyp9m10 resulted from recent tandem duplication. In this study, we discovered and isolated a Cyp9m10 haplotype closely related to this duplicated Cyp9m10 haplotype from JHB, a strain used for the recent genome project for this mosquito species. The isolated haplotype (JHB-NIID-B haplotype) shared the same insertion of a transposable element upstream of the coding region with JPal-per strain but not duplicated. The JHB-NIID-B haplotype was considered to have diverged from the JPal-per lineage just before the duplication event. Cyp9m10 was moderately overexpressed in larvae with the JHB-NIID-B haplotype. The overexpressions in JHB-NIID-B and JPal-per haplotypes were developmentally regulated in similar pattern indicating both haplotypes share a common cis-acting mutation responsible for the overexpressions. The isolated moderately overexpressed haplotype conferred resistance, however, its efficacy was relatively small. We hypothesized that the first cis-acting mutation modified the consequence of the subsequent duplication in JPal-per lineage to confer stronger phenotypic effect than that if it occurred before the first cis-acting mutation. Copyright © 2011 Elsevier Ltd. All rights reserved.
Zhao, Xiaohong; Chen, Xiaogang; Zhao, Yuancun; Zhang, Shu; Gao, Zehua; Yang, Yiwen; Wang, Yufang; Zhang, Ji
2018-05-01
Insertion/deletion polymorphisms (indels), which combine the advantages of both short tandem repeats and single-nucleotide polymorphisms, are suitable for parentage testing. To overcome the limitations of the low polymorphism of di-allelic indels, we constructed a set of haplotypes with physically linked, multi-allelic indels. Candidate haplotypes were selected from the 1000 Genomes Project database, and were subject to the following criteria for inclusion: (i) each marker must have a minimum allele frequency (MAF) of ≥0.1 in the Han population of China; (ii) markers must exist in a non-coding region; (iii) the physical distance between a pair of candidate indels must be <500 bp; (iv) the allele length variation of each indel from 1 to 20 bp; (v) different haplotypes must be located on different chromosomes or chromosomal arms, or be more than 10 Mb apart if on the same chromosomal arm; and (vi) they must not be located across a recombination hotspot. A multiplex system with 11 haplotype markers, comprising 22 tri-allelic indel loci distributed over 10 chromosomes was developed. To validate the multiplex panel, we investigated the haplotype distribution in sets of two and three-generation pedigrees. The results demonstrated that the haplotypes consisting of multi-allelic indel markers exhibited higher polymorphism than a single indel locus, and thus provide Supplementary information for forensic kinship identification. Copyright © 2018 Elsevier B.V. All rights reserved.
Rashid, Muhammad Abdul Rehman; Zhao, Yan; Zhang, Hongliang; Li, Jinjie; Li, Zichao
2016-07-01
Lodging resistance is one of the vital traits in yield improvement and sustainability. Culm wall thickness, diameter, and strength are different traits that can govern the lodging resistance in rice. The genes SCM2 and FC1 have been isolated for culm thickness, strength, and flexibility, but their functional nucleotide variations were still unknown. We used a 13× deep sequence of 795 diverse genotypes to present the functional variation and SNP diversity in SCM2 and FC1. The major functional variant for the SCM2 gene was at position 27480181 and for the FC1 gene at position 31072992. Haplotype analysis of both genes provided their various allelic differences among haplotypes. SCM2 alleles further presented the evolution of Oryza sativa L. subsp. indica and subsp. japonica genomes from common parent in different geographical zones, while the haplotypes of FC1 suggested their evolution from different strains of the common parent Oryza rufipogon. SCM2 showed purifying selection and functional associations with rare alleles, while FC1 displayed balanced selection favored by multiple heterozygous alleles. Genotypes with an allelic combination of SCM2-3 and FC1-2 in japonica background exhibited striking resistance against lodging, which can be used in further breeding programs.
Dos Santos Silva, Wellington; de Nazaré Klautau-Guimarães, Maria; Grisolia, Cesar Koppe
2010-07-01
Five restriction site polymorphisms in the β-globin gene cluster (HincII-5' ε, HindIII-(G) γ, HindIII-(A) γ, HincII- ψβ1 and HincII-3' ψβ1) were analyzed in three populations (n = 114) from Reconcavo Baiano, State of Bahia, Brazil. The groups included two urban populations from the towns of Cachoeira and Maragojipe and one rural Afro-descendant population, known as the "quilombo community", from Cachoeira municipality. The number of haplotypes found in the populations ranged from 10 to 13, which indicated higher diversity than in the parental populations. The haplotypes 2 (+ - - - -), 3 (- - - - +), 4 (- + - - +) and 6 (- + + - +) on the β(A) chromosomes were the most common, and two haplotypes, 9 (- + + + +) and 14 (+ + - - +), were found exclusively in the Maragojipe population. The other haplotypes (1, 5, 9, 11, 12, 13, 14 and 16) had lower frequencies. Restriction site analysis and the derived haplotypes indicated homogeneity among the populations. Thirty-two individuals with hemoglobinopathies (17 sickle cell disease, 12 HbSC disease and 3 HbCC disease) were also analyzed. The haplotype frequencies of these patients differed significantly from those of the general population. In the sickle cell disease subgroup, the predominant haplotypes were BEN (Benin) and CAR (Central African Republic), with frequencies of 52.9% and 32.4%, respectively. The high frequency of the BEN haplotype agreed with the historical origin of the afro-descendant population in the state of Bahia. However, this frequency differed from that of Salvador, the state capital, where the CAR and BEN haplotypes have similar frequencies, probably as a consequence of domestic slave trade and subsequent internal migrations to other regions of Brazil.
