Sample records for hbb gene mutations

  1. Investigation of mutations in the HBB gene using the 1,000 genomes database.

    PubMed

    Carlice-Dos-Reis, Tânia; Viana, Jaime; Moreira, Fabiano Cordeiro; Cardoso, Greice de Lemos; Guerreiro, João; Santos, Sidney; Ribeiro-Dos-Santos, Ândrea

    2017-01-01

    Mutations in the HBB gene are responsible for several serious hemoglobinopathies, such as sickle cell anemia and β-thalassemia. Sickle cell anemia is one of the most common monogenic diseases worldwide. Due to its prevalence, diverse strategies have been developed for a better understanding of its molecular mechanisms. In silico analysis has been increasingly used to investigate the genotype-phenotype relationship of many diseases, and the sequences of healthy individuals deposited in the 1,000 Genomes database appear to be an excellent tool for such analysis. The objective of this study is to analyze the variations in the HBB gene in the 1,000 Genomes database, to describe the mutation frequencies in the different population groups, and to investigate the pattern of pathogenicity. The computational tool SNPEFF was used to align the data from 2,504 samples of the 1,000 Genomes database with the HG19 genome reference. The pathogenicity of each amino acid change was investigated using the databases CLINVAR, dbSNP and HbVar and five different predictors. Twenty different mutations were found in 209 healthy individuals. The African group had the highest number of individuals with mutations, and the European group had the lowest number. Thus, it is concluded that approximately 8.3% of phenotypically healthy individuals from the 1,000 Genomes database have some mutation in the HBB gene. The frequency of mutated genes was estimated at 0.042, so that the expected frequency of being homozygous or compound heterozygous for these variants in the next generation is approximately 0.002. In total, 193 subjects had a non-synonymous mutation, which 186 (7.4%) have a deleterious mutation. Considering that the 1,000 Genomes database is representative of the world's population, it can be estimated that fourteen out of every 10,000 individuals in the world will have a hemoglobinopathy in the next generation.

  2. Compound Heterozygosity for Hb Alperton (HBB: c.407C>T) and IVS-I-5 (G>C) (HBB: c.92+5G>C) Mutations Presenting as a Moderate Anemia in an Indian Family.

    PubMed

    Godbole, Koumudi G; Ramachandran, Angelina; Karkamkar, Ashwini S; Dalal, Ashwin B

    2018-04-13

    While knowledge of HBB gene mutations is necessary for offering prenatal diagnosis (PND) of β-thalassemia (β-thal), a genotype-phenotype correlation may not always be available for rare variants. We present for the first time, genotype-phenotype correlation for a compound heterozygous status with IVS-I-5 (G>C) (HBB: c.92+5G>C) and HBB: c.407C>T (Hb Alperton) mutations on the HBB gene in an Indian family. Hb Alperton is a very rare hemoglobin (Hb) variant with scant published information about its clinical presentation, especially when accompanied with another HBB gene mutation. Here we provide biochemical as well as clinical details of this variant.

  3. Rapid detection of pathological mutations and deletions of the haemoglobin beta gene (HBB) by High Resolution Melting (HRM) analysis and Gene Ratio Analysis Copy Enumeration PCR (GRACE-PCR).

    PubMed

    Turner, Andrew; Sasse, Jurgen; Varadi, Aniko

    2016-10-19

    Inherited disorders of haemoglobin are the world's most common genetic diseases, resulting in significant morbidity and mortality. The large number of mutations associated with the haemoglobin beta gene (HBB) makes gene scanning by High Resolution Melting (HRM) PCR an attractive diagnostic approach. However, existing HRM-PCR assays are not able to detect all common point mutations and have only a very limited ability to detect larger gene rearrangements. The aim of the current study was to develop a HBB assay, which can be used as a screening test in highly heterogeneous populations, for detection of both point mutations and larger gene rearrangements. The assay is based on a combination of conventional HRM-PCR and a novel Gene Ratio Analysis Copy Enumeration (GRACE) PCR method. HRM-PCR was extensively optimised, which included the use of an unlabelled probe and incorporation of universal bases into primers to prevent interference from common non-pathological polymorphisms. GRACE-PCR was employed to determine HBB gene copy numbers relative to a reference gene using melt curve analysis to detect rearrangements in the HBB gene. The performance of the assay was evaluated by analysing 410 samples. A total of 44 distinct pathological genotypes were detected. In comparison with reference methods, the assay has a sensitivity of 100 % and a specificity of 98 %. We have developed an assay that detects both point mutations and larger rearrangements of the HBB gene. This assay is quick, sensitive, specific and cost effective making it suitable as an initial screening test that can be used for highly heterogeneous cohorts.

  4. Both TALENs and CRISPR/Cas9 directly target the HBB IVS2-654 (C > T) mutation in β-thalassemia-derived iPSCs.

    PubMed

    Xu, Peng; Tong, Ying; Liu, Xiu-zhen; Wang, Ting-ting; Cheng, Li; Wang, Bo-yu; Lv, Xiang; Huang, Yue; Liu, De-pei

    2015-07-09

    β-Thalassemia is one of the most common genetic blood diseases and is caused by either point mutations or deletions in the β-globin (HBB) gene. The generation of patient-specific induced pluripotent stem cells (iPSCs) and subsequent correction of the disease-causing mutations may be a potential therapeutic strategy for this disease. Due to the low efficiency of typical homologous recombination, endonucleases, including TALENs and CRISPR/Cas9, have been widely used to enhance the gene correction efficiency in patient-derived iPSCs. Here, we designed TALENs and CRISPR/Cas9 to directly target the intron2 mutation site IVS2-654 in the globin gene. We observed different frequencies of double-strand breaks (DSBs) at IVS2-654 loci using TALENs and CRISPR/Cas9, and TALENs mediated a higher homologous gene targeting efficiency compared to CRISPR/Cas9 when combined with the piggyBac transposon donor. In addition, more obvious off-target events were observed for CRISPR/Cas9 compared to TALENs. Finally, TALENs-corrected iPSC clones were selected for erythroblast differentiation using the OP9 co-culture system and detected relatively higher transcription of HBB than the uncorrected cells. This comparison of using TALENs or CRISPR/Cas9 to correct specific HBB mutations in patient-derived iPSCs will guide future applications of TALENs- or CRISPR/Cas9-based gene therapies in monogenic diseases.

  5. Hb Midnapore [β53(D4)Ala→Val; HBB: c.161C>T]: A Novel Hemoglobin Variant with a Structural Abnormality Associated with IVS-I-5 (G>C) (HBB: c.92+5G>C) Found in a Bengali Indian Family.

    PubMed

    Panja, Amrita; Chowdhury, Prosanto; Basu, Anupam

    2016-09-01

    We describe a novel C>T substitution at codon 53 of the HBB gene (HBB: c.161C>T). The proband was a transfusion-dependent β-thalassemia major (β-TM) patient. DNA was extracted and subsequently, DNA sequencing was done to detect the mutations on the HBB gene. Capillary zone electrophoresis (CZE) revealed the presence of an unknown peak. She inherited this mutation from her grandmother through her mother. This mutation exists in cis with the common β 0 mutation IVS-I-5 (G>C) (HBB: c.92+5G>C). The proband is homozygous for HBB: c.92+5G>C and needs monthly transfusions. On the other hand, her grandmother, mother and sister all possess this novel mutation cis with the heterozygous HBB: c.92+5G>C. They are carriers not thalassemic. This mutation produces the substitution β53(D4)Ala→Val; HBB: c.161C>T, a new structural hemoglobin (Hb) variant. As this variant was identified in a Bengali family from Paschim Midnapore district of West Bengal, India, it has been designated as Hb Midnapore. This variant has now been reported to the HbVar database.

  6. Both TALENs and CRISPR/Cas9 directly target the HBB IVS2–654 (C > T) mutation in β-thalassemia-derived iPSCs

    PubMed Central

    Xu, Peng; Tong, Ying; Liu, Xiu-zhen; Wang, Ting-ting; Cheng, Li; Wang, Bo-yu; Lv, Xiang; Huang, Yue; Liu, De-pei

    2015-01-01

    β-Thalassemia is one of the most common genetic blood diseases and is caused by either point mutations or deletions in the β-globin (HBB) gene. The generation of patient-specific induced pluripotent stem cells (iPSCs) and subsequent correction of the disease-causing mutations may be a potential therapeutic strategy for this disease. Due to the low efficiency of typical homologous recombination, endonucleases, including TALENs and CRISPR/Cas9, have been widely used to enhance the gene correction efficiency in patient-derived iPSCs. Here, we designed TALENs and CRISPR/Cas9 to directly target the intron2 mutation site IVS2-654 in the globin gene. We observed different frequencies of double-strand breaks (DSBs) at IVS2-654 loci using TALENs and CRISPR/Cas9, and TALENs mediated a higher homologous gene targeting efficiency compared to CRISPR/Cas9 when combined with the piggyBac transposon donor. In addition, more obvious off-target events were observed for CRISPR/Cas9 compared to TALENs. Finally, TALENs-corrected iPSC clones were selected for erythroblast differentiation using the OP9 co-culture system and detected relatively higher transcription of HBB than the uncorrected cells. This comparison of using TALENs or CRISPR/Cas9 to correct specific HBB mutations in patient-derived iPSCs will guide future applications of TALENs- or CRISPR/Cas9-based gene therapies in monogenic diseases. PMID:26156589

  7. Seamless correction of the sickle cell disease mutation of the HBB gene in human induced pluripotent stem cells using TALENs.

    PubMed

    Sun, Ning; Zhao, Huimin

    2014-05-01

    Sickle cell disease (SCD) is the most common human genetic disease which is caused by a single mutation of human β-globin (HBB) gene. The lack of long-term treatment makes the development of reliable cell and gene therapies highly desirable. Disease-specific patient-derived human induced pluripotent stem cells (hiPSCs) have great potential for developing novel cell and gene therapies. With the disease-causing mutations corrected in situ, patient-derived hiPSCs can restore normal cell functions and serve as a renewable autologous cell source for the treatment of genetic disorders. Here we successfully utilized transcription activator-like effector nucleases (TALENs), a recently emerged novel genome editing tool, to correct the SCD mutation in patient-derived hiPSCs. The TALENs we have engineered are highly specific and generate minimal off-target effects. In combination with piggyBac transposon, TALEN-mediated gene targeting leaves no residual ectopic sequences at the site of correction and the corrected hiPSCs retain full pluripotency and a normal karyotype. Our study demonstrates an important first step of using TALENs for the treatment of genetic diseases such as SCD, which represents a significant advance toward hiPSC-based cell and gene therapies. © 2013 Wiley Periodicals, Inc.

  8. β-Thalassemia gene mutations in Antalya, Turkey: results from a single centre study.

    PubMed

    Kurtoğlu, Ayşegül; Karakuş, Volkan; Erkal, Özgür; Kurtoğlu, Erdal

    2016-11-01

    β-Thalassemia (β-thal) is a common autosomal recessive disorder resulting from over 300 different mutations of the β-globin genes. Our aim was to create a mutation map of β-thal in the province of Antalya, Turkey. In this study, mutation analysis of a total 146 of β-thal patients followed at the Thalassemia Center of the Antalya Education and Research Hospital, Antalya, Turkey, were included. Direct DNA sequence analysis was performed for mutation scanning of the β-globin gene. One hundred and forty-six patients with β-thal including all types were analyzed, and 14 different β-thal mutations were detected. The most frequently seen mutation was HBB: c.93 - 21G > A [IVS-I-110 (G > A)] (52.7%), followed by HBB: .c.92 + 6T > C [IVS-I-6 (T > C)] (14.4%), HBB: c.-80T > A [-30 (T > A)] (8.2%), HBB: c.315 + 1G > A [IVS-II-1 (G > A)] (8.2%), which made up 83.1% of the observed mutations. Our results indicate the importance of micromapping and epidemiology studies of thalassemia, which will assist in establishing the national prevention and control program in Turkey.

  9. Characterization of Deletions of the HBA and HBB Loci by Array Comparative Genomic Hybridization

    PubMed Central

    Sabath, Daniel E.; Bender, Michael A.; Sankaran, Vijay G.; Vamos, Esther; Kentsis, Alex; Yi, Hye-Son; Greisman, Harvey A.

    2017-01-01

    Thalassemia is among the most common genetic diseases worldwide. α-Thalassemia is usually caused by deletion of one or more of the duplicated HBA genes on chromosome 16. In contrast, most β-thalassemia results from point mutations that decrease or eliminate expression of the HBB gene on chromosome 11. Deletions within the HBB locus result in thalassemia or hereditary persistence of fetal Hb. Although routine diagnostic testing cannot distinguish thalassemia deletions from point mutations, deletional hereditary persistence of fetal Hb is notable for having an elevated HbF level with a normal mean corpuscular volume. A small number of deletions accounts for most α-thalassemias; in contrast, there are no predominant HBB deletions causing β-thalassemia. To facilitate the identification and characterization of deletions of the HBA and HBB globin loci, we performed array-based comparative genomic hybridization using a custom oligonucleotide microarray. We accurately mapped the breakpoints of known and previously uncharacterized HBB deletions defining previously uncharacterized deletion breakpoints by PCR amplification and sequencing. The array also successfully identified the common HBA deletions --SEA and --FIL. In summary, comparative genomic hybridization can be used to characterize deletions of the HBA and HBB loci, allowing high-resolution characterization of novel deletions that are not readily detected by PCR-based methods. PMID:26612711

  10. Combining Single Strand Oligodeoxynucleotides and CRISPR/Cas9 to Correct Gene Mutations in β-Thalassemia-induced Pluripotent Stem Cells.

    PubMed

    Niu, Xiaohua; He, Wenyin; Song, Bing; Ou, Zhanhui; Fan, Di; Chen, Yuchang; Fan, Yong; Sun, Xiaofang

    2016-08-05

    β-Thalassemia (β-Thal) is one of the most common genetic diseases in the world. The generation of patient-specific β-Thal-induced pluripotent stem cells (iPSCs), correction of the disease-causing mutations in those cells, and then differentiation into hematopoietic stem cells offers a new therapeutic strategy for this disease. Here, we designed a CRISPR/Cas9 to specifically target the Homo sapiens hemoglobin β (HBB) gene CD41/42(-CTTT) mutation. We demonstrated that the combination of single strand oligodeoxynucleotides with CRISPR/Cas9 was capable of correcting the HBB gene CD41/42 mutation in β-Thal iPSCs. After applying a correction-specific PCR assay to purify the corrected clones followed by sequencing to confirm mutation correction, we verified that the purified clones retained full pluripotency and exhibited normal karyotyping. Additionally, whole-exome sequencing showed that the mutation load to the exomes was minimal after CRISPR/Cas9 targeting. Furthermore, the corrected iPSCs were selected for erythroblast differentiation and restored the expression of HBB protein compared with the parental iPSCs. This method provides an efficient and safe strategy to correct the HBB gene mutation in β-Thal iPSCs. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Simple, efficient, and cost-effective multiplex genotyping with matrix assisted laser desorption/ionization time-of-flight mass spectrometry of hemoglobin beta gene mutations.

    PubMed

    Thongnoppakhun, Wanna; Jiemsup, Surasak; Yongkiettrakul, Suganya; Kanjanakorn, Chompunut; Limwongse, Chanin; Wilairat, Prapon; Vanasant, Anusorn; Rungroj, Nanyawan; Yenchitsomanus, Pa-Thai

    2009-07-01

    A number of common mutations in the hemoglobin beta (HBB) gene cause beta-thalassemia, a monogenic disease with high prevalence in certain ethnic groups. As there are 30 HBB variants that cover more than 99.5% of HBB mutant alleles in the Thai population, an efficient and cost-effective screening method is required. Three panels of multiplex primer extensions, followed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry were developed. The first panel simultaneously detected 21 of the most common HBB mutations, while the second panel screened nine additional mutations, plus seven of the first panel for confirmation; the third panel was used to confirm three HBB mutations, yielding a 9-Da mass difference that could not be clearly distinguished by the previous two panels. The protocol was both standardized using 40 samples of known genotypes and subsequently validated in 162 blind samples with 27 different genotypes (including a normal control), comprising heterozygous, compound heterozygous, and homozygous beta-thalassemia. Results were in complete agreement with those from the genotyping results, conducted using three different methods overall. The method developed here permitted the detection of mutations missed using a single genotyping procedure. The procedure should serve as the method of choice for HBB genotyping due to its accuracy, sensitivity, and cost-effectiveness, and can be applied to studies of other gene variants that are potential disease biomarkers.

  12. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  13. High resolution melting curve analysis targeting the HBB gene mutational hot-spot offers a reliable screening approach for all common as well as most of the rare beta-globin gene mutations in Bangladesh.

    PubMed

    Islam, Md Tarikul; Sarkar, Suprovath Kumar; Sultana, Nusrat; Begum, Mst Noorjahan; Bhuyan, Golam Sarower; Talukder, Shezote; Muraduzzaman, A K M; Alauddin, Md; Islam, Mohammad Sazzadul; Biswas, Pritha Promita; Biswas, Aparna; Qadri, Syeda Kashfi; Shirin, Tahmina; Banu, Bilquis; Sadya, Salma; Hussain, Manzoor; Sarwardi, Golam; Khan, Waqar Ahmed; Mannan, Mohammad Abdul; Shekhar, Hossain Uddin; Chowdhury, Emran Kabir; Sajib, Abu Ashfaqur; Akhteruzzaman, Sharif; Qadri, Syed Saleheen; Qadri, Firdausi; Mannoor, Kaiissar

    2018-01-02

    Bangladesh lies in the global thalassemia belt, which has a defined mutational hot-spot in the beta-globin gene. The high carrier frequencies of beta-thalassemia trait and hemoglobin E-trait in Bangladesh necessitate a reliable DNA-based carrier screening approach that could supplement the use of hematological and electrophoretic indices to overcome the barriers of carrier screening. With this view in mind, the study aimed to establish a high resolution melting (HRM) curve-based rapid and reliable mutation screening method targeting the mutational hot-spot of South Asian and Southeast Asian countries that encompasses exon-1 (c.1 - c.92), intron-1 (c.92 + 1 - c.92 + 130) and a portion of exon-2 (c.93 - c.217) of the HBB gene which harbors more than 95% of mutant alleles responsible for beta-thalassemia in Bangladesh. Our HRM approach could successfully differentiate ten beta-globin gene mutations, namely c.79G > A, c.92 + 5G > C, c.126_129delCTTT, c.27_28insG, c.46delT, c.47G > A, c.92G > C, c.92 + 130G > C, c.126delC and c.135delC in heterozygous states from the wild type alleles, implying the significance of the approach for carrier screening as the first three of these mutations account for ~85% of total mutant alleles in Bangladesh. Moreover, different combinations of compound heterozygous mutations were found to generate melt curves that were distinct from the wild type alleles and from one another. Based on the findings, sixteen reference samples were run in parallel to 41 unknown specimens to perform direct genotyping of the beta-thalassemia specimens using HRM. The HRM-based genotyping of the unknown specimens showed 100% consistency with the sequencing result. Targeting the mutational hot-spot, the HRM approach could be successfully applied for screening of beta-thalassemia carriers in Bangladesh as well as in other countries of South Asia and Southeast Asia. The approach could be a useful supplement of hematological and

  14. IVS-II-648/649 (-T) (HBB: c.316-202del) Triggers a Novel β-Thalassemia Phenotype.

    PubMed

    Azimi, Azam; Alibakhshi, Reza; Hayati, Hasibeh; Tahmasebi, Soosan; Alimoradi, Sasan

    2017-01-01

    Thalassemia is the most common inherited disorder in Iran. There are approximately 800 different genomic alterations of the β-globin gene described in the HbVar database. In this study, we identified a novel mutation in a 21-year-old woman [IVS-II-648/649 (-T); HBB: c.316-202del)] and describe its clinical implications. Two other members of this family, all with hematological and clinical features associated with β-thalassemia (β-thal), also carried this mutation. The molecular diagnosis of the β-globin gene mutation was performed by direct sequencing. Based on the observed β-thal phenotype and in silico analysis results, we concluded that this novel β-globin gene mutation was associated with the mild phenotype of β-thal.

  15. Mutational Profile of Homozygous β-Thalassemia in Rio de Janeiro, Brazil.

    PubMed

    Carrocini, Gisele C S; Venancio, Larissa P R; Pessoa, Viviani L R; Lobo, Clarisse L C; Bonini-Domingos, Claudia R

    2017-01-01

    β-Thalassemia (β-thal) is a hemolytic anemia that is caused by point mutations in most cases. The Brazilian population is highly heterogeneous and knowledge of the mutations that make up the genotypic profile of individuals can contribute information about the formation of the population and clinical condition of patients. In this study, we evaluated the mutations present in homozygous β-thal patients from Rio de Janeiro, Brazil. We analyzed 24 samples of peripheral blood of patients with homozygous β-thal. To identify the mutations, we carried out allele-specific-polymerase chain reaction (AS-PCR) and DNA sequencing. We found 11 different mutations on the β-globin gene. Among the most frequent mutations observed were HBB: c.92 + 6T>C, followed by HBB: c.93-21G>A, HBB: c.118C>T and HBB: c.92 + 1G>A. We also identified the rare mutation HBB: c.75T>A that was reported in an individual carrying Hb S (HBB: c.20A>T)/β-thal (HBB: c.75T>A) but not in Brazilian thalassemic patients, thus, this is the first report of this mutation in Brazilian β-thal patients. For its multiethnic character, Brazil has different mutations that cause β-thal and that are distributed with different frequencies according to the regions of the country. Our findings contribute to the description of the mutational profile of Brazilian thalassemic patients, showing wide heterogeneity and genetic variability.

  16. Production of Gene-Corrected Adult Beta Globin Protein in Human Erythrocytes Differentiated from Patient iPSCs After Genome Editing of the Sickle Point Mutation.

    PubMed

    Huang, Xiaosong; Wang, Ying; Yan, Wei; Smith, Cory; Ye, Zhaohui; Wang, Jing; Gao, Yongxing; Mendelsohn, Laurel; Cheng, Linzhao

    2015-05-01

    Human induced pluripotent stem cells (iPSCs) and genome editing provide a precise way to generate gene-corrected cells for disease modeling and cell therapies. Human iPSCs generated from sickle cell disease (SCD) patients have a homozygous missense point mutation in the HBB gene encoding adult β-globin proteins, and are used as a model system to improve strategies of human gene therapy. We demonstrate that the CRISPR/Cas9 system designer nuclease is much more efficient in stimulating gene targeting of the endogenous HBB locus near the SCD point mutation in human iPSCs than zinc finger nucleases and TALENs. Using a specific guide RNA and Cas9, we readily corrected one allele of the SCD HBB gene in human iPSCs by homologous recombination with a donor DNA template containing the wild-type HBB DNA and a selection cassette that was subsequently removed to avoid possible interference of HBB transcription and translation. We chose targeted iPSC clones that have one corrected and one disrupted SCD allele for erythroid differentiation assays, using an improved xeno-free and feeder-free culture condition we recently established. Erythrocytes from either the corrected or its parental (uncorrected) iPSC line were generated with similar efficiencies. Currently ∼6%-10% of these differentiated erythrocytes indeed lacked nuclei, characteristic of further matured erythrocytes called reticulocytes. We also detected the 16-kDa β-globin protein expressed from the corrected HBB allele in the erythrocytes differentiated from genome-edited iPSCs. Our results represent a significant step toward the clinical applications of genome editing using patient-derived iPSCs to generate disease-free cells for cell and gene therapies. Stem Cells 2015;33:1470-1479. © 2015 AlphaMed Press.

  17. The effects of old and recent migration waves in the distribution of HBB*S globin gene haplotypes

    PubMed Central

    Lindenau, Juliana D.; Wagner, Sandrine C.; de Castro, Simone M.; Hutz, Mara H.

    2016-01-01

    Abstract Sickle cell hemoglobin is the result of a mutation at the sixth amino acid position of the beta (β) globin chain. The HBB*S gene is in linkage disequilibrium with five main haplotypes in the β-globin-like gene cluster named according to their ethnic and geographic origins: Bantu (CAR), Benin (BEN), Senegal (SEN), Cameroon (CAM) and Arabian-Indian (ARAB). These haplotypes demonstrated that the sickle cell mutation arose independently at least five times in human history. The distribution of βS haplotypes among Brazilian populations showed a predominance of the CAR haplotype. American populations were clustered in two groups defined by CAR or BEN haplotype frequencies. This scenario is compatible with historical records about the slave trade in the Americas. When all world populations where the sickle cell gene occurs were analyzed, three clusters were disclosed based on CAR, BEN or ARAB haplotype predominance. These patterns may change in the next decades due to recent migrations waves. Since these haplotypes show different clinical characteristics, these recent migrations events raise the necessity to develop optimized public health programs for sickle cell disease screening and management. PMID:27706371

  18. Molecular Characterization of β-Thalassemia Mutations in Central Vietnam.

    PubMed

    Doro, Maria G; Casu, Giuseppina; Frogheri, Laura; Persico, Ivana; Triet, Le Phan Minh; Hoa, Phan Thi Thuy; Hoang, Nguyen Huy; Pirastru, Monica; Mereu, Paolo; Cucca, Francesco; Masala, Bruno

    2017-03-01

    The molecular basis of β-thalassemia (β-thal) mutations in North and in South Vietnam have been described during the past 15 years, whereas limited data were available concerning the central area of the country. In this study, we describe the molecular characterization and frequency of β-globin gene mutations in the Thua Thien Hue Province of Central Vietnam as the result of a first survey conducted in 22 transfusion-dependent patients, and four unrelated heterozygotes. Nine different known mutations were identified (seven of the β 0 and two of the β + type) in a total of 48 chromosomes. The most common was codon 26 (G>A) or Hb E (HBB: c.79 G>A) accounting for 29.2% of the total studied chromosomes, followed by codon 17 (A>T) (HBB: c.52 A>T) (25.0%), and codons 41/42 (-TTCT) (HBB: c.126_129delCTTT) (18.8%). Other mutations with appreciable frequencies (6.3-8.3%) were IVS-I-1 (G>T) (HBB: c.92+1 G>T), codon 26 (G>T) (HBB: c.79 G>T) and codons 71/72 (+A) (HBB: c.216_217insA). Relatively rarer (2.0%) were the promoter -28 (A>G) (HBB: c.78 A>G) mutation, the codon 95 (+A) (HBB: c.287_288insA), which is reported only in the Vietnamese, and the codons 14/15 (+G) (HBB: c.45_46insG) mutation, thus far observed only in Thailand. Results are relevant for implementing appropriate measures for β-thal prevention and control in the region as well as in the whole country.

  19. Hb Mozhaisk [β92(F8)His→Arg; HBB: c.278A>G] as a De Novo Mutation in a Child of Mixed Ethnic Origins.

    PubMed

    Benzoni, Elena; Giannone, Valentina; Michetti, Laura; Seia, Manuela; Cavalleri, Laura; Curcio, Cristina

    Approximately 150 variants described in the HbVar database have been found to be unstable and about 80.0% of these are on the β-globin gene. We describe the case of a 3-year-old child who presented at the emergency room with fever and asthenia. Hematological data suggested severe hemolytic anemia. Sequencing of the β-globin gene revealed the mutation HBB: c.278A>G at codon 92 in a heterozygous state, reported as Hb Mozhaisk in the HbVar database. Other family members did not have Hb Mozhaisk, thus, this variant is due to a de novo mutation. Because of the rarity of this globin variant, we believe it is important to report similar cases, to have a more complete phenotype description of the pathology and define an adequate reproductive risk for couples, considering the dominant inheritance pattern (hence an inheritance risk of 50.0%).

  20. High Frequency of Hb E-Saskatoon (HBB: c.67G > A) in Brazilians: A New Genetic Origin?

    PubMed

    Wagner, Sandrine C; Lindenau, Juliana D; Castro, Simone M de; Santin, Ana Paula; Zaleski, Carina F; Azevedo, Laura A; Ribeiro Dos Santos, Ândrea K C; Dos Santos, Sidney E B; Hutz, Mara H

    2016-08-01

    Hb E-Saskatoon [β22(B4)Glu→Lys, HBB: c.67G > A] is a rare, nonpathological β-globin variant that was first described in a Canadian woman of Scottish and Dutch ancestry and has since then been detected in several populations. The aim of the present study was to identify the origin of Hb E-Saskatoon in Brazil using β-globin haplotypes and genetic ancestry in carriers of this hemoglobin (Hb) variant. Blood samples were investigated by isoelectric focusing (IEF) and high performance liquid chromatography (HPLC) using commercial kits. Hb E-Saskatoon was confirmed by amplification of the HBB gene, followed by sequence analysis. Haplotypes of the β-globin gene were determined by polymerase chain reaction (PCR), followed by digestion with specific restriction enzymes. Individual ancestry was estimated with 48 biallelic insertion/deletions using three 16-plex PCR amplifications. The IEF pattern was similar to Hbs C (HBB: c.19G > A) and Hb E (HBB: c.79G > A) [isoelectric point (pI): 7.59-7.65], and HPLC results showed an elution in the Hb S (HBB: c.20A > T) window [retention time (RT): 4.26-4.38]. DNA sequencing of the amplified β-globin gene showed a mutation at codon 22 (GAA>AAA) corresponding to Hb E-Saskatoon. A total of 11 cases of this variant were identified. In nine unrelated individuals, Hb E-Saskatoon was in linkage disequilibrium with haplotype 2 [+ - - - -]. All subjects showed a high degree of European contribution (mean = 0.85). Hb E-Saskatoon occurred on the β-globin gene of haplotype 2 in all Brazilian carriers. These findings suggest a different genetic origin for this Hb variant from that previously described.

  1. African gene flow to north Brazil as revealed by HBB*S gene haplotype analysis.

    PubMed

    Lemos Cardoso, Greice; Farias Guerreiro, João

    2006-01-01

    Haplotypes linked to the HBB*S gene were analyzed in a sample of 260 chromosomes of Brazilian sickle cell anemia patients from the population of Belém, state of Pará, to evaluate if the present-day haplotype frequencies correlate as well as expected with historical information on the geographic origin of African slaves sent directly to Northern Brazil. The HBB*S gene haplotype distribution (66% Bantu, 21.8% Benin, 10.9% Senegal, and 1.3% Cameroon) is in agreement with those observed for other Brazilian populations regarding the highest proportion of the Bantu type, followed by the Benin type, but it differs significantly concerning the Senegal type as this haplotype is rare or absent in samples from other Brazilian regions already studied. In addition, our results are in accordance with historical records that establish that about 90% of the slaves sent to Northern Brazil were from Angola, Congo, and Mozambique, where the Bantu haplotype predominates, in contrast to 10% of slaves from Senegambia, Guine-Bissau, and Cape Verde, where the Senegal haplotype is the most common. On the other hand, the observed frequency of the Benin haplotype in Belém was much higher than that expected by historical data. This fact corroborates the suggestion that the high prevalence of the Benin type in Belém is due to domestic slave trade and later internal migrations, mainly from the Northeast, since there are no historical records of direct slave trade from Central West Africa to North Brazil. Am. J. Hum. Biol. 18:93-98, 2006. (c) 2005 Wiley-Liss, Inc.

  2. Coinheritance of a novel mutation on the HBA1 gene: c.187delG (p.W62fsX66) [codon 62 (-G) (α1)] with the α212 patchwork allele and Hb S [β6(A3)Glu→Val, GAG>GTG; HBB: c.20A>T].

    PubMed

    Scheps, Karen G; De Paula, Silvia M; Bitsman, Alicia R; Freigeiro, Daniel H; Basack, F Nora; Pennesi, Sandra P; Varela, Viviana

    2013-01-01

    We describe a novel frameshift mutation on the HBA1 gene (c.187delG), causative of α-thalassemia (α-thal) in a Black Cuban family with multiple sequence variants in the HBA genes and the Hb S [β6(A3)Glu→Val, GAG>GTG; HBB: c.20A>T] mutation. The deletion of the first base of codon 62 resulted in a frameshift at amino acid 62 with a putative premature termination codon (PTC) at amino acid 66 on the same exon (p.W62fsX66), which most likely triggers nonsense mediated decay of the resulting mRNA. This study also presents the first report of the α212 patchwork allele in Latin America and the description of two new sequence variants in the HBA2 region (c.-614G>A in the promoter region and c.95+39 C>T on the first intron).

  3. Hb Moscva [β24(B6)Gly→Asp (GGT>GAT), HBB: c.74G>A]: An Unstable Hemoglobin Newly Detected as a De Novo Mutation in a Mauritanian Patient.

    PubMed

    Ghaber, Sidi M; Trabelsi, Nawel; Salem, Mohamed L; Haddad, Faten; Abba, Aminetou; Darragi, Imen; Abbes, Salem

    2018-01-01

    Unstable hemoglobins (Hbs) are a group of Hb disorders that could be the origin of chronic hemolytic anemia. Most of these disorders are caused by point mutations taking place in the globin genes and affecting the stability of the Hb molecule. They are inherited as autosomal dominant diseases and described worldwide. Herein we report a new observation of an unstable variant in the Mauritanian population. The patient was a young girl of Mauritanian origin. She presented with chronic hemolytic anemia with an unknown etiology after being referred to several medical centers. Laboratory investigations based on routine analyses, capillary electrophoresis (CE), cation exchange high performance liquid chromatography (HPLC) and DNA sequencing revealed an abnormal unstable Hb known as Hb Moscva [β24(B6)Gly→Asp (GGT>GAT), HBB: c.74G>A] that occurred as a de novo mutation newly detected in an African girl of Mauritanian origin.

  4. A comprehensive review of the prevalence of beta globin gene variations and the co-inheritance of related gene variants in Saudi Arabians with beta-thalassemia

    PubMed Central

    Alaithan, Mousa A.; AbdulAzeez, Sayed; Borgio, J. Francis

    2018-01-01

    Beta-thalassemia is a genetic disorder that is caused by variations in the beta-hemoglobin (HBB) gene. Saudi Arabia is among the countries most affected by beta-thalassemia, and this is particularly problematic in the Eastern regions. This review article is an attempt to compile all the reported mutations to facilitate further national-level studies to prepare a Saudi repository of HBB gene variations. In Saudi Arabians, IVSI-5 (G>C) and Cd 39 (C>T) are the most prevalent HBB gene variations out of 42 variations. The coinheritance of HBB gene variations with ATRX, HBA1, HBA2, HBA12, AHSP, and KLF1 gene variations were observed to be common in the Saudi population. National surveys on the molecular nature of hemoglobinopathies should be set up through collaborations between research centers from various regions to create a well-documented molecular data bank. This data bank can be used to develop a premarital screening program and lead to the best treatment and prevention strategies for beta-thalassemia. PMID:29619482

  5. Hb Alesha [β67(E11)Val→Met (GTG>ATG); HBB: c.202G > A] Found in a Chinese Girl.

    PubMed

    Jiang, Hua; Yan, Jin-Mei; Zhou, Jian-Ying; Li, Dong-Zhi

    2016-11-01

    Mutations that cause destabilization of the hemoglobin (Hb) tetramer are a rare cause of hemolytic anemia. In contrast to the hemolytic anemia caused by enzyme deficiencies, a dominant mode of inheritance characterizes the unstable Hbs. Hb Alesha [β67(E11)Val→Met; HBB: c.202G>A] is caused by a G>A mutation at codon 67 of the β-globin gene, resulting in a valine to methionine substitution at helix E11. This replacement disrupts the apolar bonds between valine and the heme group, producing an unstable Hb and severe hemolysis. We report this rare hemoglobinopathy in a Chinese girl with severe hemolytic anemia, splenomegaly and frequent requirement for red blood cell (RBC) transfusions.

  6. Population-Based Genetic Study of β-Thalassemia Mutations in Mardan Division, Khyber Pakhtunkhwa Province, Pakistan.

    PubMed

    Muhammad, Raj; Shakeel, Muhammad; Rehman, Shoaib U; Lodhi, Muhammad A

    2017-03-01

    β-Thalassemia (β-thal) is the most prevalent hereditary blood disorder in Pakistan with a carrier rate of 5.0-8.0%. The homozygous affected children require frequent blood transfusions for their survival. This autosomal recessive disease can only be prevented through awareness programs, carrier screening, mutation detection, genetic counseling and prenatal diagnosis (PND). The present study aimed to determine the prevalence of various mutations causing β-thal and also to detect carriers of these mutations in families living in the Mardan Division, Khyber Pakhtunkhwa (KP) Province, Pakistan. The study was conducted at the Department of Biochemistry, Abdul Wali Khan University Mardan, Pakistan. Blood samples of β-thalassemic families were collected from various transfusion centers in Mardan Division. Using the amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) technique, all samples were analyzed for the six most common mutations causing β-thal in this area. Six different mutant primers for the detection of different mutations were used. The most common mutations detected in thalassemic patients were frameshift codons (FSC) 8/9 (+G) (HBB: c.27_28insG), codons 41/42 (-TTCT) (HBB: c.126_129delCTTT), and IVS-I-5 (G>C) (HBB: c.92+5G>C). The predominant mutation for carrying the mutant genes for β-thal were FSC 8/9, IVS-I-5, codons 41/42, IVS-I-1. It was also found that 66.7% of marriages were consanguineous. The FSC 8/9 mutation was found to be the most common β-thal mutation with a frequency of 44.4%. This research project provides a strong incentive for the establishment of large scale mutation detection and PND services in the Mardan Division.

  7. In Silico Analysis of Single Nucleotide Polymorphism (SNPs) in Human β-Globin Gene

    PubMed Central

    Alanazi, Mohammed; Abduljaleel, Zainularifeen; Khan, Wajahatullah; Warsy, Arjumand S.; Elrobh, Mohamed; Khan, Zahid; Amri, Abdullah Al; Bazzi, Mohammad D.

    2011-01-01

    Single amino acid substitutions in the globin chain are the most common forms of genetic variations that produce hemoglobinopathies- the most widespread inherited disorders worldwide. Several hemoglobinopathies result from homozygosity or compound heterozygosity to beta-globin (HBB) gene mutations, such as that producing sickle cell hemoglobin (HbS), HbC, HbD and HbE. Several of these mutations are deleterious and result in moderate to severe hemolytic anemia, with associated complications, requiring lifelong care and management. Even though many hemoglobinopathies result from single amino acid changes producing similar structural abnormalities, there are functional differences in the generated variants. Using in silico methods, we examined the genetic variations that can alter the expression and function of the HBB gene. Using a sequence homology-based Sorting Intolerant from Tolerant (SIFT) server we have searched for the SNPs, which showed that 200 (80%) non-synonymous polymorphism were found to be deleterious. The structure-based method via PolyPhen server indicated that 135 (40%) non-synonymous polymorphism may modify protein function and structure. The Pupa Suite software showed that the SNPs will have a phenotypic consequence on the structure and function of the altered protein. Structure analysis was performed on the key mutations that occur in the native protein coded by the HBB gene that causes hemoglobinopathies such as: HbC (E→K), HbD (E→Q), HbE (E→K) and HbS (E→V). Atomic Non-Local Environment Assessment (ANOLEA), Yet Another Scientific Artificial Reality Application (YASARA), CHARMM-GUI webserver for macromolecular dynamics and mechanics, and Normal Mode Analysis, Deformation and Refinement (NOMAD-Ref) of Gromacs server were used to perform molecular dynamics simulations and energy minimization calculations on β-Chain residue of the HBB gene before and after mutation. Furthermore, in the native and altered protein models, amino acid residues

  8. Genetic Background of the Sickle Cell Disease Pediatric Population of Dakar, Senegal, and Characterization of a Novel Frameshift β-Thalassemia Mutation [HBB: c.265_266del; p.Leu89Glufs*2].

    PubMed

    Gueye Tall, Fatou; Martin, Cyril; Malick Ndour, El Hadji; Déme Ly, Indou; Renoux, Céline; Chillotti, Louis; Veyrenche, Nicolas; Connes, Philippe; Madieye Gueye, Papa; Ndiaye Diallo, Rokhaya; Lacan, Philippe; Diagne, Ibrahima; Amadou Diop, Pape; Cissé, Aynina; Lopez Sall, Philomène; Joly, Philippe

    2017-03-01

    Sickle cell disease is a genetic disorder with a large variability in the pattern and severity of clinical manifestations. Different genetic modulators have been identified but very few epidemiologic data are available on these modifier genes in Senegal. This study aimed to determine their prevalence in a Senegalese sickle cell disease pediatric population. The following genetic parameters were genotyped in 295 sickle cell disease children of the Dakar pediatric hospital: sickle cell disease genotype [β S /β S (HBB: c.20A>T), β S /β C (HBB: c.19G>A), β S /β 0 -thalassemia (β 0 -thal)], XmnI polymorphism, the five most common α-thalassemia (α-thal) deletions and the A(-) and Betica glucose-6-phosphate-dehydrogenase (G6PD) deficient variants. Despite very few β S /β C and β S /β 0 -thal children (1.0% each), a novel frameshift β 0 -thal mutation was characterized: HBB: c.265_266del; p.Leu89Glufs*2. The -α 3.7 (rightward) deletion was the only α-thal deletion identified in this cohort (12.0% allelic frequency). Most of β S /β S patients (61.9%) were homozygous for the XmnI polymorphism and assumed to carry a Senegal/Senegal β S haplotype. The remaining haplotypes were predominantly of the Benin type. While the Betica G6PD variant was quite frequent (13.0%), a low frequency of the A(-) variant was detected (1.0-2.0%). The systematic genotyping of the -α 3.7 deletion and of the G6PD Betica variant in sickle cell disease patients from Senegal could be useful to identify patients at risk for several complications, such as cerebral vasculopathy, where it has been demonstrated that a normal α-globin genotype and G6PD deficiency are predisposing factors. These patients should be eligible for a transcranial Doppler examination that is not routinely offered in Senegal.

  9. Repeated evolution of chimeric fusion genes in the β-globin gene family of laurasiatherian mammals.

    PubMed

    Gaudry, Michael J; Storz, Jay F; Butts, Gary Tyler; Campbell, Kevin L; Hoffmann, Federico G

    2014-05-09

    The evolutionary fate of chimeric fusion genes may be strongly influenced by their recombinational mode of origin and the nature of functional divergence between the parental genes. In the β-globin gene family of placental mammals, the two postnatally expressed δ- and β-globin genes (HBD and HBB, respectively) have a propensity for recombinational exchange via gene conversion and unequal crossing-over. In the latter case, there are good reasons to expect differences in retention rates for the reciprocal HBB/HBD and HBD/HBB fusion genes due to thalassemia pathologies associated with the HBD/HBB "Lepore" deletion mutant in humans. Here, we report a comparative genomic analysis of the mammalian β-globin gene cluster, which revealed that chimeric HBB/HBD fusion genes originated independently in four separate lineages of laurasiatherian mammals: Eulipotyphlans (shrews, moles, and hedgehogs), carnivores, microchiropteran bats, and cetaceans. In cases where an independently derived "anti-Lepore" duplication mutant has become fixed, the parental HBD and/or HBB genes have typically been inactivated or deleted, so that the newly created HBB/HBD fusion gene is primarily responsible for synthesizing the β-type subunits of adult and fetal hemoglobin (Hb). Contrary to conventional wisdom that the HBD gene is a vestigial relict that is typically inactivated or expressed at negligible levels, we show that HBD-like genes often encode a substantial fraction (20-100%) of β-chain Hbs in laurasiatherian taxa. Our results indicate that the ascendancy or resuscitation of genes with HBD-like coding sequence requires the secondary acquisition of HBB-like promoter sequence via unequal crossing-over or interparalog gene conversion. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  10. Beta thalassemia in 31,734 cases with HBB gene mutations: Pathogenic and structural analysis of the common mutations; Iran as the crossroads of the Middle East.

    PubMed

    Mahdieh, Nejat; Rabbani, Bahareh

    2016-11-01

    Thalassemia is one of the most common single gene disorders worldwide. Nearly 80 to 90 million with minor beta thalassemia and 60-70 thousand affected infants are born annually worldwide. A comprehensive search on several databases including PubMed, InterScience, British Library Direct, and Science Direct was performed extracting papers about mutation detection and frequency of beta thalassemia. All papers reporting on the mutation frequency of beta thalassemia patients were selected to analyze the frequency of mutations in different regions and various ethnicities. Mutations of 31,734 individuals were identified. Twenty common mutations were selected for further analysis. Genotype-phenotype correlation, interactome, and in silico analyses of the mutations were performed using available bioinformatics tools. Secondary structure prediction was achieved for two common mutations with online tools. The mutations were also common among the countries neighboring Iran, which are responsible for 71% to 98% of mutations. Computational analyses could be used in addition to segregation and expression analysis to assess the extent of pathogenicity of the variant. The genetics of beta thalassemia in Iran is more extensively heterogeneous than in neighboring countries. Some common mutations have arisen historically from Iran and moved to other populations due to population migrations. Also, due to genetic drift, the frequencies of some mutations have increased in small populations. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. CRISPR/Cas9-mediated gene editing in human tripronuclear zygotes.

    PubMed

    Liang, Puping; Xu, Yanwen; Zhang, Xiya; Ding, Chenhui; Huang, Rui; Zhang, Zhen; Lv, Jie; Xie, Xiaowei; Chen, Yuxi; Li, Yujing; Sun, Ying; Bai, Yaofu; Songyang, Zhou; Ma, Wenbin; Zhou, Canquan; Huang, Junjiu

    2015-05-01

    Genome editing tools such as the clustered regularly interspaced short palindromic repeat (CRISPR)-associated system (Cas) have been widely used to modify genes in model systems including animal zygotes and human cells, and hold tremendous promise for both basic research and clinical applications. To date, a serious knowledge gap remains in our understanding of DNA repair mechanisms in human early embryos, and in the efficiency and potential off-target effects of using technologies such as CRISPR/Cas9 in human pre-implantation embryos. In this report, we used tripronuclear (3PN) zygotes to further investigate CRISPR/Cas9-mediated gene editing in human cells. We found that CRISPR/Cas9 could effectively cleave the endogenous β-globin gene (HBB). However, the efficiency of homologous recombination directed repair (HDR) of HBB was low and the edited embryos were mosaic. Off-target cleavage was also apparent in these 3PN zygotes as revealed by the T7E1 assay and whole-exome sequencing. Furthermore, the endogenous delta-globin gene (HBD), which is homologous to HBB, competed with exogenous donor oligos to act as the repair template, leading to untoward mutations. Our data also indicated that repair of the HBB locus in these embryos occurred preferentially through the non-crossover HDR pathway. Taken together, our work highlights the pressing need to further improve the fidelity and specificity of the CRISPR/Cas9 platform, a prerequisite for any clinical applications of CRSIPR/Cas9-mediated editing.

  12. The Combination of CRISPR/Cas9 and iPSC Technologies in the Gene Therapy of Human β-thalassemia in Mice.

    PubMed

    Ou, Zhanhui; Niu, Xiaohua; He, Wenyin; Chen, Yuchang; Song, Bing; Xian, Yexing; Fan, Di; Tang, Daolin; Sun, Xiaofang

    2016-09-01

    β-thalassemia results from point mutations or small deletions in the β-globin (HBB) gene that ultimately cause anemia. The generation of induced pluripotent stem cells (iPSCs) from the somatic cells of patients in combination with subsequent homologous recombination-based gene correction provides new approaches to cure this disease. CRISPR/Cas9 is a genome editing tool that is creating a buzz in the scientific community for treating human diseases, especially genetic disorders. Here, we reported that correction of β-thalassemia mutations in patient-specific iPSCs using the CRISPR/Cas9 tool promotes hematopoietic differentiation in vivo. CRISPR/Cas9-corrected iPSC-derived hematopoietic stem cells (HSCs) were injected into sublethally-irradiated NOD-scid-IL2Rg-/- (NSI) mice. HBB expression was observed in these HSCs after hematopoietic differentiation in the NSI mice. Importantly, no tumor was found in the livers, lungs, kidneys, or bone marrow at 10 weeks in the NSI mice after implantation with these HSCs. Collectively, our findings demonstrated that CRISPR/Cas9 successfully corrects β-thalassemia mutations in patient-specific iPSCs. These CRISPR/Cas9-corrected iPSC-derived HSCs express normal HBB in mice without tumorigenic potential, suggesting a safe strategy for personalized treatment of β-thalassemia.

  13. Correction of β-thalassemia mutant by base editor in human embryos.

    PubMed

    Liang, Puping; Ding, Chenhui; Sun, Hongwei; Xie, Xiaowei; Xu, Yanwen; Zhang, Xiya; Sun, Ying; Xiong, Yuanyan; Ma, Wenbin; Liu, Yongxiang; Wang, Yali; Fang, Jianpei; Liu, Dan; Songyang, Zhou; Zhou, Canquan; Huang, Junjiu

    2017-11-01

    β-Thalassemia is a global health issue, caused by mutations in the HBB gene. Among these mutations, HBB -28 (A>G) mutations is one of the three most common mutations in China and Southeast Asia patients with β-thalassemia. Correcting this mutation in human embryos may prevent the disease being passed onto future generations and cure anemia. Here we report the first study using base editor (BE) system to correct disease mutant in human embryos. Firstly, we produced a 293T cell line with an exogenous HBB -28 (A>G) mutant fragment for gRNAs and targeting efficiency evaluation. Then we collected primary skin fibroblast cells from a β-thalassemia patient with HBB -28 (A>G) homozygous mutation. Data showed that base editor could precisely correct HBB -28 (A>G) mutation in the patient's primary cells. To model homozygous mutation disease embryos, we constructed nuclear transfer embryos by fusing the lymphocyte or skin fibroblast cells with enucleated in vitro matured (IVM) oocytes. Notably, the gene correction efficiency was over 23.0% in these embryos by base editor. Although these embryos were still mosaic, the percentage of repaired blastomeres was over 20.0%. In addition, we found that base editor variants, with narrowed deamination window, could promote G-to-A conversion at HBB -28 site precisely in human embryos. Collectively, this study demonstrated the feasibility of curing genetic disease in human somatic cells and embryos by base editor system.

  14. The genetic basis of asymptomatic codon 8 frame-shift (HBB:c25_26delAA) β(0) -thalassaemia homozygotes.

    PubMed

    Jiang, Zhihua; Luo, Hong-Yuan; Huang, Shengwen; Farrell, John J; Davis, Lance; Théberge, Roger; Benson, Katherine A; Riolueang, Suchada; Viprakasit, Vip; Al-Allawi, Nasir A S; Ünal, Sule; Gümrük, Fatma; Akar, Nejat; Başak, A Nazli; Osorio, Leonor; Badens, Catherine; Pissard, Serge; Joly, Philippe; Campbell, Andrew D; Gallagher, Patrick G; Steinberg, Martin H; Forget, Bernard G; Chui, David H K

    2016-03-01

    Two 21-year old dizygotic twin men of Iraqi descent were homozygous for HBB codon 8, deletion of two nucleotides (-AA) frame-shift β(0) -thalassaemia mutation (FSC8; HBB:c25_26delAA). Both were clinically well, had splenomegaly, and were never transfused. They had mild microcytic anaemia (Hb 120-130 g/l) and 98% of their haemoglobin was fetal haemoglobin (HbF). Both were carriers of Hph α-thalassaemia mutation. On the three major HbF quantitative trait loci (QTL), the twins were homozygous for G>A HBG2 Xmn1 site at single nucleotide polymorphism (SNP) rs7482144, homozygous for 3-bp deletion HBS1L-MYB intergenic polymorphism (HMIP) at rs66650371, and heterozygous for the A>C BCL11A intron 2 polymorphism at rs766432. These findings were compared with those found in 22 other FSC8 homozygote patients: four presented with thalassaemia intermedia phenotype, and 18 were transfusion dependent. The inheritance of homozygosity for HMIP 3-bp deletion at rs66650371 and heterozygosity for Hph α-thalassaemia mutation was found in the twins and not found in any of the other 22 patients. Further studies are needed to uncover likely additional genetic variants that could contribute to the exceptionally high HbF levels and mild phenotype in these twins. © 2016 John Wiley & Sons Ltd.

  15. Mild Microcytic Anemia in an Infant with a Compound Heterozygosity for Hb C (HBB: c.19G > A) and Hb Osu Christiansborg (HBB: c.157G > A).

    PubMed

    Boucher, Maria O; Chui, David H K; Woda, Bruce A; Newburger, Peter E

    2016-06-01

    We report an infant with a compound heterozygosity for Hb C (HBB: c.19G > A) and Hb Osu Christiansborg (HBB: c.157G > A) and a phenotype of mild microcytic anemia with target cell morphology but without overt hemolysis.

  16. A Novel Frameshift Mutation at Codons 138/139 (HBB: c.417_418insT) on the β-Globin Gene Leads to β-Thalassemia.

    PubMed

    Jiang, Fan; Huang, Lv-Yin; Chen, Gui-Lan; Zhou, Jian-Ying; Xie, Xing-Mei; Li, Dong-Zhi

    2017-01-01

    We describe a new β-thalassemic mutation in a Chinese subject. This allele develops by insertion of one nucleotide (+T) between codons 138 and 139 in the third exon of the β-globin gene. The mutation causes a frameshift that leads to a termination codon at codon 139. In the heterozygote, this allele has the phenotype of classical β-thalassemia (β-thal) minor.

  17. New Insights on β-Thalassemia in the Palestinian Population of Gaza: High Frequency and Milder Phenotype Among Homozygous IVS-I-1 (HBB: c.92+1G>A) Patients with High Levels of Hb F.

    PubMed

    Ghoti, Hussam; Fibach, Eitan; Rachmilewitz, Eliezer A; Jeadi, Hisham; Filon, Dvora

    2017-03-01

    β-Thalassemia (β-thal) is a very common disease in the Palestinian population of the Gaza Strip. We studied their mutation frequency and clinical features. Thirteen different mutations were identified. The most common mutation was IVS-I-1 (G>A) (HBB: c.92+1G>A), which was prevalent in 31.5% of the thalassemia alleles studied. The IVS-I-110 (G>A) (HBB: c.93-21G>A) mutation was found in 25.0% of the alleles. Homozygotes for the IVS-I-1 mutation had higher mean hemoglobin (Hb) levels, required less blood transfusions, and lower transferrin saturation than the homozygotes for the IVS-I-110 mutation. This milder phenotype was, most likely, the result of the persistent production of Hb F; it was 9-fold higher in absolute terms (g/dL) and 7.7-fold higher in relative terms (percentage of total Hb). About half of our IVS-I-1 patients carried the XmnI polymorphism, which is known to be associated with elevated Hb F levels.

  18. Prevalence and mutations of β-thalassemia trait and abnormal hemoglobins in premarital screening in Çanakkale province, Turkey

    PubMed Central

    Uludağ, A; Uludağ, A; Ertekin, YH; Tekin, M; Kütük, B; Silan, F; Özdemir, Ö

    2016-01-01

    Abstract The prevalence of β-thalassemia (β-thal) carriers in Turkey varies according to region but in general it is 2.0%. Çanakkale is a city in the Aegean region of Turkey but no study about β-thal frequency in Çanakkale has been published to date. In this study, we aimed to investigate the frequency of β-thal mutations in this province. A total of 4452 couples (8904 individuals) applied for premarital thalassemia scans at the Çanakkale State Health Directorate Laboratory between January 2008 and June 2012 and scanning was done with high performance liquid chromatography (HPLC). Of 125 β-thal carriers seen at the Medical Genetics Clinic, Çanakkale Onsekiz Mart University, Çanakkale, Turkey, for genetic counseling, 46 participated in the study. The remaining 79 patients could not be reached. The prevalence for β-thal carriers in Çanakkale was identified as 1.4% (125/8904). One couple were both β-thal carriers. β-Globin gene analysis of 46 carriers found the total frequency of the three most common mutations was 45.6%. These mutations were found to be HBB: c.93-21G>A [IVS-I-110 (G>A)], 26.08% (12/46); HBB: c.17_ 18delCT [codon 5 (‒CT)], 10.85% (5/46); HBB: c.20delA [codon 6 (‒A)] 8.69% (4/46). This is the first report on the frequency and mutation profiles of β-thal for Çanakkale. The incidence of β-thal carriers in Çanakkale is below the average for Turkey. The most frequently observed mutation profile and rate of β-thal in our region is different from the other regions of Turkey. PMID:27785405

  19. Genetic basis of congenital erythrocytosis: mutation update and online databases.

    PubMed

    Bento, Celeste; Percy, Melanie J; Gardie, Betty; Maia, Tabita Magalhães; van Wijk, Richard; Perrotta, Silverio; Della Ragione, Fulvio; Almeida, Helena; Rossi, Cedric; Girodon, François; Aström, Maria; Neumann, Drorit; Schnittger, Susanne; Landin, Britta; Minkov, Milen; Randi, Maria Luigia; Richard, Stéphane; Casadevall, Nicole; Vainchenker, William; Rives, Susana; Hermouet, Sylvie; Ribeiro, M Leticia; McMullin, Mary Frances; Cario, Holger; Chauveau, Aurelie; Gimenez-Roqueplo, Anne-Paule; Bressac-de-Paillerets, Brigitte; Altindirek, Didem; Lorenzo, Felipe; Lambert, Frederic; Dan, Harlev; Gad-Lapiteau, Sophie; Catarina Oliveira, Ana; Rossi, Cédric; Fraga, Cristina; Taradin, Gennadiy; Martin-Nuñez, Guillermo; Vitória, Helena; Diaz Aguado, Herrera; Palmblad, Jan; Vidán, Julia; Relvas, Luis; Ribeiro, Maria Leticia; Luigi Larocca, Maria; Luigia Randi, Maria; Pedro Silveira, Maria; Percy, Melanie; Gross, Mor; Marques da Costa, Ricardo; Beshara, Soheir; Ben-Ami, Tal; Ugo, Valérie

    2014-01-01

    Congenital erythrocytosis (CE), or congenital polycythemia, represents a rare and heterogeneous clinical entity. It is caused by deregulated red blood cell production where erythrocyte overproduction results in elevated hemoglobin and hematocrit levels. Primary congenital familial erythrocytosis is associated with low erythropoietin (Epo) levels and results from mutations in the Epo receptor gene (EPOR). Secondary CE arises from conditions causing tissue hypoxia and results in increased Epo production. These include hemoglobin variants with increased affinity for oxygen (HBB, HBA mutations), decreased production of 2,3-bisphosphoglycerate due to BPGM mutations, or mutations in the genes involved in the hypoxia sensing pathway (VHL, EPAS1, and EGLN1). Depending on the affected gene, CE can be inherited either in an autosomal dominant or recessive mode, with sporadic cases arising de novo. Despite recent important discoveries in the molecular pathogenesis of CE, the molecular causes remain to be identified in about 70% of the patients. With the objective of collecting all the published and unpublished cases of CE the COST action MPN&MPNr-Euronet developed a comprehensive Internet-based database focusing on the registration of clinical history, hematological, biochemical, and molecular data (http://www.erythrocytosis.org/). In addition, unreported mutations are also curated in the corresponding Leiden Open Variation Database. © 2013 WILEY PERIODICALS, INC.

  20. Detection of EGFR Gene Mutation by Mutation-oriented LAMP Method.

    PubMed

    Matsumoto, Naoyuki; Kumasaka, Akira; Ando, Tomohiro; Komiyama, Kazuo

    2018-04-01

    Epidermal growth factor receptor (EGFR) is a target of molecular therapeutics for non-small cell lung cancer. EGFR gene mutations at codons 746-753 promote constitutive EGFR activation and result in worst prognosis. However, these mutations augment the therapeutic effect of EGFR-tyrosine kinase inhibitor. Therefore, the detection of EGFR gene mutations is important for determining treatment planning. The aim of the study was to establish a method to detect EGFR gene mutations at codons 746-753. EGFR gene mutation at codons 746-753 in six cancer cell lines were investigated. A loop-mediated isothermal amplification (LAMP)-based procedure was developed, that employed peptide nucleic acid to suppress amplification of the wild-type allele. This mutation-oriented LAMP can amplify the DNA fragment of the EGFR gene with codons 746-753 mutations within 30 min. Moreover, boiled cells can work as template resources. Mutation oriented-LAMP assay for EGFR gene mutation is sensitive on extracted DNA. This procedure would be capable of detecting EGFR gene mutation in sputum, pleural effusion, broncho-alveolar lavage fluid or trans-bronchial lung biopsy by chair side. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  1. CD34+ cells from dental pulp stem cells with a ZFN-mediated and homology-driven repair-mediated locus-specific knock-in of an artificial β-globin gene.

    PubMed

    Chattong, S; Ruangwattanasuk, O; Yindeedej, W; Setpakdee, A; Manotham, K

    2017-07-01

    In humans, mutations in the β-globin gene (HBB) have two important clinical manifestations: β-thalassemia and sickle cell disease. The progress in genome editing and stem cell research may be relevant to the treatment of β-globin-related diseases. In this work, we employed zinc-finger nuclease (ZFN)-mediated gene integration of synthetic β-globin cDNA into HBB loci, thus correcting almost all β-globin mutations. The integration was achieved in both HEK 293 cells and isolated dental pulp stem cell (DPSCs). We also showed that DPSCs with an artificial gene knock-in were capable of generating stable six-cell clones and were expandable at least 10 8 -fold; therefore, they may serve as a personalized stem cell factory. In addition, transfection with non-integrated pCAG-hOct4 and culturing in a conditioned medium converted the genome-edited DPSCs to CD34 + HSC-like cells. We believe that this approach may be useful for the treatment of β-globin-related diseases, especially the severe form of β-thalassemia.

  2. Combination of Hb Heze [β144(HC1)Lys→Arg; HBB: c.434A>G] and β0-Thalassemia in a Chinese Patient with β-Thalassemia Intermedia.

    PubMed

    Li, Yan; Yan, Jin-Mei; Zhou, Jian-Ying; Lu, Yue-Cheng; Li, Dong-Zhi

    2017-01-01

    We first report a novel β chain variant, Hb Heze [β144(HC1)Lys→Arg; HBB: c.434A>G], in a Chinese family. Heterozygous inheritance of the mutation results in a mild β-thalassemia (β-thal) phenotype, whereas compound heterozygosity of Hb Heze with β 0 -thal appears as the cause of β-thal intermedia (β-TI) in our case.

  3. Diagnostic Dilemma of Hb Perth [β32(B14)Leu→Pro; HBB: c.98T > C] in Mainland China.

    PubMed

    Jiang, Hua; Yan, Jin-Mei; Li, Jian; Xie, Xing-Mei; Li, Dong-Zhi

    2016-06-01

    Unstable hemoglobin (Hb) variants represent a rare etiology of congenital hemolytic anemia. Correct diagnosis can be a challenge due to the relative rarity or lack of awareness of this disorder. We report an 18-month-old girl, who presented with a long-standing hemolytic anemia. Her diagnosis of unstable Hb Perth [β32(B14)Leu→Pro, HBB: c.98T > C] had not been made until gene sequencing of the β-globin gene was performed.

  4. Molecular mapping of the tubby (tub) mutation on mouse chromosome 7

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chung, W.K.; Goldberg-Berman, J.; Power-Kehoe, L.

    1996-03-01

    Using 180 F2 progeny of a C57BL6/J x CAST/Ei tub/+F1 intersubspecific intercross, a map of 28 molecular markers (including eight genes) on chromosome 7 surrounding the tub locus was generated. Using 33 obese F2 progeny, tub was localized approximately 50-52 cM distal to the centromere on mouse chromosome 7 in the interval defined proximally by hemoglobin beta (Hbb), D7Mit38, D7Mit217, D7Mit37, D7Mit96, and D7Mit33 and distally by D7Mit 98. Using 39 obese F2 progeny from a similar intersubspecific intercross, a telomeric boundary of the interval defining tub was defined by D7Mit53; the order centromere-Hbb/tub-D7Mit53/D7Mit328/D7Mit220-parathyroid hormone (Pth)-calcitonin (Calc)-zona pellucida 2 (2p2)more » was established. By combining the data from the two crosses, the most likely gene order on mouse chromosome 7 is centromere-Hbb-tub-Pth-Calc, thus making it likely that the human homolog of tub resides on 11p15, where the gene order HBB-PTH-CALC is conserved. Assignment of the human tubby homolog to 11p15 allows selection and development of polymorphic molecular markers that can be used to examine segregation of a human homolog of tubby in pedigrees segregating for obesity. The gene sulfonylurea receptor was eliminated as a candidate gene for tubby on the basis of its map position, approximately 3.1 {plus_minus} 3.1 cM centromeric of tyrosinase and approximately 14.9 {plus_minus} 4.8 cM centromeric of Hbb. 47 refs., 2 figs., 2 tabs.« less

  5. [Gene mutation analysis of X-linked hypophosphatemic rickets].

    PubMed

    Song, Ying; Ma, Hong-Wei; Li, Fang; Hu, Man; Ren, Shuang; Yu, Ya-Fen; Zhao, Gui-Jie

    2013-11-01

    To investigate the frequency and type of PHEX gene mutations in children with X-linked hypophosphatemic rickets (XLH), the possible presence of mutational hot spots, and the relationship between genotype and clinical phenotype. Clinical data of 10 children with XLH was retrospectively reviewed. The relationship between gene mutation type and severity of XLH was evaluated. PHEX gene mutations were detected in all 10 children with XLH, including 6 cases of missense mutation, 2 cases of splice site mutation, 1 case of frameshift mutation, and 1 case of nonsense mutation. Two new mutations, c.2048T>C and IVS14+1delAG, were found. The type of PHEX gene mutation was not associated with the degree of short stature and leg deformity (P=0.571 and 0.467), and the mutation site was also not associated with the degree of short stature and leg deformity (P=0.400 and 1.000). Missense mutation is the most common type of PHEX gene mutation in children with XLH, and c.2048T>C and IVS14+1delAG are two new PHEX gene mutations. The type and site of PHEX gene mutation are not associated with the severity of XLH.

  6. Novel recurrently mutated genes and a prognostic mutation signature in colorectal cancer.

    PubMed

    Yu, Jun; Wu, William K K; Li, Xiangchun; He, Jun; Li, Xiao-Xing; Ng, Simon S M; Yu, Chang; Gao, Zhibo; Yang, Jie; Li, Miao; Wang, Qiaoxiu; Liang, Qiaoyi; Pan, Yi; Tong, Joanna H; To, Ka F; Wong, Nathalie; Zhang, Ning; Chen, Jie; Lu, Youyong; Lai, Paul B S; Chan, Francis K L; Li, Yingrui; Kung, Hsiang-Fu; Yang, Huanming; Wang, Jun; Sung, Joseph J Y

    2015-04-01

    Characterisation of colorectal cancer (CRC) genomes by next-generation sequencing has led to the discovery of novel recurrently mutated genes. Nevertheless, genomic data has not yet been used for CRC prognostication. To identify recurrent somatic mutations with prognostic significance in patients with CRC. Exome sequencing was performed to identify somatic mutations in tumour tissues of 22 patients with CRC, followed by validation of 187 recurrent and pathway-related genes using targeted capture sequencing in additional 160 cases. Seven significantly mutated genes, including four reported (APC, TP53, KRAS and SMAD4) and three novel recurrently mutated genes (CDH10, FAT4 and DOCK2), exhibited high mutation prevalence (6-14% for novel cancer genes) and higher-than-expected number of non-silent mutations in our CRC cohort. For prognostication, a five-gene-signature (CDH10, COL6A3, SMAD4, TMEM132D, VCAN) was devised, in which mutation(s) in one or more of these genes was significantly associated with better overall survival independent of tumor-node-metastasis (TNM) staging. The median survival time was 80.4 months in the mutant group versus 42.4 months in the wild type group (p=0.0051). The prognostic significance of this signature was successfully verified using the data set from the Cancer Genome Atlas study. The application of next-generation sequencing has led to the identification of three novel significantly mutated genes in CRC and a mutation signature that predicts survival outcomes for stratifying patients with CRC independent of TNM staging. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  7. A genome-editing strategy to treat β-hemoglobinopathies that recapitulates a mutation associated with a benign genetic condition.

    PubMed

    Traxler, Elizabeth A; Yao, Yu; Wang, Yong-Dong; Woodard, Kaitly J; Kurita, Ryo; Nakamura, Yukio; Hughes, Jim R; Hardison, Ross C; Blobel, Gerd A; Li, Chunliang; Weiss, Mitchell J

    2016-09-01

    Disorders resulting from mutations in the hemoglobin subunit beta gene (HBB; which encodes β-globin), mainly sickle cell disease (SCD) and β-thalassemia, become symptomatic postnatally as fetal γ-globin expression from two paralogous genes, hemoglobin subunit gamma 1 (HBG1) and HBG2, decreases and adult β-globin expression increases, thereby shifting red blood cell (RBC) hemoglobin from the fetal (referred to as HbF or α2γ2) to adult (referred to as HbA or α2β2) form. These disorders are alleviated when postnatal expression of fetal γ-globin is maintained. For example, in hereditary persistence of fetal hemoglobin (HPFH), a benign genetic condition, mutations attenuate γ-globin-to-β-globin switching, causing high-level HbF expression throughout life. Co-inheritance of HPFH with β-thalassemia- or SCD-associated gene mutations alleviates their clinical manifestations. Here we performed CRISPR-Cas9-mediated genome editing of human blood progenitors to mutate a 13-nt sequence that is present in the promoters of the HBG1 and HBG2 genes, thereby recapitulating a naturally occurring HPFH-associated mutation. Edited progenitors produced RBCs with increased HbF levels that were sufficient to inhibit the pathological hypoxia-induced RBC morphology found in SCD. Our findings identify a potential DNA target for genome-editing-mediated therapy of β-hemoglobinopathies.

  8. Evaluation of Helping Babies Breathe Quality Improvement Cycle (HBB-QIC) on retention of neonatal resuscitation skills six months after training in Nepal.

    PubMed

    Kc, Ashish; Wrammert, Johan; Nelin, Viktoria; Clark, Robert B; Ewald, Uwe; Peterson, Stefan; Målqvist, Mats

    2017-04-11

    Each year 700,000 infants die due to intrapartum-related complications. Implementation of Helping Babies Breathe (HBB)-a simplified neonatal resuscitation protocol in low-resource clinical settings has shown to reduce intrapartum stillbirths and first-day neonatal mortality. However, there is a lack of evidence on the effect of different HBB implementation strategies to improve and sustain the clinical competency of health workers on bag-and-mask ventilation. This study was conducted to evaluate the impact of multi-faceted implementation strategy for HBB, as a quality improvement cycle (HBB-QIC), on the retention of neonatal resuscitation skills in a tertiary hospital of Nepal. A time-series design was applied. The multi-faceted intervention for HBB-QIC included training, daily bag-and-mask skill checks, preparation for resuscitation before every birth, self-evaluation and peer review on neonatal resuscitation skills, and weekly review meetings. Knowledge and skills were assessed through questionnaires, skill checklists, and Objective Structured Clinical Examinations (OSCE) before implementation of the HBB-QIC, immediately after HBB training, and again at 6 months. Means were compared using paired t-tests, and associations between skill retention and HBB-QIC components were analyzed using logistic regression analysis. One hundred thirty seven health workers were enrolled in the study. Knowledge scores were higher immediately following the HBB training, 16.4 ± 1.4 compared to 12.8 ± 1.6 before (out of 17), and the knowledge was retained 6 months after the training (16.5 ± 1.1). Bag-and-mask skills improved immediately after the training and were retained 6 months after the training. The retention of bag-and-mask skills was associated with daily bag-and-mask skill checks, preparation for resuscitation before every birth, use of a self-evaluation checklist, and attendance at weekly review meetings. The implementation strategies with the highest association to skill

  9. Improved hematopoietic differentiation efficiency of gene-corrected beta-thalassemia induced pluripotent stem cells by CRISPR/Cas9 system.

    PubMed

    Song, Bing; Fan, Yong; He, Wenyin; Zhu, Detu; Niu, Xiaohua; Wang, Ding; Ou, Zhanhui; Luo, Min; Sun, Xiaofang

    2015-05-01

    The generation of beta-thalassemia (β-Thal) patient-specific induced pluripotent stem cells (iPSCs), subsequent homologous recombination-based gene correction of disease-causing mutations/deletions in the β-globin gene (HBB), and their derived hematopoietic stem cell (HSC) transplantation offers an ideal therapeutic solution for treating this disease. However, the hematopoietic differentiation efficiency of gene-corrected β-Thal iPSCs has not been well evaluated in the previous studies. In this study, we used the latest gene-editing tool, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9), to correct β-Thal iPSCs; gene-corrected cells exhibit normal karyotypes and full pluripotency as human embryonic stem cells (hESCs) showed no off-targeting effects. Then, we evaluated the differentiation efficiency of the gene-corrected β-Thal iPSCs. We found that during hematopoietic differentiation, gene-corrected β-Thal iPSCs showed an increased embryoid body ratio and various hematopoietic progenitor cell percentages. More importantly, the gene-corrected β-Thal iPSC lines restored HBB expression and reduced reactive oxygen species production compared with the uncorrected group. Our study suggested that hematopoietic differentiation efficiency of β-Thal iPSCs was greatly improved once corrected by the CRISPR/Cas9 system, and the information gained from our study would greatly promote the clinical application of β-Thal iPSC-derived HSCs in transplantation.

  10. Molecular Characterization of β-Thalassemia Intermedia in Southeast Iran.

    PubMed

    Miri-Moghaddam, Ebrahim; Bahrami, Sara; Naderi, Majid; Bazi, Ali; Karimipoor, Morteza

    2016-06-01

    Inheritance of mild mutations within the β-globin gene and coinheritance of α-thalassemia (α-thal) are known as two important genetic modifiers in β-thalassemia (β-thal) intermedia (β-TI). We aimed to evaluate the spectrum of β- and α-thal mutations in β-TI patients in Southeast Iran. Common β- and α-globin gene mutations were detected by amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) and multiplex gap-PCR, respectively. There were 26 male (57.8%) and 19 female (42.2%) patients. HBB: c.92 + 5T > C [IVS-I-5 (G > C)] and HBB: c.-138C + 1G > A [IVS-II-I (G > A)] represented the prevalent alleles with respective frequencies of 60.0 and 10.0%. Other β-globin mutations included HBB: c.-138C > T [-88 (C > T)], HBB: c.27_28insG [frameshift codons (FSC) 8/9 (+G)], HBB: c.46delT [codon 15 (-T)], HBB: c.93-22_95del (IVS-I, 25 del), and the 619 bp deletion (NG_000007.3: g.71609_72227del619). The predominant genotypic combinations were β(0)/β(0) (68.9%), β(0)/β(+ )(8.9%) and β(+)/β(+ )(2.2%). Coinheritance of α-thal was observed in 33.0% of the patients, with the -α(3.7) (rightward) (NG_000006.1: g.34164_37967del3804) as the most common deletion (86.0%). One patient was diagnosed with the -α(4.2) (leftward) (AF221717) and one with the - -(MED) (g.24664_41064del16401) deletions, while no patients carried the -(α)(20.5) (g.15164_37864del22701), α(-5 nt) (HBA2: c.95 + 2_95_6delTGAGG) or codon 19 (-G) (HBA2: c.56delG) mutations. The alleviating molecular mechanism was not explainable by β(+ )or concurrent α-thal in more than half of our β-TI patients. This encourages conducting more studies to identify other contributing factors, especially Hb F-inducing genetic modifiers.

  11. [Study of gene mutation in 62 hemophilia A children].

    PubMed

    Hu, Q; Liu, A G; Zhang, L Q; Zhang, A; Wang, Y Q; Wang, S M; Lu, Y J; Wang, X

    2017-11-02

    Objective: To analyze the mutation type of FⅧ gene in children with hemophilia A and to explore the relationship among hemophilia gene mutation spectrum, gene mutation and clinical phenotype. Method: Sixty-two children with hemophilia A from Department of Pediatric Hematology, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology between January 2015 and March 2017 were enrolled. All patients were male, aged from 4 months to 7 years and F Ⅷ activity ranged 0.2%-11.0%. Fifty cases had severe, 10 cases had moderate and 2 cases had mild hemophilia A. DNA was isolated from peripheral blood in hemophilia A children and the target gene fragment was amplified by PCR, in combination with the second generation sequencing, 22 and 1 introns were detected. Negative cases were detected by the second generation sequencing and results were compared with those of the international FⅧ gene mutation database. Result: There were 20 cases (32%) of intron 22 inversion, 2 cases (3%) of intron 1 inversion, 18 cases (29%) of missense mutation, 5 cases (8%) of nonsense mutation, 7 cases (11%) of deletion mutation, 1 case(2%)of splice site mutation, 2 cases (3%) of large fragment deletion and 1 case of insertion mutation (2%). No mutation was detected in 2 cases (3%), and 4 cases (7%) failed to amplify. The correlation between phenotype and genotype showed that the most common gene mutation in severe hemophilia A was intron 22 inversion (20 cases), accounting for 40% of severe patients, followed by 11 cases of missense mutation (22%). The most common mutation in moderate hemophilia A was missense mutation (6 cases), accounting for 60% of moderate patients. Conclusion: The most frequent mutation type in hemophilia A was intron 22 inversion, followed by missense mutation, again for missing mutation. The relationship between phenotype and genotype: the most frequent gene mutation in severe hemophilia A is intron 22 inversion, followed by missense

  12. CRISPR/Cas9-mediated gene editing in human zygotes using Cas9 protein.

    PubMed

    Tang, Lichun; Zeng, Yanting; Du, Hongzi; Gong, Mengmeng; Peng, Jin; Zhang, Buxi; Lei, Ming; Zhao, Fang; Wang, Weihua; Li, Xiaowei; Liu, Jianqiao

    2017-06-01

    Previous works using human tripronuclear zygotes suggested that the clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 system could be a tool in correcting disease-causing mutations. However, whether this system was applicable in normal human (dual pronuclear, 2PN) zygotes was unclear. Here we demonstrate that CRISPR/Cas9 is also effective as a gene-editing tool in human 2PN zygotes. By injection of Cas9 protein complexed with the appropriate sgRNAs and homology donors into one-cell human embryos, we demonstrated efficient homologous recombination-mediated correction of point mutations in HBB and G6PD. However, our results also reveal limitations of this correction procedure and highlight the need for further research.

  13. Genotype–phenotype correlation among beta-thalassemia and beta-thalassemia/HbE disease in Thai children: predictable clinical spectrum using genotypic analysis

    PubMed Central

    Traivaree, Chanchai; Monsereenusorn, Chalinee; Rujkijyanont, Piya; Prasertsin, Warakorn; Boonyawat, Boonchai

    2018-01-01

    Introduction Beta-thalassemia is a group of inherited hemolytic anemias and one of the most common genetic disorders in Thailand. The clinical spectrum of beta-thalassemia disease ranges from mild to severe clinical symptoms including mild beta-thalassemia intermedia (TI) and severe beta-thalassemia major (TM). Objective This study aimed to determine the correlation between beta-globin gene (HBB) mutations and their phenotypic manifestations by evaluating patients’ clinical characteristics, transfusion requirements, growth and hematologic parameters, and hemoglobin typing among pediatric patients treated at Phramongkutklao Hospital. Materials and methods Seventy beta-thalassemia patients, including 63 with beta-thalassemia/hemoglobin E (HbE) and 7 with either homozygous or compound heterozygous beta-thalassemia, were enrolled in this study. Their clinical presentation, growth parameters and laboratory findings were reviewed and analyzed. The mean follow-up time was 10.52±5.62 years. Mutation analysis in each individual was performed using multiplex amplification refractory mutation system (M-ARMS), direct DNA sequencing of beta-globin gene and gap PCR for 3.4 kb deletion detection. Results All 7 homozygous and compound heterozygous beta-thalassemia patients were classified in TM. Among 63 patients with beta-thalassemia/HbE, 58 were classified in TM and 4 were classified in TI. Mean age at diagnosis was 0.8±0.49 years for homozygous or compound heterozygous beta-thalassemia and 3.43±3.5 years for beta-thalassemia/HbE. The most common HBB mutation was HBB:c.126_129delCTTT [codon 41/42 (-TCTT)] found in 34 alleles (48.6%). The height for age was also lower in homozygous beta-thalassemia patients (<3rd percentile) compared to compound heterozygous beta-thalassemia patients (25–50th percentile). Conclusion This study revealed a genotype–phenotype correlation of the most prevalent beta-thalassemia in Thai children using diagnostic capacity in genotypic analysis

  14. Hereditary cancer genes are highly susceptible to splicing mutations

    PubMed Central

    Soemedi, Rachel; Maguire, Samantha; Murray, Michael F.; Monaghan, Sean F.

    2018-01-01

    Substitutions that disrupt pre-mRNA splicing are a common cause of genetic disease. On average, 13.4% of all hereditary disease alleles are classified as splicing mutations mapping to the canonical 5′ and 3′ splice sites. However, splicing mutations present in exons and deeper intronic positions are vastly underreported. A recent re-analysis of coding mutations in exon 10 of the Lynch Syndrome gene, MLH1, revealed an extremely high rate (77%) of mutations that lead to defective splicing. This finding is confirmed by extending the sampling to five other exons in the MLH1 gene. Further analysis suggests a more general phenomenon of defective splicing driving Lynch Syndrome. Of the 36 mutations tested, 11 disrupted splicing. Furthermore, analyzing past reports suggest that MLH1 mutations in canonical splice sites also occupy a much higher fraction (36%) of total mutations than expected. When performing a comprehensive analysis of splicing mutations in human disease genes, we found that three main causal genes of Lynch Syndrome, MLH1, MSH2, and PMS2, belonged to a class of 86 disease genes which are enriched for splicing mutations. Other cancer genes were also enriched in the 86 susceptible genes. The enrichment of splicing mutations in hereditary cancers strongly argues for additional priority in interpreting clinical sequencing data in relation to cancer and splicing. PMID:29505604

  15. Mutation screening of X-chromosomal neuroligin genes: no mutations in 196 autism probands.

    PubMed

    Vincent, John B; Kolozsvari, Debbie; Roberts, Wendy S; Bolton, Patrick F; Gurling, Hugh M D; Scherer, Stephen W

    2004-08-15

    Autism, a childhood neuropsychiatric disorder with a strong genetic component, is currently the focus of considerable attention within the field of human genetics as well many other medical-related disciplines. A recent study has implicated two X-chromosomal neuroligin genes, NLGN3 and NLGN4, as having an etiological role in autism, having identified a frameshift mutation in one gene and a substitution mutation in the other, segregating in multiplex autism spectrum families (Jamain et al. [2003: Nat Genet 34:27-29]). The function of neuroligin as a trigger for synapse formation would suggest that such mutations would likely result in some form of pathological manifestation. Our own study, screening a larger sample of 196 autism probands, failed to identify any mutations that would affect the coding regions of these genes. Our findings suggest that mutations in these two genes are infrequent in autism. Copyright 2004 Wiley-Liss, Inc.

  16. Simulation of gene evolution under directional mutational pressure

    NASA Astrophysics Data System (ADS)

    Dudkiewicz, Małgorzata; Mackiewicz, Paweł; Kowalczuk, Maria; Mackiewicz, Dorota; Nowicka, Aleksandra; Polak, Natalia; Smolarczyk, Kamila; Banaszak, Joanna; R. Dudek, Mirosław; Cebrat, Stanisław

    2004-05-01

    The two main mechanisms generating the genetic diversity, mutation and recombination, have random character but they are biased which has an effect on the generation of asymmetry in the bacterial chromosome structure and in the protein coding sequences. Thus, like in a case of two chiral molecules-the two possible orientations of a gene in relation to the topology of a chromosome are not equivalent. Assuming that the sequence of a gene may oscillate only between certain limits of its structural composition means that the gene could be forced out of these limits by the directional mutation pressure, in the course of evolution. The probability of the event depends on the time the gene stays under the same mutation pressure. Inversion of the gene changes the directional mutational pressure to the reciprocal one and hence it changes the distance of the gene to its lower and upper bound of the structural tolerance. Using Monte Carlo methods we were able to simulate the evolution of genes under experimentally found mutational pressure, assuming simple mechanisms of selection. We found that the mutation and recombination should work in accordance to lower their negative effects on the function of the products of coding sequences.

  17. Cancer Susceptibility Gene Mutations in Individuals With Colorectal Cancer

    PubMed Central

    Yurgelun, Matthew B.; Kulke, Matthew H.; Fuchs, Charles S.; Allen, Brian A.; Uno, Hajime; Hornick, Jason L.; Ukaegbu, Chinedu I.; Brais, Lauren K.; McNamara, Philip G.; Mayer, Robert J.; Schrag, Deborah; Meyerhardt, Jeffrey A.; Ng, Kimmie; Kidd, John; Singh, Nanda; Hartman, Anne-Renee; Wenstrup, Richard J.

    2017-01-01

    Purpose Hereditary factors play an important role in colorectal cancer (CRC) risk, yet the prevalence of germline cancer susceptibility gene mutations in patients with CRC unselected for high-risk features (eg, early age at diagnosis, personal/family history of cancer or polyps, tumor microsatellite instability [MSI], mismatch repair [MMR] deficiency) is unknown. Patients and Methods We recruited 1,058 participants who received CRC care in a clinic-based setting without preselection for age at diagnosis, personal/family history, or MSI/MMR results. All participants underwent germline testing for mutations in 25 genes associated with inherited cancer risk. Each gene was categorized as high penetrance or moderate penetrance on the basis of published estimates of the lifetime cancer risks conferred by pathogenic germline mutations in that gene. Results One hundred five (9.9%; 95% CI, 8.2% to 11.9%) of 1,058 participants carried one or more pathogenic mutations, including 33 (3.1%) with Lynch syndrome (LS). Twenty-eight (96.6%) of 29 available LS CRCs demonstrated abnormal MSI/MMR results. Seventy-four (7.0%) of 1,058 participants carried non-LS gene mutations, including 23 (2.2%) with mutations in high-penetrance genes (five APC, three biallelic MUTYH, 11 BRCA1/2, two PALB2, one CDKN2A, and one TP53), 15 of whom lacked clinical histories suggestive of their underlying mutation. Thirty-eight (3.6%) participants had moderate-penetrance CRC risk gene mutations (19 monoallelic MUTYH, 17 APC*I1307K, two CHEK2). Neither proband age at CRC diagnosis, family history of CRC, nor personal history of other cancers significantly predicted the presence of pathogenic mutations in non-LS genes. Conclusion Germline cancer susceptibility gene mutations are carried by 9.9% of patients with CRC. MSI/MMR testing reliably identifies LS probands, although 7.0% of patients with CRC carry non-LS mutations, including 1.0% with BRCA1/2 mutations. PMID:28135145

  18. LNDriver: identifying driver genes by integrating mutation and expression data based on gene-gene interaction network.

    PubMed

    Wei, Pi-Jing; Zhang, Di; Xia, Junfeng; Zheng, Chun-Hou

    2016-12-23

    Cancer is a complex disease which is characterized by the accumulation of genetic alterations during the patient's lifetime. With the development of the next-generation sequencing technology, multiple omics data, such as cancer genomic, epigenomic and transcriptomic data etc., can be measured from each individual. Correspondingly, one of the key challenges is to pinpoint functional driver mutations or pathways, which contributes to tumorigenesis, from millions of functional neutral passenger mutations. In this paper, in order to identify driver genes effectively, we applied a generalized additive model to mutation profiles to filter genes with long length and constructed a new gene-gene interaction network. Then we integrated the mutation data and expression data into the gene-gene interaction network. Lastly, greedy algorithm was used to prioritize candidate driver genes from the integrated data. We named the proposed method Length-Net-Driver (LNDriver). Experiments on three TCGA datasets, i.e., head and neck squamous cell carcinoma, kidney renal clear cell carcinoma and thyroid carcinoma, demonstrated that the proposed method was effective. Also, it can identify not only frequently mutated drivers, but also rare candidate driver genes.

  19. Novel recurrently mutated genes in African American colon cancers.

    PubMed

    Guda, Kishore; Veigl, Martina L; Varadan, Vinay; Nosrati, Arman; Ravi, Lakshmeswari; Lutterbaugh, James; Beard, Lydia; Willson, James K V; Sedwick, W David; Wang, Zhenghe John; Molyneaux, Neil; Miron, Alexander; Adams, Mark D; Elston, Robert C; Markowitz, Sanford D; Willis, Joseph E

    2015-01-27

    We used whole-exome and targeted sequencing to characterize somatic mutations in 103 colorectal cancers (CRC) from African Americans, identifying 20 new genes as significantly mutated in CRC. Resequencing 129 Caucasian derived CRCs confirmed a 15-gene set as a preferential target for mutations in African American CRCs. Two predominant genes, ephrin type A receptor 6 (EPHA6) and folliculin (FLCN), with mutations exclusive to African American CRCs, are by genetic and biological criteria highly likely African American CRC driver genes. These previously unsuspected differences in the mutational landscapes of CRCs arising among individuals of different ethnicities have potential to impact on broader disparities in cancer behaviors.

  20. Exome-wide Sequencing Shows Low Mutation Rates and Identifies Novel Mutated Genes in Seminomas.

    PubMed

    Cutcutache, Ioana; Suzuki, Yuka; Tan, Iain Beehuat; Ramgopal, Subhashini; Zhang, Shenli; Ramnarayanan, Kalpana; Gan, Anna; Lee, Heng Hong; Tay, Su Ting; Ooi, Aikseng; Ong, Choon Kiat; Bolthouse, Jonathan T; Lane, Brian R; Anema, John G; Kahnoski, Richard J; Tan, Patrick; Teh, Bin Tean; Rozen, Steven G

    2015-07-01

    Testicular germ cell tumors are the most common cancer diagnosed in young men, and seminomas are the most common type of these cancers. There have been no exome-wide examinations of genes mutated in seminomas or of overall rates of nonsilent somatic mutations in these tumors. The objective was to analyze somatic mutations in seminomas to determine which genes are affected and to determine rates of nonsilent mutations. Eight seminomas and matched normal samples were surgically obtained from eight patients. DNA was extracted from tissue samples and exome sequenced on massively parallel Illumina DNA sequencers. Single-nucleotide polymorphism chip-based copy number analysis was also performed to assess copy number alterations. The DNA sequencing read data were analyzed to detect somatic mutations including single-nucleotide substitutions and short insertions and deletions. The detected mutations were validated by independent sequencing and further checked for subclonality. The rate of nonsynonymous somatic mutations averaged 0.31 mutations/Mb. We detected nonsilent somatic mutations in 96 genes that were not previously known to be mutated in seminomas, of which some may be driver mutations. Many of the mutations appear to have been present in subclonal populations. In addition, two genes, KIT and KRAS, were affected in two tumors each with mutations that were previously observed in other cancers and are presumably oncogenic. Our study, the first report on exome sequencing of seminomas, detected somatic mutations in 96 new genes, several of which may be targetable drivers. Furthermore, our results show that seminoma mutation rates are five times higher than previously thought, but are nevertheless low compared to other common cancers. Similar low rates are seen in other cancers that also have excellent rates of remission achieved with chemotherapy. We examined the DNA sequences of seminomas, the most common type of testicular germ cell cancer. Our study identified 96

  1. Mutation profile of BBS genes in Iranian patients with Bardet-Biedl syndrome: genetic characterization and report of nine novel mutations in five BBS genes.

