Science.gov

Sample records for hcmv ie1 exon4

  1. A fusion protein of HCMV IE1 exon4 and IE2 exon5 stimulates potent cellular immunity in an MVA vaccine vector

    SciTech Connect

    Wang, Z.; Zhou, W.; Srivastava, T.; La Rosa, C.; Mandarino, A.; Forman, S.J.; Zaia, J.A.; Britt, W.J.; Diamond, D.J.

    2008-08-01

    A therapeutic CMV vaccine incorporating an antigenic repertoire capable of eliciting a cellular immune response has yet to be successfully implemented for patients who already have acquired an infection. To address this problem, we have developed a vaccine candidate derived from modified vaccinia Ankara (MVA) that expresses three immunodominant antigens (pp65, IE1, IE2) from CMV. The novelty of this vaccine is the fusion of two adjacent exons from the immediate-early region of CMV, their successful expression in MVA, and robust immunogenicity in both primary and memory response models. Evaluation of the immunogenicity of the viral vaccine in mouse models shows that it can stimulate primary immunity against all three antigens in both the CD4{sup +} and CD8{sup +} T cell subsets. Evaluation of human PBMC from healthy CMV-positive donors or patients within 6 months of receiving hematopoietic cell transplant shows robust stimulation of existing CMV-specific CD4{sup +} and CD8{sup +} T cell subsets.

  2. Exon4 Amelogenin Transcripts in Enamel Biomineralization

    PubMed Central

    Stahl, J.; Nakano, Y.; Horst, J.; Zhu, L.; Le, M.; Zhang, Y.; Liu, H.; Li, W.

    2015-01-01

    Amelogenins are proteins formed by alternative splicing of the amelogenin gene, and are essential for tooth enamel formation. However, the unique functions of various alternatively spliced amelogenins in enamel formation are not well understood. In this study, we determined the spatiotemporal location of amelogenins derived from transcripts containing exon4 (AMG+4) in the enamel matrix, and the relative binding of recombinant AMG+4 to hydroxyapatite (HAP). Immunohistochemistry and mass spectrometry analyses showed that AMG+4 proteins were secreted into the enamel matrix at the early maturation stage. A stage-specific increase in the synthesis of AMG+4 was further supported by our observation that in mice overexpressing leucine-rich amelogenin peptide (TgLRAP), in which ameloblasts differentiate earlier, AMG+4 transcripts were also upregulated earlier. In vitro binding studies, supported by in silico modeling of protein binding to calcium and phosphate, showed that more recombinant AMG+4 bound to hydroxyapatite (HAP) as compared with recombinant AMG-4. The temporal and spatial localization of amelogenins containing exon4 peptide, and their functional differences in HAP binding, suggests that the unique properties of amelogenins containing exon4 cause a specific enhancement of biomineralization related to stabilization of early-formed HAP at the maturation stage. PMID:25792521

  3. Exon4 amelogenin transcripts in enamel biomineralization.

    PubMed

    Stahl, J; Nakano, Y; Horst, J; Zhu, L; Le, M; Zhang, Y; Liu, H; Li, W; Den Besten, P K

    2015-06-01

    Amelogenins are proteins formed by alternative splicing of the amelogenin gene, and are essential for tooth enamel formation. However, the unique functions of various alternatively spliced amelogenins in enamel formation are not well understood. In this study, we determined the spatiotemporal location of amelogenins derived from transcripts containing exon4 (AMG+4) in the enamel matrix, and the relative binding of recombinant AMG+4 to hydroxyapatite (HAP). Immunohistochemistry and mass spectrometry analyses showed that AMG+4 proteins were secreted into the enamel matrix at the early maturation stage. A stage-specific increase in the synthesis of AMG+4 was further supported by our observation that in mice overexpressing leucine-rich amelogenin peptide (TgLRAP), in which ameloblasts differentiate earlier, AMG+4 transcripts were also upregulated earlier. In vitro binding studies, supported by in silico modeling of protein binding to calcium and phosphate, showed that more recombinant AMG+4 bound to hydroxyapatite (HAP) as compared with recombinant AMG-4. The temporal and spatial localization of amelogenins containing exon4 peptide, and their functional differences in HAP binding, suggests that the unique properties of amelogenins containing exon4 cause a specific enhancement of biomineralization related to stabilization of early-formed HAP at the maturation stage. PMID:25792521

  4. Human Cytomegalovirus IE1 Protein Disrupts Interleukin-6 Signaling by Sequestering STAT3 in the Nucleus

    PubMed Central

    Reitsma, Justin M.; Sato, Hiromi; Nevels, Michael

    2013-01-01

    In the canonical STAT3 signaling pathway, binding of agonist to receptors activates Janus kinases that phosphorylate cytoplasmic STAT3 at tyrosine 705 (Y705). Phosphorylated STAT3 dimers accumulate in the nucleus and drive the expression of genes involved in inflammation, angiogenesis, invasion, and proliferation. Here, we demonstrate that human cytomegalovirus (HCMV) infection rapidly promotes nuclear localization of STAT3 in the absence of robust phosphorylation at Y705. Furthermore, infection disrupts interleukin-6 (IL-6)-induced phosphorylation of STAT3 and expression of a subset of IL-6-induced STAT3-regulated genes, including SOCS3. We show that the HCMV 72-kDa immediate-early 1 (IE1) protein associates with STAT3 and is necessary to localize STAT3 to the nucleus during infection. Furthermore, expression of IE1 is sufficient to disrupt IL-6-induced phosphorylation of STAT3, binding of STAT3 to the SOCS3 promoter, and SOCS3 gene expression. Finally, inhibition of STAT3 nuclear localization or STAT3 expression during infection is linked to diminished HCMV genome replication. Viral gene expression is also disrupted, with the greatest impact seen following viral DNA synthesis. Our study identifies IE1 as a new regulator of STAT3 intracellular localization and IL-6 signaling and points to an unanticipated role of STAT3 in HCMV infection. PMID:23903834

  5. Protective CD8+ T-cell responses to cytomegalovirus driven by rAAV/GFP/IE1 loading of dendritic cells

    PubMed Central

    Yu, Yuefei; Pilgrim, Petra; Yan, Juqiang; Zhou, Wei; Jenkins, Marjorie; Gagliano, Nicoletta; Bumm, Klaus; Cannon, Martin; Milzani, Aldo; Dalle-Donne, Isabella; Kast, W Martin; Cobos, Everardo; Chiriva-Internati, Maurizio

    2008-01-01

    Background Recent studies demonstrate that recombinant adeno-associated virus (rAAV)-based antigen loading of dendritic cells (DCs) generates in vitro, significant and rapid cytotoxic T-lymphocyte (CTL) responses against viral antigens. Methods We used the rAAV system to induce specific CTLs against CVM antigens for the development of cytomegalovirus HCMV) gene therapy. As an extension of the versatility of the rAAV system, we incorporated immediate-early 1 (IE1), expressed in HCMV. Our rAAV vector induced a strong stimulation of CTLs directed against the HCMV antigen IE1. We then investigated the efficiency of the CTLs in killing IE1 targeted cells. Results A significant MHC Class I-restricted, anti-IE1-specific CTL killing was demonstrated against IE1 positive peripheral blood mononuclear cells (PBMC) after one, in vitro, stimulation. Conclusion In summary, single PBMC stimulation with rAAV/IE1 pulsed DCs induces strong antigen specific-CTL generation. CTLs were capable to lyse low doses of peptides pulsed into target cells. These data suggest that AAV-based antigen loading of DCs is highly effective for generating human CTL responses against HCMV antigens. PMID:18834548

  6. Characterization of Recombinant Human Cytomegaloviruses Encoding IE1 Mutants L174P and 1-382 Reveals that Viral Targeting of PML Bodies Perturbs both Intrinsic and Innate Immune Responses

    PubMed Central

    Scherer, Myriam; Otto, Victoria; Stump, Joachim D.; Klingl, Stefan; Müller, Regina; Reuter, Nina; Muller, Yves A.; Sticht, Heinrich

    2015-01-01

    ABSTRACT PML is the organizer of cellular structures termed nuclear domain 10 (ND10) or PML-nuclear bodies (PML-NBs) that act as key mediators of intrinsic immunity against human cytomegalovirus (HCMV) and other viruses. The antiviral function of ND10 is antagonized by viral regulatory proteins such as the immediate early protein IE1 of HCMV. IE1 interacts with PML through its globular core domain (IE1CORE) and induces ND10 disruption in order to initiate lytic HCMV infection. Here, we investigate the consequences of a point mutation (L174P) in IE1CORE, which was shown to abrogate the interaction with PML, for lytic HCMV infection. We found that a recombinant HCMV encoding IE1-L174P displays a severe growth defect similar to that of an IE1 deletion virus. Bioinformatic modeling based on the crystal structure of IE1CORE suggested that insertion of proline into the highly alpha-helical domain severely affects its structural integrity. Consistently, L174P mutation abrogates the functionality of IE1CORE and results in degradation of the IE1 protein during infection. In addition, our data provide evidence that IE1CORE as expressed by a recombinant HCMV encoding IE1 1-382 not only is required to antagonize PML-mediated intrinsic immunity but also affects a recently described function of PML in innate immune signaling. We demonstrate a coregulatory role of PML in type I and type II interferon-induced gene expression and provide evidence that upregulation of interferon-induced genes is inhibited by IE1CORE. In conclusion, our data suggest that targeting PML by viral regulatory proteins represents a strategy to antagonize both intrinsic and innate immune mechanisms. IMPORTANCE PML nuclear bodies (PML-NBs), which represent nuclear multiprotein complexes consisting of PML and additional proteins, represent important cellular structures that mediate intrinsic resistance against many viruses, including human cytomegalovirus (HCMV). During HCMV infection, the major immediate

  7. Physical requirements and functional consequences of complex formation between the cytomegalovirus IE1 protein and human STAT2.

    PubMed

    Krauss, Steffen; Kaps, Julia; Czech, Nathalie; Paulus, Christina; Nevels, Michael

    2009-12-01

    Our previous work has shown that efficient evasion from type I interferon responses by human cytomegalovirus (hCMV) requires expression of the 72-kDa immediate-early 1 (IE1) protein. It has been suggested that IE1 inhibits interferon signaling through intranuclear sequestration of the signal transducer and activator of transcription 2 (STAT2) protein. Here we show that physical association and subnuclear colocalization of IE1 and STAT2 depend on short acidic and serine/proline-rich low-complexity motifs in the carboxy-terminal region of the 491-amino-acid viral polypeptide. These motifs compose an essential core (amino acids 373 to 420) and an adjacent ancillary site (amino acids 421 to 445) for STAT2 interaction that are predicted to form part of a natively unstructured domain. The presence of presumably "disordered" carboxy-terminal domains enriched in low-complexity motifs is evolutionarily highly conserved across all examined mammalian IE1 orthologs, and the murine cytomegalovirus IE1 protein appears to interact with STAT2 just like the human counterpart. A recombinant hCMV specifically mutated in the IE1 core STAT2 binding site displays hypersensitivity to alpha interferon, delayed early viral protein accumulation, and attenuated growth in fibroblasts. However, replication of this mutant virus is specifically restored by knockdown of STAT2 expression. Interestingly, complex formation with STAT2 proved to be entirely separable from disruption of nuclear domain 10 (ND10), another key activity of IE1. Finally, our results demonstrate that IE1 counteracts the antiviral interferon response and promotes viral replication by at least two distinct mechanisms, one depending on sequestration of STAT2 and the other one likely involving ND10 interaction. PMID:19812155

  8. A Viral Pilot for HCMV Navigation?

    PubMed Central

    Adler, Barbara

    2015-01-01

    gH/gL virion envelope glycoprotein complexes of herpesviruses serve as entry complexes and mediate viral cell tropism. By binding additional viral proteins, gH/gL forms multimeric complexes which bind to specific host cell receptors. Both Epstein–Barr virus (EBV) and human cytomegalovirus (HCMV) express alternative multimeric gH/gL complexes. Relative amounts of these alternative complexes in the viral envelope determine which host cells are preferentially infected. Host cells of EBV can modulate the gH/gL complex complement of progeny viruses by cell type-dependent degradation of one of the associating proteins. Host cells of HCMV modulate the tropism of their virus progenies by releasing or not releasing virus populations with a specific gH/gL complex complement out of a heterogeneous pool of virions. The group of Jeremy Kamil has recently shown that the HCMV ER-resident protein UL148 controls integration of one of the HCMV gH/gL complexes into virions and thus creates a pool of virions which can be routed by different host cells. This first mechanistic insight into regulation of the gH/gL complex complement of HCMV progenies presents UL148 as a pilot candidate for HCMV navigation in its infected host. PMID:26184287

  9. Identification of Proteins in Human Cytomegalovirus (HCMV) Particles: the HCMV Proteome

    SciTech Connect

    Varnum, Susan M.; Streblow, Daniel N.; Monroe, Matthew E.; Smith, Patricia; Auberry, Kenneth J.; Pasa-Tolic, Liljiana; Wang, Dai; Camp, David G.; Rodland, Karin D.; Wiley, H S.; Britt, William; Shenk, Thomas; Smith, Richard D.; Nelson, Jay

    2004-10-15

    Human cytomegalovirus (HCMV), a member of the herpes virus family, is a large complex enveloped virus composed of both viral and cellular gene products. While the sequence of the HCMV genome has been known for over a decade, the full set of viral and cellular proteins that compose the HCMV virion are unknown. To approach this problem we have utilized gel-free two-dimensional capillary liquid chromatography-tandem mass spectrometry (MS/MS) and Fourier transform ion cyclotron resonance MS to identify and determine the relative abundances of viral and cellular proteins in purified HCMV AD169 virions and dense bodies. Analysis of the proteins from purified HCMV virion preparations has indicated that the particle contains significantly more viral proteins than previously known. In this study, we identified 71 HCMV-encoded proteins that included 12 proteins encoded by known viral open reading frames (ORFs) previously not associated with virions and 12 proteins from novel viral ORFs. Analysis of the relative abundance of HCMV proteins indicated that the predominant virion protein was the pp65 tegument protein and that gM rather than gB was the most abundant glycoprotein. We have also identified over 70 host cellular proteins in HCMV virions, which include cellular structural proteins, enzymes, and chaperones. In addition, analysis of HCMV dense bodies indicated that these viral particles are composed of 29 viral proteins with a reduced quantity of cellular proteins in comparison to HCMV virions. This study provides the first comprehensive quantitative analysis of the viral and cellular proteins that compose infectious particles of a large complex virus.

  10. Crystal Structure of Cytomegalovirus IE1 Protein Reveals Targeting of TRIM Family Member PML via Coiled-Coil Interactions

    PubMed Central

    Sevvana, Madhumati; Otto, Victoria; Schilling, Eva-Maria; Stump, Joachim D.; Müller, Regina; Reuter, Nina; Sticht, Heinrich; Muller, Yves A.; Stamminger, Thomas

    2014-01-01

    PML nuclear bodies (PML-NBs) are enigmatic structures of the cell nucleus that act as key mediators of intrinsic immunity against viral pathogens. PML itself is a member of the E3-ligase TRIM family of proteins that regulates a variety of innate immune signaling pathways. Consequently, viruses have evolved effector proteins to modify PML-NBs; however, little is known concerning structure-function relationships of viral antagonists. The herpesvirus human cytomegalovirus (HCMV) expresses the abundant immediate-early protein IE1 that colocalizes with PML-NBs and induces their dispersal, which correlates with the antagonization of NB-mediated intrinsic immunity. Here, we delineate the molecular basis for this antagonization by presenting the first crystal structure for the evolutionary conserved primate cytomegalovirus IE1 proteins. We show that IE1 consists of a globular core (IE1CORE) flanked by intrinsically disordered regions. The 2.3 Å crystal structure of IE1CORE displays an all α-helical, femur-shaped fold, which lacks overall fold similarity with known protein structures, but shares secondary structure features recently observed in the coiled-coil domain of TRIM proteins. Yeast two-hybrid and coimmunoprecipitation experiments demonstrate that IE1CORE binds efficiently to the TRIM family member PML, and is able to induce PML deSUMOylation. Intriguingly, this results in the release of NB-associated proteins into the nucleoplasm, but not of PML itself. Importantly, we show that PML deSUMOylation by IE1CORE is sufficient to antagonize PML-NB-instituted intrinsic immunity. Moreover, co-immunoprecipitation experiments demonstrate that IE1CORE binds via the coiled-coil domain to PML and also interacts with TRIM5α We propose that IE1CORE sequesters PML and possibly other TRIM family members via structural mimicry using an extended binding surface formed by the coiled-coil region. This mode of interaction might render the antagonizing activity less susceptible to

  11. Amelogenin Exon4 Forms a Novel miRNA That Directs Ameloblast and Osteoblast Differentiation.

    PubMed

    Le, M H; Warotayanont, R; Stahl, J; Den Besten, P K; Nakano, Y

    2016-04-01

    Amelogenins constitute the major portion of secretory enamel matrix proteins and are known to be highly alternative spliced. Of all the alternatively spliced forms of amelogenins, exon4 is most commonly spliced out. Our analyses of the exon4 sequence led us to hypothesize that when spliced out, exon4 may generate a novel mature miRNA. To explore this possibility, we used in vivo mouse models (wild-type and Amel knockout mice) and in vitro cell culture to investigate the presence and function of a mature miRNA derived from exon4 (miR-exon4). When ameloblast-like cells (LS8) were transfected with an amelogenin minigene to increase amelogenin synthesis, the transfected cells synthesized miR-exon4. Introduction of a mutation in the conserved CNNC sequence required for primary miRNA recognition, downstream of the mature miR-exon4 sequence, resulted in a significantly reduced production of miR-exon4 in the transfected cells. In vivo, miR-exon4 was most highly amplified from wild-type mouse enamel organs at the secretory stage. In Amel knockout mice, an in vivo model for reduced amelogenin synthesis, we found reduced miR-exon4, with no changes in expression of enamel matrix-related genes. However, expression of Runx2 and its downstream genes Odam and Amtn were significantly downregulated. Transfection of miR-exon4 mimic to the LS8 cells also significantly upregulated Runx2. The mature miR-exon4 as well as Runx2 was also present in mouse osteoblasts with no apparent change in expression level between wild-type and Amel knockout mice. However, transfecting miR-exon4 inhibitor to the MC3T3-E1 osteoblastic cells resulted in a significant downregulation of Runx2 expression. These data indicate that when exon4 is spliced out, as occurs most of the time during alternative splicing of amelogenin pre-mRNA, a novel mature miRNA is generated from exon4. This miR-exon4 may contribute to the differentiation of ameloblasts and osteoblasts through regulation of Runx2 expression. PMID

  12. CTCF Binding to the First Intron of the Major Immediate Early (MIE) Gene of Human Cytomegalovirus (HCMV) Negatively Regulates MIE Gene Expression and HCMV Replication

    PubMed Central

    Martínez, Francisco Puerta; Cruz, Ruth; Lu, Fang; Plasschaert, Robert; Deng, Zhong; Rivera-Molina, Yisel A.; Bartolomei, Marisa S.; Lieberman, Paul M.

    2014-01-01

    ABSTRACT Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin

  13. Cross-presentation of HCMV chimeric protein enables generation and measurement of polyclonal T cells.

    PubMed

    Nguyen, Thi H O; Sullivan, Lucy C; Kotsimbos, Tom C; Schwarer, Anthony P; Mifsud, Nicole A

    2010-08-01

    CD8(+) T cell immunity has a critical function in controlling human cytomegalovirus (HCMV) infection. In immunocompromized individuals, HCMV reactivation or disease can lead to increased morbidity and mortality, particularly in transplant recipients. In this setting, adoptive transfer of HCMV-specific CD8(+) T cells is a promising vaccine strategy to restore viral immunity, with most clinical approaches focussing on the use of peptides for the generation of single epitope-specific CD8(+) T cells. We show that using an IE1-pp65 chimeric protein as the antigen source promotes effective cross-presentation, by monocyte-derived dendritic cells (MoDCs), to generate polyclonal CD8(+) T cell epitopes. By exploring human leukocyte antigen (HLA)-restricted immunodominance hierarchies both within and across two immunodominant proteins, we show that HLA-B7 epitopes elicit higher CD8(+) T cell responses compared with HLA-A1, -A2 or -B8. This study provides important evidence highlighting both the efficacy of the IE1-pp65 chimeric protein and the importance of immunodominance in designing future therapeutic vaccines. PMID:20195281

  14. Human cytomegalovirus (HCMV) immediate-early enhancer/promoter specificity during embryogenesis defines target tissues of congenital HCMV infection.

    PubMed Central

    Koedood, M; Fichtel, A; Meier, P; Mitchell, P J

    1995-01-01

    Congenital human cytomegalovirus (HCMV) infection is a common cause of deafness and neurological disabilities. Many aspects of this prenatal infection, including which cell types are infected and how infection proceeds, are poorly understood. Transcription of HCMV immediate-early (IE) genes is required for expression of all other HCMV genes and is dependent on host cell transcription factors. Cell type-specific differences in levels of IE transcription are believed to underlie differences in infection permissivity. However, DNA transfection experiments have paradoxically suggested that the HCMV major IE enhancer/promoter is a broadly active transcriptional element with little cell type specificity. In contrast, we show here that expression of a lacZ gene driven by the HCMV major IE enhancer/promoter -524 to +13 segment is restricted in transgenic mouse embryos to sites that correlate with known sites of congenital HCMV infection in human fetuses. This finding suggests that the IE enhancer/promoter is a major determinant of HCMV infection sites in humans and that transcription factors responsible for its regulation are cell type-specifically conserved between humans and mice. The lacZ expression patterns of these transgenic embryos yield insight into congenital HCMV pathogenesis by providing a spatiotemporal map of the sets of vascular, neural, and epithelial cells that are likely targets of infection. These transgenic mice may constitute a useful model system for investigating IE enhancer/promoter regulation in vivo and for identifying factors that modulate active and latent HCMV infections in humans. PMID:7884867

  15. SF2 and SRp55 regulation of CD45 exon 4 skipping during T cell activation.

    PubMed

    Lemaire, R; Winne, A; Sarkissian, M; Lafyatis, R

    1999-03-01

    CD45 is an alternatively spliced membrane phosphatase required for T cell activation. Exons 4, 5 and 6 can be included or skipped from spliced mRNA resulting in several protein isoforms that include or exclude epitopes referred to as RA, RB or RC, respectively. T cells reciprocally express CD45RA or CD45RO (lacking all three exons), corresponding to naive versus memory T cells. Overexpression of the alternative splicing regulators, SF2 or SWAP, induces skipping of CD45 exon 4 in transfected COS cells. We show here that the arginine/serine-rich domain of SWAP and the RNA recognition motifs of SF2 are required for skipping of CD45 exon 4. Unlike SWAP, SF2 specifically regulated alternative splicing of CD45 exon 4, having no effect on a non-regulated exon of CD45 (exon 9). Like SF2 and SWAP, the SR proteins SC35, SRp40 and SRp75, but not SRp55 also induced CD45 exon 4 skipping. In contrast, antisense inhibition of SRp55 induced exon 4 skipping. SF2 and SRp55 proteins were not detectable or expressed at a very low level in freshly isolated CD45RA+ and CD45RO+ T cells. Activation of CD45RA+ T cells shifted CD45 expression from CD45RA to CD45RO, and induced a large increase in expression of both SF2 and SRp55. Thus, SF2 at least in part determines splicing of CD45 exon 4 during T cell activation. SRp55, SR protein phosphorylation, or other splicing factors likely regulate CD45 splicing in CD45RO+ memory T cells. The different SR proteins expressed by memory and activated T cells emphasize the different phenotypes of these cell types that both express CD45RO. PMID:10092085

  16. Alternative splicing of Wilms tumor suppressor 1 (Wt1) exon 4 results in protein isoforms with different functions.

    PubMed

    Schnerwitzki, Danny; Perner, Birgit; Hoppe, Beate; Pietsch, Stefan; Mehringer, Rebecca; Hänel, Frank; Englert, Christoph

    2014-09-01

    The Wilms tumor suppressor gene Wt1 encodes a zinc finger transcription factor that is essential for development of multiple organs including kidneys, gonads, spleen and heart. In mammals Wt1 comprises 10 exons with two characteristic splicing events: inclusion or skipping of exon 5 and alternative usage of two splice donor sites between exons 9 and 10. Most fish including zebrafish and medaka possess two wt1 paralogs, wt1a and wt1b, both lacking exon 5. Here we have characterized wt1 in guppy, platyfish and the short-lived African killifish Nothobranchius furzeri. All fish except zebrafish show alternative splicing of exon 4 of wt1a but not of wt1b with the wt1a(-exon 4) isoform being the predominant splice variant. With regard to function, Wt1a(+exon 4) showed less dimerization but stimulated transcription more effectively than the Wt1a(-exon 4) isoform. A specific knockdown of wt1a exon 4 in zebrafish was associated with anomalies in kidney development demonstrating a physiological function for Wt1a exon 4. Interestingly, alternative splicing of exon 4 seems to be an early evolutionary event as it is observed in the single wt1 gene of the sturgeon, a species that has not gone through teleost-specific genome duplication. PMID:25014653

  17. Alveolar Macrophages Isolated Directly From Human Cytomegalovirus (HCMV)–Seropositive Individuals Are Sites of HCMV Reactivation In Vivo

    PubMed Central

    Poole, Emma; Juss, Jatinder K.; Krishna, Benjamin; Herre, Jurgen; Chilvers, Edwin R.; Sinclair, John

    2015-01-01

    Human cytomegalovirus (HCMV) causes significant morbidity in the immunocompromised host. Following primary infection, the virus establishes latent infection in progenitor cells of the myeloid lineage. These cells exhibit limited viral gene transcription and no evidence of de novo virion production. It is well recognized that differentiation of latently infected myeloid progenitor cells to dendritic or macrophage-like cells permits viral reactivation in vitro. This has been used to support the concept that viral reactivation in HCMV carriers routinely occurs from such terminally differentiated myeloid cells in vivo. However, to date this has not been shown for in vivo–differentiated macrophages. This study is the first to demonstrate that alveolar macrophages from HCMV carriers express immediate early lytic genes and produce infectious virus. This supports the view, until now based on in vitro data, that terminally differentiated myeloid cells in vivo are sites of HCMV reactivation and potential centers of viral dissemination in latently infected individuals with no evidence of virus disease or dissemination. PMID:25552371

  18. Baculoviruses deficient in ie1 gene function abrogate viral gene expression in transduced mammalian cells

    SciTech Connect

    Efrose, Rodica; Swevers, Luc; Iatrou, Kostas

    2010-10-25

    One of the newest niches for baculoviruses-based technologies is their use as vectors for mammalian cell transduction and gene therapy applications. However, an outstanding safety issue related to such use is the residual expression of viral genes in infected mammalian cells. Here we show that infectious baculoviruses lacking the major transcriptional regulator, IE1, can be produced in insect host cells stably transformed with IE1 expression constructs lacking targets of homologous recombination that could promote the generation of wt-like revertants. Such ie1-deficient baculoviruses are unable to direct viral gene transcription to any appreciable degree and do not replicate in normal insect host cells. Most importantly, the residual viral gene expression, which occurs in mammalian cells infected with wt baculoviruses is reduced 10 to 100 fold in cells infected with ie1-deficient baculoviruses. Thus, ie1-deficient baculoviruses offer enhanced safety features to baculovirus-based vector systems destined for use in gene therapy applications.

  19. 11 CFR 300.60 - Scope (2 U.S.C. 441i(e)(1)).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ...) REGULATIONS NON-FEDERAL FUNDS Federal Candidates and Officeholders § 300.60 Scope (2 U.S.C. 441i(e)(1)). This subpart applies to: (a) Federal candidates; (b) Individuals holding Federal office (see 11 CFR 300.2(o... 11 Federal Elections 1 2010-01-01 2010-01-01 false Scope (2 U.S.C. 441i(e)(1)). 300.60 Section...

  20. 11 CFR 300.60 - Scope (2 U.S.C. 441i(e)(1)).

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ...) REGULATIONS NON-FEDERAL FUNDS Federal Candidates and Officeholders § 300.60 Scope (2 U.S.C. 441i(e)(1)). This subpart applies to: (a) Federal candidates; (b) Individuals holding Federal office (see 11 CFR 300.2(o... 11 Federal Elections 1 2011-01-01 2011-01-01 false Scope (2 U.S.C. 441i(e)(1)). 300.60 Section...

  1. The Baculovirus PE38 Protein Augments Apoptosis Induced by Transactivator IE1

    PubMed Central

    Prikhod’ko, Elena A.; Miller, Lois K.

    1999-01-01

    While studying apoptosis induced by baculovirus transactivator IE1 in SF-21 cells, we found that the levels of IE1-induced apoptosis were increased approximately twofold upon cotransfection with the baculovirus early pe38 gene. However, no apoptotic activity was observed in cells transfected with pe38 alone, even when placed under the control of a constitutive promoter. Thus, pe38 was able to augment IE1-induced apoptosis but was unable to induce apoptosis when expressed in SF-21 cells alone. PE38, the full-length product of pe38, is a nuclear protein with RING finger and leucine zipper motifs. Deletion of the amino-terminal region, which contains a putative nuclear localization motif, resulted in cytoplasmic localization of the PE38 mutants. These N-terminal deletion mutants were unable to enhance IE1-induced apoptosis. Mutation of a single conserved leucine (L242) of the leucine zipper motif also eliminated the ability of PE38 to augment apoptosis induced by IE1. In contrast, PE38 mutants with alanine substitutions for conserved cysteine residues (C109 or C138) of the RING finger motif were able to increase IE1-induced apoptosis to levels equivalent to those of wild-type PE38. We propose that PE38 is one of at least two viral factors which collectively evoke a cellular apoptotic response during baculovirus infection. PMID:10400766

  2. Further genotype-phenotype correlation emerging from two families with PLP1 exon 4 skipping.

    PubMed

    Biancheri, Roberta; Grossi, Serena; Regis, Stefano; Rossi, Andrea; Corsolini, Fabio; Rossi, Daniela Paola; Cavalli, Pietro; Severino, Mariasavina; Filocamo, Mirella

    2014-03-01

    Proteolipid protein 1 (PLP1) gene-related disorders due to mutations in the PLP1 include a wide spectrum of X-linked disorders ranging from severe connatal Pelizaeus-Merzbacher disease (PMD) to spastic paraplegia 2 (SPG2). Duplications, deletions or point mutations in coding and noncoding regions of the PLP1 gene may occur. We report the clinical, neuroradiologic and molecular findings in six patients from two unrelated families. The affected males showed severe mental retardation, spastic tetraparesis, inability of walking and pes cavus at onset in early infancy. Brain magnetic resonance imaging (MRI) showed hypomyelination and brain atrophy. Nystagmus was never observed. The affected females showed adult-onset progressive spastic paraparesis leading to wheel-chair dependency and subtle white matter changes on brain MRI. Molecular studies in the two families identified two different intronic mutations, the novel c.622+2T>C and the known c.622+1G>A, leading to the skipping of PLP1-exon 4. The clinical presentation of the affected males did not consistently fit in any of the PLP1-related disorder subtypes (i.e., connatal or classic PMD, SPG2 and 'PLP1 null syndrome'), and in addition, the carrier females were symptomatic despite the severe clinical picture of their respective probands. This study provides new insight into the genotype-phenotype correlations of patients with PLP1 splice-site mutations. PMID:23711321

  3. Human Cytomegalovirus (HCMV)-Specific CD4+ and CD8+ T Cells Are Both Required for Prevention of HCMV Disease in Seropositive Solid-Organ Transplant Recipients

    PubMed Central

    Gabanti, Elisa; Bruno, Francesca; Lilleri, Daniele; Fornara, Chiara; Zelini, Paola; Cane, Ilaria; Migotto, Clara; Sarchi, Eleonora; Furione, Milena; Gerna, Giuseppe

    2014-01-01

    In solid-organ transplant recipients (SOTR) the protective role of human cytomegalovirus (HCMV)-specific CD4+, CD8+ and γδ T-cells vs. HCMV reactivation requires better definition. The aim of this study was to investigate the relevant role of HCMV-specific CD4+, CD8+ and γδ T-cells in different clinical presentations during the post-transplant period. Thirty-nine SOTR underwent virologic and immunologic follow-up for about 1 year after transplantation. Viral load was determined by real-time PCR, while immunologic monitoring was performed by measuring HCMV-specific CD4+ and CD8+ T cells (following stimulation with autologous HCMV-infected dendritic cells) and γδ T-cells by flow cytometry. Seven patients had no infection and 14 had a controlled infection, while both groups maintained CD4+ T-cell numbers above the established cut-off (0.4 cell/µL blood). Of the remaining patients, 9 controlled the infection temporarily in the presence of HCMV-specific CD8+ only, until CD4+ T-cell appearance; while 9 had to be treated preemptively due to a viral load greater than the established cut-off (3×105 DNA copies/mL blood) in the absence of specific CD4+ T-cells. Polyfunctional CD8+ T-cells as well as Vδ2− γδ T-cells were not associated with control of infection. In conclusion, in the absence of HCMV-specific CD4+ T-cells, no long-term protection is conferred to SOTR by either HCMV-specific CD8+ T-cells alone or Vδ2− γδ T-cell expansion. PMID:25166270

  4. Molecular Detection of Human Cytomegalovirus (HCMV) Among Infants with Congenital Anomalies in Khartoum State, Sudan

    PubMed Central

    Ebrahim, Maha G.; Ali, Aisha S.; Mustafa, Mohamed O.; Musa, Dalal F.; El Hussein, Abdel Rahim M.; Elkhidir, Isam M.; Enan, Khalid A.

    2015-01-01

    Human Cytomegalovirus (HCMV) infection still represents the most common potentially serious viral complication in humans and is a major cause of congenital anomalies in infants. This study is aimed to detect HCMV in infants with congenital anomalies. Study subjects consisted of infants born with neural tube defect, hydrocephalus and microcephaly. Fifty serum specimens (20 males, 30 females) were collected from different hospitals in Khartoum State. The sera were investigated for cytomegalovirus specific immunoglobin M (IgM) antibodies using enzyme-linked immunosorbent assay (ELISA), and for Cytomegalovirus DNA using polymerase chain reaction (PCR). Out of the 50 sera tested, one patient’s (2%) sample showed HCMV IgM, but with no detectable DNA, other 4(8.2 %) sera were positive for HCMV DNA but with no detectable IgM. Various diagnostic techniques should be considered to evaluate HCMV disease and routine screening for HCMV should be introduced for pregnant women in this setting. It is vital to initiate further research work with many samples from different area to assess prevalence and characterize HCMV and evaluate its maternal health implications. PMID:26862356

  5. US28 actions in HCMV infection: lessons from a versatile hijacker.

    PubMed

    Boomker, J M; van Luyn, M J A; The, T H; de Leij, L F M H; Harmsen, M C

    2005-01-01

    Mimicking host proteins is a strategy adopted by several herpesviruses to exploit the host cell for their own benefit. In this respect the human cytomegalovirus (HCMV) chemokine receptor homologue US28, has been extensively studied. Molecular pirates such as US28 can teach us about crucial events in HCMV infection and may either offer a potential target for antiviral therapy or provide an alternative strategy to immune suppression. Despite elaborate research into the chemokine binding affinity, signalling properties, intracellular trafficking and expression kinetics of US28, a solid hypothesis about the role of US28 in HCMV infection has not yet been proposed. It appears that US28 may behave as a molecular pirate that employs smart strategies for cell entry, host gene regulation and immune evasion. This review will elaborate on these aspects of US28 biology and discuss possible implications for HCMV infection. PMID:15861487

  6. HCMV Encoded Glycoprotein M (UL100) Interacts with Rab11 Effector Protein FIP4

    PubMed Central

    Krzyzaniak, Magdalena A.; Mach, Michael; Britt, William J.

    2009-01-01

    The envelope of human cytomegalovirus (HCMV) consists of a large number of glycoproteins. The most abundant glycoprotein in the HCMV envelope is the glycoprotein M (UL100) which together with glycoprotein N (UL73) form the gM/gN protein complex. Using yeast two hybrid screening, we found that the gM carboxy-terminal cytoplasmic tail (gM-CT) interacts with FIP4, a Rab11-GTPase effector protein. Depletion of FIP4 expression in HCMV infected cells resulted in a decrease of infectious virus production that was also associated with an alteration of the HCMV assembly compartment (AC) phenotype. A similar phenotype was also observed in HCMV infected cells that expressed dominant negative Rab11(S25N). Recently, it has been shown that FIP4 interactions with Rab11 and additionally with Arf6/Arf5 are important for the vesicular transport of proteins in the endosomal recycling compartment (ERC) and during cytokinesis. Surprisingly, FIP4 interaction with gM-CT limited binding of FIP4 with Arf5/Arf6, however, FIP4 interaction with gM-CT did not prevent recruitment of Rab11 into the ternary complex. These data argued for a contribution of the ERC during cytoplasmic envelopment of HCMV and revealed a novel FIP4 function independent of Arf5 or Arf6 activity. PMID:19761540

  7. Mapping two major resistance genes in an indica cultivar Zhe733 to the race IE-1K of Magnaporthe oryzae

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Resistance (R) genes in rice confer resistance to races of Magnaporthe oryzae that contain the corresponding avirulence genes. The race IE-1K of M. oryzae recovered from the southern US overcomes R gene Pi-ta. The objectives of the present study were to identify new resistance sources to IE-1k an...

  8. In vivo expression of human cytomegalovirus (HCMV) microRNAs during latency.

    PubMed

    Meshesha, Mesfin K; Bentwich, Zvi; Solomon, Semaria A; Avni, Yonat Shemer

    2016-01-01

    Viral encoded microRNAs play key roles in regulating gene expression and the life cycle of human herpes viruses. Latency is one of the hallmarks of the human cytomegalovirus (HCMV or HHV5) life cycle, and its control may have immense practical applications. The present study aims to identify HCMV encoded microRNAs during the latency phase of the virus. We used a highly sensitive real time PCR (RTPCR) assay that involves a pre-amplification step before RTPCR. It can detect HCMV encoded microRNAs (miRNAs) during latency in purified monocytes and PBMCs from HCMV IgG positive donors and in latently infected monocytic THP-1 cell lines. During the latency phase, only eight HCMV encoded microRNAs were detected in PBMCs, monocytes and in the THP-1 cells. Five originated from the UL region of the virus genome and three from the US region. Reactivation of the virus from latency, in monocytes obtained from the same donor, using dexamethasone restored the expression of all known HCMV encoded miRNAs including those that were absent during latency. We observed a shift in the abundance of the two arms of mir-US29 between the productive and latency stages of the viral life cycle, suggesting that the star "passenger" form of this microRNA is preferentially expressed during latency. As a whole, our study demonstrates that HCMV expresses during the latency phase, both in vivo and in vitro, only a subset of its microRNAs, which may indicate that they play an important role in maintenance and reactivation of latency. PMID:26302752

  9. Altered Striatal Synaptic Function and Abnormal Behaviour in Shank3 Exon4-9 Deletion Mouse Model of Autism.

    PubMed

    Jaramillo, Thomas C; Speed, Haley E; Xuan, Zhong; Reimers, Jeremy M; Liu, Shunan; Powell, Craig M

    2016-03-01

    Shank3 is a multi-domain, synaptic scaffolding protein that organizes proteins in the postsynaptic density of excitatory synapses. Clinical studies suggest that ∼ 0.5% of autism spectrum disorder (ASD) cases may involve SHANK3 mutation/deletion. Patients with SHANK3 mutations exhibit deficits in cognition along with delayed/impaired speech/language and repetitive and obsessive/compulsive-like (OCD-like) behaviors. To examine how mutation/deletion of SHANK3 might alter brain function leading to ASD, we have independently created mice with deletion of Shank3 exons 4-9, a region implicated in ASD patients. We find that homozygous deletion of exons 4-9 (Shank3(e4-9) KO) results in loss of the two highest molecular weight isoforms of Shank3 and a significant reduction in other isoforms. Behaviorally, both Shank3(e4-9) heterozygous (HET) and Shank3(e4-9) KO mice display increased repetitive grooming, deficits in novel and spatial object recognition learning and memory, and abnormal ultrasonic vocalizations. Shank3(e4-9) KO mice also display abnormal social interaction when paired with one another. Analysis of synaptosome fractions from striata of Shank3(e4-9) KO mice reveals decreased Homer1b/c, GluA2, and GluA3 expression. Both Shank3(e4-9) HET and KO demonstrated a significant reduction in NMDA/AMPA ratio at excitatory synapses onto striatal medium spiny neurons. Furthermore, Shank3(e4-9) KO mice displayed reduced hippocampal LTP despite normal baseline synaptic transmission. Collectively these behavioral, biochemical and physiological changes suggest Shank3 isoforms have region-specific roles in regulation of AMPAR subunit localization and NMDAR function in the Shank3(e4-9) mutant mouse model of autism. PMID:26559786

  10. Structure of HCMV glycoprotein B in the postfusion conformation bound to a neutralizing human antibody

    PubMed Central

    Chandramouli, Sumana; Ciferri, Claudio; Nikitin, Pavel A.; Caló, Stefano; Gerrein, Rachel; Balabanis, Kara; Monroe, James; Hebner, Christy; Lilja, Anders E.; Settembre, Ethan C.; Carfi, Andrea

    2015-01-01

    Human cytomegalovirus (HCMV) poses a significant threat to immunocompromised individuals and neonates infected in utero. Glycoprotein B (gB), the herpesvirus fusion protein, is a target for neutralizing antibodies and a vaccine candidate due to its indispensable role in infection. Here we show the crystal structure of the HCMV gB ectodomain bound to the Fab fragment of 1G2, a neutralizing human monoclonal antibody isolated from a seropositive subject. The gB/1G2 interaction is dominated by aromatic residues in the 1G2 heavy chain CDR3 protruding into a hydrophobic cleft in the gB antigenic domain 5 (AD-5). Structural analysis and comparison with HSV gB suggest the location of additional neutralizing antibody binding sites on HCMV gB. Finally, immunoprecipitation experiments reveal that 1G2 can bind to HCMV virion gB suggesting that its epitope is exposed and accessible on the virus surface. Our data will support the development of vaccines and therapeutic antibodies against HCMV infection. PMID:26365435

  11. C-deletion in exon 4 codon 63 of p53 gene as a molecular marker for oral squamous cell carcinoma: A preliminary study

    PubMed Central

    Sukhija, Hemani; Krishnan, Rajkumar; Balachander, N.; Raghavendhar, Karthik; Ramadoss, Ramya; Sen, Sukanta

    2015-01-01

    Background: Exfoliated oral cancer cells in saliva samples from patients with oral squamous cell carcinoma (OSCC) can be used to determine the incidence and type of mutations of the p53 tumor suppressor gene. The purpose of this study was to identify C-deletion mutation in exon 4 codon 63 of p53 gene in the saliva of OSCC patients by polymerase chain reaction (PCR). Materials and Methods: Saliva samples of 20 newly histopathologically diagnosed OSCC patients and 5 healthy volunteers were subjected to isolation of the total genomic DNA and PCR amplification for C-deletion on exon 4 of p53 gene. The resulting products were resolved by agarose gel electrophoresis, viewed and photographed on ultraviolet-transilluminator. Results: The relationship between the frequencies of genetic alterations was assessed by Chi-square test. Differences with values of P < 0.05 were statistically significant. Conclusion: The study concluded a 100% presence of C-deletion mutation in exon 4 codon 63 of p53 in the saliva of OSCC patients. This study suggests that detection of mutation in exon 4 codon 63 of p53 by PCR is a fast, reliable, accurate, and sensitive molecular method for OSCC diagnosis. PMID:26604578

  12. N-terminal determinants of human cytomegalovirus IE1 protein in nuclear targeting and disrupting PML-associated subnuclear structures

    SciTech Connect

    Lee, Hye-Ra; Huh, Yong Ho; Kim, Young-Eui; Lee, Karim; Kim, Sunyoung; Ahn, Jin-Hyun . E-mail: jahn@med.skku.ac.kr

    2007-05-04

    The 72-kDa IE1 protein of human cytomegalovirus disrupts PML-associated subnuclear structures (PODs) by inducing PML desumoylation. This process correlates with the functions of IE1 in transcriptional regulation and efficient viral replication. Here, we defined the N-terminal regions of IE1 required for nuclear targeting and POD-disrupting activity. Although the 24 N-terminal amino acids encoded by exon 2, which were previously shown to be essential for nuclear targeting, did not appear to contain typical basic nuclear localization signals, these residues were able to efficiently convey the GFP protein into the nucleus, suggesting a role in promoting nuclear translocation. In assays using a series of N-terminal truncation IE1 mutants, which were forced to enter the nucleus, exon 2 was completely dispensable for POD disruption. However, the predicted two {alpha}-helix regions in exon 3 were identified as important structural determinants for protein stability and for the correlating activities in POD disruption and PML desumoylation.

  13. Modulation of Radiation-Induced Genetic Damage by HCMV in Peripheral Blood Lymphocytes from a Brain Tumor Case-Control Study

    PubMed Central

    Rourke, Elizabeth A.; Lopez, Mirtha S.; Monroy, Claudia M.; Scheurer, Michael E.; Etzel, Carol J.; Albrecht, Thomas; Bondy, Melissa L.; El-Zein, Randa A.

    2010-01-01

    Human cytomegalovirus (HCMV) infection occurs early in life and viral persistence remains through life. An association between HCMV infection and malignant gliomas has been reported, suggesting that HCMV may play a role in glioma pathogenesis and could facilitate an accrual of genotoxic damage in the presence of γ-radiation; an established risk factor for gliomas. We tested the hypothesis that HCMV infection modifies the sensitivity of cells to γ-radiation-induced genetic damage. We used peripheral blood lymphocytes (PBLs) from 110 glioma patients and 100 controls to measure the level of chromosome damage and cell death. We evaluated baseline, HCMV-, γ-radiation and HCMV + γ-radiation induced genetic instability with the comprehensive Cytokinesis-Blocked Micronucleus Cytome (CBMN-CYT). HCMV, similar to radiation, induced a significant increase in aberration frequency among cases and controls. PBLs infected with HCMV prior to challenge with γ-radiation led to a significant increase in aberrations as compared to baseline, γ-radiation and HCMV alone. With regards to apoptosis, glioma cases showed a lower percentage of induction following in vitro exposure to γ-radiation and HCMV infection as compared to controls. This strongly suggests that, HCMV infection enhances the sensitivity of PBLs to γ-radiation-induced genetic damage possibly through an increase in chromosome damage and decrease in apoptosis. PMID:24281077

  14. Guinea pig cytomegalovirus GP84 is a functional homolog of the human cytomegalovirus (HCMV) UL84 gene that can complement for the loss of UL84 in a chimeric HCMV.

    PubMed

    McGregor, A; Choi, K Y; Schleiss, M R

    2011-02-01

    The guinea pig cytomegalovirus (GPCMV) co-linear gene and potential functional homolog of HCMV UL84 (GP84) was investigated. The GP84 gene had delayed early transcription kinetics and transient expression studies of GP84 protein (pGP84) demonstrated that it targeted the nucleus and co-localized with the viral DNA polymerase accessory protein as described for HCMV pUL84. Additionally, pGP84 exhibited a transdominant inhibitory effect on viral growth as described for HCMV. The inhibitory domain could be localized to a minimal peptide sequence of 99 aa. Knockout of GP84 generated virus with greatly impaired growth kinetics. Lastly, the GP84 ORF was capable of complementing for the loss of the UL84 coding sequence in a chimeric HCMV. Based on this research and previous studies we conclude that GPCMV is similar to HCMV by encoding single copy co-linear functional homologs of HCMV UL82 (pp71), UL83 (pp65) and UL84 genes. PMID:21094510

  15. Microsomal epoxide hydrolase (EPHX1), slow (exon 3, 113His) and fast (exon 4, 139Arg) alleles confer susceptibility to squamous cell esophageal cancer

    SciTech Connect

    Jain, Meenu; Tilak, Anup Raj; Upadhyay, Rohit; Kumar, Ashwani; Mittal, Balraj

    2008-07-15

    Genetic polymorphisms in xenobiotic metabolizing enzymes may alter risk of various cancers. Present case-control study evaluated the influence of EPHX1 genetic variations on squamous cell esophageal cancer (ESCC) susceptibility in 107 patients and 320 controls. EPHX1 polymorphic alleles were genotyped by direct sequencing (exon 3, Tyr113His) or PCR-RFLP (exon 4, His139Arg). Patients with exon 3 genotypes (Tyr113His, His113His) and 113His allele were at risk of ESCC (OR{sub Tyr113His} 2.0, 95% CI = 1.2-3.4, p = 0.007; OR{sub His113His} 2.3 95% CI = 1.0-5.2, p = 0.03 and OR{sub His} 1.5, 95% CI = 1.0-2.1, p = 0.01). In contrast, individuals with exon 4, 139Arg allele were at low risk of cancer (OR 0.34, 95% CI = 0.20-0.56, p = 0.001). However, none of haplotype combinations of exon 3 (Tyr113His) and exon 4 (His139Arg) polymorphisms showed modulation of risk for ESCC. Sub-grouping of patients based on anatomical location of tumor predicted that patients with exon 3, His113His and Tyr113His genotypes were at higher risk for developing ESCC tumor at upper and middle third locations (OR 4.4, 95% CI = 1.0-18.5, p = 0.04; OR 2.5, 95% CI = 1.3-5.0, p = 0.005 respectively). The frequency of exon 4, His139Arg genotype was significantly lower in ESCC patients with lower third tumor location as compared to controls (14.8% vs. 36.3%, p = 0.02). In case-only study, gene-environment interaction of EPHX1 genotypes with tobacco, alcohol and occupational exposures did not appear to modulate the cancer susceptibility. In conclusion, exon 3, Tyr113His genotype was associated with higher risk of ESCC particularly at upper and middle-third anatomical locations of tumor. However, His139Arg genotype of exon 4, exhibited low risk for ESCC as well as its clinical characteristics.

  16. HCMV pUL135 Remodels the Actin Cytoskeleton to Impair Immune Recognition of Infected Cells

    PubMed Central

    Stanton, Richard J.; Prod’homme, Virginie; Purbhoo, Marco A.; Moore, Melanie; Aicheler, Rebecca J.; Heinzmann, Marcus; Bailer, Susanne M.; Haas, Jürgen; Antrobus, Robin; Weekes, Michael P.; Lehner, Paul J.; Vojtesek, Borivoj; Miners, Kelly L.; Man, Stephen; Wilkie, Gavin S.; Davison, Andrew J.; Wang, Eddie C.Y.; Tomasec, Peter; Wilkinson, Gavin W.G.

    2014-01-01

    Summary Immune evasion genes help human cytomegalovirus (HCMV) establish lifelong persistence. Without immune pressure, laboratory-adapted HCMV strains have undergone genetic alterations. Among these, the deletion of the UL/b’ domain is associated with loss of virulence. In a screen of UL/b’, we identified pUL135 as a protein responsible for the characteristic cytopathic effect of clinical HCMV strains that also protected from natural killer (NK) and T cell attack. pUL135 interacted directly with abl interactor 1 (ABI1) and ABI2 to recruit the WAVE2 regulatory complex to the plasma membrane, remodel the actin cytoskeleton and dramatically reduce the efficiency of immune synapse (IS) formation. An intimate association between F-actin filaments in target cells and the IS was dispelled by pUL135 expression. Thus, F-actin in target cells plays a critical role in synaptogenesis, and this can be exploited by pathogens to protect against cytotoxic immune effector cells. An independent interaction between pUL135 and talin disrupted cell contacts with the extracellular matrix. PMID:25121749

  17. Characterization of the HCMV-Specific CD4 T Cell Responses that Are Associated with Protective Immunity.

    PubMed

    Wunsch, Marie; Zhang, Wenji; Hanson, Jodi; Caspell, Richard; Karulin, Alexey Y; Recks, Mascha S; Kuerten, Stefanie; Sundararaman, Srividya; Lehmann, Paul V

    2015-08-01

    Most humans become infected with human cytomegalovirus (HCMV). Typically, the immune system controls the infection, but the virus persists and can reactivate in states of immunodeficiency. While substantial information is available on the contribution of CD8 T cells and antibodies to anti-HCMV immunity, studies of the TH1, TH2, and TH17 subsets have been limited by the low frequency of HCMV-specific CD4 T cells in peripheral blood mononuclear cell (PBMC). Using the enzyme-linked Immunospotr assay (ELISPOT) that excels in low frequency measurements, we have established these in a sizable cohort of healthy HCMV controllers. Cytokine recall responses were seen in all seropositive donors. Specifically, interferon (IFN)- and/or interleukin (IL)-17 were seen in isolation or with IL-4 in all test subjects. IL-4 recall did not occur in isolation. While the ratios of TH1, TH2, and TH17 cells exhibited substantial variations between different individuals these ratios and the frequencies were relatively stable when tested in samples drawn up to five years apart. IFN- and IL-2 co-expressing polyfunctional cells were seen in most subjects. Around half of the HCMV-specific CD4 cells were in a reversible state of exhaustion. The data provided here established the TH1, TH2, and TH17 characteristic of the CD4 cells that convey immune protection for successful immune surveillance against which reactivity can be compared when the immune surveillance of HCMV fails. PMID:26258786

  18. HCMV gB shares structural and functional properties with gB proteins from other herpesviruses

    SciTech Connect

    Sharma, Sapna; Wisner, Todd W.; Johnson, David C.; Heldwein, Ekaterina E.

    2013-01-20

    Glycoprotein B (gB) facilitates HCMV entry into cells by binding receptors and mediating membrane fusion. The crystal structures of gB ectodomains from HSV-1 and EBV are available, but little is known about the HCMV gB structure. Using multiangle light scattering and electron microscopy, we show here that HCMV gB ectodomain is a trimer with the overall shape similar to HSV-1 and EBV gB ectodomains. HCMV gB ectodomain forms rosettes similar to rosettes formed by EBV gB and the postfusion forms of other viral fusogens. Substitution of several bulky hydrophobic residues within the putative fusion loops with more hydrophilic residues reduced rosette formation and abolished cell fusion. We propose that like gB proteins from HSV-1 and EBV, HCMV gB has two internal hydrophobic fusion loops that likely interact with target membranes. Our work establishes structural and functional similarities between gB proteins from three subfamilies of herpesviruses.

  19. Bombyx mori nucleopolyhedrovirus orf8 encodes a nucleic acid binding protein that colocalizes with IE1 during infection.

    PubMed

    Imai, N; Kurihara, M; Matsumoto, S; Kang, W-K

    2004-08-01

    This report describes the characterization of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf8 gene. Immunoblot analyses demonstrated that orf8 was expressed as an early gene. The ORF8 protein accumulated in the nucleus, and was maintained at relatively constant levels from 4 to 24 h postinfection. Immunoblot analysis failed to detect ORF8 protein associated with budded virus and occlusion derived virus. In addition, immunohistochemical analysis by confocal microscopy showed that ORF8 protein colocalized with IE1 to specific nuclear foci throughout infection. To further examine the function of ORF8, a reporter gene was inserted into the orf8 reading frame. One orf8 disruption mutant (BmD8), which expressed the N-terminal half of ORF8, was isolated. However, it was not possible to isolate a null mutant, suggesting that orf8 may have an important role during viral infection. Single-step growth curves showed that BV production was reduced in BmD8 infected cells. Biochemical analyses indicated that ORF8 bound to nucleic acids. Together, these results suggest that BmNPV ORF8 may be involved in viral DNA replication and/or transcription. PMID:15290382

  20. Suppressive effects of sirtinol on human cytomegalovirus (hCMV) infection and hCMV-induced activation of molecular mechanisms of senescence and production of reactive oxygen species.

    PubMed

    Mao, Genxiang; Li, Huifen; Ding, Xiang; Meng, Xin; Wang, Guofu; Leng, Sean X

    2016-09-01

    Substantial evidence suggests that chronic human cytomegalovirus (hCMV) infection contributes significantly to T-cell immunosenescence and adverse health outcomes in older adults. As such, it is important to search for compounds with anti-hCMV properties. Studies have shown that resveratrol, a sirtuin activator, suppresses hCMV infection. Here we report suppressive effects of sirtinol, a sirtuin antagonist, on hCMV infection and its cellular and molecular consequences. Human diploid fibroblast WI-38 cells were infected by hCMV Towne strain in the absence or presence of sirtinol. hCMV replication was measured using qPCR. Senescent phenotype was determined by senescence-associated β galactosidase (SA-β-Gal) activity. Expression of hCMV immediate early (IE) and early (E) proteins and senescence-associated proteins (pRb and Rb, p16(INK4), and p53) and production of reactive oxygen species (ROS) were assessed using standard laboratory assays. The results demonstrated that sirtinol suppressed hCMV infection as well as hCMV-induced activation of molecular mechanisms of senescence and ROS production. While underlying molecular mechanisms remain to be elucidated, these findings indicate sirtinol as a novel and potent anti-hCMV agent with the potential to be developed as an effective treatment for chronic hCMV infection and its cellular and molecular consequences that are important to ageing and health of older adults. PMID:26763147

  1. Identification of two major resistance genes against race IE-1k of Magnaporthe oryzae in the indica rice cultivar ZHE733

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The race IE-1K of Magnaporthe oryzae overcoming the resistance (R) gene Pi-ta has been recovered from the southern US over a period several years. In the present study, three isolates TM2, S1, and 94071 of the race IE-1K were used to identify R genes from a newly introduced resistant indica cultiva...

  2. The mammalian homolog of suppressor-of-white-apricot regulates alternative mRNA splicing of CD45 exon 4 and fibronectin IIICS.

    PubMed

    Sarkissian, M; Winne, A; Lafyatis, R

    1996-12-01

    We have previously described human (HsSWAP) and mouse (MmSWAP) homologs to the Drosophila alternative splicing regulator suppressor-of-white-apricot (su(wa) or DmSWAP). DmSWAP was formally defined as an alternative splicing regulator by studies showing that it autoregulates splicing of its own pre-mRNA. We report here that mammalian SWAP regulates its own splicing, and also the splicing of fibronectin and CD45. Using an in vivo system of cell transfection, mammalian SWAP regulated 5' splice site selection in splicing of its own second intron. SWAP enhanced splicing to the distal 5' splice site, whereas the SR protein ASF/SF2 enhanced splicing to the proximal site. SWAP also regulated alternative splicing of the fibronectin IIICS region by promoting exclusion of the entire IIICS region. In contrast, ASF/SF2 stimulated inclusion of the entire IIICS region. Finally, SWAP regulated splicing of CD45 exon 4, promoting exclusion of this exon, an effect also seen with ASF/SF2. Experiments using SWAP deletion mutants showed that splicing regulation of the fibronectin IIICS region and CD45 exon 4 requires a region including a carboxyl-terminal arginine/serine (R/S)-rich motif. Since R/S motifs of various splicing proteins have been shown to interact with each other, these results suggest that the R/S motif in SWAP may regulate splicing, at least in part, through interactions with other R/S containing splicing factors. PMID:8940107

  3. HCMV pUS28 initiates pro-migratory signaling via activation of Pyk2 kinase

    SciTech Connect

    Vomaske, Jennifer; Varnum, Susan M.; Melnychuk, Ryan; Smith, Patricia; Pasa-Tolic, Ljiljana; Shutthanandan, Janani I.; Streblow, Daniel N.

    2010-12-10

    The HCMV-encoded chemokine receptor US28 mediates smooth muscle cell (SMC) and macrophage motility and this activity has been implicated in the acceleration of vascular disease. US28 induced SMC migration involves the activation of the protein tyrosine kinases (PTKs) Src and Focal adhesion kinase as well as the small GTPase RhoA. In the current study, we examined the involvement of the PTK Pyk2 in US28-induced cellular motility. Expression of a Pyk2 lacking the autophosphorylation site (Tyr-402) blocks US28-mediated SMC migration in response to RANTES, while the kinase-inactive mutant failed to elicit the same negative effect on migration. US28 stimulation with RANTES results in ligand-dependent and calcium-dependent phosphorylation of Pyk2 Tyr-402 and induced the formation of an active Pyk2 kinase complex containing several novel Pyk2 binding proteins. Interestingly, expression of the autophosphorylation site mutant Pyk2 F402Y did not abrogate the formation of an active Pyk2 kinase complex, but instead prevented US28-mediated activation of RhoA. These findings represent the first demonstration that US28 signals through Pyk2 and that this PTK participates in US28-mediated cellular motility via activation of RhoA. Additionally, US28 activated RhoA via Pyk2 in the U373 glioblastoma cells. Interestingly, the Pyk2 kinase complex in U373 contained several proteins known to participate in glioma tumorigenesis. These results provide a potential mechanistic link between HCMV-US28 and glioblastoma cell activation and motility.

  4. Congenital HCMV infection: a collaborative and comparative study of virus detection in amniotic fluid by culture and by PCR.

    PubMed

    Gouarin, S; Palmer, P; Cointe, D; Rogez, S; Vabret, A; Rozenberg, F; Denis, F; Freymuth, F; Lebon, P; Grangeot-Keros, L

    2001-04-01

    Cytomegalovirus (HCMV) infection is the leading cause of congenital virus infection in developed countries, affecting an estimated 1% of births. This antenatal infection can cause serious sequelae. Strategies for prevention and treatment must, therefore, be agreed upon, entailing a preliminary performance assessment of antenatal virus diagnosis techniques. Between 1992 and 1999, HCMV serology status was established for 19456 pregnant women in four French hospitals. Seronegative patients (55.4%) were given serology screening, and antenatal diagnosis was given to 152 women who had shown seroconversion during their pregnancies (1.4%). The detection of HCMV transmission from mother to fetus was finally established in 95 cases, using polymerase chain reaction (PCR) and viral culture methods for detecting HCMV in the amniotic fluid. These results were compared with viral culture of children's urine after birth, enabling us to distinguish between children really infected in utero (30%) and non-infected children (70%). The results of the virus culture and those of PCR were identical in 94 of the 95 cases, with one discrepancy (culture-/PCR+). The two diagnosis techniques had identical sensitivity (72%), with culture proving slightly more specific than PCR (98.4% as opposed to 96.9%). Positive prediction values for culture and for PCR were, respectively, 95.6 and 91.3%. Antenatal virus diagnosis on amniotic fluid was negative with both techniques in 8 out of 29 cases of children born with HCMV infection (VPN=89%). Over half of these wrongly negative results can be explained by amniocentesis carried out too early in the pregnancy or too early with respect to the mother's primary infection. PMID:11255097

  5. Circulating human cytomegalovirus-encoded HCMV-miR-US4-1 as an indicator for predicting the efficacy of IFNα treatment in chronic hepatitis B patients

    PubMed Central

    Pan, Yi; Wang, Nan; Zhou, Zhenxian; Liang, Hongwei; Pan, Chaoyun; Zhu, Dihan; Liu, Fenyong; Zhang, Chen-Yu; Zhang, Yujing; Zen, Ke

    2016-01-01

    The efficacy of interferon α (IFNα) therapy for chronic hepatitis B (CHB) patients is about 40% and often associates with adverse side-effects, thus identification of an easy accessible biomarker that can predict the outcome of IFNα treatment for individual CHB patients would be greatly helpful. Recent reports by us and others show that microRNAs encoded by human cytomegalovirus (HCMV) were readily detected in human serum and can interfere with lymphocyte responses required by IFNα therapeutic effect. We thus postulate that differential expression profile of serum HCMV miRNAs in CHB patients may serve as indicator to predict the efficacy of IFNα treatment for CHB patients. Blood was drawn from 56 individual CHB patients prior to IFNα treatment. By quantifying 13 HCMV miRNAs in serum samples, we found that the levels of HCMV-miR-US4-1 and HCMV-miR-UL-148D were significantly higher in IFNα-responsive group than in IFNα-non-responsive group. In a prospective study of 96 new CHB patients, serum level of HCMV-miR-US4-1 alone classified those who were and were not responsive to IFN-α treatment with correct rate of 84.00% and 71.74%, respectively. In conclusion, our results demonstrate that serum HCMV-miR-US4-1 can serve as a novel biomarker for predicting the outcome of IFNα treatment in CHB patients. PMID:26961899

  6. Transcriptional enhancer activity of hr5 requires dual-palindrome half sites that mediate binding of a dimeric form of the baculovirus transregulator IE1.

    PubMed

    Rodems, S M; Friesen, P D

    1995-09-01

    The hr5 enhancer element stimulates early viral transcription and may function as an origin of DNA replication for Autographa californica nuclear polyhedrosis virus (AcMNPV). The smallest functional unit of hr5 is a 28-bp repeat consisting of an imperfect palindrome (28-mer). To identify essential sequences and examine the molecular basis of hr5 activity, the effects of site-directed mutations on transcriptional enhancement by the 28-mer and binding of the AcMNPV transregulator IE1 were investigated. In transfection assays and infections with AcMNPV recombinants, activation of a basal viral promoter required sequences within both halves of the 28-mer. Basal promoter activation also required a critical spacing between these half sites. Mobility shift assays indicated that hr5 probes containing a single 28-mer were bound by in vitro-synthesized IE1. Competition assays using DNA fragments that contained mutated 28-mers demonstrated that both half sites were required for optimal binding of IE1. Similar assays using mutated 28-mer DNAs and nuclear extracts indicated that the relative affinity with which AcMNPV infection-specific proteins bound to the 28-mer was similar to that of in vitro-synthesized IE1. By using a combination of DNA binding and antibody supershift assays, it was demonstrated that IE1 binds to the 28-mer as a dimer. Collectively, these findings support a model in which symmetrical IE1 binding and simultaneous interaction with each half site are required for IE1-mediated transcriptional enhancement by hr5. Thus, sequence-specific binding may be one of the mechanisms by which IE1 directly or indirectly transregulates baculovirus gene expression. PMID:7636981

  7. Anti-human cytomegalovirus activity of cytokines produced by CD4+ T-cell clones specifically activated by IE1 peptides in vitro.

    PubMed Central

    Davignon, J L; Castanié, P; Yorke, J A; Gautier, N; Clément, D; Davrinche, C

    1996-01-01

    The control of latent cytomegalovirus (CMV) infections by the immune system is poorly understood. We have previously shown that CD4+ T cells specific for the human CMV major regulatory protein IE1 are frequent in latently infected healthy blood donors. In order to learn about the possible role of these cells, we have developed IE1-specific CD4+ T-cell clones and, in this study, analyzed their epitope specificity and function in vitro. We measured their cytokine production when stimulated with specific IE1 peptides or whole recombinant IE1 protein. Their cytokine profiles, as deduced from gamma interferon (IFN-gamma), tumor necrosis factor alpha (TNF-alpha), and interleukin-4 (IL-4) and IL-6 production, were of the Th0- and Th1-like phenotypes. Supernatants from IE1-specific clones producing IFN-gamma and TNF-alpha were shown to inhibit CMV replication in U373 MG cells. This effect was due, as found by using cytokine-specific neutralizing antibodies, mostly to IFN-gamma, which was secreted at higher levels than TNF-alpha. To better assess the anti-CMV activity of cytokines, recombinant IFN-gamma and TNF-alpha were used and shown to have a synergistic effect on the inhibition of CMV replication and protein expression. Thus, IE1-specific CD4+ T cells display in vitro anti-CMV activity through cytokine secretion and may play a role in the control of in vivo latent infections. PMID:8642638

  8. HDR syndrome: a follow-up genotype-phenotype analysis of a de novo missense Thr272Ile mutation in exon 4 of GATA3.

    PubMed

    Gomes, T S; Gortner, L; Dockter, G; Leitner, D; Thakker, R V; Rohrer, T

    2012-11-01

    Hypoparathyroidism, sensorineural deafness and renal dysplasia (HDR) syndrome (MIM 146255) is a rare autosomal dominant disorder caused by mutations in the gene encoding GATA3, a dual zinc-finger transcription factor involved in vertebrate embryonic development. In this clinical case study we report on a follow-up of a phenotype associated with a GATA3 mutation. HDR syndrome was clinically diagnosed at age of 1.5 years in a boy with a de novo heterozygous missense (c.815C→T) mutation, Thr272Ile, in exon 4 of the GATA3 gene. Both parents were negative for Thr272Ile.At age of 17 months, the patient had a weight of 10.7, a body length of 78 cm, and a head circumference of 47.5 cm. By the age of 7 years, growth is age-appropriate, severe bilateral hearing loss (dB 60) was corrected by hearing aids. However, cognitive development (auditory sensory me-mory and language abilities) is at the lower ends of the test scores.In conclusion, a mildly impaired clinical course was achieved by the age of 7 years in a patient with HDR syndrome; this report adds to the body of data on genotype-phenotype analysis in HDR syndrome. · PMID:23203342

  9. Controlled crystal dehydration triggers a space-group switch and shapes the tertiary structure of cytomegalovirus immediate-early 1 (IE1) protein.

    PubMed

    Klingl, Stefan; Scherer, Myriam; Stamminger, Thomas; Muller, Yves A

    2015-07-01

    Cytomegalovirus immediate-early 1 (IE1) protein is a key viral effector protein that reprograms host cells. Controlled dehydration experiments with IE1 crystals not only extended their diffraction limit from 2.85 to 2.3 Å resolution but also triggered a monoclinic to tetragonal space-group transition with only minor alterations in the unit-cell parameters. An analysis of the pre-dehydration and post-dehydration crystal structures shows how dehydration rearranges the packing of IE1 molecules to meet the unit-cell constraints of the higher lattice symmetry. The transition from P21 to P43 reduces the number of copies in the asymmetric unit from four to two, and molecules previously related by noncrystallographic symmetry merge into identical crystallographic copies in the tetragonal space group. At the same time, dehydration considerably alters the tertiary structure of one of the two remaining IE1 chains in the asymmetric unit. It appears that this conformational switch is required to compensate for a transition that is assumed to be unfavourable, namely from a highly preferred to a rarely observed space group. At the same time, the dehydration-triggered molecular reshaping could reveal an inherent molecular flexibility that possibly informs on the biological function of IE1, namely on its binding to target proteins from the host cell. PMID:26143921

  10. Glucocorticosteroids trigger reactivation of human cytomegalovirus from latently infected myeloid cells and increase the risk for HCMV infection in D+R+ liver transplant patients

    PubMed Central

    Van Damme, Ellen; Sauviller, Sarah; Lau, Betty; Kesteleyn, Bart; Griffiths, Paul; Burroughs, Andrew; Emery, Vincent; Sinclair, John

    2015-01-01

    Graft rejection in transplant patients is managed clinically by suppressing T-cell function with immunosuppressive drugs such as prednisolone and methylprednisolone. In such immunocompromised hosts, human cytomegalovirus (HCMV) is an important opportunistic pathogen and can cause severe morbidity and mortality. Currently, the effect of glucocorticosteroids (GCSs) on the HCMV life cycle remains unclear. Previous reports showed enhanced lytic replication of HCMV in vitro in the presence of GCSs. In the present study, we explored the implications of steroid exposure on latency and reactivation. We observed a direct effect of several GCSs used in the clinic on the activation of a quiescent viral major immediate-early promoter in stably transfected THP-1 monocytic cells. This activation was prevented by the glucocorticoid receptor (GR) antagonist Ru486 and by shRNA-mediated knockdown of the GR. Consistent with this observation, prednisolone treatment of latently infected primary monocytes resulted in HCMV reactivation. Analysis of the phenotype of these cells showed that treatment with GCSs was correlated with differentiation to an anti-inflammatory macrophage-like cell type. On the basis that these observations may be pertinent to HCMV reactivation in post-transplant settings, we retrospectively evaluated the incidence, viral kinetics and viral load of HCMV in liver transplant patients in the presence or absence of GCS treatment. We observed that combination therapy of baseline prednisolone and augmented methylprednisolone, upon organ rejection, significantly increased the incidence of HCMV infection in the intermediate risk group where donor and recipient are both HCMV seropositive (D+R+) to levels comparable with the high risk D+R− group. PMID:25312585

  11. Glucocorticosteroids trigger reactivation of human cytomegalovirus from latently infected myeloid cells and increase the risk for HCMV infection in D+R+ liver transplant patients.

    PubMed

    Van Damme, Ellen; Sauviller, Sarah; Lau, Betty; Kesteleyn, Bart; Griffiths, Paul; Burroughs, Andrew; Emery, Vincent; Sinclair, John; Van Loock, Marnix

    2015-01-01

    Graft rejection in transplant patients is managed clinically by suppressing T-cell function with immunosuppressive drugs such as prednisolone and methylprednisolone. In such immunocompromised hosts, human cytomegalovirus (HCMV) is an important opportunistic pathogen and can cause severe morbidity and mortality. Currently, the effect of glucocorticosteroids (GCSs) on the HCMV life cycle remains unclear. Previous reports showed enhanced lytic replication of HCMV in vitro in the presence of GCSs. In the present study, we explored the implications of steroid exposure on latency and reactivation. We observed a direct effect of several GCSs used in the clinic on the activation of a quiescent viral major immediate-early promoter in stably transfected THP-1 monocytic cells. This activation was prevented by the glucocorticoid receptor (GR) antagonist Ru486 and by shRNA-mediated knockdown of the GR. Consistent with this observation, prednisolone treatment of latently infected primary monocytes resulted in HCMV reactivation. Analysis of the phenotype of these cells showed that treatment with GCSs was correlated with differentiation to an anti-inflammatory macrophage-like cell type. On the basis that these observations may be pertinent to HCMV reactivation in post-transplant settings, we retrospectively evaluated the incidence, viral kinetics and viral load of HCMV in liver transplant patients in the presence or absence of GCS treatment. We observed that combination therapy of baseline prednisolone and augmented methylprednisolone, upon organ rejection, significantly increased the incidence of HCMV infection in the intermediate risk group where donor and recipient are both HCMV seropositive (D+R+) to levels comparable with the high risk D+R- group. PMID:25312585

  12. US28 Is a Potent Activator of Phospholipase C during HCMV Infection of Clinically Relevant Target Cells

    PubMed Central

    Miller, William E.; Zagorski, William A.; Brenneman, Joanna D.; Avery, Diana; Miller, Jeanette L. C.; O’Connor, Christine M.

    2012-01-01

    Members of the cytomegalovirus family each encode two or more genes with significant homology to G-protein coupled receptors (GPCRs). In rodent models of pathogenesis, these viral encoded GPCRs play functionally significant roles, as their deletion results in crippled viruses that cannot traffic properly and/or replicate in virally important target cells. Of the four HCMV encoded GPCRs, US28 has garnered the most attention due to the fact that it exhibits both agonist-independent and agonist-dependent signaling activity and has been demonstrated to promote cellular migration and proliferation. Thus, it appears that the CMV GPCRs play important roles in viral replication in vivo as well as promote the development of virus-associated pathology. In the current study we have utilized a series of HCMV/US28 recombinants to investigate the expression profile and signaling activities of US28 in a number of cell types relevant to HCMV infection including smooth muscle cells, endothelial cells and cells derived from glioblastoma multiforme (GBM) tumors. The results indicate that US28 is expressed and exhibits constitutive agonist-independent signaling activity through PLC-β in all cell types tested. Moreover, while CCL5/RANTES and CX3CL1/Fractalkine both promote US28-dependent Ca++ release in smooth muscle cells, this agonist-dependent effect appears to be cell-specific as we fail to detect US28 driven Ca++ release in the GBM cells. We have also investigated the effects of US28 on signaling via endogenous GPCRs including those in the LPA receptor family. Our data indicate that US28 can enhance signaling via endogenous LPA receptors. Taken together, our results indicate that US28 induces a variety of signaling events in all cell types tested suggesting that US28 signaling likely plays a significant role during HCMV infection and dissemination in vivo. PMID:23209769

  13. IL-12–producing monocytes and HLA-E control HCMV-driven NKG2C+ NK cell expansion

    PubMed Central

    Rölle, Alexander; Pollmann, Julia; Ewen, Eva-Maria; Le, Vu Thuy Khanh; Halenius, Anne; Hengel, Hartmut; Cerwenka, Adelheid

    2014-01-01

    Human cytomegalovirus (HCMV) infection is the most common cause of congenital viral infections and a major source of morbidity and mortality after organ transplantation. NK cells are pivotal effector cells in the innate defense against CMV. Recently, hallmarks of adaptive responses, such as memory-like features, have been recognized in NK cells. HCMV infection elicits the expansion of an NK cell subset carrying an activating receptor heterodimer, comprising CD94 and NKG2C (CD94/NKG2C), a response that resembles the clonal expansion of adaptive immune cells. Here, we determined that expansion of this NKG2C+ subset and general NK cell recovery rely on signals derived from CD14+ monocytes. In a coculture system, a subset of CD14+ cells with inflammatory monocyte features produced IL-12 in response to HCMV-infected fibroblasts, and neutralization of IL-12 in this model substantially reduced CD25 upregulation and NKG2C+ subset expansion. Finally, blockade of CD94/NKG2C on NK cells or silencing of the cognate ligand HLA-E in infected fibroblasts greatly impaired expansion of NKG2C+ NK cells. Together, our results reveal that IL-12, CD14+ cells, and the CD94/NKG2C/HLA-E axis are critical for the expansion of NKG2C+ NK cells in response to HCMV infection. Moreover, strategies targeting the NKG2C+ NK cell subset have the potential to be exploited in NK cell–based intervention strategies against viral infections and cancer. PMID:25384219

  14. The HCMV gH/gL/UL128-131 Complex Triggers the Specific Cellular Activation Required for Efficient Viral Internalization into Target Monocytes

    PubMed Central

    Nogalski, Maciej T.; Chan, Gary C. T.; Stevenson, Emily V.; Collins-McMillen, Donna K.; Yurochko, Andrew D.

    2013-01-01

    We have established that HCMV acts as a specific ligand engaging and activating cellular integrins on monocytes. As a result, integrin signaling via Src activation leads to the functional activation of paxillin required for efficient viral entry and for the biological changes in monocytes needed for viral dissemination. These biological/molecular changes allow HCMV to use monocytes as “vehicles” for systemic spread and the establishment of lifelong persistence. However, it remains unresolved how HCMV specifically induces this observed monocyte activation. It was previously demonstrated that the HCMV gH/gL/UL128-131 glycoprotein complex facilitates viral entry into biologically relevant cell types. Nevertheless, the mechanism by which the gH/gL/UL128-131 complex promotes this process is unknown. We now show that only HCMV virions possessing the gH/gL/UL128-131 complex are capable of activating integrin/Src/paxillin-signaling in monocytes. In fibroblasts, this signaling is reversed, such that virus lacking the gH/gL/UL128-131 complex is the only virus able to induce the paxillin activation cascade. The presence of the gH/gL/UL128-131 complex also may have an inhibitory effect on integrin-mediated signaling pathway in fibroblasts. Furthermore, we demonstrate that the presence of the gH/gL/UL128-131 complex on the viral envelope, through its activation of the integrin/Src/paxillin pathway, is necessary for efficient HCMV internalization into monocytes and that appropriate actin and dynamin regulation is critical for this entry process. Importantly, productive infection in monocyte-derived macrophages was seen only in cells exposed to HCMV expressing the gH/gL/UL128-131 complex. From our data, the HCMV gH/gL/U128-131 complex emerges as the specific ligand driving the activation of the receptor-mediated signaling required for the regulation of the actin cytoskeleton and, consequently, for efficient and productive internalization of HCMV into monocytes. To our

  15. Humoral immune response against human cytomegalovirus (HCMV)-specific proteins after HCMV infection in lung transplantation as detected with recombinant and naturally occurring proteins.

    PubMed Central

    van Zanten, J; Harmsen, M C; van der Giessen, M; van der Bij, W; Prop, J; de Leij, L; The, T H

    1995-01-01

    The humoral immune response to four intracellularly located cytomegalovirus (CMV) proteins was studied in 15 lung transplant recipients experiencing active CMV infections. Five patients had primary infections, and 10 had secondary infections. Antibodies of the immunoglobulin M (IgM) and IgG classes were measured in an enzyme-linked immunosorbent assay (ELISA) system in which procaryotically expressed recombinant proteins were used as a substrate and also in a monoclonal antibody-based capture ELISA which uses naturally occurring proteins as a substrate. The proteins investigated were the lower matrix protein pp65 (ppUL83), the major DNA-binding protein p52 (ppUL44), and the two immediate early proteins IE1 and IE2 (different splicing products of UL123). Higher levels of antibodies were found to pp65 and especially to p52 than to the immediate early antigens. Antibody levels detected in the recombinant protein-based ELISAs were generally lower than antibody responses detected with the matching antigen capture ELISA. Moreover, some patients appeared to have antibodies mainly to epitopes present on naturally occurring proteins. The antibody responses detected in both assays were related to the viral load during infection as assessed by the CMV antigenemia test, which is a quantitative marker for CMV load. It was found that although epitopes on naturally occurring proteins induce higher antibody responses and responses in more patients, antibodies directed to epitopes present on the recombinant proteins were inversely related to the viral load during a CMV infection. Therefore, antibodies to epitopes on the recombinant proteins might be more clinically relevant in this group of lung transplant recipients. PMID:7535179

  16. Structural and biochemical studies of HCMV gH/gL/gO and Pentamer reveal mutually exclusive cell entry complexes

    PubMed Central

    Ciferri, Claudio; Chandramouli, Sumana; Donnarumma, Danilo; Nikitin, Pavel A.; Cianfrocco, Michael A.; Gerrein, Rachel; Feire, Adam L.; Barnett, Susan W.; Lilja, Anders E.; Rappuoli, Rino; Norais, Nathalie; Settembre, Ethan C.; Carfi, Andrea

    2015-01-01

    Human cytomegalovirus (HCMV) is a major cause of morbidity and mortality in transplant patients and the leading viral cause of birth defects after congenital infection. The glycoprotein complexes gH/gL/gO and gH/gL/UL128/UL130/UL131A (Pentamer) are key targets of the human humoral response against HCMV and are required for HCMV entry into fibroblasts and endothelial/epithelial cells, respectively. We expressed and characterized soluble forms of gH/gL, gH/gL/gO, and Pentamer. Mass spectrometry and mutagenesis analysis revealed that gL-Cys144 forms disulfide bonds with gO-Cys351 in gH/gL/gO and with UL128-Cys162 in the Pentamer. Notably, Pentamer harboring the UL128-Cys162Ser/gL-Cys144Ser mutations had impaired syncytia formation and reduced interference of HCMV entry into epithelial cells. Electron microscopy analysis showed that HCMV gH/gL resembles HSV gH/gL and that gO and UL128/UL130/UL131A bind to the same site at the gH/gL N terminus. These data are consistent with gH/gL/gO and Pentamer forming mutually exclusive cell entry complexes and reveal the overall location of gH/gL-, gH/gL/gO-, and Pentamer-specific neutralizing antibody binding sites. Our results provide, to our knowledge, the first structural view of gH/gL/gO and Pentamer supporting the development of vaccines and antibody therapeutics against HCMV. PMID:25624487

  17. 3D Analysis of HCMV Induced-Nuclear Membrane Structures by FIB/SEM Tomography: Insight into an Unprecedented Membrane Morphology

    PubMed Central

    Villinger, Clarissa; Neusser, Gregor; Kranz, Christine; Walther, Paul; Mertens, Thomas

    2015-01-01

    We show that focused ion beam/scanning electron microscopy (FIB/SEM) tomography is an excellent method to analyze the three-dimensional structure of a fibroblast nucleus infected with human cytomegalovirus (HCMV). We found that the previously described infoldings of the inner nuclear membrane, which are unique among its kind, form an extremely complex network of membrane structures not predictable by previous two-dimensional studies. In all cases they contained further invaginations (2nd and 3rd order infoldings). Quantification revealed 5498 HCMV capsids within two nuclear segments, allowing an estimate of 15,000 to 30,000 capsids in the entire nucleus five days post infection. Only 0.8% proved to be enveloped capsids which were exclusively detected in 1st order infoldings (perinuclear space). Distribution of the capsids between 1st, 2nd and 3rd order infoldings is in complete agreement with the envelopment/de-envelopment model for egress of HCMV capsids from the nucleus and we confirm that capsid budding does occur at the large infoldings. Based on our results we propose the pushing membrane model: HCMV infection induces local disruption of the nuclear lamina and synthesis of new membrane material which is pushed into the nucleoplasm, forming complex membrane infoldings in a highly abundant manner, which then may be also used by nucleocapsids for budding. PMID:26556360

  18. 3D Analysis of HCMV Induced-Nuclear Membrane Structures by FIB/SEM Tomography: Insight into an Unprecedented Membrane Morphology.

    PubMed

    Villinger, Clarissa; Neusser, Gregor; Kranz, Christine; Walther, Paul; Mertens, Thomas

    2015-11-01

    We show that focused ion beam/scanning electron microscopy (FIB/SEM) tomography is an excellent method to analyze the three-dimensional structure of a fibroblast nucleus infected with human cytomegalovirus (HCMV). We found that the previously described infoldings of the inner nuclear membrane, which are unique among its kind, form an extremely complex network of membrane structures not predictable by previous two-dimensional studies. In all cases they contained further invaginations (2nd and 3rd order infoldings). Quantification revealed 5498HCMV capsids within two nuclear segments, allowing an estimate of 15,000 to 30,000 capsids in the entire nucleus five days post infection. Only 0.8% proved to be enveloped capsids which were exclusively detected in 1st order infoldings (perinuclear space). Distribution of the capsids between 1st, 2nd and 3rd order infoldings is in complete agreement with the envelopment/de-envelopment model for egress of HCMV capsids from the nucleus and we confirm that capsid budding does occur at the large infoldings. Based on our results we propose the pushing membrane model: HCMV infection induces local disruption of the nuclear lamina and synthesis of new membrane material which is pushed into the nucleoplasm, forming complex membrane infoldings in a highly abundant manner, which then may be also used by nucleocapsids for budding. PMID:26556360

  19. HCMV vCXCL1 Binds Several Chemokine Receptors and Preferentially Attracts Neutrophils over NK Cells by Interacting with CXCR2.

    PubMed

    Yamin, Rachel; Lecker, Laura S M; Weisblum, Yiska; Vitenshtein, Alon; Le-Trilling, Vu Thuy Khanh; Wolf, Dana G; Mandelboim, Ofer

    2016-05-17

    HCMV is a highly sophisticated virus that has developed various mechanisms for immune evasion and viral dissemination throughout the body (partially mediated by neutrophils). NK cells play an important role in elimination of HCMV-infected cells. Both neutrophils and NK cells utilize similar sets of chemokine receptors to traffic, to and from, various organs. However, the mechanisms by which HCMV attracts neutrophils and not NK cells are largely unknown. Here, we show a unique viral protein, vCXCL1, which targets three chemokine receptors: CXCR1 and CXCR2 expressed on neutrophils and CXCR1 and CX3CR1 expressed on NK cells. Although vCXCL1 attracted both cell types, neutrophils migrated faster and more efficiently than NK cells through the binding of CXCR2. Therefore, we propose that HCMV has developed vCXCL1 to orchestrate its rapid systemic dissemination through preferential attraction of neutrophils and uses alternative mechanisms to counteract the later attraction of NK cells. PMID:27160907

  20. Plasma membrane profiling defines an expanded class of cell surface proteins selectively targeted for degradation by HCMV US2 in cooperation with UL141.