2010-01-01
Five restriction site polymorphisms in the β-globin gene cluster (HincII-5‘ ε, HindIII-G γ, HindIII-A γ, HincII- ψβ1 and HincII-3‘ ψβ1) were analyzed in three populations (n = 114) from Reconcavo Baiano, State of Bahia, Brazil. The groups included two urban populations from the towns of Cachoeira and Maragojipe and one rural Afro-descendant population, known as the “quilombo community”, from Cachoeira municipality. The number of haplotypes found in the populations ranged from 10 to 13, which indicated higher diversity than in the parental populations. The haplotypes 2 (+ - - - -), 3 (- - - - +), 4 (- + - - +) and 6 (- + + - +) on the βA chromosomes were the most common, and two haplotypes, 9 (- + + + +) and 14 (+ + - - +), were found exclusively in the Maragojipe population. The other haplotypes (1, 5, 9, 11, 12, 13, 14 and 16) had lower frequencies. Restriction site analysis and the derived haplotypes indicated homogeneity among the populations. Thirty-two individuals with hemoglobinopathies (17 sickle cell disease, 12 HbSC disease and 3 HbCC disease) were also analyzed. The haplotype frequencies of these patients differed significantly from those of the general population. In the sickle cell disease subgroup, the predominant haplotypes were BEN (Benin) and CAR (Central African Republic), with frequencies of 52.9% and 32.4%, respectively. The high frequency of the BEN haplotype agreed with the historical origin of the afro-descendant population in the state of Bahia. However, this frequency differed from that of Salvador, the state capital, where the CAR and BEN haplotypes have similar frequencies, probably as a consequence of domestic slave trade and subsequent internal migrations to other regions of Brazil. PMID:21637405
Tonomura, Noriko; Elvers, Ingegerd; Thomas, Rachael; Megquier, Kate; Turner-Maier, Jason; Howald, Cedric; Sarver, Aaron L.; Swofford, Ross; Frantz, Aric M.; Ito, Daisuke; Mauceli, Evan; Arendt, Maja; Noh, Hyun Ji; Koltookian, Michele; Biagi, Tara; Fryc, Sarah; Williams, Christina; Avery, Anne C.; Kim, Jong-Hyuk; Barber, Lisa; Burgess, Kristine; Lander, Eric S.; Karlsson, Elinor K.; Azuma, Chieko
2015-01-01
Dogs, with their breed-determined limited genetic background, are great models of human disease including cancer. Canine B-cell lymphoma and hemangiosarcoma are both malignancies of the hematologic system that are clinically and histologically similar to human B-cell non-Hodgkin lymphoma and angiosarcoma, respectively. Golden retrievers in the US show significantly elevated lifetime risk for both B-cell lymphoma (6%) and hemangiosarcoma (20%). We conducted genome-wide association studies for hemangiosarcoma and B-cell lymphoma, identifying two shared predisposing loci. The two associated loci are located on chromosome 5, and together contribute ~20% of the risk of developing these cancers. Genome-wide p-values for the top SNP of each locus are 4.6×10-7 and 2.7×10-6, respectively. Whole genome resequencing of nine cases and controls followed by genotyping and detailed analysis identified three shared and one B-cell lymphoma specific risk haplotypes within the two loci, but no coding changes were associated with the risk haplotypes. Gene expression analysis of B-cell lymphoma tumors revealed that carrying the risk haplotypes at the first locus is associated with down-regulation of several nearby genes including the proximal gene TRPC6, a transient receptor Ca2+-channel involved in T-cell activation, among other functions. The shared risk haplotype in the second locus overlaps the vesicle transport and release gene STX8. Carrying the shared risk haplotype is associated with gene expression changes of 100 genes enriched for pathways involved in immune cell activation. Thus, the predisposing germ-line mutations in B-cell lymphoma and hemangiosarcoma appear to be regulatory, and affect pathways involved in T-cell mediated immune response in the tumor. This suggests that the interaction between the immune system and malignant cells plays a common role in the tumorigenesis of these relatively different cancers. PMID:25642983
Luukkonen, Aino; Teramo, Kari; Puttonen, Hilkka; Ojaniemi, Marja; Varilo, Teppo; Chaudhari, Bimal P.; Plunkett, Jevon; Murray, Jeffrey C.; McCarroll, Steven A.; Muglia, Louis J.; Palotie, Aarno; Hallman, Mikko
2011-01-01