    PubMed

    Fattahi, Zohreh; Rostami, Parvin; Najmabadi, Amin; Mohseni, Marzieh; Kahrizi, Kimia; Akbari, Mohammad Reza; Kariminejad, Ariana; Najmabadi, Hossein

    2014-07-01

    Bardet-Biedl syndrome (BBS) is a rare ciliopathy disorder that is clinically and genetically heterogeneous with 18 known genes. This study was performed to characterize responsible genes and mutation spectrum in a cohort of 14 Iranian families with BBS. Sanger sequencing of the most commonly mutated genes (BBS1, BBS2 and BBS10) accounting for ∼50% of BBS patients determined mutations only in BBS2, including three novel mutations. Next, three of the remaining patients were subjected to whole exome sequencing with 96% at 20 × depth of coverage that revealed novel BBS4 mutation. Observation of no mutation in the other patients represents the possible presence of novel genes. Screening of the remaining patients for six other genes (BBS3, BBS4, BBS6, BBS7, BBS9 and BBS12) revealed five novel mutations. This result represents another indication for the genetic heterogeneity of BBS and extends the mutational spectrum of the disease by introducing nine novel mutations in five BBS genes. In conclusion, although BBS1 and BBS10 are among the most commonly mutated genes in other populations like Caucasian, these two seem not to have an important role in Iranian patients. This suggests that a different strategy in molecular genetics diagnostic approaches in Middle Eastern countries such as Iran should be considered.

  2. Glucokinase gene mutations (MODY 2) in Asian Indians.

    PubMed

    Kanthimathi, Sekar; Jahnavi, Suresh; Balamurugan, Kandasamy; Ranjani, Harish; Sonya, Jagadesan; Goswami, Soumik; Chowdhury, Subhankar; Mohan, Viswanathan; Radha, Venkatesan

    2014-03-01

    Heterozygous inactivating mutations in the glucokinase (GCK) gene cause a hyperglycemic condition termed maturity-onset diabetes of the young (MODY) 2 or GCK-MODY. This is characterized by mild, stable, usually asymptomatic, fasting hyperglycemia that rarely requires pharmacological intervention. The aim of the present study was to screen for GCK gene mutations in Asian Indian subjects with mild hyperglycemia. Of the 1,517 children and adolescents of the population-based ORANGE study in Chennai, India, 49 were found to have hyperglycemia. These children along with the six patients referred to our center with mild hyperglycemia were screened for MODY 2 mutations. The GCK gene was bidirectionally sequenced using BigDye(®) Terminator v3.1 (Applied Biosystems, Foster City, CA) chemistry. In silico predictions of the pathogenicity were carried out using the online tools SIFT, Polyphen-2, and I-Mutant 2.0 software programs. Direct sequencing of the GCK gene in the patients referred to our Centre revealed one novel mutation, Thr206Ala (c.616A>G), in exon 6 and one previously described mutation, Met251Thr (c.752T>C), in exon 7. In silico analysis predicted the novel mutation to be pathogenic. The highly conserved nature and critical location of the residue Thr206 along with the clinical course suggests that the Thr206Ala is a MODY 2 mutation. However, we did not find any MODY 2 mutations in the 49 children selected from the population-based study. Hence prevalence of GCK mutations in Chennai is <1:1,517. This is the first study of MODY 2 mutations from India and confirms the importance of considering GCK gene mutation screening in patients with mild early-onset hyperglycemia who are negative for β-cell antibodies.

  3. Setup of a Protocol of Molecular Diagnosis of β-Thalassemia Mutations in Tunisia using Denaturing High-Performance Liquid Chromatography (DHPLC).

    PubMed

    Sahli, Chaima Abdelhafidh; Ben Salem, Ikbel; Jouini, Latifa; Laouini, Naouel; Dabboubi, Rym; Hadj Fredj, Sondes; Siala, Hajer; Othmeni, Rym; Dakhlaoui, Boutheina; Fattoum, Slaheddine; Bibi, Amina; Messaoud, Taieb

    2016-09-01

    β-Thalassemia is one of the most prevalent worldwide autosomal recessive disorders. It presents a great molecular heterogeneity resulting from more than 200 causative mutations in the β-globin gene. In Tunisia, β-thalassemia represents the most prevalent monogenic hemoglobin disorder with 2.21% of carriers. Efficient and reliable mutation-screening methods are essential in order to establish appropriate prevention programs for at risk couples. The aim of the present study is to develop an efficient method based on the denaturing high-performance liquid chromatography (DHPLC) in which the whole β-globin gene (HBB) is screened for mutations covering about 90% of the spectrum. We have performed the validation of a DHPLC assay for direct genotyping of 11 known β-thalassemia mutations in the Tunisian population. DHPLC assay was established based on the analysis of 62 archival β-thalassemia samples previously genotyped then validated with full concordance on 50 tests with blind randomized samples previously genotyped with DNA sequencing and with 96% of consistency on 40 samples as a prospective study. Compared to other genotyping techniques, the DHPLC method can meet the requirements of direct genotyping of known β-thalassemia mutations in Tunisia and to be applied as a powerful tool for the genetic screening of prenatal and postnatal individuals. © 2016 Wiley Periodicals, Inc.

  4. HFE gene mutations and Wilson's disease in Sardinia.

    PubMed

    Sorbello, Orazio; Sini, Margherita; Civolani, Alberto; Demelia, Luigi

    2010-03-01

    Hypocaeruloplasminaemia can lead to tissue iron storage in Wilson's disease and the possibility of iron overload in long-term overtreated patients should be considered. The HFE gene encodes a protein that is intimately involved in intestinal iron absorption. The aim of this study was to determine the prevalence of the HFE gene mutation, its role in iron metabolism of Wilson's disease patients and the interplay of therapy in copper and iron homeostasis. The records of 32 patients with Wilson's disease were reviewed for iron and copper indices, HFE gene mutations and liver biopsy. Twenty-six patients were negative for HFE gene mutations and did not present significant alterations of iron metabolism. The HFE mutation was significantly associated with increased hepatic iron content (P<0.02) and transferrin saturation index (P<0.03). After treatment period, iron indices were significantly decreased only in HFE gene wild-type. The HFE gene mutations may be an addictional factor in iron overload in Wilson's disease. Our results showed that an adjustment of dosage of drugs could prevent further iron overload induced by overtreatment only in patients HFE wild-type. 2009. Published by Elsevier Ltd.

  5. The androgen receptor gene mutations database.

    PubMed

    Patterson, M N; Hughes, I A; Gottlieb, B; Pinsky, L

    1994-09-01

    The androgen receptor gene mutations database is a comprehensive listing of mutations published in journals and meetings proceedings. The majority of mutations are point mutations identified in patients with androgen insensitivity syndrome. Information is included regarding the phenotype, the nature and location of the mutations, as well as the effects of the mutations on the androgen binding activity of the receptor. The current version of the database contains 149 entries, of which 114 are unique mutations. The database is available from EMBL (NetServ@EMBL-Heidelberg.DE) or as a Macintosh Filemaker file (mc33001@musica.mcgill.ca).

  6. [FANCA gene mutation analysis in Fanconi anemia patients].

    PubMed

    Chen, Fei; Peng, Guang-Jie; Zhang, Kejian; Hu, Qun; Zhang, Liu-Qing; Liu, Ai-Guo

    2005-10-01

    To screen the FANCA gene mutation and explore the FANCA protein function in Fanconi anemia (FA) patients. FANCA protein expression and its interaction with FANCF were analyzed using Western blot and immunoprecipitation in 3 cases of FA-A. Genomic DNA was used for MLPA analysis followed by sequencing. FANCA protein was undetectable and FANCA and FANCF protein interaction was impaired in these 3 cases of FA-A. Each case of FA-A contained biallelic pathogenic mutations in FANCA gene. No functional FANCA protein was found in these 3 cases of FA-A, and intragenic deletion, frame shift and splice site mutation were the major pathogenic mutations found in FANCA gene.

  7. Simultaneous mutation detection of three homoeologous genes in wheat by High Resolution Melting analysis and Mutation Surveyor.

    PubMed

    Dong, Chongmei; Vincent, Kate; Sharp, Peter

    2009-12-04

    TILLING (Targeting Induced Local Lesions IN Genomes) is a powerful tool for reverse genetics, combining traditional chemical mutagenesis with high-throughput PCR-based mutation detection to discover induced mutations that alter protein function. The most popular mutation detection method for TILLING is a mismatch cleavage assay using the endonuclease CelI. For this method, locus-specific PCR is essential. Most wheat genes are present as three similar sequences with high homology in exons and low homology in introns. Locus-specific primers can usually be designed in introns. However, it is sometimes difficult to design locus-specific PCR primers in a conserved region with high homology among the three homoeologous genes, or in a gene lacking introns, or if information on introns is not available. Here we describe a mutation detection method which combines High Resolution Melting (HRM) analysis of mixed PCR amplicons containing three homoeologous gene fragments and sequence analysis using Mutation Surveyor software, aimed at simultaneous detection of mutations in three homoeologous genes. We demonstrate that High Resolution Melting (HRM) analysis can be used in mutation scans in mixed PCR amplicons containing three homoeologous gene fragments. Combining HRM scanning with sequence analysis using Mutation Surveyor is sensitive enough to detect a single nucleotide mutation in the heterozygous state in a mixed PCR amplicon containing three homoeoloci. The method was tested and validated in an EMS (ethylmethane sulfonate)-treated wheat TILLING population, screening mutations in the carboxyl terminal domain of the Starch Synthase II (SSII) gene. Selected identified mutations of interest can be further analysed by cloning to confirm the mutation and determine the genomic origin of the mutation. Polyploidy is common in plants. Conserved regions of a gene often represent functional domains and have high sequence similarity between homoeologous loci. The method described here

  8. Modeling Autism by SHANK Gene Mutations in Mice

    PubMed Central

    Jiang, Yong-hui; Ehlers, Michael D.

    2013-01-01

    Summary Shank family proteins (Shank1, Shank2, and Shank3) are synaptic scaffolding proteins that organize an extensive protein complex at the postsynaptic density (PSD) of excitatory glutamatergic synapses. Recent human genetic studies indicate that SHANK family genes (SHANK1, SHANK2, and SHANK3) are causative genes for idiopathic autism spectrum disorders (ASD). Neurobiological studies of Shank mutations in mice support a general hypothesis of synaptic dysfunction in the pathophysiology of ASD. However, the molecular diversity of SHANK family gene products, as well as the heterogeneity in human and mouse phenotypes, pose challenges to modeling human SHANK mutations. Here, we review the molecular genetics of SHANK mutations in human ASD and discuss recent findings where such mutations have been modeled in mice. Conserved features of synaptic dysfunction and corresponding behaviors in Shank mouse mutants may help dissect the pathophysiology of ASD, but also highlight divergent phenotypes that arise from different mutations in the same gene. PMID:23583105

  9. One-step genetic correction of hemoglobin E/beta-thalassemia patient-derived iPSCs by the CRISPR/Cas9 system.

    PubMed

    Wattanapanitch, Methichit; Damkham, Nattaya; Potirat, Ponthip; Trakarnsanga, Kongtana; Janan, Montira; U-Pratya, Yaowalak; Kheolamai, Pakpoom; Klincumhom, Nuttha; Issaragrisil, Surapol

    2018-02-26

    Thalassemia is the most common genetic disease worldwide; those with severe disease require lifelong blood transfusion and iron chelation therapy. The definitive cure for thalassemia is allogeneic hematopoietic stem cell transplantation, which is limited due to lack of HLA-matched donors and the risk of post-transplant complications. Induced pluripotent stem cell (iPSC) technology offers prospects for autologous cell-based therapy which could avoid the immunological problems. We now report genetic correction of the beta hemoglobin (HBB) gene in iPSCs derived from a patient with a double heterozygote for hemoglobin E and β-thalassemia (HbE/β-thalassemia), the most common thalassemia syndrome in Thailand and Southeast Asia. We used the CRISPR/Cas9 system to target the hemoglobin E mutation from one allele of the HBB gene by homology-directed repair with a single-stranded DNA oligonucleotide template. DNA sequences of the corrected iPSCs were validated by Sanger sequencing. The corrected clones were differentiated into hematopoietic progenitor and erythroid cells to confirm their multilineage differentiation potential and hemoglobin expression. The hemoglobin E mutation of HbE/β-thalassemia iPSCs was seamlessly corrected by the CRISPR/Cas9 system. The corrected clones were differentiated into hematopoietic progenitor cells under feeder-free and OP9 coculture systems. These progenitor cells were further expanded in erythroid liquid culture system and developed into erythroid cells that expressed mature HBB gene and HBB protein. Our study provides a strategy to correct hemoglobin E mutation in one step and these corrected iPSCs can be differentiated into hematopoietic stem cells to be used for autologous transplantation in patients with HbE/β-thalassemia in the future.

  10. Diverse growth hormone receptor gene mutations in Laron syndrome.

    PubMed Central

    Berg, M A; Argente, J; Chernausek, S; Gracia, R; Guevara-Aguirre, J; Hopp, M; Pérez-Jurado, L; Rosenbloom, A; Toledo, S P; Francke, U

    1993-01-01

    To better understand the molecular genetic basis and genetic epidemiology of Laron syndrome (growth-hormone insensitivity syndrome), we analyzed the growth-hormone receptor (GHR) genes of seven unrelated affected individuals from the United States, South America, Europe, and Africa. We amplified all nine GHR gene exons and splice junctions from these individuals by PCR and screened the products for mutations by using denaturing gradient gel electrophoresis (DGGE). We identified a single GHR gene fragment with abnormal DGGE results for each affected individual, sequenced this fragment, and, in each case, identified a mutation likely to cause Laron syndrome, including two nonsense mutations (R43X and R217X), two splice-junction mutations, (189-1 G to T and 71 + 1 G to A), and two frameshift mutations (46 del TT and 230 del TA or AT). Only one of these mutations, R43X, has been previously reported. Using haplotype analysis, we determined that this mutation, which involves a CpG dinucleotide hot spot, likely arose as a separate event in this case, relative to the two prior reports of R43X. Aside from R43X, the mutations we identified are unique to patients from particular geographic regions. Ten GHR gene mutations have now been described in this disorder. We conclude that Laron syndrome is caused by diverse GHR gene mutations, including deletions, RNA processing defects, translational stop codons, and missense codons. All the identified mutations involve the extracellular domain of the receptor, and most are unique to particular families or geographic areas. Images Figure 1 Figure 2 PMID:8488849

  11. Multiscale mutation clustering algorithm identifies pan-cancer mutational clusters associated with pathway-level changes in gene expression

    PubMed Central

    Poole, William; Leinonen, Kalle; Shmulevich, Ilya

    2017-01-01

    Cancer researchers have long recognized that somatic mutations are not uniformly distributed within genes. However, most approaches for identifying cancer mutations focus on either the entire-gene or single amino-acid level. We have bridged these two methodologies with a multiscale mutation clustering algorithm that identifies variable length mutation clusters in cancer genes. We ran our algorithm on 539 genes using the combined mutation data in 23 cancer types from The Cancer Genome Atlas (TCGA) and identified 1295 mutation clusters. The resulting mutation clusters cover a wide range of scales and often overlap with many kinds of protein features including structured domains, phosphorylation sites, and known single nucleotide variants. We statistically associated these multiscale clusters with gene expression and drug response data to illuminate the functional and clinical consequences of mutations in our clusters. Interestingly, we find multiple clusters within individual genes that have differential functional associations: these include PTEN, FUBP1, and CDH1. This methodology has potential implications in identifying protein regions for drug targets, understanding the biological underpinnings of cancer, and personalizing cancer treatments. Toward this end, we have made the mutation clusters and the clustering algorithm available to the public. Clusters and pathway associations can be interactively browsed at m2c.systemsbiology.net. The multiscale mutation clustering algorithm is available at https://github.com/IlyaLab/M2C. PMID:28170390

  12. Multiscale mutation clustering algorithm identifies pan-cancer mutational clusters associated with pathway-level changes in gene expression.

    PubMed

    Poole, William; Leinonen, Kalle; Shmulevich, Ilya; Knijnenburg, Theo A; Bernard, Brady

    2017-02-01

    Cancer researchers have long recognized that somatic mutations are not uniformly distributed within genes. However, most approaches for identifying cancer mutations focus on either the entire-gene or single amino-acid level. We have bridged these two methodologies with a multiscale mutation clustering algorithm that identifies variable length mutation clusters in cancer genes. We ran our algorithm on 539 genes using the combined mutation data in 23 cancer types from The Cancer Genome Atlas (TCGA) and identified 1295 mutation clusters. The resulting mutation clusters cover a wide range of scales and often overlap with many kinds of protein features including structured domains, phosphorylation sites, and known single nucleotide variants. We statistically associated these multiscale clusters with gene expression and drug response data to illuminate the functional and clinical consequences of mutations in our clusters. Interestingly, we find multiple clusters within individual genes that have differential functional associations: these include PTEN, FUBP1, and CDH1. This methodology has potential implications in identifying protein regions for drug targets, understanding the biological underpinnings of cancer, and personalizing cancer treatments. Toward this end, we have made the mutation clusters and the clustering algorithm available to the public. Clusters and pathway associations can be interactively browsed at m2c.systemsbiology.net. The multiscale mutation clustering algorithm is available at https://github.com/IlyaLab/M2C.

  13. Adjusting for background mutation frequency biases improves the identification of cancer driver genes.

    PubMed

    Evans, Perry; Avey, Stefan; Kong, Yong; Krauthammer, Michael

    2013-09-01

    A common goal of tumor sequencing projects is finding genes whose mutations are selected for during tumor development. This is accomplished by choosing genes that have more non-synonymous mutations than expected from an estimated background mutation frequency. While this background frequency is unknown, it can be estimated using both the observed synonymous mutation frequency and the non-synonymous to synonymous mutation ratio. The synonymous mutation frequency can be determined across all genes or in a gene-specific manner. This choice introduces an interesting trade-off. A gene-specific frequency adjusts for an underlying mutation bias, but is difficult to estimate given missing synonymous mutation counts. Using a genome-wide synonymous frequency is more robust, but is less suited for adjusting biases. Studying four evaluation criteria for identifying genes with high non-synonymous mutation burden (reflecting preferential selection of expressed genes, genes with mutations in conserved bases, genes with many protein interactions, and genes that show loss of heterozygosity), we find that the gene-specific synonymous frequency is superior in the gene expression and protein interaction tests. In conclusion, the use of the gene-specific synonymous mutation frequency is well suited for assessing a gene's non-synonymous mutation burden.

  14. Spectrum of Mutations in Hypertrophic Cardiomyopathy Genes Among Tunisian Patients.

    PubMed

    Jaafar, Nawel; Gómez, Juan; Kammoun, Ikram; Zairi, Ihsen; Amara, Wael Ben; Kachboura, Salem; Kraiem, Sondes; Hammami, Mohamed; Iglesias, Sara; Alonso, Belén; Coto, Eliecer

    2016-11-01

    Hypertrophic cardiomyopathy (HCM) is a common cardiac genetic disorder associated with heart failure and sudden death. Mutations in the cardiac sarcomere genes are found in approximately half of HCM patients and are more common among cases with a family history of the disease. Data about the mutational spectrum of the sarcomeric genes in HCM patients from Northern Africa are limited. The population of Tunisia is particularly interesting due to its Berber genetic background. As founder mutations have been reported in other disorders. We performed semiconductor chip (Ion Torrent PGM) next generation sequencing of the nine main sarcomeric genes (MYH7, MYBPC3, TNNT2, TNNI3, ACTC1, TNNC1, MYL2, MYL3, TPM1) as well as the recently identified as an HCM gene, FLNC, in 45 Tunisian HCM patients. We found sarcomere gene polymorphisms in 12 patients (27%), with MYBPC3 and MYH7 representing 83% (10/12) of the mutations. One patient was homozygous for a new MYL3 mutation and two were double MYBPC3 + MYH7 mutation carriers. Screening of the FLNC gene identified three new mutations, which points to FLNC mutations as an important cause of HCM among Tunisians. The mutational background of HCM in Tunisia is heterogeneous. Unlike other Mendelian disorders, there were no highly prevalent mutations that could explain most of the cases. Our study also suggested that FLNC mutations may play a role on the risk for HCM among Tunisians.

  15. Gene mutations in children with chronic pancreatitis.

    PubMed

    Witt, H

    2001-01-01

    In the last few years, several genes have been identified as being associated with hereditary and idiopathic chronic pancreatitis (CP), i.e. PRSS1, CFTR and SPINK1. In this study, we investigated 164 unrelated children and adolescents with CP for mutations in disease-associated genes by direct DNA sequencing, SSCP, RFLP and melting curve analysis. In 15 patients, we detected a PRSS1 mutation (8 with A16V, 5 with R122H, 2 with N29I), and in 34 patients, a SPINK1 mutation (30 with N34S, 4 with others). SPINK1 mutations were predominantly found in patients without a family history (29/121). Ten patients were homozygous for N34S, SPINK1 mutations were most common in 'idiopathic' CP, whereas patients with 'hereditary' CP predominantly showed a PRSS1 mutation (R122H, N29I). In patients without a family history, the most common PRSS1 mutation was A16V (7/121). In conclusion, our data suggest that CP may be inherited in a dominant, recessive or multigenetic manner as a result of mutations in the above-mentioned or as yet unidentified genes. This challenges the concept of idiopathic CP as a nongenetic disorder and the differentiation between hereditary and idiopathic CP. Therefore, we propose to classify CP as either 'primary CP' (with or without a family history) or 'secondary CP' caused by toxic, metabolic or other factors.

  16. [Mechanisms of endogenous drug resistance acquisition by spontaneous chromosomal gene mutation].

    PubMed

    Fukuda, H; Hiramatsu, K

    1997-05-01

    Endogenous resistance in bacteria is caused by a change or loss of function and generally genetically recessive. However, this type of resistance acquisition are now prevalent in clinical setting. Chromosomal genes that afford endogenous resistance are the genes correlated with the target of the drug, the drug inactivating enzymes, and permeability of the molecules including the antibacterial agents. Endogenous alteration of the drug target are mediated by the spontaneous mutation of their structural gene. This mutation provides much lower affinity of the drugs for the target. Gene expression of the inactivating enzymes, such as class C beta-lactamase, is generally regulated by regulatory genes. Spontaneous mutations in the regulatory genes cause constitutive enzyme production and provides the resistant to the agent which is usually stable for such enzymes. Spontaneous mutation in the structural gene gives the enzyme extra-spectrum substrate specificity, like ESBL (Extra-Spectrum-beta-Lactamase). Expression of structural genes encoding the permeability systems are also regulated by some regulatory genes. The spontaneous mutation of the regulatory genes reduce an amount of porin protein. This mutation causes much lower influx of the drug in the cell. Spontaneous mutation in promoter region of the structural gene of efflux protein was observed. This mutation raised the gene transcription and overproduced efflux protein. This protein progresses the drug efflux from the cell.

  17. [Maple syrup urine disease and gene mutations in twin neonates].

    PubMed

    Li, Tao; Wang, Yu; Li, Cui; Xu, Wei-Wei; Niu, Feng-Hai; Zhang, Di

    2016-12-01

    To investigate the clinical features of one pair of twin neonates with maple syrup urine disease (MSUD) in the Chinese Han population and pathogenic mutations in related genes, and to provide guidance for the early diagnosis and treatment of MSUD. The clinical and imaging data of the twin neonates were collected. The peripheral blood samples were collected from the twin neonates and their parents to detect the genes related to MSUD (BCKDHA, BCKDHB, DBT, and DLD). The loci with gene mutations were identified, and a bioinformatic analysis was performed. Two mutations were detected in the BCKDHB gene, missense mutation c.304G>A (p.Gly102Arg) and nonsense mutation c.331C>T (p.Arg111*), and both of them were heterozygotes. The mutation c.304G>A (p.Gly102Arg) had not been reported in the world. Their father carried the missense mutation c.304G>A (p.Gly102Arg), and their mother carried the nonsense mutation c.331C>T (p.Arg111*). The c.331C>T (p.Arg111*) heterozygous mutation in BCKDHB gene is the pathogenic mutation in these twin neonates and provides a genetic and molecular basis for the clinical features of children with MSUD.

  18. MUFFINN: cancer gene discovery via network analysis of somatic mutation data.

    PubMed

    Cho, Ara; Shim, Jung Eun; Kim, Eiru; Supek, Fran; Lehner, Ben; Lee, Insuk

    2016-06-23

    A major challenge for distinguishing cancer-causing driver mutations from inconsequential passenger mutations is the long-tail of infrequently mutated genes in cancer genomes. Here, we present and evaluate a method for prioritizing cancer genes accounting not only for mutations in individual genes but also in their neighbors in functional networks, MUFFINN (MUtations For Functional Impact on Network Neighbors). This pathway-centric method shows high sensitivity compared with gene-centric analyses of mutation data. Notably, only a marginal decrease in performance is observed when using 10 % of TCGA patient samples, suggesting the method may potentiate cancer genome projects with small patient populations.

  19. Mutations of the Norrie gene in Korean ROP infants.

    PubMed

    Kim, Jeong Hun; Yu, Young Suk; Kim, Jiyeon; Park, Seong Sup

    2002-12-01

    The present study was conducted to evaluate if there is a Norrie disease gene (ND gene) mutation involved in the retinopathy of prematurity (ROP), and to identify the possibility of a genetic abnormality that may be linked to the presence of ROP. Nineteen premature Korean infants, with a low birth weight (1500 g or less) or low gestational age (32 weeks or less), were included in the study. Eighteen infants had ROP, and the other did not. Genomic DNA was isolated from the peripheral blood leukocytes of these patients, and all three exons and their flanking areas, all known ND gene mutations regions, were evaluated following amplification by a polymerase chain reaction, but no ND gene mutations were detected. Any disagreement between the relationship of ROP to the ND gene mutation will need to be clarified by further investigation.

  20. DRUMS: a human disease related unique gene mutation search engine.

    PubMed

    Li, Zuofeng; Liu, Xingnan; Wen, Jingran; Xu, Ye; Zhao, Xin; Li, Xuan; Liu, Lei; Zhang, Xiaoyan

    2011-10-01

    With the completion of the human genome project and the development of new methods for gene variant detection, the integration of mutation data and its phenotypic consequences has become more important than ever. Among all available resources, locus-specific databases (LSDBs) curate one or more specific genes' mutation data along with high-quality phenotypes. Although some genotype-phenotype data from LSDB have been integrated into central databases little effort has been made to integrate all these data by a search engine approach. In this work, we have developed disease related unique gene mutation search engine (DRUMS), a search engine for human disease related unique gene mutation as a convenient tool for biologists or physicians to retrieve gene variant and related phenotype information. Gene variant and phenotype information were stored in a gene-centred relational database. Moreover, the relationships between mutations and diseases were indexed by the uniform resource identifier from LSDB, or another central database. By querying DRUMS, users can access the most popular mutation databases under one interface. DRUMS could be treated as a domain specific search engine. By using web crawling, indexing, and searching technologies, it provides a competitively efficient interface for searching and retrieving mutation data and their relationships to diseases. The present system is freely accessible at http://www.scbit.org/glif/new/drums/index.html. © 2011 Wiley-Liss, Inc.

  1. Analysis of gene mutations in Chinese patients with maple syrup urine disease.

    PubMed

    Yang, Nan; Han, Lianshu; Gu, Xuefan; Ye, Jun; Qiu, Wenjuan; Zhang, Huiwen; Gong, Zhuwen; Zhang, Yafen

    2012-08-01

    Maple syrup urine disease (MSUD) is predominantly caused by mutations in the BCKDHA, BCKDHB and DBT genes, which encode for the E1α, E1β and E2 subunits of the branched-chain α-keto acid dehydrogenase complex, respectively. The aim of this study was to screen DNA samples from 16 Chinese MSUD patients and assess a potential correlation between genotype and phenotype. BCKDHA, BCKDHB and DBT genes were analyzed by polymerase chain reaction (PCR) and direct sequencing. Segments bearing novel mutations were identified by PCR-restriction fragment length polymorphism (PCR-RFLP) analysis. Within the variant alleles, 28 mutations (28/32, 87.5%), were detected in 15 patients, while one patient displayed no mutations. Mutations were comprised of 20 different: 6 BCKDHA gene mutations in 4 cases, 10 BCKDHB gene mutations in 8 cases and 4 DBT gene mutations in 3 cases. From these, 14 were novel, which included 3 mutations in the BCKDHA gene, 7 in the BCKDHB gene and 4 in the DBT gene. Only two patients with mutations in the BCKDHB and DBT genes were thiamine-responsive and presented a better clinical outcome. We identified 20 different mutations within the BCKDHA, BCKDHB and DBT genes among 16 Chinese MSUD patients, including 14 novel mutations. The majority were non-responsive to thiamine, associating with a worse clinical outcome. Our data provide the basis for further genotype-phenotype correlation studies in these patients, which will be beneficial for early diagnosis and in directing the approach to clinical intervention. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. Molecular Characterization of β-Thalassemia in the Czech and Slovak Populations: Mediterranean, Asian and Unique Mutations.

    PubMed

    Divoka, Martina; Partschova, Martina; Kucerova, Jana; Mojzikova, Renata; Cermak, Jaroslav; Pospisilova, Dagmar; Fabryova, Viera; Prochazkova, Daniela; Indrak, Karel; Divoky, Vladimir

    2016-06-01

    β-Thalassemia (β-thal) is considered rare in Central Europe. As in other malaria-free regions, the presence of β-thal in Central Europe reflects historical and recent immigration, and demographic changes that have influenced the genetic variability of the current populations living in this area. This study assesses the frequency and spectrum of mutations on the β-globin gene in Czech and Slovak subjects with clinical symptoms of thalassemia. The results of the initial part of this research were published more than two decades ago; the aim of this study was to update these original reports. During the period from 2002 to 2015, 400 cases from Czech and Slovak hematological centers were analyzed. Twenty-nine β-thal mutations, identified in 356 heterozygotes from 218 unrelated families, involve five unique mutations including a recently described insertion of a transposable L1 element into the β-globin gene. One mutation described here is reported for the first time. Most of the mutations were of Mediterranean origin and accounted for 82.0% of cases. All but one case studied were heterozygous carriers, manifesting β-thal minor, with rare exceptions represented by the rare (β(0)) codons 46/47 (+G) (HBB: c.142_142dupG) mutation associated with an α-globin gene quadruplication and by dominantly inherited β-thal with a more severe phenotype. One double heterozygous β-thal patient was a recent immigrant from Moldavia. The list of δβ-thal alleles (26 carriers, 16 families) contains Hb Lepore and two types of δβ(0)-thal deletions. In the past, genetic drift and migration as well as recent immigrations were responsible for the introduction of Mediterranean alleles, while several mutations described in single families were of local origin.

  3. Ancient genes establish stress-induced mutation as a hallmark of cancer.

    PubMed

    Cisneros, Luis; Bussey, Kimberly J; Orr, Adam J; Miočević, Milica; Lineweaver, Charles H; Davies, Paul

    2017-01-01

    Cancer is sometimes depicted as a reversion to single cell behavior in cells adapted to live in a multicellular assembly. If this is the case, one would expect that mutation in cancer disrupts functional mechanisms that suppress cell-level traits detrimental to multicellularity. Such mechanisms should have evolved with or after the emergence of multicellularity. This leads to two related, but distinct hypotheses: 1) Somatic mutations in cancer will occur in genes that are younger than the emergence of multicellularity (1000 million years [MY]); and 2) genes that are frequently mutated in cancer and whose mutations are functionally important for the emergence of the cancer phenotype evolved within the past 1000 million years, and thus would exhibit an age distribution that is skewed to younger genes. In order to investigate these hypotheses we estimated the evolutionary ages of all human genes and then studied the probability of mutation and their biological function in relation to their age and genomic location for both normal germline and cancer contexts. We observed that under a model of uniform random mutation across the genome, controlled for gene size, genes less than 500 MY were more frequently mutated in both cases. Paradoxically, causal genes, defined in the COSMIC Cancer Gene Census, were depleted in this age group. When we used functional enrichment analysis to explain this unexpected result we discovered that COSMIC genes with recessive disease phenotypes were enriched for DNA repair and cell cycle control. The non-mutated genes in these pathways are orthologous to those underlying stress-induced mutation in bacteria, which results in the clustering of single nucleotide variations. COSMIC genes were less common in regions where the probability of observing mutational clusters is high, although they are approximately 2-fold more likely to harbor mutational clusters compared to other human genes. Our results suggest this ancient mutational response to

  4. Ancient genes establish stress-induced mutation as a hallmark of cancer

    PubMed Central

    Orr, Adam J.; Miočević, Milica; Lineweaver, Charles H.; Davies, Paul

    2017-01-01

    Cancer is sometimes depicted as a reversion to single cell behavior in cells adapted to live in a multicellular assembly. If this is the case, one would expect that mutation in cancer disrupts functional mechanisms that suppress cell-level traits detrimental to multicellularity. Such mechanisms should have evolved with or after the emergence of multicellularity. This leads to two related, but distinct hypotheses: 1) Somatic mutations in cancer will occur in genes that are younger than the emergence of multicellularity (1000 million years [MY]); and 2) genes that are frequently mutated in cancer and whose mutations are functionally important for the emergence of the cancer phenotype evolved within the past 1000 million years, and thus would exhibit an age distribution that is skewed to younger genes. In order to investigate these hypotheses we estimated the evolutionary ages of all human genes and then studied the probability of mutation and their biological function in relation to their age and genomic location for both normal germline and cancer contexts. We observed that under a model of uniform random mutation across the genome, controlled for gene size, genes less than 500 MY were more frequently mutated in both cases. Paradoxically, causal genes, defined in the COSMIC Cancer Gene Census, were depleted in this age group. When we used functional enrichment analysis to explain this unexpected result we discovered that COSMIC genes with recessive disease phenotypes were enriched for DNA repair and cell cycle control. The non-mutated genes in these pathways are orthologous to those underlying stress-induced mutation in bacteria, which results in the clustering of single nucleotide variations. COSMIC genes were less common in regions where the probability of observing mutational clusters is high, although they are approximately 2-fold more likely to harbor mutational clusters compared to other human genes. Our results suggest this ancient mutational response to

  5. Screening for mutations in two exons of FANCG gene in Pakistani population.

    PubMed

    Aymun, Ujala; Iram, Saima; Aftab, Iram; Khaliq, Saba; Nadir, Ali; Nisar, Ahmed; Mohsin, Shahida

    2017-06-01

    Fanconi anemia is a rare autosomal recessive disorder of genetic instability. It is both molecularly and clinically, a heterogeneous disorder. Its incidence is 1 in 129,000 births and relatively high in some ethnic groups. Sixteen genes have been identified among them mutations in FANCG gene are most common after FANCA and FANCC gene mutations. To study mutations in exon 3 and 4 of FANCG gene in Pakistani population. Thirty five patients with positive Diepoxybutane test were included in the study. DNA was extracted and amplified for exons 3 and 4. Thereafter Sequencing was done and analyzed for the presence of mutations. No mutation was detected in exon 3 whereas a carrier of known mutation c.307+1 G>T was found in exon 4 of the FANCG gene. Absence of any mutation in exon 3 and only one heterozygous mutation in exon 4 of FANCG gene points to a different spectrum of FA gene pool in Pakistan that needs extensive research in this area.

  6. TALEN-mediated generation and genetic correction of disease-specific human induced pluripotent stem cells.

    PubMed

    Ramalingam, Sivaprakash; Annaluru, Narayana; Kandavelou, Karthikeyan; Chandrasegaran, Srinivasan

    2014-01-01

    Generation and precise genetic correction of patient-derived hiPSCs have great potential in regenerative medicine. Such targeted genetic manipulations can now be achieved using gene-editing nucleases. Here, we report generation of cystic fibrosis (CF) and Gaucher's disease (GD) hiPSCs respectively from CF (homozygous for CFTRΔF508 mutation) and Type II GD [homozygous for β-glucocerebrosidase (GBA) 1448T>C mutation] patient fibroblasts, using CCR5- specific TALENs. Site-specific addition of loxP-flanked Oct4/Sox2/Klf4/Lin28/Nanog/eGFP gene cassette at the endogenous CCR5 site of patient-derived disease-specific primary fibroblasts induced reprogramming, giving rise to both monoallele (heterozygous) and biallele CCR5-modified hiPSCs. Subsequent excision of the donor cassette was done by treating CCR5-modified CF and GD hiPSCs with Cre. We also demonstrate site-specific correction of sickle cell disease (SCD) mutations at the endogenous HBB locus of patient-specific hiPSCs [TNC1 line that is homozygous for mutated β- globin alleles (βS/βS)], using HBB-specific TALENs. SCD-corrected hiPSC lines showed gene conversion of the mutated βS to the wild-type βA in one of the HBB alleles, while the other allele remained a mutant phenotype. After excision of the loxP-flanked DNA cassette from the SCD-corrected hiPSC lines using Cre, we obtained secondary heterozygous βS/βA hiPSCs, which express the wild-type (βA) transcript to 30-40% level as compared to uncorrected (βS/βS) SCD hiPSCs when differentiated into erythroid cells. Furthermore, we also show that TALEN-mediated generation and genetic correction of disease-specific hiPSCs did not induce any off-target mutations at closely related sites.

  7. Analysis of gene mutations among South Indian patients with maple syrup urine disease: identification of four novel mutations.

    PubMed

    Narayanan, M P; Menon, Krishnakumar N; Vasudevan, D M

    2013-10-01

    Maple syrup urine disease (MSUD) is predominantly caused by mutations in the BCKDHA, BCKDHB and DBT genes, which encode for the E1alpha, E1beta and E2 subunits of the branched-chain alpha-keto acid dehydrogenase complex, respectively. Because disease causing mutations play a major role in the development of the disease, prenatal diagnosis at gestational level may have significance in making decisions by parents. Thus, this study was aimed to screen South Indian MSUD patients for mutations and assess the genotype-phenotype correlation. Thirteen patients diagnosed with MSUD by conventional biochemical screening such as urine analysis by DNPH test, thin layer chromatography for amino acids and blood amino acid quantification by HPLC were selected for mutation analysis. The entire coding regions of the BCKDHA, BCKDHB and DBT genes were analyzed for mutations by PCR-based direct DNA sequencing. BCKDHA and BCKDHB mutations were seen in 43% of the total ten patients, while disease-causing DBT gene mutation was observed only in 14%. Three patients displayed no mutations. Novel mutations were c.130C>T in BCKDHA gene, c. 599C>T and c.121_122delAC in BCKDHB gene and c.190G>A in DBT gene. Notably, patients harbouring these mutations were non-responsive to thiamine supplementation and other treatment regimens and might have a worse prognosis as compared to the patients not having such mutations. Thus, identification of these mutations may have a crucial role in the treatment as well as understanding the molecular mechanisms in MSUD.

  8. Arrestin gene mutations in autosomal recessive retinitis pigmentosa.

    PubMed

    Nakazawa, M; Wada, Y; Tamai, M

    1998-04-01

    To assess the clinical and molecular genetic studies of patients with autosomal recessive retinitis pigmentosa associated with a mutation in the arrestin gene. Results of molecular genetic screening and case reports with DNA analysis and clinical features. University medical center. One hundred twenty anamnestically unrelated patients with autosomal recessive retinitis pigmentosa. DNA analysis was performed by single strand conformation polymorphism followed by nucleotide sequencing to search for a mutation in exon 11 of the arrestin gene. Clinical features were characterized by visual acuity slitlamp biomicroscopy, fundus examinations, fluorescein angiography, kinetic visual field testing, and electroretinography. We identified 3 unrelated patients with retinitis pigmentosa associated with a homozygous 1-base-pair deletion mutation in codon 309 of the arrestin gene designated as 1147delA. All 3 patients showed pigmentary retinal degeneration in the midperipheral area with or without macular involvement. Patient 1 had a sibling with Oguchi disease associated with the same mutation. Patient 2 demonstrated pigmentary retinal degeneration associated with a golden-yellow reflex in the peripheral fundus. Patients 1 and 3 showed features of retinitis pigmentosa without the golden-yellow fundus reflex. Although the arrestin 1147delA has been known as a frequent cause of Oguchi disease, this mutation also may be related to the pathogenesis of autosomal recessive retinitis pigmentosa. This phenomenon may provide evidence of variable expressivity of the mutation in the arrestin gene.

  9. Cis-regulatory somatic mutations and gene-expression alteration in B-cell lymphomas.

    PubMed

    Mathelier, Anthony; Lefebvre, Calvin; Zhang, Allen W; Arenillas, David J; Ding, Jiarui; Wasserman, Wyeth W; Shah, Sohrab P

    2015-04-23

    With the rapid increase of whole-genome sequencing of human cancers, an important opportunity to analyze and characterize somatic mutations lying within cis-regulatory regions has emerged. A focus on protein-coding regions to identify nonsense or missense mutations disruptive to protein structure and/or function has led to important insights; however, the impact on gene expression of mutations lying within cis-regulatory regions remains under-explored. We analyzed somatic mutations from 84 matched tumor-normal whole genomes from B-cell lymphomas with accompanying gene expression measurements to elucidate the extent to which these cancers are disrupted by cis-regulatory mutations. We characterize mutations overlapping a high quality set of well-annotated transcription factor binding sites (TFBSs), covering a similar portion of the genome as protein-coding exons. Our results indicate that cis-regulatory mutations overlapping predicted TFBSs are enriched in promoter regions of genes involved in apoptosis or growth/proliferation. By integrating gene expression data with mutation data, our computational approach culminates with identification of cis-regulatory mutations most likely to participate in dysregulation of the gene expression program. The impact can be measured along with protein-coding mutations to highlight key mutations disrupting gene expression and pathways in cancer. Our study yields specific genes with disrupted expression triggered by genomic mutations in either the coding or the regulatory space. It implies that mutated regulatory components of the genome contribute substantially to cancer pathways. Our analyses demonstrate that identifying genomically altered cis-regulatory elements coupled with analysis of gene expression data will augment biological interpretation of mutational landscapes of cancers.

  10. CFTR gene mutations in isolated chronic obstructive pulmonary disease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pignatti, P.F.; Bombien, C.; Marigo, C.

    1994-09-01

    In order to identify a possible hereditary predisposition to the development of chronic obstructive pulmonary disease (COPD), we have looked for the presence of cystic fibrosis transmembrane regulator (CFTR) gene DNA sequence modifications in 28 unrelated patients with no signs of cystic fibrosis. The known mutations in Italian CF patients, as well as the most frequent worldwide CF mutations, were investigated. In addition, a denaturing gradient gel electrophoresis analysis of about half of the coding sequence of the gene in 56 chromosomes from the patients and in 102 chromosomes from control individuals affected by other pulmonary diseases and from normalmore » controls was performed. Nine different CFTR gene mutations and polymorphisms were found in seven patients, a highly significant increase over controls. Two of the patients were compound heterozygotes. Two frequent CF mutations were detected: deletion F508 and R117H; two rare CF mutations: R1066C and 3667ins4; and five CF sequence variants: R75Q (which was also described as a disease-causing mutation in male sterility cases due to the absence of the vasa deferentia), G576A, 2736 A{r_arrow}G, L997F, and 3271+18C{r_arrow}T. Seven (78%) of the mutations are localized in transmembrane domains. Six (86%) of the patients with defined mutations and polymorphisms had bronchiectasis. These results indicate that CFTR gene mutations and sequence alterations may be involved in the etiopathogenesis of some cases of COPD.« less

  11. PIK3CA gene mutations in Northwest Chinese esophageal squamous cell carcinoma

    PubMed Central

    Liu, Shi-Yuan; Chen, Wei; Chughtai, Ehtesham Annait; Qiao, Zhe; Jiang, Jian-Tao; Li, Shao-Min; Zhang, Wei; Zhang, Jin

    2017-01-01

    AIM To evaluate PIK3CA gene mutational status in Northwest Chinese esophageal squamous cell carcinoma (ESCC) patients, and examine the associations of PIK3CA gene mutations with clinicopathological characteristics and clinical outcome. METHODS A total of 210 patients with ESCC who underwent curative resection were enrolled in this study. Pyrosequencing was applied to investigate mutations in exons 9 and 20 of PIK3CA gene in 210 Northwest Chinese ESCCs. The associations of PIK3CA gene mutations with clinicopathological characteristics and clinical outcome were examined. RESULTS PIK3CA gene mutations in exon 9 were detected in 48 cases (22.9%) of a non-biased database of 210 curatively resected Northwest Chinese ESCCs. PIK3CA gene mutations were not associated with sex, tobacco use, alcohol use, tumor location, stage, or local recurrence. When compared with wild-type PIK3CA gene cases, patients with PIK3CA gene mutations in exons 9 experienced significantly better disease-free survival and overall survival rates. CONCLUSION The results of this study suggest that PIK3CA gene mutations could act as a prognostic biomarker in Northwest Chinese ESCC patients. PMID:28465643

  12. The landscape of cancer genes and mutational processes in breast cancer

    PubMed Central

    Stephens, Philip J.; Tarpey, Patrick S.; Davies, Helen; Loo, Peter Van; Greenman, Chris; Wedge, David C.; Nik-Zainal, Serena; Martin, Sancha; Varela, Ignacio; Bignell, Graham R.; Yates, Lucy R.; Papaemmanuil, Elli; Beare, David; Butler, Adam; Cheverton, Angela; Gamble, John; Hinton, Jonathan; Jia, Mingming; Jayakumar, Alagu; Jones, David; Latimer, Calli; Lau, King Wai; McLaren, Stuart; McBride, David J.; Menzies, Andrew; Mudie, Laura; Raine, Keiran; Rad, Roland; Chapman, Michael Spencer; Teague, Jon; Easton, Douglas; Langerød, Anita; OSBREAC; Lee, Ming Ta Michael; Shen, Chen-Yang; Tee, Benita Tan Kiat; Huimin, Bernice Wong; Broeks, Annegien; Vargas, Ana Cristina; Turashvili, Gulisa; Martens, John; Fatima, Aquila; Miron, Penelope; Chin, Suet-Feung; Thomas, Gilles; Boyault, Sandrine; Mariani, Odette; Lakhani, Sunil R.; van de Vijver, Marc; van ’t Veer, Laura; Foekens, John; Desmedt, Christine; Sotiriou, Christos; Tutt, Andrew; Caldas, Carlos; Reis-Filho, Jorge S.; Aparicio, Samuel A. J. R.; Salomon, Anne Vincent; Børresen-Dale, Anne-Lise; Richardson, Andrea L.; Campbell, Peter J.; Futreal, P. Andrew; Stratton, Michael R.

    2012-01-01

    All cancers carry somatic mutations in their genomes. A subset, known as driver mutations, confer clonal selective advantage on cancer cells and are causally implicated in oncogenesis1, and the remainder are passenger mutations. The driver mutations and mutational processes operative in breast cancer have not yet been comprehensively explored. Here we examine the genomes of 100 tumours for somatic copy number changes and mutations in the coding exons of protein-coding genes. The number of somatic mutations varied markedly between individual tumours. We found strong correlations between mutation number, age at which cancer was diagnosed and cancer histological grade, and observed multiple mutational signatures, including one present in about ten per cent of tumours characterized by numerous mutations of cytosine at TpC dinucleotides. Driver mutations were identified in several new cancer genes including AKT2, ARID1B, CASP8, CDKN1B, MAP3K1, MAP3K13, NCOR1, SMARCD1 and TBX3. Among the 100 tumours, we found driver mutations in at least 40 cancer genes and 73 different combinations of mutated cancer genes. The results highlight the substantial genetic diversity underlying this common disease. PMID:22722201

  13. Mutations in the Norrie disease gene.

    PubMed

    Schuback, D E; Chen, Z Y; Craig, I W; Breakefield, X O; Sims, K B

    1995-01-01

    We report our experience to date in mutation identification in the Norrie disease (ND) gene. We carried out mutational analysis in 26 kindreds in an attempt to identify regions presumed critical to protein function and potentially correlated with generation of the disease phenotype. All coding exons, as well as noncoding regions of exons 1 and 2, 636 nucleotides in the noncoding region of exon 3, and 197 nucleotides of 5' flanking sequence, were analyzed for single-strand conformation polymorphisms (SSCP) by polymerase chain reaction (PCR) amplification of genomic DNA. DNA fragments that showed altered SSCP band mobilities were sequenced to locate the specific mutations. In addition to three previously described submicroscopic deletions encompassing the entire ND gene, we have now identified 6 intragenic deletions, 8 missense (seven point mutations, one 9-bp deletion), 6 nonsense (three point mutations, three single bp deletions/frameshift) and one 10-bp insertion, creating an expanded repeat in the 5' noncoding region of exon 1. Thus, mutations have been identified in a total of 24 of 26 (92%) of the kindreds we have studied to date. With the exception of two different mutations, each found in two apparently unrelated kindreds, these mutations are unique and expand the genotype database. Localization of the majority of point mutations at or near cysteine residues, potentially critical in protein tertiary structure, supports a previous protein model for norrin as member of a cystine knot growth factor family (Meitinger et al., 1993). Genotype-phenotype correlations were not evident with the limited clinical data available, except in the cases of larger submicroscopic deletions associated with a more severe neurologic syndrome.(ABSTRACT TRUNCATED AT 250 WORDS)

  14. Cancer genes mutation profiling in calcifying epithelial odontogenic tumour.

    PubMed

    de Sousa, Sílvia Ferreira; Diniz, Marina Gonçalves; França, Josiane Alves; Fontes Pereira, Thaís Dos Santos; Moreira, Rennan Garcias; Santos, Jean Nunes Dos; Gomez, Ricardo Santiago; Gomes, Carolina Cavalieri

    2018-03-01

    To identify calcifying epithelial odontogenic tumour (CEOT) mutations in oncogenes and tumour suppressor genes. A panel of 50 genes commonly mutated in cancer was sequenced in CEOT by next-generation sequencing. Sanger sequencing was used to cover the region of the frameshift deletion identified in one sample. Missense single nucleotide variants (SNVs) with minor allele frequency (MAF) <1% were detected in PTEN , MET and JAK3 . A frameshift deletion in CDKN2A occurred in association with a missense mutation in the same gene region, suggesting a second hit in the inactivation of this gene. APC, KDR, KIT, PIK3CA and TP53 missense SNVs were identified; however, these are common SNVs, showing MAF >1%. CEOT harbours mutations in the tumour suppressor PTEN and CDKN2A and in the oncogenes JAK3 and MET . As these mutations occurred in only one case each, they are probably not driver mutations for these tumours. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  15. [Fluoroquinolone resistance mutations in topoisomerase genes of Salmonella typhimurium isolates].

    PubMed

    Guo, Yunchang; Pei, Xiaoyan; Liu, Xiumei

    2004-09-01

    Mutations in topoisomerase genes were main cause of the resistence of Salmonella typhimurium to fluoroquinolone. The MICs of three Salmonella typhimurium isolates X2, X7, X11 to ciprofloxacin were above 32 microg/ml, 0.38 microg/ml and 0.023 microg/ml, respectively. The genetic alterations in four topoisomerase genes, gyrA, gyrB, parC, and parE were detected by multiplex PCR amplimer conformation analysis in these three strains. X2 isolate showed both gyrA mutations (Ser83-->Phe, Asp87-->Asn) and parC mutation (Ser80-->Arg). X7 isolate showed a single gyrA mutation (Ser83-->Phe) and X11 isolate had no changes in all of the four quinolone resistance genes, gyrA, gyrB, parC, and parE. X7 isolate with a single gyrA mutation was less resistant to ciprofloxacin than X2 with double gyrA mutations and an additional parC mutation. GyrA and parC genes play important role of the resistance of Salmonella typhimurium to ciprofloxacin.

  16. Occult HBV among Anti-HBc Alone: Mutation Analysis of an HBV Surface Gene and Pre-S Gene.

    PubMed

    Kim, Myeong Hee; Kang, So Young; Lee, Woo In

    2017-05-01

    The aim of this study is to investigate the molecular characteristics of occult hepatitis B virus (HBV) infection in 'anti-HBc alone' subjects. Twenty-four patients with 'anti-HBc alone' and 20 control patients diagnosed with HBV were analyzed regarding S and pre-S gene mutations. All specimens were analyzed for HBs Ag, anti-HBc, and anti-HBs. For specimens with an anti-HBc alone, quantitative analysis of HBV DNA, as well as sequencing and mutation analysis of S and pre-S genes, were performed. A total 24 were analyzed for the S gene, and 14 were analyzed for the pre-S gene through sequencing. A total of 20 control patients were analyzed for S and pre-S gene simultaneously. Nineteen point mutations of the major hydrophilic region were found in six of 24 patients. Among them, three mutations, S114T, P127S/T, M133T, were detected in common. Only one mutation was found in five subjects of the control group; this mutation was not found in the occult HBV infection group, however. Pre-S mutations were detected in 10 patients, and mutations of site aa58-aa100 were detected in 9 patients. A mutation on D114E was simultaneously detected. Although five mutations from the control group were found at the same location (aa58-aa100), no mutations of occult HBV infection were detected. The prevalence of occult HBV infection is not low among 'anti-HBc alone' subjects. Variable mutations in the S gene and pre-S gene were associated with the occurrence of occult HBV infection. Further larger scale studies are required to determine the significance of newly detected mutations. © Copyright: Yonsei University College of Medicine 2017

  17. Increased expression of a set of genes enriched in oxygen binding function discloses a predisposition of breast cancer bone metastases to generate metastasis spread in multiple organs.

    PubMed

    Capulli, Mattia; Angelucci, Adriano; Driouch, Keltouma; Garcia, Teresa; Clement-Lacroix, Philippe; Martella, Francesco; Ventura, Luca; Bologna, Mauro; Flamini, Stefano; Moreschini, Oreste; Lidereau, Rosette; Ricevuto, Enrico; Muraca, Maurizio; Teti, Anna; Rucci, Nadia

    2012-11-01

    Bone is the preferential site of distant metastasis in breast carcinoma (BrCa). Patients with metastasis restricted to bone (BO) usually show a longer overall survival compared to patients who rapidly develop multiple metastases also involving liver and lung. Hence, molecular predisposition to generate bone and visceral metastases (BV) represents a clear indication of poor clinical outcome. We performed microarray analysis with two different chip platforms, Affymetrix and Agilent, on bone metastasis samples from BO and BV patients. The unsupervised hierarchical clustering of the resulting transcriptomes correlated with the clinical progression, segregating the BO from the BV profiles. Matching the twofold significantly regulated genes from Affymetrix and Agilent chips resulted in a 15-gene signature with 13 upregulated and two downregulated genes in BV versus BO bone metastasis samples. In order to validate the resulting signature, we isolated different MDA-MB-231 clonal subpopulations that metastasize only in the bone (MDA-BO) or in bone and visceral tissues (MDA-BV). Six of the signature genes were also significantly upregulated in MDA-BV compared to MDA-BO clones. A group of upregulated genes, including Hemoglobin B (HBB), were involved in oxygen metabolism, and in vitro functional analysis of HBB revealed that its expression in the MDA subpopulations was associated with a reduced production of hydrogen peroxide. Expression of HBB was detected in primary BrCa tissue but not in normal breast epithelial cells. Metastatic lymph nodes were frequently more positive for HBB compared to the corresponding primary tumors, whereas BO metastases had a lower expression than BV metastases, suggesting a positive correlation between HBB and ability of bone metastasis to rapidly spread to other organs. We propose that HBB, along with other genes involved in oxygen metabolism, confers a more aggressive metastatic phenotype in BrCa cells disseminated to bone. Copyright © 2012

  18. ABCG5/G8 gene is associated with hypercholesterolemias without mutation in candidate genes and noncholesterol sterols.

    PubMed

    Lamiquiz-Moneo, Itziar; Baila-Rueda, Lucía; Bea, Ana M; Mateo-Gallego, Rocío; Pérez-Calahorra, Sofía; Marco-Benedí, Victoria; Martín-Navarro, Antonio; Ros, Emilio; Cofán, Montserrat; Rodríguez-Rey, José Carlos; Pocovi, Miguel; Cenarro, Ana; Civeira, Fernando

    Approximately 20% to 40% of clinically defined familial hypercholesterolemia (FH) cases do not show a causative mutation in candidate genes (mutation-negative FH), and some of them may have a polygenic origin. The aim of this work was to study the prevalence of ABCG5/G8 genetic variants in mutation-negative FH, as defects in these genes relate to intestinal hyperabsorption of cholesterol and thus ABCG5/G8 variants could explain in part the mechanism of hypercholesterolemia. We sequenced the ABCG5/G8 genes in 214 mutation-negative FH and 97 controls. Surrogate markers of cholesterol absorption (5α-cholestanol, β-sitosterol, campesterol, stigmasterol, and sitostanol) were quantified by high-performance liquid chromatography-tandem mass spectrometry in both studied groups. We found 8 mutation-negative FH patients (3.73%) with a pathogenic mutation in ABCG5/G8 genes. We observed significantly higher concentration of surrogate markers of cholesterol absorption in mutation-negative FH than in controls. In addition, we found significantly higher concentrations of cholesterol absorption markers in mutation-negative FH with ABCG5/G8 defects than in mutation-negative, ABCG5/G8-negative FH. A gene score reflecting the number of common single nucleotide variants associated with hypercholesterolemia was significantly higher in cases than in controls (P = .032). Subjects with a gene score above the mean had significantly higher 5α-cholestanol and stigmasterol than those with a lower gene score. Mutation-negative FH subjects accumulate an excess of rare and common gene variations in ABCG5/G8 genes. This variation is associated with increased intestinal absorption of cholesterol, as determined by surrogate makers, suggesting that these loci contribute to hypercholesterolemia by enhancing intestinal cholesterol absorption. Copyright © 2017 National Lipid Association. Published by Elsevier Inc. All rights reserved.

  19. The androgen receptor gene mutations database.

    PubMed

    Gottlieb, B; Trifiro, M; Lumbroso, R; Vasiliou, D M; Pinsky, L

    1996-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. We have added (if available) data on the androgen binding phenotype of the mutant AR, the clinical phenotype of the affected persons, the family history and whether the pathogenicity of a mutation has been proven. Exonic mutations are now listed in 5'-->3' sequence regardless of type and single base pair changes are presented in codon context. Splice site and intronic mutations are listed separately. The database has allowed us to substantiate and amplify the observation of mutational hot spots within exons encoding the AR androgen binding domain. The database is available from EML (ftp://www.ebi.ac.uk/pub/databases/androgen) or as a Macintosh Filemaker file (MC33@musica.mcgill.ca).

  20. Comprehensive Characterization of Cancer Driver Genes and Mutations.

    PubMed

    Bailey, Matthew H; Tokheim, Collin; Porta-Pardo, Eduard; Sengupta, Sohini; Bertrand, Denis; Weerasinghe, Amila; Colaprico, Antonio; Wendl, Michael C; Kim, Jaegil; Reardon, Brendan; Ng, Patrick Kwok-Shing; Jeong, Kang Jin; Cao, Song; Wang, Zixing; Gao, Jianjiong; Gao, Qingsong; Wang, Fang; Liu, Eric Minwei; Mularoni, Loris; Rubio-Perez, Carlota; Nagarajan, Niranjan; Cortés-Ciriano, Isidro; Zhou, Daniel Cui; Liang, Wen-Wei; Hess, Julian M; Yellapantula, Venkata D; Tamborero, David; Gonzalez-Perez, Abel; Suphavilai, Chayaporn; Ko, Jia Yu; Khurana, Ekta; Park, Peter J; Van Allen, Eliezer M; Liang, Han; Lawrence, Michael S; Godzik, Adam; Lopez-Bigas, Nuria; Stuart, Josh; Wheeler, David; Getz, Gad; Chen, Ken; Lazar, Alexander J; Mills, Gordon B; Karchin, Rachel; Ding, Li

    2018-04-05

    Identifying molecular cancer drivers is critical for precision oncology. Multiple advanced algorithms to identify drivers now exist, but systematic attempts to combine and optimize them on large datasets are few. We report a PanCancer and PanSoftware analysis spanning 9,423 tumor exomes (comprising all 33 of The Cancer Genome Atlas projects) and using 26 computational tools to catalog driver genes and mutations. We identify 299 driver genes with implications regarding their anatomical sites and cancer/cell types. Sequence- and structure-based analyses identified >3,400 putative missense driver mutations supported by multiple lines of evidence. Experimental validation confirmed 60%-85% of predicted mutations as likely drivers. We found that >300 MSI tumors are associated with high PD-1/PD-L1, and 57% of tumors analyzed harbor putative clinically actionable events. Our study represents the most comprehensive discovery of cancer genes and mutations to date and will serve as a blueprint for future biological and clinical endeavors. Published by Elsevier Inc.

  1. Update of the androgen receptor gene mutations database.

    PubMed

    Gottlieb, B; Beitel, L K; Lumbroso, R; Pinsky, L; Trifiro, M

    1999-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 309 to 374 during the past year. We have expanded the database by adding information on AR-interacting proteins; and we have improved the database by identifying those mutation entries that have been updated. Mutations of unknown significance have now been reported in both the 5' and 3' untranslated regions of the AR gene, and in individuals who are somatic mosaics constitutionally. In addition, single nucleotide polymorphisms, including silent mutations, have been discovered in normal individuals and in individuals with male infertility. A mutation hotspot associated with prostatic cancer has been identified in exon 5. The database is available on the internet (http://www.mcgill.ca/androgendb/), from EMBL-European Bioinformatics Institute (ftp.ebi.ac.uk/pub/databases/androgen), or as a Macintosh FilemakerPro or Word file (MC33@musica.mcgill.ca). Copyright 1999 Wiley-Liss, Inc.

  2. AID-initiated purposeful mutations in immunoglobulin genes.

    PubMed

    Goodman, Myron F; Scharff, Matthew D; Romesberg, Floyd E

    2007-01-01

    Exposure brings risk to all living organisms. Using a remarkably effective strategy, higher vertebrates mitigate risk by mounting a complex and sophisticated immune response to counter the potentially toxic invasion by a virtually limitless army of chemical and biological antagonists. Mutations are almost always deleterious, but in the case of antibody diversification there are mutations occurring at hugely elevated rates within the variable (V) and switch regions (SR) of the immunoglobulin (Ig) genes that are responsible for binding to and neutralizing foreign antigens throughout the body. These mutations are truly purposeful. This chapter is centered on activation-induced cytidine deaminase (AID). AID is required for initiating somatic hypermutation (SHM) in the V regions and class switch recombination (CSR) in the SR portions of Ig genes. By converting C --> U, while transcription takes place, AID instigates a cascade of mutational events involving error-prone DNA polymerases, base excision and mismatch repair enzymes, and recombination pathways. Together, these processes culminate in highly mutated antibody genes and the B cells expressing antibodies that have achieved optimal antigenic binding undergo positive selection in germinal centers. We will discuss the biological role of AID in this complex process, primarily in terms of its biochemical properties in relation to SHM in vivo. The chapter also discusses recent advances in experimental methods to characterize antibody dynamics as a function of SHM to help elucidate the role that the AID-induced mutations play in tailoring molecular recognition. The emerging experimental techniques help to address long-standing conundrums concerning evolution-imposed constraints on antibody structure and function.

  3. Mutations in HAMP and HJV genes and their impact on expression of clinical hemochromatosis in a cohort of 100 Spanish patients homozygous for the C282Y mutation of HFE gene.

    PubMed

    Altès, Albert; Bach, Vanessa; Ruiz, Angels; Esteve, Anna; Felez, Jordi; Remacha, Angel F; Sardà, M Pilar; Baiget, Montserrat

    2009-10-01

    Most hereditary hemochromatosis (HH) patients are homozygous for the C282Y mutation of the HFE gene. Nevertheless, penetrance of the disease is very variable. In some patients, penetrance can be mediated by concomitant mutations in other iron master genes. We evaluated the clinical impact of hepcidin (HAMP) and hemojuvelin mutations in a cohort of 100 Spanish patients homozygous for the C282Y mutation of the HFE gene. HAMP and hemojuvelin mutations were evaluated in all patients by bidirectional direct cycle sequencing. Phenotype-genotype interactions were evaluated. A heterozygous mutation of the HAMP gene (G71D) was found in only one out of 100 cases. Following, we performed a study of several members of that family, and we observed several members had a digenic inheritance of the C282Y mutation of the HFE gene and the G71D mutation of the HAMP gene. This mutation in the HAMP gene did not modify the phenotype of the individuals who were homozygous for the C282Y mutation. One other patient presented a new polymorphism in the hemojuvelin gene, without consequences in iron load or clinical course of the disease. In conclusion, HAMP and hemojuvelin mutations are rare among Spanish HH patients, and their impact in this population is not significant.

  4. Mutation analysis of the Smad3 gene in human osteoarthritis.

    PubMed

    Yao, Jun-Yan; Wang, Yan; An, Jing; Mao, Chun-Ming; Hou, Ning; Lv, Ya-Xin; Wang, You-Liang; Cui, Fang; Huang, Min; Yang, Xiao

    2003-09-01

    Osteoarthritis (OA) is the most common joint disease worldwide. Recent studies have shown that targeted disruption of Smad3 in mouse results in OA. To reveal the possible association between the Smad3 gene mutation and human OA, we employed polymerase chain reaction-single strand conformation polymorphism and sequencing to screen mutations in all nine exons of the Smad3 gene in 32 patients with knee OA and 50 patients with only bone fracture. A missense mutation of the Smad3 gene was found in one patient. The single base mutation located in the linker region of the SMAD3 protein was A --> T change in the position 2 of codon 197 and resulted in an asparagine to isoleucine amino-acid substitution. The expressions of matrix metalloproteinase 2 (MMP-2) and MMP-9 in sera of the patient carrying the mutation were higher than other OA patients and controls. This is the first report showing that the Smad3 gene mutations could be associated with the pathogenesis of human OA.

  5. Dosage Mutator Genes in Saccharomyces cerevisiae: A Novel Mutator Mode-of-Action of the Mph1 DNA Helicase.

    PubMed

    Ang, J Sidney; Duffy, Supipi; Segovia, Romulo; Stirling, Peter C; Hieter, Philip

    2016-11-01

    Mutations that cause genome instability are considered important predisposing events that contribute to initiation and progression of cancer. Genome instability arises either due to defects in genes that cause an increased mutation rate (mutator phenotype), or defects in genes that cause chromosome instability (CIN). To extend the catalog of genome instability genes, we systematically explored the effects of gene overexpression on mutation rate, using a forward-mutation screen in budding yeast. We screened ∼5100 plasmids, each overexpressing a unique single gene, and characterized the five strongest mutators, MPH1 (mutator phenotype 1), RRM3, UBP12, PIF1, and DNA2 We show that, for MPH1, the yeast homolog of Fanconi Anemia complementation group M (FANCM), the overexpression mutator phenotype is distinct from that of mph1Δ. Moreover, while four of our top hits encode DNA helicases, the overexpression of 48 other DNA helicases did not cause a mutator phenotype, suggesting this is not a general property of helicases. For Mph1 overexpression, helicase activity was not required for the mutator phenotype; in contrast Mph1 DEAH-box function was required for hypermutation. Mutagenesis by MPH1 overexpression was independent of translesion synthesis (TLS), but was suppressed by overexpression of RAD27, a conserved flap endonuclease. We propose that binding of DNA flap structures by excess Mph1 may block Rad27 action, creating a mutator phenotype that phenocopies rad27Δ. We believe this represents a novel mutator mode-of-action and opens up new prospects to understand how upregulation of DNA repair proteins may contribute to mutagenesis. Copyright © 2016 by the Genetics Society of America.

  6. Mutational analysis of FLASH and PTPN13 genes in colorectal carcinomas.

    PubMed

    Jeong, Eun Goo; Lee, Sung Hak; Yoo, Nam Jin; Lee, Sug Hyung

    2008-01-01

    The Fas-Fas ligand system is considered a major pathway for induction of apoptosis in cells and tissues. FLASH was identified as a pro-apoptotic protein that transmits apoptosis signal during Fas-mediated apoptosis. PTPN13 interacts with Fas and functions as both suppressor and inducer of Fas-mediated apoptosis. There are polyadenine tracts in both FLASH (A8 and A9 in exon 8) and PTPN13 (A8 in exon 7) genes that could be frameshift mutation targets in colorectal carcinomas. Because genes encoding proteins in Fas-mediated apoptosis frequently harbor somatic mutations in cancers, we explored the possibility as to whether mutations of FLASH and PTPN13 are a feature of colorectal carcinomas. We analysed human FLASH in exon 8 and PTPN13 in exon 7 for the detection of somatic mutations in 103 colorectal carcinomas by a polymerase chain reaction (PCR)- based single-strand conformation polymorphism (SSCP). We detected two mutations in FLASH gene, but none in PTPN13 gene. However, the two mutations were not frameshift (deletion or insertion) mutations in the polyadenine tracts of FLASH. The two mutations consisted of a deletion mutation (c.3734-3737delAGAA) and a missense mutation (c.3703A>C). These data indicate that frameshift mutation in the polyadenine tracts in both FLASH and PTPN13 genes is rare in colorectal carcinomas. Also, the data suggest that both FLASH and PTPN13 mutations in the polyadenine tracts may not have a crucial role in the pathogenesis of colorectal carcinomas.

  7. Mutation profiling of 16 candidate genes in de novo acute myeloid leukemia patients.

    PubMed

    Zhang, Yang; Wang, Fang; Chen, Xue; Liu, Wenjing; Fang, Jiancheng; Wang, Mingyu; Teng, Wen; Cao, Panxiang; Liu, Hongxing

    2018-05-26

    This retrospective analysis aimed to investigate the mutation profile of 16 common mutated genes in de novo acute myeloid leukemia (AML) patients. A total of 259 patients who were diagnosed of de novo AML were enrolled in this study. Mutation profiling of 16 candidate genes were performed in bone marrow samples by using Sanger sequencing.We identified at least 1 mutation in 199 of the 259 samples (76.8%), and 2 or more mutations in 31.7% of samples. FLT3-ITD was the most common mutated gene (16.2%, 42/259), followed by CEBPA (15.1%, 39/259), NRAS (14.7%, 38/259), and NPM1 (13.5%, 35/259). Concurrence was observed in 97.1% of the NPM1 mutated cases and in 29.6% of the double mutated CEBPA cases. Distinct patterns of co-occurrence were observed for different hotspot mutations within the IDH2 gene: R140 mutations were associated with NPM1 and/or FLT3-ITD mutations, whereas R172 mutations co-occurred with DNMT3A mutations only. Concurrence was also observed in 86.6% of epigenetic regulation genes, most of which co-occurred with NPM1 mutations. The results showed certain rules in the mutation profiling and concurrence of AML patients, which was related to the function classification of genes. Defining the mutation spectrum and mutation pattern of AML will contribute to the comprehensive assessment of patients and identification of new therapeutic targets.

  8. Mutational analysis of the HGO gene in Finnish alkaptonuria patients

    PubMed Central

    de Bernabe, D. B.-V.; Peterson, P.; Luopajarvi, K.; Matintalo, P.; Alho, A.; Konttinen, Y.; Krohn, K.; de Cordoba, S. R.; Ranki, A.

    1999-01-01

    Alkaptonuria (AKU), the prototypic inborn error of metabolism, has recently been shown to be caused by loss of function mutations in the homogentisate-1,2-dioxygenase gene (HGO). So far 17 mutations have been characterised in AKU patients of different ethnic origin. We describe three novel mutations (R58fs, R330S, and H371R) and one common AKU mutation (M368V), detected by mutational and polymorphism analysis of the HGO gene in five Finnish AKU pedigrees. The three novel AKU mutations are most likely specific for the Finnish population and have originated recently.


Keywords: alkaptonuria; homogentisate-1,2-dioxygenase; Finland PMID:10594001

  9. Low load for disruptive mutations in autism genes and their biased transmission

    PubMed Central

    Iossifov, Ivan; Levy, Dan; Allen, Jeremy; Ye, Kenny; Ronemus, Michael; Lee, Yoon-ha; Yamrom, Boris; Wigler, Michael

    2015-01-01

    We previously computed that genes with de novo (DN) likely gene-disruptive (LGD) mutations in children with autism spectrum disorders (ASD) have high vulnerability: disruptive mutations in many of these genes, the vulnerable autism genes, will have a high likelihood of resulting in ASD. Because individuals with ASD have lower fecundity, such mutations in autism genes would be under strong negative selection pressure. An immediate prediction is that these genes will have a lower LGD load than typical genes in the human gene pool. We confirm this hypothesis in an explicit test by measuring the load of disruptive mutations in whole-exome sequence databases from two cohorts. We use information about mutational load to show that lower and higher intelligence quotients (IQ) affected individuals can be distinguished by the mutational load in their respective gene targets, as well as to help prioritize gene targets by their likelihood of being autism genes. Moreover, we demonstrate that transmission of rare disruptions in genes with a lower LGD load occurs more often to affected offspring; we show transmission originates most often from the mother, and transmission of such variants is seen more often in offspring with lower IQ. A surprising proportion of transmission of these rare events comes from genes expressed in the embryonic brain that show sharply reduced expression shortly after birth. PMID:26401017

  10. Inherited DNA-Repair Gene Mutations in Men with Metastatic Prostate Cancer.

    PubMed

    Pritchard, Colin C; Mateo, Joaquin; Walsh, Michael F; De Sarkar, Navonil; Abida, Wassim; Beltran, Himisha; Garofalo, Andrea; Gulati, Roman; Carreira, Suzanne; Eeles, Rosalind; Elemento, Olivier; Rubin, Mark A; Robinson, Dan; Lonigro, Robert; Hussain, Maha; Chinnaiyan, Arul; Vinson, Jake; Filipenko, Julie; Garraway, Levi; Taplin, Mary-Ellen; AlDubayan, Saud; Han, G Celine; Beightol, Mallory; Morrissey, Colm; Nghiem, Belinda; Cheng, Heather H; Montgomery, Bruce; Walsh, Tom; Casadei, Silvia; Berger, Michael; Zhang, Liying; Zehir, Ahmet; Vijai, Joseph; Scher, Howard I; Sawyers, Charles; Schultz, Nikolaus; Kantoff, Philip W; Solit, David; Robson, Mark; Van Allen, Eliezer M; Offit, Kenneth; de Bono, Johann; Nelson, Peter S

    2016-08-04

    Inherited mutations in DNA-repair genes such as BRCA2 are associated with increased risks of lethal prostate cancer. Although the prevalence of germline mutations in DNA-repair genes among men with localized prostate cancer who are unselected for family predisposition is insufficient to warrant routine testing, the frequency of such mutations in patients with metastatic prostate cancer has not been established. We recruited 692 men with documented metastatic prostate cancer who were unselected for family history of cancer or age at diagnosis. We isolated germline DNA and used multiplex sequencing assays to assess mutations in 20 DNA-repair genes associated with autosomal dominant cancer-predisposition syndromes. A total of 84 germline DNA-repair gene mutations that were presumed to be deleterious were identified in 82 men (11.8%); mutations were found in 16 genes, including BRCA2 (37 men [5.3%]), ATM (11 [1.6%]), CHEK2 (10 [1.9% of 534 men with data]), BRCA1 (6 [0.9%]), RAD51D (3 [0.4%]), and PALB2 (3 [0.4%]). Mutation frequencies did not differ according to whether a family history of prostate cancer was present or according to age at diagnosis. Overall, the frequency of germline mutations in DNA-repair genes among men with metastatic prostate cancer significantly exceeded the prevalence of 4.6% among 499 men with localized prostate cancer (P<0.001), including men with high-risk disease, and the prevalence of 2.7% in the Exome Aggregation Consortium, which includes 53,105 persons without a known cancer diagnosis (P<0.001). In our multicenter study, the incidence of germline mutations in genes mediating DNA-repair processes among men with metastatic prostate cancer was 11.8%, which was significantly higher than the incidence among men with localized prostate cancer. The frequencies of germline mutations in DNA-repair genes among men with metastatic disease did not differ significantly according to age at diagnosis or family history of prostate cancer. (Funded by

  11. Gene mutation-based and specific therapies in precision medicine.

    PubMed

    Wang, Xiangdong

    2016-04-01

    Precision medicine has been initiated and gains more and more attention from preclinical and clinical scientists. A number of key elements or critical parts in precision medicine have been described and emphasized to establish a systems understanding of precision medicine. The principle of precision medicine is to treat patients on the basis of genetic alterations after gene mutations are identified, although questions and challenges still remain before clinical application. Therapeutic strategies of precision medicine should be considered according to gene mutation, after biological and functional mechanisms of mutated gene expression or epigenetics, or the correspondent protein, are clearly validated. It is time to explore and develop a strategy to target and correct mutated genes by direct elimination, restoration, correction or repair of mutated sequences/genes. Nevertheless, there are still numerous challenges to integrating widespread genomic testing into individual cancer therapies and into decision making for one or another treatment. There are wide-ranging and complex issues to be solved before precision medicine becomes clinical reality. Thus, the precision medicine can be considered as an extension and part of clinical and translational medicine, a new alternative of clinical therapies and strategies, and have an important impact on disease cures and patient prognoses. © 2015 The Author. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  12. Validation of high-resolution DNA melting analysis for mutation scanning of the CDKL5 gene: identification of novel mutations.

    PubMed

    Raymond, Laure; Diebold, Bertrand; Leroux, Céline; Maurey, Hélène; Drouin-Garraud, Valérie; Delahaye, Andre; Dulac, Olivier; Metreau, Julia; Melikishvili, Gia; Toutain, Annick; Rivier, François; Bahi-Buisson, Nadia; Bienvenu, Thierry

    2013-01-01

    Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5) have been predominantly described in epileptic encephalopathies of female, including infantile spasms with Rett-like features. Up to now, detection of mutations in this gene was made by laborious, expensive and/or time consuming methods. Here, we decided to validate high-resolution melting analysis (HRMA) for mutation scanning of the CDKL5 gene. Firstly, using a large DNA bank consisting to 34 samples carrying different mutations and polymorphisms, we validated our analytical conditions to analyse the different exons and flanking intronic sequences of the CDKL5 gene by HRMA. Secondly, we screened CDKL5 by both HRMA and denaturing high performance liquid chromatography (dHPLC) in a cohort of 135 patients with early-onset seizures. Our results showed that point mutations and small insertions and deletions can be reliably detected by HRMA. Compared to dHPLC, HRMA profiles are more discriminated, thereby decreasing unnecessary sequencing. In this study, we identified eleven novel sequence variations including four pathogenic mutations (2.96% prevalence). HRMA appears cost-effective, easy to set up, highly sensitive, non-toxic and rapid for mutation screening, ideally suited for large genes with heterogeneous mutations located along the whole coding sequence, such as the CDKL5 gene. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Novel mutations in the USH1C gene in Usher syndrome patients.

    PubMed

    Aparisi, María José; García-García, Gema; Jaijo, Teresa; Rodrigo, Regina; Graziano, Claudio; Seri, Marco; Simsek, Tulay; Simsek, Enver; Bernal, Sara; Baiget, Montserrat; Pérez-Garrigues, Herminio; Aller, Elena; Millán, José María

    2010-12-31

    Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by severe-profound sensorineural hearing loss, retinitis pigmentosa, and vestibular areflexia. To date, five USH1 genes have been identified. One of these genes is Usher syndrome 1C (USH1C), which encodes a protein, harmonin, containing PDZ domains. The aim of the present work was the mutation screening of the USH1C gene in a cohort of 33 Usher syndrome patients, to identify the genetic cause of the disease and to determine the relative involvement of this gene in USH1 pathogenesis in the Spanish population. Thirty-three patients were screened for mutations in the USH1C gene by direct sequencing. Some had already been screened for mutations in the other known USH1 genes (myosin VIIA [MYO7A], cadherin-related 23 [CDH23], protocadherin-related 15 [PCDH15], and Usher syndrome 1G [USH1G]), but no mutation was found. Two novel mutations were found in the USH1C gene: a non-sense mutation (p.C224X) and a frame-shift mutation (p.D124TfsX7). These mutations were found in a homozygous state in two unrelated USH1 patients. In the present study, we detected two novel pathogenic mutations in the USH1C gene. Our results suggest that mutations in USH1C are responsible for 1.5% of USH1 disease in patients of Spanish origin (considering the total cohort of 65 Spanish USH1 patients since 2005), indicating that USH1C is a rare form of USH in this population.

  14. Novel mutations in the USH1C gene in Usher syndrome patients

    PubMed Central

    Aparisi, María José; García-García, Gema; Jaijo, Teresa; Rodrigo, Regina; Graziano, Claudio; Seri, Marco; Simsek, Tulay; Simsek, Enver; Bernal, Sara; Baiget, Montserrat; Pérez-Garrigues, Herminio; Millán, José María

    2010-01-01

    Purpose Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by severe-profound sensorineural hearing loss, retinitis pigmentosa, and vestibular areflexia. To date, five USH1 genes have been identified. One of these genes is Usher syndrome 1C (USH1C), which encodes a protein, harmonin, containing PDZ domains. The aim of the present work was the mutation screening of the USH1C gene in a cohort of 33 Usher syndrome patients, to identify the genetic cause of the disease and to determine the relative involvement of this gene in USH1 pathogenesis in the Spanish population. Methods Thirty-three patients were screened for mutations in the USH1C gene by direct sequencing. Some had already been screened for mutations in the other known USH1 genes (myosin VIIA [MYO7A], cadherin-related 23 [CDH23], protocadherin-related 15 [PCDH15], and Usher syndrome 1G [USH1G]), but no mutation was found. Results Two novel mutations were found in the USH1C gene: a non-sense mutation (p.C224X) and a frame-shift mutation (p.D124TfsX7). These mutations were found in a homozygous state in two unrelated USH1 patients. Conclusions In the present study, we detected two novel pathogenic mutations in the USH1C gene. Our results suggest that mutations in USH1C are responsible for 1.5% of USH1 disease in patients of Spanish origin (considering the total cohort of 65 Spanish USH1 patients since 2005), indicating that USH1C is a rare form of USH in this population. PMID:21203349

  15. Novel biallelic mutations in MSH6 and PMS2 genes: gene conversion as a likely cause of PMS2 gene inactivation.

    PubMed

    Auclair, Jessie; Leroux, Dominique; Desseigne, Françoise; Lasset, Christine; Saurin, Jean Christophe; Joly, Marie Odile; Pinson, Stéphane; Xu, Xiao Li; Montmain, Gilles; Ruano, Eric; Navarro, Claudine; Puisieux, Alain; Wang, Qing

    2007-11-01

    Since the first report by our group in 1999, more than 20 unrelated biallelic mutations in DNA mismatch repair genes (MMR) have been identified. In the present report, we describe two novel cases: one carrying compound heterozygous mutations in the MSH6 gene; and the other, compound heterozygous mutations in the PMS2 gene. Interestingly, the inactivation of one PMS2 allele was likely caused by gene conversion. Although gene conversion has been suggested to be a mutation mechanism underlying PMS2 inactivation, this is the first report of its involvement in a pathogenic mutation. The clinical features of biallelic mutation carriers were similar to other previously described patients, with the presence of café-au-lait spots (CALS), early onset of brain tumors, and colorectal neoplasia. Our data provide further evidence of the existence, although rare, of a distinct recessively inherited syndrome on the basis of MMR constitutional inactivation. The identification of this syndrome should be useful for genetic counseling, especially in families with atypical hereditary nonpolyposis colon cancer (HNPCC) associated with childhood cancers, and for the clinical surveillance of these mutation carriers. 2007 Wiley-Liss, Inc.

  16. Differential analysis between somatic mutation and germline variation profiles reveals cancer-related genes.

    PubMed

    Przytycki, Pawel F; Singh, Mona

    2017-08-25

    A major aim of cancer genomics is to pinpoint which somatically mutated genes are involved in tumor initiation and progression. We introduce a new framework for uncovering cancer genes, differential mutation analysis, which compares the mutational profiles of genes across cancer genomes with their natural germline variation across healthy individuals. We present DiffMut, a fast and simple approach for differential mutational analysis, and demonstrate that it is more effective in discovering cancer genes than considerably more sophisticated approaches. We conclude that germline variation across healthy human genomes provides a powerful means for characterizing somatic mutation frequency and identifying cancer driver genes. DiffMut is available at https://github.com/Singh-Lab/Differential-Mutation-Analysis .

  17. A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome

    PubMed Central

    Taghdiri, Maryam; Dastsooz, Hassan; Fardaei, Majid; Mohammadi, Sanaz; Farazi Fard, Mohammad Ali; Faghihi, Mohammad Ali

    2017-01-01

    Cockayne syndrome (CS) is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C) in our patient. Another gene (ERCC6), which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family. PMID:28848724

  18. A Novel Mutation in ERCC8 Gene Causing Cockayne Syndrome.

    PubMed

    Taghdiri, Maryam; Dastsooz, Hassan; Fardaei, Majid; Mohammadi, Sanaz; Farazi Fard, Mohammad Ali; Faghihi, Mohammad Ali

    2017-01-01

    Cockayne syndrome (CS) is a rare autosomal recessive multisystem disorder characterized by impaired neurological and sensory functions, cachectic dwarfism, microcephaly, and photosensitivity. This syndrome shows a variable age of onset and rate of progression, and its phenotypic spectrum include a wide range of severity. Due to the progressive nature of this disorder, diagnosis can be more important when additional signs and symptoms appear gradually and become steadily worse over time. Therefore, mutation analysis of genes involved in CS pathogenesis can be helpful to confirm the suspected clinical diagnosis. Here, we report a novel mutation in ERCC8 gene in a 16-year-old boy who suffers from poor weight gain, short stature, microcephaly, intellectual disability, and photosensitivity. The patient was born to consanguineous family with no previous documented disease in his parents. To identify disease-causing mutation in the patient, whole exome sequencing utilizing next-generation sequencing on an Illumina HiSeq 2000 platform was performed. Results revealed a novel homozygote mutation in ERCC8 gene (NM_000082: exon 11, c.1122G>C) in our patient. Another gene ( ERCC6 ), which is also involved in CS did not have any disease-causing mutations in the proband. The new identified mutation was then confirmed by Sanger sequencing in the proband, his parents, and extended family members, confirming co-segregation with the disease. In addition, different bioinformatics programs which included MutationTaster, I-Mutant v2.0, NNSplice, Combined Annotation Dependent Depletion, The PhastCons, Genomic Evolutationary Rate Profiling conservation score, and T-Coffee Multiple Sequence Alignment predicted the pathogenicity of the mutation. Our study identified a rare novel mutation in ERCC8 gene and help to provide accurate genetic counseling and prenatal diagnosis to minimize new affected individuals in this family.

  19. Novel KRAS Gene Mutations in Sporadic Colorectal Cancer

    PubMed Central

    Naser, Walid M.; Shawarby, Mohamed A.; Al-Tamimi, Dalal M.; Seth, Arun; Al-Quorain, Abdulaziz; Nemer, Areej M. Al; Albagha, Omar M. E.

    2014-01-01

    Introduction In this article, we report 7 novel KRAS gene mutations discovered while retrospectively studying the prevalence and pattern of KRAS mutations in cancerous tissue obtained from 56 Saudi sporadic colorectal cancer patients from the Eastern Province. Methods Genomic DNA was extracted from formalin-fixed, paraffin-embedded cancerous and noncancerous colorectal tissues. Successful and specific PCR products were then bi-directionally sequenced to detect exon 4 mutations while Mutector II Detection Kits were used for identifying mutations in codons 12, 13 and 61. The functional impact of the novel mutations was assessed using bioinformatics tools and molecular modeling. Results KRAS gene mutations were detected in the cancer tissue of 24 cases (42.85%). Of these, 11 had exon 4 mutations (19.64%). They harbored 8 different mutations all of which except two altered the KRAS protein amino acid sequence and all except one were novel as revealed by COSMIC database. The detected novel mutations were found to be somatic. One mutation is predicted to be benign. The remaining mutations are predicted to cause substantial changes in the protein structure. Of these, the Q150X nonsense mutation is the second truncating mutation to be reported in colorectal cancer in the literature. Conclusions Our discovery of novel exon 4 KRAS mutations that are, so far, unique to Saudi colorectal cancer patients may be attributed to environmental factors and/or racial/ethnic variations due to genetic differences. Alternatively, it may be related to paucity of clinical studies on mutations other than those in codons 12, 13, 61 and 146. Further KRAS testing on a large number of patients of various ethnicities, particularly beyond the most common hotspot alleles in exons 2 and 3 is needed to assess the prevalence and explore the exact prognostic and predictive significance of the discovered novel mutations as well as their possible role in colorectal carcinogenesis. PMID:25412182

  20. The androgen receptor gene mutations database.

    PubMed

    Gottlieb, B; Trifiro, M; Lumbroso, R; Pinsky, L

    1997-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 212 to 272. We have expanded the database: (i) by adding a large amount of new data on somatic mutations in prostatic cancer tissue; (ii) by defining a new constitutional phenotype, mild androgen insensitivity (MAI); (iii) by placing additional relevant information on an internet site (http://www.mcgill.ca/androgendb/ ). The database has allowed us to examine the contribution of CpG sites to the multiplicity of reports of the same mutation in different families. The database is also available from EMBL (ftp.ebi.ac.uk/pub/databases/androgen) or as a Macintosh Filemaker Pro or Word file (MC33@musica,mcgill.ca)

  1. The androgen receptor gene mutations database.

    PubMed Central

    Gottlieb, B; Trifiro, M; Lumbroso, R; Pinsky, L

    1997-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 212 to 272. We have expanded the database: (i) by adding a large amount of new data on somatic mutations in prostatic cancer tissue; (ii) by defining a new constitutional phenotype, mild androgen insensitivity (MAI); (iii) by placing additional relevant information on an internet site (http://www.mcgill.ca/androgendb/ ). The database has allowed us to examine the contribution of CpG sites to the multiplicity of reports of the same mutation in different families. The database is also available from EMBL (ftp.ebi.ac.uk/pub/databases/androgen) or as a Macintosh Filemaker Pro or Word file (MC33@musica,mcgill.ca) PMID:9016528

  2. Mutated-leptin gene transfer induces increases in body weight by electroporation and hydrodynamics-based gene delivery in mice.