    PubMed

    Hsu, Jye-Lin; van den Boomen, Dick J H; Tomasec, Peter; Weekes, Michael P; Antrobus, Robin; Stanton, Richard J; Ruckova, Eva; Sugrue, Daniel; Wilkie, Gavin S; Davison, Andrew J; Wilkinson, Gavin W G; Lehner, Paul J

    2015-04-01

    Human cytomegalovirus (HCMV) US2, US3, US6 and US11 act in concert to prevent immune recognition of virally infected cells by CD8+ T-lymphocytes through downregulation of MHC class I molecules (MHC-I). Here we show that US2 function goes far beyond MHC-I degradation. A systematic proteomic study using Plasma Membrane Profiling revealed US2 was unique in downregulating additional cellular targets, including: five distinct integrin α-chains, CD112, the interleukin-12 receptor, PTPRJ and thrombomodulin. US2 recruited the cellular E3 ligase TRC8 to direct the proteasomal degradation of all its targets, reminiscent of its degradation of MHC-I. Whereas integrin α-chains were selectively degraded, their integrin β1 binding partner accumulated in the ER. Consequently integrin signaling, cell adhesion and migration were strongly suppressed. US2 was necessary and sufficient for degradation of the majority of its substrates, but remarkably, the HCMV NK cell evasion function UL141 requisitioned US2 to enhance downregulation of the NK cell ligand CD112. UL141 retained CD112 in the ER from where US2 promoted its TRC8-dependent retrotranslocation and degradation. These findings redefine US2 as a multifunctional degradation hub which, through recruitment of the cellular E3 ligase TRC8, modulates diverse immune pathways involved in antigen presentation, NK cell activation, migration and coagulation; and highlight US2's impact on HCMV pathogenesis. PMID:25875600

  1. Plasma Membrane Profiling Defines an Expanded Class of Cell Surface Proteins Selectively Targeted for Degradation by HCMV US2 in Cooperation with UL141

    PubMed Central

    Antrobus, Robin; Stanton, Richard J.; Ruckova, Eva; Sugrue, Daniel; Wilkie, Gavin S.; Davison, Andrew J.; Wilkinson, Gavin W. G.; Lehner, Paul J.

    2015-01-01

    Human cytomegalovirus (HCMV) US2, US3, US6 and US11 act in concert to prevent immune recognition of virally infected cells by CD8+ T-lymphocytes through downregulation of MHC class I molecules (MHC-I). Here we show that US2 function goes far beyond MHC-I degradation. A systematic proteomic study using Plasma Membrane Profiling revealed US2 was unique in downregulating additional cellular targets, including: five distinct integrin α-chains, CD112, the interleukin-12 receptor, PTPRJ and thrombomodulin. US2 recruited the cellular E3 ligase TRC8 to direct the proteasomal degradation of all its targets, reminiscent of its degradation of MHC-I. Whereas integrin α-chains were selectively degraded, their integrin β1 binding partner accumulated in the ER. Consequently integrin signaling, cell adhesion and migration were strongly suppressed. US2 was necessary and sufficient for degradation of the majority of its substrates, but remarkably, the HCMV NK cell evasion function UL141 requisitioned US2 to enhance downregulation of the NK cell ligand CD112. UL141 retained CD112 in the ER from where US2 promoted its TRC8-dependent retrotranslocation and degradation. These findings redefine US2 as a multifunctional degradation hub which, through recruitment of the cellular E3 ligase TRC8, modulates diverse immune pathways involved in antigen presentation, NK cell activation, migration and coagulation; and highlight US2’s impact on HCMV pathogenesis. PMID:25875600

  2. HCMV Infection of Human Trophoblast Progenitor Cells of the Placenta Is Neutralized by a Human Monoclonal Antibody to Glycoprotein B and Not by Antibodies to the Pentamer Complex

    PubMed Central

    Zydek, Martin; Petitt, Matthew; Fang-Hoover, June; Adler, Barbara; Kauvar, Lawrence M.; Pereira, Lenore; Tabata, Takako

    2014-01-01

    Human cytomegalovirus (HCMV) is the major viral cause of congenital infection and birth defects. Primary maternal infection often results in virus transmission, and symptomatic babies can have permanent neurological deficiencies and deafness. Congenital infection can also lead to intrauterine growth restriction, a defect in placental transport. HCMV replicates in primary cytotrophoblasts (CTBs), the specialized cells of the placenta, and inhibits differentiation/invasion. Human trophoblast progenitor cells (TBPCs) give rise to the mature cell types of the chorionic villi, CTBs and multi-nucleated syncytiotrophoblasts (STBs). Here we report that TBPCs are fully permissive for pathogenic and attenuated HCMV strains. Studies with a mutant virus lacking a functional pentamer complex (gH/gL/pUL128-131A) showed that virion entry into TBPCs is independent of the pentamer. In addition, infection is blocked by a potent human neutralizing monoclonal antibody (mAb), TRL345, reactive with glycoprotein B (gB), but not mAbs to the pentamer proteins pUL130/pUL131A. Functional studies revealed that neutralization of infection preserved the capacity of TBPCs to differentiate and assemble into trophospheres composed of CTBs and STBs in vitro. Our results indicate that mAbs to gB protect trophoblast progenitors of the placenta and could be included in antibody treatments developed to suppress congenital infection and prevent disease. PMID:24651029

  3. Antigenic Characterization of the HCMV gH/gL/gO and Pentamer Cell Entry Complexes Reveals Binding Sites for Potently Neutralizing Human Antibodies

    PubMed Central

    Ciferri, Claudio; Chandramouli, Sumana; Leitner, Alexander; Donnarumma, Danilo; Cianfrocco, Michael A.; Gerrein, Rachel; Friedrich, Kristian; Aggarwal, Yukti; Palladino, Giuseppe; Aebersold, Ruedi; Norais, Nathalie; Settembre, Ethan C.; Carfi, Andrea

    2015-01-01

    Human Cytomegalovirus (HCMV) is a major cause of morbidity and mortality in transplant patients and in fetuses following congenital infection. The glycoprotein complexes gH/gL/gO and gH/gL/UL128/UL130/UL131A (Pentamer) are required for HCMV entry in fibroblasts and endothelial/epithelial cells, respectively, and are targeted by potently neutralizing antibodies in the infected host. Using purified soluble forms of gH/gL/gO and Pentamer as well as a panel of naturally elicited human monoclonal antibodies, we determined the location of key neutralizing epitopes on the gH/gL/gO and Pentamer surfaces. Mass Spectrometry (MS) coupled to Chemical Crosslinking or to Hydrogen Deuterium Exchange was used to define residues that are either in proximity or part of neutralizing epitopes on the glycoprotein complexes. We also determined the molecular architecture of the gH/gL/gO- and Pentamer-antibody complexes by Electron Microscopy (EM) and 3D reconstructions. The EM analysis revealed that the Pentamer specific neutralizing antibodies bind to two opposite surfaces of the complex, suggesting that they may neutralize infection by different mechanisms. Together, our data identify the location of neutralizing antibodies binding sites on the gH/gL/gO and Pentamer complexes and provide a framework for the development of antibodies and vaccines against HCMV. PMID:26485028

  4. Real-time analysis of the transcriptional regulation of HIV and hCMV promoters in single mammalian cells.

    PubMed

    White, M R; Masuko, M; Amet, L; Elliott, G; Braddock, M; Kingsman, A J; Kingsman, S M

    1995-02-01

    The regulation of human cytomegalovirus (hCMV) and human immunodeficiency virus (HIV) gene expression has been studied in single intact mammalian cells. Viral promoters were placed upstream of the firefly luciferase reporter gene and the resulting hybrid reporter constructs were stably integrated into the HeLa cell genome. A highly sensitive photon-counting camera system was used to study the level of gene expression in single intact cells. Luciferase expression was studied in the absence of activators of viral gene expression, in the presence of the HIV-1 TAT transactivator protein, or in the presence of sodium butyrate, a non-viral activator of gene expression. In the absence of any activator of gene expression, while expression was undetectable in most cells, significant levels of basal luciferase activity were observed in a few cells, indicating heterogeneity in gene expression in the cell population. In the presence of the general activator of viral gene expression, sodium butyrate, transcriptional activation from the viral promoters gave rise to significant and relatively homogeneous levels of luciferase expression in a majority of cells. The luciferase imaging technology was used for the real-time analysis of changes of gene expression within a single cell. This non-invasive reporter assay should become important for studies of the temporal regulation of gene expression in single cells. PMID:7768992

  5. EBV, HCMV, HHV6, and HHV7 Screening in Bone Marrow Samples from Children with Acute Lymphoblastic Leukemia

    PubMed Central

    Morales-Sánchez, A.; Pompa-Mera, E. N.; Fajardo-Gutiérrez, A.; Alvarez-Rodríguez, F. J.; Bekker-Méndez, V. C.; Flores-Chapa, J. de Diego; Flores-Lujano, J.; Jiménez-Hernández, E.; Peñaloza-González, J. G.; Rodríguez-Zepeda, M. C.; Torres-Nava, J. R.; Velázquez-Aviña, M. M.; Amador-Sánchez, R.; Alvarado-Ibarra, M.; Reyes-Zepeda, N.; Espinosa-Elizondo, R. M.; Pérez-Saldivar, M. L.; Núñez-Enríquez, J. C.; Mejía-Aranguré, J. M.; Fuentes-Pananá, E. M.

    2014-01-01

    Acute lymphoblastic leukemia (ALL) is the most common cancer in childhood worldwide and Mexico has reported one of the highest incidence rates. An infectious etiology has been suggested and supported by epidemiological evidences; however, the identity of the involved agent(s) is not known. We considered that early transmitted lymphotropic herpes viruses were good candidates, since transforming mechanisms have been described for them and some are already associated with human cancers. In this study we interrogated the direct role of EBV, HCMV, HHV6, and HHV7 human herpes viruses in childhood ALL. Viral genomes were screened in 70 bone marrow samples from ALL patients through standard and a more sensitive nested PCR. Positive samples were detected only by nested PCR indicating a low level of infection. Our result argues that viral genomes were not present in all leukemic cells, and, hence, infection most likely was not part of the initial genetic lesions leading to ALL. The high statistical power of the study suggested that these agents are not involved in the genesis of ALL in Mexican children. Additional analysis showed that detected infections or coinfections were not associated with prognosis. PMID:25309913

  6. Inhibition of IL-1β Transcription by Peptides Derived from the hCMV IE2 Transactivator

    PubMed Central

    Listman, James; Race, JoAnne E.; Walker-Kopp, Nancy; Unlu, Sebnem; Auron, Philip E.

    2008-01-01

    The immediate early (IE) proteins of human cytomegalovirus (hCMV) have diverse roles in directing viral and host cell transcription. Among these is the ability of IE2 to induce transcription of the IL1B gene that codes for IL-1β in monocytes. This function is partially explained by interaction between IE2 and the host cell transcription factor Spi-1/PU.1 (Spi-1). We now show that maximal IE2 function also depends on productive interactions localizing to two C/EBP sites on the IL1B promoter suggesting either bi- or tri-molecular interactions between IE2, Spi-1 and C/EBPβ at two different locations on the promoter. The IE2 interaction region on Spi-1 was previously mapped to the DNA-binding ETS domain and overlaps the region of Spi-1 that interacts with the transcription factor C/EBPβ, a factor known to be critical for the induction of IL1B in response to Toll/IL-1 receptor (TIR) family signal transduction. The Spi-1 interacting region of IE2 maps to amino acids 315–328, a sequence that also interacts with the bZIP domain of C/EBPβ. An expression vector coding for amino acids 291–364 of IE2 can suppress LPS induction of a cotransfected IL1B enhancer-promoter fragment in a monocyte cell line. This inhibition is likely the result of competition between Spi-1 and C/EBPβ, thus blunting gene induction. PMID:18308397

  7. Protein and DNA elements involved in transactivation of the promoter of the bovine herpesvirus (BHV) 1 IE-1 transcription unit by the BHV alpha gene trans-inducing factor.

    PubMed Central

    Misra, V; Bratanich, A C; Carpenter, D; O'Hare, P

    1994-01-01

    In herpes simplex virus (HSV)-infected cells, the transcription of immediate-early (alpha) genes is regulated by a virion component, the alpha gene trans-inducing factor (alpha TIF). This protein forms a complex with cellular factors and TAATGARAT motifs present in one or more copies in the promoters of all alpha genes. We have characterized the bovine herpesvirus 1 (BHV-1) homolog of this protein. Like its HSV counterpart, the BHV alpha TIF was synthesized in the later stages of infection and could be demonstrated to be a component of purified virions. In transient expression assays, BHV alpha TIF was a strong transactivator and stimulated the activity of IE-1, the major BHV-1 alpha gene promoter, with an efficiency comparable to that of HSV alpha TIF. This stimulation was largely dependent on a TAATGAGCT sequence present in a single copy in IE-1, and BHV alpha TIF, in conjunction with cellular factors, formed a complex with oligonucleotides containing this sequence. Despite these similarities between the two alpha TIFs, our preliminary observations suggest that the proteins may activate transcription by different mechanisms. Although BHV alpha TIF strongly transactivated IE-1, it differed from its HSV counterpart in that the carboxyl terminus of BHV alpha TIF, when fused to the DNA-binding domain of GAL4, was a relatively poor stimulator of a promoter containing GAL4-binding sites. Also unlike HSV alpha TIF, removal of the carboxyl terminus of BHV alpha TIF reduced but did not eliminate the ability of the protein to transactivate IE-1. These results are discussed in view of the structural similarities and differences among the alpha TIFs of alphaherpes-viruses. Images PMID:8035488

  8. Microgravity Analogues of Herpes Virus Pathogenicity: Human Cytomegalovirus (hCMV) and Varicella Zoster (VZV) Infectivity in Human Tissue Like Assemblies (TLAs)

    NASA Technical Reports Server (NTRS)

    Goodwin, T. J.; McCarthy, M.; Albrecht, T.; Cohrs, R.

    2009-01-01

    The old adage we are our own worst enemies may perhaps be the most profound statement ever made when applied to man s desire for extraterrestrial exploration and habitation of Space. Consider the immune system protects the integrity of the entire human physiology and is comprised of two basic elements the adaptive or circulating and the innate immune system. Failure of the components of the adaptive system leads to venerability of the innate system from opportunistic microbes; viral, bacteria, and fungal, which surround us, are transported on our skin, and commonly inhabit the human physiology as normal and imunosuppressed parasites. The fine balance which is maintained for the preponderance of our normal lives, save immune disorders and disease, is deregulated in microgravity. Thus analogue systems to study these potential Risks are essential for our progress in conquering Space exploration and habitation. In this study we employed two known physiological target tissues in which the reactivation of hCMV and VZV occurs, human neural and lung systems created for the study and interaction of these herpes viruses independently and simultaneously on the innate immune system. Normal human neural and lung tissue analogues called tissue like assemblies (TLAs) were infected with low MOIs of approximately 2 x 10(exp -5) pfu hCMV or VZV and established active but prolonged low grade infections which spanned .7-1.5 months in length. These infections were characterized by the ability to continuously produce each of the viruses without expiration of the host cultures. Verification and quantification of viral replication was confirmed via RT_PCR, IHC, and confocal spectral analyses of the respective essential viral genomes. All host TLAs maintained the ability to actively proliferate throughout the entire duration of the experiments as is analogous to normal in vivo physiological conditions. These data represent a significant advance in the ability to study the triggering

  9. Co-expression of four baculovirus proteins, IE1, LEF3, P143, and PP31, elicits a cellular chromatin-containing reticulate structure in the nuclei of uninfected cells

    SciTech Connect

    Nagamine, Toshihiro; Abe, Atsushi; Suzuki, Takehiro; Dohmae, Naoshi; Matsumoto, Shogo

    2011-08-15

    Baculovirus DNA replication, transcription, and nucleocapsid assembly occur within a subnuclear structure called the virogenic stroma (VS) that consists of two subcompartments. Specific components of the VS sub-compartments have not been identified except for PP31, a DNA-binding protein that localizes specifically to the electron-dense region of VS. Here, we investigate the dynamic structure of VS using a GFP-tagged PP31 molecule (GFP-PP31). GFP-PP31 localizes to the VS throughout the course of infection. At later times post-infection, a PP31 reticulum distributed within VS was also apparent, indicating that VS sub-compartments compose a reticulate structure. Transient expression of PP31 with the viral proteins, IE1, LEF3, and P143, in uninfected cells resulted in the formation of a reticulate structure containing cellular chromatin and the spatial arrangements of the four proteins within the induced reticulum were the same as those within VS reticulum, suggesting that the two reticula are formed by a similar mechanism.

  10. Members of the HCMV US12 family of predicted heptaspanning membrane proteins have unique intracellular distributions, including association with the cytoplasmic virion assembly complex

    SciTech Connect

    Das, Subhendu; Pellett, Philip E. . E-mail: pelletp@ccf.org

    2007-05-10

    The human cytomegalovirus (HCMV) US12 gene family is a group of 10 predicted seven-transmembrane domain proteins that have some features in common with G-protein-coupled receptors. Little is known of their patterns of expression, localization, or functional interactions. Here, we studied the intracellular localization of three US12 family members, US14, US17, and US18, with respect to various intracellular markers and the cytoplasmic virion assembly compartment (AC). The three proteins have distinct patterns of expression, which include associations with the AC. US14 is often distributed in a uniform granular manner throughout the cytoplasm, concentrating in the AC in some cells. US17 is expressed in a segmented manner, with its N-terminal domain localizing to the periphery of what we show here to be the AC and the C-terminal domain localizing to nuclei and the cytoplasm [Das, S., Skomorovska-Prokvolit, Y., Wang, F. Z., Pellett, P.E., 2006. Infection-dependent nuclear localization of US17, a member of the US12 family of human cytomegalovirus-encoded seven-transmembrane proteins. J. Virol. 80, 1191-1203]. Here, we show that the C-terminal domain is present at the center of the AC, in close association with markers of early endosomes; the N-terminal staining corresponds to an area stained by markers for the Golgi and trans-Golgi. US18 is distributed throughout the cytoplasm, concentrating in the AC at later stages of infection; it is localized more to the periphery of the AC than are US14 and US17C, in association with markers of the trans-Golgi. Although not detected in virions, their structures and localization in various zones within the AC suggest possible roles for these proteins in the process of virion maturation and egress.

  11. Repertoire, diversity, and differentiation of specific CD8 T cells are associated with immune protection against human cytomegalovirus disease.

    PubMed

    Sacre, Karim; Carcelain, Guislaine; Cassoux, Nathalie; Fillet, Anne-Marie; Costagliola, Dominique; Vittecoq, Daniel; Salmon, Dominique; Amoura, Zahir; Katlama, Christine; Autran, Brigitte

    2005-06-20

    To determine the correlates of immune recovery from active human CMV (HCMV) disease, we compared the antigenic repertoire, diversity, magnitude, and differentiation of HCMV-specific CD8+ T cells in HIV-HCMV coinfected subjects with no, cured, or active HCMV disease and in healthy HIV-negative HCMV-positive controls. ELISPOT-IFN-gamma assays using peptide pools spanning the pp65 and immediate early 1 (IE1) HCMV proteins showed that HCMV-specific CD8+ T cells had a significantly broader antigenic repertoire and greater diversity in HIV-positive patients controlling HCMV replication than in those with active HCMV disease, but the magnitude of the CD8 T cell response did not differ between the different groups. HCMV-specific T cells mainly were focused against IE1 during the short-term recovery from retinitis, and switched toward pp65 during long-term recovery. HCMV-specific T cells displaying an "early" (CD8+CD27+CD28+) and "intermediate" (CD8+CD27-CD28+) differentiation phenotype were increased significantly during long-term recovery compared with other HIV-positive patients and were nearly undetectable during active HCMV disease. HCMV-specific T cells with a "late" (CD8+CD27-28-) differentiation phenotype predominated in all cases. Therefore, restoration of immune protection against HCMV after active HCMV disease in immunodeficient individuals is associated with enlarged repertoire and diversity, and with early differentiation of virus-specific CD8+ T cells, thus defining immune correlates of protection against diseases caused by persistent viruses. PMID:15967826

  12. A Diverse Repertoire of CD4 T Cells Targets the Immediate-Early 1 Protein of Human Cytomegalovirus

    PubMed Central

    Ameres, Stefanie; Liang, Xiaoling; Wiesner, Martina; Mautner, Josef; Moosmann, Andreas

    2015-01-01

    T-cell responses to the immediate-early 1 (IE-1) protein of human cytomegalovirus (HCMV) are associated with protection from viral disease. Thus, IE-1 is a promising target for immunotherapy. CD8 T-cell responses to IE-1 are generally strong. In contrast, CD4 T-cell responses to IE-1 were described to be comparatively infrequent or undetectable in HCMV carriers, and information on their target epitopes and their function has been limited. To analyze the repertoire of IE-1-specific CD4 T cells, we expanded them from healthy donors with autologous IE-1-expressing mini-Epstein–Barr virus-transformed B-cell lines and established IE-1-specific CD4 T-cell clones. Clones from seven out of seven HCMV-positive donors recognized endogenously processed IE-1 epitopes restricted through HLA-DR, DQ, or DP. Three to seven IE-1 epitopes were recognized per donor. Cumulatively, about 27 different HLA/peptide class II complexes were recognized by 117 IE-1-specific clones. Our results suggest that a highly diversified repertoire of IE-1-specific CD4 T cells targeting multiple epitopes is usually present in healthy HCMV carriers. Therefore, multiepitope approaches to immunomonitoring and immunotherapy will make optimal use of this potentially important class of HCMV-specific effector cells. PMID:26635812

  13. Single Chain Antibodies Against gp55 of Human Cytomegalovirus (HCMV) for Prophylaxis and Treatment of HCMV Infections

    PubMed Central

    Moazen, Bahareh; Ebrahimi, Elahe; Nejatollahi, Foroogh

    2016-01-01

    Background: Immunotherapy is a promising prospective new treatment for cytomegalovirus (CMV) infections. Neutralizing effects have been reported using monoclonal antibodies. Recombinant single chain antibodies (scFvs) due to their advantages over monoclonal antibodies are potential alternatives and provide valuable clinical agents. Objectives: The aim of this study was to select specific single chain antibodies against gp55 of CMV and to evaluate their neutralizing effects. In the present study, we selected specific single chain antibodies against glycoprotein 55 (gp55) of CMV for their use in treatment and diagnosis. Materials and Methods: Single chain antibodies specific against an epitope located in the C-terminal part of gp55 were selected from a phage antibody display library. After four rounds of panning, twenty clones were amplified by the polymerase chain reaction (PCR) and fingerprinted by MvaI restriction enzyme. The reactivities of the specific clones were tested by the enzyme-linked immunosorbent assay (ELISA) and the neutralizing effects were evaluated by the plaque reduction assay. Results: Fingerprinting of selected clones revealed three specific single chain antibodies (scFv1, scFv2 and scFv3) with frequencies 25%, 20 and 20%. The clones produced positive ELISA with the corresponding peptide. The percentages of plaque reduction for scFv1, scFv2 and scFv3 were 23.7, 68.8 and 11.6, respectively. Conclusions: Gp55 of human CMV is considered as an important candidate for immunotherapy. In this study, we selected three specific clones against gp55. The scFvs reacted only with the corresponding peptide in a positive ELISA. The scFv2 with 68.8% neutralizing effect showed the potential to be considered for prophylaxis and treatment of CMV infections, especially in solid organ transplant recipients, for whom treatment of CMV is urgently needed. The scFv2 with neutralizing effect of 68.8%, has the potential to be considered for treatment of these patients. The specific scFv1 and scFv3 with lower neutralizing effects can be used for diagnostic purposes. PMID:27217918

  14. Fine specificity of cellular immune responses in humans to human cytomegalovirus immediate-early 1 protein.

    PubMed Central

    Alp, N J; Allport, T D; Van Zanten, J; Rodgers, B; Sissons, J G; Borysiewicz, L K

    1991-01-01

    Cell-mediated immunity is important in maintaining the virus-host equilibrium in persistent human cytomegalovirus (HCMV) infection. The HCMV 72-kDa major immediate early 1 protein (IE1) is a target for CD8+ cytotoxic T cells in humans, as is the equivalent 89-kDa protein in mouse. Less is known about responses against this protein by CD4+ T cells, which may be important as direct effector cells or helper cells for antibody and CD8+ responses. Proliferative-T-cell responses to HCMV IE1 were studied in normal seropositive subjects. Peripheral blood mononuclear cells from 85% of seropositive subjects proliferated in response to HCMV from infected fibroblasts, and of these, 73% responded to recombinant baculovirus IE1. Responding cells were predominantly CD3+ CD4+. IE1 antigen preparations, including baculovirus recombinant protein, transfected rat cell nuclei, and synthetic peptides, induced IE1-specific T-cell lines which cross-reacted between the preparations. The fine specificity of these IE1-specific T-cell lines was studied by using overlapping synthetic peptides encompassing the entire sequence of the IE1 protein. The regions of the IE1 molecule recognized were identified and these varied between individuals, possibly reflecting differences in major histocompatibility complex (MHC) class II haplotype. In one subject, the peptide specificities of proliferative and MHC class I-restricted cytotoxic determinants on IE1 were spatially distinct. Thus, no single immunodominant T-cell determinant within HCMV IE1 was identified, suggesting that multiple peptides or a region of the 72-kDa IE1 protein would be required to induce specific T-cell responses in humans. PMID:1714519

  15. Cytomegalovirus immediate early proteins promote stemness properties in glioblastoma

    PubMed Central

    Soroceanu, Liliana; Matlaf, Lisa; Khan, Sabeena; Akhavan, Armin; Singer, Eric; Bezrookove, Vladimir; Decker, Stacy; Ghanny, Saleena; Hadaczek, Piotr; Bengtsson, Henrik; Ohlfest, John; Luciani-Torres, Maria-Gloria; Harkins, Lualhati; Perry, Arie; Guo, Hong; Soteropoulos, Patricia; Cobbs, Charles S

    2015-01-01

    Glioblastoma (GBM) is the most common and aggressive human brain tumor. Human cytomegalovirus (HCMV) immediate early (IE) proteins that are endogenously expressed in GBM cells are strong viral transactivators with onconcogenic properties. Here, we show how HCMV IE are preferentially expressed in glioma stem-like cells (GSC), where they co-localize with the other GBM stemness markers, CD133, Nestin, and Sox2. In patient-derived GSC that are endogenously infected with HCMV, attenuating IE expression by an RNA-i-based strategy, was sufficient to inhibit tumorsphere formation, Sox2 expression, cell cycle progression, and cell survival. Conversely, HCMV infection of HMCV-negative GSC elicited robust self-renewal and proliferation of cells that could be partially reversed by IE attenuation. In HCMV-positive GSC, IE attenuation induced a molecular program characterized by enhanced expression of mesenchymal markers and pro-inflammatory cytokines, resembling the therapeutically-resistant GBM phenotype. Mechanistically, HCMV/IE regulation of Sox2 occurred via inhibition of miRNA-145, a negative regulator of Sox2 protein expression. In a spontaneous mouse model of glioma, ectopic expression of the IE1 gene (UL123) specifically increased Sox2 and Nestin levels in the IE1-positive tumors, upregulating stemness and proliferation markers in vivo. Similarly, human GSC infected with the HCMV strain Towne but not the IE1-deficient strain CR208 showed enhanced growth as tumorspheres and intracranial tumor xenografts, compared to mock-infected human GSC. Overall, our findings offer new mechanistic insights into how HCMV/IE control stemness properties in glioblastoma cells. PMID:26239477

  16. The nucleotide sequence of HLA-B{sup *}2704 reveals a new amino acid substitution in exon 4 which is also present in HLA-B{sup *}2706

    SciTech Connect

    Rudwaleit, M.; Bowness, P.; Wordsworth, P.

    1996-12-31

    The HLA-B27 subtype HLA-B{sup *}2704 is virtually absent in Caucasians but common in Orientals, where it is associated with ankylosing spondylitis. The amino acid sequence of HLA-B{sup *}2704 has been established by peptide mapping and was shown to differ by two amino acids from HLA-B{sup *}2705, HLA-B{sup *}2704 is characterized by a serine for aspartic acid substitution at position 77 and glutamic acid for valine at position 152. To date, however, no nucleotide sequence confirming these changes at the DNA level has been published. 13 refs., 2 figs.

  17. 11 CFR 300.65 - Exceptions for certain tax-exempt organizations (2 U.S.C. 441i(e)(1) and (4)).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... Federal election activity: (1) Voter registration activity, as described in 11 CFR 100.24(a)(2), during... connection with an election in which one or more Federal candidates appear on the ballot (see 11 CFR 100.24(a... identification as described in 11 CFR 100.24(a)(4); (ii) Get-out-the-vote activity as described in 11 CFR...

  18. 11 CFR 300.52 - Fundraising by Federal candidates and Federal officeholders (2 U.S.C. 441i(e)(1)&(4)).

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... activity: (1) Voter registration activity, as described in 11 CFR 100.24(a)(2), during the period that... election in which one or more Federal candidates appear on the ballot (see 11 CFR 100.24(a)(1)), regardless... described in 11 CFR 100.24(a)(4); (ii) Get-out-the-vote activity as described in 11 CFR 100.24(a)(3);...

  19. Positive Role of Promyelocytic Leukemia Protein in Type I Interferon Response and Its Regulation by Human Cytomegalovirus

    PubMed Central

    Kim, Young-Eui; Ahn, Jin-Hyun

    2015-01-01

    Promyelocytic leukemia protein (PML), a major component of PML nuclear bodies (also known as nuclear domain 10), is involved in diverse cellular processes such as cell proliferation, apoptosis, gene regulation, and DNA damage response. PML also acts as a restriction factor that suppresses incoming viral genomes, therefore playing an important role in intrinsic defense. Here, we show that PML positively regulates type I interferon response by promoting transcription of interferon-stimulated genes (ISGs) and that this regulation by PML is counteracted by human cytomegalovirus (HCMV) IE1 protein. Small hairpin RNA-mediated PML knockdown in human fibroblasts reduced ISG induction by treatment of interferon-β or infection with UV-inactivated HCMV. PML was required for accumulation of activated STAT1 and STAT2, interacted with them and HDAC1 and HDAC2, and was associated with ISG promoters after HCMV infection. During HCMV infection, viral IE1 protein interacted with PML, STAT1, STAT2, and HDACs. Analysis of IE1 mutant viruses revealed that, in addition to the STAT2-binding domain, the PML-binding domain of IE1 was necessary for suppression of interferon-β-mediated ISG transcription, and that IE1 inhibited ISG transcription by sequestering interferon-stimulated gene factor 3 (ISGF3) in a manner requiring its binding of PML and STAT2, but not of HDACs. In conclusion, our results demonstrate that PML participates in type I interferon-induced ISG expression by regulating ISGF3, and that this regulation by PML is counteracted by HCMV IE1, highlighting a widely shared viral strategy targeting PML to evade intrinsic and innate defense mechanisms. PMID:25812002

  20. Immune Adaptation to Environmental Influence: The Case of NK Cells and HCMV.

    PubMed

    Rölle, Alexander; Brodin, Petter

    2016-03-01

    The immune system of an individual human is determined by heritable traits and a continuous process of adaptation to a broad variety of extrinsic, non-heritable factors such as viruses, bacteria, dietary components and more. Cytomegalovirus (CMV) successfully infects the majority of the human population and establishes latency, thereby exerting a life-long influence on the immune system of its host. CMV has been shown to influence the majority of immune parameters in healthy individuals. Here we focus on adaptive changes induced by CMV in subsets of Natural Killer (NK) cells, changes that question our very definition of adaptive and innate immunity by suggesting that adaptations of immune cells to environmental influences occur across the entire human immune system and not restricted to the classical adaptive branch of the immune system. PMID:26869205

  1. An inducible promoter mediates abundant expression from the immediate-early 2 gene region of human cytomegalovirus at late times after infection.

    PubMed Central

    Puchtler, E; Stamminger, T

    1991-01-01

    An abundant late transcript of 1.5 kb originates from the immediate-early 2 (IE-2) gene region of human cytomegalovirus (HCMV) at late times after infection. The transcriptional start of this RNA was precisely mapped, and the putative promoter region was cloned in front of the CAT gene as reporter. This region, which comprises 78 nucleotides of IE-2 sequence upstream of the determined cap site, was strongly activated by viral superinfection at late times in the replicative cycle. As shown by RNase protection analyses, the authentic transcription start is used. No activation of this late promoter was observed after cotransfection with an expression plasmid containing the HCMV IE-1 and -2 gene region. This result suggests that, compared with early and early late promoters of HCMV, different or additional viral functions are required for the activation of true late promoters. Images PMID:1656096

  2. Impact of Persistent Cytomegalovirus Infection on Dynamic Changes in Human Immune System Profile

    PubMed Central

    Vescovini, Rosanna; Telera, Anna Rita; Pedrazzoni, Mario; Abbate, Barbara; Rossetti, Pietro; Verzicco, Ignazio; Arcangeletti, Maria Cristina; Medici, Maria Cristina; Calderaro, Adriana; Volpi, Riccardo; Sansoni, Paolo; Fagnoni, Francesco Fausto

    2016-01-01

    Human cytomegalovirus (HCMV) imprints the immune system after primary infection, however its effect during chronic infection still needs to be deciphered. In this study we report the variation of blood cell count along with anti-HCMV IgG and T cell responses to pp-65 and IE-1 antigens, that occurred after an interval of five years in a cohort of 25 seropositive healthy adults. We found increased anti-viral IgG antibody responses and intracellular interferon-gamma secreting CD8+ T cell responses to pp-65: a result consistent with memory inflation. With the only exception of shortage in naive CD8+ T cells most memory T cell subsets as well as total CD8+ T cells, T cells, lymphocytes, monocytes and leukocytes had increased. By contrast, none of the cell types tested were found to have increased in 14 subjects stably seronegative. Rather, in addition to a shortage in naive CD8+ T cells, also memory T cell subsets and most other cell types decreased, either in a statistically significant or non-significant manner. The trend of T cell pool representation with regard to CD4/CD8 ratio was in the opposing directions depending on HCMV serology. Globally, this study demonstrates different dynamic changes of most blood cell types depending on presence or absence of HCMV infection. Therefore, HCMV plays a continual role in modulating homeostasis of blood T cells and a broader expanding effect on other cell populations of lymphoid and myeloid origin. PMID:26990192

  3. Maintenance of Large Numbers of Virus Genomes in Human Cytomegalovirus-Infected T98G Glioblastoma Cells

    PubMed Central

    Duan, Ying-Liang; Ye, Han-Qing; Zavala, Anamaria G.; Yang, Cui-Qing; Miao, Ling-Feng; Fu, Bi-Shi; Seo, Keun Seok; Davrinche, Christian

    2014-01-01

    ABSTRACT After infection, human cytomegalovirus (HCMV) persists for life. Primary infections and reactivation of latent virus can both result in congenital infection, a leading cause of central nervous system birth defects. We previously reported long-term HCMV infection in the T98G glioblastoma cell line (1). HCMV infection has been further characterized in T98Gs, emphasizing the presence of HCMV DNA over an extended time frame. T98Gs were infected with either HCMV Towne or AD169-IE2-enhanced green fluorescent protein (eGFP) strains. Towne infections yielded mixed IE1 antigen-positive and -negative (Ag+/Ag−) populations. AD169-IE2-eGFP infections also yielded mixed populations, which were sorted to obtain an IE2− (Ag−) population. Viral gene expression over the course of infection was determined by immunofluorescent analysis (IFA) and reverse transcription-PCR (RT-PCR). The presence of HCMV genomes was determined by PCR, nested PCR (n-PCR), and fluorescence in situ hybridization (FISH). Compared to the HCMV latency model, THP-1, Towne-infected T98Gs expressed IE1 and latency-associated transcripts for longer periods, contained many more HCMV genomes during early passages, and carried genomes for a greatly extended period of passaging. Large numbers of HCMV genomes were also found in purified Ag− AD169-infected cells for the first several passages. Interestingly, latency transcripts were observed from very early times in the Towne-infected cells, even when IE1 was expressed at low levels. Although AD169-infected Ag− cells expressed no detectable levels of either IE1 or latency transcripts, they also maintained large numbers of genomes within the cell nuclei for several passages. These results identify HCMV-infected T98Gs as an attractive new model in the study of the long-term maintenance of virus genomes in the context of neural cell types. IMPORTANCE Our previous work showed that T98G glioblastoma cells were semipermissive to HCMV infection; virus

  4. Human Cytomegalovirus Immediate-Early 1 Protein Rewires Upstream STAT3 to Downstream STAT1 Signaling Switching an IL6-Type to an IFNγ-Like Response

    PubMed Central

    Lukas, Simone; Zenger, Marion; Reitberger, Tobias; Danzer, Daniela; Übner, Theresa; Munday, Diane C.; Paulus, Christina

    2016-01-01

    The human cytomegalovirus (hCMV) major immediate-early 1 protein (IE1) is best known for activating transcription to facilitate viral replication. Here we present transcriptome data indicating that IE1 is as significant a repressor as it is an activator of host gene expression. Human cells induced to express IE1 exhibit global repression of IL6- and oncostatin M-responsive STAT3 target genes. This repression is followed by STAT1 phosphorylation and activation of STAT1 target genes normally induced by IFNγ. The observed repression and subsequent activation are both mediated through the same region (amino acids 410 to 445) in the C-terminal domain of IE1, and this region serves as a binding site for STAT3. Depletion of STAT3 phenocopies the STAT1-dependent IFNγ-like response to IE1. In contrast, depletion of the IL6 receptor (IL6ST) or the STAT kinase JAK1 prevents this response. Accordingly, treatment with IL6 leads to prolonged STAT1 instead of STAT3 activation in wild-type IE1 expressing cells, but not in cells expressing a mutant protein (IE1dl410-420) deficient for STAT3 binding. A very similar STAT1-directed response to IL6 is also present in cells infected with a wild-type or revertant hCMV, but not an IE1dl410-420 mutant virus, and this response results in restricted viral replication. We conclude that IE1 is sufficient and necessary to rewire upstream IL6-type to downstream IFNγ-like signaling, two pathways linked to opposing actions, resulting in repressed STAT3- and activated STAT1-responsive genes. These findings relate transcriptional repressor and activator functions of IE1 and suggest unexpected outcomes relevant to viral pathogenesis in response to cytokines or growth factors that signal through the IL6ST-JAK1-STAT3 axis in hCMV-infected cells. Our results also reveal that IE1, a protein considered to be a key activator of the hCMV productive cycle, has an unanticipated role in tempering viral replication. PMID:27387064

  5. Human Cytomegalovirus Immediate-Early 1 Protein Rewires Upstream STAT3 to Downstream STAT1 Signaling Switching an IL6-Type to an IFNγ-Like Response.

    PubMed

    Harwardt, Thomas; Lukas, Simone; Zenger, Marion; Reitberger, Tobias; Danzer, Daniela; Übner, Theresa; Munday, Diane C; Nevels, Michael; Paulus, Christina

    2016-07-01

    The human cytomegalovirus (hCMV) major immediate-early 1 protein (IE1) is best known for activating transcription to facilitate viral replication. Here we present transcriptome data indicating that IE1 is as significant a repressor as it is an activator of host gene expression. Human cells induced to express IE1 exhibit global repression of IL6- and oncostatin M-responsive STAT3 target genes. This repression is followed by STAT1 phosphorylation and activation of STAT1 target genes normally induced by IFNγ. The observed repression and subsequent activation are both mediated through the same region (amino acids 410 to 445) in the C-terminal domain of IE1, and this region serves as a binding site for STAT3. Depletion of STAT3 phenocopies the STAT1-dependent IFNγ-like response to IE1. In contrast, depletion of the IL6 receptor (IL6ST) or the STAT kinase JAK1 prevents this response. Accordingly, treatment with IL6 leads to prolonged STAT1 instead of STAT3 activation in wild-type IE1 expressing cells, but not in cells expressing a mutant protein (IE1dl410-420) deficient for STAT3 binding. A very similar STAT1-directed response to IL6 is also present in cells infected with a wild-type or revertant hCMV, but not an IE1dl410-420 mutant virus, and this response results in restricted viral replication. We conclude that IE1 is sufficient and necessary to rewire upstream IL6-type to downstream IFNγ-like signaling, two pathways linked to opposing actions, resulting in repressed STAT3- and activated STAT1-responsive genes. These findings relate transcriptional repressor and activator functions of IE1 and suggest unexpected outcomes relevant to viral pathogenesis in response to cytokines or growth factors that signal through the IL6ST-JAK1-STAT3 axis in hCMV-infected cells. Our results also reveal that IE1, a protein considered to be a key activator of the hCMV productive cycle, has an unanticipated role in tempering viral replication. PMID:27387064

  6. Consecutive Inhibition of ISG15 Expression and ISGylation by Cytomegalovirus Regulators

    PubMed Central

    Kim, Young-Eui; Lee, Myoung Kyu; Kwon, Ki Mun; Kim, Keun Il; Stamminger, Thomas; Ahn, Jin-Hyun

    2016-01-01

    Interferon-stimulated gene 15 (ISG15) encodes an ubiquitin-like protein that covalently conjugates protein. Protein modification by ISG15 (ISGylation) is known to inhibit the replication of many viruses. However, studies on the viral targets and viral strategies to regulate ISGylation-mediated antiviral responses are limited. In this study, we show that human cytomegalovirus (HCMV) replication is inhibited by ISGylation, but the virus has evolved multiple countermeasures. HCMV-induced ISG15 expression was mitigated by IE1, a viral inhibitor of interferon signaling, however, ISGylation was still strongly upregulated during virus infection. RNA interference of UBE1L (E1), UbcH8 (E2), Herc5 (E3), and UBP43 (ISG15 protease) revealed that ISGylation inhibits HCMV growth by downregulating viral gene expression and virion release in a manner that is more prominent at low multiplicity of infection. A viral regulator pUL26 was found to interact with ISG15, UBE1L, and Herc5, and be ISGylated. ISGylation of pUL26 regulated its stability and inhibited its activities to suppress NF-κB signaling and complement the growth of UL26-null mutant virus. Moreover, pUL26 reciprocally suppressed virus-induced ISGylation independent of its own ISGylation. Consistently, ISGylation was more pronounced in infections with the UL26-deleted mutant virus, whose growth was more sensitive to IFNβ treatment than that of the wild-type virus. Therefore, pUL26 is a viral ISG15 target that also counteracts ISGylation. Our results demonstrate that ISGylation inhibits HCMV growth at multiple steps and that HCMV has evolved countermeasures to suppress ISG15 transcription and protein ISGylation, highlighting the importance of the interplay between virus and ISGylation in productive viral infection. PMID:27564865

  7. Consecutive Inhibition of ISG15 Expression and ISGylation by Cytomegalovirus Regulators.

    PubMed

    Kim, Ye Ji; Kim, Eui Tae; Kim, Young-Eui; Lee, Myoung Kyu; Kwon, Ki Mun; Kim, Keun Il; Stamminger, Thomas; Ahn, Jin-Hyun

    2016-08-01

    Interferon-stimulated gene 15 (ISG15) encodes an ubiquitin-like protein that covalently conjugates protein. Protein modification by ISG15 (ISGylation) is known to inhibit the replication of many viruses. However, studies on the viral targets and viral strategies to regulate ISGylation-mediated antiviral responses are limited. In this study, we show that human cytomegalovirus (HCMV) replication is inhibited by ISGylation, but the virus has evolved multiple countermeasures. HCMV-induced ISG15 expression was mitigated by IE1, a viral inhibitor of interferon signaling, however, ISGylation was still strongly upregulated during virus infection. RNA interference of UBE1L (E1), UbcH8 (E2), Herc5 (E3), and UBP43 (ISG15 protease) revealed that ISGylation inhibits HCMV growth by downregulating viral gene expression and virion release in a manner that is more prominent at low multiplicity of infection. A viral regulator pUL26 was found to interact with ISG15, UBE1L, and Herc5, and be ISGylated. ISGylation of pUL26 regulated its stability and inhibited its activities to suppress NF-κB signaling and complement the growth of UL26-null mutant virus. Moreover, pUL26 reciprocally suppressed virus-induced ISGylation independent of its own ISGylation. Consistently, ISGylation was more pronounced in infections with the UL26-deleted mutant virus, whose growth was more sensitive to IFNβ treatment than that of the wild-type virus. Therefore, pUL26 is a viral ISG15 target that also counteracts ISGylation. Our results demonstrate that ISGylation inhibits HCMV growth at multiple steps and that HCMV has evolved countermeasures to suppress ISG15 transcription and protein ISGylation, highlighting the importance of the interplay between virus and ISGylation in productive viral infection. PMID:27564865

  8. Structural organization, expression, and functional characterization of the murine cytomegalovirus immediate-early gene 3.

    PubMed Central

    Messerle, M; Bühler, B; Keil, G M; Koszinowski, U H

    1992-01-01

    We have previously defined ie3 as a coding region located downstream of the ie1 gene which gives rise to a 2.75-kb immediate-early (IE) transcript. Here we describe the structural organization of the ie3 gene, the amino acid sequence of the gene product, and some of the functional properties of the protein. The 2.75-kb ie3 mRNA is generated by splicing and is composed of four exons. The first three exons, of 300, 111, and 191 nucleotides (nt), are shared with the ie1 mRNA and are spliced to exon 5, which is located downstream of the fourth exon used by the ie1 mRNA. Exon 5 starts 28 nt downstream of the 3' end of the ie1 mRNA and has a length of 1,701 nt. The IE3 protein contains 611 amino acids, the first 99 of which are shared with the ie1 product pp89. The IE3 protein expressed at IE times has a relative mobility of 88 kDa in gels, and a mobility shift to 90 kDa during the early phase is indicative of posttranslational modification. Sequence comparison reveals significant homology of the exon 5-encoded amino acid sequence with the respective sequence of UL 122, a component of the IE1-IE2 complex of human cytomegalovirus (HCMV). This homology is also apparent at the functional level. The IE3 protein is a strong transcriptional activator of the murine cytomegalovirus (MCMV) e1 promoter and shows an autoregulatory function by repression of the MCMV ie1/ie3 promoter. The high degree of conservation between the MCMV ie3 and HCMV IE2 genes and their products with regard to gene structure, amino acid sequence, and protein functions suggests that these genes play a comparable role in the transcriptional control of the two cytomegaloviruses. Images PMID:1309246

  9. An intein-mediated modulation of protein stability system and its application to study human cytomegalovirus essential gene function

    PubMed Central

    Pan, Deng; Xuan, Baoqin; Sun, Yamei; Huang, Shaowu; Xie, Maorong; Bai, Yadan; Xu, Wenjia; Qian, Zhikang

    2016-01-01

    Functional analysis of the essential proteins encoded by human cytomegalovirus (HCMV) is hindered by the lack of complementing systems. To overcome this difficulty, we have established a novel approach, termed the intein-mediated modulation of protein stability (imPS), in which a destabilizing domain and part of a split intein are fused to the essential protein. The growth of the mutant virus can then be regulated by the degradation and splicing of the protein. We found that an ultrafast gp41-1 split intein was able to rescue or degrade the protein of interest (POI) by removing or adding a strong degron through protein splicing. As a result, the function of the POI was turned on or off during the process. Using HCMV essential gene IE1/IE2, we confirmed that imPS worked remarkably well in conditionally regulating protein stability during viral infection. This conditional approach is likely to be applicable for dissecting the gene functions of HCMV or other viruses. PMID:27188239

  10. Multiple phosphorylation sites at the C-terminus regulate nuclear import of HCMV DNA polymerase processivity factor ppUL44

    SciTech Connect

    Alvisi, Gualtiero; Marin, Oriano; Pari, Gregory; Mancini, Manuela; Avanzi, Simone; Loregian, Arianna; Jans, David A.; Ripalti, Alessandro

    2011-09-01

    The processivity factor of human cytomegalovirus DNA polymerase, phosphoprotein ppUL44, is essential for viral replication. During viral infection ppUL44 is phosphorylated by the viral kinase pUL97, but neither the target residues on ppUL44 nor the effect of phosphorylation on ppUL44's activity are known. We report here that ppUL44 is phosphorylated when transiently expressed in mammalian cells and coimmunoprecipitates with cellular kinases. Of three potential phosphorylation sites (S413, S415, S418) located upstream of ppUL44's nuclear localization signal (NLS) and one (T427) within the NLS itself, protein kinase CK2 (CK2) specifically phosphorylates S413, to trigger a cascade of phosphorylation of S418 and S415 by CK1 and CK2, respectively. Negative charge at the CK2/CK1 target serine residues facilitates optimal nuclear accumulation of ppUL44, whereas negative charge on T427, a potential cyclin-dependent 1 phosphorylation site, strongly decreases nuclear accumulation. Thus, nuclear transport of ppUL44 is finely tuned during viral infection through complex phosphorylation events.

  11. Using multi-channel level sets to measure the cytoplasmic localization of HCMV pUL97 in GFP-B-gal fusion constructs.

    PubMed

    Held, Christian; Webel, Rike; Palmisano, Ralf; Hutterer, Corina; Marschall, Manfred; Wittenberg, Thomas

    2014-04-01

    Human cytomegalovirus UL97-encoded protein kinase (pUL97) phosphorylates cellular and viral proteins and is critical for viral replication. To quantify the efficiency of nuclear translocation and to elucidate the role of putative nuclear localization signal (NLS) elements, immunofluorescence analysis of different pUL97 expression constructs was performed. Since manual quantitation of respective expression levels lacks objectivity and reproducibility, and is time-consuming as well, a computer-based model is established. This model enables objective quantitation of the degree of cytoplasmic localization λ. To determine the degree of cytoplasmic localization of different pUL97-GFP-β-gal fusion proteins automatically, a multi-channel segmentation of the nucleus and cytoplasm of transfected HeLa cells is performed in DAPI and GFP micrographs. A watershed transform-based segmentation scheme is used for the segmentation of the cell nuclei. Subsequently, the cytoplasm is segmented using a fast marching level set method. Based on the segmentation of cell nuclei and cytoplasm, λ can be determined for each HeLa cell by quantitation of the ratio of average signal intensity outside and inside the nucleus. The degree of cytoplasmic localization of an individual construct is then determined by evaluating the average and standard deviation of λ for the corresponding HeLa cells. Evaluation demonstrates that nuclear transport of pUL97 is a multilayered mechanism resulting in different efficiencies of nuclear translocation between a small and a large isoform and objective quantitation of the cytoplasmic localization is possible with a high accuracy (96.7% and 94.3%). PMID:24445057

  12. PUL21a-Cyclin A2 Interaction is Required to Protect Human Cytomegalovirus-Infected Cells from the Deleterious Consequences of Mitotic Entry

    PubMed Central

    Eifler, Martin; Uecker, Ralf; Weisbach, Henry; Bogdanow, Boris; Richter, Ellen; König, Lydia; Vetter, Barbara; Lenac-Rovis, Tihana; Jonjic, Stipan; Neitzel, Heidemarie; Hagemeier, Christian; Wiebusch, Lüder

    2014-01-01

    Entry into mitosis is accompanied by dramatic changes in cellular architecture, metabolism and gene expression. Many viruses have evolved cell cycle arrest strategies to prevent mitotic entry, presumably to ensure sustained, uninterrupted viral replication. Here we show for human cytomegalovirus (HCMV) what happens if the viral cell cycle arrest mechanism is disabled and cells engaged in viral replication enter into unscheduled mitosis. We made use of an HCMV mutant that, due to a defective Cyclin A2 binding motif in its UL21a gene product (pUL21a), has lost its ability to down-regulate Cyclin A2 and, therefore, to arrest cells at the G1/S transition. Cyclin A2 up-regulation in infected cells not only triggered the onset of cellular DNA synthesis, but also promoted the accumulation and nuclear translocation of Cyclin B1-CDK1, premature chromatin condensation and mitotic entry. The infected cells were able to enter metaphase as shown by nuclear lamina disassembly and, often irregular, metaphase spindle formation. However, anaphase onset was blocked by the still intact anaphase promoting complex/cyclosome (APC/C) inhibitory function of pUL21a. Remarkably, the essential viral IE2, but not the related chromosome-associated IE1 protein, disappeared upon mitotic entry, suggesting an inherent instability of IE2 under mitotic conditions. Viral DNA synthesis was impaired in mitosis, as demonstrated by the abnormal morphology and strongly reduced BrdU incorporation rates of viral replication compartments. The prolonged metaphase arrest in infected cells coincided with precocious sister chromatid separation and progressive fragmentation of the chromosomal material. We conclude that the Cyclin A2-binding function of pUL21a contributes to the maintenance of a cell cycle state conducive for the completion of the HCMV replication cycle. Unscheduled mitotic entry during the course of the HCMV replication has fatal consequences, leading to abortive infection and cell death. PMID

  13. Identification of Cellular Proteins that Interact with Human Cytomegalovirus Immediate-Early Protein 1 by Protein Array Assay

    PubMed Central

    Puerta Martínez, Francisco; Tang, Qiyi

    2013-01-01

    Human cytomegalovirus (HCMV) gene expression during infection is characterized as a sequential process including immediate-early (IE), early (E), and late (L)-stage gene expression. The most abundantly expressed gene at the IE stage of infection is the major IE (MIE) gene that produces IE1 and IE2. IE1 has been the focus of study because it is an important protein, not only for viral gene expression but also for viral replication. It is believed that IE1 plays important roles in viral gene regulation by interacting with cellular proteins. In the current study, we performed protein array assays and identified 83 cellular proteins that interact with IE1. Among them, seven are RNA-binding proteins that are important in RNA processing; more than half are nuclear proteins that are involved in gene regulations. Tumorigenesis-related proteins are also found to interact with IE1, implying that the role of IE1 in tumorigenesis might need to be reevaluated. Unexpectedly, cytoplasmic proteins, such as Golgi autoantigen and GGA1 (both related to the Golgi trafficking protein), are also found to be associated with IE1. We also employed a coimmunoprecipitation assay to test the interactions of IE1 and some of the proteins identified in the protein array assays and confirmed that the results from the protein array assays are reliable. Many of the proteins identified by the protein array assay have not been previously reported. Therefore, the functions of the IE1-protein interactions need to be further explored in the future. PMID:24385082

  14. Intrinsic host restriction factors of human cytomegalovirus replication and mechanisms of viral escape

    PubMed Central

    Landolfo, Santo; De Andrea, Marco; Dell’Oste, Valentina; Gugliesi, Francesca

    2016-01-01

    Before a pathogen even enters a cell, intrinsic immune defenses are active. This first-line defense is mediated by a variety of constitutively expressed cell proteins collectively termed “restriction factors” (RFs), and they form a vital element of the immune response to virus infections. Over time, however, viruses have evolved in a variety ways so that they are able to overcome these RF defenses via mechanisms that are specific for each virus. This review provides a summary of the universal characteristics of RFs, and goes on to focus on the strategies employed by some of the most important RFs in their attempt to control human cytomegalovirus (HCMV) infection. This is followed by a discussion of the counter-restriction mechanisms evolved by viruses to circumvent the host cell’s intrinsic immune defenses. RFs include nuclear proteins IFN-γ inducible protein 16 (IFI16) (a Pyrin/HIN domain protein), Sp100, promyelocytic leukemia, and hDaxx; the latter three being the keys elements of nuclear domain 10 (ND10). IFI16 inhibits the synthesis of virus DNA by down-regulating UL54 transcription - a gene encoding a CMV DNA polymerase; in response, the virus antagonizes IFI16 via a process involving viral proteins UL97 and pp65 (pUL83), which results in the mislocalizing of IFI16 into the cytoplasm. In contrast, viral regulatory proteins, including pp71 and IE1, seek to modify or disrupt the ND10 proteins and thus block or reverse their inhibitory effects upon virus replication. All in all, detailed knowledge of these HCMV counter-restriction mechanisms will be fundamental for the future development of new strategies for combating HCMV infection and for identifying novel therapeutic agents. PMID:27563536

  15. Intrinsic host restriction factors of human cytomegalovirus replication and mechanisms of viral escape.

    PubMed

    Landolfo, Santo; De Andrea, Marco; Dell'Oste, Valentina; Gugliesi, Francesca

    2016-08-12

    Before a pathogen even enters a cell, intrinsic immune defenses are active. This first-line defense is mediated by a variety of constitutively expressed cell proteins collectively termed "restriction factors" (RFs), and they form a vital element of the immune response to virus infections. Over time, however, viruses have evolved in a variety ways so that they are able to overcome these RF defenses via mechanisms that are specific for each virus. This review provides a summary of the universal characteristics of RFs, and goes on to focus on the strategies employed by some of the most important RFs in their attempt to control human cytomegalovirus (HCMV) infection. This is followed by a discussion of the counter-restriction mechanisms evolved by viruses to circumvent the host cell's intrinsic immune defenses. RFs include nuclear proteins IFN-γ inducible protein 16 (IFI16) (a Pyrin/HIN domain protein), Sp100, promyelocytic leukemia, and hDaxx; the latter three being the keys elements of nuclear domain 10 (ND10). IFI16 inhibits the synthesis of virus DNA by down-regulating UL54 transcription - a gene encoding a CMV DNA polymerase; in response, the virus antagonizes IFI16 via a process involving viral proteins UL97 and pp65 (pUL83), which results in the mislocalizing of IFI16 into the cytoplasm. In contrast, viral regulatory proteins, including pp71 and IE1, seek to modify or disrupt the ND10 proteins and thus block or reverse their inhibitory effects upon virus replication. All in all, detailed knowledge of these HCMV counter-restriction mechanisms will be fundamental for the future development of new strategies for combating HCMV infection and for identifying novel therapeutic agents. PMID:27563536

  16. NKG2C+CD57+ Natural Killer Cell Expansion Parallels Cytomegalovirus-Specific CD8+ T Cell Evolution towards Senescence

    PubMed Central

    Heath, John; Newhook, Nicholas; Comeau, Emilie; Gallant, Maureen; Fudge, Neva

    2016-01-01

    Objective. Measuring NKG2C+CD57+ natural killer (NK) cell expansion to investigate NK responses against human cytomegalovirus (HCMV) and assessing relationships with adaptive immunity against HCMV. Methods. Expansion of NKG2C+CD57+ NK was measured in peripheral blood mononuclear cells (PBMC) from groups distinguished by HCMV and human immunodeficiency virus (HIV) infection status. Anti-HCMV antibody levels against HCMV-infected MRC-5 cell lysate were assessed by ELISA and HCMV-specific CD8+ T cell responses characterized by intracellular flow cytometry following PBMC stimulation with immunodominant HCMV peptides. Results. Median NK, antibody, and CD8+ T cell responses against HCMV were significantly greater in the HCMV/HIV coinfected group than the group infected with CMV alone. The fraction of CMV-specific CD8+ T cells expressing CD28 correlated inversely with NKG2C+CD57+ NK expansion in HIV infection. Conclusion. Our data reveal no significant direct relationships between NK and adaptive immunity against HCMV. However, stronger NK and adaptive immune responses against HCMV and an inverse correlation between NKG2C+CD57+ NK expansion and proliferative reserve of HCMV-specific CD8+ T cells, as signified by CD28 expression, indicate parallel evolution of NK and T cell responses against HCMV in HIV infection. Similar aspects of chronic HCMV infection may drive both NK and CD8+ T cell memory inflation. PMID:27314055

  17. Discordant humoral and cellular immune responses to Cytomegalovirus (CMV) in glioblastoma patients whose tumors are positive for CMV

    PubMed Central

    Rahbar, Afsar; Peredo, Inti; Solberg, Nina Wolmer; Taher, Chato; Dzabic, Mensur; Xu, Xinling; Skarman, Petra; Fornara, Olesja; Tammik, Charlotte; Yaiw, Koon; Wilhelmi, Vanessa; Assinger, Alice; Stragliotto, Giuseppe; Söderberg-Naucler, Cecilia

    2015-01-01

    Background. Glioblastoma (GBM) is the most common malignant brain tumor in adults and is nearly always fatal. Emerging evidence suggests that human Cytomegalovirus (HCMV) is present in 90–100% of GBMs and that add-on antiviral treatment for HCMV show promise to improve survival. Methods. In a randomized, placebo-controlled trial of valganciclovir in 42 GBM patients, blood samples were collected for analyses of HCMV DNA, RNA, reactivity against HCMV peptides, IgG, and IgM at baseline and at 3, 12, and 24 weeks of treatment. Results. All 42 tumors were positive for HCMV protein. All patients examined had at least one blood sample positive for HCMV DNA, 63% were HCMV RNA positive, and 21% were IgM positive. However, 29% of GBM patients were IgG negative for HCMV. Five of these samples were positive in an enzyme-linked immunosorbent assay (ELISA) that used antigens derived from a clinical isolate. Blood T cells from 11 of 13 (85%) HCMV IgG-negative GBM patients reacted against HCMV peptides. Valganciclovir did not affect IgG titers, DNA, or RNA levels of the HCMV immediate early (HCMV IE) gene in blood. Conclusion. In GBM patients, HCMV activity is higher than in healthy controls and serology is a poor test to define previous or active HCMV infection in these patients. PMID:25949880

  18. Pathogenesis of Experimental Rhesus Cytomegalovirus Infection

    PubMed Central

    Lockridge, Kristen M.; Sequar, Getachew; Zhou, Shan Shan; Yue, Yujuan; Mandell, Carol P.; Barry, Peter A.

    1999-01-01

    Human cytomegalovirus (HCMV) establishes and maintains a lifelong persistence following infection in an immunocompetent host. The determinants of a stable virus-host relationship are poorly defined. A nonhuman primate model for HCMV was used to investigate virological and host parameters of infection in a healthy host. Juvenile rhesus macaques (Macaca mulatta) were inoculated with rhesus cytomegalovirus (RhCMV), either orally or intravenously (i.v.), and longitudinally necropsied. None of the animals displayed clinical signs of disease, although hematologic abnormalities were observed intermittently in i.v. inoculated animals. RhCMV DNA was detected transiently in the plasma of all animals at 1 to 2 weeks postinfection (wpi) and in multiple tissues beginning at 2 to 4 wpi. Splenic tissue was the only organ positive for RhCMV DNA in all animals. The location of splenic cells expressing RhCMV immediate-early protein 1 (IE1) in i.v. inoculated animals changed following inoculation. At 4 to 5 wpi, most IE1-positive cells were perifollicular, and at 25 wpi, the majority were located within the red pulp. All animals developed anti-RhCMV immunoglobulin M (IgM) antibodies within 1 to 2 wpi and IgG antibodies within 2 to 4 wpi against a limited number of viral proteins. Host reactivity to RhCMV proteins increased in titer (total and neutralizing) and avidity with time. These results demonstrate that while antiviral immune responses were able to protect from disease, they were insufficient to eliminate reservoirs of persistent viral gene expression. PMID:10516066

  19. Human Cytomegalovirus Infection Upregulates the Mitochondrial Transcription and Translation Machineries

    PubMed Central

    Weekes, M. P.; Antrobus, R.; Rorbach, J.; van Haute, L.; Umrania, Y.; Smith, D. L.; Minczuk, M.; Lehner, P. J.; Sinclair, J. H.

    2016-01-01

    ABSTRACT Infection with human cytomegalovirus (HCMV) profoundly affects cellular metabolism. Like in tumor cells, HCMV infection increases glycolysis, and glucose carbon is shifted from the mitochondrial tricarboxylic acid cycle to the biosynthesis of fatty acids. However, unlike in many tumor cells, where aerobic glycolysis is accompanied by suppression of mitochondrial oxidative phosphorylation, HCMV induces mitochondrial biogenesis and respiration. Here, we affinity purified mitochondria and used quantitative mass spectrometry to determine how the mitochondrial proteome changes upon HCMV infection. We found that the mitochondrial transcription and translation systems are induced early during the viral replication cycle. Specifically, proteins involved in biogenesis of the mitochondrial ribosome were highly upregulated by HCMV infection. Inhibition of mitochondrial translation with chloramphenicol or knockdown of HCMV-induced ribosome biogenesis factor MRM3 abolished the HCMV-mediated increase in mitochondrially encoded proteins and significantly impaired viral growth under bioenergetically restricting conditions. Our findings demonstrate how HCMV manipulates mitochondrial biogenesis to support its replication. PMID:27025248

  20. An animal model of human cytomegalovirus infection.

    PubMed

    Gao, L; Qian, S; Zeng, L; Wang, R; Wei, G; Fan, J; Zheng, S

    2007-12-01

    To develop a rat model that allowed in vivo progressive human cytomegalovirus (HCMV) infection, allogeneic liver transplantation was performed across a rat combination of Dark Agouti (DA) to Brown Norway (BN). AD169, a well-characterized laboratory strain of HCMV, was used to establish a rat model of HCMV infection by injection of 0.4 mL (30.0 logTCID50) supernate into the rat peritoneum. Histological and blood specimens were obtained from animals sacrificed at predetermined timepoints. We performed immunohistochemical staining in liver, heart, kidney, spleen, and lung for HCMV immediate-early antigen (IE), lower matrix protein (pp65) detection in peripheral blood leukocytes, and HCMV early antigen (EA) and late antigen (LA). We compared survival rates. Our results showed positive HCMV IE and pp65 antigenemia detected in peripheral blood leukocytes in transplanted recipients from day 1 to day 30. Positive HCMV EA and LA staining cells were only detected in sections 10 days after liver transplantation, namely, in hepatocytes, mononuclear cells, bile duct epithelial cells, and endothelial cells. Successful HCMV replication was due to the combination of liver transplantation and cyclosporine (CsA) immunosuppression. Survival analysis showed no significant differences between the HCMV-infected group and HCMV-uninfected group. This new rat model of HCMV infection may be helpful to understand immune system modulation of HCMV infection. PMID:18089401

  1. Absence of human cytomegalovirus infection in childhood brain tumors.

    PubMed

    Sardi, Iacopo; Lucchesi, Maurizio; Becciani, Sabrina; Facchini, Ludovica; Guidi, Milena; Buccoliero, Anna Maria; Moriondo, Maria; Baroni, Gianna; Stival, Alessia; Farina, Silvia; Genitori, Lorenzo; de Martino, Maurizio

    2015-01-01

    Human cytomegalovirus (HCMV) is a common human pathogen which induces different clinical manifestations related to the age and the immune conditions of the host. HCMV infection seems to be involved in the pathogenesis of adult glioblastomas. The aim of our study was to detect the presence of HCMV in high grade gliomas and other pediatric brain tumors. This hypothesis might have important therapeutic implications, offering a new target for adjuvant therapies. Among 106 pediatric patients affected by CNS tumors we selected 27 patients with a positive HCMV serology. The serological analysis revealed 7 patients with positive HCMV IGG (≥14 U/mL), whom had also a high HCMV IgG avidity, suggesting a more than 6 months-dated infection. Furthermore, HCMV IGM were positive (≥22 U/mL) in 20 patients. Molecular and immunohistochemical analyses were performed in all the 27 samples. Despite a positive HCMV serology, confirmed by ELISA, no viral DNA was shown at the PCR analysis in the patients' neoplastic cells. At immunohistochemistry, no expression of HCMV antigens was observed in tumoral cells. Our results are in agreement with recent results in adults which did not evidence the presence of HCMV genome in glioblastoma lesions. We did not find any correlation between HCMV infection and pediatric CNS tumors. PMID:26396923

  2. Absence of human cytomegalovirus infection in childhood brain tumors

    PubMed Central

    Sardi, Iacopo; Lucchesi, Maurizio; Becciani, Sabrina; Facchini, Ludovica; Guidi, Milena; Buccoliero, Anna Maria; Moriondo, Maria; Baroni, Gianna; Stival, Alessia; Farina, Silvia; Genitori, Lorenzo; de Martino, Maurizio

    2015-01-01

    Human cytomegalovirus (HCMV) is a common human pathogen which induces different clinical manifestations related to the age and the immune conditions of the host. HCMV infection seems to be involved in the pathogenesis of adult glioblastomas. The aim of our study was to detect the presence of HCMV in high grade gliomas and other pediatric brain tumors. This hypothesis might have important therapeutic implications, offering a new target for adjuvant therapies. Among 106 pediatric patients affected by CNS tumors we selected 27 patients with a positive HCMV serology. The serological analysis revealed 7 patients with positive HCMV IGG (≥14 U/mL), whom had also a high HCMV IgG avidity, suggesting a more than 6 months-dated infection. Furthermore, HCMV IGM were positive (≥22 U/mL) in 20 patients. Molecular and immunohistochemical analyses were performed in all the 27 samples. Despite a positive HCMV serology, confirmed by ELISA, no viral DNA was shown at the PCR analysis in the patients’ neoplastic cells. At immunohistochemistry, no expression of HCMV antigens was observed in tumoral cells. Our results are in agreement with recent results in adults which did not evidence the presence of HCMV genome in glioblastoma lesions. We did not find any correlation between HCMV infection and pediatric CNS tumors. PMID:26396923

  3. High Human Cytomegalovirus IgG Level is Associated with Increased Incidence of Diabetic Atherosclerosis in Type 2 Diabetes Mellitus Patients

    PubMed Central

    Zhang, Jun; Liu, Yuan-yuan; Sun, Hui-ling; Li, Shan; Xiong, Hai-rong; Yang, Zhan-qiu; Xiang, Guang-da; Jiang, Xiao-jing

    2015-01-01

    Background At present, whether human cytomegalovirus (HCMV) infection is associated with type 2 diabetes mellitus (T2DM) is debatable. The effect of active HCMV infection on glucose regulation has been poorly studied. Although HCMV infection is correlated with atherosclerosis in cardiovascular disease, the role of HCMV infection in the development of diabetic atherosclerosis in T2DM is unclear and is usually neglected by endocrinologists. The aim of this study was to assess the effects of HCMV infection on glucose regulation and the development of diabetic atherosclerosis in T2DM patients. Material/Methods A total of 222 hospitalized T2DM patients were enrolled. Nested polymerase chain reactions were used to detect HCMV DNA extracted from peripheral blood leukocytes. Quantitative real-time PCR was used to determine viral load. HCMV IgG antibody concentrations were analyzed by chemiluminescence immunoassay. Results HCMV active infection, viral load, and HCMV IgG titers were not correlated with glucose regulation. Binary logistic regression demonstrated that the highest quartile of HCMV IgG concentration (>500 U/ml) was correlated with the incidence of diabetic atherosclerosis (OR: 8.0, 95%CI: 2.3–27.2), and that titer >127U/ml of HCMV IgG is an independent predictor for the development of diabetic atherosclerosis in T2DM patients (OR: 4.6, 95%CI: 1.9–11.3) after adjustment for all potential confounding factors. Conclusions Active HCMV infection is unlikely to influence glucose regulation in T2DM. However, HCMV IgG titers are associated with the incidence of diabetic atherosclerosis, and titer >127U/ml of HCMV IgG might be an independent risk factor for the development of diabetic atherosclerosis in T2DM patients. PMID:26717490

  4. Two Novel Human Cytomegalovirus NK Cell Evasion Functions Target MICA for Lysosomal Degradation

    PubMed Central

    Fielding, Ceri A.; Aicheler, Rebecca; Stanton, Richard J.; Wang, Eddie C. Y.; Han, Song; Seirafian, Sepehr; Davies, James; McSharry, Brian P.; Weekes, Michael P.; Antrobus, P. Robin; Prod'homme, Virginie; Blanchet, Fabien P.; Sugrue, Daniel; Cuff, Simone; Roberts, Dawn; Davison, Andrew J.; Lehner, Paul J.; Wilkinson, Gavin W. G.; Tomasec, Peter

    2014-01-01

    NKG2D plays a major role in controlling immune responses through the regulation of natural killer (NK) cells, αβ and γδ T-cell function. This activating receptor recognizes eight distinct ligands (the MHC Class I polypeptide-related sequences (MIC) A andB, and UL16-binding proteins (ULBP)1–6) induced by cellular stress to promote recognition cells perturbed by malignant transformation or microbial infection. Studies into human cytomegalovirus (HCMV) have aided both the identification and characterization of NKG2D ligands (NKG2DLs). HCMV immediate early (IE) gene up regulates NKGDLs, and we now describe the differential activation of ULBP2 and MICA/B by IE1 and IE2 respectively. Despite activation by IE functions, HCMV effectively suppressed cell surface expression of NKGDLs through both the early and late phases of infection. The immune evasion functions UL16, UL142, and microRNA(miR)-UL112 are known to target NKG2DLs. While infection with a UL16 deletion mutant caused the expected increase in MICB and ULBP2 cell surface expression, deletion of UL142 did not have a similar impact on its target, MICA. We therefore performed a systematic screen of the viral genome to search of addition functions that targeted MICA. US18 and US20 were identified as novel NK cell evasion functions capable of acting independently to promote MICA degradation by lysosomal degradation. The most dramatic effect on MICA expression was achieved when US18 and US20 acted in concert. US18 and US20 are the first members of the US12 gene family to have been assigned a function. The US12 family has 10 members encoded sequentially through US12–US21; a genetic arrangement, which is suggestive of an ‘accordion’ expansion of an ancestral gene in response to a selective pressure. This expansion must have be an ancient event as the whole family is conserved across simian cytomegaloviruses from old world monkeys. The evolutionary benefit bestowed by the combinatorial effect of US18 and US20 on

  5. Leukocyte Responsiveness to Exercise in Individuals Positive for Human Cytomegalovirus.

    PubMed

    Wilson, J N; Navalta, J W

    2016-05-01

    Human cytomegalovirus (HCMV) infects 50% of adults in the United States. HCMV can become a cause for concern in individuals who have a compromised immune system, which may occur after high-intensity exercise. The purpose of this preliminary study was to characterize the lymphocyte, monocyte, and neutrophil responses to exercise in HCMV+individuals. Participants were either positive (HCMV +) or negative (HCMV-) for HCMV. Participants visited the laboratory on 3 separate occasions: HCMV screening, 100% VO2max test, and 80% VO2max run. Mixed-model factorial ANOVA procedures with repeated measures on sampling condition were performed on absolute and relative circulating lymphocytes, monocytes, and neutrophils. Significant main effects for time for both absolute and relative values were seen for all leukocyte subsets regardless of virus status. Significant differences for absolute and relative values were seen between sampling conditions for all leukocyte subsets. We report for the first time that HCMV status does not affect circulating neutrophil responses to high-intensity exercise, though exercise-induced neutrocytosis is seen during the post-exercise and 60 min post-exercise sampling conditions, regardless of HCMV status. There is no HCMV effect on circulating monocyte responses to exercise, though exercise-induced monocytosis was seen during the post-exercise sampling condition regardless of HCMV status. PMID:26837931

  6. Glucocorticoids facilitate the transcription from the human cytomegalovirus major immediate early promoter in glucocorticoid receptor- and nuclear factor-I-like protein-dependent manner

    SciTech Connect

    Inoue-Toyoda, Maki; Kato, Kohsuke; Nagata, Kyosuke; Yoshikawa, Hiroyuki

    2015-02-27

    Human cytomegalovirus (HCMV) is a common and usually asymptomatic virus agent in healthy individuals. Initiation of HCMV productive infection depends on expression of the major immediate early (MIE) genes. The transcription of HCMV MIE genes is regulated by a diverse set of transcription factors. It was previously reported that productive HCMV infection is triggered probably by elevation of the plasma hydroxycorticoid level. However, it is poorly understood whether the transcription of MIE genes is directly regulated by glucocorticoid. Here, we found that the dexamethasone (DEX), a synthetic glucocorticoid, facilitates the transcription of HCMV MIE genes through the MIE promoter and enhancer in a glucocorticoid receptor (GR)-dependent manner. By competitive EMSA and reporter assays, we revealed that an NF-I like protein is involved in DEX-mediated transcriptional activation of the MIE promoter. Thus, this study supports a notion that the increased level of hydroxycorticoid in the third trimester of pregnancy reactivates HCMV virus production from the latent state. - Highlights: • DEX facilitates the transcription from the HCMV MIE promoter. • GR is involved in DEX-dependent transcription from the HCMV MIE promoter. • A 17 bp repeat is responsible for the HCMV MIE promoter activation by DEX. • An NF-I-like protein is involved in the HCMV MIE promoter activation by DEX.

  7. Toll-like receptor 4 is involved in the cell cycle modulation and required for effective human cytomegalovirus infection in THP-1 macrophages

    SciTech Connect

    Arcangeletti, Maria-Cristina; Germini, Diego; Rodighiero, Isabella; Mirandola, Prisco; De Conto, Flora; Medici, Maria-Cristina; Gatti, Rita; Chezzi, Carlo; Calderaro, Adriana

    2013-05-25

    Suitable host cell metabolic conditions are fundamental for the effective development of the human cytomegalovirus (HCMV) lytic cycle. Indeed, several studies have demonstrated the ability of this virus to interfere with cell cycle regulation, mainly by blocking proliferating cells in G1 or G1/S. In the present study, we demonstrate that HCMV deregulates the cell cycle of THP-1 macrophages (a cell line irreversibly arrested in G0) by pushing them into S and G2 phases. Moreover, we show that HCMV infection of THP-1 macrophages leads to Toll-like receptor 4 (TLR4) activation. Since various studies have indicated TLR4 to be involved in promoting cell proliferation, here we investigate the possible role of TLR4 in the observed HCMV-induced cell cycle perturbation. Our data strongly support TLR4 as a mediator of HCMV-triggered cell cycle activation in THP-1 macrophages favouring, in turn, the development of an efficient viral lytic cycle. - Highlights: ► We studied HCMV infection impact on THP-1 macrophage cell cycle. ► We analysed the role played by Toll-like receptor (TLR) 4 upon HCMV infection. ► HCMV pushes THP-1 macrophages (i.e. resting cells) to re-enter the cell cycle. ► TLR4 pathway inhibition strongly affects the effectiveness of HCMV replication. ► TLR4 pathway inhibition significantly decreases HCMV-induced cell cycle re-entry.

  8. The Oncogenic Potential of Human Cytomegalovirus and Breast Cancer

    PubMed Central

    Herbein, Georges; Kumar, Amit

    2014-01-01

    Breast cancer is the leading causes of cancer-related death among women. The vast majority of breast cancers are carcinomas that originate from cells lining the milk-forming ducts of the mammary gland. Numerous articles indicate that breast tumors exhibit diverse phenotypes depending on their distinct physiopathological signatures, clinical courses, and therapeutic possibilities. The human cytomegalovirus (HCMV) is a multifaceted highly host specific betaherpesvirus that is regarded as asymptomatic or mildly pathogenic virus in immunocompetent host. HCMV may cause serious in utero infections as well as acute and chronic complications in immunocompromised individual. The involvement of HCMV in late inflammatory complications underscores its possible role in inflammatory diseases and cancer. HCMV targets a variety of cell types in vivo, including macrophages, epithelial cells, endothelial cells, fibroblasts, stromal cells, neuronal cells, smooth muscle cells, and hepatocytes. HCMV can be detected in the milk after delivery and thereby HCMV could spread to adjacent mammary epithelial cells. HCMV also infects macrophages and induces an atypical M1/M2 phenotype, close to the tumor-associated macrophage phenotype, which is associated with the release of cytokines involved in cancer initiation or promotion and breast cancer of poor prognosis. HCMV antigens and DNA have been detected in tissue biopsies of breast cancers and elevation in serum HCMV IgG antibody levels has been reported to precede the development of breast cancer in some women. In this review, we will discuss the potential role of HCMV in the initiation and progression of breast cancer. PMID:25202681

  9. Bone-marrow-derived mesenchymal stem cells as a target for cytomegalovirus infection: Implications for hematopoiesis, self-renewal and differentiation potential

    SciTech Connect

    Smirnov, Sergey V.; Harbacheuski, Ryhor; Lewis-Antes, Anita; Zhu Hua; Rameshwar, Pranela; Kotenko, Sergei V. . E-mail: kotenkse@umdnj.edu

    2007-03-30

    Mesenchymal stem cells (MSCs) in bone marrow (BM) regulate the differentiation and proliferation of adjacent hematopoietic precursor cells and contribute to the regeneration of mesenchymal tissues, including bone, cartilage, fat and connective tissue. BM is an important site for the pathogenesis of human cytomegalovirus (HCMV) where the virus establishes latency in hematopoietic progenitors and can transmit after reactivation to neighboring cells. Here we demonstrate that BM-MSCs are permissive to productive HCMV infection, and that HCMV alters the function of MSCs: (i) by changing the repertoire of cell surface molecules in BM-MSCs, HCMV modifies the pattern of interaction between BM-MSCs and hematopoietic cells; (ii) HCMV infection of BM-MSCs undergoing adipogenic or osteogenic differentiation impaired the process of differentiation. Our results suggest that by altering BM-MSC biology, HCMV may contribute to the development of various diseases.

  10. Strategies to control human cytomegalovirus infection in adult hematopoietic stem cell transplant recipients.

    PubMed

    Lilleri, Daniele; Gerna, Giuseppe

    2016-09-01

    Human cytomegalovirus (HCMV) represents the major viral complication after hematopoietic stem cell transplantation. HCMV infection may be controlled by the reconstituting immune system and remain subclinical or can lead to severe systemic and/or organ disease (mainly pneumonia and gastroenteritis) when immune reconstitution is delayed or impaired. In order to prevent the occurrence of HCMV disease, a prompt diagnosis of HCMV infection is mandatory. The adoption of pre-emptive therapy strategies guided by virological monitoring dramatically reduced the occurrence of HCMV disease. However, late-onset end-organ disease may occur in some patients with apparent immune reconstitution. In the near future, introduction of immunological monitoring and immunotherapies could markedly improve management of HCMV infection. PMID:27485084

  11. Monitoring of Human Cytomegalovirus and Virus-Specific T-Cell Response in Young Patients Receiving Allogeneic Hematopoietic Stem Cell Transplantation

    PubMed Central

    Lilleri, Daniele; Gerna, Giuseppe; Zelini, Paola; Chiesa, Antonella; Rognoni, Vanina; Mastronuzzi, Angela; Giorgiani, Giovanna; Zecca, Marco; Locatelli, Franco

    2012-01-01

    In allogeneic hematopoietic stem-cell transplantation (HSCT) recipients, outcome of human cytomegalovirus (HCMV) infection results from balance between viral load/replication and pathogen-specific T-cell response. Using a cut-off of 30,000 HCMV DNA copies/ml blood for pre-emptive therapy and cut-offs of 1 and 3 virus-specific CD4+ and CD8+ T cells/µl blood for T-cell protection, we conducted in 131 young patients a prospective 3-year study aimed at verifying whether achievement of such immunological cut-offs protects from HCMV disease. In the first three months after transplantation, 55/89 (62%) HCMV-seropositive patients had infection and 36/55 (65%) were treated pre-emptively, whereas only 7/42 (17%) HCMV-seronegative patients developed infection and 3/7 (43%) were treated. After 12 months, 76 HCMV-seropositive and 9 HCMV-seronegative patients (cumulative incidence: 90% and 21%, respectively) displayed protective HCMV-specific immunity. Eighty of these 85 (95%) patients showed spontaneous control of HCMV infection without additional treatment. Five patients after reaching protective T-cell levels needed pre-emptive therapy, because they developed graft-versus-host disease (GvHD). HSCT recipients reconstituting protective levels of HCMV-specific T-cells in the absence of GvHD are no longer at risk for HCMV disease, at least within 3 years after transplantation. The decision to treat HCMV infection in young HSCT recipients may be taken by combining virological and immunological findings. PMID:22848556

  12. Active human cytomegalovirus infection and glycoprotein b genotypes in brazilian pediatric renal or hematopoietic stem cell transplantation patients.

    PubMed

    de Campos Dieamant, Débora; Bonon, Sandra Helena Alves; Prates, Liliane Cury; Belangelo, Vera Maria Santoro; Pontes, Erika R; Costa, Sandra Cecília Botelho

    2010-01-01

    A prospective analysis of active Human Cytomegalovirus infection (HCMV) was conducted on 33 pediatric renal or hematopoietic stem cell post-transplant patients. The HCMV-DNA positive samples were evaluated for the prevalence of different gB subtypes and their subsequent correlation with clinical signs. The surveillance of HCMV active infection was based on the monitoring of antigenemia (AGM) and on a nested polymerase chain reaction (N-PCR) for the detection of HCMV in the patients studied. Using restriction analysis of the gB gene sequence by PCR-RFLP (Restriction Fragment Length Polymorphism), different HCMV strains could be detected and classified in at least four HCMV genotypes. Thirty-three pediatric recipients of renal or bone marrow transplantation were monitored. Twenty out of thirty-three (60.6%) patients demonstrated active HCMV infection. gB1 and gB2 genotypes were more frequent in this population. In this study, we observed that gB2 had correlation with reactivation of HCMV infection and that patients with mixture of genotypes did not show any symptoms of HCMV disease. Future studies has been made to confirm this. PMID:24031463

  13. Human Cytomegalovirus Inhibits Erythropoietin Production

    PubMed Central

    Dzabic, Mensur; Bakker, Frank; Davoudi, Belghis; Jeffery, Hannah; Religa, Piotr; Bojakowski, Krzysztof; Yaiw, Koon-Chu; Rahbar, Afsar; Söderberg-Naucler, Cecilia

    2014-01-01

    Anemia is a feature of CKD and a complication of renal transplantation, often caused by impaired production of erythropoietin. The kidney is a target organ for human cytomegalovirus (hCMV) in such patients, but it is not known whether hCMV effects erythropoietin production. We found that kidneys from patients with CKD were positive for hCMV protein and that blood levels of hCMV IgG inversely correlated with red blood cell count. In mice, systemic murine cytomegalovirus infection decreased serum erythropoietin levels. In human erythropoietin-producing cells, hCMV inhibited hypoxia-induced expression of erythropoietin mRNA and protein. hCMV early gene expression was responsible, as ultraviolet-inactivated virus had no effect and valganciclovir treatment showed that late gene expression was nonessential. Hypoxia-induced gene transcription is controlled by the transcription factors hypoxia-inducible transcription factor (HIF)-1α and HIF2α, which are constitutively produced but stable only under low oxygen conditions. We found that hCMV inhibited constitutive production of HIF2α mRNA. HIF2α is thought to be the master regulator of erythropoietin transcription. Single-cell analysis revealed that nuclear accumulation of HIF2α was inhibited in hCMV-infected cells, and the extent of inhibition correlated with hCMV protein expression. Our findings suggest that renal hCMV infection could induce or exacerbate anemia in patients. PMID:24722450

  14. Exploiting viral natural history for vaccine development.

    PubMed

    Barry, Peter A

    2015-06-01

    The partial successes of the Phase 2 gB-based vaccine trials for HCMV highlight the very real likelihood that vaccine-mediated induction of antibodies that neutralize the fusion pathway of fibroblast infection is not sufficient as a singular strategy to confer protective efficacy against primary HCMV infection. Alternative strategies that serve as adjuncts to gB-based vaccines are likely required to target different aspects of the complex lifecycle of HCMV infection. There has been considerable recent interest in targeting the gH/gL/UL128/UL130/UL131 pentamer complex (gH/gL-PC) to neutralize the endocytic pathway of HCMV infection of epithelial and endothelial cells. Since both cell types are critical during primary mucosal infection, intrahost spread, and shedding of HCMV in an infected host, the gH/gL-PC represents a high-value target for vaccination to interrupt the HCMV lifecycle. The natural history of HCMV is exceedingly complex and incompletely resolved, and the protective efficacy generated by gH/gL-PC remains to be validated in clinical trials. Yet, there are salient aspects of its lifecycle that offer clues about how other novel vaccine strategies can be targeted to especially susceptible parts of the viral proteome to significantly disrupt HCMV's ability to infect susceptible hosts. In particular, the protracted evolution of Herpesvirales has endowed HCMV with two remarkable properties of its natural history: (1) lifelong persistence within immune hosts that develop extraordinarily large antiviral immune responses and (2) the ability to reinfect those with prior immunity. The latter phenotype strongly implies that, if HCMV can overcome prior immunity to initiate a new infection, it is likely irrelevant whether prior immunity derives from prior infection or prior vaccination. Both phenotypes are unified by the extensive devotion of the HCMV coding repertoire (~50%) to viral proteins that modulate host cell signaling, trafficking, activation, antigen

  15. Sequestration of human cytomegalovirus by human renal and mammary epithelial cells

    SciTech Connect

    Twite, Nicolas; Andrei, Graciela; Kummert, Caroline; Donner, Catherine; Perez-Morga, David; De Vos, Rita; Snoeck, Robert; Marchant, Arnaud

    2014-07-15

    Urine and breast milk represent the main routes of human cytomegalovirus (HCMV) transmission but the contribution of renal and mammary epithelial cells to viral excretion remains unclear. We observed that kidney and mammary epithelial cells were permissive to HCMV infection and expressed immediate early, early and late antigens within 72 h of infection. During the first 24 h after infection, high titers of infectious virus were measured associated to the cells and in culture supernatants, independently of de novo synthesis of virus progeny. This phenomenon was not observed in HCMV-infected fibroblasts and suggested the sequestration and the release of HCMV by epithelial cells. This hypothesis was supported by confocal and electron microscopy analyses. The sequestration and progressive release of HCMV by kidney and mammary epithelial cells may play an important role in the excretion of the virus in urine and breast milk and may thereby contribute to HCMV transmission. - Highlights: • Primary renal and mammary epithelial cells are permissive to HCMV infection. • HCMV is sequestered by epithelial cells and this phenomenon does not require viral replication. • HCMV sequestration by epithelial cells is reduced by antibodies and IFN-γ.