Preterm birth is the major cause of neonatal death and serious morbidity. Most preterm births are due to spontaneous onset of labor without a known cause or effective prevention. Both maternal and fetal genomes influence the predisposition to spontaneous preterm birth (SPTB), but the susceptibility loci remain to be defined. We utilized a combination of unique population structures, family-based linkage analysis, and subsequent case-control association to identify a susceptibility haplotype for SPTB. Clinically well-characterized SPTB families from northern Finland, a subisolate founded by a relatively small founder population that has subsequently experienced a number of bottlenecks, were selected for the initial discovery sample. Genome-wide linkage analysis using a high-density single-nucleotide polymorphism (SNP) array in seven large northern Finnish non-consanginous families identified a locus on 15q26.3 (HLOD 4.68). This region contains the IGF1R gene, which encodes the type 1 insulin-like growth factor receptor IGF-1R. Haplotype segregation analysis revealed that a 55 kb 12-SNP core segment within the IGF1R gene was shared identical-by-state (IBS) in five families. A follow-up case-control study in an independent sample representing the more general Finnish population showed an association of a 6-SNP IGF1R haplotype with SPTB in the fetuses, providing further evidence for IGF1R as a SPTB predisposition gene (frequency in cases versus controls 0.11 versus 0.05, P = 0.001, odds ratio 2.3). This study demonstrates the identification of a predisposing, low-frequency haplotype in a multifactorial trait using a well-characterized population and a combination of family and case-control designs. Our findings support the identification of the novel susceptibility gene IGF1R for predisposition by the fetal genome to being born preterm. PMID:21304894
Sugahara, Kanako; Kaneko, Yuko; Ito, Satoshi; Yamanaka, Keisuke; Sakio, Hitoshi; Hoshizaki, Kazuhiko; Suzuki, Wajiro; Yamanaka, Norikazu; Setoguchi, Hiroaki
2011-01-01
Japanese horse chestnut (Aesculus turbinata: Hippocastanaceae) is one of the typical woody plants that grow in temperate riparian forests in the Japanese Archipelago. To analyze the phylogeography of this plant in the Japanese Archipelago, we determined cpDNA haplotypes for 337 samples from 55 populations covering the entire distribution range. Based on 1,313 bp of two spacers, we determined ten haplotypes that are distinguished from adjacent haplotypes by one or two steps. Most of the populations had a single haplotype, suggesting low diversity. Spatial analysis of molecular variance suggested three obvious phylogeographic structures in western Japan, where Japanese horse chestnut is scattered and isolated in mountainous areas. Conversely, no clear phylogeographic structure was observed from the northern to the southern limit of this species, including eastern Japan, where this plant is more common. Rare and private haplotypes were also found in southwestern Japan, where Japanese horse chestnuts are distributed sparsely. These findings imply that western Japan might have maintained a relatively large habitat for A. turbinata during the Quaternary climatic oscillations, while northerly regions could not.
Origin and Diversification Dynamics of Self-Incompatibility Haplotypes
Gervais, Camille E.; Castric, Vincent; Ressayre, Adrienne; Billiard, Sylvain
2011-01-01
Self-incompatibility (SI) is a genetic system found in some hermaphrodite plants. Recognition of pollen by pistils expressing cognate specificities at two linked genes leads to rejection of self pollen and pollen from close relatives, i.e., to avoidance of self-fertilization and inbred matings, and thus increased outcrossing. These genes generally have many alleles, yet the conditions allowing the evolution of new alleles remain mysterious. Evolutionary changes are clearly necessary in both genes, since any mutation affecting only one of them would result in a nonfunctional self-compatible haplotype. Here, we study diversification at the S-locus (i.e., a stable increase in the total number of SI haplotypes in the population, through the incorporation of new SI haplotypes), both deterministically (by investigating analytically the fate of mutations in an infinite population) and by simulations of finite populations. We show that the conditions allowing diversification are far less stringent in finite populations with recurrent mutations of the pollen and pistil genes, suggesting that diversification is possible in a panmictic population. We find that new SI haplotypes emerge fastest in populations with few SI haplotypes, and we discuss some implications for empirical data on S-alleles. However, allele numbers in our simulations never reach values as high as observed in plants whose SI systems have been studied, and we suggest extensions of our models that may reconcile the theory and data. PMID:21515570
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chapman, Carol; Henry, Matthew; Bishop-Lilly, Kimberly A.