    PubMed

    Xiang, Lan; Murai, Atsushi; Muramatsu, Tatsuo

    2005-12-01

    To investigate whether in vivo gene transfer causes leptin-antagonistic effects on food intake, animal body weight and fat tissue weight, the R128Q mutated-leptin gene, an R to Q substitution at position 128 of mouse leptin, was transferred into mouse liver and leg muscle by electroporation and hydrodynamics-based gene delivery. Mutated-leptin gene transfer by electroporation caused significant increases in body weight at 5 days and after (5.4% increase relative to control; p<0.05). Hydrodynamics-based gene delivery of the mutated-leptin gene also caused an increase in body weight (3.0% increase relative to control; p<0.05). Mutated-leptin gene transfer by electroporation significantly increased the tissue weight of epididymal white fat and neuropeptide Y mRNA expression in the hypothalamus compared with those of the control group 3 weeks after gene transfer (p<0.05). These results suggest that mutated-leptin gene transfer successfully produced leptin-antagonistic effects by modulating the central regulator of energy homeostasis. Also, the extent of leptin-antagonistic effects by electroporation was much higher than hydrodynamics-based gene delivery, with at least single gene transfer.

  3. DNA mutation motifs in the genes associated with inherited diseases.

    PubMed

    Růžička, Michal; Kulhánek, Petr; Radová, Lenka; Čechová, Andrea; Špačková, Naďa; Fajkusová, Lenka; Réblová, Kamila

    2017-01-01

    Mutations in human genes can be responsible for inherited genetic disorders and cancer. Mutations can arise due to environmental factors or spontaneously. It has been shown that certain DNA sequences are more prone to mutate. These sites are termed hotspots and exhibit a higher mutation frequency than expected by chance. In contrast, DNA sequences with lower mutation frequencies than expected by chance are termed coldspots. Mutation hotspots are usually derived from a mutation spectrum, which reflects particular population where an effect of a common ancestor plays a role. To detect coldspots/hotspots unaffected by population bias, we analysed the presence of germline mutations obtained from HGMD database in the 5-nucleotide segments repeatedly occurring in genes associated with common inherited disorders, in particular, the PAH, LDLR, CFTR, F8, and F9 genes. Statistically significant sequences (mutational motifs) rarely associated with mutations (coldspots) and frequently associated with mutations (hotspots) exhibited characteristic sequence patterns, e.g. coldspots contained purine tract while hotspots showed alternating purine-pyrimidine bases, often with the presence of CpG dinucleotide. Using molecular dynamics simulations and free energy calculations, we analysed the global bending properties of two selected coldspots and two hotspots with a G/T mismatch. We observed that the coldspots were inherently more flexible than the hotspots. We assume that this property might be critical for effective mismatch repair as DNA with a mutation recognized by MutSα protein is noticeably bent.

  4. 21 CFR 866.5900 - Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation detection system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... regulator (CFTR) gene mutation detection system. 866.5900 Section 866.5900 Food and Drugs FOOD AND DRUG...) gene mutation detection system. (a) Identification. The CFTR gene mutation detection system is a device used to simultaneously detect and identify a panel of mutations and variants in the CFTR gene. It is...

  5. 21 CFR 866.5900 - Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation detection system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... regulator (CFTR) gene mutation detection system. 866.5900 Section 866.5900 Food and Drugs FOOD AND DRUG...) gene mutation detection system. (a) Identification. The CFTR gene mutation detection system is a device used to simultaneously detect and identify a panel of mutations and variants in the CFTR gene. It is...

  6. 21 CFR 866.5900 - Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation detection system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... regulator (CFTR) gene mutation detection system. 866.5900 Section 866.5900 Food and Drugs FOOD AND DRUG...) gene mutation detection system. (a) Identification. The CFTR gene mutation detection system is a device used to simultaneously detect and identify a panel of mutations and variants in the CFTR gene. It is...

  7. 21 CFR 866.5900 - Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation detection system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... regulator (CFTR) gene mutation detection system. 866.5900 Section 866.5900 Food and Drugs FOOD AND DRUG...) gene mutation detection system. (a) Identification. The CFTR gene mutation detection system is a device used to simultaneously detect and identify a panel of mutations and variants in the CFTR gene. It is...

  8. Mutation profiling of 19 candidate genes in acute myeloid leukemia suggests significance of DNMT3A mutations.

    PubMed

    Shin, Sang-Yong; Lee, Seung-Tae; Kim, Hee-Jin; Cho, Eun Hae; Kim, Jong-Won; Park, Silvia; Jung, Chul Won; Kim, Sun-Hee

    2016-08-23

    We selected 19 significantly-mutated genes in AMLs, including FLT3, DNMT3A, NPM1, TET2, RUNX1, CEBPA, WT1, IDH1, IDH2, NRAS, ASXL1, SETD2, PTPN11, TP53, KIT, JAK2, KRAS, BRAF and CBL, and performed massively parallel sequencing for 114 patients with acute myeloid leukemias, mainly including those with normal karyotypes (CN-AML). More than 80% of patients had at least one mutation in the genes tested. DNMT3A mutation was significantly associated with adverse outcome in addition to conventional risk stratification such as the European LeukemiaNet (ELN) classification. We observed clinical usefulness of mutation testing on multiple target genes and the association with disease subgroups, clinical features and prognosis in AMLs.

  9. Mutated Genes in Schizophrenia Map to Brain Networks

    MedlinePlus

    ... Research Matters August 12, 2013 Mutated Genes in Schizophrenia Map to Brain Networks Schizophrenia networks in the prefrontal cortex area of the ... University of Washington Researchers found that people with schizophrenia have a high number of spontaneous mutations in ...

  10. Remarkable difference of somatic mutation patterns between oncogenes and tumor suppressor genes.

    PubMed

    Liu, Haoxuan; Xing, Yuhang; Yang, Sihai; Tian, Dacheng

    2011-12-01

    Cancers arise owing to mutations that confer selective growth advantages on the cells in a subset of tumor suppressor and/or oncogenes. To understand oncogenesis and diagnose cancers, it is crucial to discriminate these two groups of genes by using the difference in their mutation patterns. Here, we investigated>120,000 mutation samples in 66 well-known tumor suppressor genes and oncogenes of the COSMIC database, and found a set of significant differences in mutation patterns (e.g., non-3n-indel, non-sense SNP and mutation hotspot) between them. By screening the best measurement, we developed indices to readily distinguish one from another and predict clearly the unknown oncogenesis genes as tumor suppressors (e.g., ASXL1, HNF1A and KDM6A) or oncogenes (e.g., FOXL2, MYD88 and TSHR). Based on our results, a third gene group can be classified, which has a mutational pattern between tumor suppressors and oncogenes. The concept of the third gene group could help to understand gene function in different cancers or individual patients and to know the exact function of genes in oncogenesis. In conclusion, our study provides further insights into cancer-related genes and identifies several potential therapeutic targets.

  11. Law-medicine interfacing: patenting of human genes and mutations.

    PubMed

    Fialho, Arsenio M; Chakrabarty, Ananda M

    2011-08-01

    Mutations, Single Nucleotide Polymorphisms (SNPs), deletions and genetic rearrangements in specific genes in the human genome account for not only our physical characteristics and behavior, but can lead to many in-born and acquired diseases. Such changes in the genome can also predispose people to cancers, as well as significantly affect the metabolism and efficacy of many drugs, resulting in some cases in acute toxicity to the drug. The testing of the presence of such genetic mutations and rearrangements is of great practical and commercial value, leading many of these genes and their mutations/deletions and genetic rearrangements to be patented. A recent decision by a judge in the Federal District Court in the Southern District of New York, has created major uncertainties, based on the revocation of BRCA1 and BRCA2 gene patents, in the eligibility of all human and presumably other gene patents. This article argues that while patents on BRCA1 and BRCA2 genes could be challenged based on a lack of utility, the patenting of the mutations and genetic rearrangements is of great importance to further development and commercialization of genetic tests that can save human lives and prevent suffering, and should be allowed.

  12. Mutational analysis of genes coding for cell surface proteins in colorectal cancer cell lines reveal novel altered pathways, druggable mutations and mutated epitopes for targeted therapy

    PubMed Central

    Correa, Bruna R.; Bettoni, Fabiana; Koyama, Fernanda C.; Navarro, Fabio C.P.; Perez, Rodrigo O.; Mariadason, John; Sieber, Oliver M.; Strausberg, Robert L.; Simpson, Andrew J.G.; Jardim, Denis L.F.; Reis, Luiz Fernando L.; Parmigiani, Raphael B.; Galante, Pedro A.F.; Camargo, Anamaria A.

    2014-01-01

    We carried out a mutational analysis of 3,594 genes coding for cell surface proteins (Surfaceome) in 23 colorectal cancer cell lines, searching for new altered pathways, druggable mutations and mutated epitopes for targeted therapy in colorectal cancer. A total of 3,944 somatic non-synonymous substitutions and 595 InDels, occurring in 2,061 (57%) Surfaceome genes were catalogued. We identified 48 genes not previously described as mutated in colorectal tumors in the TCGA database, including genes that are mutated and expressed in >10% of the cell lines (SEMA4C, FGFRL1, PKD1, FAM38A, WDR81, TMEM136, SLC36A1, SLC26A6, IGFLR1). Analysis of these genes uncovered important roles for FGF and SEMA4 signaling in colorectal cancer with possible therapeutic implications. We also found that cell lines express on average 11 druggable mutations, including frequent mutations (>20%) in the receptor tyrosine kinases AXL and EPHA2, which have not been previously considered as potential targets for colorectal cancer. Finally, we identified 82 cell surface mutated epitopes, however expression of only 30% of these epitopes was detected in our cell lines. Notwithstanding, 92% of these epitopes were expressed in cell lines with the mutator phenotype, opening new venues for the use of “general” immune checkpoint drugs in this subset of patients. PMID:25193853

  13. VarWalker: Personalized Mutation Network Analysis of Putative Cancer Genes from Next-Generation Sequencing Data

    PubMed Central

    Jia, Peilin; Zhao, Zhongming

    2014-01-01

    A major challenge in interpreting the large volume of mutation data identified by next-generation sequencing (NGS) is to distinguish driver mutations from neutral passenger mutations to facilitate the identification of targetable genes and new drugs. Current approaches are primarily based on mutation frequencies of single-genes, which lack the power to detect infrequently mutated driver genes and ignore functional interconnection and regulation among cancer genes. We propose a novel mutation network method, VarWalker, to prioritize driver genes in large scale cancer mutation data. VarWalker fits generalized additive models for each sample based on sample-specific mutation profiles and builds on the joint frequency of both mutation genes and their close interactors. These interactors are selected and optimized using the Random Walk with Restart algorithm in a protein-protein interaction network. We applied the method in >300 tumor genomes in two large-scale NGS benchmark datasets: 183 lung adenocarcinoma samples and 121 melanoma samples. In each cancer, we derived a consensus mutation subnetwork containing significantly enriched consensus cancer genes and cancer-related functional pathways. These cancer-specific mutation networks were then validated using independent datasets for each cancer. Importantly, VarWalker prioritizes well-known, infrequently mutated genes, which are shown to interact with highly recurrently mutated genes yet have been ignored by conventional single-gene-based approaches. Utilizing VarWalker, we demonstrated that network-assisted approaches can be effectively adapted to facilitate the detection of cancer driver genes in NGS data. PMID:24516372

  14. VarWalker: personalized mutation network analysis of putative cancer genes from next-generation sequencing data.

    PubMed

    Jia, Peilin; Zhao, Zhongming

    2014-02-01

    A major challenge in interpreting the large volume of mutation data identified by next-generation sequencing (NGS) is to distinguish driver mutations from neutral passenger mutations to facilitate the identification of targetable genes and new drugs. Current approaches are primarily based on mutation frequencies of single-genes, which lack the power to detect infrequently mutated driver genes and ignore functional interconnection and regulation among cancer genes. We propose a novel mutation network method, VarWalker, to prioritize driver genes in large scale cancer mutation data. VarWalker fits generalized additive models for each sample based on sample-specific mutation profiles and builds on the joint frequency of both mutation genes and their close interactors. These interactors are selected and optimized using the Random Walk with Restart algorithm in a protein-protein interaction network. We applied the method in >300 tumor genomes in two large-scale NGS benchmark datasets: 183 lung adenocarcinoma samples and 121 melanoma samples. In each cancer, we derived a consensus mutation subnetwork containing significantly enriched consensus cancer genes and cancer-related functional pathways. These cancer-specific mutation networks were then validated using independent datasets for each cancer. Importantly, VarWalker prioritizes well-known, infrequently mutated genes, which are shown to interact with highly recurrently mutated genes yet have been ignored by conventional single-gene-based approaches. Utilizing VarWalker, we demonstrated that network-assisted approaches can be effectively adapted to facilitate the detection of cancer driver genes in NGS data.

  15. GeneChip{sup {trademark}} screening assay for cystic fibrosis mutations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cronn, M.T.; Miyada, C.G.; Fucini, R.V.

    1994-09-01

    GeneChip{sup {trademark}} assays are based on high density, carefully designed arrays of short oligonucleotide probes (13-16 bases) built directly on derivatized silica substrates. DNA target sequence analysis is achieved by hybridizing fluorescently labeled amplification products to these arrays. Fluorescent hybridization signals located within the probe array are translated into target sequence information using the known probe sequence at each array feature. The mutation screening assay for cystic fibrosis includes sets of oligonucleotide probes designed to detect numerous different mutations that have been described in 14 exons and one intron of the CFTR gene. Each mutation site is addressed by amore » sub-array of at least 40 probe sequences, half designed to detect the wild type gene sequence and half designed to detect the reported mutant sequence. Hybridization with homozygous mutant, homozygous wild type or heterozygous targets results in distinctive hybridization patterns within a sub-array, permitting specific discrimination of each mutation. The GeneChip probe arrays are very small (approximately 1 cm{sup 2}). There miniature size coupled with their high information content make GeneChip probe arrays a useful and practical means for providing CF mutation analysis in a clinical setting.« less

  16. [Application of gene capture technology on mutation screening of RB1 gene in retinoblastoma patients].

    PubMed

    Meng, Q Y; Huang, L Z; Wang, B; Li, X X; Liang, J H

    2017-06-11

    Objectives: To analyze RB1 gene mutation in retinoblastoma (RB) patients using gene capture technology. Methods: Experimental research. The clinical data of 17 RB patients were collected at Department of Ophthalmology, Peking University People's Hospital from June 2010 to Jun 2014. Peripheral blood samples of seventeen RB patients and their parents were collected and genomic DNA were extracted. DNA library from RB patients was mixed with designed gene capture probe of RB1 exons and its flanking sequences. The data were analyzed using bioinformatics software. To avoid the false positive, the abnormal sites were verified using the Sanger sequencing method. Results: Totally, there were 17 RB patients, including 12 males and 5 females, from 0.5 to 23 years old, average ages were (3.2±5.2) years old. Both eyes were involved in 6 patients. The other 11 cases were only one eye was attacked. Four RB patients were found to have germline mutations, among whom 2 had bilateral tumors and 2 had unilateral tumors. 2 novel missense mutations were identified, including 15(th) exon c.1408A>T (p. Ile470Phe) and c.1960G>C (p. Val654Leu) at 19(th) exon. No RB1 mutation was identified in any of their parents. We also identified 2 mutations reported previously. One is c.1030C>T termination mutation at 10(th) exon in a bilateral RB patients and his father, who was diagnosed with unilateral RB. The other is c.371-372delTA frame shift mutation at 3(rd) exon. No mutation was found in their parents. Conclusions: Two novel germline RB1 mutations were found using gene capture technology, which enriched RB1 mutations library. (Chin J Ophthalmol, 2017, 53: 455-459) .

  17. Mutations of the cystic fibrosis gene, but not cationic trypsinogen gene, are associated with recurrent or chronic idiopathic pancreatitis.

    PubMed

    Ockenga, J; Stuhrmann, M; Ballmann, M; Teich, N; Keim, V; Dörk, T; Manns, M P

    2000-08-01

    We investigated whether mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene and cationic trypsinogen gene are associated with recurrent acute, or chronic idiopathic pancreatitis. Twenty patients with idiopathic pancreatitis (11 women, nine men; mean age, 30 yr) were studied for the presence of a CFTR mutation by screening the genomic DNA for more than 30 mutations and variants in the CFTR gene. Selected mutations of the cationic trypsinogen gene were screened by Afl III restriction digestion or by a mutation-specific polymerase chain reaction (PCR). In each patient exons 1, 2, and 3 of the cationic trypsinogen gene were sequenced. Patients with a CFTR mutation underwent evaluation of further functional electrophysiological test (intestinal current measurement). No mutation of the cationic trypsinogen gene was detected. A CFTR mutation was detected in 6/20 (30.0%) patients. Three patients (15.0%) had a cystic fibrosis (CF) mutation on one chromosome (deltaF508, I336K, Y1092X), which is known to cause phenotypical severe cystic fibrosis. One patient was heterozygous for the 5T allele. In addition, two possibly predisposing CFTR variants (R75Q, 1716G-->A) were detected on four patients, one of these being a compound heterozygous for the missense mutation I336K and R75Q. No other family member (maternal I336K; paternal R75Q; sister I1336K) developed pancreatitis. An intestinal current measurement in rectum samples of patients with a CFTR mutation revealed no CF-typical constellations. CFTR mutations are associated with recurrent acute, or chronic idiopathic pancreatitis, whereas mutations of the cationic trypsinogen mutation do not appear to be a frequent pathogenetic factor.

  18. Intraspecific Polymorphism, Interspecific Divergence, and the Origins of Function-Altering Mutations in Deer Mouse Hemoglobin

    PubMed Central

    Natarajan, Chandrasekhar; Hoffmann, Federico G.; Lanier, Hayley C.; Wolf, Cole J.; Cheviron, Zachary A.; Spangler, Matthew L.; Weber, Roy E.; Fago, Angela; Storz, Jay F.

    2015-01-01

    Major challenges for illuminating the genetic basis of phenotypic evolution are to identify causative mutations, to quantify their functional effects, to trace their origins as new or preexisting variants, and to assess the manner in which segregating variation is transduced into species differences. Here, we report an experimental analysis of genetic variation in hemoglobin (Hb) function within and among species of Peromyscus mice that are native to different elevations. A multilocus survey of sequence variation in the duplicated HBA and HBB genes in Peromyscus maniculatus revealed that function-altering amino acid variants are widely shared among geographically disparate populations from different elevations, and numerous amino acid polymorphisms are also shared with closely related species. Variation in Hb-O2 affinity within and among populations of P. maniculatus is attributable to numerous amino acid mutations that have individually small effects. One especially surprising feature of the Hb polymorphism in P. maniculatus is that an appreciable fraction of functional standing variation in the two transcriptionally active HBA paralogs is attributable to recurrent gene conversion from a tandemly linked HBA pseudogene. Moreover, transpecific polymorphism in the duplicated HBA genes is not solely attributable to incomplete lineage sorting or introgressive hybridization; instead, it is mainly attributable to recurrent interparalog gene conversion that has occurred independently in different species. Partly as a result of concerted evolution between tandemly duplicated globin genes, the same amino acid changes that contribute to variation in Hb function within P. maniculatus also contribute to divergence in Hb function among different species of Peromyscus. In the case of function-altering Hb mutations in Peromyscus, there is no qualitative or quantitative distinction between segregating variants within species and fixed differences between species. PMID:25556236

  19. [Mutations of EGFR gene and EML4-ALK fusion gene in superficial lymph node of non-small cell lung cancer].

    PubMed

    Wei, Lili; Li, Xingzhou; Yu, Zhonghe

    2015-07-14

    To explore the mutation status of epidermal growth factor receptor (EGFR) fusion gene and microtubule associated protein like 4-anaplastic lymphoma kinase (EML4-ALK) fusion gene in superficial lymph nodes of non-small cell lung cancer (NSCLC). The technique of fluorescent quantitative polymerase chain reaction (FQ-PCR) was employed for detecting the mutation rate of EGFR gene and EML4-ALK fusion gene for 40 cases of superficial lymph node tissue of NSCLC inpatients at General Military Hospital of Beijing PLA Command from February 2013 to November 2014. And then the correlations were analyzed between EMIA-ALK fusion gene and EGFR gene with clinical features and the clinical efficacies of targeted therapy. The mutation rate of EGFR gene was 35% (14/40) and 50% (10/20) in non-smokers and 46.7% (14/30) in adenocarcinoma patients. The mutation distribution was as follows: exon 18 (n = 1), exon 19 (n =8) and exon 21 (n =5). The mutation rate of EML4-ALK fusion gene was 2. 5% (1/40). EGFR gene mutation was predominantly present in non-smokers (P < 0. 05) and adenocarcinoma (P <0. 01) while no significant difference existed between gender, age or stage (P >0. 05). Those on a targeted therapy had a disease control rate of 93. 3%. Both EGFR gene and EMI4-ALK fusion gene may be detected in superficial lymph nodes of NSCLC patients. The mutation rate of EGFR gene is high in adenocarcinoma and non-smokers while EML4-ALK fusion gene has a low mutation rate.

  20. Deep learning of mutation-gene-drug relations from the literature.

    PubMed

    Lee, Kyubum; Kim, Byounggun; Choi, Yonghwa; Kim, Sunkyu; Shin, Wonho; Lee, Sunwon; Park, Sungjoon; Kim, Seongsoon; Tan, Aik Choon; Kang, Jaewoo

    2018-01-25

    Molecular biomarkers that can predict drug efficacy in cancer patients are crucial components for the advancement of precision medicine. However, identifying these molecular biomarkers remains a laborious and challenging task. Next-generation sequencing of patients and preclinical models have increasingly led to the identification of novel gene-mutation-drug relations, and these results have been reported and published in the scientific literature. Here, we present two new computational methods that utilize all the PubMed articles as domain specific background knowledge to assist in the extraction and curation of gene-mutation-drug relations from the literature. The first method uses the Biomedical Entity Search Tool (BEST) scoring results as some of the features to train the machine learning classifiers. The second method uses not only the BEST scoring results, but also word vectors in a deep convolutional neural network model that are constructed from and trained on numerous documents such as PubMed abstracts and Google News articles. Using the features obtained from both the BEST search engine scores and word vectors, we extract mutation-gene and mutation-drug relations from the literature using machine learning classifiers such as random forest and deep convolutional neural networks. Our methods achieved better results compared with the state-of-the-art methods. We used our proposed features in a simple machine learning model, and obtained F1-scores of 0.96 and 0.82 for mutation-gene and mutation-drug relation classification, respectively. We also developed a deep learning classification model using convolutional neural networks, BEST scores, and the word embeddings that are pre-trained on PubMed or Google News data. Using deep learning, the classification accuracy improved, and F1-scores of 0.96 and 0.86 were obtained for the mutation-gene and mutation-drug relations, respectively. We believe that our computational methods described in this research could be

  1. Systematic analysis of mutation distribution in three dimensional protein structures identifies cancer driver genes.

    PubMed

    Fujimoto, Akihiro; Okada, Yukinori; Boroevich, Keith A; Tsunoda, Tatsuhiko; Taniguchi, Hiroaki; Nakagawa, Hidewaki

    2016-05-26

    Protein tertiary structure determines molecular function, interaction, and stability of the protein, therefore distribution of mutation in the tertiary structure can facilitate the identification of new driver genes in cancer. To analyze mutation distribution in protein tertiary structures, we applied a novel three dimensional permutation test to the mutation positions. We analyzed somatic mutation datasets of 21 types of cancers obtained from exome sequencing conducted by the TCGA project. Of the 3,622 genes that had ≥3 mutations in the regions with tertiary structure data, 106 genes showed significant skew in mutation distribution. Known tumor suppressors and oncogenes were significantly enriched in these identified cancer gene sets. Physical distances between mutations in known oncogenes were significantly smaller than those of tumor suppressors. Twenty-three genes were detected in multiple cancers. Candidate genes with significant skew of the 3D mutation distribution included kinases (MAPK1, EPHA5, ERBB3, and ERBB4), an apoptosis related gene (APP), an RNA splicing factor (SF1), a miRNA processing factor (DICER1), an E3 ubiquitin ligase (CUL1) and transcription factors (KLF5 and EEF1B2). Our study suggests that systematic analysis of mutation distribution in the tertiary protein structure can help identify cancer driver genes.

  2. Systematic analysis of mutation distribution in three dimensional protein structures identifies cancer driver genes

    PubMed Central

    Fujimoto, Akihiro; Okada, Yukinori; Boroevich, Keith A.; Tsunoda, Tatsuhiko; Taniguchi, Hiroaki; Nakagawa, Hidewaki

    2016-01-01

    Protein tertiary structure determines molecular function, interaction, and stability of the protein, therefore distribution of mutation in the tertiary structure can facilitate the identification of new driver genes in cancer. To analyze mutation distribution in protein tertiary structures, we applied a novel three dimensional permutation test to the mutation positions. We analyzed somatic mutation datasets of 21 types of cancers obtained from exome sequencing conducted by the TCGA project. Of the 3,622 genes that had ≥3 mutations in the regions with tertiary structure data, 106 genes showed significant skew in mutation distribution. Known tumor suppressors and oncogenes were significantly enriched in these identified cancer gene sets. Physical distances between mutations in known oncogenes were significantly smaller than those of tumor suppressors. Twenty-three genes were detected in multiple cancers. Candidate genes with significant skew of the 3D mutation distribution included kinases (MAPK1, EPHA5, ERBB3, and ERBB4), an apoptosis related gene (APP), an RNA splicing factor (SF1), a miRNA processing factor (DICER1), an E3 ubiquitin ligase (CUL1) and transcription factors (KLF5 and EEF1B2). Our study suggests that systematic analysis of mutation distribution in the tertiary protein structure can help identify cancer driver genes. PMID:27225414

  3. Prenatal diagnosis for a Chinese family with a de novo DMD gene mutation

    PubMed Central

    Li, Tao; Zhang, Zhao-jing; Ma, Xin; Lv, Xue; Xiao, Hai; Guo, Qian-nan; Liu, Hong-yan; Wang, Hong-dan; Wu, Dong; Lou, Gui-yu; Wang, Xin; Zhang, Chao-yang; Liao, Shi-xiu

    2017-01-01

    Abstract Background: Patients with Duchenne muscular dystrophy (DMD) usually have severe and fatal symptoms. At present, there is no effective treatment for DMD, thus it is very important to avoid the birth of children with DMD by effective prenatal diagnosis. We identified a de novo DMD gene mutation in a Chinese family, and make a prenatal diagnosis. Methods: First, multiplex ligation-dependent probe amplification (MLPA) was applied to analyze DMD gene exon deletion/duplication in all family members. The coding sequences of 79 exons in DMD gene were analyzed by Sanger sequencing in the patient; and then according to DMD gene exon mutation in the patient, DMD gene sequencing was performed in the family members. On the basis of results above, the pathogenic mutation in DMD gene was identified. Results: MLPA showed no DMD gene exon deletion/duplication in all family members. Sanger sequencing revealed c.2767_2767delT [p.Ser923LeufsX26] mutation in DMD gene of the patient. Heterozygous deletion mutation (T/-) at this locus was observed in the pregnant woman and her mother and younger sister. The analyses of amniotic fluid samples indicated negative Y chromosome sex-determining gene, no DMD gene exon deletion/duplication, no mutations at c.2767 locus, and the inherited maternal X chromosome different from that of the patient. Conclusion: The pathogenic mutation in DMD gene, c.2767_2767delT [p.Ser923LeufsX26], identified in this family is a de novo mutation. On the basis of specific conditions, it is necessary to select suitable methods to make prenatal diagnosis more effective, accurate, and economic. PMID:29390271

  4. rpoB gene mutations among Mycobacterium tuberculosis isolates from extrapulmonary sites.

    PubMed

    Khosravi, Azar Dokht; Meghdadi, Hossein; Ghadiri, Ata A; Alami, Ameneh; Sina, Amir Hossein; Mirsaeidi, Mehdi

    2018-03-01

    The aim of this study was to analyze mutations occurring in the rpoB gene of Mycobacterium tuberculosis (MTB) isolates from clinical samples of extrapulmonary tuberculosis (EPTB). Seventy formalin-fixed, paraffin-embedded samples and fresh tissue samples from confirmed EPTB cases were analyzed. Nested PCR based on the rpoB gene was performed on the extracted DNAs, combined with cloning and subsequent sequencing. Sixty-seven (95.7%) samples were positive for nester PCR. Sequence analysis of the 81 bp region of the rpoB gene demonstrated mutations in 41 (61.2%) of 67 sequenced samples. Several point mutations including deletion mutations at codons 510, 512, 513 and 515, with 45% and 51% of the mutations in codons 512 and 513 respectively were seen, along with 26% replacement mutations at codons 509, 513, 514, 518, 520, 524 and 531. The most common alteration was Gln → His, at codon 513, presented in 30 (75.6%) isolates. This study demonstrated sequence alterations in codon 513 of the 81 bp region of the rpoB gene as the most common mutation occurred in 75.6% of molecularly confirmed rifampin-resistant strains. In addition, simultaneous mutation at codons 512 and 513 was demonstrated in 34.3% of the isolates. © 2018 APMIS. Published by John Wiley & Sons Ltd.

  5. Distribution of Gene Mutations Associated with Familial Normosmic Idiopathic Hypogonadotropic Hypogonadism

    PubMed Central

    Gürbüz, Fatih; Kotan, L. Damla; Mengen, Eda; Şıklar, Zeynep; Berberoğlu, Merih; Dökmetaş, Sebila; Kılıçlı, Mehmet Fatih; Güven, Ayla; Kirel, Birgül; Saka, Nurçin; Poyrazoğlu, Şükran; Cesur, Yaşar; Doğan, Murat; Özen, Samim; Özbek, Mehmet Nuri; Demirbilek, Hüseyin; Kekil, M. Burcu; Temiz, Fatih; Önenli Mungan, Neslihan; Yüksel, Bilgin; Topaloğlu, Ali Kemal

    2012-01-01

    Objective: Normosmic idiopathic hypogonadotropic hypogonadism (nIHH) is characterized by failure of initiation or maintenance of puberty due to insufficient gonadotropin release, which is not associated with anosmia/hyposmia. The objective of this study was to determine the distribution of causative mutations in a hereditary form of nIHH. Methods: In this prospective collaborative study, 22 families with more than one affected individual (i.e. multiplex families) with nIHH were recruited and screened for genes known or suspected to be strong candidates for nIHH. Results: Mutations were identified in five genes (GNRHR, TACR3, TAC3, KISS1R, and KISS1) in 77% of families with autosomal recessively inherited nIHH. GNRHR and TACR3 mutations were the most common two causative mutations occurring with about equal frequency. Conclusions: Mutations in these five genes account for about three quarters of the causative mutations in nIHH families with more than one affected individual. This frequency is significantly greater than the previously reported rates in all inclusive (familial plus sporadic) cohorts. GNRHR and TACR3 should be the first two genes to be screened for diagnostic purposes. Identification of causative mutations in the remaining families will shed light on the regulation of puberty. Conflict of interest:None declared. PMID:22766261

  6. Mutation screening of the HGD gene identifies a novel alkaptonuria mutation with significant founder effect and high prevalence.

    PubMed

    Sakthivel, Srinivasan; Zatkova, Andrea; Nemethova, Martina; Surovy, Milan; Kadasi, Ludevit; Saravanan, Madurai P

    2014-05-01

    Alkaptonuria (AKU) is an autosomal recessive disorder; caused by the mutations in the homogentisate 1, 2-dioxygenase (HGD) gene located on Chromosome 3q13.33. AKU is a rare disorder with an incidence of 1: 250,000 to 1: 1,000,000, but Slovakia and the Dominican Republic have a relatively higher incidence of 1: 19,000. Our study focused on studying the frequency of AKU and identification of HGD gene mutations in nomads. HGD gene sequencing was used to identify the mutations in alkaptonurics. For the past four years, from subjects suspected to be clinically affected, we found 16 positive cases among a randomly selected cohort of 41 Indian nomads (Narikuravar) settled in the specific area of Tamil Nadu, India. HGD gene mutation analysis showed that 11 of these patients carry the same homozygous splicing mutation c.87 + 1G > A; in five cases, this mutation was found to be heterozygous, while the second AKU-causing mutation was not identified in these patients. This result indicates that the founder effect and high degree of consanguineous marriages have contributed to AKU among nomads. Eleven positive samples were homozygous for a novel mutation c.87 + 1G > A, that abolishes an intron 2 donor splice site and most likely causes skipping of exon 2. The prevalence of AKU observed earlier seems to be highly increased in people of nomadic origin. © 2014 John Wiley & Sons Ltd/University College London.

  7. Application of Digital PCR in Detecting Human Diseases Associated Gene Mutation.

    PubMed

    Tong, Yu; Shen, Shizhen; Jiang, Hui; Chen, Zhi

    2017-01-01

    Gene mutation has been considered a research hotspot, and the rapid development of biomedicine has enabled significant advances in the evaluation of gene mutations. The advent of digital polymerase chain reaction (dPCR) elevates the detection of gene mutations to unprecedented levels of precision, especially in cancer-associated genes. dPCR has been utilized in the detection of tumor markers in cell-free DNA (cfDNA) samples from patients with different types of cancer in samples such as plasma, cerebrospinal fluid, urine and sputum, which confers significant value for dPCR in both clinical applications and basic research. Moreover, dPCR is extensively used in detecting pathogen mutations related to typical features of infectious diseases (e.g., drug resistance) and mutation status of heteroplasmic mitochondrial DNA, which determines the manifestation and progression of mtDNA-related diseases, as well as allows for the prenatal diagnosis of monogenic diseases and the assessment of the genome editing effects. Compared with real-time PCR (qPCR) and sequencing, the higher sensitivity and accuracy of dPCR indicates a great advantage in the detection of rare mutation. As a new technique, dPCR has some limitations, such as the necessity of highly allele-specific probes and a large sample volume. In this review, we summarize the application of dPCR in the detection of human disease-associated gene mutations. © 2017 The Author(s). Published by S. Karger AG, Basel.

  8. A novel splicing mutation in GALT gene causing Galactosemia in Ecuadorian family.

    PubMed

    De Lucca, M; Barba, C; Casique, L

    2017-07-01

    Classic Galactosemia (OMIM 230400) is an autosomal recessive disorder of galactose metabolism caused by mutations in the galactose-1-phosphate uridyl transferase (GALT) gene. This disease caused by the inability to metabolize galactose is potentially life-threatening but its pathophysiology has not been clearly defined. GALT gene presents high allelic heterogeneity and around 336 variations have been identified. Here, we report the case of a patient with Classic Galactosemia who was detected during a neonatal screening in Ecuador. Molecular study revealed a mutation in GALT gene intron 1, c.82+3A>G in homozygous condition, this mutation has not been previously reported. This gene variation was not found in any of the 119 healthy Ecuadorian individuals used as control. Furthermore, the mutation was the only alteration detected in the propositus's GALT after sequencing all exons and introns of this gene. In silico modeling predicted that the mutation was pathogenic. Copyright © 2017. Published by Elsevier B.V.

  9. Challenging a dogma: co-mutations exist in MAPK pathway genes in colorectal cancer.

    PubMed

    Grellety, Thomas; Gros, Audrey; Pedeutour, Florence; Merlio, Jean-Philippe; Duranton-Tanneur, Valerie; Italiano, Antoine; Soubeyran, Isabelle

    2016-10-01

    Sequencing of genes encoding mitogen-activated protein kinase (MAPK) pathway proteins in colorectal cancer (CRC) has established as dogma that of the genes in a pathway only a single one is ever mutated. We searched for cases with a mutation in more than one MAPK pathway gene (co-mutations). Tumor tissue samples of all patients presenting with CRC, and referred between 01/01/2008 and 01/06/2015 to three French cancer centers for determination of mutation status of RAS/RAF+/-PIK3CA, were retrospectively screened for co-mutations using Sanger sequencing or next-generation sequencing. We found that of 1791 colorectal patients with mutations in the MAPK pathway, 20 had a co-mutation, 8 of KRAS/NRAS, and some even with a third mutation. More than half of the mutations were in codons 12 and 13. We also found 3 cases with a co-mutation of NRAS/BRAF and 9 with a co-mutation of KRAS/BRAF. In 2 patients with a co-mutation of KRAS/NRAS, the co-mutation existed in the primary as well as in a metastasis, which suggests that co-mutations occur early during carcinogenesis and are maintained when a tumor disseminates. We conclude that co-mutations exist in the MAPK genes but with low frequency and as yet with unknown outcome implications.

  10. KMeyeDB: a graphical database of mutations in genes that cause eye diseases.

    PubMed

    Kawamura, Takashi; Ohtsubo, Masafumi; Mitsuyama, Susumu; Ohno-Nakamura, Saho; Shimizu, Nobuyoshi; Minoshima, Shinsei

    2010-06-01

    KMeyeDB (http://mutview.dmb.med.keio.ac.jp/) is a database of human gene mutations that cause eye diseases. We have substantially enriched the amount of data in the database, which now contains information about the mutations of 167 human genes causing eye-related diseases including retinitis pigmentosa, cone-rod dystrophy, night blindness, Oguchi disease, Stargardt disease, macular degeneration, Leber congenital amaurosis, corneal dystrophy, cataract, glaucoma, retinoblastoma, Bardet-Biedl syndrome, and Usher syndrome. KMeyeDB is operated using the database software MutationView, which deals with various characters of mutations, gene structure, protein functional domains, and polymerase chain reaction (PCR) primers, as well as clinical data for each case. Users can access the database using an ordinary Internet browser with smooth user-interface, without user registration. The results are displayed on the graphical windows together with statistical calculations. All mutations and associated data have been collected from published articles. Careful data analysis with KMeyeDB revealed many interesting features regarding the mutations in 167 genes that cause 326 different types of eye diseases. Some genes are involved in multiple types of eye diseases, whereas several eye diseases are caused by different mutations in one gene.

  11. Detecting recurrent gene mutation in interaction network context using multi-scale graph diffusion.

    PubMed

    Babaei, Sepideh; Hulsman, Marc; Reinders, Marcel; de Ridder, Jeroen

    2013-01-23

    Delineating the molecular drivers of cancer, i.e. determining cancer genes and the pathways which they deregulate, is an important challenge in cancer research. In this study, we aim to identify pathways of frequently mutated genes by exploiting their network neighborhood encoded in the protein-protein interaction network. To this end, we introduce a multi-scale diffusion kernel and apply it to a large collection of murine retroviral insertional mutagenesis data. The diffusion strength plays the role of scale parameter, determining the size of the network neighborhood that is taken into account. As a result, in addition to detecting genes with frequent mutations in their genomic vicinity, we find genes that harbor frequent mutations in their interaction network context. We identify densely connected components of known and putatively novel cancer genes and demonstrate that they are strongly enriched for cancer related pathways across the diffusion scales. Moreover, the mutations in the clusters exhibit a significant pattern of mutual exclusion, supporting the conjecture that such genes are functionally linked. Using multi-scale diffusion kernel, various infrequently mutated genes are found to harbor significant numbers of mutations in their interaction network neighborhood. Many of them are well-known cancer genes. The results demonstrate the importance of defining recurrent mutations while taking into account the interaction network context. Importantly, the putative cancer genes and networks detected in this study are found to be significant at different diffusion scales, confirming the necessity of a multi-scale analysis.

  12. Novel XLRS1 gene mutations cause X-linked juvenile retinoschisis in Chinese families.

    PubMed

    Ma, Xiang; Li, Xiaoxin; Wang, Lihua

    2008-01-01

    To investigate various XLRS1 (RS1) gene mutations in Chinese families with X-linked juvenile retinoschisis (XLRS or RS). Genomic DNA was isolated from leukocytes of 29 male patients with X-linked juvenile retinoschisis, 38 female carriers, and 100 normal controls. All 6 exons of the RS1 gene were amplified by polymerase chain reaction, and the RS1 gene mutations were determined by direct sequencing. Eleven different RS1 mutations in 12 families were identified in the 29 male patients. The mutations comprised eight missense, two frameshift, and one splice donor site mutation. Four of these mutations, one frameshift mutation (26 del T) in exon 1, one frameshift mutation (488 del G) in exon 5, Asp145His and Arg156Gly in exon 5, have not been previously described. One novel non-disease-related polymorphism, 576C to T (Pro192Pro) in exon 6, was also found. Six recurrent mutations, Ser73Pro and Arg102Gln mutations in exon 4 and Arg200Cys, Arg209His, Arg213Gln, and Cys223Arg mutations in exon 6, were also identified in this study. RS1 gene mutations caused X-linked juvenile retinoschisis in these Chinese families.

  13. Towards linked open gene mutations data

    PubMed Central

    2012-01-01

    Background With the advent of high-throughput technologies, a great wealth of variation data is being produced. Such information may constitute the basis for correlation analyses between genotypes and phenotypes and, in the future, for personalized medicine. Several databases on gene variation exist, but this kind of information is still scarce in the Semantic Web framework. In this paper, we discuss issues related to the integration of mutation data in the Linked Open Data infrastructure, part of the Semantic Web framework. We present the development of a mapping from the IARC TP53 Mutation database to RDF and the implementation of servers publishing this data. Methods A version of the IARC TP53 Mutation database implemented in a relational database was used as first test set. Automatic mappings to RDF were first created by using D2RQ and later manually refined by introducing concepts and properties from domain vocabularies and ontologies, as well as links to Linked Open Data implementations of various systems of biomedical interest. Since D2RQ query performances are lower than those that can be achieved by using an RDF archive, generated data was also loaded into a dedicated system based on tools from the Jena software suite. Results We have implemented a D2RQ Server for TP53 mutation data, providing data on a subset of the IARC database, including gene variations, somatic mutations, and bibliographic references. The server allows to browse the RDF graph by using links both between classes and to external systems. An alternative interface offers improved performances for SPARQL queries. The resulting data can be explored by using any Semantic Web browser or application. Conclusions This has been the first case of a mutation database exposed as Linked Data. A revised version of our prototype, including further concepts and IARC TP53 Mutation database data sets, is under development. The publication of variation information as Linked Data opens new perspectives

  14. Towards linked open gene mutations data.

    PubMed

    Zappa, Achille; Splendiani, Andrea; Romano, Paolo

    2012-03-28

    With the advent of high-throughput technologies, a great wealth of variation data is being produced. Such information may constitute the basis for correlation analyses between genotypes and phenotypes and, in the future, for personalized medicine. Several databases on gene variation exist, but this kind of information is still scarce in the Semantic Web framework. In this paper, we discuss issues related to the integration of mutation data in the Linked Open Data infrastructure, part of the Semantic Web framework. We present the development of a mapping from the IARC TP53 Mutation database to RDF and the implementation of servers publishing this data. A version of the IARC TP53 Mutation database implemented in a relational database was used as first test set. Automatic mappings to RDF were first created by using D2RQ and later manually refined by introducing concepts and properties from domain vocabularies and ontologies, as well as links to Linked Open Data implementations of various systems of biomedical interest. Since D2RQ query performances are lower than those that can be achieved by using an RDF archive, generated data was also loaded into a dedicated system based on tools from the Jena software suite. We have implemented a D2RQ Server for TP53 mutation data, providing data on a subset of the IARC database, including gene variations, somatic mutations, and bibliographic references. The server allows to browse the RDF graph by using links both between classes and to external systems. An alternative interface offers improved performances for SPARQL queries. The resulting data can be explored by using any Semantic Web browser or application. This has been the first case of a mutation database exposed as Linked Data. A revised version of our prototype, including further concepts and IARC TP53 Mutation database data sets, is under development.The publication of variation information as Linked Data opens new perspectives: the exploitation of SPARQL searches on

  15. Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia.

    PubMed

    Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W; Papadopoulos, Nickolas; Malek, Sami N

    2011-11-24

    To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell lines uncovered 4 (21%) BCORL1 mutated cell lines. The majority (87%) of the mutations in BCORL1 were predicted to inactivate the gene product as a result of nonsense mutations, splice site mutation, or out-of-frame insertions or deletions. These results indicate that BCORL1 by genetic criteria is a novel candidate tumor suppressor gene, joining the growing list of genes recurrently mutated in AML.

  16. Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia

    PubMed Central

    Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W.

    2011-01-01

    To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell lines uncovered 4 (21%) BCORL1 mutated cell lines. The majority (87%) of the mutations in BCORL1 were predicted to inactivate the gene product as a result of nonsense mutations, splice site mutation, or out-of-frame insertions or deletions. These results indicate that BCORL1 by genetic criteria is a novel candidate tumor suppressor gene, joining the growing list of genes recurrently mutated in AML. PMID:21989985

  17. Iranian hereditary hemochromatosis patients: baseline characteristics, laboratory data and gene mutations.

    PubMed

    Zamani, Farhad; Bagheri, Zohreh; Bayat, Maryam; Fereshtehnejad, Seyed-Mohammad; Basi, Ali; Najmabadi, Hossein; Ajdarkosh, Hossein

    2012-10-01

    Hereditary hemochromatosis (HH) is the most common autosomal recessive disorder in white people, characterized by highly abnormal uptake of iron from the gastrointestinal tracts. Recently, mutation studies have focused to detect the genes responsible for HH. In this cross-sectional study, 12 HH patients were recruited, who were referred to Firoozgar Hospital, Tehran, Iran. In addition to the clinical assessments, a complete laboratory evaluation, imaging modalities, histopathologic assessment, atomic absorption spectrophotometry and gene mutation study were performed. The genetic study for HFE gene mutation was examined for all of the patients since 2006, while non-HFE mutation was conducted since December 2010 (only for 1 of them). Twelve patients were evaluated consisting of 11 men and 1 woman, with the mean age of 39.58±12.68 yr. The average of atomic iron loads was 13.25±4.83-fold higher than normal standards. Four patients had heterozygotic mutation of H63D (33.3%). There was no significant difference in either the iron load of liver (P=0.927) and heart (P=0.164) or serum concentration of ferritin (P=0.907) and TIBC (P=0.937) between the HFE-mutant and without HFE mutation HH cases. In contrast to other studies, C282Y mutation was not detected in any of our Iranian HH patients. Heterozygotic mutations of H63D (HFE) and TFR2 (non-HFE) genes were found to be more common in these patients. Similar to previous reports, these mutations were not found to be significantly associated with severity of presentation in HH patients.

  18. De novo mutations in histone modifying genes in congenital heart disease

    PubMed Central

    Zaidi, Samir; Choi, Murim; Wakimoto, Hiroko; Ma, Lijiang; Jiang, Jianming; Overton, John D.; Romano-Adesman, Angela; Bjornson, Robert D.; Breitbart, Roger E.; Brown, Kerry K.; Carriero, Nicholas J.; Cheung, Yee Him; Deanfield, John; DePalma, Steve; Fakhro, Khalid A.; Glessner, Joseph; Hakonarson, Hakon; Italia, Michael; Kaltman, Jonathan R.; Kaski, Juan; Kim, Richard; Kline, Jennie K.; Lee, Teresa; Leipzig, Jeremy; Lopez, Alexander; Mane, Shrikant M.; Mitchell, Laura E.; Newburger, Jane W.; Parfenov, Michael; Pe'er, Itsik; Porter, George; Roberts, Amy; Sachidanandam, Ravi; Sanders, Stephan J.; Seiden, Howard S.; State, Mathew W.; Subramanian, Sailakshmi; Tikhonova, Irina R.; Wang, Wei; Warburton, Dorothy; White, Peter S.; Williams, Ismee A.; Zhao, Hongyu; Seidman, Jonathan G.; Brueckner, Martina; Chung, Wendy K.; Gelb, Bruce D.; Goldmuntz, Elizabeth; Seidman, Christine E.; Lifton, Richard P.

    2013-01-01

    Congenital heart disease (CHD) is the most frequent birth defect, affecting 0.8% of live births1. Many cases occur sporadically and impair reproductive fitness, suggesting a role for de novo mutations. By analysis of exome sequencing of parent-offspring trios, we compared the incidence of de novo mutations in 362 severe CHD cases and 264 controls. CHD cases showed a significant excess of protein-altering de novo mutations in genes expressed in the developing heart, with an odds ratio of 7.5 for damaging mutations. Similar odds ratios were seen across major classes of severe CHD. We found a marked excess of de novo mutations in genes involved in production, removal or reading of H3K4 methylation (H3K4me), or ubiquitination of H2BK120, which is required for H3K4 methylation2–4. There were also two de novo mutations in SMAD2; SMAD2 signaling in the embryonic left-right organizer induces demethylation of H3K27me5. H3K4me and H3K27me mark `poised' promoters and enhancers that regulate expression of key developmental genes6. These findings implicate de novo point mutations in several hundred genes that collectively contribute to ~10% of severe CHD. PMID:23665959

  19. Mutation analysis of the MECP2 gene in patients of Slavic origin with Rett syndrome: novel mutations and polymorphisms.

    PubMed

    Zahorakova, Daniela; Rosipal, Robert; Hadac, Jan; Zumrova, Alena; Bzduch, Vladimir; Misovicova, Nadezda; Baxova, Alice; Zeman, Jiri; Martasek, Pavel

    2007-01-01

    Rett syndrome (RTT), an X-linked dominant neurodevelopmental disorder in females, is caused mainly by de novo mutations in the methyl-CpG-binding protein 2 gene (MECP2). Here we report mutation analysis of the MECP2 gene in 87 patients with RTT from the Czech and Slovak Republics, and Ukraine. The patients, all girls, with classical RTT were investigated for mutations using bi-directional DNA sequencing and conformation sensitive gel electrophoresis analysis of the coding sequence and exon/intron boundaries of the MECP2 gene. Restriction fragment length polymorphism analysis was performed to confirm the mutations that cause the creation or abolition of the restriction site. Mutation-negative cases were subsequently examined by multiple ligation-dependent probe amplification (MLPA) to identify large deletions. Mutation screening revealed 31 different mutations in 68 patients and 12 non-pathogenic polymorphisms. Six mutations have not been previously published: two point mutations (323T>A, 904C>T), three deletions (189_190delGA, 816_832del17, 1069delAGC) and one deletion/inversion (1063_1236del174;1189_1231inv43). MLPA analysis revealed large deletions in two patients. The detection rate was 78.16%. Our results confirm the high frequency of MECP2 mutations in females with RTT and provide data concerning the mutation heterogeneity in the Slavic population.

  20. [From gene to disease; primary hyperoxaluria type I caused by mutations in the AGXT gene].

    PubMed

    van Woerden, C S; Groothof, J W; Wanders, R J A; Waterham, H R; Wijburg, F R

    2006-07-29

    Primary hyperoxaluria type I (PH1) is a congenital defect in glyoxylate metabolism caused by a deficiency in the liver-specific peroxisomal enzyme known as alanine glyoxylate aminotransferase (AGT). The deficiency is due to mutations in the AGXT gene, located on chromosome 2q37.3, and results in the conversion of glyoxylate to oxalate. The crystallisation of oxalate with calcium results in symptoms varying from a solitary kidney stone to end-stage renal disease with systemic oxalosis. The diagnosis is based on increased oxalate and glycolate excretion in the urine, reduced AGT activity in liver tissue, and confirmed mutations in the AGXT gene. Over 50 disease-causing mutations have been identified in PH1, which are associated with a wide range of effects on the AGT enzyme. Homozygous Gly170Arg or Phei52Ile mutations are associated with a reduction in urinary oxalate excretion upon pyridoxine administration and long-term preservation of renal function when treatment is initiated in a timely manner. Homozygous 33insC and Gly82Arg mutations result in a much poorer prognosis. Mutational analysis of the AGXT gene in PH1 patients can be a useful tool for establishing the diagnosis and choosing an appropriate therapeutic strategy.

  1. Mutation spectrum and differential gene expression in cystic and solid vestibular schwannoma.

    PubMed

    Zhang, Zhihua; Wang, Zhaoyan; Sun, Lianhua; Li, Xiaohua; Huang, Qi; Yang, Tao; Wu, Hao

    2014-03-01

    We sought to characterize the mutation spectrum of NF2 and the differential gene expression in cystic and solid vestibular schwannomas. We collected tumor tissue and blood samples of 31 cystic vestibular schwannomas and 114 solid vestibular schwannomas. Mutation screening of NF2 was performed in both tumor and blood DNA samples of all patients. cDNA microarray was used to analyze the differential gene expression between 11 cystic vestibular schwannomas and 6 solid vestibular schwannomas. Expression levels of top candidate genes were verified by quantitative reverse transcription PCR. NF2 mutations were identified in 34.5% of sporadic vestibular schwannomas, with all mutations being exclusively somatic. No significant difference was found between the mutation detection rates of cystic vestibular schwannoma (35.5%) and solid vestibular schwannoma (34.2%). cDNA microarray analysis detected a total of 46 differentially expressed genes between the cystic vestibular schwannoma and solid vestibular schwannoma samples. The significantly decreased expression of four top candidate genes, C1orf130, CNTF, COL4A3, and COL4A4, was verified by quantitative reverse transcription PCR. NF2 mutations are not directly involved in the cystic formation of vestibular schwannoma. In addition, the differential gene expression of cystic vestibular schwannoma reported in our study may provide useful insights into the molecular mechanism underlying this process.

  2. Mutational screening of the USH2A gene in Spanish USH patients reveals 23 novel pathogenic mutations

    PubMed Central

    2011-01-01

    Background Usher Syndrome type II (USH2) is an autosomal recessive disorder, characterized by moderate to severe hearing impairment and retinitis pigmentosa (RP). Among the three genes implicated, mutations in the USH2A gene account for 74-90% of the USH2 cases. Methods To identify the genetic cause of the disease and determine the frequency of USH2A mutations in a cohort of 88 unrelated USH Spanish patients, we carried out a mutation screening of the 72 coding exons of this gene by direct sequencing. Moreover, we performed functional minigene studies for those changes that were predicted to affect splicing. Results As a result, a total of 144 DNA sequence variants were identified. Based upon previous studies, allele frequencies, segregation analysis, bioinformatics' predictions and in vitro experiments, 37 variants (23 of them novel) were classified as pathogenic mutations. Conclusions This report provide a wide spectrum of USH2A mutations and clinical features, including atypical Usher syndrome phenotypes resembling Usher syndrome type I. Considering only the patients clearly diagnosed with Usher syndrome type II, and results obtained in this and previous studies, we can state that mutations in USH2A are responsible for 76.1% of USH2 disease in patients of Spanish origin. PMID:22004887

  3. The Androgen Receptor Gene Mutations Database.

    PubMed

    Gottlieb, B; Lehvaslaiho, H; Beitel, L K; Lumbroso, R; Pinsky, L; Trifiro, M

    1998-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 272 to 309 in the past year. We have expanded the database: (i) by giving each entry an accession number; (ii) by adding information on the length of polymorphic polyglutamine (polyGln) and polyglycine (polyGly) tracts in exon 1; (iii) by adding information on large gene deletions; (iv) by providing a direct link with a completely searchable database (courtesy EMBL-European Bioinformatics Institute). The addition of the exon 1 polymorphisms is discussed in light of their possible relevance as markers for predisposition to prostate or breast cancer. The database is also available on the internet (http://www.mcgill. ca/androgendb/ ), from EMBL-European Bioinformatics Institute (ftp. ebi.ac.uk/pub/databases/androgen ), or as a Macintosh FilemakerPro or Word file (MC33@musica.mcgill.ca).

  4. The Androgen Receptor Gene Mutations Database.

    PubMed Central

    Gottlieb, B; Lehvaslaiho, H; Beitel, L K; Lumbroso, R; Pinsky, L; Trifiro, M

    1998-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. The total number of reported mutations has risen from 272 to 309 in the past year. We have expanded the database: (i) by giving each entry an accession number; (ii) by adding information on the length of polymorphic polyglutamine (polyGln) and polyglycine (polyGly) tracts in exon 1; (iii) by adding information on large gene deletions; (iv) by providing a direct link with a completely searchable database (courtesy EMBL-European Bioinformatics Institute). The addition of the exon 1 polymorphisms is discussed in light of their possible relevance as markers for predisposition to prostate or breast cancer. The database is also available on the internet (http://www.mcgill. ca/androgendb/ ), from EMBL-European Bioinformatics Institute (ftp. ebi.ac.uk/pub/databases/androgen ), or as a Macintosh FilemakerPro or Word file (MC33@musica.mcgill.ca). PMID:9399843

  5. Mutation analysis of Leber congenital amaurosis‑associated genes in patients with retinitis pigmentosa.

    PubMed

    Shen, Tao; Guan, Liping; Li, Shiqiang; Zhang, Jianguo; Xiao, Xueshan; Jiang, Hui; Yang, Jianhua; Guo, Xiangming; Wang, Jun; Zhang, Qingjiong

    2015-03-01

    The genetic defects underlying approximately half of all retinitis pigmentosa (RP) cases are unknown. A number of genes responsible for Leber congenital amaurosis (LCA) may also cause RP when they are mutated. Our previous study revealed that variants in the most frequently mutated nine exons accounted for approximately half of the mutations detected in a cohort of patients with LCA. The aim of the present study was to detect mutations in LCA-associated genes in patients with RP using two different strategies. Sanger sequencing was used to screen mutations in the nine exons in 293 patients with RP and exome sequencing was used to detect variants in 12 LCA-associated genes in 157 of the 293 patients with RP and then to validate the variants by Sanger sequencing. Potential pathogenic mutations were identified in four patients with early onset RP, including homozygous CRB1 mutations in two patients, compound heterozygous CRB1 mutations in one patient and compound heterozygous CEP290 mutations in one patient. The present study indicated that mutations in CEP290 may also be associated with RP but not with LCA. With the exception of CEP290, the remaining 11 genes known to be associated with LCA but not with RP are unlikely to be a common cause of RP.

  6. Mutation and virulence assessment of chromosomal genes of Rhodococcus equi 103

    PubMed Central

    Pei, Yanlong; Parreira, Valeria; Nicholson, Vivian M.; Prescott, John F.

    2007-01-01

    Rhodococcus equi can cause severe or fatal pneumonia in foals as well as in immunocompromised animals and humans. Its ability to persist in macrophages is fundamental to how it causes disease, but the basis of this is poorly understood. To examine further the general application of a recently developed system of targeted gene mutation and to assess the importance of different genes in resistance to innate immune defenses, we disrupted the genes encoding high-temperature requirement A (htrA), nitrate reductase (narG), peptidase D (pepD), phosphoribosylaminoimidazole-succinocarboxamide synthase (purC), and superoxide dismutase (sodC) in strain 103 of R. equi using a double-crossover homologous recombination approach. Virulence testing by clearance after intravenous injection in mice showed that the htrA and narG mutants were fully attenuated, the purC and sodC mutants were unchanged, and the pepD mutant was slightly attenuated. Complementation with the pREM shuttle plasmid restored the virulence of the htrA and pepD mutants but not that of the narG mutant. A single-crossover mutation approach was simpler and faster than the double-crossover homologous recombination technique and was used to obtain mutations in 6 other genes potentially involved in virulence (clpB, fadD8, fbpB, glnA1, regX3, and sigF). These mutants were not attenuated in the mouse clearance assay. We were not able to obtain mutants for genes furA, galE, and sigE using the single-crossover mutation approach. In summary, the targeted-mutation system had general applicability but was not always completely successful, perhaps because some genes are essential under the growth conditions used or because the success of mutation depends on the target genes. PMID:17193875

  7. HFE gene mutation is a risk factor for tissue iron accumulation in hemodialysis patients.

    PubMed

    Turkmen, Ercan; Yildirim, Tolga; Yilmaz, Rahmi; Hazirolan, Tuncay; Eldem, Gonca; Yilmaz, Engin; Aybal Kutlugun, Aysun; Altindal, Mahmut; Altun, Bulent

    2017-07-01

    HFE gene mutations are responsible from iron overload in general population. Studies in hemodialysis patients investigated the effect of presence of HFE gene mutations on serum ferritin and transferrin saturation (TSAT) with conflicting results. However effect of HFE mutations on iron overload in hemodialysis patients was not previously extensively studied. 36 hemodialysis patients (age 51.3 ± 15.6, (18/18) male/female) and 44 healthy control subjects included in this cross sectional study. Hemoglobin, ferritin, TSAT in the preceding 2 years were recorded. Iron and erythropoietin (EPO) administered during this period were calculated. Iron accumulation in heart and liver was detected by MRI. Relationship between HFE gene mutation, hemoglobin, iron parameters and EPO doses, and tissue iron accumulation were determined. Iron overload was detected in nine (25%) patients. Hemoglobin, iron parameters, weekly EPO doses, and monthly iron doses of patients with and without iron overload were similar. There was no difference between control group and hemodialysis patients with respect to the prevalence of HFE gene mutations. Iron overload was detected in five of eight patients who had HFE gene mutations, but iron overload was present in 4 of 28 patients who had no mutations (P = 0.01). Hemoglobin, iron parameters, erythropoietin, and iron doses were similar in patients with and without gene mutations. HFE gene mutations remained the main determinant of iron overload after multivariate logistic regression analysis (P = 0.02; OR, 11.6). Serum iron parameters were not adequate to detect iron overload and HFE gene mutation was found to be an important risk factor for iron accumulation. © 2017 International Society for Hemodialysis.

  8. Mutation analysis of 13 driver genes of colorectal cancer-related pathways in Taiwanese patients.

    PubMed

    Chang, Yuli Christine; Chang, Jan-Gowth; Liu, Ta-Chih; Lin, Chien-Yu; Yang, Shu-Fen; Ho, Cheng-Mao; Chen, William Tzu-Liang; Chang, Ya-Sian

    2016-02-21

    To investigate the driver gene mutations associated with colorectal cancer (CRC) in the Taiwanese population. In this study, 103 patients with CRC were evaluated. The samples consisted of 66 men and 37 women with a median age of 59 years and an age range of 26-86 years. We used high-resolution melting analysis (HRM) and direct DNA sequencing to characterize the mutations in 13 driver genes of CRC-related pathways. The HRM assays were conducted using the LightCycler® 480 Instrument provided with the software LightCycler® 480 Gene Scanning Software Version 1.5. We also compared the clinicopathological data of CRC patients with the driver gene mutation status. Of the 103 patients evaluated, 73.79% had mutations in one of the 13 driver genes. We discovered 18 novel mutations in APC, MLH1, MSH2, PMS2, SMAD4 and TP53 that have not been previously reported. Additionally, we found 16 de novo mutations in APC, BMPR1A, MLH1, MSH2, MSH6, MUTYH and PMS2 in cancerous tissues previously reported in the dbSNP database; however, these mutations could not be detected in peripheral blood cells. The APC mutation correlates with lymph node metastasis (34.69% vs 12.96%, P = 0.009) and cancer stage (34.78% vs 14.04%, P = 0.013). No association was observed between other driver gene mutations and clinicopathological features. Furthermore, having two or more driver gene mutations correlates with the degree of lymph node metastasis (42.86% vs 24.07%, P = 0.043). Our findings confirm the importance of 13 CRC-related pathway driver genes in the development of CRC in Taiwanese patients.

  9. DHPLC-based mutation analysis of ENG and ALK-1 genes in HHT Italian population.

    PubMed

    Lenato, Gennaro M; Lastella, Patrizia; Di Giacomo, Marilena C; Resta, Nicoletta; Suppressa, Patrizia; Pasculli, Giovanna; Sabbà, Carlo; Guanti, Ginevra

    2006-02-01

    Hereditary haemorrhagic telangiectasia (HHT or Rendu-Osler-Weber syndrome) is an autosomal dominant disorder characterized by localized angiodysplasia due to mutations in endoglin, ALK-1 gene, and a still unidentified locus. The lack of highly recurrent mutations, locus heterogeneity, and the presence of mutations in almost all coding exons of the two genes makes the screening for mutations time-consuming and costly. In the present study, we developed a DHPLC-based protocol for mutation detection in ALK1 and ENG genes through retrospective analysis of known sequence variants, 20 causative mutations and 11 polymorphisms, and a prospective analysis on 47 probands with unknown mutation. Overall DHPLC analysis identified the causative mutation in 61 out 66 DNA samples (92.4%). We found 31 different mutations in the ALK1 gene, of which 15 are novel, and 20, of which 12 are novel, in the ENG gene, thus providing for the first time the mutational spectrum in a cohort of Italian HHT patients. In addition, we characterized the splicing pattern of ALK1 gene in lymphoblastoid cells, both in normal controls and in two individuals carrying a mutation in the non-invariant -3 position of the acceptor splice site upstream exon 6 (c.626-3C>G). Functional essay demonstrated the existence, also in normal individuals, of a small proportion of ALK1 alternative splicing, due to exon 5 skipping, and the presence of further aberrant splicing isoforms in the individuals carrying the c.626-3C>G mutation. 2006 Wiley-Liss, Inc.

  10. Characterization of Homozygous Hb Setif (HBA2: c.283G>T) in the Iranian Population.

    PubMed

    Farashi, Samaneh; Garous, Negin F; Vakili, Shadi; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

    2016-01-01

    Hemoglobin (Hb) variants are abnormalities resulting from point mutations in either of the two α-globin genes (HBA2 or HBA1) or the β-globin gene (HBB). Various reports of Hb variants have been described in Iran and other countries around the world. Hb Setif (or HBA2: c.283G>T) is one of these variants with a mutation at codon 94 of of the α2-globin gene that is characterized in clinically normal heterozygous individuals. We here report clinical and hematological findings in two homozygous cases of Iranian origin for this unstable Hb variant.

  11. Novel Mutations in pncA Gene of Pyrazinamide Resistant Clinical Isolates of Mycobacterium tuberculosis.

    PubMed

    Kahbazi, Manijeh; Sarmadian, Hossein; Ahmadi, Azam; Didgar, Farshideh; Sadrnia, Maryam; Poolad, Toktam; Arjomandzadegan, Mohammad

    2018-04-16

    In clinical isolates of Mycobacterium tuberculosis (MTB), resistance to pyrazinamide occurs by mutations in any positions of the pncA gene (NC_000962.3) especially in nucleotides 359 and 374. In this study we examined the pncA gene sequence in clinical isolates of MTB. Genomic DNA of 33 clinical isolates of MTB was extracted by the Chelex100 method. The polymerase chain reactions (PCR) were performed using specific primers for amplification of 744 bp amplicon comprising the coding sequences (CDS) of the pncA gene. PCR products were sequenced by an automated sequencing Bioscience system. Additionally, semi Nested-allele specific (sNASP) and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) methods were carried out for verification of probable mutations in nucleotides 359 and 374. Sequencing results showed that from 33 MTB clinical isolates, nine pyrazinamide-resistant isolates have mutations. Furthermore, no mutation was detected in 24 susceptible strains in the entire 561 bp of the pncA gene. Moreover, new mutations of G→A at position 3 of the pncA gene were identified in some of the resistant isolates. Results showed that the sNASP method could detect mutations in nucleotide 359 and 374 of the pncA gene, but the PCR-RFLP method by the SacII enzyme could not detect these mutations. In conclusion, the identification of new mutations in the pncA gene confirmed the probable occurrence of mutations in any nucleotides of the pncA gene sequence in resistant isolates of MTB.

  12. An innovative strategy to clone positive modifier genes of defects caused by mtDNA mutations: MRPS18C as suppressor gene of m.3946G>A mutation in MT-ND1 gene.

    PubMed

    Rodríguez-García, María Elena; Cotrina-Vinagre, Francisco Javier; Carnicero-Rodríguez, Patricia; Martínez-Azorín, Francisco

    2017-07-01

    We have developed a new functional complementation approach to clone modifier genes which overexpression is able to suppress the biochemical defects caused by mtDNA mutations (suppressor genes). This strategy consists in transferring human genes into respiratory chain-deficient fibroblasts, followed by a metabolic selection in a highly selective medium. We used a normalized expression cDNA library in an episomal vector (pREP4) to transfect the fibroblasts, and a medium with glutamine and devoid of any carbohydrate source to select metabolically. Growing the patient's fibroblasts in this selective medium, the deficient cells rapidly disappear unless they are rescued by the cDNA of a suppressor gene. The use of an episomal vector allows us to carry out several rounds of transfection/selection (cyclical phenotypic rescue) to enrich the rescue with true clones of suppressor genes. Using fibroblasts from a patient with epileptic encephalopathy with the m.3946G>A (p.E214K) mutation in the MT-ND1 gene, several candidate genes were identified and one of them was characterized functionally. Thus, overexpression of MRPS18C gene (that encode for bS18m protein) suppressed the molecular defects produced by this mtDNA mutation, recovering the complex I activity and reducing the ROS produced by this complex to normal levels. We suggest that modulation of bS18m expression may be an effective therapeutic strategy for the patients with this mutation.

  13. CRISPR-mediated direct mutation of cancer genes in the mouse liver

    PubMed Central

    Xue, Wen; Chen, Sidi; Yin, Hao; Tammela, Tuomas; Papagiannakopoulos, Thales; Joshi, Nikhil S.; Cai, Wenxin; Yang, Gillian; Bronson, Roderick; Crowley, Denise G.; Zhang, Feng; Anderson, Daniel G.; Sharp, Phillip A.; Jacks, Tyler

    2014-01-01

    The study of cancer genes in mouse models has traditionally relied on genetically-engineered strains made via transgenesis or gene targeting in embryonic stem (ES) cells1. Here we describe a new method of cancer model generation using the CRISPR/Cas system in vivo in wild-type mice. We have used hydrodynamic injection to deliver a CRISPR plasmid DNA expressing Cas9 and single guide RNAs (sgRNAs)2–4 to the liver and directly target the tumor suppressor genes Pten5 and p536, alone and in combination. CRISPR-mediated Pten mutation led to elevated Akt phosphorylation and lipid accumulation in hepatocytes, phenocopying the effects of deletion of the gene using Cre-LoxP technology7, 8. Simultaneous targeting of Pten and p53 induced liver tumors that mimicked those caused by Cre-loxP-mediated deletion of Pten and p53. DNA sequencing of liver and tumor tissue revealed insertion or deletion (indel) mutations of the tumor suppressor genes, including bi-allelic mutations of both Pten and p53 in tumors. Furthermore, co-injection of Cas9 plasmids harboring sgRNAs targeting the β-Catenin gene (Ctnnb1) and a single-stranded DNA (ssDNA) oligonucleotide donor carrying activating point mutations led to the generation of hepatocytes with nuclear localization of β-Catenin. This study demonstrates the feasibility of direct mutation of tumor suppressor genes and oncogenes in the liver using the CRISPR/Cas system, which presents a new avenue for rapid development of liver cancer models and functional genomics. PMID:25119044

  14. CRISPR-mediated direct mutation of cancer genes in the mouse liver.

    PubMed

    Xue, Wen; Chen, Sidi; Yin, Hao; Tammela, Tuomas; Papagiannakopoulos, Thales; Joshi, Nikhil S; Cai, Wenxin; Yang, Gillian; Bronson, Roderick; Crowley, Denise G; Zhang, Feng; Anderson, Daniel G; Sharp, Phillip A; Jacks, Tyler

    2014-10-16

    The study of cancer genes in mouse models has traditionally relied on genetically-engineered strains made via transgenesis or gene targeting in embryonic stem cells. Here we describe a new method of cancer model generation using the CRISPR/Cas (clustered regularly interspaced short palindromic repeats/CRISPR-associated proteins) system in vivo in wild-type mice. We used hydrodynamic injection to deliver a CRISPR plasmid DNA expressing Cas9 and single guide RNAs (sgRNAs) to the liver that directly target the tumour suppressor genes Pten (ref. 5) and p53 (also known as TP53 and Trp53) (ref. 6), alone and in combination. CRISPR-mediated Pten mutation led to elevated Akt phosphorylation and lipid accumulation in hepatocytes, phenocopying the effects of deletion of the gene using Cre-LoxP technology. Simultaneous targeting of Pten and p53 induced liver tumours that mimicked those caused by Cre-loxP-mediated deletion of Pten and p53. DNA sequencing of liver and tumour tissue revealed insertion or deletion mutations of the tumour suppressor genes, including bi-allelic mutations of both Pten and p53 in tumours. Furthermore, co-injection of Cas9 plasmids harbouring sgRNAs targeting the β-catenin gene and a single-stranded DNA oligonucleotide donor carrying activating point mutations led to the generation of hepatocytes with nuclear localization of β-catenin. This study demonstrates the feasibility of direct mutation of tumour suppressor genes and oncogenes in the liver using the CRISPR/Cas system, which presents a new avenue for rapid development of liver cancer models and functional genomics.

  15. Advances in computational approaches for prioritizing driver mutations and significantly mutated genes in cancer genomes.

    PubMed

    Cheng, Feixiong; Zhao, Junfei; Zhao, Zhongming

    2016-07-01

    Cancer is often driven by the accumulation of genetic alterations, including single nucleotide variants, small insertions or deletions, gene fusions, copy-number variations, and large chromosomal rearrangements. Recent advances in next-generation sequencing technologies have helped investigators generate massive amounts of cancer genomic data and catalog somatic mutations in both common and rare cancer types. So far, the somatic mutation landscapes and signatures of >10 major cancer types have been reported; however, pinpointing driver mutations and cancer genes from millions of available cancer somatic mutations remains a monumental challenge. To tackle this important task, many methods and computational tools have been developed during the past several years and, thus, a review of its advances is urgently needed. Here, we first summarize the main features of these methods and tools for whole-exome, whole-genome and whole-transcriptome sequencing data. Then, we discuss major challenges like tumor intra-heterogeneity, tumor sample saturation and functionality of synonymous mutations in cancer, all of which may result in false-positive discoveries. Finally, we highlight new directions in studying regulatory roles of noncoding somatic mutations and quantitatively measuring circulating tumor DNA in cancer. This review may help investigators find an appropriate tool for detecting potential driver or actionable mutations in rapidly emerging precision cancer medicine. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  16. Functional and Genomic Features of Human Genes Mutated in Neuropsychiatric Disorders.

    PubMed

    Forero, Diego A; Prada, Carlos F; Perry, George

    2016-01-01

    In recent years, a large number of studies around the world have led to the identification of causal genes for hereditary types of common and rare neurological and psychiatric disorders. To explore the functional and genomic features of known human genes mutated in neuropsychiatric disorders. A systematic search was used to develop a comprehensive catalog of genes mutated in neuropsychiatric disorders (NPD). Functional enrichment and protein-protein interaction analyses were carried out. A false discovery rate approach was used for correction for multiple testing. We found several functional categories that are enriched among NPD genes, such as gene ontologies, protein domains, tissue expression, signaling pathways and regulation by brain-expressed miRNAs and transcription factors. Sixty six of those NPD genes are known to be druggable. Several topographic parameters of protein-protein interaction networks and the degree of conservation between orthologous genes were identified as significant among NPD genes. These results represent one of the first analyses of enrichment of functional categories of genes known to harbor mutations for NPD. These findings could be useful for a future creation of computational tools for prioritization of novel candidate genes for NPD.

  17. Functional and Genomic Features of Human Genes Mutated in Neuropsychiatric Disorders

    PubMed Central

    Forero, Diego A.; Prada, Carlos F.; Perry, George

    2016-01-01

    Background: In recent years, a large number of studies around the world have led to the identification of causal genes for hereditary types of common and rare neurological and psychiatric disorders. Objective: To explore the functional and genomic features of known human genes mutated in neuropsychiatric disorders. Methods: A systematic search was used to develop a comprehensive catalog of genes mutated in neuropsychiatric disorders (NPD). Functional enrichment and protein-protein interaction analyses were carried out. A false discovery rate approach was used for correction for multiple testing. Results: We found several functional categories that are enriched among NPD genes, such as gene ontologies, protein domains, tissue expression, signaling pathways and regulation by brain-expressed miRNAs and transcription factors. Sixty six of those NPD genes are known to be druggable. Several topographic parameters of protein-protein interaction networks and the degree of conservation between orthologous genes were identified as significant among NPD genes. Conclusion: These results represent one of the first analyses of enrichment of functional categories of genes known to harbor mutations for NPD. These findings could be useful for a future creation of computational tools for prioritization of novel candidate genes for NPD. PMID:27990183

  18. [Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].

    PubMed

    Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan

    2016-08-01

    To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.

  19. Hyperinsulinism–hyperammonaemia syndrome: novel mutations in the GLUD1 gene and genotype–phenotype correlations

    PubMed Central

    Kapoor, Ritika R; Flanagan, Sarah E; Fulton, Piers; Chakrapani, Anupam; Chadefaux, Bernadette; Ben-Omran, Tawfeg; Banerjee, Indraneel; Shield, Julian P; Ellard, Sian; Hussain, Khalid

    2009-01-01

    Background Activating mutations in the GLUD1 gene (which encodes for the intra-mitochondrial enzyme glutamate dehydrogenase, GDH) cause the hyperinsulinism–hyperammonaemia (HI/HA) syndrome. Patients present with HA and leucine-sensitive hypoglycaemia. GDH is regulated by another intra-mitochondrial enzyme sirtuin 4 (SIRT4). Sirt4 knockout mice demonstrate activation of GDH with increased amino acid-stimulated insulin secretion. Objectives To study the genotype–phenotype correlations in patients with GLUD1 mutations. To report the phenotype and functional analysis of a novel mutation (P436L) in the GLUD1 gene associated with the absence of HA. Patients and methods Twenty patients with HI from 16 families had mutational analysis of the GLUD1 gene in view of HA (n=19) or leucine sensitivity (n=1). Patients negative for a GLUD1 mutation had sequence analysis of the SIRT4 gene. Functional analysis of the novel P436L GLUD1 mutation was performed. Results Heterozygous missense mutations were detected in 15 patients with HI/HA, 2 of which are novel (N410D and D451V). In addition, a patient with a normal serum ammonia concentration (21 μmol/l) was heterozygous for a novel missense mutation P436L. Functional analysis of this mutation confirms that it is associated with a loss of GTP inhibition. Seizure disorder was common (43%) in our cohort of patients with a GLUD1 mutation. No mutations in the SIRT4 gene were identified. Conclusion Patients with HI due to mutations in the GLUD1 gene may have normal serum ammonia concentrations. Hence, GLUD1 mutational analysis may be indicated in patients with leucine sensitivity; even in the absence of HA. A high frequency of epilepsy (43%) was observed in our patients with GLUD1 mutations. PMID:19690084

  20. Mutational Survey of the PHEX Gene in Patients with X-linked Hypophosphatemic Rickets

    PubMed Central

    Ichikawa, Shoji; Traxler, Elizabeth A.; Estwick, Selina A.; Curry, Leah R.; Johnson, Michelle L.; Sorenson, Andrea H.; Imel, Erik A.; Econs, Michael J.

    2008-01-01

    X-linked hypophosphatemic rickets (XLH) is a dominantly inherited disorder characterized by renal phosphate wasting, aberrant vitamin D metabolism, and abnormal bone mineralization. XLH is caused by inactivating mutations in PHEX (phosphate-regulating gene with homologies to endopeptidases on the X chromosome). In this study, we sequenced the PHEX gene in subjects from 26 kindreds who were clinically diagnosed with XLH. Sequencing revealed 18 different mutations, of which thirteen have not been reported previously. In addition to deletions, splice site mutations, and missense and nonsense mutations, a rare point mutation in the 3’-untranslated region (3’-UTR) was identified as a novel cause of XLH. In summary, we identified a wide spectrum of mutations in the PHEX gene. Our data, in accord with those of others, indicate that there is no single predominant PHEX mutation responsible for XLH. PMID:18625346

  1. G20210A prothrombin gene mutation identified in patients with venous leg ulcers.

    PubMed

    Jebeleanu, G; Procopciuc, L

    2001-01-01

    The G20210A mutation variant of prothrombin gene is the second most frequent mutation identified in patients with deep venous thrombosis, after factor V Leiden. The risk for developing deep venous thrombosis is high in patients identified as heterozygous for G20210A mutation. In order to identify this polymorphism in the gene coding prothrombin, the 345bp fragment in the 3'- untranslated region of the prothrombin gene was amplified using amplification by polymerase chain reaction and enzymatic digestion by HindIII (restriction endonuclease enzyme). The products of amplification and enzymatic's digestion were analized using agarose gel electrophoresis. We investigated 20 patients with venous leg ulcers and we found 2 heterozygous (10%) for G20210A mutation. None of the patients in the control group had G20210A mutation. Our study confirms the presence of G20210A mutation in the Romanian population. Our study also shows the link between venous leg ulcers and this polymorphism in the prothrombin gene.

  2. A novel lipoprotein lipase gene missense mutation in Chinese patients with severe hypertriglyceridemia and pancreatitis

    PubMed Central

    2014-01-01

    Background Alterations or mutations in the lipoprotein lipase (LPL) gene contribute to severe hypertriglyceridemia (HTG). This study reported on two patients in a Chinese family with LPL gene mutations and severe HTG and acute pancreatitis. Methods Two patients with other five family members were included in this study for DNA-sequences of hyperlipidemia-related genes (such as LPL, APOC2, APOA5, LMF1, and GPIHBP1) and 43 healthy individuals and 70 HTG subjects were included for the screening of LPL gene mutations. Results Both patients were found to have a compound heterozygote for a novel LPL gene mutation (L279V) and a known mutation (A98T). Furthermore, one HTG subject out of 70 was found to carry this novel LPL L279V mutation. Conclusions The data from this study showed that compound heterozygote mutations of A98T and L279V inactivate lipoprotein lipase enzymatic activity and contribute to severe HTG and acute pancreatitis in two Chinese patients. Further study will investigate how these LPL gene mutations genetically inactivate the LPL enzyme. PMID:24646025

  3. Mutation analysis of 13 driver genes of colorectal cancer-related pathways in Taiwanese patients

    PubMed Central

    Chang, Yuli Christine; Chang, Jan-Gowth; Liu, Ta-Chih; Lin, Chien-Yu; Yang, Shu-Fen; Ho, Cheng-Mao; Chen, William Tzu-Liang; Chang, Ya-Sian

    2016-01-01

    AIM: To investigate the driver gene mutations associated with colorectal cancer (CRC) in the Taiwanese population. METHODS: In this study, 103 patients with CRC were evaluated. The samples consisted of 66 men and 37 women with a median age of 59 years and an age range of 26-86 years. We used high-resolution melting analysis (HRM) and direct DNA sequencing to characterize the mutations in 13 driver genes of CRC-related pathways. The HRM assays were conducted using the LightCycler® 480 Instrument provided with the software LightCycler® 480 Gene Scanning Software Version 1.5. We also compared the clinicopathological data of CRC patients with the driver gene mutation status. RESULTS: Of the 103 patients evaluated, 73.79% had mutations in one of the 13 driver genes. We discovered 18 novel mutations in APC, MLH1, MSH2, PMS2, SMAD4 and TP53 that have not been previously reported. Additionally, we found 16 de novo mutations in APC, BMPR1A, MLH1, MSH2, MSH6, MUTYH and PMS2 in cancerous tissues previously reported in the dbSNP database; however, these mutations could not be detected in peripheral blood cells. The APC mutation correlates with lymph node metastasis (34.69% vs 12.96%, P = 0.009) and cancer stage (34.78% vs 14.04%, P = 0.013). No association was observed between other driver gene mutations and clinicopathological features. Furthermore, having two or more driver gene mutations correlates with the degree of lymph node metastasis (42.86% vs 24.07%, P = 0.043). CONCLUSION: Our findings confirm the importance of 13 CRC-related pathway driver genes in the development of CRC in Taiwanese patients. PMID:26900293

  4. Frequent NF2 gene transcript mutations in sporadic meningiomas and vestibular schwannomas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Deprez, R.H.L.; Groen, N.A.; Zwarthoff, E.C.

    1994-06-01

    The gene for the hereditary disorder neurofibromatosis type 2 (NF2), which predisposes for benign CNS tumors such as vestibular schwannomas and meningiomas, has been assigned to chromosome 22 and recently has been isolated. Mutations in the NF2 gene were found in both sporadic meningiomas and vestibular schwannomas. However, so far only 6 of the 16 exons of the gene have been analyzed. In order to extend the analysis of an involvement of the NF2 gene in the sporadic counterparts of these NF2-related tumors, the authors have used reverse transcriptase-PCR amplification followed by SSCP and DNA sequence analysis to screen formore » mutations in the coding region of the NF2 gene. Analysis of the NF2 gene transcript in 53 unrelated patients with meningiomas and vestibular schwannomas revealed mutations in 32% of the sporadic meningiomas (n = 44), in 50% of the sporadic vestibular schwannomas (n = 4), in 100% of the tumors found in NF2 patients (n = 2), and in one of three tumors from multiple-meningioma patients. Of the 18 tumors in which a mutation in the NF2 gene transcript was observed and the copy number of chromosome 22 could be established, 14 also showed loss of (parts of) chromosome 22. This suggests that in sporadic meningiomas and NF2-associated tumors the NF2 gene functions as a recessive tumor-suppressor gene. The mutations detected resulted mostly in frameshifts, predicting truncations starting within the N-terminal half of the putative protein. 23 refs., 2 figs. 3 tabs.« less

  5. SomInaClust: detection of cancer genes based on somatic mutation patterns of inactivation and clustering.

    PubMed

    Van den Eynden, Jimmy; Fierro, Ana Carolina; Verbeke, Lieven P C; Marchal, Kathleen

    2015-04-23

    With the advances in high throughput technologies, increasing amounts of cancer somatic mutation data are being generated and made available. Only a small number of (driver) mutations occur in driver genes and are responsible for carcinogenesis, while the majority of (passenger) mutations do not influence tumour biology. In this study, SomInaClust is introduced, a method that accurately identifies driver genes based on their mutation pattern across tumour samples and then classifies them into oncogenes or tumour suppressor genes respectively. SomInaClust starts from the observation that oncogenes mainly contain mutations that, due to positive selection, cluster at similar positions in a gene across patient samples, whereas tumour suppressor genes contain a high number of protein-truncating mutations throughout the entire gene length. The method was shown to prioritize driver genes in 9 different solid cancers. Furthermore it was found to be complementary to existing similar-purpose methods with the additional advantages that it has a higher sensitivity, also for rare mutations (occurring in less than 1% of all samples), and it accurately classifies candidate driver genes in putative oncogenes and tumour suppressor genes. Pathway enrichment analysis showed that the identified genes belong to known cancer signalling pathways, and that the distinction between oncogenes and tumour suppressor genes is biologically relevant. SomInaClust was shown to detect candidate driver genes based on somatic mutation patterns of inactivation and clustering and to distinguish oncogenes from tumour suppressor genes. The method could be used for the identification of new cancer genes or to filter mutation data for further data-integration purposes.

  6. Gene therapy for the eye focus on mutation-independent approaches.

    PubMed

    Dalkara, Deniz; Duebel, Jens; Sahel, José-Alain

    2015-02-01

    This review will discuss retinal gene therapy strategies with a focus on mutation-independent approaches to treat a large number of patients without knowledge of the mutant gene. These approaches rely on the secretion of neurotrophic factors to slow down retinal degeneration and the use of optogenetics to restore vision in late-stage disease. Success in clinical application of adeno-associated virus (AAV)-mediated gene therapy for Leber's congenital amaurosis established the feasibility of retinal gene therapy. More clinical trials are currently on their way for recessive diseases with known mutations. However, the genetic and mechanistic diversity of the retinal diseases presents an enormous obstacle for the development of gene therapies tailored to each patient-specific mutation. To extend gene therapy's promise to a large number of patients, evidence suggests retina-specific trophic factors, such as rod-derived cone viability factor, can be used to slow down loss of cone cells responsible for our high acuity vision. In parallel, it has been shown that microbial opsins are able to restore light sensitivity when expressed in blind retinas. Recent findings imply that using the viral technology that has been demonstrated as well tolerated in patients, there are opportunities to develop widely applicable gene therapeutic interventions in clinical ophthalmology.

  7. Mutation screening for thalassaemia in the Jino ethnic minority population of Yunnan Province, Southwest China.

    PubMed

    Wang, Shiyun; Zhang, Rong; Xiang, Guangxin; Li, Yang; Hou, Xuhong; Jiang, Fusong; Jiang, Feng; Hu, Cheng; Jia, Weiping

    2015-12-29

    This study aimed to detect α- and β-thalassaemia mutations in the Jino ethnic minority population of Yunnan Province, Southwest China. A total of 1613 Jino adults were continuously recruited from February 2012 to April 2012. Fasting venous blood samples were obtained to determine haematological variables. Haemoglobin analysis was conducted using high-performance liquid chromatography. Participants with hypochromic microcytic anaemia or positive haemoglobin analysis profiles were confirmed by α- and β-globin genetic testing, including DNA microarray analysis, direct sequencing methods and multiplex gap-PCR assays. Shanghai Diabetes Institute, Shanghai Key Laboratory of Diabetes Mellitus, Shanghai Jiao Tong University Affiliated Sixth People's Hospital. We found 363 suspected cases by primary screening of haematological variables and haemoglobin analysis. After further genetic testing, four types of α- and β-thalassaemia mutation were detected in 203 out of 363 individuals. Both α(0)- and α(+)-thalassaemia mutations, --(SEA) and -α(3.7), were identified. β-Thalassaemia mutations included CD17 (HBB:c.52A>T) and CD26 (HbE or HBB:c.79G>A). In addition, 13 HbE carriers had coexisting α(0)- or α(+)-thalassaemia deletions. Clinical haematological variables indicated that, in this study, carriers of all thalassaemic genotypes had more severe hypochromic microcytic anaemia than non-thalassaemic individuals. Our results provide information on the Jino ethnic minority that may be useful for further genetic counselling, prenatal screening and clinical diagnosis of thalassaemia in this region. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  8. [Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].

    PubMed

    Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun

    2017-08-10

    To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.

  9. Mutation and virulence assessment of chromosomal genes of Rhodococcus equi 103.

    PubMed

    Pei, Yanlong; Parreira, Valeria; Nicholson, Vivian M; Prescott, John F

    2007-01-01

    Rhodococcus equi can cause severe or fatal pneumonia in foals as well as in immunocompromised animals and humans. Its ability to persist in macrophages is fundamental to how it causes disease, but the basis of this is poorly understood. To examine further the general application of a recently developed system of targeted gene mutation and to assess the importance of different genes in resistance to innate immune defenses, we disrupted the genes encoding high-temperature requirement A (htrA), nitrate reductase (narG), peptidase D (pepD), phosphoribosylaminoimidazole-succinocarboxamide synthase (purC), and superoxide dismutase (sodC) in strain 103 of R. equi using a double-crossover homologous recombination approach. Virulence testing by clearance after intravenous injection in mice showed that the htrA and narG mutants were fully attenuated, the purC and sodC mutants were unchanged, and the pepD mutant was slightly attenuated. Complementation with the pREM shuttle plasmid restored the virulence of the htrA and pepD mutants but not that of the narG mutant. A single-crossover mutation approach was simpler and faster than the double-crossover homologous recombination technique and was used to obtain mutations in 6 other genes potentially involved in virulence (clpB, fadD8, fbpB, glnA1, regX3, and sigF). These mutants were not attenuated in the mouse clearance assay. We were not able to obtain mutants for genesfurA, galE, and sigE using the single-crossover mutation approach. In summary, the targeted-mutation system had general applicability but was not always completely successful, perhaps because some genes are essential under the growth conditions used or because the success of mutation depends on the target genes.