  16. Human cytomegalovirus Fcγ binding proteins gp34 and gp68 antagonize Fcγ receptors I, II and III.

    PubMed

    Corrales-Aguilar, Eugenia; Trilling, Mirko; Hunold, Katja; Fiedler, Manuela; Le, Vu Thuy Khanh; Reinhard, Henrike; Ehrhardt, Katrin; Mercé-Maldonado, Eva; Aliyev, Enver; Zimmermann, Albert; Johnson, David C; Hengel, Hartmut

    2014-05-01

    Human cytomegalovirus (HCMV) establishes lifelong infection with recurrent episodes of virus production and shedding despite the presence of adaptive immunological memory responses including HCMV immune immunoglobulin G (IgG). Very little is known how HCMV evades from humoral and cellular IgG-dependent immune responses, the latter being executed by cells expressing surface receptors for the Fc domain of IgG (FcγRs). Remarkably, HCMV expresses the RL11-encoded gp34 and UL119-118-encoded gp68 type I transmembrane glycoproteins which bind Fcγ with nanomolar affinity. Using a newly developed FcγR activation assay, we tested if the HCMV-encoded Fcγ binding proteins (HCMV FcγRs) interfere with individual host FcγRs. In absence of gp34 or/and gp68, HCMV elicited a much stronger activation of FcγRIIIA/CD16, FcγRIIA/CD32A and FcγRI/CD64 by polyclonal HCMV-immune IgG as compared to wildtype HCMV. gp34 and gp68 co-expression culminates in the late phase of HCMV replication coinciding with the emergence of surface HCMV antigens triggering FcγRIII/CD16 responses by polyclonal HCMV-immune IgG. The gp34- and gp68-dependent inhibition of HCMV immune IgG was fully reproduced when testing the activation of primary human NK cells. Their broad antagonistic function towards FcγRIIIA, FcγRIIA and FcγRI activation was also recapitulated in a gain-of-function approach based on humanized monoclonal antibodies (trastuzumab, rituximab) and isotypes of different IgG subclasses. Surface immune-precipitation showed that both HCMV-encoded Fcγ binding proteins have the capacity to bind trastuzumab antibody-HER2 antigen complexes demonstrating simultaneous linkage of immune IgG with antigen and the HCMV inhibitors on the plasma membrane. Our studies reveal a novel strategy by which viral FcγRs can compete for immune complexes against various Fc receptors on immune cells, dampening their activation and antiviral immunity. PMID:24830376

  17. Interleukin-2 from Adaptive T Cells Enhances Natural Killer Cell Activity against Human Cytomegalovirus-Infected Macrophages

    PubMed Central

    Wu, Zeguang; Frascaroli, Giada; Bayer, Carina; Schmal, Tatjana

    2015-01-01

    ABSTRACT Control of human cytomegalovirus (HCMV) requires a continuous immune surveillance, thus HCMV is the most important viral pathogen in severely immunocompromised individuals. Both innate and adaptive immunity contribute to the control of HCMV. Here, we report that peripheral blood natural killer cells (PBNKs) from HCMV-seropositive donors showed an enhanced activity toward HCMV-infected autologous macrophages. However, this enhanced response was abolished when purified NK cells were applied as effectors. We demonstrate that this enhanced PBNK activity was dependent on the interleukin-2 (IL-2) secretion of CD4+ T cells when reexposed to the virus. Purified T cells enhanced the activity of purified NK cells in response to HCMV-infected macrophages. This effect could be suppressed by IL-2 blocking. Our findings not only extend the knowledge on the immune surveillance in HCMV—namely, that NK cell-mediated innate immunity can be enhanced by a preexisting T cell antiviral immunity—but also indicate a potential clinical implication for patients at risk for severe HCMV manifestations due to immunosuppressive drugs, which mainly suppress IL-2 production and T cell responsiveness. IMPORTANCE Human cytomegalovirus (HCMV) is never cleared by the host after primary infection but instead establishes a lifelong latent infection with possible reactivations when the host′s immunity becomes suppressed. Both innate immunity and adaptive immunity are important for the control of viral infections. Natural killer (NK) cells are main innate effectors providing a rapid response to virus-infected cells. Virus-specific T cells are the main adaptive effectors that are critical for the control of the latent infection and limitation of reinfection. In this study, we found that IL-2 secreted by adaptive CD4+ T cells after reexposure to HCMV enhances the activity of NK cells in response to HCMV-infected target cells. This is the first direct evidence that the adaptive T cells can

  18. Identification of domains within the human cytomegalovirus major immediate-early 86-kilodalton protein and the retinoblastoma protein required for physical and functional interaction with each other.

    PubMed Central

    Fortunato, E A; Sommer, M H; Yoder, K; Spector, D H

    1997-01-01

    The human cytomegalovirus major immediate-early 86-kDa protein (IE2 86) plays an important role in the trans activation and regulation of HCMV gene expression. Previously, we demonstrated that IE2 86 contains three regions (amino acids [aa] 86 to 135, 136 to 290, and 291 to 364) that can independently bind to in vitro-translated Rb when IE2 86 is produced as a glutathione S-transferase fusion protein (M. H. Sommer, A. L. Scully, and D. H. Spector, J. Virol. 68:6223-6231, 1994). In this report, we have elucidated the regions of Rb involved in binding to IE2 86 and have further analyzed the functional nature of the interaction between these two proteins. We find that two domains on Rb, the A/B pocket and the carboxy terminus, can each independently form a complex with IE2 86. In functional assays, we demonstrate that IE2 86 and another IE protein, IE1 72, can counter the enlarged flat cell phenotype, but not the G1/S block, which results from expression of wild-type Rb in the human osteosarcoma cell line Saos-2. Mutational analysis reveals that there are two domains on IE2 86 that can independently affect Rb function. One region (aa 241 to 369) includes the major Rb-binding domain, while the second maps to the amino-terminal region (aa 1 to 85) common to both IE2 86 and IE1 72. These data show that Rb and IE2 86 physically and functionally interact with each other via at least two separate domains and provide further support for the hypothesis that IE2 86 may exert its pleiotropic effects through the formation of multimeric protein complexes. PMID:9343168

  19. Human Cytomegalovirus-Induced NKG2Chi CD57hi Natural Killer Cells Are Effectors Dependent on Humoral Antiviral Immunity

    PubMed Central

    Wu, Zeguang; Sinzger, Christian; Frascaroli, Giada; Reichel, Johanna; Bayer, Carina; Wang, Li; Schirmbeck, Reinhold

    2013-01-01

    Recent studies indicate that expansion of NKG2C-positive natural killer (NK) cells is associated with human cytomegalovirus (HCMV); however, their activity in response to HCMV-infected cells remains unclear. We show that NKG2Chi CD57hi NK cells gated on CD3neg CD56dim cells can be phenotypically identified as HCMV-induced NK cells that can be activated by HCMV-infected cells. Using HCMV-infected autologous macrophages as targets, we were able to show that these NKG2Chi CD57hi NK cells are highly responsive to HCMV-infected macrophages only in the presence of HCMV-specific antibodies, whereas they are functionally poor effectors of natural cytotoxicity. We further demonstrate that NKG2Chi CD57hi NK cells are intrinsically responsive to signaling through CD16 cross-linking. Our findings show that the activity of pathogen-induced innate immune cells can be enhanced by adaptive humoral immunity. Understanding the activity of NKG2Chi CD57hi NK cells against HCMV-infected cells will be of relevance for the further development of adoptive immunotherapy. PMID:23637420

  20. Human Cytomegalovirus Inhibits the PARsylation Activity of Tankyrase—A Potential Strategy for Suppression of the Wnt Pathway

    PubMed Central

    Roy, Sujayita; Liu, Fengjie; Arav-Boger, Ravit

    2015-01-01

    Human cytomegalovirus (HCMV) was reported to downregulate the Wnt/β-catenin pathway. Induction of Axin1, the negative regulator of the Wnt pathway, has been reported as an important mechanism for inhibition of β-catenin. Since Tankyrase (TNKS) negatively regulates Axin1, we investigated the effect of HCMV on TNKS expression and poly-ADP ribose polymerase (PARsylation) activity, during virus replication. Starting at 24 h post infection, HCMV stabilized the expression of TNKS and reduced its PARsylation activity, resulting in accumulation of Axin1 and reduction in its PARsylation as well. General PARsylation was not changed in HCMV-infected cells, suggesting specific inhibition of TNKS PARsylation. Similarly, treatment with XAV939, a chemical inhibitor of TNKS’ activity, resulted in the accumulation of TNKS in both non-infected and HCMV-infected cell lines. Reduction of TNKS activity or knockdown of TNKS was beneficial for HCMV, evidenced by its improved growth in fibroblasts. Our results suggest that HCMV modulates the activity of TNKS to induce Axin1, resulting in inhibition of the β-catenin pathway. Since HCMV replication is facilitated by TNKS knockdown or inhibition of its activity, TNKS may serve as an important virus target for control of a variety of cellular processes. PMID:26729153

  1. Bacterial Muramyl Dipeptide (MDP) Restricts Human Cytomegalovirus Replication via an IFN-β-Dependent Pathway

    PubMed Central

    Kapoor, Arun; Fan, Yi-Hsin; Arav-Boger, Ravit

    2016-01-01

    We recently reported that induction of NOD2 by human Cytomegalovirus (HCMV) resulted in virus inhibition and upregulation of antiviral and inflammatory cytokines. Here we investigated the effects of muramyl dipeptide (MDP), a bacterial cell wall component that activates NOD2, on HCMV replication and antiviral responses. HCMV infection of human foreskin fibroblasts induced NOD2, the downstream receptor-interacting serine/threonine-protein kinase 2 (RIPK2), resulting in phosphorylation of TANK-binding kinase 1 (TBK1) and interferon regulatory factor 3 (IRF3). MDP treatment following infection at low multiplicity (MOI = 0.1 PFU/cell) inhibited HCMV in a dose-dependent manner and further induced phosphorylation of TBK1, IRF3 and expression of IFN-β. None of these effects of MDP were observed following infection at multiplicity of 1. In infected NOD2 knocked-down cells MDP did not induce IFN-β, irrespective of MOI. Treatment with MDP before infection also inhibited HCMV, an effect augmented with treatment duration. Treatment with an IFN-β receptor blocking antibody or knockdown of IFN-β significantly attenuated the inhibitory effect of MDP on HCMV. MDP treatment before or after infection with herpesvirus 1 did not inhibit its replication. Summarized, NOD2 activation exerts anti-HCMV activities predominantly via IFN-β. Since MDP is a bacterial cell wall component, ongoing microbial exposure may influence HCMV replication. PMID:26830977

  2. Human cytomegalovirus renders cells non-permissive for replication of herpes simplex viruses

    SciTech Connect

    Cockley, K.D.

    1988-01-01

    The herpes simplex virus (HSV) genome during production infection in vitro may be subject to negative regulation which results in modification of the cascade of expression of herpes virus macromolecular synthesis leading to establishment of HSV latency. In the present study, human embryonic lung (HEL) cells infected with human cytomegalovirus (HCMV) restricted the replication of HSV type-1 (HSV-1). A delay in HSV replication of 15 hr as well as a consistent, almost 1000-fold inhibition of HSV replication in HCMV-infected cell cultures harvested 24 to 72 hr after superinfection were observed compared with controls infected with HSV alone. HSV type-2 (HSV-2) replication was similarly inhibited in HCMV-infected HEL cells. Prior ultraviolet-irradiation (UV) of HCMV removed the block to HSV replication, demonstrating the requirement for an active HCMV genome. HCMV deoxyribonucleic acid (DNA) negative temperature-sensitive (ts) mutants inhibited HSV replications as efficiently as wild-type (wt) HCMV at the non-permissive temperature. Evidence for penetration and replication of superinfecting HSV into HCMV-infected cells was provided by blot hybridization of HSV DNA synthesized in HSV-superinfected cell cultures and by cesium chloride density gradient analysis of ({sup 3}H)-labeled HSV-1-superinfected cells.

  3. Human cytomegalovirus antiviral drug resistance in hematopoietic stem cell transplantation: current state of the art.

    PubMed

    Campos, Ana Bela; Ribeiro, Joana; Boutolleau, David; Sousa, Hugo

    2016-05-01

    Human cytomegalovirus (HCMV) infection is a major cause of morbidity and mortality in allogeneic hematopoietic stem cell transplant recipients. The significant clinical impact of HCMV infection and progression to HCMV disease among allogeneic hematopoietic stem cell transplant recipients has been reduced by prophylactic, preemptive, and curative treatments using ganciclovir, valganciclovir, foscarnet, and cidofovir. Resistance to (val)ganciclovir results from mutations localized in HCMV UL97 gene (encoding the pUL97 phosphotransferase), UL54 gene (encoding the pUL54 DNA polymerase), or both genes, whereas foscarnet and cidofovir resistance results from mutations localized within UL54 gene only. This review is focused on HCMV antiviral drug resistance, including the functions of target genes of antivirals, the mechanisms of antiviral resistance, the different mutations in pUL97 and pUL54 that have been identified in either clinical isolates or laboratory strains, and their impact on HCMV susceptibility to antiviral drugs. It emphasizes the importance of proving that observed genetic changes confer resistance so they can be distinguished from polymorphisms. Because of the emergence of HCMV resistance to currently available drugs, novel drugs are urgently needed for the therapeutic management of HCMV-resistant infections in hematopoietic stem cell transplant patients. PMID:26990717

  4. VCL-CB01, an injectable bivalent plasmid DNA vaccine for potential protection against CMV disease and infection

    PubMed Central

    Schleiss, Mark R

    2010-01-01

    Vaccines for the prevention of human CMV (hCMV) infection and disease are a major public health priority. Immunization with DNA vaccines encoding key proteins involved in the immune response to hCMV has emerged as a major focus of hCMV vaccine research. Validation of the protective effect of DNA vaccination in animal models has provided support for clinical trials. VCL-CB01, under development byVical Inc for the prevention of hCMV infection and disease, is a poloxamer-formulated, bivalent DNA vaccine that contains plasmids encoding hCMV tegument phosphoprotein 65 and the major hCMV surface glycoprotein B. In a phase I trial in healthy adults, VCL-CB01 was well tolerated. In interim results from a phase II trial in hCMV-seropositive hematopoietic cell transplant recipients, VCL-CB01 increased T-cell responses compared with placebo. The final results from the phase II trial will be of value for developing strategies to prevent hCMV disease in hCMV-seropositive transplant recipients, and may lead to other trials of VCL-CB01 or related vaccines for the prevention of congenital hCMV infection. PMID:19806506

  5. Development of the adaptive NK cell response to human cytomegalovirus in the context of aging.

    PubMed

    López-Botet, Miguel; Muntasell, Aura; Martínez-Rodríguez, José E; López-Montañés, María; Costa-García, Marcel; Pupuleku, Aldi

    2016-09-01

    Human cytomegalovirus (HCMV) establishes a highly prevalent life-long latent infection. Though generally subclinical, HCMV infection may have severe consequences during fetal development and in immunocompromised individuals. Based on epidemiological studies HCMV(+) serology has been associated with the development of atherosclerosis, immune senescence and an increase mortality rate in elderly people. Such long-term detrimental effects of the viral infection presumably result from an inefficient immune control of the pathogen, depending on the quality and evolution of the individual host-pathogen relationship. Together with antigen-specific T lymphocytes, NK cells play an important role in anti-viral immune defense. HCMV promotes in some individuals the differentiation and persistent steady state expansion of an NK cell subset bearing the CD94/NKG2C activating receptor. The relationship between this adaptive NK cell response to HCMV and aging is overviewed. PMID:27349430

  6. The life cycle and pathogenesis of human cytomegalovirus infection: lessons from proteomics

    PubMed Central

    Beltran, Pierre M. Jean; Cristea, Ileana M.

    2015-01-01

    Viruses have co-evolved with their hosts, acquiring strategies to subvert host cellular pathways for effective viral replication and spread. Human cytomegalovirus (HCMV), a widely-spread β-herpesvirus, is a major cause of birth defects and opportunistic infections in HIV-1/AIDS patients. HCMV displays an intricate system-wide modulation of the human cell proteome. An impressive array of virus–host protein interactions occurs throughout the infection. To investigate the virus life cycle, proteomics has recently become a significant component of virology studies. Here, we review the mass spectrometry-based proteomics approaches used in HCMV studies, as well as their contribution to understanding the HCMV life cycle and the virus-induced changes to host cells. The importance of the biological insights gained from these studies clearly demonstrate the impact that proteomics has had and can continue to have on understanding HCMV biology and identifying new therapeutic targets. PMID:25327590

  7. Acute Cytomegalovirus Infection as a Cause of Venous Thromboembolism

    PubMed Central

    Rinaldi, Francesca; Lissandrin, Raffaella; Mojoli, Francesco; Baldanti, Fausto; Brunetti, Enrico; Pascarella, Michela; Giordani, Maria Teresa

    2014-01-01

    Acute Human Cytomegalovirus (HCMV) infection is an unusual cause of venous thromboembolism, a potentially life-threatening condition. Thrombus formation can occur at the onset of the disease or later during the recovery and may also occur in the absence of acute HCMV hepatitis. It is likely due to both vascular endothelium damage caused by HCMV and impairment of the clotting balance caused by the virus itself. Here we report on two immunocompetent women with splanchnic thrombosis that occurred during the course of acute HCMV infection. Although the prevalence of venous thrombosis in patients with acute HCMV infection is unknown, physicians should be aware of its occurrence, particularly in immunocompetent patients presenting with fever and unexplained abdominal pain. PMID:24959338

  8. Is human cytomegalovirus associated with breast cancer progression?

    PubMed Central

    2013-01-01

    Background It has been hypothesized that human cytomegalovirus (HCMV) may be associated with breast cancer progression. However, the role of HCMV infection in breast cancer remains controversial. We aimed to assess whether HCMV genes (UL122 and UL83) could be detected in breast carcinomas and reinvestigated their possible association with breast cancer progression. DNA from paraffin-embedded tissues was analyzed by real-time PCR. We investigated 20 fibroadenomas and 27 primary breast carcinomas (stages II, III, and IV). Findings Two carcinomas were positive for HCMV, one was positive for two TaqMan viral detection probes, and one was positive for a sole TaqMan viral detection probe (UL83), whereas the remainder of the samples was negative. Conclusions Samples studied showed no association between HCMV infection and breast cancer progression. PMID:23557440

  9. Human cytomegalovirus gene expression in long-term infected glioma stem cells.

    PubMed

    Fiallos, Estefania; Judkins, Jonathon; Matlaf, Lisa; Prichard, Mark; Dittmer, Dirk; Cobbs, Charles; Soroceanu, Liliana

    2014-01-01

    The most common adult primary brain tumor, glioblastoma (GBM), is characterized by fifteen months median patient survival and has no clear etiology. We and others have identified the presence of human cytomegalovirus (HCMV) gene products endogenously expressed in GBM tissue and primary cells, with a subset of viral genes being consistently expressed in most samples. Among these viral genes, several have important oncomodulatory properties, regulating tumor stemness, proliferation, immune evasion, invasion and angiogenesis. These findings lead us to hypothesize that a specific HCMV gene signature may be associated with GBM pathogenesis. To investigate this hypothesis, we used glioma cell lines and primary glioma stem-like cells (GSC) infected with clinical and laboratory HCMV strains and measured relative viral gene expression levels along several time points up to 15 weeks post-infection. While HCMV gene expression was detected in several infected glioma lines through week 5 post-infection, only HCMV-infected GSC expressed viral gene products 15 weeks post-infection. Efficiency of infection across time was higher in GSC compared to cell lines. Importantly, HCMV-infected GSC outlived their uninfected counterparts, and this extended survival was paralleled by increased tumorsphere frequency and upregulation of stemness regulators, such as SOX2, p-STAT3, and BMX (a novel HCMV target identified in this study). Interleukin 6 (IL-6) treatment significantly upregulated HCMV gene expression in long-term infected glioma cultures, suggesting that pro-inflammatory signaling in the tumor milieu may further augment HCMV gene expression and subsequent tumor progression driven by viral-induced cellular signaling. Together, our data support a critical role for long-term, low-level HCMV infection in promoting survival, stemness, and proliferation of GSC that could significantly contribute to GBM pathogenesis. PMID:25549333

  10. Induction of cellular hsp70 expression by human cytomegalovirus.

    PubMed Central

    Santomenna, L D; Colberg-Poley, A M

    1990-01-01

    Expression of the cellular heat shock protein 70 gene (hsp70) is transiently induced by human cytomegalovirus (HCMV) infection of permissive human diploid fibroblasts. Induction of the cellular heat shock response during critical times of infection had previously been reported to alter the growth of HCMV in vitro. Thus, a potential interaction between heat shock proteins and HCMV expression was indicated. HCMV dramatically increased expression of hsp70 RNA within 8 h of infection. hsp70 RNA remained elevated at 24 and 48 h postinfection and decreased to low levels of 72 h postinfection. Induction of HSP70 protein occurred more slowly; inducible HSP70 protein encoded by this RNA increased within 16 h postinfection and continued to increase throughout infection until 72 h postinfection, when the highest abundance of inducible HSP70 protein was observed. Cells that received both heat (43 degrees C for 70 min) treatment and HCMV infection expressed hsp70 RNA to levels above the sum of levels present in cells given either treatment alone. Furthermore, hsp70 RNA induction occurred earlier and remained elevated longer than in cells infected with HCMV alone or in cells treated with heat alone, respectively. Nevertheless, the pattern of HCMV immediate-early transcript expression at 2, 4, and 6 h postinfection appeared to be unchanged by this prior heat treatment. Our results suggest that heat shock treatment and HCMV infection can act additively in stimulating hsp70 RNA expression. The previously reported stimulation of HCMV growth in vitro following the heat shock response apparently does not result from alterations in the steady-state expression of HCMV immediate-early transcripts. Images PMID:2157870

  11. Cytomegalovirus infection induces a stem cell phenotype in human primary glioblastoma cells: prognostic significance and biological impact.

    PubMed

    Fornara, O; Bartek, J; Rahbar, A; Odeberg, J; Khan, Z; Peredo, I; Hamerlik, P; Bartek, J; Stragliotto, G; Landázuri, N; Söderberg-Nauclér, C

    2016-02-01

    Glioblastoma (GBM) is associated with poor prognosis despite aggressive surgical resection, chemotherapy, and radiation therapy. Unfortunately, this standard therapy does not target glioma cancer stem cells (GCSCs), a subpopulation of GBM cells that can give rise to recurrent tumors. GBMs express human cytomegalovirus (HCMV) proteins, and previously we found that the level of expression of HCMV immediate-early (IE) protein in GBMs is a prognostic factor for poor patient survival. In this study, we investigated the relation between HCMV infection of GBM cells and the presence of GCSCs. Primary GBMs were characterized by their expression of HCMV-IE and GCSCs marker CD133 and by patient survival. The extent to which HCMV infection of primary GBM cells induced a GCSC phenotype was evaluated in vitro. In primary GBMs, a large fraction of CD133-positive cells expressed HCMV-IE, and higher co-expression of these two proteins predicted poor patient survival. Infection of GBM cells with HCMV led to upregulation of CD133 and other GSCS markers (Notch1, Sox2, Oct4, Nestin). HCMV infection also promoted the growth of GBM cells as neurospheres, a behavior typically displayed by GCSCs, and this phenotype was prevented by either chemical inhibition of the Notch1 pathway or by treatment with the anti-viral drug ganciclovir. GBM cells that maintained expression of HCMV-IE failed to differentiate into neuronal or astrocytic phenotypes. Our findings imply that HCMV infection induces phenotypic plasticity of GBM cells to promote GCSC features and may thereby increase the aggressiveness of this tumor. PMID:26138445

  12. Human cytomegalovirus inhibits maturation and impairs function of monocyte-derived dendritic cells.

    PubMed

    Moutaftsi, Magdalena; Mehl, Anja M; Borysiewicz, Leszek K; Tabi, Zsuzsanna

    2002-04-15

    Dendritic cells (DCs) play a pivotal role in the generation of virus-specific cytotoxic T-cell responses, but some viruses can render DCs inefficient in stimulating T cells. We studied whether infection of DCs with human cytomegalovirus (HCMV) results in a suppression of DC function which may assist HCMV in establishing persistence. The effect of HCMV infection on the phenotype and function of monocyte-derived DCs and on their ability to mature following infection with an endothelial cell-adapted clinical HCMV isolate were studied. HCMV infection induced no maturation of DCs; instead, it efficiently down-regulated the expression of surface major histocompatibility complex (MHC) class I, CD40, and CD80 molecules. Slight down-regulation of MHC class II and CD86 molecules was also observed. Lipopolysaccharide (LPS)-induced maturation of infected DCs was strongly inhibited, as indicated by lower levels of surface expression of MHC class I, class II, costimulatory, and CD83 molecules. The down-regulation or inhibition of these surface markers occurred only in HCMV antigen-positive DCs. DCs produced no interleukin 12 (IL-12) and only low levels of tumor necrosis factor alpha (TNF-alpha) upon HCMV infection. Furthermore, cytokine production upon stimulation with LPS or CD40L was significantly impaired. Inhibition of cytokine production did not depend on viral gene expression as UV-irradiated HCMV resulted in the same effect. Proliferation and cytotoxicity of T cells specific to a recall antigen presented by DCs were also reduced when DCs were HCMV infected. This study shows that HCMV inhibits DC function, revealing a powerful viral strategy to delay or prevent the generation of virus-specific cytotoxic T cells. PMID:11929782

  13. Activation of Nucleotide Oligomerization Domain 2 (NOD2) by Human Cytomegalovirus Initiates Innate Immune Responses and Restricts Virus Replication

    PubMed Central

    Kapoor, Arun; Forman, Michael; Arav-Boger, Ravit

    2014-01-01

    Nucleotide-binding oligomerization domain 2 (NOD2) is an important innate immune sensor of bacterial pathogens. Its induction results in activation of the classic NF-κB pathway and alternative pathways including type I IFN and autophagy. Although the importance of NOD2 in recognizing RNA viruses has recently been identified, its role in sensing DNA viruses has not been studied. We report that infection with human cytomegalovirus (HCMV) results in significant induction of NOD2 expression, beginning as early as 2 hours post infection and increasing steadily 24 hours post infection and afterwards. Infection with human herpesvirus 1 and 2 does not induce NOD2 expression. While the HCMV-encoded glycoprotein B is not required for NOD2 induction, a replication competent virion is necessary. Lentivirus-based NOD2 knockdown in human foreskin fibroblasts (HFFs) and U373 glioma cells leads to enhanced HCMV replication along with decreased levels of interferon beta (IFN-β) and the pro-inflammatory cytokine, IL8. NOD2 induction in HCMV-infected cells activates downstream NF-κB and interferon pathways supported by reduced nuclear localization of NF-κB and pIRF3 in NOD2 knockdown HFFs. Stable overexpression of NOD2 in HFFs restricts HCMV replication in association with increased levels of IFN-β and IL8. Similarly, transient overexpression of NOD2 in U373 cells or its downstream kinase, RIPK2, results in decreased HCMV replication and enhanced cytokine responses. However, overexpression of a mutant NOD2, 3020insC, associated with severe Crohn's disease, results in enhanced HCMV replication and decreased levels of IFN-β in U373 cells. These results show for the first time that NOD2 plays a significant role in HCMV replication and may provide a model for studies of HCMV recognition by the host cell and HCMV colitis in Crohn's disease. PMID:24671169

  14. Two distinct upstream regulatory domains containing multicopy cellular transcription factor binding sites provide basal repression and inducible enhancer characteristics to the immediate-early IES (US3) promoter from human cytomegalovirus.

    PubMed

    Chan, Y J; Tseng, W P; Hayward, G S

    1996-08-01

    , HeLa, and Vero cells all formed both the A and B NRE binding factor complexes, whereas those from HF cells produced only A complexes, and Raji, HL60, and BALB/c 3T3 cells lacked both types of binding factor complexes. The core pentameric CGACA and CGATA half sites present in both the P and I Nru motifs are related to recently described Drosophila chromosomal insulator binding sites. Therefore, in addition to its cis-repression or silencer characteristics, the NRE domain appears likely to act to shield adjacent segments of the viral genome from the chromatin-reorganizing effects of the IES-inducible enhancer. We speculate that differential expression and regulation of the IES enhancer-controlled US3 protein, either in concert with or separately from the major IE (MIE) enhancer-controlled IE1 and IE2 transactivator proteins, may play a critical role in determining HCMV permissiveness in some cell types and perhaps also in the establishment of or reactivation from latency. PMID:8764042

  15. Bioactive Molecules Released From Cells Infected with the Human Cytomegalovirus

    PubMed Central

    Luganini, Anna; Terlizzi, Maria E.; Gribaudo, Giorgio

    2016-01-01

    Following primary infection in humans, the human cytomegalovirus (HCMV) persists in a latent state throughout the host’s lifetime despite a strong and efficient immune response. If the host experiences some form of immune dysregulation, such as immunosuppression or immunodeficiency, HCMV reactivates, thereby emerging from latency. Thus, in the absence of effective functional immune responses, as occurs in immunocompromised or immunoimmature individuals, both HCMV primary infections and reactivations from latency can cause significant morbidity and mortality. However, even in immunocompetent hosts, HCMV represents a relevant risk factor for the development of several chronic inflammatory diseases and certain forms of neoplasia. HCMV infection may shift between the lytic and latent state, regulated by a delicate and intricate balance between virus-mediated immunomodulation and host immune defenses. Indeed, HCMV is a master in manipulating innate and adaptive host defense pathways, and a large portion of its genome is devoted to encoding immunomodulatory proteins; such proteins may thus represent important virulence determinants. However, the pathogenesis of HCMV-related diseases is strengthened by the activities of bioactive molecules, of both viral and cellular origin, that are secreted from infected cells and collectively named as the secretome. Here, we review the state of knowledge on the composition and functions of HCMV-derived secretomes. In lytic infections of fibroblasts and different types of endothelial cells, the majority of HCMV-induced secreted proteins act in a paracrine fashion to stimulate the generation of an inflammatory microenvironment around infected cells; this may lead to vascular inflammation and angiogenesis that, in turn, foster HCMV replication and its dissemination through host tissues. Conversely, the HCMV secretome derived from latently infected hematopoietic progenitor cells induces an immunosuppressive extracellular environment that

  16. Bioactive Molecules Released From Cells Infected with the Human Cytomegalovirus.

    PubMed

    Luganini, Anna; Terlizzi, Maria E; Gribaudo, Giorgio

    2016-01-01

    Following primary infection in humans, the human cytomegalovirus (HCMV) persists in a latent state throughout the host's lifetime despite a strong and efficient immune response. If the host experiences some form of immune dysregulation, such as immunosuppression or immunodeficiency, HCMV reactivates, thereby emerging from latency. Thus, in the absence of effective functional immune responses, as occurs in immunocompromised or immunoimmature individuals, both HCMV primary infections and reactivations from latency can cause significant morbidity and mortality. However, even in immunocompetent hosts, HCMV represents a relevant risk factor for the development of several chronic inflammatory diseases and certain forms of neoplasia. HCMV infection may shift between the lytic and latent state, regulated by a delicate and intricate balance between virus-mediated immunomodulation and host immune defenses. Indeed, HCMV is a master in manipulating innate and adaptive host defense pathways, and a large portion of its genome is devoted to encoding immunomodulatory proteins; such proteins may thus represent important virulence determinants. However, the pathogenesis of HCMV-related diseases is strengthened by the activities of bioactive molecules, of both viral and cellular origin, that are secreted from infected cells and collectively named as the secretome. Here, we review the state of knowledge on the composition and functions of HCMV-derived secretomes. In lytic infections of fibroblasts and different types of endothelial cells, the majority of HCMV-induced secreted proteins act in a paracrine fashion to stimulate the generation of an inflammatory microenvironment around infected cells; this may lead to vascular inflammation and angiogenesis that, in turn, foster HCMV replication and its dissemination through host tissues. Conversely, the HCMV secretome derived from latently infected hematopoietic progenitor cells induces an immunosuppressive extracellular environment that

  17. Human Cytomegalovirus Inhibition by Cardiac Glycosides: Evidence for Involvement of the hERG Gene

    PubMed Central

    Kapoor, Arun; Cai, Hongyi; Forman, Michael; He, Ran; Shamay, Meir

    2012-01-01

    Infection with human cytomegalovirus (HCMV) continues to be a major threat for pregnant women and the immunocompromised population. Although several anti-HCMV therapies are available, the development of new anti-HCMV agents is highly desired. There is growing interest in identifying compounds that might inhibit HCMV by modulating the cellular milieu. Interest in cardiac glycosides (CG), used in patients with congestive heart failure, has increased because of their established anticancer and their suggested antiviral activities. We report that the several CG—digoxin, digitoxin, and ouabain—are potent inhibitors of HCMV at nM concentrations. HCMV inhibition occurred prior to DNA replication, but following binding to its cellular receptors. The levels of immediate early, early, and late viral proteins and cellular NF-κB were significantly reduced in CG-treated cells. The activity of CG in infected cells correlated with the expression of the potassium channel gene, hERG. CMV infection upregulated hERG, whereas CG significantly downregulated its expression. Infection with mouse CMV upregulated mouse ERG (mERG), but treatment with CG did not inhibit virus replication or mERG transcription. These findings suggest that CG may inhibit HCMV by modulating human cellular targets associated with hERG and that these compounds should be studied for their antiviral activities. PMID:22777050

  18. A novel flow cytometry-based tool for determining the efficiency of human cytomegalovirus infection in THP-1 derived macrophages.

    PubMed

    Li, Huifen; Mao, Genxiang; Carlson, Joshua; Leng, Sean X

    2015-09-01

    Human cytomegalovirus (hCMV) is a ubiquitous pathogen that causes congenital infection and severe infections in immunocompromised patients. Chronic hCMV infection may also play an important role in immunosenescence and adverse health outcomes in older adults. THP-1, a human monocytic cell line and its derived macrophages serve as a useful cell culture model for mechanistic studies of hCMV infection and its underlying biology. A major methodological challenge is the lack of a quick and reliable tool to accurately determine the efficiency of hCMV infection in THP-1 derived macrophages. In this study, we developed a flow cytometry based method using commercially available monoclonal antibody (MAb) against hCMV immediate early (IE) antigen that can accurately determine infection efficiency. We used 0.5% formaldehyde for fixation, 90% methanol for permeabilization, and incubation with FITC conjugated MAb at 37°C. The method was tested by hCMV infection with laboratory Towne strain in the presence or absence of hydrocortisone. It was also compared with the routine flow cytometry protocol using Cytofix/Cytoperm solution and with immunofluorescence. The results indicate that this new method is reliable and time saving for accurate determination of infection efficiency. It may facilitate further investigations into the underlying biological mechanisms of hCMV infection. PMID:25958130

  19. Human Cytomegalovirus Antigens in Malignant Gliomas as Targets for Adoptive Cellular Therapy

    PubMed Central

    Landi, Daniel; Hegde, Meenakshi; Ahmed, Nabil

    2014-01-01

    Malignant gliomas are the most common primary brain tumor in adults, with over 12,000 new cases diagnosed in the United States each year. Over the last decade, investigators have reliably identified human cytomegalovirus (HCMV) proteins, nucleic acids, and virions in most high-grade gliomas, including glioblastoma (GBM). This discovery is significant because HCMV gene products can be targeted by immune-based therapies. In this review, we describe the current level of understanding regarding the presence and role in pathogenesis of HCMV in GBM. We describe our success detecting and expanding HCMV-specific cytotoxic T lymphocytes to kill GBM cells and explain how these cells can be used as a platform for enhanced cellular therapies. We discuss alternative approaches that capitalize on HCMV infection to treat patients with HCMV-positive tumors. Adoptive cellular therapy for HCMV-positive GBM has been tried in a small number of patients with some benefit, but we reason why, to date, these approaches generally fail to generate long-term remission or cure. We conjecture how cellular therapy for GBM can be improved and describe the barriers that must be overcome to cure these patients. PMID:25505736

  20. Limits and patterns of cytomegalovirus genomic diversity in humans

    PubMed Central

    Renzette, Nicholas; Pokalyuk, Cornelia; Gibson, Laura; Bhattacharjee, Bornali; Schleiss, Mark R.; Hamprecht, Klaus; Yamamoto, Aparecida Y.; Mussi-Pinhata, Marisa M.; Britt, William J.; Jensen, Jeffrey D.; Kowalik, Timothy F.

    2015-01-01

    Human cytomegalovirus (HCMV) exhibits surprisingly high genomic diversity during natural infection although little is known about the limits or patterns of HCMV diversity among humans. To address this deficiency, we analyzed genomic diversity among congenitally infected infants. We show that there is an upper limit to HCMV genomic diversity in these patient samples, with ∼25% of the genome being devoid of polymorphisms. These low diversity regions were distributed across 26 loci that were preferentially located in DNA-processing genes. Furthermore, by developing, to our knowledge, the first genome-wide mutation and recombination rate maps for HCMV, we show that genomic diversity is positively correlated with these two rates. In contrast, median levels of viral genomic diversity did not vary between putatively single or mixed strain infections. We also provide evidence that HCMV populations isolated from vascular compartments of hosts from different continents are genetically similar and that polymorphisms in glycoproteins and regulatory proteins are enriched in these viral populations. This analysis provides the most highly detailed map of HCMV genomic diversity in human hosts to date and informs our understanding of the distribution of HCMV genomic diversity within human hosts. PMID:26150505

  1. Enhanced capacity of DNA repair in human cytomegalovirus-infected cells

    SciTech Connect

    Nishiyama, Y.; Rapp, F.

    1981-04-01

    Plaque formation in Vero cells by UV-irradiated herpes simplex virus was enhanced by infection with human cytomegalovirus (HCMV), UV irradiation, or treatment with methylmethanesulfonate. Preinfection of Vero cells with HCMV enhanced reactivation of UV-irradiated herpes simplex virus more significantly than did treatment with UV or methylmethanesulfonate alone. A similar enhancement by HCMV was observed in human embryonic fibroblasts, but not in xeroderma pigmentosum (XP12BE) cells. It was also found that HCMV infection enhanced hydroxyurea-resistant DNA synthesis induced by UV light or methylmethanesulfonate. Alkaline sucrose gradient sedimentation analysis revealed an enhanced rate of synthesis of all size classes of DNA in UV-irradiated HCMV-infected Vero cells. However, HCMV infection did not induce repairable lesions in cellular DNA and did not significantly inhibit host cell DNA synthesis, unlike UV or methylmethanesulfonate. These results indicate that HCMV enhanced DNA repair capacity in the host cells without producing detectable lesions in cellular DNA and without inhibiting DNA synthesis. This repair appeared to be error proof for UV-damaged herpes simplex virus DNA when tested with herpes simplex virus thymidine kinase-negative mutants.

  2. Infection of Vascular Endothelial Cells with Human Cytomegalovirus under Fluid Shear Stress Reveals Preferential Entry and Spread of Virus in Flow Conditions Simulating Atheroprone Regions of the Artery

    PubMed Central

    DuRose, Jenny B.; Li, Julie; Chien, Shu

    2012-01-01

    Atherosclerosis is a major pathogenic factor in cardiovascular diseases, which are the leading cause of mortality in developed countries. While risk factors for atherosclerosis tend to be systemic, the distribution of atherosclerotic plaques within the vasculature is preferentially located at branch points and curves where blood flow is disturbed and shear stress is low. It is now widely accepted that hemodynamic factors can modulate endothelial gene expression and function and influence the pathophysiological changes associated with atherosclerosis. Human cytomegalovirus (HCMV), a ubiquitous pathogen, has long been proposed as a risk factor for atherosclerosis. To date, the role of HCMV in atherogenesis has been explored only in static conditions, and it is not known how HCMV infection is influenced by the physiological context of flow. In this study, we utilized a parallel-plate flow system to simulate the effects of shear stresses in different regions of the vasculature in vitro. We found that endothelial cells cultured under low shear stress, which simulates the flow condition of atheroprone regions in vivo, are more permissive to HCMV infection than cells experiencing high shear stress or static conditions. Cells exposed to low shear stress show increased entry of HCMV compared to cells exposed to high shear stress or static conditions. Viral structural gene expression, viral titers, and viral spread are also enhanced in endothelial cells exposed to low shear stress. These results suggest that hemodynamic factors modulate HCMV infection of endothelial cells, thus providing new insights into the induction/acceleration of atherosclerosis by HCMV. PMID:23055562

  3. Regulation of CCAAT/enhancer-binding protein (C/EBP) α in human-cytomegalovirus-infected fibroblasts.

    PubMed

    Lee, Junsub; Kim, Sunyoung

    2016-05-01

    CCAAT/enhancer-binding protein (C/EBP) α, a member of the C/EBP family of transcription factors, is known to be involved in gene expression and DNA replication of human cytomegalovirus (HCMV). This study aimed to understand the regulation of endogenous C/EBPα during HCMV infection using an in vitro infection model. The expression and localization of C/EBPα were investigated in fibroblasts infected with HCMV. The overexpression of C/EBP homologous protein (CHOP), the endogenous inhibitor of C/EBP, was also employed to test the involvement of C/EBPα during HCMV infection. Our data showed that HCMV infection increases the expression of the full-length C/EBPα isoform (p42) especially during the late stage of infection at the transcriptional and post-translational levels. The increased p42 accumulated in the viral DNA replication compartment. p42 expression was not induced in cells treated with UV-irradiated virus or in cells infected with normal virus in the presence of ganciclovir. CHOP-mediated inhibition of C/EBP activity suppressed viral gene expression and DNA replication, which lowered the level of viral production. Together, our data suggest that HCMV-mediated C/EBPα regulation might play a beneficial role in the lytic cycle of HCMV. PMID:26831934

  4. The risk of early and late cytomegalovirus DNAemia associated with Campath use in stem cell transplant recipients

    PubMed Central

    Buyck, Hubertus C; Prentice, H Grant; Griffiths, Paul D; Emery, Vincent C

    2009-01-01

    The risks associated with in vivo and ex vivo use of Campath-1H and -1G in a cohort of 206 stem cell transplant recipients for cytomegalovirus (HCMV) DNAemia have been quantified. DNAemia showed a biphasic incidence pattern with an inflexion at day 60. The first phase had a linear risk rate for HCMV DNAemia of 0.3 % day−1 whilst the second phase had a substantially lower risk rate of 0.058 % day−1. In multivariable analyses, risk factors for early DNAemia were HCMV serostatus, radiotherapy based conditioning and CD34 stem cell dose, with the use of in vivo Campath-1H having the most significant risk (Hazards Ratio = 3.68 (95% CI 2.02-6.72; p<0.001). Ex vivo use of Campath was not associated with an increased risk for HCMV DNAemia. Patients receiving either in vivo Campath-1H or -1G experienced HCMV DNAemia earlier (27 and 33 days respectively) compared to patients receiving no Campath (time to DNAemia, 51 days; p = 0.0006). Multivariable analysis of risk factors for HCMV DNAemia occurring beyond 100 days after transplant were older age, acute GVHD > grade II and a lower CD34 stem cell dose whereas Campath-1H use was not associated with late HCMV DNAemia. PMID:19966846

  5. IL-12 and type I IFN response of neonatal myeloid DC to human CMV infection.

    PubMed

    Renneson, Joelle; Dutta, Binita; Goriely, Stanislas; Danis, Bénédicte; Lecomte, Sandra; Laes, Jean-François; Tabi, Zsuzsanna; Goldman, Michel; Marchant, Arnaud

    2009-10-01

    Following congenital human CMV (HCMV) infection, 15-20% of infected newborns develop severe health problems whereas infection in immunocompetent adults rarely causes illness. The immaturity of neonatal antigen presenting cells could play a pivotal role in this susceptibility. Neonatal myeloid DC were shown to be deficient in IFN-beta and IL-12 synthesis in response to TLR triggering. We studied the response of cord and adult blood-derived myeloid DC to HCMV infection. Neonatal and adult DC were equally susceptible to in vitro HCMV infection. Among immunomodulatory cytokines, IL-12, IFN-beta and IFN-lambda1 were produced at lower levels by neonatal as compared with adult DC. In contrast, neonatal and adult DC produced similar levels of IFN-alpha and IFN-inducible genes. Microarray analysis indicated that among the more than thousand genes up- or down-regulated by HCMV infection of myeloid DC, 88 were differently regulated between adult and neonatal DC. We conclude that neonatal and adult DC trigger a partly different response to HCMV infection. The deficient IL-12 and mature IFN-alpha production by neonatal DC exposed to HCMV are likely to influence the quality of the T lymphocyte response to HCMV infection in early life. PMID:19637227

  6. Rhesus and Human Cytomegalovirus Glycoprotein L Are Required for Infection and Cell-to-Cell Spread of Virus but Cannot Complement Each Other▿

    PubMed Central

    Bowman, J. Jason; Lacayo, Juan C.; Burbelo, Peter; Fischer, Elizabeth R.; Cohen, Jeffrey I.

    2011-01-01

    Rhesus cytomegalovirus (RhCMV), the homolog of human cytomegalovirus (HCMV), serves as a model for understanding the pathogenesis of HCMV and for developing candidate vaccines. In order to develop a replication-defective virus as a vaccine candidate, we constructed RhCMV with glycoprotein L (gL) deleted. RhCMV gL was essential for viral replication, and virus with gL deleted could only replicate in cells expressing RhCMV gL. Noncomplementing cells infected with RhCMV with gL deleted released intact, noninfectious RhCMV particles that were indistinguishable from wild-type RhCMV by electron microscopy and could be rescued by treatment of cells with polyethylene glycol. In addition, noncomplementing cells infected with RhCMV with gL deleted produced levels of gB, the major target of neutralizing antibodies, at levels similar to those observed in cells infected with wild-type RhCMV. Since RhCMV and HCMV gL share 53% amino acid identity, we determined whether the two proteins could complement the heterologous virus. Cells transfected with an HCMV bacterial artificial chromosome with gL deleted yielded virus that could replicate in human cells expressing HCMV gL. This is the second HCMV mutant with an essential glycoprotein deleted that has been complemented in cell culture. Finally, we found that HCMV gL could not complement the replication of RhCMV with gL deleted and that RhCMV gL could not complement the replication of HCMV with gL deleted. These data indicate that RhCMV and HCMV gL are both essential for replication of their corresponding viruses and, although the two gLs are highly homologous, they are unable to complement each another. PMID:21191007

  7. Aminobisphosphonates Synergize with Human Cytomegalovirus To Activate the Antiviral Activity of Vγ9Vδ2 Cells.

    PubMed

    Daguzan, Charline; Moulin, Morgane; Kulyk-Barbier, Hanna; Davrinche, Christian; Peyrottes, Suzanne; Champagne, Eric

    2016-03-01

    Human Vγ9Vδ2 T cells are activated through their TCR by neighboring cells producing phosphoantigens. Zoledronate (ZOL) treatment induces intracellular accumulation of the phosphoantigens isopentenyl pyrophosphate and ApppI. Few attempts have been made to use immunomanipulation of Vγ9Vδ2 lymphocytes in chronic viral infections. Although Vγ9Vδ2 T cells seem to ignore human CMV (HCMV)-infected cells, we examined whether they can sense HCMV when a TCR stimulus is provided with ZOL. Fibroblasts treated with ZOL activate Vγ9Vδ2 T cells to produce IFN-γ but not TNF. Following the same treatment, HCMV-infected fibroblasts stimulate TNF secretion and an increased production of IFN-γ, indicating that Vγ9Vδ2 cells can sense HCMV infection. Increased lymphokine production was observed with most clinical isolates and laboratory HCMV strains, HCMV-permissive astrocytoma, or dendritic cells, as well as "naive" and activated Vγ9Vδ2 cells. Quantification of intracellular isopentenyl pyrophosphate/ApppI following ZOL treatment showed that HCMV infection boosts their accumulation. This was explained by an increased capture of ZOL and by upregulation of HMG-CoA synthase and reductase transcription. Using an experimental setting where infected fibroblasts were cocultured with γδ cells in submicromolar concentrations of ZOL, we show that Vγ9Vδ2 cells suppressed substantially the release of infectious particles while preserving uninfected cells. Vγ9Vδ2 cytotoxicity was decreased by HCMV infection of targets whereas anti-IFN-γ and anti-TNF Abs significantly blocked the antiviral effect. Our experiments indicate that cytokines produced by Vγ9Vδ2 T cells have an antiviral potential in HCMV infection. This should lead to in vivo studies to explore the possible antiviral effect of immunostimulation with ZOL in this context. PMID:26819204

  8. Role of human cytomegalovirus in the proliferation and invasion of extravillous cytotrophoblasts isolated from early placentae

    PubMed Central

    Liu, Tao; Zheng, Xiaofei; Li, Qin; Chen, Juanjuan; Yin, Zongzhi; Xiao, Juan; Zhang, Dandan; Li, Wei; Qiao, Yuan; Chen, Suhua

    2015-01-01

    Aim: We investigated the role of human cytomegalovirus (HCMV) and its mechanism in extravillous cytotrophoblast (EVT) proliferation and invasion in vitro. Methods: Differential enzymatic digestion combined with gradient centrifugation, was used to isolate primary EVT from human chorionic villi collected from early placentae of healthy pregnant women. HCMV infection was determined by immunofluorescence staining of HCMVpp65 antigen expression. An MTT assay was used to examine the role of HCMV in the proliferation of EVT. Quantitative real-time polymerase chain reaction (qRT-PCR), immunocytochemical staining and Western blots were carried out in a control group (EVT) and a virus group (EVT+HCMV) to examine the expression of major genes and protein in TGF-β/Smad signaling pathways in EVT 48 h after inoculation with HCMV. An in vitro cell invasion assay was performed to analyze the influence of HCMV on EVT invasion. Results: HCMV significantly inhibited the proliferation of EVT 48 h after viral infection (P < 0.05). The expression of TGF-β1, Smad1, Smad2, Smad3, Smad4, and Smad5 genes was significantly increased (P < 0.05), but that of TGF-β2, TGF-β3, TGFβRI, TGFβRII, Smad7, MMP2, and MMP9 was significantly decreased in the virus group 48 h after HCMV infection (P < 0.05). Smad7, MMP-2 and MMP-9 protein levels were significantly decreased and the TGF-β1 protein level was significantly increased in infected EVT (all P < 0.05). Conclusions: HCMV may act on multiple steps of the TGF-β/Smad signaling pathway to impede EVT proliferation and invasion. PMID:26770317

  9. Human Cytomegalovirus Promotes Survival of Infected Monocytes via a Distinct Temporal Regulation of Cellular Bcl-2 Family Proteins

    PubMed Central

    Collins-McMillen, Donna; Kim, Jung Heon; Nogalski, Maciej T.; Stevenson, Emily V.; Caskey, Joshua R.; Cieply, Stephen J.

    2015-01-01

    ABSTRACT Monocytes play a key role in the hematogenous dissemination of human cytomegalovirus (HCMV) to target organ systems. To infect monocytes and reprogram them to deliver infectious virus, HCMV must overcome biological obstacles, including the short life span of monocytes and their antiviral proapoptotic response to infection. We have shown that virally induced upregulation of cellular Mcl-1 promotes early survival of HCMV-infected monocytes, allowing cells to overcome an early apoptotic checkpoint at around 48 h postinfection (hpi). Here, we demonstrate an HCMV-dependent shift from Mcl-1 as the primary antiapoptotic player to the related protein, Bcl-2, later during infection. Bcl-2 was upregulated in HCMV-infected monocytes beginning at 48 hpi. Treatment with the Bcl-2 antagonist ABT-199 only reduced the prosurvival effects of HCMV in target monocytes beginning at 48 hpi, suggesting that Mcl-1 controls survival prior to 48 hpi, while Bcl-2 promotes survival after 48 hpi. Although Bcl-2 was upregulated following viral binding/signaling through cellular integrins (compared to Mcl-1, which is upregulated through binding/activation of epidermal growth factor receptor [EGFR]), it functioned similarly to Mcl-1, adopting the early role of Mcl-1 in preventing caspase-3 cleavage/activation. This distinct, HCMV-induced shift from Mcl-1 to Bcl-2 occurs in response to a cellular upregulation of proapoptotic Bax, as small interfering RNA (siRNA)-mediated knockdown of Bax reduced the upregulation of Bcl-2 in infected monocytes and rescued the cells from the apoptotic effects of Bcl-2 inhibition. Our data demonstrate a distinct survival strategy whereby HCMV induces a biphasic regulation of cellular Bcl-2 proteins to promote host cell survival, leading to viral dissemination and the establishment of persistent HCMV infection. IMPORTANCE Hematogenous dissemination of HCMV via infected monocytes is a crucial component of the viral survival strategy and is required for the

  10. Inactivation of the Human Cytomegalovirus US20 Gene Hampers Productive Viral Replication in Endothelial Cells

    PubMed Central

    Cavaletto, Noemi; Luganini, Anna

    2015-01-01

    ABSTRACT The human cytomegalovirus (HCMV) US12 gene family includes a group of 10 contiguous genes (US12 to US21) encoding predicted seven-transmembrane-domain (7TMD) proteins that are nonessential for replication within cultured fibroblasts. Nevertheless, inactivation of some US12 family members affects virus replication in other cell types; e.g., deletion of US16 or US18 abrogates virus growth in endothelial and epithelial cells or in human gingival tissue, respectively, suggesting a role for some US12 proteins in HCMV cell tropism. Here, we provide evidence that another member, US20, impacts the ability of a clinical strain of HCMV to replicate in endothelial cells. Through the use of recombinant HCMV encoding tagged versions of the US20 protein, we investigated the expression pattern, localization, and topology of the US20-encoded protein (pUS20). We show that pUS20 is expressed as a partially glycosylated 7TMD protein which accumulates late in infection in endoplasmic reticulum-derived peripheral structures localized outside the cytoplasmic virus assembly compartment (cVAC). US20-deficient mutants generated in the TR clinical strain of HCMV exhibited major growth defects in different types of endothelial cells, whereas they replicated normally in fibroblasts and epithelial cells. While the attachment and entry phases in endothelial cells were not significantly affected by the absence of US20 protein, US20-null viruses failed to replicate viral DNA and express representative E and L mRNAs and proteins. Taken together, these results indicate that US20 sustains the HCMV replication cycle at a stage subsequent to entry but prior to E gene expression and viral DNA synthesis in endothelial cells. IMPORTANCE Human cytomegalovirus (HCMV) is a major pathogen in newborns and immunocompromised individuals. A hallmark of HCMV pathogenesis is its ability to productively replicate in an exceptionally broad range of target cells, including endothelial cells, which represent

  11. A Neutralizing Anti-gH/gL Monoclonal Antibody Is Protective in the Guinea Pig Model of Congenital CMV Infection

    PubMed Central

    Auerbach, Marcy R.; Yan, Donghong; Vij, Rajesh; Hongo, Jo-Anne; Nakamura, Gerald; Vernes, Jean-Michel; Meng, Y. Gloria; Lein, Samantha; Chan, Pamela; Ross, Jed; Carano, Richard; Deng, Rong; Lewin-Koh, Nicholas; Xu, Min; Feierbach, Becket

    2014-01-01

    Human cytomegalovirus (HCMV) is the most common cause of congenital virus infection. Congenital HCMV infection occurs in 0.2–1% of all births, and causes birth defects and developmental abnormalities, including sensorineural hearing loss and developmental delay. Several key studies have established the guinea pig as a tractable model for the study of congenital HCMV infection and have shown that polyclonal antibodies can be protective [1]–[3]. In this study, we demonstrate that an anti-guinea pig CMV (GPCMV) glycoprotein H/glycoprotein L neutralizing monoclonal antibody protects against fetal infection and loss in the guinea pig. Furthermore, we have delineated the kinetics of GPCMV congenital infection, from maternal infection (salivary glands, seroconversion, placenta) to fetal infection (fetus and amniotic fluid). Our studies support the hypothesis that a neutralizing monoclonal antibody targeting an envelope GPCMV glycoprotein can protect the fetus from infection and may shed light on the therapeutic intervention of HCMV congenital infection in humans. PMID:24722349

  12. Impact of persistent cytomegalovirus infection on human neuroblastoma cell gene expression.

    PubMed

    Hoever, Gerold; Vogel, Jens-Uwe; Lukashenko, Polina; Hofmann, Wolf-Karsten; Komor, Martina; Doerr, Hans Wilhelm; Cinatl, Jindrich

    2005-01-14

    In a model of human neuroblastoma (NB) cell lines persistently infected with human cytomegalovirus (HCMV) we previously showed that persistent HCMV infection is associated with an increased malignant phenotype, enhanced drug resistance, and invasive properties. To gain insights into the mechanisms of increased malignancy we analyzed the global changes in cellular gene expression induced by persistent HCMV infection of human neuroblastoma cells by use of high-density oligonucleotide microarrays (HG-U133A, Affymetrix) and RT-PCR. Comparing the gene expression of different NB cell lines with persistently infected cell sub-lines revealed 11 host cell genes regulated in a similar manner throughout all infected samples. Nine of these 11 genes may contribute to the previously observed changes in malignant phenotype of persistently HCMV infected NB cells by influencing invasive growth, apoptosis, angiogenesis, and proliferation. Thus, this work provides the basis for further functional studies. PMID:15582591

  13. Diverse immune evasion strategies by human cytomegalovirus.

    PubMed

    Noriega, Vanessa; Redmann, Veronika; Gardner, Thomas; Tortorella, Domenico

    2012-12-01

    Members of the Herpesviridae family have the capacity to undergo both lytic and latent infection to establish a lifelong relationship with their host. Following primary infection, human cytomegalovirus (HCMV) can persist as a subclinical, recurrent infection for the lifetime of an individual. This quiescent portion of its life cycle is termed latency and is associated with periodic bouts of reactivation during times of immunosuppression, inflammation, or stress. In order to exist indefinitely and establish infection, HCMV encodes a multitude of immune modulatory mechanisms devoted to escaping the host antiviral response. HCMV has become a paradigm for studies of viral immune evasion of antigen presentation by both major histocompatibility complex (MHC) class I and II molecules. By restricting the presentation of viral antigens during both productive and latent infection, HCMV limits elimination by the human immune system. This review will focus on understanding how the virus manipulates the pathways of antigen presentation in order to modulate the host response to infection. PMID:22454101

  14. THY-1 Cell Surface Antigen (CD90) Has an Important Role in the Initial Stage of Human Cytomegalovirus Infection.

    PubMed

    Li, Qingxue; Wilkie, Adrian R; Weller, Melodie; Liu, Xueqiao; Cohen, Jeffrey I

    2015-07-01

    Human cytomegalovirus (HCMV) infects about 50% of the US population, is the leading infectious cause of birth defects, and is considered the most important infectious agent in transplant recipients. The virus infects many cell types in vivo and in vitro. While previous studies have identified several cellular proteins that may function at early steps of infection in a cell type dependent manner, the mechanism of virus entry is still poorly understood. Using a computational biology approach, correlating gene expression with virus infectivity in 54 cell lines, we identified THY-1 as a putative host determinant for HCMV infection in these cells. With a series of loss-of-function, gain-of-function and protein-protein interaction analyses, we found that THY-1 mediates HCMV infection at the entry step and is important for infection that occurs at a low m.o.i. THY-1 antibody that bound to the cell surface blocked HCMV during the initial 60 minutes of infection in a dose-dependent manner. Down-regulation of THY-1 with siRNA impaired infectivity occurred during the initial 60 minutes of inoculation. Both THY-1 antibody and siRNA inhibited HCMV-induced activation of the PI3-K/Akt pathway required for entry. Soluble THY-1 protein blocked HCMV infection during, but not after, virus internalization. Expression of exogenous THY-1 enhanced entry in cells expressing low levels of the protein. THY-1 interacted with HCMV gB and gH and may form a complex important for entry. However, since gB and gH have previously been shown to interact, it is uncertain if THY-1 directly binds to both of these proteins. Prior observations that THY-1 (a) interacts with αVβ3 integrin and recruits paxillin (implicated in HCMV entry), (b) regulates leukocyte extravasation (critical for HCMV viremia), and (c) is expressed on many cells targeted for HCMV infection including epithelial and endothelial cells, fibroblast, and CD34+/CD38- stem cells, all support a role for THY-1 as an HCMV entry mediator in

  15. Trehalose, an mTOR-Independent Inducer of Autophagy, Inhibits Human Cytomegalovirus Infection in Multiple Cell Types

    PubMed Central

    Belzile, Jean-Philippe; Sabalza, Maite; Craig, Megan; Clark, Elizabeth; Morello, Christopher S.

    2015-01-01

    ABSTRACT Human cytomegalovirus (HCMV) is the major viral cause of birth defects and a serious problem in immunocompromised individuals and has been associated with atherosclerosis. Previous studies have shown that the induction of autophagy can inhibit the replication of several different types of DNA and RNA viruses. The goal of the work presented here was to determine whether constitutive activation of autophagy would also block replication of HCMV. Most prior studies have used agents that induce autophagy via inhibition of the mTOR pathway. However, since HCMV infection alters the sensitivity of mTOR kinase-containing complexes to inhibitors, we sought an alternative method of inducing autophagy. We chose to use trehalose, a nontoxic naturally occurring disaccharide that is found in plants, insects, microorganisms, and invertebrates but not in mammals and that induces autophagy by an mTOR-independent mechanism. Given the many different cell targets of HCMV, we proceeded to determine whether trehalose would inhibit HCMV infection in human fibroblasts, aortic artery endothelial cells, and neural cells derived from human embryonic stem cells. We found that in all of these cell types, trehalose induces autophagy and inhibits HCMV gene expression and production of cell-free virus. Treatment of HCMV-infected neural cells with trehalose also inhibited production of cell-associated virus and partially blocked the reduction in neurite growth and cytomegaly. These results suggest that activation of autophagy by the natural sugar trehalose or other safe mTOR-independent agents might provide a novel therapeutic approach for treating HCMV disease. IMPORTANCE HCMV infects multiple cell types in vivo, establishes lifelong persistence in the host, and can cause serious health problems for fetuses and immunocompromised individuals. HCMV, like all other persistent pathogens, has to finely tune its interplay with the host cellular machinery to replicate efficiently and evade

  16. THY-1 Cell Surface Antigen (CD90) Has an Important Role in the Initial Stage of Human Cytomegalovirus Infection

    PubMed Central

    Li, Qingxue; Wilkie, Adrian R.; Weller, Melodie; Liu, Xueqiao; Cohen, Jeffrey I.

    2015-01-01

    Human cytomegalovirus (HCMV) infects about 50% of the US population, is the leading infectious cause of birth defects, and is considered the most important infectious agent in transplant recipients. The virus infects many cell types in vivo and in vitro. While previous studies have identified several cellular proteins that may function at early steps of infection in a cell type dependent manner, the mechanism of virus entry is still poorly understood. Using a computational biology approach, correlating gene expression with virus infectivity in 54 cell lines, we identified THY-1 as a putative host determinant for HCMV infection in these cells. With a series of loss-of-function, gain-of-function and protein-protein interaction analyses, we found that THY-1 mediates HCMV infection at the entry step and is important for infection that occurs at a low m.o.i. THY-1 antibody that bound to the cell surface blocked HCMV during the initial 60 minutes of infection in a dose-dependent manner. Down-regulation of THY-1 with siRNA impaired infectivity occurred during the initial 60 minutes of inoculation. Both THY-1 antibody and siRNA inhibited HCMV-induced activation of the PI3-K/Akt pathway required for entry. Soluble THY-1 protein blocked HCMV infection during, but not after, virus internalization. Expression of exogenous THY-1 enhanced entry in cells expressing low levels of the protein. THY-1 interacted with HCMV gB and gH and may form a complex important for entry. However, since gB and gH have previously been shown to interact, it is uncertain if THY-1 directly binds to both of these proteins. Prior observations that THY-1 (a) interacts with αVβ3 integrin and recruits paxillin (implicated in HCMV entry), (b) regulates leukocyte extravasation (critical for HCMV viremia), and (c) is expressed on many cells targeted for HCMV infection including epithelial and endothelial cells, fibroblast, and CD34+/CD38- stem cells, all support a role for THY-1 as an HCMV entry mediator in

  17. Human cytomegalovirus vaccine based on the envelope gH/gL pentamer complex.

    PubMed

    Wussow, Felix; Chiuppesi, Flavia; Martinez, Joy; Campo, John; Johnson, Erica; Flechsig, Christin; Newell, Maegan; Tran, Elaine; Ortiz, Jose; La Rosa, Corinna; Herrmann, Andreas; Longmate, Jeff; Chakraborty, Rana; Barry, Peter A; Diamond, Don J

    2014-11-01

    Human Cytomegalovirus (HCMV) utilizes two different pathways for host cell entry. HCMV entry into fibroblasts requires glycoproteins gB and gH/gL, whereas HCMV entry into epithelial and endothelial cells (EC) requires an additional complex composed of gH, gL, UL128, UL130, and UL131A, referred to as the gH/gL-pentamer complex (gH/gL-PC). While there are no established correlates of protection against HCMV, antibodies are thought to be important in controlling infection. Neutralizing antibodies (NAb) that prevent gH/gL-PC mediated entry into EC are candidates to be assessed for in vivo protective function. However, these potent NAb are predominantly directed against conformational epitopes derived from the assembled gH/gL-PC. To address these concerns, we constructed Modified Vaccinia Ankara (MVA) viruses co-expressing all five gH/gL-PC subunits (MVA-gH/gL-PC), subsets of gH/gL-PC subunits (gH/gL or UL128/UL130/UL131A), or the gB subunit from HCMV strain TB40/E. We provide evidence for cell surface expression and assembly of complexes expressing full-length gH or gB, or their secretion when the corresponding transmembrane domains are deleted. Mice or rhesus macaques (RM) were vaccinated three times with MVA recombinants and serum NAb titers that prevented 50% infection of human EC or fibroblasts by HCMV TB40/E were determined. NAb responses induced by MVA-gH/gL-PC blocked HCMV infection of EC with potencies that were two orders of magnitude greater than those induced by MVA expressing gH/gL, UL128-UL131A, or gB. In addition, MVA-gH/gL-PC induced NAb responses that were durable and efficacious to prevent HCMV infection of Hofbauer macrophages, a fetal-derived cell localized within the placenta. NAb were also detectable in saliva of vaccinated RM and reached serum peak levels comparable to NAb titers found in HCMV hyperimmune globulins. This vaccine based on a translational poxvirus platform co-delivers all five HCMV gH/gL-PC subunits to achieve robust humoral

  18. Peptide inhibition of human cytomegalovirus infection

    PubMed Central

    2011-01-01

    Background Human cytomegalovirus (HCMV) is the most prevalent congenital viral infection in the United States and Europe causing significant morbidity and mortality to both mother and child. HCMV is also an opportunistic pathogen in immunocompromised individuals, including human immunodeficiency virus (HIV)- infected patients with AIDS, and solid organ and allogeneic stem cell transplantation recipients. Current treatments for HCMV-associated diseases are insufficient due to the emergence of drug-induced resistance and cytotoxicity, necessitating novel approaches to limit HCMV infection. The aim of this study was to develop therapeutic peptides targeting glycoprotein B (gB), a major glycoprotein of HCMV that is highly conserved across the Herpesviridae family, that specifically inhibit fusion of the viral envelope with the host cell membrane preventing HCMV entry and infection. Results Using the Wimley-White Interfacial Hydrophobicity Scale (WWIHS), several regions within gB were identified that display a high potential to interact with lipid bilayers of cell membranes and hydrophobic surfaces within proteins. The ability of synthetic peptides analogous to WWIHS-positive sequences of HCMV gB to inhibit viral infectivity was evaluated. Human foreskin fibroblasts (HFF) were infected with the Towne-GFP strain of HCMV (0.5 MOI), preincubated with peptides at a range of concentrations (78 nm to 100 μM), and GFP-positive cells were visualized 48 hours post-infection by fluorescence microscopy and analyzed quantitatively by flow cytometry. Peptides that inhibited HCMV infection demonstrated different inhibitory concentration curves indicating that each peptide possesses distinct biophysical properties. Peptide 174-200 showed 80% inhibition of viral infection at a concentration of 100 μM, and 51% and 62% inhibition at concentrations of 5 μM and 2.5 μM, respectively. Peptide 233-263 inhibited infection by 97% and 92% at concentrations of 100 μM and 50 μM, respectively

  19. Comparative magnitude and kinetics of human cytomegalovirus-specific CD4(+) and CD8(+) T-cell responses in pregnant women with primary versus remote infection and in transmitting versus non-transmitting mothers: Its utility for dating primary infection in pregnancy.

    PubMed

    Fornara, Chiara; Furione, Milena; Arossa, Alessia; Gerna, Giuseppe; Lilleri, Daniele

    2016-07-01

    To discriminate between primary (PI) and remote (RI) human cytomegalovirus (HCMV) infection, several immunological parameters were monitored for a 2-year period in 53 pregnant women with PI, and 33 pregnant women experiencing HCMV PI at least 5 years prior. Cytokine (IFN-γ and IL-2) production by and phenotype (effector/memory CD45RA(+) ) of HCMV-specific CD4(+) and CD8(+) T-cells as well as the lymphoproliferative responses (LPR) were evaluated, with special reference to the comparison between a group of women transmitting (T) and a group of non-transmitting (NT) the infection to fetus. While HCMV-specific CD4(+) T-cells reached at 90 days post-infection (p.i.) values comparable to RI, CD8(+) T-cells reached at 60 days p.i. levels significantly higher and persisting throughout the entire follow-up. Instead, IL-2 production and lymphoproliferative responses were lower in PI than RI for the entire follow-up period. Effector memory CD45RA(+) CD4(+) and CD8(+) HCMV-specific T-cells increased until 90 days p.i., reaching and maintaining levels higher than RI. The comparison between T and NT women showed that, at 30 days p.i., in NT women there was a significantly higher IL-2 production by HCMV-specific CD4(+) T-cells, and at 60 days p.i. a significantly higher frequency of both specific CD4(+) and CD8(+) CD45RA(+) T-cells. HCMV T-cell response appears to correlate with virus transmission to fetus and some parameters (CD4(+) lymphoproliferation, and frequency of HCMV-specific CD8(+) IL2(+) T-cells) may help in dating PI during pregnancy. J. Med. Virol. 88:1238-1246, 2016. © 2015 Wiley Periodicals, Inc. PMID:26680747

  20. The 6-Aminoquinolone WC5 Inhibits Human Cytomegalovirus Replication at an Early Stage by Interfering with the Transactivating Activity of Viral Immediate-Early 2 Protein ▿ †

    PubMed Central

    Loregian, Arianna; Mercorelli, Beatrice; Muratore, Giulia; Sinigalia, Elisa; Pagni, Silvana; Massari, Serena; Gribaudo, Giorgio; Gatto, Barbara; Palumbo, Manlio; Tabarrini, Oriana; Cecchetti, Violetta; Palù, Giorgio

    2010-01-01

    WC5 is a 6-aminoquinolone that potently inhibits the replication of human cytomegalovirus (HCMV) but has no activity, or significantly less activity, against other herpesviruses. Here we investigated the nature of its specific anti-HCMV activity. Structure-activity relationship studies on a small series of analogues showed that WC5 possesses the most suitable pattern of substitutions around the quinolone scaffold to give potent and selective anti-HCMV activity. Studies performed to identify the possible target of WC5 indicated that it prevents viral DNA synthesis but does not significantly affect DNA polymerase activity. In yield reduction experiments with different multiplicities of infection, the anti-HCMV activity of WC5 appeared to be highly dependent on the viral inoculum, suggesting that WC5 may act at an initial stage of virus replication. Consistently, time-of-addition and time-of-removal studies demonstrated that WC5 affects a phase of the HCMV replicative cycle that precedes viral DNA synthesis. Experiments to monitor the effects of the compound on virus attachment and entry showed that it does not inhibit either process. Evaluation of viral mRNA and protein expression revealed that WC5 targets an event of the HCMV replicative cycle that follows the transcription and translation of immediate-early genes and precedes those of early and late genes. In cell-based assays to test the effects of WC5 on the transactivating activity of the HCMV immediate-early 2 (IE2) protein, WC5 markedly interfered with IE2-mediated transactivation of viral early promoters. Finally, WC5 combined with ganciclovir in checkerboard experiments exhibited highly synergistic activity. These findings suggest that WC5 deserves further investigation as a candidate anti-HCMV drug with a novel mechanism of action. PMID:20194695

  1. Cytomegalovirus-Infected Cells Resist T Cell Mediated Killing in an HLA-Recognition Independent Manner.

    PubMed

    Proff, Julia; Walterskirchen, Christian; Brey, Charlotte; Geyeregger, Rene; Full, Florian; Ensser, Armin; Lehner, Manfred; Holter, Wolfgang

    2016-01-01

    In order to explore the potential of HLA-independent T cell therapy for human cytomegalovirus (HCMV) infections, we developed a chimeric antigen receptor (CAR) directed against the HCMV encoded glycoprotein B (gB), which is expressed at high levels on the surface of infected cells. T cells engineered with this anti-gB CAR recognized HCMV-infected cells and released cytokines and cytotoxic granules. Unexpectedly, and in contrast to analogous approaches for HIV, Hepatitis B or Hepatitis C virus, we found that HCMV-infected cells were resistant to killing by the CAR-modified T cells. In order to elucidate whether this phenomenon was restricted to the use of CARs, we extended our experiments to T cell receptor (TCR)-mediated recognition of infected cells. To this end we infected fibroblasts with HCMV-strains deficient in viral inhibitors of antigenic peptide presentation and targeted these HLA-class I expressing peptide-loaded infected cells with peptide-specific cytotoxic T cells (CTLs). Despite strong degranulation and cytokine production by the T cells, we again found significant inhibition of lysis of HCMV-infected cells. Impairment of cell lysis became detectable 1 day after HCMV infection and gradually increased during the following 3 days. We thus postulate that viral anti-apoptotic factors, known to inhibit suicide of infected host cells, have evolved additional functions to directly abrogate T cell cytotoxicity. In line with this hypothesis, CAR-T cell cytotoxicity was strongly inhibited in non-infected fibroblasts by expression of the HCMV-protein UL37x1, and even more so by additional expression of UL36. Our data extend the current knowledge on Betaherpesviral evasion from T cell immunity and show for the first time that, beyond impaired antigen presentation, infected cells are efficiently protected by direct blockade of cytotoxic effector functions through viral proteins. PMID:27375569

  2. A High-Affinity Native Human Antibody Neutralizes Human Cytomegalovirus Infection of Diverse Cell Types

    PubMed Central

    Liu, Keyi; Park, Minha; DeChene, Neal; Stephenson, Robert; Tenorio, Edgar; Ellsworth, Stote L.; Tabata, Takako; Petitt, Matthew; Tsuge, Mitsuru; Fang-Hoover, June; Adler, Stuart P.; Cui, Xiaohong; McVoy, Michael A.; Pereira, Lenore

    2014-01-01

    Human cytomegalovirus (HCMV) is the most common infection causing poor outcomes among transplant recipients. Maternal infection and transplacental transmission are major causes of permanent birth defects. Although no active vaccines to prevent HCMV infection have been approved, passive immunization with HCMV-specific immunoglobulin has shown promise in the treatment of both transplant and congenital indications. Antibodies targeting the viral glycoprotein B (gB) surface protein are known to neutralize HCMV infectivity, with high-affinity binding being a desirable trait, both to compete with low-affinity antibodies that promote the transmission of virus across the placenta and to displace nonneutralizing antibodies binding nearby epitopes. Using a miniaturized screening technology to characterize secreted IgG from single human B lymphocytes, 30 antibodies directed against gB were previously cloned. The most potent clone, TRL345, is described here. Its measured affinity was 1 pM for the highly conserved site I of the AD-2 epitope of gB. Strain-independent neutralization was confirmed for 15 primary HCMV clinical isolates. TRL345 prevented HCMV infection of placental fibroblasts, smooth muscle cells, endothelial cells, and epithelial cells, and it inhibited postinfection HCMV spread in epithelial cells. The potential utility for preventing congenital transmission is supported by the blockage of HCMV infection of placental cell types central to virus transmission to the fetus, including differentiating cytotrophoblasts, trophoblast progenitor cells, and placental fibroblasts. Further, TRL345 was effective at controlling an ex vivo infection of human placental anchoring villi. TRL345 has been utilized on a commercial scale and is a candidate for clinical evaluation. PMID:25534746

  3. cGAS Senses Human Cytomegalovirus and Induces Type I Interferon Responses in Human Monocyte-Derived Cells.

    PubMed

    Paijo, Jennifer; Döring, Marius; Spanier, Julia; Grabski, Elena; Nooruzzaman, Mohammed; Schmidt, Tobias; Witte, Gregor; Messerle, Martin; Hornung, Veit; Kaever, Volkhard; Kalinke, Ulrich

    2016-04-01

    Human cytomegalovirus (HCMV) infections of healthy individuals are mostly unnoticed and result in viral latency. However, HCMV can also cause devastating disease, e.g., upon reactivation in immunocompromised patients. Yet, little is known about human immune cell sensing of DNA-encoded HCMV. Recent studies indicated that during viral infection the cyclic GMP/AMP synthase (cGAS) senses cytosolic DNA and catalyzes formation of the cyclic di-nucleotide cGAMP, which triggers stimulator of interferon genes (STING) and thus induces antiviral type I interferon (IFN-I) responses. We found that plasmacytoid dendritic cells (pDC) as well as monocyte-derived DC and macrophages constitutively expressed cGAS and STING. HCMV infection further induced cGAS, whereas STING expression was only moderately affected. Although pDC expressed particularly high levels of cGAS, and the cGAS/STING axis was functional down-stream of STING, as indicated by IFN-I induction upon synthetic cGAMP treatment, pDC were not susceptible to HCMV infection and mounted IFN-I responses in a TLR9-dependent manner. Conversely, HCMV infected monocyte-derived cells synthesized abundant cGAMP levels that preceded IFN-I production and that correlated with the extent of infection. CRISPR/Cas9- or siRNA-mediated cGAS ablation in monocytic THP-1 cells and primary monocyte-derived cells, respectively, impeded induction of IFN-I responses following HCMV infection. Thus, cGAS is a key sensor of HCMV for IFN-I induction in primary human monocyte-derived DC and macrophages. PMID:27058035

  4. Association between human cytomegalovirus and onset of epilepsy

    PubMed Central

    Lei, Hong-Yan; Yang, Dai-Qun; Li, Yu-Xin; Wang, Li-Quan; Zheng, Mei

    2015-01-01

    Objective: To explore the association between human cytomegalovirus (HCMV) and epilepsy. Methods: Epilepsy patients (n = 112) in neurology clinic of our hospital during January 2012 and December 2014 were allocated to the case groups, including intractable epilepsy group (n = 96) and non-intractable epilepsy group (n = 16). Healthy individual (n = 120) who received physical examination during the same period were allocated to the control group. The expression of serum HCMV late gene pp67-RNA was detected by reverse transcription-polymerase chain reaction (RT-PCR). The expressions of serum HCMV immunoglobulin G (IgG), immunoglobulin M (IgM) and interleukin-6 (IL-6) were detected by enzyme-linked immunosorbent assay (ELISA). Serum hypersensitive c-reactive protein (hs-CRP) was detected by latex-enhanced immunoturbidimetry. The electroencephalogram (EEG) of refractory epilepsy group, non-refractory epilepsy group and control group were recorded. Results: The expression of pp67-mRNA was significantly higher in intractable epilepsy group than non-intractable epilepsy group (P < 0.05) and control group (P < 0.001). The HCMV-IgG positive rate and HCMV-IgM positive rate were significantly higher in intractable epilepsy group than control group (both P < 0.001). The HCMV-IgM positive rate was significantly higher in intractable epilepsy group than non-intractable epilepsy group (P < 0.001). The HCMV-IgM positive rate was significantly higher in non-intractable epilepsy group than control group (P < 0.001). The hs-CRP and IL-6 levels presented descending trends respectively in intractable epilepsy group, non-intractable epilepsy group and control group (all P < 0.001). Conclusion: HCMV was prominently expressed in epilepsy and might contribute to the development of epilepsy. PMID:26884973

  5. The Latency-Associated UL138 Gene Product of Human Cytomegalovirus Sensitizes Cells to Tumor Necrosis Factor Alpha (TNF-α) Signaling by Upregulating TNF-α Receptor 1 Cell Surface Expression ▿

    PubMed Central

    Montag, Christina; Wagner, Jutta Annabella; Gruska, Iris; Vetter, Barbara; Wiebusch, Lüder; Hagemeier, Christian

    2011-01-01

    Many viruses antagonize tumor necrosis factor alpha (TNF-α) signaling in order to counteract its antiviral properties. One way viruses achieve this goal is to reduce TNF-α receptor 1 (TNFR1) on the surface of infected cells. Such a mechanism is also employed by human cytomegalovirus (HCMV), as recently reported by others and us. On the other hand, TNF-α has also been shown to foster reactivation of HCMV from latency. By characterizing a new variant of HCMV AD169, we show here that TNFR1 downregulation by HCMV only becomes apparent upon infection of cells with HCMV strains lacking the so-called ULb′ region. This region contains genes involved in regulating viral immune escape, cell tropism, or latency and is typically lost from laboratory strains but present in low-passage strains and clinical isolates. We further show that although ULb′-positive viruses also contain the TNFR1-antagonizing function, this activity is masked by a dominant TNFR1 upregulation mediated by the ULb′ gene product UL138. Isolated expression of UL138 in the absence of viral infection upregulates TNFR1 surface expression and can rescue both TNFR1 reexpression and TNF-α responsiveness of cells infected with an HCMV mutant lacking the UL138-containing transcription unit. Given that the UL138 gene product is one of the few genes recognized to be expressed during HCMV latency and the known positive effects of TNF-α on viral reactivation, we suggest that via upregulating TNFR1 surface expression UL138 may sensitize latently infected cells to TNF-α-mediated reactivation of HCMV. PMID:21880774

  6. Modeling of Human Cytomegalovirus Maternal-Fetal Transmission in a Novel Decidual Organ Culture ▿

    PubMed Central

    Weisblum, Yiska; Panet, Amos; Zakay-Rones, Zichria; Haimov-Kochman, Ronit; Goldman-Wohl, Debra; Ariel, Ilana; Falk, Haya; Natanson-Yaron, Shira; Goldberg, Miri D.; Gilad, Ronit; Lurain, Nell S.; Greenfield, Caryn; Yagel, Simcha; Wolf, Dana G.