Historically, cholera outbreaks have been linked to V. cholerae O1 serogroup strains or its derivatives of the O37 and O139 serogroups. A genomic study on the 2010 Haiti cholera outbreak strains highlighted the putative role of non O1/non-O139 V. cholerae in causing cholera and the lack of genomic sequences of such strains from around the world. Here we address these gaps by scanning a global collection of V. cholerae strains as a first step towards understanding the population genetic diversity and epidemic potential of non O1/non-O139 strains. Whole Genome Mapping (Optical Mapping) based bar coding produces a high resolution, orderedmore » restriction map, depicting a complete view of the unique chromosomal architecture of an organism. To assess the genomic diversity of non-O1/non-O139 V. cholerae, we applied a Whole Genome Mapping strategy on a well-defined and geographically and temporally diverse strain collection, the Sakazaki serogroup type strains. Whole Genome Map data on 91 of the 206 serogroup type strains support the hypothesis that V. cholerae has an unprecedented genetic and genomic structural diversity. Interestingly, we discovered chromosomal fusions in two unusual strains that possess a single chromosome instead of the two chromosomes usually found in V. cholerae. We also found pervasive chromosomal rearrangements such as duplications and indels in many strains. The majority of Vibrio genome sequences currently in public databases are unfinished draft sequences. The Whole Genome Mapping approach presented here enables rapid screening of large strain collections to capture genomic complexities that would not have been otherwise revealed by unfinished draft genome sequencing and thus aids in assembling and finishing draft sequences of complex genomes. Furthermore, Whole Genome Mapping allows for prediction of novel V. cholerae non-O1/non-O139 strains that may have the potential to cause future cholera outbreaks.« less
Chapman, Carol; Henry, Matthew; Bishop-Lilly, Kimberly A.; ...
2015-03-20
Historically, cholera outbreaks have been linked to V. cholerae O1 serogroup strains or its derivatives of the O37 and O139 serogroups. A genomic study on the 2010 Haiti cholera outbreak strains highlighted the putative role of non O1/non-O139 V. cholerae in causing cholera and the lack of genomic sequences of such strains from around the world. Here we address these gaps by scanning a global collection of V. cholerae strains as a first step towards understanding the population genetic diversity and epidemic potential of non O1/non-O139 strains. Whole Genome Mapping (Optical Mapping) based bar coding produces a high resolution, orderedmore » restriction map, depicting a complete view of the unique chromosomal architecture of an organism. To assess the genomic diversity of non-O1/non-O139 V. cholerae, we applied a Whole Genome Mapping strategy on a well-defined and geographically and temporally diverse strain collection, the Sakazaki serogroup type strains. Whole Genome Map data on 91 of the 206 serogroup type strains support the hypothesis that V. cholerae has an unprecedented genetic and genomic structural diversity. Interestingly, we discovered chromosomal fusions in two unusual strains that possess a single chromosome instead of the two chromosomes usually found in V. cholerae. We also found pervasive chromosomal rearrangements such as duplications and indels in many strains. The majority of Vibrio genome sequences currently in public databases are unfinished draft sequences. The Whole Genome Mapping approach presented here enables rapid screening of large strain collections to capture genomic complexities that would not have been otherwise revealed by unfinished draft genome sequencing and thus aids in assembling and finishing draft sequences of complex genomes. Furthermore, Whole Genome Mapping allows for prediction of novel V. cholerae non-O1/non-O139 strains that may have the potential to cause future cholera outbreaks.« less
The mitochondrial genome in embryo technologies.
Hiendleder, S; Wolf, E
2003-08-01
The mammalian mitochondrial genome encodes for 37 genes which are involved in a broad range of cellular functions. The mitochondrial DNA (mtDNA) molecule is commonly assumed to be inherited through oocyte cytoplasm in a clonal manner, and apparently species-specific mechanisms have evolved to eliminate the contribution of sperm mitochondria after natural fertilization. However, recent evidence for paternal mtDNA inheritance in embryos and offspring questions the general validity of this model, particularly in the context of assisted reproduction and embryo biotechnology. In addition to normal mt DNA haplotype variation, oocytes and spermatozoa show remarkable differences in mtDNA content and may be affected by inherited or acquired mtDNA aberrations. All these parameters have been correlated with gamete quality and reproductive success rates. Nuclear transfer (NT) technology provides experimental models for studying interactions between nuclear and mitochondrial genomes. Recent studies demonstrated (i) a significant effect of mtDNA haplotype or other maternal cytoplasmic factors on the efficiency of NT; (ii) phenotypic differences between transmitochondrial clones pointing to functionally relevant nuclear-cytoplasmic interactions; and (iii) neutral or non-neutral selection of mtDNA haplotypes in heteroplasmic conditions. Mitochondria form a dynamic reticulum, enabling complementation of mitochondrial components and possibly mixing of different mtDNA populations in heteroplasmic individuals. Future directions of research on mtDNA in the context of reproductive biotechnology range from the elimination of adverse effects of artificial heteroplasmy, e.g. created by ooplasm transfer, to engineering of optimized constellations of nuclear and cytoplasmic genes for the production of superior livestock.