  10. Mutations in the S gene region of hepatitis B virus genotype D in Turkish patients.

    PubMed

    Ozaslan, Mehmet; Ozaslan, Ersan; Barsgan, Arzu; Koruk, Mehmet

    2007-12-01

    The S gene region of the hepatitis B virus (HBV) is responsible for the expression of surface antigens and includes the 'a'-determinant region. Thus, mutation(s) in this region would afford HBV variants a distinct survival advantage, permitting the mutant virus to escape from the immune system. The aim of this study was to search for mutations of the S gene region in different patient groups infected with genotype D variants of HBV, and to analyse the biological significance of these mutations. Moreover, we investigated S gene mutation inductance among family members. Forty HBV-DNA-positive patients were determined among 132 hepatitis B surface antigen (HbsAg) carriers by the first stage of seminested PCR. Genotypes and subtypes were established by sequencing of the amplified S gene regions. Variants were compared with original sequences of these serotypes, and mutations were identified. All variants were designated as genotype D and subtype ayw3. Ten kinds of point mutations were identified within the S region. The highest rates of mutation were found in chronic hepatitis patients and their family members. The amino acid mutations 125 (M -> T) and 127 (T -> P) were found on the first loop of 'a'-determinant. The other consequence was mutation inductance in a family member. We found some mutations in the S gene region known to be stable and observed that some of these mutations affected S gene expression.

  11. Molecular Scanning of β-Thalassemia in the Southern Region of Central Java, Indonesia; a Step Towards a Local Prevention Program.

    PubMed

    Rujito, Lantip; Basalamah, Muhammad; Mulatsih, Sri; Sofro, Abdul Salam M

    2015-08-03

    Thalassemia is the most prevalent genetic blood disorder worldwide, and particularly prevalent in Indonesia. The purpose of this study was to determine the spectrum of β-thalassemia (β-thal) mutations found in the southern region of Central Java, Indonesia. The subjects of the study included 209 β-thal Javanese patients from Banyumas Residency, a southwest region of Central Java Province. DNA analysis was performed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), amplification refractory mutation system (ARMS), and the direct sequencing method. The results showed that 14 alleles were found in the following order: IVS-I-5 (G > C) (HBB: c.92 + 5G > C) 43.5%, codon 26 (Hb E; HBB: c.79G > A) 28.2%, IVS-I-1 (G > A) (HBB: c.92 + 1G > A) 5.0%, codon 15 (TGG > TAG) (HBB: c.47G > A) 3.8%, IVS-I-1 (G > T) (HBB: c.92 + 1G > T) 3.1%, codon 35 (-C) (HBB: c.110delC) 2.4%. The rest, including codons 41/42 (-TTCT) (HBB: c.126_129delCTTT), codons 8/9 (+G) (HBB: c.27_28insG), codon 19 (AAC > AGC) (HBB: c.59A > G), codon 17 (AAG > TAG) (HBB: c.52A > T), IVS-I-2 (T > C) (HBB: c.92 + 2T > C), codons 123/124/125 (-ACCCCACC) (HBB: c.370_378delACCCCACCA), codon 40 (-G) (HBB: c.123delG) and Cap +1 (A > C) (HBB: c.-50A > C), accounted for up to 1.0% each. The most prevalent alleles would be recommended to be used as part of β-thal screening for the Javanese, one of the major ethnic groups in the country.

  12. Molecular Scanning of β-Thalassemia in the Southern Region of Central Java, Indonesia; a Step Towards a Local Prevention Program.

    PubMed

    Rujito, Lantip; Basalamah, Muhammad; Mulatsih, Sri; Sofro, Abdul Salam M

    2015-01-01

    Thalassemia is the most prevalent genetic blood disorder worldwide, and particularly prevalent in Indonesia. The purpose of this study was to determine the spectrum of β-thalassemia (β-thal) mutations found in the southern region of Central Java, Indonesia. The subjects of the study included 209 β-thal Javanese patients from Banyumas Residency, a southwest region of Central Java Province. DNA analysis was performed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), amplification refractory mutation system (ARMS), and the direct sequencing method. The results showed that 14 alleles were found in the following order: IVS-I-5 (G > C) (HBB: c.92 + 5G > C) 43.5%, codon 26 (Hb E; HBB: c.79G > A) 28.2%, IVS-I-1 (G > A) (HBB: c.92 + 1G > A) 5.0%, codon 15 (TGG > TAG) (HBB: c.47G > A) 3.8%, IVS-I-1 (G > T) (HBB: c.92 + 1G > T) 3.1%, codon 35 (-C) (HBB: c.110delC) 2.4%. The rest, including codons 41/42 (-TTCT) (HBB: c.126_129delCTTT), codons 8/9 (+G) (HBB: c.27_28insG), codon 19 (AAC > AGC) (HBB: c.59A > G), codon 17 (AAG > TAG) (HBB: c.52A > T), IVS-I-2 (T > C) (HBB: c.92 + 2T > C), codons 123/124/125 (-ACCCCACC) (HBB: c.370_378delACCCCACCA), codon 40 (-G) (HBB: c.123delG) and Cap +1 (A > C) (HBB: c.-50A > C), accounted for up to 1.0% each. The most prevalent alleles would be recommended to be used as part of β-thal screening for the Javanese, one of the major ethnic groups in the country.

  13. A mitochondrial tRNA(His) gene mutation causing pigmentary retinopathy and neurosensorial deafness.

    PubMed

    Crimi, M; Galbiati, S; Perini, M P; Bordoni, A; Malferrari, G; Sciacco, M; Biunno, I; Strazzer, S; Moggio, M; Bresolin, N; Comi, G P

    2003-04-08

    We have identified a heteroplasmic G to A mutation at position 12,183 of the mitochondrial transfer RNA Histidine (tRNA(His)) gene in three related patients. These phenotypes varied according to mutation heteroplasmy: one had severe pigmentary retinopathy, neurosensorial deafness, testicular dysfunction, muscle hypotrophy, and ataxia; the other two had only retinal and inner ear involvement. The mutation is in a highly conserved region of the T(psi)C stem of the tRNA(His) gene and may alter secondary structure formation. This is the first described pathogenic, maternally inherited mutation of the mitochondrial tRNA(His) gene.

  14. A mutation of the p63 gene in non‐syndromic cleft lip

    PubMed Central

    Leoyklang, P; Siriwan, P; Shotelersuk, V

    2006-01-01

    Mutations in the p63 gene (TP63) underlie several monogenic malformation syndromes manifesting cleft lip with or without cleft palate (CL/P). We investigated whether p63 mutations also result in non‐syndromic CL/P. Specifically, we performed mutation analysis of the 16 exons of the p63 gene for 100 Thai patients with non‐syndromic CL/P. In total, 21 variant sites were identified. All were single nucleotide changes, with six in coding regions, including three novel non‐synonymous changes: S90L, R313G, and D564H. The R313G was concluded to be pathogenic on the basis of its amino acid change, evolutionary conservation, its occurrence in a functionally important domain, its predicted damaging function, its de novo occurrence, and its absence in 500 control individuals. Our data strongly suggest, for the first time, a causative role of a heterozygous mutation in the p63 gene in non‐syndromic CL/P, highlighting the wide phenotypic spectrum of p63 gene mutations. PMID:16740912

  15. Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa

    PubMed Central

    Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying

    2014-01-01

    Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031

  16. From Gene Mutation to Protein Characterization

    ERIC Educational Resources Information Center

    Moffet, David A.

    2009-01-01

    A seven-week "gene to protein" laboratory sequence is described for an undergraduate biochemistry laboratory course. Student pairs were given the task of introducing a point mutation of their choosing into the well studied protein, enhanced green fluorescent protein (EGFP). After conducting literature searches, each student group chose the…

  17. Screening for mutations in exon 4 of the LDL receptor gene: identification of a new deletion mutation.

    PubMed Central

    Theart, L; Kotze, M J; Langenhoven, E; Loubser, O; Peeters, A V; Lintott, C J; Scott, R S

    1995-01-01

    DNA from 14 unrelated New Zealand familial hypercholesterolaemia (FH) heterozygotes, originating from the United Kingdom, was screened for mutations in exon 4 of the low density lipoprotein receptor (LDLR) gene. One patient was heterozygous for mutation D206E, which was initially identified in South Africa. The chromosomal background of this mutant allele was compatible with that described previously in Afrikaner and English patients, suggesting that this mutation originated in the United Kingdom. The 2 bp deletion in codon 206 and mutations D154N and D200G, previously reported in English FH patients, were not detected in this sample. In one of the patients, however, a new deletion of 7 bp was identified after nucleotide 581 (or 582) in exon 4 of the LDLR gene. Images PMID:7616546

  18. [Gene mutation and clinical phenotype analysis of patients with Noonan syndrome and hypertrophic cardiomyopathy].

    PubMed

    Liu, X H; Ding, W W; Han, L; Liu, X R; Xiao, Y Y; Yang, J; Mo, Y

    2017-10-02

    Objective: To analyze the gene mutations and clinical features of patients with Noonan syndrome and hypertrophic cardiomyopathy. Method: Determined the mutation domain in five cases diagnosed with Noonan syndrome and hypertrophic cardiomyopathy and identified the relationship between the mutant domain and hypertrophic cardiomyopathy by searching relevant articles in pubmed database. Result: Three mutant genes (PTPN11 gene in chromosome 12, RIT1 gene in chromosome 1 and RAF1 gene in chromosome 3) in five cases all had been reported to be related to hypertrophic cardiomyopathy. The reported hypertrophic cardiomyopathy relevant genes MYPN, MYH6 and MYBP3 had also been found in case 1 and 2. Patients with same gene mutation had different clinical manifestations. Both case 4 and 5 had RAF1 mutation (c.770C>T). However, case 4 had special face, low IQ, mild pulmonary artery stenosis, and only mild ventricular hypertrophy. Conclusion: Noonan syndrome is a genetic heterogeneity disease. Our study identified specific gene mutations that could result in Noonan syndrome with hypertrophic cardiomyopathy through molecular biology methods. The results emphasize the importance of gene detection in the management of Noonan syndrome.

  19. MEFV gene mutations and clinical course in pediatric patients with Henoch-Schönlein purpura.

    PubMed

    Can, Emrah; Kılınç Yaprak, Zubeyde; Hamilçıkan, Şahin; Erol, Meltem; Bostan Gayret Y Özgül Yiğit, Özlem

    2018-06-01

    To determine the frequency of the MEFV gene mutations in pediatric patients diagnosed with HSP and to assess the effect of the MEFV gene mutations on their prognosis. Material and Methods. Ccross-sectional study; pediatric patients between 2-11 years diagnosed with HSP were included. These cases were investigated for 6 MEFV gene mutations (M694V, M680I, A744S, R202Q, K695R, E148Q). Eighty cases were included in the study of which 55% were male (n= 44). The mean age was 6.44 ± 2.52 years. Disease recurrence occurred in 9 patients, invagination in 5 patients and convulsion in 1 patient during follow-up. Approximately half of the patients received steroids. The MEFV gene mutations was not detected in 44 (55%) of the patients. There was a heterozygous mutation in 19 (22%). E148Q was found in 8 patients, M694V in 5 patients, A744S in 4 patients, and the R202Q heterozygous mutation in 2 patients. The M608I homozygous mutation was detected in 1 patient and the M694V homozygous mutation in 1 patient. The compound heterozygous MEFV gene mutations was found in 15 patients. The presence of the MEFV gene mutations was not correlated with the frequency of renal and gastrointestinal involvement and prognosis, the development of complications and the use of steroids. The presence of the MEFV gene mutations does not correlate with the clinical course and complication in Turkish pediatric patients with HSP. Sociedad Argentina de Pediatría.

  20. [Mutation analysis of beta myosin heavy chain gene in hypertrophic cardiomyopathy families].

    PubMed

    Fan, Xin-ping; Yang, Zhong-wei; Feng, Xiu-li; Yang, Fu-hui; Xiao, Bai; Liang, Yan

    2011-08-01

    To detect the gene mutations of beta-myosin heavy chain gene (MYH7) in Chinese pedigrees with hypertrophic cardiomyopathy (HCM), and to analyze the correlation between the genotype and phenotype. Exons 3, 5, 7-9, 11-16 and 18-23 of the MYH7 gene were amplified with PCR in three Chinese pedigrees with HCM. The products were sequenced. Sequence alignment between the detected and the standard sequences was performed. A missense mutation of Thr441Met in exon 14 was identified in a pedigree, which was not detected in the controls. Several synonymous mutations of MYH7 gene were detected in the three pedigrees. The mutation of Thr441Met, located in the actin binding domain of the globular head, was first identified in Chinese. It probably caused HCM. HCM is a heterogeneous disease. Many factors are involved in the process of its occurrence and development.

  1. Update on Novel CCM Gene Mutations in Patients with Cerebral Cavernous Malformations.

    PubMed

    Scimone, Concetta; Bramanti, Placido; Alafaci, Concetta; Granata, Francesca; Piva, Francesco; Rinaldi, Carmela; Donato, Luigi; Greco, Federica; Sidoti, Antonina; D'Angelo, Rosalia

    2017-02-01

    Cerebral cavernous malformations (CCMs) are lesions affecting brain microvessels. The pathogenesis is not clearly understood. Conventional classification criterion is based on genetics, and thus, familial and sporadic forms can be distinguished; however, classification of sporadic cases with multiple lesions still remains uncertain. To date, three CCM causative genes have been identified: CCM1/KRIT1, CCM2/MGC4607 and CCM3/PDCD10. In our previous mutation screening, performed in a cohort of 95 Italian patients, with both sporadic and familial cases, we identified several mutations in CCM genes. This study represents further molecular screening in a cohort of 19 Italian patients enrolled by us in the few last years and classified into familial, sporadic and sporadic with multiple lesions cases. Direct sequencing and multiplex ligation-dependent probe amplification (MLPA) analysis were performed to detect point mutations and large genomic rearrangements, respectively. Effects of detected mutations and single-nucleotide polymorphisms (SNPs) were evaluated by an in silico approach and by western blot analysis. A novel nonsense mutation in CCM1 and a novel missense mutation in CCM2 were detected; moreover, several CCM2 gene polymorphisms in sporadic CCM patients were reported. We believe that these data enrich the mutation spectrum of CCM genes, which is useful for genetic counselling to identify both familial and sporadic CCM cases, as early as possible.

  2. [Correlation of clinicopathologic features and driver gene mutation in non-small cell lung cancer].

    PubMed

    Chen, L F; Chen, X Y; Yu, X B

    2016-04-08

    To study the relationship between mutations of well-known driver genes and clinicopathologic characteristics of non-small cell lung cancers (NSCLC). Scorpions amplification refractory mutation system (scorpions ARMS) fluorescence quantitative PCR was performed to investigate 205 driver gene mutation status in NSCLC in correlation with clinicopathological characteristics of the patients. Driver gene mutations were detected in 146 of 205 (71.2%) patients with NSCLC, including 81.7%(138/169) adenocarcinomas, in which mutations of nine genes were found: EGFR (63.3%, 107/169), KRAS (5.9%, 10/169), PIK3CA (4.1%, 7/169), ALK (4.1%, 7/169), ROS1 (3.0%, 5/169), RET (3.6%, 6/169), HER2 (1.8%, 3/169), NRAS (0.6%, 1/169) and BRAF (0.6%, 1/169). The frequencies of driver gene mutations were higher in adenocarcinomas, female patients and non-smokers (P<0.01, P=0.003, P<0.01, respectively). Driver gene mutation status showed no correlation with either the age or the clinical stage (P=0.281, P=0.490, respectively). However, EGFR mutations tended to occur in adenocarcinoma, female, non-smokers, and patients of ≥62 years of age (P<0.01, P<0.01, P=0.002, P=0.012, respectively). The frequency of EGFR mutation was positively correlated with the tumor histology of lepidic, acinar, papillary and micropapillary predominant growth patterns. There was no relationship between EGFR mutation and the clinical stage (P=0.237). The frequency of KRAS mutation was higher in solid predominant and invasive mucinous adenocarcinomas (P=0.015); that of PIK3CA mutation was higher in patients of ≥62 years of age, invasive mucinous adenocarcinoma and fetal adenocarcinoma (P=0.015, P=0.006, respectively). ALK, ROS1 or RET mutation positive NSCLC tended to occur in nonsmokers and have solid predominant tumors and invasive mucinous adenocarcinoma (P=0.012, P=0.017 respectively). The frequency of EML4-ALK mutation was higher in the early stage patients with solid predominant tumors and invasive mucinous

  3. Extensive Variation in the Mutation Rate Between and Within Human Genes Associated with Mendelian Disease.

    PubMed

    Smith, Thomas; Ho, Gladys; Christodoulou, John; Price, Elizabeth Ann; Onadim, Zerrin; Gauthier-Villars, Marion; Dehainault, Catherine; Houdayer, Claude; Parfait, Beatrice; van Minkelen, Rick; Lohman, Dietmar; Eyre-Walker, Adam

    2016-05-01

    We have investigated whether the mutation rate varies between genes and sites using de novo mutations (DNMs) from three genes associated with Mendelian diseases (RB1, NF1, and MECP2). We show that the relative frequency of mutations at CpG dinucleotides relative to non-CpG sites varies between genes and relative to the genomic average. In particular we show that the rate of transition mutation at CpG sites relative to the rate of non-CpG transversion is substantially higher in our disease genes than amongst DNMs in general; the rate of CpG transition can be several hundred-fold greater than the rate of non-CpG transversion. We also show that the mutation rate varies significantly between sites of a particular mutational type, such as non-CpG transversion, within a gene. We estimate that for all categories of sites, except CpG transitions, there is at least a 30-fold difference in the mutation rate between the 10% of sites with the highest and lowest mutation rates. However, our best estimate is that the mutation rate varies by several hundred-fold variation. We suggest that the presence of hypermutable sites may be one reason certain genes are associated with disease. © 2016 WILEY PERIODICALS, INC.

  4. A novel large deletion mutation of FERMT1 gene in a Chinese patient with Kindler syndrome.

    PubMed

    Gao, Ying; Bai, Jin-li; Liu, Xiao-yan; Qu, Yu-jin; Cao, Yan-yan; Wang, Jian-cai; Jin, Yu-wei; Wang, Hong; Song, Fang

    2015-11-01

    Kindler syndrome (KS; OMIM 173650) is a rare autosomal recessive skin disorder, which results in symptoms including blistering, epidermal atrophy, increased risk of cancer, and poor wound healing. The majority of mutations of the disease-determining gene (FERMT1 gene) are single nucleotide substitutions, including missense mutations, nonsense mutations, etc. Large deletion mutations are seldom reported. To determine the mutation in the FERMT1 gene associated with a 7-year-old Chinese patient who presented clinical manifestation of KS, we performed direct sequencing of all the exons of FERMT1 gene. For the exons 2-6 without amplicons, we analyzed the copy numbers using quantitative real-time polymerase chain reaction (qRT-PCR) with specific primers. The deletion breakpoints were sublocalized and the range of deletion was confirmed by PCR and direct sequencing. In this study, we identified a new 17-kb deletion mutation spanning the introns 1-6 of FERMT1 gene in a Chinese patient with severe KS phenotypes. Her parents were carriers of the same mutation. Our study reported a newly identified large deletion mutation of FERMT1 gene involved in KS, which further enriched the mutation spectrum of the FERMT1 gene.

  5. [Cystic fibrosis gene mutations in the West of France: clinical application].

    PubMed

    Verlingue, C; Travert, G; Le Roux, M G; Laroche, D; Audrézet, M P; Mercier, B; Moisan, J P; Férec, C

    1994-01-01

    The cystic fibrosis transmembrane conductance regulator (CFTR) gene, responsible for the cystic fibrosis phenotype when both alleles are mutated, was cloned and sequenced in 1989. Since then, more than 400 mutations have been reported in the gene, although most of these are rare. We have systematically analysed the entire coding sequence of the CFTR gene in a cohort of patients originating from the West of France (Caen, Brest and Nantes). More than 450 CF children, 914 chromosomes in all, have been exhaustively studied in the three centers. We have been able to characterize more than 90% of the mutations, respectively 93.5%, 99% and 95.8%. Despite the large diversity in the CFTR mutations occurring in CF patients from this area, these results can help to improve genetic counselling, prenatal diagnosis as well as our understanding of the molecular basis of the pathophysiology of cystic fibrosis.

  6. Clustered Mutation Signatures Reveal that Error-Prone DNA Repair Targets Mutations to Active Genes.

    PubMed

    Supek, Fran; Lehner, Ben

    2017-07-27

    Many processes can cause the same nucleotide change in a genome, making the identification of the mechanisms causing mutations a difficult challenge. Here, we show that clustered mutations provide a more precise fingerprint of mutagenic processes. Of nine clustered mutation signatures identified from >1,000 tumor genomes, three relate to variable APOBEC activity and three are associated with tobacco smoking. An additional signature matches the spectrum of translesion DNA polymerase eta (POLH). In lymphoid cells, these mutations target promoters, consistent with AID-initiated somatic hypermutation. In solid tumors, however, they are associated with UV exposure and alcohol consumption and target the H3K36me3 chromatin of active genes in a mismatch repair (MMR)-dependent manner. These regions normally have a low mutation rate because error-free MMR also targets H3K36me3 chromatin. Carcinogens and error-prone repair therefore redistribute mutations to the more important regions of the genome, contributing a substantial mutation load in many tumors, including driver mutations. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Analysis of GPR101 and AIP genes mutations in acromegaly: a multicentric study.

    PubMed

    Ferraù, Francesco; Romeo, P D; Puglisi, S; Ragonese, M; Torre, M L; Scaroni, C; Occhi, G; De Menis, E; Arnaldi, G; Trimarchi, F; Cannavò, S

    2016-12-01

    This multicentric study aimed to investigate the prevalence of the G protein-coupled receptor 101 (GPR101) p.E308D variant and aryl hydrocarbon receptor interacting protein (AIP) gene mutations in a representative cohort of Italian patients with acromegaly. 215 patients with GH-secreting pituitary adenomas, referred to 4 Italian referral centres for pituitary diseases, have been included. Three cases of gigantism were present. Five cases were classified as FIPA. All the patients have been screened for germline AIP gene mutations and GPR101 gene p.E308D variant. Heterozygous AIP gene variants have been found in 7 patients (3.2 %). Five patients carried an AIP mutation (2.3 %; 4 females): 3 patients harboured the p.R3O4Q mutation, one had the p.R304* mutation and the last one the IVS3+1G>A mutation. The prevalence of AIP mutations was 3.3 % and 2.8 % when considering only the patients diagnosed when they were <30 or <40-year old, respectively. Furthermore, 2.0 % of the patients with a pituitary macroadenoma and 4.2 % of patients resistant to somatostatin analogues treatment were found to harbour an AIP gene mutation. None of the patients was found to carry the GPR101 p.E308D variant. The prevalence of AIP gene mutations among our sporadic and familial acromegaly cases was similar to that one reported in previous studies, but lower when considering only the cases diagnosed before 40 years of age. The GPR101 p.E308D change is unlikely to have a role in somatotroph adenomas tumorigenesis, since none of our sporadic or familial patients tested positive for this variant.

  8. Mutations on the α2-Globin Gene That May Trigger α(+)-Thalassemia.

    PubMed

    Farashi, Samaneh; Vakili, Shadi; Garous, Negin F; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

    2015-01-01

    In the present study, a total of 11 individuals with hypochromic microcytic anemia who did not reveal the most common α-thalassemia (α-thal) deletions or mutations, were subjected to more investigations by DNA sequencing of the α-globin genes. Seven novel nondeletional α-thal mutations localized on the α2-globin gene in the heterozygous state were identified. These mutations either corrupted regulatory splice sites and consequently affected RNA processing or created unstable hemoglobin (Hb) variants. The mutations described here produced globin gene variants that lead to amino acid changes in critical regions of the globin chain. The clinical presentation of most patients was a persistent mild microcytic anemia similar to an α(+)-thal. In the last decade, numerous α-globin mutations have been observed leading to an α-thal phenotype and these studies have been considered to be important as discussed here.

  9. Genes and Mutations Causing Autosomal Dominant Retinitis Pigmentosa

    PubMed Central

    Daiger, Stephen P.; Bowne, Sara J.; Sullivan, Lori S.

    2015-01-01

    Retinitis pigmentosa (RP) has a prevalence of approximately one in 4000; 25%–30% of these cases are autosomal dominant retinitis pigmentosa (adRP). Like other forms of inherited retinal disease, adRP is exceptionally heterogeneous. Mutations in more than 25 genes are known to cause adRP, more than 1000 mutations have been reported in these genes, clinical findings are highly variable, and there is considerable overlap with other types of inherited disease. Currently, it is possible to detect disease-causing mutations in 50%–75% of adRP families in select populations. Genetic diagnosis of adRP has advantages over other forms of RP because segregation of disease in families is a useful tool for identifying and confirming potentially pathogenic variants, but there are disadvantages too. In addition to identifying the cause of disease in the remaining 25% of adRP families, a central challenge is reconciling clinical diagnosis, family history, and molecular findings in patients and families. PMID:25304133

  10. Phenotypic patterns of desminopathy associated with three novel mutations in the desmin gene

    PubMed Central

    Olivé, Montse; Armstrong, Judith; Miralles, Francesc; Pou, Adolf; Fardeau, Michel; Gonzalez, Laura; Martínez, Francesca; Fischer, Dirk; Matos, Juan Antonio Martínez; Shatunov, Alexey; Goldfarb, Lev; Ferrer, Isidre

    2016-01-01

    Desminopathy represents a subgroup of myofibrillar myopathies caused by mutations in the desmin gene. Three novel disease-associated mutations in the desmin gene were identified in unrelated Spanish families affected by cardioskeletal myopathy. A selective pattern of muscle involvement, which differed from that observed in myofibrillar myopathy resulting from mutations in the myotilin gene, was observed in each of the three families with novel mutations and each of three desminopathy patients with known desmin mutations. Prominent joint retractions at the ankles and characteristic nasal speech were observed early in the course of illness. These findings suggest that muscle imaging in combination with routine clinical and pathological examination may be helpful in distinguishing desminopathy from other forms of myofibrillar myopathy and ordering appropriate molecular investigations. PMID:17418574

  11. Binge eating as a major phenotype of melanocortin 4 receptor gene mutations.

    PubMed

    Branson, Ruth; Potoczna, Natascha; Kral, John G; Lentes, Klaus-Ulrich; Hoehe, Margret R; Horber, Fritz F

    2003-03-20

    Obesity, a multifactorial disease caused by the interaction of genetic factors with the environment, is largely polygenic. A few mutations in these genes, such as in the leptin receptor (LEPR) gene and melanocortin 4 receptor (MC4R) gene, have been identified as causes of monogenic obesity. We sequenced the complete MC4R coding region, the region of the proopiomelanocortin gene (POMC) encoding the alpha melanocyte-stimulating hormone, and the leptin-binding domain of LEPR in 469 severely obese white subjects (370 women and 99 men; mean [+/-SE] age, 41.0+/-0.5 years; body-mass index [the weight in kilograms divided by the square of the height in meters], 44.1+/-2.0). Fifteen women and 10 men without a history of dieting or a family history of obesity served as normal-weight controls (age, 47.7+/-2.0 years; body-mass index, 21.6+/-0.4). Detailed phenotypic data, including information on body fat, resting energy expenditure, diet-induced thermogenesis, serum concentrations of leptin, and eating behavior, were collected. Twenty-four obese subjects (5.1 percent) and one control subject (4 percent) had MC4R mutations, including five novel variants. Twenty of the 24 obese subjects with an MC4R mutation were matched for age, sex, and body-mass index with 120 of the 445 obese subjects without an MC4R mutation. All mutation carriers reported binge eating, as compared with 14.2 percent of obese subjects without mutations (P<0.001) and 0 percent of the normal-weight subjects without mutations. The prevalence of binge eating was similar among carriers of mutations in the leptin-binding domain of LEPR and noncarriers. No mutations were found in the region of POMC encoding alpha melanocyte-stimulating hormone. Binge eating is a major phenotypic characteristic of subjects with a mutation in MC4R, a candidate gene for the control of eating behavior. Copyright 2003 Massachusetts Medical Society

  12. Retinal phenotype-genotype correlation of pediatric patients expressing mutations in the Norrie disease gene.

    PubMed

    Wu, Wei-Chi; Drenser, Kimberly; Trese, Michael; Capone, Antonio; Dailey, Wendy

    2007-02-01

    To correlate the ophthalmic findings of patients with pediatric vitreoretinopathies with mutations occurring in the Norrie disease gene (NDP). One hundred nine subjects with diverse pediatric vitreoretinopathies and 54 control subjects were enrolled in the study. Diagnoses were based on retinal findings at each patient's first examination. Samples of DNA from each patient underwent polymerase chain reaction amplification and direct sequencing of the NDP gene. Eleven male patients expressing mutations in the NDP gene were identified in the test group, whereas the controls demonstrated wild-type NDP. All patients diagnosed as having Norrie disease had mutations in the NDP gene. Four of the patients with Norrie disease had mutations involving a cysteine residue in the cysteine-knot motif. Four patients diagnosed as having familial exudative vitreoretinopathy were found to have noncysteine mutations. One patient with retinopathy of prematurity had a 14-base deletion in the 5' untranslated region (exon 1), and 1 patient with bilateral persistent fetal vasculature syndrome expressed a noncysteine mutation in the second exon. Mutations disrupting the cysteine-knot motif corresponded to severe retinal dysgenesis, whereas patients with noncysteine mutations had varying degrees of avascular peripheral retina, extraretinal vasculature, and subretinal exudate. Patients exhibiting severe retinal dysgenesis should be suspected of carrying a mutation that disrupts the cysteine-knot motif in the NDP gene.

  13. Identification a nonsense mutation of APC gene in Chinese patients with familial adenomatous polyposis.

    PubMed

    Li, Haishan; Zhang, Lingling; Jiang, Quan; Shi, Zhenwang; Tong, Hanxing

    2017-04-01

    Familial adenomatous polyposis (FAP; Mendelian of Inherintance in Man ID, 175100) is a rare autosomal dominant disorder characterized by the development of numerous adenomatous polyps throughout the colon and rectum associated with an increased risk of colorectal cancer. FAP is at time accompanied with certain extraintestinal manifestations such as congenital hypertrophy of the retinal pigment epithelium, dental disorders and desmoid tumors. It is caused by mutations in the adenomatous polyposis coli ( APC ) gene. The present study reported on a Chinese family with FAP. Polymerase chain reaction and direct sequencing of the full coding sequence of the APC gene were performed to identify the mutation in this family. A nonsense mutation of the APC gene was identified in this pedigree. It is a heterozygous G>T substitution at position 2,971 in exon 15 of the APC gene, which formed a premature stop codon at amino acid residue 991 (p.Glu991*). The resulting truncated protein lacked 1,853 amino acids. The present study expanded the database on APC gene mutations in FAP and enriched the spectrum of known germline mutations of the APC gene. Prophylactic proctocolectomy may be considered as a possible treatment for carriers of the mutation.

  14. Significant associations between driver gene mutations and DNA methylation alterations across many cancer types

    PubMed Central

    Chen, Yun-Ching; Margolin, Gennady

    2017-01-01

    Recent evidence shows that mutations in several driver genes can cause aberrant methylation patterns, a hallmark of cancer. In light of these findings, we hypothesized that the landscapes of tumor genomes and epigenomes are tightly interconnected. We measured this relationship using principal component analyses and methylation-mutation associations applied at the nucleotide level and with respect to genome-wide trends. We found that a few mutated driver genes were associated with genome-wide patterns of aberrant hypomethylation or CpG island hypermethylation in specific cancer types. In addition, we identified associations between 737 mutated driver genes and site-specific methylation changes. Moreover, using these mutation-methylation associations, we were able to distinguish between two uterine and two thyroid cancer subtypes. The driver gene mutation–associated methylation differences between the thyroid cancer subtypes were linked to differential gene expression in JAK-STAT signaling, NADPH oxidation, and other cancer-related pathways. These results establish that driver gene mutations are associated with methylation alterations capable of shaping regulatory network functions. In addition, the methodology presented here can be used to subdivide tumors into more homogeneous subsets corresponding to underlying molecular characteristics, which could improve treatment efficacy. PMID:29125844

  15. Mutations in the ADAR1 gene in Chinese families with dyschromatosis symmetrica hereditaria.

    PubMed

    Zhang, G L; Shi, H J; Shao, M H; Li, M; Mu, H J; Gu, Y; Du, X F; Xie, P

    2013-01-04

    We investigated 2 Chinese families with dyschromatosis symmetrica hereditaria (DSH) and search for mutations in the adenosine deaminase acting on RNA1 (ADAR1) gene in these 2 pedigrees. We performed a mutation analysis of the ADAR1 gene in 2 Chinese families with DSH and reviewed all articles published regarding ADAR1 mutations reported since 2003 by using PubMed. By direct sequencing, a 2-nucleotide AG deletion, 2099-2100delAG, was found in family 1, and a C→T mutation was identified at nucleotide 1420 that changed codon 474 from arginine to a translational termination codon in family 2. Two different pathogenic mutations were identified, c.2099-2100delAG and c.1420C>T, the former being a novel mutation, and the latter previously reported in 3 other families with DSH. To date, a total of 110 mutations in the ADAR1 gene have been reported, and 10 of them were recurrent; the mutations R474X, R1083C, R1096X, and R1155W might be the DSH-related hotspots.

  16. Novel mutations of endothelin-B receptor gene in Pakistani patients with Waardenburg syndrome.

    PubMed

    Jabeen, Raheela; Babar, Masroor Ellahi; Ahmad, Jamil; Awan, Ali Raza

    2012-01-01

    Mutations in EDNRB gene have been reported to cause Waardenburg-Shah syndrome (WS4) in humans. We investigated 17 patients with WS4 for identification of mutations in EDNRB gene using PCR and direct sequencing technique. Four genomic mutations were detected in four patients; a G to C transversion in codon 335 (S335C) in exon 5 and a transition of T to C in codon (S361L) in exon 5, a transition of A to G in codon 277 (L277L) in exon 4, a non coding transversion of T to A at -30 nucleotide position of exon 5. None of these mutations were found in controls. One of the patients harbored two novel mutations (S335C, S361L) in exon 5 and one in Intronic region (-30exon5 A>G). All of the mutations were homozygous and novel except the mutation observed in exon 4. In this study, we have identified 3 novel mutations in EDNRB gene associated with WS4 in Pakistani patients.

  17. Subclinical hyperthyroidism due to a thyrotropin receptor (TSHR) gene mutation (S505R).

    PubMed

    Pohlenz, Joachim; Pfarr, Nicole; Krüger, Silvia; Hesse, Volker

    2006-12-01

    To identify the molecular defect by which non-autoimmune subclinical hyperthyroidism was caused in a 6-mo-old infant who presented with weight loss. Congenital non-autoimmune hyperthyroidism is caused by activating germline mutations in the thyrotropin receptor (TSHR) gene. Therefore, the TSHR gene was sequenced directly from the patient's genomic DNA. Molecular analysis revealed a heterozygous point mutation (S505R) in the TSHR gene as the underlying defect. A constitutively activating mutation in the TSHR gene has to be considered not only in patients with severe congenital non-autoimmune hyperthyroidism, but also in children with subclinical non-autoimmune hyperthyroidism.

  18. Mutational Analysis of the Rhodopsin Gene in Sector Retinitis Pigmentosa.

    PubMed

    Napier, Maria L; Durga, Dash; Wolsley, Clive J; Chamney, Sarah; Alexander, Sharon; Brennan, Rosie; Simpson, David A; Silvestri, Giuliana; Willoughby, Colin E

    2015-01-01

    To determine the role of rhodopsin (RHO) gene mutations in patients with sector retinitis pigmentosa (RP) from Northern Ireland. A case series of sector RP in a tertiary ocular genetics clinic. Four patients with sector RP were recruited from the Royal Victoria Hospital (Belfast, Northern Ireland) and Altnagelvin Hospital (Londonderry, Northern Ireland) following informed consent. The diagnosis of sector RP was based on clinical examination, International Society for Clinical Electrophysiology of Vision (ISCEV) standard electrophysiology, and visual field analysis. DNA was extracted from peripheral blood leucocytes and the coding regions and adjacent flanking intronic sequences of the RHO gene were polymerase chain reaction (PCR) amplified and cycle sequenced. Rhodopsin mutational status. A heterozygous missense mutation in RHO (c.173C > T) resulting in a non-conservative substitution of threonine to methionine (p. Thr58Met) was identified in one patient and was absent from 360 control individuals. This non-conservative substitution (p.Thr58Met) replaces a highly evolutionary conserved polar hydrophilic threonine residue with a non-polar hydrophobic methionine residue at position 58 near the cytoplasmic border of helix A of RHO. The study identified a RHO gene mutation (p.Thr58Met) not previously reported in RP in a patient with sector RP. These findings outline the phenotypic variability associated with RHO mutations. It has been proposed that the regional effects of RHO mutations are likely to result from interplay between mutant alleles and other genetic, epigenetic and environmental factors.

  19. Mutator gene and hereditary non-polyposis colorectal cancer

    DOEpatents

    de la Chapelle, Albert [Helsingfors, FI; Vogelstein, Bert [Baltimore, MD; Kinzler, Kenneth W [Baltimore, MD

    2008-02-05

    The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.

  20. Feature genes predicting the FLT3/ITD mutation in acute myeloid leukemia

    PubMed Central

    LI, CHENGLONG; ZHU, BIAO; CHEN, JIAO; HUANG, XIAOBING

    2016-01-01

    In the present study, gene expression profiles of acute myeloid leukemia (AML) samples were analyzed to identify feature genes with the capacity to predict the mutation status of FLT3/ITD. Two machine learning models, namely the support vector machine (SVM) and random forest (RF) methods, were used for classification. Four datasets were downloaded from the European Bioinformatics Institute, two of which (containing 371 samples, including 281 FLT3/ITD mutation-negative and 90 mutation-positive samples) were randomly defined as the training group, while the other two datasets (containing 488 samples, including 350 FLT3/ITD mutation-negative and 138 mutation-positive samples) were defined as the test group. Differentially expressed genes (DEGs) were identified by significance analysis of the micro-array data by using the training samples. The classification efficiency of the SCM and RF methods was evaluated using the following parameters: Sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV) and the area under the receiver operating characteristic curve. Functional enrichment analysis was performed for the feature genes with DAVID. A total of 585 DEGs were identified in the training group, of which 580 were upregulated and five were downregulated. The classification accuracy rates of the two methods for the training group, the test group and the combined group using the 585 feature genes were >90%. For the SVM and RF methods, the rates of correct determination, specificity and PPV were >90%, while the sensitivity and NPV were >80%. The SVM method produced a slightly better classification effect than the RF method. A total of 13 biological pathways were overrepresented by the feature genes, mainly involving energy metabolism, chromatin organization and translation. The feature genes identified in the present study may be used to predict the mutation status of FLT3/ITD in patients with AML. PMID:27177049

  1. Myostatin gene mutated mice induced with tale nucleases.

    PubMed

    Zhou, Fangfang; Sun, Ruilin; Chen, Hongyan; Fei, Jian; Lu, Daru

    2015-01-01

    Myostain gene (MSTN) is expressed primarily in skeletal muscle, and negatively regulates skeletal muscle mass; it has been suggested that mice with MSTN inhibition have reduced adiposity and improved insulin sensitivity. Therefore, it is important to establish a fast and effective gene editing method. In this report, we established the myostatin mutated-mouse model by microinjection of Transcription Activator-Like Effector Nucleases (TALENs) mRNA within the mouse fertilized oocytes and achieved high rates of mutagenesis of the mouse MSTN in C57BL/6J. Six of 45 born mice carried target mutations and we appointed one as the parental mating with wild mouse to produce the F1 and backcross to produce the F2 generation. All the mutations of the mice were examined quickly and efficiently by high-resolution melting curve analysis (HRMA) and then verified by direct sequencing. We obtained the homozygous of the F2 generation which transmitted the mutant alleles to the progeny with 100% efficiency. Mutant mice exhibited increases in muscle mass comparable to those observed in wild-type mice. Therefore, combining TALEN-mediated gene targeting with HRMA technology is a superior method of constructing genetically modified mice through microinjection in the mouse fertilized oocytes with high efficiency and short time of selection.

  2. Eight previously unidentified mutations found in the OA1 ocular albinism gene

    PubMed Central

    Mayeur, Hélène; Roche, Olivier; Vêtu, Christelle; Jaliffa, Carolina; Marchant, Dominique; Dollfus, Hélène; Bonneau, Dominique; Munier, Francis L; Schorderet, Daniel F; Levin, Alex V; Héon, Elise; Sutherland, Joanne; Lacombe, Didier; Said, Edith; Mezer, Eedy; Kaplan, Josseline; Dufier, Jean-Louis; Marsac, Cécile; Menasche, Maurice; Abitbol, Marc

    2006-01-01

    Background Ocular albinism type 1 (OA1) is an X-linked ocular disorder characterized by a severe reduction in visual acuity, nystagmus, hypopigmentation of the retinal pigmented epithelium, foveal hypoplasia, macromelanosomes in pigmented skin and eye cells, and misrouting of the optical tracts. This disease is primarily caused by mutations in the OA1 gene. Methods The ophthalmologic phenotype of the patients and their family members was characterized. We screened for mutations in the OA1 gene by direct sequencing of the nine PCR-amplified exons, and for genomic deletions by PCR-amplification of large DNA fragments. Results We sequenced the nine exons of the OA1 gene in 72 individuals and found ten different mutations in seven unrelated families and three sporadic cases. The ten mutations include an amino acid substitution and a premature stop codon previously reported by our team, and eight previously unidentified mutations: three amino acid substitutions, a duplication, a deletion, an insertion and two splice-site mutations. The use of a novel Taq polymerase enabled us to amplify large genomic fragments covering the OA1 gene. and to detect very likely six distinct large deletions. Furthermore, we were able to confirm that there was no deletion in twenty one patients where no mutation had been found. Conclusion The identified mutations affect highly conserved amino acids, cause frameshifts or alternative splicing, thus affecting folding of the OA1 G protein coupled receptor, interactions of OA1 with its G protein and/or binding with its ligand. PMID:16646960

  3. Mutation analysis of the APC gene in Taiwanese FAP families: low incidence of APC germline mutation in a distinct subgroup of FAP families.

    PubMed

    Chiang, J M; Chen, H W; Tang, R P; Chen, J S; Changchien, C R; Hsieh, P S; Wang, J Y

    2010-06-01

    Familial adenomatous polyposis (FAP) is an autosomal-dominant disease caused by germline mutations in the adenomatous polyposis coli (APC) gene. The affected individuals develop colorectal polyposis and show various extra-colonic manifestations. In this study, we aimed to investigate the genetic and clinical characteristics of FAP in Taiwanese families and analyze the genotype-phenotype correlations. Blood samples were obtained from 66 FAP patients registered in the hereditary colorectal cancer database. Then, germline mutations in the APC genes of these 66 polyposis patients from 47 unrelated FAP families were analyzed. The germline-mutation-negative cases were analyzed by performing multiplex ligation-dependent probe amplification (MLPA) and single-strand conformation polymorphism (SSCP) analysis of the MUTYH gene. Among the analyzed families, 79% (37/47) of the families showed 28 APC mutations, including 19 frameshift mutations, 4 nonsense mutations, 3 genomic deletion mutations, 1 missense mutation, and 1 splice-site mutation. In addition, we identified 15 novel mutations in 32% (15/47) of the families. The cases in which APC mutations were not identified showed significantly lower incidence of profuse polyposis (P = 0.034) and gastroduodenal polyps (P = 0.027). Furthermore, FAP families in which some affected individuals had less than 100 polyps showed significant association with low incidence of APC germline mutations (P = 0.002). We have added the APC germline-mutation data for Taiwanese FAP patients and indicated the presence of an FAP subgroup comprising affected individuals with nonadenomatous polyps or less than 100 adenomatous polyps; this form of FAP is less frequently caused by germline mutations of the APC gene.

  4. Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).

    PubMed

    Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L

    1997-04-01

    Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.

  5. [Analysis on mutation of S gene and P gene of hepatitis B virus in two counties of Sichuan Province].

    PubMed

    Tong, Wen-Bin; He, Ji-Lan; Sun, Li

    2009-02-01

    To analyze HBV S gene/P gene mutation in 2 counties (districts) of Sichuan province. HBV DNA were extracted from sera positive both for HBsAg and HBeAg. After PCR and nucleotide sequencing, nucleotide/amino acid mutation in S and P gene were compared and analyzed. Of 47 serum samples from patients with chronic HBV infection, amino acid mutation in 'a' determinant occurred in 12 samples (25.53%,12/47), correlating with T126A, I126T/S, P127T, T131N, M133L, M133T and T140I; high proportion of mutation clustered in first loop of 'a' determinant (92.86%,13/14), rtV207I mutation in C domain of reverse transcription occured in one sample. Naturally occurring mutation in 'a' determinant clustered predominantly in the first loop and usually associated with altered antigenicity, posing a potential threat to successfully vaccinated individuals; Lamivudine-resistant mutant might occur in patient even without nucleotide analogue treatment.

  6. Analysis of HFE and non-HFE gene mutations in Brazilian patients with hemochromatosis.

    PubMed

    Bittencourt, Paulo Lisboa; Marin, Maria Lúcia Carnevale; Couto, Cláudia Alves; Cançado, Eduardo Luiz Rachid; Carrilho, Flair José; Goldberg, Anna Carla

    2009-01-01

    Approximately one-half of Brazilian patients with hereditary hemochromatosis (HH) are neither homozygous for the C282Y mutation nor compound heterozygous for the H63D and C282Y mutations that are associated with HH in Caucasians. Other mutations have been described in the HFE gene as well as in genes involved in iron metabolism, such as transferrin receptor 2 (TfR2) and ferroportin 1 (SCL40A1). To evaluate the role of HFE, TfR2 and SCL40A1 mutations in Brazilian subjects with HH. Nineteen male subjects (median age 42 [range: 20-72] years) with HH were evaluated using the Haemochromatosis StripAssay A. This assay is capable of detecting twelve HFE mutations, which are V53M, V59M, H63D, H63H, S65C, Q127H, P160delC, E168Q, E168X, W169X, C282Y and Q283, four TfR2 mutations, which are E60X, M172K, Y250X, AVAQ594-597del, and two SCL40A1 mutations, which are N144H and V162del. In our cohort, nine (47%) patients were homozygous for the C282Y mutation, two (11%) were heterozygous for the H63D mutation, and one each (5%) was either heterozygous for C282Y or compound heterozygous for C282Y and H63D. No other mutations in the HFE, TfR2 or SCL40A1 genes were observed in the studied patients. One-third of Brazilian subjects with the classical phenotype of HH do not carry HFE or other mutations that are currently associated with the disease in Caucasians. This observation suggests a role for other yet unknown mutations in the aforementioned genes or in other genes involved in iron homeostasis in the pathogenesis of HH in Brazil.

  7. The Impact of Mutation and Gene Conversion on the Local Diversification of Antigen Genes in African Trypanosomes

    PubMed Central

    Gjini, Erida; Haydon, Daniel T.; Barry, J. David; Cobbold, Christina A.

    2012-01-01

    Patterns of genetic diversity in parasite antigen gene families hold important information about their potential to generate antigenic variation within and between hosts. The evolution of such gene families is typically driven by gene duplication, followed by point mutation and gene conversion. There is great interest in estimating the rates of these processes from molecular sequences for understanding the evolution of the pathogen and its significance for infection processes. In this study, a series of models are constructed to investigate hypotheses about the nucleotide diversity patterns between closely related gene sequences from the antigen gene archive of the African trypanosome, the protozoan parasite causative of human sleeping sickness in Equatorial Africa. We use a hidden Markov model approach to identify two scales of diversification: clustering of sequence mismatches, a putative indicator of gene conversion events with other lower-identity donor genes in the archive, and at a sparser scale, isolated mismatches, likely arising from independent point mutations. In addition to quantifying the respective probabilities of occurrence of these two processes, our approach yields estimates for the gene conversion tract length distribution and the average diversity contributed locally by conversion events. Model fitting is conducted using a Bayesian framework. We find that diversifying gene conversion events with lower-identity partners occur at least five times less frequently than point mutations on variant surface glycoprotein (VSG) pairs, and the average imported conversion tract is between 14 and 25 nucleotides long. However, because of the high diversity introduced by gene conversion, the two processes have almost equal impact on the per-nucleotide rate of sequence diversification between VSG subfamily members. We are able to disentangle the most likely locations of point mutations and conversions on each aligned gene pair. PMID:22735079

  8. Mutations in the deubiquitinase gene USP8 cause Cushing's disease.

    PubMed

    Reincke, Martin; Sbiera, Silviu; Hayakawa, Akira; Theodoropoulou, Marily; Osswald, Andrea; Beuschlein, Felix; Meitinger, Thomas; Mizuno-Yamasaki, Emi; Kawaguchi, Kohei; Saeki, Yasushi; Tanaka, Keiji; Wieland, Thomas; Graf, Elisabeth; Saeger, Wolfgang; Ronchi, Cristina L; Allolio, Bruno; Buchfelder, Michael; Strom, Tim M; Fassnacht, Martin; Komada, Masayuki

    2015-01-01

    Cushing's disease is caused by corticotroph adenomas of the pituitary. To explore the molecular mechanisms of endocrine autonomy in these tumors, we performed exome sequencing of 10 corticotroph adenomas. We found somatic mutations in the USP8 deubiquitinase gene in 4 of 10 adenomas. The mutations clustered in the 14-3-3 protein binding motif and enhanced the proteolytic cleavage and catalytic activity of USP8. Cleavage of USP8 led to increased deubiqutination of the EGF receptor, impairing its downregulation and sustaining EGF signaling. USP8 mutants enhanced promoter activity of the gene encoding proopiomelanocortin. In summary, our data show that dominant mutations in USP8 cause Cushing's disease via activation of EGF receptor signaling.

  9. HFE Gene Mutations and Iron Status in 100 Healthy Polish Children.

    PubMed

    Kaczorowska-Hac, Barbara; Luszczyk, Marcin; Antosiewicz, Jedrzej; Ziolkowski, Wieslaw; Adamkiewicz-Drozynska, Elzbieta; Mysliwiec, Malgorzata; Milosz, Ewa; Kaczor, Jan J

    2017-07-01

    Iron participates in oxygen transport, energetic, metabolic, and immunologic processes. There are 2 main causes of iron overload: hereditary hemochromatosis which is a primary cause, is a metabolic disorder caused by mutations of genes that control iron metabolism and secondary hemochromatosis caused by multitransfusions, chronic hemolysis, and intake of iron rich food. The most common type of hereditary hemochromatosis is caused by HFE gene mutation. In this study, we analyzed iron metabolism in 100 healthy Polish children in relation to their HFE gene status. The wild-type HFE gene was predominant being observed in 60 children (60%). Twenty-five children (25%), presented with heterozygotic H63D mutation, and 15 children (15%), presented with other mutations (heterozygotic C282Y and S65C mutation, compound heterozygotes C282Y/S65C, C282Y/H63D, H63D homozygote). The mean concentration of iron, the level of ferritin, and transferrin saturation were statistically higher in the group of HFE variants compared with the wild-type group. H63D carriers presented with higher mean concentration of iron, ferritin levels, and transferrin saturation compared with the wild-type group. Male HFE carriers presented with higher iron concentration, transferrin saturation, and ferritin levels than females. This preliminary investigation demonstrates allelic impact on potential disease progression from childhood.

  10. Congenital nephrogenic diabetes insipidus with a novel mutation in the aquaporin 2 gene.

    PubMed

    Park, Youn Jong; Baik, Haing Woon; Cheong, Hae Il; Kang, Ju Hyung

    2014-07-01

    Congenital nephrogenic diabetes insipidus (CNDI) is a rare disorder caused by mutations of the arginine vasopressin (AVP) V2 receptor or aquaporin 2 ( AQP2 ) genes. The current study presented the case of CNDI in a 1-month-old male with a novel mutation in the AQP2 gene. The patient was referred due to the occurrence of hypernatremia and mild-intermittent fever since birth. An AVP stimulation test was compatible with CNDI as there was no significant response to desmopressin. Molecular genetic analysis demonstrated two mutations in exon 1 of the AQP2 gene: C to T transition, which resulted in a missense mutation of 108 Thr (ACG) to Met (ATG); and a 127, 128 delCA, which resulted in a deletion mutation of glutamine in position 43 at codon CAG as the first affected amino acid, with the new reading frame endign in a termination codon at position 62. The molecular genetic analysis of the parents showed that the missense mutation was inherited maternally and the deletion mutation was inherited paternally. The parents showed no signs or symptoms of CNDI, indicating autosomal recessive inheritance. The 108 Thr (ACG) to Met (ATG) mutation was confirmed as a novel mutation. Therefore, the molecular identification of the AQP2 gene has clinical significance, as early recognition of CNDI in infants that show only non-specific symptoms, can be facilitated. Thus, repeated episodes of dehydration, which may cause physical and mental retardation can be avoided.

  11. Congenital nephrogenic diabetes insipidus with a novel mutation in the aquaporin 2 gene

    PubMed Central

    PARK, YOUN JONG; BAIK, HAING WOON; CHEONG, HAE IL; KANG, JU HYUNG

    2014-01-01

    Congenital nephrogenic diabetes insipidus (CNDI) is a rare disorder caused by mutations of the arginine vasopressin (AVP) V2 receptor or aquaporin 2 (AQP2) genes. The current study presented the case of CNDI in a 1-month-old male with a novel mutation in the AQP2 gene. The patient was referred due to the occurrence of hypernatremia and mild-intermittent fever since birth. An AVP stimulation test was compatible with CNDI as there was no significant response to desmopressin. Molecular genetic analysis demonstrated two mutations in exon 1 of the AQP2 gene: C to T transition, which resulted in a missense mutation of 108Thr (ACG) to Met (ATG); and a 127, 128 delCA, which resulted in a deletion mutation of glutamine in position 43 at codon CAG as the first affected amino acid, with the new reading frame endign in a termination codon at position 62. The molecular genetic analysis of the parents showed that the missense mutation was inherited maternally and the deletion mutation was inherited paternally. The parents showed no signs or symptoms of CNDI, indicating autosomal recessive inheritance. The 108Thr (ACG) to Met (ATG) mutation was confirmed as a novel mutation. Therefore, the molecular identification of the AQP2 gene has clinical significance, as early recognition of CNDI in infants that show only non-specific symptoms, can be facilitated. Thus, repeated episodes of dehydration, which may cause physical and mental retardation can be avoided. PMID:24944815

  12. New splicing-site mutations in the SURF1 gene in Leigh syndrome patients.

    PubMed

    Pequignot, M O; Desguerre, I; Dey, R; Tartari, M; Zeviani, M; Agostino, A; Benelli, C; Fouque, F; Prip-Buus, C; Marchant, D; Abitbol, M; Marsac, C

    2001-05-04

    The gene SURF1 encodes a factor involved in the biogenesis of cytochrome c oxidase, the last complex in the respiratory chain. Mutations of the SURF1 gene result in Leigh syndrome and severe cytochrome c oxidase deficiency. Analysis of seven unrelated patients with cytochrome c oxidase deficiency and typical Leigh syndrome revealed different SURF1 mutations in four of them. Only these four cases had associated demyelinating neuropathy. Three mutations were novel splicing-site mutations that lead to the excision of exon 6. Two different novel heterozygous mutations were found at the same guanine residue at the donor splice site of intron 6; one was a deletion, whereas the other was a transition [588+1G>A]. The third novel splicing-site mutation was a homozygous [516-2_516-1delAG] in intron 5. One patient only had a homozygous polymorphism in the middle of the intron 8 [835+25C>T]. Western blot analysis showed that Surf1 protein was absent in all four patients harboring mutations. Our studies confirm that the SURF1 gene is an important nuclear gene involved in the cytochrome c oxidase deficiency. We also show that Surf1 protein is not implicated in the assembly of other respiratory chain complexes or the pyruvate dehydrogenase complex.

  13. Novel mutation in the TMEM127 gene associated with phaeochromocytoma.

    PubMed

    Elston, M S; Meyer-Rochow, G Y; Prosser, D; Love, D R; Conaglen, J V

    2013-04-01

    Phaeochromocytomas and paragangliomas are rare neuroendocrine tumours that arise from the adrenal glands or paraganglia (paragangliomas) within the abdomen, thorax and neck. Although it was originally suggested that approximately 10% of these tumours were inherited, it is now recognised that up to approximately 30% of these tumours are associated with a germline mutation in one of the phaeochromocytoma/paraganglioma susceptibility genes. Of the 12 currently known genes predisposing to these tumours, the TMEM127 gene is one of the more recently identified and appears to be present in approximately 2% of apparently sporadic phaeochromocytomas. We report a 33-year-old man who presented with an apparently sporadic adrenal phaeochromocytoma and was identified as carrying a novel TMEM127 germline mutation, p.Gln139X. Patients harbouring a germline TMEM127 mutation most commonly present with an apparently sporadic solitary adrenal phaeochromocytoma. Testing patients who present with a phaeochromocytoma or paraganglioma for an underlying germline mutation needs to be considered in all patients due to implications for family members, but a strategy based on clinical and immunohistochemical findings would be prudent to limit costs. © 2013 The Authors; Internal Medicine Journal © 2013 Royal Australasian College of Physicians.

  14. ADAMTS13 Gene Mutations in Children with Hemolytic Uremic Syndrome

    PubMed Central

    Choi, Hyoung Soo; Cheong, Hae Il; Kim, Nam Keun

    2011-01-01

    We investigated ADAMTS13 activity as well as the ADAMTS13 gene mutation in children with hemolytic uremic syndrome (HUS). Eighteen patients, including 6 diarrhea-negative (D-HUS) and 12 diarrhea-associated HUS (D+HUS) patients, were evaluated. The extent of von Willebrand factor (VWF) degradation was assayed by multimer analysis, and all exons of the ADAMTS13 gene were PCR-amplified using Taq DNA polymerase. The median and range for plasma activity of ADAMTS13 in 6 D-HUS and 12 D+HUS patients were 71.8% (22.8-94.1%) and 84.9% (37.9-119.9%), respectively, which were not statistically significantly different from the control group (86.4%, 34.2-112.3%) (p>0.05). Five ADAMTS13 gene mutations, including 2 novel mutations [1584+2T>A, 3941C>T (S1314L)] and 3 polymorphisms (Q448E, P475S, S903L), were found in 2 D-HUS and one D+HUS patients, which were not associated with deficiency of ADAMTS13 activity. Whether these mutations without reduced ADAMTS13 activity are innocent bystanders or predisposing factors in HUS remains unanswered. PMID:21488199

  15. Frequency of pathogenic germline mutations in cancer susceptibility genes in breast cancer patients.

    PubMed

    Kaur, Raman Preet; Shafi, Gowhar; Benipal, Raja Paramjeet Singh; Munshi, Anjana

    2018-04-26

    In this study, we evaluated the incidence of pathogenic germline mutations in 30 breast cancer susceptibility genes in breast cancer patients. Our aim was to understand the involvement of the inherited mutations in these genes in a breast cancer cohort. Two hundred ninety-six female breast cancer patients including 4.5% of familial breast cancer cases were included in the study. 200 ng of genomic DNA was used to evaluate the pathogenic mutations, detected using Global Screening Array (GSA) microchip (Illumina Inc.) according to the manufacturer's instructions. The pathogenic frameshift and nonsense mutations were observed in BRCA2 (10.9%), MLH1 (58.6%), MTHFR (50%), MSH2 (14.2%), and CYTB (52%) genes. Familial breast cancer patients (4.5%) had variations in BRCA2, MLH1, MSH2, and CYTB genes. 28% of patients with metastasis, recurrence, and death harbored mono/biallelic alterations in MSH2, MLH1, and BRCA2 genes. The results of this study can guide to develop a panel to test the breast cancer patients for pathogenic mutations, from Malwa region of Punjab. The screening of MSH2, MLH1, and BRCA2 should be carried in individuals with or without family history of breast cancer as these genes have been reported to increase the cancer risk by tenfold.

  16. A family with the Arg103Pro mutation in the NEUROD1 gene detected by next-generation sequencing - Clinical characteristics of mutation carriers.

    PubMed

    Szopa, Magdalena; Ludwig-Galezowska, Agnieszka H; Radkowski, Piotr; Skupien, Jan; Machlowska, Julita; Klupa, Tomasz; Wolkow, Pawel; Borowiec, Maciej; Mlynarski, Wojciech; Malecki, Maciej T

    2016-02-01

    Until now only a few families with early onset autosomal diabetes due to the NEUROD1 gene mutations have been identified. Moreover, only some of them meet strict MODY (maturity-onset diabetes of the young) criteria. Next-generation sequencing (NGS) provides an opportunity to detect more pathogenic mutations in this gene. Here, we evaluated the segregation of the Arg103Pro mutation in the NEUROD1 gene in a pedigree in which it was detected, and described the clinical characteristics of the mutation carriers. We included 156 diabetic probands of MODY families, among them 52 patients earlier tested for GCK-MODY and/or HNF1A-MODY by Sanger sequencing with negative results. Genetic testing was performed by targeted NGS sequencing using a panel of 28 monogenic diabetes genes. As detected by NGS, one patient had the missense Arg103Pro (CGC/CCC) mutation in the gene NEUROD1 changing the amino-acid structure of the DNA binding domain of this transcription factor. We confirmed this sequence difference by Sanger sequencing. This family had previously been tested with negative results for HNF1A gene mutations. 17 additional members of this family were invited for further testing. We confirmed the presence of the mutation in 11 subjects. Seven adult mutation carriers (all but one) from three generations had been already diagnosed with diabetes. There were 3 individuals with the Arg103Pro mutation diagnosed before the age of 30 years in the family. The range of age of the four unaffected mutation carriers (3 minors and 1 adult) was 3-48 years. Interestingly, one mutation carrier had a history of transient neonatal hypoglycemia, of which the clinical course resembled episodes typical for HNF4A-MODY. We report a family with autosomal dominant diabetes related to a new NEUROD1 mutation, one of very few meeting MODY criteria. The use of the NGS method will facilitate identification of more families with rare forms of MODY. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  17. Mutations in the hereditary haemochromatosis gene HFE in professional endurance athletes

    PubMed Central

    Chicharro, J; Hoyos, J; Gomez-Gallego, F; Villa, J; Bandres, F; Celaya, P; Jimenez, F; Alonso, J; Cordova, A; Lucia, A

    2004-01-01

    Background: Hereditary haemochromatosis, a disease that affects iron metabolism, progresses with a greater or lesser tendency to induce iron overload, possibly leading to severe organ dysfunction. Most elite endurance athletes take iron supplements during their active sporting life, which could aggravate this condition. Objective: To determine the prevalence and discuss potential clinical implications of mutations of HFE (the gene responsible for hereditary haemochromatosis) in endurance athletes. Methods: Basal concentrations of iron, ferritin, and transferrin and transferrin saturation were determined in the period before competition in 65 highly trained athletes. Possible mutations in the HFE gene were evaluated in each subject by extracting genomic DNA from peripheral blood. The restriction enzymes SnaBI and BclI were used to detect the mutations 845G→A (C282Y) and 187C→G (H63D). Results: Our findings indicate a high prevalence of HFE gene mutations in this population (49.2%) compared with sedentary controls (33.5%). No association was detected in the athletes between mutations and blood iron markers. Conclusions: The findings support the need to assess regularly iron stores in elite endurance athletes. PMID:15273174

  18. Mutation spectrum in BBS genes guided by homozygosity mapping in an Indian cohort.

    PubMed

    Sathya Priya, C; Sen, P; Umashankar, V; Gupta, N; Kabra, M; Kumaramanickavel, G; Stoetzel, C; Dollfus, H; Sripriya, S

    2015-02-01

    Bardet-Biedl syndrome (BBS), a ciliopathy disorder with pleiotropic effect manifests primarily as retinal degeneration along with renal insufficiency, polydactyly and obesity. In this study, we have performed homozygosity mapping using NspI 250K affymetrix gene chip followed by mutation screening of the candidate genes located in the homozygous blocks. These regions are prioritized based on the block length and candidature of the genes in BBS and other ciliopathies. Gene alterations in known BBS (22) and other ciliopathy genes such as ALMS1 (2) were seen in 24 of 30 families (80%). Mutations in BBS3 gene, inclusive of a novel recurrent mutation (p.I91T) accounted for 18% of the identified variations. Disease associated polymorphisms p.S70N (BBS2), rs1545 and rs1547 (BBS6) were also observed. This is the first study in Indian BBS patients and homozygosity mapping has proved to be an effective tool in prioritizing the candidate genes in consanguineous pedigrees. The study reveals a different mutation profile in the ciliopathy genes in Indian population and implication of novel loci/genes in 20% of the study group. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Identification of two poorly prognosed ovarian carcinoma subtypes associated with CHEK2 germ-line mutation and non-CHEK2 somatic mutation gene signatures.

    PubMed

    Ow, Ghim Siong; Ivshina, Anna V; Fuentes, Gloria; Kuznetsov, Vladimir A

    2014-01-01

    High-grade serous ovarian cancer (HG-SOC), a major histologic type of epithelial ovarian cancer (EOC), is a poorly-characterized, heterogeneous and lethal disease where somatic mutations of TP53 are common and inherited loss-of-function mutations in BRCA1/2 predispose to cancer in 9.5-13% of EOC patients. However, the overall burden of disease due to either inherited or sporadic mutations is not known. We performed bioinformatics analyses of mutational and clinical data of 334 HG-SOC tumor samples from The Cancer Genome Atlas to identify novel tumor-driving mutations, survival-significant patient subgroups and tumor subtypes potentially driven by either hereditary or sporadic factors. We identified a sub-cluster of high-frequency mutations in 22 patients and 58 genes associated with DNA damage repair, apoptosis and cell cycle. Mutations of CHEK2, observed with the highest intensity, were associated with poor therapy response and overall survival (OS) of these patients (P = 8.00e-05), possibly due to detrimental effect of mutations at the nuclear localization signal. A 21-gene mutational prognostic signature significantly stratifies patients into relatively low or high-risk subgroups with 5-y OS of 37% or 6%, respectively (P = 7.31e-08). Further analysis of these genes and high-risk subgroup revealed 2 distinct classes of tumors characterized by either germline mutations of genes such as CHEK2, RPS6KA2 and MLL4, or somatic mutations of other genes in the signature. Our results could provide improvement in prediction and clinical management of HG-SOC, facilitate our understanding of this complex disease, guide the design of targeted therapeutics and improve screening efforts to identify women at high-risk of hereditary ovarian cancers distinct from those associated with BRCA1/2 mutations.

  20. Identification of two poorly prognosed ovarian carcinoma subtypes associated with CHEK2 germ-line mutation and non-CHEK2 somatic mutation gene signatures

    PubMed Central

    Ow, Ghim Siong; Ivshina, Anna V; Fuentes, Gloria; Kuznetsov, Vladimir A

    2014-01-01

    High-grade serous ovarian cancer (HG-SOC), a major histologic type of epithelial ovarian cancer (EOC), is a poorly-characterized, heterogeneous and lethal disease where somatic mutations of TP53 are common and inherited loss-of-function mutations in BRCA1/2 predispose to cancer in 9.5–13% of EOC patients. However, the overall burden of disease due to either inherited or sporadic mutations is not known.     We performed bioinformatics analyses of mutational and clinical data of 334 HG-SOC tumor samples from The Cancer Genome Atlas to identify novel tumor-driving mutations, survival-significant patient subgroups and tumor subtypes potentially driven by either hereditary or sporadic factors. We identified a sub-cluster of high-frequency mutations in 22 patients and 58 genes associated with DNA damage repair, apoptosis and cell cycle. Mutations of CHEK2, observed with the highest intensity, were associated with poor therapy response and overall survival (OS) of these patients (P = 8.00e-05), possibly due to detrimental effect of mutations at the nuclear localization signal. A 21-gene mutational prognostic signature significantly stratifies patients into relatively low or high-risk subgroups with 5-y OS of 37% or 6%, respectively (P = 7.31e-08). Further analysis of these genes and high-risk subgroup revealed 2 distinct classes of tumors characterized by either germline mutations of genes such as CHEK2, RPS6KA2 and MLL4, or somatic mutations of other genes in the signature. Our results could provide improvement in prediction and clinical management of HG-SOC, facilitate our understanding of this complex disease, guide the design of targeted therapeutics and improve screening efforts to identify women at high-risk of hereditary ovarian cancers distinct from those associated with BRCA1/2 mutations. PMID:24879340

  1. An association study between CHEK2 gene mutations and susceptibility to breast cancer.

    PubMed

    Jalilvand, Manizheh; Oloomi, Mana; Najafipour, Reza; Alizadeh, Safar Ali; Saki, Najmaldin; Rad, Fatemeh Samiee; Shekari, Mohammad

    2017-01-01

    CHEK2 gene is known as a tumor suppressor gene in breast cancer (BC), which plays a role in DNA repair. The germ line mutations in CEHK2 have been associated with different types of cancer. The present study was aimed at studying the association between CHEK2 mutations and BC. Peripheral blood was collected from patients into a test tube containing EDTA, and DNA was extracted from blood samples. Then, we analyzed mutations including 1100delc, IVS2+1>A, del5395bp, and I157T within CHEK2 gene in patients with BC and 100 normal healthy controls according to PCR-RFLP, allelic specific PCR, and multiplex-PCR. Although IVS2+1G>A mutation within CHEK2 gene was found in two BC patients, other defined mutants were not detected. For the first time, we identified CHEK2 IVS2+1G>A mutation, one out of four different CHEK2 alterations in two Iranian BC patients (2%). Also, our results showed that CHEK2 1100elC, del5395bp, and I157T mutations are not associated with genetic susceptibility for BC among Iranian population.

  2. Spectrum of CFTR gene mutations in Ecuadorian cystic fibrosis patients: the second report of the p.H609R mutation.

    PubMed

    Ortiz, Sofía C; Aguirre, Santiago J; Flores, Sofía; Maldonado, Claudio; Mejía, Juan; Salinas, Lilian

    2017-11-01

    High heterogeneity in the CFTR gene mutations disturbs the molecular diagnosis of cystic fibrosis (CF). In order to improve the diagnosis of CF in our country, the present study aims to define a panel of common CFTR gene mutations by sequencing 27 exons of the gene in Ecuadorian Cystic Fibrosis patients. Forty-eight Ecuadorian individuals with suspected/confirmed CF diagnosis were included. Twenty-seven exons of CFTR gene were sequenced to find sequence variations. Prevalence of pathogenic variations were determined and compared with other countries' data. We found 70 sequence variations. Eight of these are CF-causing mutations: p.F508del, p.G85E, p.G330E, p.A455E, p.G970S, W1098X, R1162X, and N1303K. Also this study is the second report of p.H609R in Ecuadorian population. Mutation prevalence differences between Ecuadorian population and other Latin America countries were found. The panel of mutations suggested as an initial screening for the Ecuadorian population with cystic fibrosis should contain the mutations: p.F508del, p.G85E, p.G330E, p.A455E, p.G970S, W1098X, R1162X, and N1303K. © 2017 NETLAB Laboratorios Especializados. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  3. Sarcomere protein gene mutations and inherited heart disease: a beta-cardiac myosin heavy chain mutation causing endocardial fibroelastosis and heart failure.

    PubMed

    Kamisago, Mitsuhiro; Schmitt, Joachim P; McNamara, Dennis; Seidman, Christine; Seidman, J G

    2006-01-01

    Inherited human cardiomyopathies often lead to heart failure. A common feature of these conditions is that affected individuals can express the disease causing mutations for many years without showing clinical signs of the disease. Previous studies have demonstrated that sarcomere protein gene mutations can cause either dilated cardiomyopathy or hypertrophic cardiomyopathy. Here we demonstrate that the Arg442His missense mutation in beta-cardiac myosin heavy chain (betaMHC) causes dilated cardiomyopathy, endocardial fibroelastosis and heart failure at a very early age. Using standard genetic engineering tools we and others have made murine models by introducing human disease causing mutations into mice. The central hypothesis of these studies has been that by identifying the pathophysiological pathways activated by these mutations we can define enzymatic activities that are modified during the disease process and which may be involved in pathways that involve more common forms of cardiac disease. Murine models bearing different mutant myosins are being used to address whether each disease causing mutant betaMHC activates the same or different cellular pathways. Dissecting the molecular pathways modulated by mutations in sarcomere protein genes as well as other genes has already demonstrated that there are multiple pathways leading to cardiac remodelling and heart failure. Defining the mechanisms by which mutations in the same genes activate different cellular pathways remains an important question.

  4. Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie.

    PubMed

    Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong

    2010-12-01

    P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance.

  5. Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie

    PubMed Central

    Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol

    2010-01-01

    P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance. PMID:21113104

  6. Prevalence and Spectrum of Germline Cancer Susceptibility Gene Mutations Among Patients With Early-Onset Colorectal Cancer

    PubMed Central

    Pearlman, Rachel; Frankel, Wendy L.; Swanson, Benjamin; Zhao, Weiqiang; Yilmaz, Ahmet; Miller, Kristin; Bacher, Jason; Bigley, Christopher; Nelsen, Lori; Goodfellow, Paul J.; Goldberg, Richard M.; Paskett, Electra; Shields, Peter G.; Freudenheim, Jo L.; Stanich, Peter P; Lattimer, Ilene; Arnold, Mark; Liyanarachchi, Sandya; Kalady, Matthew; Heald, Brandie; Greenwood, Carla; Paquette, Ian; Prues, Marla; Draper, David J.; Lindeman, Carolyn; Kuebler, J. Philip; Reynolds, Kelly; Brell, Joanna M.; Shaper, Amy A.; Mahesh, Sameer; Buie, Nicole; Weeman, Kisa; Shine, Kristin; Haut, Mitchell; Edwards, Joan; Bastola, Shyamal; Wickham, Karen; Khanduja, Karamjit S.; Zacks, Rosemary; Pritchard, Colin C.; Shirts, Brian H.; Jacobson, Angela; Allen, Brian; de la Chapelle, Albert; Hampel, Heather

    2017-01-01

    IMPORTANCE Hereditary cancer syndromes infer high cancer risks and require intensive cancer surveillance, yet the prevalence and spectrum of these conditions among unselected patients with early-onset colorectal cancer (CRC) is largely undetermined. OBJECTIVE To determine the frequency and spectrum of cancer susceptibility gene mutations among patients with early-onset CRC. DESIGN, SETTING, AND PARTICIPANTS Overall, 450 patients diagnosed with colorectal cancer younger than 50 years were prospectively accrued from 51 hospitals into the Ohio Colorectal Cancer Prevention Initiative from January 1, 2013, to June 20, 2016. Mismatch repair (MMR) deficiency was determined by microsatellite instability and/or immunohistochemistry. Germline DNA was tested for mutations in 25 cancer susceptibility genes using next-generation sequencing. MAIN OUTCOMES AND MEASURES Mutation prevalence and spectrum in patients with early-onset CRC was determined. Clinical characteristics were assessed by mutation status. RESULTS In total 450 patients younger than 50 years were included in the study, and 75 gene mutations were found in 72 patients (16%). Forty-eight patients (10.7%) had MMR-deficient tumors, and 40 patients (83.3%) had at least 1 gene mutation: 37 had Lynch syndrome (13, MLH1 [including one with constitutional MLH1 methylation]; 16, MSH2; 1, MSH2/monoallelic MUTYH; 2, MSH6; 5, PMS2); 1 patient had the APC c.3920T>A, p.I1307K mutation and a PMS2 variant; 9 patients (18.8%) had double somatic MMR mutations (including 2 with germline biallelic MUTYH mutations); and 1 patient had somatic MLH1 methylation. Four hundred two patients (89.3%) had MMR-proficient tumors, and 32 patients (8%) had at least 1 gene mutation: 9 had mutations in high-penetrance CRC genes (5, APC; 1, APC/PMS2; 2, biallelic MUTYH; 1, SMAD4); 13 patients had mutations in high- or moderate-penetrance genes not traditionally associated with CRC (3, ATM; 1, ATM/CHEK2; 2, BRCA1; 4, BRCA2; 1, CDKN2A; 2, PALB2); 10

  7. INS-gene mutations: From genetics and beta cell biology to clinical disease

    PubMed Central

    Liu, Ming; Sun, Jinhong; Cui, Jinqiu; Chen, Wei; Guo, Huan; Barbetti, Fabrizio; Arvan, Peter

    2015-01-01

    A growing list of insulin gene mutations causing a new form of monogenic diabetes has drawn increasing attention over the past seven years. The mutations have been identified in the untranslated regions of the insulin gene as well as the coding sequence of preproinsulin including within the signal peptide, insulin B-chain, C-peptide, insulin A-chain, and the proteolytic cleavage sites both for signal peptidase and the prohormone convertases. These mutations affect a variety of different steps of insulin biosynthesis in pancreatic beta cells. Importantly, although many of these mutations cause proinsulin misfolding with early onset autosomal dominant diabetes, some of the mutant alleles appear to engage different cellular and molecular mechanisms that underlie beta cell failure and diabetes. In this article, we review the most recent advances in the field and discuss challenges as well as potential strategies to prevent/delay the development and progression of autosomal dominant diabetes caused by INS-gene mutations. It is worth noting that although diabetes caused by INS gene mutations is rare, increasing evidence suggests that defects in the pathway of insulin biosynthesis may also be involved in the progression of more common types of diabetes. Collectively, the (pre)proinsulin mutants provide insightful molecular models to better understand the pathogenesis of all forms of diabetes in which preproinsulin processing defects, proinsulin misfolding, and ER stress are involved. PMID:25542748

  8. Two common low density lipoprotein receptor gene mutations cause familial hypercholesterolemia in Afrikaners.

    PubMed

    Leitersdorf, E; Van der Westhuyzen, D R; Coetzee, G A; Hobbs, H H

    1989-09-01

    Familial hypercholesterolemia (FH), an autosomal dominant disease caused by mutations in the LDL receptor gene, is five times more frequent in the Afrikaner population of South Africa than it is in the population of the United States and Europe. It has been proposed that the high frequency is due to a founder effect. In this paper, we characterized 24 mutant LDL receptor alleles from 12 Afrikaner individuals homozygous for FH. We identified two mutations that together makeup greater than 95% of the mutant LDL receptor genes represented in our sample. Both mutations were basepair substitutions that result in single-amino acid changes. Each mutation can be detected readily with the polymerase chain reaction and restriction analysis. The finding of two common LDL receptor mutations in the Afrikaner FH homozygotes predicts that these mutations will predominate in the Afrikaner population and that the high frequency of FH is due to a founder effect. The increased incidence of ischemic heart disease in the Afrikaner population may in part be due to the high frequency of these two mutations in the LDL receptor gene.

  9. Mutation screening of melatonin-related genes in patients with autism spectrum disorders

    PubMed Central

    2010-01-01

    Background One consistent finding in autism spectrum disorders (ASD) is a decreased level of the pineal gland hormone melatonin and it has recently been demonstrated that this decrease to a large extent is due to low activity of the acetylserotonin O-methyltransferase (ASMT), the last enzyme in the melatonin synthesis pathway. Moreover, mutations in the ASMT gene have been identified, including a splice site mutation, that were associated with low ASMT activity and melatonin secretion, suggesting that the low ASMT activity observed in autism is, at least partly, due to variation within the ASMT gene. Methods In the present study, we have investigated all the genes involved in the melatonin pathway by mutation screening of AA-NAT (arylalkylamine N-acetyltransferase), ASMT, MTNR1A, MTNR1B (melatonin receptor 1A and 1B) and GPR50 (G protein-coupled receptor 50), encoding both synthesis enzymes and the three main receptors of melatonin, in 109 patients with autism spectrum disorders (ASD). A cohort of 188 subjects from the general population was used as a comparison group and was genotyped for the variants identified in the patient sample. Results Several rare variants were identified in patients with ASD, including the previously reported splice site mutation in ASMT (IVS5+2T>C). Of the variants affecting protein sequence, only the V124I in the MTNR1B gene was absent in our comparison group. However, mutations were found in upstream regulatory regions in three of the genes investigated, ASMT, MTNR1A, and MTNR1B. Conclusions Our report of another ASD patient carrying the splice site mutation IVS5+2T>C, in ASMT further supports an involvement of this gene in autism. Moreover, our results also suggest that other melatonin related genes might be interesting candidates for further investigation in the search for genes involved in autism spectrum disorders and related neurobehavioral phenotypes. However, further studies of the novel variants identified in this study are

  10. Mutation screening of melatonin-related genes in patients with autism spectrum disorders.

    PubMed

    Jonsson, Lina; Ljunggren, Elin; Bremer, Anna; Pedersen, Christin; Landén, Mikael; Thuresson, Kent; Giacobini, Maibritt; Melke, Jonas

    2010-04-08

    One consistent finding in autism spectrum disorders (ASD) is a decreased level of the pineal gland hormone melatonin and it has recently been demonstrated that this decrease to a large extent is due to low activity of the acetylserotonin O-methyltransferase (ASMT), the last enzyme in the melatonin synthesis pathway. Moreover, mutations in the ASMT gene have been identified, including a splice site mutation, that were associated with low ASMT activity and melatonin secretion, suggesting that the low ASMT activity observed in autism is, at least partly, due to variation within the ASMT gene. In the present study, we have investigated all the genes involved in the melatonin pathway by mutation screening of AA-NAT (arylalkylamine N-acetyltransferase), ASMT, MTNR1A, MTNR1B (melatonin receptor 1A and 1B) and GPR50 (G protein-coupled receptor 50), encoding both synthesis enzymes and the three main receptors of melatonin, in 109 patients with autism spectrum disorders (ASD). A cohort of 188 subjects from the general population was used as a comparison group and was genotyped for the variants identified in the patient sample. Several rare variants were identified in patients with ASD, including the previously reported splice site mutation in ASMT (IVS5+2T>C). Of the variants affecting protein sequence, only the V124I in the MTNR1B gene was absent in our comparison group. However, mutations were found in upstream regulatory regions in three of the genes investigated, ASMT, MTNR1A, and MTNR1B. Our report of another ASD patient carrying the splice site mutation IVS5+2T>C, in ASMT further supports an involvement of this gene in autism. Moreover, our results also suggest that other melatonin related genes might be interesting candidates for further investigation in the search for genes involved in autism spectrum disorders and related neurobehavioral phenotypes. However, further studies of the novel variants identified in this study are warranted to shed light on their potential

  11. Germline mutations in 40 cancer susceptibility genes among Chinese patients with high hereditary risk breast cancer.

    PubMed

    Li, Junyan; Jing, Ruilin; Wei, Hongyi; Wang, Minghao; Qi, Xiaowei; Liu, Haoxi; Liu, Jian; Ou, Jianghua; Jiang, Weihua; Tian, Fuguo; Sheng, Yuan; Li, Hengyu; Xu, Hong; Zhang, Ruishan; Guan, Aihua; Liu, Ke; Jiang, Hongchuan; Ren, Yu; He, Jianjun; Huang, Weiwei; Liao, Ning; Cai, Xiangjun; Ming, Jia; Ling, Rui; Xu, Yan; Hu, Chunyan; Zhang, Jianguo; Guo, Baoliang; Ouyang, Lizhi; Shuai, Ping; Liu, Zhenzhen; Zhong, Ling; Zeng, Zhen; Zhang, Ting; Xuan, Zhaoling; Tan, Xuanni; Liang, Junbin; Pan, Qinwen; Chen, Li; Zhang, Fan; Fan, Linjun; Zhang, Yi; Yang, Xinhua; Li, Jingbo; Chen, Chongjian; Jiang, Jun

    2018-05-12

    Multigene panel testing of breast cancer predisposition genes have been extensively conducted in Europe and America, which is relatively rare in Asia however. In this study, we assessed the frequency of germline mutations in 40 cancer predisposition genes, including BRCA1 and BRCA2, among a large cohort of Chinese patients with high hereditary risk of BC. From 2015 to 2016, consecutive BC patients from 26 centers of China with high hereditary risk were recruited (n=937). Clinical information was collected and next-generation sequencing (NGS) was performed using blood samples of participants to identify germline mutations. In total, we acquired 223 patients with putative germline mutations, including 159 in BRCA1/2, 61 in 15 other BC susceptibility genes and 3 in both BRCA1/2 and non-BRCA1/2 gene. Major mutant non-BRCA1/2 genes were TP53 (n=18), PALB2 (n=11), CHEK2 (n=6), ATM (n=6), and BARD1 (n=5). No factors predicted pathologic mutations in non-BRCA1/2 genes when treated as a whole. TP53 mutations were associated with HER-2 positive BC and younger age at diagnosis; and CHEK2 and PALB2 mutations were enriched in patients with luminal BC. Among high hereditary risk Chinese BC patients, 23.8% contained germline mutations, including 6.8% in non-BRCA1/2 genes. TP53 and PALB2 had a relatively high mutation rates (1.9% and 1.2%). Although no factors predicted for detrimental mutations in non-BRCA1/2 genes, some clinical features were associated with mutations of several particular genes. This article is protected by copyright. All rights reserved. © 2018 UICC.

  12. Identification of novel mutations of the WFS1 gene in Brazilian patients with Wolfram syndrome.

    PubMed

    Gasparin, Maria Regina R; Crispim, Felipe; Paula, Sílvia L; Freire, Maria Beatriz S; Dalbosco, Ivaldir S; Manna, Thais Della; Salles, João Eduardo N; Gasparin, Fábio; Guedes, Aléxis; Marcantonio, João M; Gambini, Márcio; Salim, Camila P; Moisés, Regina S

    2009-02-01

    Wolfram syndrome (WS) is a rare, progressive, neurodegenerative disorder with an autosomal recessive pattern of inheritance. The gene for WS, WFS1, was identified on chromosome 4p16 and most WS patients carry mutations in this gene. However, some studies have provided evidence for genetic heterogeneity and the genotype-phenotype relationships are not clear. Our aim was to ascertain the spectrum of WFS1 mutations in Brazilian patients with WS and to examine the phenotype-genotype relationships in these patients. Clinical characterization and analyses of the WFS1 gene were performed in 27 Brazilian patients with WS from 19 families. We identified 15 different mutations in the WFS1 gene in 26 patients, among which nine are novel. All mutations occurred in exon 8, except for one missense mutation which was located in exon 5. Although we did not find any clear phenotype-genotype relationship in patients with mutations in exon 8, the homozygous missense mutation in exon 5 was associated with a mild phenotype: onset of diabetes mellitus and optic atrophy during adulthood with good metabolic control being achieved with low doses of sulfonylurea. Our data show that WFS1 is the major gene involved in WS in Brazilian patients and most mutations are concentrated in exon 8. Also, our study increases the spectrum of WFS1 mutations. Although no clear phenotype-genotype relationship was found for mutations in exon 8, a mild phenotype was associated with a homozygous missense mutation in exon 5.

  13. Novel mutation at the initiation codon in the Norrie disease gene in two Japanese families.

    PubMed

    Isashiki, Y; Ohba, N; Yanagita, T; Hokita, N; Doi, N; Nakagawa, M; Ozawa, M; Kuroda, N

    1995-01-01

    We have identified a new mutation of Norrie disease (ND) gene in two Japanese males from unrelated families; they showed typical ocular features of ND but no mental retardation or hearing impairment. A mutation was found in both patients at the initiation codon of exon 2 of the ND gene (ATG to GTG), with otherwise normal nucleotide sequences. Their mothers had the normal and mutant types of the gene, which was expected for heterozygotes of the disease. The mutation of the initiation codon would cause the failure of ND gene expression or a defect in translation thereby truncating the amino terminus of ND protein. In view of the rarity and marked heterogeneity of mutations in the ND gene, the present apparently unrelated Japanese families who have lived in the same area for over two centuries presumably share the origin of the mutation.

  14. Mutations in the RS1 gene in a Chinese family with X-linked juvenile retinoschisis.

    PubMed

    Hou, Qiaofang; Chu, Yan; Guo, Qiannan; Wu, Dong; Liao, Shixiu

    2012-02-01

    The purpose of our study was to identify the mutations in the retinoschisis 1 (RS1) gene, which was associated with X-linked retinoschisis (XLRS) in a four-generation Chinese family, and to provide the theoretical basis for gene diagnosis and gene therapy. Genomic DNA was extracted from peripheral leukocytes. All six exons and flanking intronic regions were amplified by polymerase chain reaction (PCR), followed by direct sequencing. Through our genetic analysis, one frameshift 573delG mutation was identified in the patients of this four-generation pedigree; however, this mutation was absent in normal or non-carrier subjects. In conclusion, this 573delG mutation is reported in the Chinese population for the first time. This mutation widens the mutational spectrum of RS1 in Asians. Identification of mutations in the RS1 gene and expanded information on clinical manifestations will facilitate early diagnosis, appropriate early therapy, and genetic counseling regarding the prognosis of XLRS.

  15. SAMHD1 Gene Mutations Are Associated with Cerebral Large-Artery Atherosclerosis

    PubMed Central

    Xin, Baozhong; Yan, Junpeng; Wu, Ying; Hu, Bo; Liu, Liping; Wang, Yilong; Ahn, Jinwoo; Skowronski, Jacek; Zhang, Zaiqiang; Wang, Yongjun; Wang, Heng

    2015-01-01

    Background. To investigate whether one or more SAMHD1 gene mutations are associated with cerebrovascular disease in the general population using a Chinese stroke cohort. Methods. Patients with a Chinese Han background (N = 300) diagnosed with either cerebral large-artery atherosclerosis (LAA, n = 100), cerebral small vessel disease (SVD, n = 100), or other stroke-free neurological disorders (control, n = 100) were recruited. Genomic DNA from the whole blood of each patient was isolated, and direct sequencing of the SAMHD1 gene was performed. Both wild type and mutant SAMHD1 proteins identified from the patients were expressed in E. coli and purified; then their dNTPase activities and ability to form stable tetramers were analysed in vitro. Results. Three heterozygous mutations, including two missense mutations c.64C>T (P22S) and c.841G>A (p.E281K) and one splice site mutation c.696+2T>A, were identified in the LAA group with a prevalence of 3%. No mutations were found in the patients with SVD or the controls (p = 0.05). The mutant SAMHD1 proteins were functionally impaired in terms of their catalytic activity as a dNTPase and ability to assemble stable tetramers. Conclusions. Heterozygous SAMHD1 gene mutations might cause genetic predispositions that interact with other risk factors, resulting in increased vulnerability to stroke. PMID:26504826

  16. BSE Case Associated with Prion Protein Gene Mutation

    PubMed Central

    Richt, Jürgen A.; Hall, S. Mark

    2008-01-01

    Bovine spongiform encephalopathy (BSE) is a transmissible spongiform encephalopathy (TSE) of cattle and was first detected in 1986 in the United Kingdom. It is the most likely cause of variant Creutzfeldt-Jakob disease (CJD) in humans. The origin of BSE remains an enigma. Here we report an H-type BSE case associated with the novel mutation E211K within the prion protein gene (Prnp). Sequence analysis revealed that the animal with H-type BSE was heterozygous at Prnp nucleotides 631 through 633. An identical pathogenic mutation at the homologous codon position (E200K) in the human Prnp has been described as the most common cause of genetic CJD. This finding represents the first report of a confirmed case of BSE with a potential pathogenic mutation within the bovine Prnp gene. A recent epidemiological study revealed that the K211 allele was not detected in 6062 cattle from commercial beef processing plants and 42 cattle breeds, indicating an extremely low prevalence of the E211K variant (less than 1 in 2000) in cattle. PMID:18787697

  17. Analysis of the GCK gene in 79 MODY type 2 patients: A multicenter Turkish study, mutation profile and description of twenty novel mutations.