    2011-01-01

    Human cytomegalovirus (HCMV) is the leading cause of congenital infection, associated with severe birth defects and intrauterine growth retardation. The mechanism of HCMV transmission via the maternal-fetal interface is largely unknown, and there are no animal models for HCMV. The initial stages of infection are believed to occur in the maternal decidua. Here we employed a novel decidual organ culture, using both clinically derived and laboratory-derived viral strains, for the ex vivo modeling of HCMV transmission in the maternal-fetal interface. Viral spread in the tissue was demonstrated by the progression of infected-cell foci, with a 1.3- to 2-log increase in HCMV DNA and RNA levels between days 2 and 9 postinfection, the expression of immediate-early and late proteins, the appearance of typical histopathological features of natural infection, and dose-dependent inhibition of infection by ganciclovir and acyclovir. HCMV infected a wide range of cells in the decidua, including invasive cytotrophoblasts, macrophages, and endothelial, decidual, and dendritic cells. Cell-to-cell viral spread was revealed by focal extension of infected-cell clusters, inability to recover infectious extracellular virus, and high relative proportions (88 to 93%) of cell-associated viral DNA. Intriguingly, neutralizing HCMV hyperimmune globulins exhibited inhibitory activity against viral spread in the decidua even when added at 24 h postinfection—providing a mechanistic basis for their clinical use in prenatal prevention. The ex vivo-infected decidual cultures offer unique insight into patterns of viral tropism and spread, defining initial stages of congenital HCMV transmission, and can facilitate evaluation of the effects of new antiviral interventions within the maternal-fetal interface milieu. PMID:21976654

  7. RhoB is a component of the human cytomegalovirus assembly complex and is required for efficient viral production

    PubMed Central

    Goulidaki, Nektaria; Alarifi, Saud; Alkahtani, Saad H; Al-Qahtani, Ahmed; Spandidos, Demetrios A; Stournaras, Christos; Sourvinos, George

    2015-01-01

    Human Cytomegalovirus (HCMV), an ubiquitous β-herpesvirus, is a significant pathogen that causes medically severe diseases in immunocompromised individuals and in congenitally infected neonates. RhoB belongs to the family of Rho GTPases, which regulates diverse cellular processes. Rho proteins are implicated in the entry and egress from the host cell of mainly α- and γ-herpesviruses, whereas β-herpesviruses are the least studied in this regard. Here, we studied the role of RhoB GTPase during HCMV lytic infection. Microscopy analysis, both in fixed and live infected cells showed that RhoB was translocated to the assembly complex/compartment (AC) of HCMV, a cytoplasmic zone in infected cells where many viral structural proteins are known to accumulate and assembly of new virions takes place. Furthermore, RhoB was localized at the AC even when the expression of the late HCMV AC proteins was inhibited. At the very late stages of infection, cellular projections were formed containing RhoB and HCMV virions, potentially contributing to the successful viral spread. Interestingly, the knockdown of RhoB in HCMV-infected cells resulted in a significant reduction of the virus titer and could also affect the accumulation of AC viral proteins at this subcellular compartment. RhoB knockdown also affected actin fibers' structure. Actin reorganization was observed at late stages of infection originating from the viral AC and surrounding the cellular projections, implying a potential interplay between RhoB and actin during HCMV assembly and egress. In conclusion, our results demonstrate for the first time that RhoB is a constituent of the viral AC and is required for HCMV productive infection. PMID:26114383

  8. Human Cytomegalovirus Entry into Dendritic Cells Occurs via a Macropinocytosis-Like Pathway in a pH-Independent and Cholesterol-Dependent Manner

    PubMed Central

    Haspot, Fabienne; Lavault, Amélie; Sinzger, Christian; Laib Sampaio, Kerstin; Stierhof, York-Dieter; Pilet, Paul; Bressolette-Bodin, Céline; Halary, Franck

    2012-01-01

    Human cytomegalovirus (HCMV) is a ubiquitous herpesvirus that is able to infect fibroblastic, epithelial, endothelial and hematopoietic cells. Over the past ten years, several groups have provided direct evidence that dendritic cells (DCs) fully support the HCMV lytic cycle. We previously demonstrated that the C-type lectin dendritic cell-specific intercellular adhesion molecule-3-grabbing non-integrin (DC-SIGN) has a prominent role in the docking of HCMV on monocyte-derived DCs (MDDCs). The DC-SIGN/HCMV interaction was demonstrated to be a crucial and early event that substantially enhanced infection in trans, i.e., from one CMV-bearing cell to another non-infected cell (or trans-infection), and rendered susceptible cells fully permissive to HCMV infection. Nevertheless, nothing is yet known about how HCMV enters MDDCs. In this study, we demonstrated that VHL/E HCMV virions (an endothelio/dendrotropic strain) are first internalized into MDDCs by a macropinocytosis-like process in an actin- and cholesterol-dependent, but pH-independent, manner. We observed the accumulation of virions in large uncoated vesicles with endosomal features, and the virions remained as intact particles that retained infectious potential for several hours. This trans-infection property was specific to MDDCs because monocyte-derived macrophages or monocytes from the same donor were unable to allow the accumulation of and the subsequent transmission of the virus. Together, these data allowed us to delineate the early mechanisms of the internalization and entry of an endothelio/dendrotropic HCMV strain into human MDDCs and to propose that DCs can serve as a "Trojan horse" to convey CMV from entry sites to other locations that may favor the occurrence of either latency or acute infection. PMID:22496863

  9. TLR9 -1486T/C and 2848C/T SNPs Are Associated with Human Cytomegalovirus Infection in Infants

    PubMed Central

    Paradowska, Edyta; Jabłońska, Agnieszka; Studzińska, Mirosława; Skowrońska, Katarzyna; Suski, Patrycja; Wiśniewska-Ligier, Małgorzata; Woźniakowska-Gęsicka, Teresa; Nowakowska, Dorota; Gaj, Zuzanna; Wilczyński, Jan; Leśnikowski, Zbigniew J.

    2016-01-01

    Toll-like receptor 9 (TLR9) recognizes non-methylated viral CpG-containing DNA and serves as a pattern recognition receptor that signals the presence of human cytomegalovirus (HCMV). Here, we present the genotype distribution of single-nucleotide polymorphisms (SNPs) of the TLR9 gene in infants and the relationship between TLR9 polymorphisms and HCMV infection. Four polymorphisms (-1237T/C, rs5743836; -1486T/C, rs187084; 1174G/A, rs352139; and 2848C/T, rs352140) in the TLR9 gene were genotyped in 72 infants with symptomatic HCMV infection and 70 healthy individuals. SNP genotyping was performed by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Digested fragments were separated and identified by capillary electrophoresis. The HCMV DNA copy number was measured by a quantitative real-time PCR assay. We found an increased frequency of heterozygous genotypes TLR9 -1486T/C and 2848C/T in infants with HCMV infection compared with uninfected cases. Heterozygous variants of these two SNPs increased the risk of HCMV disease in children (P = 0.044 and P = 0.029, respectively). In infants with a mutation present in at least one allele of -1486T/C and 2848C/T SNPs, a trend towards increased risk of cytomegaly was confirmed after Bonferroni’s correction for multiple testing (Pc = 0.063). The rs352139 GG genotype showed a significantly reduced relative risk for HCMV infection (Pc = 0.006). In contrast, the -1237T/C SNP was not related to viral infection. We found no evidence for linkage disequilibrium with the four examined TLR9 SNPs. The findings suggest that the TLR9 -1486T/C and 2848C/T polymorphisms could be a genetic risk factor for the development of HCMV disease. PMID:27105145

  10. cGAS Senses Human Cytomegalovirus and Induces Type I Interferon Responses in Human Monocyte-Derived Cells

    PubMed Central

    Paijo, Jennifer; Döring, Marius; Spanier, Julia; Grabski, Elena; Nooruzzaman, Mohammed; Schmidt, Tobias; Witte, Gregor; Messerle, Martin; Hornung, Veit; Kaever, Volkhard; Kalinke, Ulrich

    2016-01-01

    Human cytomegalovirus (HCMV) infections of healthy individuals are mostly unnoticed and result in viral latency. However, HCMV can also cause devastating disease, e.g., upon reactivation in immunocompromised patients. Yet, little is known about human immune cell sensing of DNA-encoded HCMV. Recent studies indicated that during viral infection the cyclic GMP/AMP synthase (cGAS) senses cytosolic DNA and catalyzes formation of the cyclic di-nucleotide cGAMP, which triggers stimulator of interferon genes (STING) and thus induces antiviral type I interferon (IFN-I) responses. We found that plasmacytoid dendritic cells (pDC) as well as monocyte-derived DC and macrophages constitutively expressed cGAS and STING. HCMV infection further induced cGAS, whereas STING expression was only moderately affected. Although pDC expressed particularly high levels of cGAS, and the cGAS/STING axis was functional down-stream of STING, as indicated by IFN-I induction upon synthetic cGAMP treatment, pDC were not susceptible to HCMV infection and mounted IFN-I responses in a TLR9-dependent manner. Conversely, HCMV infected monocyte-derived cells synthesized abundant cGAMP levels that preceded IFN-I production and that correlated with the extent of infection. CRISPR/Cas9- or siRNA-mediated cGAS ablation in monocytic THP-1 cells and primary monocyte-derived cells, respectively, impeded induction of IFN-I responses following HCMV infection. Thus, cGAS is a key sensor of HCMV for IFN-I induction in primary human monocyte-derived DC and macrophages. PMID:27058035

  11. Crystal Structure of the Human Cytomegalovirus Glycoprotein B

    PubMed Central

    Burke, Heidi G.; Heldwein, Ekaterina E.

    2015-01-01

    Human cytomegalovirus (HCMV), a dsDNA, enveloped virus, is a ubiquitous pathogen that establishes lifelong latent infections and caused disease in persons with compromised immune systems, e.g., organ transplant recipients or AIDS patients. HCMV is also a leading cause of congenital viral infections in newborns. Entry of HCMV into cells requires the conserved glycoprotein B (gB), thought to function as a fusogen and reported to bind signaling receptors. gB also elicits a strong immune response in humans and induces the production of neutralizing antibodies although most anti-gB Abs are non-neutralizing. Here, we report the crystal structure of the HCMV gB ectodomain determined to 3.6-Å resolution, which is the first atomic-level structure of any betaherpesvirus glycoprotein. The structure of HCMV gB resembles the postfusion structures of HSV-1 and EBV homologs, establishing it as a new member of the class III viral fusogens. Despite structural similarities, each gB has a unique domain arrangement, demonstrating structural plasticity of gB that may accommodate virus-specific functional requirements. The structure illustrates how extensive glycosylation of the gB ectodomain influences antibody recognition. Antigenic sites that elicit neutralizing antibodies are more heavily glycosylated than those that elicit non-neutralizing antibodies, which suggest that HCMV gB uses glycans to shield neutralizing epitopes while exposing non-neutralizing epitopes. This glycosylation pattern may have evolved to direct the immune response towards generation of non-neutralizing antibodies thus helping HCMV to avoid clearance. HCMV gB structure provides a starting point for elucidation of its antigenic and immunogenic properties and aid in the design of recombinant vaccines and monoclonal antibody therapies. PMID:26484870

  12. Influenza Vaccination Generates Cytokine-Induced Memory-like NK Cells: Impact of Human Cytomegalovirus Infection.

    PubMed

    Goodier, Martin R; Rodriguez-Galan, Ana; Lusa, Chiara; Nielsen, Carolyn M; Darboe, Alansana; Moldoveanu, Ana L; White, Matthew J; Behrens, Ron; Riley, Eleanor M

    2016-07-01

    Human NK cells are activated by cytokines, immune complexes, and signals transduced via activating ligands on other host cells. After vaccination, or during secondary infection, adaptive immune responses can enhance both cytokine-driven and Ab-dependent NK cell responses. However, induction of NK cells for enhanced function after in vitro exposure to innate inflammatory cytokines has also been reported and may synergize with adaptive signals to potentiate NK cell activity during infection or vaccination. To test this hypothesis, we examined the effect of seasonal influenza vaccination on NK cell function and phenotype in 52 previously unvaccinated individuals. Enhanced, IL-2-dependent, NK cell IFN-γ responses to Influenza A/California/7/2009 virus were detected up to 4 wk postvaccination and higher in human CMV (HCMV)-seronegative (HCMV(-)) individuals than in HCMV-seropositive (HCMV(+)) individuals. By comparison, robust NK cell degranulation responses were observed both before and after vaccination, due to high titers of naturally occurring anti-influenza Abs in human plasma, and did not differ between HCMV(+) and HCMV(-) subjects. In addition to these IL-2-dependent and Ab-dependent responses, NK cell responses to innate cytokines were also enhanced after influenza vaccination; this was associated with proliferation of CD57(-) NK cells and was most evident in HCMV(+) subjects. Similar enhancement of cytokine responsiveness was observed when NK cells were cocultured in vitro with Influenza A/California/7/2009 virus, and this was at least partially dependent upon IFN-αβR2. In summary, our data indicate that attenuated or live viral vaccines promote cytokine-induced memory-like NK cells and that this process is influenced by HCMV infection. PMID:27233958

  13. Cytomegalovirus-Infected Cells Resist T Cell Mediated Killing in an HLA-Recognition Independent Manner

    PubMed Central

    Proff, Julia; Walterskirchen, Christian; Brey, Charlotte; Geyeregger, Rene; Full, Florian; Ensser, Armin; Lehner, Manfred; Holter, Wolfgang

    2016-01-01

    In order to explore the potential of HLA-independent T cell therapy for human cytomegalovirus (HCMV) infections, we developed a chimeric antigen receptor (CAR) directed against the HCMV encoded glycoprotein B (gB), which is expressed at high levels on the surface of infected cells. T cells engineered with this anti-gB CAR recognized HCMV-infected cells and released cytokines and cytotoxic granules. Unexpectedly, and in contrast to analogous approaches for HIV, Hepatitis B or Hepatitis C virus, we found that HCMV-infected cells were resistant to killing by the CAR-modified T cells. In order to elucidate whether this phenomenon was restricted to the use of CARs, we extended our experiments to T cell receptor (TCR)-mediated recognition of infected cells. To this end we infected fibroblasts with HCMV-strains deficient in viral inhibitors of antigenic peptide presentation and targeted these HLA-class I expressing peptide-loaded infected cells with peptide-specific cytotoxic T cells (CTLs). Despite strong degranulation and cytokine production by the T cells, we again found significant inhibition of lysis of HCMV-infected cells. Impairment of cell lysis became detectable 1 day after HCMV infection and gradually increased during the following 3 days. We thus postulate that viral anti-apoptotic factors, known to inhibit suicide of infected host cells, have evolved additional functions to directly abrogate T cell cytotoxicity. In line with this hypothesis, CAR-T cell cytotoxicity was strongly inhibited in non-infected fibroblasts by expression of the HCMV-protein UL37x1, and even more so by additional expression of UL36. Our data extend the current knowledge on Betaherpesviral evasion from T cell immunity and show for the first time that, beyond impaired antigen presentation, infected cells are efficiently protected by direct blockade of cytotoxic effector functions through viral proteins. PMID:27375569

  14. The Human Cytomegalovirus-Specific UL1 Gene Encodes a Late-Phase Glycoprotein Incorporated in the Virion Envelope

    PubMed Central

    Shikhagaie, Medya; Mercé-Maldonado, Eva; Isern, Elena; Muntasell, Aura; Albà, M. Mar; López-Botet, Miguel; Hengel, Hartmut

    2012-01-01

    We have investigated the previously uncharacterized human cytomegalovirus (HCMV) UL1 open reading frame (ORF), a member of the rapidly evolving HCMV RL11 family. UL1 is HCMV specific; the absence of UL1 in chimpanzee cytomegalovirus (CCMV) and sequence analysis studies suggest that UL1 may have originated by the duplication of an ancestor gene from the RL11-TRL cluster (TRL11, TRL12, and TRL13). Sequence similarity searches against human immunoglobulin (Ig)-containing proteins revealed that HCMV pUL1 shows significant similarity to the cellular carcinoembryonic antigen-related (CEA) protein family N-terminal Ig domain, which is responsible for CEA ligand recognition. Northern blot analysis revealed that UL1 is transcribed during the late phase of the viral replication cycle in both fibroblast-adapted and endotheliotropic strains of HCMV. We characterized the protein encoded by hemagglutinin (HA)-tagged UL1 in the AD169-derived HB5 background. UL1 is expressed as a 224-amino-acid type I transmembrane glycoprotein which becomes detectable at 48 h postinfection. In infected human fibroblasts, pUL1 colocalized at the cytoplasmic site of virion assembly and secondary envelopment together with TGN-46, a marker for the trans-Golgi network, and viral structural proteins, including the envelope glycoprotein gB and the tegument phosphoprotein pp28. Furthermore, analyses of highly purified AD169 UL1-HA epitope-tagged virions revealed that pUL1 is a novel constituent of the HCMV envelope. Importantly, the deletion of UL1 in HCMV TB40/E resulted in reduced growth in a cell type-specific manner, suggesting that pUL1 may be implicated in regulating HCMV cell tropism. PMID:22345456

  15. Identification of Transcription Factor AML-1 Binding Site Upstream of Human Cytomegalovirus UL111A Gene

    PubMed Central

    Zheng, Xiaoqun; Gao, Yan; Zhang, Qi; Liu, Yanqing; Peng, Ying; Fu, Miao; Ji, Yanhong

    2015-01-01

    Human cytomegalovirus (HCMV) interleukin-10 (hcmvIL-10), encoded by HCMV UL111A gene, is a homolog of human IL-10. It exerts immunomodulatory effects that allow HCMV to evade host defense mechanisms. However, the exact mechanism underlying the regulation of hcmvIL-10 expression is not well understood. The transcription factor acute myeloid leukemia 1 (AML-1) plays an important role in the regulation of various genes involved in the differentiation of hematopoietic lineages. A putative AML-1 binding site is present within the upstream regulatory region (URR) of UL111A gene. To provide evidence that AML-1 is involved in regulating UL111A gene expression, we examined the interaction of AML-1 with the URR of UL111A in HCMV-infected human monocytic THP-1 cells using a chromatin immunoprecipitation assay. HcmvIL-10 transcription was detected in differentiated THP-1 cells, but not in undifferentiated ones. Furthermore, the URR of UL111A showed a higher intensity of AML-1 binding, a higher level of histone H3 acetyl-K9, but a lower level of histone H3 dimethyl-K9 in differentiated THP-1 cells than undifferentiated cells. Down-regulation of AML1 by RNA interference decreased the expression of the UL111A gene. Our results suggest that AML-1 may contribute to the epigenetic regulation of UL111A gene via histone modification in HCMV-infected differentiated THP-1 cells. This finding could be useful for the development of new anti-viral therapies. PMID:25658598

  16. The intimate relationship between human cytomegalovirus and the dendritic cell lineage

    PubMed Central

    Sinclair, John; Reeves, Matthew

    2014-01-01

    Primary infection of healthy individuals with human cytomegalovirus (HCMV) is normally asymptomatic but results in the establishment of a lifelong infection of the host. One important cellular reservoir of HCMV latency is the CD34+ haematopoietic progenitor cells resident in the bone marrow. Viral gene expression is highly restricted in these cells with an absence of viral progeny production. However, cellular differentiation into mature myeloid cells is concomitant with the induction of a full lytic transcription program, DNA replication and, ultimately, the production of infectious viral progeny. Such reactivation of HCMV is a major cause of morbidity and mortality in a number of immune-suppressed patient populations. Our current understanding of HCMV carriage and reactivation is that cellular differentiation of the CD34+ progenitor cells through the myeloid lineage, resulting in terminal differentiation to either a macrophage or dendritic cell (DC) phenotype, is crucial for the reactivation event. In this mini-review, we focus on the interaction of HCMV with DCs, with a particular emphasis on their role in reactivation, and discuss how the critical regulation of viral major immediate-early gene expression appears to be delicately entwined with the activation of cellular pathways in differentiating DCs. Furthermore, we also explore the possible immune consequences associated with reactivation in a professional antigen presenting cell and potential countermeasures HCMV employs to abrogate these. PMID:25147545

  17. Human Cytomegalovirus Up-Regulates Endothelin Receptor Type B: Implication for Vasculopathies?

    PubMed Central

    Yaiw, Koon-Chu; Mohammad, Abdul-Aleem; Costa, Helena; Taher, Chato; Badrnya, Sigrun; Assinger, Alice; Wilhelmi, Vanessa; Ananthaseshan, Sharan; Estekizadeh, Atosa; Davoudi, Belghis; Ovchinnikova, Olga; Shlyakhto, Eugene; Rafnsson, Arnar; Khan, Zahidul; Butler, Lynn; Rahbar, Afsar; Pernow, John; Söderberg-Nauclér, Cecilia

    2015-01-01

    Background. Both endothelin receptor type B ([ETBR], a G protein-coupled receptor that mediates the vascular effects of the potent vasoconstrictor endothelin-1) and human cytomegalovirus ([HCMV], a ubiquitous herpesvirus) have been implicated in the pathogenesis of cardiovascular disease (CVD). The effects of HCMV infection on ETBR expression are unknown. We hypothesized that HCMV may contribute to the pathogenesis of CVD via ETBR modulation. Methods. Human CMV effects on ETBR were studied in vitro in endothelial cells (ECs) and smooth muscle cells (SMCs) and ex vivo in human carotid plaque tissue specimens. Expression of ETBR and viral immediate-early were quantified using quantitative polymerase chain reaction. Functional consequences after ETBR blockade in ECs were examined by 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide proliferation, wound healing, tube formation, and flow adhesion assays. Results. Human CMV is capable of upregulating both ETBR mRNA and protein expression in ECs and SMCs. The ETBR was also abundantly expressed in ECs, foam cells, and SMCs, and, more importantly, in HCMV-positive cells in human carotid plaques. Endothelin receptor type B blockade led to decreased proliferation and reduced tumor necrosis factor α-mediated leukocyte recruitment in both uninfected and HCMV-infected ECs. Direct HCMV infection was antimigratory and antiangiogenic in ECs. Conclusions. Human CMV may contribute to CVD via ETBR induction. PMID:26719843

  18. Adenovirus E1A/E1B Transformed Amniotic Fluid Cells Support Human Cytomegalovirus Replication

    PubMed Central

    Krömmelbein, Natascha; Wiebusch, Lüder; Schiedner, Gudrun; Büscher, Nicole; Sauer, Caroline; Florin, Luise; Sehn, Elisabeth; Wolfrum, Uwe; Plachter, Bodo

    2016-01-01

    The human cytomegalovirus (HCMV) replicates to high titers in primary human fibroblast cell cultures. A variety of primary human cells and some tumor-derived cell lines do also support permissive HCMV replication, yet at low levels. Cell lines established by transfection of the transforming functions of adenoviruses have been notoriously resistant to HCMV replication and progeny production. Here, we provide first-time evidence that a permanent cell line immortalized by adenovirus type 5 E1A and E1B (CAP) is supporting the full HCMV replication cycle and is releasing infectious progeny. The CAP cell line had previously been established from amniotic fluid cells which were likely derived from membranes of the developing fetus. These cells can be grown under serum-free conditions. HCMV efficiently penetrated CAP cells, expressed its immediate-early proteins and dispersed restrictive PML-bodies. Viral DNA replication was initiated and viral progeny became detectable by electron microscopy in CAP cells. Furthermore, infectious virus was released from CAP cells, yet to lower levels compared to fibroblasts. Subviral dense bodies were also secreted from CAP cells. The results show that E1A/E1B expression in transformed cells is not generally repressive to HCMV replication and that CAP cells may be a good substrate for dense body based vaccine production. PMID:26848680

  19. Human cytomegalovirus RL13 protein interacts with host NUDT14 protein affecting viral DNA replication.

    PubMed

    Wang, Guili; Ren, Gaowei; Cui, Xin; Lu, Zhitao; Ma, Yanping; Qi, Ying; Huang, Yujing; Liu, Zhongyang; Sun, Zhengrong; Ruan, Qiang

    2016-03-01

    The interaction between the host and human cytomegalovirus (HCMV) is important in determining the outcome of a viral infection. The HCMV RL13 gene product exerts independent, inhibitory effects on viral growth in fibroblasts and epithelial cells. At present, there are few reports on the interactions between the HCMV RL13 protein and human host proteins. The present study provided direct evidence for the specific interaction between HCMV RL13 and host nucleoside diphosphate linked moiety X (nudix)‑type motif 14 (NUDT14), a UDP‑glucose pyrophosphatase, using two‑hybrid screening, an in vitro glutathione S‑transferase pull‑down assay, and co‑immunoprecipitation in human embryonic kidney HEK293 cells. Additionally, the RL13 protein was shown to co‑localize with the NUDT14 protein in the HEK293 cell membrane and cytoplasm, demonstrated using fluorescence confocal microscopy. Decreasing the expression level of NUDT14 via NUDT14‑specific small interfering RNAs increased the number of viral DNA copies in the HCMV‑infected cells. However, the overexpression of NUDT14 in a stably expressing cell line did not affect viral DNA levels significantly in the HCMV infected cells. Based on the known functions of NUDT14, the results of the present study suggested that the interaction between the RL13 protein and NUDT14 protein may be involved in HCMV DNA replication, and that NUDT14 may offer potential in the modulation of viral infection. PMID:26781650

  20. Broadly targeted human cytomegalovirus-specific CD4+ and CD8+ T cells dominate the memory compartments of exposed subjects.

    PubMed

    Sylwester, Andrew W; Mitchell, Bridget L; Edgar, John B; Taormina, Cara; Pelte, Christian; Ruchti, Franziska; Sleath, Paul R; Grabstein, Kenneth H; Hosken, Nancy A; Kern, Florian; Nelson, Jay A; Picker, Louis J

    2005-09-01

    Human cytomegalovirus (HCMV) infections of immunocompetent hosts are characterized by a dynamic, life-long interaction in which host immune responses, particularly of T cells, restrain viral replication and prevent disease but do not eliminate the virus or preclude transmission. Because HCMV is among the largest and most complex of known viruses, the T cell resources committed to maintaining this balance have never been characterized completely. Here, using cytokine flow cytometry and 13,687 overlapping 15mer peptides comprising 213 HCMV open reading frames (ORFs), we found that 151 HCMV ORFs were immunogenic for CD4(+) and/or CD8(+) T cells, and that ORF immunogenicity was influenced only modestly by ORF expression kinetics and function. We further documented that total HCMV-specific T cell responses in seropositive subjects were enormous, comprising on average approximately 10% of both the CD4(+) and CD8(+) memory compartments in blood, whereas cross-reactive recognition of HCMV proteins in seronegative individuals was limited to CD8(+) T cells and was rare. These data provide the first glimpse of the total human T cell response to a complex infectious agent and will provide insight into the rules governing immunodominance and cross-reactivity in complex viral infections of humans. PMID:16147978

  1. Broadly targeted human cytomegalovirus-specific CD4+ and CD8+ T cells dominate the memory compartments of exposed subjects

    PubMed Central

    Sylwester, Andrew W.; Mitchell, Bridget L.; Edgar, John B.; Taormina, Cara; Pelte, Christian; Ruchti, Franziska; Sleath, Paul R.; Grabstein, Kenneth H.; Hosken, Nancy A.; Kern, Florian; Nelson, Jay A.; Picker, Louis J.

    2005-01-01

    Human cytomegalovirus (HCMV) infections of immunocompetent hosts are characterized by a dynamic, life-long interaction in which host immune responses, particularly of T cells, restrain viral replication and prevent disease but do not eliminate the virus or preclude transmission. Because HCMV is among the largest and most complex of known viruses, the T cell resources committed to maintaining this balance have never been characterized completely. Here, using cytokine flow cytometry and 13,687 overlapping 15mer peptides comprising 213 HCMV open reading frames (ORFs), we found that 151 HCMV ORFs were immunogenic for CD4+ and/or CD8+ T cells, and that ORF immunogenicity was influenced only modestly by ORF expression kinetics and function. We further documented that total HCMV-specific T cell responses in seropositive subjects were enormous, comprising on average ∼10% of both the CD4+ and CD8+ memory compartments in blood, whereas cross-reactive recognition of HCMV proteins in seronegative individuals was limited to CD8+ T cells and was rare. These data provide the first glimpse of the total human T cell response to a complex infectious agent and will provide insight into the rules governing immunodominance and cross-reactivity in complex viral infections of humans. PMID:16147978

  2. Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene

    SciTech Connect

    Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.

    1987-01-01

    DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus.

  3. A Proteomics Analysis of Human Cytomegalovirus Particles

    SciTech Connect

    Streblow, Daniel N.; Varnum, Susan M.; Smith, Richard D.; Nelson, Jay

    2006-01-01

    While the sequence of the AD169 HCMV genome has been known for several years, the viral and cellular proteins that compose the infectious HCMV virion and entry-competent, non-replicating viral particles such as Dense Bodies (DBs) and Non-Infectious Enveloped Particles (NIEPs) are unknown. To approach this problem we have utilized a gel-free 2-D capillary liquid chromatography (LC)-MS/MS and Fourier transform ion cyclotron resonance (FTICR) mass spectrometry to identify and determine the relative abundance of viral and cellular proteins in purified HCMV AD169 particles. !is study has identified and quantitated the proteins that compose both HCMV virions and DBs. While a number of previously identified proteins were detected by this method the number of viral proteins that compose the HCMV virion was doubled in this study suggesting that over a third of the viral open reading frames are part of an infectious virion. !is chapter will discuss the implications of our findings in relation to what was previously known about HCMV and MCMV virion composition.

  4. Human Cytomegalovirus Infection Interferes with the Maintenance and Differentiation of Trophoblast Progenitor Cells of the Human Placenta

    PubMed Central

    Tabata, Takako; Petitt, Matthew; Zydek, Martin; Fang-Hoover, June; Larocque, Nicholas; Tsuge, Mitsuru; Gormley, Matthew; Kauvar, Lawrence M.

    2015-01-01

    ABSTRACT Human cytomegalovirus (HCMV) is a major cause of birth defects that include severe neurological deficits, hearing and vision loss, and intrauterine growth restriction. Viral infection of the placenta leads to development of avascular villi, edema, and hypoxia associated with symptomatic congenital infection. Studies of primary cytotrophoblasts (CTBs) revealed that HCMV infection impedes terminal stages of differentiation and invasion by various molecular mechanisms. We recently discovered that HCMV arrests earlier stages involving development of human trophoblast progenitor cells (TBPCs), which give rise to the mature cell types of chorionic villi—syncytiotrophoblasts on the surfaces of floating villi and invasive CTBs that remodel the uterine vasculature. Here, we show that viral proteins are present in TBPCs of the chorion in cases of symptomatic congenital infection. In vitro studies revealed that HCMV replicates in continuously self-renewing TBPC lines derived from the chorion and alters expression and subcellular localization of proteins required for cell cycle progression, pluripotency, and early differentiation. In addition, treatment with a human monoclonal antibody to HCMV glycoprotein B rescues differentiation capacity, and thus, TBPCs have potential utility for evaluation of the efficacies of novel antiviral antibodies in protecting and restoring placental development. Our results suggest that HCMV replicates in TBPCs in the chorion in vivo, interfering with the earliest steps in the growth of new villi, contributing to virus transmission and impairing compensatory development. In cases of congenital infection, reduced responsiveness of the placenta to hypoxia limits the transport of substances from maternal blood and contributes to fetal growth restriction. IMPORTANCE Human cytomegalovirus (HCMV) is a leading cause of birth defects in the United States. Congenital infection can result in permanent neurological defects, mental retardation

  5. Leukocyte Immunoglobulin-Like Receptor 1-Expressing Human Natural Killer Cell Subsets Differentially Recognize Isolates of Human Cytomegalovirus through the Viral Major Histocompatibility Complex Class I Homolog UL18

    PubMed Central

    Chen, Kevin C.; Banat, Jareer J.

    2016-01-01

    ABSTRACT Immune responses of natural killer (NK) cell are controlled by the balance between activating and inhibitory receptors, but the expression of these receptors varies between cells within an individual. Although NK cells are a component of the innate immune system, particular NK cell subsets expressing Ly49H are positively selected and increase in frequency in response to cytomegalovirus infection in mice. Recent evidence suggests that in humans certain NK subsets also have an increased frequency in the blood of human cytomegalovirus (HCMV)-infected individuals. However, whether these subsets differ in their capacity of direct control of HCMV-infected cells remains unclear. In this study, we developed a novel in vitro assay to assess whether human NK cell subsets have differential abilities to inhibit HCMV growth and dissemination. NK cells expressing or lacking NKG2C did not display any differences in controlling viral dissemination. However, when in vitro-expanded NK cells were used, cells expressing or lacking the inhibitory receptor leukocyte immunoglobulin-like receptor 1 (LIR1) were differentially able to control dissemination. Surprisingly, the ability of LIR1+ NK cells to control virus spread differed between HCMV viral strains, and this phenomenon was dependent on amino acid sequences within the viral ligand UL18. Together, the results here outline an in vitro technique to compare the long-term immune responses of different human NK cell subsets and suggest, for the first time, that phenotypically defined human NK cell subsets may differentially recognize HCMV infections. IMPORTANCE HCMV infection is ubiquitous in most populations; it is not cleared by the host after primary infection but persists for life. The innate and adaptive immune systems control the spread of virus, for which natural killer (NK) cells play a pivotal role. NK cells can respond to HCMV infection by rapid, short-term, nonspecific innate responses, but evidence from murine

  6. Efficacy and Mechanism of Action of Low Dose Emetine against Human Cytomegalovirus

    PubMed Central

    Mukhopadhyay, Rupkatha; Roy, Sujayita; Venkatadri, Rajkumar; Su, Yu-Pin; Ye, Wenjuan; Barnaeva, Elena; Mathews Griner, Lesley; Southall, Noel; Hu, Xin; Wang, Amy Q.; Xu, Xin; Dulcey, Andrés E.; Marugan, Juan J.; Ferrer, Marc; Arav-Boger, Ravit

    2016-01-01

    Infection with human cytomegalovirus (HCMV) is a threat for pregnant women and immunocompromised hosts. Although limited drugs are available, development of new agents against HCMV is desired. Through screening of the LOPAC library, we identified emetine as HCMV inhibitor. Additional studies confirmed its anti-HCMV activities in human foreskin fibroblasts: EC50−40±1.72 nM, CC50−8±0.56 μM, and selectivity index of 200. HCMV inhibition occurred after virus entry, but before DNA replication, and resulted in decreased expression of viral proteins. Synergistic virus inhibition was achieved when emetine was combined with ganciclovir. In a mouse CMV (MCMV) model, emetine was well-tolerated, displayed long half-life, preferential distribution to tissues over plasma, and effectively suppressed MCMV. Since the in vitro anti-HCMV activity of emetine decreased significantly in low-density cells, a mechanism involving cell cycle regulation was suspected. HCMV inhibition by emetine depended on ribosomal processing S14 (RPS14) binding to MDM2, leading to disruption of HCMV-induced MDM2-p53 and MDM2-IE2 interactions. Irrespective of cell density, emetine induced RPS14 translocation into the nucleus during infection. In infected high-density cells, MDM2 was available for interaction with RPS14, resulting in disruption of MDM2-p53 interaction. However, in low-density cells the pre-existing interaction of MDM2-p53 could not be disrupted, and RPS14 could not interact with MDM2. In high-density cells the interaction of MDM2-RPS14 resulted in ubiquitination and degradation of RPS14, which was not observed in low-density cells. In infected-only or in non-infected emetine-treated cells, RPS14 failed to translocate into the nucleus, hence could not interact with MDM2, and was not ubiquitinated. HCMV replicated similarly in RPS14 knockdown or control cells, but emetine did not inhibit virus replication in the former cell line. The interaction of MDM2-p53 was maintained in infected

  7. Efficacy and Mechanism of Action of Low Dose Emetine against Human Cytomegalovirus.

    PubMed

    Mukhopadhyay, Rupkatha; Roy, Sujayita; Venkatadri, Rajkumar; Su, Yu-Pin; Ye, Wenjuan; Barnaeva, Elena; Mathews Griner, Lesley; Southall, Noel; Hu, Xin; Wang, Amy Q; Xu, Xin; Dulcey, Andrés E; Marugan, Juan J; Ferrer, Marc; Arav-Boger, Ravit

    2016-06-01

    Infection with human cytomegalovirus (HCMV) is a threat for pregnant women and immunocompromised hosts. Although limited drugs are available, development of new agents against HCMV is desired. Through screening of the LOPAC library, we identified emetine as HCMV inhibitor. Additional studies confirmed its anti-HCMV activities in human foreskin fibroblasts: EC50-40±1.72 nM, CC50-8±0.56 μM, and selectivity index of 200. HCMV inhibition occurred after virus entry, but before DNA replication, and resulted in decreased expression of viral proteins. Synergistic virus inhibition was achieved when emetine was combined with ganciclovir. In a mouse CMV (MCMV) model, emetine was well-tolerated, displayed long half-life, preferential distribution to tissues over plasma, and effectively suppressed MCMV. Since the in vitro anti-HCMV activity of emetine decreased significantly in low-density cells, a mechanism involving cell cycle regulation was suspected. HCMV inhibition by emetine depended on ribosomal processing S14 (RPS14) binding to MDM2, leading to disruption of HCMV-induced MDM2-p53 and MDM2-IE2 interactions. Irrespective of cell density, emetine induced RPS14 translocation into the nucleus during infection. In infected high-density cells, MDM2 was available for interaction with RPS14, resulting in disruption of MDM2-p53 interaction. However, in low-density cells the pre-existing interaction of MDM2-p53 could not be disrupted, and RPS14 could not interact with MDM2. In high-density cells the interaction of MDM2-RPS14 resulted in ubiquitination and degradation of RPS14, which was not observed in low-density cells. In infected-only or in non-infected emetine-treated cells, RPS14 failed to translocate into the nucleus, hence could not interact with MDM2, and was not ubiquitinated. HCMV replicated similarly in RPS14 knockdown or control cells, but emetine did not inhibit virus replication in the former cell line. The interaction of MDM2-p53 was maintained in infected RPS14

  8. Vaccine-Derived Neutralizing Antibodies to the Human Cytomegalovirus gH/gL Pentamer Potently Block Primary Cytotrophoblast Infection

    PubMed Central

    Chiuppesi, Flavia; Wussow, Felix; Johnson, Erica; Bian, Chao; Zhuo, Meng; Rajakumar, Augustine; Barry, Peter A.; Britt, William J.; Chakraborty, Rana

    2015-01-01

    ABSTRACT Human cytomegalovirus (HCMV) elicits neutralizing antibodies (NAb) of various potencies and cell type specificities to prevent HCMV entry into fibroblasts (FB) and epithelial/endothelial cells (EpC/EnC). NAb targeting the major essential envelope glycoprotein complexes gB and gH/gL inhibit both FB and EpC/EnC entry. In contrast to FB infection, HCMV entry into EpC/EnC is additionally blocked by extremely potent NAb to conformational epitopes of the gH/gL/UL128/130/131A pentamer complex (PC). We recently developed a vaccine concept based on coexpression of all five PC subunits by a single modified vaccinia virus Ankara (MVA) vector, termed MVA-PC. Vaccination of mice and rhesus macaques with MVA-PC resulted in a high titer and sustained NAb that blocked EpC/EnC infection and lower-titer NAb that inhibited FB entry. However, antibody function responsible for the neutralizing activity induced by the MVA-PC vaccine is uncharacterized. Here, we demonstrate that MVA-PC elicits NAb with cell type-specific neutralization potency and antigen recognition pattern similar to human NAb targeting conformational and linear epitopes of the UL128/130/131A subunits or gH. In addition, we show that the vaccine-derived PC-specific NAb are significantly more potent than the anti-gH NAb to prevent HCMV spread in EpC and infection of human placental cytotrophoblasts, cell types thought to be of critical importance for HCMV transmission to the fetus. These findings further validate MVA-PC as a clinical vaccine candidate to elicit NAb that resembles those induced during HCMV infection and provide valuable insights into the potency of PC-specific NAb to interfere with HCMV cell-associated spread and infection of key placental cells. IMPORTANCE As a consequence of the leading role of human cytomegalovirus (HCMV) in causing permanent birth defects, developing a vaccine against HCMV has been assigned a major public health priority. We have recently introduced a vaccine strategy based

  9. Cytomegalovirus infection does not impact on survival or time to first treatment in patients with chronic lymphocytic leukemia.

    PubMed

    Parry, Helen Marie; Damery, Sarah; Hudson, Christopher; Maurer, Matthew J; Cerhan, James R; Pachnio, Annette; Begum, Jusnara; Slager, Susan L; Fegan, Christopher; Man, Stephen; Pepper, Christopher; Shanafelt, Tait D; Pratt, Guy; Moss, Paul A H

    2016-08-01

    Human cytomegalovirus (HCMV) is a widely prevalent herpes virus which establishes a state of chronic infection. The establishment of CMV-specific immunity controls viral reactivation and leads to the accumulation of very large numbers of virus-specific T cells which come to dominate the immune repertoire. There is concern that this may reduce the immune response to heterologous infections and HCMV infection has been associated with reduced survival in elderly people. Patients with chronic lymphocytic leukemia (B-CLL) suffer from a state of immune suppression but have a paradoxical increase in the magnitude of the CMV-specific T cell and humoral immune response. As such, there is now considerable interest in how CMV infection impacts on the clinical outcome of patients with B-CLL. Utilizing a large prospective cohort of patients with B-CLL (n = 347) we evaluated the relationship between HCMV seropositivity and patient outcome. HCMV seropositive patients had significantly worse overall survival than HCMV negative patients in univariate analysis (HR = 2.28, 95% CI: 1.34-3.88; P = 0.002). However, CMV seropositive patients were 4 years older than seronegative donors and this survival difference was lost in multivariate modeling adjusted for age and other validated prognostic markers (P = 0.34). No significant difference was found in multivariate modeling between HCMV positive and negative patients in relation to the time to first treatment (HR = 1.12, 95% CI: 0.68-1.84; P = 0.65). These findings in a second independent cohort of 236 B-CLL patients were validated. In conclusion no evidence that HCMV impacts on the clinical outcome of patients with B-CLL was found. Am. J. Hematol. 91:776-781, 2016. © 2016 Wiley Periodicals, Inc. PMID:27124884

  10. Human cytomegalovirus pp65- and immediate early 1 antigen-specific HLA class I-restricted cytotoxic T cell responses induced by cross-presentation of viral antigens.

    PubMed

    Tabi, Z; Moutaftsi, M; Borysiewicz, L K

    2001-05-01

    Dendritic cells (DCs) play a pivotal role in the development of anti-viral CD8(+) CTL responses. This is straightforward if they are directly infected with virus, but is less clear in response to viruses that cannot productively infect DCS: Human CMV (HCMV) shows strain-specific cell tropism: fibroblast (Fb)-adapted laboratory strains (AD169) and recent clinical isolates do not infect DCs, whereas endothelial cell-adapted strains (TB40/E) result in productive lytic DC infection. However, we show here that uninfected DCs induce CD8(+) T cell cytotoxicity and IFN-gamma production against HCMV pp65 and immediate early 1 Ags following in vitro coculture with HCMV-AD169-infected Fbs, regardless of the HLA type of these FBS: CD8(+) T cell stimulation was inhibited by pretreatment of DCs with cytochalasin B or brefeldin A, indicating a phagosome/endosome to cytosol pathway. HCMV-infected Fbs were not apoptotic as measured by annexin V binding, and induction of apoptosis of infected Fbs in vitro did not augment CTL induction by DCs, suggesting a mechanism other than apoptosis in the initiation of cross-presentation. Furthermore, HCMV-infected Fbs provided a maturation signal for immature DCs during coculture, as evidenced by increased CD83 and HLA class II expression. Cross-presentation of HCMV Ags by host DCs enables these professional APCs to bypass some of the evasion mechanisms HCMV has developed to avoid T cell recognition. It may also serve to explain the presence of immediate early 1 Ag-specific CTLs in the face of pp65-induced inhibition of Ag presentation at the level of the infected cell. PMID:11313411

  11. Antibody-mediated response of NKG2Cbright NK cells against human cytomegalovirus.

    PubMed

    Costa-Garcia, Marcel; Vera, Andrea; Moraru, Manuela; Vilches, Carlos; López-Botet, Miguel; Muntasell, Aura

    2015-03-15

    Human CMV (HCMV) infection promotes a variable and persistent expansion of functionally mature NKG2C(bright) NK cells. We analyzed NKG2C(bright) NK cell responses triggered by Abs from HCMV(+) sera against HCMV-infected MRC5 fibroblasts. Specific Abs promoted the degranulation (i.e., CD107a expression) and the production of cytokines (TNF-α and IFN-γ) by a significant fraction of NK cells, exceeding the low natural cytotoxicity against HCMV-infected targets. NK cell-mediated Ab-dependent cell-mediated cytotoxicity was limited by viral Ag availability and HLA class I expression on infected cells early postinfection and increased at late stages, overcoming viral immunoevasion strategies. Moreover, the presence of specific IgG triggered the activation of NK cells against Ab-opsonized cell-free HCMV virions. As compared with NKG2A(+) NK cells, a significant proportion of NKG2C(bright) NK cells was FcεR γ-chain defective and highly responsive to Ab-driven activation, being particularly efficient in the production of antiviral cytokines, mainly TNF-α. Remarkably, the expansion of NKG2C(bright) NK cells in HCMV(+) subjects was related to the overall magnitude of TNF-α and IFN-γ cytokine secretion upon Ab-dependent and -independent activation. We show the power and sensitivity of the anti-HCMV response resulting from the cooperation between specific Abs and the NKG2C(bright) NK-cell subset. Furthermore, we disclose the proinflammatory potential of NKG2C(bright) NK cells, a variable that could influence the individual responses to other pathogens and tumors. PMID:25667418

  12. Human Cytomegalovirus in Oral Squamous Cell Carcinoma in Southeast of Iran

    PubMed Central

    Saravani, Shirin; Kadeh, Hamideh; Miri-Moghaddam, Ebrahim; Zekri, Ali; Sanadgol, Nima; Gholami, Aliye

    2015-01-01

    Background: Carcinogenesis is a multi-step process and the role of infectious agents in this progression has not been fully identified. Since human cytomegalovirus (HCMV) is frequently presented in the gingival sulcus fluid, we hypothesized that this virus would be important in the pathogenesis of oral squamous cell carcinoma (OSCC). Objectives: The aim of this study was to investigate the presence of active HCMV in different histopathological grades of OSCC in southeast of Iran. Materials and Methods: Forty eight individual specimens were evaluated in this study. Serial sections were obtained from paraffin-embedded tissue samples of OSCC biopsies. The frequency of HCMV was investigated using the real-time polymerase change reaction method after DNA extraction from biopsies. Results: The mean age of the patients (66.7% female and 33.3% male) was 58.6 years. Only three cases (6.3%) of the grade I, OSCC biopsies, were positive for active HCMV with average load of 57.7 × 103. Conclusions: According to the low prevalence of HCMV in OSCC, it seems that this virus plays a minor role in this kind of cancer at least in southeast of Iran. More comprehensive studies are needed to investigate the oncomodulatory effect of this virus on OSCC. PMID:26464768

  13. PCR activity of CMV in healthy CMV-seropositive individuals: does latency need redefinition?

    PubMed

    Toro, A I; Ossa, J

    1996-01-01

    To demonstrate a possible association between stress factors and the presence of human cytomegalovirus (HCMV) DNA in leukocytes and in cell-free body fluids, at 2-week intervals over a 6-month period, specimens were taken for HCMV DNA testing from 11 healthy CMV-seropositive individuals who were also surveyed for stress-producing events occurring during the previous week. A positive polymerase chain reaction (PCR) signal was given in 104/127 (81.9%) urines, 73/127 (57.3%) throat washings and 68/127 (53.6%) leukocyte samples. An association was found between HCMV DNA in urine and a stress-producing event at work (p < 0.04). An association was also found between detection of HCMV DNA in throat washings and alcohol ingestion (P < 0.006) and between the presence of oral herpes lesions and the detection of HCMV DNA in leukocytes (p < 0.0019). The results suggest that viral reactivation is more common than previously thought and that stress may be a triggering event. PMID:8837231

  14. Viral binding-induced signaling drives a unique and extended intracellular trafficking pattern during infection of primary monocytes.

    PubMed

    Kim, Jung Heon; Collins-McMillen, Donna; Caposio, Patrizia; Yurochko, Andrew D

    2016-08-01

    We initiated experiments to examine the infection of monocytes postentry. New data show that human cytomegalovirus (HCMV) DNA is detected in the nucleus beginning only at 3 d postinfection in monocytes, compared with 30 min postinfection in fibroblasts and endothelial cells, suggesting that HCMV nuclear translocation in monocytes is distinct from that seen in other cell types. We now show that HCMV is initially retained in early endosomes and then moves sequentially to the trans-Golgi network (TGN) and recycling endosomes before nuclear translocation. HCMV is retained initially as a mature particle before deenvelopment in recycling endosomes. Disruption of the TGN significantly reduced nuclear translocation of viral DNA, and HCMV nuclear translocation in infected monocytes was observed only when correct gH/gL/UL128-131/integrin/c-Src signaling occurred. Taken together, our findings show that viral binding of the gH/gL/UL128-131 complex to integrins and the ensuing c-Src signaling drive a unique nuclear translocation pattern that promotes productive infection and avoids viral degradation, suggesting that it represents an additional viral evasion/survival strategy. PMID:27432979

  15. Inhibitory activity of S-adenosylhomocysteine hydrolase inhibitors against human cytomegalovirus replication.

    PubMed

    Snoeck, R; Andrei, G; Neyts, J; Schols, D; Cools, M; Balzarini, J; De Clercq, E

    1993-07-01

    Various acyclic and carbocyclic adenosine analogues, which are apparently targeted at the S-adenosylhomocysteine (AdoHcy) hydrolase have been reported to inhibit the replication of a number of pox-, rhabdo-, paramyxo-, arena-, and reoviruses. Here we show that this activity spectrum extends to human cytomegalovirus (HCMV). Of the compounds tested, neplanocin A, 3-deazaneplanocin A, 6'-C-methylneplanocin A and 5'-noraristeromycin were found to be the most potent inhibitors of HCMV replication in vitro. Their 50% inhibitory concentration ranged from 0.05 to 1.35 micrograms/ml. In general, the anti-HCMV activity of the adenosine analogues correlated well with their affinity (Ki) for AdoHcy hydrolase, suggesting that AdoHcy hydrolase may be considered as a target enzyme for anti-HCMV agents. For four compounds (3-deazaneplanocin A, 6'-C-methylneplanocin A (isomers I and II) and 3-deazaadenosine), anti-HCMV potency was greater than could be expected solely from their interaction with AdoHcy hydrolase, suggesting that these compounds may be functioning by an additional mechanism. PMID:8215298

  16. Genomic localization, sequence analysis, and transcription of the putative human cytomegalovirus DNA polymerase gene.

    PubMed Central

    Heilbronn, R; Jahn, G; Bürkle, A; Freese, U K; Fleckenstein, B; zur Hausen, H

    1987-01-01

    The human cytomegalovirus (HCMV)-induced DNA polymerase has been well characterized biochemically and functionally, but its genomic location has not yet been assigned. To identify the coding sequence, cross-hybridization with the herpes simplex virus type 1 (HSV-1) polymerase gene was used, as suggested by the close similarity of the herpes group virus-induced DNA polymerases to the HCMV DNA polymerase. A cosmid and plasmid library of the entire HCMV genome was screened with the BamHI Q fragment of HSV-1 at different stringency conditions. One PstI-HincII restriction fragment of 850 base pairs mapping within the EcoRI M fragment of HCMV cross-hybridized at Tm - 25 degrees C. Sequence analysis revealed one open reading frame spanning the entire sequence. The amino acid sequence showed a highly conserved domain of 133 amino acids shared with the HSV and putative Epstein-Barr virus polymerase sequences. This domain maps within the C-terminal part of the HSV polymerase gene, which has been suggested to contain part of the catalytic center of the enzyme. Transcription analysis revealed one 5.4-kilobase early transcript in the sense orientation with respect to the open reading frame identified. This transcript appears to code for the 140-kilodalton HCMV polymerase protein. Images PMID:3023689

  17. Human cytomegalovirus mediates cell cycle progression through G(1) into early S phase in terminally differentiated cells.

    PubMed

    Sinclair, J; Baillie, J; Bryant, L; Caswell, R

    2000-06-01

    Terminal differentiation of embryonal carcinoma cells and monocytes has been shown to be important for their permissiveness for human cytomegalovirus (HCMV) infection, even though such terminally differentiated cells have withdrawn from the cell cycle and are, essentially, in G(0) arrest. Recently, data from a number of laboratories have shown that productive infection with HCMV of quiescent fibroblasts held reversibly in G(0) of the cell cycle can result in cell cycle progression, which results eventually in cycle arrest. In contrast to quiescent fibroblasts, the effect of HCMV on cells that have withdrawn irreversibly from the cell cycle due to terminal differentiation has not, so far, been addressed. Here, it is shown that, in cells that have arrested in G(0) as a result of terminal differentiation, HCMV is able to induce cell functions associated with progression of the cell cycle through G(1) into early S phase. This progression is correlated with a direct physical and functional interaction between the HCMV 86 kDa major immediate-early protein (IE86) and the cyclin-dependent kinase inhibitor p21(Cip1). PMID:10811939

  18. Analysis of the complete DNA sequence of murine cytomegalovirus.

    PubMed Central

    Rawlinson, W D; Farrell, H E; Barrell, B G

    1996-01-01

    The complete DNA sequence of the Smith strain of murine cytomegalovirus (MCMV) was determined from virion DNA by using a whole-genome shotgun approach. The genome has an overall G+C content of 58.7%, consists of 230,278 bp, and is arranged as a single unique sequence with short (31-bp) terminal direct repeats and several short internal repeats. Significant similarity to the genome of the sequenced human cytomegalovirus (HCMV) strain AD169 is evident, particularly for 78 open reading frames encoded by the central part of the genome. There is a very similar distribution of G+C content across the two genomes. Sequences toward the ends of the MCMV genome encode tandem arrays of homologous glycoproteins (gps) arranged as two gene families. The left end encodes 15 gps that represent one family, and the right end encodes a different family of 11 gps. A homolog (m144) of cellular major histocompatibility complex (MHC) class I genes is located at the end of the genome opposite the HCMV MHC class I homolog (UL18). G protein-coupled receptor (GCR) homologs (M33 and M78) occur in positions congruent with two (UL33 and UL78) of the four putative HCMV GCR homologs. Counterparts of all of the known enzyme homologs in HCMV are present in the MCMV genome, including the phosphotransferase gene (M97), whose product phosphorylates ganciclovir in HCMV-infected cells, and the assembly protein (M80). PMID:8971012

  19. Interaction of the human cytomegalovirus particle with the host cell induces hypoxia-inducible factor 1 alpha

    SciTech Connect

    McFarlane, Steven; Nicholl, Mary Jane; Sutherland, Jane S.; Preston, Chris M.

    2011-05-25

    The cellular protein hypoxia-inducible factor 1 alpha (HIF-1{alpha}) was induced after infection of human fibroblasts with human cytomegalovirus (HCMV). HCMV irradiated with ultraviolet light (uv-HCMV) also elicited the effect, demonstrating that the response was provoked by interaction of the infecting virion with the cell and that viral gene expression was not required. Although induction of HIF-1{alpha} was initiated by an early event, accumulation of the protein was not detected until 9 hours post infection, with levels increasing thereafter. Infection with uv-HCMV resulted in increased abundance of HIF-1{alpha}-specific RNA, indicating stimulation of transcription. In addition, greater phosphorylation of the protein kinase Akt was observed, and the activity of this enzyme was required for induction of HIF-1{alpha} to occur. HIF-1{alpha} controls the expression of many cellular gene products; therefore the findings reveal new ways in which interaction of the HCMV particle with the host cell may cause significant alterations to cellular physiology.

  20. Tumor control by human cytomegalovirus in a murine model of hepatocellular carcinoma

    PubMed Central

    Kumar, Amit; Coquard, Laurie; Pasquereau, Sébastien; Russo, Laetitia; Valmary-Degano, Séverine; Borg, Christophe; Pothier, Pierre; Herbein, Georges

    2016-01-01

    Although viruses can cause cancer, other studies reported the regression of human tumors upon viral infections. We investigated the cytoreductive potential of human cytomegalovirus (HCMV) in a murine model of human hepatocellular carcinoma (HCC) in severe-immunodeficient mice. Infection of HepG2 cells with HCMV resulted in the absence of tumor or in a limited tumor growth following injection of cells subcutaneously. By contrast all mice injected with uninfected HepG2 cells and with HepG2 cells infected with UV-treated HCMV did develop tumors without any significant restriction. Analysis of tumors indicated that in mice injected with HCMV-infected-HepG2 cells, but not in controls, a restricted cellular proliferation was observed parallel to a limited activation of the STAT3-cyclin D1 axis, decreased formation of colonies in soft agar, and activation of the intrinsic apoptotic pathway. We conclude that HCMV can provide antitumoral effects in a murine model of HCC which requires replicative virus at some stages that results in limitation of tumor cell proliferation and enhanced apoptosis mediated through the intrinsic caspase pathway. PMID:27626063

  1. Host protein Snapin interacts with human cytomegalovirus pUL130 and affects viral DNA replication.

    PubMed

    Wang, Guili; Ren, Gaowei; Cui, Xin; Lu, Zhitao; Ma, Yanpin; Qi, Ying; Huang, Yujing; Liu, Zhongyang; Sun, Zhengrong; Ruan, Qiang

    2016-06-01

    The interplay between the host and Human cytomegalovirus (HCMV) plays a pivotal role in the outcome of an infection. HCMV growth in endothelial and epithelial cells requires expression of viral proteins UL128, UL130, and UL131 proteins (UL128-131), of which UL130 is the largest gene and the only one that is not interrupted by introns.Mutation of the C terminus of the UL130 protein causes reduced tropism of endothelial cells (EC). However, very few host factors have been identified that interact with the UL130 protein. In this study, HCMV UL130 protein was shown to directly interact with the human protein Snapin in human embryonic kidney HEK293 cells by Yeast two-hybrid screening, in vitro glutathione S-transferase (GST) pull-down, and co-immunoprecipitation. Additionally, heterologous expression of protein UL130 revealed co-localization with Snapin in the cell membrane and cytoplasm of HEK293 cells using fluorescence confocal microscopy. Furthermore, decreasing the level of Snapin via specific small interfering RNAs decreased the number of viral DNA copies and titer inHCMV-infected U373-S cells. Taken together, these results suggest that Snapin, the pUL130 interacting protein, has a role in modulating HCMV DNA synthesis. PMID:27240978

  2. Immediate-early gene region of human cytomegalovirus trans-activates the promoter of human immunodeficiency virus

    SciTech Connect

    Davis, M.G.; Kenney, S.C.; Kamine, J.; Pagano, J.S.; Huang, E.S.

    1987-12-01

    Almost all homosexual patients with acquired immunodeficiency syndrome are also actively infected with human cytomegalovirus (HCMV). The authors have hypothesized that an interaction between HCMV and human immunodeficiency virus (HIV), the agent that causes acquired immunodeficiency syndrome, may exist at a molecular level and contribute to the manifestations of HIV infection. In this report, they demonstrate that the immediate-early gene region of HCMV, in particular immediate-early region 2, trans-activates the expression of the bacterial gene chloramphenicol acetyltransferase that is fused to the HIV long terminal repeat and carried by plasmid pHIV-CAT. The HCMV immediate-early trans-activator increases the level of mRNA from the plamid pHIV-CAT. The sequences of HIV that are responsive to trans-activation by the HDMV immediate-early region are distinct from HIV sequences that are required for response to the HIV tat. The stimulation of HIV gene expression by HDMV gene functions could enhance the consequences of HIV infection in persons with previous or concurrent HCMV infection.

  3. Genomic localization, sequence analysis, and transcription of the putative human cytomegalovirus DNA polymerase gene

    SciTech Connect

    Heilbronn, T.; Jahn, G.; Buerkle, A.; Freese, U.K.; Fleckenstein, B.; Zur Hausen, H.

    1987-01-01

    The human cytomegalovirus (HCMV)-induced DNA polymerase has been well characterized biochemically and functionally, but its genomic location has not yet been assigned. To identify the coding sequence, cross-hybridization with the herpes simplex virus type 1 (HSV-1) polymerase gene was used, as suggested by the close similarity of the herpes group virus-induced DNA polymerases to the HCMV DNA polymerase. A cosmid and plasmid library of the entire HCMV genome was screened with the BamHI Q fragment of HSF-1 at different stringency conditions. One PstI-HincII restriction fragment of 850 base pairs mapping within the EcoRI M fragment of HCMV cross-hybridized at T/sub m/ - 25/degrees/C. Sequence analysis revealed one open reading frame spanning the entire sequence. The amino acid sequence showed a highly conserved domain of 133 amino acids shared with the HSV and putative Esptein-Barr virus polymerase sequences. This domain maps within the C-terminal part of the HSV polymerase gene, which has been suggested to contain part of the catalytic center of the enzyme. Transcription analysis revealed one 5.4-kilobase early transcript in the sense orientation with respect to the open reading frame identified. This transcript appears to code for the 140-kilodalton HCMV polymerase protein.

  4. Interaction between the human cytomegalovirus‑encoded UL142 and cellular Snapin proteins.

    PubMed

    Liu, Chang; Qi, Ying; Ma, Yanping; He, Rong; Sun, Zhengrong; Huang, Yujing; Ji, Yaohua; Ruan, Qiang

    2015-02-01

    Human cytomegalovirus (HCMV) infection can cause severe illness in immunocompromised and immunodeficient individuals. As a novel HCMV‑encoded major histocompatibility complex class I‑related molecule, the UL142‑encoded protein (pUL142) is capable of suppressing natural killer (NK) cell recognition in the course of infection. However, no host factors that directly interact with HCMV pUL142 have been reported so far. In order to understand the interactions between HCMV pUL142 and host proteins, the current study used yeast two‑hybrid screening, a GST pull‑down assay and an immunofluorescence assay. A host protein, the SNARE‑associated protein Snapin, was identified to directly interact and colocalize with HCMV pUL142 in transfected human embryonic kidney‑293 cells. Snapin is abundantly expressed in the majority of cells and mediates the release of neurotransmitters through vesicular transport in the nervous system and vesicle fusion in non‑neuronal cells. It is hypothesized that HCMV pUL142 may have an impact on the neurotransmitter release process and viral dissemination via interaction with Snapin. PMID:25369979

  5. The human cytomegalovirus lytic cycle is induced by 1,25-dihydroxyvitamin D3 in peripheral blood monocytes and in the THP-1 monocytic cell line.

    PubMed

    Wu, Shu-En; Miller, William E

    2015-09-01

    Human cytomegalovirus (HCMV) resides in a latent form in hematopoietic progenitors and undifferentiated cells within the myeloid lineage. Maturation and differentiation along the myeloid lineage triggers lytic replication. Here, we used peripheral blood monocytes and the monocytic cell line THP-1 to investigate the effects of 1,25-dihydroxyvitamin D3 on HCMV replication. Interestingly, 1,25-dihydroxyvitamin D3 induces lytic replication marked by upregulation of HCMV gene expression and production of infectious virus. Moreover, we demonstrate that the effects of 1,25-dihydroxyvitamin D3 correlate with maturation/differentiation of the monocytes and not by directly stimulating the MIEP. These results are somewhat surprising as 1,25-dihydroxyvitamin D3 typically boosts immunity to bacteria and viruses rather than driving the infectious life cycle as it does for HCMV. Defining the signaling pathways kindled by 1,25-dihydroxyvitamin D3 will lead to a better understanding of the underlying molecular mechanisms that determine the fate of HCMV once it infects cells in the myeloid lineage. PMID:25965798

  6. Evaluating Human T-Cell Therapy of Cytomegalovirus Organ Disease in HLA-Transgenic Mice

    PubMed Central

    Thomas, Simone; Klobuch, Sebastian; Podlech, Jürgen; Plachter, Bodo; Hoffmann, Petra; Renzaho, Angelique; Theobald, Matthias

    2015-01-01

    Reactivation of human cytomegalovirus (HCMV) can cause severe disease in recipients of hematopoietic stem cell transplantation. Although preclinical research in murine models as well as clinical trials have provided 'proof of concept' for infection control by pre-emptive CD8 T-cell immunotherapy, there exists no predictive model to experimentally evaluate parameters that determine antiviral efficacy of human T cells in terms of virus control in functional organs, prevention of organ disease, and host survival benefit. We here introduce a novel mouse model for testing HCMV epitope-specific human T cells. The HCMV UL83/pp65-derived NLV-peptide was presented by transgenic HLA-A2.1 in the context of a lethal infection of NOD/SCID/IL-2rg-/- mice with a chimeric murine CMV, mCMV-NLV. Scenarios of HCMV-seropositive and -seronegative human T-cell donors were modeled by testing peptide-restimulated and T-cell receptor-transduced human T cells, respectively. Upon transfer, the T cells infiltrated host tissues in an epitope-specific manner, confining the infection to nodular inflammatory foci. This resulted in a significant reduction of viral load, diminished organ pathology, and prolonged survival. The model has thus proven its potential for a preclinical testing of the protective antiviral efficacy of HCMV epitope-specific human T cells in the evaluation of new approaches to an immunotherapy of CMV disease. PMID:26181057

  7. Tumor control by human cytomegalovirus in a murine model of hepatocellular carcinoma.

    PubMed

    Kumar, Amit; Coquard, Laurie; Pasquereau, Sébastien; Russo, Laetitia; Valmary-Degano, Séverine; Borg, Christophe; Pothier, Pierre; Herbein, Georges

    2016-01-01

    Although viruses can cause cancer, other studies reported the regression of human tumors upon viral infections. We investigated the cytoreductive potential of human cytomegalovirus (HCMV) in a murine model of human hepatocellular carcinoma (HCC) in severe-immunodeficient mice. Infection of HepG2 cells with HCMV resulted in the absence of tumor or in a limited tumor growth following injection of cells subcutaneously. By contrast all mice injected with uninfected HepG2 cells and with HepG2 cells infected with UV-treated HCMV did develop tumors without any significant restriction. Analysis of tumors indicated that in mice injected with HCMV-infected-HepG2 cells, but not in controls, a restricted cellular proliferation was observed parallel to a limited activation of the STAT3-cyclin D1 axis, decreased formation of colonies in soft agar, and activation of the intrinsic apoptotic pathway. We conclude that HCMV can provide antitumoral effects in a murine model of HCC which requires replicative virus at some stages that results in limitation of tumor cell proliferation and enhanced apoptosis mediated through the intrinsic caspase pathway. PMID:27626063

  8. Dynamics of the NK-cell subset redistribution induced by cytomegalovirus infection in preterm infants.

    PubMed

    Noyola, Daniel E; Alarcón, Ana; Noguera-Julian, Antoni; Muntasell, Aura; Muñoz-Almagro, Carmen; García, Jordi; Mur, Antonio; Fortuny, Claudia; López-Botet, Miguel

    2015-03-01

    Human cytomegalovirus (HCMV) infection promotes an expansion of NK-cells expressing the CD94/NKG2C receptor. We prospectively monitored the effects of HCMV on the NK-cell receptor (NKG2C, NKG2A, KIR, LILRB1) distribution in preterm infants. As compared to non-infected moderately preterm newborns (n=19, gestational age: 32-37 weeks), very preterm infants (n=5, gestational age: <32 weeks) suffering symptomatic postnatal HCMV infection displayed increased numbers of NKG2C+, KIR+ NK-cells, encompassed by a reduction of NKG2A+ NK-cells. A similar profile was observed in HCMV-negative newborns (n=4) with asymptomatic infection, during follow-up at ~4 and 10 months of age. Of note, viremia remained detectable in three symptomatic cases at ~10 months despite the persistent expansion of NKG2C+ NK-cells. Our study provides original insights on the dynamics of the imprint exerted by primary HCMV infection on the NK-cell compartment, revealing that the expansion of NKG2C+ NK-cells may be insufficient to control viral replication in very preterm infants. PMID:25636568

  9. In vitro antiviral efficacy of the ganciclovir complexed with beta-cyclodextrin on human cytomegalovirus clinical strains.

    PubMed

    Nicolazzi, Céline; Venard, Véronique; Le Faou, Alain; Finance, Chantal

    2002-05-01

    The toxicity of the compounds currently used in the treatment of human cytomegalovirus (HCMV) infections in immunocompromised hosts may force the treatment to be discontinued. The aim of this study was to improve the antiviral activity of ganciclovir (GCV), one the most widely used drug, by complexing it with beta-cyclodextrin. Cyclodextrins (cds) have the property to form inclusion complexes with a great number of molecules and to enhance bioavailability and biological properties of these molecules. In this study, we investigated the in vitro antiviral activity of complexed GCV against several strains of HCMV: AD169, a reference strain, RCL-1, a laboratory mutant resistant to GCV, and four clinical isolates. The complexed GCV was more effective than free GCV against all HCMV strains tested. Cds as carriers for antiviral drugs would represent a useful adjunct to classical treatment procedures. They may make it possible to administer lower doses, thus reducing the toxic side effects of the drugs. PMID:12062397

  10. Human Cytomegalovirus Glycoprotein gO Complexes with gH/gL, Promoting Interference with Viral Entry into Human Fibroblasts but Not Entry into Epithelial Cells▿

    PubMed Central

    Vanarsdall, Adam L.; Chase, Marie C.; Johnson, David C.

    2011-01-01

    A complex of five human cytomegalovirus virus (HCMV) proteins, gH, gL, UL128, UL130, and UL131 (gH/gL/UL128-131), is essential for virus entry into epithelial cells. We previously showed that gH/gL/UL128-131 expressed in epithelial cells interferes with subsequent HCMV entry into cells. There was no interference with only gH/gL or gB. We concluded that the expression of gH/gL/UL128-131 causes a mislocalization or downregulation of epithelial cell proteins that HCMV requires for entry. In contrast, gH/gL/UL128-131 expression in fibroblasts did not produce interference, suggesting a different mechanism for entry. Here, we show that the coexpression of another HCMV glycoprotein, gO, with gH/gL in human fibroblasts interferes with HCMV entry into fibroblasts but not epithelial cells. However, the coexpression of gO with gH/gL did not increase the cell surface expression level of gH/gL and did not enhance cell-cell fusion, a process that depends upon cell surface gH/gL. Instead, gO promoted the export of gH/gL from the endoplasmic reticulum (ER) and the accumulation of gH/gL in the trans-Golgi network. Thus, interference with gH/gL or gH/gL/gO, i.e., the mislocalization or blocking of entry mediators, occurs in cytoplasmic membranes and not in cell surface membranes of fibroblasts. Together, the results provide additional support for our hypotheses that epithelial cells express putative gH/gL/UL128-1331 receptors important for HCMV entry and that fibroblasts express distinct gH/gL receptors. PMID:21880752

  11. Influenza Vaccination Generates Cytokine-Induced Memory-like NK Cells: Impact of Human Cytomegalovirus Infection

    PubMed Central

    Goodier, Martin R.; Rodriguez-Galan, Ana; Lusa, Chiara; Nielsen, Carolyn M.; Darboe, Alansana; Moldoveanu, Ana L.; White, Matthew J.; Behrens, Ron

    2016-01-01

    Human NK cells are activated by cytokines, immune complexes, and signals transduced via activating ligands on other host cells. After vaccination, or during secondary infection, adaptive immune responses can enhance both cytokine-driven and Ab-dependent NK cell responses. However, induction of NK cells for enhanced function after in vitro exposure to innate inflammatory cytokines has also been reported and may synergize with adaptive signals to potentiate NK cell activity during infection or vaccination. To test this hypothesis, we examined the effect of seasonal influenza vaccination on NK cell function and phenotype in 52 previously unvaccinated individuals. Enhanced, IL-2–dependent, NK cell IFN-γ responses to Influenza A/California/7/2009 virus were detected up to 4 wk postvaccination and higher in human CMV (HCMV)-seronegative (HCMV−) individuals than in HCMV-seropositive (HCMV+) individuals. By comparison, robust NK cell degranulation responses were observed both before and after vaccination, due to high titers of naturally occurring anti-influenza Abs in human plasma, and did not differ between HCMV+ and HCMV− subjects. In addition to these IL-2–dependent and Ab-dependent responses, NK cell responses to innate cytokines were also enhanced after influenza vaccination; this was associated with proliferation of CD57− NK cells and was most evident in HCMV+ subjects. Similar enhancement of cytokine responsiveness was observed when NK cells were cocultured in vitro with Influenza A/California/7/2009 virus, and this was at least partially dependent upon IFN-αβR2. In summary, our data indicate that attenuated or live viral vaccines promote cytokine-induced memory-like NK cells and that this process is influenced by HCMV infection. PMID:27233958

  12. A Vaccine Based on the Rhesus Cytomegalovirus UL128 Complex Induces Broadly Neutralizing Antibodies in Rhesus Macaques

    PubMed Central

    Wussow, Felix; Yue, Yujuan; Martinez, Joy; Deere, Jesse D.; Longmate, Jeff; Herrmann, Andreas

    2013-01-01

    Neutralizing antibodies (NAb) are important for interfering with horizontal transmission of human cytomegalovirus (HCMV) leading to primary and congenital HCMV infection. Recent findings have shown that a pentameric virion complex formed by the glycoproteins gH/gL, UL128, UL130, and UL131A (UL128C) is required for HCMV entry into epithelial/endothelial cells (Epi/EC) and is the target of potent NAb in HCMV-seropositive individuals. Using bacterial artificial chromosome technology, we have generated a modified vaccinia Ankara virus (MVA) that stably coexpresses all 5 rhesus CMV (RhCMV) proteins homologous to HCMV UL128C, termed MVA-RhUL128C. Coimmunoprecipitation confirmed the interaction of RhgH with the other 4 RhCMV subunits of the pentameric complex. All 8 RhCMV-naïve rhesus macaques (RM) vaccinated with MVA-RhUL128C developed NAb that blocked infection of monkey kidney epithelial cells (MKE) and rhesus fibroblasts. NAb titers induced by MVA-RhUL128C measured on both cell types at 2 to 6 weeks postvaccination were comparable to levels observed in naturally infected RM. In contrast, MVA expressing a subset of RhUL128C proteins or RhgB glycoprotein only minimally stimulated NAb that inhibited infection of MKE. In addition, following subcutaneous RhCMV challenge at 8 weeks postvaccination, animals vaccinated with MVA-RhUL128C showed reduced plasma viral loads. These results indicate that MVA expressing the RhUL128C induces NAb inhibiting RhCMV entry into both Epi/EC and fibroblasts and limits RhCMV replication in RM. This novel approach is the first step in developing a prophylactic HCMV vaccine designed to interfere with virus entry into major cell types permissive for viral replication, a required property of an effective vaccine. PMID:23152525

  13. PPARγ Is Activated during Congenital Cytomegalovirus Infection and Inhibits Neuronogenesis from Human Neural Stem Cells

    PubMed Central

    Rolland, Maude; Li, Xiaojun; Perez-Berezo, Teresa; Rauwel, Benjamin; Benchoua, Alexandra; Bessières, Bettina; Aziza, Jacqueline; Cenac, Nicolas; Luo, Minhua; Casper, Charlotte; Peschanski, Marc; Gonzalez-Dunia, Daniel; Leruez-Ville, Marianne; Davrinche, Christian; Chavanas, Stéphane

    2016-01-01

    Congenital infection by human cytomegalovirus (HCMV) is a leading cause of permanent sequelae of the central nervous system, including sensorineural deafness, cerebral palsies or devastating neurodevelopmental abnormalities (0.1% of all births). To gain insight on the impact of HCMV on neuronal development, we used both neural stem cells from human embryonic stem cells (NSC) and brain sections from infected fetuses and investigated the outcomes of infection on Peroxisome Proliferator-Activated Receptor gamma (PPARγ), a transcription factor critical in the developing brain. We observed that HCMV infection dramatically impaired the rate of neuronogenesis and strongly increased PPARγ levels and activity. Consistent with these findings, levels of 9-hydroxyoctadecadienoic acid (9-HODE), a known PPARγ agonist, were significantly increased in infected NSCs. Likewise, exposure of uninfected NSCs to 9-HODE recapitulated the effect of infection on PPARγ activity. It also increased the rate of cells expressing the IE antigen in HCMV-infected NSCs. Further, we demonstrated that (1) pharmacological activation of ectopically expressed PPARγ was sufficient to induce impaired neuronogenesis of uninfected NSCs, (2) treatment of uninfected NSCs with 9-HODE impaired NSC differentiation and (3) treatment of HCMV-infected NSCs with the PPARγ inhibitor T0070907 restored a normal rate of differentiation. The role of PPARγ in the disease phenotype was strongly supported by the immunodetection of nuclear PPARγ in brain germinative zones of congenitally infected fetuses (N = 20), but not in control samples. Altogether, our findings reveal a key role for PPARγ in neurogenesis and in the pathophysiology of HCMV congenital infection. They also pave the way to the identification of PPARγ gene targets in the infected brain. PMID:27078877

  14. The Intracellular DNA Sensor IFI16 Gene Acts as Restriction Factor for Human Cytomegalovirus Replication

    PubMed Central

    Gariano, Grazia Rosaria; Dell'Oste, Valentina; Bronzini, Matteo; Gatti, Deborah; Luganini, Anna; De Andrea, Marco; Gribaudo, Giorgio; Gariglio, Marisa; Landolfo, Santo

    2012-01-01

    Human interferon (IFN)-inducible IFI16 protein, an innate immune sensor of intracellular DNA, modulates various cell functions, however, its role in regulating virus growth remains unresolved. Here, we adopt two approaches to investigate whether IFI16 exerts pro- and/or anti-viral actions. First, the IFI16 gene was silenced using specific small interfering RNAs (siRNA) in human embryo lung fibroblasts (HELF) and replication of DNA and RNA viruses evaluated. IFI16-knockdown resulted in enhanced replication of Herpesviruses, in particular, Human Cytomegalovirus (HCMV). Consistent with this, HELF transduction with a dominant negative form of IFI16 lacking the PYRIN domain (PYD) enhanced the replication of HCMV. Second, HCMV replication was compared between HELFs overexpressing either the IFI16 gene or the LacZ gene. IFI16 overexpression decreased both virus yield and viral DNA copy number. Early and late, but not immediate-early, mRNAs and proteins were strongly down-regulated, thus IFI16 may exert its antiviral effect by impairing viral DNA synthesis. Constructs with the luciferase reporter gene driven by deleted or site-specific mutated forms of the HCMV DNA polymerase (UL54) promoter demonstrated that the inverted repeat element 1 (IR-1), located between −54 and −43 relative to the transcription start site, is the target of IFI16 suppression. Indeed, electrophoretic mobility shift assays and chromatin immunoprecipitation demonstrated that suppression of the UL54 promoter is mediated by IFI16-induced blocking of Sp1-like factors. Consistent with these results, deletion of the putative Sp1 responsive element from the HCMV UL44 promoter also relieved IFI16 suppression. Together, these data implicate IFI16 as a novel restriction factor against HCMV replication and provide new insight into the physiological functions of the IFN-inducible gene IFI16 as a viral restriction factor. PMID:22291595

  15. Development and optimization of a sensitive TaqMan® real-time PCR with synthetic homologous extrinsic control for quantitation of Human cytomegalovirus viral load.

    PubMed

    Slavov, Svetoslav Nanev; Otaguiri, Katia Kaori; de Figueiredo, Glauciane Garcia; Yamamoto, Aparecida Yulie; Mussi-Pinhata, Marisa Marcia; Kashima, Simone; Covas, Dimas Tadeu

    2016-09-01

    Human cytomegalovirus (Human herpesvirus 5, HCMV) causes frequent asymptomatic infections in the general population. However, in immunosuppressed patients or congenitally infected infants, HCMV is related to high morbidity and mortality. In such cases, a rapid viral detection is crucial for monitoring the clinical outcome and the antiviral treatment. In this study, we optimized a sensitive biplex TaqMan® real-time PCR for the simultaneous detection and differentiation of a partial HCMV UL97 sequence and homologous extrinsic control (HEC) in the same tube. HEC was represented by a plasmid containing a modified HCMV sequence retaining the original primer binding sites, while the probe sequence was substituted by a phylogenetically divergent one (chloroplast CF0 subunit plant gene). It was estimated that the optimal HEC concentration, which did not influence the HCMV amplification is 1,000 copies/reaction. The optimized TaqMan® PCR demonstrated high analytical sensitivity (6.97 copies/reaction, CI = 95%) and specificity (100%). Moreover, the reaction showed adequate precision (repeatability, CV = 0.03; reproducibility, CV = 0.0027) and robustness (no carry-over or cross-contamination). The diagnostic sensitivity (100%) and specificity (97.8%) were adequate for the clinical application of the molecular platform. The optimized TaqMan® real-time PCR is suitable for HCMV detection and quantitation in predisposed patients and monitoring of the applied antiviral therapy. J. Med. Virol. 88:1604-1612, 2016. © 2016 Wiley Periodicals, Inc. PMID:26890091

  16. Structure of the mouse calcitonin/calcitonin gene-related peptide alpha and beta genes.

    PubMed

    Thomas, P M; Nasonkin, I; Zhang, H; Gagel, R F; Cote, G J

    2001-01-01

    We report the cloning, genomic organization and sequence of the mouse alpha-CALC and beta-CALC genes. The two genes share extensive sequence homology. The transcription units of both genes contain 6 exons. Transcripts of the alpha-CALC gene were found to alternatively include exon 4 or exons 5 and 6. For the beta-CALC gene exon 4 was not detected in transcripts derived from this gene. The predicted mouse alpha-CGRP was found to be identical to rat alpha-CGRP, however, beta-CGRP predicted amino acid sequences revealed three amino acid differences suggesting these residues are not critical to CGRP function. PMID:11761712

  17. Human Cytomegalovirus Strategies to Maintain and Promote mRNA Translation

    PubMed Central

    Vincent, Heather A.; Ziehr, Benjamin; Moorman, Nathaniel J.

    2016-01-01

    mRNA translation requires the ordered assembly of translation initiation factors and ribosomal subunits on a transcript. Host signaling pathways regulate each step in this process to match levels of protein synthesis to environmental cues. In response to infection, cells activate multiple defenses that limit viral protein synthesis, which viruses must counteract to successfully replicate. Human cytomegalovirus (HCMV) inhibits host defenses that limit viral protein expression and manipulates host signaling pathways to promote the expression of both host and viral proteins necessary for virus replication. Here we review key regulatory steps in mRNA translation, and the strategies used by HCMV to maintain protein synthesis in infected cells. PMID:27089357

  18. Human cytomegalovirus and Epstein-Barr virus infection in inflammatory bowel disease: Need for mucosal viral load measurement

    PubMed Central

    Ciccocioppo, Rachele; Racca, Francesca; Paolucci, Stefania; Campanini, Giulia; Pozzi, Lodovica; Betti, Elena; Riboni, Roberta; Vanoli, Alessandro; Baldanti, Fausto; Corazza, Gino Roberto

    2015-01-01

    AIM: To evaluate the best diagnostic technique and risk factors of the human Cytomegalovirus (HCMV) and Epstein-Barr virus (EBV) infection in inflammatory bowel disease (IBD). METHODS: A cohort of 40 IBD patients (17 refractory) and 40 controls underwent peripheral blood and endoscopic colonic mucosal sample harvest. Viral infection was assessed by quantitative real-time polymerase chain reaction and immunohistochemistry, and correlations with clinical and endoscopic indexes of activity, and risk factors were investigated. RESULTS: All refractory patients carried detectable levels of HCMV and/or EBV mucosal load as compared to 13/23 (56.5%) non-refractory and 13/40 (32.5%) controls. The median DNA value was significantly higher in refractory (HCMV 286 and EBV 5.440 copies/105 cells) than in non-refractory (HCMV 0 and EBV 6 copies/105 cells; P < 0.05 and < 0.001) IBD patients and controls (HCMV and EBV 0 copies/105 cells; P < 0.001 for both). Refractory patients showed DNA peak values ≥ 103 copies/105 cells in diseased mucosa in comparison to non-diseased mucosa (P < 0.0121 for HCMV and < 0.0004 for EBV), while non-refractory patients and controls invariably displayed levels below this threshold, thus allowing us to differentiate viral colitis from mucosal infection. Moreover, the mucosal load positively correlated with the values found in the peripheral blood, whilst no correlation with the number of positive cells at immunohistochemistry was found. Steroid use was identified as a significant risk factor for both HCMV (P = 0.018) and EBV (P = 0.002) colitis. Finally, a course of specific antiviral therapy with ganciclovir was successful in all refractory patients with HCMV colitis, whilst refractory patients with EBV colitis did not show any improvement despite steroid tapering and discontinuation of the other medications. CONCLUSION: Viral colitis appeared to contribute to mucosal lesions in refractory IBD, and its correct diagnosis and management require

  19. Molecular evolution of coding and non-coding sequences of the growth hormone receptor (GHR) gene in the family Bovidae.

    PubMed

    Maj, Andrzej; Zwierzchowski, Lech

    2006-01-01

    The GHR gene exon 1A and exon 4 with fragments of its flanking introns were sequenced in twelve Bovidae species and the obtained sequences were aligned and analysed by the ClustalW method. In coding exon 4 only three interspecies differences were found, one of which had an effect on the amino-acid sequence--leucine 152 proline. The average mutation frequency in non-coding exon 1A was 10.5 per 100 bp, and was 4.6-fold higher than that in coding exon 4 (2.3 per 100 bp). The mutation frequency in intron sequences was similar to that in non-coding exon 1A (8.9 vs 10.5/100 bp). For non-coding exon 1A, the mutation levels were lower within than between the subfamilies Bovinae and Caprinae. Exon 4 was 100% identical within the genera Ovis, Capra, Bison, and Bos and 97.7% identical for Ovis moschatus, Ammotragus lervia and Bovinae species. The identity level of non-coding exon 1A of the GHR gene was 93.8% between species belonging to Bovinae and Caprinae. The average mutation rate was 0.2222/100 bp/MY and 0.0513/100 bp/MY for the Bovidae GHR gene exons 1A and 4, respectively. Thus, the GHR gene is well conserved in the Bovidae family. Also, in this study some novel intraspecies polymorphisms were found for cattle and sheep. PMID:17044257

  20. IL-10 Gene Polymorphisms and Their Association with Immune Traits in Four Rabbit Populations

    PubMed Central

    WAN, Xiaoying; MAO, Liuliu; LI, Ting; QIN, Lizhi; PAN, Yulai; LI, Bichun; WU, Xinsheng

    2013-01-01

    ABSTRACT Interleukin-10 (IL-10) has been recently identified as a multifunctional cytokine, because of its close link with immunoregulation and anti-inflammatory responses. This study investigated the association of IL-10 genetic polymorphisms with the immune traits of New Zealand white rabbits (N-W), Fujian yellow rabbits (F-Y) and their reciprocal crosses (N-Y and Y-N, respectively). SNPs on five exons of the IL-10 gene were genotyped in 204 healthy rabbits via PCR-SSCP and DNA sequencing. Two SNPs (A1435G and G1519A, both were synonymous mutations) and six genotypes (AA, BB, CC, AB, AC and BC) were found on exon 3 and one SNP (T base insertion between loci 2532 and 2533, which caused a frameshift mutation), and three genotypes (OO, TT and TO) were present on exon 4. Allele A was the most frequent allele on exon 3 (from 0.548 to 0.771), whereas O was the most frequent on exon 4 (from 0.808 to 0.968). These four populations were all in Hardy-Weinberg equilibrium on both exon3 and exon4. Association analysis between polymorphisms and immune parameters showed that SNPs on exon 3 were significantly associated with immune traits, while SNP on exon 4 may not significantly affect immune traits, but the mechanism is yet to be further studied. PMID:24240540

  1. Study of the correlation between GH gene polymorphism and growth traits in sheep.

    PubMed

    Jia, J L; Zhang, L P; Wu, J P; Ha, Z J; Li, W W

    2014-01-01

    The growth hormone gene plays an important role in the physiological function of an organism. The current study aimed to investigate the correlation between polymorphisms in the 5' regulatory region, exon 4, and 3' untranslated region (UTR) of the sheep GH gene and sheep growth traits. The DNA from 510 adult sheep was analyzed by DNA sequencing and polymerase chain reaction single-strand conformation polymorphism. Two alleles (A and B) and 3 genotypes (AA, AB, and BB), 2 alleles (A and B) and 3 genotypes (AA, AB, and BB), and 3 alleles (A, B, and C) and 4 genotypes (AA, AB, BB, and AC) were found within the 5' regulatory region, exon 4, and 3' UTR, respectively. In Tibetan sheep, the association analysis indicated that there were statistically significant differences in the scores of weight, length, and heart girth within the 5' regulatory region; weight, length, wither height, and heart girth within exon 4; and weight, length, wither height, and heart girth within the 3' UTR among the different genotypes. For exon 4, Poll Dorset sheep individuals with genotype AA showed a lower score than those of genotypes BB and AB (P<0.05). With regard to the 3' UTR, Poll Dorset sheep with genotype AC showed higher scores than those of genotypes AA and AB (P<0.05). PMID:25222225

  2. Activity of trifluorothymidine against cytomegalovirus.

    PubMed Central

    Wingard, J R; Stuart, R K; Saral, R; Burns, W H

    1981-01-01

    Trifluorothymidine (TFT) was tested for antiviral activity against mouse cytomegalovirus (MCMV) and human cytomegalovirus (HCMV) in one-step replication assays. The TFT concentration required to reduce virus yield by 50% (ID50) was 0.22 microM for MCMV and 0.012 microM for HCMV. The antiviral activity of TFT against MCMV was reversed by addition of equimolar thymidine, and no antiviral activity was demonstrable in a host cell line lacking thymidine kinase. Thus, TFT's anti-MCMV activity is dependent on a host cell TK since this herpesvirus lacks thymidine kinase. A continuous subcutaneous infusion of TFT achieving a serum concentration of 1 microM failed to protect mice from lethal MCMV infection, perhaps because serum levels of thymidine were comparable to the drug level. Comparison of the ID50 against HCMV and the ID50 against human bone marrow progenitor cells resulted in an in vitro therapeutic ratio of 108, suggesting that TFT might offer some promise as a clinically useful anti-HCMV agent. PMID:6272627

  3. Poly(A) binding protein abundance regulates eukaryotic translation initiation factor 4F assembly in human cytomegalovirus-infected cells.