Kooke, Rik; Kruijer, Willem; Bours, Ralph; Becker, Frank; Kuhn, André; van de Geest, Henri; Buntjer, Jaap; Doeswijk, Timo; Guerra, José; Bouwmeester, Harro; Vreugdenhil, Dick; Keurentjes, Joost J B
2016-04-01
Quantitative traits in plants are controlled by a large number of genes and their interaction with the environment. To disentangle the genetic architecture of such traits, natural variation within species can be explored by studying genotype-phenotype relationships. Genome-wide association studies that link phenotypes to thousands of single nucleotide polymorphism markers are nowadays common practice for such analyses. In many cases, however, the identified individual loci cannot fully explain the heritability estimates, suggesting missing heritability. We analyzed 349 Arabidopsis accessions and found extensive variation and high heritabilities for different morphological traits. The number of significant genome-wide associations was, however, very low. The application of genomic prediction models that take into account the effects of all individual loci may greatly enhance the elucidation of the genetic architecture of quantitative traits in plants. Here, genomic prediction models revealed different genetic architectures for the morphological traits. Integrating genomic prediction and association mapping enabled the assignment of many plausible candidate genes explaining the observed variation. These genes were analyzed for functional and sequence diversity, and good indications that natural allelic variation in many of these genes contributes to phenotypic variation were obtained. For ACS11, an ethylene biosynthesis gene, haplotype differences explaining variation in the ratio of petiole and leaf length could be identified. © 2016 American Society of Plant Biologists. All Rights Reserved.
Loper, Joyce E.; Hassan, Karl A.; Mavrodi, Dmitri V.; Davis, Edward W.; Lim, Chee Kent; Shaffer, Brenda T.; Elbourne, Liam D. H.; Stockwell, Virginia O.; Hartney, Sierra L.; Breakwell, Katy; Henkels, Marcella D.; Tetu, Sasha G.; Rangel, Lorena I.; Kidarsa, Teresa A.; Wilson, Neil L.; van de Mortel, Judith E.; Song, Chunxu; Blumhagen, Rachel; Radune, Diana; Hostetler, Jessica B.; Brinkac, Lauren M.; Durkin, A. Scott; Kluepfel, Daniel A.; Wechter, W. Patrick; Anderson, Anne J.; Kim, Young Cheol; Pierson, Leland S.; Pierson, Elizabeth A.; Lindow, Steven E.; Kobayashi, Donald Y.; Raaijmakers, Jos M.; Weller, David M.; Thomashow, Linda S.; Allen, Andrew E.; Paulsen, Ian T.
2012-01-01
We provide here a comparative genome analysis of ten strains within the Pseudomonas fluorescens group including seven new genomic sequences. These strains exhibit a diverse spectrum of traits involved in biological control and other multitrophic interactions with plants, microbes, and insects. Multilocus sequence analysis placed the strains in three sub-clades, which was reinforced by high levels of synteny, size of core genomes, and relatedness of orthologous genes between strains within a sub-clade. The heterogeneity of the P. fluorescens group was reflected in the large size of its pan-genome, which makes up approximately 54% of the pan-genome of the genus as a whole, and a core genome representing only 45–52% of the genome of any individual strain. We discovered genes for traits that were not known previously in the strains, including genes for the biosynthesis of the siderophores achromobactin and pseudomonine and the antibiotic 2-hexyl-5-propyl-alkylresorcinol; novel bacteriocins; type II, III, and VI secretion systems; and insect toxins. Certain gene clusters, such as those for two type III secretion systems, are present only in specific sub-clades, suggesting vertical inheritance. Almost all of the genes associated with multitrophic interactions map to genomic regions present in only a subset of the strains or unique to a specific strain. To explore the evolutionary origin of these genes, we mapped their distributions relative to the locations of mobile genetic elements and repetitive extragenic palindromic (REP) elements in each genome. The mobile genetic elements and many strain-specific genes fall into regions devoid of REP elements (i.e., REP deserts) and regions displaying atypical tri-nucleotide composition, possibly indicating relatively recent acquisition of these loci. Collectively, the results of this study highlight the enormous heterogeneity of the P. fluorescens group and the importance of the variable genome in tailoring individual strains
Yund, Philip O; Collins, Catherine; Johnson, Sheri L
2015-06-01
The colonial ascidian Botryllus schlosseri should be considered cryptogenic (i.e., not definitively classified as either native or introduced) in the Northwest Atlantic. Although all the evidence is quite circumstantial, over the last 15 years most research groups have accepted the scenario of human-mediated dispersal and classified B. schlosseri as introduced; others have continued to consider it native or cryptogenic. We address the invasion status of this species by adding 174 sequences to the growing worldwide database for the mitochondrial gene cytochrome c oxidase subunit I (COI) and analyzing 1077 sequences to compare genetic diversity of one clade of haplotypes in the Northwest Atlantic with two hypothesized source regions (the Northeast Atlantic and Mediterranean). Our results lead us to reject the prevailing view of the directionality of transport across the Atlantic. We argue that the genetic diversity patterns at COI are far more consistent with the existence of at least one haplotype clade in the Northwest Atlantic (and possibly a second) that substantially pre-dates human colonization from Europe, with this native North American clade subsequently introduced to three sites in Northeast Atlantic and Mediterranean waters. However, we agree with past researchers that some sites in the Northwest Atlantic have more recently been invaded by alien haplotypes, so that some populations are currently composed of a mixture of native and invader haplotypes. © 2015 Marine Biological Laboratory.