    PubMed

    Aykut, Ayça; Karaca, Emin; Onay, Hüseyin; Gökşen, Damla; Çetinkalp, Şevki; Eren, Erdal; Ersoy, Betül; Çakır, Esra Papatya; Büyükinan, Muammer; Kara, Cengiz; Anık, Ahmet; Kırel, Birgül; Özen, Samim; Atik, Tahir; Darcan, Şükran; Özkınay, Ferda

    2018-01-30

    Maturity onset diabetes is a genetic form of diabetes mellitus characterized by an early age at onset and several etiologic genes for this form of diabetes have been identified in many patients. Maturity onset diabetes type 2 [MODY2 (#125851)] caused by mutations in the glucokinase gene (GCK). Although its prevalence is not clear, it is estimated that 1%-2% of patients with diabetes have the monogenic form. The aim of this study was to evaluate the molecular spectrum of GCK gene mutations in 177 Turkish MODY type 2 patients. Mutations in the GCK gene were identified in 79 out of 177. All mutant alleles were identified, including 45 different GCK mutations, 20 of which were novel. Copyright © 2017. Published by Elsevier B.V.

  18. Frequency and spectrum of hemoglobinopathy mutations in a Uruguayan pediatric population

    PubMed Central

    Luz, Julio Da; Ávila, Amalia; Icasuriaga, Sandra; Gongóra, María; Castillo, Luis; Serrón, Alejandra; Kimura, Elza Miyuki; Costa, Fernando Ferreira; Sans, Mónica; Sonati, Maria de Fátima

    2013-01-01

    Hemoglobinopathies are the most common recessive diseases worldwide but their prevalence in Uruguay has not been investigated. In this study, 397 unrelated outpatient children from the Pereira Rosell Hospital Center (CHPR), as well as 31 selected patients with microcytic anemia and 28 β-thalassemia carriers were analyzed for hemoglobinopathies by using biochemical and molecular biology methods. Parametric and non-parametric methods were used to compare the hematological indices between groups of genotypes. Of the 397 patients in the first group, approximately 1% (0.76% HbS and 0.25% β-thalassemia) had a mutation in the HBB gene and 3.3% had β-thalassemia. These mutations had a heterogeneous distribution that varied according to individual ancestry. HbS was found exclusively in individuals with declared African ancestry and had a carrier frequency of 2.2%. The frequency of α-thalassemia carriers in outpatients of European and African ancestry was 1.2% and 6.5%, respectively. In contrast, the frequency of α-thalassemia carriers in patients with microcytic anemia was 25.8%, significantly higher (p < 0.01) than that observed in the sample as a whole and in Afro-descendants and Euro-descendants. Significant differences were observed in the hematological parameters between individuals with thalassemia genotypes and those with a normal genotype. These results indicate that hemoglobinopathies are a relevant health problem in Uruguay. PMID:24130436

  19. Molecular Analysis of Glucose-6-Phosphate Dehydrogenase Gene Mutations in Bangladeshi Individuals.

    PubMed

    Sarker, Suprovath Kumar; Islam, Md Tarikul; Eckhoff, Grace; Hossain, Mohammad Amir; Qadri, Syeda Kashfi; Muraduzzaman, A K M; Bhuyan, Golam Sarower; Shahidullah, Mohammod; Mannan, Mohammad Abdul; Tahura, Sarabon; Hussain, Manzoor; Akhter, Shahida; Nahar, Nazmun; Shirin, Tahmina; Qadri, Firdausi; Mannoor, Kaiissar

    2016-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common X-linked human enzyme defect of red blood cells (RBCs). Individuals with this gene defect appear normal until exposed to oxidative stress which induces hemolysis. Consumption of certain foods such as fava beans, legumes; infection with bacteria or virus; and use of certain drugs such as primaquine, sulfa drugs etc. may result in lysis of RBCs in G6PD deficient individuals. The genetic defect that causes G6PD deficiency has been identified mostly as single base missense mutations. One hundred and sixty G6PD gene mutations, which lead to amino acid substitutions, have been described worldwide. The purpose of this study was to detect G6PD gene mutations in hospital-based settings in the local population of Dhaka city, Bangladesh. Qualitative fluorescent spot test and quantitative enzyme activity measurement using RANDOX G6PDH kit were performed for analysis of blood specimens and detection of G6PD-deficient participants. For G6PD-deficient samples, PCR was done with six sets of primers specific for G6PD gene. Automated Sanger sequencing of the PCR products was performed to identify the mutations in the gene. Based on fluorescence spot test and quantitative enzyme assay followed by G6PD gene sequencing, 12 specimens (11 males and one female) among 121 clinically suspected patient-specimens were found to be deficient, suggesting a frequency of 9.9% G6PD deficiency. Sequencing of the G6PD-deficient samples revealed c.C131G substitution (exon-3: Ala44Gly) in six samples, c.G487A substitution (exon-6:Gly163Ser) in five samples and c.G949A substitution (exon-9: Glu317Lys) of coding sequence in one sample. These mutations either affect NADP binding or disrupt protein structure. From the study it appears that Ala44Gly and Gly163Ser are the most common G6PD mutations in Dhaka, Bangladesh. This is the first study of G6PD mutations in Bangladesh.

  20. Somatic USP8 Gene Mutations Are a Common Cause of Pediatric Cushing Disease.

    PubMed

    Faucz, Fabio R; Tirosh, Amit; Tatsi, Christina; Berthon, Annabel; Hernández-Ramírez, Laura C; Settas, Nikolaos; Angelousi, Anna; Correa, Ricardo; Papadakis, Georgios Z; Chittiboina, Prashant; Quezado, Martha; Pankratz, Nathan; Lane, John; Dimopoulos, Aggeliki; Mills, James L; Lodish, Maya; Stratakis, Constantine A

    2017-08-01

    Somatic mutations in the ubiquitin-specific protease 8 (USP8) gene have been recently identified as the most common genetic alteration in patients with Cushing disease (CD). However, the frequency of these mutations in the pediatric population has not been extensively assessed. We investigated the status of the USP8 gene at the somatic level in a cohort of pediatric patients with corticotroph adenomas. The USP8 gene was fully sequenced in both germline and tumor DNA samples from 42 pediatric patients with CD. Clinical, biochemical, and imaging data were compared between patients with and without somatic USP8 mutations. Five different USP8 mutations (three missense, one frameshift, and one in-frame deletion) were identified in 13 patients (31%), all of them located in exon 14 at the previously described mutational hotspot, affecting the 14-3-3 binding motif of the protein. Patients with somatic mutations were older at disease presentation [mean 5.1 ± 2.1 standard deviation (SD) vs 13.1 ± 3.6 years, P = 0.03]. Levels of urinary free cortisol, midnight serum cortisol, and adrenocorticotropic hormone, as well as tumor size and frequency of invasion of the cavernous sinus, were not significantly different between the two groups. However, patients harboring somatic USP8 mutations had a higher likelihood of recurrence compared with patients without mutations (46.2% vs 10.3%, P = 0.009). Somatic USP8 gene mutations are a common cause of pediatric CD. Patients harboring a somatic mutation had a higher likelihood of tumor recurrence, highlighting the potential importance of this molecular defect for the disease prognosis and the development of targeted therapeutic options. Copyright © 2017 Endocrine Society

  1. Identification of a novel CLRN1 gene mutation in Usher syndrome type 3: two case reports.

    PubMed

    Yoshimura, Hidekane; Oshikawa, Chie; Nakayama, Jun; Moteki, Hideaki; Usami, Shin-Ichi

    2015-05-01

    This study examines the CLRN1 gene mutation analysis in Japanese patients who were diagnosed with Usher syndrome type 3 (USH3) on the basis of clinical findings. Genetic analysis using massively parallel DNA sequencing (MPS) was conducted to search for 9 causative USH genes in 2 USH3 patients. We identified the novel pathogenic mutation in the CLRN1 gene in 2 patients. The missense mutation was confirmed by functional prediction software and segregation analysis. Both patients were diagnosed as having USH3 caused by the CLRN1 gene mutation. This is the first report of USH3 with a CLRN1 gene mutation in Asian populations. Validating the presence of clinical findings is imperative for properly differentiating among USH subtypes. In addition, mutation screening using MPS enables the identification of causative mutations in USH. The clinical diagnosis of this phenotypically variable disease can then be confirmed. © The Author(s) 2015.

  2. The p16INK4alpha/p19ARF gene mutations are infrequent and are mutually exclusive to p53 mutations in Indian oral squamous cell carcinomas.

    PubMed

    Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G

    2000-03-01

    Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.

  3. Two new mutations in the MTATP6 gene associated with Leigh syndrome.

    PubMed

    Moslemi, A-R; Darin, N; Tulinius, M; Oldfors, A; Holme, E

    2005-10-01

    In this study we have analyzed the mtDNA encoded ATPase 6 and 8 genes ( MTATP6 and MTATP8) in two children with Leigh syndrome (LS) and reduced Mg (2+) ATPase activity in muscle mitochondria. In patient 1, with a mild and reversible phenotype, mutational analysis revealed a heteroplasmic T --> C mutation at nt position 9185 (T9185C) in the MTATP6. The mutation resulted in substitution of a highly conserved leucine to proline at codon 220. The proportion of the mutation was > 97 % in the patient's blood and muscle and 85 % in blood of his asymptomatic mother. Patient 2, with severe clinical phenotype and death at 2 years of age, exhibited a novel heteroplasmic T9191C missense mutation in the MTATP6, which converted a highly conserved leucine to a proline at position 222 of the polypeptide. The proportion of the mutation was 90 % in fibroblasts and 94 % muscle tissue. This mutation was absent in the patient's parents and sister suggesting that the mutation was de novo. Our findings expand the spectrum of mutations causing LS and emphasize the role of MTATP6 gene mutations in pathogenesis of LS.

  4. Novel Mutations in HESX1 and PROP1 Genes in Combined Pituitary Hormone Deficiency.

    PubMed

    Avbelj Stefanija, Magdalena; Kotnik, Primož; Bratanič, Nina; Žerjav Tanšek, Mojca; Bertok, Sara; Bratina, Nataša; Battelino, Tadej; Trebušak Podkrajšek, Katarina

    2015-01-01

    The HESX1 gene is essential in forebrain development and pituitary organogenesis, and its mutations are the most commonly identified genetic cause of septo-optic dysplasia (SOD). The PROP1 gene is involved in anterior pituitary cell lineage specification and is commonly implicated in non-syndromic combined pituitary hormone deficiency (CPHD). We aimed to assess the involvement of HESX1 and PROP1 mutations in a cohort of patients with SOD and CPHD. Six patients with sporadic SOD and 16 patients with CPHD from 14 pedigrees were screened for mutations in HESX1 and PROP1 genes by exon sequencing. Half of the CPHD patients had variable associated clinical characteristics, such as hearing loss, orofacial cleft, kidney disorder or developmental delay. Novel variants were evaluated in silico and verified in SNP databases. A novel heterozygous p.Glu102Gly mutation in the HESX1 gene and a novel homozygous p.Arg121Thr mutation in the PROP1 gene were detected in 2 pedigrees with CPHD. A small previously reported deletion in PROP1 c.301_302delAG was detected in a separate patient with CPHD, in heterozygous state. No mutations were identified in patients with SOD. Our results expand the spectrum of mutations implicated in CPHD. The frequency of 15% of the PROP1 mutations in CPHD was low, likely due to the clinical heterogeneity of the cohort. © 2015 S. Karger AG, Basel.

  5. Summary of mutations underlying autosomal recessive congenital ichthyoses (ARCI) in Arabs with four novel mutations in ARCI-related genes from the United Arab Emirates.

    PubMed

    Bastaki, Fatma; Mohamed, Madiha; Nair, Pratibha; Saif, Fatima; Mustafa, Ethar M; Bizzari, Sami; Al-Ali, Mahmoud T; Hamzeh, Abdul Rezzak

    2017-05-01

    Clinical and molecular heterogeneity is a prominent characteristic of congenital ichthyoses, with the involvement of numerous causative loci. Mutations in these loci feature in autosomal recessive congenital ichthyoses (ARCIs) quite variably, with certain genes/mutations being more frequently uncovered in particular populations. In this study, we used whole exome sequencing as well as direct Sanger sequencing to uncover four novel mutations in ARCI-related genes, which were found in families from the United Arab Emirates. In silico tools such as CADD and SIFT Indel were used to predict the functional consequences of these mutations. The here-presented mutations occurred in three genes (ALOX12B, TGM1, ABCA12), and these are a mixture of missense and indel variants with damaging functional consequences on their encoded proteins. This study presents an overview of the mutations that were found in ARCI-related genes in Arabs and discusses molecular and clinical details pertaining to the above-mentioned Emirati cases and their novel mutations with special emphasis on the resulting protein changes. © 2017 The International Society of Dermatology.

  6. [Identification of novel pathogenic gene mutations in pediatric acute myeloid leukemia by whole-exome resequencing].

    PubMed

    Shiba, Norio

    2015-12-01

    A new class of gene mutations, identified in the pathogenesis of adult acute myeloid leukemia (AML), includes DNMT3A, IDH1/2, TET2 and EZH2. However, these mutations are rare in pediatric AML cases, indicating that pathogeneses differ between adult and pediatric forms of AML. Meanwhile, the recent development of massively parallel sequencing technologies has provided a new opportunity to discover genetic changes across entire genomes or proteincoding sequences. In order to reveal a complete registry of gene mutations, we performed whole exome resequencing of paired tumor-normal specimens from 19 pediatric AML cases using Illumina HiSeq 2000. In total, 80 somatic mutations or 4.2 mutations per sample were identified. Many of the recurrent mutations identified in this study involved previously reported targets in AML, such as FLT3, CEBPA, KIT, CBL, NRAS, WT1 and EZH2. On the other hand, several genes were newly identified in the current study, including BCORL1 and major cohesin components such as SMC3 and RAD21. Whole exome resequencing revealed a complex array of gene mutations in pediatric AML genomes. Our results indicate that a subset of pediatric AML represents a discrete entity that could be discriminated from its adult counterpart, in terms of the spectrum of gene mutations.

  7. Birt-Hogg-Dube Syndrome with a Novel Mutation in the FLCN Gene.

    PubMed

    Kayhan, Gulsum; Yılmaz Demirci, Nilgun; Turktas, Haluk; Ergun, Mehmet Ali

    2017-10-01

    Birt-Hogg-Dube syndrome (BHDS) is an autosomal dominant disease characterized by hair follicle hamartomas, kidney tumors, and spontaneous pneumothorax; its cause is a heterozygous mutation in the FLCN gene. Colorectal polyps and carcinoma have also been reported in BHDS. FLCN mutations can be detected in patients with isolated primary spontaneous pneumothorax (PSP), so PSP may present as part of BHDS. The aim of this report is to enhance awareness that patients presenting with spontaneous PSP should be evaluated for FLCN mutations. A 44-year-old woman with PSP and her parents were analyzed for FLCN mutations. One of the patient's paternal aunts had a PSP and two of her paternal aunts had colon cancer diagnosed at early ages. A novel in-frame deletion in the FLCN gene, c.932_933delCT (P311Rfs*78), was detected in the proband and in her unaffected father. We recommend that molecular analysis of the FLCN gene be performed in patients with PSP and their families, and that mutation carriers be examined for kidney and colon tumors.

  8. LATS2 tumour specific mutations and down-regulation of the gene in non-small cell carcinoma.

    PubMed

    Strazisar, Mojca; Mlakar, Vid; Glavac, Damjan

    2009-06-01

    LATS2 is a new member of the LATS tumour suppressor family. The human LATS2 gene is located at chromosome 13q11-12, a hot spot (67%) for loss of heterozygosity (LOH) in non-small cell lung cancer (NSCLC). We screened 129 non-small cell lung cancer samples and 13 lung cancer cell lines, initially for mutations in the LATS2 gene and subsequently for mutations in P53 and K-RAS genes. Either polymorphisms or mutations were identified in over 50 percent of analysed tumours. A novel missense mutation, S1073R, and a large deletion of 8 amino acids in the PAPA-repeat region were detected in 9 and 2 NSCLC tumours, respectively. Those mutations were not identified in the 13 lung cancer cell lines. Mutations were tumour specific and were absent from adjacent normal tissue and healthy controls. Down-regulation of the LATS2 gene was observed in most NSCLC tumours but was not related to any mutation or polymorphism. Tumours with a LATS2 mutation often also harbour a P53 but not K-RAS gene mutation and were mostly in an advanced stage of development, with regional lymph node involvement.

  9. [Gene Mutation Spectrum of β-Thalassemia in Dai Ethinic Population of Two Border Region in Chinese Yunnan Province].

    PubMed

    Zhang, Jie; He, Jing; Zeng, Xiao-Hong; Su, Jie; Chen, Hong; Xu, Yong-Mei; Pu, Jian; Zhu, Bao-Sheng

    2016-02-01

    To investigate the gene mutation spectrum of β-thalassemia in Dai ethnic population of 2 border region in Chinese Yunnan Province. The patients with β-thalassemia in Dai ethnic population of Dehong and Xishuangbanna autonamic prefecture were screened by using blood routine detection and capillary electrophoresis. The β-globin gene mutation in patients with β-thalassemia were detected by using PCR reverse dot-blot hybridization (PCR-RDB), the constitutive rate of gene mutation in patients with β-thalassemia of Dai ethnic population in two border regions was analyzed and compared. A total of 186 patients with gene mutation of β-thalassemia were confirmed. Among them, 10 gene mutation were found, and the 5 main gene mutations were CD26 (62.56%), CD41-42 (18.97%), CD17 (14.36%), CD71-72 (2.05%) and IVS-II-654 (1.54%). Among Dai ethinic population in Dehong region, 4 gene mutations were found including CD26 (80.31%), CD17 (11.02%), CD41-42 (6.30%) and CD71-72 (2.36%). Among Dai ethinic population in Xishuangbanna region, 6 gene mutations were found, out of them the more common gene mutations were CD41-42 (42.64%), CD26 (29.41%) and CD17 (20.59%). The gene mutations of β-thalassemia in Dai ethinic population of Yunnan province has been confirmed to be more genetic heterogenicity, the spectrums of β-thalassemia mutations in Dai ethinic population of different regions were significant different.

  10. [Analysis of gene mutation in a Chinese family with Norrie disease].

    PubMed

    Zhang, Tian-xiao; Zhao, Xiu-li; Hua, Rui; Zhang, Jin-song; Zhang, Xue

    2012-09-01

    To detect the pathogenic mutation in a Chinese family with Norrie disease. Clinical diagnosis was based on familial history, clinical sign and B ultrasonic examination. Peripheral blood samples were obtained from all available members in a Chinese family with Norrie disease. Genomic DNA was extracted from lymphocytes by the standard SDS-proteinase K-phenol/chloroform method. Two coding exons and all intron-exon boundaries of the NDP gene were PCR amplified using three pairs of primers and subjected to automatic DNA sequence. The causative mutation was confirmed by restriction enzyme analysis and genotyping analysis in all members. Sequence analysis of NDP gene revealed a missense mutation c.220C > T (p.Arg74Cys) in the proband and his mother. Further mutation identification by restriction enzyme analysis and genotyping analysis showed that the proband was homozygote of this mutation. His mother and other four unaffected members (III3, IV4, III5 and II2) were carriers of this mutation. The mutant amino acid located in the C-terminal cystine knot-like domain, which was critical motif for the structure and function of NDP. A NDP missense mutation was identified in a Chinese family with Norrie disease.

  11. [Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].

    PubMed

    Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang

    2011-12-01

    To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.

  12. Clinical impact of recurrently mutated genes on lymphoma diagnostics: state-of-the-art and beyond.

    PubMed

    Rosenquist, Richard; Rosenwald, Andreas; Du, Ming-Qing; Gaidano, Gianluca; Groenen, Patricia; Wotherspoon, Andrew; Ghia, Paolo; Gaulard, Philippe; Campo, Elias; Stamatopoulos, Kostas

    2016-09-01

    Similar to the inherent clinical heterogeneity of most, if not all, lymphoma entities, the genetic landscape of these tumors is markedly complex in the majority of cases, with a rapidly growing list of recurrently mutated genes discovered in recent years by next-generation sequencing technology. Whilst a few genes have been implied to have diagnostic, prognostic and even predictive impact, most gene mutations still require rigorous validation in larger, preferably prospective patient series, to scrutinize their potential role in lymphoma diagnostics and patient management. In selected entities, a predominantly mutated gene is identified in almost all cases (e.g. Waldenström's macroglobulinemia/lymphoplasmacytic lymphoma and hairy-cell leukemia), while for the vast majority of lymphomas a quite diverse mutation pattern is observed, with a limited number of frequently mutated genes followed by a seemingly endless tail of genes with mutations at a low frequency. Herein, the European Expert Group on NGS-based Diagnostics in Lymphomas (EGNL) summarizes the current status of this ever-evolving field, and, based on the present evidence level, segregates mutations into the following categories: i) immediate impact on treatment decisions, ii) diagnostic impact, iii) prognostic impact, iv) potential clinical impact in the near future, or v) should only be considered for research purposes. In the coming years, coordinated efforts aiming to apply targeted next-generation sequencing in large patient series will be needed in order to elucidate if a particular gene mutation will have an immediate impact on the lymphoma classification, and ultimately aid clinical decision making. Copyright© Ferrata Storti Foundation.

  13. Adaptive Mutations in RNA Polymerase and the Transcriptional Terminator Rho Have Similar Effects on Escherichia coli Gene Expression.

    PubMed

    González-González, Andrea; Hug, Shaun M; Rodríguez-Verdugo, Alejandra; Patel, Jagdish Suresh; Gaut, Brandon S

    2017-11-01

    Modifications to transcriptional regulators play a major role in adaptation. Here, we compared the effects of multiple beneficial mutations within and between Escherichia coli rpoB, the gene encoding the RNA polymerase β subunit, and rho, which encodes a transcriptional terminator. These two genes have harbored adaptive mutations in numerous E. coli evolution experiments but particularly in our previous large-scale thermal stress experiment, where the two genes characterized alternative adaptive pathways. To compare the effects of beneficial mutations, we engineered four advantageous mutations into each of the two genes and measured their effects on fitness, growth, gene expression and transcriptional termination at 42.2 °C. Among the eight mutations, two rho mutations had no detectable effect on relative fitness, suggesting they were beneficial only in the context of epistatic interactions. The remaining six mutations had an average relative fitness benefit of ∼20%. The rpoB mutations affected the expression of ∼1,700 genes; rho mutations affected the expression of fewer genes but most (83%) were a subset of those altered by rpoB mutants. Across the eight mutants, relative fitness correlated with the degree to which a mutation restored gene expression back to the unstressed, 37.0 °C state. The beneficial mutations in the two genes did not have identical effects on fitness, growth or gene expression, but they caused parallel phenotypic effects on gene expression and genome-wide transcriptional termination. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  14. Utilization of gene mapping and candidate gene mutation screening for diagnosing clinically equivocal conditions: a Norrie disease case study.

    PubMed

    Chini, Vasiliki; Stambouli, Danai; Nedelea, Florina Mihaela; Filipescu, George Alexandru; Mina, Diana; Kambouris, Marios; El-Shantil, Hatem

    2014-06-01

    Prenatal diagnosis was requested for an undiagnosed eye disease showing X-linked inheritance in a family. No medical records existed for the affected family members. Mapping of the X chromosome and candidate gene mutation screening identified a c.C267A[p.F89L] mutation in NPD previously described as possibly causing Norrie disease. The detection of the c.C267A[p.F89L] variant in another unrelated family confirms the pathogenic nature of the mutation for the Norrie disease phenotype. Gene mapping, haplotype analysis, and candidate gene screening have been previously utilized in research applications but were applied here in a diagnostic setting due to the scarcity of available clinical information. The clinical diagnosis and mutation identification were critical for providing proper genetic counseling and prenatal diagnosis for this family.

  15. Spectrum and prevalence of FP/TMEM127 gene mutations in pheochromocytomas and paragangliomas.

    PubMed

    Yao, Li; Schiavi, Francesca; Cascon, Alberto; Qin, Yuejuan; Inglada-Pérez, Lucia; King, Elizabeth E; Toledo, Rodrigo A; Ercolino, Tonino; Rapizzi, Elena; Ricketts, Christopher J; Mori, Luigi; Giacchè, Mara; Mendola, Antonella; Taschin, Elisa; Boaretto, Francesca; Loli, Paola; Iacobone, Maurizio; Rossi, Gian-Paolo; Biondi, Bernadette; Lima-Junior, José Viana; Kater, Claudio E; Bex, Marie; Vikkula, Miikka; Grossman, Ashley B; Gruber, Stephen B; Barontini, Marta; Persu, Alexandre; Castellano, Maurizio; Toledo, Sergio P A; Maher, Eamonn R; Mannelli, Massimo; Opocher, Giuseppe; Robledo, Mercedes; Dahia, Patricia L M

    2010-12-15

    Pheochromocytomas and paragangliomas are genetically heterogeneous neural crest-derived neoplasms. We recently identified germline mutations of the novel transmembrane-encoding gene FP/TMEM127 in familial and sporadic pheochromocytomas consistent with a tumor suppressor effect. To examine the prevalence and spectrum of FP/TMEM127 mutations in pheochromocytomas and paragangliomas and to test the effect of mutations in vitro. We sequenced the FP/TMEM127 gene in 990 individuals with pheochromocytomas and/or paragangliomas, including 898 previously unreported cases without mutations in other susceptibility genes from 8 independent worldwide referral centers between January 2009 and June 2010. A multiplex polymerase chain reaction-based method was developed to screen for large gene deletions in 545 of these samples. Confocal microscopy of 5 transfected mutant proteins was used to determine their subcellular localization. The frequency and type of FP/TMEM127 mutation or deletion was assessed and correlated with clinical variables; the subcellular localization of 5 overexpressed mutants was compared with wild-type FP/TMEM127 protein. We identified 19 potentially pathogenic FP/TMEM127 germline mutations in 20 independent families, but no large deletions were detected. All mutation carriers had adrenal tumors, including 7 bilateral (P = 2.7 × 10(-4)) and/or with familial disease (5 of 20 samples; P = .005). The median age at disease onset in the FP/TMEM127 mutation group was similar to that of patients without a mutation (41.5 vs 45 years, respectively; P = .54). The most common presentation was that of a single benign adrenal tumor in patients older than 40 years. Malignancy was seen in 1 mutation carrier (5%). Expression of 5 novel FP/TMEM127 mutations in cell lines revealed diffuse localization of the mutant proteins in contrast with the discrete multiorganelle distribution of wild-type TMEM127. Germline mutations of FP/TMEM127 were associated with pheochromocytoma but

  16. Effect of KCNJ5 Mutations on Gene Expression in Aldosterone-Producing Adenomas and Adrenocortical Cells

    PubMed Central

    Monticone, Silvia; Hattangady, Namita G.; Nishimoto, Koshiro; Mantero, Franco; Rubin, Beatrice; Cicala, Maria Verena; Pezzani, Raffaele; Auchus, Richard J.; Ghayee, Hans K.; Shibata, Hirotaka; Kurihara, Isao; Williams, Tracy A.; Giri, Judith G.; Bollag, Roni J.; Edwards, Michael A.; Isales, Carlos M.

    2012-01-01

    Context: Primary aldosteronism is a heterogeneous disease that includes both sporadic and familial forms. A point mutation in the KCNJ5 gene is responsible for familial hyperaldosteronism type III. Somatic mutations in KCNJ5 also occur in sporadic aldosterone producing adenomas (APA). Objective: The objective of the study was to define the effect of the KCNJ5 mutations on gene expression and aldosterone production using APA tissue and human adrenocortical cells. Methods: A microarray analysis was used to compare the transcriptome profiles of female-derived APA samples with and without KCNJ5 mutations and HAC15 adrenal cells overexpressing either mutated or wild-type KCNJ5. Real-time PCR validated a set of differentially expressed genes. Immunohistochemical staining localized the KCNJ5 expression in normal adrenals and APA. Results: We report a 38% (18 of 47) prevalence of KCNJ5 mutations in APA. KCNJ5 immunostaining was highest in the zona glomerulosa of NA and heterogeneous in APA tissue, and KCNJ5 mRNA was 4-fold higher in APA compared with normal adrenals (P < 0.05). APA with and without KCNJ5 mutations displayed slightly different gene expression patterns, notably the aldosterone synthase gene (CYP11B2) was more highly expressed in APA with KCNJ5 mutations. Overexpression of KCNJ5 mutations in HAC15 increased aldosterone production and altered expression of 36 genes by greater than 2.5-fold (P < 0.05). Real-time PCR confirmed increases in CYP11B2 and its transcriptional regulator, NR4A2. Conclusions: KCNJ5 mutations are prevalent in APA, and our data suggest that these mutations increase expression of CYP11B2 and NR4A2, thus increasing aldosterone production. PMID:22628608

  17. INS-gene mutations: from genetics and beta cell biology to clinical disease.

    PubMed

    Liu, Ming; Sun, Jinhong; Cui, Jinqiu; Chen, Wei; Guo, Huan; Barbetti, Fabrizio; Arvan, Peter

    2015-04-01

    A growing list of insulin gene mutations causing a new form of monogenic diabetes has drawn increasing attention over the past seven years. The mutations have been identified in the untranslated regions of the insulin gene as well as the coding sequence of preproinsulin including within the signal peptide, insulin B-chain, C-peptide, insulin A-chain, and the proteolytic cleavage sites both for signal peptidase and the prohormone convertases. These mutations affect a variety of different steps of insulin biosynthesis in pancreatic beta cells. Importantly, although many of these mutations cause proinsulin misfolding with early onset autosomal dominant diabetes, some of the mutant alleles appear to engage different cellular and molecular mechanisms that underlie beta cell failure and diabetes. In this article, we review the most recent advances in the field and discuss challenges as well as potential strategies to prevent/delay the development and progression of autosomal dominant diabetes caused by INS-gene mutations. It is worth noting that although diabetes caused by INS gene mutations is rare, increasing evidence suggests that defects in the pathway of insulin biosynthesis may also be involved in the progression of more common types of diabetes. Collectively, the (pre)proinsulin mutants provide insightful molecular models to better understand the pathogenesis of all forms of diabetes in which preproinsulin processing defects, proinsulin misfolding, and ER stress are involved. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Mutation spectrum of the rhodopsin gene among patients with autosomal dominant retinitis pigmentosa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dryja, T.P.; Han, L.B.; Cowley, G.S.

    1991-10-15

    The authors searched for point mutations in every exon of the rhodopsin gene in 150 patients from separate families with autosomal dominant retinitis pigmentosa. Including the 4 mutations the authors reported previously, they found a total of 17 different mutations that correlate with the disease. Each of these mutations is a single-base substitution corresponding to a single amino acid substitution. Based on current models for the structure of rhodopsin, 3 of the 17 mutant amino acids are normally located on the cytoplasmic side of the protein, 6 in transmembrane domains, and 8 on the intradiscal side. Forty-three of the 150more » patients (29%) carry 1 of these mutations, and no patient has more than 1 mutation. In every family with a mutation so far analyzed, the mutation cosegregates with the disease. They found one instance of a mutation in an affected patient that was absent in both unaffected parents (i.e., a new germ-line mutation), indicating that some isolate cases of retinitis pigmentosa carry a mutation of the rhodopsin gene.« less

  19. [The study of gene mutations in unknown refractory viral infection and primary hemophagocytic lymphohistiocytosis].

    PubMed

    Tong, Chun-Rong; Liu, Hong-Xing; Xie, Jian-Jun; Wang, Fang; Cai, Peng; Wang, Hui; Zhu, Juan; Teng, Wen; Zhang, Xian; Yang, Jun-Fang; Zhang, Ya-Li; Fei, Xin-Hong; Zhao, Jie; Yin, Yu-Ming; Wu, Tong; Wang, Jing-Bo; Sun, Yuan; Liu, Rong; Shi, Xiao-Dong; Lu, Dao-Pei

    2011-04-01

    To study the type and corresponding clinical characteristics of primary hemophagocytic lymphohistiocytosis (HLH) associated immune gene mutations in the refractory virus infection or HLH of unknown causes. From December 2009 to July 2010, the patients with refractory virus infection or HLH of unknown causes were screened for the primary HLH associated immune genes mutations by DNA sequence analysis, including PRF1, UNC13D, STX11, STXBP2, SH2D1A and XIAP. The clinical characteristics and outcomes were followed up. Totally 25 patients with refractory virus infection or HLH of unknown causes were investigated for the 6 genes and 13 cases were found carrying gene mutations, composing of 6 of PRF1 mutation, 3 of UNC13D, and each one of STX11, XIAP, SH2D1A and STXBP2, respectively. Among the 13 cases with gene mutations, 5 suffered from Epstein-Barr virus associated HLH (EBV-HLH), 1 human herpes virus 7 associated HLH (HHV7-HLH), 1 HLH without causes, 4 chronic activated EB virus infection (CAEBV) with 1 progressing to Hodgkin's lymphoma carrying abnormal chromosome of t(15;17) (q22;q25) and hyperdiploid, 2 EBV associated lymphoma. Among the other 12 patients without gene mutation, 4 suffered from EBV-HLH with 1 progressing to peripheral T lymphoma, 8 suffered from CAEBV. Primary HLH associated immune gene mutations are critical causes of refractory virus infection of unknown causes, most patients manifest as HLH, some cases appear in CAEBV and EBV associated lymphoma. DNA sequence analysis is helpful to early diagnosis and correct decision-making for treatment.

  20. [Analysis of EML4-ALK gene fusion mutation in patients 
with non-small cell lung cancer].

    PubMed

    Wang, Xuzhou; Chen, Weisheng; Yu, Yinghao

    2015-02-01

    Non-small cell lung cancer (NSCLC) is the main type of lung cancer, and the related locus mutation detection research has become a hot direction of molecular targeted therapy, studying on gene mutation status of echinodem microtubule associated protein like 4-Anaplastic lymphoma kinase (EML4-ALK) and epidermal growth factor receptor (EGFR), detecting the sensitivity of EML4-ALK gene fusion and gene mutation of EGFR. EML4-ALK gene fusion in 85 cases of paraffin embedded tumor tissue and adjacent lung tissue was detected with the application of immunohistochemistry (IHC), Scorpions amplification refractory mutation system (Scorpions ARMS) fluorescence quantitative PCR and fluorescence in situ hybridization (FISH) technology, and EGFR gene in 18, 19, 20 and 21 exon mutation status was detected with the application of ARMS method. In 115 cases of NSCLC, IHC showed 32 cases with ALK (D5F3) expression, the expression rate was 27.8%; ARMS showed 27 cases with EML4-ALK fusion gene mutation, the mutation detection rate was 23.5%; 53 cases were detected with EGFR mutation, the mutation rate was 46%. While FISH showed 23 cases with EML4-ALK fusion gene mutation, the detection rate was 20%, slightly lower than the ARMS detection results, suggesting that ARMS more sensitive. The application of IHC, ARMS fluorescence quantitative PCR and FISH technology can make a rapid and accurate evaluation of EML4-ALK gene fusion.

  1. Detecting negative selection on recurrent mutations using gene genealogy

    PubMed Central

    2013-01-01

    Background Whether or not a mutant allele in a population is under selection is an important issue in population genetics, and various neutrality tests have been invented so far to detect selection. However, detection of negative selection has been notoriously difficult, partly because negatively selected alleles are usually rare in the population and have little impact on either population dynamics or the shape of the gene genealogy. Recently, through studies of genetic disorders and genome-wide analyses, many structural variations were shown to occur recurrently in the population. Such “recurrent mutations” might be revealed as deleterious by exploiting the signal of negative selection in the gene genealogy enhanced by their recurrence. Results Motivated by the above idea, we devised two new test statistics. One is the total number of mutants at a recurrently mutating locus among sampled sequences, which is tested conditionally on the number of forward mutations mapped on the sequence genealogy. The other is the size of the most common class of identical-by-descent mutants in the sample, again tested conditionally on the number of forward mutations mapped on the sequence genealogy. To examine the performance of these two tests, we simulated recurrently mutated loci each flanked by sites with neutral single nucleotide polymorphisms (SNPs), with no recombination. Using neutral recurrent mutations as null models, we attempted to detect deleterious recurrent mutations. Our analyses demonstrated high powers of our new tests under constant population size, as well as their moderate power to detect selection in expanding populations. We also devised a new maximum parsimony algorithm that, given the states of the sampled sequences at a recurrently mutating locus and an incompletely resolved genealogy, enumerates mutation histories with a minimum number of mutations while partially resolving genealogical relationships when necessary. Conclusions With their

  2. 'RetinoGenetics': a comprehensive mutation database for genes related to inherited retinal degeneration.

    PubMed

    Ran, Xia; Cai, Wei-Jun; Huang, Xiu-Feng; Liu, Qi; Lu, Fan; Qu, Jia; Wu, Jinyu; Jin, Zi-Bing

    2014-01-01

    Inherited retinal degeneration (IRD), a leading cause of human blindness worldwide, is exceptionally heterogeneous with clinical heterogeneity and genetic variety. During the past decades, tremendous efforts have been made to explore the complex heterogeneity, and massive mutations have been identified in different genes underlying IRD with the significant advancement of sequencing technology. In this study, we developed a comprehensive database, 'RetinoGenetics', which contains informative knowledge about all known IRD-related genes and mutations for IRD. 'RetinoGenetics' currently contains 4270 mutations in 186 genes, with detailed information associated with 164 phenotypes from 934 publications and various types of functional annotations. Then extensive annotations were performed to each gene using various resources, including Gene Ontology, KEGG pathways, protein-protein interaction, mutational annotations and gene-disease network. Furthermore, by using the search functions, convenient browsing ways and intuitive graphical displays, 'RetinoGenetics' could serve as a valuable resource for unveiling the genetic basis of IRD. Taken together, 'RetinoGenetics' is an integrative, informative and updatable resource for IRD-related genetic predispositions. Database URL: http://www.retinogenetics.org/. © The Author(s) 2014. Published by Oxford University Press.

  3. [Hot spot mutation screening of RYR1 gene in diagnosis of congenital myopathies].

    PubMed

    Chang, Xing-zhi; Jin, Yi-wen; Wang, Jing-min; Yuan, Yun; Xiong, Hui; Wang, Shuang; Qin, Jiong

    2014-10-18

    To detect hot spot mutation of RYR1 gene in 15 cases of congenital myopathy with different subtypes, and to discuss the value of RYR1 gene hot spot mutation detection in the diagnosis of the disease. Clinical data were collected in all the patients, including clinical manifestations and signs, serum creatine kinase, electromyography. Fourteen of the patients accepted the muscle biopsy. Hot spot mutation in the C-terminal of RYR1 gene (extron 96-106) had been detected in all the 15 patients. All the patients presented with motor development delay, and they could walk at the age of 1 to 3.5 years,but were always easy to fall and could not run or jump. There were no progressive deteriorations. Physical examination showed different degrees of muscle weakness and hypotonia.High arched palates were noted in 3 patients. The serum levels of creatine kinase were mildly elevated in 3 cases, and normal in 12 cases. Electromyography showed "myogenic" features in 11 patients, being normal in the other 4 patients. Muscle biopsy pathologic diagnosis was the central core disease in 3 patients, the central nuclei in 2 patients, the congenital fiber type disproportion in 2 patients, the nameline myopathy in 3 patient, the multiminicore disease in 1 patient, and nonspecific minimal changes in the other 3 patients; one patient was diagnosed with central core disease according to positive family history and gene mutation. In the family case (Patient 2) of central core disease, the c.14678G>A (p.Arg4893Gln) mutation in 102 extron of RYR1 was identified in three members of the family, which had been reported to be a pathogenic mutation. The c.14596A>G(p.Lys4866Gln) mutation in 101 extron was found in one patient with central core disease(Patient 1), and the c.14719G>A(p.Gly4907Ser) mutation in 102 extron was found in another case of the central core disease(Patient 3).The same novel mutation was verified in one of the patients' (Patient 3) asymptomatic father. Congenital myopathies in

  4. Two common low density lipoprotein receptor gene mutations cause familial hypercholesterolemia in Afrikaners.

    PubMed Central

    Leitersdorf, E; Van der Westhuyzen, D R; Coetzee, G A; Hobbs, H H

    1989-01-01

    Familial hypercholesterolemia (FH), an autosomal dominant disease caused by mutations in the LDL receptor gene, is five times more frequent in the Afrikaner population of South Africa than it is in the population of the United States and Europe. It has been proposed that the high frequency is due to a founder effect. In this paper, we characterized 24 mutant LDL receptor alleles from 12 Afrikaner individuals homozygous for FH. We identified two mutations that together makeup greater than 95% of the mutant LDL receptor genes represented in our sample. Both mutations were basepair substitutions that result in single-amino acid changes. Each mutation can be detected readily with the polymerase chain reaction and restriction analysis. The finding of two common LDL receptor mutations in the Afrikaner FH homozygotes predicts that these mutations will predominate in the Afrikaner population and that the high frequency of FH is due to a founder effect. The increased incidence of ischemic heart disease in the Afrikaner population may in part be due to the high frequency of these two mutations in the LDL receptor gene. Images PMID:2569482

  5. NLGN3/NLGN4 gene mutations are not responsible for autism in the Quebec population.

    PubMed

    Gauthier, Julie; Bonnel, Anna; St-Onge, Judith; Karemera, Liliane; Laurent, Sandra; Mottron, Laurent; Fombonne, Eric; Joober, Ridha; Rouleau, Guy A

    2005-01-05

    Jamain [2003: Nat Genet 34:27-29] recently reported mutations in two neuroligin genes in sib-pairs affected with autism. In order to confirm these causative mutations in our autistic population and to determine their frequency we screened 96 individuals affected with autism. We found no mutations in these X-linked genes. These results indicate that mutations in NLGN3 and NLGN4 genes are responsible for at most a small fraction of autism cases and additional screenings in other autistic populations are needed to better determine the frequency with which mutations in NLGN3 and NLGN4 occur in autism. Copyright 2004 Wiley-Liss, Inc.

  6. IDENTIFICATION OF NOVEL FIBROBLAST GROWTH FACTOR RECEPTOR 3 GENE MUTATIONS IN ACTINIC CHEILITIS

    PubMed Central

    Chou, Annie; Dekker, Nusi; Jordan, Richard C.K.

    2009-01-01

    Objective Activating mutations in the fibroblast growth factor receptor 3 (FGFR3) gene are responsible for several craniosynostosis and chondrodysplasia syndromes as well as some human cancers including bladder and cervical carcinoma. Despite a high frequency in some benign skin disorders, FGFR3 mutations have not been reported in cutaneous malignancies. Actinic cheilitis (AC) is a sun-induced premalignancy affecting the lower lip that frequently progresses to squamous cell carcinoma (SCC). The objective of this study was to determine if FGFR3 gene mutations are present in AC and SCC of the lip. Study Design DNA was extracted and purified from micro-dissected, formalin-fixed, paraffin-embedded tissue sections of 20 cases of AC and SCC arising in AC. Exons 7, 15, and 17 were PCR amplified and direct sequenced. Results Four novel somatic mutations in the FGFR3 gene were identified: exon 7 mutation 742C→T (amino acid change R248C), exon 15 mutations 1850A→G (D617G) and 1888G→A (V630M), and exon 17 mutation 2056G→A (E686K). Grade of dysplasia did not correlate with presence of mutations. Conclusion The frequency of FGFR3 receptor mutations suggests a functional role for the FGFR3 receptor in the development of epithelial disorders and perhaps a change may contribute to the pathogenesis of some AC and SCC. PMID:19327639

  7. Study of hepatitis B virus gene mutations with enzymatic colorimetry-based DNA microarray.

    PubMed

    Mao, Hailei; Wang, Huimin; Zhang, Donglei; Mao, Hongju; Zhao, Jianlong; Shi, Jian; Cui, Zhichu

    2006-01-01

    To establish a modified microarray method for detecting HBV gene mutations in the clinic. Site-specific oligonucleotide probes were immobilized to microarray slides and hybridized to biotin-labeled HBV gene fragments amplified from two-step PCR. Hybridized targets were transferred to nitrocellulose membranes, followed by intensity measurement using BCIP/NBT colorimetry. HBV genes from 99 Hepatitis B patients and 40 healthy blood donors were analyzed. Mutation frequencies of HBV pre-core/core and basic core promoter (BCP) regions were found to be significantly higher in the patient group (42%, 40% versus 2.5%, 5%, P < 0.01). Compared with a traditional fluorescence method, the colorimetry method exhibited the same level of sensitivity and reproducibility. An enzymatic colorimetry-based DNA microarray assay was successfully established to monitor HBV mutations. Pre-core/core and BCP mutations of HBV genes could be major causes of HBV infection in HBeAg-negative patients and could also be relevant to chronicity and aggravation of hepatitis B.

  8. Feature genes predicting the FLT3/ITD mutation in acute myeloid leukemia.

    PubMed

    Li, Chenglong; Zhu, Biao; Chen, Jiao; Huang, Xiaobing

    2016-07-01

    In the present study, gene expression profiles of acute myeloid leukemia (AML) samples were analyzed to identify feature genes with the capacity to predict the mutation status of FLT3/ITD. Two machine learning models, namely the support vector machine (SVM) and random forest (RF) methods, were used for classification. Four datasets were downloaded from the European Bioinformatics Institute, two of which (containing 371 samples, including 281 FLT3/ITD mutation-negative and 90 mutation‑positive samples) were randomly defined as the training group, while the other two datasets (containing 488 samples, including 350 FLT3/ITD mutation-negative and 138 mutation-positive samples) were defined as the test group. Differentially expressed genes (DEGs) were identified by significance analysis of the microarray data by using the training samples. The classification efficiency of the SCM and RF methods was evaluated using the following parameters: Sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV) and the area under the receiver operating characteristic curve. Functional enrichment analysis was performed for the feature genes with DAVID. A total of 585 DEGs were identified in the training group, of which 580 were upregulated and five were downregulated. The classification accuracy rates of the two methods for the training group, the test group and the combined group using the 585 feature genes were >90%. For the SVM and RF methods, the rates of correct determination, specificity and PPV were >90%, while the sensitivity and NPV were >80%. The SVM method produced a slightly better classification effect than the RF method. A total of 13 biological pathways were overrepresented by the feature genes, mainly involving energy metabolism, chromatin organization and translation. The feature genes identified in the present study may be used to predict the mutation status of FLT3/ITD in patients with AML.

  9. X-Linked Hypohidrotic Ectodermal Dysplasia: New Features and a Novel EDA Gene Mutation.

    PubMed

    Savasta, Salvatore; Carlone, Giorgia; Castagnoli, Riccardo; Chiappe, Francesca; Bassanese, Francesco; Piras, Roberta; Salpietro, Vincenzo; Brazzelli, Valeria; Verrotti, Alberto; Marseglia, Gian L

    2017-01-01

    We described a 5-year-old male with hypodontia, hypohidrosis, and facial dysmorphisms characterized by a depressed nasal bridge, maxillary hypoplasia, and protuberant lips. Chromosomal analysis revealed a normal 46,XY male karyotype. Due to the presence of clinical features of hypohidrotic ectodermal dysplasia (HED), the EDA gene, located at Xq12q13.1, of the patient and his family was sequenced. Analysis of the proband's sequence revealed a missense mutation (T to A transversion) in hemizygosity state at nucleotide position 158 in exon 1 of the EDA gene, which changes codon 53 from leucine to histidine, while heterozygosity at this position was detected in the slightly affected mother; moreover, this mutation was not found in the publically available Human Gene Mutation Database. To date, our findings indicate that a novel mutation in EDA is associated with X-linked HED, adding it to the repertoire of EDA mutations. © 2017 S. Karger AG, Basel.

  10. Whole exome sequencing reveals concomitant mutations of multiple FA genes in individual Fanconi anemia patients

    PubMed Central

    2014-01-01

    Background Fanconi anemia (FA) is a rare inherited genetic syndrome with highly variable clinical manifestations. Fifteen genetic subtypes of FA have been identified. Traditional complementation tests for grouping studies have been used generally in FA patients and in stepwise methods to identify the FA type, which can result in incomplete genetic information from FA patients. Methods We diagnosed five pediatric patients with FA based on clinical manifestations, and we performed exome sequencing of peripheral blood specimens from these patients and their family members. The related sequencing data were then analyzed by bioinformatics, and the FANC gene mutations identified by exome sequencing were confirmed by PCR re-sequencing. Results Homozygous and compound heterozygous mutations of FANC genes were identified in all of the patients. The FA subtypes of the patients included FANCA, FANCM and FANCD2. Interestingly, four FA patients harbored multiple mutations in at least two FA genes, and some of these mutations have not been previously reported. These patients’ clinical manifestations were vastly different from each other, as were their treatment responses to androstanazol and prednisone. This finding suggests that heterozygous mutation(s) in FA genes could also have diverse biological and/or pathophysiological effects on FA patients or FA gene carriers. Interestingly, we were not able to identify de novo mutations in the genes implicated in DNA repair pathways when the sequencing data of patients were compared with those of their parents. Conclusions Our results indicate that Chinese FA patients and carriers might have higher and more complex mutation rates in FANC genes than have been conventionally recognized. Testing of the fifteen FANC genes in FA patients and their family members should be a regular clinical practice to determine the optimal care for the individual patient, to counsel the family and to obtain a better understanding of FA pathophysiology

  11. Whole exome sequencing reveals concomitant mutations of multiple FA genes in individual Fanconi anemia patients.

    PubMed

    Chang, Lixian; Yuan, Weiping; Zeng, Huimin; Zhou, Quanquan; Wei, Wei; Zhou, Jianfeng; Li, Miaomiao; Wang, Xiaomin; Xu, Mingjiang; Yang, Fengchun; Yang, Yungui; Cheng, Tao; Zhu, Xiaofan

    2014-05-15

    Fanconi anemia (FA) is a rare inherited genetic syndrome with highly variable clinical manifestations. Fifteen genetic subtypes of FA have been identified. Traditional complementation tests for grouping studies have been used generally in FA patients and in stepwise methods to identify the FA type, which can result in incomplete genetic information from FA patients. We diagnosed five pediatric patients with FA based on clinical manifestations, and we performed exome sequencing of peripheral blood specimens from these patients and their family members. The related sequencing data were then analyzed by bioinformatics, and the FANC gene mutations identified by exome sequencing were confirmed by PCR re-sequencing. Homozygous and compound heterozygous mutations of FANC genes were identified in all of the patients. The FA subtypes of the patients included FANCA, FANCM and FANCD2. Interestingly, four FA patients harbored multiple mutations in at least two FA genes, and some of these mutations have not been previously reported. These patients' clinical manifestations were vastly different from each other, as were their treatment responses to androstanazol and prednisone. This finding suggests that heterozygous mutation(s) in FA genes could also have diverse biological and/or pathophysiological effects on FA patients or FA gene carriers. Interestingly, we were not able to identify de novo mutations in the genes implicated in DNA repair pathways when the sequencing data of patients were compared with those of their parents. Our results indicate that Chinese FA patients and carriers might have higher and more complex mutation rates in FANC genes than have been conventionally recognized. Testing of the fifteen FANC genes in FA patients and their family members should be a regular clinical practice to determine the optimal care for the individual patient, to counsel the family and to obtain a better understanding of FA pathophysiology.

  12. Mutation analysis of seven known glaucoma-associated genes in Chinese patients with glaucoma.

    PubMed

    Huang, Xiaobo; Li, Miaoling; Guo, Xiangming; Li, Shiqiang; Xiao, Xueshan; Jia, Xiaoyun; Liu, Xing; Zhang, Qingjiong

    2014-05-13

    To evaluate mutations in the MYOC, WDR36, OPTN, OPA1, NTF4, CYP1B1, and LTBP2 genes in a cohort of Chinese patients with primary glaucoma. Genomic DNA was prepared from 683 unrelated patients, including 50 with primary congenital glaucoma, 104 with juvenile open-angle glaucoma (JOAG), 186 with primary open-angle glaucoma (POAG), and 343 with primary angle-closure glaucoma (PACG). Mutations in the seven genes in 257 patients (36 with JOAG, 89 with POAG, and 132 with PACG) were initially analyzed by exome sequencing and then confirmed by Sanger sequencing. In addition, Sanger sequencing was used to detect MYOC mutations in the remaining 426 patients. Exome sequencing identified 19 mutations (6 in MYOC, 9 in WDR36, 3 in OPA1, and 1 in OPTN) in 20 of 257 patients, including 4 patients with JOAG, 8 patients with POAG, and 8 patients with PACG. No mutation was detected in the other three genes. In addition, Sanger sequencing detected additional MYOC mutations in 5 of the remaining 426 patients, including 3 patients with JOAG and 2 patients with POAG. Twenty-two mutations in MYOC, WDR36, OPA1, and OPTN were detected in 25 of the 683 patients with primary glaucoma, including nine MYOC mutations in 11 patients, nine WDR36 mutations in 11 patients, three OPA1 mutations in 3 patients, and one OPTN mutation in a patient who also carried a MYOC mutation. Eight mutations in MYOC, WDR36, and OPA1 in 8 of the 343 PACG patients are of uncertain significance and need to be analyzed further. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

  13. Detection of epidermal growth factor receptor gene T790M mutation in cytology samples using the cobas® EGFR mutation test.

    PubMed

    Satouchi, Miyako; Tanaka, Hiroshi; Yoshioka, Hiroshige; Shimokawaji, Tadasuke; Mizuno, Keiko; Takeda, Koji; Yoshino, Ichiro; Seto, Takashi; Kurata, Takayasu; Tashiro, Naoki; Hagiwara, Koichi

    2017-09-01

    Detection of epidermal growth factor receptor (EGFR) gene mutations is essential in deciding therapeutic strategy in non-small cell lung cancer (NSCLC) patients at initial diagnosis. Moreover, in EGFR mutation-positive (EGFRm) NSCLC patients, re-biopsy at disease progression to clarify resistance mechanisms is also important. However, collecting histology samples is often difficult because of inaccessibility and invasiveness. In some cases, only cytology samples can be collected, and studies have reported that cytology samples are appropriate for EGFR gene mutation testing. The cobas ® EGFR Mutation Test (Roche Molecular Systems Inc., Branchburg, New Jersey, USA) is approved as a companion diagnostic for osimertinib, a third-generation EGFR-tyrosine kinase inhibitor approved in Japan. However, it is not clear whether the EGFR T790M mutation can be detected in cytology samples using this test. The primary objective of this study was to assess concordance of EGFR T790M gene mutation detection between histology and matched cytology samples using the cobas ® EGFR Mutation Test. We conducted a multicenter, observational study in Japan. Overall, 41 EGFRm NSCLC patients who had both histology and cytology samples collected at the same time at re-biopsy and with the results of EGFR mutation test using histology samples were enrolled. The EGFR mutation status of both sample types was tested using the cobas ® EGFR Mutation Test and the concordance rates were calculated. The EGFR T790M mutation detection rate in histology and cytology samples was 42.5% and 37.5%, respectively. The overall percent agreement between the histology and cytology samples was 91.7%. These data demonstrate that the cobas ® EGFR Mutation Test can detect the EGFR T790M mutation in both cytology and histology samples. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  14. Iron overload and HFE gene mutations in Czech patients with chronic liver diseases.

    PubMed

    Dostalikova-Cimburova, Marketa; Kratka, Karolina; Stransky, Jaroslav; Putova, Ivana; Cieslarova, Blanka; Horak, Jiri

    2012-01-01

    The aim of the study was to identify the prevalence of HFE gene mutations in Czech patients with chronic liver diseases and the influence of the mutations on iron status. The presence of HFE gene mutations (C282Y, H63D, and S65C) analyzed by the PCR-RFLP method, presence of cirrhosis, and serum iron indices were compared among 454 patients with different chronic liver diseases (51 with chronic hepatitis B, 122 with chronic hepatitis C, 218 with alcoholic liver disease, and 63 patients with hemochromatosis). Chronic liver diseases patients other than hemochromatics did not have an increased frequency of HFE gene mutations compared to controls. Although 33.3% of patients with hepatitis B, 43% of patients with hepatitis C, and 73.2% of patients with alcoholic liver disease had elevated transferrin saturation or serum ferritin levels, the presence of HFE gene mutations was not significantly associated with iron overload in these patients. Additionally, patients with cirrhosis did not have frequencies of HFE mutations different from those without cirrhosis. This study emphasizes the importance, not only of C282Y, but also of the H63D homozygous genetic constellation in Czech hemochromatosis patients. Our findings show that increased iron indices are common in chronic liver diseases but {\\it HFE} mutations do not play an important role in the pathogenesis of chronic hepatitis B, chronic hepatitis C, and alcoholic liver disease.

  15. Genes with mutation significance were highly associated with the clinical pattern of patients with breast cancer.

    PubMed

    Ding, Wan-Jun; Zeng, Tao; Wang, Li-Jun; Lei, Hong-Bo; Ge, Wei; Wang, Zhi

    2017-11-17

    In the United States, breast cancer is the second leading cause of cancer death in women. Over the past 20 years, breast cancer incidence and mortality rates increased rapidly in developing regions. We aimed to identify the gene mutation patterns that associated with the clinical patterns, including survival status, histo-pathological classes and so forth, of breast cancer. We retrieved 1098 cases of the clinical information, and level-3 legacy data of mRNA expression level, protein expression data and mutation files from GDC data portal. The genes with mutation significance were obtained. We studied the impacts of mutation types on the expression levels of mRNA and protein. Different statistics methods were used to calculate the correlation between the mutation types and the expression data or histo-clinical measures. There were 24 genes with mutation significance identified. The most mutated genes were selected to study the role of specific mutations played on the patients with breast cancer. One interesting finding was the missense mutations on TP53 were related with high expression levels of mRNA and protein. The missense mutations on TP53 were highly related with the morphology, race, ER status, PR status and HER2 Status, while the truncated mutations were only related with the morphology, ER status and PR status. The missense mutation on PIK3CA was highly associated with the morphology, race, ER status and PR status. The mutants with different mutants and the wild type of the most mutated genes had different impacts on the histo-clinical measures that might help personalized therapy.

  16. VCP gene analyses in Japanese patients with sporadic amyotrophic lateral sclerosis identify a new mutation.

    PubMed

    Hirano, Makito; Nakamura, Yusaku; Saigoh, Kazumasa; Sakamoto, Hikaru; Ueno, Shuichi; Isono, Chiharu; Mitsui, Yoshiyuki; Kusunoki, Susumu

    2015-03-01

    Accumulating evidence has proven that mutations in the VCP gene encoding valosin-containing protein (VCP) cause inclusion body myopathy with Paget disease of the bone and frontotemporal dementia. This gene was later found to be causative for amyotrophic lateral sclerosis (ALS), a fatal neurodegenerative disease, occurring typically in elderly persons. We thus sequenced the VCP gene in 75 Japanese patients with sporadic ALS negative for mutations in other genes causative for ALS and found a novel mutation, p.Arg487His, in 1 patient. The newly identified mutant as well as known mutants rendered neuronal cells susceptible to oxidative stress. The presence of the mutation in the Japanese population extends the geographic region for involvement of the VCP gene in sporadic ALS to East Asia. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Chromatin remodelling and DNA repair genes are frequently mutated in endometrioid endometrial carcinoma.

    PubMed

    García-Sanz, Pablo; Triviño, Juan Carlos; Mota, Alba; Pérez López, María; Colás, Eva; Rojo-Sebastián, Alejandro; García, Ángel; Gatius, Sonia; Ruiz, María; Prat, Jaime; López-López, Rafael; Abal, Miguel; Gil-Moreno, Antonio; Reventós, Jaume; Matias-Guiu, Xavier; Moreno-Bueno, Gema

    2017-04-01

    In developed countries, endometrial carcinoma is the most common cancer that affects the female genital tract. Endometrial carcinoma is divided into two main histological types, type I or endometrioid and type II or non-endometrioid, each of which have characteristic, although not exclusive, molecular alterations and mutational profiles. Nevertheless, information about the implication and relevance of some of these genes in this disease is lacking. We sought here to identify new recurrently mutated genes in endometrioid cancers that play a role in tumourigenesis and that influence the clinical outcome. We focused on low-grade, non-ultramutated tumours as these tumours have a worse prognosis than the ultramutated POLE-positive endometrioid endometrial carcinomas (EECs). We performed exome-sequencing of 11 EECs with matched normal tissue and subsequently validated 15 candidate genes in 76 samples. For the first time, we show that mutations in chromatin remodelling-related genes (KMT2D, KMT2C, SETD1B and BCOR) and in DNA-repair-related genes (BRCA1, BRCA2, RAD50 and CHD4) are frequent in this subtype of endometrial cancer. The alterations to these genes occurred with frequencies ranging from 35.5% for KMT2D to 10.5% for BRCA1 and BCOR, with some showing a tendency toward co-occurrence (RAD50-KMT2D and RAD50-SETD1B). All these genes harboured specific mutational hotspots. In addition, the mutational status of KMT2C, KMT2D and SETD1B helps to predict the degree of myometrial invasion, a critical prognostic feature. These results highlight the possible implication of these genes in this disease, creating opportunities for new therapeutic approaches. © 2016 UICC.

  18. Leveraging Distant Relatedness to Quantify Human Mutation and Gene-Conversion Rates

    PubMed Central

    Palamara, Pier Francesco; Francioli, Laurent C.; Wilton, Peter R.; Genovese, Giulio; Gusev, Alexander; Finucane, Hilary K.; Sankararaman, Sriram; Sunyaev, Shamil R.; de Bakker, Paul I.W.; Wakeley, John; Pe’er, Itsik; Price, Alkes L.

    2015-01-01

    The rate at which human genomes mutate is a central biological parameter that has many implications for our ability to understand demographic and evolutionary phenomena. We present a method for inferring mutation and gene-conversion rates by using the number of sequence differences observed in identical-by-descent (IBD) segments together with a reconstructed model of recent population-size history. This approach is robust to, and can quantify, the presence of substantial genotyping error, as validated in coalescent simulations. We applied the method to 498 trio-phased sequenced Dutch individuals and inferred a point mutation rate of 1.66 × 10−8 per base per generation and a rate of 1.26 × 10−9 for <20 bp indels. By quantifying how estimates varied as a function of allele frequency, we inferred the probability that a site is involved in non-crossover gene conversion as 5.99 × 10−6. We found that recombination does not have observable mutagenic effects after gene conversion is accounted for and that local gene-conversion rates reflect recombination rates. We detected a strong enrichment of recent deleterious variation among mismatching variants found within IBD regions and observed summary statistics of local sharing of IBD segments to closely match previously proposed metrics of background selection; however, we found no significant effects of selection on our mutation-rate estimates. We detected no evidence of strong variation of mutation rates in a number of genomic annotations obtained from several recent studies. Our analysis suggests that a mutation-rate estimate higher than that reported by recent pedigree-based studies should be adopted in the context of DNA-based demographic reconstruction. PMID:26581902

  19. [Copy number variation of trinucleotide repeat in dynamic mutation sites of autosomal dominant cerebellar ataxias related genes].

    PubMed

    Chen, Pu; Ma, Mingyi; Shang, Huifang; Su, Dan; Zhang, Sizhong; Yang, Yuan

    2009-12-01

    To standardize the experimental procedure of the gene test for autosomal dominant cerebellar ataxias (ADCA), and provide the basis for quantitative criteria of the dynamic mutation of spinocerebellar ataxia (SCA) genes in Chinese population. Genotyping of the dynamic mutation loci of the SCA1, SCA2, SCA3, SCA6 and SCA7 genes was performed, using florescence PCR-capillary electrophoresis followed by DNA sequencing, to investigate the variation range of copy number of CAG tandem repeat of the genes in 263 probands of ADCA pedigrees and 261 non-related normal controls. Based on the sequencing result, the bias of the CAG copy number estimation using capillary electrophoresis with different DNA controls was compared to analyze the technical detailes of the electrophresis method in testing the dynamic mutation sites. PCR products containing dynamic mutation loci of the SCA genes showed significantly higher mobility than that of molecular weigh marker with relatively balanced GC content. This was particularly obvious in the SCA2, SCA 6 and SCA7 genes whereas the deviation of copy number could be corrected to +/-1 when known CAG copy number fragments were used as controls. The mobility of PCR products was primarily related to the copy number of CAG repeat when the fragments contained normal CAG repeat. In the 263 ADCA pedigrees, 6 (2.28%) carried SCA1 gene mutation, 8 (3.04%) had SCA2 mutation and 81 (30.80%) harbored SCA3 mutation. The gene mutation of SCA6 and SCA7 was not found. The normal variation range of the CAG repeat was 17-36 copies in SCA1 gene, 13-30 copies in SCA2, 14-39 copies in SCA3, 6-16 copies in SCA6 and 6-13 copies in SCA7. The heterozygosity was 76.1%, 17.7%, 74.4%, 72.1% and 41.3%, respectively. The mutation range of the CAG repeat was 49-56 copies in SCA1 gene, 36-41 copies in SCA2, 59-81 copies in SCA3. Neither homozygous mutation of an SCA gene nor double heterozygous mutation of the SCA genes was observed in the study. The copy number of the CAG

  20. Somatic frameshift mutations in the Bloom syndrome BLM gene are frequent in sporadic gastric carcinomas with microsatellite mutator phenotype

    PubMed Central

    Calin, George; Ranzani, Guglielmina N; Amadori, Dino; Herlea, Vlad; Matei, Irina; Barbanti-Brodano, Giuseppe; Negrini, Massimo

    2001-01-01

    Background Genomic instability has been reported at microsatellite tracts in few coding sequences. We have shown that the Bloom syndrome BLM gene may be a target of microsatelliteinstability (MSI) in a short poly-adenine repeat located in its coding region. To further characterize the involvement of BLM in tumorigenesis, we have investigated mutations in nine genes containing coding microsatellites in microsatellite mutator phenotype (MMP) positive and negative gastric carcinomas (GCs). Methods We analyzed 50 gastric carcinomas (GCs) for mutations in the BLM poly(A) tract aswell as in the coding microsatellites of the TGFβ1-RII, IGFIIR, hMSH3, hMSH6, BAX, WRN, RECQL and CBL genes. Results BLM mutations were found in 27% of MMP+ GCs (4/15 cases) but not in any of the MMP negative GCs (0/35 cases). The frequency of mutations in the other eight coding regions microsatellite was the following: TGFβ1-RII (60 %), BAX (27%), hMSH6 (20%),hMSH3 (13%), CBL (13%), IGFIIR (7%), RECQL (0%) and WRN (0%). Mutations in BLM appear to be more frequently associated with frameshifts in BAX and in hMSH6and/or hMSH3. Tumors with BLM alterations present a higher frequency of unstable mono- and trinucleotide repeats located in coding regions as compared with mutator phenotype tumors without BLM frameshifts. Conclusions BLM frameshifts are frequent alterations in GCs specifically associated with MMP+tumors. We suggest that BLM loss of function by MSI may increase the genetic instability of a pre-existent unstable genotype in gastric tumors. PMID:11532193

  1. Identification of constrained cancer driver genes based on mutation timing.

    PubMed

    Sakoparnig, Thomas; Fried, Patrick; Beerenwinkel, Niko

    2015-01-01

    Cancer drivers are genomic alterations that provide cells containing them with a selective advantage over their local competitors, whereas neutral passengers do not change the somatic fitness of cells. Cancer-driving mutations are usually discriminated from passenger mutations by their higher degree of recurrence in tumor samples. However, there is increasing evidence that many additional driver mutations may exist that occur at very low frequencies among tumors. This observation has prompted alternative methods for driver detection, including finding groups of mutually exclusive mutations and incorporating prior biological knowledge about gene function or network structure. Dependencies among drivers due to epistatic interactions can also result in low mutation frequencies, but this effect has been ignored in driver detection so far. Here, we present a new computational approach for identifying genomic alterations that occur at low frequencies because they depend on other events. Unlike passengers, these constrained mutations display punctuated patterns of occurrence in time. We test this driver-passenger discrimination approach based on mutation timing in extensive simulation studies, and we apply it to cross-sectional copy number alteration (CNA) data from ovarian cancer, CNA and single-nucleotide variant (SNV) data from breast tumors and SNV data from colorectal cancer. Among the top ranked predicted drivers, we find low-frequency genes that have already been shown to be involved in carcinogenesis, as well as many new candidate drivers. The mutation timing approach is orthogonal and complementary to existing driver prediction methods. It will help identifying from cancer genome data the alterations that drive tumor progression.

  2. Identification of Constrained Cancer Driver Genes Based on Mutation Timing

    PubMed Central

    Sakoparnig, Thomas; Fried, Patrick; Beerenwinkel, Niko

    2015-01-01

    Cancer drivers are genomic alterations that provide cells containing them with a selective advantage over their local competitors, whereas neutral passengers do not change the somatic fitness of cells. Cancer-driving mutations are usually discriminated from passenger mutations by their higher degree of recurrence in tumor samples. However, there is increasing evidence that many additional driver mutations may exist that occur at very low frequencies among tumors. This observation has prompted alternative methods for driver detection, including finding groups of mutually exclusive mutations and incorporating prior biological knowledge about gene function or network structure. Dependencies among drivers due to epistatic interactions can also result in low mutation frequencies, but this effect has been ignored in driver detection so far. Here, we present a new computational approach for identifying genomic alterations that occur at low frequencies because they depend on other events. Unlike passengers, these constrained mutations display punctuated patterns of occurrence in time. We test this driver–passenger discrimination approach based on mutation timing in extensive simulation studies, and we apply it to cross-sectional copy number alteration (CNA) data from ovarian cancer, CNA and single-nucleotide variant (SNV) data from breast tumors and SNV data from colorectal cancer. Among the top ranked predicted drivers, we find low-frequency genes that have already been shown to be involved in carcinogenesis, as well as many new candidate drivers. The mutation timing approach is orthogonal and complementary to existing driver prediction methods. It will help identifying from cancer genome data the alterations that drive tumor progression. PMID:25569148

  3. Overexpression of genes involved in miRNA biogenesis in medullary thyroid carcinomas with RET mutation.

    PubMed

    Puppin, Cinzia; Durante, Cosimo; Sponziello, Marialuisa; Verrienti, Antonella; Pecce, Valeria; Lavarone, Elisa; Baldan, Federica; Campese, Antonio Francesco; Boichard, Amelie; Lacroix, Ludovic; Russo, Diego; Filetti, Sebastiano; Damante, Giuseppe

    2014-11-01

    Abnormal expression of non-coding micro RNA (miRNA) has been described in medullary thyroid carcinoma (MTC). Expression of genes encoding factors involved in miRNA biogenesis results often deregulated in human cancer and correlates with aggressive clinical behavior. In this study, expression of four genes involved in miRNA biogenesis (DICER, DROSHA, DCGR8, and XPO5) was investigated in 54 specimens of MTC. Among them, 33 and 13 harbored RET and RAS mutations, respectively. DICER, DGCR8, and XPO5 mRNA levels were significantly overexpressed in MTC harboring RET mutations, in particular, in the presence of RET634 mutation. When MTCs with RET and RAS mutations were compared, only DGCR8 displayed a significant difference, while MTCs with RAS mutations did not show significant differences with respect to non-mutated tumors. We then attempted to correlate expression of miRNA biogenesis genes with tumor aggressiveness. According to the TNM status, MTCs were divided in two groups and compared (N0 M0 vs. N1 and/or M1): for all four genes no significant difference was detected. Cell line experiments, in which expression of a RET mutation is silenced by siRNA, suggest the existence of a causal relationship between RET mutation and overexpression of DICER, DGCR8, and XPO5 genes. These findings demonstrate that RET- but not RAS-driven tumorigenic alterations include abnormalities in the expression of some important genes involved in miRNA biogenesis that could represent new potential markers for targeted therapies in the treatment of RET-mutated MTCs aimed to restore the normal miRNA expression profile.

  4. Characterization of differential gene expression in adrenocortical tumors harboring beta-catenin (CTNNB1) mutations.

    PubMed

    Durand, Julien; Lampron, Antoine; Mazzuco, Tania L; Chapman, Audrey; Bourdeau, Isabelle

    2011-07-01

    Mutations of β-catenin gene (CTNNB1) are frequent in adrenocortical adenomas (AA) and adrenocortical carcinomas (ACC). However, the target genes of β-catenin have not yet been identified in adrenocortical tumors. Our objective was to identify genes deregulated in adrenocortical tumors harboring CTNNB1 genetic alterations and nuclear accumulation of β-catenin. Microarray analysis identified a dataset of genes that were differently expressed between AA with CTNNB1 mutations and wild-type (WT) tumors. Within this dataset, the expression profiles of five genes were validated by real time-PCR (RT-PCR) in a cohort of 34 adrenocortical tissues (six AA and one ACC with CTNNB1 mutations, 13 AA and four ACC with WT CTNNB1, and 10 normal adrenal glands) and two human ACC cell lines. We then studied the effects of suppressing β-catenin transcriptional activity with the T-cell factor/β-catenin inhibitors PKF115-584 and PNU74654 on gene expression in H295R and SW13 cells. RT-PCR analysis confirmed the overexpression of ISM1, RALBP1, and PDE2A and the down-regulation of PHYHIP in five of six AA harboring CTNNB1 mutations compared with WT AA (n = 13) and normal adrenal glands (n = 10). RALBP1 and PDE2A overexpression was also confirmed at the protein level by Western blotting analysis in mutated tumors. ENC1 was specifically overexpressed in three of three AA harboring CTNNB1 point mutations. mRNA expression and protein levels of RALBP1, PDE2A, and ENC1 were decreased in a dose-dependent manner in H295R cells after treatment with PKF115-584 or PNU74654. This study identified candidate genes deregulated in CTNNB1-mutated adrenocortical tumors that may lead to a better understanding of the role of the Wnt-β-catenin pathway in adrenocortical tumorigenesis.

  5. New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands.

    PubMed

    Florijn, Ralph J; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J J M; Mannens, Marcel M A M; Tijmes, Nel; Brooks, Simon P; Hardcastle, Alison J; Bergen, Arthur A B

    2006-09-01

    Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the Netherlands, by dHPLC and direct sequencing. We identified an unique mutation in each family. Three out of these four mutations were not reported before. We report here the first splice site sequence alteration mutation and three protein truncating mutations. Our results suggest that X-linked cataract and NHS are allelic disorders.

  6. Phenotypic Involvement in Females with the FMR1 Gene Mutation.

    ERIC Educational Resources Information Center

    Riddle, J. E.; Cheema, A.; Sobesky, W. E.; Gardner, S. C.; Taylor, A. K.; Pennington, B. F.; Hagerman, R. J.

    1998-01-01

    A study investigated phenotypic effects seen in 114 females with premutation and 41 females (ages 18-58) with full Fragile X mental retardation gene mutation. Those with the full mutation had a greater incidence of hand-flapping, eye contact problems, special education help for reading and math, and grade retention. (Author/CR)

  7. Mutations in the pericentrin (PCNT) gene cause primordial dwarfism.

    PubMed

    Rauch, Anita; Thiel, Christian T; Schindler, Detlev; Wick, Ursula; Crow, Yanick J; Ekici, Arif B; van Essen, Anthonie J; Goecke, Timm O; Al-Gazali, Lihadh; Chrzanowska, Krystyna H; Zweier, Christiane; Brunner, Han G; Becker, Kristin; Curry, Cynthia J; Dallapiccola, Bruno; Devriendt, Koenraad; Dörfler, Arnd; Kinning, Esther; Megarbane, André; Meinecke, Peter; Semple, Robert K; Spranger, Stephanie; Toutain, Annick; Trembath, Richard C; Voss, Egbert; Wilson, Louise; Hennekam, Raoul; de Zegher, Francis; Dörr, Helmuth-Günther; Reis, André

    2008-02-08

    Fundamental processes influencing human growth can be revealed by studying extreme short stature. Using genetic linkage analysis, we find that biallelic loss-of-function mutations in the centrosomal pericentrin (PCNT) gene on chromosome 21q22.3 cause microcephalic osteodysplastic primordial dwarfism type II (MOPD II) in 25 patients. Adults with this rare inherited condition have an average height of 100 centimeters and a brain size comparable to that of a 3-month-old baby, but are of near-normal intelligence. Absence of PCNT results in disorganized mitotic spindles and missegregation of chromosomes. Mutations in related genes are known to cause primary microcephaly (MCPH1, CDK5RAP2, ASPM, and CENPJ).

  8. The role of mutations in the SCN5A gene in cardiomyopathies.

    PubMed

    Zaklyazminskaya, Elena; Dzemeshkevich, Sergei

    2016-07-01

    The SCN5A gene encodes the alpha-subunit of the Nav1.5 ion channel protein, which is responsible for the sodium inward current (INa). Since 1995 several hundred mutations in this gene have been found to be causative for inherited arrhythmias including Long QT syndrome, Brugada syndrome, cardiac conduction disease, sudden infant death syndrome, etc. As expected these syndromes are primarily electrical heart diseases leading to life-threatening arrhythmias with an "apparently normal heart". In 2003 a new form of dilated cardiomyopathy was identified associated with mutations in the SCN5A gene. Recently mutations have been also found in patients with arrhythmogenic right ventricular cardiomyopathy and atrial standstill. The purpose of this review is to outline and analyze the following four topics: 1) SCN5A genetic variants linked to different cardiomyopathies; 2) clinical manifestations of the known mutations; 3) possible molecular mechanisms of myocardial remodeling; and 4) the potential implications of gene-specific treatment for those disorders. This article is part of a Special Issue entitled: Cardiomyocyte Biology: Integration of Developmental and Environmental Cues in the Heart edited by Marcus Schaub and Hughes Abriel. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Risk of colorectal cancer for people with a mutation in both a MUTYH and a DNA mismatch repair gene.

    PubMed

    Win, Aung Ko; Reece, Jeanette C; Buchanan, Daniel D; Clendenning, Mark; Young, Joanne P; Cleary, Sean P; Kim, Hyeja; Cotterchio, Michelle; Dowty, James G; MacInnis, Robert J; Tucker, Katherine M; Winship, Ingrid M; Macrae, Finlay A; Burnett, Terrilea; Le Marchand, Loïc; Casey, Graham; Haile, Robert W; Newcomb, Polly A; Thibodeau, Stephen N; Lindor, Noralane M; Hopper, John L; Gallinger, Steven; Jenkins, Mark A

    2015-12-01

    The base excision repair protein, MUTYH, functionally interacts with the DNA mismatch repair (MMR) system. As genetic testing moves from testing one gene at a time, to gene panel and whole exome next generation sequencing approaches, understandin g the risk associated with co-existence of germline mutations in these genes will be important for clinical interpretation and management. From the Colon Cancer Family Registry, we identified 10 carriers who had both a MUTYH mutation (6 with c.1187G>A p.(Gly396Asp), 3 with c.821G>A p.(Arg274Gln), and 1 with c.536A>G p.(Tyr179Cys)) and a MMR gene mutation (3 in MLH1, 6 in MSH2, and 1 in PMS2), 375 carriers of a single (monoallelic) MUTYH mutation alone, and 469 carriers of a MMR gene mutation alone. Of the 10 carriers of both gene mutations, 8 were diagnosed with colorectal cancer. Using a weighted cohort analysis, we estimated that risk of colorectal cancer for carriers of both a MUTYH and a MMR gene mutation was substantially higher than that for carriers of a MUTYH mutation alone [hazard ratio (HR) 21.5, 95% confidence interval (CI) 9.19-50.1; p < 0.001], but not different from that for carriers of a MMR gene mutation alone (HR 1.94, 95% CI 0.63-5.99; p = 0.25). Within the limited power of this study, there was no evidence that a monoallelic MUTYH gene mutation confers additional risk of colorectal cancer for carriers of a MMR gene mutation alone. Our finding suggests MUTYH mutation testing in MMR gene mutation carriers is not clinically informative.

  10. Novel mutations in the RB1 gene from Chinese families with a history of retinoblastoma.

    PubMed

    Zhang, Leilei; Jia, Renbing; Zhao, Junyang; Fan, Jiayan; Zhou, YiXiong; Han, Bing; Song, Xin; Wu, Li; Zhang, He; Song, Huaidong; Ge, Shengfang; Fan, Xianqun

    2015-04-01

    Retinoblastoma is an aggressive eye cancer that develops during infancy and is divided into two clinical types, sporadic and heritable. RB1 has been identified as the only pathological gene responsible for heritable retinoblastoma. Here, we identified 11 RB1 germline mutations in the Han pedigrees of 17 bilateral retinoblastoma patients from China. Four mutations were nonsense mutations, five were splice site mutations, and two resulted in a frame shift due to an insertion or a deletion. Three of the mutations had not been previously reported, and the p.Q344L mutation occurred in two generations of retinoblastoma patients. We investigated phenotypic-genotypic relationships for the novel mutations and showed that these mutations affected the expression, location, and function of the retinoblastoma protein. Abnormal protein localization was observed after transfection of the mutant genes. In addition, changes in the cell cycle distribution and apoptosis rates were observed when the Saos-2 cell line was transfected with plasmids encoding the mutant RB1 genes. Our findings expand the spectrum of known RB1 mutations and will benefit the investigation of RB1 mutation hotspots. Genetic counseling can be offered to families with heritable RB1 mutations.

  11. [Analysis of MAT1A gene mutations in a child affected with simple hypermethioninemia].

    PubMed

    Sun, Yun; Ma, Dingyuan; Wang, Yanyun; Yang, Bin; Jiang, Tao

    2017-02-10

    To detect potential mutations of MAT1A gene in a child suspected with simple hypermethioninemia by MS/MS neonatal screening. Clinical data of the child was collected. Genomic DNA was extracted by a standard method and subjected to targeted sequencing using an Ion Ampliseq TM Inherited Disease Panel. Detected mutations were verified by Sanger sequencing. The child showed no clinical features except evaluated methionine. A novel compound mutation of the MAT1A gene, i.e., c.345delA and c.529C>T, was identified in the child. His father and mother were found to be heterozygous for the c.345delA mutation and c.529C>T mutation, respectively. The compound mutation c.345delA and c.529C>T of the MAT1A gene probably underlie the disease in the child. The semi-conductor sequencing has provided an important means for the diagnosis of hereditary diseases.

  12. A spectrum of novel NPHS1 and NPHS2 gene mutations in pediatric nephrotic syndrome patients from Pakistan.

    PubMed

    Abid, Aiysha; Khaliq, Shagufta; Shahid, Saba; Lanewala, Ali; Mubarak, Mohammad; Hashmi, Seema; Kazi, Javed; Masood, Tahir; Hafeez, Farkhanda; Naqvi, Syed Ali Anwar; Rizvi, Syed Adeebul Hasan; Mehdi, Syed Qasim

    2012-07-10

    Mutations in the NPHS1 and NPHS2 genes are among the main causes of early-onset and familial steroid resistant nephrotic syndrome respectively. This study was carried out to assess the frequencies of mutations in these two genes in a cohort of Pakistani pediatric NS patients. Mutation analysis was carried out by direct sequencing of the NPHS1 and NPHS2 genes in 145 nephrotic syndrome (NS) patients. This cohort included 36 samples of congenital or infantile onset NS cases and 39 samples of familial cases obtained from 30 families. A total of 7 homozygous (6 novel) mutations were found in the NPHS1 gene and 4 homozygous mutations in the NPHS2 gene. All mutations in the NPHS1 gene were found in the early onset cases. Of these, one patient has a family history of NS. Homozygous p.R229Q mutation in the NPHS2 gene was found in two children with childhood-onset NS. Our results show a low prevalence of disease causing mutations in the NPHS1 (22% early onset, 5.5% overall) and NPHS2 (3.3% early onset and 3.4% overall) genes in the Pakistani NS children as compared to the European populations. In contrast to the high frequency of the NPHS2 gene mutations reported for familial SRNS in Europe, no mutation was found in the familial Pakistani cases. To our knowledge, this is the first comprehensive screening of the NPHS1 and NPHS2 gene mutations in sporadic and familial NS cases from South Asia. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. High frequency of coexistent mutations of PIK3CA and PTEN genes in endometrial carcinoma.

    PubMed

    Oda, Katsutoshi; Stokoe, David; Taketani, Yuji; McCormick, Frank

    2005-12-01

    The phosphatidylinositol 3'-kinase (PI3K) pathway is activated in many human cancers. In addition to inactivation of the PTEN tumor suppressor gene, mutations or amplifications of the catalytic subunit alpha of PI3K (PIK3CA) have been reported. However, the coexistence of mutations in these two genes seems exceedingly rare. As PTEN mutations occur at high frequency in endometrial carcinoma, we screened 66 primary endometrial carcinomas for mutations in the helical and catalytic domains of PIK3CA. We identified a total of 24 (36%) mutations in this gene and coexistence of PIK3CA/PTEN mutations at high frequency (26%). PIK3CA mutations were more common in tumors with PTEN mutations (17 of 37, 46%) compared with those without PTEN mutations (7 of 29, 24%). Array comparative genomic hybridization detected 3q24-qter amplification, which covers the PIK3CA gene (3q26.3), in one of nine tumors. Knocking down PTEN expression in the HEC-1B cell line, which possesses both K-Ras and PIK3CA mutations, further enhances phosphorylation of Akt (Ser473), indicating that double mutation of PIK3CA and PTEN has an additive effect on PI3K activation. Our data suggest that the PI3K pathway is extensively activated in endometrial carcinomas, and that combination of PIK3CA/PTEN alterations might play an important role in development of these tumors.

  14. [The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].

    PubMed

    Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi

    2014-12-01

    To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.

  15. Mutations within the HBc gene of the hepatitis B virus: a study on Iranian patients.

    PubMed

    Zare-Bidaki, Mohammad; Ayoobi, Fatemeh; Hassanshahi, Gholamhossein; Arababadi, Mohammad Kazemi; Mirzaei, Tayebeh; Darehdori, Ahmad Shebanizade; Kennedy, Derek

    2014-01-01

    Hepatitis B virus (HBV) is a serious risk factor for several severe liver diseases such as cirrhosis and hepatocellular carcinoma. HBV, like other viruses, uses several mechanisms to escape from specific immune responses including the use of mutations in the genome which lead to epitope variations. There are several immune responses, including T helper cells, cytotoxic T lymphocytes, and B cells, against the core antigen of HBV (HBcAg) that can lead to HBV eradication. Therefore, mutations within the HBc gene can lead to escape from immune responses by HBV and, hence, understanding the prevalence of HBc mutations among a specific population can be helpful for future treatment and vaccination. This review addresses the recent information regarding the prevalence of mutations within the HBc gene among Iranian HBV infected patients. The data presented here was collected gene sequences reported from Iran to the NCBI nucleotide Gen Bank. Results showed that the prevalence of HBc gene mutations is frequent in Iranian HBV infected patients. Based on our searches it seems that escape from immune responses is a plausible reason for the high prevalence of HBc gene mutations among Iranian HBV infected patients.

  16. Mutations in the AVPR2, AVP-NPII, and AQP2 genes in Turkish patients with diabetes insipidus.

    PubMed

    Duzenli, Duygu; Saglar, Emel; Deniz, Ferhat; Azal, Omer; Erdem, Beril; Mergen, Hatice

    2012-12-01

    The aim of this study was to identify mutations in three different genes, the arginine-vasopressin-neurophysin II (AVP-NPII) gene, the arginine-vasopressin receptor 2 (AVPR2) gene, and the vasopressin-sensitive water channel aquaporin-2 (AQP2) gene in Turkish patients affected by central diabetes insipidus or nephrogenic diabetes insipidus. This study included 15 patients from unrelated families. Prospective clinical data were collected for all patients including the patients underwent a water deprivation-desmopressin test. The coding regions of the AVPR2, AQP2, and AVP-NPII genes were amplified by polymerase chain reaction and submitted to direct sequence analysis. Of the 15 patients with diabetes insipidus referred to Gulhane Military Medical Academy, Department of Endocrinology and Metabolism, eight patients have AVPR2 mutations, five patients have AQP2 mutations and two patients have AVP-NPII mutations. Of the patients, which have AVPR2 mutations, one is compound heterozygous for AVPR2 gene. Seven of these mutations are novel. Comparison of the clinical outcomes of these mutations may facilitate in understanding the functions of AVP-NPII, AQP2, and AVPR2 genes in future studies.

  17. Molecular Analysis of Glucose-6-Phosphate Dehydrogenase Gene Mutations in Bangladeshi Individuals

    PubMed Central

    Sarker, Suprovath Kumar; Hossain, Mohammad Amir; Qadri, Syeda Kashfi; Muraduzzaman, A. K. M.; Bhuyan, Golam Sarower; Shahidullah, Mohammod; Mannan, Mohammad Abdul; Tahura, Sarabon; Hussain, Manzoor; Akhter, Shahida; Nahar, Nazmun; Shirin, Tahmina; Qadri, Firdausi; Mannoor, Kaiissar

    2016-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common X-linked human enzyme defect of red blood cells (RBCs). Individuals with this gene defect appear normal until exposed to oxidative stress which induces hemolysis. Consumption of certain foods such as fava beans, legumes; infection with bacteria or virus; and use of certain drugs such as primaquine, sulfa drugs etc. may result in lysis of RBCs in G6PD deficient individuals. The genetic defect that causes G6PD deficiency has been identified mostly as single base missense mutations. One hundred and sixty G6PD gene mutations, which lead to amino acid substitutions, have been described worldwide. The purpose of this study was to detect G6PD gene mutations in hospital-based settings in the local population of Dhaka city, Bangladesh. Qualitative fluorescent spot test and quantitative enzyme activity measurement using RANDOX G6PDH kit were performed for analysis of blood specimens and detection of G6PD-deficient participants. For G6PD-deficient samples, PCR was done with six sets of primers specific for G6PD gene. Automated Sanger sequencing of the PCR products was performed to identify the mutations in the gene. Based on fluorescence spot test and quantitative enzyme assay followed by G6PD gene sequencing, 12 specimens (11 males and one female) among 121 clinically suspected patient-specimens were found to be deficient, suggesting a frequency of 9.9% G6PD deficiency. Sequencing of the G6PD-deficient samples revealed c.C131G substitution (exon-3: Ala44Gly) in six samples, c.G487A substitution (exon-6:Gly163Ser) in five samples and c.G949A substitution (exon-9: Glu317Lys) of coding sequence in one sample. These mutations either affect NADP binding or disrupt protein structure. From the study it appears that Ala44Gly and Gly163Ser are the most common G6PD mutations in Dhaka, Bangladesh. This is the first study of G6PD mutations in Bangladesh. PMID:27880809

  18. Mutational analysis in patients with Autosomal Dominant Polycystic Kidney Disease (ADPKD): Identification of five mutations in the PKD1 gene.