    PubMed

    McKinney, Caleb; Perez, Cesar; Mohr, Ian

    2012-04-10

    By commandeering cellular translation initiation factors, or destroying those dispensable for viral mRNA translation, viruses often suppress host protein synthesis. In contrast, cellular protein synthesis proceeds in human cytomegalovirus (HCMV)-infected cells, forcing viral and cellular mRNAs to compete for limiting translation initiation factors. Curiously, inactivating the host translational repressor 4E-BP1 in HCMV-infected cells stimulates synthesis of the cellular poly(A) binding protein (PABP), significantly increasing PABP abundance. Here, we establish that new PABP synthesis is translationally controlled by the HCMV-encoded UL38 mammalian target of rapamycin complex 1-activator. The 5' UTR within the mRNA encoding PABP contains a terminal oligopyrimidine (TOP) element found in mRNAs, the translation of which is stimulated in response to mitogenic, growth, and nutritional stimuli, and proteins encoded by TOP-containing mRNAs accumulated in HCMV-infected cells. Furthermore, UL38 expression was necessary and sufficient to regulate expression of a PABP TOP-containing reporter. Remarkably, preventing the rise in PABP abundance by RNAi impaired eIF4E binding to eIF4G, thereby reducing assembly of the multisubunit initiation factor eIF4F, viral protein production, and replication. This finding demonstrates that viruses can increase host translation initiation factor concentration to foster their replication and defines a unique mechanism whereby control of PABP abundance regulates eIF4F assembly. PMID:22431630

  4. Assessment of the Human Cytomegalovirus UL97 Gene for Identification of Resistance to Ganciclovir in Iranian Immunosuppressed Patients

    PubMed Central

    Keyvani, Hossein; Taghinezhad Saroukalaei, Sedigheh; Mohseni, Amir Hossein

    2016-01-01

    Background Human cytomegalovirus (HCMV) infections are a major cause of morbidity and mortality among immunocompromised patients. Prolonged antiviral therapy is a cause of mutation and drug resistance in the HCMV genome. Objectives The aim of this study was to identify resistance to ganciclovir (GCV) in Iranian immunosuppressed patients at two different stages of the disease: early (before GCV is initiated) and late (after six months of GCV therapy). Patients and Methods In this study, 87 specimens from Iranian patients were amplified using nested PCR amplification of the UL97 gene. Sequence analyses of products were performed for identifying the mutated codons. Results The present study show that the most frequent GCV-resistant mutations occurred in codons A594V (26.43%), H520Q (18.39%), and M460V (13.79%), consequently occurring at a low frequency in the L595S (2.29%), E596G (1.14%), and Del 594 (1.14%) codons, and with intermediate frequency in the C592G (10.34%), M460I (9.19%), and C603W (6.89%) codons. We describe for the first time a new GCV-resistance mutation, the deletion of codon 594, in the UL97 gene of Iranian HCMV patients after GCV therapy, following renal transplantation. Conclusions The findings of the present study can be utilized to detect GCV resistance patterns among Iranian immunocompromised patients and to treat HCMV infections accordingly. PMID:27540455

  5. Visualization of the dynamic multimerization of human Cytomegalovirus pp65 in punctuate nuclear foci

    SciTech Connect

    Cui Zongqiang; Zhang Ke; Zhang Zhiping; Liu Yalan; Zhou Yafeng; Wei Hongping; Zhang Xian-En

    2009-09-30

    The phosphorylated protein pp65 of human Cytomegalovirus (HCMV) is the predominant virion protein and the major tegument constituent. It plays important roles in HCMV infection and virion assembly. Live cell imaging and fluorescence recovery after photobleaching (FRAP) analysis showed that HCMV pp65 accumulated dynamically in punctuate nuclear foci when transiently expressed in mammalian cells. Fluorescence resonance energy transfer (FRET) imaging disclosed that pp65 can self-interact in its localization foci. Yeast two-hybrid assay verified that pp65 is a self-associating protein, and the N-terminal amino acids 14-22 were determined to be essential for pp65 self-association. However, these amino acids were not related to pp65 localization in the specific nuclear foci. The interaction of pp65 and ppUL97 was also studied by FRET microscopy, and the result suggested that there is another signal sequence in pp65, being the ppUL97 phosphorylation site, that is responsible for localization of pp65 in nuclear foci. These results help to understand the function of pp65 in HCMV infection and virion morphogenesis.

  6. Human Cytomegalovirus Secretome Contains Factors That Induce Angiogenesis and Wound Healing

    SciTech Connect

    Dumortier, Jerome; Streblow, Daniel N.; Moses, Ashlee V.; Jacobs, Jon M.; Kreklywich, Craig N.; Camp, David G.; Smith, Richard D.; Orloff, Susan L.; Nelson, Jay

    2008-07-01

    Human cytomegalovirus (HCMV) is implicated in the acceleration of a number of vascular diseases including transplant vascular sclerosis (TVS), the lesion associated with chronic rejection (CR) of solid organ transplants. Although the virus persists in the allograft throughout the course of disease, few cells are directly infected by CMV. This observation is in contrast to the global effects that CMV has on the acceleration of TVS/CR, suggesting that CMV infection indirectly promotes the vascular disease process. Recent transcriptome analysis of CMV-infected heart allografts indicates that the virus induces cytokines and growth factors associated with angiogenesis (AG) and wound healing (WH), suggesting that CMV may accelerate TVS/CR through the induction and secretion of AG/WH factors from infected cells. We analyzed virus-free supernatants from HCMV-infected cells (HCMV secretomes) for growth factors, by mass spectrometry and immunoassays, and found that the HCMV secretome contains over 1,000 cellular proteins, many of which are involved in AG/WH. Importantly, functional assays demonstrated that CMV but not herpes simplex virus secretomes not only induce AG/WH but also promote neovessel stabilization and endothelial cell survival for 2 weeks. These findings suggest that CMV acceleration of TVS occurs through virus-induced growth factors and cytokines in the CMV secretome.

  7. New Cytotoxic Cembranolides from the Soft Coral Lobophytum michaelae

    PubMed Central

    Wang, Shang-Kwei; Duh, Chang-Yih

    2012-01-01

    Six new cembranolides, michaolides L–Q (1–6), and a known cembranolide, lobomichaolide (7) were isolated from the CH2Cl2 extract of the soft coral Lobophytum michaelae. Their structures were established by extensive spectral analysis. The anti-HCMV (human cytomegalovirus) activity of 1–7 and their cytotoxicity against selected cell lines were evaluated. PMID:22412802

  8. Paralemnolide A, an Unprecedented Bisnorsesquiterpene from the Taiwanese Soft Coral Paralemnalia thyrsoides

    PubMed Central

    Wang, Shang-Kwei; Lee, Yu-Sheng; Duh, Chang-Yih

    2012-01-01

    Paralemnolide A (1), possessing an unprecedented bisnorsesquiterpene skeleton, was isolated from the soft coral Paralemnalia thyrsoides. The structure of paralemnolide A was elucidated by extensive analysis of spectroscopic data. The anti-HCMV (human cytomegalovirus) activity of 1 and its cytotoxicity against selected cell lines were evaluated. PMID:22851923

  9. RNase P Ribozymes Inhibit the Replication of Human Cytomegalovirus by Targeting Essential Viral Capsid Proteins

    PubMed Central

    Yang, Zhu; Reeves, Michael; Ye, Jun; Trang, Phong; Zhu, Li; Sheng, Jingxue; Wang, Yu; Zen, Ke; Wu, Jianguo; Liu, Fenyong

    2015-01-01

    An engineered RNase P-based ribozyme variant, which was generated using the in vitro selection procedure, was used to target the overlapping mRNA region of two proteins essential for human cytomegalovirus (HCMV) replication: capsid assembly protein (AP) and protease (PR). In vitro studies showed that the generated variant, V718-A, cleaved the target AP mRNA sequence efficiently and its activity was about 60-fold higher than that of wild type ribozyme M1-A. Furthermore, we observed a reduction of 98%–99% in AP/PR expression and an inhibition of 50,000 fold in viral growth in cells with V718-A, while a 75% reduction in AP/PR expression and a 500-fold inhibition in viral growth was found in cells with M1-A. Examination of the antiviral effects of the generated ribozyme on the HCMV replication cycle suggested that viral DNA encapsidation was inhibited and as a consequence, viral capsid assembly was blocked when the expression of AP and PR was inhibited by the ribozyme. Thus, our study indicates that the generated ribozyme variant is highly effective in inhibiting HCMV gene expression and blocking viral replication, and suggests that engineered RNase P ribozyme can be potentially developed as a promising gene-targeting agent for anti-HCMV therapy. PMID:26114473

  10. Negative and positive regulation by a short segment in the 5'-flanking region of the human cytomegalovirus major immediate-early gene

    SciTech Connect

    Nelson, J.A.; Reynolds-Kohler, C.; Smith, B.A.

    1987-11-01

    To analyze the significance of inducible DNase I-hypersensitive sites occurring in the 5'-flanking sequence of the major immediate-early gene of human cytomegalovirus (HCMV), various deleted portions of the HCMV immediate-early promoter regulatory region were attached to the chloramphenicol acetyltransferase (CAT) gene and assayed for activity in transiently transfected undifferentiated and differentiated human teratocarcinoma cells, Tera-2. Assays of progressive deletions in the promoter regulatory region indicated that removal of a 395-base-pair portion of this element (nucleotides -750 to -1145) containing two inducible DNase I sites which correlate with gene expression resulted in a 7.5-fold increase in CAT activity in undifferentiated cells. However, in permissive differentiated Tera-2, human foreskin fibroblast, and HeLa cells, removal of this regulatory region resulted in decreased activity. In addition, attachment of this HCMV upstream element to a homologous or heterologous promoter increased activity three-to fivefold in permissive cells. Therefore, a cis regulatory element exists 5' to the enhancer of the major immediate-early gene of HCMV. This element negatively modulates expression in nonpermissive cells but positively influences expression in permissive cells.

  11. Human Cytomegalovirus DNA Quantification and Gene Expression in Gliomas of Different Grades

    PubMed Central

    Medeiros, Raphael Salles Scortegagna; Guerra, Juliana Mariotti; Kimura, Lidia Midori; Shirata, Neuza Kazumi; Nonogaki, Suely; dos Santos, Claudia Januário; Carlan Silva, Maria Cristina

    2016-01-01

    Gliomas are the most common type of primary brain tumors. The most aggressive type, Glioblastoma multiforme (GBM), is one of the deadliest human diseases, with an average survival at diagnosis of about 1 year. Previous evidence suggests a link between human cytomegalovirus (HCMV) and gliomas. HCMV has been shown to be present in these tumors and several viral proteins can have oncogenic properties in glioma cells. Here we have investigated the presence of HCMV DNA, RNA and proteins in fifty-two gliomas of different grades of malignancy. The UL83 viral region, the early beta 2.7 RNA and viral protein were detected in 73%, 36% and 57% by qPCR, ISH and IHC, respectively. Positivity of the viral targets and viral load was independent of tumor type or grade suggesting no correlation between viral presence and tumor progression. Our results demonstrate high prevalence of the virus in gliomas from Brazilian patients, contributing to a better understanding of the association between HCMV infection and gliomas worldwide and supporting further investigations of the virus oncomodulatory properties. PMID:27458810

  12. Inhibition of viral proteases by Zingiberaceae extracts and flavones isolated from Kaempferia parviflora.

    PubMed

    Sookkongwaree, K; Geitmann, M; Roengsumran, S; Petsom, A; Danielson, U H

    2006-08-01

    In order to identify novel lead compounds with antiviral effect, methanol and aqueous extracts of eight medicinal plants in the Zingiberaceae family were screened for inhibition of proteases from human immunodeficiency virus type 1 (HIV-1), hepatitis C virus (HCV) and human cytomegalovirus (HCMV). In general, the methanol extracts inhibited the enzymes more effectively than the aqueous extracts. HIV-1 protease was strongly inhibited by the methanol extract of Alpinia galanga. This extract also inhibited HCV and HCMV proteases, but to a lower degree. HCV protease was most efficiently inhibited by the extracts from Zingiber officinale, with little difference between the aqueous and the methanol extracts. Many of the methanol extracts inhibited HCMV protease, but the aqueous extracts showed weak inhibition. In a first endeavor to identify the active constituents, eight flavones were isolated from the black rhizomes of Kaempferia parviflora. The most effective inhibitors, 5-hydroxy-7-methoxyflavone and 5,7-dimethoxyflavone, inhibited HIV-1 protease with IC50 values of 19 microM. Moreover, 5-hydroxy-3,7-dimethoxyflavone inhibited HCV protease and HCMV protease with IC50 values of 190 and 250 microM, respectively. PMID:16964717

  13. Mutations in human cytomegalovirus UL97 gene confer clinical resistance to ganciclovir and can be detected directly in patient plasma.

    PubMed Central

    Wolf, D G; Smith, I L; Lee, D J; Freeman, W R; Flores-Aguilar, M; Spector, S A

    1995-01-01

    Specific mutations in the UL97 region of human cytomegalovirus (HCMV) have been found to confer resistance to laboratory-adapted strains subjected to ganciclovir selection. In this study, mutations in the UL97 region of HCMV isolates obtained from patients receiving ganciclovir therapy were examined to determine whether they would confer ganciclovir resistance, and if these mutations could be detected directly in the plasma of AIDS patients with progressive HCMV disease despite ganciclovir treatment. A single nucleotide change within a conserved region of UL97 was found in five resistant isolates, resulting in an amino acid substitution in residue 595: from leucine to phenylalanine in one, and from leucine to serine in four resistant isolates. A sixth resistant isolate demonstrated a single nucleotide change, leading to a threonine to isoleucine substitution in residue 659. The role of the 595 amino acid substitution in conferring ganciclovir resistance was confirmed by marker transfer experiments. In further studies, direct sequencing of HCMV DNA present in plasma obtained from persons with resistant viruses revealed the identical amino acid substitutions in plasma as those present in the cultured viruses. These findings indicate that clinical resistance to ganciclovir can result from specific point mutations in the UL97 gene, and that the emergence of the resistant genotype can be detected directly in patient plasma. Images PMID:7814623

  14. Quantitative Temporal Viromics: An Approach to Investigate Host-Pathogen Interaction

    PubMed Central

    Weekes, Michael P.; Tomasec, Peter; Huttlin, Edward L.; Fielding, Ceri A.; Nusinow, David; Stanton, Richard J.; Wang, Eddie C.Y.; Aicheler, Rebecca; Murrell, Isa; Wilkinson, Gavin W.G.; Lehner, Paul J.; Gygi, Steven P.

    2014-01-01

    Summary A systematic quantitative analysis of temporal changes in host and viral proteins throughout the course of a productive infection could provide dynamic insights into virus-host interaction. We developed a proteomic technique called “quantitative temporal viromics” (QTV), which employs multiplexed tandem-mass-tag-based mass spectrometry. Human cytomegalovirus (HCMV) is not only an important pathogen but a paradigm of viral immune evasion. QTV detailed how HCMV orchestrates the expression of >8,000 cellular proteins, including 1,200 cell-surface proteins to manipulate signaling pathways and counterintrinsic, innate, and adaptive immune defenses. QTV predicted natural killer and T cell ligands, as well as 29 viral proteins present at the cell surface, potential therapeutic targets. Temporal profiles of >80% of HCMV canonical genes and 14 noncanonical HCMV open reading frames were defined. QTV is a powerful method that can yield important insights into viral infection and is applicable to any virus with a robust in vitro model. PaperClip PMID:24906157

  15. 5-Bromo (or chloro)-6-azido-5,6-dihydro-2' -deoxyuridine and -thymidine derivatives with potent antiviral activity.

    PubMed

    Kumar, Rakesh

    2002-02-11

    Synthesis, antiviral, and cytotoxic activities of 5-bromo (or chloro)-6-azido-5,6-dihydro-2' -deoxyuridine (4,5) and -thymidine (6,7) are reported. Compounds 4 and 5 exhibited a broad spectrum of antiherpes activity against (HSV-1, HSV-2, HCMV, and VZV). PMID:11814776

  16. Inhibition of IKKα by BAY61-3606 Reveals IKKα-Dependent Histone H3 Phosphorylation in Human Cytomegalovirus Infected Cells

    PubMed Central

    Ho, Catherine M. K.; Donovan-Banfield, I’ah Z.; Tan, Li; Zhang, Tinghu; Gray, Nathanael S.; Strang, Blair L.

    2016-01-01

    Protein kinase inhibitors can be used as tools to identify proteins and pathways required for virus replication. Using virus replication assays and western blotting we found that the widely used protein kinase inhibitor BAY61-3606 inhibits replication of human cytomegalovirus (HCMV) strain AD169 and the accumulation of HCMV immediate-early proteins in AD169 infected cells, but has no effect on replication of HCMV strain Merlin. Using in vitro kinase assays we found that BAY61-3606 is a potent inhibitor of the cellular kinase IKKα. Infection of cells treated with siRNA targeting IKKα indicated IKKα was required for efficient AD169 replication and immediate-early protein production. We hypothesized that IKKα was required for AD169 immediate-early protein production as part of the canonical NF-κB signaling pathway. However, although BAY61-3606 inhibited phosphorylation of the IKKα substrate IκBα, we found no canonical or non-canonical NF-κB signaling in AD169 infected cells. Rather, we observed that treatment of cells with BAY61-3606 or siRNA targeting IKKα decreased phosphorylation of histone H3 at serine 10 (H3S10p) in western blotting assays. Furthermore, we found treatment of cells with BAY61-3606, but not siRNA targeting IKKα, inhibited the accumulation of histone H3 acetylation (H3K9ac, H3K18ac and H3K27ac) and tri-methylation (H3K27me3 and H3K36me3) modifications. Therefore, the requirement for IKKα in HCMV replication was strain-dependent and during replication of an HCMV strain requiring IKKα, IKKα-dependent H3S10 phosphorylation was associated with efficient HCMV replication and immediate-early protein production. Plus, inhibition of HCMV replication by BAY61-3606 is associated with acetylation and tri-methylation modifications of histone H3 that do not involve IKKα. PMID:26930276

  17. Inhibition of IKKα by BAY61-3606 Reveals IKKα-Dependent Histone H3 Phosphorylation in Human Cytomegalovirus Infected Cells.

    PubMed

    Ho, Catherine M K; Donovan-Banfield, I'ah Z; Tan, Li; Zhang, Tinghu; Gray, Nathanael S; Strang, Blair L

    2016-01-01

    Protein kinase inhibitors can be used as tools to identify proteins and pathways required for virus replication. Using virus replication assays and western blotting we found that the widely used protein kinase inhibitor BAY61-3606 inhibits replication of human cytomegalovirus (HCMV) strain AD169 and the accumulation of HCMV immediate-early proteins in AD169 infected cells, but has no effect on replication of HCMV strain Merlin. Using in vitro kinase assays we found that BAY61-3606 is a potent inhibitor of the cellular kinase IKKα. Infection of cells treated with siRNA targeting IKKα indicated IKKα was required for efficient AD169 replication and immediate-early protein production. We hypothesized that IKKα was required for AD169 immediate-early protein production as part of the canonical NF-κB signaling pathway. However, although BAY61-3606 inhibited phosphorylation of the IKKα substrate IκBα, we found no canonical or non-canonical NF-κB signaling in AD169 infected cells. Rather, we observed that treatment of cells with BAY61-3606 or siRNA targeting IKKα decreased phosphorylation of histone H3 at serine 10 (H3S10p) in western blotting assays. Furthermore, we found treatment of cells with BAY61-3606, but not siRNA targeting IKKα, inhibited the accumulation of histone H3 acetylation (H3K9ac, H3K18ac and H3K27ac) and tri-methylation (H3K27me3 and H3K36me3) modifications. Therefore, the requirement for IKKα in HCMV replication was strain-dependent and during replication of an HCMV strain requiring IKKα, IKKα-dependent H3S10 phosphorylation was associated with efficient HCMV replication and immediate-early protein production. Plus, inhibition of HCMV replication by BAY61-3606 is associated with acetylation and tri-methylation modifications of histone H3 that do not involve IKKα. PMID:26930276

  18. Human cytomegalovirus resistance to deoxyribosylindole nucleosides maps to a transversion mutation in the terminase subunit-encoding gene UL89.

    PubMed

    Gentry, Brian G; Phan, Quang; Hall, Ellie D; Breitenbach, Julie M; Borysko, Katherine Z; Kamil, Jeremy P; Townsend, Leroy B; Drach, John C

    2015-01-01

    Human cytomegalovirus (HCMV) infection can cause severe illnesses, including encephalopathy and mental retardation, in immunocompromised and immunologically immature patients. Current pharmacotherapies for treating systemic HCMV infections include ganciclovir, cidofovir, and foscarnet. However, long-term administration of these agents can result in serious adverse effects (myelosuppression and/or nephrotoxicity) and the development of viral strains with reduced susceptibility to drugs. The deoxyribosylindole (indole) nucleosides demonstrate a 20-fold greater activity in vitro (the drug concentration at which 50% of the number of plaques was reduced with the presence of drug compared to the number in the absence of drug [EC50] = 0.34 μM) than ganciclovir (EC50 = 7.4 μM) without any observed increase in cytotoxicity. Based on structural similarity to the benzimidazole nucleosides, we hypothesize that the indole nucleosides target the HCMV terminase, an enzyme responsible for packaging viral DNA into capsids and cleaving the DNA into genome-length units. To test this hypothesis, an indole nucleoside-resistant HCMV strain was isolated, the open reading frames of the genes that encode the viral terminase were sequenced, and a G766C mutation in exon 1 of UL89 was identified; this mutation resulted in an E256Q change in the amino acid sequence of the corresponding protein. An HCMV wild-type strain, engineered with this mutation to confirm resistance, demonstrated an 18-fold decrease in susceptibility to the indole nucleosides (EC50 = 3.1 ± 0.7 μM) compared to that of wild-type virus (EC50 = 0.17 ± 0.04 μM). Interestingly, this mutation did not confer resistance to the benzimidazole nucleosides (EC50 for wild-type HCMV = 0.25 ± 0.04 μM, EC50 for HCMV pUL89 E256Q = 0.23 ± 0.04 μM). We conclude, therefore, that the G766C mutation that results in the E256Q substitution is unique for indole nucleoside resistance and distinct from previously discovered substitutions

  19. Genomic Sequencing and Characterization of Cynomolgus Macaque Cytomegalovirus▿

    PubMed Central

    Marsh, Angie K.; Willer, David O.; Ambagala, Aruna P. N.; Dzamba, Misko; Chan, Jacqueline K.; Pilon, Richard; Fournier, Jocelyn; Sandstrom, Paul; Brudno, Michael; MacDonald, Kelly S.

    2011-01-01

    Cytomegalovirus (CMV) infection is the most common opportunistic infection in immunosuppressed individuals, such as transplant recipients or people living with HIV/AIDS, and congenital CMV is the leading viral cause of developmental disabilities in infants. Due to the highly species-specific nature of CMV, animal models that closely recapitulate human CMV (HCMV) are of growing importance for vaccine development. Here we present the genomic sequence of a novel nonhuman primate CMV from cynomolgus macaques (Macaca fascicularis; CyCMV). CyCMV (Ottawa strain) was isolated from the urine of a healthy, captive-bred, 4-year-old cynomolgus macaque of Philippine origin, and the viral genome was sequenced using next-generation Illumina sequencing to an average of 516-fold coverage. The CyCMV genome is 218,041 bp in length, with 49.5% G+C content and 84% protein-coding density. We have identified 262 putative open reading frames (ORFs) with an average coding length of 789 bp. The genomic organization of CyCMV is largely colinear with that of rhesus macaque CMV (RhCMV). Of the 262 CyCMV ORFs, 137 are homologous to HCMV genes, 243 are homologous to RhCMV 68.1, and 200 are homologous to RhCMV 180.92. CyCMV encodes four ORFs that are not present in RhCMV strain 68.1 or 180.92 but have homologies with HCMV (UL30, UL74A, UL126, and UL146). Similar to HCMV, CyCMV does not produce the RhCMV-specific viral homologue of cyclooxygenase-2. This newly characterized CMV may provide a novel model in which to study CMV biology and HCMV vaccine development. PMID:21994460

  20. Cell-cycle-dependent localization of human cytomegalovirus UL83 phosphoprotein in the nucleolus and modulation of viral gene expression in human embryo fibroblasts in vitro.

    PubMed

    Arcangeletti, Maria-Cristina; Rodighiero, Isabella; Mirandola, Prisco; De Conto, Flora; Covan, Silvia; Germini, Diego; Razin, Sergey; Dettori, Giuseppe; Chezzi, Carlo

    2011-01-01

    The nucleolus is a multifunctional nuclear compartment widely known to be involved in several cellular processes, including mRNA maturation and shuttling to cytoplasmic sites, control of the cell cycle, cell proliferation, and apoptosis; thus, it is logical that many viruses, including herpesvirus, target the nucleolus in order to exploit at least one of the above-mentioned functions. Recent studies from our group demonstrated the early accumulation of the incoming ppUL83 (pp65), the major tegument protein of human cytomegalovirus (HCMV), in the nucleolus. The obtained results also suggested that a functional relationship might exist between the nucleolar localization of pp65, rRNA synthesis, and the development of the lytic program of viral gene expression. Here we present new data which support the hypothesis of a potentially relevant role of HCMV pp65 and its nucleolar localization for the control of the cell cycle by HCMV (arrest of cell proliferation in G1-G1/S), and for the promotion of viral infection. We demonstrated that, although the incoming pp65 amount in the infected cells appears to be constant irrespective of the cell-cycle phase, its nucleolar accumulation is prominent in G1 and G1/S, but very poor in S or G2/M. This correlates with the observation that only cells in G1 and G1/S support an efficient development of the HCMV lytic cycle. We propose that HCMV pp65 might be involved in regulatory/signaling pathways related to nucleolar functions, such as the cell-cycle control. Co-immunoprecipitation experiments have permitted to identify nucleolin as one of the nucleolar partners of pp65. PMID:21053310

  1. Bicaudal D1-Dependent Trafficking of Human Cytomegalovirus Tegument Protein pp150 in Virus-Infected Cells ▿

    PubMed Central

    Indran, Sabarish V.; Ballestas, Mary E.; Britt, William J.

    2010-01-01

    Human cytomegalovirus (HCMV) virion assembly takes place in the nucleus and cytoplasm of infected cells. The HCMV virion tegument protein pp150 (ppUL32) is an essential protein of HCMV and has been suggested to play a role in the cytoplasmic phase of HCMV assembly. To further define its role in viral assembly and to identify host cell proteins that interact with pp150 during viral assembly, we utilized yeast two-hybrid analyses to detect an interaction between pp150 and Bicaudal D1 (BicD1), a protein thought to play a role in trafficking within the secretory pathway. BicD1 is known to interact with the dynein motor complex and the Rab6 GTPase. The interaction between pp150 and BicD1 was confirmed by coimmunoprecipitation and fluorescence resonance energy transfer. Depletion of BicD1 with short hairpin RNA (shRNA) caused decreased virus yield and a defect in trafficking of pp150 to the cytoplasmic viral assembly compartment (AC), without altering trafficking to the AC of another essential tegument protein, pp28, or the viral glycoprotein complex gM/gN. The C terminus of BicD1 has been previously shown to interact with the GTPase Rab6, suggesting a potential role for Rab6-mediated vesicular trafficking in HCMV assembly. Finally, overexpression of the N terminus of truncated BicD1 acts in a dominant-negative manner and leads to disruption of the AC and a decrease in the assembly of infectious virus. This phenotype was similar to that observed following overexpression of dynamitin (p50) and provided additional evidence that morphogenesis of the AC and virus assembly were dynein dependent. PMID:20089649

  2. Soluble Human Cytomegalovirus gH/gL/pUL128–131 Pentameric Complex, but Not gH/gL, Inhibits Viral Entry to Epithelial Cells and Presents Dominant Native Neutralizing Epitopes*

    PubMed Central

    Loughney, John W.; Rustandi, Richard R.; Wang, Dai; Troutman, Matthew C.; Dick, Lawrence W.; Li, Guanghua; Liu, Zhong; Li, Fengsheng; Freed, Daniel C.; Price, Colleen E.; Hoang, Van M.; Culp, Timothy D.; DePhillips, Pete A.; Fu, Tong-Ming; Ha, Sha

    2015-01-01

    Congenital infection of human cytomegalovirus (HCMV) is one of the leading causes of nongenetic birth defects, and development of a prophylactic vaccine against HCMV is of high priority for public health. The gH/gL/pUL128–131 pentameric complex mediates HCMV entry into endothelial and epithelial cells, and it is a major target for neutralizing antibody responses. To better understand the mechanism by which antibodies interact with the epitopes of the gH/gL/pUL128–131 pentameric complex resulting in viral neutralization, we expressed and purified soluble gH/gL/pUL128–131 pentameric complex and gH/gL from Chinese hamster ovary cells to >95% purity. The soluble gH/gL, which exists predominantly as (gH/gL)2 homodimer with a molecular mass of 220 kDa in solution, has a stoichiometry of 1:1 and a pI of 6.0–6.5. The pentameric complex has a molecular mass of 160 kDa, a stoichiometry of 1:1:1:1:1, and a pI of 7.4–8.1. The soluble pentameric complex, but not gH/gL, adsorbs 76% of neutralizing activities in HCMV human hyperimmune globulin, consistent with earlier reports that the most potent neutralizing epitopes for blocking epithelial infection are unique to the pentameric complex. Functionally, the soluble pentameric complex, but not gH/gL, blocks viral entry to epithelial cells in culture. Our results highlight the importance of the gH/gL/pUL128–131 pentameric complex in HCMV vaccine design and emphasize the necessity to monitor the integrity of the pentameric complex during the vaccine manufacturing process. PMID:25947373

  3. Complex Interplay of the UL136 Isoforms Balances Cytomegalovirus Replication and Latency

    PubMed Central

    Caviness, Katie; Bughio, Farah; Crawford, Lindsey B.; Streblow, Daniel N.; Nelson, Jay A.; Caposio, Patrizia

    2016-01-01

    ABSTRACT Human cytomegalovirus (HCMV), a betaherpesvirus, persists indefinitely in the human host through poorly understood mechanisms. The UL136 gene is carried within a genetic locus important to HCMV latency termed the UL133/8 locus, which also carries UL133, UL135, and UL138. Previously, we demonstrated that UL136 is expressed as five protein isoforms ranging from 33-kDa to 19-kDa, arising from alternative transcription and, likely, translation initiation mechanisms. We previously showed that the UL136 isoforms are largely dispensable for virus infection in fibroblasts, a model for productive virus replication. In our current work, UL136 has emerged as a complex regulator of HCMV infection in multiple contexts of infection relevant to HCMV persistence: in an endothelial cell (EC) model of chronic infection, in a CD34+ hematopoietic progenitor cell (HPC) model of latency, and in an in vivo NOD-scid IL2Rγcnull humanized (huNSG) mouse model for latency. The 33- and 26-kDa isoforms promote replication, while the 23- and 19-kDa isoforms suppress replication in ECs, in CD34+ HPCs, and in huNSG mice. The role of the 25-kDa isoform is context dependent and influences the activity of the other isoforms. These isoforms localize throughout the secretory pathway, and loss of the 33- and 26-kDa UL136 isoforms results in virus maturation defects in ECs. This work reveals an intriguing functional interplay between protein isoforms that impacts virus replication, latency, and dissemination, contributing to the overall role of the UL133/8 locus in HCMV infection. PMID:26933055

  4. An intact sequence-specific DNA-binding domain is required for human cytomegalovirus-mediated sequestration of p53 and may promote in vivo binding to the viral genome during infection

    SciTech Connect

    Rosenke, Kyle; Samuel, Melanie A.; McDowell, Eric T.; Toerne, Melissa A.; Fortunato, Elizabeth A. . E-mail: lfort@uidaho.edu

    2006-04-25

    The p53 protein is stabilized during infection of primary human fibroblasts with human cytomegalovirus (HCMV). However, the p53 in HCMV-infected cells is unable to activate its downstream targets. HCMV accomplishes this inactivation, at least in part, by sequestering p53 into viral replication centers within the cell's nucleus soon after they are established. In order to better understand the interplay between HCMV and p53 and the mechanism of sequestration, we constructed a panel of mutant p53-GFP fusion constructs for use in transfection/infection experiments. These mutants affected several post-translational modification sites and several sites within the central sequence-specific DNA-binding domain of the protein. Two categories of p53 sequestration were observed when the mutant constructs were transfected into primary fibroblasts and then infected at either high or low multiplicity. The first category, including all of the post-translational modification mutants, showed sequestration comparable to a wild-type (wt) control, while the second category, mutants affecting the DNA-binding core, were not specifically sequestered above control GFP levels. This suggested that the DNA-binding ability of the protein was required for sequestration. When the HCMV genome was analyzed for p53 consensus binding sites, 21 matches were found, which localized either to the promoters or the coding regions of viral proteins involved in DNA replication and processing as well as structural proteins. An analysis of in vivo binding to these identified sites via chromatin immunoprecipitation assays revealed differential binding to several of the sites over the course of infection.

  5. A viral regulator of glycoprotein complexes contributes to human cytomegalovirus cell tropism

    PubMed Central

    Li, Gang; Nguyen, Christopher C.; Ryckman, Brent J.; Britt, William J.; Kamil, Jeremy P.

    2015-01-01

    Viral glycoproteins mediate entry of enveloped viruses into cells and thus play crucial roles in infection. In herpesviruses, a complex of two viral glycoproteins, gH and gL (gH/gL), regulates membrane fusion events and influences virion cell tropism. Human cytomegalovirus (HCMV) gH/gL can be incorporated into two different protein complexes: a glycoprotein O (gO)-containing complex known as gH/gL/gO, and a complex containing UL128, UL130, and UL131 known as gH/gL/UL128-131. Variability in the relative abundance of the complexes in the virion envelope correlates with differences in cell tropism exhibited between strains of HCMV. Nonetheless, the mechanisms underlying such variability have remained unclear. We have identified a viral protein encoded by the UL148 ORF (UL148) that influences the ratio of gH/gL/gO to gH/gL/UL128-131 and the cell tropism of HCMV virions. A mutant disrupted for UL148 showed defects in gH/gL/gO maturation and enhanced infectivity for epithelial cells. Accordingly, reintroduction of UL148 into an HCMV strain that lacked the gene resulted in decreased levels of gH/gL/UL128-131 on virions and, correspondingly, decreased infectivity for epithelial cells. UL148 localized to the endoplasmic reticulum, but not to the cytoplasmic sites of virion envelopment. Coimmunoprecipitation results indicated that gH, gL, UL130, and UL131 associate with UL148, but that gO and UL128 do not. Taken together, the findings suggest that UL148 modulates HCMV tropism by regulating the composition of alternative gH/gL complexes. PMID:25831500

  6. Poor survival in glioblastoma patients is associated with early signs of immunosenescence in the CD4 T-cell compartment after surgery

    PubMed Central

    Fornara, Olesja; Odeberg, Jenny; Wolmer Solberg, Nina; Tammik, Charlotte; Skarman, Petra; Peredo, Inti; Stragliotto, Giuseppe; Rahbar, Afsar; Söderberg-Nauclér, Cecilia

    2015-01-01

    Patients with glioblastoma multiforme (GBM) are immunosuppressed and have a broad range of immunological defects in both innate and adaptive immune responses. GBMs are frequently infected with human cytomegalovirus (HCMV), a virus capable of causing immunosuppression. In 42 HCMV-positive GBM patients in a clinical trial (VIGAS), we investigated T-cell phenotypes in the blood and assessed their relation to survival. Blood was collected before and 3, 12, and 24 weeks after surgery, and the frequency of T-cell subsets was compared with that in 26 age-matched healthy controls. GBM patients had lower levels of CD3 cells than the controls, but had significantly higher levels of CD4+CD28− T cells before and 3 and 12 weeks after surgery and increased levels of CD4+CD57+ and CD4+CD57+CD28+ T cells at all-time points. These T-cell subsets were associated with both immunosenescence and HCMV infection. GBM patients also had higher levels of γδ T cells at all-times after surgery and lower levels of CD4+CD25+ cells before and 3 weeks after surgery than healthy controls. Overall survival was significantly shorter in patients with higher levels of CD4+CD28− T cells (p = 0.025), CD4+CD57+ T (p = 0.025) cells, and CD4+CD28−CD57+CD28− T cells (p < 0.0004) at 3 weeks after surgery. Our findings indicate that signs of immunosenescence in the CD4+ compartment are associated with poor prognosis in patients with HCMV-positive GBMs and may reflect the HCMV activity in their tumors. PMID:26405601

  7. Cross-Presentation of Human Cytomegalovirus pp65 (UL83) to CD8+ T Cells Is Regulated by Virus-Induced, Soluble-Mediator-Dependent Maturation of Dendritic Cells

    PubMed Central

    Arrode, Géraldine; Boccaccio, Claire; Abastado, Jean-Pierre; Davrinche, Christian

    2002-01-01

    Cytotoxic CD8+ T lymphocytes (CTL) directed against the matrix protein pp65 are major effectors in controlling infection against human cytomegalovirus (HCMV), a persistent virus of the Betaherpesvirus family. We previously suggested that cross-presentation of pp65 by nonpermissive dendritic cells (DCs) could overcome viral strategies that interfere with activation of CTL (G. Arrode, C. Boccaccio, J. Lule, S. Allart, N. Moinard, J. Abastado, A. Alam, and C. Davrinche, J. Virol. 74:10018–10024, 2000). It is well established that mature DCs are very potent in initiating T-cell-mediated immunity. Consequently, the DC maturation process is a key step targeted by viruses in order to avoid an immune response. Here, we report that immature DCs maintained in coculture with infected human (MRC5) fibroblasts acquired pp65 from early-infected cells for cross-presentation to specific HLA-A2-restricted CTL. In contrast, coculture of DCs in the presence of late-infected cells decreased their capacity to stimulate CTL. Analyses of DC maturation after either coculture with infected MRC5 cells or incubation with infected-cell-conditioned medium revealed that acquisition of a mature phenotype was a prerequisite for efficient stimulation of CTL and that soluble factors secreted by infected cells were responsible for both up and down regulation of CD83 expression on DCs. We identified transforming growth factor β1 secreted by late HCMV-infected cells as one of these down regulating mediators. These findings suggest that HCMV has devised another means to compromise immune surveillance mechanisms. Together, our data indicate that recognition of HCMV-infected cells by DCs has to occur early after infection to avoid immune evasion and to allow generation of anti-HCMV CTL. PMID:11739680

  8. Identification of Human Cytomegalovirus Genes Important for Biogenesis of the Cytoplasmic Virion Assembly Complex

    PubMed Central

    Das, Subhendu; Ortiz, Daniel A.; Gurczynski, Stephen J.; Khan, Fatin

    2014-01-01

    ABSTRACT Human cytomegalovirus (HCMV) has many effects on cells, including remodeling the cytoplasm to form the cytoplasmic virion assembly complex (cVAC), the site of final virion assembly. Viral tegument, envelope, and some nonstructural proteins localize to the cVAC, and cytoskeletal filaments radiate from a microtubule organizing center in the cVAC. The endoplasmic reticulum (ER)-to-Golgi intermediate compartment, Golgi apparatus, and trans-Golgi network form a ring that outlines the cVAC. The center of the cVAC ring is occupied by numerous vesicles that share properties with recycling endosomes. In prior studies, we described the three-dimensional structure and the extensive remodeling of the cytoplasm and shifts in organelle identity that occur during development of the cVAC. The objective of this work was to identify HCMV proteins that regulate cVAC biogenesis. Because the cVAC does not form in the absence of viral DNA synthesis, we employed HCMV-infected cells transfected with synthetic small interfering RNAs (siRNAs) that targeted 26 candidate early-late and late protein-coding genes required for efficient virus replication. We identified three HCMV genes (UL48, UL94, and UL103) whose silencing had major effects on cVAC development, including failure to form the Golgi ring and dispersal of markers of early and recycling endosomes. To confirm and extend the siRNA results, we constructed recombinant viruses in which pUL48 and pUL103 are fused with a regulatable protein destabilization domain (dd-FKBP). In the presence of a stabilizing ligand (Shield-1), the cVAC appeared to develop normally. In its absence, cVAC development was abrogated, verifying roles for pUL48 and pUL103 in cVAC biogenesis. IMPORTANCE Human cytomegalovirus (HCMV) is an important human pathogen that causes disease and disability in immunocompromised individuals and in children infected before birth. Few drugs are available for treatment of HCMV infections. HCMV remodels the interior of

  9. Novel Method Based on Real-Time Cell Analysis for Drug Susceptibility Testing of Herpes Simplex Virus and Human Cytomegalovirus.

    PubMed

    Piret, Jocelyne; Goyette, Nathalie; Boivin, Guy

    2016-08-01

    The plaque reduction assay (PRA) is the gold standard phenotypic method to determine herpes simplex virus (HSV) and human cytomegalovirus (HCMV) susceptibilities to antiviral drugs. However, this assay is subjective and labor intensive. Here, we describe a novel antiviral phenotypic method based on real-time cell analysis (RTCA) that measures electronic impedance over time. The effective drug concentrations that reduced by 50% (EC50s) the cytopathic effects induced by HSV-1 and HCMV were evaluated by both methods. The EC50s of acyclovir and foscarnet against a reference wild-type (WT) HSV-1 strain in Vero cells were, respectively, 0.5 μM and 32.6 μM by PRA and 0.8 μM and 93.6 μM by RTCA. The EC50 ratios for acyclovir against several HSV-1 thymidine kinase (TK) mutants were 101.8×, 73.4×, 28.8×, and 35.4× (PRA) and 18.0×, 52.0×, 5.5×, and 87.8× (RTCA) compared to those for the WT. The EC50 ratios for acyclovir and foscarnet against the HSV-1 TK/DNA polymerase mutant were 182.8× and 9.7× (PRA) and >125.0× and 10.8× (RTCA) compared to the WT. The EC50s of ganciclovir and foscarnet against WT HCMV strain AD169 in fibroblasts were, respectively, 1.6 μM and 27.8 μM by PRA and 5.0 μM and 111.4 μM by RTCA. The EC50 ratios of ganciclovir against the HCMV UL97 mutant were 3.8× (PRA) and 8.2× (RTCA) compared to those for the WT. The EC50 ratios of ganciclovir and foscarnet against the HCMV UL97/DNA polymerase mutant were 17.1× and 12.1× (PRA) and 14.7× and 4.6× (RTCA) compared to those for the WT. RTCA allows objective drug susceptibility testing of HSV and HCMV and could permit high-throughput screening of new antivirals. PMID:27252463

  10. Metabolism of Cyclopropavir and Ganciclovir in Human Cytomegalovirus-Infected Cells

    PubMed Central

    Drach, John C.

    2014-01-01

    Human cytomegalovirus (HCMV) is a widespread pathogen that can cause severe disease in immunologically immature and immunocompromised patients. The current standard of therapy for the treatment of HCMV infections is ganciclovir (GCV). However, high incidence rates of adverse effects are prevalent and limit the use of this drug. Cyclopropavir (CPV) is 10-fold more effective against HCMV in vitro than GCV (50% effective concentrations [EC50s] = 0.46 and 4.1 μM, respectively) without any observed increase in cytotoxicity (S. Zhou, J. M. Breitenbach, K. Z. Borysko, J. C. Drach, E. R. Kern, E. Gullen, Y. C. Cheng, and J. Zemlicka, J. Med. Chem. 47:566–575, 2004, doi:10.1021/jm030316s). We have previously determined that the viral protein kinase pUL97 and endogenous cellular kinases are responsible for the conversion of CPV to a triphosphate (TP), the active compound responsible for inhibiting viral DNA synthesis and viral replication. However, this conversion has not been observed in HCMV-infected cells. To that end, we subjected HCMV-infected cells to equivalently effective concentrations (∼5 times the EC50) of either CPV or GCV and observed a time-dependent increase in triphosphate levels for both compounds (CPV-TP = 121 ± 11 pmol/106 cells; GCV-TP = 43.7 ± 0.4 pmol/106 cells). A longer half-life was observed for GCV-TP (48.2 ± 5.7 h) than for CPV-TP (23.8 ± 5.1 h). The area under the curve for CPV-TP produced from incubation with 2.5 μM CPV was 8,680 ± 930 pmol · h/106 cells, approximately 2-fold greater than the area under the curve for GCV-TP of 4,520 ± 420 pmol · h/106 cells produced from incubation with 25 μM GCV. We therefore conclude that the exposure of HCMV-infected cells to CPV-TP is greater than that of GCV-TP under these experimental conditions. PMID:24514084

  11. The Tegument Protein pp65 of Human Cytomegalovirus Acts as an Optional Scaffold Protein That Optimizes Protein Uploading into Viral Particles

    PubMed Central

    Reyda, Sabine; Tenzer, Stefan; Navarro, Pedro; Gebauer, Wolfgang; Saur, Michael; Krauter, Steffi; Büscher, Nicole

    2014-01-01

    ABSTRACT The mechanisms that lead to the tegumentation of herpesviral particles are only poorly defined. The phosphoprotein 65 (pp65) is the most abundant constituent of the virion tegument of human cytomegalovirus (HCMV). It is, however, nonessential for virion formation. This seeming discrepancy has not met with a satisfactory explanation regarding the role of pp65 in HCMV particle morphogenesis. Here, we addressed the question of how the overall tegument composition of the HCMV virion depended on pp65 and how the lack of pp65 influenced the packaging of particular tegument proteins. To investigate this, we analyzed the proteomes of pp65-positive (pp65pos) and pp65-negative (pp65neg) virions by label-free quantitative mass spectrometry and determined the relative abundances of tegument proteins. Surprisingly, only pUL35 was elevated in pp65neg virions. As the abundance of pUL35 in the HCMV tegument is low, it is unlikely that it replaced pp65 as a structural component in pp65neg virions. A subset of proteins, including the third most abundant tegument protein, pUL25, as well as pUL43, pUL45, and pUL71, were reduced in pp65neg or pp65low virions, indicating that the packaging of these proteins was related to pp65. The levels of tegument components, like pp28 and the capsid-associated tegument proteins pp150, pUL48, and pUL47, were unaffected by the lack of pp65. Our analyses demonstrate that deletion of pp65 is not compensated for by other viral proteins in the process of virion tegumentation. The results are concordant with a model of pp65 serving as an optional scaffold protein that facilitates protein upload into the outer tegument of HCMV particles. IMPORTANCE The assembly of the tegument of herpesviruses is only poorly understood. Particular proteins, like HCMV pp65, are abundant tegument constituents. pp65 is thus considered to play a major role in tegument assembly in the process of virion morphogenesis. We show here that deletion of the pp65 gene leads to

  12. Improved molecular diagnosis of the common recurrent intragenic deletion mutation in IKBKG in a Filipino family with incontinentia pigmenti.

    PubMed

    Guevara, Bryan Edgar K; Hsu, Chao-Kai; Liu, Lu; Feast, Alice; Alabado, Karen Lee P; Lacuesta, Maricarr Pamela M; Lee, Julia Yu-Yun; McGrath, John A

    2016-05-01

    Incontinentia pigmenti is a rare, multisystem X-linked dominant genetic disorder caused by mutations in IKBKG, the encoding inhibitor of kappa light polypeptide gene enhancer in B-cells. Almost 80% of all cases result from a recurrent intragenic deletion mutation that removes exon 4-10. At present, this mutation can be detected by a multi-primer polymerase chain reaction (PCR) technique although current protocols may preferentially amplify the wild-type allele and miss the deletion. Here, we report a female infant with incontinentia pigmenti that also affected her mother and sister, and two spontaneously aborted male siblings. We developed a modified PCR amplification method that provides more robust detection of the exon 4-10 deletion mutation, which was demonstrated in all affected females in this pedigree. PMID:26437686

  13. An intron capture strategy used to identify and map a lysyl oxidase-like gene on chromosome 9 in the mouse

    SciTech Connect

    Wydner, K.S.; Passmore, H.C.; Kim, Houngho; Csiszar, K.; Boyd, C.D.

    1997-03-01

    An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.

  14. An AT-rich region in the APC gene may cause misinterpretation of familial adenomatous polyposis molecular screening.

    PubMed

    Palmirotta, Raffaele; De Marchis, Maria Laura; Ludovici, Giorgia; Leone, Barbara; Valente, Maria Giovanna; Alessandroni, Jhessica; Spila, Antonella; Della-Morte, David; Guadagni, Fiorella

    2012-05-01

    Familial adenomatous polyposis (FAP) is an autosomal-dominant condition mainly due to a mutation of the adenomatous polyposis coli (APC) gene. The present study reports evidence of a technical issue occurring during the mutational analysis of APC exon 4. Genetic conventional direct sequence analysis of a repetitive AT-rich region in the splice acceptor site of APC intron 3 could be misinterpreted as a pathogenetic frameshift result. However, this potential bias may be bypassed adopting a method for random mutagenesis of DNA based on the use of a triphosphate nucleoside analogues mixture. Using this method as a second-level analysis, we also demonstrated the nonpathogenic nature of the variant in the poly A trait in APC exon 4 region (c.423-4delA) that do not result in aberrant splicing of APC exons 3-4; conversely, we did not find a previously reported T deletion/insertion polymorphism. PMID:22447671

  15. Probabilistic Splicing of Dscam1 Establishes Identity at the Level of Single Neurons

    PubMed Central

    Miura, Satoru K.; Martins, André; Zhang, Kelvin X.; Graveley, Brenton R.; Zipursky, S. Lawrence

    2014-01-01

    The Drosophila Dscam1 gene encodes a vast number of cell recognition molecules through alternative splicing. These exhibit isoform-specific homophilic binding and regulate self-avoidance, the tendency of neurites from the same cell to repel one another. Genetic experiments indicate that different cells must express different isoforms. How this is achieved is not known, as the expression of alternative exons in vivo has not been shown. Here, we modified the endogenous Dscam1 locus to generate splicing reporters for all variants of exon 4. We demonstrate that splicing does not occur in a cell-type specific fashion, that cells identified by their unique locations express different exon 4 variants in different animals, and that splicing in identified neurons can change over time. Probabilistic expression is compatible with a widespread role in neural circuit assembly through self-avoidance and is incompatible with models in which specific isoforms of Dscam1 mediate recognition between processes of different cells. PMID:24267895

  16. TAOK3 Phosphorylates the Methylenecyclopropane Nucleoside MBX 2168 to its Monophosphate

    PubMed Central

    Komazin-Meredith, Gloria; Cardinale, Steven C.; Comeau, Katelyn; Magalhaes, Kevin J.; Hartline, Caroll B.; Williams, John D.; Opperman, Timothy J.; Prichard, Mark N.; Bowlin, Terry L.

    2015-01-01

    Monohydroxymethyl methylenecyclopropane nucleosides (MCPNs) with ether or thioether substituents at the 6-position show promise as broad-spectrum herpes virus inhibitors. Their proposed mechanism of action involves sequential phosphorylation to a triphosphate, which can then inhibit viral DNA polymerase. The inhibition of herpes simplex virus (HSV) by these compounds is not dependent on the viral thymidine kinase (TK), which is known to phosphorylate acyclovir (ACV), a standard treatment for HSV infections. Previous studies on the mechanism of action of these compounds against human cytomegalovirus (HCMV) implicated a host kinase in addition to HCMV UL97 kinase in performing the initial phosphorylation. After first eliminating other candidate HSV-1 encoded kinases (UL13 and US3) as well as potential host nucleoside kinases, using activity-based fractionation, we have now identified the host serine-threonine protein kinase TAOK3 as the kinase responsible for transforming the representative monohydroxymethyl MCPN analog MBX 2168 to its monophosphate. PMID:25857706

  17. Cytomegalovirus reactivation in critically ill immunocompetent hosts: A decade of progress and remaining challenges

    PubMed Central

    Cook, Charles H.; Trgovcich, Joanne

    2011-01-01

    Human cytomegalovirus (HCMV) is an undisputed pathogen in humans with severe immunocompromise that has historically been thought to carry little consequence in immunecompetent hosts. During the past decade, however, accumulating data suggest that significant numbers of immunocompetent humans reactivate HCMV during critical illness, and that these reactivation episodes are associated with worsened outcomes. Because most people are infected with this ubiquitous virus by adulthood, confirming pathogenicity has now become a clinical priority. In this article, we will review the incidence and implications of reactivation, the relevant immune responses and reactivation triggers relevant to the immunocompetent host. We will summarize the progress made during the past ten years, outline work ongoing in this field, and identify the major gaps remaining in our emerging understanding of this phenomenon. PMID:21439328

  18. Polyhydroxylated Steroids from the Bamboo Coral Isis hippuris

    PubMed Central

    Chen, Wei-Hua; Wang, Shang-Kwei; Duh, Chang-Yih

    2011-01-01

    In previous studies on the secondary metabolites of the Taiwanese octocoral Isis hippuris, specimens have always been collected at Green Island. In the course of our studies on bioactive compounds from marine organisms, the acetone-solubles of the Taiwanese octocoral I. hippuris collected at Orchid Island have led to the isolation of five new polyoxygenated steroids: hipposterone M–O (1–3), hipposterol G (4) and hippuristeroketal A (5). The structures of these compounds were determined on the basis of their spectroscopic and physical data. The anti-HCMV (human cytomegalovirus) activity of 1–5 and their cytotoxicity against selected cell lines were evaluated. Compound 2 exhibited inhibitory activity against HCMV, with an EC50 value of 6.0 μg/mL. PMID:22072998

  19. TAOK3 phosphorylates the methylenecyclopropane nucleoside MBX 2168 to its monophosphate.

    PubMed

    Komazin-Meredith, Gloria; Cardinale, Steven C; Comeau, Katelyn; Magalhaes, Kevin J; Hartline, Caroll B; Williams, John D; Opperman, Timothy J; Prichard, Mark N; Bowlin, Terry L

    2015-07-01

    Monohydroxymethyl methylenecyclopropane nucleosides (MCPNs) with ether or thioether substituents at the 6-position show promise as broad-spectrum herpes virus inhibitors. Their proposed mechanism of action involves sequential phosphorylation to a triphosphate, which can then inhibit viral DNA polymerase. The inhibition of herpes simplex virus (HSV) by these compounds is not dependent on the viral thymidine kinase (TK), which is known to phosphorylate acyclovir (ACV), a standard treatment for HSV infections. Previous studies on the mechanism of action of these compounds against human cytomegalovirus (HCMV) implicated a host kinase in addition to HCMV UL97 kinase in performing the initial phosphorylation. After first eliminating other candidate HSV-1 encoded kinases (UL13 and US3) as well as potential host nucleoside kinases, using activity-based fractionation, we have now identified the host serine-threonine protein kinase TAOK3 as the kinase responsible for transforming the representative monohydroxymethyl MCPN analog MBX 2168 to its monophosphate. PMID:25857706

  20. Cytomegalovirus Infection Drives Adaptive Epigenetic Diversification of NK Cells with Altered Signaling and Effector Function

    PubMed Central

    Schlums, Heinrich; Cichocki, Frank; Tesi, Bianca; Theorell, Jakob; Beziat, Vivien; Holmes, Tim D.; Han, Hongya; Chiang, Samuel C.C.; Foley, Bree; Mattsson, Kristin; Larsson, Stella; Schaffer, Marie; Malmberg, Karl-Johan; Ljunggren, Hans-Gustaf; Miller, Jeffrey S.; Bryceson, Yenan T.

    2015-01-01

    SUMMARY The mechanisms underlying human natural killer (NK) cell phenotypic and functional heterogeneity are unknown. Here, we describe the emergence of diverse subsets of human NK cells selectively lacking expression of signaling proteins after human cytomegalovirus (HCMV) infection. The absence of B and myeloid cell-related signaling protein expression in these NK cell subsets correlated with promoter DNA hyperme-thylation. Genome-wide DNA methylation patterns were strikingly similar between HCMV-associated adaptive NK cells and cytotoxic effector T cells but differed from those of canonical NK cells. Functional interrogation demonstrated altered cytokine responsiveness in adaptive NK cells that was linked to reduced expression of the transcription factor PLZF. Furthermore, subsets of adaptive NK cells demonstrated significantly reduced functional responses to activated autologous T cells. The present results uncover a spectrum of epigenetically unique adaptive NK cell subsets that diversify in response to viral infection and have distinct functional capabilities compared to canonical NK cell subsets. PMID:25786176

  1. Scanning Mutagenesis of Human Cytomegalovirus Glycoprotein gH/gL

    PubMed Central

    Schultz, Eric P.; Lanchy, Jean-Marc; Ellerbeck, Erin E.

    2015-01-01

    ABSTRACT The core, conserved function of the herpesvirus gH/gL is to promote gB-mediated membrane fusion during entry, although the mechanism is poorly understood. The human cytomegalovirus (HCMV) gH/gL can exist as either the gH/gL/gO trimer or the gH/gL/UL128/UL130/UL131 (gH/gL/UL128-131) pentamer. One model suggests that gH/gL/gO provides the core fusion role during entry into all cells within the broad tropism of HCMV, whereas gH/gL/UL128-131 acts at an earlier stage, by a distinct receptor-binding mechanism to enhance infection of select cell types, such as epithelial cells, endothelial cells, and monocytes/macrophages. To further study the distinct functions of these complexes, mutants with individual charged cluster-to-alanine (CCTA) mutations of gH and gL were combined to generate a library of 80 mutant gH/gL heterodimers. The majority of the mutant gH/gL complexes were unable to facilitate gB-mediated membrane fusion in transient-expression cell-cell fusion experiments. In contrast, these mutants supported the formation of gH/gL/UL128-131 complexes that could block HCMV infection in receptor interference experiments. These results suggest that receptor interactions with gH/gL/UL128-131 involve surfaces contained on the UL128-131 proteins but not on gH/gL. gH/gL/UL128-131 receptor interference could be blocked with anti-gH antibodies, suggesting that interference is a cell surface phenomenon and that anti-gH antibodies can block gH/gL/UL128-131 in a manner that is distinct from that for gH/gL/gO. IMPORTANCE Interest in the gH/gL complexes of HCMV (especially gH/gL/UL128-131) as vaccine targets has far outpaced our understanding of the mechanism by which they facilitate entry and contribute to broad cellular tropism. For Epstein-Barr virus (EBV), gH/gL and gH/gL/gp42 are both capable of promoting gB fusion for entry into epithelial cells and B cells, respectively. In contrast, HCMV gH/gL/gO appears to be the sole fusion cofactor that promotes gB fusion

  2. Transient activation of human cytomegalovirus lytic gene expression during latency allows cytotoxic T cell killing of latently infected cells.

    PubMed

    Krishna, B A; Lau, B; Jackson, S E; Wills, M R; Sinclair, J H; Poole, E

    2016-01-01

    Human cytomegalovirus (HCMV) latency in the myeloid lineage is maintained by repressive histone modifications around the major immediate early promoter (MIEP), which results in inhibition of the lytic viral life cycle. We now show that pharmacological inhibition of histone deacetylases (HDACs) relieves this repression of the MIEP and induces transient expression of the viral lytic immediate early (IE) antigens but, importantly, not full virus reactivation. In turn, these latently infected cells now become targets for IE-specific cytotoxic T cells (CTLs) which are present at high frequency in all normal healthy HCMV positive carriers but would normally be unable to target latent (lytic antigen-negative) cells. This approach of transiently inducing viral lytic gene expression by HDAC inhibition, in otherwise latently infected cells, offers a window of opportunity to target and purge the latent myeloid cell reservoir by making these normally immunologically undetectable cells visible to pre-existing host immune responses to viral lytic antigens. PMID:27091512

  3. CEACAM1-Mediated Inhibition of Virus Production.

    PubMed

    Vitenshtein, Alon; Weisblum, Yiska; Hauka, Sebastian; Halenius, Anne; Oiknine-Djian, Esther; Tsukerman, Pinchas; Bauman, Yoav; Bar-On, Yotam; Stern-Ginossar, Noam; Enk, Jonatan; Ortenberg, Rona; Tai, Julie; Markel, Gal; Blumberg, Richard S; Hengel, Hartmut; Jonjic, Stipan; Wolf, Dana G; Adler, Heiko; Kammerer, Robert; Mandelboim, Ofer

    2016-06-14

    Cells in our body can induce hundreds of antiviral genes following virus sensing, many of which remain largely uncharacterized. CEACAM1 has been previously shown to be induced by various innate systems; however, the reason for such tight integration to innate sensing systems was not apparent. Here, we show that CEACAM1 is induced following detection of HCMV and influenza viruses by their respective DNA and RNA innate sensors, IFI16 and RIG-I. This induction is mediated by IRF3, which bound to an ISRE element present in the human, but not mouse, CEACAM1 promoter. Furthermore, we demonstrate that, upon induction, CEACAM1 suppresses both HCMV and influenza viruses in an SHP2-dependent process and achieves this broad antiviral efficacy by suppressing mTOR-mediated protein biosynthesis. Finally, we show that CEACAM1 also inhibits viral spread in ex vivo human decidua organ culture. PMID:27264178

  4. Transient activation of human cytomegalovirus lytic gene expression during latency allows cytotoxic T cell killing of latently infected cells

    PubMed Central

    Krishna, B. A.; Lau, B.; Jackson, S. E.; Wills, M. R.; Sinclair, J. H.; Poole, E.

    2016-01-01

    Human cytomegalovirus (HCMV) latency in the myeloid lineage is maintained by repressive histone modifications around the major immediate early promoter (MIEP), which results in inhibition of the lytic viral life cycle. We now show that pharmacological inhibition of histone deacetylases (HDACs) relieves this repression of the MIEP and induces transient expression of the viral lytic immediate early (IE) antigens but, importantly, not full virus reactivation. In turn, these latently infected cells now become targets for IE-specific cytotoxic T cells (CTLs) which are present at high frequency in all normal healthy HCMV positive carriers but would normally be unable to target latent (lytic antigen-negative) cells. This approach of transiently inducing viral lytic gene expression by HDAC inhibition, in otherwise latently infected cells, offers a window of opportunity to target and purge the latent myeloid cell reservoir by making these normally immunologically undetectable cells visible to pre-existing host immune responses to viral lytic antigens. PMID:27091512

  5. [Construction and transfection of eucaryotic expression recombinant vector containing truncated region of UL83 gene of human cytomegalovirus and it's sheltered effect as DNA vaccine].

    PubMed

    Gao, Rong-Bao; Li, Yan-Qiu; Wang, Ming-Li

    2006-06-01

    To construct eucaryotic expression recombinant vector containing vivo truncated region of UL83 gene of human cytomegalovirus, realize its steady expression in Hep-2 cell, and study sheltered effect of the eucaryotic expression recombinant vector as DNA vaccine. A vivo truncated UL83 gene fragment encoding for truncated HCMV pp65 was obtained by PCR from human cytomegalovirus AD169 stock genome. By gene recombinant ways, the truncated UL83 gene fragment was cloned into eucaryotic expression vector pEGFP-C1 with reported gene coding GFP to construct recombinant vector pEGFP-C1-UL83. The recombinant vector pEGFP-C1-UL83 was tested by different methods including PCR, restriction digestion and gene sequencing. Test results showed the recombinant vector was constructed successfully. After pEGFP-C1-UL83 was transfected into Hep-2 cell by lipofectin mediation, expression of GFP and truncated pp65 fusion protein in Hep-2 cell was observed at different time points by fluorescence microscope. Results showed that quantity of fusion protein expression was the highest at 36h point. Then, Hep-2 cell was cultured selectively by RPMI-1640 containing G418 (200 microg/mL) to obtain a new cell stock of expressing truncated UL83 Gene fragment steadily. RT-PCR and Western blot results showed the truncated fragment of UL83 gene could be expressed steadily in Hep-2 cell. The result showed a new cell stock of expressing Tpp65 was established. This cell stock could be useful in some HCMV research fields, for example, it could be a tool in study of pp65 and HCMV infection, and it could provide a platform for the research into the therapy of HCMV infection. Immune sheltered effect of pEGFP-C1-UL83 as DNA vaccine was studied in vivo of HCMV congenital infection mouse model. The mouse model was immunized solely by pEGFP-C1-UL83, and was immunized jointly by pEGFP-C1-UL83 and its expression product. When the mouse was pregnant and brought to bed, differential antibody of anti-HCMV pp65 was

  6. Development of flavonoid-based inverse agonists of the key signaling receptor US28 of human cytomegalovirus.

    PubMed

    Kralj, Ana; Nguyen, Mai-Thao; Tschammer, Nuska; Ocampo, Nicolette; Gesiotto, Quinto; Heinrich, Markus R; Phanstiel, Otto

    2013-06-27

    A series of 31 chalcone- and flavonoid-based derivatives were synthesized in good overall yields and screened for their inverse agonist activity on the US28 receptor of human cytomegalovirus (HCMV). With one exception (e.g., 2-(5-bromo-2-methoxyphenyl)-3-hydroxy-4H-chromen-4-one), halogen-substituted flavonoids were typically more potent inverse agonists than their related hydro derivatives. While toxicity could be used to partially explain the inverse agonist activity of some members of the series, 5-(benzyloxy)-2-(5-bromo-2-methoxyphenyl)-4H-chromen-4-one (11b) acted on the US28 receptor as a nontoxic, inverse agonist. The full inverse agonism (efficacy, -89%) and potency (EC50 = 3.5 μM) observed with flavonoid 11b is especially important as it provides both a new tool to study US28 signaling and a potential platform for the future development of HCMV-targeting drugs. PMID:23768434

  7. [Polymorphism of the kappa-casein gene in populations of the subfamily Bovinae].

    PubMed

    Sulimova, G E; Badagueva, Iu N; Udina, I G

    1996-11-01

    Polymorphism of the 5'-untranslated region and exon 4 of kappa-casein (kappa-casein) gene was studied in Yakutian and Black Pied cattle, yak, European bison, and buffalo by means of a polymerase chain reaction and subsequent restriction fragment length polymorphism analysis (PCR-RFLP). In the species studied, restriction polymorphism by the endonucleases AluI and Bg/II in the 5'-untranslated region of the gene is absent. Four restriction endonucleases testing nucleotide substitutions in 136 codon (TaqI), 148 codon (HinfI and HindIII), and 167 and 168 codons (PstI) were used to study polymorphism of exon 4. The use of several restriction endonucleases allowed three alleles of kappa-casein (kappa-CnA, kappa-CnB, kappa-CnF) to be typed and new allele variants in yak, European bison, and buffalo to be revealed. Nucleotide sequences of the fragments of exon 4 studied were determined for two new alleles of the gene: kappa-CnG in yak and European bison and kappa-CnH in buffalo. Nucleotide substitutions determining new alleles were localized. In kappa-CnG, 148 and 168 codons coincide with the corresponding codons of kappa-CnB, and 136 and 167 codons correspond to kappa-CnA. Stop codons of kappa-CnG in yak are different from stop codons of other alleles of the gene: TGA, instead of TAA. The nucleotide sequence of exon 4 of kappa-CnH differs from bovine kappa-CnA by 15 nucleotide substitutions, causing 10 amino acid changes in the protein sequence, which coincide with the corresponding known amino acid sequence of kappa-casein in buffalo. Interbreed and interspecies differences in the profile of allele frequencies of the species studied were revealed. Aspects connected with evolution of the alleles of kappa-casein are discussed. PMID:9119217

  8. The spectrum of Notch3 mutations in 28 Italian CADASIL families

    PubMed Central

    Dotti, M; Federico, A; Mazzei, R; Bianchi, S; Scali, O; Conforti, F; Sprovieri, T; Guidetti, D; Aguglia, U; Consoli, D; Pantoni, L; Sarti, C; Inzitari, D; Quattrone, A

    2005-01-01

    Objective: To report Notch3 mutation analysis in 28 unrelated Italian CADASIL families from central and south Italy. Results: The highest rate of mutations was found in exon 11 (21%) and only 18% of mutations were in exon 4. This may be related to the peculiar distribution of Notch3 mutations in the regions of origin of the families. Conclusions: The results suggest that limited scanning of exons 3 and 4 is inadvisable in CADASIL cases of Italian origin. PMID:15834039

  9. Functional Characterization of the spf/ash Splicing Variation in OTC Deficiency of Mice and Man

    PubMed Central

    Viecelli, Hiu Man; Rüfenacht, Veronique; Pérez, Belén; Ugarte, Magdalena; Häberle, Johannes; Thöny, Beat; Desviat, Lourdes Ruiz

    2015-01-01

    The spf/ash mouse model of ornithine transcarbamylase (OTC) deficiency, a severe urea cycle disorder, is caused by a mutation (c.386G>A; p.R129H) in the last nucleotide of exon 4 of the Otc gene, affecting the 5’ splice site and resulting in partial use of a cryptic splice site 48 bp into the adjacent intron. The equivalent nucleotide change and predicted amino acid change is found in OTC deficient patients. Here we have used liver tissue and minigene assays to dissect the transcriptional profile resulting from the “spf/ash” mutation in mice and man. For the mutant mouse, we confirmed liver transcripts corresponding to partial intron 4 retention by the use of the c.386+48 cryptic site and to normally spliced transcripts, with exon 4 always containing the c.386G>A (p.R129H) variant. In contrast, the OTC patient exhibited exon 4 skipping or c.386G>A (p.R129H)-variant exon 4 retention by using the natural or a cryptic splice site at nucleotide position c.386+4. The corresponding OTC tissue enzyme activities were between 3-6% of normal control in mouse and human liver. The use of the cryptic splice sites was reproduced in minigenes carrying murine or human mutant sequences. Some normally spliced transcripts could be detected in minigenes in both cases. Antisense oligonucleotides designed to block the murine cryptic +48 site were used in minigenes in an attempt to redirect splicing to the natural site. The results highlight the relevance of in depth investigations of the molecular mechanisms of splicing mutations and potential therapeutic approaches. Notably, they emphasize the fact that findings in animal models may not be applicable for human patients due to the different genomic context of the mutations. PMID:25853564

  10. Identification of a Novel C-Terminal Truncated WT1 Isoform with Antagonistic Effects against Major WT1 Isoforms

    PubMed Central

    Tatsumi, Naoya; Hojo, Nozomi; Sakamoto, Hiroyuki; Inaba, Rena; Moriguchi, Nahoko; Matsuno, Keiko; Fukuda, Mari; Matsumura, Akihide; Hayashi, Seiji; Morimoto, Soyoko; Nakata, Jun; Fujiki, Fumihiro; Nishida, Sumiyuki; Nakajima, Hiroko; Tsuboi, Akihiro; Oka, Yoshihiro; Hosen, Naoki; Sugiyama, Haruo; Oji, Yusuke

    2015-01-01

    The Wilms’ tumor gene WT1 consists of 10 exons and encodes a zinc finger transcription factor. There are four major WT1 isoforms resulting from alternative splicing at two sites, exon 5 (17AA) and exon 9 (KTS). All major WT1 isoforms are overexpressed in leukemia and solid tumors and play oncogenic roles such as inhibition of apoptosis, and promotion of cell proliferation, migration and invasion. In the present study, a novel alternatively spliced WT1 isoform that had an extended exon 4 (designated as exon 4a) with an additional 153 bp (designated as 4a sequence) at the 3’ end was identified and designated as an Ex4a(+)WT1 isoform. The insertion of exon 4a resulted in the introduction of premature translational stop codons in the reading frame in exon 4a and production of C-terminal truncated WT1 proteins lacking zinc finger DNA-binding domain. Overexpression of the truncated Ex4a(+)WT1 isoform inhibited the major WT1-mediated transcriptional activation of anti-apoptotic Bcl-xL gene promoter and induced mitochondrial damage and apoptosis. Conversely, suppression of the Ex4a(+)WT1 isoform by Ex4a-specific siRNA attenuated apoptosis. These results indicated that the Ex4a(+)WT1 isoform exerted dominant negative effects on anti-apoptotic function of major WT1 isoforms. Ex4a(+)WT1 isoform was endogenously expressed as a minor isoform in myeloid leukemia and solid tumor cells and increased regardless of decrease in major WT1 isoforms during apoptosis, suggesting the dominant negative effects on anti-apoptotic function of major WT1 isoforms. These results indicated that Ex4a(+)WT1 isoform had an important physiological function that regulated oncogenic function of major WT1 isoforms. PMID:26090994

  11. A Homolog Pentameric Complex Dictates Viral Epithelial Tropism, Pathogenicity and Congenital Infection Rate in Guinea Pig Cytomegalovirus.

    PubMed

    Coleman, Stewart; Choi, K Yeon; Root, Matthew; McGregor, Alistair

    2016-07-01

    In human cytomegalovirus (HCMV), tropism to epithelial and endothelial cells is dependent upon a pentameric complex (PC). Given the structure of the placenta, the PC is potentially an important neutralizing antibody target antigen against congenital infection. The guinea pig is the only small animal model for congenital CMV. Guinea pig cytomegalovirus (GPCMV) potentially encodes a UL128-131 HCMV PC homolog locus (GP128-GP133). In transient expression studies, GPCMV gH and gL glycoproteins interacted with UL128, UL130 and UL131 homolog proteins (designated GP129 and GP131 and GP133 respectively) to form PC or subcomplexes which were determined by immunoprecipitation reactions directed to gH or gL. A natural GP129 C-terminal deletion mutant (aa 107-179) and a chimeric HCMV UL128 C-terminal domain swap GP129 mutant failed to form PC with other components. GPCMV infection of a newly established guinea pig epithelial cell line required a complete PC and a GP129 mutant virus lacked epithelial tropism and was attenuated in the guinea pig for pathogenicity and had a low congenital transmission rate. Individual knockout of GP131 or 133 genes resulted in loss of viral epithelial tropism. A GP128 mutant virus retained epithelial tropism and GP128 was determined not to be a PC component. A series of GPCMV mutants demonstrated that gO was not strictly essential for epithelial infection whereas gB and the PC were essential. Ectopic expression of a GP129 cDNA in a GP129 mutant virus restored epithelial tropism, pathogenicity and congenital infection. Overall, GPCMV forms a PC similar to HCMV which enables evaluation of PC based vaccine strategies in the guinea pig model. PMID:27387220

  12. Vaccination against a virus-encoded cytokine significantly restricts viral challenge.

    PubMed

    Eberhardt, Meghan K; Deshpande, Ashlesha; Chang, W L William; Barthold, Stephen W; Walter, Mark R; Barry, Peter A

    2013-11-01

    Identification of immune correlates of protection for viral vaccines is complicated by multiple factors, but there is general consensus on the importance of antibodies that neutralize viral attachment to susceptible cells. Development of new viral vaccines has mostly followed this neutralizing antibody paradigm, but as a recent clinical trial of human cytomegalovirus (HCMV) vaccination demonstrated, this singular approach can yield limited protective efficacy. Since HCMV devotes >50% of its coding capacity to proteins that modulate host immunity, it is hypothesized that expansion of vaccine targets to include this part of the viral proteome will disrupt viral natural history. HCMV and rhesus cytomegalovirus (RhCMV) each encode an ortholog to the cellular interleukin-10 (cIL-10) cytokine: cmvIL-10 and rhcmvIL10, respectively. Despite extensive sequence divergence from their host's cIL-10, each viral IL-10 retains nearly identical functionality to cIL-10. Uninfected rhesus macaques were immunized with engineered, nonfunctional rhcmvIL-10 variants, which were constructed by site-directed mutagenesis to abolish binding to the cIL-10 receptor. Vaccinees developed antibodies that neutralized rhcmvIL-10 function with no cross-neutralization of cIL-10. Following subcutaneous RhCMV challenge, the vaccinees exhibited both reduced RhCMV replication locally at the inoculation site and systemically and significantly reduced RhCMV shedding in bodily fluids compared to controls. Attenuation of RhCMV infection by rhcmvIL-10 vaccination argues that neutralization of viral immunomodulation may be a new vaccine paradigm for HCMV by expanding potential vaccine targets. PMID:23946461

  13. Diagnosis and management of human cytomegalovirus infection in the mother, fetus, and newborn infant.

    PubMed

    Revello, Maria Grazia; Gerna, Giuseppe

    2002-10-01

    Human cytomegalovirus (HCMV) is the leading cause of congenital viral infection and mental retardation. HCMV infection, while causing asymptomatic infections in most immunocompetent subjects, can be transmitted during pregnancy from the mother with primary (and also recurrent) infection to the fetus. Hence, careful diagnosis of primary infection is required in the pregnant woman based on the most sensitive serologic assays (immunoglobulin M [IgM] and IgG avidity assays) and conventional virologic and molecular procedures for virus detection in blood. Maternal prognostic markers of fetal infection are still under investigation. If primary infection is diagnosed in a timely manner, prenatal diagnosis can be offered, including the search for virus and virus components in fetal blood and amniotic fluid, with fetal prognostic markers of HCMV disease still to be defined. However, the final step for definite diagnosis of congenital HCMV infection is detection of virus in the blood or urine in the first 1 to 2 weeks of life. To date, treatment of congenital infection with antiviral drugs is only palliative both prior to and after birth, whereas the only efficacious preventive measure seems to be the development of a safe and immunogenic vaccine, including recombinant, subunit, DNA, and peptide-based vaccines now under investigation. The following controversial issues are discussed in the light of the most recent advances in the field: the actual perception of the problem; universal serologic screening before pregnancy; the impact of correct counseling on decision making by the couple involved; the role of prenatal diagnosis in ascertaining transmission of virus to the fetus; the impact of preconceptional and periconceptional infections on the prevalence of congenital infection; and the prevalence of congenitally infected babies born to mothers who were immune prior to pregnancy compared to the number born to mothers undergoing primary infection during pregnancy. PMID

  14. Briacavatolides D–F, New Briaranes from the Taiwanese Octocoral Briareum excavatum

    PubMed Central

    Wang, Shang-Kwei; Yeh, Tsun-Tai; Duh, Chang-Yih

    2012-01-01

    In the continued search for novel bioactive substances from the Taiwanese octocoral Briareum excavatum collected at Orchid Island, three new briarane-type diterpenoids, briacavatolides D–F (1–3) were isolated from the acetone extract. The structures of these compounds were elucidated by extensive NMR spectroscopic analysis and physical data. The anti-HCMV (human cytomegalovirus) activity of 1–3 and their cytotoxicity against selected cancer cell lines were evaluated. PMID:23118724

  15. New Steroids from the Soft Coral Nephthea chabrolii

    PubMed Central

    Wang, Shang-Kwei; Puu, Shyh-Yueh; Duh, Chang-Yih

    2013-01-01

    A new cytotoxic 19-oxygenated steroid, nebrosteroid Q (1) and two new cytotoxic 19-norergosterols, nebrosteroids R and S (2 and 3) were isolated from the soft coral Nephthea chabrolii collected at San-Hsian-Tai. The structures of nebrosteroids Q–S (1–3) were elucidated by spectral analysis, and their cytotoxicity against selected cancer cells as well as antiviral activity against human cytomegalovirus (HCMV) were measured in vitro. PMID:23434799

  16. Phosphonate analogues of cyclopropavir phosphates and their E-isomers. Synthesis and antiviral activity.

    PubMed

    Mhaske, Santosh B; Ksebati, Bashar; Prichard, Mark N; Drach, John C; Zemlicka, Jiri

    2009-06-01

    Z- and E-Phosphonate analogues 12 and 13 derived from cyclopropavir and the corresponding cyclic phosphonates 14 and 15 were synthesized and their antiviral activity was investigated. The 2,2-bis(hydroxymethylmethylenecyclopropane acetate (17) was transformed to tetrahydropyranyl acetate 18. Deacetylation gave intermediate 19 which was converted to bromide 20. Alkylation with diisopropyl methylphosphonate afforded after protecting group exchange (21 to 22) acetylated phosphonate intermediate 22. Addition of bromine gave the dibromo derivative 16 which was used in the alkylation-elimination procedure with 2-amino-6-chloropurine to give Z- and E-isomers 23 and 24. Hydrolytic dechlorination coupled with removal of all protecting groups gave the guanine phosphonates 12 and 13. Cyclization afforded the cyclic phosphonates 14 and 15. Z-Phosphonate 12 was a potent and non-cytotoxic inhibitor of human and murine cytomegalovirus (HCMV and MCMV) with EC(50) 2.2-2.7 and 0.13 microM, respectively. It was also an effective agent against Epstein-Barr virus (EBV, EC(50) 3.1 microM). The cyclic phosphonate 14 inhibited HCMV (EC(50) 2.4-11.5 microM) and MCMV (EC(50) 0.4 microM) but it was ineffective against EBV. Both phosphonates 12 and 14 were as active against two HCMV Towne strains with mutations in UL97 as they were against wild-type HCMV thereby circumventing resistance due to such mutations. Z-Phosphonate 12 was a moderate inhibitor of replication of herpes simplex virus types 1 and 2 (HSV-1 and HSV-2) but it was a potent agent against varicella zoster virus (VZV, EC(50) 2.9 microM). The cyclic phosphonate 14 lacked significant potency against these viruses. E-isomers 13 and 15 were devoid of antiviral activity. PMID:19410465

  17. Phosphonate Analogues of Cyclopropavir Phosphates and Their E-isomers. Synthesis and Antiviral Activity

    PubMed Central

    Mhaske, Santosh B.; Ksebati, Bashar; Prichard, Mark N.; Drach, John C.; Zemlicka, Jiri

    2009-01-01

    Z- and E-phosphonate analogues 12 and 13 derived from cyclopropavir and the corresponding cyclic phosphonates 14 and 15 were synthesized and their antiviral activity was investigated. The 2,2-bis(hydroxymethylmethylenecyclopropane acetate (17) was transformed to tetrahydropyranyl acetate 18. Deacetylation gave intermediate 19 which was converted to bromide 20. Alkylation with diisopropyl methylphosphonate afforded after protecting group exchange (21 to 22) acetylated phosphonate intermediate 22. Addition of bromine gave the dibromo derivative 16 which was used in the alkylation-elimination procedure with 2-amino-6-chloropurine to give Z- and E-isomers 23 and 24. Hydrolytic dechlorination coupled with removal of all protecting groups gave the guanine phosphonates 12 and 13. Cyclization afforded the cyclic phosphonates 14 and 15. Z-Phosphonate 12 was a potent and non-cytotoxic inhibitor of human and murine cytomegalovirus (HCMV and MCMV) with EC50 2.2-2.7 and 0.13 μM, respectively. It was also an effective agent against Epstein-Barr virus (EBV, EC50 3.1 μM). The cyclic phosphonate 14 inhibited HCMV (EC50 2.4-11.5 μM) and MCMV (EC50 0.4 μM) but it was ineffective against EBV. Both phosphonates 12 and 14 were as active against two HCMV Towne strains with mutations in UL97 as they were against wild-type HCMV thereby circumventing resistance due to such mutations. Z-Phosphonate 12 was a moderate inhibitor of replication of herpes simplex virus types 1 and 2 (HSV-1 and HSV-2) but it was a potent agent against varicella zoster virus (VZV, EC50 2.9 μM). The cyclic phosphonate 14 lacked significant potency against these viruses. E-isomers 13 and 15 were devoid of antiviral activity. PMID:19410465

  18. A Homolog Pentameric Complex Dictates Viral Epithelial Tropism, Pathogenicity and Congenital Infection Rate in Guinea Pig Cytomegalovirus

    PubMed Central

    McGregor, Alistair

    2016-01-01

    In human cytomegalovirus (HCMV), tropism to epithelial and endothelial cells is dependent upon a pentameric complex (PC). Given the structure of the placenta, the PC is potentially an important neutralizing antibody target antigen against congenital infection. The guinea pig is the only small animal model for congenital CMV. Guinea pig cytomegalovirus (GPCMV) potentially encodes a UL128-131 HCMV PC homolog locus (GP128-GP133). In transient expression studies, GPCMV gH and gL glycoproteins interacted with UL128, UL130 and UL131 homolog proteins (designated GP129 and GP131 and GP133 respectively) to form PC or subcomplexes which were determined by immunoprecipitation reactions directed to gH or gL. A natural GP129 C-terminal deletion mutant (aa 107–179) and a chimeric HCMV UL128 C-terminal domain swap GP129 mutant failed to form PC with other components. GPCMV infection of a newly established guinea pig epithelial cell line required a complete PC and a GP129 mutant virus lacked epithelial tropism and was attenuated in the guinea pig for pathogenicity and had a low congenital transmission rate. Individual knockout of GP131 or 133 genes resulted in loss of viral epithelial tropism. A GP128 mutant virus retained epithelial tropism and GP128 was determined not to be a PC component. A series of GPCMV mutants demonstrated that gO was not strictly essential for epithelial infection whereas gB and the PC were essential. Ectopic expression of a GP129 cDNA in a GP129 mutant virus restored epithelial tropism, pathogenicity and congenital infection. Overall, GPCMV forms a PC similar to HCMV which enables evaluation of PC based vaccine strategies in the guinea pig model. PMID:27387220

  19. Chromatin structure regulates human cytomegalovirus gene expression during latency, reactivation and lytic infection.