The scope and strength of sex-specific selection in genome evolution
Wright, A E; Mank, J E
2013-01-01
Males and females share the vast majority of their genomes and yet are often subject to different, even conflicting, selection. Genomic and transcriptomic developments have made it possible to assess sex-specific selection at the molecular level, and it is clear that sex-specific selection shapes the evolutionary properties of several genomic characteristics, including transcription, post-transcriptional regulation, imprinting, genome structure and gene sequence. Sex-specific selection is strongly influenced by mating system, which also causes neutral evolutionary changes that affect different regions of the genome in different ways. Here, we synthesize theoretical and molecular work in order to provide a cohesive view of the role of sex-specific selection and mating system in genome evolution. We also highlight the need for a combined approach, incorporating both genomic data and experimental phenotypic studies, in order to understand precisely how sex-specific selection drives evolutionary change across the genome. PMID:23848139
Genomic diversity and evolution of the fish pathogen Flavobacterium psychrophilum
USDA-ARS?s Scientific Manuscript database
Flavobacterium psychrophilum, the etiological agent of rainbow trout fry syndrome and bacterial cold-water disease in salmonid fish, is currently one of the main bacterial pathogens hampering the productivity of salmonid farming worldwide. In this study, the genomic diversity of the F. psychrophilum...
Mapping human genetic diversity in Asia.
Abdulla, Mahmood Ameen; Ahmed, Ikhlak; Assawamakin, Anunchai; Bhak, Jong; Brahmachari, Samir K; Calacal, Gayvelline C; Chaurasia, Amit; Chen, Chien-Hsiun; Chen, Jieming; Chen, Yuan-Tsong; Chu, Jiayou; Cutiongco-de la Paz, Eva Maria C; De Ungria, Maria Corazon A; Delfin, Frederick C; Edo, Juli; Fuchareon, Suthat; Ghang, Ho; Gojobori, Takashi; Han, Junsong; Ho, Sheng-Feng; Hoh, Boon Peng; Huang, Wei; Inoko, Hidetoshi; Jha, Pankaj; Jinam, Timothy A; Jin, Li; Jung, Jongsun; Kangwanpong, Daoroong; Kampuansai, Jatupol; Kennedy, Giulia C; Khurana, Preeti; Kim, Hyung-Lae; Kim, Kwangjoong; Kim, Sangsoo; Kim, Woo-Yeon; Kimm, Kuchan; Kimura, Ryosuke; Koike, Tomohiro; Kulawonganunchai, Supasak; Kumar, Vikrant; Lai, Poh San; Lee, Jong-Young; Lee, Sunghoon; Liu, Edison T; Majumder, Partha P; Mandapati, Kiran Kumar; Marzuki, Sangkot; Mitchell, Wayne; Mukerji, Mitali; Naritomi, Kenji; Ngamphiw, Chumpol; Niikawa, Norio; Nishida, Nao; Oh, Bermseok; Oh, Sangho; Ohashi, Jun; Oka, Akira; Ong, Rick; Padilla, Carmencita D; Palittapongarnpim, Prasit; Perdigon, Henry B; Phipps, Maude Elvira; Png, Eileen; Sakaki, Yoshiyuki; Salvador, Jazelyn M; Sandraling, Yuliana; Scaria, Vinod; Seielstad, Mark; Sidek, Mohd Ros; Sinha, Amit; Srikummool, Metawee; Sudoyo, Herawati; Sugano, Sumio; Suryadi, Helena; Suzuki, Yoshiyuki; Tabbada, Kristina A; Tan, Adrian; Tokunaga, Katsushi; Tongsima, Sissades; Villamor, Lilian P; Wang, Eric; Wang, Ying; Wang, Haifeng; Wu, Jer-Yuarn; Xiao, Huasheng; Xu, Shuhua; Yang, Jin Ok; Shugart, Yin Yao; Yoo, Hyang-Sook; Yuan, Wentao; Zhao, Guoping; Zilfalil, Bin Alwi
2009-12-11
Asia harbors substantial cultural and linguistic diversity, but the geographic structure of genetic variation across the continent remains enigmatic. Here we report a large-scale survey of autosomal variation from a broad geographic sample of Asian human populations. Our results show that genetic ancestry is strongly correlated with linguistic affiliations as well as geography. Most populations show relatedness within ethnic/linguistic groups, despite prevalent gene flow among populations. More than 90% of East Asian (EA) haplotypes could be found in either Southeast Asian (SEA) or Central-South Asian (CSA) populations and show clinal structure with haplotype diversity decreasing from south to north. Furthermore, 50% of EA haplotypes were found in SEA only and 5% were found in CSA only, indicating that SEA was a major geographic source of EA populations.