    PubMed

    Abdelwahed, Mayssa; Hilbert, Pascale; Ahmed, Asma; Mahfoudh, Hichem; Bouomrani, Salem; Dey, Mouna; Hachicha, Jamil; Kamoun, Hassen; Keskes-Ammar, Leila; Belguith, Neïla

    2018-05-31

    Autosomal Dominant Polycystic Kidney Disease (ADPKD), the most frequent genetic disorder of the kidneys, is characterized by a typical presenting symptoms include cysts development in different organs and a non-cysts manifestations. ADPKD is caused by mutations in PKD1 or PKD2 genes. In this study, we aimed to search for molecular causative defects among PKD1 and PKD2 genes. Eighteen patients were diagnosed based on renal ultrasonography and renal/extra-renal manifestations. Then, Sanger sequencing was performed for PKD1 and PKD2 genes. Multiplex Ligation dependent Probe Amplification method (MLPA) methods was performed for both PKD genes. Mutational analysis of the PKD2 gene revealed the absence of variants and no deletions or duplications of both PKD genes were detected. But three novels mutations i.e. p.S463C exon 7; c. c.11156+2T>C IVS38 and c.8161-1G>A IVS22 and two previously reported c.1522T>C exon 7 and c.412C>T exon 4 mutations in the PKD1 gene were detected. Bioinformatics tools predicted that the novel variants have a pathogenic effects on splicing machinery, pre-mRNA secondary structure and stability and protein stability. Our results highlighted molecular features of Tunisian patients with ADPKD and revealed novel variations that can be utilized in clinical diagnosis and in the evaluation of living kidney donor. To the best of our knowledge, this is the first report of Autosomal Polycystic Kidney Disease in Tunisia. Copyright © 2017. Published by Elsevier B.V.

  19. Recognizable cerebellar dysplasia associated with mutations in multiple tubulin genes

    PubMed Central

    Oegema, Renske; Cushion, Thomas D.; Phelps, Ian G.; Chung, Seo-Kyung; Dempsey, Jennifer C.; Collins, Sarah; Mullins, Jonathan G.L.; Dudding, Tracy; Gill, Harinder; Green, Andrew J.; Dobyns, William B.; Ishak, Gisele E.; Rees, Mark I.; Doherty, Dan

    2015-01-01

    Mutations in alpha- and beta-tubulins are increasingly recognized as a major cause of malformations of cortical development (MCD), typically lissencephaly, pachygyria and polymicrogyria; however, sequencing tubulin genes in large cohorts of MCD patients has detected tubulin mutations in only 1–13%. We identified patients with a highly characteristic cerebellar dysplasia but without lissencephaly, pachygyria and polymicrogyria typically associated with tubulin mutations. Remarkably, in seven of nine patients (78%), targeted sequencing revealed mutations in three different tubulin genes (TUBA1A, TUBB2B and TUBB3), occurring de novo or inherited from a mosaic parent. Careful re-review of the cortical phenotype on brain imaging revealed only an irregular pattern of gyri and sulci, for which we propose the term tubulinopathy-related dysgyria. Basal ganglia (100%) and brainstem dysplasia (80%) were common features. On the basis of in silico structural predictions, the mutations affect amino acids in diverse regions of the alpha-/beta-tubulin heterodimer, including the nucleotide binding pocket. Cell-based assays of tubulin dynamics reveal various effects of the mutations on incorporation into microtubules: TUBB3 p.Glu288Lys and p.Pro357Leu do not incorporate into microtubules at all, whereas TUBB2B p.Gly13Ala shows reduced incorporation and TUBA1A p.Arg214His incorporates fully, but at a slower rate than wild-type. The broad range of effects on microtubule incorporation is at odds with the highly stereotypical clinical phenotype, supporting differential roles for the three tubulin genes involved. Identifying this highly characteristic phenotype is important due to the low recurrence risk compared with the other (recessive) cerebellar dysplasias and the apparent lack of non-neurological medical issues. PMID:26130693

  20. Mutations in a novel gene with transmembrane domains underlie Usher syndrome type 3.

    PubMed

    Joensuu, T; Hämäläinen, R; Yuan, B; Johnson, C; Tegelberg, S; Gasparini, P; Zelante, L; Pirvola, U; Pakarinen, L; Lehesjoki, A E; de la Chapelle, A; Sankila, E M

    2001-10-01

    Usher syndrome type 3 (USH3) is an autosomal recessive disorder characterized by progressive hearing loss, severe retinal degeneration, and variably present vestibular dysfunction, assigned to 3q21-q25. Here, we report on the positional cloning of the USH3 gene. By haplotype and linkage-disequilibrium analyses in Finnish carriers of a putative founder mutation, the critical region was narrowed to 250 kb, of which we sequenced, assembled, and annotated 207 kb. Two novel genes-NOPAR and UCRP-and one previously identified gene-H963-were excluded as USH3, on the basis of mutational analysis. USH3, the candidate gene that we identified, encodes a 120-amino-acid protein. Fifty-two Finnish patients were homozygous for a termination mutation, Y100X; patients in two Finnish families were compound heterozygous for Y100X and for a missense mutation, M44K, whereas patients in an Italian family were homozygous for a 3-bp deletion leading to an amino acid deletion and substitution. USH3 has two predicted transmembrane domains, and it shows no homology to known genes. As revealed by northern blotting and reverse-transcriptase PCR, it is expressed in many tissues, including the retina.

  1. Mutations inside rifampicin-resistance determining region of rpoB gene associated with rifampicin-resistance in Mycobacterium tuberculosis.

    PubMed

    Zaw, Myo T; Emran, Nor A; Lin, Zaw

    2018-04-26

    Rifampicin (RIF) plays a pivotal role in the treatment of tuberculosis due to its bactericidal effects. Because the action of RIF is on rpoB gene encoding RNA polymerase β subunit, 95% of RIF resistant mutations are present in rpoB gene. The majority of the mutations in rpoB gene are found within an 81bp RIF-resistance determining region (RRDR). Literatures on RIF resistant mutations published between 2010 and 2016 were thoroughly reviewed. The most commonly mutated codons in RRDR of rpoB gene are 531, 526 and 516. The possibilities of absence of mutation in RRDR of rpoB gene in MDR-TB isolates in few studies was due to existence of other rare rpoB mutations outside RRDR or different mechanism of rifampicin resistance. Molecular methods which can identify extensive mutations associated with multiple anti-tuberculous drugs are in urgent need so that the research on drug resistant mutations should be extended. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  2. Zinc finger point mutations within the WT1 gene in Wilms tumor patients.

    PubMed Central

    Little, M H; Prosser, J; Condie, A; Smith, P J; Van Heyningen, V; Hastie, N D

    1992-01-01

    A proposed Wilms tumor gene, WT1, which encodes a zinc finger protein, has previously been isolated from human chromosome 11p13. Chemical mismatch cleavage analysis was used to identify point mutations in the zinc finger region of this gene in a series of 32 Wilms tumors. Two exonic single base changes were detected. In zinc finger 3 of a bilateral Wilms tumor patient, a constitutional de novo C----T base change was found changing an arginine to a stop codon. One tumor from this patient showed allele loss leading to 11p hemizygosity of the abnormal allele. In zinc finger 2 of a sporadic Wilms tumor patient, a C----T base change resulted in an arginine to cysteine amino acid change. To our knowledge, a WT1 gene missense mutation has not been detected previously in a Wilms tumor. By comparison with a recent NMR and x-ray crystallographic analysis of an analogous zinc finger gene, early growth response gene 1 (EGR1), this amino acid change in WT1 occurs at a residue predicted to be critical for DNA binding capacity and site specificity. The detection of one nonsense point mutation and one missense WT1 gene point mutation adds to the accumulating evidence implicating this gene in a proportion of Wilms tumor patients. Images PMID:1317572

  3. Prenatal diagnosis of fetal glutaric aciduria type 1 with rare compound heterozygous mutations in GCDH gene.

    PubMed

    Peng, Hsiu-Huei; Shaw, Sheng-Wen; Huang, Kuan-Gen

    2018-02-01

    Glutaric aciduria type 1 is a rare disease, with the estimated prevalence about 1 in 100,000 newborns. GCDH gene mutation can lead to glutaric acid and 3- OH glutaric acid accumulation, with clinical manifestation of neuronal damage, brain atrophy, microencephalic macrocephaly, decreased coordination of swallowing, poor muscle coordination, spasticity, and severe dystonic movement disorder. A 22-year-old female, Gravida 4 Para 2, is pregnancy at 13 weeks of gestational age. Her first child is normal, however, the second child was diagnosed as glutaric aciduria type I after birth. She came to our hospital for prenatal genetic counselling of her fetus at 13 weeks of gestational age. We performed GCDH gene mutation analysis of maternal blood showed IVS 3 + 1 G > A heterozygous mutation, GCDH gene mutation analysis of paternal blood showed c. 1240 G > A heterozygous mutation, and the second child has compound heterozygous IVS 3 + 1 G > A and c. 1240 G > A mutations. Later, we performed amniocentesis at 16 weeks of gestational age for chromosome study and GCDH gene mutation analysis for the fetus. The fetal chromosome study showed normal karyotype, however, GCDH gene mutation analysis showed compound heterozygous IVS 3 + 1 G > A and c. 1240 G > A mutations. The couple decided to termination of pregnancy thereafter. Glutaric acidemia type 1 is an autosomal recessive disorder because of pathogenic mutations in the GCDH gene. Early diagnosis and therapy of glutaric acidemia type 1 can reduce the risk of neuronal damage and acute dystonia. We report a case of prenatal diagnosis of fetal glutaric aciduria type 1 with rare compound heterozygous GCDH gene mutation at IVS 3 + 1 G > A and c. 1240 G > A mutations, which provide better genetic counselling for the couples. Copyright © 2018. Published by Elsevier B.V.

  4. Integrated Analysis of Mutation Data from Various Sources Identifies Key Genes and Signaling Pathways in Hepatocellular Carcinoma

    PubMed Central

    Wei, Lin; Tang, Ruqi; Lian, Baofeng; Zhao, Yingjun; He, Xianghuo; Xie, Lu

    2014-01-01

    Background Recently, a number of studies have performed genome or exome sequencing of hepatocellular carcinoma (HCC) and identified hundreds or even thousands of mutations in protein-coding genes. However, these studies have only focused on a limited number of candidate genes, and many important mutation resources remain to be explored. Principal Findings In this study, we integrated mutation data obtained from various sources and performed pathway and network analysis. We identified 113 pathways that were significantly mutated in HCC samples and found that the mutated genes included in these pathways contained high percentages of known cancer genes, and damaging genes and also demonstrated high conservation scores, indicating their important roles in liver tumorigenesis. Five classes of pathways that were mutated most frequently included (a) proliferation and apoptosis related pathways, (b) tumor microenvironment related pathways, (c) neural signaling related pathways, (d) metabolic related pathways, and (e) circadian related pathways. Network analysis further revealed that the mutated genes with the highest betweenness coefficients, such as the well-known cancer genes TP53, CTNNB1 and recently identified novel mutated genes GNAL and the ADCY family, may play key roles in these significantly mutated pathways. Finally, we highlight several key genes (e.g., RPS6KA3 and PCLO) and pathways (e.g., axon guidance) in which the mutations were associated with clinical features. Conclusions Our workflow illustrates the increased statistical power of integrating multiple studies of the same subject, which can provide biological insights that would otherwise be masked under individual sample sets. This type of bioinformatics approach is consistent with the necessity of making the best use of the ever increasing data provided in valuable databases, such as TCGA, to enhance the speed of deciphering human cancers. PMID:24988079

  5. Integrated analysis of mutation data from various sources identifies key genes and signaling pathways in hepatocellular carcinoma.

    PubMed

    Zhang, Yuannv; Qiu, Zhaoping; Wei, Lin; Tang, Ruqi; Lian, Baofeng; Zhao, Yingjun; He, Xianghuo; Xie, Lu

    2014-01-01

    Recently, a number of studies have performed genome or exome sequencing of hepatocellular carcinoma (HCC) and identified hundreds or even thousands of mutations in protein-coding genes. However, these studies have only focused on a limited number of candidate genes, and many important mutation resources remain to be explored. In this study, we integrated mutation data obtained from various sources and performed pathway and network analysis. We identified 113 pathways that were significantly mutated in HCC samples and found that the mutated genes included in these pathways contained high percentages of known cancer genes, and damaging genes and also demonstrated high conservation scores, indicating their important roles in liver tumorigenesis. Five classes of pathways that were mutated most frequently included (a) proliferation and apoptosis related pathways, (b) tumor microenvironment related pathways, (c) neural signaling related pathways, (d) metabolic related pathways, and (e) circadian related pathways. Network analysis further revealed that the mutated genes with the highest betweenness coefficients, such as the well-known cancer genes TP53, CTNNB1 and recently identified novel mutated genes GNAL and the ADCY family, may play key roles in these significantly mutated pathways. Finally, we highlight several key genes (e.g., RPS6KA3 and PCLO) and pathways (e.g., axon guidance) in which the mutations were associated with clinical features. Our workflow illustrates the increased statistical power of integrating multiple studies of the same subject, which can provide biological insights that would otherwise be masked under individual sample sets. This type of bioinformatics approach is consistent with the necessity of making the best use of the ever increasing data provided in valuable databases, such as TCGA, to enhance the speed of deciphering human cancers.

  6. Unexpected identification of a recurrent mutation in the DLX3 gene causing amelogenesis imperfecta.

    PubMed

    Kim, Y-J; Seymen, F; Koruyucu, M; Kasimoglu, Y; Gencay, K; Shin, T J; Hyun, H-K; Lee, Z H; Kim, J-W

    2016-05-01

    To identify the molecular genetic aetiology of a family with autosomal dominant amelogenesis imperfecta (AI). DNA samples were collected from a six-generation family, and the candidate gene approach was used to screen for the enamelin (ENAM) gene. Whole-exome sequencing and linkage analysis with SNP array data identified linked regions, and candidate gene screening was performed. Mutational analysis revealed a mutation (c.561_562delCT and p.Tyr188Glnfs*13) in the DLX3 gene. After finding a recurrent DLX3 mutation, the clinical phenotype of the family members was re-examined. The proband's mother had pulp elongation in the third molars. The proband had not hair phenotype, but her cousin had curly hair at birth. In this study, we identified a recurrent 2-bp deletional DLX3 mutation in a new family. The clinical phenotype was the mildest one associated with the DLX3 mutations. These results will advance the understanding of the functional role of DLX3 in developmental processes. © 2016 The Authors. Oral Diseases Published by John Wiley & Sons Ltd.

  7. KIT gene mutations and patterns of protein expression in mucosal and acral melanoma.

    PubMed

    Abu-Abed, Suzan; Pennell, Nancy; Petrella, Teresa; Wright, Frances; Seth, Arun; Hanna, Wedad

    2012-01-01

    Recently characterized KIT (CD117) gene mutations have revealed new pathways involved in melanoma pathogenesis. In particular, certain subtypes harbor mutations similar to those observed in gastrointestinal stromal tumors, which are sensitive to treatment with tyrosine kinase inhibitors. The purpose of this study was to characterize KIT gene mutations and patterns of protein expression in mucosal and acral melanoma. Formalin-fixed, paraffin-embedded tissues were retrieved from our archives. Histologic assessment included routine hematoxylin-eosin stains and immunohistochemical staining for KIT. Genomic DNA was used for polymerase chain reaction-based amplification of exons 11 and 13. We identified 59 acral and mucosal melanoma cases, of which 78% showed variable levels of KIT expression. Sequencing of exons 11 and 13 was completed on all cases, and 4 (6.8%) mutant cases were isolated. We successfully optimized conditions for the detection of KIT mutations and showed that 8.6% of mucosal and 4.2% of acral melanoma cases at our institution harbor KIT mutations; all mutant cases showed strong, diffuse KIT protein expression. Our case series represents the first Canadian study to characterize KIT gene mutations and patterns of protein expression in acral and mucosal melanoma.

  8. New mutations and an updated database for the patched-1 (PTCH1) gene.

    PubMed

    Reinders, Marie G; van Hout, Antonius F; Cosgun, Betûl; Paulussen, Aimée D; Leter, Edward M; Steijlen, Peter M; Mosterd, Klara; van Geel, Michel; Gille, Johan J

    2018-05-01

    Basal cell nevus syndrome (BCNS) is an autosomal dominant disorder characterized by multiple basal cell carcinomas (BCCs), maxillary keratocysts, and cerebral calcifications. BCNS most commonly is caused by a germline mutation in the patched-1 (PTCH1) gene. PTCH1 mutations are also described in patients with holoprosencephaly. We have established a locus-specific database for the PTCH1 gene using the Leiden Open Variation Database (LOVD). We included 117 new PTCH1 variations, in addition to 331 previously published unique PTCH1 mutations. These new mutations were found in 141 patients who had a positive PTCH1 mutation analysis in either the VU University Medical Centre (VUMC) or Maastricht University Medical Centre (MUMC) between 1995 and 2015. The database contains 331 previously published unique PTCH1 mutations and 117 new PTCH1 variations. We have established a locus-specific database for the PTCH1 gene using the Leiden Open Variation Database (LOVD). The database provides an open collection for both clinicians and researchers and is accessible online at http://www.lovd.nl/PTCH1. © 2018 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  9. Mutational analysis of GALT gene in Greek patients with galactosaemia: identification of two novel mutations and clinical evaluation.

    PubMed

    Schulpis, Kleopatra H; Thodi, Georgia; Iakovou, Konstantinos; Chatzidaki, Maria; Dotsikas, Yannis; Molou, Elina; Triantafylli, Olga; Loukas, Yannis L

    2017-10-01

    Classical galactosaemia is an inborn error of metabolism due to the deficiency of the enzyme galactose-1-phosphate uridylyltransferase (GALT). The aim of the study was to identify the underlying mutations in Greek patients with GALT deficiency and evaluate their psychomotor and speech development. Patients with GALT deficiency (n = 17) were picked up through neonatal screening. Mutational analysis was conducted via Sanger sequencing, while in silico analysis was used in the cases of novel missense mutations. Psychomotor speech development tests were utilized for the clinical evaluation of the patients. Eleven different mutations in the GALT gene were detected in the patient cohort, including two novel ones. The most frequent mutation was p.Q188R (c.563 A > G). As for the novel mutations, p.M298I (c.894 G > A) was identified in four out of 32 independent alleles, while p.P115S (c.343 C > T) was identified once. Psychomotor evaluation revealed that most of the patients were found in the borderline area (Peabody test), while only two had speech delay problems. The WISK test revealed three patients at borderline limits and two were at lower than normal limits. The mutational spectrum of the GALT gene in Greek patients is presented for the first time. The mutation p.Q188R is the most frequent among Greek patients. Two novel mutations were identified and their potential pathogenicity was estimated. Regarding the phenotypic characteristics, psychomotor disturbances and speech delay were mainly observed among GALT-deficient patients.

  10. [Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].

    PubMed

    Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen

    2018-02-10

    OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.

  11. Frequent mutations in the p53 tumor suppressor gene in human leukemia T-cell lines.

    PubMed Central

    Cheng, J; Haas, M

    1990-01-01

    Human T-cell leukemia and T-cell acute lymphoblastic leukemia cell lines were studied for alterations in the p53 tumor suppressor gene. Southern blot analysis of 10 leukemic T-cell lines revealed no gross genomic deletions or rearrangements. Reverse transcription-polymerase chain reaction analysis of p53 mRNA indicated that all 10 lines produced p53 mRNA of normal size. By direct sequencing of polymerase chain reaction-amplified cDNA, we detected 11 missense and nonsense point mutations in 5 of the 10 leukemic T-cell lines studied. The mutations are primarily located in the evolutionarily highly conserved regions of the p53 gene. One of the five cell lines in which a mutation was detected possesses a homozygous point mutation in both p53 alleles, while the other four cell lines harbor from two to four different point mutations. An allelic study of two of the lines (CEM, A3/Kawa) shows that the two missense mutations found in each line are located on separate alleles, thus both alleles of the p53 gene may have been functionally inactivated by two different point mutations. Since cultured leukemic T-cell lines represent a late, fully tumorigenic stage of leukemic T cells, mutation of both (or more) alleles of the p53 gene may reflect the selection of cells possessing an increasingly tumorigenic phenotype, whether the selection took place in vivo or in vitro. Previously, we have shown that the HSB-2 T-cell acute lymphoblastic leukemia cell line had lost both alleles of the retinoblastoma tumor suppressor gene. Taken together, our data show that at least 6 of 10 leukemic T-cell lines examined may have lost the normal function of a known tumor suppressor gene, suggesting that this class of genes serves a critical role in the generation of fully tumorigenic leukemic T cells. Images PMID:2144611

  12. HAEdb: a novel interactive, locus-specific mutation database for the C1 inhibitor gene.

    PubMed

    Kalmár, Lajos; Hegedüs, Tamás; Farkas, Henriette; Nagy, Melinda; Tordai, Attila

    2005-01-01

    Hereditary angioneurotic edema (HAE) is an autosomal dominant disorder characterized by episodic local subcutaneous and submucosal edema and is caused by the deficiency of the activated C1 esterase inhibitor protein (C1-INH or C1INH; approved gene symbol SERPING1). Published C1-INH mutations are represented in large universal databases (e.g., OMIM, HGMD), but these databases update their data rather infrequently, they are not interactive, and they do not allow searches according to different criteria. The HAEdb, a C1-INH gene mutation database (http://hae.biomembrane.hu) was created to contribute to the following expectations: 1) help the comprehensive collection of information on genetic alterations of the C1-INH gene; 2) create a database in which data can be searched and compared according to several flexible criteria; and 3) provide additional help in new mutation identification. The website uses MySQL, an open-source, multithreaded, relational database management system. The user-friendly graphical interface was written in the PHP web programming language. The website consists of two main parts, the freely browsable search function, and the password-protected data deposition function. Mutations of the C1-INH gene are divided in two parts: gross mutations involving DNA fragments >1 kb, and micro mutations encompassing all non-gross mutations. Several attributes (e.g., affected exon, molecular consequence, family history) are collected for each mutation in a standardized form. This database may facilitate future comprehensive analyses of C1-INH mutations and also provide regular help for molecular diagnostic testing of HAE patients in different centers.

  13. Risk of colorectal cancer for people with a mutation in both a MUTYH and a DNA mismatch repair gene

    PubMed Central

    Win, Aung Ko; Reece, Jeanette C.; Buchanan, Daniel D.; Clendenning, Mark; Young, Joanne P.; Cleary, Sean P.; Kim, Hyeja; Cotterchio, Michelle; Dowty, James G.; MacInnis, Robert J.; Tucker, Katherine M.; Winship, Ingrid M.; Macrae, Finlay A.; Burnett, Terrilea; Le Marchand, Loïc; Casey, Graham; Haile, Robert W.; Newcomb, Polly A.; Thibodeau, Stephen N.; Lindor, Noralane M.; Hopper, John L.; Gallinger, Steven; Jenkins, Mark A.

    2015-01-01

    The base excision repair protein, MUTYH, functionally interacts with the DNA mismatch repair (MMR) system. As genetic testing moves from testing one gene at a time, to gene panel and whole exome next generation sequencing approaches, understanding the risk associated with co-existence of germline mutations in these genes will be important for clinical interpretation and management. From the Colon Cancer Family Registry, we identified 10 carriers who had both a MUTYH mutation (6 with c.1187G>A p.(Gly396Asp), 3 with c.821G>A p.(Arg274Gln), and 1 with c.536A>G p.(Tyr179Cys)) and a MMR gene mutation (3 in MLH1, 6 in MSH2, and 1 in PMS2), 375 carriers of a single (monoallelic) MUTYH mutation alone, and 469 carriers of a MMR gene mutation alone. Of the 10 carriers of both gene mutations, 8 were diagnosed with colorectal cancer. Using a weighted cohort analysis, we estimated that risk of colorectal cancer for carriers of both a MUTYH and a MMR gene mutation was substantially higher than that for carriers of a MUTYH mutation alone [hazard ratio (HR) 21.5, 95 % confidence interval (CI) 9.19–50.1; p < 0.001], but not different from that for carriers of a MMR gene mutation alone (HR 1.94, 95 % CI 0.63–5.99; p = 0.25). Within the limited power of this study, there was no evidence that a monoallelic MUTYH gene mutation confers additional risk of colorectal cancer for carriers of a MMR gene mutation alone. Our finding suggests MUTYH mutation testing in MMR gene mutation carriers is not clinically informative. PMID:26202870

  14. Distal renal tubular acidosis. Clinical manifestations in patients with different underlying gene mutations.

    PubMed

    Alonso-Varela, Marta; Gil-Peña, Helena; Coto, Eliecer; Gómez, Juan; Rodríguez, Julián; Rodríguez-Rubio, Enrique; Santos, Fernando

    2018-05-03

    To evaluate whether there are differences in the phenotype of primary distal renal tubular acidosis (dRTA) patients according to the causal defective gene. Twenty-seven non-oriental patients with genetically confirmed dRTA were grouped according to the identified underlying mutations in either ATP6V1B1 (n = 10), ATP6V0A4 (n = 12), or SLC4A1 (n = 5) gene. Demographic features, growth impairment, biochemical variables and presence of deafness, nephrocalcinosis, and urolithiasis at diagnosis were compared among the three groups. Patients with SLC4A1 mutations presented later than those with ATP6V1B1 or ATP6V0A4 defects (120 vs. 7 and 3 months, respectively). Hearing loss at diagnosis was present in the majority of patients with ATP6V1B1 mutations, in two patients with ATP6V0A4 mutations, and in none of cases harboring SLC4A1 mutations. Serum potassium concentration (X ± SD) was higher in SLC4A1 group (3.66 ± 0.44 mEq/L) than in ATP6V0A4 group (2.96 ± 0.63 mEq/L) (p = 0.046). There were no differences in the other clinical or biochemical variables analyzed in the three groups. This study indicates that non-oriental patients with dRTA caused by mutations in the SLC4A1 gene present later and have normokalemia or milder hypokalemia. Hypoacusia at diagnosis is characteristically associated with ATP6V1B1 gene mutations although it may also be present in infants with ATP6V0A4 defects. Other phenotypical manifestations do not allow predicting the involved gene.

  15. Mutation analysis of the carbohydrate sulfotransferase gene in Vietnamese with macular corneal dystrophy.

    PubMed

    Ha, Nguyen Thanh; Chau, Hoang Minh; Cung, Le Xuan; Thanh, Ton Kim; Fujiki, Keiko; Murakami, Akira; Hiratsuka, Yoshimune; Kanai, Atsushi

    2003-08-01

    Mutations in a new carbohydrate sulfotransferase gene (CHST6) encoding corneal N-acetylglucosamine-6-sulfotransferase (C-GlcNac-6-ST) have been identified as the cause of macular corneal dystrophy (MCD) in various ethnicities. This study was conducted to examine the CHST6 gene in Vietnamese with MCD. Nineteen unrelated families, including 35 patients and 38 unaffected relatives were examined clinically. Blood samples were collected. Fifty normal Vietnamese individuals served as control subjects. Genomic DNA was extracted from leukocytes. Analysis of the CHST6 gene was performed with polymerase chain reaction and direct sequencing. Corneal buttons were studied histopathologically. A slit lamp examination revealed clinical features of MCD with gray-white opacities and stromal haze between. On histopathology, corneal sections showed positive staining with colloidal iron. Sequencing of the CHST6 gene revealed six homozygous and three compound heterozygous mutations. The homozygous mutations, including L59P, V66L, R211Q, W232X, Y268C, and 1067-1068ins(GGCCGTG) were detected, respectively, in two, one, eight, one, one, and two families. Compound heterozygous mutations R211Q/Q82X, S51L/Y268C, and Y268C/1067-1068ins(GGCCGTG) were identified, each in one family. A single heterozygous change at codon 76 (GTG-->ATG) was detected in family L, resulting in a valine-to-methionine substitution (V76M). None of these mutations was detected in the control group. Mutations identified in the CHST6 gene cosegregated with the disease phenotype in all but one family studied and thus caused MCD. Among these, the R211Q detected in 9 of 19 families may be the most common mutation in Vietnamese. These data also indicate that significant allelic heterogeneity exists for MCD.

  16. Leigh syndrome associated with a novel mutation in the COX15 gene.

    PubMed

    Miryounesi, Mohammad; Fardaei, Majid; Tabei, Seyed Mohammadbagher; Ghafouri-Fard, Soudeh

    2016-06-01

    Leigh syndrome (LS) is a subacute necrotizing encephalomyelopathy with a diverse range of symptoms, such as psychomotor delay or regression, weakness, hypotonia, truncal ataxia, intention tremor as well as lactic acidosis in the blood, cerebrospinal fluid or urine. Both nuclear gene defects and mutations of the mitochondrial genome have been detected in these patients. Here we report a 7-year-old girl with hypotonia, tremor, developmental delay and psychomotor regression. However, serum lactate level as well as brain magnetic resonance imaging were normal. Mutational analysis has revealed a novel mutation in exon 4 of COX15 gene (c.415C>G) which results in p.Leu139Val. Previous studies have demonstrated that COX15 mutations are associated with typical LS as well as fatal infantile hypertrophic cardiomyopathy. Consequently, clinical manifestations of COX15 mutations may be significantly different in patients. Such information is of practical importance in genetic counseling.

  17. [Detection of gene mutation in glucose-6-phosphate dehydrogenase deficiency by RT-PCR sequencing].

    PubMed

    Lyu, Rong-Yu; Chen, Xiao-Wen; Zhang, Min; Chen, Yun-Sheng; Yu, Jie; Wen, Fei-Qiu

    2016-07-01

    Since glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common hereditary hemolytic erythrocyte enzyme deficiency, most cases have single nucleotide mutations in the coding region, and current test methods for gene mutation have some missed detections, this study aimed to investigate the feasibility of RT-PCR sequencing in the detection of gene mutation in G6PD deficiency. According to the G6PD/6GPD ratio, 195 children with anemia of unknown cause or who underwent physical examination between August 2013 and July 2014 were classified into G6PD-deficiency group with 130 children (G6PD/6GPD ratio <1.00) and control group with 65 children (G6PD/6GPD ratio≥1.00). The primer design and PCR amplification conditions were optimized, and RT-PCR sequencing was used to analyze the complete coding sequence and verify the genomic DNA sequence in the two groups. In the G6PD-deficiency group, the detection rate of gene mutation was 100% and 13 missense mutations were detected, including one new mutation. In the control group, no missense mutation was detected in 28 boys; 13 heterozygous missense mutations, 1 homozygous same-sense mutation (C1191T) which had not been reported in China and abroad, and 14 single nucleotide polymorphisms of C1311T were detected in 37 girls. The control group showed a high rate of missed detection of G6PD deficiency (carriers) in the specimens from girls (35%, 13/37). RT-PCR sequencing has a high detection rate of G6PD gene mutation and a certain value in clinical diagnosis of G6PD deficiency.

  18. Mutation in gelsolin gene in Finnish hereditary amyloidosis

    PubMed Central

    1990-01-01

    Familial amyloidosis, Finnish type (FAF), is an autosomal dominant form of familial amyloid polyneuropathy. The novel amyloid fibril protein found in these patients is a degradation fragment of gelsolin, an actin- binding protein. We found a mutation (adenine for guanine) at nucleotide 654 of the gelsolin gene in genomic DNA isolated from five FAF patients. This site is polymorphic since the normal allele was also present in all the patients tested. This mutation was not found in two unaffected family members and 11 normal controls. The A for G transition causes an amino acid substitution (asparagine for aspartic acid) that was found at position 15 of the amyloid protein. The mutation and consequent amino acid substitution may lead to the development of FAF. PMID:2175344

  19. Novel autosomal recessive gene mutations in aquaporin-2 in two Chinese congenital nephrogenic diabetes insipidus pedigrees

    PubMed Central

    Cen, Jing; Nie, Min; Duan, Lian; Gu, Feng

    2015-01-01

    Recent evidence has linked novel mutations in the arginine vasopressin receptor 2 gene (AVPR2) and aquaporin-2 gene (AQP2) present in Southeast Asian populations to congenital nephrogenic diabetes insipidus (NDI). To investigate mutations in 2 distinct Chinese pedigrees with NDI patients, clinical data, laboratory findings, and genomic DNA sequences from peripheral blood leukocytes were analyzed in two 5.5- and 8-year-old boys (proband 1 and 2, respectively) and their first-degree relatives. Water intake, urinary volume, body weight and medication use were recorded. Mutations in coding regions and intron-exon borders of both AQP2 and AVPR2 gene were sequenced. Three mutations in AQP2 were detected, including previously reported heterozygous frameshift mutation (c.127_128delCA, p.Gln43Aspfs ×63) inherited from the mother, a novel frameshift mutation (c.501_502insC, p.Val168Argfs ×30, inherited from the father) in proband 1 and a novel missense mutation (c. 643G>A, p. G215S), inherited from both parents in proband 2. In family 2 both parents and one sister were heterozygous carriers of the novel missense mutation. Neither pedigree exhibited mutation in the AVPR2 gene. The patient with truncated AQP2 may present with much more severe NDI manifestations. Identification of these novel AQP2 gene mutations expands the AQP2 genotypic spectrum and may contribute to etiological diagnosis and genetic counseling. PMID:26064258

  20. The role of sarcomere gene mutations in patients with idiopathic dilated cardiomyopathy

    PubMed Central

    Møller, Daniel Vega; Andersen, Paal Skytt; Hedley, Paula; Ersbøll, Mads Kristian; Bundgaard, Henning; Moolman-Smook, Johanna; Christiansen, Michael; Køber, Lars

    2009-01-01

    We investigated a Danish cohort of 31 unrelated patients with idiopathic dilated cardiomyopathy (IDC), to assess the role that mutations in sarcomere protein genes play in IDC. Patients were genetically screened by capillary electrophoresis single strand conformation polymorphism and subsequently by bidirectional DNA sequencing of conformers in the coding regions of MYH7, MYBPC3, TPM1, ACTC, MYL2, MYL3, TNNT2, CSRP3 and TNNI3. Eight probands carried disease-associated genetic variants (26%). In MYH7, three novel mutations were found; in MYBPC3, one novel variant and two known mutations were found; and in TNNT2, a known mutation was found. One proband was double heterozygous. We find evidence of phenotypic plasticity: three mutations described earlier as HCM causing were found in four cases of IDC, with no history of a hypertrophic phase. Furthermore, one pedigree presented with several cases of classic DCM as well as one case with left ventricular non-compaction. Disease-causing sarcomere gene mutations were found in about one-quarter of IDC patients, and seem to play an important role in the causation of the disease. The genetics is as complex as seen in HCM. Thus, our data suggest that a genetic work-up should include screening of the most prominent sarcomere genes even in the absence of a family history of the disease. PMID:19293840

  1. Recurrent mutation in the crystallin alpha A gene associated with inherited paediatric cataract.

    PubMed

    Javadiyan, Shari; Craig, Jamie E; Souzeau, Emmanuelle; Sharma, Shiwani; Lower, Karen M; Pater, John; Casey, Theresa; Hodson, Trevor; Burdon, Kathryn P

    2016-02-11

    Cataract is a major cause of childhood blindness worldwide. The purpose of this study was to determine the genetic cause of paediatric cataract in a South Australian family with a bilateral lamellar paediatric cataract displaying variable phenotypes. Fifty-one genes implicated in congenital cataract in human or mouse were sequenced in an affected individual from an Australian (Caucasian) family using a custom Ampliseq library on the Ion Torrent Personal Genome Machine. Reads were mapped against the human genome (hg19) and variants called with the Torrent Suite software. Variants were annotated to dbSNP 137 using Ion Reporter (IR 1.6.2) and were prioritised for validation if they were novel or rare and were predicted to be protein changing. We identified a previously reported oligomerization disrupting mutation, c.62G > A (p.R21Q), in the Crystallin alpha A (CRYAA) gene segregating in this three generation family. No other novel or rare coding mutations were detected in the known cataract genes sequenced. Microsatellite markers were used to compare the haplotypes between the family reported here and a previously published family with the same segregating mutation. Haplotype analysis indicated a potential common ancestry between the two South Australian families with this mutation. The work strengthens the genotype-phenotype correlations between this functional mutation in the crystallin alpha A (CRYAA) gene and paediatric cataract. The p.R21Q mutation is the most likely cause of paediatric cataract in this family. The recurrence of this mutation in paediatric cataract families is likely due to a familial relationship.

  2. Pediatric acute myeloid leukemia with NPM1 mutations is characterized by a gene expression profile with dysregulated HOX gene expression distinct from MLL-rearranged leukemias.

    PubMed

    Mullighan, C G; Kennedy, A; Zhou, X; Radtke, I; Phillips, L A; Shurtleff, S A; Downing, J R

    2007-09-01

    Somatic mutations in nucleophosmin (NPM1) occur in approximately 35% of adult acute myeloid leukemia (AML). To assess the frequency of NPM1 mutations in pediatric AML, we sequenced NPM1 in the diagnostic blasts from 93 pediatric AML patients. Six cases harbored NPM1 mutations, with each case lacking common cytogenetic abnormalities. To explore the phenotype of the AMLs with NPM1 mutations, gene expression profiles were obtained using Affymetrix U133A microarrays. NPM1 mutations were associated with increased expression of multiple homeobox genes including HOXA9, A10, B2, B6 and MEIS1. As dysregulated homeobox gene expression is also a feature of MLL-rearranged leukemia, the gene expression signatures of NPM1-mutated and MLL-rearranged leukemias were compared. Significant differences were identified between these leukemia subtypes including the expression of different HOX genes, with NPM1-mutated AML showing higher levels of expression of HOXB2, B3, B6 and D4. These results confirm recent reports of perturbed HOX expression in NPM1-mutated adult AML, and provide the first evidence that the NPM1-mutated signature is distinct from MLL-rearranged AML. These findings suggest that mutated NPM1 leads to dysregulated HOX expression via a different mechanism than MLL rearrangement.

  3. Mutations in Splicing Factor Genes Are a Major Cause of Autosomal Dominant Retinitis Pigmentosa in Belgian Families

    PubMed Central

    Coppieters, Frauke; Roels, Dimitri; De Jaegere, Sarah; Flipts, Helena; De Zaeytijd, Julie; Walraedt, Sophie; Claes, Charlotte; Fransen, Erik; Van Camp, Guy; Depasse, Fanny; Casteels, Ingele; de Ravel, Thomy

    2017-01-01

    Purpose Autosomal dominant retinitis pigmentosa (adRP) is characterized by an extensive genetic heterogeneity, implicating 27 genes, which account for 50 to 70% of cases. Here 86 Belgian probands with possible adRP underwent genetic testing to unravel the molecular basis and to assess the contribution of the genes underlying their condition. Methods Mutation detection methods evolved over the past ten years, including mutation specific methods (APEX chip analysis), linkage analysis, gene panel analysis (Sanger sequencing, targeted next-generation sequencing or whole exome sequencing), high-resolution copy number screening (customized microarray-based comparative genomic hybridization). Identified variants were classified following American College of Medical Genetics and Genomics (ACMG) recommendations. Results Molecular genetic screening revealed mutations in 48/86 cases (56%). In total, 17 novel pathogenic mutations were identified: four missense mutations in RHO, five frameshift mutations in RP1, six mutations in genes encoding spliceosome components (SNRNP200, PRPF8, and PRPF31), one frameshift mutation in PRPH2, and one frameshift mutation in TOPORS. The proportion of RHO mutations in our cohort (14%) is higher than reported in a French adRP population (10.3%), but lower than reported elsewhere (16.5–30%). The prevalence of RP1 mutations (10.5%) is comparable to other populations (3.5%-10%). The mutation frequency in genes encoding splicing factors is unexpectedly high (altogether 19.8%), with PRPF31 the second most prevalent mutated gene (10.5%). PRPH2 mutations were found in 4.7% of the Belgian cohort. Two families (2.3%) have the recurrent NR2E3 mutation p.(Gly56Arg). The prevalence of the recurrent PROM1 mutation p.(Arg373Cys) was higher than anticipated (3.5%). Conclusions Overall, we identified mutations in 48 of 86 Belgian adRP cases (56%), with the highest prevalence in RHO (14%), RP1 (10.5%) and PRPF31 (10.5%). Finally, we expanded the molecular

  4. Novel mutations in the homogentisate 1,2 dioxygenase gene identified in Jordanian patients with alkaptonuria.

    PubMed

    Al-sbou, Mohammed

    2012-06-01

    This study was conducted to identify mutations in the homogentisate 1,2 dioxygenase gene (HGD) in alkaptonuria patients among Jordanian population. Blood samples were collected from four alkaptonuria patients, four carriers, and two healthy volunteers. DNA was isolated from peripheral blood. All 14 exons of the HGD gene were amplified using the polymerase chain reaction (PCR) technique. The PCR products were then purified and analyzed by sequencing. Five mutations were identified in our samples. Four of them were novel C1273A, T1046G, 551-552insG, T533G and had not been previously reported, and one mutation T847C has been described before. The types of mutations identified were two missense mutations, one splice site mutation, one frameshift mutation, and one polymorphism. We present the first molecular study of the HGD gene in Jordanian alkaptonuria patients. This study provides valuable information about the molecular basis of alkaptonuria in Jordanian population.

  5. [Mutation analysis of the PAH gene in children with phenylketonuria from the Qinghai area of China].

    PubMed

    He, Jiang; Wang, Hui-Zhen; Xu, Fa-Liang; Yang, Xi; Wang, Rui; Zou, Hong-Yun; Yu, Wu-Zhong

    2015-11-01

    To study the mutation characteristics of the phenylalanine hydroxylase (PAH) gene in children with phenylketonuria (PKU) from the Qinghai area of China, in order to provide basic information for genetic counseling and prenatal diagnosis. Mutations of the PAH gene were detected in the promoter and exons 1-13 and their flanking intronic sequences of PAH gene by PCR and DNA sequencing in 49 children with PKU and their parents from the Qinghai area of China. A total of 30 different mutations were detected in 80 out of 98 mutant alleles (82%), including 19 missense (63%), 5 nonsense (17%), 3 splice-site (10%) and 3 deletions (10%). Most mutations were detected in exons 3, 6, 7, 11 and intron 4 of PAH gene. The most frequent mutations were p.R243Q (19%), IVS4-1G>A (9%), p.Y356X (7%) and p.EX6-96A>G(5%). Two novel mutations p.N93fsX5 (c.279-282delCATC) and p.G171E (c.512G>A) were found. p.H64fsX9(c.190delC) was documented for the second time in Chinese PAH gene. The mutation spectrum of the gene PAH in the Qinghai population was similar to that in other populations in North China while significantly different from that in the populations from some provinces in southern China, Japan and Europe. The mutations of PAH gene in the Qinghai area of China demonstrate a unique diversity, complexity and specificity.

  6. Software and database for the analysis of mutations in the human FBN1 gene.

    PubMed Central

    Collod, G; Béroud, C; Soussi, T; Junien, C; Boileau, C

    1996-01-01

    Fibrillin is the major component of extracellular microfibrils. Mutations in the fibrillin gene on chromosome 15 (FBN1) were described at first in the heritable connective tissue disorder, Marfan syndrome (MFS). More recently, FBN1 has also been shown to harbor mutations related to a spectrum of conditions phenotypically related to MFS and many mutations will have to be accumulated before genotype/phenotype relationships emerge. To facilitate mutational analysis of the FBN1 gene, a software package along with a computerized database (currently listing 63 entries) have been created. PMID:8594563

  7. Patients with autosomal nephrogenic diabetes insipidus homozygous for mutations in the aquaporin 2 water-channel gene.

    PubMed Central

    van Lieburg, A. F.; Verdijk, M. A.; Knoers, V. V.; van Essen, A. J.; Proesmans, W.; Mallmann, R.; Monnens, L. A.; van Oost, B. A.; van Os, C. H.; Deen, P. M.

    1994-01-01

    Mutations in the X-chromosomal V2 receptor gene are known to cause nephrogenic diabetes insipidus (NDI). Besides the X-linked form, an autosomal mode of inheritance has been described. Recently, mutations in the autosomal gene coding for water-channel aquaporin 2 (AQP2) of the renal collecting duct were reported in an NDI patient. In the present study, missense mutations and a single nucleotide deletion in the aquaporin 2 gene of three NDI patients from consanguineous matings are described. Expression studies in Xenopus oocytes showed that the missense AQP2 proteins are nonfunctional. These results prove that mutations in the AQP2 gene cause autosomal recessive NDI. PMID:7524315

  8. Frequency of familial Mediterranean fever (MEFV) gene mutations in patients with biopsy-proven primary glomerulonephritis.

    PubMed

    Huzmeli, Can; Candan, Ferhan; Bagci, Gokhan; Alaygut, Demet; Yilmaz, Ali; Gedikli, Asim; Bagci, Binnur; Timucin, Meryem; Sezgin, Ilhan; Kayatas, Mansur

    2017-11-01

    Primary glomerulopathies are those disorders that affect glomerular structure, function, or both in the absence of a multisystem disorder. We aimed to evaluate the frequency of MEFV gene mutation to show possible coexistence of FMF in patients diagnosed with biopsy-proven primary glomerulonephritis (GN). A total of 64 patients with biopsy-proven primary GN were included in the study. MEFV gene mutations examined retrospectively. The mean age of patients was 39.6 ± 13.4 (range 18-69), 35 of patients were female and 29 of patients were male. Of the 64 patients, 17 were mesangial proliferative glomerulonephritis (MsPGN), 15 were IgA nephropathy (IgAN), 12 were membranous glomerulonephritis (MGN), 11 were focal segmental glomerulosclerosis (FSGS), three were membranous proliferative glomerulonephritis (MPGN), three were immune complex glomerulonephritis (ICGN), two were minimal change disease (MCD), and one was IgM nephropathy (IgMN). MEFV gene mutation was detected in 35.9% (23) of these patients. The most frequently detected mutations were E148Q and M694V. Twelve cases (18.75% of GN patients) with MEFV gene mutation were diagnosed as FMF phenotype I. The frequency of MEFV gene mutation was detected at a high rate of 35.9%. Further studies with larger populations are needed to clarify the importance of these mutations on clinical progression of glomerulonephritis.

  9. Targeted next-generation sequencing in steroid-resistant nephrotic syndrome: mutations in multiple glomerular genes may influence disease severity.

    PubMed

    Bullich, Gemma; Trujillano, Daniel; Santín, Sheila; Ossowski, Stephan; Mendizábal, Santiago; Fraga, Gloria; Madrid, Álvaro; Ariceta, Gema; Ballarín, José; Torra, Roser; Estivill, Xavier; Ars, Elisabet

    2015-09-01

    Genetic diagnosis of steroid-resistant nephrotic syndrome (SRNS) using Sanger sequencing is complicated by the high genetic heterogeneity and phenotypic variability of this disease. We aimed to improve the genetic diagnosis of SRNS by simultaneously sequencing 26 glomerular genes using massive parallel sequencing and to study whether mutations in multiple genes increase disease severity. High-throughput mutation analysis was performed in 50 SRNS and/or focal segmental glomerulosclerosis (FSGS) patients, a validation cohort of 25 patients with known pathogenic mutations, and a discovery cohort of 25 uncharacterized patients with probable genetic etiology. In the validation cohort, we identified the 42 previously known pathogenic mutations across NPHS1, NPHS2, WT1, TRPC6, and INF2 genes. In the discovery cohort, disease-causing mutations in SRNS/FSGS genes were found in nine patients. We detected three patients with mutations in an SRNS/FSGS gene and COL4A3. Two of them were familial cases and presented a more severe phenotype than family members with mutation in only one gene. In conclusion, our results show that massive parallel sequencing is feasible and robust for genetic diagnosis of SRNS/FSGS. Our results indicate that patients carrying mutations in an SRNS/FSGS gene and also in COL4A3 gene have increased disease severity.

  10. Myelin protein zero gene mutated in Charcot-Marie-Tooth type 1B patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Su, Ying; Li, Lanying; Lepercq, J.

    1993-11-15

    The autosomal dominant of Charcot-Marie-Tooth disease (CMT), whose gene is type 1B (CMT1B), has slow nerve conduction with demyelinated Schwann cells. In this study the abundant peripheral myelin protein zero (MPZ) gene, MPZ, was mapped 130 kb centromeric to the Fc receptor immunoglobulin gene cluster in band 1q22, and a major MPZ point mutation was found to cosegregate with CMT1B in one large CMT1B family. The MPZ point mutation in 18 of 18 related CMT1B pedigree 1 patients converts a positively charged lysine in codon 96 to a negatively charged glutamate. The same MPZ locus cosegregates with the CMT1B diseasemore » gene in a second CMT1B family [total multipoint logarithm of odds (lod) = 11.4 at [theta] = 0.00] with a splice junction mutation. Both mutations occur in MPZ protein regions otherwise conserved identically in human, rat, and cow since these species diverged 100 million years ago. MPZ protein, expressed exclusively in myelinated peripheral nerve Schwann cells, constitutes >50% of myelin protein. These mutations are anticipated to disrupt homophilic MPZ binding and result in CMT1B peripheral nerve demyelination.« less

  11. Erythrocytosis associated with a novel missense mutation in the HIF2A gene

    PubMed Central

    van Wijk, Richard; Sutherland, Scott; Van Wesel, Annet C.W.; Huizinga, Eric G.; Percy, Melanie J.; Bierings, Marc; Lee, Frank S.

    2010-01-01

    The ERYTHROPOIETIN (EPO) gene is regulated by the transcription factor Hypoxia Inducible Factor-α (HIF-α). In this pathway, Prolyl Hydroxylase Domain protein 2 (PHD2) hydroxylates two prolyl residues in HIF-α, which in turn promotes HIF-α degradation by the von Hippel Lindau (VHL) protein. Evidence that HIF-2α is the important isoform for EPO regulation in humans comes from the recent observation that mutations in the HIF2A gene are associated with cases of erythrocytosis. We report here a new erythrocytosis-associated mutation, p.Asp539Glu, in the HIF2A gene. Similar to all reported cases, the affected residue is in close vicinity and C-terminal to the primary hydroxylation site in HIF-2α, Pro531. This mutation, however, is notable in producing a rather subtle amino acid substitution. Nonetheless, we find that this mutation compromises binding of HIF-2α to both PHD2 and VHL, and we propose that this mutation is the cause of erythrocytosis in this individual. PMID:20007141

  12. Splice Site Mutations in the ATP7A Gene

    PubMed Central

    Møller, Lisbeth Birk

    2011-01-01

    Menkes disease (MD) is caused by mutations in the ATP7A gene. We describe 33 novel splice site mutations detected in patients with MD or the milder phenotypic form, Occipital Horn Syndrome. We review these 33 mutations together with 28 previously published splice site mutations. We investigate 12 mutations for their effect on the mRNA transcript in vivo. Transcriptional data from another 16 mutations were collected from the literature. The theoretical consequences of splice site mutations, predicted with the bioinformatics tool Human Splice Finder, were investigated and evaluated in relation to in vivo results. Ninety-six percent of the mutations identified in 45 patients with classical MD were predicted to have a significant effect on splicing, which concurs with the absence of any detectable wild-type transcript in all 19 patients investigated in vivo. Sixty-seven percent of the mutations identified in 12 patients with milder phenotypes were predicted to have no significant effect on splicing, which concurs with the presence of wild-type transcript in 7 out of 9 patients investigated in vivo. Both the in silico predictions and the in vivo results support the hypothesis previously suggested by us and others, that the presence of some wild-type transcript is correlated to a milder phenotype. PMID:21494555

  13. The STAT3 HIES mutation is a gain-of-function mutation that activates genes via AGG-element carrying promoters.

    PubMed

    Xu, Li; Ji, Jin-Jun; Le, Wangping; Xu, Yan S; Dou, Dandan; Pan, Jieli; Jiao, Yifeng; Zhong, Tianfei; Wu, Dehong; Wang, Yumei; Wen, Chengping; Xie, Guan-Qun; Yao, Feng; Zhao, Heng; Fan, Yong-Sheng; Chin, Y Eugene

    2015-10-15

    Cytokine or growth factor activated STAT3 undergoes multiple post-translational modifications, dimerization and translocation into nuclei, where it binds to serum-inducible element (SIE, 'TTC(N3)GAA')-bearing promoters to activate transcription. The STAT3 DNA binding domain (DBD, 320-494) mutation in hyper immunoglobulin E syndrome (HIES), called the HIES mutation (R382Q, R382W or V463Δ), which elevates IgE synthesis, inhibits SIE binding activity and sensitizes genes such as TNF-α for expression. However, the mechanism by which the HIES mutation sensitizes STAT3 in gene induction remains elusive. Here, we report that STAT3 binds directly to the AGG-element with the consensus sequence 'AGG(N3)AGG'. Surprisingly, the helical N-terminal region (1-355), rather than the canonical STAT3 DBD, is responsible for AGG-element binding. The HIES mutation markedly enhances STAT3 AGG-element binding and AGG-promoter activation activity. Thus, STAT3 is a dual specificity transcription factor that promotes gene expression not only via SIE- but also AGG-promoter activity. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Association of a novel point mutation in MSH2 gene with familial multiple primary cancers.

    PubMed

    Hu, Hai; Li, Hong; Jiao, Feng; Han, Ting; Zhuo, Meng; Cui, Jiujie; Li, Yixue; Wang, Liwei

    2017-10-03

    Multiple primary cancers (MPC) have been identified as two or more cancers without any subordinate relationship that occur either simultaneously or metachronously in the same or different organs of an individual. Lynch syndrome is an autosomal dominant genetic disorder that increases the risk of many types of cancers. Lynch syndrome patients who suffer more than two cancers can also be considered as MPC; patients of this kind provide unique resources to learn how genetic mutation causes MPC in different tissues. We performed a whole genome sequencing on blood cells and two tumor samples of a Lynch syndrome patient who was diagnosed with five primary cancers. The mutational landscape of the tumors, including somatic point mutations and copy number alternations, was characterized. We also compared Lynch syndrome with sporadic cancers and proposed a model to illustrate the mutational process by which Lynch syndrome progresses to MPC. We revealed a novel pathologic mutation on the MSH2 gene (G504 splicing) that associates with Lynch syndrome. Systematical comparison of the mutation landscape revealed that multiple cancers in the proband were evolutionarily independent. Integrative analysis showed that truncating mutations of DNA mismatch repair (MMR) genes were significantly enriched in the patient. A mutation progress model that included germline mutations of MMR genes, double hits of MMR system, mutations in tissue-specific driver genes, and rapid accumulation of additional passenger mutations was proposed to illustrate how MPC occurs in Lynch syndrome patients. Our findings demonstrate that both germline and somatic alterations are driving forces of carcinogenesis, which may resolve the carcinogenic theory of Lynch syndrome.

  15. [Hyperuricemia and gene mutations: a case report].

    PubMed

    Tattoli, Fabio; Falconi, Daniela; De Prisco, Ornella; Maurizio, Gherzi; Marazzi, Federico; Marengo, Marita; Serra, Ilaria; Tamagnone, Michela; Cordero di Montezemolo, Luca; Pasini, Barbara; Formica, Marco

    2017-06-01

    Hyperuricemia is frequently found in nephrology. The case presented may be useful to clarify some pathogenetic aspects. It is a patient of 18 years, hyperuricaemic. Non-consanguineous parents, hyperuricemia in the paternal line, not neuropsychiatric disorders in the family. Delay in neuromotor acquisitions, average intellectual disabilities, anxiety disorder, obsessive-compulsive personality traits. Normal renal function and renal ultrasound. Evidence of hyperuricemia in 2015. Never gouty episodes and / or lithiasis, initiated allopurinol 100 mg on alternate days, with no side effects, urea in the control range, slightly below normal uricuria. Given the complex clinical, he carried out a genetic analysis of array-CGH. He showed a deletion on the short arm of chromosome 3 (3p12.3) and a duplication of the long arm of chromosome 1 (19q13-42). The deletion 3p12.3 (paternal inheritance), involves the ROBO2 gene. Duplication 19q13.42, (maternal inheritance), includes NLRP12, DPRX, ZNF331 genes. The ROBO2 gene with its mutation, is associated with vesicoureteral reflux. The NLRP12 gene encodes proteins called "Nalps", forming a subfamily of proteins "CATERPILLAR". Many "Nalps" as well as the "Nalps 12" have an N-terminal domain (DYP) with a purin. Since uric acid is a byproduct of purine metabolism, considered the familiarity, we believe that we can hypothesize that the mutations found. In particular those concerning the NLRP-12 gene, may have a role in the presence of hyperuricemia. We believe that in patients with hyperuricemia, associated with a particular impairment of neurological picture, it is likely that there is a subtended common genetic deficiency. Copyright by Società Italiana di Nefrologia SIN, Rome, Italy.

  16. Brachdactyly Instigated as a Result of Mutation in GDF5 and NOG Genes in Pakistani Population.

    PubMed

    Khan, Samiullah; Mudassir, Muhammad; Khan, Naqab; Marwat, Asmatullah

    2018-01-01

    Brachdactyly a genetic disorder associated with the abnormal development of metacarpals, phalanges or both which results in the shortening of hands and feet. Mutations in the contributing genes has been recognized with the majority of the investigated syndromic form of brachdactyly. The current study was proposed to examine mutation in NOG and GDF5 genes in a Pakistani family. Poly Acrylamide Gel Electrophoresis and Polymerase Chain Reaction was used for the genomic screening and linkage analysis to observe the mutation in genes. The samples were collected from Luckki Marwat district, KPK, while the research study was conducted in the department of Biochemistry, Quaid-I-Azam University, Islamabad, Pakistan. After survey, family was identified with brachdactyly type A2 and investigated a heterozygous arginine to glutamine exchange in the growth demarcation factor 5 in all the victim persons. Different types of skeletal dysplasia resulted due to mutation in the GDF5 genes. Novel GDF5 genes mutations were reported with distinct limb malformation and sequencing of coding region revealed that the mildly affected individuals were heterozygous while the harshly affected individuals were homozygous. The current study reported the genetic variability and concluded that the Brachdacytyly type A2 and type B2 resulted due to mutation in GDF5 and NOG genes respectively. A new subtype of brachydactyly (BDB2) was instigated as a result of novel mutations in NOG. The mutation has been reported for the first time in Pakistani population and especially in Pushtoon ethnic population.

  17. Mutations in Plasmodium falciparum K13 propeller gene from Bangladesh (2009-2013).

    PubMed

    Mohon, Abu Naser; Alam, Mohammad Shafiul; Bayih, Abebe Genetu; Folefoc, Asongna; Shahinas, Dea; Haque, Rashidul; Pillai, Dylan R

    2014-11-18

    Bangladesh is a malaria hypo-endemic country sharing borders with India and Myanmar. Artemisinin combination therapy (ACT) remains successful in Bangladesh. An increase of artemisinin-resistant malaria parasites on the Thai-Cambodia and Thai-Myanmar borders is worrisome. K13 propeller gene (PF3D7_1343700 or PF13_0238) mutations have been linked to both in vitro artemisinin resistance and in vivo slow parasite clearance rates. This group undertook to evaluate if mutations seen in Cambodia have emerged in Bangladesh where ACT use is now standard for a decade. Samples were obtained from Plasmodium falciparum-infected malaria patients from Upazila health complexes (UHC) between 2009 and 2013 in seven endemic districts of Bangladesh. These districts included Khagrachari (Matiranga UHC), Rangamati (Rajasthali UHC), Cox's Bazar (Ramu and Ukhia UHC), Bandarban (Lama UHC), Mymensingh (Haluaghat UHC), Netrokona (Durgapur and Kalmakanda UHC), and Moulvibazar (Sreemangal and Kamalganj UHC). Out of 296 microscopically positive P. falciparum samples, 271 (91.6%) were confirmed as mono-infections by both real-time PCR and nested PCR. The K13 propeller gene from 253 (93.4%) samples was sequenced bi-directionally. One non-synonymous mutation (A578S) was found in Bangladeshi clinical isolates. The A578S mutation was confirmed and lies adjacent to the C580Y mutation, the major mutation causing delayed parasite clearance in Cambodia. Based on computational modeling A578S should have a significant effect on tertiary structure of the protein. The data suggest that P. falciparum in Bangladesh remains free of the C580Y mutation linked to delayed parasite clearance. However, the mutation A578S is present and based on structural analysis could affect K13 gene function. Further in vivo clinical studies are required to validate the effect of this mutation.

  18. Investigation of the Mitochondrial ATPase 6/8 and tRNALys Genes Mutations in Autism

    PubMed Central

    Piryaei, Fahimeh; Houshmand, Massoud; Aryani, Omid; Dadgar, Sepideh; Soheili, Zahra-Soheila

    2012-01-01

    Objective: Autism results from developmental factors that affect many or all functional brain systems. Brain is one of tissues which are crucially in need of adenosine triphosphate (ATP). Autism is noticeably affected by mitochondrial dysfunction which impairs energy metabolism. Considering mutations within ATPase 6, ATPase 8 and tRNALys genes, associated with different neural diseases, and the main role of ATPase 6/8 in energy generation, we decided to investigate mutations on these mtDNA-encoded genes to reveal their roles in autism pathogenesis. Materials and Methods: In this experimental study, mutation analysis for the mentioned genes were performed in a cohort of 24 unrelated patients with idiopathic autism by employing amplicon sequencing of mtDNA fragments. Results: In this study, 12 patients (50%) showed point mutations that represent a significant correlation between autism and mtDNA variations. Most of the identified substitutions (55.55%) were observed on MT-ATP6, altering some conserved amino acids to other ones which could potentially affect ATPase 6 function. Mutations causing amino acid replacement denote involvement of mtDNA genes, especially ATPase 6 in autism pathogenesis. Conclusion: MtDNA mutations in relation with autism could be remarkable to realize an understandable mechanism of pathogenesis in order to achieve therapeutic solutions. PMID:23508290

  19. Seventeen Novel Mutations in PCCA and PCCB Genes in Indian Propionic Acidemia Patients, and Their Outcomes.

    PubMed

    Gupta, Deepti; Bijarnia-Mahay, Sunita; Kohli, Sudha; Saxena, Renu; Puri, Ratna Dua; Shigematsu, Yosuke; Yamaguchi, Seiji; Sakamoto, Osamu; Gupta, Neerja; Kabra, Madhulika; Thakur, Seema; Deb, Roumi; Verma, Ishwar Chander

    2016-07-01

    The goal of this study was to identify mutations in the propionyl-CoA carboxylase alpha subunit (PCCA) and propionyl-CoA carboxylase beta subunit (PCCB) genes, and to assess their effects on propionic academia (PA) patients. Twenty-five Indian children with PA were enrolled in this study. Bidirectional Sanger sequencing was performed on both the coding and flanking regions of the PCCA and PCCB genes and the chromatograms were analyzed. Bioinformatic tools were used to classify novel variations into pathogenic or benign. The majority of the cases (19/25, 76%) were of the early-onset (<90 days of age) type and 5 were of the late-onset type. The majority of patients had mutations in the PCCA gene (18/25). A total of 26 mutations were noted: 20 in the PCCA gene and 6 in PCCB gene. Seventeen mutations were novel (14 in PCCA and 3 in PCCB). The SNP c.937C>T (p.Arg313Ter), was noted in 9/36 (25%) alleles in the PCCA gene. All of the children were symptomatic and only three survived who are doing well with no major disabilities. The spectrum of mutations in the PCCA and PCCB genes among Indians is distinct from other populations. The absence of a common mutation signifies the heterogeneity and admixture of various subpopulations. These findings also suggest that individuals of Indian origin may not benefit from the mutation-based "carrier screening panels" offered by many genetic laboratories.

  20. Clinical evaluation and mutational analysis of GALK and GALE genes in patients with galactosemia in Greece: one novel mutation and two rare cases.

    PubMed

    Schulpis, Kleopatra H; Thodi, Georgia; Iakovou, Konstantinos; Chatzidaki, Maria; Dotsikas, Yannis; Molou, Elina; Triantafylli, Olga; Loukas, Yannis L

    2017-07-26

    Deficiencies of galactokinase (GALK) and UDP-epimerase (GALE) are implicated with galactose metabolic disorders. The aim of the study was the identification of mutations in GALK and GALE genes and clinical evaluation of patients. Five patients with GALK and five with GALE deficiency were picked up via the Neonatal Screening Program. Additionally, two females, 4 years old, were referred with late diagnosed galactosemia, as rare cases. Mutational analysis was conducted via Sanger sequencing, while in silico analysis tools were utilized for the novel mutation. Psychomotor and speech development tests were performed, as well. The mutation p.Pro28Thr was identified in both alleles in GALK-deficient patients of Roma (gypsy) origin, whereas the novel p.Asn39Ser was detected in two non-Roma patients. In GALE-deficient patients benign and/or likely benign mutations were found. Psychomotor and speech delay were determined in the Roma GALK patients. In each of the late diagnosed females, four mutations were identified in all galactosemia-related genes. The mutational spectrums of GALE- and GALK-deficient patients in Greece are presented for the first time along with a clinical evaluation. Mutational analysis in all galactosemia-related genes of symptomatic patients is highly recommended for future cases.

  1. Gene Mutation Profiles in Primary Diffuse Large B Cell Lymphoma of Central Nervous System: Next Generation Sequencing Analyses

    PubMed Central

    Todorovic Balint, Milena; Jelicic, Jelena; Mihaljevic, Biljana; Kostic, Jelena; Stanic, Bojana; Balint, Bela; Pejanovic, Nadja; Lucic, Bojana; Tosic, Natasa; Marjanovic, Irena; Stojiljkovic, Maja; Karan-Djurasevic, Teodora; Perisic, Ognjen; Rakocevic, Goran; Popovic, Milos; Raicevic, Sava; Bila, Jelena; Antic, Darko; Andjelic, Bosko; Pavlovic, Sonja

    2016-01-01

    The existence of a potential primary central nervous system lymphoma-specific genomic signature that differs from the systemic form of diffuse large B cell lymphoma (DLBCL) has been suggested, but is still controversial. We investigated 19 patients with primary DLBCL of central nervous system (DLBCL CNS) using the TruSeq Amplicon Cancer Panel (TSACP) for 48 cancer-related genes. Next generation sequencing (NGS) analyses have revealed that over 80% of potentially protein-changing mutations were located in eight genes (CTNNB1, PIK3CA, PTEN, ATM, KRAS, PTPN11, TP53 and JAK3), pointing to the potential role of these genes in lymphomagenesis. TP53 was the only gene harboring mutations in all 19 patients. In addition, the presence of mutated TP53 and ATM genes correlated with a higher total number of mutations in other analyzed genes. Furthermore, the presence of mutated ATM correlated with poorer event-free survival (EFS) (p = 0.036). The presence of the mutated SMO gene correlated with earlier disease relapse (p = 0.023), inferior event-free survival (p = 0.011) and overall survival (OS) (p = 0.017), while mutations in the PTEN gene were associated with inferior OS (p = 0.048). Our findings suggest that the TP53 and ATM genes could be involved in the molecular pathophysiology of primary DLBCL CNS, whereas mutations in the PTEN and SMO genes could affect survival regardless of the initial treatment approach. PMID:27164089

  2. NDP gene mutations in 14 French families with Norrie disease.

    PubMed

    Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul

    2003-12-01

    Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.

  3. The interplay of mutations and electronic properties in disease-related genes

    NASA Astrophysics Data System (ADS)

    Shih, Chi-Tin; Wells, Stephen A.; Hsu, Ching-Ling; Cheng, Yun-Yin; Römer, Rudolf A.

    2012-02-01

    Electronic properties of DNA are believed to play a crucial role in many phenomena in living organisms, for example the location of DNA lesions by base excision repair (BER) glycosylases and the regulation of tumor-suppressor genes such as p53 by detection of oxidative damage. However, the reproducible measurement and modelling of charge migration through DNA molecules at the nanometer scale remains a challenging and controversial subject even after more than a decade of intense efforts. Here we show, by analysing 162 disease-related genes from a variety of medical databases with a total of almost 20,000 observed pathogenic mutations, a significant difference in the electronic properties of the population of observed mutations compared to the set of all possible mutations. Our results have implications for the role of the electronic properties of DNA in cellular processes, and hint at the possibility of prediction, early diagnosis and detection of mutation hotspots.

  4. A high frequency of distinct ATM gene mutations in ataxia-telangiectasia.

    PubMed Central

    Wright, J.; Teraoka, S.; Onengut, S.; Tolun, A.; Gatti, R. A.; Ochs, H. D.; Concannon, P.

    1996-01-01

    The clinical features of the autosomal recessive disorder ataxia-telangiectasia (AT) include a progressive cerebellar ataxia, hypersensitivity to ionizing radiation, and an increased susceptibility to malignancies. Epidemiological studies have suggested that AT heterozygotes may also be at increased risk for malignancy, possibly as a consequence of radiation exposure. A gene mutated in AT patients (ATM) has recently been isolated, making mutation screening in both patients and the general population possible. Because of the relatively large size of the ATM gene, the design of screening programs will depend on the types and distribution of mutations in the general population. In this report, we describe 30 mutations identified in a panel of unrelated AT patients and controls. Twenty-five of the 30 were distinct, and most patients were compound heterozygotes. The most frequently detected mutation was found in three different families and had previously been reported in five others. This corresponds to a frequency of 8% of all reported ATM mutations. Twenty-two of the alterations observed would be predicted to lead to protein truncation at sites scattered throughout the molecule. Two fibroblast cell lines, which displayed normal responses to ionizing radiation, also proved to be heterozygous for truncation mutations of ATM. These observations suggest that the carrier frequency of ATM mutations may be sufficiently high to make population screening practical. However, such screening may need to be done prospectively, that is, by searching for new mutations rather than by screening for just those already identified in AT families. PMID:8808599

  5. Lack of pathogenic mutations in SOS1 gene in phenytoin-induced gingival overgrowth patients.

    PubMed

    Margiotti, Katia; Pascolini, Giulia; Consoli, Federica; Guida, Valentina; Di Bonaventura, Carlo; Giallonardo, Anna Teresa; Pizzuti, Antonio; De Luca, Alessandro

    2017-08-01

    Gingival overgrowth is a side effect associated with some distinct classes of drugs, such as anticonvulsants, immunosuppressants, and calcium channel blockers. One of the main drugs associated with gingival overgrowth is the antiepileptic phenytoin, which affects gingival tissues by altering extracellular matrix metabolism. It has been shown that mutation of human SOS1 gene is responsible for a rare hereditary gingival fibromatosis type 1, a benign gingival overgrowth. The aim of the present study is to evaluate the possible contribution of SOS1 mutation to gingival overgrowth-related phenotype. We selected and screened for mutations a group of 24 epileptic patients who experienced significant gingival overgrowth following phenytoin therapy. Mutation scanning was carried out by denaturing high-performance liquid chromatography analysis of the entire coding region of the SOS1 gene. Novel identified variants were analyzed in-silico by using Alamut Visual mutation interpretation software, and comparison with normal control group was done. Mutation scanning of the entire coding sequence of SOS1 gene identified seven intronic variants and one new exonic substitution (c.138G>A). The seven common intronic variants were not considered to be of pathogenic importance. The exonic substitution c.138G>A was found to be absent in 100 ethnically matched normal control chromosomes, but was not expected to have functional significance based on prediction bioinformatics tools. This study represents the first mutation analysis of the SOS1 gene in phenytoin-induced gingival overgrowth epileptic patients. Present results suggest that obvious pathogenic mutations in the SOS1 gene do not represent a common mechanism underlying phenytoin-induced gingival overgrowth in epileptic patients; other mechanisms are likely to be involved in the pathogenesis of this drug-induced phenotype. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Delineation of the Marfan phenotype associated with mutations in exons 23-32 of the FBN1 gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Putnam, E.A.; Cho, M.; Milewicz, D.M.

    Marfan syndrome is a dominantly inherited connective tissue disorder with a wide range of phenotypic severity. The condition is the result of mutations in FBN1, a large gene composed of 65 exons encoding the fibrillin-1 protein. While mutations causing classic manifestations of Marfan syndrome have been identified throughout the FBN1 gene, the six previously characterized mutations resulting in the severe, perinatal lethal form of Marfan syndrome have clustered in exons 24-32 of the gene. We screened 8 patients with either neonatal Marfan syndrome or severe cardiovascular complications of Marfan syndrome for mutations in this region of the gene. Using intron-basedmore » exon-specific primers, we amplified exons 23-32 from genomic DNAs, screened these fragments by single-stranded conformational polymorphism analysis, and sequenced indicated exons. This analysis documented mutations in exons 25-27 of the FBN1 mutations in 6 of these patients. These results, taken together with previously published FBN1 mutations in this region, further define the phenotype associated with mutations in exons 24-32 of the FBN1 gene, information important for the development of possible diagnostic tests and genetic counseling. 49 refs., 4 figs., 2 tabs.« less

  7. Characterization of six mutations in Exon 37 of neurofibromatosis type 1 gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Upadhyaya, M.; Osborn, M.; Maynard, J.

    Neurofibromatosis type 1 (NF1) is one of the most common inherited disorders, with an incidence of 1 in 3,000. We screened a total of 320 unrelated NF1 patients for mutations in exon 37 of the NF1 gene. Six independent mutations were identified, of which three are novel, and these include a recurrent nonsense mutation identified in 2 unrelated patients at codon 2281 (G2281X), a 1-bp insertion (6791 ins A) resulting in a change of TAG (tyrosine) to a TAA (stop codon), and a 3-bp deletion (6839 del TAC) which generated a frameshift. Another recurrent nonsense mutation, Y2264X, which was detectedmore » in 2 unrelated patients in this study, was also previously reported in 2 NF1 individuals. All the mutations were identified within a contiguous 49-bp sequence. Further studies are warranted to support the notion that this region of the gene contains highly mutable sequences. 17 refs., 2 figs., 1 tab.« less

  8. Mutation analysis of 12 genes in Chinese families with congenital cataracts

    PubMed Central

    Sun, Wenmin; Xiao, Xueshan; Li, Shiqiang; Guo, Xiangming

    2011-01-01

    Purpose To identify mutations in 12 genes in Chinese families with congenital cataracts. Methods Twenty five families with congenital cataracts involved in this study. The coding exons and adjacent intronic regions of 12 genes were analyzed by cycle sequencing, including the alpha A crystallin (CRYAA), alpha B crystallin (CRYAB), beta A1 crystallin (CRYBA1), beta A4 crystallin (CRYBA4), beta B1 crystallin (CRYBB1), beta B2 crystallin (CRYBB2), beta B3 crystallin (CRYBB3), gamma C crystallin (CRYGC), gamma D crystallin (CRYGD), gamma S crystallin (CRYGS), alpha 3 gap junction protein (GJA3), and alpha 8 gap junction protein (GJA8) genes. Novel variants were further evaluated in 96 normal controls. Results Nine mutations were identified in 10 of the 25 families (40%), including 5 novel (c.350_352delGCT in CRYAA, c.205C>T in CRYAB, c.106G>C in CRYGD, c.77A>G in CRYGS, c.1143_1165del23 in GJA3) and 4 known (c.292G>A in CRYAA; c.215+1G>A and c.272_274delGAG in CRYBA1, and c.176C>T in GJA3). All novel mutations were predicted to be pathogenic and were not present in 96 controls. Conclusions Mutations in the 12 genes encoding crystallins and connexins were responsible for 40% Chinese families with congenital cataracts. Our results enriched our knowledge on the molecular basis of congenital cataracts in Chinese population. PMID:21866213

  9. Multi-layered mutation in hedgehog-related genes in Gorlin syndrome may affect the phenotype.

    PubMed

    Onodera, Shoko; Saito, Akiko; Hasegawa, Daigo; Morita, Nana; Watanabe, Katsuhito; Nomura, Takeshi; Shibahara, Takahiko; Ohba, Shinsuke; Yamaguchi, Akira; Azuma, Toshifumi

    2017-01-01

    Gorlin syndrome is a genetic disorder of autosomal dominant inheritance that predisposes the affected individual to a variety of disorders that are attributed largely to heterozygous germline patched1 (PTCH1) mutations. PTCH1 is a hedgehog (Hh) receptor as well as a repressor, mutation of which leads to constitutive activation of Hh pathway. Hh pathway encompasses a wide variety of cellular signaling cascades, which involve several molecules; however, no associated genotype-phenotype correlations have been reported. Recently, mutations in Suppressor of fused homolog (SUFU) or PTCH2 were reported in patients with Gorlin syndrome. These facts suggest that multi-layered mutations in Hh pathway may contribute to the development of Gorlin syndrome. We demonstrated multiple mutations of Hh-related genes in addition to PTCH1, which possibly act in an additive or multiplicative manner and lead to Gorlin syndrome. High-throughput sequencing was performed to analyze exome sequences in four unrelated Gorlin syndrome patient genomes. Mutations in PTCH1 gene were detected in all four patients. Specific nucleotide variations or frameshift variations of PTCH1 were identified along with the inferred amino acid changes in all patients. We further filtered 84 different genes which are closely related to Hh signaling. Fifty three of these had enough coverage of over ×30. The sequencing results were filtered and compared to reduce the number of sequence variants identified in each of the affected individuals. We discovered three genes, PTCH2, BOC, and WNT9b, with mutations with a predicted functional impact assessed by MutationTaster2 or PolyPhen-2 (Polymorphism Phenotyping v2) analysis. It is noticeable that PTCH2 and BOC are Hh receptor molecules. No significant mutations were observed in SUFU. Multi-layered mutations in Hh pathway may change the activation level of the Hh signals, which may explain the wide phenotypic variability of Gorlin syndrome.

  10. RNA-guided genome editing for target gene mutations in wheat.

    PubMed

    Upadhyay, Santosh Kumar; Kumar, Jitesh; Alok, Anshu; Tuli, Rakesh

    2013-12-09

    The clustered, regularly interspaced, short palindromic repeats (CRISPR) and CRISPR-associated protein (Cas) system has been used as an efficient tool for genome editing. We report the application of CRISPR-Cas-mediated genome editing to wheat (Triticum aestivum), the most important food crop plant with a very large and complex genome. The mutations were targeted in the inositol oxygenase (inox) and phytoene desaturase (pds) genes using cell suspension culture of wheat and in the pds gene in leaves of Nicotiana benthamiana. The expression of chimeric guide RNAs (cgRNA) targeting single and multiple sites resulted in indel mutations in all the tested samples. The expression of Cas9 or sgRNA alone did not cause any mutation. The expression of duplex cgRNA with Cas9 targeting two sites in the same gene resulted in deletion of DNA fragment between the targeted sequences. Multiplexing the cgRNA could target two genes at one time. Target specificity analysis of cgRNA showed that mismatches at the 3' end of the target site abolished the cleavage activity completely. The mismatches at the 5' end reduced cleavage, suggesting that the off target effects can be abolished in vivo by selecting target sites with unique sequences at 3' end. This approach provides a powerful method for genome engineering in plants.

  11. CRISPR/Cas9 system and its applications in human hematopoietic cells.

    PubMed

    Hu, Xiaotang

    2016-11-01

    Since 2012, the CRISPR-Cas9 system has been quickly and successfully tested in a broad range of organisms and cells including hematopoietic cells. The application of CRISPR-Cas9 in human hematopoietic cells mainly involves the genes responsible for HIV infection, β-thalassemia and sickle cell disease (SCD). The successful disruption of CCR5 and CXCR4 genes in T cells by CRISPR-Cas9 promotes the prospect of the technology in the functional cure of HIV. More recently, eliminating CCR5 and CXCR4 in induced pluripotent stem cells (iPSCs) derived from patients and targeting the HIV genome have been successfully carried out in several laboratories. The outcome from these approaches bring us closer to the goal of eradicating HIV infection. For hemoglobinopathies the ability to produce iPSC-derived from patients with the correction of hemoglobin (HBB) mutations by CRISPR-Cas9 has been tested in a number of laboratories. These corrected iPSCs also show the potential to differentiate into mature erythrocytes expressing high-level and normal HBB. In light of the initial success of CRESPR-Cas9 in target mutated gene(s) in the iPSCs, a combination of genomic editing and autogenetic stem cell transplantation would be the best strategy for root treatment of the diseases, which could replace traditional allogeneic stem cell transplantation. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Decreased mutation frequencies among immunoglobulin G variable region genes during viremic HIV-1 infection.

    PubMed

    Bowers, Elisabeth; Scamurra, Ronald W; Asrani, Anil; Beniguel, Lydie; MaWhinney, Samantha; Keays, Kathryne M; Thurn, Joseph R; Janoff, Edward N

    2014-01-01

    HIV-1 infection is complicated by high rates of opportunistic infections against which specific antibodies contribute to immune defense. Antibody function depends on somatic hypermutation (SHM) of variable regions of immunoglobulin heavy chain genes (VH-D-J). We characterized the frequency of SHM in expressed IgG mRNA immunoglobulin transcripts from control and HIV-1-infected patients. We compared utilization of genes in the most prominent VH family (VH3) and mutation frequencies and patterns of cDNA from VH3-IgG genes from 10 seronegative control subjects and 21 patients with HIV-1 infection (6 without and 15 patients with detectable plasma viremia). Unique IgG VH3 family cDNA sequences (n = 1,565) were PCR amplified, cloned, and sequenced from blood. Sequences were analyzed using online (Vbase) and in-house immunoglobulin alignment resources. Mutation frequencies in the antigen-binding hypervariable complementarity determining regions (CDR1/2) of IgG class-switched B cells were lower among viremic HIV-1-infected patients vs. controls for nucleotides (CDR1/2: 10±5% vs. 13.5±6%, p = 0.03) and amino acids (CDR: 20%±10 vs. 25%±12, p = 0.02) and in structural framework regions. Mutation patterns were similar among groups. The most common VH3 gene, VH3-23, was utilized less frequently among viremic HIV-1-infected patients (p = 0.03), and overall, mutation frequencies were decreased in nearly all VH3 genes compared with controls. B cells from HIV-1-infected patients show decreased mutation frequencies, especially in antigen-binding VH3 CDR genes, and selective defects in gene utilization. Similar mutation patterns suggest defects in the quantity, but not quality, of mutator activity. Lower levels of SHM in IgG class-switched B cells from HIV-1-infected patients may contribute to the increased risk of opportunistic infections and impaired humoral responses to preventative vaccines.

  13. Mutations in the gene for X-linked adrenoleukodystrophy in patients with different clinical phenotypes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Braun, A.; Ambach, H.; Kammerer, S.

    Recently, the gene for the most common peroxisomal disorder, X-linked adrenoleukodystrophy (X-ALD), has been described encoding a peroxisomal membrane transporter protein. We analyzed the entire protein-coding sequence of this gene by reverse-transcription PCR, SSCP, and DNA sequencing in five patients with different clinical expressions were cerebral childhood ALD, adrenomyecloneuropathy (AMN), and {open_quotes}Addison disease only{close_quotes} (AD) phenotype. In the three patients exhibiting the classical picture of severe childhood ALD we identified in the 5{prime} portion of the X-ALD gene a 38-bp deletion that causes a frameshift mutation, a 3-bp deletion leading to a deletion of an amino acid in the ATP-bindingmore » domain of the ALD protein, and a missense mutation. In the patient with the clinical phenotype of AMN, a nonsense mutation in codon 212, along with a second site mutation at codon 178, was observed. Analysis of the patient with the ADO phenotype revealed a further missense mutation at a highly conserved position in the ALDP/PMP70 comparison. The disruptive nature of two mutations (i.e., the frameshift and the nonsense mutation) in patients with biochemically proved childhood ALD and AMN further strongly supports the hypothesis that alterations in this gene play a crucial role in the pathogenesis of X-ALD. Since the current biochemical techniques for X-ALD carrier detection in affected families lack sufficient reliability, our procedure described for systematic mutation scanning is also capable of improving genetic counseling and prenatal diagnosis. 19 refs., 6 figs., 3 tabs.« less

  14. Molecular Epidemiological Survey of Glucose-6-Phosphate Dehydrogenase Deficiency and Thalassemia in Uygur and Kazak Ethnic Groups in Xinjiang, Northwest China.

    PubMed

    Han, Luhao; Su, Hai; Wu, Hao; Jiang, Weiying; Chen, Suqin

    2016-06-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency and thalassemia occur frequently in tropical and subtropical regions, while the prevalence of relationship between the two diseases in Xinjiang has not been reported. We aimed to determine the prevalence of these diseases and clarify the relationship between genotypes and phenotypes of the two diseases in the Uygur and Kazak ethnic groups in Xinjiang. We measured G6PD activity by G6PD:6PGD (glucose acid-6-phosphate dehydrogenase) ratio, identified the gene variants of G6PD and α- and β-globin genes by polymerase chain reaction (PCR)-DNA sequencing and gap-PCR and compared these variants in different ethnic groups in Xinjiang with those adjacent to it. Of the 149 subjects with molecular analysis of G6PD deficiency conducted, a higher prevalence of the combined mutations c.1311C > T/IVSXI + 93T > C and IVSXI + 93T > C, both with normal enzymatic activities, were observed in the Uygur and Kazak subjects. A case of rare mutation HBB: c.135delC [codon 44 (-C) in the heterozygous state], a heterozygous case of HBB: c.68A > G [Hb G-Taipei or β22(B4)Glu→Gly] and several common single nucleotide polymorphisms (SNPs) were found on the β-globin gene. In conclusion, G6PD deficiency with pathogenic mutations and three common α-thalassemia (α-thal) [- -(SEA), -α(3.7) (rightward), -α(4.2) (leftward)] deletions and point mutations of the α-globin gene were not detected in the present study. The average incidence of β-thalassemia (β-thal) in Uygurs was 1.45% (2/138) in Xinjiang. The polymorphisms of G6PD and β-globin genes might be useful genetic markers to trace the origin and migration of the Uygur and Kazak in Xinjiang.

  15. Somatic mutation profiles of clear cell endometrial tumors revealed by whole exome and targeted gene sequencing.

    PubMed

    Le Gallo, Matthieu; Rudd, Meghan L; Urick, Mary Ellen; Hansen, Nancy F; Zhang, Suiyuan; Lozy, Fred; Sgroi, Dennis C; Vidal Bel, August; Matias-Guiu, Xavier; Broaddus, Russell R; Lu, Karen H; Levine, Douglas A; Mutch, David G; Goodfellow, Paul J; Salvesen, Helga B; Mullikin, James C; Bell, Daphne W

    2017-09-01

    The molecular pathogenesis of clear cell endometrial cancer (CCEC), a tumor type with a relatively unfavorable prognosis, is not well defined. We searched exome-wide for novel somatically mutated genes in CCEC and assessed the mutational spectrum of known and candidate driver genes in a large cohort of cases. We conducted whole exome sequencing of paired tumor-normal DNAs from 16 cases of CCEC (12 CCECs and the CCEC components of 4 mixed histology tumors). Twenty-two genes-of-interest were Sanger-sequenced from another 47 cases of CCEC. Microsatellite instability (MSI) and microsatellite stability (MSS) were determined by genotyping 5 mononucleotide repeats. Two tumor exomes had relatively high mutational loads and MSI. The other 14 tumor exomes were MSS and had 236 validated nonsynonymous or splice junction somatic mutations among 222 protein-encoding genes. Among the 63 cases of CCEC in this study, we identified frequent somatic mutations in TP53 (39.7%), PIK3CA (23.8%), PIK3R1 (15.9%), ARID1A (15.9%), PPP2R1A (15.9%), SPOP (14.3%), and TAF1 (9.5%), as well as MSI (11.3%). Five of 8 mutations in TAF1, a gene with no known role in CCEC, localized to the putative histone acetyltransferase domain and included 2 recurrently mutated residues. Based on patterns of MSI and mutations in 7 genes, CCEC subsets molecularly resembled serous endometrial cancer (SEC) or endometrioid endometrial cancer (EEC). Our findings demonstrate molecular similarities between CCEC and SEC and EEC and implicate TAF1 as a novel candidate CCEC driver gene. Cancer 2017;123:3261-8. © 2017 American Cancer Society. © 2017 American Cancer Society.

  16. [Rapid detection of hot spot mutations of FGFR3 gene with PCR-high resolution melting assay].

    PubMed

    Li, Shan; Wang, Han; Su, Hua; Gao, Jinsong; Zhao, Xiuli

    2017-08-10

    To identify the causative mutations in five individuals affected with dyschondroplasia and develop an efficient procedure for detecting hot spot mutations of the FGFR3 gene. Genomic DNA was extracted from peripheral blood samples with a standard phenol/chloroform method. PCR-Sanger sequencing was used to analyze the causative mutations in the five probands. PCR-high resolution melting (HRM) was developed to detect the identified mutations. A c.1138G>A mutation in exon 8 was found in 4 probands, while a c.1620C>G mutation was found in exon 11 of proband 5 whom had a mild phenotype. All patients were successfully distinguished from healthy controls with the PCR-HRM method. The results of HRM analysis were highly consistent with that of Sanger sequencing. The Gly380Arg and Asn540Lys are hot spot mutations of the FGFR3 gene among patients with ACH/HCH. PCR-HRM analysis is more efficient for detecting hot spot mutations of the FGFR3 gene.