    PubMed

    Sinclair, John

    2010-01-01

    Infection of cells with human cytomegalovirus (HCMV) has two potential outcomes. For instance, infection of fibroblasts results in extensive viral gene expression, viral DNA replication and release of progeny virus. In contrast, in undifferentiated myeloid cells, the lytic transcription programme of HCMV is effectively suppressed and cells undergo latent infection. It is now accepted that the suppression of viral lytic gene expression observed during latency in myeloid cells is a result of the inability of undifferentiated cell types to support robust viral immediate early (IE) gene expression--crucial genes responsible for driving the lytic cycle. The repression of IE gene expression in undifferentiated myeloid cells, at least in part, results from specific post-translational modifications of histones associated with the viral major immediate early promoter (MIEP). In cells of the early myeloid lineage, the histone modifications present on the MIEP impart on it a repressive chromatin structure preventing transcriptional activity. Reactivation of HCMV lytic infection is correlated to changes in histone modifications around the MIEP resulting in a chromatin structure conducive to transcriptional activity. These changes are intimately linked with the differentiation of myeloid cells - a phenomenon known to reactivate latent virus in vivo. Chromatin structure of the viral MIEP, therefore, plays a crucial role in latency and reactivation of this persistent human herpesvirus. Whether chromatin-mediated regulation of viral lytic gene expression also occurs, is only beginning to be addressed. However, recent work suggests that all classes of lytic HCMV promoters are subjected to regulation by post-translational modification of their associated histones throughout the time course of infection. Incoming viral genomes appear to be the targets of intrinsic cellular defence mechanisms which attempt to silence viral gene expression through chromatinisation. Viral functions

  20. Inhibition of p53 transcriptional activity by human cytomegalovirus UL44.

    PubMed

    Kwon, Yejin; Kim, Mi-Na; Young Choi, Eun; Heon Kim, Jung; Hwang, Eung-Soo; Cha, Chang-Yong

    2012-05-01

    Human cytomegalovirus (HCMV) stimulates cellular synthesis of DNA and proteins and induces transition of the cell cycle from G(1) to S and G(2) /M phase, in spite of increased amounts of p53 in the infected cells. The immediate early protein IE2-86  kDa (IE86) tethers a transcriptional repression domain to p53; however, its repression of p53 function is not enough to abrogate the G(1) checkpoint function of p53. Other HCMV proteins that suppress the activity of p53 were investigated in this study. Of the HCMV proteins that bind to p53 when assessed by immunoprecipitation and immunoblot analysis, HCMV UL44 was chosen as a candidate protein. It was found that reporter gene containing p53 consensus sequence was activated by transfection with wild type p53, but when plasmids of p53 with IE86 or UL44 were co-transfected, p53 transcriptional activity was decreased to 3-7% of the p53 control in a dose-dependent manner. When the deletion mutant of UL44 was co-transected with p53, the carboxyl one-third portion of UL44 had little effect on inhibition of p53 transcriptional activity. The amount of mRNA p21 was measured in H1299 by real time PCR after transfection of the combination of p53 and UL44 vectors and it was found that p21 transcription by p53 was inhibited dose-dependently by UL44. Increased G0/G1 and decreased S phases in p53 wild type-transfected H1299 cells were recovered to the level of p53 mutant type-transfected ones by the additional transfection of UL44 in a dose-dependent manner. In conclusion, the transcriptional activity of p53 is suppressed by UL44 as well as by IE86. PMID:22376288

  1. NKG2D ligand MICA is retained in the cis-Golgi apparatus by human cytomegalovirus protein UL142.

    PubMed

    Ashiru, Omodele; Bennett, Neil J; Boyle, Louise H; Thomas, Mair; Trowsdale, John; Wills, Mark R

    2009-12-01

    Human cytomegalovirus (HCMV) evades T-cell recognition by down-regulating expression of major histocompatibility complex (MHC) class I and II molecules on the surfaces of infected cells. Contrary to the "missing-self" hypothesis, HCMV-infected cells are refractory to lysis by natural killer (NK) cells. Inhibition of NK cell function is mediated by a number of HCMV immune evasion molecules, which operate by delivering inhibitory signals to NK cells and preventing engagement of activating ligands. One such molecule is UL142, which is an MHC class I-related glycoprotein encoded by clinical isolates and low-passage-number strains of HCMV. UL142 is known to down-modulate surface expression of MHC class I-related chain A (MICA), which is a ligand of the activating NK receptor NKG2D. However, the mechanism by which UL142 interferes with MICA is unknown. Here, we show that UL142 localizes predominantly to the endoplasmic reticulum (ER) and cis-Golgi apparatus. The transmembrane domain of UL142 mediates its ER localization, while we propose that the UL142 luminal domain is involved in its cis-Golgi localization. We also confirm that UL142 down-modulates surface expression of full-length MICA alleles while having no effect on the truncated allele MICA*008. However, we demonstrate for the first time that UL142 retains full-length MICA alleles in the cis-Golgi apparatus. In addition, we propose that UL142 interacts with nascent MICA en route to the cell surface but not mature MICA at the cell surface. Our data also demonstrate that the UL142 luminal and transmembrane domains are involved in recognition and intracellular sequestration of full-length MICA alleles. PMID:19793804

  2. Deletion of the Human Cytomegalovirus US17 Gene Increases the Ratio of Genomes per Infectious Unit and Alters Regulation of Immune and Endoplasmic Reticulum Stress Response Genes at Early and Late Times after Infection

    PubMed Central

    Gurczynski, Stephen J.; Das, Subhendu

    2014-01-01

    Human cytomegalovirus (HCMV) employs numerous strategies to combat, subvert, or co-opt host immunity. One evolutionary strategy for this involves capture of a host gene and then its successive duplication and divergence, forming a family of genes, many of which have immunomodulatory activities. The HCMV US12 family consists of 10 tandemly arranged sequence-related genes in the unique short (US) region of the HCMV genome (US12 to US21). Each gene encodes a protein possessing seven predicted transmembrane domains, patches of sequence similarity with cellular G-protein-coupled receptors, and the Bax inhibitor 1 family of antiapoptotic proteins. We show that one member, US17, plays an important role during virion maturation. Microarray analysis of cells infected with a recombinant HCMV isolate with a US17 deletion (the ΔUS17 mutant virus) revealed blunted host innate and interferon responses at early times after infection (12 h postinfection [hpi]), a pattern opposite that previously seen in the absence of the immunomodulatory tegument protein pp65 (pUL83). Although the ΔUS17 mutant virus produced numbers of infectious particles in fibroblasts equal to the numbers produced by the parental virus, it produced >3-fold more genome-containing noninfectious viral particles and delivered increased amounts of pp65 to newly infected cells. These results suggest that US17 has evolved to control virion composition, to elicit an appropriately balanced host immune response. At later time points (96 hpi), ΔUS17 mutant-infected cells displayed aberrant expression of several host endoplasmic reticulum stress response genes and chaperones, some of which are important for the final stages of virion assembly and egress. Our results suggest that US17 modulates host pathways to enable production of virions that elicit an appropriately balanced host immune response. PMID:24335296

  3. Proteomic Analysis of the Multimeric Nuclear Egress Complex of Human Cytomegalovirus*

    PubMed Central

    Milbradt, Jens; Kraut, Alexandra; Hutterer, Corina; Sonntag, Eric; Schmeiser, Cathrin; Ferro, Myriam; Wagner, Sabrina; Lenac, Tihana; Claus, Claudia; Pinkert, Sandra; Hamilton, Stuart T.; Rawlinson, William D.; Sticht, Heinrich; Couté, Yohann; Marschall, Manfred

    2014-01-01

    Herpesviral capsids are assembled in the host cell nucleus before being translocated into the cytoplasm for further maturation. The crossing of the nuclear envelope represents a major event that requires the formation of the nuclear egress complex (NEC). Previous studies demonstrated that human cytomegalovirus (HCMV) proteins pUL50 and pUL53, as well as their homologs in all members of Herpesviridae, interact with each other at the nuclear envelope and form the heterodimeric core of the NEC. In order to characterize further the viral and cellular protein content of the multimeric NEC, the native complex was isolated from HCMV-infected human primary fibroblasts at various time points and analyzed using quantitative proteomics. Previously postulated components of the HCMV-specific NEC, as well as novel potential NEC-associated proteins such as emerin, were identified. In this regard, interaction and colocalization between emerin and pUL50 were confirmed by coimmunoprecipitation and confocal microscopy analyses, respectively. A functional validation of viral and cellular NEC constituents was achieved through siRNA-mediated knockdown experiments. The important role of emerin in NEC functionality was demonstrated by a reduction of viral replication when emerin expression was down-regulated. Moreover, under such conditions, reduced production of viral proteins and deregulation of viral late cytoplasmic maturation were observed. Combined, these data prove the functional importance of emerin as an NEC component, associated with pUL50, pUL53, pUL97, p32/gC1qR, and further regulatory proteins. Summarized, our findings provide the first proteomics-based characterization and functional validation of the HCMV-specific multimeric NEC. PMID:24969177

  4. Nucleolin associates with the human cytomegalovirus DNA polymerase accessory subunit UL44 and is necessary for efficient viral replication.

    PubMed

    Strang, Blair L; Boulant, Steeve; Coen, Donald M

    2010-02-01

    In the eukaryotic cell, DNA replication entails the interaction of multiple proteins with the DNA polymerase processivity factor PCNA. As the structure of the presumptive human cytomegalovirus (HCMV) DNA polymerase processivity factor UL44 is highly homologous to that of PCNA, we hypothesized that UL44 also interacts with numerous proteins. To investigate this possibility, recombinant HCMV expressing FLAG-tagged UL44 was generated and used to immunoprecipitate UL44 and associated proteins from infected cell lysates. Unexpectedly, nucleolin, a major protein component of the nucleolus, was identified among these proteins by mass spectrometry and Western blotting. The association of nucleolin and UL44 in infected cell lysate was confirmed by reciprocal coimmunoprecipitation in the presence and absence of nuclease. Western blotting and immunofluorescence assays demonstrated that the level of nucleolin increases during infection and that nucleolin becomes distributed throughout the nucleus. Furthermore, the colocalization of nucleolin and UL44 in infected cell nuclei was observed by immunofluorescence assays. Assays of HCMV-infected cells treated with small interfering RNA (siRNA) targeting nucleolin mRNA indicated that nucleolin was required for efficient virus production, viral DNA synthesis, and the expression of a late viral protein, with a correlation between the efficacy of knockdown and the effect on virus replication. In contrast, the level of neither global protein synthesis nor the replication of an unrelated virus (reovirus) was reduced in siRNA-treated cells. Taken together, our results indicate an association of nucleolin and UL44 in HCMV-infected cells and a role for nucleolin in viral DNA synthesis. PMID:20007282

  5. Cis and Trans Acting Factors Involved in Human Cytomegalovirus Experimental and Natural Latent Infection of CD14 (+) Monocytes and CD34 (+) Cells

    PubMed Central

    Pari, Gregory S.

    2013-01-01

    The parameters involved in human cytomegalovirus (HCMV) latent infection in CD14 (+) and CD34 (+) cells remain poorly identified. Using next generation sequencing we deduced the transcriptome of HCMV latently infected CD14 (+) and CD34 (+) cells in experimental as well as natural latency settings. The gene expression profile from natural infection in HCMV seropositive donors closely matched experimental latency models, and included two long non-coding RNAs (lncRNAs), RNA4.9 and RNA2.7 as well as the mRNAs encoding replication factors UL84 and UL44. Chromatin immunoprecipitation assays on experimentally infected CD14 (+) monocytes followed by next generation sequencing (ChIP-Seq) were employed to demonstrate both UL84 and UL44 proteins interacted with the latent viral genome and overlapped at 5 of the 8 loci identified. RNA4.9 interacts with components of the polycomb repression complex (PRC) as well as with the MIE promoter region where the enrichment of the repressive H3K27me3 mark suggests that this lncRNA represses transcription. Formaldehyde Assisted Isolation of Regulatory Elements (FAIRE), which identifies nucleosome-depleted viral DNA, was used to confirm that latent mRNAs were associated with actively transcribed, FAIRE analysis also showed that the terminal repeat (TR) region of the latent viral genome is depleted of nucleosomes suggesting that this region may contain an element mediating viral genome maintenance. ChIP assays show that the viral TR region interacts with factors associated with the pre replication complex and a plasmid subclone containing the HCMV TR element persisted in latently infected CD14 (+) monocytes, strongly suggesting that the TR region mediates viral chromosome maintenance. PMID:23717203

  6. Identification of a novel nonsense mutation in RP1 that causes autosomal recessive retinitis pigmentosa in an Indonesian family

    PubMed Central

    Siemiatkowska, Anna M.; Astuti, Galuh D.N.; Arimadyo, Kentar; den Hollander, Anneke I.; Faradz, Sultana M.H.; Cremers, Frans P.M.

    2012-01-01

    Purpose The purpose of this study was to identify the underlying molecular genetic defect in an Indonesian family with three affected individuals who had received a diagnosis of retinitis pigmentosa (RP). Methods Clinical evaluation of the family members included measuring visual acuity and fundoscopy, and assessing visual field and color vision. Genomic DNA of the three affected individuals was analyzed with Illumina 700k single nucleotide polymorphism (SNP) arrays, and homozygous regions were identified using PLINK software. Mutation analysis was performed with sequence analysis of the retinitis pigmentosa 1 (RP1) gene that resided in one of the homozygous regions. The frequency of the identified mutation in the Indonesian population was determined with TaqI restriction fragment length polymorphism analysis. Results A novel homozygous nonsense mutation in exon 4 of the RP1 gene, c.1012C>T (p.R338*), was identified in the proband and her two affected sisters. Unaffected family members either carried two wild-type alleles or were heterozygous carriers of the mutation. The mutation was not present in 184 Indonesian control samples. Conclusions Most of the previously reported RP1 mutations are inherited in an autosomal dominant mode, and appear to cluster in exon 4. Here, we identified a novel homozygous p.R338* mutation in exon 4 of RP1, and speculate on the mutational mechanisms of different RP1 mutations underlying dominant and recessive RP. PMID:23077400

  7. NAB2-STAT6 Gene Fusion in Meningeal Hemangiopericytoma and Solitary Fibrous Tumor.

    PubMed

    Fritchie, Karen J; Jin, Long; Rubin, Brian P; Burger, Peter C; Jenkins, Sarah M; Barthelmeß, Sarah; Moskalev, Evgeny A; Haller, Florian; Oliveira, Andre M; Giannini, Caterina

    2016-03-01

    Meningeal solitary fibrous tumor (SFT) and hemangiopericytoma (HPC) are considered to be distinct entities in the WHO Classification of CNS Tumours (2007). They harbor NAB2-STAT6 fusions similar to their soft tissue counterparts, supporting the view that they are part of a tumor continuum. We examined 30 meningeal-based tumors originally diagnosed as either SFT or HPC. These showed a spectrum of morphologic features and were diagnosed as SFTs, malignant SFTs, HPCs, or tumors with "intermediate" features. All of the tumors showed nuclear expression of STAT6. SFTs consistently expressed diffuse CD34, while HPCs and intermediate tumors had heterogeneous staining. NAB2-STAT6 fusions were identified in 20 cases, including 7 with exon 4-exon 3, 9 with exon 6-exon 17, and 4 with exon 6-exon 18 fusions. NAB2 exon 4-STAT6 exon 3 fusion correlated with classic SFT morphology and older age and showed a trend toward less mitotic activity; there was also a trend toward more aggressive behavior in tumors lacking NAB2 exon 4-STAT6 exon 3. Thus, despite their clinical and morphologic differences, meningeal-based SFTs, HPCs, and tumors with intermediate features, similar to their soft tissue counterparts, form a histopathologic spectrum unified by STAT6 immunoexpression and NAB2-STAT6 fusion. PMID:26883114

  8. CYP1A1, mEH, and GSTM1 Polymophisms and Risk of Oral and Pharyngeal Cancer: A Spanish Case-Control Study

    PubMed Central

    Varela-Lema, L.; Ruano-Ravina, A.; Juiz Crespo, M. A.; Kelsey, K. T.; Loidi, L.; Barros-Dios, J. M.

    2008-01-01

    Background. Genetic polymorphisms of drug metabolizing enzymes involved in the detoxification pathways of carcinogenic substances may influence cancer risk. Methods. Case-control study that investigates the relationship between CYP1A1 Ile/Val, exon 4 mEH, and GSTM1 null genetic polymorphism and the risk of oral and pharyngeal cancer examining the interaction between these genes, tobacco, and alcohol. 92 incident cases and 130 consecutive hospital-based controls have been included. Results. No significant associations were found for any of the genotypes assessed. The estimated risk was slightly elevated in subjects with the wild type of the mEH gene and the null GSTM1 genotype. For exon 4 mEH heterozygous polymorphism, the risk was slightly lower for heavy smokers than for light smokers. The inverse association was observed for the GSTM1 null genotype. Conclusions. The results suggest that exon 4 mEH and GSTM1 null polymorphisms might influence oral and pharyngeal cancer. PMID:19259333

  9. CYP1A1, mEH, and GSTM1 Polymophisms and Risk of Oral and Pharyngeal Cancer: A Spanish Case-Control Study.

    PubMed

    Varela-Lema, L; Ruano-Ravina, A; Juiz Crespo, M A; Kelsey, K T; Loidi, L; Barros-Dios, J M

    2008-01-01

    Background. Genetic polymorphisms of drug metabolizing enzymes involved in the detoxification pathways of carcinogenic substances may influence cancer risk. Methods. Case-control study that investigates the relationship between CYP1A1 Ile/Val, exon 4 mEH, and GSTM1 null genetic polymorphism and the risk of oral and pharyngeal cancer examining the interaction between these genes, tobacco, and alcohol. 92 incident cases and 130 consecutive hospital-based controls have been included. Results. No significant associations were found for any of the genotypes assessed. The estimated risk was slightly elevated in subjects with the wild type of the mEH gene and the null GSTM1 genotype. For exon 4 mEH heterozygous polymorphism, the risk was slightly lower for heavy smokers than for light smokers. The inverse association was observed for the GSTM1 null genotype. Conclusions. The results suggest that exon 4 mEH and GSTM1 null polymorphisms might influence oral and pharyngeal cancer. PMID:19259333

  10. The Transcription and Translation Landscapes during Human Cytomegalovirus Infection Reveal Novel Host-Pathogen Interactions.

    PubMed

    Tirosh, Osnat; Cohen, Yifat; Shitrit, Alina; Shani, Odem; Le-Trilling, Vu Thuy Khanh; Trilling, Mirko; Friedlander, Gilgi; Tanenbaum, Marvin; Stern-Ginossar, Noam

    2015-01-01

    Viruses are by definition fully dependent on the cellular translation machinery, and develop diverse mechanisms to co-opt this machinery for their own benefit. Unlike many viruses, human cytomegalovirus (HCMV) does suppress the host translation machinery, and the extent to which translation machinery contributes to the overall pattern of viral replication and pathogenesis remains elusive. Here, we combine RNA sequencing and ribosomal profiling analyses to systematically address this question. By simultaneously examining the changes in transcription and translation along HCMV infection, we uncover extensive transcriptional control that dominates the response to infection, but also diverse and dynamic translational regulation for subsets of host genes. We were also able to show that, at late time points in infection, translation of viral mRNAs is higher than that of cellular mRNAs. Lastly, integration of our translation measurements with recent measurements of protein abundance enabled comprehensive identification of dozens of host proteins that are targeted for degradation during HCMV infection. Since targeted degradation indicates a strong biological importance, this approach should be applicable for discovering central host functions during viral infection. Our work provides a framework for studying the contribution of transcription, translation and degradation during infection with any virus. PMID:26599541

  11. Adenovirus-mediated expression of an elastase-specific inhibitor (elafin): a comparison of different promoters.

    PubMed

    Sallenave, J M; Xing, Z; Simpson, A J; Graham, F L; Gauldie, J

    1998-03-01

    This report describes the design and construction of three recombinant adenoviruses of serotype 5 (Ad5) expressing elafin (EL), also called elastase-specific inhibitor. Three promoters were chosen to drive the synthesis of elafin: the small (380 bp) human cytomegalovirus promoter (HCMV), the Ad2 major late promoter (MLP) and the mouse cytomegalovirus (MCMV) promoter. Human alveolar epithelial cells (A549), as well as rat and human primary pulmonary fibroblasts were infected with Ad5-HCMV-EL, Ad5-MLP-EL, Ad5-MCMV-EL and with the control Ad5-dl70/3. The MCMV promoter was the most efficient promoter in all cells studied. MLP was the least efficient promoter Intermediate between MCMV and MLP was HCMV which was able to induce significant amounts of elafin, particularly in human A549 cells. When compared in vivo in rat lungs, results were similar; MCMV was the only promoter which induced significant amounts of elafin as assessed by Northern blot analysis and ELISA, even with a low dose of virus (3 x 10(8) p.f.u.). Our data indicate that the MCMV promoter is the promoter of choice for the strong induction of adenovirus-mediated transgenes in the lung and suggest its suitability both in rodent experimental models and in humans for investigative and therapeutic purposes. PMID:9614555

  12. Human cytomegalovirus UL97 kinase confers ganciclovir susceptibility to recombinant vaccinia virus.

    PubMed Central

    Metzger, C; Michel, D; Schneider, K; Lüske, A; Schlicht, H J; Mertens, T

    1994-01-01

    We analyzed whether the phosphotransferase encoded by the UL97 open reading frame of human cytomegalovirus (HCMV) alone is sufficient to confer ganciclovir (GCV) susceptibility to a foreign virus. Two vaccinia virus recombinants (T1 and A5) containing the UL97 open reading frames from a GCV-sensitive HCMV and from a GCV-resistant strain were constructed. T1 exhibited a GCV-sensitive phenotype in plaque reduction assays, whereas A5 did not. Moreover, T1-infected cell cultures showed a strongly increased incorporation of [14C]GCV triphosphate into macromolecular DNA, compared with recombinant A5 or vaccinia virus controls, which could be inhibited by the addition of guanosine. This shows that UL97 kinase is the only additional gene product required to make vaccinia virus susceptible to GCV, and guanosine seems to be one natural substrate for the enzyme. The system described here should be very helpful for fast and detailed functional analyses of UL97 mutations found in GCV-resistant HCMV isolates. Images PMID:7966639

  13. Antiviral Drug- and Multidrug Resistance in Cytomegalovirus Infected SCT Patients

    PubMed Central

    Göhring, Katharina; Hamprecht, Klaus; Jahn, Gerhard

    2015-01-01

    In pediatric and adult patients after stem cell transplantation (SCT) disseminated infections caused by human cytomegalovirus (HCMV) can cause life threatening diseases. For treatment, the three antivirals ganciclovir (GCV), foscarnet (PFA) and cidofovir (CDV) are approved and most frequently used. Resistance to all of these antiviral drugs may induce a severe problem in this patient cohort. Responsible for resistance phenomena are mutations in the HCMV phosphotransferase-gene (UL97) and the polymerase-gene (UL54). Most frequently mutations in the UL97-gene are associated with resistance to GCV. Resistance against all three drugs is associated to mutations in the UL54-gene. Monitoring of drug resistance by genotyping is mostly done by PCR-based Sanger sequencing. For phenotyping with cell culture the isolation of HCMV is a prerequisite. The development of multidrug resistance with mutation in both genes is rare, but it is often associated with a fatal outcome. The manifestation of multidrug resistance is mostly associated with combined UL97/UL54-mutations. Normally, mutations in the UL97 gene occur initially followed by UL54 mutation after therapy switch. The appearance of UL54-mutation alone without any detection of UL97-mutation is rare. Interestingly, in a number of patients the UL97 mutation could be detected in specific compartments exclusively and not in blood. PMID:25750703

  14. Use of flow cytometry for characterization of human cytomegalovirus vaccine particles.

    PubMed

    Vlasak, Josef; Hoang, Van M; Christanti, Sianny; Peluso, Richard; Li, Fengsheng; Culp, Timothy D

    2016-04-29

    Despite a 40-year effort, an effective vaccine against human cytomegalovirus (HCMV) remains an unmet medical need. The discovery of potent neutralizing epitopes on the pentameric gH complex (gH/gL/UL128/130/131) has reenergized HCMV vaccine development. Our whole-virus vaccine candidate, currently in a Phase I clinical trial, is based on the attenuated AD169 strain with restored expression of the pentameric gH complex. Given the complexity of a whole-virus vaccine, improved analytical methods have been developed to better characterize heterogeneous viral particles released from infected cells during vaccine production. Here we show the utility of a commercial flow cytometer for the detection of individual HCMV particles, either via light scattering or using fluorescence after labeling of specific antigens. Rapid measurements requiring minimal material provide near real-time information on particle concentration, distributions of different particle types, and product purity. Additionally, utilizing immunoreagents has allowed us to characterize the distribution of key antigens across individual particles and particle types. PMID:27020711

  15. Analysis of the role of autophagy inhibition by two complementary human cytomegalovirus BECN1/Beclin 1-binding proteins.

    PubMed

    Mouna, Lina; Hernandez, Eva; Bonte, Dorine; Brost, Rebekka; Amazit, Larbi; Delgui, Laura R; Brune, Wolfram; Geballe, Adam P; Beau, Isabelle; Esclatine, Audrey

    2016-01-01

    Autophagy is activated early after human cytomegalovirus (HCMV) infection but, later on, the virus blocks autophagy. Here we characterized 2 HCMV proteins, TRS1 and IRS1, which inhibit autophagy during infection. Expression of either TRS1 or IRS1 was able to block autophagy in different cell lines, independently of the EIF2S1 kinase, EIF2AK2/PKR. Instead, TRS1 and IRS1 interacted with the autophagy protein BECN1/Beclin 1. We mapped the BECN1-binding domain (BBD) of IRS1 and TRS1 and found it to be essential for autophagy inhibition. Mutant viruses that express only IRS1 or TRS1 partially controlled autophagy, whereas a double mutant virus expressing neither protein stimulated autophagy. A mutant virus that did not express IRS1 and expressed a truncated form of TRS1 in which the BBD was deleted, failed to control autophagy. However, this mutant virus had similar replication kinetics as wild-type virus, suggesting that autophagy inhibition is not critical for viral replication. In fact, using pharmacological modulators of autophagy and inhibition of autophagy by shRNA knockdown, we discovered that stimulating autophagy enhanced viral replication. Conversely, inhibiting autophagy decreased HCMV infection. Thus, our results demonstrate a new proviral role of autophagy for a DNA virus. PMID:26654401

  16. The switch from latent to productive infection in epstein-barr virus-infected B cells is associated with sensitization to NK cell killing.

    PubMed

    Pappworth, Isabel Y; Wang, Eddie C; Rowe, Martin

    2007-01-01

    Following activation of Epstein-Barr virus (EBV)-infected B cells from latent to productive (lytic) infection, there is a concomitant reduction in the level of cell surface major histocompatibility complex (MHC) class I molecules and an impaired antigen-presenting function that may facilitate evasion from EBV-specific CD8+ cytotoxic T cells. In some other herpesviruses studied, most notably human cytomegalovirus (HCMV), evasion of virus-specific CD8+ effector responses via downregulation of surface MHC class I molecules is supplemented with specific mechanisms for evading NK cells. We now report that EBV differs from HCMV in this respect. While latently infected EBV-positive B cells were resistant to lysis by two NK lines and by primary polyclonal NK cells from peripheral blood, these effectors efficiently killed cells activated into the lytic cycle. Susceptibility to NK lysis coincided not only with downregulation of HLA-A, -B, and -C molecules that bind to the KIR family of inhibitory receptors on NK cells but also with downregulation of HLA-E molecules binding the CD94/NKG2A inhibitory receptors. Conversely, ULBP-1 and CD112, ligands for the NK cell-activating receptors NKG2D and DNAM-1, respectively, were elevated. Susceptibility of the virus-producing target cells to NK cell lysis was partially reversed by blocking ULBP-1 or CD112 with specific antibodies. These results highlight a fundamental difference between EBV and HCMV with regards to evasion of innate immunity. PMID:17079298

  17. Drug Repurposing Approach Identifies Inhibitors of the Prototypic Viral Transcription Factor IE2 that Block Human Cytomegalovirus Replication.

    PubMed

    Mercorelli, Beatrice; Luganini, Anna; Nannetti, Giulio; Tabarrini, Oriana; Palù, Giorgio; Gribaudo, Giorgio; Loregian, Arianna

    2016-03-17

    New targets for antiviral strategies are needed against human cytomegalovirus (HCMV), a major human pathogen. A cell-based screen aimed at finding inhibitors of the viral transcription factor Immediate-Early 2 (IE2) was performed in HCMV-infected cells expressing EGFP under the control of an IE2-inducible viral promoter. Screening of a library of bioactive small molecules led to the identification of several compounds able to inhibit EGFP expression and also HCMV replication with potency in the low-micromolar range. Follow-up studies with four selected hits indicated that they all block viral DNA synthesis as well as viral Early and Late gene expression. Furthermore, mechanistic studies confirmed that the compounds specifically act via inhibition of IE2 transactivating activity, thus blocking viral Early gene expression and the progression of virus replication. These results provide proof of concept for identifying small molecules that modulate the activity of a microbial transcription factor to control pathogen replication. PMID:26877023

  18. Human Cytomegalovirus UL40 Signal Peptide Regulates Cell Surface Expression of the Natural Killer Cell Ligands HLA-E and gpUL18

    PubMed Central

    Prod’homme, Virginie; Tomasec, Peter; Cunningham, Charles; Lemberg, Marius K.; Stanton, Richard J.; McSharry, Brian P.; Wang, Eddie C.Y.; Cuff, Simone; Martoglio, Bruno; Davison, Andrew J.; Braud, Véronique M.; Wilkinson, Gavin W. G.

    2012-01-01

    Human cytomegalovirus (HCMV)-encoded NK cell evasion functions include an MHC-I homologue (UL18) with high affinity for the leukocyte inhibitory receptor LIR-1 (CD85j, ILT2 or LILRB1) and a signal peptide (SPUL40) that acts by upregulating cell surface expression of HLA-E. Detailed characterization of SPUL40 revealed that the N-terminal 14 amino acid residues bestowed TAP-independent upregulation of HLA-E, while c-region sequences delayed processing of SPUL40 by a signal peptide peptidase-type intramembrane protease. Most significantly, the consensus HLA-E-binding epitope within SPUL40 was shown to promote cell surface expression of both HLA-E and gpUL18. UL40 was found to possess two transcription start sites, with utilization of the downstream site resulting in translational being initiated within the HLA-E-binding epitope (P2). Remarkably, this truncated SPUL40 was functional and retained the capacity to upregulate gpUL18, but not HLA-E. Our findings thus identify an elegant mechanism by which an HCMV signal peptide differentially regulates two distinct NK cell evasion pathways. Moreover, we describe a natural SPUL40 mutant that provides the first example of an HCMV clinical virus with a defect in an NK cell evasion function and exemplifies issues that confront the virus when adapting to immunogenetic diversity in the host. PMID:22345649

  19. Human cytomegalovirus UL40 signal peptide regulates cell surface expression of the NK cell ligands HLA-E and gpUL18.

    PubMed

    Prod'homme, Virginie; Tomasec, Peter; Cunningham, Charles; Lemberg, Marius K; Stanton, Richard J; McSharry, Brian P; Wang, Eddie C Y; Cuff, Simone; Martoglio, Bruno; Davison, Andrew J; Braud, Véronique M; Wilkinson, Gavin W G

    2012-03-15

    Human CMV (HCMV)-encoded NK cell-evasion functions include an MHC class I homolog (UL18) with high affinity for the leukocyte inhibitory receptor-1 (CD85j, ILT2, or LILRB1) and a signal peptide (SP(UL40)) that acts by upregulating cell surface expression of HLA-E. Detailed characterization of SP(UL40) revealed that the N-terminal 14 aa residues bestowed TAP-independent upregulation of HLA-E, whereas C region sequences delayed processing of SP(UL40) by a signal peptide peptidase-type intramembrane protease. Most significantly, the consensus HLA-E-binding epitope within SP(UL40) was shown to promote cell surface expression of both HLA-E and gpUL18. UL40 was found to possess two transcription start sites, with utilization of the downstream site resulting in translation being initiated within the HLA-E-binding epitope (P2). Remarkably, this truncated SP(UL40) was functional and retained the capacity to upregulate gpUL18 but not HLA-E. Thus, our findings identify an elegant mechanism by which an HCMV signal peptide differentially regulates two distinct NK cell-evasion pathways. Moreover, we describe a natural SP(UL40) mutant that provides a clear example of an HCMV clinical virus with a defect in an NK cell-evasion function and exemplifies issues that confront the virus when adapting to immunogenetic diversity in the host. PMID:22345649

  20. Spatial Relationships between Markers for Secretory and Endosomal Machinery in Human Cytomegalovirus-Infected Cells versus Those in Uninfected Cells▿†

    PubMed Central

    Das, Subhendu; Pellett, Philip E.

    2011-01-01

    Human cytomegalovirus (HCMV) induces extensive remodeling of the secretory apparatus to form the cytoplasmic virion assembly compartment (cVAC), where virion tegumentation and envelopment take place. We studied the structure of the cVAC by confocal microscopy to assess the three-dimensional distribution of proteins specifically associated with individual secretory organelles. In infected cells, early endosome antigen 1 (EEA1)-positive vesicles are concentrated at the center of the cVAC and, as previously seen, are distinct from structures visualized by markers for the endoplasmic reticulum, Golgi apparatus, and trans-Golgi network (TGN). EEA1-positive vesicles can be strongly associated with markers for recycling endosomes, to a lesser extent with markers associated with components of the endosomal sorting complex required for transport III (ESCRT III) machinery, and then with markers of late endosomes. In comparisons of uninfected and infected cells, we found significant changes in the structural associations and colocalization of organelle markers, as well as in net organelle volumes. These results provide new evidence that the HCMV-induced remodeling of the membrane transport apparatus involves much more than simple relocation and expansion of preexisting structures and are consistent with the hypothesis that the shift in identity of secretory organelles in HCMV-infected cells results in new functional profiles. PMID:21471245

  1. The cytomegalovirus protein UL138 induces apoptosis of gastric cancer cells by binding to heat shock protein 70

    PubMed Central

    Zhang, Liang; Guo, Gangqiang; Sun, Xiangwei; Chen, Jing; Ye, Lulu; Ye, Sisi; Mao, Chenchen; Xu, Jianfeng; Zhang, Lifang; Jiang, Lubin; Shen, Xian; Xue, Xiangyang

    2016-01-01

    It has been hypothesized that human cytomegalovirus (HCMV) could act as a tumor promoter and play an “oncomodulatory” role in the neoplastic process of several human malignancies. However, we demonstrate for the first time that UL138, a HCMV latency-associated gene, could act as a tumor inhibitor in gastric cancer (GC). The expression of UL138 is down-regulated in HCMV positive gastric adenocarcinoma tissues, especially in poorly or none differentiated tumors. Overexpression of UL138 in several human GC cell lines inhibits cell viability and induces apoptosis, in association with the reduction of an anti-apoptotic Bcl-2 protein and the induction of cleaved caspase-3 and caspase-9. Moreover, protein array analysis reveals that UL138 interacts with a chaperone protein, heat shock protein 70 (HSP70). This interaction is confirmed by immunoprecipitation and immunostaining in situ in GC cell lines. In addition, this UL138-mediated cancer cell death could efficiently lead to suppression of human tumor growth in a xenograft animal model of GC. In conclusion, these results uncover a previously unknown role of the cytomegalovirus protein UL138 in inducing GC cells apoptosis, which might imply a general mechanism that viral proteins inhibit cancer growth in interactions with both chaperones and apoptosis-related proteins. Our findings might provide a potential target for new therapeutic strategies of GC treatment. PMID:26735338

  2. Expression of cytomegalovirus in glioblastoma multiforme: Myth or reality?

    PubMed

    Taha, Mahmoud S; Abdalhamid, Baha A; El-Badawy, Samy A; Sorour, Yasser M; Almsned, Fahad M; Al-Abbadi, Mousa A

    2016-06-01

    A role for human cytomegalovirus (HCMV) in the pathogenesis of glioblastoma multiforme (GBM) was proposed more than a decade ago and has since generated a considerable debate as a possible therapeutic target. We investigate the presence of HCMV in the specimens of patients with GBM treated in our centre. This is a retrospective cohort study to investigate the presence of HCMV by routine immunohistochemical stains and polymerase chain reaction (PCR)-based molecular analysis on formalin-fixed-paraffin-embedded tissue of all patients with GBM treated in our hospital in 2009-2013 (5 years). The evaluation of positivity by immunohistochemistry (IHC) was semi-quantitative. The molecular analysis was performed by extracting the tumour DNA from representative paraffin-embedded tissue blocks and amplified for detection by a sensitive real time PCR (RT-PCR) CMV assay. During the study period, we treated 45 patients with GBM; however, adequate pathology tissue materials were available only for 32 patients. All the pathology material was reviewed and the diagnosis was confirmed. All the cases were found to be negative for CMV expression by our IHC and RT-PCR CMV assay. Our study has shown no expression of CMV in GBM. Our results were similar to other recent reports that concluded insufficient evidence to recommend routine testing for CMV in GBM or treatment as an add-on therapy. PMID:26742571

  3. The Transcription and Translation Landscapes during Human Cytomegalovirus Infection Reveal Novel Host-Pathogen Interactions

    PubMed Central

    Shitrit, Alina; Shani, Odem; Le-Trilling, Vu Thuy Khanh; Trilling, Mirko; Friedlander, Gilgi; Tanenbaum, Marvin; Stern-Ginossar, Noam

    2015-01-01

    Viruses are by definition fully dependent on the cellular translation machinery, and develop diverse mechanisms to co-opt this machinery for their own benefit. Unlike many viruses, human cytomegalovirus (HCMV) does suppress the host translation machinery, and the extent to which translation machinery contributes to the overall pattern of viral replication and pathogenesis remains elusive. Here, we combine RNA sequencing and ribosomal profiling analyses to systematically address this question. By simultaneously examining the changes in transcription and translation along HCMV infection, we uncover extensive transcriptional control that dominates the response to infection, but also diverse and dynamic translational regulation for subsets of host genes. We were also able to show that, at late time points in infection, translation of viral mRNAs is higher than that of cellular mRNAs. Lastly, integration of our translation measurements with recent measurements of protein abundance enabled comprehensive identification of dozens of host proteins that are targeted for degradation during HCMV infection. Since targeted degradation indicates a strong biological importance, this approach should be applicable for discovering central host functions during viral infection. Our work provides a framework for studying the contribution of transcription, translation and degradation during infection with any virus. PMID:26599541

  4. The cytomegalovirus protein UL138 induces apoptosis of gastric cancer cells by binding to heat shock protein 70.

    PubMed

    Chen, Wenjing; Lin, Kezhi; Zhang, Liang; Guo, Gangqiang; Sun, Xiangwei; Chen, Jing; Ye, Lulu; Ye, Sisi; Mao, Chenchen; Xu, Jianfeng; Zhang, Lifang; Jiang, Lubin; Shen, Xian; Xue, Xiangyang

    2016-02-01

    It has been hypothesized that human cytomegalovirus (HCMV) could act as a tumor promoter and play an "oncomodulatory" role in the neoplastic process of several human malignancies. However, we demonstrate for the first time that UL138, a HCMV latency-associated gene, could act as a tumor inhibitor in gastric cancer (GC). The expression of UL138 is down-regulated in HCMV positive gastric adenocarcinoma tissues, especially in poorly or none differentiated tumors. Overexpression of UL138 in several human GC cell lines inhibits cell viability and induces apoptosis, in association with the reduction of an anti-apoptotic Bcl-2 protein and the induction of cleaved caspase-3 and caspase-9. Moreover, protein array analysis reveals that UL138 interacts with a chaperone protein, heat shock protein 70 (HSP70). This interaction is confirmed by immunoprecipitation and immunostaining in situ in GC cell lines. In addition, this UL138-mediated cancer cell death could efficiently lead to suppression of human tumor growth in a xenograft animal model of GC. In conclusion, these results uncover a previously unknown role of the cytomegalovirus protein UL138 in inducing GC cells apoptosis, which might imply a general mechanism that viral proteins inhibit cancer growth in interactions with both chaperones and apoptosis-related proteins. Our findings might provide a potential target for new therapeutic strategies of GC treatment. PMID:26735338

  5. Contribution of the Major ND10 Proteins PML, hDaxx and Sp100 to the Regulation of Human Cytomegalovirus Latency and Lytic Replication in the Monocytic Cell Line THP-1

    PubMed Central

    Wagenknecht, Nadine; Reuter, Nina; Scherer, Myriam; Reichel, Anna; Müller, Regina; Stamminger, Thomas

    2015-01-01

    Promyelocytic leukemia nuclear bodies, also termed nuclear domain 10 (ND10), have emerged as nuclear protein accumulations mediating an intrinsic cellular defense against viral infections via chromatin-based mechanisms, however, their contribution to the control of herpesviral latency is still controversial. In this study, we utilized the monocytic cell line THP-1 as an in vitro latency model for human cytomegalovirus infection (HCMV). Characterization of THP-1 cells by immunofluorescence and Western blot analysis confirmed the expression of all major ND10 components. THP-1 cells with a stable, individual knockdown of PML, hDaxx or Sp100 were generated. Importantly, depletion of the major ND10 proteins did not prevent the terminal cellular differentiation of THP-1 monocytes. After construction of a recombinant, endotheliotropic human cytomegalovirus expressing IE2-EYFP, we investigated whether the depletion of ND10 proteins affects the onset of viral IE gene expression. While after infection of differentiated, THP-1-derived macrophages as well as during differentiation-induced reactivation from latency an increase in the number of IE-expressing cells was readily detectable in the absence of the major ND10 proteins, no effect was observed in non-differentiated monocytes. We conclude that PML, hDaxx and Sp100 primarily act as cellular restriction factors during lytic HCMV replication and during the dynamic process of reactivation but do not serve as key determinants for the establishment of HCMV latency. PMID:26057166

  6. The Expression of Human Cytomegalovirus MicroRNA MiR-UL148D during Latent Infection in Primary Myeloid Cells Inhibits Activin A-triggered Secretion of IL-6

    PubMed Central

    Lau, Betty; Poole, Emma; Krishna, Benjamin; Sellart, Immaculada; Wills, Mark R.; Murphy, Eain; Sinclair, John

    2016-01-01

    The successful establishment and maintenance of human cytomegalovirus (HCMV) latency is dependent on the expression of a subset of viral genes. Whilst the exact spectrum and functions of these genes are far from clear, inroads have been made for protein-coding genes. In contrast, little is known about the expression of non-coding RNAs. Here we show that HCMV encoded miRNAs are expressed de novo during latent infection of primary myeloid cells. Furthermore, we demonstrate that miR-UL148D, one of the most highly expressed viral miRNAs during latent infection, directly targets the cellular receptor ACVR1B of the activin signalling axis. Consistent with this, we observed upregulation of ACVR1B expression during latent infection with a miR-UL148D deletion virus (ΔmiR-UL148D). Importantly, we observed that monocytes latently infected with ΔmiR-UL148D are more responsive to activin A stimulation, as demonstrated by their increased secretion of IL-6. Collectively, our data indicates miR-UL148D inhibits ACVR1B expression in latently infected cells to limit proinflammatory cytokine secretion, perhaps as an immune evasion strategy or to postpone cytokine-induced reactivation until conditions are more favourable. This is the first demonstration of an HCMV miRNA function during latency in primary myeloid cells, implicating that small RNA species may contribute significantly to latent infection. PMID:27491954

  7. Human cytomegalovirus pUL97 kinase induces global changes in the infected cell phosphoproteome

    PubMed Central

    Oberstein, Adam; Perlman, David H.; Shenk, Thomas; Terry, Laura J.

    2015-01-01

    Replication of human cytomegalovirus is regulated in part by cellular kinases and the single viral Ser/Thr kinase, pUL97. The virus-coded kinase augments the replication of human cytomegalovirus (HCMV) by enabling nuclear egress and altering cell cycle progression. These roles are accomplished through direct phosphorylation of nuclear lamins and the retinoblastoma protein, respectively. In an effort to identify additional pUL97 substrates, we analyzed the phosphoproteome of SILAC-labeled human fibroblasts during infection with either wild-type HCMV or a pUL97 kinase-dead mutant virus. Phosphopeptides were enriched over a titanium dioxide matrix and analyzed by high resolution mass spectrometry. We identified 157 unambiguous phosphosites from 106 cellular and 17 viral proteins whose phosphorylation required UL97. Analysis of peptides containing these sites allowed the identification of several candidate pUL97 phosphorylation motifs, including a completely novel phosphorylation motif, LxSP. Substrates harboring the LxSP motif were enriched in nucleocytoplasmic transport functions, including a number of components of the nuclear pore complex. These results extend the known functions of pUL97 and suggest that modulation of nuclear pore function may be important during HCMV replication. PMID:25867546

  8. Novel Heparan Sulfate-Binding Peptides for Blocking Herpesvirus Entry

    PubMed Central

    Dogra, Pranay; Martin, Emily B.; Williams, Angela; Richardson, Raphael L.; Foster, James S.; Hackenback, Nicole; Kennel, Stephen J.; Sparer, Tim E.; Wall, Jonathan S.

    2015-01-01

    Human cytomegalovirus (HCMV) infection can lead to congenital hearing loss and mental retardation. Upon immune suppression, reactivation of latent HCMV or primary infection increases morbidity in cancer, transplantation, and late stage AIDS patients. Current treatments include nucleoside analogues, which have significant toxicities limiting their usefulness. In this study we screened a panel of synthetic heparin-binding peptides for their ability to prevent CMV infection in vitro. A peptide designated, p5+14 exhibited ~ 90% reduction in murine CMV (MCMV) infection. Because negatively charged, cell-surface heparan sulfate proteoglycans (HSPGs), serve as the attachment receptor during the adsorption phase of the CMV infection cycle, we hypothesized that p5+14 effectively competes for CMV adsorption to the cell surface resulting in the reduction in infection. Positively charged Lys residues were required for peptide binding to cell-surface HSPGs and reducing viral infection. We show that this inhibition was not due to a direct neutralizing effect on the virus itself and that the peptide blocked adsorption of the virus. The peptide also inhibited infection of other herpesviruses: HCMV and herpes simplex virus 1 and 2 in vitro, demonstrating it has broad-spectrum antiviral activity. Therefore, this peptide may offer an adjunct therapy for the treatment of herpes viral infections and other viruses that use HSPGs for entry. PMID:25992785

  9. Spatial relationships between markers for secretory and endosomal machinery in human cytomegalovirus-infected cells versus those in uninfected cells.

    PubMed

    Das, Subhendu; Pellett, Philip E

    2011-06-01

    Human cytomegalovirus (HCMV) induces extensive remodeling of the secretory apparatus to form the cytoplasmic virion assembly compartment (cVAC), where virion tegumentation and envelopment take place. We studied the structure of the cVAC by confocal microscopy to assess the three-dimensional distribution of proteins specifically associated with individual secretory organelles. In infected cells, early endosome antigen 1 (EEA1)-positive vesicles are concentrated at the center of the cVAC and, as previously seen, are distinct from structures visualized by markers for the endoplasmic reticulum, Golgi apparatus, and trans-Golgi network (TGN). EEA1-positive vesicles can be strongly associated with markers for recycling endosomes, to a lesser extent with markers associated with components of the endosomal sorting complex required for transport III (ESCRT III) machinery, and then with markers of late endosomes. In comparisons of uninfected and infected cells, we found significant changes in the structural associations and colocalization of organelle markers, as well as in net organelle volumes. These results provide new evidence that the HCMV-induced remodeling of the membrane transport apparatus involves much more than simple relocation and expansion of preexisting structures and are consistent with the hypothesis that the shift in identity of secretory organelles in HCMV-infected cells results in new functional profiles. PMID:21471245

  10. Generation of a Gaussia luciferase-expressing endotheliotropic cytomegalovirus for screening approaches and mutant analyses.

    PubMed

    Falk, Jessica J; Laib Sampaio, Kerstin; Stegmann, Cora; Lieber, Diana; Kropff, Barbara; Mach, Michael; Sinzger, Christian

    2016-09-01

    For many questions in human cytomegalovirus (HCMV) research, assays are desired that allow robust and fast quantification of infection efficiencies under high-throughput conditions. The secreted Gaussia luciferase has been demonstrated as a suitable reporter in the context of a fibroblast-adapted HCMV strain, which however is greatly restricted in the number of cell types to which it can be applied. We inserted the Gaussia luciferase expression cassette into the BAC-cloned virus strain TB40-BAC4, which displays the natural broad cell tropism of HCMV and hence allows application to screening approaches in a variety of cell types including fibroblasts, epithelial, and endothelial cells. Here, we applied the reporter virus TB40-BAC4-IE-GLuc to identify mouse hybridoma clones that preferentially neutralize infection of endothelial cells. In addition, as the Gaussia luciferase is secreted into culture supernatants from infected cells it allows kinetic analyses in living cultures. This can speed up and facilitate phenotypic characterization of BAC-cloned mutants. For example, we analyzed a UL74 stop-mutant of TB40-BAC4-IE-GLuc immediately after reconstitution in transfected cultures and found the increase of luciferase delayed and reduced as compared to wild type. Phenotypic monitoring directly in transfected cultures can minimize the risk of compensating mutations that might occur with extended passaging. PMID:27326666

  11. Coordinated expansion of both memory T cells and NK cells in response to CMV infection in humans.

    PubMed

    Bayard, Charles; Lepetitcorps, Hélène; Roux, Antoine; Larsen, Martin; Fastenackels, Solène; Salle, Virginie; Vieillard, Vincent; Marchant, Arnaud; Stern, Marc; Boddaert, Jacques; Bajolle, Fanny; Appay, Victor; Sauce, Delphine

    2016-05-01

    NK cells are key players in the fight against persistent viruses. Human cytomegalovirus (HCMV) infection is associated with the presence of a population of CD16(+) CD56(dim) NKG2C(+) NK cells in both acutely and latently infected individuals. Here, we studied the nature of these terminally differentiated NK cells in different human populations infected with HCMV: healthy donors stratified by age, thymectomized individuals, pregnant women suffering from primary CMV infection, and lung transplant patients. Both CD16(+) CD56(dim) NK- and CD8 T-cell phenotypes as well as functional capacities were determined and stratified according to age and/or CMV event. Similarly to T-cell responsiveness, we observe an accumulation over time of NKG2C(+) NK cells, which preferentially expressed CD57. This accumulation is particularly prominent in elderly and amplified further by CMV infection. Latent HCMV infection (without replication) is sufficient for NKG2C(+) CD57(+) NK cells to persist in healthy individuals but is not necessarily required in old age. Collectively, the present work supports the emerging concept that CMV shapes both innate and adaptive immunity in humans. PMID:26910859

  12. Impaired lymphoid chemokine-mediated migration due to a block on the chemokine receptor switch in human cytomegalovirus-infected dendritic cells.

    PubMed

    Moutaftsi, Magdalena; Brennan, Paul; Spector, Stephen A; Tabi, Zsuzsanna

    2004-03-01

    Dendritic cell (DC) migration from the site of infection to the site of T-cell priming is a crucial event in the generation of antiviral T-cell responses. Here we present to our knowledge the first functional evidence that human cytomegalovirus (HCMV) blocks the migration of infected monocyte-derived DCs toward lymphoid chemokines CCL19 and CCL21. DC migration is blocked by viral impairment of the chemokine receptor switch at the level of the expression of CCR7 molecules. The inhibition occurs with immediate-early-early kinetics, and viral interference with NF-kappaB signaling is likely to be at least partially responsible for the lack of CCR7 expression. DCs which migrate from the infected cultures are HCMV antigen negative, and consequently they do not stimulate HCMV-specific CD8(+) T cells, while CD4(+)-T-cell activation is not impaired. Although CD8(+) T cells can also be activated by alternative antigen presentation mechanisms, the spatial segregation of naive T cells and infected DCs seems a potent mechanism of delaying the generation of primary CD8(+)-T-cell responses and aiding early viral spread. PMID:14990723

  13. Impaired Lymphoid Chemokine-Mediated Migration due to a Block on the Chemokine Receptor Switch in Human Cytomegalovirus-Infected Dendritic Cells

    PubMed Central

    Moutaftsi, Magdalena; Brennan, Paul; Spector, Stephen A.; Tabi, Zsuzsanna

    2004-01-01

    Dendritic cell (DC) migration from the site of infection to the site of T-cell priming is a crucial event in the generation of antiviral T-cell responses. Here we present to our knowledge the first functional evidence that human cytomegalovirus (HCMV) blocks the migration of infected monocyte-derived DCs toward lymphoid chemokines CCL19 and CCL21. DC migration is blocked by viral impairment of the chemokine receptor switch at the level of the expression of CCR7 molecules. The inhibition occurs with immediate-early-early kinetics, and viral interference with NF-κB signaling is likely to be at least partially responsible for the lack of CCR7 expression. DCs which migrate from the infected cultures are HCMV antigen negative, and consequently they do not stimulate HCMV-specific CD8+ T cells, while CD4+-T-cell activation is not impaired. Although CD8+ T cells can also be activated by alternative antigen presentation mechanisms, the spatial segregation of naive T cells and infected DCs seems a potent mechanism of delaying the generation of primary CD8+-T-cell responses and aiding early viral spread. PMID:14990723

  14. Viral Glycoprotein Complex Formation, Essential Function and Immunogenicity in the Guinea Pig Model for Cytomegalovirus.

    PubMed

    Coleman, Stewart; Hornig, Julia; Maddux, Sarah; Choi, K Yeon; McGregor, Alistair

    2015-01-01

    Development of a cytomegalovirus (CMV) vaccine is a major public health priority due to the risk of congenital infection. A key component of a vaccine is thought to be an effective neutralizing antibody response against the viral glycoproteins necessary for cell entry. Species specificity of human CMV (HCMV) precludes direct studies in an animal model. The guinea pig is the only small animal model for congenital cytomegalovirus infection. Analysis of the guinea pig CMV (GPCMV) genome indicates that it potentially encodes homologs to the HCMV glycoproteins (including gB, gH, gL, gM, gN and gO) that form various cell entry complexes on the outside of the virus: gCI (gB); gCII (gH/gL/gO); gCIII (gM/gN). The gB homolog (GP55) has been investigated as a candidate subunit vaccine but little is known about the other homolog proteins. GPCMV glycoproteins were investigated by transient expression studies which indicated that homolog glycoproteins to gN and gM, or gH, gL and gO were able to co-localize in cells and generate respective homolog complexes which could be verified by immunoprecipitation assays. ELISA studies demonstrated that the individual complexes were highly immunogenic in guinea pigs. The gO (GP74) homolog protein has 13 conserved N-glycosylation sites found in HCMV gO. In transient expression studies, only the glycosylated protein is detected but in virus infected cells both N-glycosylated and non-glycosylated gO protein were detected. In protein interaction studies, a mutant gO that lacked N-glycosylation sites had no impact on the ability of the protein to interact with gH/gL which indicated a potential alternative function associated with these sites. Knockout GPCMV BAC mutagenesis of the respective glycoprotein genes (GP55 for gB, GP75 for gH, GP115 for gL, GP100 for gM, GP73 for gN and GP74 for gO) in separate reactions was lethal for virus regeneration on fibroblast cells which demonstrated the essential nature of the GPCMV glycoproteins. The gene

  15. Viral Glycoprotein Complex Formation, Essential Function and Immunogenicity in the Guinea Pig Model for Cytomegalovirus

    PubMed Central

    Maddux, Sarah; Choi, K. Yeon; McGregor, Alistair

    2015-01-01

    Development of a cytomegalovirus (CMV) vaccine is a major public health priority due to the risk of congenital infection. A key component of a vaccine is thought to be an effective neutralizing antibody response against the viral glycoproteins necessary for cell entry. Species specificity of human CMV (HCMV) precludes direct studies in an animal model. The guinea pig is the only small animal model for congenital cytomegalovirus infection. Analysis of the guinea pig CMV (GPCMV) genome indicates that it potentially encodes homologs to the HCMV glycoproteins (including gB, gH, gL, gM, gN and gO) that form various cell entry complexes on the outside of the virus: gCI (gB); gCII (gH/gL/gO); gCIII (gM/gN). The gB homolog (GP55) has been investigated as a candidate subunit vaccine but little is known about the other homolog proteins. GPCMV glycoproteins were investigated by transient expression studies which indicated that homolog glycoproteins to gN and gM, or gH, gL and gO were able to co-localize in cells and generate respective homolog complexes which could be verified by immunoprecipitation assays. ELISA studies demonstrated that the individual complexes were highly immunogenic in guinea pigs. The gO (GP74) homolog protein has 13 conserved N-glycosylation sites found in HCMV gO. In transient expression studies, only the glycosylated protein is detected but in virus infected cells both N-glycosylated and non-glycosylated gO protein were detected. In protein interaction studies, a mutant gO that lacked N-glycosylation sites had no impact on the ability of the protein to interact with gH/gL which indicated a potential alternative function associated with these sites. Knockout GPCMV BAC mutagenesis of the respective glycoprotein genes (GP55 for gB, GP75 for gH, GP115 for gL, GP100 for gM, GP73 for gN and GP74 for gO) in separate reactions was lethal for virus regeneration on fibroblast cells which demonstrated the essential nature of the GPCMV glycoproteins. The gene

  16. Human Cytomegalovirus gH/gL Forms a Stable Complex with the Fusion Protein gB in Virions

    PubMed Central

    Vanarsdall, Adam L.; Howard, Paul W.; Wisner, Todd W.; Johnson, David C.

    2016-01-01

    Human cytomegalovirus (HCMV) is a ubiquitous virus that is a major pathogen in newborns and immunocompromised or immunosuppressed patients. HCMV infects a wide variety of cell types using distinct entry pathways that involve different forms of the gH/gL glycoprotein: gH/gL/gO and gH/gL/UL128-131 as well as the viral fusion glycoprotein, gB. However, the minimal or core fusion machinery (sufficient for cell-cell fusion) is just gH/gL and gB. Here, we demonstrate that HCMV gB and gH/gL form a stable complex early after their synthesis and in the absence of other viral proteins. gH/gL can interact with gB mutants that are unable to mediate cell-cell fusion. gB-gH/gL complexes included as much as 16–50% of the total gH/gL in HCMV virus particles. In contrast, only small amounts of gH/gL/gO and gH/gL/UL128-131 complexes were found associated with gB. All herpesviruses express gB and gH/gL molecules and most models describing herpesvirus entry suggest that gH/gL interacts with gB to mediate membrane fusion, although there is no direct evidence for this. For herpes simplex virus (HSV-1) it has been suggested that after receptor binding gH/gL binds to gB either just before, or coincident with membrane fusion. Therefore, our results have major implications for these models, demonstrating that HCMV gB and gH/gL forms stable gB-gH/gL complexes that are incorporated virions without receptor binding or membrane fusion. Moreover, our data is the best support to date for the proposal that gH/gL interacts with gB. PMID:27082872

  17. Antagonistic Determinants Controlling Replicative and Latent States of Human Cytomegalovirus Infection

    PubMed Central

    Umashankar, Mahadevaiah; Rak, Michael; Bughio, Farah; Zagallo, Patricia; Caviness, Katie

    2014-01-01

    ABSTRACT The mechanisms by which viruses persist and particularly those by which viruses actively contribute to their own latency have been elusive. Here we report the existence of opposing functions encoded by genes within a polycistronic locus of the human cytomegalovirus (HCMV) genome that regulate cell type-dependent viral fates: replication and latency. The locus, referred to as the UL133-UL138 (UL133/8) locus, encodes four proteins, pUL133, pUL135, pUL136, and pUL138. As part of the ULb′ region of the genome, the UL133/8 locus is lost upon serial passage of clinical strains of HCMV in cultured fibroblasts and is therefore considered dispensable for replication in this context. Strikingly, we could not reconstitute infection in permissive fibroblasts from bacterial artificial chromosome clones of the HCMV genome where UL135 alone was disrupted. The loss of UL135 resulted in complex phenotypes and could ultimately be overcome by infection at high multiplicities. The requirement for UL135 but not the entire locus led us to hypothesize that another gene in this locus suppressed virus replication in the absence of UL135. The defect associated with the loss of UL135 was largely rescued by the additional disruption of the UL138 latency determinant, indicating a requirement for UL135 for virus replication when UL138 is expressed. In the CD34+ hematopoietic progenitor model of latency, viruses lacking only UL135 were defective for viral genome amplification and reactivation. Taken together, these data indicate that UL135 and UL138 comprise a molecular switch whereby UL135 is required to overcome UL138-mediated suppression of virus replication to balance states of latency and reactivation. IMPORTANCE Mechanisms by which viruses persist in their host remain one of the most poorly understood phenomena in virology. Herpesviruses, including HCMV, persist in an incurable, latent state that has profound implications for immunocompromised individuals, including transplant

  18. A Human Cytomegalovirus gO-Null Mutant Fails To Incorporate gH/gL into the Virion Envelope and Is Unable To Enter Fibroblasts and Epithelial and Endothelial Cells▿

    PubMed Central

    Wille, Paul T.; Knoche, Amber J.; Nelson, Jay A.; Jarvis, Michael A.; Johnson, David C.

    2010-01-01

    Human cytomegalovirus (HCMV) depends upon a five-protein complex, gH/gL/UL128-131, to enter epithelial and endothelial cells. A separate HCMV gH/gL-containing complex, gH/gL/gO, has been described. Our prevailing model is that gH/gL/UL128-131 is required for entry into biologically important epithelial and endothelial cells and that gH/gL/gO is required for infection of fibroblasts. Genes encoding UL128-131 are rapidly mutated during laboratory propagation of HCMV on fibroblasts, apparently related to selective pressure for the fibroblast entry pathway. Arguing against this model in the accompanying paper by B. J. Ryckman et al. (J. Virol., 84:2597-2609, 2010), we describe evidence that clinical HCMV strain TR expresses a gO molecule that acts to promote endoplasmic reticulum (ER) export of gH/gL and that gO is not stably incorporated into the virus envelope. This was different from results involving fibroblast-adapted HCMV strain AD169, which incorporates gO into the virion envelope. Here, we constructed a TR gO-null mutant, TRΔgO, that replicated to low titers, spread poorly among fibroblasts, but produced normal quantities of extracellular virus particles. TRΔgO particles released from fibroblasts failed to infect fibroblasts and epithelial and endothelial cells, but the chemical fusogen polyethylene glycol (PEG) could partially overcome defects in infection. Therefore, TRΔgO is defective for entry into all three cell types. Defects in entry were explained by observations showing that TRΔgO incorporated about 5% of the quantities of gH/gL in extracellular virus particles compared with that in wild-type virions. Although TRΔgO particles could not enter cells, cell-to-cell spread involving epithelial and endothelial cells was increased relative to TR, apparently resulting from increased quantities of gH/gL/UL128-131 in virions. Together, our data suggest that TR gO acts as a chaperone to promote ER export and the incorporation of gH/gL complexes into the HCMV

  19. A human cytomegalovirus gO-null mutant fails to incorporate gH/gL into the virion envelope and is unable to enter fibroblasts and epithelial and endothelial cells.

    PubMed

    Wille, Paul T; Knoche, Amber J; Nelson, Jay A; Jarvis, Michael A; Johnson, David C

    2010-03-01

    Human cytomegalovirus (HCMV) depends upon a five-protein complex, gH/gL/UL128-131, to enter epithelial and endothelial cells. A separate HCMV gH/gL-containing complex, gH/gL/gO, has been described. Our prevailing model is that gH/gL/UL128-131 is required for entry into biologically important epithelial and endothelial cells and that gH/gL/gO is required for infection of fibroblasts. Genes encoding UL128-131 are rapidly mutated during laboratory propagation of HCMV on fibroblasts, apparently related to selective pressure for the fibroblast entry pathway. Arguing against this model in the accompanying paper by B. J. Ryckman et al. (J. Virol., 84:2597-2609, 2010), we describe evidence that clinical HCMV strain TR expresses a gO molecule that acts to promote endoplasmic reticulum (ER) export of gH/gL and that gO is not stably incorporated into the virus envelope. This was different from results involving fibroblast-adapted HCMV strain AD169, which incorporates gO into the virion envelope. Here, we constructed a TR gO-null mutant, TRDeltagO, that replicated to low titers, spread poorly among fibroblasts, but produced normal quantities of extracellular virus particles. TRDeltagO particles released from fibroblasts failed to infect fibroblasts and epithelial and endothelial cells, but the chemical fusogen polyethylene glycol (PEG) could partially overcome defects in infection. Therefore, TRDeltagO is defective for entry into all three cell types. Defects in entry were explained by observations showing that TRDeltagO incorporated about 5% of the quantities of gH/gL in extracellular virus particles compared with that in wild-type virions. Although TRDeltagO particles could not enter cells, cell-to-cell spread involving epithelial and endothelial cells was increased relative to TR, apparently resulting from increased quantities of gH/gL/UL128-131 in virions. Together, our data suggest that TR gO acts as a chaperone to promote ER export and the incorporation of g

  20. Genetic Stability of Bacterial Artificial Chromosome-Derived Human Cytomegalovirus during Culture In Vitro

    PubMed Central

    Murrell, Isa; Wilkie, Gavin S.; Davison, Andrew J.; Statkute, Evelina; Fielding, Ceri A.; Tomasec, Peter; Wilkinson, Gavin W. G.

    2016-01-01

    ABSTRACT Clinical human cytomegalovirus (HCMV) strains invariably mutate when propagated in vitro. Mutations in gene RL13 are selected in all cell types, whereas in fibroblasts mutants in the UL128 locus (UL128L; genes UL128, UL130, and UL131A) are also selected. In addition, sporadic mutations are selected elsewhere in the genome in all cell types. We sought to investigate conditions under which HCMV can be propagated without incurring genetic defects. Bacterial artificial chromosomes (BACs) provide a stable, genetically defined source of viral genome. Viruses were generated from BACs containing the genomes of strains TR, TB40, FIX, and Merlin, as well as from Merlin-BAC recombinants containing variant nucleotides in UL128L from TB40-BAC4 or FIX-BAC. Propagation of viruses derived from TR-BAC, TB40-BAC4, and FIX-BAC in either fibroblast or epithelial cells was associated with the generation of defects around the prokaryotic vector, which is retained in the unique short (US) region of viruses. This was not observed for Merlin-BAC, from which the vector is excised in derived viruses; however, propagation in epithelial cells was consistently associated with mutations in the unique long b′ (UL/b′) region, all impacting on gene UL141. Viruses derived from Merlin-BAC in fibroblasts had mutations in UL128L, but mutations occurred less frequently with recombinants containing UL128L nucleotides from TB40-BAC4 or FIX-BAC. Viruses derived from a Merlin-BAC derivative in which RL13 and UL128L were either mutated or repressed were remarkably stable in fibroblasts. Thus, HCMV containing a wild-type gene complement can be generated in vitro by deriving virus from a self-excising BAC in fibroblasts and repressing RL13 and UL128L. IMPORTANCE Researchers should aim to study viruses that accurately represent the causative agents of disease. This is problematic for HCMV because clinical strains mutate rapidly when propagated in vitro, becoming less cell associated, altered in

  1. Human Cytomegalovirus gH/gL/gO Promotes the Fusion Step of Entry into All Cell Types, whereas gH/gL/UL128-131 Broadens Virus Tropism through a Distinct Mechanism

    PubMed Central

    Zhou, Momei; Lanchy, Jean-Marc

    2015-01-01

    ABSTRACT Interaction between gH/gL and the fusion protein gB is likely a conserved feature of the entry mechanism for all herpesviruses. Human cytomegalovirus (HCMV) gH/gL can be bound by gO or by the set of proteins UL128, UL130, and UL131, forming gH/gL/gO and gH/gL/UL128-131. The mechanisms by which these complexes facilitate entry are poorly understood. Mutants lacking UL128-131 replicate well on fibroblasts but fail to enter epithelial/endothelial cells, and this has led to the general assumption that gH/gL/UL128-131 promotes gB-mediated fusion on epithelial/endothelial cells whereas gH/gL/gO provides this function on fibroblasts. This was challenged by observations that gO-null mutants were defective on all of these cell types, suggesting that entry into epithelial/endothelial cells requires both of the gH/gL complexes, but the severe replication defect of the gO mutants precluded detailed analysis. We previously reported that the ratio of gH/gL/gO and gH/gL/UL128-131 in the virion envelope varied dramatically among HCMV strains. Here, we show that strains not only differ in the ratio, but also vary in the total amount of gH/gL in the virion. Cell-type-specific particle-to-PFU ratios of HCMV strains that contained different amounts of gH/gL/gO and gH/gL/UL128-131 were determined. Infection of both fibroblasts and epithelial cells was generally correlated with the abundance of gH/gL/gO, but not with that of gH/gL/UL128-131. The low infectivity of virions rich in gH/gL/UL128-131 but low in gH/gL/gO could be overcome by treatment with the chemical fusogen polyethylene glycol (PEG), strongly arguing that gH/gL/gO provides the conserved herpesvirus gH/gL entry function of promoting gB-mediated fusion for entry into all cell types, whereas gH/gL/UL128-131 acts through a distinct mechanism to allow infection of select cell types. IMPORTANCE The functions of HCMV gH/gL complexes in entry are unclear. Unlike the well-studied Epstein-Barr virus (EBV), where gH/gL and g

  2. A mechanism for negative gene regulation in Autographa californica multinucleocapsid nuclear polyhedrosis virus

    USGS Publications Warehouse

    Leisy, D.J.; Rasmussen, C.; Owusu, E.O.; Rohrmann, G.F.

    1997-01-01

    The Autographa californica multinucleocapsid nuclear polyhedrosis virus (AcMNPV) ie-1 gene product (IE-1) is thought to play a central role in stimulating early viral transcription. IE-1 has been demonstrated to activate several early viral gene promoters and to negatively regulate the promoters of two other AcMNPV regulatory genes, ie-0 and ie-2. Our results indicate that IE-1 negatively regulates the expression of certain genes by binding directly, or as part of a complex, to promoter regions containing a specific IE-1-binding motif (5'-ACBYGTAA-3') near their mRNA start sites. The IE-1 binding motif was also found within the palindromic sequences of AcMNPV homologous repeat (hr) regions that have been shown to bind IE-1. The role of this IE-1 binding motif in the regulation of the ie-2 and pe-38 promoters was examined by introducing mutations in these promoters in which the central 6 bp were replaced with Bg/II sites. GUS reporter constructs containing ie-2 and pe-38 promoter fragments with and without these specific mutations were cotransfected into Sf9 cells with various amounts of an ie-1-containing plasmid (ple-1). Comparisons of GUS expression produced by the mutant and wild-type constructs demonstrated that the IE-1 binding motif mediated a significant decrease in expression from the ie-2 and pe-38 promoters in response to increasing pIe-1 concentrations. Electrophoretic mobility shift assays with pIe-1-transfected cell extracts and supershift assays with IE-1- specific antiserum demonstrated that IE-1 binds to promoter fragments containing the IE-1 binding motif but does not bind to promoter fragments lacking this motif.

  3. Role of Endoplasmic Reticulum Stress in Epithelial–Mesenchymal Transition of Alveolar Epithelial Cells

    PubMed Central

    Zhong, Qian; Zhou, Beiyun; Ann, David K.; Minoo, Parviz; Liu, Yixin; Banfalvi, Agnes; Krishnaveni, Manda S.; Dubourd, Mickael; Demaio, Lucas; Willis, Brigham C.; Kim, Kwang-Jin; duBois, Roland M.; Crandall, Edward D.; Beers, Michael F.

    2011-01-01

    Endoplasmic reticulum (ER) stress has been implicated in alveolar epithelial type II (AT2) cell apoptosis in idiopathic pulmonary fibrosis. We hypothesized that ER stress (either chemically induced or due to accumulation of misfolded proteins) is also associated with epithelial–mesenchymal transition (EMT) in alveolar epithelial cells (AECs). ER stress inducers, thapsigargin (TG) or tunicamycin (TN), increased expression of ER chaperone, Grp78, and spliced X-box binding protein 1, decreased epithelial markers, E-cadherin and zonula occludens–1 (ZO-1), increased the myofibroblast marker, α–smooth muscle actin (α-SMA), and induced fibroblast-like morphology in both primary AECs and the AT2 cell line, RLE-6TN, consistent with EMT. Overexpression of the surfactant protein (SP)–C BRICHOS mutant SP-CΔExon4 in A549 cells increased Grp78 and α-SMA and disrupted ZO-1 distribution, and, in primary AECs, SP-CΔExon4 induced fibroblastic-like morphology, decreased ZO-1 and E-cadherin and increased α-SMA, mechanistically linking ER stress associated with mutant SP to fibrosis through EMT. Whereas EMT was evident at lower concentrations of TG or TN, higher concentrations caused apoptosis. The Src inhibitor, 4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo[3,4]pyramidine) (PP2), abrogated EMT associated with TN or TG in primary AECs, whereas overexpression of SP-CΔExon4 increased Src phosphorylation, suggesting a common mechanism. Furthermore, increased Grp78 immunoreactivity was observed in AT2 cells of mice after bleomycin injury, supporting a role for ER stress in epithelial abnormalities in fibrosis in vivo. These results demonstrate that ER stress induces EMT in AECs, at least in part through Src-dependent pathways, suggesting a novel role for ER stress in fibroblast accumulation in pulmonary fibrosis. PMID:21169555

  4. Role of endoplasmic reticulum stress in epithelial-mesenchymal transition of alveolar epithelial cells: effects of misfolded surfactant protein.

    PubMed

    Zhong, Qian; Zhou, Beiyun; Ann, David K; Minoo, Parviz; Liu, Yixin; Banfalvi, Agnes; Krishnaveni, Manda S; Dubourd, Mickael; Demaio, Lucas; Willis, Brigham C; Kim, Kwang-Jin; duBois, Roland M; Crandall, Edward D; Beers, Michael F; Borok, Zea

    2011-09-01

    Endoplasmic reticulum (ER) stress has been implicated in alveolar epithelial type II (AT2) cell apoptosis in idiopathic pulmonary fibrosis. We hypothesized that ER stress (either chemically induced or due to accumulation of misfolded proteins) is also associated with epithelial-mesenchymal transition (EMT) in alveolar epithelial cells (AECs). ER stress inducers, thapsigargin (TG) or tunicamycin (TN), increased expression of ER chaperone, Grp78, and spliced X-box binding protein 1, decreased epithelial markers, E-cadherin and zonula occludens-1 (ZO-1), increased the myofibroblast marker, α-smooth muscle actin (α-SMA), and induced fibroblast-like morphology in both primary AECs and the AT2 cell line, RLE-6TN, consistent with EMT. Overexpression of the surfactant protein (SP)-C BRICHOS mutant SP-C(ΔExon4) in A549 cells increased Grp78 and α-SMA and disrupted ZO-1 distribution, and, in primary AECs, SP-C(ΔExon4) induced fibroblastic-like morphology, decreased ZO-1 and E-cadherin and increased α-SMA, mechanistically linking ER stress associated with mutant SP to fibrosis through EMT. Whereas EMT was evident at lower concentrations of TG or TN, higher concentrations caused apoptosis. The Src inhibitor, 4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo[3,4]pyramidine) (PP2), abrogated EMT associated with TN or TG in primary AECs, whereas overexpression of SP-C(ΔExon4) increased Src phosphorylation, suggesting a common mechanism. Furthermore, increased Grp78 immunoreactivity was observed in AT2 cells of mice after bleomycin injury, supporting a role for ER stress in epithelial abnormalities in fibrosis in vivo. These results demonstrate that ER stress induces EMT in AECs, at least in part through Src-dependent pathways, suggesting a novel role for ER stress in fibroblast accumulation in pulmonary fibrosis. PMID:21169555

  5. Inactivation of Retinoblastoma Protein Does Not Overcome the Requirement for Human Cytomegalovirus UL97 in Lamina Disruption and Nuclear Egress

    PubMed Central

    Reim, Natalia I.; Wang, Depeng; Lin, Alison; Sharma, Mayuri; Ericsson, Maria; Pesola, Jean M.; Golan, David E.

    2013-01-01

    Human cytomegalovirus (HCMV) encodes one conventional protein kinase, UL97. During infection, UL97 phosphorylates the retinoblastoma tumor suppressor protein (pRb) on sites ordinarily phosphorylated by cyclin-dependent kinases (CDK), inactivating the ability of pRb to repress host genes required for cell cycle progression to S phase. UL97 is important for viral DNA synthesis in quiescent cells, but this function can be replaced by human papillomavirus type 16 E7, which targets pRb for degradation. However, viruses in which E7 replaces UL97 are still defective for virus production. UL97 is also required for efficient nuclear egress of viral nucleocapsids, which is associated with disruption of the nuclear lamina during infection, and phosphorylation of lamin A/C on serine 22, which antagonizes lamin polymerization. We investigated whether inactivation of pRb might overcome the requirement of UL97 for these roles, as pRb inactivation induces CDK1, and CDK1 phosphorylates lamin A/C on serine 22. We found that lamin A/C serine 22 phosphorylation during HCMV infection correlated with expression of UL97 and was considerably delayed in UL97-null mutants, even when E7 was expressed. E7 failed to restore gaps in the nuclear lamina seen in wild-type but not UL97-null virus infections. In electron microscopy analyses, a UL97-null virus expressing E7 was as impaired as a UL97-null mutant in cytoplasmic accumulation of viral nucleocapsids. Our results demonstrate that pRb inactivation is insufficient to restore efficient viral nuclear egress of HCMV in the absence of UL97 and instead argue further for a direct role of UL97 in this stage of the infectious cycle. PMID:23427156

  6. Proteomic Interaction Patterns between Human Cyclins, the Cyclin-Dependent Kinase Ortholog pUL97 and Additional Cytomegalovirus Proteins

    PubMed Central

    Steingruber, Mirjam; Kraut, Alexandra; Socher, Eileen; Sticht, Heinrich; Reichel, Anna; Stamminger, Thomas; Amin, Bushra; Couté, Yohann; Hutterer, Corina; Marschall, Manfred

    2016-01-01

    The human cytomegalovirus (HCMV)-encoded cyclin-dependent kinase (CDK) ortholog pUL97 associates with human cyclin B1 and other types of cyclins. Here, the question was addressed whether cyclin interaction of pUL97 and additional viral proteins is detectable by mass spectrometry-based approaches. Proteomic data were validated by coimmunoprecipitation (CoIP), Western blot, in vitro kinase and bioinformatic analyses. Our findings suggest that: (i) pUL97 shows differential affinities to human cyclins; (ii) pUL97 inhibitor maribavir (MBV) disrupts the interaction with cyclin B1, but not with other cyclin types; (iii) cyclin H is identified as a new high-affinity interactor of pUL97 in HCMV-infected cells; (iv) even more viral phosphoproteins, including all known substrates of pUL97, are detectable in the cyclin-associated complexes; and (v) a first functional validation of pUL97-cyclin B1 interaction, analyzed by in vitro kinase assay, points to a cyclin-mediated modulation of pUL97 substrate preference. In addition, our bioinformatic analyses suggest individual, cyclin-specific binding interfaces for pUL97-cyclin interaction, which could explain the different strengths of interactions and the selective inhibitory effect of MBV on pUL97-cyclin B1 interaction. Combined, the detection of cyclin-associated proteins in HCMV-infected cells suggests a complex pattern of substrate phosphorylation and a role of cyclins in the fine-modulation of pUL97 activities. PMID:27548200

  7. The Viral Chemokine MCK-2 of Murine Cytomegalovirus Promotes Infection as Part of a gH/gL/MCK-2 Complex

    PubMed Central

    Prager, Adrian; Trsan, Tihana; Arapovic, Maja; Lemmermann, Niels A. W.; Podlech, Jürgen; Reddehase, Matthias J.; Lemnitzer, Frederic; Bosse, Jens Bernhard; Gimpfl, Martina; Marcinowski, Lisa; MacDonald, Margaret; Adler, Heiko; Koszinowski, Ulrich H.; Adler, Barbara

    2013-01-01

    Human cytomegalovirus (HCMV) forms two gH/gL glycoprotein complexes, gH/gL/gO and gH/gL/pUL(128,130,131A), which determine the tropism, the entry pathways and the mode of spread of the virus. For murine cytomegalovirus (MCMV), which serves as a model for HCMV, a gH/gL/gO complex functionally homologous to the HCMV gH/gL/gO complex has been described. Knock-out of MCMV gO does impair, but not abolish, virus spread indicating that also MCMV might form an alternative gH/gL complex. Here, we show that the MCMV CC chemokine MCK-2 forms a complex with the glycoprotein gH, a complex which is incorporated into the virion. We could additionally show that mutants lacking both, gO and MCK-2 are not able to produce infectious virus. Trans-complementation of these double mutants with either gO or MCK-2 showed that both proteins can promote infection of host cells, although through different entry pathways. MCK-2 has been extensively studied in vivo by others. It has been shown to be involved in attracting cells for virus dissemination and in regulating antiviral host responses. We now show that MCK-2, by forming a complex with gH, strongly promotes infection of macrophages in vitro and in vivo. Thus, MCK-2 may play a dual role in MCMV infection, as a chemokine regulating the host response and attracting specific target cells and as part of a glycoprotein complex promoting entry into cells crucial for virus dissemination. PMID:23935483

  8. Lymph Node Macrophages Restrict Murine Cytomegalovirus Dissemination

    PubMed Central

    Farrell, Helen E.; Davis-Poynter, Nick; Bruce, Kimberley; Lawler, Clara; Dolken, Lars; Mach, Michael

    2015-01-01

    ABSTRACT Cytomegaloviruses (CMVs) establish chronic infections that spread from a primary entry site to secondary vascular sites, such as the spleen, and then to tertiary shedding sites, such as the salivary glands. Human CMV (HCMV) is difficult to analyze, because its spread precedes clinical presentation. Murine CMV (MCMV) offers a tractable model. It is hypothesized to spread from peripheral sites via vascular endothelial cells and associated monocytes. However, viral luciferase imaging showed footpad-inoculated MCMV first reaching the popliteal lymph nodes (PLN). PLN colonization was rapid and further spread was slow, implying that LN infection can be a significant bottleneck. Most acutely infected PLN cells were CD169+ subcapsular sinus macrophages (SSM). Replication-deficient MCMV also reached them, indicating direct infection. Many SSM expressed viral reporter genes, but few expressed lytic genes. SSM expressed CD11c, and MCMV with a cre-sensitive fluorochrome switch showed switched infected cells in PLN of CD11c-cre mice but yielded little switched virus. SSM depletion with liposomal clodronate or via a CD169-diphtheria toxin receptor transgene shifted infection to ER-TR7+ stromal cells, increased virus production, and accelerated its spread to the spleen. Therefore, MCMV disseminated via LN, and SSM slowed this spread by shielding permissive fibroblasts and poorly supporting viral lytic replication. IMPORTANCE HCMV chronically infects most people, and it can cause congenital disability and harm the immunocompromised. A major goal of vaccination is to prevent systemic infection. How this is established is unclear. Restriction to humans makes HCMV difficult to analyze. We show that peripheral MCMV infection spreads via lymph nodes. Here, MCMV infected filtering macrophages, which supported virus replication poorly. When these macrophages were depleted, MCMV infected susceptible fibroblasts and spread faster. The capacity of filtering macrophages to limit

  9. A Role for Nuclear F-Actin Induction in Human Cytomegalovirus Nuclear Egress

    PubMed Central

    Wilkie, Adrian R.; Lawler, Jessica L.

    2016-01-01

    ABSTRACT Herpesviruses, which include important pathogens, remodel the host cell nucleus to facilitate infection. This remodeling includes the formation of structures called replication compartments (RCs) in which herpesviruses replicate their DNA. During infection with the betaherpesvirus, human cytomegalovirus (HCMV), viral DNA synthesis occurs at the periphery of RCs within the nuclear interior, after which assembled capsids must reach the inner nuclear membrane (INM) for translocation to the cytoplasm (nuclear egress). The processes that facilitate movement of HCMV capsids to the INM during nuclear egress are unknown. Although an actin-based mechanism of alphaherpesvirus capsid trafficking to the INM has been proposed, it is controversial. Here, using a fluorescently-tagged, nucleus-localized actin-binding peptide, we show that HCMV, but not herpes simplex virus 1, strongly induced nuclear actin filaments (F-actin) in human fibroblasts. Based on studies using UV inactivation and inhibitors, this induction depended on viral gene expression. Interestingly, by 24 h postinfection, nuclear F-actin formed thicker structures that appeared by super-resolution microscopy to be bundles of filaments. Later in infection, nuclear F-actin primarily localized along the RC periphery and between the RC periphery and the nuclear rim. Importantly, a drug that depolymerized nuclear F-actin caused defects in production of infectious virus, capsid accumulation in the cytoplasm, and capsid localization near the nuclear rim, without decreasing capsid accumulation in the nucleus. Thus, our results suggest that for at least one herpesvirus, nuclear F-actin promotes capsid movement to the nuclear periphery and nuclear egress. We discuss our results in terms of competing models for these processes. PMID:27555312

  10. Terminal structure and heterogeneity in human cytomegalovirus strain AD169.

    PubMed Central

    Tamashiro, J C; Spector, D H

    1986-01-01

    We have characterized the heterogeneity occurring at the junction of the long (L) and short (S) segments and at the termini of the strain AD169 human cytomegalovirus (HCMV) genome by restriction endonuclease mapping and nucleotide sequence analyses. The HCMV a sequence was identified by its position at both termini and inverted orientation at the L-S junction. Heterogeneity at both termini and the L-S junction was generated by the presence of fused and tandem a sequences. Some S termini lacked an a sequence. In addition, near the L terminus and at the L-S junction there were a variable number of 217-base-pair (bp) XhoI fragments arranged in tandem. The 217-bp fragments consisted of a portion of the a and adjacent b sequences (in the L-segment repeat) bounded by the same direct repeats (DR1) found at the boundaries of the a sequence. A model for the generation of these heterogeneous fragments is presented. We also determined the sequence of seven cloned terminal fragments, five from the L terminus and two from the S terminus. All L termini contained identical terminal sequences ending with base 32 of a 33-bp DR1. The S termini differed from each other and from the L-segment termini. One S terminus lacked an a sequence and terminated within S-segment repeat (c) sequences. The second S terminus contained an a sequence and terminated with bases 20 to 33 of a 33-bp DR1. A comparison of the cloned L and S terminal sequences with cloned L-S junction sequences suggested that the termini contained 3' single base extensions which were removed during the cloning. We also show that the herpesvirus conserved sequence is in a similar position relative to the termini of HCMV and several other herpesviruses, thus adding further support for the role of the sequence in the maturation of viral DNA. Images PMID:3016322

  11. Reevaluation of the Coding Potential and Proteomic Analysis of the BAC Derived Rhesus Cytomegalovirus Strain 68-1

    SciTech Connect

    Malouli, Daniel; Nakayasu, Ernesto S.; Viswanathan, Kasinath; Camp, David G.; Chang, W. L.; Barry, Peter A.; Smith, Richard D.; Fruh, Klaus

    2012-09-01

    Cytomegaloviruses are highly host restricted resulting in co-speciation with their hosts. As a natural pathogen of rhesus macaques (RM), Rhesus Cytomegalovirus (RhCMV) has therefore emerged as a highly relevant experimental model for pathogenesis and vaccine development due to its close evolutionary relationship to human CMV (HCMV). To date, most in vivo experiments performed with RhCMV employed strain 68-1 cloned as bacterial artificial chromosome (BAC). However, the complete genome sequence of the 68-1 BAC has not been determined. Furthermore, the gene content of the RhCMV genome is unknown and previous open reading frame (ORF) predictions relied solely on uninterrupted ORFs with an arbitrary cutoff of 300bp. To obtain a more precise picture of the actual proteins encoded by the most commonly used molecular clone of RhCMV we re-evaluated the RhCMV 68-1 BAC-genome by whole genome shotgun sequencing and determined the protein content of the resulting RhCMV virions by proteomics. By additionally comparing the RhCMV genome to that of several closely related Old World Monkey (OWM) CMVs we were able to filter out many unlikely ORFs and obtain a simplified map of the RhCMV genome. This comparative genomics analysis eliminated many genes previously characterized as RhCMV-specific while consolidating a high conservation of ORFs among OWM-CMVs and between RhCMV and HCMV. Moreover, virion proteomics independently validated the revised ORF predictions since only proteins encoded by predicted ORFs could be detected. Taken together these data suggest a much higher conservation of genome and virion structure between CMVs of humans, apes and OWMs than previously assumed. Remarkably, BAC-derived RhCMV is able to establish and maintain persistent infection despite the lack of multiple genes homologous to HCMV genes involved in tissue tropism.