Guo, Yong; Qiu, Li-Juan
2013-01-01
The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max). In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs) were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.
Zhang, Zhi-Yong; Wu, Rong; Wang, Qun; Zhang, Zhi-Rong; López-Pujol, Jordi; Fan, Deng-Mei; Li, De-Zhu
2013-01-01
In subtropical China, large-scale phylogeographic comparisons among multiple sympatric plants with similar ecological preferences are scarce, making generalizations about common response to historical events necessarily tentative. A phylogeographic comparison of two sympatric Chinese beeches (Fagus lucida and F. longipetiolata, 21 and 28 populations, respectively) was conducted to test whether they have responded to historical events in a concerted fashion and to determine whether their phylogeographic structure is exclusively due to Quaternary events or it is also associated with pre-Quaternary events. Twenty-three haplotypes were recovered for F. lucida and F. longipetiolata (14 each one and five shared). Both species exhibited a species-specific mosaic distribution of haplotypes, with many of them being range-restricted and even private to populations. The two beeches had comparable total haplotype diversity but F. lucida had much higher within-population diversity than F. longipetiolata. Molecular dating showed that the time to most recent common ancestor of all haplotypes was 6.36 Ma, with most haplotypes differentiating during the Quaternary. [Correction added on 14 October 2013, after first online publication: the timeunit has been corrected to ‘6.36’.] Our results support a late Miocene origin and southwards colonization of Chinese beeches when the aridity in Central Asia intensified and the monsoon climate began to dominate the East Asia. During the Quaternary, long-term isolation in subtropical mountains of China coupled with limited gene flow would have lead to the current species-specific mosaic distribution of lineages. PMID:24340187
Investigating the Genome Diversity of B. cereus and Evolutionary Aspects of B. anthracis Emergence
Papazisi, Leka; Rasko, David A.; Ratnayake, Shashikala; Bock, Geoff R.; Remortel, Brian G.; Appalla, Lakshmi; Liu, Jia; Dracheva, Tatiana; Braisted, John C.; Shallom, Shamira; Jarrahi, Benham; Snesrud, Erik; Ahn, Susie; Sun, Qiang; Rilstone, Jenifer; Økstad, Ole Andreas; Kolstø, Anne-Brit; Fleischmann, Robert D.; Peterson, Scott N.
2011-01-01
Here we report the use of a multi-genome DNA microarray to investigate the genome diversity of Bacillus cereus group members and elucidate the events associated with the emergence of B. anthracis the causative agent of anthrax–a lethal zoonotic disease. We initially performed directed genome sequencing of seven diverse B. cereus strains to identify novel sequences encoded in those genomes. The novel genes identified, combined with those publicly available, allowed the design of a “species” DNA microarray. Comparative genomic hybridization analyses of 41 strains indicates that substantial heterogeneity exists with respect to the genes comprising functional role categories. While the acquisition of the plasmid-encoded pathogenicity island (pXO1) and capsule genes (pXO2) represent a crucial landmark dictating the emergence of B. anthracis, the evolution of this species and its close relatives was associated with an overall a shift in the fraction of genes devoted to energy metabolism, cellular processes, transport, as well as virulence. PMID:21447378
Vanwonterghem, Inka; Jensen, Paul D; Rabaey, Korneel; Tyson, Gene W
2016-09-01
Our understanding of the complex interconnected processes performed by microbial communities is hindered by our inability to culture the vast majority of microorganisms. Metagenomics provides a way to bypass this cultivation bottleneck and recent advances in this field now allow us to recover a growing number of genomes representing previously uncultured populations from increasingly complex environments. In this study, a temporal genome-centric metagenomic analysis was performed of lab-scale anaerobic digesters that host complex microbial communities fulfilling a series of interlinked metabolic processes to enable the conversion of cellulose to methane. In total, 101 population genomes that were moderate to near-complete were recovered based primarily on differential coverage binning. These populations span 19 phyla, represent mostly novel species and expand the genomic coverage of several rare phyla. Classification into functional guilds based on their metabolic potential revealed metabolic networks with a high level of functional redundancy as well as niche specialization, and allowed us to identify potential roles such as hydrolytic specialists for several rare, uncultured populations. Genome-centric analyses of complex microbial communities across diverse environments provide the key to understanding the phylogenetic and metabolic diversity of these interactive communities. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.