  17. Adiposity is associated with p53 gene mutations in breast cancer.

    PubMed

    Ochs-Balcom, Heather M; Marian, Catalin; Nie, Jing; Brasky, Theodore M; Goerlitz, David S; Trevisan, Maurizio; Edge, Stephen B; Winston, Janet; Berry, Deborah L; Kallakury, Bhaskar V; Freudenheim, Jo L; Shields, Peter G

    2015-10-01

    Mutations in the p53 gene are among the most frequent genetic events in human cancer and may be triggered by environmental and occupational exposures. We examined the association of clinical and pathological characteristics of breast tumors and breast cancer risk factors according to the prevalence and type of p53 mutations. Using tumor blocks from incident cases from a case-control study in western New York, we screened for p53 mutations in exons 2-11 using the Affymetrix p53 Gene Chip array and analyzed case-case comparisons using logistic regression. The p53 mutation frequency among cases was 28.1 %; 95 % were point mutations (13 % of which were silent) and the remainder were single base pair deletions. Sixty seven percent of all point mutations were transitions; 24 % of them are G:C>A:T at CpG sites. Positive p53 mutation status was associated with poorer differentiation (OR, 95 % CI 2.29, 1.21-4.32), higher nuclear grade (OR, 95 % CI 1.99, 1.22-3.25), and increased Ki-67 status (OR, 95 % CI 1.81, 1.10-2.98). Cases with P53 mutations were more likely to have a combined ER-positive and PR-negative status (OR, 95 % CI 1.65, 1.01-2.71), and a combined ER-negative and PR-negative status (OR, 95 % CI 2.18, 1.47-3.23). Body mass index >30 kg/m(2), waist circumference >79 cm, and waist-to-hip ratio >0.86 were also associated with p53 status; obese breast cancer cases are more likely to have p53 mutations (OR, 95 % CI 1.78, 1.19-2.68). We confirmed that p53 mutations are associated with less favorable tumor characteristics and identified an association of p53 mutation status and adiposity.

  18. Two novel mutations in the GAN gene causing giant axonal neuropathy.

    PubMed

    Normendez-Martínez, Monica Irad; Monterde-Cruz, Lucero; Martínez, Roberto; Marquez-Harper, Magdalena; Esquitin-Garduño, Nayelli; Valdes-Flores, Margarita; Casas-Avila, Leonora; de Leon-Suarez, Valeria Ponce; Romero-Díaz, Viktor Javier; Hidalgo-Bravo, Alberto

    2018-06-06

    Giant axonal neuropathy (GAN) is a rare neurodegenerative disease transmitted in an autosomal recessive mode. This disorder presents motor and sensitive symptoms with an onset in early childhood. Progressive neurodegeneration makes the patients wheelchair dependent by the end of the second decade of life. Affected individuals do not survive beyond the third decade of life. Molecular analysis has identified mutations in the gene GAN in patients with this disorder. This gene produces a protein called gigaxonin which is presumably involved in protein degradation via the ubiquitin-proteasome system. However, the underlying molecular mechanism is not clearly understood yet. Here we present the first patient from Mexico with clinical data suggesting GAN. Sequencing of the GAN gene was carried out. Changes in the nucleotide sequence were investigated for their possible impact on protein function and structure using the publicly available prediction tools PolyPhen-2 and PANTHER. The patient is a compound heterozygous carrying two novel mutations in the GAN gene. The sequence analysis revealed two missense mutations in the Kelch repeats domain. In one allele, a C>T transition was found in exon 9 at the nucleotide position 55393 (g.55393C>T). In the other allele, a transversion G>T in exon 11 at the nucleotide position 67471 (g.67471G>T) was observed. Both of the bioinformatic tools predicted that these amino acid substitutions would have a negative impact on gigaxonin's function. This work provides useful information for health professionals and expands the spectrum of disease-causing mutations in the GAN gene and it is the first documented case in Mexican population.

  19. Distribution of gene mutations in sporadic congenital cataract in a Han Chinese population

    PubMed Central

    Li, Dan; Wang, Siying; Ye, Hongfei; Tang, Yating; Qiu, Xiaodi; Fan, Qi; Rong, Xianfang; Liu, Xin; Chen, Yuhong; Yang, Jin

    2016-01-01

    Purpose This study aimed to investigate the genetic effects underlying non-familial sporadic congenital cataract (SCC). Methods We collected DNA samples from 74 patients with SCC and 20 patients with traumatic cataract (TC) in an age-matched group and performed genomic sequencing of 61 lens-related genes with target region capture and next-generation sequencing (NGS). The suspected SCC variants were validated with MassARRAY and Sanger sequencing. DNA samples from 103 healthy subjects were used as additional controls in the confirmation examination. Results By filtering against common variants in public databases and those associated with TC cases, we identified 23 SCC-specific variants in 17 genes from 19 patients, which were predicted to be functional. These mutations were further confirmed by examination of the 103 healthy controls. Among the mutated genes, CRYBB3 had the highest mutation frequency with mutations detected four times in four patients, followed by EPHA2, NHS, and WDR36, the mutation of which were detected two times in two patients. We observed that the four patients with CRYBB3 mutations had three different cataract phenotypes. Conclusions From this study, we concluded the clinical and genetic heterogeneity of SCC. This is the first study to report broad spectrum genotyping for patients with SCC. PMID:27307692

  20. AV59M KCNJ11 gene mutation leading to intermediate DEND syndrome in a Chinese child.

    PubMed

    Sang, Yanmei; Ni, Guichen; Gu, Yi; Liu, Min

    2011-01-01

    Heterozygous activating mutations in the KCNJ11 gene can cause permanent and transient neonatal diabetes. In the present study, we sequenced the KCNJ11 gene in a Chinese boy diagnosed with permanent neonatal diabetes mellitus (PNDM) and also in his parents. A heterozygous 175G > A (V59M) mutation was identified in the patient, while no KCNJ11 gene mutations were found in his parents, indicating that this mutation is de novo. The patient with the V59M mutation successfully switched from insulin injections to oral glibenclamide; 2 years of follow-up revealed that the patient had intermediate developmental delay, epilepsy and neonatal diabetes (DEND) syndrome. This is the first patient who is reported to have iDEND syndrome due to KCNJ11 V59M mutation in China.

  1. A novel start codon mutation of the MERTK gene in a patient with retinitis pigmentosa

    PubMed Central

    Jinda, Worapoj; Poungvarin, Naravat; Taylor, Todd D.; Suzuki, Yutaka; Thongnoppakhun, Wanna; Limwongse, Chanin; Lertrit, Patcharee; Suriyaphol, Prapat

    2016-01-01

    Purpose Retinitis pigmentosa (RP) is a clinically and genetically heterogeneous group of inherited retinal degenerations characterized by progressive loss of photoreceptor cells and RPE functions. More than 70 causative genes are known to be responsible for RP. This study aimed to identify the causative gene in a patient from a consanguineous family with childhood-onset severe retinal dystrophy. Methods To identify the defective gene, whole exome sequencing was performed. Candidate causative variants were selected and validated using Sanger sequencing. Segregation analysis of the causative gene was performed in additional family members. To verify that the mutation has an effect on protein synthesis, an expression vector containing the first ten amino acids of the mutant protein fused with the DsRed2 fluorescent protein was constructed and transfected into HEK293T cells. Expression of the fusion protein in the transfected cells was measured using fluorescence microscopy. Results By filtering against public variant databases, a novel homozygous missense mutation (c.3G>A) localized in the start codon of the MERTK gene was detected as a potentially pathogenic mutation for autosomal recessive RP. The c.3G>A mutation cosegregated with the disease phenotype in the family. No expression of the first ten amino acids of the MerTK mutant fused with the DsRed2 fluorescent protein was detected in HEK293T cells, indicating that the mutation affects the translation initiation site of the gene that may lead to loss of function of the MerTK signaling pathway. Conclusions We report a novel missense mutation (c.3G>A, p.0?) in the MERTK gene that causes severe vision impairment in a patient. Taken together with previous reports, our results expand the spectrum of MERTK mutations and extend our understanding of the role of the MerTK protein in the pathogenesis of retinitis pigmentosa. PMID:27122965

  2. A novel alpha-thalassemia nonsense mutation in HBA2: C.382 A > T globin gene.

    PubMed

    Hamid, Mohammad; Bokharaei Merci, Hanieh; Galehdari, Hamid; Saberi, Ali Hossein; Kaikhaei, Bijan; Mohammadi-Anaei, Marziye; Ahmadzadeh, Ahmad; Shariati, Gholamreza

    2014-07-01

    In this study, a new alpha globin gene mutation on the α2-globin gene is reported. This mutation resulted in a Lys > stop codon substitution at position 127 which was detected in four individuals (three males and one female). DNA sequencing revealed this mutation in unrelated persons in Khuzestan province, Southwestern Iran of Lor ethnicity. This mutation caused no severe hematological abnormalities in the carriers. From the nature of substituted residues in α2-globin, it is widely expected that this mutation leads to unstable and truncated protein and should be detected in couples at risk for α-thalassemia.

  3. Molecular analysis of globin gene expression in different thalassaemia disorders: individual variation of β(E) pre-mRNA splicing determine disease severity.

    PubMed

    Tubsuwan, Alisa; Munkongdee, Thongperm; Jearawiriyapaisarn, Natee; Boonchoy, Chanikarn; Winichagoon, Pranee; Fucharoen, Suthat; Svasti, Saovaros

    2011-09-01

    Thalassaemia is characterized by the reduced or absent production of globins in the haemoglobin molecule leading to imbalanced α-globin/non α-globin chains. HbE, the result of a G to A mutation in codon 26 of the HBB (β-globin) gene, activates a cryptic 5' splice site in codon 25 leading to a reduction of correctly spliced β(E) -globin (HBB:c.79G>A) mRNA and consequently β(+) -thalassaemia. A wide range of clinical severities in bothα- and β-thalassaemia syndromes, from nearly asymptomatic to transfusion-dependent, has been observed. The correlation between clinical heterogeneity in various genotypes of thalassaemia and the levels of globin gene expression and β(E) -globin pre-mRNA splicing were examined using multiplex quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) and allele-specific RT-qPCR. The α-globin/non α-globin mRNA ratio was demonstrated to be a good indicator for disease severity among different thalassaemia disorders. However, the α-globin/non α-globin mRNA ratio ranged widely in β-thalassaemia/HbE patients, with no significant difference between mild and severe phenotypes. Interestingly, the correctly to aberrantly spliced β(E) -globin mRNA ratio in 30% of mild β-thalassaemia/HbE patients was higher than that of the severe patients. The splicing process of β(E) -globin pre-mRNA differs among β-thalassaemia/HbE patients and serves as one of the modifying factors for disease severity. © 2011 Blackwell Publishing Ltd.

  4. Frameshift mutational target gene analysis identifies similarities and differences in constitutional mismatch repair-deficiency and Lynch syndrome.

    PubMed

    Maletzki, Claudia; Huehns, Maja; Bauer, Ingrid; Ripperger, Tim; Mork, Maureen M; Vilar, Eduardo; Klöcking, Sabine; Zettl, Heike; Prall, Friedrich; Linnebacher, Michael

    2017-07-01

    Mismatch-repair deficient (MMR-D) malignancies include Lynch Syndrome (LS), which is secondary to germline mutations in one of the MMR genes, and the rare childhood-form of constitutional mismatch repair-deficiency (CMMR-D); caused by bi-allelic MMR gene mutations. A hallmark of LS-associated cancers is microsatellite instability (MSI), characterized by coding frameshift mutations (cFSM) in target genes. By contrast, tumors arising in CMMR-D patients are thought to display a somatic mutation pattern differing from LS. This study has the main goal to identify cFSM in MSI target genes relevant in CMMR-D and to compare the spectrum of common somatic mutations, including alterations in DNA polymerases POLE and D1 between LS and CMMR-D. CMMR-D-associated tumors harbored more somatic mutations compared to LS cases, especially in the TP53 gene and in POLE and POLD1, where novel mutations were additionally identified. Strikingly, MSI in classical mononucleotide markers BAT40 and CAT25 was frequent in CMMR-D cases. MSI-target gene analysis revealed mutations in CMMR-D-associated tumors, some of them known to be frequently hit in LS, such as RNaseT2, HT001, and TGFβR2. Our results imply a general role for these cFSM as potential new drivers of MMR-D tumorigenesis. © 2017 Wiley Periodicals, Inc.

  5. A multiplex method for detection of glucose-6-phosphate dehydrogenase (G6PD) gene mutations.

    PubMed

    Zhang, L; Yang, Y; Liu, R; Li, Q; Yang, F; Ma, L; Liu, H; Chen, X; Yang, Z; Cui, L; He, Y

    2015-12-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzyme defect caused by G6PD gene mutations. This study aimed to develop a cost-effective, multiplex, genotyping method for detecting common mutations in the G6PD gene. We used a SNaPshot approach to genotype multiple G6PD mutations that are common to human populations in South-East Asia. This assay is based on multiplex PCR coupled with primer extension reactions. Different G6PD gene mutations were determined by peak retention time and colors of the primer extension products. We designed PCR primers for multiplex amplification of the G6PD gene fragments and for primer extension reactions to genotype 11 G6PD mutations. DNA samples from a total of 120 unrelated G6PD-deficient individuals from the China-Myanmar border area were used to establish and validate this method. Direct sequencing of the PCR products demonstrated 100% concordance between the SNaPshot and the sequencing results. The SNaPshot method offers a specific and sensitive alternative for simultaneously interrogating multiple G6PD mutations. © 2015 John Wiley & Sons Ltd.

  6. Mutation detection in the human HSP70B′ gene by denaturing high-performance liquid chromatography

    PubMed Central

    Hecker, Karl H.; Asea, Alexzander; Kobayashi, Kaoru; Green, Stacy; Tang, Dan; Calderwood, Stuart K.

    2000-01-01

    Variances, particularly single nucleotide polymorphisms (SNP), in the genomic sequence of individuals are the primary key to understanding gene function as it relates to differences in the susceptibility to disease, environmental influences, and therapy. In this report, the HSP70B′ gene is the target sequence for mutation detection in biopsy samples from human prostate cancer patients undergoing combined hyperthermia and radiation therapy at the Dana-Farber Cancer Institute, using temperature-modulated heteroduplex analysis (TMHA). The underlying principles of TMHA for mutation detection using DHPLC technology are discussed. The procedures involved in amplicon design for mutation analysis by DHPLC are detailed. The melting behavior of the complete coding sequence of the target gene is characterized using WAVEMAKERTM software. Four overlapping amplicons, which span the complete coding region of the HSP70B′ gene, amenable to mutation detection by DHPLC were identified based on the software-predicted melting profile of the target sequence. TMHA was performed on PCR products of individual amplicons of the HSP70B′ gene on the WAVE® Nucleic Acid Fragment Analysis System. The criteria for mutation calling by comparing wild-type and mutant chromatographic patterns are discussed. PMID:11189446

  7. Mutation detection in the human HSP7OB' gene by denaturing high-performance liquid chromatography.

    PubMed

    Hecker, K H; Asea, A; Kobayashi, K; Green, S; Tang, D; Calderwood, S K

    2000-11-01

    Variances, particularly single nucleotide polymorphisms (SNP), in the genomic sequence of individuals are the primary key to understanding gene function as it relates to differences in the susceptibility to disease, environmental influences, and therapy. In this report, the HSP70B' gene is the target sequence for mutation detection in biopsy samples from human prostate cancer patients undergoing combined hyperthermia and radiation therapy at the Dana-Farber Cancer Institute, using temperature-modulated heteroduplex analysis (TMHA). The underlying principles of TMHA for mutation detection using DHPLC technology are discussed. The procedures involved in amplicon design for mutation analysis by DHPLC are detailed. The melting behavior of the complete coding sequence of the target gene is characterized using WAVEMAKER software. Four overlapping amplicons, which span the complete coding region of the HSP70B' gene, amenable to mutation detection by DHPLC were identified based on the software-predicted melting profile of the target sequence. TMHA was performed on PCR products of individual amplicons of the HSP70B' gene on the WAVE Nucleic Acid Fragment Analysis System. The criteria for mutation calling by comparing wild-type and mutant chromatographic patterns are discussed.

  8. Mutations in XLF/NHEJ1/Cernunnos gene results in downregulation of telomerase genes expression and telomere shortening.

    PubMed

    Carrillo, Jaime; Calvete, Oriol; Pintado-Berninches, Laura; Manguan-García, Cristina; Sevilla Navarro, Julian; Arias-Salgado, Elena G; Sastre, Leandro; Guenechea, Guillermo; López Granados, Eduardo; de Villartay, Jean-Pierre; Revy, Patrick; Benitez, Javier; Perona, Rosario

    2017-05-15

    NHEJ1-patients develop severe progressive lymphocytopenia and premature aging of hematopoietic stem cells (HSCs) at a young age. Here we show a patient with a homozygous-NHEJ1 mutation identified by whole exome-sequencing that developed severe pancytopenia and bone marrow aplasia correlating with the presence of short telomeres. The mutation resulted in a truncated protein. In an attempt to identify the mechanism behind the short telomere phenotype found in the NHEJ1-patient we downregulated NHEJ1 expression in 293T and CD34+cells. This downregulation resulted in reduced telomerase activity and decreased expression of several telomerase/shelterin genes. Interestingly, cell lines derived from two other NHEJ1-deficient patients with different mutations also showed increased p21 expression, inhibition in expression of several telomerase complex genes and shortened telomeres. Decrease in expression of telomerase/shelterin genes did not occur when we inhibited expression of other NHEJ genes mutated in SCID patients: DNA-PK, Artemis or LigaseIV. Because premature aging of HSCs is observed only in NHEJ1 patients, we propose that is the result of senescence induced by decreased expression of telomerase/shelterin genes that lead to an inhibition of telomerase activity. Previous reports failed to find this connection because of the use of patient´s cells immortalized by TERT expression or recombined telomeres by ALT pathway. In summary, defective regulation of telomere biology together with defective V(D)J recombination can negatively impact on the evolution of the disease in these patients. Identification of telomere shortening is important since it may open new therapeutic interventions for these patients by treatments aimed to recover the expression of telomerase genes. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. [Analysis of gene mutation of early onset epileptic spasm with unknown reason].

    PubMed

    Yang, X; Pan, G; Li, W H; Zhang, L M; Wu, B B; Wang, H J; Zhang, P; Zhou, S Z

    2017-11-02

    Objective: To summarize the gene mutation of early onset epileptic spasm with unknown reason. Method: In this prospective study, data of patients with early onset epileptic spasm with unknown reason were collected from neurological department of Children's Hospital of Fudan University between March 2016 and December 2016. Patients with known disorders such as infection, metabolic, structural, immunological problems and known genetic mutations were excluded. Patients with genetic disease that can be diagnosed by clinical manifestations and phenotypic characteristics were also excluded. Genetic research methods included nervous system panel containing 1 427 epilepsy genes, whole exome sequencing (WES), analysis of copy number variation (CNV) and karyotype analysis of chromosome. The basic information, phenotypes, genetic results and the antiepileptic treatment of patients were analyzed. Result: Nine of the 17 cases with early onset epileptic spasm were boys and eight were girls. Patients' age at first seizure onset ranged from 1 day after birth to 8 months (median age of 3 months). The first hospital visit age ranged from 1 month to 2 years (median age of 4.5 months). The time of following-up ranged from 8 months to 3 years and 10 months. All the 17 patients had early onset epileptic spasm. Video electroencephalogram was used to monitor the spasm seizure. Five patients had Ohtahara syndrome, 10 had West syndrome, two had unclear classification. In 17 cases, 10 of them had detected pathogenic genes. Nine cases had point mutations, involving SCN2A, ARX, UNC80, KCNQ2, and GABRB3. Except one case of mutations in GABRB3 gene have been reported, all the other cases had new mutations. One patient had deletion mutation in CDKL5 gene. One CNV case had 6q 22.31 5.5MB repeats. Ten cases out of 17 were using 2-3 antiepileptic drugs (AEDs) and the drugs had no effect. Seven cases used adrenocorticotropic hormone (ACTH) and prednisone besides AEDs (a total course for 8 weeks

  10. Novel growth hormone receptor gene mutation in a patient with Laron syndrome.

    PubMed

    Arman, Ahmet; Yüksel, Bilgin; Coker, Ajda; Sarioz, Ozlem; Temiz, Fatih; Topaloglu, Ali Kemal

    2010-04-01

    Growth Hormone (GH) is a 22 kDa protein that has effects on growth and glucose and fat metabolisms. These effects are initiated by binding of growth hormone (GH) to growth hormone receptors (GHR) expressed in target cells. Mutations or deletions in the growth hormone receptor cause an autosomal disorder called Laron-type dwarfism (LS) characterized by high circulating levels of serum GH and low levels of insulin like growth factor-1 (IGF-1). We analyzed the GHR gene for genetic defect in seven patients identified as Laron type dwarfism. We identified two missense mutations (S40L and W104R), and four polymorphisms (S473S, L526I, G168G and exon 3 deletion). We are reporting a mutation (W104R) at exon 5 of GHR gene that is not previously reported, and it is a novel mutation.

  11. Splicing factor gene mutations in the myelodysplastic syndromes: impact on disease phenotype and therapeutic applications.

    PubMed

    Pellagatti, Andrea; Boultwood, Jacqueline

    2017-01-01

    Splicing factor gene mutations are the most frequent mutations found in patients with the myeloid malignancy myelodysplastic syndrome (MDS), suggesting that spliceosomal dysfunction plays a major role in disease pathogenesis. The aberrantly spliced target genes and deregulated cellular pathways associated with the commonly mutated splicing factor genes in MDS (SF3B1, SRSF2 and U2AF1) are being identified, illuminating the molecular mechanisms underlying MDS. Emerging data from mouse modeling studies indicate that the presence of splicing factor gene mutations can lead to bone marrow hematopoietic stem/myeloid progenitor cell expansion, impaired hematopoiesis and dysplastic differentiation that are hallmarks of MDS. Importantly, recent evidence suggests that spliceosome inhibitors and splicing modulators may have therapeutic value in the treatment of splicing factor mutant myeloid malignancies. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Novel and recurrent mutations in the C1NH gene of Arab patients affected with hereditary angioedema.

    PubMed

    Faiyaz-Ul-Haque, Muhammad; Al-Gazlan, Sulaiman; Abalkhail, Halah A; Al-Abdulatif, Ahmad; Toulimat, Mohamed; Peltekova, Iskra; Khaliq, Agha M R; Al-Dayel, Fouad; Zaidi, Syed H E

    2010-01-01

    Autosomal dominant hereditary angioedema (HAE) results in episodes of subcutaneous edema in any body part and/or submucosal edema of the upper respiratory or gastrointestinal tracts. This disorder is caused by mutations in the C1NH gene, many of which have been described primarily in European patients. However, the genetic cause of HAE in Middle Eastern Arab patients has not yet been determined. Four unrelated Arab families, in which 15 patients were diagnosed with HAE, were studied. DNA from 13 patients was analyzed for mutations in the C1NH gene by DNA sequencing. Three novel and 2 recurrent mutations were identified in the C1NH gene of HAE patients. In family 1, the patient was heterozygous for a novel c.856C>T and a recurrent c.1361T>A missense mutation encoding for p.Arg264Cys and p.Val432Glu, respectively. In patients from family 2, a novel c.509C>T missense mutation encoding for a p.Ser148Phe was identified. In patients from family 3, a novel c.1142delC nonsense mutation encoding for a p.Ala359AlafsX15 was discovered. In family 4, a recurrent c.1397G>A missense mutation encoding for a p.Arg444His was present. This is the first ever report of C1NH gene mutations in Middle Eastern Arab patients. Our study suggests that, despite the numerous existing mutations in the C1NH gene, there are novel and recurrent mutations in HAE patients of non-European origin. We conclude that the spectrum of C1NH gene mutations in HAE patients is wider due to the likely presence of novel and recurrent mutations in patients of other ethnicities. 2009 S. Karger AG, Basel.

  13. PROP1 gene mutations in a 36-year-old female presenting with psychosis

    PubMed Central

    Rijal, Tshristi; Jha, Kunal Kishor; Saluja, Harpreet

    2017-01-01

    Summary Combined pituitary hormonal deficiency (CPHD) is a rare disease that results from mutations in genes coding for transcription factors that regulate the differentiation of pituitary cells. PROP1 gene mutations are one of the etiological diagnoses of congenital panhypopituitarism, however symptoms vary depending on phenotypic expression. We present a case of psychosis in a 36-year-old female with congenital panhypopituitarism who presented with paranoia, flat affect and ideas of reference without a delirious mental state, which resolved with hormone replacement and antipsychotics. Further evaluation revealed that she had a homozygous mutation of PROP1 gene. In summary, compliance with hormonal therapy for patients with hypopituitarism appears to be effective for the prevention and treatment of acute psychosis symptoms. Learning points: Patients with PROP1 gene mutation may present with psychosis with no impairment in orientation and memory. There is currently inadequate literature on this topic, and further study on the possible mechanisms of psychosis as a result of endocrine disturbance is required. Compliance with hormonal therapy for patients with hypopituitarism appears to be effective for prevention and treatment of acute psychosis symptoms. PMID:28458894

  14. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kang, Qing-lin; Xu, Jia; Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People's Hospital, Shanghai 200233

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related genemore » with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.« less

  15. Clinical evaluation of panel testing by next-generation sequencing (NGS) for gene mutations in myeloid neoplasms.

    PubMed

    Au, Chun Hang; Wa, Anna; Ho, Dona N; Chan, Tsun Leung; Ma, Edmond S K

    2016-01-22

    Genomic techniques in recent years have allowed the identification of many mutated genes important in the pathogenesis of acute myeloid leukemia (AML). Together with cytogenetic aberrations, these gene mutations are powerful prognostic markers in AML and can be used to guide patient management, for example selection of optimal post-remission therapy. The mutated genes also hold promise as therapeutic targets themselves. We evaluated the applicability of a gene panel for the detection of AML mutations in a diagnostic molecular pathology laboratory. Fifty patient samples comprising 46 AML and 4 other myeloid neoplasms were accrued for the study. They consisted of 19 males and 31 females at a median age of 60 years (range: 18-88 years). A total of 54 genes (full coding exons of 15 genes and exonic hotspots of 39 genes) were targeted by 568 amplicons that ranged from 225 to 275 bp. The combined coverage was 141 kb in sequence length. Amplicon libraries were prepared by TruSight myeloid sequencing panel (Illumina, CA) and paired-end sequencing runs were performed on a MiSeq (Illumina) genome sequencer. Sequences obtained were analyzed by in-house bioinformatics pipeline, namely BWA-MEM, Samtools, GATK, Pindel, Ensembl Variant Effect Predictor and a novel algorithm ITDseek. The mean count of sequencing reads obtained per sample was 3.81 million and the mean sequencing depth was over 3000X. Seventy-seven mutations in 24 genes were detected in 37 of 50 samples (74 %). On average, 2 mutations (range 1-5) were detected per positive sample. TP53 gene mutations were found in 3 out of 4 patients with complex and unfavorable cytogenetics. Comparing NGS results with that of conventional molecular testing showed a concordance rate of 95.5 %. After further resolution and application of a novel bioinformatics algorithm ITDseek to aid the detection of FLT3 internal tandem duplication (ITD), the concordance rate was revised to 98.2 %. Gene panel testing by NGS approach was

  16. Identification of 5 novel mutations in the AGXT gene.

    PubMed

    Basmaison, O; Rolland, M O; Cochat, P; Bozon, D

    2000-06-01

    In order to identify additional genotypes in primary hyperoxaluria type 1, we sequenced the AGXT genes of 9 patients. We report 5 new mutations. Three are splice-site mutations situated at the end of intron 4 and 8 (647-1G>A, 969-1G>C, 969-3C>G), one is a missense mutation in exon 5 (D183N), and one is a short duplication in exon 2 (349ins7). Their consequence is always a lack of enzymatic activity of the Alanine-Glyoxylate Aminotransferase (AGT); for 4 of them, we were able to deduce that they were associated to the absence of AGT protein. These mutations are rare, as they have been found on one allele in our study (except 969-3C>G present in 2 unrelated families), and have not been previously reported.

  17. Almost 2% of Spanish breast cancer families are associated to germline pathogenic mutations in the ATM gene.

    PubMed

    Tavera-Tapia, A; Pérez-Cabornero, L; Macías, J A; Ceballos, M I; Roncador, G; de la Hoya, M; Barroso, A; Felipe-Ponce, V; Serrano-Blanch, R; Hinojo, C; Miramar-Gallart, M D; Urioste, M; Caldés, T; Santillan-Garzón, S; Benitez, J; Osorio, A

    2017-02-01

    There is still a considerable percentage of hereditary breast and ovarian cancer (HBOC) cases not explained by BRCA1 and BRCA2 genes. In this report, next-generation sequencing (NGS) techniques were applied to identify novel variants and/or genes involved in HBOC susceptibility. Using whole exome sequencing, we identified a novel germline mutation in the moderate-risk gene ATM (c.5441delT; p.Leu1814Trpfs*14) in a family negative for mutations in BRCA1/2 (BRCAX). A case-control association study was performed to establish its prevalence in Spanish population, in a series of 1477 BRCAX families and 589 controls further screened, and NGS panels were used for ATM mutational screening in a cohort of 392 HBOC Spanish BRCAX families and 350 patients affected with diseases not related to breast cancer. Although the interrogated mutation was not prevalent in case-control association study, a comprehensive mutational analysis of the ATM gene revealed 1.78% prevalence of mutations in the ATM gene in HBOC and 1.94% in breast cancer-only BRCAX families in Spanish population, where data about ATM mutations were very limited. ATM mutation prevalence in Spanish population highlights the importance of considering ATM pathogenic variants linked to breast cancer susceptibility.

  18. Iron overload and HFE gene mutations in Polish patients with liver cirrhosis.

    PubMed

    Sikorska, Katarzyna; Romanowski, Tomasz; Stalke, Piotr; Iżycka-Świeszewska, Ewa; Bielawski, Krzysztof Piotr

    2011-06-01

    Increased liver iron stores may contribute to the progression of liver injury and fibrosis, and are associated with a higher risk of hepatocellular carcinoma development. Pre-transplant symptoms of iron overload in patients with liver cirrhosis are associated with higher risk of infectious and malignant complications in liver transplant recipients. HFE gene mutations may be involved in the pathogenesis of liver iron overload and influence the progression of chronic liver diseases of different origins. This study was designed to determine the prevalence of iron overload in relation to HFE gene mutations among Polish patients with liver cirrhosis. Sixty-one patients with liver cirrhosis included in the study were compared with a control group of 42 consecutive patients subjected to liver biopsy because of chronic liver diseases. Liver function tests and serum iron markers were assessed in both groups. All patients were screened for HFE mutations (C282Y, H63D, S65C). Thirty-six of 61 patients from the study group and all controls had liver biopsy performed with semiquantitative assessment of iron deposits in hepatocytes. The biochemical markers of iron overload and iron deposits in the liver were detected with a higher frequency (70% and 47% respectively) in patients with liver cirrhosis. There were no differences in the prevalence of all HFE mutations in both groups. In patients with a diagnosis of hepatocellular carcinoma, no significant associations with iron disorders and HFE gene mutations were found. Iron disorders were detected in patients with liver cirrhosis frequently but without significant association with HFE gene mutations. Only the homozygous C282Y mutation seems to occur more frequently in the selected population of patients with liver cirrhosis. As elevated biochemical iron indices accompanied liver iron deposits more frequently in liver cirrhosis compared to controls with chronic liver disease, there is a need for more extensive studies searching for

  19. AGXT Gene Mutations and Prevalence of Primary Hyperoxaluria Type 1 in Moroccan Population.

    PubMed

    Boualla, Lamiae; Tajir, Mariam; Oulahiane, Najat; Lyahyai, Jaber; Laarabi, Fatima Zahra; Chafai Elalaoui, Siham; Soulami, Kenza; Ait Ouamar, Hassan; Sefiani, Abdelaziz

    2015-11-01

    Primary hyperoxaluria type 1 (PH1) is an autosomal recessive disorder caused by deficiency of alanine glyoxylate aminotransferase, due to a defect in the AGXT gene. Several mutations in this gene have been reported and some of them have been observed in multiple populations. The aim of our study was to analyze the mutations causing PH1 in the Moroccan population and to estimate its prevalence in Morocco. Molecular studies of 29 unrelated Moroccan patients with PH were performed by direct sequencing of all exons of the AGXT gene. In addition, to estimate the prevalence of PH1, we screened for the recurrent p.Ile244Thr mutation in 250 unrelated Moroccan newborns using real-time polymerase chain reaction. Four pathogenic mutations were detected in 25 unrelated patients. The c.731T>C (p.Ile244Thr) was the most frequent mutation with a frequency of 84%. The other three mutations were c.33delC, c.976delG, and c.331C>T. The prevalence of the PH1 mutation among Moroccans was then estimated to range from 1/7267 to 1/6264. PH1 is one of the most prevalent genetic diseases in the Moroccan population and is probably underdiagnosed. Front line genetic testing for PH1 in Morocco should be initiated using an assay for the recurrent p.Ile244Thr mutation. This strategy would provide a useful tool for precocious diagnosis of presymptomatic individuals and to prevent their rapid progression to renal failure.

  20. Clinical features and gene mutational spectrum of CDKL5-related diseases in a cohort of Chinese patients

    PubMed Central

    2014-01-01

    Background Mutations in the cyclin-dependent kinase-like 5 (CDKL5) (NM_003159.2) gene have been associated with early-onset epileptic encephalopathies or Hanefeld variants of RTT(Rett syndrome). In order to clarify the CDKL5 genotype-phenotype correlations in Chinese patients, CDKL5 mutational screening in cases with early-onset epileptic encephalopathies and RTT without MECP2 mutation were performed. Methods The detailed clinical information including clinical manifestation, electroencephalogram (EEG), magnetic resonance imaging (MRI), blood, urine amino acid and organic acid screening of 102 Chinese patients with early-onset epileptic encephalopathies and RTT were collected. CDKL5 gene mutations were analyzed by PCR, direct sequencing and multiplex ligation-dependent probe amplification (MLPA). The patterns of X-chromosome inactivation (XCI) were studied in the female patients with CDKL5 gene mutation. Results De novo CDKL5 gene mutations were found in ten patients including one missense mutation (c.533G > A, p.R178Q) which had been reported, two splicing mutations (ISV6 + 1A > G, ISV13 + 1A > G), three micro-deletions (c.1111delC, c.2360delA, c.234delA), two insertions (c.1791 ins G, c.891_892 ins TT in a pair of twins) and one nonsense mutation (c.1375C > T, p.Q459X). Out of ten patients, 7 of 9 females with Hanefeld variants of RTT and the remaining 2 females with early onset epileptic encephalopathy, were detected while only one male with infantile spasms was detected. The common features of all female patients with CDKL5 gene mutations included refractory seizures starting before 4 months of age, severe psychomotor retardation, Rett-like features such as hand stereotypies, deceleration of head growth after birth and poor prognosis. In contrast, the only one male patient with CDKL5 mutation showed no obvious Rett-like features as females in our cohort. The X-chromosome inactivation patterns of all the female patients were random. Conclusions Mutations in CDKL

  1. Clinical features and gene mutational spectrum of CDKL5-related diseases in a cohort of Chinese patients.

    PubMed

    Zhao, Ying; Zhang, Xiaoying; Bao, Xinhua; Zhang, Qingping; Zhang, Jingjing; Cao, Guangna; Zhang, Jie; Li, Jiarui; Wei, Liping; Pan, Hong; Wu, Xiru

    2014-02-25

    Mutations in the cyclin-dependent kinase-like 5 (CDKL5) (NM_003159.2) gene have been associated with early-onset epileptic encephalopathies or Hanefeld variants of RTT(Rett syndrome). In order to clarify the CDKL5 genotype-phenotype correlations in Chinese patients, CDKL5 mutational screening in cases with early-onset epileptic encephalopathies and RTT without MECP2 mutation were performed. The detailed clinical information including clinical manifestation, electroencephalogram (EEG), magnetic resonance imaging (MRI), blood, urine amino acid and organic acid screening of 102 Chinese patients with early-onset epileptic encephalopathies and RTT were collected. CDKL5 gene mutations were analyzed by PCR, direct sequencing and multiplex ligation-dependent probe amplification (MLPA). The patterns of X-chromosome inactivation (XCI) were studied in the female patients with CDKL5 gene mutation. De novo CDKL5 gene mutations were found in ten patients including one missense mutation (c.533G > A, p.R178Q) which had been reported, two splicing mutations (ISV6 + 1A > G, ISV13 + 1A > G), three micro-deletions (c.1111delC, c.2360delA, c.234delA), two insertions (c.1791 ins G, c.891_892 ins TT in a pair of twins) and one nonsense mutation (c.1375C > T, p.Q459X). Out of ten patients, 7 of 9 females with Hanefeld variants of RTT and the remaining 2 females with early onset epileptic encephalopathy, were detected while only one male with infantile spasms was detected. The common features of all female patients with CDKL5 gene mutations included refractory seizures starting before 4 months of age, severe psychomotor retardation, Rett-like features such as hand stereotypies, deceleration of head growth after birth and poor prognosis. In contrast, the only one male patient with CDKL5 mutation showed no obvious Rett-like features as females in our cohort. The X-chromosome inactivation patterns of all the female patients were random. Mutations in CDKL5 gene are responsible for 7 with

  2. Novel compound heterozygous mutations in the OTOF Gene identified by whole-exome sequencing in auditory neuropathy spectrum disorder.

    PubMed

    Tang, Fengzhu; Ma, Dengke; Wang, Yulan; Qiu, Yuecai; Liu, Fei; Wang, Qingqing; Lu, Qiutian; Shi, Min; Xu, Liang; Liu, Min; Liang, Jianping

    2017-03-23

    Many hearing-loss diseases are demonstrated to have Mendelian inheritance caused by mutations in single gene. However, many deaf individuals have diseases that remain genetically unexplained. Auditory neuropathy is a sensorineural deafness in which sounds are able to be transferred into the inner ear normally but the transmission of the signals from inner ear to auditory nerve and brain is injured, also known as auditory neuropathy spectrum disorder (ANSD). The pathogenic mutations of the genes responsible for the Chinese ANSD population remain poorly understood. A total of 127 patients with non-syndromic hearing loss (NSHL) were enrolled in Guangxi Zhuang Autonomous Region. A hereditary deafness gene mutation screening was performed to identify the mutation sites in four deafness-related genes (GJB2, GJB3, 12S rRNA, and SLC26A4). In addition, whole-exome sequencing (WES) was applied to explore unappreciated mutation sites in the cases with the singularity of its phenotype. Well-characterized mutations were found in only 8.7% (11/127) of the patients. Interestingly, two mutations in the OTOF gene were identified in two affected siblings with ANSD from a Chinese family, including one nonsense mutation c.1273C > T (p.R425X) and one missense mutation c.4994 T > C (p.L1665P). Furthermore, we employed Sanger sequencing to confirm the mutations in each subject. Two compound heterozygous mutations in the OTOF gene were observed in the two affected siblings, whereas the two parents and unaffected sister were heterozygous carriers of c.1273C > T (father and sister) and c.4994 T > C (mother). The nonsense mutation p.R425X, contributes to a premature stop codon, may result in a truncated polypeptide, which strongly suggests its pathogenicity for ANSD. The missense mutation p.L1665P results in a single amino acid substitution in a highly conserved region. Two mutations in the OTOF gene in the Chinese deaf population were recognized for the first time. These

  3. [Study of a family with epidermolysis bullosa simplex resulting from a novel mutation of KRT14 gene].

    PubMed

    Meng, Lanlan; Du, Juan; Li, Wen; Lu, Guangxiu; Tan, Yueqiu

    2017-08-10

    To determine the molecular etiology for a Chinese pedigree affected with epidermolysis bullosa simplex (EBS). Target region sequencing using a hereditary epidermolysis bullosa capture array combined with Sanger sequencing and bioinformatics analysis were used. Mutation taster, PolyPhen-2, Provean, and SIFT software and NCBI online were employed to assess the pathogenicity and conservation of detected mutations. One hundred healthy unrelated individuals were used as controls. Target region sequencing showed that the proband has carried a unreported heterozygous c.1234A>G (p.Ile412Val) mutation of the KRT14 gene, which was confirmed by Sanger sequencing in other 8 affected individuals but not among healthy members of the pedigree. Bioinformatics analysis indicated that the mutation is highly pathogenic. Remarkably, 3 members of the family (2 affected and 1 unaffected) have carried a heterozygous c.1237G>A (p.Ala413Thr) mutation of the KRT14 gene, which was collected in Human Gene Mutation Database (HGMD). Bioinformatics analysis indicated that the mutation may not be pathogenic. Both mutations were not detected among the 100 healthy controls. The novel c.1234A>G(p.Ile412Val) mutation of the KRT14 gene is probably responsible for the disease, while c.1237G>A (p.Ala413Thr) mutation of KRT14 gene may be a polymorphism. Compared with Sanger sequencing, target region capture sequencing is more efficient and can significantly reduce the cost of genetic testing for EBS.

  4. Identification of missense mutations in the Norrie disease gene associated with advanced retinopathy of prematurity.

    PubMed

    Shastry, B S; Pendergast, S D; Hartzer, M K; Liu, X; Trese, M T

    1997-05-01

    Retinopathy of prematurity (ROP) is a retinal vascular disease occurring in infants with short gestational age and low birth weight and can lead to retinal detachment (ROP stages 4 and 5). X-linked familial exudative vitreoretinopathy is phenotypically similar to ROP and has been associated with mutations in the Norrie disease (ND) gene in some cases. To determine if similar mutations in the ND gene may play a role in the development of advanced ROP. Clinical examination and molecular genetic analysis were performed on 16 children, including 2 dizygotic and 1 monozygotic twin pairs, and their parents from 13 families. Sequencing of the amplified products revealed missense mutations (R121W and L108P) in the third exon of the ND gene in 4 patients. These mutations were not present in an unaffected premature twin, 2 children with regressed stage 3 ROP, the parents, or in 50 unrelated healthy control subjects. These findings suggest that mutations in the ND gene may play a role in the development of severe ROP in premature infants.

  5. A mutation in the MATP gene causes the cream coat colour in the horse

    PubMed Central

    Mariat, Denis; Taourit, Sead; Guérin, Gérard

    2003-01-01

    In horses, basic colours such as bay or chestnut may be partially diluted to buckskin and palomino, or extremely diluted to cream, a nearly white colour with pink skin and blue eyes. This dilution is expected to be controlled by one gene and we used both candidate gene and positional cloning strategies to identify the "cream mutation". A horse panel including reference colours was established and typed for different markers within or in the neighbourhood of two candidate genes. Our data suggest that the causal mutation, a G to A transition, is localised in exon 2 of the MATP gene leading to an aspartic acid to asparagine substitution in the encoded protein. This conserved mutation was also described in mice and humans, but not in medaka. PMID:12605854

  6. Recessive mutations in the INS gene result in neonatal diabetes through reduced insulin biosynthesis

    PubMed Central

    Garin, Intza; Edghill, Emma L.; Akerman, Ildem; Rubio-Cabezas, Oscar; Rica, Itxaso; Locke, Jonathan M.; Maestro, Miguel Angel; Alshaikh, Adnan; Bundak, Ruveyde; del Castillo, Gabriel; Deeb, Asma; Deiss, Dorothee; Fernandez, Juan M.; Godbole, Koumudi; Hussain, Khalid; O’Connell, Michele; Klupa, Thomasz; Kolouskova, Stanislava; Mohsin, Fauzia; Perlman, Kusiel; Sumnik, Zdenek; Rial, Jose M.; Ugarte, Estibaliz; Vasanthi, Thiruvengadam; Johnstone, Karen; Flanagan, Sarah E.; Martínez, Rosa; Castaño, Carlos; Patch, Ann-Marie; Fernández-Rebollo, Eduardo; Raile, Klemens; Morgan, Noel; Harries, Lorna W.; Castaño, Luis; Ellard, Sian; Ferrer, Jorge; de Nanclares, Guiomar Perez; Hattersley, Andrew T.

    2010-01-01

    Heterozygous coding mutations in the INS gene that encodes preproinsulin were recently shown to be an important cause of permanent neonatal diabetes. These dominantly acting mutations prevent normal folding of proinsulin, which leads to beta-cell death through endoplasmic reticulum stress and apoptosis. We now report 10 different recessive INS mutations in 15 probands with neonatal diabetes. Functional studies showed that recessive mutations resulted in diabetes because of decreased insulin biosynthesis through distinct mechanisms, including gene deletion, lack of the translation initiation signal, and altered mRNA stability because of the disruption of a polyadenylation signal. A subset of recessive mutations caused abnormal INS transcription, including the deletion of the C1 and E1 cis regulatory elements, or three different single base-pair substitutions in a CC dinucleotide sequence located between E1 and A1 elements. In keeping with an earlier and more severe beta-cell defect, patients with recessive INS mutations had a lower birth weight (−3.2 SD score vs. −2.0 SD score) and were diagnosed earlier (median 1 week vs. 10 weeks) compared to those with dominant INS mutations. Mutations in the insulin gene can therefore result in neonatal diabetes as a result of two contrasting pathogenic mechanisms. Moreover, the recessively inherited mutations provide a genetic demonstration of the essential role of multiple sequence elements that regulate the biosynthesis of insulin in man. PMID:20133622

  7. A new nonsense mutation in the NF1 gene with neurofibromatosis-Noonan syndrome phenotype.

    PubMed

    Yimenicioğlu, Sevgi; Yakut, Ayten; Karaer, Kadri; Zenker, Martin; Ekici, Arzu; Carman, Kürşat Bora

    2012-12-01

    Neurofibromatosis-Noonan syndrome is a rare autosomal dominant disorder which combines neurofibromatosis type 1 (NF1) features with Noonan syndrome. NF1 gene mutations are reported in the majority of these patients. Sequence analysis of the established genes for Noonan syndrome revealed no mutation; a heterozygous NF1 point mutation c.7549C>T in exon 51, creating a premature stop codon (p.R2517X), had been demonstrated. Neurofibromatosis-Noonan syndrome recently has been considered a subtype of NF1 and caused by different NF1 mutations. We report the case of a 14-year-old boy with neurofibromatosis type 1 with Noonan-like features, who complained of headache with triventricular hydrocephaly and a heterozygous NF1 point mutation c.7549C>T in exon 51.

  8. [PAX3 gene mutation analysis for two Waardenburg syndrome type Ⅰ families and their prenatal diagnosis].

    PubMed

    Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B

    2016-12-07

    Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.

  9. Missense mutation of the cholecystokinin B receptor gene: Lack of association with panic disorder

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kato, Tadafumi; Wang, Zhe Wu; Crowe, R.R.

    1996-07-26

    Cholecystokinin tetrapeptide (CCK{sub 4}) is known to induce panic attacks in patients with panic disorder at a lower dose than in normal controls. Therefore, the cholecystokinin B (CCK{sub B}) receptor gene is a candidate gene for panic disorder. We searched for mutations in the CCK{sub B} gene in 22 probands of panic disorder pedigrees, using single-strand conformation polymorphism (SSCP) analysis. Two polymorphisms were detected. A polymorphism in an intron (2491 C{yields}A) between exons 4 and 5 was observed in 10 of 22 probands. A missense mutation in the extracellular loop of exon 2 (1550 G{yields}A, Val{sup 125}{yields}Ile) was found inmore » only one proband. This mutation was also examined in additional 34 unrelated patients with panic disorder and 112 controls. The prevalence rate of this mutation was 8.8% in patients with panic disorder (3/34) and 4.4% in controls (5/112). The mutation did not segregate with panic disorder in two families where this could be tested. These results suggest no pathophysiological significance of this mutation in panic disorder. 21 refs., 4 figs., 1 tab.« less

  10. [NOTCH3 gene mutations in two Chinese families featuring cerebral autosomal dominant arteriopathy with subcortical infarct and leucoencephalopathy].

    PubMed

    Sun, Qiying; Li, Wenwen; Zhou, Yafang; Yi, Fang; Wang, Jianfeng; Hu, Yacen; Yao, Lingyan; Zhou, Lin; Xu, Hongwei

    2017-12-10

    To analyze potential mutations of the NOTCH3 gene in two Chinese families featuring cerebral autosomal dominant arteriopathy with subcortical infarct and leucoencephalopathy (CADASIL). The two probands and related family members and 100 healthy controls were recruited. Potential mutations of the NOTCH3 gene were screened by PCR and direct sequencing. PolyPhen-2 and SIFT software were used to predict the protein function. The conditions of both probands were adult-onset, with main clinical features including recurrent transient ischemic attacks and/or strokes, cognitive impairment. MRI findings suggested multiple cerebral infarcts and severe leukoencephalopathy. A heterozygous mutation c.328C>T (p.Arg110Cys), which was located in exon 3 of the NOTCH3 gene and known as a causative mutation, was identified in proband 1. A novel heterozygous mutation c.1013 G>C (p.Cys338Ser) located in exon 6 of the NOTCH3 gene was identified in the proband 2, which was not reported previously. The same mutations were not detected among the 100 unrelated healthy controls. Function analysis suggested that heterozygous mutation c.1013G>C can severely affect the functions of NOTCH3 protein. Two heterozygous missense mutations in the NOTCH3 gene have been identified in two families affected with CADASIL. The novel heterozygous Cys338Ser mutation in exon 6 of the NOTCH3 gene probably underlies the CADASIL.

  11. A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene.

    PubMed

    Sadighi, Sanambar; Ghaffari-Moghaddam, Mahsa; Saffari, Mojtaba; Mohagheghi, Mohammad Ali; Shirkoohi, Reza

    2017-02-01

    Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP) as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.

  12. X-linked juvenile retinoschisis: mutations at the retinoschisis and Norrie disease gene loci?

    PubMed

    Hiraoka, M; Rossi, F; Trese, M T; Shastry, B S

    2001-01-01

    Juvenile retinoschisis (RS) and Norrie disease (ND) are X-linked recessive retinal disorders. Both disorders, in the majority of cases, are monogenic and are caused by mutations in the RS and ND genes, respectively. Here we report the identification of a family in which mutations in both the RS and ND genes are segregating with RS pathology. Although the mutations identified in this report were not functionally characterized with regard to their pathogenicity, it is likely that both of them are involved in RS pathology in the family analyzed. This suggests the complexity and digenic nature of monogenic human disorders in some cases. If this proves to be a widespread problem, it will complicate the strategies used to identify the genes involved in diseases and to develop methods for intervention.

  13. Screening for germline mutations in the neurofibromatosis type 2 (NF2) gene in NF2 patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Andermann, A.A.; Ruttledge, M.H.; Rangaratnam, A.

    Neurofibromatosis type 2 (NF2) is an autosomal dominant disease with over 95% penetrance which predisposes gene carriers to develop multiple tumors of the central nervous system. The NF2 gene is a putative tumor suppressor gene which was previously mapped to the long arm of chromosome 22, and has recently been identified, using positional cloning techniques. The gene encodes a protein, schwannomin (SCH), which is highly homologous to the band 4.1 protein family. In an attempt to identify and characterize mutations which lead to the manifestation of the disease, we have used single strand conformation analysis (SSCA) to screen for germlinemore » mutations in all 17 exons of the NF2 gene in 59 unrelated NF2 patients, representing both familial and new mutations. A total of 27 migration abnormalities was found in 26 patients. Using direct sequencing analysis, the majority of these variants were found to result in nonsense, splice-site or frameshift mutations. Mutations identified in familial NF2 patients segregate in the family, and may prove to be useful tools for a simple and direct SSCA-based technique of presymptomatic or prenatal diagnosis in relatives of patients with NF2. This may be of particular importance in children of patients who have new mutations in the NF2 gene, where linkage analysis may not be feasible.« less

  14. De novo gene mutations highlight patterns of genetic and neural complexity in schizophrenia

    PubMed Central

    Xu, Bin; Ionita-Laza, Iuliana; Roos, J. Louw; Boone, Braden; Woodrick, Scarlet; Sun, Yan; Levy, Shawn; Gogos, Joseph A.; Karayiorgou, Maria

    2013-01-01

    To evaluate evidence for de novo etiologies in schizophrenia, we sequenced at high coverage the exomes of families recruited from two populations with distinct demographic structure and history. We sequenced a total of 795 exomes from 231 parent-proband trios enriched for sporadic schizophrenia cases, as well as 34 unaffected trios. We observed in cases an excess of non-synonymous single nucleotide variants as well as a higher prevalence of gene-disruptive de novo mutations. We found four genes (LAMA2, DPYD, TRRAP and VPS39) affected by recurrent de novo events within or across the two populations, a finding unlikely to have occurred by chance. We show that de novo mutations affect genes with diverse functions and developmental profiles but we also find a substantial contribution of mutations in genes with higher expression in early fetal life. Our results help define the pattern of genomic and neural architecture of schizophrenia. PMID:23042115

  15. A mutation screening of oncogenes, tumor suppressor gene TP53 and nuclear encoded mitochondrial complex I genes in oncocytic thyroid tumors.

    PubMed

    Evangelisti, Cecilia; de Biase, Dario; Kurelac, Ivana; Ceccarelli, Claudio; Prokisch, Holger; Meitinger, Thomas; Caria, Paola; Vanni, Roberta; Romeo, Giovanni; Tallini, Giovanni; Gasparre, Giuseppe; Bonora, Elena

    2015-03-21

    Thyroid neoplasias with oncocytic features represent a specific phenotype in non-medullary thyroid cancer, reflecting the unique biological phenomenon of mitochondrial hyperplasia in the cytoplasm. Oncocytic thyroid cells are characterized by a prominent eosinophilia (or oxyphilia) caused by mitochondrial abundance. Although disruptive mutations in the mitochondrial DNA (mtDNA) are the most significant hallmark of such tumors, oncocytomas may be envisioned as heterogeneous neoplasms, characterized by multiple nuclear and mitochondrial gene lesions. We investigated the nuclear mutational profile of oncocytic tumors to pinpoint the mutations that may trigger the early oncogenic hit. Total DNA was extracted from paraffin-embedded tissues from 45 biopsies of oncocytic tumors. High-resolution melting was used for mutation screening of mitochondrial complex I subunits genes. Specific nuclear rearrangements were investigated by RT-PCR (RET/PTC) or on isolated nuclei by interphase FISH (PAX8/PPARγ). Recurrent point mutations were analyzed by direct sequencing. In our oncocytic tumor samples, we identified rare TP53 mutations. The series of analyzed cases did not include poorly- or undifferentiated thyroid carcinomas, and none of the TP53 mutated cases had significant mitotic activity or high-grade features. Thus, the presence of disruptive TP53 mutations was completely unexpected. In addition, novel mutations in nuclear-encoded complex I genes were identified. These findings suggest that nuclear genetic lesions altering the bioenergetics competence of thyroid cells may give rise to an aberrant mitochondria-centered compensatory mechanism and ultimately to the oncocytic phenotype.

  16. A bacterial model for expression of mutations in the human ornithine transcarbamylase (OTC) gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tuchman, M.; McCann, M.T.; Qureshi, A.A.

    1994-09-01

    OTC is a mitochondrial enzyme catalyzing the formation of citrulline from carbamyl phosphate and ornithine. X-linked deficiency of OTC is the most prevalent genetic defect of ureagenesis. Mutations and polymorphisms in the OTC gene identified in deficient patients have indicated the occurrence of many family-specific, unique alleles. Due to the low frequency of recurrent mutations, distinguishing between deleterious mutations and polymorphisms is difficult. Using a human OTC gene containing plasmid driven by a tac promoter, we have devised a simple and efficient method for expressing mutations in the mature human OTC enzyme. To demonstrate this method, PCR engineered site-directed mutagenesismore » was employed to generated cDNA fragments which contained either the R151Q or R277W known mutations found in patients with neonatal and late-onset OTC deficiency, respectively. The normal allele for each mutation was also generated by an identical PCR procedure. Digestion with Bgl II- and Sty I-generated mutant and normal replacement cassettes containing the respective mutant and wild type sequences. Upon transformation of JM109 E.coli cells, OTC enzymatic activity was measured at log and stationary phases of growth using a radiochromatographic method. The R141Q mutation abolished enzymatic activity (<0.02% of normal), whereas the R277W mutation expressed partial activity (2.3% of normal). In addition, a PCR-generated mutation, A280V, resulted in 73% loss of catalytic activity. This OTC expression system is clinically applicable for distinguishing between mutations and polymorphisms, and it can be used to investigate the effects of mutations on various domains of the OTC gene.« less

  17. Mutations in the PDE6B gene in autosomal recessive retinitis pigmentosa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Danciger, M.; Blaney, J.; Gao, Y.Q.

    1995-11-01

    We have studied 24 small families with presumed autosomal recessive inheritance of retinitis pigmentosa by a combination of haplotype analysis and exon screening. Initial analysis of the families was made with a dinucleotide repeat polymorphism adjacent to the gene for rod cGMP-phosphodiesterase (PDE6B). This was followed by denaturing gradient gel electrophoresis (DGGE) and single-strand conformation polymorphism electrophoresis (SSCPE) of the 22 exons and a portion of the 5{prime} untranslated region of the PDE6B gene in the probands of each family in which the PDE6B locus could not be ruled out from segregating with disease. Two probands were found with compoundmore » heterozygous mutations: Gly576Asp and His620(1-bp del) mutations were present in one proband, and a Lys706X null mutation and an AG to AT splice acceptor site mutation in intron 2 were present in the other. Only the affecteds of each of the two families carried both corresponding mutations. 29 refs., 3 figs., 1 tab.« less

  18. Frequent mutation of histone-modifying genes in non-Hodgkin lymphoma | Office of Cancer Genomics

    Cancer.gov

    In a recent Nature article, Morin et al. uncovered a novel role for chromatin modification in driving the progression of two non-Hodgkin lymphomas (NHLs), follicular lymphoma and diffuse large B-cell lymphoma. Through DNA and RNA sequencing of 117 tumor samples and 10 assorted cell lines, the authors identified and validated 109 genes with multiple mutations in these B-cell NHLs. Of the 109 genes, several genes not previously linked to lymphoma demonstrated positive selection for mutation including two genes involved in histone modification, MLL2 and MEF2B.

  19. Two novel mutations in the BCKDHB gene that cause maple syrup urine disease.

    PubMed

    Han, Bingjuan; Han, Bingchao; Guo, Bin; Liu, Yingxia; Cao, Zhiyang

    2018-01-06

    Maple syrup urine disease (MSUD) is a rare metabolic disorder of autosomal recessive inheritance caused by decreased activity of branched-chain α-ketoacid dehydrogenase complex (BCKD). Mutations in the three genes (BCKDHA, BCKDHB and DBT) are associated with MSUD. Here, we describe the presenting symptoms, clinical course and gene mutation analysis of a Chinese boy with MSUD. Plasma amino acid analysis was performed by tandem mass spectrometry and the levels of organic acids in urine were measured with gas chromatography-mass spectrometry. The BCKDHB gene was sequenced by Sanger method. Furthermore, the significance of the novel mutations was predicted by Polyphen and Mutationtaster. After diagnosis, the patient was fed with protein-restricted diet to reduce intake of BCAA and was treated with l -carnitine. Metabolic parameters, clinical presentation and mental development were followed up. The patient was diagnosed as MSUD. Two novel BCKDHB mutations (c.523 T > C and c.478-25_552del100) were identified. In silico analysis predicted that the two mutations were "disease causing". The boy tolerated the treatment well and had symptomatic improvement. He presented with mild hypotonia and had nearly normal DQ scores at the age of 10 months. The two novel mutations resulted in the clinical manifestations of MSUD. Our results may reflect the heterogeneity of the pathogenic variants found in patients with MSUD. Copyright © 2018. Published by Elsevier B.V.

  20. Novel mutations of the AGXT gene causing primary hyperoxaluria type 1.

    PubMed

    Yuen, Yuet-Ping; Lai, Chi-Kong; Tong, Gensy Mei-Wah; Wong, Ping-Nam; Wong, Francis Kim-Ming; Mak, Siu-Ka; Lo, Kin-Yee; Wong, Andrew Kui-Man; Tong, Sui-Fan; Chan, Yan-Wo; Lam, Ching-Wan

    2004-01-01

    Primary hyperoxaluria type 1 (PH1), an inherited cause of nephrolithiasis, is due to a functional defect of the liver-specific peroxisomal enzyme alanine:glyoxylate aminotransferase (AGT). A definitive PH1 diagnosis can be established by analyzing AGT activity in liver tissue or mutation analysis of the AGXT gene. The molecular basis of PH1 in three Chinese patients, two with adult-onset and one with childhood-onset recurrent nephrolithiasis, was established by analyzing the entire AGXT gene. Three novel mutations (c2T>C, c817insAG and c844C>T) and two previously reported mutations (c33insC and 679-IVS6+2delAAgt) were identified. c2T>C converts the initiation codon from ATG to ACG, which predicts significant reduction, if not complete abolition, of protein translation. c817insAG leads to a frameshift and changes the amino acid sequence after codon 274. c844C>T changes glutamine at codon 282 to a termination codon, resulting in protein truncation. This is the first report describing AGXT gene mutations in Chinese patients with PH1. AGXT genotypes cannot fully explain the clinical heterogeneity of PH1, and other factors involved in disease pathogenesis remain to be identified. Our experience emphasizes the importance of excluding PH1 in patients with recurrent nephrolithiasis to avoid delay or inappropriate management.

  1. Microarray Analysis of Iris Gene Expression in Mice with Mutations Influencing Pigmentation

    PubMed Central

    Trantow, Colleen M.; Cuffy, Tryphena L.; Fingert, John H.; Kuehn, Markus H.

    2011-01-01

    Purpose. Several ocular diseases involve the iris, notably including oculocutaneous albinism, pigment dispersion syndrome, and exfoliation syndrome. To screen for candidate genes that may contribute to the pathogenesis of these diseases, genome-wide iris gene expression patterns were comparatively analyzed from mouse models of these conditions. Methods. Iris samples from albino mice with a Tyr mutation, pigment dispersion–prone mice with Tyrp1 and Gpnmb mutations, and mice resembling exfoliation syndrome with a Lyst mutation were compared with samples from wild-type mice. All mice were strain (C57BL/6J), age (60 days old), and sex (female) matched. Microarrays were used to compare transcriptional profiles, and differentially expressed transcripts were described by functional annotation clustering using DAVID Bioinformatics Resources. Quantitative real-time PCR was performed to validate a subset of identified changes. Results. Compared with wild-type C57BL/6J mice, each disease context exhibited a large number of statistically significant changes in gene expression, including 685 transcripts differentially expressed in albino irides, 403 in pigment dispersion–prone irides, and 460 in exfoliative-like irides. Conclusions. Functional annotation clusterings were particularly striking among the overrepresented genes, with albino and pigment dispersion–prone irides both exhibiting overall evidence of crystallin-mediated stress responses. Exfoliative-like irides from mice with a Lyst mutation showed overall evidence of involvement of genes that influence immune system processes, lytic vacuoles, and lysosomes. These findings have several biologically relevant implications, particularly with respect to secondary forms of glaucoma, and represent a useful resource as a hypothesis-generating dataset. PMID:20739468

  2. Discovery of mutations in homologous recombination genes in African-American women with breast cancer.

    PubMed

    Ding, Yuan Chun; Adamson, Aaron W; Steele, Linda; Bailis, Adam M; John, Esther M; Tomlinson, Gail; Neuhausen, Susan L

    2018-04-01

    African-American women are more likely to develop aggressive breast cancer at younger ages and experience poorer cancer prognoses than non-Hispanic Caucasians. Deficiency in repair of DNA by homologous recombination (HR) is associated with cancer development, suggesting that mutations in genes that affect this process may cause breast cancer. Inherited pathogenic mutations have been identified in genes involved in repairing DNA damage, but few studies have focused on African-Americans. We screened for germline mutations in seven HR repair pathway genes in DNA of 181 African-American women with breast cancer, evaluated the potential effects of identified missense variants using in silico prediction software, and functionally characterized a set of missense variants by yeast two-hybrid assays. We identified five likely-damaging variants, including two PALB2 truncating variants (Q151X and W1038X) and three novel missense variants (RAD51C C135R, and XRCC3 L297P and V337E) that abolish protein-protein interactions in yeast two-hybrid assays. Our results add to evidence that HR gene mutations account for a proportion of the genetic risk for developing breast cancer in African-Americans. Identifying additional mutations that diminish HR may provide a tool for better assessing breast cancer risk and improving approaches for targeted treatment.

  3. On the Sequence-Directed Nature of Human Gene Mutation: The Role of Genomic Architecture and the Local DNA Sequence Environment in Mediating Gene Mutations Underlying Human Inherited Disease

    PubMed Central

    Cooper, David N.; Bacolla, Albino; Férec, Claude; Vasquez, Karen M.; Kehrer-Sawatzki, Hildegard; Chen, Jian-Min

    2011-01-01

    Different types of human gene mutation may vary in size, from structural variants (SVs) to single base-pair substitutions, but what they all have in common is that their nature, size and location are often determined either by specific characteristics of the local DNA sequence environment or by higher-order features of the genomic architecture. The human genome is now recognized to contain ‘pervasive architectural flaws’ in that certain DNA sequences are inherently mutation-prone by virtue of their base composition, sequence repetitivity and/or epigenetic modification. Here we explore how the nature, location and frequency of different types of mutation causing inherited disease are shaped in large part, and often in remarkably predictable ways, by the local DNA sequence environment. The mutability of a given gene or genomic region may also be influenced indirectly by a variety of non-canonical (non-B) secondary structures whose formation is facilitated by the underlying DNA sequence. Since these non-B DNA structures can interfere with subsequent DNA replication and repair, and may serve to increase mutation frequencies in generalized fashion (i.e. both in the context of subtle mutations and SVs), they have the potential to serve as a unifying concept in studies of mutational mechanisms underlying human inherited disease. PMID:21853507

  4. Novel mutations of the carbohydrate sulfotransferase-6 (CHST6) gene causing macular corneal dystrophy in India.

    PubMed

    Sultana, Afia; Sridhar, Mittanamalli S; Jagannathan, Aparna; Balasubramanian, Dorairajan; Kannabiran, Chitra; Klintworth, Gordon K

    2003-12-22

    Macular corneal dystrophy (MCD) is an autosomal recessive disorder characterized by progressive central haze, confluent punctate opacities and abnormal deposits in the cornea. It is caused by mutations in the carbohydrate sulfotransferase-6 (CHST6) gene, encoding corneal N-acetyl glucosamine-6-O-sulfotransferase (C-GlcNAc-6-ST). We screened the CHST6 gene for mutations in Indian families with MCD, in order to determine the range of pathogenic mutations. Genomic DNA was isolated from peripheral blood leukocytes of patients with MCD and normal controls. The coding regions of the CHST6 gene were amplified using three pairs of primers and amplified products were directly sequenced. We identified 22 (5 nonsense, 5 frameshift, 2 insertion, and 10 missense) mutations in 36 patients from 31 families with MCD, supporting the conclusion that loss of function of this gene is responsible for this corneal disease. Seventeen of these mutations are novel. These data highlight the allelic heterogeneity of macular corneal dystrophy in Indian patients.

  5. Mutation Analysis of the Common Deafness Genes in Patients with Nonsyndromic Hearing Loss in Linyi by SNPscan Assay.

    PubMed

    Zhang, Fengguo; Xiao, Yun; Xu, Lei; Zhang, Xue; Zhang, Guodong; Li, Jianfeng; Lv, Huaiqing; Bai, Xiaohui; Wang, Haibo

    2016-01-01

    Hearing loss is a common sensory disorder, and at least 50% of cases are due to a genetic etiology. Although hundreds of genes have been reported to be associated with nonsyndromic hearing loss, GJB2, SLC26A4, and mtDNA12SrRNA are the major contributors. However, the mutation spectrum of these common deafness genes varies among different ethnic groups. The present work summarized mutations in these three genes and their prevalence in 339 patients with nonsyndromic hearing loss at three different special education schools and one children's hospital in Linyi, China. A new multiplex genetic screening system "SNPscan assay" was employed to detect a total of 115 mutations of the above three genes. Finally, 48.67% of the patients were identified with hereditary hearing loss caused by mutations in GJB2, SLC26A4, and mtDNA12SrRNA. The carrying rate of mutations in the three genes was 37.76%, 19.75%, and 4.72%, respectively. This mutation profile in our study is distinct from other parts of China, with high mutation rate of GJB2 suggesting a unique mutation spectrum in this area.

  6. A novel intronic mutation in the DDP1 gene in a family with X-linked dystonia-deafness syndrome.

    PubMed

    Ezquerra, Mario; Campdelacreu, Jaume; Muñoz, Esteban; Tolosa, Eduardo; Martí, María J

    2005-02-01

    X-linked dystonia-deafness syndrome (Mohr-Tranebjaerg syndrome) is a rare neurodegenerative disease characterized by hearing loss and dystonia. So far, 7 mutations in the coding region of the DDP1 gene have been described. They consist of frameshift, nonsense, missense mutations or deletions. To investigate the presence of mutations in the DDP1 gene in a family with dystonia-deafness syndrome. Seven members belonging to 2 generations of a family with 2 affected subjects underwent genetic analysis. Mutational screening in the DDP1 gene was made through DNA direct sequencing. We found an intronic mutation in the DDP1 gene. It consists of an A-to-C substitution in the position -23 in reference to the first nucleotide of exon 2 (IVS1-23A>C). The mutation was present in 2 affected men and their respective unaffected mothers, whereas it was absent in the healthy men from this family and in 90 healthy controls. Intronic mutations in the DDP1 gene can also cause X-linked dystonia-deafness syndrome. In our case, the effect of the mutation could be due to a splicing alteration.

  7. Clinical and Prognostic Profiles of Cardiomyopathies Caused by Mutations in the Troponin T Gene.

    PubMed

    Ripoll-Vera, Tomás; Gámez, José María; Govea, Nancy; Gómez, Yolanda; Núñez, Juana; Socías, Lorenzo; Escandell, Ángela; Rosell, Jorge

    2016-02-01

    Mutations in the troponin T gene (TTNT2) have been associated in small studies with the development of hypertrophic cardiomyopathy characterized by a high risk of sudden death and mild hypertrophy. We describe the clinical course of patients carrying mutations in this gene. We analyzed the clinical characteristics and prognosis of patients with mutations in the TNNT2 gene who were seen in an inherited cardiac disease unit. Of 180 families with genetically studied cardiomyopathies, 21 families (11.7%) were identified as having mutations in TNNT2: 10 families had Arg92Gln, 5 had Arg286His, 3 had Arg278Cys, 1 had Arg92Trp, 1 had Arg94His, and 1 had Ile221Thr. Thirty-three additional genetic carriers were identified through family assessment. The study included 54 genetic carriers: 56% were male, and the mean average age was 41 ± 17 years. There were 33 cases of hypertrophic cardiomyopathy, 9 of dilated cardiomyopathy, and 1 of noncompaction cardiomyopathy, and maximal myocardial thickness was 18.5 ± 6mm. Ventricular dysfunction was present in 30% of individuals and a history of sudden death in 62%. During follow-up, 4 patients died and 14 (33%) received a defibrillator (8 probands, 6 relatives). Mean survival was 54 years. Carriers of Arg92Gln had early disease development, high penetrance, a high risk of sudden death, a high rate of defibrillator implantation, and a high frequency of mixed phenotype. Mutations in the TNNT2 gene were more common in this series than in previous studies. The clinical and prognostic profiles depended on the mutation present. Carriers of the Arg92Gln mutation developed hypertrophic or dilated cardiomyopathy and had a significantly worse prognosis than those with other mutations in TNNT2 or other sarcomeric genes. Copyright © 2015 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.

  8. Mutations in the ABCA4 (ABCR) gene are the major cause of autosomal recessive cone-rod dystrophy.

    PubMed

    Maugeri, A; Klevering, B J; Rohrschneider, K; Blankenagel, A; Brunner, H G; Deutman, A F; Hoyng, C B; Cremers, F P

    2000-10-01

    The photoreceptor cell-specific ATP-binding cassette transporter gene (ABCA4; previously denoted "ABCR") is mutated, in most patients, with autosomal recessive (AR) Stargardt disease (STGD1) or fundus flavimaculatus (FFM). In addition, a few cases with AR retinitis pigmentosa (RP) and AR cone-rod dystrophy (CRD) have been found to have ABCA4 mutations. To evaluate the importance of the ABCA4 gene as a cause of AR CRD, we selected 5 patients with AR CRD and 15 patients from Germany and The Netherlands with isolated CRD. Single-strand conformation-polymorphism analysis and sequencing revealed 19 ABCA4 mutations in 13 (65%) of 20 patients. In six patients, mutations were identified in both ABCA4 alleles; in seven patients, mutations were detected in one allele. One complex ABCA4 allele (L541P;A1038V) was found exclusively in German patients with CRD; one patient carried this complex allele homozygously, and five others were compound heterozygous. These findings suggest that mutations in the ABCA4 gene are the major cause of AR CRD. A primary role of the ABCA4 gene in STGD1/FFM and AR CRD, together with the gene's involvement in an as-yet-unknown proportion of cases with AR RP, strengthens the idea that mutations in the ABCA4 gene could be the most frequent cause of inherited retinal dystrophy in humans.

  9. [NOD2 gene mutation in Moroccan patients with Crohn's disease: prevalence, genotypic study and correlation of NOD2 gene mutation with the phenotype of Crohn's disease].

    PubMed

    Tamzaourte, Mouna; Errabih, Ikram; Krami, Hayat; Maha, Fadlouallah; Maria, Lahmiri; Benzzoubeir, Nadia; Ouazzani, Laaziza; Sefiani, Ahmed; Ouazzani, Houria

    2017-01-01

    The aim of this study was to determine the prevalence of NOD2/CARD15 gene mutations in a group of Moroccan patients with Crohn's disease and to study its correlation with genotype-phenotypic expression. We conducted a cross-sectional case-control study over a period of 16 months. 101 patients with Crohn's disease were enrolled between January 2012 and April 2013 as well as a control group of 107 patients. We performed a genetic analysis to identify 3 NOD2 gene variants: p.Arg702Trp, p.Gly908Arg and p.Leu1007fsins. Then we conducted a study of the correlation between genotype and phenotypic expression. The genetic analysis of patients with Crohn's disease highlighted the presence of NOD2 mutation in 14 patients (13.77%) versus 7 patients (6.53%) in the control group. The study of the frequency of different alleles showed p.Gly908Arg mutation in 6.43%, p.Leu1007fsins in 0.99% and p.Arg702Trp in 0.49% versus 2.80%, 0% and 0.46% in the control group respectively. The study of the correlation between genotype and phenotypic expression showed that CARD15 mutation is associated with ileocecal Crohn's disease, with fistulizing and stenosing behavior in Crohn's disease as well as with severe evolution and frequent recourse to surgery and immunosuppressants. The prevalence of NOD2/ CARD15 mutation in our case series is low. This mutation is correlated with severe Crohn's disease.

  10. Investigation of the Mitochondrial ATPase 6/8 and tRNA(Lys) Genes Mutations in Autism.

    PubMed

    Piryaei, Fahimeh; Houshmand, Massoud; Aryani, Omid; Dadgar, Sepideh; Soheili, Zahra-Soheila

    2012-01-01

    Autism results from developmental factors that affect many or all functional brain systems. Brain is one of tissues which are crucially in need of adenosine triphosphate (ATP). Autism is noticeably affected by mitochondrial dysfunction which impairs energy metabolism. Considering mutations within ATPase 6, ATPase 8 and tRNA(Lys) genes, associated with different neural diseases, and the main role of ATPase 6/8 in energy generation, we decided to investigate mutations on these mtDNA-encoded genes to reveal their roles in autism pathogenesis. In this experimental study, mutation analysis for the mentioned genes were performed in a cohort of 24 unrelated patients with idiopathic autism by employing amplicon sequencing of mtDNA fragments. In this study, 12 patients (50%) showed point mutations that represent a significant correlation between autism and mtDNA variations. Most of the identified substitutions (55.55%) were observed on MT-ATP6, altering some conserved amino acids to other ones which could potentially affect ATPase 6 function. Mutations causing amino acid replacement denote involvement of mtDNA genes, especially ATPase 6 in autism pathogenesis. MtDNA mutations in relation with autism could be remarkable to realize an understandable mechanism of pathogenesis in order to achieve therapeutic solutions.

  11. Association of MTHFR gene C677T mutation with diabetic peripheral neuropathy and diabetic retinopathy

    PubMed Central

    Yigit, Serbulent; Inanir, Ahmet

    2013-01-01

    Purpose Diabetic peripheral neuropathy (DPN) is one of the most common diabetic chronic complications. Methylenetetrahydrofolate reductase (MTHFR) gene variants have been associated with vasculopathy that has been linked to diabetic neuropathy. The aim of the present study was to investigate the possible association between MTHFR gene C677T mutation and DPN and evaluate if there is an association with clinical features in a relatively large cohort of Turkish patients. Methods The study included 230 patients affected by DPN and 282 healthy controls. Genomic DNA was isolated and genotyped using the polymerase chain reaction–based restriction fragment length polymorphism assay for the MTHFR gene C677T mutation. Results The genotype and allele frequencies of the C677T mutation showed statistically significant differences between the patients with DPN and the controls (p=0.003 and p=0.002, respectively). After the patients with DPN were stratified according to clinical and demographic characteristics, a significant association was observed between the C677T mutation and history of retinopathy (p=0.039). Conclusions A high association between the MTHFR gene C677T mutation and DPN was observed in the present study. In addition, history of retinopathy was associated with the MTHFR C677T mutation in patients with DPN. PMID:23901246

  12. Could familial Mediterranean fever gene mutations be related to PFAPA syndrome?

    PubMed

    Celiksoy, Mehmet H; Ogur, Gonul; Yaman, Elif; Abur, Ummet; Fazla, Semanur; Sancak, Recep; Yildiran, Alisan

    2016-02-01

    The cause and pathophysiology of PFAPA syndrome is unknown. The aim of this study was to determine all MEFV gene variants relevant to familial Mediterranean fever in children with PFAPA syndrome. All MEFV gene variants were analyzed in patients with PFAPA syndrome. All patients were evaluated using the Gaslini scoring system. Serum immunoglobulin levels were also determined upon admission. We evaluated 64 patients with PFAPA syndrome. The median age at diagnosis was 37.5 (min-max: 6-96) months, and the percentage of male patients was 55.0%. The Gaslini diagnostic score for periodic fever was high in 81.0% of the patients. An MEFV gene mutation was found in 42 (66.0%) children. Mostly, heterozygous or compound heterozygous variants of the MEFV gene were found. Two patients were homozygous for R202Q. MEFV gene mutations were not detected in 22 (34.0%) patients. No significant differences in clinical or laboratory findings were observed between the two groups (p > 0.05), and there were no significant differences in period and duration of the fever episodes (p > 0.05). The fever of all 47 patients (100.0%) who received prednisolone during the episodes decreased within hours and did not recur. Eighteen of the patients using prednisolone underwent prophylaxis with colchicine, and the fever episodes of 9/18 (50.0%) patients using colchicine decreased within months. Most patients presenting with PFAPA syndrome have heterozygous MEFV gene mutations. Whether carrying a heterozygous MEFV gene is the primary cause of this syndrome requires further investigation. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. Immunohistochemical loss of 5-hydroxymethylcytosine expression in acute myeloid leukaemia: relationship to somatic gene mutations affecting epigenetic pathways.

    PubMed

    Magotra, Minoti; Sakhdari, Ali; Lee, Paul J; Tomaszewicz, Keith; Dresser, Karen; Hutchinson, Lloyd M; Woda, Bruce A; Chen, Benjamin J

    2016-12-01

    Genes affecting epigenetic pathways are frequently mutated in myeloid malignancies, including acute myeloid leukaemia (AML). The genes encoding TET2, IDH1 and IDH2 are among the most commonly mutated genes, and cause defective conversion of 5-methylcytosine into 5-hydroxymethylcytosine (5hmC), impairing demethylation of DNA, and presumably serving as driver mutations in leukaemogenesis. The aim of this study was to correlate 5hmC immunohistochemical loss with the mutation status of genes involved in epigenetic pathways in AML. Immunohistochemical staining with an anti-5hmC antibody was performed on 41 decalcified, formalin-fixed paraffin-embedded (FFPE) bone marrow biopsies from patients with AML. Archived DNA was subjected to next-generation sequencing for analysis of a panel of genes, including TET2, IDH1, IDH2, WT1 and DNMT3A. TET2, IDH1, IDH2, WT1 and DNMT3A mutations were found in 46% (19/41) of the cases. Ten of 15 cases (67%) with TET2, IDH1, IDH2 or WT1 mutations showed deficient 5hmC staining, whereas nine of 26 cases (35%) without a mutation in these genes showed loss of 5hmC. It is of note that all four cases with TET2 mutations showed deficient 5hmC staining. Overall, somatic mutations in TET2, IDH1, IDH2, WT1 and DNMT3A were common in our cohort of AML cases. Immunohistochemical staining for 5hmC was lost in the majority of cases harbouring mutations in these genes, reflecting the proposed relationship between dysfunctional epigenetic pathways and leukaemogenesis. © 2016 John Wiley & Sons Ltd.

  14. Mutations in the von Hippel-Lindau (VHL) tumor suppressor gene and VHL-haplotype analysis in patients with presumable congenital erythrocytosis.

    PubMed

    Cario, Holger; Schwarz, Klaus; Jorch, Norbert; Kyank, Ulrike; Petrides, Petro E; Schneider, Dominik T; Uhle, Renate; Debatin, Klaus-Michael; Kohne, Elisabeth

    2005-01-01

    Congenital erythrocytoses or polycythemias are rare and heterogeneous. A homozygous mutation (C598T->Arg200Trp) in the von Hippel-Lindau (VHL) gene was originally identified as the cause of the endemic Chuvash polycythemia. Subsequently this and other mutations in the VHL gene were also detected in several patients of different ethnic origin. Haplotype analyses of the VHL gene suggested a common origin for the Chuvash-type mutation. Thirty-four patients with presumable congenital erythrocytosis due to an unknown underlying disorder were examined for VHL gene mutations and VHL region haplotypes. Four patients were homozygous and one patient heterozygous for the Chuvash-type mutation. One additional patient presented a previously not described heterozygous mutation G311->T VHL in exon 1. The haplotype analyses were in agreement with recently published data for three of the four patients with homozygous mutations as well as for the patient with a heterozygous Chuvash-type mutation. One patient of Turkish origin with homozygous Chuvash-type mutation had a haplotype not previously found in individuals with Chuvash-type mutation. These results confirm that mutations in the VHL gene are responsible for a substantial proportion of patients with congenital erythrocytoses. Erythrocytoses due to a C598->T mutation of the VHL gene are not geographically restricted. The majority of patients with Chuvash polycythemia share a common VHL gene haplotype. The different haplotype in one of the patients with Chuvash-type mutation indicates that this mutation was not spread only from a single founder but developed independently in other individuals.

  15. Frequency of Germline Mutations in 25 Cancer Susceptibility Genes in a Sequential Series of Patients With Breast Cancer

    PubMed Central

    Lin, Nancy U.; Kidd, John; Allen, Brian A.; Singh, Nanda; Wenstrup, Richard J.; Hartman, Anne-Renee; Winer, Eric P.; Garber, Judy E.

    2016-01-01

    Purpose Testing for germline mutations in BRCA1/2 is standard for select patients with breast cancer to guide clinical management. Next-generation sequencing (NGS) allows testing for mutations in additional breast cancer predisposition genes. The frequency of germline mutations detected by using NGS has been reported in patients with breast cancer who were referred for BRCA1/2 testing or with triple-negative breast cancer. We assessed the frequency and predictors of mutations in 25 cancer predisposition genes, including BRCA1/2, in a sequential series of patients with breast cancer at an academic institution to examine the utility of genetic testing in this population. Methods Patients with stages I to III breast cancer who were seen at a single cancer center between 2010 and 2012, and who agreed to participate in research DNA banking, were included (N = 488). Personal and family cancer histories were collected and germline DNA was sequenced with NGS to identify mutations. Results Deleterious mutations were identified in 10.7% of women, including 6.1% in BRCA1/2 (5.1% in non-Ashkenazi Jewish patients) and 4.6% in other breast/ovarian cancer predisposition genes including CHEK2 (n = 10), ATM (n = 4), BRIP1 (n = 4), and one each in PALB2, PTEN, NBN, RAD51C, RAD51D, MSH6, and PMS2. Whereas young age (P < .01), Ashkenazi Jewish ancestry (P < .01), triple-negative breast cancer (P = .01), and family history of breast/ovarian cancer (P = .01) predicted for BRCA1/2 mutations, no factors predicted for mutations in other breast cancer predisposition genes. Conclusion Among sequential patients with breast cancer, 10.7% were found to have a germline mutation in a gene that predisposes women to breast or ovarian cancer, using a panel of 25 predisposition genes. Factors that predict for BRCA1/2 mutations do not predict for mutations in other breast/ovarian cancer susceptibility genes when these genes are analyzed as a single group. Additional cohorts will be helpful to define

  16. Sarcomeric gene mutations in sudden infant death syndrome (SIDS).

    PubMed

    Brion, Maria; Allegue, Catarina; Santori, Montserrat; Gil, Rocio; Blanco-Verea, Alejandro; Haas, Cordula; Bartsch, Christine; Poster, Simone; Madea, Burkhard; Campuzano, Oscar; Brugada, Ramon; Carracedo, Angel

    2012-06-10

    In developed countries, sudden infant death syndrome (SIDS) represents the most prevalent cause of death in children between 1 month and 1 year of age. SIDS is a diagnosis of exclusion, a negative autopsy which requires the absence of structural organ disease. Although investigators have confirmed that a significant percentage of SIDS cases are actually channelopathies, no data have been made available as to whether other sudden cardiac death-associated diseases, such as hypertrophic cardiomyopathy (HCM), could be responsible for some cases of SIDS. The presence of a genetic mutation in the sarcomeric protein usually affects the force of contraction of the myocyte, whose weakness is compensated with progressive hypertrophy and disarray. However, it is unclear whether in the most incipient forms, that is, first years of life, the lack of these phenotypes still confers a risk of arrhythmogenesis. The main goal of the present study is to wonder whether genetic defects in the sarcomeric proteins, previously associated with HCM, could be responsible for SIDS. We have analysed 286 SIDS cases for the most common genes implicated in HCM in adults. A total of 680 mutations localised in 16 genes were analysed by semi-automated matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDITOF-MS) using the Sequenom MassARRAY(®) System. Ten subjects with completely normal hearts showed mutated alleles at nine of the genetic variants analysed, and one additional novel mutation was detected by conventional sequencing. Therefore, a genetic mutation associated with HCM may cause sudden cardiac death in the absence of an identifiable phenotype. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  17. High frequency of genes' promoter methylation, but lack of BRAF V600E mutation among Iranian colorectal cancer patients.

    PubMed

    Naghibalhossaini, Fakhraddin; Hosseini, Hamideh Mahmoodzadeh; Mokarram, Pooneh; Zamani, Mozhdeh

    2011-12-01

    Gene silencing due to DNA hypermethylation is a major mechanism for loss of tumor suppressor genes function in colorectal cancer. Activating V600E mutation in BRAF gene has been linked with widespread methylation of CpG islands in sporadic colorectal cancers. The aim of the present study was to evaluate the methylation status of three cancer-related genes, APC2, p14ARF, and ECAD in colorectal carcinogenesis and their association with the mutational status of BRAF and KRAS among Iranian colorectal cancer patients. DNA from 110 unselected series of sporadic colorectal cancer patients was examined for BRAF V600E mutation by PCR-RFLP. Promoter methylation of genes in tumors was determined by methylation specific PCR. The frequency of APC2, E-CAD, and p14 methylation was 92.6%, 40.4% and 16.7%, respectively. But, no V600E mutation was identified in the BRAF gene in any sample. No association was found in cases showing epigenetic APC, ECAD, and p14 abnormality with the clinicopathological parameters under study. The association between KRAS mutations and the so called methylator phenotype was previously reported. Therefore, we also analyzed the association between the hot spot KRAS gene mutations in codons of 12 and 13 with genes' promoter hypermethylation in a subset of this group of patients. Out of 86 tumors, KRAS was mutated in 24 (28%) of tumors, the majority occurring in codon 12. KRAS mutations were not associated with genes' methylation in this tumor series. These findings suggest a distinct molecular pathway for methylation of APC2, p14, and ECAD genes from those previously described for colorectal cancers with BRAF or KRAS mutations.

  18. Four novel mutations in the lactase gene (LCT) underlying congenital lactase deficiency (CLD).

    PubMed

    Torniainen, Suvi; Freddara, Roberta; Routi, Taina; Gijsbers, Carolien; Catassi, Carlo; Höglund, Pia; Savilahti, Erkki; Järvelä, Irma

    2009-01-22

    Congenital lactase deficiency (CLD) is a severe gastrointestinal disorder of newborns. The diagnosis is challenging and based on clinical symptoms and low lactase activity in intestinal biopsy specimens. The disease is enriched in Finland but is also present in other parts of the world. Mutations encoding the lactase (LCT) gene have recently been shown to underlie CLD. The purpose of this study was to identify new mutations underlying CLD in patients with different ethnic origins, and to increase awareness of this disease so that the patients could be sought out and treated correctly. Disaccharidase activities in intestinal biopsy specimens were assayed and the coding region of LCT was sequenced from five patients from Europe with clinical features compatible with CLD. In the analysis and prediction of mutations the following programs: ClustalW, Blosum62, PolyPhen, SIFT and Panther PSEC were used. Four novel mutations in the LCT gene were identified. A single nucleotide substitution leading to an amino acid change S688P in exon 7 and E1612X in exon 12 were present in a patient of Italian origin. Five base deletion V565fsX567 leading to a stop codon in exon 6 was found in one and a substitution R1587H in exon 12 from another Finnish patient. Both Finnish patients were heterozygous for the Finnish founder mutation Y1390X. The previously reported mutation G1363S was found in a homozygous state in two siblings of Turkish origin. This is the first report of CLD mutations in patients living outside Finland. It seems that disease is more common than previously thought. All mutations in the LCT gene lead to a similar phenotype despite the location and/or type of mutation.

  19. Full-length mutation search of the TP53 gene in acute myeloid leukemia has increased significance as a prognostic factor.