  12. Effects of human cytomegalovirus major immediate-early proteins in controlling the cell cycle and inhibiting apoptosis: studies with ts13 cells.

    PubMed

    Lukac, D M; Alwine, J C

    1999-04-01

    The major immediate-early (MIE) gene of human cytomegalovirus (HCMV) encodes several MIE proteins (MIEPs) produced as a result of alternative splicing and polyadenylation of the primary transcript. Previously we demonstrated that the HCMV MIEPs expressed from the entire MIE gene could rescue the temperature-sensitive (ts) transcriptional defect in the ts13 cell line. This defect is caused by a ts mutation in TAFII250, the 250-kDa TATA binding protein-associated factor (TAF). These and other data suggested that the MIEPs perform a TAF-like function in complex with the basal transcription factor TFIID. In addition to the transcriptional defect, the ts mutation in ts13 cells results in a defect in cell cycle progression which ultimately leads to apoptosis. Since all of these defects can be rescued by wild-type TAFII250, we asked whether the MIEPs could rescue the cell cycle defect and/or affect the progression to apoptosis. We have found that the MIEPs, expressed from the entire MIE gene, do not rescue the cell cycle block in ts13 cells grown at the nonpermissive temperature. However, despite the maintenance of the cell cycle block, the ts13 cells which express the MIEPs are resistant to apoptosis. MIEP mutants, which have previously been shown to be defective in rescuing the ts transcriptional defect, maintained the ability to inhibit apoptosis. Hence, the MIEP functions which affect transcription appear to be separable from the functions which inhibit apoptosis. We discuss these data in the light of the HCMV life cycle and the possibility that the MIEPs promote cellular transformation by a "hit-and-run" mechanism. PMID:10074130

  13. Complexity of Host Micro-RNA Response to Cytomegalovirus Reactivation After Organ Transplantation.

    PubMed

    Egli, A; Lisboa, L F; O'Shea, D; Asberg, A; Mueller, T; Emery, V; Kumar, D; Humar, A

    2016-02-01

    Human (Homo sapiens) micro-RNAs (hsa-miRNAs) regulate virus and host-gene translation, but the biological impact in patients with human cytomegalovirus (hCMV) infection is not well defined in a clinically relevant model. First, we compared hsa-miRNA expression profiles in peripheral blood mononuclear cells from 35 transplant recipients with and without CMV viremia by using a microarray chip covering 847 hsa-miRNAs. This approach demonstrated a set of 142 differentially expressed hsa-miRNAs. Next, we examined the effect of each of these miRNAs on viral growth by using human fibroblasts (human foreskin fibroblast-1) infected with the hCMV Towne strain, identifying a subset of proviral and antiviral hsa-miRNAs. miRNA-target prediction software indicated potential binding sites within the hCMV genome (e.g., hCMV-UL52 and -UL100 [UL = unique long]) and host-genes (e.g., interleukin-1 receptor, IRF1). Luciferase-expressing plasmid constructs and immunoblotting confirmed several predicted miRNA targets. Finally, we determined the expression of selected proviral and antiviral hsa-miRNAs in 242 transplant recipients with hCMV-viremia. We measured hsa-miRNAs before and after antiviral therapy and correlated hsa-miRNA expression levels to hCMV-replication dynamics. One of six antiviral hsa-miRNAs showed a significant increase during treatment, concurrent with viral decline. In contrast, six of eight proviral hsa-miRNAs showed a decrease during viral decline. Our results indicate that a complex and multitargeted hsa-miRNA response occurs during CMV replication in immunosuppressed patients. This study provides mechanistic insight and potential novel biomarkers for CMV replication. PMID:26460801

  14. Intracellular Trafficking of the Human Cytomegalovirus-Encoded 7-trans-Membrane Protein Homologs pUS27 and pUL78 during Viral Infection: A Comparative Analysis

    PubMed Central

    Niemann, Ina; Reichel, Anna; Stamminger, Thomas

    2014-01-01

    Human cytomegalovirus (HCMV) encodes four G protein-coupled receptor (GPCR) homologs, termed pUS27, pUS28, pUL33, and pUL78. In contrast to the extensively characterized vGPCRs pUS28 and pUL33, knowledge concerning pUS27 and pUL78 is limited. Previous studies already demonstrated constitutive internalization of pUS27 and pUL78, as well as an association with the endosomal machinery, however, these results were mainly obtained using transiently transfected cells. To explore the subcellular localization of both receptors during viral infection, we constructed recombinant HCMVs expressing tagged vGPCRs. Colocalization analyses revealed a predominant association of pUS27 or pUL78 with the trans-Golgi network or the endoplasmic reticulum, respectively. Intriguingly, our data emphasize that protein sorting is highly regulated by viral functions as we detected dramatic changes in the colocalization of pUS27 and pUL78 with endosomal markers during progression of HCMV replication. Furthermore, we observed cell type-dependent differences in trafficking of both vGPCRs between fibroblasts and epithelial cells. Most importantly, infection experiments with a recombinant HCMV carrying tagged versions of pUS27 and pUL78 simultaneously, revealed that these two proteins do not colocalize during viral infection. This contrasts to results of transient expression experiments. In conclusion, our results highlight the importance to investigate vGPCR trafficking in a viral context. PMID:24517969

  15. Enhanced neutrophil activity is associated with shorter time to tumor progression in glioblastoma patients

    PubMed Central

    Rahbar, Afsar; Cederarv, Madeleine; Wolmer-Solberg, Nina; Tammik, Charlotte; Stragliotto, Giuseppe; Peredo, Inti; Fornara, Olesja; Xu, Xinling; Dzabic, Mensur; Taher, Chato; Skarman, Petra; Söderberg-Nauclér, Cecilia

    2016-01-01

    ABSTRACT Glioblastoma multiforme (GBM) is a highly malignant tumor with a poor outcome that is often positive for human cytomegalovirus (HCMV). GBM patients often have excessive numbers of neutrophils and macrophages near and within the tumor. Here, we characterized the cytokine patterns in the blood of GBM patients with and without Valganciclovir treatment. Furthermore, we determined whether neutrophil activation is related to HCMV status and patient outcome. Blood samples for analyses of cytokines and growth factors were collected from 42 GBM patients at the time of diagnosis (n = 42) and at weeks 12 and 24 after surgery. Blood neutrophils of 28 GBM patients were examined for CD11b expression. The levels of pro- and anti-inflammatory cytokines and chemokines—including interleukin (IL)-1β, IL-2, IL-6, IL-8, IL-10, IL-12p70, IL-17A, transforming growth factor (TGF)-β1, interferon-γ, interferon-α, tumor necrosis factor α, and monocyte chemoattractant protein (MCP)-1were analyzed with a bead-based flow cytometry assay. During the first six months after surgery, neutrophil activity was increased in 12 patients and was unchanged or decreased in 16. Patients with increased neutrophil activity had enhanced IL-12p70, high grade HCMV and a shorter time to tumor progression (TTP) than patients without or decreased neutrophil activity (median TTP; 5.4 vs. 12 months, 95% confidence interval; 1.6–10 vs. 0.1–0.6, hazard ratio = 3 vs. 0.4, p = 0.004). The levels of IL-12p70 were significantly decreased in Valganciclovir treated patients (n = 22, T 12W vs. T 24W, p = 0.03). In conclusion, our findings suggest that neutrophil activation is an early sign of tumor progression in GBM patients. PMID:27057448

  16. Proteomic Interaction Patterns between Human Cyclins, the Cyclin-Dependent Kinase Ortholog pUL97 and Additional Cytomegalovirus Proteins.

    PubMed

    Steingruber, Mirjam; Kraut, Alexandra; Socher, Eileen; Sticht, Heinrich; Reichel, Anna; Stamminger, Thomas; Amin, Bushra; Couté, Yohann; Hutterer, Corina; Marschall, Manfred

    2016-01-01

    The human cytomegalovirus (HCMV)-encoded cyclin-dependent kinase (CDK) ortholog pUL97 associates with human cyclin B1 and other types of cyclins. Here, the question was addressed whether cyclin interaction of pUL97 and additional viral proteins is detectable by mass spectrometry-based approaches. Proteomic data were validated by coimmunoprecipitation (CoIP), Western blot, in vitro kinase and bioinformatic analyses. Our findings suggest that: (i) pUL97 shows differential affinities to human cyclins; (ii) pUL97 inhibitor maribavir (MBV) disrupts the interaction with cyclin B1, but not with other cyclin types; (iii) cyclin H is identified as a new high-affinity interactor of pUL97 in HCMV-infected cells; (iv) even more viral phosphoproteins, including all known substrates of pUL97, are detectable in the cyclin-associated complexes; and (v) a first functional validation of pUL97-cyclin B1 interaction, analyzed by in vitro kinase assay, points to a cyclin-mediated modulation of pUL97 substrate preference. In addition, our bioinformatic analyses suggest individual, cyclin-specific binding interfaces for pUL97-cyclin interaction, which could explain the different strengths of interactions and the selective inhibitory effect of MBV on pUL97-cyclin B1 interaction. Combined, the detection of cyclin-associated proteins in HCMV-infected cells suggests a complex pattern of substrate phosphorylation and a role of cyclins in the fine-modulation of pUL97 activities. PMID:27548200

  17. Congenital Chloride Diarrhea - Novel Mutation in SLC26A3 Gene.

    PubMed

    Bhardwaj, Swati; Pandit, Deepti; Sinha, Aditi; Hari, Pankaj; Cheong, Hae Il; Bagga, Arvind

    2016-08-01

    The authors report a case of congenital chloride diarrhea with molecular confirmation of diagnosis. A 10-mo-old boy presented with failure to thrive, voluminous diarrhea, dehydration, hyponatremia, hypokalemia, metabolic alkalosis and history of maternal polyhydramnios. The diagnosis of congenital chloride diarrhea was based on high fecal and low urinary chloride excretion, in addition to biochemical abnormalities. Genetic testing revealed a novel homozygous mutation in exon 4 of the SLC26A3 gene that encodes the protein regulating chloride bicarbonate absorption in distal ileum and colon. Therapy with oral fluids and electrolytes led to decrease in stool frequency and improvement in growth parameters. PMID:26637435

  18. SOX10 mutation with peripheral amyelination and developmental disturbance of axons.

    PubMed

    Parthey, Kathleen; Kornhuber, Malte; Kunze, Christian; Wand, Dorothea; Nolte, Kay W; Nikolin, Stefan; Weis, Joachim; Schröder, J Michael

    2012-02-01

    In this study we describe a case of a term infant with the neurological variant of Waardenburg syndrome type 4 (i.e., PCWH = peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, Waardenburg syndrome, and Hirschsprung disease, as defined in OMIM #609136) due to a novel heterozygous base exchange (c.671C>G) in exon 4 of SOX10. Magnetic resonance imaging suggested central myelin deficiency with cerebral and cerebellar hypoplasia. Hirschsprung disease was confirmed by rectal biopsy. Sural nerve biopsy revealed hypoplasia due to amyelination (with the exception of a single, small myelinated fiber) and severe reduction in the number of axons. PMID:22246888

  19. Mutations of the p53 gene in human functional adrenal neoplasms

    SciTech Connect

    Shiu-Ru Lin; Yau-Jiunn Lee; Juei-Hsiung Tsai

    1994-02-01

    To clarify gene alterations in functional human adrenal tumors, the authors performed molecular analysis for p53 abnormalities in 23 cases with adrenal neoplasms. The immunohistochemical study with anti-p53 monoclonal antibody pAb1801 demonstrated that 10 of 23 (43.5%) cases overexpressed p53 protein in the tumor cells. Using a polymerase chain reaction-single strand conformation polymorphism study, 5 of 6 (83.3%) pheochromocytoma tissues (1 malignant and 5 benign) and 11 of 15 (73.3%) adrenocortical adenomas (2 with Cushing`s syndrome and 13 with primary aldosteronism, all benign) showed an apparent electrophoretic mobility shift between the tumor and its paired adjacent normal adrenal tissue. Such differences were detected in exon 4 (12 cases), exon 5 (2 cases), and exon 7 (3 cases). The types of these mutations in exon 4 were a substitution from threonine (ACC) to isoleucine (ATC) at codon 102 in 5 cases, from glutamine (CAG) to histidine (CAC) at codon 104 in 1 case, from glycine (GGG) to alanine (CGG) at codon 117 in 1 case, from glutamate (GAG) to glutamine (CAG) at codon 68 in 1 case, and single base changes resulting in a premature stop codon at codon 100 in 2 cases. A 2-basepair deletion at codon 175 in exon 5 resulting in a frame shift was identified in 1 case. A single point mutation was identified, resulting in the substitution of glutamine (CAG) for arginine (CGG) at codon 248 of exon 7 in 1 case. A single basepair deletion at codon 249 resulted in a frame shift in 2 cases. There was 1 case with malignant pheochromocytoma that combined a single point mutation in exon 4 and a single base deletion in exon 7. Only 2 of 23 cases showed a loss of a normal allele encoding in the p53 gene. Northern blot analysis with 1.8-kilobase p53 cDNA revealed that p53 mRNA was overexpressed in 6 cases. The results indicate that high frequencies of p53 gene mutation, especially in exon 4, exist in functional adrenal tumors. 39 refs., 6 figs., 4 tabs.

  20. A novel nonsense mutation in the WFS1 gene causes the Wolfram syndrome.

    PubMed

    Noorian, Shahab; Savad, Shahram; Mohammadi, Davood Shah

    2016-05-01

    Wolfram syndrome is a rare autosomal recessive neurodegenerative disorder, which is mostly caused by mutations in the WFS1 gene. The WFS1 gene product, which is called wolframin, is thought to regulate the function of endoplasmic reticulum. The endoplasmic reticulum has a critical role in protein folding and material transportation within the cell or to the surface of the cell. Identification of new mutations in WFS1 gene will unravel the molecular pathology of WS. The aim of this case report study is to describe a novel mutation in exon 4 of the WFS1 gene (c.330C>A) in a 9-year-old boy with WS. PMID:26943604

  1. Unusual case presentations associated with the CD45 C77G polymorphism.

    PubMed

    Tchilian, E Z; Gil, J; Navarro, M L; Fernandez-Cruz, E; Chapel, H; Misbah, S; Ferry, B; Renz, H; Schwinzer, R; Beverley, P C L

    2006-12-01

    CD45, the leucocyte common antigen, is a haematopoietic cell specific tyrosine phosphatase. Human polymorphic CD45 variants are associated with autoimmune and infectious diseases and alter the phenotype and function of lymphocytes, establishing CD45 as an important regulator of immune function. Here we report four patients with diverse diseases with unusual clinical features. All four have the C77G polymorphism of CD45 exon 4, which alters the splicing and CD45RA/CD45R0 phenotype of lymphocytes. We suggest that C77G may be a contributing factor in these unusual cases. PMID:17100764

  2. Application of denaturing gradient gel electrophoresis to detect DNA sequence differences encoding apolipoprotein E isoforms

    SciTech Connect

    Parker, S.; Angelico, M.C.; Laffel, L.; Krolewski, A.S. Harvard Medical School, Boston, MA )

    1993-04-01

    Apolipoprotein E (apoE) plays an important role in plasma lipid metabolism. Three common isoforms of this protein have been identified by the isoelectric focusing method. In this report the authors describe a new method for distinguishing these isoforms. Their method employs PCR amplification of the DNA sequence of exon 4 in the apoE gene followed by denaturing gradient gel electrophoresis (DGGE) to distinguish its different melting characteristics. Identification of the ApoE isoforms through DNA melting behavior rather than protein charge differences eliminates the problems associated with isoelectric focusing and facilitates screening for additional mutations at the apoE locus. 12 refs., 2 figs.

  3. Extensive germinal mosaicism in a family with X linked myotubular myopathy simulates genetic heterogeneity.

    PubMed Central

    Vincent, M C; Guiraud-Chaumeil, C; Laporte, J; Manouvrier-Hanu, S; Mandel, J L

    1998-01-01

    A family with two male cousins affected with myotubular myopathy (MTM) was referred to us for genetic counselling. Linkage analysis appeared to exclude the Xq28 region. As a gene for X linked MTM was recently identified in Xq28, we screened the obligatory carrier mothers for mutation. We found a 4 bp deletion in exon 4 of the MTM1 gene, which originated from the grandfather of the affected children and which was transmitted to three daughters. This illustrates the importance of mutation detection to avoid pitfalls in linkage analysis that may be caused by such cases of germinal mosaicism. Images PMID:9541111

  4. Secocrassumol, a seco-Cembranoid from the Dongsha Atoll Soft Coral Lobophytum crassum

    PubMed Central

    Cheng, Shi-Yie; Wang, Shang-Kwei; Duh, Chang-Yih

    2014-01-01

    Chemical investigations on the Dongsha Atoll soft coral Lobophytum crassum led to the purification of a new seco-cembranoid, secocrassumol. The structural elucidation was established by extensive NMR, HRESIMS and CD data. The absolute configuration at C-12 was determined as S using a modified Mosher’s acylation. Secocrassumol differs from previously known marine seco-cembranoid in that it possesses an unprecedented skeleton functionalized at C11-C12 bond cleavage. Secocrassumol showed antiviral activity against human cytomegalovirus (HCMV) with an IC50 value of 5.0 μg/mL. PMID:25522315

  5. Synthesis and anti-DNA viral activities in vitro of certain 2,4-disubstituted-7-(2-deoxy-2-fluoro-beta-D-arabinofuranosyl)pyrrolo[2,3-d d pyrimidine nucleosides.

    PubMed

    Bhattacharya, B K; Ojwang, J O; Rando, R F; Huffman, J H; Revankar, G R

    1995-09-29

    Several novel 2,4-disubstituted-7-(2-deoxy-2-fluoro-beta-D- arabinofuranosyl)pyrrolo[2,3-d]pyrimidines have been synthesized and evaluated for their anti-human cytomegalovirus (HCMV), anti-hepatitis B virus (HBV), and anti-herpes simplex virus (HSV) activities in vitro. These nucleosides were prepared starting from 2-amino-4-chloro-7-(2-deoxy-2-fluoro- 3,5-di-O-benzoyl-beta-D-arabinofuranosyl)pyrrolo[2,3-d]pyrimidine (3), which in turn was synthesized by direct glycosylation of the sodium salt of 2-amino-4-chloropyrrolo[2,3-d]pyrimidine (1) with 2-deoxy-2-fluoro-3,5-di-O-benzoyl-alpha-D-arabinofuranosyl bromide (2). Displacement of the 4-chloro group of 3 with OH, NH2, NHOH, SH, and SeH nucleophiles furnished the corresponding nucleosides 6-8, 12, and 14, respectively. The 3'-deoxygenation of 2-amino-4-chloro-7- (2-deoxy-2-fluoro-beta-D-arabinofuranosyl)pyrrolo[2,3-d]pyrimidine (4) and subsequent amination gave 2,4-diamino-2',3'-dideoxy derivative 19. Catalytic hydrogenation of 3 followed by debenzoylation afforded 2-aminopyrrolo[2,3-d]pyrimidine nucleoside 23. Among the compounds evaluated for their ability to inhibit the growth of HCMV (strain AD169) in MRC-5 cells using a plaque reduction assay, only 7 was significantly active in vitro with a 50% inhibitory concentration (IC50) of 3.7 micrograms/mL (TI > 125), whereas the IC50 value of ganciclovir (DHPG) was 3.2 micrograms/mL. Strain D16 of HCMV was more resistant to 7 (IC50 11 micrograms/mL) than the AD169 strain. When 7 was tested in combination with DHPG, the resultant anti-HCMV activity was found to be moderately synergistic with no evidence of antagonism. Nucleoside 7 also reduced episomal HBV replication in human hepatoblastoma 2.2.15 cells with an IC50 of 0.7 micrograms/mL (TI > 143). Development of cells harboring HBV which had become resistant to the drug was not observed with 7. Compound 7 also exhibited significant activity against herpes simplex virus types 1 and 2 (IC50 of 4.1 and 6.3 micrograms

  6. Three New Cembranoids from the Taiwanese Soft Coral Sarcophyton ehrenbergi

    PubMed Central

    Wang, Shang-Kwei; Hsieh, Mu-Keng; Duh, Chang-Yih

    2012-01-01

    In order to search for new bioactive substances from marine organisms, we have investigated the acetone extracts of the soft coral Sarcophyton ehrenbergi collected at San-Hsian-Tai, Taitong County, Taiwan. Chromatographic fractionation of the extracts of the octocoral S. ehrenbergi led to the isolation of three new cembranoids, (+)-12-ethoxycarbonyl-11Z-sarcophine (1), ehrenbergol A and B (2 and 3). The structures of these isolated metabolites were elucidated through extensive spectroscopic analyses. Moreover, metabolites 1–3 were evaluated in vitro for their cytotoxicity towards selected cancer cell lines and antiviral activity against human cytomegalovirus (HCMV). PMID:22851917

  7. Cembranoids from the Dongsha Atoll Soft Coral Lobophytum crassum

    PubMed Central

    Lin, Shih-Tseng; Wang, Shang-Kwei; Duh, Chang-Yih

    2011-01-01

    Chemical investigation of the Dongsha Atoll soft coral Lobophytum crassum has afforded four new cembranoids, crassumols A–C (1–3) and 13-acetoxysarcophytoxide (4). The structures of these isolated compounds were elucidated by extensive NMR and HRESIMS experiments. The cytotoxicity and anti-HCMV (Human cytomegalovirus) activities of 1–4 were evaluated in vitro. Compound 4 exhibited cytotoxicity against A-549 (human lung carcinoma) cell line with an ED50 of 3.6 μg/mL. PMID:22363246

  8. Briacavatolides A–C, New Briaranes from the Taiwanese Octocoral Briareum excavatum

    PubMed Central

    Yeh, Tsun-Tai; Wang, Shang-Kwei; Dai, Chang-Feng; Duh, Chang-Yih

    2012-01-01

    In order to search for novel bioactive substances from marine organisms, we have investigated the organic extracts of the Taiwanese octocoral Briareum excavatum collected at Orchid Island. Three new briarane-type diterpenoids, briacavatolides A–C (1–3) as well as two known briaranes, briaexcavatolide U (4) and briaexcavatin L (5) were isolated from the acetone extract. The structures of these compounds were elucidated by extensive NMR spectroscopic analysis and physical data. The anti-HCMV (human cytomegalovirus) activity of 1–5 and their cytotoxicity against selected cancer cell lines were evaluated. PMID:22822353

  9. Development of recombinant canine adenovirus type-2 expressing the Gn glycoprotein of Seoul virus.

    PubMed

    Yuan, Ziguo; Zhang, Xiuxiang; Zhang, Shoufeng; Liu, Ye; Gao, Shengyan; Zhang, Fei; Xu, Huijuan; Wang, Xiaohu; Hu, Rongliang

    2008-05-01

    Seoul virus glycoprotein Gn is a major structural protein and candidate antigen of hantavirus that induces a highly immunogenic response for hantavirus vaccine. In this study, a replication-competent recombinant canine adenovirus type-2 expressing Gn was constructed by the in vitro ligation method. The Gn expression cassette, including the human cytomegalovirus (hCMV) promoter/enhancer and the SV40 early mRNA polyadenylation signal, was cloned into the SspI site of the E3 region which is not essential for proliferation of CAV-2. Expression of Gn was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Western blotting. PMID:18249007

  10. Diagnosis of children’s attention deficit hyperactivity disorder (ADHD) and its association with cytomegalovirus infection with ADHD: a historical review

    PubMed Central

    Zhou, Rui; Xia, Qun; Shen, Huaiyun; Yang, Xiaoyun; Zhang, Yongli; Xu, Jiali

    2015-01-01

    As the most common mental disorder identified in children and teenagers, attention deficit hyperactivity disorder (ADHD) affects millions of children and their families, making it a critical health issue worldwide. This article reviewed the historical opinions about the diagnosis of ADHD and defined different subtypes of this disorder. It also summarized the current diagnostic criteria and available medications. After re-visiting the etiology of ADHD in the sense of both genetic and environment factors, it was further hypothesized that viral infection might be involved in ADHD pathogenesis. Human cytomegalovirus (HCMV) infection may be associated with ADHD, although both clinical observations and animal studies need to be performed for validation. PMID:26550354

  11. Viral induction of site-specific chromosome damage.

    PubMed

    Fortunato, Elizabeth A; Spector, Deborah H

    2003-01-01

    The advent of advanced cell culture and cytogenetics techniques in the 1950s opened a new avenue for research on the pathogenic interactions between animal viruses and their hosts. Studies of many viruses revealed their ability to nonspecifically induce cytogenetic damage to their host cell's chromosomes. However, only three viruses, the oncogenic adenoviruses, herpes simplex virus (HSV) and human cytomegalovirus (HCMV), have been found to cause non-random, site-specific chromosomal damage. Adenovirus (Ad) type 12 induces fragility at four distinct loci (RNU1, RNU2, RN5S and PSU1) in many different types of human cells. A common feature of these loci is that they contain a repeated array of transcriptionally active genes encoding small structural RNAs. Site-specific induction of breaks also requires the virally encoded E1B protein of M(r) 55000 and the C-terminus of the cellular p53 protein. Analysis of the induction of damage by HSV and HCMV necessitates consideration of several factors, including the strain of virus used, the timing of infection, the type of cell used, and the multiplicity of infection. Both HSV strains 1 and 2 are cytotoxic, although the former seems to be more proficient at inducing damage. At early times post infection, HSV induces breaks and specific uncoiling of the centromeres of chromosomes 1, 9 and 16. This is followed at later times by a more complete severing of all of the chromosomes, termed pulverisation. Damage by HSV requires viral entry and de novo viral protein synthesis, with immediate early viral proteins responsible for the induction of breaks and uncoiling and early gene products (most likely nucleases) involved in the extensive pulverisation seen later. HCMV has been studied primarily in permissive human fibroblasts. Its ability to induce specific damage in chromosome 1 at two loci, 1q21 and 1q42, was only recently revealed as the cells must be in S-phase when they are infected for the breaks to be observed. In contrast to

  12. Enveloped Virus-Like Particle Expression of Human Cytomegalovirus Glycoprotein B Antigen Induces Antibodies with Potent and Broad Neutralizing Activity

    PubMed Central

    Kirchmeier, Marc; Fluckiger, Anne-Catherine; Soare, Catalina; Bozic, Jasminka; Ontsouka, Barthelemy; Ahmed, Tanvir; Diress, Abebaw; Pereira, Lenore; Schödel, Florian; Plotkin, Stanley; Dalba, Charlotte; Klatzmann, David

    2014-01-01

    A prophylactic vaccine to prevent the congenital transmission of human cytomegalovirus (HCMV) in newborns and to reduce life-threatening disease in immunosuppressed recipients of HCMV-infected solid organ transplants is highly desirable. Neutralizing antibodies against HCMV confer significant protection against infection, and glycoprotein B (gB) is a major target of such neutralizing antibodies. However, one shortcoming of past HCMV vaccines may have been their failure to induce high-titer persistent neutralizing antibody responses that prevent the infection of epithelial cells. We used enveloped virus-like particles (eVLPs), in which particles were produced in cells after the expression of murine leukemia virus (MLV) viral matrix protein Gag, to express either full-length CMV gB (gB eVLPs) or the full extracellular domain of CMV gB fused with the transmembrane and cytoplasmic domains from vesicular stomatitis virus (VSV)-G protein (gB-G eVLPs). gB-G-expressing eVLPs induced potent neutralizing antibodies in mice with a much greater propensity toward epithelial cell-neutralizing activity than that induced with soluble recombinant gB protein. An analysis of gB antibody binding titers and T-helper cell responses demonstrated that high neutralizing antibody titers were not simply due to enhanced immunogenicity of the gB-G eVLPs. The cells transiently transfected with gB-G but not gB plasmid formed syncytia, consistent with a prefusion gB conformation like those of infected cells and viral particles. Two of the five gB-G eVLP-induced monoclonal antibodies we examined in detail had neutralizing activities, one of which possessed particularly potent epithelial cell-neutralizing activity. These data differentiate gB-G eVLPs from gB antigens used in the past and support their use in a CMV vaccine candidate with improved neutralizing activity against epithelial cell infection. PMID:24334684

  13. Enveloped virus-like particle expression of human cytomegalovirus glycoprotein B antigen induces antibodies with potent and broad neutralizing activity.

    PubMed

    Kirchmeier, Marc; Fluckiger, Anne-Catherine; Soare, Catalina; Bozic, Jasminka; Ontsouka, Barthelemy; Ahmed, Tanvir; Diress, Abebaw; Pereira, Lenore; Schödel, Florian; Plotkin, Stanley; Dalba, Charlotte; Klatzmann, David; Anderson, David E

    2014-02-01

    A prophylactic vaccine to prevent the congenital transmission of human cytomegalovirus (HCMV) in newborns and to reduce life-threatening disease in immunosuppressed recipients of HCMV-infected solid organ transplants is highly desirable. Neutralizing antibodies against HCMV confer significant protection against infection, and glycoprotein B (gB) is a major target of such neutralizing antibodies. However, one shortcoming of past HCMV vaccines may have been their failure to induce high-titer persistent neutralizing antibody responses that prevent the infection of epithelial cells. We used enveloped virus-like particles (eVLPs), in which particles were produced in cells after the expression of murine leukemia virus (MLV) viral matrix protein Gag, to express either full-length CMV gB (gB eVLPs) or the full extracellular domain of CMV gB fused with the transmembrane and cytoplasmic domains from vesicular stomatitis virus (VSV)-G protein (gB-G eVLPs). gB-G-expressing eVLPs induced potent neutralizing antibodies in mice with a much greater propensity toward epithelial cell-neutralizing activity than that induced with soluble recombinant gB protein. An analysis of gB antibody binding titers and T-helper cell responses demonstrated that high neutralizing antibody titers were not simply due to enhanced immunogenicity of the gB-G eVLPs. The cells transiently transfected with gB-G but not gB plasmid formed syncytia, consistent with a prefusion gB conformation like those of infected cells and viral particles. Two of the five gB-G eVLP-induced monoclonal antibodies we examined in detail had neutralizing activities, one of which possessed particularly potent epithelial cell-neutralizing activity. These data differentiate gB-G eVLPs from gB antigens used in the past and support their use in a CMV vaccine candidate with improved neutralizing activity against epithelial cell infection. PMID:24334684

  14. Differentiation-Coupled Induction of Human Cytomegalovirus Replication by Union of the Major Enhancer Retinoic Acid, Cyclic AMP, and NF-κB Response Elements

    PubMed Central

    Yuan, Jinxiang; Li, Ming; Torres, Yasaira Rodriguez; Galle, Courtney S.

    2015-01-01

    ABSTRACT Triggers and regulatory pathways that effectively link human cytomegalovirus (HCMV) major immediate early (MIE) latent-lytic switch activation with progeny production are incompletely understood. In the quiescently infected human NTera2 cell model of primitive neural stem cells, we found that costimulation with vasoactive intestinal peptide (V) and phorbol ester (P) synergistically activated viral infection, but this effect waned over time. Coupling retinoic acid (R), an inducer of neuronal differentiation, to VP pulse stimulation attenuated the decline in viral activity and promoted the spread of the active infection through concentric layers of neighboring cells as cellular differentiation progressed. R stimulation alone was unable to activate the infection. The MIE enhancer cis-regulatory mechanisms responsible for this result were characterized by a strategy of combinatorial mutagenesis of five cis-acting element types (retinoic acid receptor binding elements [RARE], cyclic AMP [cAMP] response elements [CRE], NF-κB binding sites [kB], serum response element, and ETS/ELK-1 binding site) and multiple methods of assessment. We found that the CRE and kB combination sets the preinduction enhancer tone, is the major initiator and amplifier of RVP-induced MIE gene expression, and cooperates with RARE during cellular differentiation to enhance viral spread. In predifferentiated NTera2, we also found that the CRE-kB combination functions as initiator and amplifier of unstimulated HCMV MIE gene expression and cooperatively interacts with RARE to enhance viral spread. We conclude that RVP-stimulated signaling cascades and cellular differentiation operate through the enhancer CRE-kB-RARE core in strengthening induction of HCMV MIE gene expression in linkage with viral propagation. IMPORTANCE Cytomegalovirus-seropositive persons commonly lack detectable levels of cytomegalovirus replication, even when profoundly immunocompromised. In a human NTera2 cell model of

  15. Latent infection of myeloid progenitors by human cytomegalovirus protects cells from FAS-mediated apoptosis through the cellular IL-10/PEA-15 pathway

    PubMed Central

    Lau, Jonathan C. H.; Sinclair, John

    2015-01-01

    Latent infection of primary CD34+ progenitor cells by human cytomegalovirus (HCMV) results in their increased survival in the face of pro-apoptotic signals. For instance, we have shown previously that primary myeloid cells are refractory to FAS-mediated killing and that cellular IL-10 (cIL-10) is an important survival factor for this effect. However, how cIL-10 mediates this protection is unclear. Here, we have shown that cIL-10 signalling leading to upregulation of the cellular factor PEA-15 mediates latency-associated protection of CD34+ progenitor cells from the extrinsic death pathway. PMID:25957098

  16. Clinicopathological differences between variants of the NAB2-STAT6 fusion gene in solitary fibrous tumors of the meninges and extra-central nervous system.

    PubMed

    Nakada, Satoko; Minato, Hiroshi; Nojima, Takayuki

    2016-07-01

    Investigations on the NAB2-STAT6 fusion gene in solitary fibrous tumors (SFTs) and hemangiopericytomas (HPCs) have increased since its discovery in 2013. Although several SFTs reported without NAB2-STAT6 fusion gene analysis, we reviewed 546 SFTs/HPCs with NAB2-STAT6 fusion gene analysis in this study and investigated differences between the gene variants. In total, 452 cases tested positive for the NAB2-STAT6 fusion gene, with more than 40 variants being detected. The most frequent of these were NAB2 exon 6-STAT6 exon 16/17/18 and NAB2 exon 4-STAT6 exon 2/3, with the former occurring most frequently in SFTs in meninges, soft tissues, and head and neck; the latter predominated in SFTs in the pleura and lung. There was no difference between the histology of SFTs and fusion gene variants. A follow-up analysis of SFTs showed that 51 of 202 cases had a recurrence, with 18 of 53 meningeal SFTs having a local recurrence and/or metastasis within 0-19 years. In meninges and soft tissue, SFTs with the NAB2 exon 6-STAT6 exon 16/17/18 tended to recur more frequently than SFTs with the NAB2 exon 4-STAT6 exon 2/3. Clinicopathological data, including yearly follow-ups, are required for meningeal SFTs/HPCs to define the correlation of variants of NAB2-STAT6 fusion gene. PMID:27271270

  17. Novel mutations of endothelin-B receptor gene in Pakistani patients with Waardenburg syndrome.

    PubMed

    Jabeen, Raheela; Babar, Masroor Ellahi; Ahmad, Jamil; Awan, Ali Raza

    2012-01-01

    Mutations in EDNRB gene have been reported to cause Waardenburg-Shah syndrome (WS4) in humans. We investigated 17 patients with WS4 for identification of mutations in EDNRB gene using PCR and direct sequencing technique. Four genomic mutations were detected in four patients; a G to C transversion in codon 335 (S335C) in exon 5 and a transition of T to C in codon (S361L) in exon 5, a transition of A to G in codon 277 (L277L) in exon 4, a non coding transversion of T to A at -30 nucleotide position of exon 5. None of these mutations were found in controls. One of the patients harbored two novel mutations (S335C, S361L) in exon 5 and one in Intronic region (-30exon5 A>G). All of the mutations were homozygous and novel except the mutation observed in exon 4. In this study, we have identified 3 novel mutations in EDNRB gene associated with WS4 in Pakistani patients. PMID:21547364

  18. A 20 bp Duplication in Exon 2 of the Aristaless-Like Homeobox 4 Gene (ALX4) Is the Candidate Causative Mutation for Tibial Hemimelia Syndrome in Galloway Cattle.

    PubMed

    Brenig, Bertram; Schütz, Ekkehard; Hardt, Michael; Scheuermann, Petra; Freick, Markus

    2015-01-01

    Aristaless-like homeobox 4 (ALX4) gene is an important transcription regulator in skull and limb development. In humans and mice ALX4 mutations or loss of function result in a number of skeletal and organ malformations, including polydactyly, tibial hemimelia, omphalocele, biparietal foramina, impaired mammary epithelial morphogenesis, alopecia, coronal craniosynostosis, hypertelorism, depressed nasal bridge and ridge, bifid nasal tip, hypogonadism, and body agenesis. Here we show that a complex skeletal malformation of the hind limb in Galloway cattle together with other developmental anomalies is a recessive autosomal disorder most likely caused by a duplication of 20 bp in exon 2 of the bovine ALX4 gene. A second duplication of 34 bp in exon 4 of the same gene has no known effect, although both duplications result in a frameshift and premature stop codon leading to a truncated protein. Genotyping of 1,688 Black/Red/Belted/Riggit Galloway (GA) and 289 White Galloway (WGA) cattle showed that the duplication in exon 2 has allele frequencies of 1% in GA and 6% in WGA and the duplication in exon 4 has frequencies of 23% in GA and 38% in WGA. Both duplications were not detected in 876 randomly selected German Holstein Friesian and 86 cattle of 21 other breeds. Hence, we have identified a candidate causative mutation for tibial hemimelia syndrome in Galloway cattle and selection against this mutation can be used to eliminate the mutant allele from the breed. PMID:26076463

  19. Effect of Genetic Diversity in Swine Leukocyte Antigen-DRA Gene on Piglet Diarrhea

    PubMed Central

    Huang, Xiaoyu; Yang, Qiaoli; Yuan, Junhu; Liu, Lixia; Sun, Wenyang; Jiang, Yingdi; Zhao, Shengguo; Zhang, Shengwei; Huang, Wangzhou; Gun, Shuangbao

    2016-01-01

    The swine leukocyte antigens (SLAs) are the multigene families related to immune responses. Little is known about the effect of the DRA gene on diarrheal disease. This study reported the genetic diversity of the DRA gene in exons 1, 3 and 4 in 290 Chinese Yantai black pigs. No variation was identified in exon 3. In exon 1, three genotypes and two alleles were identified, generated by two single nucleotide polymorphisms (SNPs). In exon 4, there were eight genotypes and five alleles containing seven SNPs were detected with four SNPs being novel SNPs. The low polymorphism found in swine DRA is consistent with the concept that the DRA gene is highly conserved among all mammalian species. Statistical analyses indicated that the genotypes of exon 1 were not significantly associated with piglet diarrhea (p > 0.05); however, genotypes C4C4 (1.80 ± 0.33) and A4E4 (1.66 ± 0.25) of exon 4 were significantly susceptible to diarrhea (p < 0.01). These indicate that the particular genotypes of the DRA gene are susceptible to diarrheal disease, which provides valuable information for disease-resistance breeding in swine. PMID:27429004

  20. A 20 bp Duplication in Exon 2 of the Aristaless-Like Homeobox 4 Gene (ALX4) Is the Candidate Causative Mutation for Tibial Hemimelia Syndrome in Galloway Cattle

    PubMed Central

    Brenig, Bertram; Schütz, Ekkehard; Hardt, Michael; Scheuermann, Petra; Freick, Markus

    2015-01-01

    Aristaless-like homeobox 4 (ALX4) gene is an important transcription regulator in skull and limb development. In humans and mice ALX4 mutations or loss of function result in a number of skeletal and organ malformations, including polydactyly, tibial hemimelia, omphalocele, biparietal foramina, impaired mammary epithelial morphogenesis, alopecia, coronal craniosynostosis, hypertelorism, depressed nasal bridge and ridge, bifid nasal tip, hypogonadism, and body agenesis. Here we show that a complex skeletal malformation of the hind limb in Galloway cattle together with other developmental anomalies is a recessive autosomal disorder most likely caused by a duplication of 20 bp in exon 2 of the bovine ALX4 gene. A second duplication of 34 bp in exon 4 of the same gene has no known effect, although both duplications result in a frameshift and premature stop codon leading to a truncated protein. Genotyping of 1,688 Black/Red/Belted/Riggit Galloway (GA) and 289 White Galloway (WGA) cattle showed that the duplication in exon 2 has allele frequencies of 1% in GA and 6% in WGA and the duplication in exon 4 has frequencies of 23% in GA and 38% in WGA. Both duplications were not detected in 876 randomly selected German Holstein Friesian and 86 cattle of 21 other breeds. Hence, we have identified a candidate causative mutation for tibial hemimelia syndrome in Galloway cattle and selection against this mutation can be used to eliminate the mutant allele from the breed. PMID:26076463

  1. A specific isoform of poly(ADP-ribose) glycohydrolase is targeted to the mitochondrial matrix by a N-terminal mitochondrial targeting sequence

    SciTech Connect

    Whatcott, Clifford J.; Meyer-Ficca, Mirella L.; Meyer, Ralph G.; Jacobson, Myron K.

    2009-12-10

    Poly(ADP-ribose) polymerases (PARPs) convert NAD to polymers of ADP-ribose that are converted to free ADP-ribose by poly(ADP-ribose) glycohydrolase (PARG). The activation of the nuclear enzyme PARP-1 following genotoxic stress has been linked to release of apoptosis inducing factor from the mitochondria, but the mechanisms by which signals are transmitted between nuclear and mitochondrial compartments are not well understood. The study reported here has examined the relationship between PARG and mitochondria in HeLa cells. Endogenous PARG associated with the mitochondrial fraction migrated in the range of 60 kDa. Transient transfection of cells with PARG expression constructs with amino acids encoded by exon 4 at the N-terminus was targeted to the mitochondria as demonstrated by subcellular fractionation and immunofluorescence microscopy of whole cells. Deletion and missense mutants allowed identification of a canonical N-terminal mitochondrial targeting sequence consisting of the first 16 amino acids encoded by PARG exon 4. Sub-mitochondrial localization experiments indicate that this mitochondrial PARG isoform is targeted to the mitochondrial matrix. The identification of a PARG isoform as a component of the mitochondrial matrix raises several interesting possibilities concerning mechanisms of nuclear-mitochondrial cross talk involved in regulation of cell death pathways.

  2. Genetic polymorphisms and protein structures in growth hormone, growth hormone receptor, ghrelin, insulin-like growth factor 1 and leptin in Mehraban sheep.

    PubMed

    Bahrami, A; Behzadi, Sh; Miraei-Ashtiani, S R; Roh, S-G; Katoh, K

    2013-09-15

    The somatotropic axis, the control system for growth hormone (GH) secretion and its endogenous factors involved in the regulation of metabolism and energy partitioning, has promising potentials for producing economically valuable traits in farm animals. Here we investigated single nucleotide polymorphisms (SNPs) of the genes of factors involved in the somatotropic axis for growth hormone (GH1), growth hormone receptor (GHR), ghrelin (GHRL), insulin-like growth factor 1 (IGF-I) and leptin (LEP), using polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP) and DNA sequencing methods in 452 individual Mehraban sheep. A nonradioactive method to allow SSCP detection was used for genomic DNA and PCR amplification of six fragments: exons 4 and 5 of GH1; exon 10 of GH receptor (GHR); exon 1 of ghrelin (GHRL); exon 1 of insulin-like growth factor-I (IGF-I), and exon 3 of leptin (LEP). Polymorphisms were detected in five of the six PCR products. Two electrophoretic patterns were detected for GH1 exon 4. Five conformational patterns were detected for GH1 exon 5 and LEP exon 3, and three for IGF-I exon 1. Only GHR and GHRL were monomorphic. Changes in protein structures due to variable SNPs were also analyzed. The results suggest that Mehraban sheep, a major breed that is important for the animal industry in Middle East countries, has high genetic variability, opening interesting prospects for future selection programs and preservation strategies. PMID:23747407

  3. Naturally- and experimentally-designed restorations of the Parkin gene deficit in autosomal recessive juvenile parkinsonism

    SciTech Connect

    Asai, Hirohide; Hirano, Makito; Kiriyama, Takao; Ikeda, Masanori; Ueno, Satoshi

    2010-01-01

    Intranuclear events due to mutations in the Parkin gene remain elusive in autosomal recessive juvenile parkinsonism (ARJP). We identified a mutant PARKIN protein in fibroblast cultures from a pair of siblings with ARJP who were homozygous for the exon 4-deleted Parkin gene. Disease was mild in one patient and debilitating in the other. The detected mutant, encoded by a transcript lacking exon 3 as well as exon 4, is an in-frame deletion that removes 121 aa, resulting in a 344-aa protein (PaDel3,4). Cell culture and transfection studies revealed negative correlations between expression levels of PaDel3,4 and those of cell cycle proteins, including cyclin E, CDK2, ppRb, and E2F-1, and demonstrated that GFP-PaDel3,4 entered nucleus and ubiquitinated cyclin E as a part of SCF{sup hSel-10} ligase complex in the patient cells. In addition, nuclear localization signal-tagged PaDel3,4 expressed in the transfected patient cells most effectively ubiquitinated cyclin E and reduced DNA damage, protecting cells from oxidative stress. Antisense-oligonucleotide treatment promoted skipping of exon 3 and thus generated PaDel3,4, increasing cell survival. Collectively, we propose that naturally- and experimentally-induced exon skipping at least partly restores the mutant Parkin gene deficit, providing a molecular basis for the development of therapeutic exon skipping.

  4. Pyruvate dehydrogenase deficiency: molecular basis for intrafamilial heterogeneity.

    PubMed

    Fujii, T; Van Coster, R N; Old, S E; Medori, R; Winter, S; Gubits, R M; Matthews, P M; Brown, R M; Brown, G K; Dahl, H H

    1994-07-01

    Two half-brothers and their mother had symptomatic pyruvate dehydrogenase complex deficiency. The infants had severe congenital lactic acidosis, seizures, and apneic spells and died at the ages 3 and 4 months. The mother was less symptomatic with mental retardation, truncal ataxia, and dysarthria. The residual pyruvate dehydrogenase activities in cultured skin fibroblasts from the 2 infants and their mother were 7, 15, and 10% of control values. Immunoblot analysis showed negligible amounts of E1 alpha and E1 beta subunits of the complex. Northern blot analysis for the E1 alpha subunit showed normal results. In the 2 sons, complementary DNA sequence analysis revealed a cytosine to thymine mutation in exon 4, resulting in a change of arginine 127 to tryptophan in the E1 alpha subunit. Restriction enzyme analysis of the polymerase chain reaction product representing exon 4 of the E1 alpha gene revealed that the mother was a heterozygotes. Complementary DNA restriction analysis and methylation analysis of the X chromosome DXS255 loci revealed skewed activation of the mutant allele, consistent with the deficient pyruvate dehydrogenase activity in the mother's fibroblasts. The milder maternal phenotype is consistent with variable X-inactivation patterns in different organs of female heterozygotes. PMID:8024267

  5. Characterization of a de novo 43-bp deletion of the Gs[alpha] gene (GNAS1) in Albright hereditary osteodystrophy

    SciTech Connect

    Luttikhuis, M.E.M.O.; Trembath, R.C. ); Wilson, L.C. Institute of Child Health, London ); Leonard, J.V. )

    1994-05-15

    Albright hereditary osteodystrophy (AHO) is an autosomal dominant disorder characterized by short stature, obesity, mental retardation, subcutaneous calcification, and brachy-metaphalangia. Two distinct forms of AHO exist; pseudohypoparathyroidism type I (PHPI) and pseudopseudohypoparathyrodism (PPHP). The classification is dependent upon the presence or absence, respectively, of resistance to parathyroid and other hormones that bind to Gs-protein-coupled membrane receptors stimulating adenylyl cyclase. Gs is a heterotrimeric protein comprising [alpha], [beta], and [gamma]-subunits encoded by separate genes. Genomic DNA was isolated from peripheral leukocytes from 13 unrelated AHO patients. Exon 4 and flanking intronic sequence of GNAS1 were PCR amplified. A single PCR product corresponding to the expected 159-bp fragment was identified in 12 affected individuals with either PHPIa or PPHP. In patient 10285 an additional smaller fragment was detected but was not present in either of the unaffected parents. These two fragments were isolated from a 2% agarose gel. Direct sequencing of the smaller fragment revealed a 43-bp deletion comprising at least 35 hp of the 3[prime] end of exon 4 and the donor splice site of intron 4 and extending into the following intro. The 43-bp deletion would lead to a premature stop codon, 62 codons downstream of the deletion. The de novo mutation reported here is the largest deletion in the Gs[alpha] gene described so far for AHO patients.

  6. TP53 genetic alterations in Arab breast cancer patients: Novel mutations, pattern and distribution

    PubMed Central

    AL-QASEM, ABEER J.; TOULIMAT, MOHAMED; ELDALI, ABDELMONEIM M.; TULBAH, ASMA; AL-YOUSEF, NUJOUD; AL-DAIHAN, SOOAD K.; AL-TASSAN, NADA; AL-TWEIGERI, TAHER; ABOUSSEKHRA, ABDELILAH

    2011-01-01

    Breast cancer remains a worldwide public health concern. The incidence and mortality of breast cancer varies significantly in ethnically and geographically distinct populations. In the Kingdom of Saudi Arabia (KSA) breast cancer has shown an increase in incidence and is characterized by early onset and aggressiveness. The tumor suppressor TP53 gene is a crucial genetic factor that plays a significant role in breast carcinogenesis. Furthermore, studies have shown a correlation between certain p53 mutations and response to therapy in breast cancer. In the present study, TP53 mutations were identified by direct sequencing of the gene (exons 4–9) from 119 breast cancer tissues. The prevalence of TP53 mutations in Arab breast cancer patients living in the KSA is among the highest in the world (40%). Notably, 73% of the patients whose tumors harbored p53 mutations were less than 50 years of age. Furthermore, for the first time, we identified 7 novel mutations and 16 mutations in breast cancer tissues. Notably, all the novel point mutations were found in exon 4, wherein 29% of the mutations were localized. Furthermore, an excess of G:C→A:T transitions (49%) at non-CpG sites was noted, suggesting exposure to particular environmental carcinogens such as N-nitroso compounds. The results indicate that the TP53 gene plays a significant role in breast carcinogenesis and the early onset of the disease among Arab female individuals. PMID:22866089

  7. TP53 genetic alterations in Arab breast cancer patients: Novel mutations, pattern and distribution.

    PubMed

    Al-Qasem, Abeer J; Toulimat, Mohamed; Eldali, Abdelmoneim M; Tulbah, Asma; Al-Yousef, Nujoud; Al-Daihan, Sooad K; Al-Tassan, Nada; Al-Tweigeri, Taher; Aboussekhra, Abdelilah

    2011-03-01

    Breast cancer remains a worldwide public health concern. The incidence and mortality of breast cancer varies significantly in ethnically and geographically distinct populations. In the Kingdom of Saudi Arabia (KSA) breast cancer has shown an increase in incidence and is characterized by early onset and aggressiveness. The tumor suppressor TP53 gene is a crucial genetic factor that plays a significant role in breast carcinogenesis. Furthermore, studies have shown a correlation between certain p53 mutations and response to therapy in breast cancer. In the present study, TP53 mutations were identified by direct sequencing of the gene (exons 4-9) from 119 breast cancer tissues. The prevalence of TP53 mutations in Arab breast cancer patients living in the KSA is among the highest in the world (40%). Notably, 73% of the patients whose tumors harbored p53 mutations were less than 50 years of age. Furthermore, for the first time, we identified 7 novel mutations and 16 mutations in breast cancer tissues. Notably, all the novel point mutations were found in exon 4, wherein 29% of the mutations were localized. Furthermore, an excess of G:C→A:T transitions (49%) at non-CpG sites was noted, suggesting exposure to particular environmental carcinogens such as N-nitroso compounds. The results indicate that the TP53 gene plays a significant role in breast carcinogenesis and the early onset of the disease among Arab female individuals. PMID:22866089

  8. Molecular Characterization of TP53 Gene in Human Populations Exposed to Low-Dose Ionizing Radiation

    PubMed Central

    Brasil-Costa, Igor; Alencar, Dayse O.; Raiol-Moraes, Milene; Pessoa, Igor A.; Brito, Alexandre W. M.; Jati, Schneyder R.; Santos, Sidney E. B.; Burbano, Rommel M. R.; Ribeiro-dos-Santos, Ândrea K. C.

    2013-01-01

    Ionizing radiation, such as that emitted by uranium, may cause mutations and consequently lead to neoplasia in human cells. The TP53 gene acts to maintain genomic integrity and constitutes an important biomarker of susceptibility. The present study investigated the main alterations observed in exons 4, 5, 6, 7, and 8 of the TP53 gene and adjacent introns in Amazonian populations exposed to radioactivity. Samples were collected from 163 individuals. Occurrence of the following alterations was observed: (i) a missense exchange in exon 4 (Arg72Pro); (ii) 2 synonymous exchanges, 1 in exon 5 (His179His), and another in exon 6 (Arg213Arg); (iii) 4 intronic exchanges, 3 in intron 7 (C → T at position 13.436; C → T at position 13.491; T → G at position 13.511) and 1 in intron 8 (T → G at position 13.958). Alteration of codon 72 was found to be an important risk factor for cancer development (P = 0.024; OR = 6.48; CI: 1.29–32.64) when adjusted for age and smoking. Thus, TP53 gene may be an important biomarker for carcinogenesis susceptibility in human populations exposed to ionizing radiation. PMID:23586029

  9. A 3' splice site mutation in the thyroglobulin gene responsible for congenital goiter with hypothyroidism.

    PubMed

    Ieiri, T; Cochaux, P; Targovnik, H M; Suzuki, M; Shimoda, S; Perret, J; Vassart, G

    1991-12-01

    A case of congenital goiter with defective thyroglobulin synthesis has been studied in molecular terms. The patient is the fifth of a kindred of six, three of which have a goiter. The parents are first cousins. Segregation of thyroglobulin alleles in the family was studied by Southern blotting with a probe revealing a diallelic restriction fragment length polymorphism (RFLP). The results demonstrated that the three affected siblings were homozygous for the RFLP. Northern blotting analysis of the goiter RNA with a thyroglobulin probe suggested that thyroglobulin mRNA size was slightly reduced. Polymerase chain reaction amplification of the 8.5-kb thyroglobulin mRNA as overlapping cDNA fragments demonstrated that a 200-bp segment was missing from the 5' region of the goiter mRNA. Subcloning and sequencing of the cDNA fragments, and of the patient genomic DNA amplified from this region, revealed that exon 4 is missing from the major thyroglobulin transcript in the goiter, and that this aberrant splicing is due to a C to G transversion at position minus 3 in the acceptor splice site of intron 3. The presence in exon 4 of a putative donor tyrosine residue (Tyrosine nr 130) involved in thyroid hormone formation provides a coherent explanation to the hypothyroid status of the patient. PMID:1752952

  10. Oncogenic GNAQ and GNA11 Mutations in Uveal Melanoma in Chinese

    PubMed Central

    Xu, Xiaolin; Wei, Wen Bin; Li, Bin; Gao, Fei; Zhang, Zhibao; Jonas, Jost B.

    2014-01-01

    Purpose To examine whether GNAQ and GNA11 somatic mutations previously identified in uveal melanomas of Caucasians are associated with uveal melanomas in Chinese patients. Methods Uveal melanomas treated by primary enucleation in Chinese patients underwent a mutation analysis of GNAQ and GNA11 with sequencing of exon 5 and exon 4. Results The study included 50 patients with uveal melanoma and with a mean age of 47.6±13.0 years. During the follow-up of at least 3 years, 20 (40%) patients developed extraocular metastases. The frequencies of GNAQ and GNA11 somatic mutations in uveal melanoma were 18% (9/50) and 20% (10/50), respectively. The mutations occurred exclusively in codon 209 of exon 5. No mutations were detected in exon 4. Mutations affecting codon 209 in GNAQ were c.626A>C(Q209P) (78%) and c.626A>T(Q209L) (22%). Mutations affecting codon 209 in GNA11 were exclusively c.626A>T(Q209L) (100%). In none of the tumors, mutations of BRAF and NRAS were detected. GNAQ/11 mutations were marginally (P = 0.045) associated with optic disc involvement. In Kaplan-Meier analysis, metastasis-free survival was not significantly (P = 0.94) associated with GNAQ/11 mutations. Conclusions Mutations of GNAQ and GNA11 can be found in Chinese patients as in Caucasian patients with uveal melanoma, with a higher frequency reported for Caucasian patients. PMID:25280020

  11. Role of interleukin-15 receptor alpha polymorphisms in normal weight obese syndrome.

    PubMed

    Di Renzo, L; Gloria-Bottini, F; Saccucci, P; Bigioni, M; Abenavoli, L; Gasbarrini, G; De Lorenzo, A

    2009-01-01

    Previous published studies have identified a class of women, Normal Weight Obese women (NWO) with normal BMI and high fat content. An important role of Interleukin-15 (IL-15) has been documented in facilitating muscle proliferation and promoting fat depletion. Indeed the presence of three types of IL-15 receptor subunits in fat tissue suggests a direct effect on adipose tissue. We studied three single nucleotide polymorphisms (SNP) of IL-15R-alpha receptor gene and investigated their relationship with NWO phenotype. We considered two classes of women according to their BMI and percent fat mass (percent FAT), class 1: including 72 overweight-obese women (high BMI-high fat mass) and class 2: including 36 NWO (normal BMI, high fat mass). Three sites of Interleukin-15 receptor subunit á gene were examined, located respectively in exon4, exon5 intron-exon border and exon7. Genotyping of the identified polymorphisms was performed by restriction fragment length polymorphism. Haplotype frequency estimation was performed by using the Mendel-University of Chicago program. Odds ratio analyses were calculated by EPISTAT program. Highly significant differences were observed for exon 7- exon5 intron-exon border and exon 4-exon 7 haplotype distribution between class 1 and class 2 women. These results strongly support the hypothesis that genetic variability of the IL-15 receptor has an important role in body fat composition. Our data underscore previous findings that suggest a potential role of IL-15 cytokine in NWO syndrome. PMID:19309557

  12. Effect of Genetic Diversity in Swine Leukocyte Antigen-DRA Gene on Piglet Diarrhea.

    PubMed

    Huang, Xiaoyu; Yang, Qiaoli; Yuan, Junhu; Liu, Lixia; Sun, Wenyang; Jiang, Yingdi; Zhao, Shengguo; Zhang, Shengwei; Huang, Wangzhou; Gun, Shuangbao

    2016-01-01

    The swine leukocyte antigens (SLAs) are the multigene families related to immune responses. Little is known about the effect of the DRA gene on diarrheal disease. This study reported the genetic diversity of the DRA gene in exons 1, 3 and 4 in 290 Chinese Yantai black pigs. No variation was identified in exon 3. In exon 1, three genotypes and two alleles were identified, generated by two single nucleotide polymorphisms (SNPs). In exon 4, there were eight genotypes and five alleles containing seven SNPs were detected with four SNPs being novel SNPs. The low polymorphism found in swine DRA is consistent with the concept that the DRA gene is highly conserved among all mammalian species. Statistical analyses indicated that the genotypes of exon 1 were not significantly associated with piglet diarrhea (p > 0.05); however, genotypes C₄C₄ (1.80 ± 0.33) and A₄E₄ (1.66 ± 0.25) of exon 4 were significantly susceptible to diarrhea (p < 0.01). These indicate that the particular genotypes of the DRA gene are susceptible to diarrheal disease, which provides valuable information for disease-resistance breeding in swine. PMID:27429004

  13. De novo mutation causes steroid 21-hydroxylase deficiency in one family of HLA-identical affected and unaffected siblings

    SciTech Connect

    Tajima, Toshihiro Hokkaido Univ., Sapporo ); Fujieda, K. ); Fujii-Kuriyama, Yoshiaki )

    1993-07-01

    Over 90% of congenital adrenal hyperplasia (CAH) results from 21-hydroxylase deficiency. Because the CYP21B gene is located within the HLA complex and is very tightly linked to HLA markers, HLA typing is widely used for prenatal diagnosis and identifying heterozygous family members. In the course of a study on identification of heterozygous family members with HLA typing, the authors recognized an unusual family case in which three siblings share the same HLA haplotype, and only one of them had the simple virilizing form; her two siblings did not have any endocrinological abnormalities. They investigated the mode of genetic transmission by using polymerase chain reaction and single stranded conformation polymorphism. The present study revealed that the proband was a compound heterozygote with the intron 2 mutation that causes aberrant RNA splicing and the missense mutation of exon 4, while the other siblings and the father had only one allele of a missense mutation in exon 4; the mother is a normal homozygote. This result together with DNA fingerprint analysis strongly suggest that the intron 2 mutation occurred de novo in the maternally inherited gene of the proband. This seems to be the first case of a de novo mutation of the CYP21B gene that causes CAH. 19 refs., 5 figs., 1 tab.

  14. Cdk5rap2 regulates centrosome function and chromosome segregation in neuronal progenitors.

    PubMed

    Lizarraga, Sofia B; Margossian, Steven P; Harris, Marian H; Campagna, Dean R; Han, An-Ping; Blevins, Sherika; Mudbhary, Raksha; Barker, Jane E; Walsh, Christopher A; Fleming, Mark D

    2010-06-01

    Microcephaly affects approximately 1% of the population and is associated with mental retardation, motor defects and, in some cases, seizures. We analyzed the mechanisms underlying brain size determination in a mouse model of human microcephaly. The Hertwig's anemia (an) mutant shows peripheral blood cytopenias, spontaneous aneuploidy and a predisposition to hematopoietic tumors. We found that the an mutation is a genomic inversion of exon 4 of Cdk5rap2, resulting in an in-frame deletion of exon 4 from the mRNA. The finding that CDK5RAP2 human mutations cause microcephaly prompted further analysis of Cdk5rap2(an/an) mice and we demonstrated that these mice exhibit microcephaly comparable to that of the human disease, resulting from striking neurogenic defects that include proliferative and survival defects in neuronal progenitors. Cdk5rap2(an/an) neuronal precursors exit the cell cycle prematurely and many undergo apoptosis. These defects are associated with impaired mitotic progression coupled with abnormal mitotic spindle pole number and mitotic orientation. Our findings suggest that the reduction in brain size observed in humans with mutations in CDK5RAP2 is associated with impaired centrosomal function and with changes in mitotic spindle orientation during progenitor proliferation. PMID:20460369

  15. Aberrant splicing of androgenic receptor mRNA results in synthesis of a nonfunctional receptor protein in a patient with androgen insensitivity

    SciTech Connect

    Ris-Stalpers, C.; Kuiper, G.G.J.M.; Faber, P.W.; van Rooij, H.C.J.; Degenhart, H.J.; Trapman, J.; Brinkmann, A.O. ); Schweikert, H.U. ); Zegers, N.D. ); Hodgins, M.B. )

    1990-10-01

    Androgen insensitivity is a disorder in which the correct androgen response in an androgen target cell is impaired. The clinical symtpoms of this X chromosome-linked syndrome are presumed to be caused by mutations in the androgen receptor gene. The authors report a G {r arrow} T mutation in the splice donor site of intron 4 of the androgen receptor gene of a 46, XY subject lacking detectable androgen binding to the receptor and with the complete form of androgen insensitivity. This point mutation completely abolishes normal RNA splicing at the exon 4/intron 4 boundary and results in the activation of a cryptic splice donor site in exon 4, which leads to the deletion of 123 nucleotides from the mRNA. Translation of the mutant mRNA results in an androgen receptor protein {approx}5 kDa smaller than the wild type. This mutated androgen receptor protein was unable to bind androgens and unable to activate transcription of an androgen-regulated reporter gene construct. This mutation in the human androgen receptor gene demonstrates the importance of an intact steroid-binding domain for proper androgen receptor functioning in vivo.

  16. Effect of intron A from human cytomegalovirus (Towne) immediate-early gene on heterologous expression in mammalian cells.

    PubMed Central

    Chapman, B S; Thayer, R M; Vincent, K A; Haigwood, N L

    1991-01-01

    A 2.4 kb fragment of hCMV (Towne strain), containing the 5' end of the major immediate-early gene, has been cloned, sequenced, and used to construct a series of mammalian cell expression plasmids. The effects of regulatory regions present on this fragment were assessed using human glycoproteins as reporter molecules. We compared secreted levels of Factor VIII, t-PA, and HIV-1 envelope glycoproteins in cells transfected with plasmids in which intron A of the immediate-early gene was present or absent. Secretion of several glycoproteins was significantly higher when cells were transfected with intron A-containing plasmids. Mutation of three basepairs in the strong nuclear factor 1 (NF1) binding site in intron A led to reduced transient expression levels, but not to the level observed in the absence of intron A. Reduced expression from NF1 mutant plasmids was roughly correlated with reduced binding in vitro of NF1 proteins to a synthetic oligonucleotide containing the mutation. The evidence indicates that sequences in intron A positively regulate expression from the hCMV immediate-early enhancer/promoter in transformed monkey kidney cells. Images PMID:1650459

  17. New efficient artemisinin derived agents against human leukemia cells, human cytomegalovirus and Plasmodium falciparum: 2nd generation 1,2,4-trioxane-ferrocene hybrids.

    PubMed

    Reiter, Christoph; Fröhlich, Tony; Zeino, Maen; Marschall, Manfred; Bahsi, Hanife; Leidenberger, Maria; Friedrich, Oliver; Kappes, Barbara; Hampel, Frank; Efferth, Thomas; Tsogoeva, Svetlana B

    2015-06-01

    In our ongoing search for highly active hybrid molecules exceeding their parent compounds in anticancer, antimalaria as well as antiviral activity and being an alternative to the standard drugs, we present the synthesis and biological investigations of 2nd generation 1,2,4-trioxane-ferrocene hybrids. In vitro tests against the CCRF-CEM leukemia cell line revealed di-1,2,4-trioxane-ferrocene hybrid 7 as the most active compound (IC50 of 0.01 μM). Regarding the activity against the multidrug resistant subline CEM/ADR5000, 1,2,4-trioxane-ferrocene hybrid 5 showed a remarkable activity (IC50 of 0.53 μM). Contrary to the antimalaria activity of hybrids 4-8 against Plasmodium falciparum 3D7 strain with slightly higher IC50 values (between 7.2 and 30.2 nM) than that of their parent compound DHA, hybrids 5-7 possessed very promising activity (IC50 values lower than 0.5 μM) against human cytomegalovirus (HCMV). The application of 1,2,4-trioxane-ferrocene hybrids against HCMV is unprecedented and demonstrated here for the first time. PMID:25965779

  18. Nuclear body formation and PML body remodeling by the human cytomegalovirus protein UL35

    SciTech Connect

    Salsman, Jayme; Wang Xueqi; Frappier, Lori

    2011-06-05

    The human cytomegalovirus (HCMV) UL35 gene encodes two proteins, UL35 and UL35a. Expression of UL35 in transfected cells results in the formation of UL35 nuclear bodies that associate with promyelocytic leukemia (PML) protein. PML forms the basis for PML nuclear bodies that are important for suppressing viral lytic gene expression. Given the important relationship between PML and viral infection, we have further investigated the association of UL35 with PML bodies. We demonstrate that UL35 bodies form independently of PML and subsequently recruit PML, Sp100 and Daxx. In contrast, UL35a did not form bodies; however, it could bind UL35 and inhibit the formation of UL35 bodies. The HCMV tegument protein pp71 promoted the formation of UL35 bodies and the cytoplasmic localization of UL35a. Similarly, UL35a shifted pp71 to the cytoplasm. These results indicate that the interplay between UL35, UL35a and pp71 affects their subcellular localization and likely their functions throughout infection.

  19. High-Molecular-Weight Protein (pUL48) of Human Cytomegalovirus Is a Competent Deubiquitinating Protease: Mutant Viruses Altered in Its Active-Site Cysteine or Histidine Are Viable†

    PubMed Central

    Wang, Jianlei; Loveland, Amy N.; Kattenhorn, Lisa M.; Ploegh, Hidde L.; Gibson, Wade

    2006-01-01

    We show here that the high-molecular-weight protein (HMWP or pUL48; 253 kDa) of human cytomegalovirus (HCMV) is a functionally competent deubiquitinating protease (DUB). By using a suicide substrate probe specific for ubiquitin-binding cysteine proteases (DUB probe) to screen lysates of HCMV-infected cells, we found just one infected-cell-specific DUB. Characteristics of this protein, including its large size, expression at late times of infection, presence in extracellular virus particles, and reactivity with an antiserum to the HMWP, identified it as the HMWP. This was confirmed by constructing mutant viruses with substitutions in two of the putative active-site residues, Cys24Ile and His162Ala. HMWP with these mutations either failed to bind the DUB probe (C24I) or had significantly reduced reactivity with it (H162A). More compellingly, the deubiquitinating activity detected in wild-type virus particles was completely abolished in both the C24I and H162A mutants, thereby directly linking HMWP with deubiquitinating enzyme activity. Mutations in these active-site residues were not lethal to virus replication but slowed production of infectious virus relative to wild type and mutations of other conserved residues. Initial studies, by electron microscopy, of cells infected with the mutants revealed no obvious differences at late times of replication in the general appearance of the cells or in the distribution, relative numbers, or appearance of virus particles in the cytoplasm or nucleus. PMID:16731939

  20. Critical Role of CD2 Co-stimulation in Adaptive Natural Killer Cell Responses Revealed in NKG2C-Deficient Humans

    PubMed Central

    Liu, Lisa L.; Landskron, Johannes; Ask, Eivind H.; Enqvist, Monika; Sohlberg, Ebba; Traherne, James A.; Hammer, Quirin; Goodridge, Jodie P.; Larsson, Stella; Jayaraman, Jyothi; Oei, Vincent Y.S.; Schaffer, Marie; Taskén, Kjetil; Ljunggren, Hans-Gustaf; Romagnani, Chiara; Trowsdale, John; Malmberg, Karl-Johan; Béziat, Vivien

    2016-01-01

    Summary Infection by human cytomegalovirus (HCMV) leads to NKG2C-driven expansion of adaptive natural killer (NK) cells, contributing to host defense. However, approximately 4% of all humans carry a homozygous deletion of the gene that encodes NKG2C (NKG2C−/−). Assessment of NK cell repertoires in 60 NKG2C−/− donors revealed a broad range of NK cell populations displaying characteristic footprints of adaptive NK cells, including a terminally differentiated phenotype, functional reprogramming, and epigenetic remodeling of the interferon (IFN)-γ promoter. We found that both NKG2C− and NKG2C+ adaptive NK cells expressed high levels of CD2, which synergistically enhanced ERK and S6RP phosphorylation following CD16 ligation. Notably, CD2 co-stimulation was critical for the ability of adaptive NK cells to respond to antibody-coated target cells. These results reveal an unexpected redundancy in the human NK cell response to HCMV and suggest that CD2 provides “signal 2” in antibody-driven adaptive NK cell responses. PMID:27117418

  1. Constitutive ß-Catenin Signaling by the Viral Chemokine Receptor US28

    PubMed Central

    de Munnik, Sabrina; Schreiber, Andreas; Maussang, David; Vischer, Henry; Verkaar, Folkert; Leurs, Rob; Siderius, Marco; Smit, Martine J.

    2012-01-01

    Chronic activation of Wnt/ß-catenin signaling is found in a variety of human malignancies including melanoma, colorectal and hepatocellular carcinomas. Interestingly, expression of the HCMV-encoded chemokine receptor US28 in intestinal epithelial cells promotes intestinal neoplasia in transgenic mice, which is associated with increased nuclear accumulation of ß-catenin. In this study we show that this viral receptor constitutively activates ß-catenin and enhances ß-catenin-dependent transcription. Our data illustrate that this viral receptor does not activate ß-catenin via the classical Wnt/Frizzled signaling pathway. Analysis of US28 mediated signaling indicates the involvement of the Rho-Rho kinase (ROCK) pathway in the activation of ß-catenin. Moreover, cells infected with HCMV show significant increases in ß-catenin stabilization and signaling, which is mediated to a large extent by expression of US28. The modulation of the ß-catenin signal transduction pathway by a viral chemokine receptor provides alternative regulation of this pathway, with potential relevance for the development of colon cancer and virus-associated diseases. PMID:23145028

  2. In vitro activity evaluation of Parkia pendula seed lectin against human cytomegalovirus and herpes virus 6.

    PubMed

    Favacho, Alexsandra R M; Cintra, Elizabete A; Coelho, Luana C B B; Linhares, Maria Iêda S

    2007-06-01

    Human cytomegalovirus (HCMV) in vitro infectivity was inhibited by Parkia pendula seed lectin (PpeL) in contrast to human herpes virus 6 (HHV-6) which was not affected. The antiviral activity was detected for HCMV in human embryo lung (HEL) cells using a microtechnique in culture plates. The assay showed a reduction of cellular infectivity from approximately 95%, at a concentration of 150microg/mL with minimal cytotoxicity (25%). Also, a reduction of 75% was observed in HEL cells at a concentration of 75microg/mL without toxic effect. The reduction on infectivity was observed even after virus pre-adsorption to cells suggesting that this action should occur after virus penetration, in the intracellular replication phase. MT4 lymphocytes and cord blood mononuclear cells (CBMC) were used to evaluate the lectin effect on HHV-6 following the same technique. Lectin concentrations with few or no toxic effects on lymphocytes did not show inhibitory action of HHV-6 cytopathic effect. The results obtained with PpeL demonstrate that it may have an impact in the design of pharmacological strategies to infection of cytomegalovirus. PMID:17254798

  3. Natural Killer Cell Evasion Is Essential for Infection by Rhesus Cytomegalovirus.

    PubMed

    Sturgill, Elizabeth R; Malouli, Daniel; Hansen, Scott G; Burwitz, Benjamin J; Seo, Seongkyung; Schneider, Christine L; Womack, Jennie L; Verweij, Marieke C; Ventura, Abigail B; Bhusari, Amruta; Jeffries, Krystal M; Legasse, Alfred W; Axthelm, Michael K; Hudson, Amy W; Sacha, Jonah B; Picker, Louis J; Früh, Klaus

    2016-08-01

    The natural killer cell receptor NKG2D activates NK cells by engaging one of several ligands (NKG2DLs) belonging to either the MIC or ULBP families. Human cytomegalovirus (HCMV) UL16 and UL142 counteract this activation by retaining NKG2DLs and US18 and US20 act via lysomal degradation but the importance of NK cell evasion for infection is unknown. Since NKG2DLs are highly conserved in rhesus macaques, we characterized how NKG2DL interception by rhesus cytomegalovirus (RhCMV) impacts infection in vivo. Interestingly, RhCMV lacks homologs of UL16 and UL142 but instead employs Rh159, the homolog of UL148, to prevent NKG2DL surface expression. Rh159 resides in the endoplasmic reticulum and retains several NKG2DLs whereas UL148 does not interfere with NKG2DL expression. Deletion of Rh159 releases human and rhesus MIC proteins, but not ULBPs, from retention while increasing NK cell stimulation by infected cells. Importantly, RhCMV lacking Rh159 cannot infect CMV-naïve animals unless CD8+ cells, including NK cells, are depleted. However, infection can be rescued by replacing Rh159 with HCMV UL16 suggesting that Rh159 and UL16 perform similar functions in vivo. We therefore conclude that cytomegaloviral interference with NK cell activation is essential to establish but not to maintain chronic infection. PMID:27580123

  4. A cyclooxygenase-2 homologue encoded by rhesus cytomegalovirus is a determinant for endothelial cell tropism.

    PubMed

    Rue, Cary A; Jarvis, Michael A; Knoche, Amber J; Meyers, Heather L; DeFilippis, Victor R; Hansen, Scott G; Wagner, Markus; Früh, Klaus; Anders, David G; Wong, Scott W; Barry, Peter A; Nelson, Jay A

    2004-11-01

    Cyclooxygenase-2 (COX-2) is a cellular enzyme in the eicosanoid synthetic pathway that mediates the synthesis of prostaglandins from arachidonic acid. The eicosanoids function as critical regulators of a number of cellular processes, including the acute and chronic inflammatory response, hemostasis, and the innate immune response. Human cytomegalovirus (HCMV), which does not encode a viral COX-2 isoform, has been shown to induce cellular COX-2 expression. Importantly, although the precise role of COX-2 in CMV replication is unknown, COX-2 induction was shown to be critical for normal HCMV replication. In an earlier study, we identified an open reading frame (Rh10) within the rhesus cytomegalovirus (RhCMV) genome that encoded a putative protein (designated vCOX-2) with high homology to cellular COX-2. In the current study, we show that vCOX-2 is expressed with early-gene kinetics during RhCMV infection, resulting in production of a 70-kDa protein. Consistent with the expression of a viral COX-2 isoform, cellular COX-2 expression was not induced during RhCMV infection. Finally, analysis of growth of recombinant RhCMV with vCOX-2 deleted identified vCOX-2 as a critical determinant for replication in endothelial cells. PMID:15507640

  5. A Cyclooxygenase-2 Homologue Encoded by Rhesus Cytomegalovirus Is a Determinant for Endothelial Cell Tropism

    PubMed Central

    Rue, Cary A.; Jarvis, Michael A.; Knoche, Amber J.; Meyers, Heather L.; DeFilippis, Victor R.; Hansen, Scott G.; Wagner, Markus; Früh, Klaus; Anders, David G.; Wong, Scott W.; Barry, Peter A.; Nelson, Jay A.

    2004-01-01

    Cyclooxygenase-2 (COX-2) is a cellular enzyme in the eicosanoid synthetic pathway that mediates the synthesis of prostaglandins from arachidonic acid. The eicosanoids function as critical regulators of a number of cellular processes, including the acute and chronic inflammatory response, hemostasis, and the innate immune response. Human cytomegalovirus (HCMV), which does not encode a viral COX-2 isoform, has been shown to induce cellular COX-2 expression. Importantly, although the precise role of COX-2 in CMV replication is unknown, COX-2 induction was shown to be critical for normal HCMV replication. In an earlier study, we identified an open reading frame (Rh10) within the rhesus cytomegalovirus (RhCMV) genome that encoded a putative protein (designated vCOX-2) with high homology to cellular COX-2. In the current study, we show that vCOX-2 is expressed with early-gene kinetics during RhCMV infection, resulting in production of a 70-kDa protein. Consistent with the expression of a viral COX-2 isoform, cellular COX-2 expression was not induced during RhCMV infection. Finally, analysis of growth of recombinant RhCMV with vCOX-2 deleted identified vCOX-2 as a critical determinant for replication in endothelial cells. PMID:15507640

  6. On the relative roles of background selection and genetic hitchhiking in shaping human cytomegalovirus genetic diversity.

    PubMed

    Renzette, Nicholas; Kowalik, Timothy F; Jensen, Jeffrey D

    2016-01-01

    A central focus of population genetics has been examining the contribution of selective and neutral processes in shaping patterns of intraspecies diversity. In terms of selection specifically, surveys of higher organisms have shown considerable variation in the relative contributions of background selection and genetic hitchhiking in shaping the distribution of polymorphisms, although these analyses have rarely been extended to bacteria and viruses. Here, we study the evolution of a ubiquitous, viral pathogen, human cytomegalovirus (HCMV), by analysing the relationship among intraspecies diversity, interspecies divergence and rates of recombination. We show that there is a strong correlation between diversity and divergence, consistent with expectations of neutral evolution. However, after correcting for divergence, there remains a significant correlation between intraspecies diversity and recombination rates, with additional analyses suggesting that this correlation is largely due to the effects of background selection. In addition, a small number of loci, centred on long noncoding RNAs, also show evidence of selective sweeps. These data suggest that HCMV evolution is dominated by neutral mechanisms as well as background selection, expanding our understanding of linked selection to a novel class of organisms. PMID:26211679

  7. Structure of a herpesvirus nuclear egress complex subunit reveals an interaction groove that is essential for viral replication

    PubMed Central

    Leigh, Kendra E.; Sharma, Mayuri; Mansueto, My Sam; Boeszoermenyi, Andras; Filman, David J.; Hogle, James M.; Wagner, Gerhard; Coen, Donald M.; Arthanari, Haribabu

    2015-01-01

    Herpesviruses require a nuclear egress complex (NEC) for efficient transit of nucleocapsids from the nucleus to the cytoplasm. The NEC orchestrates multiple steps during herpesvirus nuclear egress, including disruption of nuclear lamina and particle budding through the inner nuclear membrane. In the important human pathogen human cytomegalovirus (HCMV), this complex consists of nuclear membrane protein UL50, and nucleoplasmic protein UL53, which is recruited to the nuclear membrane through its interaction with UL50. Here, we present an NMR-determined solution-state structure of the murine CMV homolog of UL50 (M50; residues 1–168) with a strikingly intricate protein fold that is matched by no other known protein folds in its entirety. Using NMR methods, we mapped the interaction of M50 with a highly conserved UL53-derived peptide, corresponding to a segment that is required for heterodimerization. The UL53 peptide binding site mapped onto an M50 surface groove, which harbors a large cavity. Point mutations of UL50 residues corresponding to surface residues in the characterized M50 heterodimerization interface substantially decreased UL50–UL53 binding in vitro, eliminated UL50–UL53 colocalization, prevented disruption of nuclear lamina, and halted productive virus replication in HCMV-infected cells. Our results provide detailed structural information on a key protein–protein interaction involved in nuclear egress and suggest that NEC subunit interactions can be an attractive drug target. PMID:26150520

  8. Molecular dissection of the human B cell response against cytomegalovirus infection by lambda display.

    PubMed

    Beghetto, Elisa; Paolis, Francesca De; Spadoni, Andrea; Del Porto, Paola; Buffolano, Wilma; Gargano, Nicola

    2008-07-01

    Human cytomegalovirus (HCMV), a ubiquitous herpesvirus, is the main cause of congenital abnormalities and mental retardation in newborns and is also responsible for severe life-threatening complications in immunocompromised individuals, including AIDS patients and transplant recipients. The disorders generated by cytomegalovirus are closely associated with the competence of the host immune system and both humoral and cell-mediated mechanisms are involved in the response to viral infection. To identify viral proteins recognized by host antibody responses, a cytomegalovirus genome library was created and displayed on lambda bacteriophage. The challenge of such a library with sera from individuals with congenital or acquired infection allowed the identification of a wide panel of recombinant bacteriophages carrying cytomegalovirus B cell epitopes. Epitope-containing fragments within the families of tegument proteins (pUL25, pUL32), structural proteins (pUL48, pUL56) and glycoproteins (pUL55) were identified. Moreover, library screening permitted isolation of phage clones carrying an antigenic region of an uncharacterized HCMV protein encoded by the UL71 open reading frame (ORF), highlighting the potential of lambda display technology in antigen and epitope discovery. PMID:18499273

  9. Activating KIRs and NKG2C in Viral Infections: Toward NK Cell Memory?

    PubMed Central

    Della Chiesa, Mariella; Sivori, Simona; Carlomagno, Simona; Moretta, Lorenzo; Moretta, Alessandro

    2015-01-01

    Natural killer (NK) cells are important players in the immune defense against viral infections. The contribution of activating killer immunoglobulin-like receptors (KIRs) and CD94/NKG2C in regulating anti-viral responses has recently emerged. Thus, in the hematopoietic stem cell transplantation setting, the presence of donor activating KIRs (aKIRs) may protect against viral infections, while in HIV-infected individuals, KIR3DS1, in combination with HLA-Bw4-I80, results in reduction of viral progression. Since, studies have been performed mainly at the genetic or transcriptional level, the effective size, the function, and the “licensing” status of NK cells expressing aKIRs, as well as the nature of their viral ligands, require further investigation. Certain viral infections, mainly due to Human cytomegalovirus (HCMV), can deeply influence the NK cell development and function by inducing a marked expansion of mature NKG2C+ NK cells expressing self-activating KIRs. This suggests that NKG2C and/or aKIRs are involved in the selective proliferation of this subset. The persistent, HCMV-induced, imprinting suggests that NK cells may display unexpected adaptive immune traits. The role of aKIRs and NKG2C in regulating NK cell responses and promoting a memory-like response to certain viruses is discussed. PMID:26617607

  10. The Cationic Cytokine IL-26 Differentially Modulates Virus Infection in Culture

    PubMed Central

    Braum, Oliver; Klages, Michael; Fickenscher, Helmut

    2013-01-01

    Interleukin-26 (IL-26) belongs to the IL-10 cytokine family, is produced by activated T cells, and targets epithelial target cells for signal transduction. Here, we describe the IL-26 effects on the infection of culture cells with recombinant vesicular stomatitis virus (VSV), human cytomegalovirus (HCMV), and herpes simplex virus type 1 (HSV-1) expressing green fluorescent protein. After pre-incubation with recombinant IL-26 and at low multiplicity of infection, VSV showed strongly enhanced infection and replication rates as measured for infectivity, for transcript levels, and for protein expression. Control proteins did not affect VSV infection. The IL-26 effect was independent of the IL-26 receptor and neutralized by anti-IL-26 serum. Pre-incubation of VSV was much more efficient than pre-incubation of the target cells to enhance virus infection. IL-26 increased virus adsorption to target cells as shown by quantitative reverse-transcription PCR. In contrast, the infection of IL-26-treated human fibroblasts with HCMV was inhibited and the infection by HSV-1 was not altered by IL-26. Thus, IL-26 differentially modulates the infection by different enveloped viruses. PMID:23875025

  11. Fragment-Based Protein-Protein Interaction Antagonists of a Viral Dimeric Protease.

    PubMed

    Gable, Jonathan E; Lee, Gregory M; Acker, Timothy M; Hulce, Kaitlin R; Gonzalez, Eric R; Schweigler, Patrick; Melkko, Samu; Farady, Christopher J; Craik, Charles S

    2016-04-19

    Fragment-based drug discovery has shown promise as an approach for challenging targets such as protein-protein interfaces. We developed and applied an activity-based fragment screen against dimeric Kaposi's sarcoma-associated herpesvirus protease (KSHV Pr) using an optimized fluorogenic substrate. Dose-response determination was performed as a confirmation screen, and NMR spectroscopy was used to map fragment inhibitor binding to KSHV Pr. Kinetic assays demonstrated that several initial hits also inhibit human cytomegalovirus protease (HCMV Pr). Binding of these hits to HCMV Pr was also confirmed by NMR spectroscopy. Despite the use of a target-agnostic fragment library, more than 80 % of confirmed hits disrupted dimerization and bound to a previously reported pocket at the dimer interface of KSHV Pr, not to the active site. One class of fragments, an aminothiazole scaffold, was further explored using commercially available analogues. These compounds demonstrated greater than 100-fold improvement of inhibition. This study illustrates the power of fragment-based screening for these challenging enzymatic targets and provides an example of the potential druggability of pockets at protein-protein interfaces. PMID:26822284

  12. Otosclerosis--do we have a viral aetiology?

    PubMed

    Singh, Mini Pritam; Ratho, Radha Kanta; Panda, Naresh; Mishra, Baijayantimala

    2005-12-01

    The etiology of otosclerosis remains an enigma though there are evidences suggesting a viral involvement. This study aimed to find out the relationship between viral infections and otosclerosis. Twenty two patients with otosclerosis and 10 healthy controls were included in the study. IgM antibodies to varicella zoster virus (VZV), measles, rubella, human cytomegalovirus (HCMV) and herpes simplex virus (HSV) were detected using micro ELISA. Paul Bunnel Davidsohn test was performed to rule out Ebstein Barr virus (EBV) infection. Overall, 5(22.7%) patients showed antibodies to one or more viruses. IgM antibodies against measles and VZV could be demonstrated in 4(18.1%) and 1(4.5%) patients respectively. None of the samples were found to be positive for HSV, HCMV, rubella and EBV antibodies. Controls were negative for all the viruses tested. The difference in seropositivity between the patient and control group was not statistically significant (p>0.05). Thus, this study suggests that otosclerosis is not commonly associated with a systemic viral infection. PMID:16519080

  13. Hsp90 inhibitor 17-DMAG decreases expression of conserved herpesvirus protein kinases and reduces virus production in Epstein-Barr virus-infected cells.