Comparative genome analysis of Pseudomonas genomes including Populus-associated isolates
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jun, Se Ran; Wassenaar, Trudy; Nookaew, Intawat
The Pseudomonas genus contains a metabolically versatile group of organisms that are known to occupy numerous ecological niches including the rhizosphere and endosphere of many plants influencing phylogenetic diversity and heterogeneity. In this study, comparative genome analysis was performed on over one thousand Pseudomonas genomes, including 21 Pseudomonas strains isolated from the roots of native Populus deltoides. Based on average amino acid identity, genomic clusters were identified within the Pseudomonas genus, which showed agreements with clades by NCBI and cliques by IMG. The P. fluorescens group was organized into 20 distinct genomic clusters, representing enormous diversity and heterogeneity. The speciesmore » P. aeruginosa showed clear distinction in their genomic relatedness compared to other Pseudomonas species groups based on the pan and core genome analysis. The 19 isolates of our 21 Populus-associated isolates formed three distinct subgroups within the P. fluorescens major group, supported by pathway profiles analysis, while two isolates were more closely related to P. chlororaphis and P. putida. The specific genes to Populus-associated subgroups were identified where genes specific to subgroup 1 include several sensory systems such as proteins which act in two-component signal transduction, a TonB-dependent receptor, and a phosphorelay sensor; specific genes to subgroup 2 contain unique hypothetical genes; and genes specific to subgroup 3 organisms have a different hydrolase activity. IMPORTANCE The comparative genome analyses of the genus Pseudomonas that included Populus-associated isolates resulted in novel insights into high diversity of Pseudomonas. Consistent and robust genomic clusters with phylogenetic homogeneity were identified, which resolved species-clades that are not clearly defined by 16S rRNA gene sequence analysis alone. The genomic clusters may be reflective of distinct ecological niches to which the organisms have adapted, but
Comparative genome analysis of Pseudomonas genomes including Populus-associated isolates
Jun, Se Ran; Wassenaar, Trudy; Nookaew, Intawat; ...
2016-01-01
The Pseudomonas genus contains a metabolically versatile group of organisms that are known to occupy numerous ecological niches including the rhizosphere and endosphere of many plants influencing phylogenetic diversity and heterogeneity. In this study, comparative genome analysis was performed on over one thousand Pseudomonas genomes, including 21 Pseudomonas strains isolated from the roots of native Populus deltoides. Based on average amino acid identity, genomic clusters were identified within the Pseudomonas genus, which showed agreements with clades by NCBI and cliques by IMG. The P. fluorescens group was organized into 20 distinct genomic clusters, representing enormous diversity and heterogeneity. The speciesmore » P. aeruginosa showed clear distinction in their genomic relatedness compared to other Pseudomonas species groups based on the pan and core genome analysis. The 19 isolates of our 21 Populus-associated isolates formed three distinct subgroups within the P. fluorescens major group, supported by pathway profiles analysis, while two isolates were more closely related to P. chlororaphis and P. putida. The specific genes to Populus-associated subgroups were identified where genes specific to subgroup 1 include several sensory systems such as proteins which act in two-component signal transduction, a TonB-dependent receptor, and a phosphorelay sensor; specific genes to subgroup 2 contain unique hypothetical genes; and genes specific to subgroup 3 organisms have a different hydrolase activity. IMPORTANCE The comparative genome analyses of the genus Pseudomonas that included Populus-associated isolates resulted in novel insights into high diversity of Pseudomonas. Consistent and robust genomic clusters with phylogenetic homogeneity were identified, which resolved species-clades that are not clearly defined by 16S rRNA gene sequence analysis alone. The genomic clusters may be reflective of distinct ecological niches to which the organisms have adapted, but
Gombos, Z; Hermann, R; Kiviniemi, M; Nejentsev, S; Reimand, K; Fadeyev, V; Peterson, P; Uibo, R; Ilonen, J
2007-12-01
Addison's disease is an organ-specific autoimmune disorder with a polygenic background. The aim of the study was to identify non-class II human leukocyte antigen (HLA) susceptibility genes for Addison's disease. Addison's disease patients from three European populations were analysed for selected HLA-DR-DQ alleles and for 11 microsatellite markers covering approximately 4 Mb over the HLA region. Subjects were 69 patients with Addison's disease from Estonia (24), Finland (14) and Russia (31). Consecutively recruited healthy newborns from the same geographical regions were used as controls (269 Estonian, 1000 Finnish and 413 Russian). Association measures for HLA-DRB1, DQB1, DQA1 and 11 microsatellites between D6S273 and D6S2223 were taken. A low-resolution full-house typing was used for HLA class II genes, while microsatellite markers were studied using fluorescence-based DNA fragment sizing technology. We confirmed that the HLA-DR3-DQ2 and the DQB1*0302-DRB1*0404 haplotypes confer disease susceptibility. In Russian patients, we also found an increase of DRB1*0403 allele, combined with DQB1*0305 allele in three out of six cases (P<0.0001). Analysis of 11 microsatellite markers including STR MICA confirmed the strong linkage in DR3-DQ2 haplotypes but DRB1*0404-DQB1*0302 haplotypes were diverse. MICA5.1 allele was found in 22 out of 24 Estonian patients, but results from Finnish and Russian patients did not support its independent role in disease susceptibility. HLA-DRB1*0403 was identified as a novel susceptibility allele for Addison's disease. Additionally, we found no evidence of a non-class II HLA disease susceptibility locus; however, the HLA-DR3-DQ2 haplotype appeared more conserved in patient groups with high DR-DQ2 frequencies.