    PubMed

    Terada, Kazuki; Yamaguchi, Hiroki; Ueki, Toshimitsu; Usuki, Kensuke; Kobayashi, Yutaka; Tajika, Kenji; Gomi, Seiji; Kurosawa, Saiko; Miyadera, Keiki; Tokura, Taichiro; Omori, Ikuko; Marumo, Atushi; Fujiwara, Yusuke; Yui, Shunsuke; Ryotokuji, Takeshi; Osaki, Yoshiki; Arai, Kunihito; Kitano, Tomoaki; Kosaka, Fumiko; Wakita, Satoshi; Tamai, Hayato; Fukuda, Takahiro; Inokuchi, Koiti

    2018-01-01

    TP53 gene abnormality has been reported to be an unfavorable prognostic factor in acute myeloid leukemia (AML). However, almost all studies of TP53 gene abnormality so far have been limited to mutation searches in the DNA binding domain. As there have been few reports examining both mutation and deletion over the full-length of the TP53 gene, the clinical characteristics of TP53 gene abnormality have not yet been clearly established. In this study, TP53 gene mutation was observed in 7.3% of the total 412 de novo AML cases (33 mutations in 30 cases), with mutation outside the DNA binding domain in eight cases (27%). TP53 gene deletion was observed in 3.1% of 358 cases. All cases had monoallelic deletion with TP53 gene mutation on the opposite allele. Multivariate analysis demonstrated that TP53 gene mutation in the DNA binding domain and outside the DNA binding domain was an independent poor prognostic factor for overall survival and relapse-free survival among the total cohort and it is also an unfavorable prognostic factor in FLT3-ITD-negative AML cases aged 70 years or below with intermediate cytogenetic prognosis. In stratified treatment, full-length search for TP53 gene mutation is therefore very important.

  20. Mutation screening of 75 candidate genes in 152 complex I deficiency cases identifies pathogenic variants in 16 genes including NDUFB9.

    PubMed

    Haack, Tobias B; Madignier, Florence; Herzer, Martina; Lamantea, Eleonora; Danhauser, Katharina; Invernizzi, Federica; Koch, Johannes; Freitag, Martin; Drost, Rene; Hillier, Ingo; Haberberger, Birgit; Mayr, Johannes A; Ahting, Uwe; Tiranti, Valeria; Rötig, Agnes; Iuso, Arcangela; Horvath, Rita; Tesarova, Marketa; Baric, Ivo; Uziel, Graziella; Rolinski, Boris; Sperl, Wolfgang; Meitinger, Thomas; Zeviani, Massimo; Freisinger, Peter; Prokisch, Holger

    2012-02-01

    Mitochondrial complex I deficiency is the most common cause of mitochondrial disease in childhood. Identification of the molecular basis is difficult given the clinical and genetic heterogeneity. Most patients lack a molecular definition in routine diagnostics. A large-scale mutation screen of 75 candidate genes in 152 patients with complex I deficiency was performed by high-resolution melting curve analysis and Sanger sequencing. The causal role of a new disease allele was confirmed by functional complementation assays. The clinical phenotype of patients carrying mutations was documented using a standardised questionnaire. Causative mutations were detected in 16 genes, 15 of which had previously been associated with complex I deficiency: three mitochondrial DNA genes encoding complex I subunits, two mitochondrial tRNA genes and nuclear DNA genes encoding six complex I subunits and four assembly factors. For the first time, a causal mutation is described in NDUFB9, coding for a complex I subunit, resulting in reduction in NDUFB9 protein and both amount and activity of complex I. These features were rescued by expression of wild-type NDUFB9 in patient-derived fibroblasts. Mutant NDUFB9 is a new cause of complex I deficiency. A molecular diagnosis related to complex I deficiency was established in 18% of patients. However, most patients are likely to carry mutations in genes so far not associated with complex I function. The authors conclude that the high degree of genetic heterogeneity in complex I disorders warrants the implementation of unbiased genome-wide strategies for the complete molecular dissection of mitochondrial complex I deficiency.

  1. DeepGene: an advanced cancer type classifier based on deep learning and somatic point mutations.

    PubMed

    Yuan, Yuchen; Shi, Yi; Li, Changyang; Kim, Jinman; Cai, Weidong; Han, Zeguang; Feng, David Dagan

    2016-12-23

    With the developments of DNA sequencing technology, large amounts of sequencing data have become available in recent years and provide unprecedented opportunities for advanced association studies between somatic point mutations and cancer types/subtypes, which may contribute to more accurate somatic point mutation based cancer classification (SMCC). However in existing SMCC methods, issues like high data sparsity, small volume of sample size, and the application of simple linear classifiers, are major obstacles in improving the classification performance. To address the obstacles in existing SMCC studies, we propose DeepGene, an advanced deep neural network (DNN) based classifier, that consists of three steps: firstly, the clustered gene filtering (CGF) concentrates the gene data by mutation occurrence frequency, filtering out the majority of irrelevant genes; secondly, the indexed sparsity reduction (ISR) converts the gene data into indexes of its non-zero elements, thereby significantly suppressing the impact of data sparsity; finally, the data after CGF and ISR is fed into a DNN classifier, which extracts high-level features for accurate classification. Experimental results on our curated TCGA-DeepGene dataset, which is a reformulated subset of the TCGA dataset containing 12 selected types of cancer, show that CGF, ISR and DNN all contribute in improving the overall classification performance. We further compare DeepGene with three widely adopted classifiers and demonstrate that DeepGene has at least 24% performance improvement in terms of testing accuracy. Based on deep learning and somatic point mutation data, we devise DeepGene, an advanced cancer type classifier, which addresses the obstacles in existing SMCC studies. Experiments indicate that DeepGene outperforms three widely adopted existing classifiers, which is mainly attributed to its deep learning module that is able to extract the high level features between combinatorial somatic point mutations and

  2. Different mutations of the human c-mpl gene indicate distinct haematopoietic diseases.

    PubMed

    He, Xin; Chen, Zhigang; Jiang, Yangyan; Qiu, Xi; Zhao, Xiaoying

    2013-01-25

    The human c-mpl gene (MPL) plays an important role in the development of megakaryocytes and platelets as well as the self-renewal of haematopoietic stem cells. However, numerous MPL mutations have been identified in haematopoietic diseases. These mutations alter the normal regulatory mechanisms and lead to autonomous activation or signalling deficiencies. In this review, we summarise 59 different MPL mutations and classify these mutations into four different groups according to the associated diseases and mutation rates. Using this classification, we clearly distinguish four diverse types of MPL mutations and obtain a deep understand of their clinical significance. This will prove to be useful for both disease diagnosis and the design of individual therapy regimens based on the type of MPL mutations.

  3. Different mutations of the human c-mpl gene indicate distinct haematopoietic diseases

    PubMed Central

    2013-01-01

    The human c-mpl gene (MPL) plays an important role in the development of megakaryocytes and platelets as well as the self-renewal of haematopoietic stem cells. However, numerous MPL mutations have been identified in haematopoietic diseases. These mutations alter the normal regulatory mechanisms and lead to autonomous activation or signalling deficiencies. In this review, we summarise 59 different MPL mutations and classify these mutations into four different groups according to the associated diseases and mutation rates. Using this classification, we clearly distinguish four diverse types of MPL mutations and obtain a deep understand of their clinical significance. This will prove to be useful for both disease diagnosis and the design of individual therapy regimens based on the type of MPL mutations. PMID:23351976

  4. Frequency of the S65C mutation in the hemochromatosis gene in Brazil.

    PubMed

    Oliveira, V C; Caxito, F A; Gomes, K B; Castro, A M; Pardini, V C; Ferreira, A C S

    2009-07-14

    Development of hereditary hemochromatosis is associated with the C282Y, H63D or S65C mutations in the hemochromatosis gene. Though there is extensive knowledge about the former two, there is little information on the mechanism of action and the allelic frequency of the S65C mutation. We examined the prevalence of the S65C mutation of the hemochromatosis gene in Brazilians with clinical suspicion of hereditary hemochromatosis. Genotyping for this mutation was carried out in 633 individuals with clinical suspicion of hereditary hemochromatosis, using the polymerase chain reaction, followed by enzymatic digestion. The sample comprised 77.1% men and 22.9% women, giving a ratio of approximately 3:1; the mean age was 48.8 +/- 13.8 years. More than half (57.3%) of the individuals in the sample were 41 to 60 years old. The frequency of heterozygotes for this mutation was 0.016; no homozygous mutant patients were found. This is the first analysis of the S65C mutation in individuals suspected of having hereditary hemochromatosis in Brazil.

  5. TP53 mutation-correlated genes predict the risk of tumor relapse and identify MPS1 as a potential therapeutic kinase in TP53-mutated breast cancers.

    PubMed

    Győrffy, Balázs; Bottai, Giulia; Lehmann-Che, Jacqueline; Kéri, György; Orfi, László; Iwamoto, Takayuki; Desmedt, Christine; Bianchini, Giampaolo; Turner, Nicholas C; de Thè, Hugues; André, Fabrice; Sotiriou, Christos; Hortobagyi, Gabriel N; Di Leo, Angelo; Pusztai, Lajos; Santarpia, Libero

    2014-05-01

    Breast cancers (BC) carry a complex set of gene mutations that can influence their gene expression and clinical behavior. We aimed to identify genes driven by the TP53 mutation status and assess their clinical relevance in estrogen receptor (ER)-positive and ER-negative BC, and their potential as targets for patients with TP53 mutated tumors. Separate ROC analyses of each gene expression according to TP53 mutation status were performed. The prognostic value of genes with the highest AUC were assessed in a large dataset of untreated, and neoadjuvant chemotherapy treated patients. The mitotic checkpoint gene MPS1 was the most significant gene correlated with TP53 status, and the most significant prognostic marker in all ER-positive BC datasets. MPS1 retained its prognostic value independently from the type of treatment administered. The biological functions of MPS1 were investigated in different BC cell lines. We also assessed the effects of a potent small molecule inhibitor of MPS1, SP600125, alone and in combination with chemotherapy. Consistent with the gene expression profiling and siRNA assays, the inhibition of MPS1 by SP600125 led to a reduction in cell viability and a significant increase in cell death, selectively in TP53-mutated BC cells. Furthermore, the chemical inhibition of MPS1 sensitized BC cells to conventional chemotherapy, particularly taxanes. Our results collectively demonstrate that TP53-correlated kinase MPS1, is a potential therapeutic target in BC patients with TP53 mutated tumors, and that SP600125 warrant further development in future clinical trials. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  6. Mutations in the human GlyT2 gene define a presynaptic component of human startle disease

    PubMed Central

    Rees, Mark I.; Harvey, Kirsten; Pearce, Brian R.; Chung, Seo-Kyung; Duguid, Ian C.; Thomas, Philip; Beatty, Sarah; Graham, Gail E.; Armstrong, Linlea; Shiang, Rita; Abbott, Kim J.; Zuberi, Sameer M.; Stephenson, John B.P.; Owen, Michael J.; Tijssen, Marina A.J.; van den Maagdenberg, Arn M.J.M.; Smart, Trevor G.; Supplisson, Stéphane; Harvey, Robert J.

    2011-01-01

    Hyperekplexia is a human neurological disorder characterized by an excessive startle response and is typically caused by missense and nonsense mutations in the gene encoding the inhibitory glycine receptor (GlyR) α1 subunit (GLRA1)1-3. Genetic heterogeneity has been confirmed in isolated sporadic cases with mutations in other postsynaptic glycinergic proteins including the GlyR β subunit (GLRB)4, gephyrin (GPHN)5 and RhoGEF collybistin (ARHGEF9)6. However, many sporadic patients diagnosed with hyperekplexia do not carry mutations in these genes2-7. Here we reveal that missense, nonsense and frameshift mutations in the presynaptic glycine transporter 2 (GlyT2) gene (SLC6A5)8 also cause hyperekplexia. Patients harbouring mutations in SLC6A5 presented with hypertonia, an exaggerated startle response to tactile or acoustic stimuli, and life-threatening neonatal apnoea episodes. GlyT2 mutations result in defective subcellular localisation and/or decreased glycine uptake, with selected mutations affecting predicted glycine and Na+ binding sites. Our results demonstrate that SLC6A5 is a major gene for hyperekplexia and define the first neurological disorder linked to mutations in a Na+/Cl−-dependent transporter for a classical fast neurotransmitter. By analogy, we suggest that in other human disorders where defects in postsynaptic receptors have been identified, similar symptoms could result from defects in the cognate presynaptic neurotransmitter transporter. PMID:16751771

  7. [Analysis of TGFBI gene mutation in a Chinese family affected with Reis-Bucklers corneal dystrophy].

    PubMed

    Guan, Tao; Zhang, Lingjie; Xu, Dejian; Wu, Haijian; Zheng, Libin

    2017-10-10

    To analyze the clinical features and TGFBI gene mutation in a Chinese family affected with Reis-Bucklers corneal dystrophy. Genomic DNA was extracted from 53 members including 9 patients from the family. The 17 exons and splice region of introns of the TGFBI gene were amplified by PCR and directly sequenced. All family members were subjected to ophthalmologic examination. A heterozygous mutation (R124L) was found in exon 4 of the TGFBI gene among all patients from the family. The same mutation was not found among unaffected family members. The inheritance pattern of the family was identified as autosomal dominant, and the Reis-Bucklers corneal dystrophy in the family was diagnosed as the geographic type. The R124L mutation of the TGFBI gene probably underlies the pathogenesis of Reis-Bucklers corneal dystrophy in this Chinese family. Molecular genetic approach is useful for the proper diagnosis of this type of corneal dystrophy.

  8. Validation of predictive models for germline mutations in DNA mismatch repair genes in colorectal cancer.

    PubMed

    Monzon, Jose G; Cremin, Carol; Armstrong, Linlea; Nuk, Jennifer; Young, Sean; Horsman, Doug E; Garbutt, Kristy; Bajdik, Chris D; Gill, Sharlene

    2010-02-15

    Lynch syndrome is defined by the presence of germline mutations in mismatch repair (MMR) genes. Several models have been recently devised that predict mutation carrier status (Myriad Genetics, Wijnen, Barnetson, PREMM and MMRpro models). Families at moderate-high risk for harboring a Lynch-associated mutation, referred to the BC Cancer Agency (BCCA) Hereditary Cancer Program (HCP), underwent mutation analysis, immunohistochemistry and/or microsatellite testing. Seventy-two tested cases were included. Twenty-five patients were mutation positive (34.7%) and 47 were mutation negative (65.3%). Nineteen of 43 patients who were both microsatellite stable and normal on immunohistochemistry for MLH1 and MSH2 were also genotyped for mutations in these genes; all 19 were negative for MMR gene mutations. Model-derived probabilities of harboring a MMR gene mutation in the proband were calculated and compared to observed results. The area under the ROC curves were 0.75 (95%CI; 0.63-0.87), 0.86 (0.7-0.96), 0.89 (0.82-0.97), 0.89 (0.81-0.98) and 0.93 (0.86-0.99) for the Myriad, Barnetson, Wijnen, MMRpro and PREMM models, respectively. The Amsterdam II criteria had a sensitivity and specificity of 0.76 and 0.74, respectively, in this cohort. The PREMM model demonstrated the best performance for predicting carrier status based on the positive likelihood ratios at the >10%, >20% and >30% probability thresholds. In this referred cohort, the PREMM model had the most favorable concordance index and predictive performance for carrier status based on the positive LR. These prediction models (PREMM, MMRPro and Wijnen) may soon replace the Amsterdam II and revised Bethesda criteria as a prescreening tool for Lynch mutations.

  9. Association mining of mutated cancer genes in different clinical stages across 11 cancer types.

    PubMed

    Hu, Wangxiong; Li, Xiaofen; Wang, Tingzhang; Zheng, Shu

    2016-10-18

    Many studies have demonstrated that some genes (e.g. APC, BRAF, KRAS, PTEN, TP53) are frequently mutated in cancer, however, underlying mechanism that contributes to their high mutation frequency remains unclear. Here we used Apriori algorithm to find the frequent mutational gene sets (FMGSs) from 4,904 tumors across 11 cancer types as part of the TCGA Pan-Cancer effort and then mined the hidden association rules (ARs) within these FMGSs. Intriguingly, we found that well-known cancer driver genes such as BRAF, KRAS, PTEN, and TP53 were often co-occurred with other driver genes and FMGSs size peaked at an itemset size of 3~4 genes. Besides, the number and constitution of FMGS and ARs differed greatly among different cancers and stages. In addition, FMGS and ARs were rare in endocrine-related cancers such as breast carcinoma, ovarian cystadenocarcinoma, and thyroid carcinoma, but abundant in cancers contact directly with external environments such as skin melanoma and stomach adenocarcinoma. Furthermore, we observed more rules in stage IV than in other stages, indicating that distant metastasis needed more sophisticated gene regulatory network.

  10. Frequency of mutations in the genes associated with hereditary sensory and autonomic neuropathy in a UK cohort

    PubMed Central

    Davidson, G. L.; Murphy, S. M.; Polke, J. M.; Laura, M.; Salih, M. A. M.; Muntoni, F.; Blake, J.; Brandner, S.; Davies, N.; Horvath, R.; Price, S.; Donaghy, M.; Roberts, M.; Foulds, N.; Ramdharry, G.; Soler, D.; Lunn, M. P.; Manji, H.; Davis, M. B.; Houlden, H.; Reilly, M. M.

    2013-01-01

    The hereditary sensory and autonomic neuropathies (HSAN, also known as the hereditary sensory neuropathies) are a clinically and genetically heterogeneous group of disorders, characterised by a progressive sensory neuropathy often complicated by ulcers and amputations, with variable motor and autonomic involvement. To date, mutations in twelve genes have been identified as causing HSAN. To study the frequency of mutations in these genes and the associated phenotypes, we screened 140 index patients in our inherited neuropathy cohort with a clinical diagnosis of HSAN for mutations in the coding regions of SPTLC1, RAB7, WNK1/HSN2, FAM134B, NTRK1 (TRKA) and NGFB. We identified 25 index patients with mutations in six genes associated with HSAN (SPTLC1, RAB7, WNK1/HSN2, FAM134B, NTRK1 and NGFB); 20 of which appear to be pathogenic giving an overall mutation frequency of 14.3%. Mutations in the known genes for HSAN are rare suggesting that further HSAN genes are yet to be identified. The p.Cys133Trp mutation in SPTLC1 is the most common cause of HSAN in the UK population and should be screened first in all patients with sporadic or autosomal dominant HSAN. PMID:22302274

  11. Frequency of mutations in the genes associated with hereditary sensory and autonomic neuropathy in a UK cohort.

    PubMed

    Davidson, G L; Murphy, S M; Polke, J M; Laura, M; Salih, M A M; Muntoni, F; Blake, J; Brandner, S; Davies, N; Horvath, R; Price, S; Donaghy, M; Roberts, M; Foulds, N; Ramdharry, G; Soler, D; Lunn, M P; Manji, H; Davis, M B; Houlden, H; Reilly, M M

    2012-08-01

    The hereditary sensory and autonomic neuropathies (HSAN, also known as the hereditary sensory neuropathies) are a clinically and genetically heterogeneous group of disorders, characterised by a progressive sensory neuropathy often complicated by ulcers and amputations, with variable motor and autonomic involvement. To date, mutations in twelve genes have been identified as causing HSAN. To study the frequency of mutations in these genes and the associated phenotypes, we screened 140 index patients in our inherited neuropathy cohort with a clinical diagnosis of HSAN for mutations in the coding regions of SPTLC1, RAB7, WNK1/HSN2, FAM134B, NTRK1 (TRKA) and NGFB. We identified 25 index patients with mutations in six genes associated with HSAN (SPTLC1, RAB7, WNK1/HSN2, FAM134B, NTRK1 and NGFB); 20 of which appear to be pathogenic giving an overall mutation frequency of 14.3%. Mutations in the known genes for HSAN are rare suggesting that further HSAN genes are yet to be identified. The p.Cys133Trp mutation in SPTLC1 is the most common cause of HSAN in the UK population and should be screened first in all patients with sporadic or autosomal dominant HSAN.

  12. MITOCHONDRIAL DNA DEPLETION SYNDROME DUE TO MUTATIONS IN THE RRM2B GENE

    PubMed Central

    Bornstein, Belén; Area, Estela; Flanigan, Kevin M.; Ganesh, Jaya; Jayakar, Parul; Swoboda, Kathryn J.; Coku, Jorida; Naini, Ali; Shanske, Sara; Tanji, Kurenai; Hirano, Michio; DiMauro, Salvatore

    2014-01-01

    Mitochondrial DNA depletion syndrome (MDS) is characterized by a reduction in mtDNA copy number and has been associated with mutations in eight nuclear genes, including enzymes involved in mitochondrial nucleotide metabolism (POLG, TK2, DGUOK, SUCLA2, SUCLG1, PEO1) and MPV17. Recently, mutations in The RRM2B gene, encoding the p53-controlled ribonucleotide reductase subunit, have been described in 7 infants from 4 families, who presented with various combinations of hypotonia, tubulopathy, seizures, respiratory distress, diarrhea, and lactic acidosis. All children died before 4 months of age. We sequenced the RRM2B gene in three unrelated cases with unexplained severe mtDNA depletion. The first patient developed intractable diarrhea, profound weakness, respiratory distress, and died at three months. The other two unrelated patients had a much milder phenotype and are still alive at ages 27 and 36 months. All three patients had lactic acidosis and severe depletion of mtDNA in muscle. Muscle histochemistry showed RRF and COX deficiency. Sequencing the RRM2B gene revealed three missense mutations and two single nucleotide deletions in exon 6, 8 and 9, confirming that RRM2B mutations are important causes of MDS and that the clinical phenotype is heterogeneous and not invariably fatal in infancy. PMID:18504129

  13. Mitochondrial DNA depletion syndrome due to mutations in the RRM2B gene.

    PubMed

    Bornstein, Belén; Area, Estela; Flanigan, Kevin M; Ganesh, Jaya; Jayakar, Parul; Swoboda, Kathryn J; Coku, Jorida; Naini, Ali; Shanske, Sara; Tanji, Kurenai; Hirano, Michio; DiMauro, Salvatore

    2008-06-01

    Mitochondrial DNA depletion syndrome (MDS) is characterized by a reduction in mtDNA copy number and has been associated with mutations in eight nuclear genes, including enzymes involved in mitochondrial nucleotide metabolism (POLG, TK2, DGUOK, SUCLA2, SUCLG1, PEO1) and MPV17. Recently, mutations in the RRM2B gene, encoding the p53-controlled ribonucleotide reductase subunit, have been described in seven infants from four families, who presented with various combinations of hypotonia, tubulopathy, seizures, respiratory distress, diarrhea, and lactic acidosis. All children died before 4 months of age. We sequenced the RRM2B gene in three unrelated cases with unexplained severe mtDNA depletion. The first patient developed intractable diarrhea, profound weakness, respiratory distress, and died at 3 months. The other two unrelated patients had a much milder phenotype and are still alive at ages 27 and 36 months. All three patients had lactic acidosis and severe depletion of mtDNA in muscle. Muscle histochemistry showed RRF and COX deficiency. Sequencing the RRM2B gene revealed three missense mutations and two single nucleotide deletions in exons 6, 8, and 9, confirming that RRM2B mutations are important causes of MDS and that the clinical phenotype is heterogeneous and not invariably fatal in infancy.

  14. Novel mutation in forkhead box G1 (FOXG1) gene in an Indian patient with Rett syndrome.

    PubMed

    Das, Dhanjit Kumar; Jadhav, Vaishali; Ghattargi, Vikas C; Udani, Vrajesh

    2014-03-15

    Rett syndrome (RTT) is a severe neurodevelopmental disorder characterized by the progressive loss of intellectual functioning, fine and gross motor skills and communicative abilities, deceleration of head growth, and the development of stereotypic hand movements, occurring after a period of normal development. The classic form of RTT involves mutation in MECP2 while the involvement of CDKL5 and FOXG1 genes has been identified in atypical RTT phenotype. FOXG1 gene encodes for a fork-head box protein G1, a transcription factor acting primarily as transcriptional repressor through DNA binding in the embryonic telencephalon as well as a number of other neurodevelopmental processes. In this report we have described the molecular analysis of FOXG1 gene in Indian patients with Rett syndrome. FOXG1 gene mutation analysis was done in a cohort of 34 MECP2/CDKL5 mutation negative RTT patients. We have identified a novel mutation (p. D263VfsX190) in FOXG1 gene in a patient with congenital variant of Rett syndrome. This mutation resulted into a frameshift, thereby causing an alteration in the reading frames of the entire coding sequence downstream of the mutation. The start position of the frameshift (Asp263) and amino acid towards the carboxyl terminal end of the protein was found to be well conserved across species using multiple sequence alignment. Since the mutation is located at forkhead binding domain, the resultant mutation disrupts the secondary structure of the protein making it non-functional. This is the first report from India showing mutation in FOXG1 gene in Rett syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Genome Mutational and Transcriptional Hotspots Are Traps for Duplicated Genes and Sources of Adaptations.

    PubMed

    Fares, Mario A; Sabater-Muñoz, Beatriz; Toft, Christina

    2017-05-01

    Gene duplication generates new genetic material, which has been shown to lead to major innovations in unicellular and multicellular organisms. A whole-genome duplication occurred in the ancestor of Saccharomyces yeast species but 92% of duplicates returned to single-copy genes shortly after duplication. The persisting duplicated genes in Saccharomyces led to the origin of major metabolic innovations, which have been the source of the unique biotechnological capabilities in the Baker's yeast Saccharomyces cerevisiae. What factors have determined the fate of duplicated genes remains unknown. Here, we report the first demonstration that the local genome mutation and transcription rates determine the fate of duplicates. We show, for the first time, a preferential location of duplicated genes in the mutational and transcriptional hotspots of S. cerevisiae genome. The mechanism of duplication matters, with whole-genome duplicates exhibiting different preservation trends compared to small-scale duplicates. Genome mutational and transcriptional hotspots are rich in duplicates with large repetitive promoter elements. Saccharomyces cerevisiae shows more tolerance to deleterious mutations in duplicates with repetitive promoter elements, which in turn exhibit higher transcriptional plasticity against environmental perturbations. Our data demonstrate that the genome traps duplicates through the accelerated regulatory and functional divergence of their gene copies providing a source of novel adaptations in yeast. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  16. Olaparib Approved for Breast Cancers with BRCA Gene Mutations

    Cancer.gov

    The Food and Drug Administration has approved olaparib (Lynparza®) to treat metastatic breast cancers that have inherited mutations in the BRCA1 or BRCA2 genes as well as a companion diagnostic test for selecting candidates for the therapy.

  17. Possible relevance of tumor-related genes mutation to malignant transformation of endometriosis.

    PubMed

    Ma, X; Hui, Y; Lin, L; Wu, Y; Zhang, X; Qin, X

    2016-01-01

    Despite studies have suggested that endometriosis has malignant potential, the molecular mechanism underlying the malignant transformation of endometriosis is poorly understood so far. Endometriosis-associated ovarian cancer (EAOC) or ovarian cancer arising from endometriosis (OCEM) may provide an ideal model for genetic studies. To investigate the genetic alterations during transformation of ovarian endometriosis into cancer, the authors analysed mutations of tumour-related genes (PTEN and p53) in EAOC cases (n=23, group 1), including 19 cases which were detected co-existence of endometriosis and cancer and four cases which fulfilled the histological criteria in malignant transformation of endometriosis (OCEMs), and in atypical hyperplasia ovarian endometriosis (aEMs) (n = 10, group 2), as well as in solitary ovarian endometriosis (EMs) (n = 20, group 3), simultaneously, to study the correlation of the two genes in the development and progression of the ovarian endometriosis malignancy. Each paraffin block was sliced into serial ten-µm-thick sections. Extracted DNA was amplified by nested PCR. Mutations of PTEN and p53 were examined by bidirectional DNA sequencing. It was acknowledged by experiments that the PTEN and p53 mutation frequency in EAOCs were significantly higher than that in aEMs and EMs. There was significant difference to compare EAOCs with EMs (p < 0.01, p < 0.05), and converse to compare with aEMs (p > 0.05), respectively. No definite involvement between the frequency of PTEN and p53 mutations in EAOCs and age difference, histological type, clinical stage, pathological grade, and whether accompanied by metastasis (p > 0.05); however, a decreasing trend of PTEN mutation with the increased age, decreased clinical stage and pathological grade, and when accompanied by metastasis was detected. Adversely, an increasing trend of p53 mutation was represented. In EAOCs group, the authors detected eight PTEN and four p53 mutation events, respectively

  18. [Frequency of CHEK2 gene mutations in patients with breast cancer from the Republic of Bashkortostan].

    PubMed

    2014-01-01

    Several studies have shown, that mutation in CHEK2 gene can increase the risk of different cancers, including breast cancer (BC). Clearly, that character of mutations distribution in the defined regions is depended on genetic structure of the population. We conducted the screening of mutations c.1100delC, c.444 + 1G>A, de15395, p.I157T andIp.R145Win CHEK2 gene in patients with breast cancer (n = 977) and in control group (n = 1069) originating from the Republic of Bashkortostan. The mutation de15395 in CHEK2 gene was detected with frequency of 1,23% (12/977)in woman with BC and 0.09% (1/1069) in controls (OR:13.28, CI 95%: 1.72-102.33, p = 0.003). Mutations c.1100delC and c.444 + 1G>A were found in BC patients and controls with frequencies of 0.4%, 0.4% (4/977) and 0.09% (1/1069), 0.2% (2/1069), respectively. The missense mutation p.I157T in CHEK2 was found as the most common variant in two studied cohorts (approximately 5%), but differences did not achieved statistical significance. We found the ethnic specificity in distribution of truncating mutations, which occurs mainly among the women of Slavic origin. All three mutations were identified in women of Russian and Ukrainian ethnic origin. Mutations c.1100delC and c.444 + 1G>A in CHEK2 gene were not detected in Bashkirs and Tatars, but CHEK2 de15395 mutation was observed in Tatars.

  19. Phenotypic spectrum associated with mutations of the mitochondrial polymerase gamma gene.

    PubMed

    Horvath, Rita; Hudson, Gavin; Ferrari, Gianfrancesco; Fütterer, Nancy; Ahola, Sofia; Lamantea, Eleonora; Prokisch, Holger; Lochmüller, Hanns; McFarland, Robert; Ramesh, V; Klopstock, Thomas; Freisinger, Peter; Salvi, Fabrizio; Mayr, Johannes A; Santer, Rene; Tesarova, Marketa; Zeman, Jiri; Udd, Bjarne; Taylor, Robert W; Turnbull, Douglass; Hanna, Michael; Fialho, Doreen; Suomalainen, Anu; Zeviani, Massimo; Chinnery, Patrick F

    2006-07-01

    Mutations in the gene coding for the catalytic subunit of the mitochondrial DNA (mtDNA) polymerase gamma (POLG1) have recently been described in patients with diverse clinical presentations, revealing a complex relationship between genotype and phenotype in patients and their families. POLG1 was sequenced in patients from different European diagnostic and research centres to define the phenotypic spectrum and advance understanding of the recurrence risks. Mutations were identified in 38 cases, with the majority being sporadic compound heterozygotes. Eighty-nine DNA sequence changes were identified, including 2 predicted to alter a splice site, 1 predicted to cause a premature stop codon and 13 predicted to cause novel amino acid substitutions. The majority of children had a mutation in the linker region, often 1399G-->A (A467T), and a mutation affecting the polymerase domain. Others had mutations throughout the gene, and 11 had 3 or more substitutions. The clinical presentation ranged from the neonatal period to late adult life, with an overlapping phenotypic spectrum from severe encephalopathy and liver failure to late-onset external ophthalmoplegia, ataxia, myopathy and isolated muscle pain or epilepsy. There was a strong gender bias in children, with evidence of an environmental interaction with sodium valproate. POLG1 mutations cause an overlapping clinical spectrum of disease with both dominant and recessive modes of inheritance. 1399G-->A (A467T) is common in children, but complete POLG1 sequencing is required to identify multiple mutations that can have complex implications for genetic counselling.

  20. FANCA Gene Mutations with 8 Novel Molecular Changes in Indian Fanconi Anemia Patients.

    PubMed

    Solanki, Avani; Mohanty, Purvi; Shukla, Pallavi; Rao, Anita; Ghosh, Kanjaksha; Vundinti, Babu Rao

    2016-01-01

    Fanconi anemia (FA), a rare heterogeneous genetic disorder, is known to be associated with 19 genes and a spectrum of clinical features. We studied FANCA molecular changes in 34 unrelated and 2 siblings of Indian patients with FA and have identified 26 different molecular changes of FANCA gene, of which 8 were novel mutations (a small deletion c.2500delC, 4 non-sense mutations c.2182C>T, c.2630C>G, c.3677C>G, c.3189G>A; and 3 missense mutations; c.1273G>C, c.3679 G>C, and c.3992 T>C). Among these only 16 patients could be assigned FA-A complementation group, because we could not confirm single exon deletions detected by MLPA or cDNA amplification by secondary confirmation method and due to presence of heterozygous non-pathogenic variations or heterozygous pathogenic mutations. An effective molecular screening strategy should be developed for confirmation of these mutations and determining the breakpoints for single exon deletions.

  1. FANCA Gene Mutations with 8 Novel Molecular Changes in Indian Fanconi Anemia Patients

    PubMed Central

    Solanki, Avani; Mohanty, Purvi; Shukla, Pallavi; Rao, Anita; Ghosh, Kanjaksha; Vundinti, Babu Rao

    2016-01-01

    Fanconi anemia (FA), a rare heterogeneous genetic disorder, is known to be associated with 19 genes and a spectrum of clinical features. We studied FANCA molecular changes in 34 unrelated and 2 siblings of Indian patients with FA and have identified 26 different molecular changes of FANCA gene, of which 8 were novel mutations (a small deletion c.2500delC, 4 non-sense mutations c.2182C>T, c.2630C>G, c.3677C>G, c.3189G>A; and 3 missense mutations; c.1273G>C, c.3679 G>C, and c.3992 T>C). Among these only 16 patients could be assigned FA-A complementation group, because we could not confirm single exon deletions detected by MLPA or cDNA amplification by secondary confirmation method and due to presence of heterozygous non-pathogenic variations or heterozygous pathogenic mutations. An effective molecular screening strategy should be developed for confirmation of these mutations and determining the breakpoints for single exon deletions. PMID:26799702

  2. Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations.

    PubMed

    Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

    2018-04-14

    To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori ( H. pylori ) and determine their association with therapeutic failure. PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar's test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori ( κ = 0.71). The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori .

  3. Mutation spectrum of the FZD-4, TSPAN12 AND ZNF408 genes in Indian FEVR patients.

    PubMed

    Musada, Ganeswara Rao; Syed, Hameed; Jalali, Subhadra; Chakrabarti, Subhabrata; Kaur, Inderjeet

    2016-06-17

    Mutations in candidate genes that encode for a ligand (NDP) and receptor complex (FZD4, LRP5 and TSPAN12) in the Norrin β-catenin signaling pathway are involved in the pathogenesis of familial exudative vitreoretinopathy (FEVR, MIM # 133780). Recently, a transcription factor (ZNF408) has also been implicated in FEVR. We had earlier characterized the variations in NDP among FEVR patients from India. The present study aimed at understanding the involvement of the remaining genes (FZD4, TSPAN12 and ZNF408) in the same cohort. The DNA of 110 unrelated FEVR patients and 115 unaffected controls were screened for variations in the entire coding and untranslated regions of these 3 genes by resequencing. Segregation of the disease-associated variants was assessed in the family members of the probands. The effect of the observed missense changes were further analyzed by SIFT and PolyPhen-2 scores. The screening of FZD4, TSPAN12 and ZNF408 genes identified 11 different mutations in 15/110 FEVR probands. Of the 11 identified mutations, 6 mutations were novel. The detected missense mutations were mainly located in the domains which are functionally crucial for the formation of ligand-receptor complex and as they replaced evolutionarily highly conserved amino acids with a SIFT score < 0.005, they are predicted to be pathogenic. Additionally 2 novel and 16 reported single nucleotide polymorphisms (SNP) were also detected. Our genetic screening revealed varying mutation frequencies in the FZD4 (8.0 %), TSPAN12 (5.4 %) and ZNF408 (2.7 %) genes among the FEVR patients, indicating their potential role in the disease pathogenesis. The observed mutations segregated with the disease phenotype and exhibited variable expressivity. The mutations in FZD4 and TSPAN12 were involved in autosomal dominant and autosomal recessive families and further validates the involvement of these gene in FEVR development.

  4. Punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in Colombian populations

    PubMed Central

    Matta, Andrés Jenuer; Zambrano, Diana Carolina; Pazos, Alvaro Jairo

    2018-01-01

    AIM To characterize punctual mutations in 23S rRNA gene of clarithromycin-resistant Helicobacter pylori (H. pylori) and determine their association with therapeutic failure. METHODS PCR products of 23S rRNA gene V domain of 74 H. pylori isolates; 34 resistant to clarithromycin (29 from a low-risk gastric cancer (GC) population: Tumaco-Colombia, and 5 from a high-risk population: Tuquerres-Colombia) and 40 from a susceptible population (28 from Tumaco and 12 from Túquerres) were sequenced using capillary electrophoresis. The concordance between mutations of V domain 23S rRNA gene of H. pylori and therapeutic failure was determined using the Kappa coefficient and McNemar’s test was performed to determine the relationship between H. pylori mutations and clarithromycin resistance. RESULTS 23S rRNA gene from H. pylori was amplified in 56/74 isolates, of which 25 were resistant to clarithromycin (20 from Tumaco and 5 from Túquerres, respectively). In 17 resistant isolates (13 from Tumaco and 4 from Túquerres) the following mutations were found: A1593T1, A1653G2, C1770T, C1954T1, and G1827C in isolates from Tumaco, and A2144G from Túquerres. The mutations T2183C, A2144G and C2196T in H. pylori isolates resistant to clarithromycin from Colombia are reported for the first time. No association between the H. pylori mutations and in vitro clarithromycin resistance was found. However, therapeutic failure of eradication treatment was associated with mutations of 23S rRNA gene in clarithromycin-resistant H. pylori (κ = 0.71). CONCLUSION The therapeutic failure of eradication treatment in the two populations from Colombia was associated with mutations of the 23S rRNA gene in clarithromycin-resistant H. pylori. PMID:29662291

  5. Pancreatic Agenesis due to Compound Heterozygosity for a Novel Enhancer and Truncating Mutation in the PTF1A Gene.

    PubMed

    Gabbay, Monica; Ellard, Sian; De Franco, Elisa; Moisés, Regina S

    2017-09-01

    Neonatal diabetes, defined as the onset of diabetes within the first six months of life, is very rarely caused by pancreatic agenesis. Homozygous truncating mutations in the PTF1A gene, which encodes a transcriptional factor, have been reported in patients with pancreatic and cerebellar agenesis, whilst mutations located in a distal pancreatic-specific enhancer cause isolated pancreatic agenesis. We report an infant, born to healthy non-consanguineous parents, with neonatal diabetes due to pancreatic agenesis. Initial genetic investigation included sequencing of KCNJ11, ABCC8 and INS genes, but no mutations were found. Following this, 22 neonatal diabetes associated genes were analyzed by a next generation sequencing assay. We found compound heterozygous mutations in the PTF1A gene: A frameshift mutation in exon 1 (c.437_462 del, p.Ala146Glyfs*116) and a mutation affecting a highly conserved nucleotide within the distal pancreatic enhancer (g.23508442A>G). Both mutations were confirmed by Sanger sequencing. Isolated pancreatic agenesis resulting from compound heterozygosity for truncating and enhancer mutations in the PTF1A gene has not been previously reported. This report broadens the spectrum of mutations causing pancreatic agenesis.

  6. Pancreatic Agenesis due to Compound Heterozygosity for a Novel Enhancer and Truncating Mutation in the PTF1A Gene

    PubMed Central

    Gabbay, Monica; Ellard, Sian; De Franco, Elisa; Moisés, Regina S.

    2017-01-01

    Neonatal diabetes, defined as the onset of diabetes within the first six months of life, is very rarely caused by pancreatic agenesis. Homozygous truncating mutations in the PTF1A gene, which encodes a transcriptional factor, have been reported in patients with pancreatic and cerebellar agenesis, whilst mutations located in a distal pancreatic-specific enhancer cause isolated pancreatic agenesis. We report an infant, born to healthy non-consanguineous parents, with neonatal diabetes due to pancreatic agenesis. Initial genetic investigation included sequencing of KCNJ11, ABCC8 and INS genes, but no mutations were found. Following this, 22 neonatal diabetes associated genes were analyzed by a next generation sequencing assay. We found compound heterozygous mutations in the PTF1A gene: A frameshift mutation in exon 1 (c.437_462 del, p.Ala146Glyfs*116) and a mutation affecting a highly conserved nucleotide within the distal pancreatic enhancer (g.23508442A>G). Both mutations were confirmed by Sanger sequencing. Isolated pancreatic agenesis resulting from compound heterozygosity for truncating and enhancer mutations in the PTF1A gene has not been previously reported. This report broadens the spectrum of mutations causing pancreatic agenesis. PMID:28663161

  7. ABCD syndrome is caused by a homozygous mutation in the EDNRB gene.

    PubMed

    Verheij, Joke B G M; Kunze, Jürgen; Osinga, Jan; van Essen, Anthonie J; Hofstra, Robert M W

    2002-03-15

    ABCD syndrome is an autosomal recessive syndrome characterized by albinism, black lock, cell migration disorder of the neurocytes of the gut (Hirschsprung disease [HSCR]), and deafness. This phenotype clearly overlaps with the features of the Shah-Waardenburg syndrome, comprising sensorineural deafness; hypopigmentation of skin, hair, and irides; and HSCR. Therefore, we screened DNA of the index patient of the ABCD syndrome family for mutations in the endothelin B receptor (EDNRB) gene, a gene known to be involved in Shah-Waardenburg syndrome. A homozygous nonsense mutation in exon 3 (R201X) of the EDNRB gene was found. We therefore suggest that ABCD syndrome is not a separate entity, but an expression of Shah-Waardenburg syndrome.

  8. Novel mutations in the TULP1 gene causing autosomal recessive retinitis pigmentosa.

    PubMed

    Paloma, E; Hjelmqvist, L; Bayés, M; García-Sandoval, B; Ayuso, C; Balcells, S; Gonzàlez-Duarte, R

    2000-03-01

    To assess the contribution of TULP1 to autosomal recessive retinitis pigmentosa (arRP). Fifteen exons of the gene were screened by single-strand conformation polymorphism analysis of 7 (of 49) arRP pedigrees showing cosegregation with TULP1 locus markers. In one of the seven families two allelic mutations, IVS4-2delAGA and c.937delC, were found in exons 5 and 10, respectively. Two novel mutations in TULP1 were found to be associated with arRP. That they both compromise the gene product supports their pathogenicity. This gene was present in no more than 2% of a panel of 49 Spanish families affected by arRP.

  9. Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia.

    PubMed

    Costa, M C; Helweg-Larsen, J; Lundgren, Bettina; Antunes, F; Matos, O

    2003-11-01

    The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure. These results are consistent with the possibility of an incidental acquisition and transmission of P. jiroveci mutant types, either by person to person transmission or from an environmental source.

  10. Mutation analysis of the p53, APC, and p16 genes in the Barrett's oesophagus, dysplasia, and adenocarcinoma.

    PubMed Central

    González, M V; Artímez, M L; Rodrigo, L; López-Larrea, C; Menéndez, M J; Alvarez, V; Pérez, R; Fresno, M F; Pérez, M J; Sampedro, A; Coto, E

    1997-01-01

    AIMS: To study the loss of heterozygosity and the presence of mutations at the p53, p16/CDKN2, and APC genes in Barrett's oesophagus, low grade dysplastic oesophageal epithelium, and adenocarcinoma of the oesophagus; to relate the presence of alterations at these genes with the progression from Barrett's oesophagus to adenocarcinoma. METHODS: DNA was extracted from paraffin blocks containing tissue from Barrett's oesophagus (12 samples), low grade dysplasia (15 cases), and adenocarcinoma (14 cases). Loss of heterozygosity (LOH) at the p53, p16, and APC genes was determined by comparing the autoradiographic patterns of several microsatellite markers between the normal tissue and the malignant tissue counterpart. SSCP was used to determine the presence of mutations at p53 (exons 5 to 8), p16 (exon 2), and APC. Homozygous deletion of the p16 gene was defined through polymerase chain reaction followed by Southern blot. RESULTS: LOH at the p53, p16, and APC genes was not observed in Barrett's oesophagus without dysplasia, and increased to 90% (p53), 89% (p16), and 60% (APC) in the adenocarcinomas. The p53 gene was mutated in only two adenocarcinomas (codons 175 and 245). In one case a mutation at the APC gene (codon 1297) was found. No patient had mutation at the second exon of p16. However, this gene was homozygously deleted in three of the 12 adenocarcinomas. CONCLUSIONS: The tumour suppressor genes p53, p16, and APC are often deleted in adenocarcinomas derived from Barrett's oesophagus. Mutations at these genes are also found in the adenocarcinomas, including the homozygous deletion of the p16 gene. However, the absence of genetic alterations in the Barrett's oesophagus and the low grade dysplastic epithelia suggest that mutations at these genes develop later in the progression from Barrett's oesophagus to adenocarcinoma. Images PMID:9155671

  11. Cloning of the neurodegeneration gene drop-dead and characterization of additional phenotypes of its mutation.

    PubMed

    Blumenthal, Edward M

    2008-01-01

    Mutations in the Drosophila gene drop-dead (drd) result in early adult lethality and neurodegeneration, but the molecular identity of the drd gene and its mechanism of action are not known. This paper describes the characterization of a new X-linked recessive adult-lethal mutation, originally called lot's wife (lwf(1)) but subsequently identified as an allele of drd (drd(lwf)); drd(lwf) mutants die within two weeks of eclosion. Through mapping and complementation, the drd gene has been identified as CG33968, which encodes a putative integral membrane protein of unknown function. The drd(lwf) allele is associated with a nonsense mutation that eliminates nearly 80% of the CG33968 gene product; mutations in the same gene were also found in two previously described drd alleles. Characterization of drd (lwf) flies revealed additional phenotypes of drd, most notably, defects in food processing by the digestive system and in oogenesis. Mutant flies store significantly more food in their crops and defecate less than wild-type flies, suggesting that normal transfer of ingested food from the crop into the midgut is dependent upon the DRD gene product. The defect in oogenesis results in the sterility of homozygous mutant females and is associated with a reduction in the number of vitellogenic egg chambers. The disruption in vitellogenesis is far more severe than that seen in starved flies and so is unlikely to be a secondary consequence of the digestive phenotype. This study demonstrates that mutation of the drd gene CG33968 results in a complex phenotype affecting multiple physiological systems within the fly.

  12. Association of HFE gene mutations with nonalcoholic fatty liver disease in the Iranian population.

    PubMed

    Saremi, L; Lotfipanah, S; Mohammadi, M; Hosseinzadeh, H; Sayad, A; Saltanatpour, Z

    2016-10-31

    To determine whether the HFE gene variants H63D and C282Y are associated with NAFLD in persons with type 2 diabetes, we conducted a case-control study including 145 case of NAFLD patients with a history of type 2 diabetes and 145 matching control. The genomic DNA was extracted from the peripheral venous blood and the genotyping of HFE gene mutations was analyzed using the PCR-RFLP technique. Statistical analysis was performed using SPSS 12.0 software by χ2 test, t test and ANOVA (P<0.05). Data showed no increased frequency of HFE mutations in persons with type 2 diabetes and no association between H63D mutation and NAFLD in the study population. Also, we analyzed index of physiological variables including FBS, lipid profile (TC, TG, LDL-C, and HDL-C), BMI, HbA1c, and micro albuminuria and Cr levels). Data showed there are no relationship between these indexes and HFE gene mutations and either NAFLD as a complication of diabetes. But our results showed a relationship between C282Y mutation and NAFLD in persons with type 2 diabetes. C282Y mutation might be a genetic marker of NAFLD in Iranian population.

  13. Mutations in the collagen XII gene define a new form of extracellular matrix-related myopathy.

    PubMed

    Hicks, Debbie; Farsani, Golara Torabi; Laval, Steven; Collins, James; Sarkozy, Anna; Martoni, Elena; Shah, Ashoke; Zou, Yaqun; Koch, Manuel; Bönnemann, Carsten G; Roberts, Mark; Lochmüller, Hanns; Bushby, Kate; Straub, Volker

    2014-05-01

    Bethlem myopathy (BM) [MIM 158810] is a slowly progressive muscle disease characterized by contractures and proximal weakness, which can be caused by mutations in one of the collagen VI genes (COL6A1, COL6A2 and COL6A3). However, there may be additional causal genes to identify as in ∼50% of BM cases no mutations in the COL6 genes are identified. In a cohort of -24 patients with a BM-like phenotype, we first sequenced 12 candidate genes based on their function, including genes for known binding partners of collagen VI, and those enzymes involved in its correct post-translational modification, assembly and secretion. Proceeding to whole-exome sequencing (WES), we identified mutations in the COL12A1 gene, a member of the FACIT collagens (fibril-associated collagens with interrupted triple helices) in five individuals from two families. Both families showed dominant inheritance with a clinical phenotype resembling classical BM. Family 1 had a single-base substitution that led to the replacement of one glycine residue in the triple-helical domain, breaking the Gly-X-Y repeating pattern, and Family 2 had a missense mutation, which created a mutant protein with an unpaired cysteine residue. Abnormality at the protein level was confirmed in both families by the intracellular retention of collagen XII in patient dermal fibroblasts. The mutation in Family 2 leads to the up-regulation of genes associated with the unfolded protein response (UPR) pathway and swollen, dysmorphic rough-ER. We conclude that the spectrum of causative genes in extracellular matrix (ECM)-related myopathies be extended to include COL12A1.

  14. Chronic Granulomatous Disease Due to Neutrophil Cytosolic Factor (NCF2) Gene Mutations in Three Unrelated Families.

    PubMed

    Vignesh, Pandiarajan; Rawat, Amit; Kumar, Ankur; Suri, Deepti; Gupta, Anju; Lau, Yu L; Chan, Koon W; Singh, Surjit

    2017-02-01

    Chronic granulomatous disease (CGD) is an inheritable and genetically heterogeneous disease resulting from mutations in different subcomponents of the NADPH oxidase system. Mutations in the NCF2 gene account for <5% of all cases of CGD. We analyzed the clinical and laboratory findings of CGD with mutations in the NCF2 gene from amongst our cohort of CGD patients. A homozygous mutation (c.835_836delAC, p.T279fsX294), a deletion in NCF2 gene was found in two cases. In the third case, two heterozygous mutations were detected, IVS13-2A>T on one allele and c.1099C>T (p.) on the other allele. The mother of this child was a carrier for the IVS13-2A>T mutation. All three cases had colitis, and it was the initial symptom in two patients. One of the patients also developed a lung abscess due to Nocardia cyriacigeorgica.

  15. HOGA1 Gene Mutations of Primary Hyperoxaluria Type 3 in Tunisian Patients.

    PubMed

    M'dimegh, Saoussen; Aquaviva-Bourdain, Cécile; Omezzine, Asma; Souche, Geneviéve; M'barek, Ibtihel; Abidi, Kamel; Gargah, Tahar; Abroug, Saoussen; Bouslama, Ali

    2017-05-01

    Primary hyperoxaluria type 3 (PH3) is due to mutations in the recently identified 4-hydroxy-2-oxoglutarate aldolase (HOGA1) gene. PH3 might be the least severe form with a milder phenotype with good preservation of kidney function in most patients. The aim of this study was to report three PH3 cases carrying mutations in HOGA1. Genetic analysis of HOGA1 was performed in patients with a high clinical suspicion of PH after sequencing of AGXT and GRHPR genes, which was negative. Also, a complete AGXT/GRHPR MLPA was performed in these patients in order to detect large deletions/insertions. Two different HOGA1 gene mutations were identified: the p.Pro190Leu in a homozygous state and the p.Gly287Val in two patients in homozygous and heterozygous carriers. The median age at onset of clinical symptoms was 3.93 years. Most of the patients had a positive family history for recurrent urolithiasis. The p.Pro190Leu mutation was reported with impaired renal function at follow-up; however, the p.Gly287Val was presented with normal renal function. All patients were presented with urolithiasis, but only one had a nephrocalcinosis. This study expanded the number of PH3 patients from 63 to 66 cases. The p.Pro190Leu and the p.Gly287Val mutations found in this study can provide a first-line investigation in Tunisian PH1 patients. © 2016 Wiley Periodicals, Inc.

  16. A common FGFR3 gene mutation is present in achondroplasia but not in hypochondroplasia.

    PubMed

    Stoilov, I; Kilpatrick, M W; Tsipouras, P

    1995-01-02

    Achondroplasia is the most common type of genetic dwarfism. It is characterized by disproportionate short stature and other skeletal anomalies resulting from a defect in the maturation of the chondrocytes in the growth plate of the cartilage. Recent studies mapped the achondroplasia gene on chromosome region 4p16.3 and identified a common mutation in the gene encoding the fibroblast growth factor receptor 3 (FGFR3). In an analysis of 19 achondroplasia families from a variety of ethnic backgrounds we confirmed the presence of the G380R mutation in 21 of 23 achondroplasia chromosomes studied. In contrast, the G380R mutation was not found in any of the 8 hypochondroplasia chromosomes studied. Furthermore, linkage studies in a 3-generation family with hypochondroplasia show discordant segregation with markers in the 4p16.3 region suggesting that at least some cases of hypochondroplasia are caused by mutations in a gene other than FGFR3.

  17. Automated DNA mutation detection using universal conditions direct sequencing: application to ten muscular dystrophy genes

    PubMed Central

    2009-01-01

    Background One of the most common and efficient methods for detecting mutations in genes is PCR amplification followed by direct sequencing. Until recently, the process of designing PCR assays has been to focus on individual assay parameters rather than concentrating on matching conditions for a set of assays. Primers for each individual assay were selected based on location and sequence concerns. The two primer sequences were then iteratively adjusted to make the individual assays work properly. This generally resulted in groups of assays with different annealing temperatures that required the use of multiple thermal cyclers or multiple passes in a single thermal cycler making diagnostic testing time-consuming, laborious and expensive. These factors have severely hampered diagnostic testing services, leaving many families without an answer for the exact cause of a familial genetic disease. A search of GeneTests for sequencing analysis of the entire coding sequence for genes that are known to cause muscular dystrophies returns only a small list of laboratories that perform comprehensive gene panels. The hypothesis for the study was that a complete set of universal assays can be designed to amplify and sequence any gene or family of genes using computer aided design tools. If true, this would allow automation and optimization of the mutation detection process resulting in reduced cost and increased throughput. Results An automated process has been developed for the detection of deletions, duplications/insertions and point mutations in any gene or family of genes and has been applied to ten genes known to bear mutations that cause muscular dystrophy: DMD; CAV3; CAPN3; FKRP; TRIM32; LMNA; SGCA; SGCB; SGCG; SGCD. Using this process, mutations have been found in five DMD patients and four LGMD patients (one in the FKRP gene, one in the CAV3 gene, and two likely causative heterozygous pairs of variations in the CAPN3 gene of two other patients). Methods and assay

  18. Automated DNA mutation detection using universal conditions direct sequencing: application to ten muscular dystrophy genes.

    PubMed

    Bennett, Richard R; Schneider, Hal E; Estrella, Elicia; Burgess, Stephanie; Cheng, Andrew S; Barrett, Caitlin; Lip, Va; Lai, Poh San; Shen, Yiping; Wu, Bai-Lin; Darras, Basil T; Beggs, Alan H; Kunkel, Louis M

    2009-10-18

    One of the most common and efficient methods for detecting mutations in genes is PCR amplification followed by direct sequencing. Until recently, the process of designing PCR assays has been to focus on individual assay parameters rather than concentrating on matching conditions for a set of assays. Primers for each individual assay were selected based on location and sequence concerns. The two primer sequences were then iteratively adjusted to make the individual assays work properly. This generally resulted in groups of assays with different annealing temperatures that required the use of multiple thermal cyclers or multiple passes in a single thermal cycler making diagnostic testing time-consuming, laborious and expensive.These factors have severely hampered diagnostic testing services, leaving many families without an answer for the exact cause of a familial genetic disease. A search of GeneTests for sequencing analysis of the entire coding sequence for genes that are known to cause muscular dystrophies returns only a small list of laboratories that perform comprehensive gene panels.The hypothesis for the study was that a complete set of universal assays can be designed to amplify and sequence any gene or family of genes using computer aided design tools. If true, this would allow automation and optimization of the mutation detection process resulting in reduced cost and increased throughput. An automated process has been developed for the detection of deletions, duplications/insertions and point mutations in any gene or family of genes and has been applied to ten genes known to bear mutations that cause muscular dystrophy: DMD; CAV3; CAPN3; FKRP; TRIM32; LMNA; SGCA; SGCB; SGCG; SGCD. Using this process, mutations have been found in five DMD patients and four LGMD patients (one in the FKRP gene, one in the CAV3 gene, and two likely causative heterozygous pairs of variations in the CAPN3 gene of two other patients). Methods and assay sequences are reported in

  19. Spectrum of mismatch repair gene mutations and clinical presentation of Hispanic individuals with Lynch syndrome.

    PubMed

    Sunga, Annette Y; Ricker, Charité; Espenschied, Carin R; Castillo, Danielle; Melas, Marilena; Herzog, Josef; Bannon, Sarah; Cruz-Correa, Marcia; Lynch, Patrick; Solomon, Ilana; Gruber, Stephen B; Weitzel, Jeffrey N

    2017-04-01

    Lynch syndrome (LS), the most common hereditary colorectal cancer syndrome, is caused by mismatch repair (MMR) gene mutations. However, data about MMR mutations in Hispanics are limited. This study aims to describe the spectrum of MMR mutations in Hispanics with LS and explore ancestral origins. This case series involved an IRB-approved retrospective chart review of self-identified Hispanic patients (n = 397) seen for genetic cancer risk assessment at four collaborating academic institutions in California, Texas, and Puerto Rico who were evaluated by MMR genotyping and/or tumor analysis. A literature review was conducted for all mutations identified. Of those who underwent clinical genetic testing (n = 176), 71 had MMR gene mutations. Nine mutations were observed more than once. One third (3/9) of recurrent mutations and two additional mutations (seen only once) were previously reported in Spain, confirming the influence of Spanish ancestry on MMR mutations in Hispanic populations. The recurrent mutations identified (n = 9) included both previously reported mutations as well as unique mutations not in the literature. This is the largest report of Hispanic MMR mutations in North America; however, a larger sample and haplotype analyses are needed to better understand recurrent MMR mutations in Hispanic populations. Copyright © 2017. Published by Elsevier Inc.

  20. Expression of inflammation-related genes in aldosterone-producing adenomas with KCNJ5 mutation.

    PubMed

    Murakami, Masanori; Yoshimoto, Takanobu; Nakano, Yujiro; Tsuchiya, Kyoichiro; Minami, Isao; Bouchi, Ryotaro; Fujii, Yasuhisa; Nakabayashi, Kazuhiko; Hashimoto, Koshi; Hata, Ken-Ichiro; Kihara, Kazunori; Ogawa, Yoshihiro

    2016-08-05

    The adrenocortical cells have been shown to produce various inflammatory cytokines such as TNFα and IL-6, which could modulate steroidogenesis. However, the role of inflammatory cytokines in aldosterone-producing adenomas (APAs) is not fully understood. In the present study, we examined the relationships between mRNA expression levels of the inflammation-related genes and somatic mutations in APA tissues. We evaluated mRNA expression levels of TNFA, IL6, and NFKB1 in APA tissues obtained from 44 Japanese APA patients. We revealed that mRNA expression patterns of the inflammation-related genes depended on a KCNJ5 somatic mutation. In addition, we showed that mRNA expression levels of the inflammation-related genes correlated with those of the steroidogenic enzyme CYP11B1 in the patients with APAs. The present study documented for the first time the expression of inflammation-related genes in APAs and the correlation of their expression levels with the KCNJ5 mutation status and mRNA expression levels of steroidogenic enzymes, indicating the pathophysiological relevance of inflammation-related genes in APAs. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Cellular context-dependent consequences of Apc mutations on gene regulation and cellular behavior.

    PubMed

    Hashimoto, Kyoichi; Yamada, Yosuke; Semi, Katsunori; Yagi, Masaki; Tanaka, Akito; Itakura, Fumiaki; Aoki, Hitomi; Kunisada, Takahiro; Woltjen, Knut; Haga, Hironori; Sakai, Yoshiharu; Yamamoto, Takuya; Yamada, Yasuhiro

    2017-01-24

    The spectrum of genetic mutations differs among cancers in different organs, implying a cellular context-dependent effect for genetic aberrations. However, the extent to which the cellular context affects the consequences of oncogenic mutations remains to be fully elucidated. We reprogrammed colon tumor cells in an Apc Min/+ (adenomatous polyposis coli) mouse model, in which the loss of the Apc gene plays a critical role in tumor development and subsequently, established reprogrammed tumor cells (RTCs) that exhibit pluripotent stem cell (PSC)-like signatures of gene expression. We show that the majority of the genes in RTCs that were affected by Apc mutations did not overlap with the genes affected in the intestine. RTCs lacked pluripotency but exhibited an increased expression of Cdx2 and a differentiation propensity that was biased toward the trophectoderm cell lineage. Genetic rescue of the mutated Apc allele conferred pluripotency on RTCs and enabled their differentiation into various cell types in vivo. The redisruption of Apc in RTC-derived differentiated cells resulted in neoplastic growth that was exclusive to the intestine, but the majority of the intestinal lesions remained as pretumoral microadenomas. These results highlight the significant influence of cellular context on gene regulation, cellular plasticity, and cellular behavior in response to the loss of the Apc function. Our results also imply that the transition from microadenomas to macroscopic tumors is reprogrammable, which underscores the importance of epigenetic regulation on tumor promotion.

  2. Cellular context-dependent consequences of Apc mutations on gene regulation and cellular behavior

    PubMed Central

    Hashimoto, Kyoichi; Yamada, Yosuke; Semi, Katsunori; Yagi, Masaki; Tanaka, Akito; Itakura, Fumiaki; Aoki, Hitomi; Kunisada, Takahiro; Woltjen, Knut; Haga, Hironori; Sakai, Yoshiharu; Yamamoto, Takuya; Yamada, Yasuhiro

    2017-01-01

    The spectrum of genetic mutations differs among cancers in different organs, implying a cellular context-dependent effect for genetic aberrations. However, the extent to which the cellular context affects the consequences of oncogenic mutations remains to be fully elucidated. We reprogrammed colon tumor cells in an ApcMin/+ (adenomatous polyposis coli) mouse model, in which the loss of the Apc gene plays a critical role in tumor development and subsequently, established reprogrammed tumor cells (RTCs) that exhibit pluripotent stem cell (PSC)-like signatures of gene expression. We show that the majority of the genes in RTCs that were affected by Apc mutations did not overlap with the genes affected in the intestine. RTCs lacked pluripotency but exhibited an increased expression of Cdx2 and a differentiation propensity that was biased toward the trophectoderm cell lineage. Genetic rescue of the mutated Apc allele conferred pluripotency on RTCs and enabled their differentiation into various cell types in vivo. The redisruption of Apc in RTC-derived differentiated cells resulted in neoplastic growth that was exclusive to the intestine, but the majority of the intestinal lesions remained as pretumoral microadenomas. These results highlight the significant influence of cellular context on gene regulation, cellular plasticity, and cellular behavior in response to the loss of the Apc function. Our results also imply that the transition from microadenomas to macroscopic tumors is reprogrammable, which underscores the importance of epigenetic regulation on tumor promotion. PMID:28057861

  3. Usefulness of BCOR gene mutation as a prognostic factor in acute myeloid leukemia with intermediate cytogenetic prognosis.

    PubMed

    Terada, Kazuki; Yamaguchi, Hiroki; Ueki, Toshimitsu; Usuki, Kensuke; Kobayashi, Yutaka; Tajika, Kenji; Gomi, Seiji; Kurosawa, Saiko; Saito, Riho; Furuta, Yutaka; Miyadera, Keiki; Tokura, Taichiro; Marumo, Atushi; Omori, Ikuko; Sakaguchi, Masahiro; Fujiwara, Yusuke; Yui, Shunsuke; Ryotokuji, Takeshi; Arai, Kunihito; Kitano, Tomoaki; Wakita, Satoshi; Fukuda, Takahiro; Inokuchi, Koiti

    2018-04-16

    BCOR gene is a transcription regulatory factor that plays an essential role in normal hematopoiesis. The wider introduction of next-generation sequencing technology has led to reports in recent years of mutations in the BCOR gene in acute myeloid leukemia (AML), but the related clinical characteristics and prognosis are not sufficiently understood. We investigated the clinical characteristics and prognosis of 377 de novo AML cases with BCOR or BCORL1 mutation. BCOR or BCORL1 gene mutations were found in 28 cases (7.4%). Among cases aged 65 years or below that were also FLT3-ITD-negative and in the intermediate cytogenetic prognosis group, BCOR or BCORL1 gene mutations were observed in 11% of cases (12 of 111 cases), and this group had significantly lower 5-year overall survival (OS) (13.6% vs. 55.0%, P=0.0021) and relapse-free survival (RFS) (14.3% vs. 44.5%, P=0.0168) compared to cases without BCOR or BCORL1 gene mutations. Multivariate analysis demonstrated that BCOR mutations were an independent unfavorable prognostic factor (P=0.0038, P=0.0463) for both OS and RFS. In cases of AML that are FLT3-ITD-negative, aged 65 years or below, and in the intermediate cytogenetic prognosis group, which are considered to have relatively favorable prognosis, BCOR gene mutations appear to be an important prognostic factor. This article is protected by copyright. All rights reserved. © 2018 Wiley Periodicals, Inc.

  4. Mutations in the ABCA4 (ABCR) Gene Are the Major Cause of Autosomal Recessive Cone-Rod Dystrophy

    PubMed Central

    Maugeri, Alessandra; Klevering, B. Jeroen; Rohrschneider, Klaus; Blankenagel, Anita; Brunner, Han G.; Deutman, August F.; Hoyng, Carel B.; Cremers, Frans P. M.

    2000-01-01

    The photoreceptor cell–specific ATP-binding cassette transporter gene (ABCA4; previously denoted “ABCR”) is mutated in most patients with autosomal recessive (AR) Stargardt disease (STGD1) or fundus flavimaculatus (FFM). In addition, a few cases with AR retinitis pigmentosa (RP) and AR cone-rod dystrophy (CRD) have been found to have ABCA4 mutations. To evaluate the importance of the ABCA4 gene as a cause of AR CRD, we selected 5 patients with AR CRD and 15 patients with isolated CRD, all from Germany and The Netherlands . Single-strand conformation–polymorphism analysis and sequencing revealed 19 ABCA4 mutations in 13 (65%) of 20 patients. In six patients, mutations were identified in both ABCA4 alleles; in seven patients, mutations were detected in one allele. One complex ABCA4 allele (L541P;A1038V) was found exclusively in German patients with CRD; one patient carried this complex allele homozygously, and five others were compound heterozygous. These findings suggest that mutations in the ABCA4 gene are the major cause of AR CRD. A primary role of the ABCA4 gene in STGD1/FFM and AR CRD, together with the gene's involvement in an as-yet-unknown proportion of cases with AR RP, strengthens the idea that mutations in the ABCA4 gene could be the most frequent cause of inherited retinal dystrophy in humans. PMID:10958761

  5. Mutations of the EGFR, K-ras, EML4-ALK, and BRAF genes in resected pathological stage I lung adenocarcinoma.

    PubMed

    Ohba, Taro; Toyokawa, Gouji; Osoegawa, Atsushi; Hirai, Fumihiko; Yamaguchi, Masafumi; Taguchi, Ken-Ichi; Seto, Takashi; Takenoyama, Mitsuhiro; Ichinose, Yukito; Sugio, Kenji

    2016-09-01

    The EGFR, K-ras, EML4-ALK, and BRAF genes are oncogenic drivers of lung adenocarcinoma. We conducted this study to analyze the mutations of these genes in stage I adenocarcinoma. The subjects of this retrospective study were 256 patients with resected stage I lung adenocarcinoma. We analyzed mutations of the EGFR, K-ras, and BRAF genes, and the EML4-ALK fusion gene. We also assessed disease-free survival (DFS) to evaluate the prognostic value and overall survival (OS) to evaluate the predictive value of treatment after recurrence. Mutations of the EGFR, K-ras, EML4-ALK, and BRAF genes were detected in 120 (46.8 %), 14 (5.5 %), 6 (2.3 %), and 2 (0.8 %) of the 256 tumors. Two tumors had double mutations (0.8 %). The incidence of EGFR mutations was significantly higher in women than in men. The EML4-ALK fusion gene was detected only in younger patients. The DFS and OS of the K-ras mutant group were significantly worse than those of the EGFR mutant group, the EML4-ALK fusion gene group, and the wild-type group. Six of the seven patients with the EML4-ALK fusion gene are still alive without recurrent disease. In patients with stage I adenocarcinoma, mutation of the K-ras gene was a poor prognostic factor for recurrence. The presence of a mutation of the EGFR or EML4-ALK gene was not a prognostic factor.

  6. Leigh syndrome associated with mitochondrial complex I deficiency due to a novel mutation in the NDUFS1 gene.

    PubMed

    Martín, Miguel A; Blázquez, Alberto; Gutierrez-Solana, Luis G; Fernández-Moreira, Daniel; Briones, Paz; Andreu, Antoni L; Garesse, Rafael; Campos, Yolanda; Arenas, Joaquín

    2005-04-01

    Mutations in the nuclear-encoded subunits of complex I of the mitochondrial respiratory chain are a recognized cause of Leigh syndrome (LS). Recently, 6 mutations in the NDUFS1 gene were identified in 3 families. To describe a Spanish family with LS, complex I deficiency in muscle, and a novel mutation in the NDUFS1 gene. Using molecular genetic approaches, we identified the underlying molecular defect in a patient with LS with a complex I defect. The proband was a child who displayed the clinical features of LS. Muscle biochemistry results showed a complex I defect of the mitochondrial respiratory chain. Sequencing analysis of the mitochondrial DNA-encoded ND genes, the nuclear DNA-encoded NDUFV1, NDUFS1, NDUFS2, NDUFS4, NDUFS6, NDUFS7, NDUFS8, and NDUFAB1 genes, and the complex I assembly factor CIA30 gene revealed a novel homozygous L231V mutation (c.691C-->G) in the NDUFS1 gene. The parents were heterozygous carriers of the L231V mutation. Identifying nuclear mutations as a cause of respiratory chain disorders will enhance the possibility of prenatal diagnosis and help us understand how molecular defects can lead to complex I deficiency.

  7. An undergraduate laboratory class using CRISPR/Cas9 technology to mutate drosophila genes.

    PubMed

    Adame, Vanesa; Chapapas, Holly; Cisneros, Marilyn; Deaton, Carol; Deichmann, Sophia; Gadek, Chauncey; Lovato, TyAnna L; Chechenova, Maria B; Guerin, Paul; Cripps, Richard M

    2016-05-06

    CRISPR/Cas9 genome editing technology is used in the manipulation of genome sequences and gene expression. Because of the ease and rapidity with which genes can be mutated using CRISPR/Cas9, we sought to determine if a single-semester undergraduate class could be successfully taught, wherein students isolate mutants for specific genes using CRISPR/Cas9. Six students were each assigned a single Drosophila gene, for which no mutants currently exist. Each student designed and created plasmids to encode single guide RNAs that target their selected gene; injected the plasmids into Cas9-expressing embryos, in order to delete the selected gene; carried out a three-generation cross to test for germline transmission of a mutated allele and generate a stable stock of the mutant; and characterized the mutant alleles by PCR and sequencing. Three genes out of six were successfully mutated. Pre- and post- survey evaluations of the students in the class revealed that student attitudes towards their research competencies increased, although the changes were not statistically significant. We conclude that it is feasible to develop a laboratory genome editing class, to provide effective laboratory training to undergraduate students, and to generate mutant lines for use by the broader scientific community. © 2016 by The International Union of Biochemistry and Molecular Biology, 44:263-275, 2016. © 2016 The International Union of Biochemistry and Molecular Biology.

  8. Novel APC gene mutations associated with protein alteration in diffuse type gastric cancer.

    PubMed

    Ghatak, Souvik; Chakraborty, Payel; Sarkar, Sandeep Roy; Chowdhury, Biswajit; Bhaumik, Arup; Kumar, Nachimuthu Senthil

    2017-06-02

    The role of adenomatous polyposis coli (APC) gene in mitosis might be critical for regulation of genomic stability and chromosome segregation. APC gene mutations have been associated to have a role in colon cancer and since gastric and colon tumors share some common genetic lesions, it is relevant to investigate the role of APC tumor suppressor gene in gastric cancer. We investigated for somatic mutations in the Exons 14 and 15 of APC gene from 40 diffuse type gastric cancersamples. Rabbit polyclonal anti-APC antibody was used, which detects the wild-type APC protein and was recommended for detection of the respective protein in human tissues. Cell cycle analysis was done from tumor and adjacent normal tissue. APC immunoreactivity showed positive expression of the protein in stages I, II, III and negative expression in Stages III and IV. Two novel deleterious variations (g.127576C > A, g.127583C > T) in exon 14 sequence were found to generate stop codon (Y622* and Q625*)in the tumor samples. Due to the generation of stop codon, the APC protein might be truncated and all the regulatory features could be lost which has led to the down-regulation of protein expression. Our results indicate that aneuploidy might occurdue to the codon 622 and 625 APC-driven gastric tumorigenesis, in agreement with our cell cycle analysis. The APC gene function in mitosis and chromosomal stability might be lost and G1 might be arrested with high quantity of DNA in the S phase. Six missense somatic mutations in tumor samples were detected in exon 15 A-B, twoof which showed pathological and disease causing effects based on SIFT, Polyphen2 and SNPs & GO score and were not previously reported in the literature or the public mutation databases. The two novel pathological somatic mutations (g.127576C > A, g.127583C > T) in exon 14 might be altering the protein expression leading to development of gastric cancer in the study population. Our study showed that mutations in the APC

  9. Mutational screening in genes related with porto-pulmonary hypertension: An analysis of 6 cases.

    PubMed

    Pousada, Guillermo; Baloira, Adolfo; Valverde, Diana

    2017-04-07

    Portopulmonary hypertension (PPH) is a rare disease with a low incidence and without a clearly-identified genetic component. The aim of this work was to check genes and genetic modifiers related to pulmonary arterial hypertension in patients with PPH in order to clarify the molecular basis of the pathology. We selected a total of 6 patients with PPH and amplified the exonic regions and intronic flanking regions of the relevant genes and regions of interest of the genetic modifiers. Six patients diagnosed with PPH were analyzed and compared to 55 healthy individuals. Potentially-pathogenic mutations were identified in the analyzed genes of 5 patients. None of these mutations, which are highly conserved throughout evolution, were detected in the control patients nor different databases analyzed (1000 Genomes, ExAC and DECIPHER). After analyzing for genetic modifiers, we found different variations that could favor the onset of the disease. The genetic analysis carried out in this small cohort of patients with PPH revealed a large number of mutations, with the ENG gene showing the greatest mutational frequency. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.

  10. Computational screening of disease-associated mutations in OCA2 gene.

    PubMed

    Kamaraj, Balu; Purohit, Rituraj

    2014-01-01

    Oculocutaneous albinism type 2 (OCA2), caused by mutations of OCA2 gene, is an autosomal recessive disorder characterized by reduced biosynthesis of melanin pigment in the skin, hair, and eyes. The OCA2 gene encodes instructions for making a protein called the P protein. This protein plays a crucial role in melanosome biogenesis, and controls the eumelanin content in melanocytes in part via the processing and trafficking of tyrosinase which is the rate-limiting enzyme in melanin synthesis. In this study we analyzed the pathogenic effect of 95 non-synonymous single nucleotide polymorphisms reported in OCA2 gene using computational methods. We found R305W mutation as most deleterious and disease associated using SIFT, PolyPhen, PANTHER, PhD-SNP, Pmut, and MutPred tools. To understand the atomic arrangement in 3D space, the native and mutant (R305W) structures were modeled. Molecular dynamics simulation was conducted to observe the structural significance of computationally prioritized disease-associated mutation (R305W). Root-mean-square deviation, root-mean-square fluctuation, radius of gyration, solvent accessibility surface area, hydrogen bond (NH bond), trace of covariance matrix, eigenvector projection analysis, and density analysis results showed prominent loss of stability and rise in mutant flexibility values in 3D space. This study presents a well designed computational methodology to examine the albinism-associated SNPs.

  11. Study on the Evolution of Genes Mutation Related With Gastrointestinal Stromal Tumors

    ClinicalTrials.gov

    2012-01-05

    Full Gene Sequences of c-KIT、PDGFRA and DOG1 Are Analyzed With the Screening-sequencing Approach; Investigate the Characteristics and Variations Associated With the Different Gene Mutations of c-KIT、PDGFRA and DOG1 in GIST Patients

  12. Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease.

    PubMed

    Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo

    2017-11-01

    Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. We identified a novel missense variant (c.314C>A) located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND.

  13. Next-generation sequencing reveals a novel NDP gene mutation in a Chinese family with Norrie disease

    PubMed Central

    Huang, Xiaoyan; Tian, Mao; Li, Jiankang; Cui, Ling; Li, Min; Zhang, Jianguo

    2017-01-01

    Purpose: Norrie disease (ND) is a rare X-linked genetic disorder, the main symptoms of which are congenital blindness and white pupils. It has been reported that ND is caused by mutations in the NDP gene. Although many mutations in NDP have been reported, the genetic cause for many patients remains unknown. In this study, the aim is to investigate the genetic defect in a five-generation family with typical symptoms of ND. Methods: To identify the causative gene, next-generation sequencing based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members using Sanger sequencing. Results: We identified a novel missense variant (c.314C>A) located within the NDP gene. The mutation cosegregated within all affected individuals in the family and was not found in unaffected members. By happenstance, in this family, we also detected a known pathogenic variant of retinitis pigmentosa in a healthy individual. Conclusion: c.314C>A mutation of NDP gene is a novel mutation and broadens the genetic spectrum of ND. PMID:29133643

  14. The cld mutation: narrowing the critical chromosomal region and selecting candidate genes.

    PubMed

    Péterfy, Miklós; Mao, Hui Z; Doolittle, Mark H

    2006-10-01

    Combined lipase deficiency (cld) is a recessive, lethal mutation specific to the tw73 haplotype on mouse Chromosome 17. While the cld mutation results in lipase proteins that are inactive, aggregated, and retained in the endoplasmic reticulum (ER), it maps separately from the lipase structural genes. We have narrowed the gene critical region by about 50% using the tw18 haplotype for deletion mapping and a recombinant chromosome used originally to map cld with respect to the phenotypic marker tf. The region now extends from 22 to 25.6 Mbp on the wild-type chromosome, currently containing 149 genes and 50 expressed sequence tags (ESTs). To identify the affected gene, we have selected candidates based on their known role in associated biological processes, cellular components, and molecular functions that best fit with the predicted function of the cld gene. A secondary approach was based on differences in mRNA levels between mutant (cld/cld) and unaffected (+/cld) cells. Using both approaches, we have identified seven functional candidates with an ER localization and/or an involvement in protein maturation and folding that could explain the lipase deficiency, and six expression candidates that exhibit large differences in mRNA levels between mutant and unaffected cells. Significantly, two genes were found to be candidates with regard to both function and expression, thus emerging as the strongest candidates for cld. We discuss the implications of our mapping results and our selection of candidates with respect to other genes, deletions, and mutations occurring in the cld critical region.

  15. Genomic characterization of biliary tract cancers identifies driver genes and predisposing mutations.

    PubMed

    Wardell, Christopher P; Fujita, Masashi; Yamada, Toru; Simbolo, Michele; Fassan, Matteo; Karlic, Rosa; Polak, Paz; Kim, Jaegil; Hatanaka, Yutaka; Maejima, Kazuhiro; Lawlor, Rita T; Nakanishi, Yoshitsugu; Mitsuhashi, Tomoko; Fujimoto, Akihiro; Furuta, Mayuko; Ruzzenente, Andrea; Conci, Simone; Oosawa, Ayako; Sasaki-Oku, Aya; Nakano, Kaoru; Tanaka, Hiroko; Yamamoto, Yujiro; Michiaki, Kubo; Kawakami, Yoshiiku; Aikata, Hiroshi; Ueno, Masaki; Hayami, Shinya; Gotoh, Kunihito; Ariizumi, Shun-Ichi; Yamamoto, Masakazu; Yamaue, Hiroki; Chayama, Kazuaki; Miyano, Satoru; Getz, Gad; Scarpa, Aldo; Hirano, Satoshi; Nakamura, Toru; Nakagawa, Hidewaki

    2018-05-01

    Biliary tract cancers (BTCs) are clinically and pathologically heterogeneous and respond poorly to treatment. Genomic profiling can offer a clearer understanding of their carcinogenesis, classification and treatment strategy. We performed large-scale genome sequencing analyses on BTCs to investigate their somatic and germline driver events and characterize their genomic landscape. We analyzed 412 BTC samples from Japanese and Italian populations, 107 by whole-exome sequencing (WES), 39 by whole-genome sequencing (WGS), and a further 266 samples by targeted sequencing. The subtypes were 136 intrahepatic cholangiocarcinomas (ICCs), 101 distal cholangiocarcinomas (DCCs), 109 peri-hilar type cholangiocarcinomas (PHCs), and 66 gallbladder or cystic duct cancers (GBCs/CDCs). We identified somatic alterations and searched for driver genes in BTCs, finding pathogenic germline variants of cancer-predisposing genes. We predicted cell-of-origin for BTCs by combining somatic mutation patterns and epigenetic features. We identified 32 significantly and commonly mutated genes including TP53, KRAS, SMAD4, NF1, ARID1A, PBRM1, and ATR, some of which negatively affected patient prognosis. A novel deletion of MUC17 at 7q22.1 affected patient prognosis. Cell-of-origin predictions using WGS and epigenetic features suggest hepatocyte-origin of hepatitis-related ICCs. Deleterious germline mutations of cancer-predisposing genes such as BRCA1, BRCA2, RAD51D, MLH1, or MSH2 were detected in 11% (16/146) of BTC patients. BTCs have distinct genetic features including somatic events and germline predisposition. These findings could be useful to establish treatment and diagnostic strategies for BTCs based on genetic information. We here analyzed genomic features of 412 BTC samples from Japanese and Italian populations. A total of 32 significantly and commonly mutated genes were identified, some of which negatively affected patient prognosis, including a novel deletion of MUC17 at 7q22.1. Cell

  16. Slowly progressive retinitis pigmentosa caused by two novel mutations in the MAK gene.

    PubMed

    Gray, Joanna Monika; Orlans, Harry Otway; Shanks, Morag; Clouston, Penny; MacLaren, Robert Elvis

    2018-05-21

    The growing number of clinical trials currently underway for inherited retinal diseases has highlighted the importance of achieving a molecular diagnosis for all new cases presenting to hospital eye services. The male germ cell-associated kinase (MAK) gene encodes a cilium-associated protein selectively expressed in the retina and testis, and has recently been implicated in autosomal recessive retinitis pigmentosa (RP). Whole exome sequencing has previously identified a homozygous Alu insertion in probands with recessive RP and nonsense and missense mutations have also been reported. Here we describe two novel mutations in different alleles of the MAK gene in a 75-year-old British female, who had a clinical diagnosis of RP () with onset in the fourth decade and no relevant family history. The mutations were established through next generation sequencing of a panel of 111 genes associated with RP and RP-like phenotypes. Two novel null mutations were identified within the MAK gene. The first c.1195_1196delAC p.(Thr399fs), was a two base-pair deletion creating a frame-shift in exon 9 predicted to result in nonsense-mediated decay. The second, c.279-2A>G, involved the splice acceptor consensus site upstream of exon 4, predicted to lead to aberrant splicing. The natural history of this individual's RP is consistent with previously described MAK mutations, being significantly milder than that associated with other photoreceptor ciliopathies. We suggest inclusion of MAK as part of wider genetic testing in all individuals presenting with RP.

  17. D816 mutation of the KIT gene in core binding factor acute myeloid leukemia is associated with poorer prognosis than other KIT gene mutations.

    PubMed

    Yui, Shunsuke; Kurosawa, Saiko; Yamaguchi, Hiroki; Kanamori, Heiwa; Ueki, Toshimitsu; Uoshima, Nobuhiko; Mizuno, Ishikazu; Shono, Katsuhiro; Usuki, Kensuke; Chiba, Shigeru; Nakamura, Yukinori; Yanada, Masamitsu; Kanda, Junya; Tajika, Kenji; Gomi, Seiji; Fukunaga, Keiko; Wakita, Satoshi; Ryotokuji, Takeshi; Fukuda, Takahiro; Inokuchi, Koiti

    2017-10-01

    The clinical impact of KIT mutations in core binding factor acute myeloid leukemia (CBF-AML) is still unclear. In the present study, we analyzed the prognostic significance of each KIT mutation (D816, N822K, and other mutations) in Japanese patients with CBF-AML. We retrospectively analyzed 136 cases of CBF-AML that had gone into complete remission (CR). KIT mutations were found in 61 (45%) of the patients with CBF-AML. D816, N822K, D816 and N822K, and other mutations of the KIT gene were detected in 29 cases (21%), 20 cases (15%), 7 cases (5%), and 5 cases (4%), respectively. The rate of relapse-free survival (RFS) and overall survival (OS) in patients with D816 and with both D816 and N822K mutations was significantly lower than in patients with other or with no KIT mutations (RFS: p < 0.001, OS: p < 0.001). Moreover, stratified analysis of the chromosomal abnormalities t(8;21)(q22;q22) and inv(16)(p13.1q22), t(16;16)(p13.1;q22) showed that D816 mutation was associated with a significantly worse prognosis. In a further multivariate analysis of RFS and OS, D816 mutation was found to be an independent risk factor for significantly poorer prognosis. In the present study, we were able to establish that, of all KIT mutations, D816 mutation alone is an unfavorable prognostic factor.

  18. Aldosterone-stimulating somatic gene mutations are common in normal adrenal glands

    PubMed Central

    Nishimoto, Koshiro; Tomlins, Scott A.; Kuick, Rork; Cani, Andi K.; Giordano, Thomas J.; Hovelson, Daniel H.; Liu, Chia-Jen; Sanjanwala, Aalok R.; Edwards, Michael A.; Gomez-Sanchez, Celso E.; Nanba, Kazutaka; Rainey, William E.

    2015-01-01

    Primary aldosteronism (PA) represents the most common cause of secondary hypertension, but little is known regarding its adrenal cellular origins. Recently, aldosterone-producing cell clusters (APCCs) with high expression of aldosterone synthase (CYP11B2) were found in both normal and PA adrenal tissue. PA-causing aldosterone-producing adenomas (APAs) harbor mutations in genes encoding ion channels/pumps that alter intracellular calcium homeostasis and cause renin-independent aldosterone production through increased CYP11B2 expression. Herein, we hypothesized that APCCs have APA-related aldosterone-stimulating somatic gene mutations. APCCs were studied in 42 normal adrenals from kidney donors. To clarify APCC molecular characteristics, we used microarrays to compare the APCC transcriptome with conventional adrenocortical zones [zona glomerulosa (ZG), zona fasciculata, and zona reticularis]. The APCC transcriptome was most similar to ZG but with an enhanced capacity to produce aldosterone. To determine if APCCs harbored APA-related mutations, we performed targeted next generation sequencing of DNA from 23 APCCs and adjacent normal adrenal tissue isolated from both formalin-fixed, paraffin-embedded, and frozen tissues. Known aldosterone driver mutations were identified in 8 of 23 (35%) APCCs, including mutations in calcium channel, voltage-dependent, L-type, α1D-subunit (CACNA1D; 6 of 23 APCCs) and ATPase, Na+/K+ transporting, α1-polypeptide (ATP1A1; 2 of 23 APCCs), which were not observed in the adjacent normal adrenal tissue. Overall, we show three major findings: (i) APCCs are common in normal adrenals, (ii) APCCs harbor somatic mutations known to cause excess aldosterone production, and (iii) the mutation spectrum of aldosterone-driving mutations is different in APCCs from that seen in APA. These results provide molecular support for APCC as a precursor of PA. PMID:26240369

  19. Mutation analysis of the STRA6 gene in isolated and non-isolated anophthalmia/microphthalmia.

    PubMed

    Chassaing, N; Ragge, N; Kariminejad, A; Buffet, A; Ghaderi-Sohi, S; Martinovic, J; Calvas, P

    2013-03-01

    PDAC syndrome [Pulmonary hypoplasia/agenesis, Diaphragmatic hernia/eventration, Anophthalmia/microphthalmia (A/M) and Cardiac Defect] is a condition associated with recessive mutations in the STRA6 gene in some of these patients. Recently, cases with isolated anophthalmia have been associated with STRA6 mutations. To determine the minimal findings associated with STRA6 mutations, we performed mutation analysis of the STRA6 gene in 28 cases with anophthalmia. In 7 of the cases the anophthalmia was isolated, in 14 cases it was associated with one of the major features included in PDAC and 7 had other abnormalities. Mutations were identified in two individuals: one with bilateral anophthalmia and some features included in PDAC, who was a compound heterozygote for a missense mutation and a large intragenic deletion, and the second case with all the major features of PDAC and who had a homozygous splicing mutation. This study suggests that STRA6 mutations are more likely to be identified in individuals with A/M and other abnormalities included in the PDAC spectrum, rather than in isolated A/M cases. © 2012 John Wiley & Sons A/S.

  20. Mutations and amplification of EPSPS gene confer resistance to glyphosate in goosegrass (Eleusine indica).

    PubMed

    Chen, Jingchao; Huang, Hongjuan; Zhang, Chaoxian; Wei, Shouhui; Huang, Zhaofeng; Chen, Jinyi; Wang, Xu

    2015-10-01

    Field-evolved resistance of goosegrass to glyphosate is due to double or single mutation in EPSPS , or amplification of EPSPS leads to increased transcription and protein levels. Glyphosate has been used widely in the south of China. The high selection pressure from glyphosate use has led to the evolution of resistance to glyphosate in weeds. We investigated the molecular mechanisms of three recently discovered glyphosate-resistant Eleusine indica populations (R1, R2 and R3). The results showed that R1 and R2 had double Thr102Ile and Pro106Ser mutation and a single mutation of Pro106Leu in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene, respectively. Escherichia coli containing the mutated EPSPS genes was tolerant to glyphosate. EPSPS activity in R1 and R2 plants was higher than in the sensitive plants. There was no amino acid substitution in EPSPS gene in R3. However, expression of EPSPS in R3 plants was higher than in glyphosate-susceptible (S) population (13.8-fold) after glyphosate treatment. EPSPS enzyme activity in both R3 and S plants was inhibited by glyphosate, while shikimate accumulation in R3 was significantly lower than for the S population. Further analysis revealed that the genome of R3 contained 28.3-fold more copies of the EPSPS gene than that of susceptible population. EPSPS expression was positively correlated with copy number of EPSPS. In conclusion, mutation of the EPSPS gene and increased EPSPS expression are part of the molecular mechanisms of resistance to glyphosate in Eleusine indica.