    PubMed

    Sun, Xiaoping; Bristol, Jillian A; Iwahori, Satoko; Hagemeier, Stacy R; Meng, Qiao; Barlow, Elizabeth A; Fingeroth, Joyce D; Tarakanova, Vera L; Kalejta, Robert F; Kenney, Shannon C

    2013-09-01

    All eight human herpesviruses have a conserved herpesvirus protein kinase (CHPK) that is important for the lytic phase of the viral life cycle. In this study, we show that heat shock protein 90 (Hsp90) interacts directly with each of the eight CHPKs, and we demonstrate that an Hsp90 inhibitor drug, 17-dimethylaminoethylamino-17-demethoxygeldanamycin (17-DMAG), decreases expression of all eight CHPKs in transfected HeLa cells. 17-DMAG also decreases expression the of the endogenous Epstein-Barr virus protein kinase (EBV PK, encoded by the BGLF4 gene) in lytically infected EBV-positive cells and inhibits phosphorylation of several different known EBV PK target proteins. Furthermore, 17-DMAG treatment abrogates expression of the human cytomegalovirus (HCMV) kinase UL97 in HCMV-infected human fibroblasts. Importantly, 17-DMAG treatment decreased the EBV titer approximately 100-fold in lytically infected AGS-Akata cells without causing significant cellular toxicity during the same time frame. Increased EBV PK expression in 17-DMAG-treated AGS-Akata cells did not restore EBV titers, suggesting that 17-DMAG simultaneously targets multiple viral and/or cellular proteins required for efficient viral replication. These results suggest that Hsp90 inhibitors, including 17-DMAG, may be a promising group of drugs that could have profound antiviral effects on herpesviruses. PMID:23843639

  14. Critical Role of CD2 Co-stimulation in Adaptive Natural Killer Cell Responses Revealed in NKG2C-Deficient Humans.

    PubMed

    Liu, Lisa L; Landskron, Johannes; Ask, Eivind H; Enqvist, Monika; Sohlberg, Ebba; Traherne, James A; Hammer, Quirin; Goodridge, Jodie P; Larsson, Stella; Jayaraman, Jyothi; Oei, Vincent Y S; Schaffer, Marie; Taskén, Kjetil; Ljunggren, Hans-Gustaf; Romagnani, Chiara; Trowsdale, John; Malmberg, Karl-Johan; Béziat, Vivien

    2016-05-01

    Infection by human cytomegalovirus (HCMV) leads to NKG2C-driven expansion of adaptive natural killer (NK) cells, contributing to host defense. However, approximately 4% of all humans carry a homozygous deletion of the gene that encodes NKG2C (NKG2C(-/-)). Assessment of NK cell repertoires in 60 NKG2C(-/-) donors revealed a broad range of NK cell populations displaying characteristic footprints of adaptive NK cells, including a terminally differentiated phenotype, functional reprogramming, and epigenetic remodeling of the interferon (IFN)-γ promoter. We found that both NKG2C(-) and NKG2C(+) adaptive NK cells expressed high levels of CD2, which synergistically enhanced ERK and S6RP phosphorylation following CD16 ligation. Notably, CD2 co-stimulation was critical for the ability of adaptive NK cells to respond to antibody-coated target cells. These results reveal an unexpected redundancy in the human NK cell response to HCMV and suggest that CD2 provides "signal 2" in antibody-driven adaptive NK cell responses. PMID:27117418

  15. Broad-spectrum antiviral activity of chebulagic acid and punicalagin against viruses that use glycosaminoglycans for entry

    PubMed Central

    2013-01-01

    Background We previously identified two hydrolyzable tannins, chebulagic acid (CHLA) and punicalagin (PUG) that blocked herpes simplex virus type 1 (HSV-1) entry and spread. These compounds inhibited viral glycoprotein interactions with cell surface glycosaminoglycans (GAGs). Based on this property, we evaluated their antiviral efficacy against several different viruses known to employ GAGs for host cell entry. Results Extensive analysis of the tannins’ mechanism of action was performed on a panel of viruses during the attachment and entry steps of infection. Virus-specific binding assays and the analysis of viral spread during treatment with these compounds were also conducted. CHLA and PUG were effective in abrogating infection by human cytomegalovirus (HCMV), hepatitis C virus (HCV), dengue virus (DENV), measles virus (MV), and respiratory syncytial virus (RSV), at μM concentrations and in dose-dependent manners without significant cytotoxicity. Moreover, the natural compounds inhibited viral attachment, penetration, and spread, to different degrees for each virus. Specifically, the tannins blocked all these steps of infection for HCMV, HCV, and MV, but had little effect on the post-fusion spread of DENV and RSV, which could suggest intriguing differences in the roles of GAG-interactions for these viruses. Conclusions CHLA and PUG may be of value as broad-spectrum antivirals for limiting emerging/recurring viruses known to engage host cell GAGs for entry. Further studies testing the efficacy of these tannins in vivo against certain viruses are justified. PMID:23924316

  16. Association between Herpesviruses and Chronic Periodontitis: A Meta-Analysis Based on Case-Control Studies

    PubMed Central

    Wong, May. Chun. Mei; Feng, Xi-Ping; Lu, Hai-Xia; Xu, Wei

    2015-01-01

    Objective Numerous studies have investigated the associations between herpesviruses and chronic periodontitis; however, the results remain controversial. To derive a more precise estimation, a meta-analysis on all available studies was performed to identify the association between herpesviruses and chronic periodontitis. Methods A computerized literature search was conducted in December 2014 to identify eligible case-control studies from the PUBMED and EMBASE databases according to inclusion and exclusion criteria. Data were extracted and pooled odds ratios (OR) with 95% confidence intervals (CI) were used to assess the association between herpesviruses and risk of chronic periodontitis. A fixed or random effects model was determined based on a heterogeneity test. Sensitivity analysis was conducted to investigate stability and reliability. Publication bias was investigated using the Begg rank correlation test and Egger's funnel plot. Results Ten eligible studies were included to investigate the association between Epstein–Barr virus (EBV) and chronic periodontitis. The results showed that EBV has a significant association with chronic periodontitis compared with periodontally healthy group (OR = 5.74, 95% CI = 2.53–13.00, P<0.001). The association between human cytomegalovirus (HCMV) and chronic periodontitis was analyzed in 10 studies. The pooled result showed that HCMV also has a significant association with chronic periodontitis (OR = 3.59, 95% CI = 1.41–9.16, P = 0.007). Similar results were found in the sensitivity analyses. No significant publication bias was observed. Two eligible studies were included to investigate the association between herpes simplex virus (HSV) and chronic periodontitis risk. The association between HSV and chronic periodontitis was inconclusive (OR = 2.81 95% CI = 0.95–8.27, P = 0.06). Only one included study investigated the association between human herpesvirus 7 (HHV-7) and chronic periodontitis risk (OR = 1.00, 95% CI = 0

  17. Synthesis and antiviral activity of certain 4-substituted and 2,4-disubstituted 7-[(2-hydroxyethoxy)methyl]pyrrolo[2,3-d]pyrimidines.

    PubMed

    Saxena, N K; Hagenow, B M; Genzlinger, G; Turk, S R; Drach, J C; Townsend, L B

    1988-08-01

    Treatment of the sodium salt of 4-chloro-2-(methylthio)pyrrolo[2,3-d]pyrimidine (2) with (2-acetoxyethoxy)methyl bromide (3) has provided 4-chloro-2-(methylthio)-7[(2-acetoxyethoxy)methyl]pyrrolo[2,3- d]pyrimidine (4). Ammonolysis of 4 at room temperature gave 4-chloro-2-(methylthio)-7-[(2-hydroxyethoxy)methyl]pyrrolo[2,3- d]pyrimidine (5). However, ammonolysis of 5 at 130 degrees C furnished 4-amino-2-(methylthio)-7-[(2-hydroxyethoxy)methyl]-pyrrolo[2,3- d]pyrimidine (6), which on desulfurization with Raney Ni yielded 4-amino-7-[(2-hydroxyethoxy)-methyl]pyrrolo[2,3-d]pyrimidine (7) (acyclic analogue of tubercidin). The oxidation of 6 with m-chloroperbenzoic acid provided the sulfone derivative 8. A nucleophilic displacement of the 2-methylsulfonyl group from 8 with methoxide anion provided 4-amino-2-methoxy-7-[(2-hydroxyethoxy)methyl]pyrrolo[2,3-d]pyrimidine (9). Demethylation of 9 with iodotrimethylsilane gave 4-amino-2-hydroxy-7-[(2-hydroxyethoxy)methyl]pyrrolo[2,3-d]pyrimidine (10). Treatment of 2,4-dichloropyrrolo[2,3-d]pyrimidine (11) with 3 gave the protected acyclic compound 12, which on deacetylation and ammonolysis under controlled reaction conditions gave 2,4-dichloro-7-[(2-hydroxyethoxy)-methyl]pyrrolo[2,3-d]pyrimidine (13) and 4-amino-2-chloro-7-[(2-hydroxyethoxy)methyl]pyrrolo[2,3- d]pyrimidine (14), respectively. The condensation of 2-acetamido-4-chloropyrrolo[2,3-d]pyrimidine (15) with 3 gave the protected acyclic compound 16, which on concomitant deacetylation and ammonolysis with methanolic ammonia at an elevated temperature yielded 2,4-diamino-7-[(2-hydroxyethoxy)methyl]pyrrolo[2,3-d]pyrimidine (17) in moderate yield. In tests involving human cytomegalovirus (HCMV) and herpes simplex virus type 1 (HSV-1), only slight activity and cytotoxicity were observed. The most active compounds (12 and 13) were slightly more active against HCMV than acyclovir, but both compounds were inactive against HSV-1. The activity against HCMV, however, was not well

  18. Functional interaction between the human cytomegalovirus 86-kilodalton IE2 protein and the cellular transcription factor CREB.

    PubMed Central

    Lang, D; Gebert, S; Arlt, H; Stamminger, T

    1995-01-01

    The 86-kDa IE2 protein (IE86) of human cytomegalovirus (HCMV) has been described as a promiscuous transactivator of viral, as well as cellular, gene expression. Investigation of the mechanism used by IE86 to activate gene expression from the early UL112/113 promoter of HCMV revealed the existence of three binding sites for IE86 located between nucleotides -290 and -120 relative to the transcriptional start site (H. Arlt, D. Lang, S. Gebert, and T. Stamminger, J. Virol. 68:4117-4125, 1994). As shown previously, deletion of these target sites resulted in a reduction of IE86-mediated transactivation by approximately 70%. The remaining promoter, however, could still be stimulated about 40-fold, indicating the presence of an additional responsive element within these sequences. Here, we provide evidence that a binding site for the cellular transcription factor CREB can also act as a target for IE86 transactivation. By DNase I protection analysis, a binding sequence for CREB could be detected between nucleotides -78 and -56 within the respective promoter region. After in vitro mutagenesis of this CREB-binding site within the context of the entire UL112/113 promoter, a marked reduction in transactivation levels was evident. Moreover, when individual CREB-binding sites were positioned upstream of a minimal, TATA box-containing UL112/113 promoter, they were able to confer strong IE86 responsiveness, whereas a mutated sequence did not exert any effect. In far Western blot and pull-down experiments, a direct interaction of IE86 with the cellular transcription factor CREB could be observed. The in vivo relevance of this in vitro interaction was confirmed by using various GAL4 fusion proteins in the presence or absence of IE86 which revealed a strong activation only in the presence of both a GAL4-CREB fusion and IE86. This shows that at least one specific member of the ATF/CREB family of transcription factors is involved in mediating transactivation by the HCMV IE86 protein

  19. Dynamic and Nucleolin-Dependent Localization of Human Cytomegalovirus UL84 to the Periphery of Viral Replication Compartments and Nucleoli

    PubMed Central

    Bender, Brian J.

    2014-01-01

    ABSTRACT Protein-protein and protein-nucleic acid interactions within subcellular compartments are required for viral genome replication. To understand the localization of the human cytomegalovirus viral replication factor UL84 relative to other proteins involved in viral DNA synthesis and to replicating viral DNA in infected cells, we created a recombinant virus expressing a FLAG-tagged version of UL84 (UL84FLAG) and used this virus in immunofluorescence assays. UL84FLAG localization differed at early and late times of infection, transitioning from diffuse distribution throughout the nucleus to exclusion from the interior of replication compartments, with some concentration at the periphery of replication compartments with newly labeled DNA and the viral DNA polymerase subunit UL44. Early in infection, UL84FLAG colocalized with the viral single-stranded DNA binding protein UL57, but colocalization became less prominent as infection progressed. A portion of UL84FLAG also colocalized with the host nucleolar protein nucleolin at the peripheries of both replication compartments and nucleoli. Small interfering RNA (siRNA)-mediated knockdown of nucleolin resulted in a dramatic elimination of UL84FLAG from replication compartments and other parts of the nucleus and its accumulation in the cytoplasm. Reciprocal coimmunoprecipitation of viral proteins from infected cell lysates revealed association of UL84, UL44, and nucleolin. These results indicate that UL84 localization during infection is dynamic, which is likely relevant to its functions, and suggest that its nuclear and subnuclear localization is highly dependent on direct or indirect interactions with nucleolin. IMPORTANCE The protein-protein interactions among viral and cellular proteins required for replication of the human cytomegalovirus (HCMV) DNA genome are poorly understood. We sought to understand how an enigmatic HCMV protein critical for virus replication, UL84, localizes relative to other viral and

  20. Effective suppression of class I major histocompatibility complex expression by the US11 or ICP47 genes can be limited by cell type or interferon-gamma exposure.

    PubMed

    Radosevich, Thomas J; Seregina, Tatiana; Link, Charles J

    2003-12-10

    An impediment encountered in many viral-based gene therapy clinical trials has been the rapid destruction of the transgene by the host's immune response. The processing and presentation of antigens through the class I major histocompatibility complex (MHC) pathway is the initial specific response to viral infection. Disruption of the class I MHC pathway by herpes simplex virus (HSV) or the human cytomegalovirus (HCMV) results in a decrease of the CD8(+) cytotoxic T lymphocyte (CTL) response and prolongs survival of infected cells in the host. Two viral immune suppression genes that interfere with the class I MHC presentation pathway, the HSV type I ICP47 gene and HCMV US11 gene, were cloned and each incorporated into a retroviral vector. HSV ICP47 and HCMV US11 transgenes were expressed in multiple cells lines and compared for their abilities to reduce antigen presentation on the cell surface by class I MHC. Retroviral supernatants were used to transduce human, canine, and rat cell lines. Fluorescence-activated cell sorter (FACS) analysis of US11- and ICP47-transduced cell lines demonstrated substantial reductions in class I MHC cell surface expression in most cell lines except in rodent cells where ICP47 is nonfunctional. The decrease in the level of class I MHC expression for ICP47 transduced cell lines ranged from 31-98% relative to negative controls. US11 decreased class I cell surface MHC by 67-96%. When both ICP47 and US11 are expressed in human cells, a further reduction of class I MHC was observed. Next, human A375 melanoma cells were tested to determine if the resulting reduction in cell surface class I MHC would reduce in vitro cytotoxicity by CTL. A375 cells expressing either ICP47 or US11 demonstrated a twofold to threefold reduction of specific lysis by primed CD8(+) CTL. These data clearly establish an ability to convey immune protection to human cells by viral genes. However, further analysis demonstrated that interferon (IFN)-gamma could reverse

  1. Cytomegalovirus pp65 limits dissemination but is dispensable for persistence

    SciTech Connect

    Malouli, Daniel; Hansen, Scott G.; Nakayasu, Ernesto S.; Marshall, Emily E.; Hughes, Colette M.; Ventura, Abigail B.; Gilbride, Roxanne M.; Lewis, Matthew S.; Xu, Guangwu; Kreklywich, Craig; Whizin, Nathan; Fischer, Miranda; Legasse, Alfred W.; Viswanathan, Kasinath; Siess, Don; Camp, David G.; Axthelm, Michael K.; Kahl, Christoph; DeFilippis, Victor R.; Smith, Richard D.; Streblow, Daniel N.; Picker, Louis J.; Früh, Klaus

    2014-04-01

    The tegument phosphoprotein pp65 (UL83) is the most abundant virion protein in human cytomegalovirus (HCMV). Since pp65 is immunodominant in persistently infected individuals, subunit vaccines against HCMV often include pp65 as T cell stimulatory component. Although HCMV pp65 is non-essential for viral growth in vitro it is thought to have an important role in primary and persistent infection since pp65 displays multiple immunomodulatory functions. To determine whether pp65 is required for infection and to evaluate its role in natural and vaccination-induced immunity we generated a rhesus CMV lacking both homologues, pp65a (Rh111) and pp65b (Rh112). Lack of pp65 resulted in a slight growth defect in vitro and an increase of defective particle formation. However, most pp65-deleted virions in the supernatant were phenotypically normal and proteomics analysis revealed that the ratios of the remaining viral proteins were largely unchanged. RhCMV Δpp65ab was able to persistently infect CMV-negative rhesus macaques (RM) and to super-infect RM previously infected with CMV. To determine whether T cells against pp65 are essential for protection against CMV, we challenged Δpp65ab-infected animals with RhCMV ΔUS2-11, a viral recombinant that lacks inhibitors of MHC-I antigen presentation and is thus unable to overcome CMV-specific T cell immunity. Despite a complete lack of pp65-specific T cells, Δpp65ab protected against ΔUS2-11 challenge suggesting that pp65-specific T cells are not essential for T cell immunity against CMV. Using the same approach we further demonstrate that pp65b-specific T cells, induced by heterologous prime/boost vaccination, are not sufficient to protect against ΔUS2-11 challenge. Our data provides a new approach to test the efficacy of subunit vaccine candidates and suggest that pp65 vaccines are insufficient to induce a T cell response that recapitulates the protective effect of natural infection.

  2. Infection of a Single Cell Line with Distinct Strains of Human Cytomegalovirus Can Result in Large Variations in Virion Production and Facilitate Efficient Screening of Virus Protein Function

    PubMed Central

    Zavala, Anamaria G.; O'Dowd, John M.

    2015-01-01

    ABSTRACT Previously, we reported that the absence of the ataxia telangiectasia mutated (ATM) kinase, a critical DNA damage response (DDR) signaling component for double-strand breaks, caused no change in HCMV Towne virion production. Later, others reported decreased AD169 viral titers in the absence of ATM. To address this discrepancy, human foreskin fibroblasts (HFF) and three ATM− lines (GM02530, GM05823, and GM03395) were infected with both Towne and AD169. Two additional ATM− lines (GM02052 and GM03487) were infected with Towne. Remarkably, both previous studies' results were confirmed. However, the increased number of cell lines and infections with both lab-adapted strains confirmed that ATM was not necessary to produce wild-type-level titers in fibroblasts. Instead, interactions between individual virus strains and the cellular microenvironment of the individual ATM− line determined efficiency of virion production. Surprisingly, these two commonly used lab-adapted strains produced drastically different titers in one ATM− cell line, GM05823. The differences in titer suggested a rapid method for identifying genes involved in differential virion production. In silico comparison of the Towne and AD169 genomes determined a list of 28 probable candidates responsible for the difference. Using serial iterations of an experiment involving virion entry and input genome nuclear trafficking with a panel of related strains, we reduced this list to four (UL129, UL145, UL147, and UL148). As a proof of principle, reintroduction of UL148 largely rescued genome trafficking. Therefore, use of a battery of related strains offers an efficient method to narrow lists of candidate genes affecting various virus life cycle checkpoints. IMPORTANCE Human cytomegalovirus (HCMV) infection of multiple cell lines lacking ataxia telangiectasia mutated (ATM) protein produced wild-type levels of infectious virus. Interactions between virus strains and the microenvironment of individual

  3. Characterization of the betaherpesviral pUL69 protein family reveals binding of the cellular mRNA export factor UAP56 as a prerequisite for stimulation of nuclear mRNA export and for efficient viral replication.

    PubMed

    Zielke, Barbara; Thomas, Marco; Giede-Jeppe, Antje; Müller, Regina; Stamminger, Thomas

    2011-02-01

    UL69 of human cytomegalovirus (HCMV) encodes a pleiotropic transactivator protein and has a counterpart in every member of the Herpesviridae family thus far sequenced. However, little is known about the conservation of the functions of the nuclear phosphoprotein pUL69 in the homologous proteins of other betaherpesviruses. Therefore, eukaryotic expression vectors were constructed for pC69 of chimpanzee cytomegalovirus, pRh69 of rhesus cytomegalovirus, pM69 of murine cytomegalovirus, pU42 of human herpesvirus 6, and pU42 of elephant endotheliotropic herpesvirus. Indirect immunofluorescence experiments showed that all pUL69 homologs expressed by these vectors were localized to the cell nucleus. Coimmunoprecipitation experiments identified homodimerization as a conserved feature of all homologs, whereas heterodimerization with pUL69 was restricted to its closer relatives. Further analyses demonstrated that pC69 and pRh69 were the only two homologs that functioned, like pUL69, as viral-mRNA export factors. As we had reported recently that nucleocytoplasmic shuttling and interaction with the cellular DExD/H-box helicases UAP56 and URH49 were prerequisites for the nuclear-mRNA export activity of pUL69, the homologs were characterized with regard to these properties. Heterokaryon assays demonstrated nucleocytoplasmic shuttling for all homologs, and coimmunoprecipitation and mRNA export assays revealed that the interaction of UAP56 and/or URH49 with pC69 or pRh69 was required for mRNA export activity. Moreover, characterization of HCMV recombinants harboring mutations within the N-terminal sequence of pUL69 revealed a strong replication defect of viruses expressing pUL69 variants that were deficient in UAP56 binding. In summary, homodimerization and nucleocytoplasmic shuttling activity were identified as conserved features of betaherpesviral pUL69 homologs. UAP56 binding was shown to represent a unique characteristic of members of the genus Cytomegalovirus that is required

  4. A “Coiled-Coil” Motif Is Important for Oligomerization and DNA Binding Properties of Human Cytomegalovirus Protein UL77

    PubMed Central

    Dittmer, Alexandra; Lapp, Sara; Bogner, Elke

    2011-01-01

    Human cytomegalovirus (HCMV) UL77 gene encodes the essential protein UL77, its function is characterized in the present study. Immunoprecipitation identified monomeric and oligomeric pUL77 in HCMV infected cells. Immunostaining of purified virions and subviral fractions showed that pUL77 is a structural protein associated with capsids. In silico analysis revealed the presence of a coiled-coil motif (CCM) at the N-terminus of pUL77. Chemical cross-linking of either wild-type pUL77 or CCM deletion mutant (pUL77ΔCCM) implicated that CCM is critical for oligomerization of pUL77. Furthermore, co-immunoprecipitations of infected and transfected cells demonstrated that pUL77 interacts with the capsid-associated DNA packaging motor components, pUL56 and pUL104, as well as the major capsid protein. The ability of pUL77 to bind dsDNA was shown by an in vitro assay. Binding to certain DNA was further confirmed by an assay using biotinylated 36-, 250-, 500-, 1000-meric dsDNA and 966-meric HCMV-specific dsDNA designed for this study. The binding efficiency (BE) was determined by image processing program defining values above 1.0 as positive. While the BE of the pUL56 binding to the 36-mer bio-pac1 containing a packaging signal was 10.0±0.63, the one for pUL77 was only 0.2±0.03. In contrast to this observation the BE of pUL77 binding to bio-500 bp or bio-1000 bp was 2.2±0.41 and 4.9±0.71, respectively. By using pUL77ΔCCM it was demonstrated that this protein could not bind to dsDNA. These data indicated that pUL77 (i) could form homodimers, (ii) CCM of pUL77 is crucial for oligomerization and (iii) could bind to dsDNA in a sequence independent manner. PMID:21998635

  5. Dynamic and nucleolin-dependent localization of human cytomegalovirus UL84 to the periphery of viral replication compartments and nucleoli.

    PubMed

    Bender, Brian J; Coen, Donald M; Strang, Blair L

    2014-10-01

    Protein-protein and protein-nucleic acid interactions within subcellular compartments are required for viral genome replication. To understand the localization of the human cytomegalovirus viral replication factor UL84 relative to other proteins involved in viral DNA synthesis and to replicating viral DNA in infected cells, we created a recombinant virus expressing a FLAG-tagged version of UL84 (UL84FLAG) and used this virus in immunofluorescence assays. UL84FLAG localization differed at early and late times of infection, transitioning from diffuse distribution throughout the nucleus to exclusion from the interior of replication compartments, with some concentration at the periphery of replication compartments with newly labeled DNA and the viral DNA polymerase subunit UL44. Early in infection, UL84FLAG colocalized with the viral single-stranded DNA binding protein UL57, but colocalization became less prominent as infection progressed. A portion of UL84FLAG also colocalized with the host nucleolar protein nucleolin at the peripheries of both replication compartments and nucleoli. Small interfering RNA (siRNA)-mediated knockdown of nucleolin resulted in a dramatic elimination of UL84FLAG from replication compartments and other parts of the nucleus and its accumulation in the cytoplasm. Reciprocal coimmunoprecipitation of viral proteins from infected cell lysates revealed association of UL84, UL44, and nucleolin. These results indicate that UL84 localization during infection is dynamic, which is likely relevant to its functions, and suggest that its nuclear and subnuclear localization is highly dependent on direct or indirect interactions with nucleolin. Importance: The protein-protein interactions among viral and cellular proteins required for replication of the human cytomegalovirus (HCMV) DNA genome are poorly understood. We sought to understand how an enigmatic HCMV protein critical for virus replication, UL84, localizes relative to other viral and cellular

  6. Blast vulnerability detected in novel blast-resistant germplasm.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Previous research in artificially inoculated greenhouse tests and field nurseries identified new rice germplasm accession as being resistant to the common blast (Pyricularia grisea) races found in Arkansas (IB-1, IB-49, IC-17, IE-1, IE-1k, IG-1, and IH-1) and eliminated those accessions with major b...

  7. Divergent Metabolic Phenotype between Two Sisters with Congenital Generalized Lipodystrophy Due to Double AGPAT2 Homozygous Mutations. A Clinical, Genetic and In Silico Study

    PubMed Central

    Cortés, Víctor A.; Smalley, Susan V.; Goldenberg, Denisse; Lagos, Carlos F.; Hodgson, María I.; Santos, José L.

    2014-01-01

    Congenital generalized lipodystrophy (CGL) is a rare autosomal recessive disorder characterized by extreme reduction of white adipose tissue (WAT) mass. CGL type 1 is the most frequent form and is caused by mutations in AGPAT2. Genetic and clinical studies were performed in two affected sisters of a Chilean family. These patients have notoriously dissimilar metabolic abnormalities that correlate with differential levels of circulating leptin and soluble leptin receptor fraction. Sequencing of AGPAT2 exons and exon-intron boundaries revealed two homozygous mutations in both sisters. Missense mutation c.299G>A changes a conserved serine in the acyltransferase NHX4D motif of AGPAT2 (p.Ser100Asn). Intronic c.493-1G>C mutation destroy a conserved splicing site that likely leads to exon 4 skipping and deletion of whole AGPAT2 substrate binding domain. In silico protein modeling provided insights of the mechanisms of lack of catalytic activity owing to both mutations. PMID:24498038

  8. A mutation in canine CLN5 causes neuronal ceroid lipofuscinosis in Border collie dogs.

    PubMed

    Melville, Scott A; Wilson, Carmen L; Chiang, Chiu S; Studdert, Virginia P; Lingaas, Frode; Wilton, Alan N

    2005-09-01

    Neuronal ceroid lipofuscinosis (NCL) is a neurodegenerative disease found in Border collie dogs, humans, and other animals. Disease gene studies in humans and animals provided candidates for the NCL gene in Border collies. A combination of linkage analysis and comparative genomics localized the gene to CFA22 in an area syntenic to HSA13q that contains the CLN5 gene responsible for the Finnish variant of human late infantile NCL. Sequencing of CLN5 revealed a nonsense mutation (Q206X) within exon 4 that correlated with NCL in Border collies. This truncation mutation should result in a protein product of a size similar to that of some mutations identified in human CLN5 and therefore the Border collie may make a good model for human NCL. A simple test was developed to enable screening of the Border collie population for carriers so the disease can be eliminated as a problem in the breed. PMID:16033706

  9. Two novel mutations in PEO1 (Twinkle) gene associated with chronic external ophthalmoplegia☆

    PubMed Central

    Ronchi, Dario; Fassone, Elisa; Bordoni, Andreina; Sciacco, Monica; Lucchini, Valeria; Di Fonzo, Alessio; Rizzuti, Mafalda; Colombo, Irene; Napoli, Laura; Ciscato, Patrizia; Moggio, Maurizio; Cosi, Alessandra; Collotta, Martina; Corti, Stefania; Bresolin, Nereo; Comi, Giacomo P.

    2011-01-01

    Maintenance and replication of mitochondrial DNA require the concerted action of several factors encoded by nuclear genome. The mitochondrial helicase Twinkle is a key player of replisome machinery. Heterozygous mutations in its coding gene, PEO1, are associated with progressive external ophthalmoplegia (PEO) characterised by ptosis and ophthalmoparesis, with cytochrome c oxidase (COX)-deficient fibres, ragged-red fibres (RRF) and multiple mtDNA deletions in muscle. Here we describe clinical, histological and molecular features of two patients presenting with mitochondrial myopathy associated with PEO. PEO1 sequencing disclosed two novel mutations in exons 1 and 4 of the gene, respectively. Although mutations in PEO1 exon 1 have already been described, this is the first report of mutation occurring in exon 4. PMID:21689831

  10. Identification of novel splicing variants from RON proto-oncogene pre-mRNA.

    PubMed

    Moon, Heegyum; Cho, Sunghee; Yang, Xiaoming; Zhou, Jianhua; Loh, Tiing Jen; Zheng, Xuexiu; Shen, Haihong

    2012-12-01

    RON is a proto-oncogene that induces cell dissociation, migration and matrix invasion. RON∆160, a splicing variant of RON, is a natural splicing product in colon cancers that is produced through skipping of exons 5 and 6 in alternative splicing process. RON∆160 promotes cellular transformation in vitro and tumor formation in vivo. We present, here, two novel splicing variants of RON in the partial splicing events that involve exons 5 and 6. The common facts of these two novel splicing variants are that exons 4-7 are included. In addition, intron 4 is spliced whereas intron 5 is included in both variants. The difference of these two isoforms is the inclusion or skipping of intron 6. In one variant intron 6 is included, but intron 6 is skipped in another variant. These two variants should be truncated but these proteins have not yet been detected. PMID:22993024

  11. Neuroferritinopathy: From ferritin structure modification to pathogenetic mechanism

    PubMed Central

    Levi, Sonia; Rovida, Ermanna

    2015-01-01

    Neuroferritinopathy is a rare, late-onset, dominantly inherited movement disorder caused by mutations in L-ferritin gene. It is characterized by iron and ferritin aggregate accumulation in brain, normal or low serum ferritin levels and high variable clinical feature. To date, nine causative mutations have been identified and eight of them are frameshift mutations determined by nucleotide(s) insertion in the exon 4 of L-ferritin gene altering the structural conformation of the C-terminus of the L-ferritin subunit. Acting in a dominant negative manner, mutations are responsible for an impairment of the iron storage efficiency of ferritin molecule. Here, we review the main characteristics of neuroferritinopathy and present a computational analysis of some representative recently defined mutations with the purpose to gain new information about the pathogenetic mechanism of the disorder. This is particularly important as neuroferritinopathy can be considered an interesting model to study the relationship between iron, oxidative stress and neurodegeneration. PMID:25772441

  12. A nonsense mutation in the LDL receptor gene leads to familial hypercholesterolemia in the Druze sect

    SciTech Connect

    Landsberger, D.; Meiner, V.; Reshef, A.; Leitersdorf, E. ); Levy, Yishai ); Westhytzen, D.R. van der; Coetzee, G.A. )

    1992-02-01

    Familial hypercholesterolemia (FH) is an autosomal dominant disease caused by mutations in the LDL receptor gene. Here the authors characterize and LDL receptor mutation that is associated with a distinct haplotype and causes FH in the Druze, a small Middle Eastern Islamic sect with a high degree of inbreeding. The mutation was found in FH families from two distinct Druze villages from the Golan Heights (northern Israel). It was not found either in another Druze FH family residing in a different geographical area nor in eight Arab and four Jewish FH heterozygote index cases whose hypercholesterolemia cosegregates with an identical LDL receptor gene haplotype. The mutation, a single-base substitution, results in a termination codon in exon 4 of the LDL receptor gene that encodes for the fourth repeat of the binding domain of the mature receptor. It can be diagnosed by allele-specific oligonucleotide hybridization of PCR-amplified DNA from FH patients.

  13. FH Tulsa-1 and -2: Two unique alleles for familial hypercholesterolemia presenting in an affected two-year-old African-American male

    SciTech Connect

    Blackett, P.R.; Altmiller, D.H.; Jelley, D.; Wilson, D.P.

    1995-11-20

    A two-year-old African American boy presented with cutaneous xanthomata and extreme hypercholesterolemia. Subsequent studies revealed that the LDL-cholesterol was 1,001 mg/dl and apoB 507 mg/dl. LDL-receptor activity was almost undetectable, which is compatible with the finding of two newly described defective alleles on exon 4 of the LDL-receptor gene coding for part of the ligand-binding domain. One allele contained a 21 base-pair insertion from codon 200 to 207 whereas the other had a point mutation at codon 207. The rarity of genes for FH reported in individuals of African ancestry is discussed. 16 refs., 2 figs., 2 tabs.

  14. Haplotype analysis of beta-actin gene for its association with sperm quality and boar fertility.

    PubMed

    Lin, C-L; Jennen, D G J; Ponsuksili, S; Tholen, E; Tesfaye, D; Schellander, K; Wimmers, K

    2006-12-01

    beta-actin (ACTB) was examined as a direct functional candidate gene for the possible association with sperm concentration, motility (MOT), semen volume per ejaculate, plasma droplet rate, abnormal sperm rate (ASR) and the fertility traits, non-return rate and number of piglets born alive (NBA). Three polymorphisms in intron 3 (T>C) and one polymorphism in exon 4 (T>C) of porcine ACTB gene were identified by comparative sequencing of animals of the breeds Pietrain and Hampshire. Association analysis revealed that haplotypes affected the variation of the traits MOT, ASR and NBA. The beneficial haplotypes may provide considerable improvement of sperm quality and fertility in the tested commercial boar population. PMID:17177693

  15. Direct fluorescence analysis of genetic polymorphisms by hybridization with oligonucleotide arrays on glass supports.

    PubMed Central

    Guo, Z; Guilfoyle, R A; Thiel, A J; Wang, R; Smith, L M

    1994-01-01

    A simple and rapid method for the analysis of genetic polymorphisms has been developed using allele-specific oligonucleotide arrays bound to glass supports. Allele-specific oligonucleotides are covalently immobilized on glass slides in arrays of 3 mm spots. Genomic DNA is amplified by PCR using one fluorescently tagged primer oligonucleotide and one biotinylated primer oligonucleotide. The two complementary DNA strands are separated, the fluorescently tagged strand is hybridized to the support-bound oligonucleotide array, and the hybridization pattern is detected by fluorescence scanning. Multiple polymorphisms present in the PCR product may be detected in parallel. The effect of spacer length, surface density and hybridization conditions were evaluated, as was the relative efficacy of hybridization with single or double-stranded PCR products. The utility of the method was demonstrated in the parallel analysis of 5 point mutations from exon 4 of the human tyrosinase gene. Images PMID:7816638

  16. Netherton Syndrome in a Neonate with Possible Growth Hormone Deficiency and Transient Hyperaldosteronism.

    PubMed

    Ilias, Chatziioannidis; Evgenia, Babatseva; Aikaterini, Patsatsi; Asimina, Galli-Tsinopoulou; Constantina, Sarri; Maria, Lithoxopoulou; George, Mitsiakos; Paraskevi, Karagianni; Christos, Tsakalidis; Zissis, Mamuris; Nikolaos, Nikolaidis

    2015-01-01

    Netherton syndrome, a rare autosomal recessive genetic disorder, is classified as an ichthyosiform syndrome. In this report we present the case of a neonate with erythroderma shortly after birth, accompanied by severe hypernatremia, recurrent infections, transient hyperaldosteronism, and signs of growth hormone (GH) deficiency. DNA molecular analysis in the SPINK5 gene revealed heterozygosity in our index patient for 238insG and 2468delA frameshift mutations in exons 4 and 26, respectively, in the maternal allele and 1431-12G>A splice-site mutation in intron 15 in the paternal allele as well as the missense variation E420K in homozygous state. Combination of the identified mutations along with transient hyperaldosteronism and possible GH deficiency have not been described before. Accordingly, the importance of early multidisciplinary approach is highlighted, in order to reach accurate diagnosis, initiate prompt treatment, and ensure survival with fewer disease complications. PMID:26229701

  17. Novel splice-site mutation in WDR62 revealed by whole-exome sequencing in a Sudanese family with primary microcephaly.

    PubMed

    Bastaki, Fatma; Mohamed, Madiha; Nair, Pratibha; Saif, Fatima; Tawfiq, Nafisa; Aithala, Gururaj; El-Halik, Majdi; Al-Ali, Mahmoud; Hamzeh, Abdul Rezzak

    2016-05-01

    The WDR62 gene encodes a scaffold protein of the c-Jun N-terminal kinase (JNK) pathway. It plays a critical role in laying out various cellular layers in the cerebral cortex during embryogenesis, and hence the dramatic clinical features resulting from WDR62 mutations. These mutations are associated with autosomal recessive primary microcephaly 2, with or without cortical malformations (MCPH2). Using whole exome sequencing we uncovered a novel WDR62 variant; c.390G > A, from two Sudanese siblings whose parents are first cousins. The patients suffered MCPH2 with incomplete lissencephaly and developmental delay. The mutation affects the last nucleotide of exon4, and probably leads to aberrant splicing, which may result in a truncated protein lacking all functional domains. PMID:26577670

  18. Molecular analysis of the 5 alpha-steroid reductase type 2 gene in a family with deficiency of the enzyme.

    PubMed

    Vilchis, F; Canto, P; Chávez, B; Ulloa-Aguirre, A; Méndez, J P

    1997-03-01

    This report describes the identification of a point mutation in the 5 alpha-reductase type 2 (5 alpha-SR2) gene from a family in which both sibs (6 and 3 years old) have steroid 5 alpha-reductase 2 deficiency. The five exons of the gene were individually amplified by the polymerase chain reaction (PCR) and analysed for single-strand conformation polymorphisms (SSCP) to detect mutations. Direct sequencing of the mutant PCR products demonstrated a single C-->T mutation, within exon 4, changing codon 227 from CGA (Arg) to TGA (premature termination signal). Both patients were homozygous for the mutation, but their parents were heterozygous. These results suggest that the mutation at codon 227 impairs normal 5 alpha-SR2 function, thus leading to the phenotypical expression of this rare enzymatic defect. PMID:9066886

  19. A case of recurrent acute encephalopathy with febrile convulsive status epilepticus with carnitine palmitoyltransferase II variation.

    PubMed

    Sakai, Eiko; Yamanaka, Gaku; Kawashima, Hisashi; Morishima, Yasuyuki; Ishida, Yu; Oana, Shingo; Miyajima, Tasuku; Shinohara, Mayu; Saitoh, Makiko; Mizuguchi, Masashi

    2013-08-01

    Acute encephalopathy with febrile convulsive status epilepticus (AEFCSE) is the most common type of acute encephalopathy in childhood in Japan, which develops with prolonged febrile convulsion, followed by mild unconsciousness. It is generally sporadic and nonrecurrent. In this report, a 1-year-old girl showed signs of AEFCSE triggered by respiratory syncytial virus infection. Two years later, she presented with AEFCSE triggered by influenza virus infection, resulting in severe neurologic sequelae. The patient had a thermolabile genotype of carnitine palmitoyltransferase II (CPT II) variations consisting of three single nucleotide polymorphisms in exons 4 [1055T > G/F352C and 1102G > A/V368I] and 5 [1939A > G/M647V]. The polymorphism has been identified as a genetic predisposition for acute encephalopathy. This report presents the first case of recurrent encephalopathy with CPT II variations that may partially associate with pathogenesis of recurrent AEFCSE. PMID:23450341

  20. Clinical variability of the cerebral autosomal-dominant arteriopathy with subcortical infarcts and leukoencephalopathy phenotype in two siblings of a large family showing the same mutation

    PubMed Central

    Vyshka, Gentian; Kruja, Jera

    2013-01-01

    A 44-year-old Albanian male was consulted and diagnosed with dementia. His magnetic resonance imaging suggested diffuse white matter changes. The suspicion of cerebral autosomal-dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) was raised, and a genetic analysis confirmed such a suspicion through uncovering a pathogenic mutation at the level of exon 4 (c.475C>T) of chromosome 19. The patient came from a large family of 13 children, all of whom underwent clinical, genetic, and imaging examination. The pathogenic mutation was found present only in his eldest sister (50 years old), and she presented also very suggestive signs of CADASIL in her respective imaging study, but without any clinically significant counterpart. All other siblings were free from clinical and radiological signs of the disorder. Our opinion was that we were dealing with a mutation showing a very low level of penetrance, with only two siblings affected in a large Albanian family with 13 children. PMID:24124395

  1. Localization of the human {beta}-catenin gene (CTNNB1) to 3p21: A region implicated in tumor development

    SciTech Connect

    Kraus, C.; Liehr, T.; Ballhausen, G.

    1994-09-01

    The human {beta}-catenin locus (CTNNB1) was mapped by in situ fluorescence analysis to band p21 on the short arm of chromosome 3, a region frequently affected by somatic alterations in a variety of tumors. PCR primers for the genomic amplification of {beta}-catenin sequences were selected on the basis of homology to exon 4 of the Drosophila armadillo gene. Analysis of a panel of somatic cell hybrids confirmed the localization of {beta}-catenin on human chromosome 3. Furthermore, exclusion mapping of three hybrids carrying defined fragments of the short arm of human chromosome 3 allowed us to determine the position of the CTNNB1 locus close to the marker D3S2 in 3p21. 22 refs., 3 figs.

  2. Netherton Syndrome in a Neonate with Possible Growth Hormone Deficiency and Transient Hyperaldosteronism

    PubMed Central

    Ilias, Chatziioannidis; Evgenia, Babatseva; Aikaterini, Patsatsi; Asimina, Galli-Tsinopoulou; Constantina, Sarri; Maria, Lithoxopoulou; George, Mitsiakos; Paraskevi, Karagianni; Christos, Tsakalidis; Zissis, Mamuris; Nikolaos, Nikolaidis

    2015-01-01

    Netherton syndrome, a rare autosomal recessive genetic disorder, is classified as an ichthyosiform syndrome. In this report we present the case of a neonate with erythroderma shortly after birth, accompanied by severe hypernatremia, recurrent infections, transient hyperaldosteronism, and signs of growth hormone (GH) deficiency. DNA molecular analysis in the SPINK5 gene revealed heterozygosity in our index patient for 238insG and 2468delA frameshift mutations in exons 4 and 26, respectively, in the maternal allele and 1431-12G>A splice-site mutation in intron 15 in the paternal allele as well as the missense variation E420K in homozygous state. Combination of the identified mutations along with transient hyperaldosteronism and possible GH deficiency have not been described before. Accordingly, the importance of early multidisciplinary approach is highlighted, in order to reach accurate diagnosis, initiate prompt treatment, and ensure survival with fewer disease complications. PMID:26229701

  3. Crystal structure of truncated human apolipoprotein A-I suggests a lipid-bound conformation

    PubMed Central

    Borhani, David W.; Rogers, Danise P.; Engler, Jeffrey A.; Brouillette, Christie G.

    1997-01-01

    The structure of truncated human apolipoprotein A-I (apo A-I), the major protein component of high density lipoprotein, has been determined at 4-Å resolution. The crystals comprise residues 44–243 (exon 4) of apo A-I, a fragment that binds to lipid similarly to intact apo A-I and that retains the lipid-bound conformation even in the absence of lipid. The molecule consists almost entirely of a pseudo-continuous, amphipathic α-helix that is punctuated by kinks at regularly spaced proline residues; it adopts a shape similar to a horseshoe of dimensions 125 × 80 × 40 Å. Four molecules in the asymmetric unit associate via their hydrophobic faces to form an antiparallel four-helix bundle with an elliptical ring shape. Based on this structure, we propose a model for the structure of apo A-I bound to high density lipoprotein. PMID:9356442

  4. Elucidation of the sequence of canine (pro)-calcitonin. A molecular biological and protein chemical approach.

    PubMed

    Mol, J A; Kwant, M M; Arnold, I C; Hazewinkel, H A

    1991-09-01

    From the canine thyroid gland a calcitonin (CT) immunoreactive peptide was purified by successive aqueous acid acetone extraction, gel filtration and HPLC. Gas-phase sequencing of the purified peptide showed that the first 25 amino acids had 65% sequence homology with the amino-terminus of the human CT prohormone. A canine cDNA library was then made from the thyroid gland. A plasmid was isolated containing a sequence that is homologous to part of exon 3, and the complete sequence of exon 4 of the human mRNA encoding preproCT. From this cDNA the amino acid sequence of canine CT is predicted. In comparison with well-known CT sequences of other species, the strongest homology exists with bovine, porcine and ovine CT. PMID:1758974

  5. A novel HYLS1 homozygous mutation in living siblings with Joubert syndrome.

    PubMed

    Oka, M; Shimojima, K; Yamamoto, T; Hanaoka, Y; Sato, S; Yasuhara, T; Yoshinaga, H; Kobayashi, K

    2016-06-01

    The p.Asp211Gly homozygous HYLS1 mutation is so far known to cause only hydrolethalus syndrome, a lethal malformation syndrome. We report living sibling patients with a homozygous no-stop mutation in exon 4 of HYLS1, NM_145014.2:c.900A>C (p.Ter300TyrextTer11) in the second decade of life. The proband has Joubert syndrome (JS). The younger brother also has JS and an enlarged posterior fossa that was initially diagnosed as Dandy-Walker malformation. The present mutation is unique as it affects the stop codon. The product protein HYLS1 plays an essential role in the formation of the primary cilium. This report provides insight into the spectrum of disorders involving midline brain defects closely related to cilium dysfunction or ciliopathy. PMID:26830932

  6. A girl with tomboy behavior: lesson from misdiagnosis in a baby with ambiguous genitalia.

    PubMed

    Dati, E; Baldinotti, F; Conidi, M E; Simi, P; Baroncelli, G I; Bertelloni, Silvano

    2010-01-01

    5alpha-Reductase-2 deficiency is a rare 46,XY disorder of sex differentiation caused by mutations in the 5alpha-reductase type 2 gene. It presents at birth with variable degree of undervirilization. Here, a baby with 5alpha-reductase-2 deficiency and misdiagnosis of complete androgen insensitivity syndrome, female sex assignment and early gonadectomy is described. During primary school, the girl developed tomboy behavior. Molecular analysis demonstrated compound heterozygosity for 5alpha-reductase type 2 gene mutations (exon 2: Q126R; exon 4: H230P). This child underlines the need for adequate endocrine and genetic testing for a definite diagnosis before gender is assigned in children with ambiguous genitalia and surgical interventions are carried out. Inadequate work-up may result in inappropriate gender assignment in infancy with possible inferences on outcome. PMID:20051677

  7. Epstein-Barr virus infection induces bone resorption in apical periodontitis via increased production of reactive oxygen species.

    PubMed

    Jakovljevic, Aleksandar; Andric, Miroslav; Miletic, Maja; Beljic-Ivanovic, Katarina; Knezevic, Aleksandra; Mojsilovic, Slavko; Milasin, Jelena

    2016-09-01

    Chronic inflammatory processes in periapical tissues caused by etiological agents of endodontic origin lead to apical periodontitis. Apart from bacteria, two herpesviruses, Epstein-Barr virus (EBV) and Human cytomegalovirus (HCMV) are recognized as putative pathogens in apical periodontitis. Although previous reports suggest the involvement of EBV in the pathogenesis of apical periodontitis, its exact role in periapical bone resorption has not yet been fully elucidated. We hypothesize that EBV infection in apical periodontitis is capable of inducing periapical bone resorption via stimulation of reactive oxygen species (ROS) overproduction. Increased levels of ROS induce expression of receptor activator of nuclear factor kappa B (NF-κB) ligand (RANKL). RANKL binding to receptor activator of nuclear factor κB (RANK) present on the surface of preosteoclasts induces their maturation and activation which consequently leads to bone resorption. The potential benefit of antiviral and antioxidant-based therapies in periapical bone resorption treatment remains to be assessed. PMID:27515196

  8. T cell responses to cytomegalovirus.

    PubMed

    Klenerman, Paul; Oxenius, Annette

    2016-06-01

    Human cytomegalovirus (HCMV) establishes a latent infection that generally remains asymptomatic in immune-competent hosts for decades but can cause serious illness in immune-compromised individuals. The long-term control of CMV requires considerable effort from the host immune system and has a lasting impact on the profile of the immune system. One hallmark of CMV infection is the maintenance of large populations of CMV-specific memory CD8(+) T cells - a phenomenon termed memory inflation - and emerging data suggest that memory inflation is associated with impaired immunity in the elderly. In this Review, we discuss the molecular triggers that promote memory inflation, the idea that memory inflation could be considered a natural pathway of T cell maturation that could be harnessed in vaccination, and the broader implications of CMV infection and the T cell responses it elicits. PMID:27108521

  9. Increased Viral Dissemination in the Brain and Lethality in MCMV-Infected, Dicer-Deficient Neonates

    PubMed Central

    Ostermann, Eleonore; Macquin, Cécile; Krezel, Wojciech; Bahram, Seiamak; Georgel, Philippe

    2015-01-01

    Among Herpesviruses, Human Cytomegalovirus (HCMV or HHV-5) represents a major threat during congenital or neonatal infections, which may lead to encephalitis with serious neurological consequences. However, as opposed to other less prevalent pathogens, the mechanisms and genetic susceptibility factors for CMV encephalitis are poorly understood. This lack of information considerably reduces the prognostic and/or therapeutic possibilities. To easily monitor the effects of genetic defects on brain dissemination following CMV infection we used a recently developed in vivo mouse model based on the neonatal inoculation of a MCMV genetically engineered to express Luciferase. Here, we further validate this protocol for live imaging, and demonstrate increased lethality associated with viral infection and encephalitis in mutant mice lacking Dicer activity. Our data indicate that miRNAs are important players in the control of MCMV pathogenesis and suggest that miRNA-based endothelial functions and integrity are crucial for CMV encephalitis. PMID:25955106

  10. Viral and host control of cytomegalovirus maturation

    PubMed Central

    Tandon, Ritesh; Mocarski, Edward S.

    2012-01-01

    Maturation in herpesviruses initiates in the nucleus of the infected cell with encapsidation of viral DNA to form nucleocapsids and concludes with envelopment in the cytoplasm to form infectious virions that egress the cell. The entire process of virus maturation is orchestrated by protein-protein interactions and enzymatic activities of viral and host origin. Viral tegument proteins play important roles in maintaining the structural stability of capsids and directing the acquisition of virus envelope. Envelopment occurs at modified host membranes and exploits host vesicular trafficking. In this review, we summarize the current knowledge and concepts in human cytomegalovirus (HCMV) maturation and their parallels in other herpesviruses with an emphasis on viral and host factors regulating this process. PMID:22633075

  11. Human Cytomegalovirus pUL47 Modulates Tegumentation and Capsid Accumulation at the Viral Assembly Complex

    PubMed Central

    Cappadona, Ilaria; Villinger, Clarissa; Schutzius, Gabi; Mertens, Thomas

    2015-01-01

    ABSTRACT Human cytomegalovirus (HCMV) tegument protein pUL47 is an interaction partner of pUL48 and highly conserved among herpesviruses. It is closely associated with the capsid and has an important function early in infection. Here, we report a specific role of pUL47 in the tegumentation of capsids in the cytoplasm. A newly generated mutant virus (TB-47stop), in which expression of pUL47 is blocked, exhibited a severe impairment in cell-to-cell spread and release of infectivity from infected cells. Ultrastructural analysis of TB-47stop-infected cells clearly showed cytoplasmic accumulations of nonenveloped capsids that were only partially tegumented, indicating that these capsids failed to complete tegumentation. Nevertheless, these accumulations were positive for HCMV inner tegument proteins pp150 and pUL48, suggesting that their attachment to capsids occurs independently of pUL47. Despite these morphological alterations, fully enveloped virus particles were found in the extracellular space and at the viral assembly complex (vAC) of TB-47stop-infected cells, indicating that pUL47 is not essential for the generation of virions. We confirmed findings that incorporation of pUL48 into virions is impaired in the absence of pUL47. Interestingly, pUL47 exhibited a strong nuclear localization in transfected cells, whereas it was found exclusively at the vAC in the context of virus infection. Colocalization of pUL47 and pUL48 at the vAC is consistent with their interaction. We also found a shift to a more nuclear localization of pUL47 when the expression of pUL48 was reduced. Summarizing our results, we hypothesize that pUL48 directs pUL47 to the vAC to promote tegumentation and secondary envelopment of capsids. IMPORTANCE Generation of infectious HCMV particles requires an organized and multistep process involving the action of several viral and cellular proteins as well as protein-protein interactions. A better understanding of these processes is important for

  12. Pharmacological inhibitors of cyclin-dependent kinases.

    PubMed

    Knockaert, Marie; Greengard, Paul; Meijer, Laurent

    2002-09-01

    Cyclin-dependent kinases (CDKs) regulate the cell division cycle, apoptosis, transcription and differentiation in addition to functions in the nervous system. Deregulation of CDKs in various diseases has stimulated an intensive search for selective pharmacological inhibitors of these kinases. More than 50 inhibitors have been identified, among which >20 have been co-crystallized with CDK2. These inhibitors all target the ATP-binding pocket of the catalytic site of the kinase. The actual selectivity of most known CDK inhibitors, and thus the underlying mechanism of their cellular effects, is poorly known. Pharmacological inhibitors of CDKs are currently being evaluated for therapeutic use against cancer, alopecia, neurodegenerative disorders (e.g. Alzheimer's disease, amyotrophic lateral sclerosis and stroke), cardiovascular disorders (e.g. atherosclerosis and restenosis), glomerulonephritis, viral infections (e.g. HCMV, HIV and HSV) and parasitic protozoa (Plasmodium sp. and Leishmania sp.). PMID:12237154

  13. Synthesis and antiviral activity of novel acyclic nucleoside analogues of 5-(1-azido-2-haloethyl)uracils.

    PubMed

    Kumar, R; Sharma, N; Nath, M; Saffran, H A; Tyrrell, D L

    2001-11-22

    We present the discovery of a novel category of 5-substituted acyclic pyrimidine nucleosides as potent antiviral agents. A series of 1-[(2-hydroxyethoxy)methyl] (5-7), 1-[(2-hydroxy-1-(hydroxymethyl)ethoxy)methyl] (8-10), and 1-[4-hydroxy-3-(hydroxymethyl)-1-butyl] (11-13) derivatives of 5-(1-azido-2-haloethyl)uracil were synthesized and evaluated for their biological activity in cell culture. 1-[4-Hydroxy-3-(hydroxymethyl)-1-butyl]-5-(1-azido-2-chloroethyl)uracil (12) was the most effective antiviral agent in the in vitro assays against DHBV (EC(50) = 0.31-1.55 microM) and HCMV (EC(50) = 3.1 microM). None of the compounds investigated showed any detectable toxicity to several stationary and proliferating host cells. PMID:11708924

  14. Complex patterns of intragenic polymorphism at the PDGFA locus.

    PubMed

    Bonthron, D T; Smith, S J; Campbell, R

    1999-11-01

    The human platelet-derived growth factor A chain gene (PDGFA) on chromosome 7p22 encodes an important mitogen. Within PDGFA lies a complex minisatellite structure that results in partial duplications of exon 4 and the IVS4 splice donor site. Here, we show that the PDGFA genes of four ape species and an Old-World monkey all have similar complex minisatellites at this position. Comparison of their structures suggests evolutionary constraints resulting from the protein-coding function of the minisatellite. Nonetheless, the IVS4 minisatellite seems to have undergone independent expansion events in different primate lineages. Within the human IVS4 minisatellite, an embedded pentanucleotide repeat, based on the sequence (CCTCC)n, shows frequent subunit sequence variation but only rare length polymorphism. In contrast, within IVS3 of human PDGFA, we have discovered a second minisatellite which, unlike the IVS4 minisatellite, is highly polymorphic. The subunit sequences of these two minisatellites, which lie less than 0.5 kb apart, are non-identical, but share a CnT-rich core. Two new single nucleotide polymorphisms (SNPs), in exon 3 and IVS4, are in linkage disequilibrium, despite flanking the two minisatellite regions. Reverse transcription-polymerase chain reaction analysis of the exon 3 SNP in human foetal tissues demonstrated biallelic expression of PDGFA in all tissues examined. The unusual location of PDGFA exon 4 between two minisatellite sequences, together with its partial duplication, may have functional implications, particularly for the splicing of the gene. The high level of polymorphism demonstrated in this region will also be valuable for disease-association and linkage studies of the PDGFA locus. PMID:10598812

  15. Analysis of the neurofilament heavy subunit (NFH) gene in familial amyotrophic lateral sclerosis

    SciTech Connect

    Rooke, K.; Rouleau, G.A.; Figlewicz, D.A.

    1994-09-01

    Amyotrophic lateral sclerosis (ALS) is a fatal, adult-onset, degenerative disorder of the motor neurons in the cortex, brainstem and spinal cord. Approximately 10% of ALS cases are familial (FALS) and are inherited as an age-dependent autosomal dominant trait. Mutations in the Cu/Zn superoxide dismutase (SOD-1) gene on chromosome 21 have been found in a subset of cases. However, for the remaining FALS cases, the etiology is unknown. The abnormal accumulation of neurofilaments in the cell body and proximal axon of motor neurons is a characteristic pathological finding in ALS. Furthermore, aberrant neuronal swellings that closely resemble those found in ALS have been reported in transgenic mice overexpressing NFH. The C-terminal region of NFH contains a unique functional domain with multiple repeats of the amino acids (Lys-Ser-Pro) (KSP) and forms the side-arms which appear, at the level of electron microscopy, to cross-link neurofilaments. Recently, deletions in the DSP repeat domain have been identified in five ALS patients diagnosed as sporadic cases of the disease. Based on these findings, we propose to analyze all 4 exons of the NFH gene for variation in FALS. DNA from 110 FALS cases has been amplified by the polymerase chain reaction (PCR) and analyzed by single strand conformation polymorphism (SSCP) analysis. Exon 2, exon 3 and the KSP repeat domain (part of exon 4) appear normal in all our FALS individuals under several different SSCP conditions. The analysis of exon 1 and the remainder of exon 4 has yet to be completed.

  16. Association of Two Variants in SMAD7 with the Risk of Congenital Heart Disease in the Han Chinese Population

    PubMed Central

    Qiao, Bin; Sun, Shuna; Huang, Guoying; Shi, Kaihu; Jin, Li; Wang, Hongyan

    2013-01-01

    SMAD7 is a general antagonist of TGF-β signaling and has been found to be involved in cardiogenesis in mouse models, but its role in human congenital heart disease (CHD) has yet to be investigated. To examine if SMAD7 is associated with CHD, we conducted a case-control study in the Han Chinese population. Exon1 and exon4 of SMAD7, which encode the functional MH1 and MH2 domains, were directly sequenced in 1,201 sporadic CHD patients and 1,116 control individuals. A total of 18 sequence variations were identified. Two common variants rs3809922 and rs3809923 are located at exon4 of SMAD7, and were found in strong linkage disequilibrium with each other (r2 = 0.93). We analyzed the association of these two loci with CHD in 3 independent subgroup case-control studies, and found that in some subgroups, rs3809922 and rs3809923 were significantly associated with CHD through genetic model analysis. In the combined data set, TT genotype in rs3809922 significantly increased the risk of CHD compared with CC and CT, while GG genotype in rs3809923 significantly increased the risk of CHD compared with CC and CG, particularly in the recessive model. In addition, haplotype analyses showed that haplotype TG significantly increased the risk of CHD (P = 6.9×10−6); this finding supports the results from the analyses based on single locus. According to data from the 1000 Genomes Project, the frequencies of the two risk alleles varied greatly between populations worldwide, which indicate the identified associations might have a population difference. To our knowledge, this is the first report that genetic variants in SMAD7 influence susceptibility to CHD risk. PMID:24039762

  17. Genome-Wide Association Study Implicates Testis-Sperm Specific FKBP6 as a Susceptibility Locus for Impaired Acrosome Reaction in Stallions

    PubMed Central

    Raudsepp, Terje; Dobson, Lauren; Vishnoi, Monika; Fritz, Krista L.; Schaefer, Robert; Rendahl, Aaron K.; Derr, James N.; Love, Charles C.; Varner, Dickson D.; Chowdhary, Bhanu P.

    2012-01-01

    Impaired acrosomal reaction (IAR) of sperm causes male subfertility in humans and animals. Despite compelling evidence about the genetic control over acrosome biogenesis and function, the genomics of IAR is as yet poorly understood, providing no molecular tools for diagnostics. Here we conducted Equine SNP50 Beadchip genotyping and GWAS using 7 IAR–affected and 37 control Thoroughbred stallions. A significant (P<6.75E-08) genotype–phenotype association was found in horse chromosome 13 in FK506 binding protein 6 (FKBP6). The gene belongs to the immunophilins FKBP family known to be involved in meiosis, calcium homeostasis, clathrin-coated vesicles, and membrane fusions. Direct sequencing of FKBP6 exons in cases and controls identified SNPs g.11040315G>A and g.11040379C>A (p.166H>N) in exon 4 that were significantly associated with the IAR phenotype both in the GWAS cohort (n = 44) and in a large multi-breed cohort of 265 horses. All IAR stallions were homozygous for the A-alleles, while this genotype was found only in 2% of controls. The equine FKBP6 was exclusively expressed in testis and sperm and had 5 different transcripts, of which 4 were novel. The expression of this gene in AC/AG heterozygous controls was monoallelic, and we observed a tendency for FKBP6 up-regulation in IAR stallions compared to controls. Because exon 4 SNPs had no effect on the protein structure, it is likely that FKBP6 relates to the IAR phenotype via regulatory or modifying functions. In conclusion, FKBP6 was considered a susceptibility gene of incomplete penetrance for IAR in stallions and a candidate gene for male subfertility in mammals. FKBP6 genotyping is recommended for the detection of IAR–susceptible individuals among potential breeding stallions. Successful use of sperm as a source of DNA and RNA propagates non-invasive sample procurement for fertility genomics in animals and humans. PMID:23284302

  18. Mutation analysis of metastatic melanomas in the central nervous system: results of a panel of 5 genes in 48 cases.

    PubMed

    Gamsizkan, Mehmet; Yilmaz, Ismail; Simsek, Hasan Aktug; Onguru, Onder; Griffin, Ann; Tihan, Tarik

    2016-01-01

    Melanocytic lesions in the central nervous system (CNS) may be primary to the site but are more commonly metastases from cutaneous primaries. In fact, melanomas are one of the most common malignancies that can metastasize to the brain, and some patients may not have a diagnosis of melanoma prior to the discovery of the CNS lesion. In such cases, identifying the primary site may be challenging. We reviewed the archives of a large referral center for melanocytic tumors involving the CNS and selected 48 patients for this study based on our inclusion criteria. We used sequencing to identify mutation status of these tumors and compared these with clinicopathological features. Mutations in exon 9, 11, 13, 17, and 18 of KIT gene, exon 15 of BRAF gene, exon 2 and 3 of NRAS gene, exon 4 and 5 of GNAQ and GNA11 genes were analyzed. Mutations in BRAF-exon 15 were the most common among tumors (58.3%). NRAS-exon 2 and NRAS-exon 3 mutations were detected in 3 and 7 cases, respectively. GNAQ-exon 4, GNAQ-exon 5 and GNA11-exon 5 mutation were present in 1 tumor each. Eight tumors were wild type for all 5 genes, and 6 of these were not known primary despite a work-up and clinical follow-up. Only 1 of these tumors showed a mutation in exon 11 of KIT gene. When compared to primary melanocytic lesions of the CNS, metastatic melanomas were characterized by BRAF gene mutations and wild-type GNAQ and GNA11 genes. PMID:27117140

  19. Identification of KCNJ15 as a susceptibility gene in Asian patients with type 2 diabetes mellitus.

    PubMed

    Okamoto, Koji; Iwasaki, Naoko; Nishimura, Chisa; Doi, Kent; Noiri, Eisei; Nakamura, Shinko; Takizawa, Miho; Ogata, Makiko; Fujimaki, Risa; Grarup, Niels; Pisinger, Charlotta; Borch-Johnsen, Knut; Lauritzen, Torsten; Sandbaek, Annelli; Hansen, Torben; Yasuda, Kazuki; Osawa, Haruhiko; Nanjo, Kishio; Kadowaki, Takashi; Kasuga, Masato; Pedersen, Oluf; Fujita, Toshiro; Kamatani, Naoyuki; Iwamoto, Yasuhiko; Tokunaga, Katsushi

    2010-01-01

    Recent advances in genome research have enabled the identification of new genomic variations that are associated with type 2 diabetes mellitus (T2DM). Via fine mapping of SNPs in a candidate region of chromosome 21q, the current study identifies potassium inwardly-rectifying channel, subfamily J, member 15 (KCNJ15) as a new T2DM susceptibility gene. KCNJ15 is expressed in the beta cell of the pancreas, and a synonymous SNP, rs3746876, in exon 4 (C566T) of this gene, with T allele frequency among control subjects of 3.1%, showed a significant association with T2DM affecting lean individuals in three independent Japanese sample sets (p = 2.5 x 10(-7), odds ratio [OR] = 2.54, 95% confidence interval [CI] = 1.76-3.67) and with unstratified T2DM (p = 6.7 x 10(-6), OR = 1.76, 95% CI = 1.37-2.25). The diabetes risk allele frequency was, however, very low among Europeans in whom no association between this variant and T2DM could be shown. Functional analysis in human embryonic kidney 293 cells demonstrated that the risk allele of the synonymous SNP in exon 4 increased KCNJ15 expression via increased mRNA stability, which resulted in the higher expression of protein as compared to that of the nonrisk allele. We also showed that KCNJ15 is expressed in human pancreatic beta cells. In conclusion, we demonstrated a significant association between a synonymous variant in KCNJ15 and T2DM in lean Japanese patients with T2DM, suggesting that KCNJ15 is a previously unreported susceptibility gene for T2DM among Asians. PMID:20085713

  20. Comparative analysis of the pteridophyte Adiantum MFT ortholog reveals the specificity of combined FT/MFT C and N terminal interaction with FD for the regulation of the downstream gene AP1.

    PubMed

    Hou, Cheng-Jing; Yang, Chang-Hsien

    2016-07-01

    To study the evolution of phosphatidylethanolamine-binding protein (PEBP) gene families in non-flowering plants, we performed a functional analysis of the PEBP gene AcMFT of the MFT clade in the pteridophyte Adiantum capillus-veneris. The expression of AcMFT was regulated by photoperiod similar to that for FT under both long day and short day conditions. Ectopic expression of AcMFT in Arabidopsis promotes the floral transition and partially complements the late flowering defect in transgenic Arabidopsis ft-1 mutants, suggesting that AcMFT functions similarly to FT in flowering plants. Interestingly, a similar partial compensation of the ft-1 late flowering phenotype was observed in Arabidopsis ectopically expressing only exon 4 of the C terminus of AcMFT and FT. This result indicated that the fourth exon of AcMFT and FT plays a similar and important role in promoting flowering. Further analysis indicated that exons 1-3 in the N terminus specifically enhanced the function of FT exon 4 in controlling flowering in Arabidopsis. Protein pull-down assays indicated that Arabidopsis FD proteins interact with full-length FT and AcMFT, as well as peptides encoded by 1-3 exon fragments or the 4th exon alone. Furthermore, similar FRET efficiencies for FT-FD and AcMFT-FD heterodimer in nucleus were observed. These results indicated that FD could form the similar complex with FT and AcMFT. Further analysis indicated that the expression of AP1, a gene downstream of FT, was up-regulated more strongly by FT than AcMFT in transgenic Arabidopsis. Our results revealed that AcMFT from a non-flowering plant could interact with FD to regulate the floral transition and that this function was reduced due to the weakened ability of AcMFT-FD to activate the downstream gene AP1. PMID:27216814

  1. Three novel and the common Arg677Ter RP1 protein truncating mutations causing autosomal dominant retinitis pigmentosa in a Spanish population

    PubMed Central

    Gamundi, María José; Hernan, Imma; Martínez-Gimeno, María; Maseras, Miquel; García-Sandoval, Blanca; Ayuso, Carmen; Antiñolo, Guillermo; Baiget, Montserrat; Carballo, Miguel

    2006-01-01

    Background Retinitis pigmentosa (RP), a clinically and genetically heterogeneous group of retinal degeneration disorders affecting the photoreceptor cells, is one of the leading causes of genetic blindness. Mutations in the photoreceptor-specific gene RP1 account for 3–10% of cases of autosomal dominant RP (adRP). Most of these mutations are clustered in a 500 bp region of exon 4 of RP1. Methods Denaturing gradient gel electrophoresis (DGGE) analysis and direct genomic sequencing were used to evaluate the 5' coding region of exon 4 of the RP1 gene for mutations in 150 unrelated index adRP patients. Ophthalmic and electrophysiological examination of RP patients and relatives according to pre-existing protocols were carried out. Results Three novel disease-causing mutations in RP1 were detected: Q686X, K705fsX712 and K722fsX737, predicting truncated proteins. One novel missense mutation, Thr752Met, was detected in one family but the mutation does not co-segregate in the family, thereby excluding this amino acid variation in the protein as a cause of the disease. We found the Arg677Ter mutation, previously reported in other populations, in two independent families, confirming that this mutation is also present in a Spanish population. Conclusion Most of the mutations reported in the RP1 gene associated with adRP are expected to encode mutant truncated proteins that are approximately one third or half of the size of wild type protein. Patients with mutations in RP1 showed mild RP with variability in phenotype severity. We also observed several cases of non-penetrant mutations. PMID:16597330

  2. Mutation analysis of the Fanconi Anemia Gene FACC

    SciTech Connect

    Verlander, P.C.; Lin, J.D.; Udono, M.U.; Zhang, Q.; Auerbach, A.D. ); Gibson, R.A.; Mathew, C.G. )

    1994-04-01

    Fanconi anemia (FA) is a genetically heterogeneous autosomal recessive disorder characterized by a unique hypersensitivity of cells to DNA cross-linking agents; a gene for complementation group C (FACC) has recently been cloned. The authors have amplified FACC exons with their flanking intron sequences from genomic DNA from 174 racially and ethnically diverse families in the International Fanconi Anemia Registry and have screened for mutations by using SSCP analysis. They have identified eight different variants in 32 families; three were detected in exon 1, one in exon 4, one in intron 4, two in exon 6, and one in exon 14. Two of the eight variants, in seven families, did not segregate with the disease allele in multiplex families, suggesting that these variants represented benign polymorphisms. Disease-associated mutations in FACC were detected in a total of 25 (14.4%) of 174 families screened. The most frequent mutations were IVS4 + 4 A [yields] T (intron 4; 12 families) and 322delG (exon 1; 9 families). Other, less common mutations include Q13X in exon 1, R185X and D195V in exon 6, and L554P in exon 14. The polymorphisms were S26F in exon 1 and G139E in exon 4. All patients in the study with 322delG, Q13X, R185X, and D195V are of northern or eastern European or southern Italian ancestry, and 18 of 19 have a mild form of the disease, while the 2 patients with L554P, both from the same family, have a severe phenotype. All 19 patients with IVS4 + 4 A [yields] T have Jewish ancestry and have a severe phenotype. 19 refs., 1 fig., 3 tabs.

  3. Glutathione S-transferase GSTT1 and GSTM1 allozymes: beyond null alleles.

    PubMed

    Agúndez, José A G; Ladero, José M

    2008-03-01

    Moyer AM, Salavaggione OE, Hebbring SJ et al.: Glutathione S-transferase T1 and M1: gene sequence variation and functional genomics. Clin. Cancer Res. 13, 7207-7216 (2007). Genetic variations in the glutathione S-transferases GSTT1 and GSTM1 have been studied in many human populations, and association of these variations with environmentally-related cancers, drug-induced hepatotoxicity and even chronification of viral hepatitis has been shown. However, studies carried out to date have been limited to gene deletion, designated as null alleles, and no extensive studies on other types of genetic variations have been carried out. This study is of great importance, as it describes the occurrence and the allele frequencies for 18 SNPs in the GSTT1 gene, including four nonsynonymous SNPs, and 69 SNPs, two of which are nonsynonymous, in the GSTM1 gene. The GSTT1 SNPs leading to the amino acid substitutions Asp43Asn, Thr65Met, Thr104Pro and a single nucleotide deletion in exon 4 cause a decrease in immunoreactive protein. Interestingly, the previously described nonsynonymous GSTT1 SNPs rs2266635 (Ala21Thr), rs11550606 (Leu30Pro), rs17856199 (Phe45Cys), rs11550605 (Thr104Pro), rs2266633 (Asp141Asn) and rs2234953 (Glu173Lys) were not identified in 400 subjects, thus indicating that these variant alleles are expected to occur at extremely low frequencies. This study reinforces the need to combine SNP databases and resequencing. On combining the data reported in this study with SNP databases, the most promising target SNPs for GSTT1 association studies are those causing the amino acid changes Asp43Asn, Thr65Met, Thr104Pro and the single nucleotide deletion in exon 4. These gene variants should be analyzed in African-American and Hispanic subjects to increase the predictive capacity of genetic tests. For Caucasians and Oriental subjects, testing for null alleles seems to be sufficient. PMID:18303971

  4. Organization, regulatory sequences, and alternatively spliced transcripts of the mucosal addressin cell adhesion molecule-1 (MAdCAM-1) gene

    SciTech Connect

    Sampaio, S.O.; Mei, C.; Butcher, E.C.

    1995-09-01

    The mucosal addressin cell adhesion molecule-1 (MAdCAM-1) is expressed selectively at venular sites of lymphocyte extravasation into mucosal lymphoid tissues and lamina propria, where it directs local lymphocyte trafficking. MAdCAM-1 is a multifunctional type I transmembrane adhesion molecule comprising two distal Ig domains involved in {alpha}4{beta}7 integrin binding, a mucin-like region able to display L-selectin-binding carbohydrates, and a membrane-proximal Ig domain homologous to IgA. We show in this work that the MAdCAM-1 gene is located on chromosome 10 and contains five exons. The signal peptide and each one of the three Ig domains are encoded by a distinct exon, whereas the transmembrane, cytoplasmic tail, and 3{prime}-untranslated region of MAdCAM-1 are combined on a single exon. The mucin-like region and the third Ig domain are encoded together on exon 4. An alternatively spliced MAdCAM-1 mRNA is identified that lacks the mucin/IgA-homologous exon 4-encoded sequences. This short variant of MAdCAM-1 may be specialized to support {alpha}4{beta}7-dependent adhesion strengthening, independent of carbohydrate-presenting function. Sequences 5{prime} of the transcription start site include tandem nuclear factor-KB sites; AP-1, AP-2, and signal peptide-1 binding sites; and an estrogen response element. Our findings reinforce the correspondence between the multidomain structure and versatile functions of this vascular addressin, and suggest an additional level of regulation of carbohydrate-presenting capability, and thus of its importance in lectin-mediated vs. {alpha}4{beta}7-dependent adhesive events in lymphocyte trafficking. 46 refs., 6 figs., 1 tab.

  5. Transcription analysis, physical mapping, and molecular characterization of a nonclassical human leukocyte antigen class I gene.

    PubMed Central

    Chorney, M J; Sawada, I; Gillespie, G A; Srivastava, R; Pan, J; Weissman, S M

    1990-01-01

    The human major histocompatibility complex contains approximately 20 class I genes, pseudogenes, and gene fragments. These include the genes for the three major transplantation antigens, HLA-A, HLA-B, and HLA-C, as well as a number of other genes or pseudogenes of unknown biological significance. Most of the latter have C + G-rich sequences in their 5' ends that are unmethylated in the B-lymphoblastoid cell line 3.1.0. We investigated one of these genes, HLA-H, in more detail. The gene is, overall, strongly homologous in sequence to HLA-A but differs in several potentially significant ways, including changes in conserved promoter sequences, a single-base deletion producing a translation termination codon in exon 4, and a region of sequence divergence downstream of the transcribed portion of the gene. Nevertheless, mouse L cells transfected with the gene accumulated small amounts of apparently full-length polyadenylated RNA. A portion of this RNA begins at the transcription site predicted by analogy to certain class I cDNA clones, while another portion appears to begin shortly upstream. L cells transfected with a hybrid gene containing the first three exons of HLA-H and the last five exons of HLA-B27 accumulated full-length HLA transcripts at the same level as cells transfected with an HLA-B27 gene; both levels are at least 15- to 20-fold higher than that directed by HLA-H alone. In addition, we isolated a cDNA clone for HLA-H that contains a portion of intron 3 attached to a normally spliced sequence comprising exons 4 through 8. These results suggest that low levels of translatable mRNA for the truncated class I heavy chain encoded by HLA-H are produced under physiologic circumstances and that sequences 3' of intron 3 decrease the levels of stable transcripts. Images PMID:2294403

  6. Gene polymorphisms of Toll-like and related recognition receptors in relation to the vaginal carriage of Gardnerella vaginalis and Atopobium vaginae.

    PubMed

    Verstraelen, Hans; Verhelst, Rita; Nuytinck, Lieve; Roelens, Kristien; De Meester, Els; De Vos, Daniel; Van Thielen, Martine; Rossau, Rudi; Delva, Wim; De Backer, Ellen; Vaneechoutte, Mario; Temmerman, Marleen

    2009-01-01

    Host genetic factors have previously been found to act as determinants of differential susceptibility to major infectious diseases. It is less clear whether such polymorphisms may also impose on pathogen recognition in mucosal overgrowth conditions such as bacterial vaginosis, an anaerobic overgrowth condition characterised by the presence of a vaginal biofilm consisting of the Gram-positive anaerobes Gardnerella vaginalis and Atopobium vaginae. We selected 34 single nucleotide polymorphisms pertaining to 9 genes involved with Toll-like receptor-mediated pathogen recognition and/or regulation (LBP, CD14, TLR1, TLR2, TLR4, TLR6, MD2, CARD15 and SIGIRR) and assessed in a nested case-control study their putative association with bacterial vaginosis, as diagnosed by Gram staining, and with the vaginal carriage of A. vaginae and G. vaginalis, as determined by species-specific PCR, among 144 pregnant women. Carriage of G. vaginalis during early pregnancy was associated with the -1155A>G substitution in the promoter region of the MD2 gene (p=0.041). The presence of A. vaginae during the first half of the pregnancy was significantly associated with the CD14 intron 2 1342G>T (p=0.039), the TLR1 exon 4 743A>G (p=0.038), and the CARD15 exon 4 14772A>T (p=0.012) polymorphisms, and marginally significantly associated with the LBP exon13 26842C>T (p=0.056), the CD14 promoter -260C>T (p=0.052), and the TLR1 promoter -7202A>G (p=0.062) polymorphisms. However, no association between gene polymorphisms and bacterial vaginosis as such could be documented. Our data suggest that some degree of genetic susceptibility involving pathogen recognition may occur with the key bacterial vaginosis organism, A. vaginae. PMID:19200604

  7. Prolonged survival in pancreatic cancer patients with increased regucalcin gene expression: Overexpression of regucalcin suppresses the proliferation in human pancreatic cancer MIA PaCa-2 cells in vitro.

    PubMed

    Yamaguchi, Masayoshi; Osuka, Satoru; Weitzmann, M Neale; El-Rayes, Bassel F; Shoji, Mamoru; Murata, Tomiyasu

    2016-05-01

    Approximately 90% of all pancreatic cancers are pancreatic ductal adenocarcinomas (PDAC). PDAC is a highly aggressive malignancy and is one of the deadliest. This poor clinical outcome is due to the prominent resistance of pancreatic cancer to drug and radiation therapies. Regucalcin plays a pivotal role as a suppressor protein in signal transduction in various types of cells including tumor tissues. We demonstrated that the prolonged survival is induced in PDAC patients with increased regucalcin gene expression using a dataset of PDAC obtained from GEO database (GSE17891) together with the clinical annotation data file. Moreover, overexpression of regucalcin with full length was demonstrated to suppress the proliferation, cell death and migration in human pancreatic cancer MIA PaCa-2 (K-ras mutated) cells that possess resistance to drug and radiation therapies. Suppressive effects of regucalcin on cell proliferation and death were not seen in the cells overexpressed with regucalcin cDNA alternatively spliced variants (deleted exon 4 or deleted exon 4 and 5). Regucalcin was suggested to induce G1 and G2/M phase cell cycle arrest in MIA PaCa-2 cells. Suppressive effects of regucalcin on cell proliferation were independent of cell death. Overexpression of regucalcin was found to suppress signaling pathways including Akt, MAP kinase and SAPK/JNK, to increase the protein levels of p53, a tumor suppresser, and to decrease K-ras, c-fos and c-jun, a oncogene, by suppressing signaling pathways that are related to signaling of K-ras. Regucalcin may play a potential role as a suppressor protein in human pancreatic cancer. PMID:26935290

  8. Identification of EpCAM as the Gene for Congenital Tufting Enteropathy

    PubMed Central

    Sivagnanam, Mamata; Mueller, James L.; Lee, Hane; Chen, Zugen; Nelson, Stanley F.; Turner, Dan; Zlotkin, Stanley H.; Pencharz, Paul B.; Ngan, Bo-Yee; Libiger, Ondrej; Schork, Nicholas J.; Lavine, Joel E.; Taylor, Sharon; Newbury, Robert O.; Kolodner, Richard D.; Hoffman, Hal M.

    2008-01-01

    Background and Aims Congenital Tufting Enteropathy (CTE) is a rare autosomal recessive diarrheal disorder presenting in the neonatal period. CTE is characterized by intestinal epithelial cell dysplasia leading to severe malabsorption and significant morbidity and mortality. The pathogenesis and genetics of this disorder are not well understood. The objective of this study was to identify the gene responsible for CTE. Methods A family with 2 children affected with CTE was identified. The affected children are double second cousins providing significant statistical power for linkage. Using Affymetrix 50K Single Nucleotide Polymorphism (SNP) chips, genotyping was performed on only two patients and one unaffected sibling. Direct DNA sequencing of candidate genes, RT-PCR, immunohistochemistry, and Western blotting were performed on specimens from patients and controls. Results SNP homozygosity mapping identified a unique 6.5 MB haplotype of homozygous SNPs on chromosome 2p21 where approximately 40 genes are located. Direct sequencing of genes in this region revealed homozygous G > A substitution at the donor splice site of exon 4 in Epithelial Cell Adhesion Molecule (EpCAM) of affected patients. RT-PCR of duodenal tissue demonstrated a novel alternative splice form with deletion of exon 4 in affected patients. Immuno-histochemistry and Western blot of patient intestinal tissue revealed decreased expression of EpCAM. Direct sequencing of EpCAM from two additional unrelated patients revealed novel mutations in the gene. Conclusions Mutations in the gene for EpCAM are responsible for Congenital Tufting Enteropathy. This information will be used to gain further insight into the molecular mechanisms of this disease. PMID:18572020

  9. Resequencing Reveals Different Domestication Rate for BADH1 and BADH2 in Rice (Oryza sativa)

    PubMed Central

    He, Qiang; Yu, Jie; Kim, Tae-Sung; Cho, Yoo-Hyun; Lee, Young-Sang; Park, Yong-Jin

    2015-01-01

    BADH1 and BADH2 are two homologous genes, encoding betaine aldehyde dehydrogenase in rice. In the present study, we scanned BADHs sequences of 295 rice cultivars, and 10 wild rice accessions to determine the polymorphisms, gene functions and domestication of these two genes. A total of 16 alleles for BADH1 and 10 alleles for BADH2 were detected in transcribed region of cultivars and wild species. Association study showed that BADH1 has significant correlation with salt tolerance in rice during germination stage, the SNP (T/A) in exon 4 is highly correlated with salt tolerance index (STI) (P<10−4). While, BADH2 was only responsible for rice fragrance, of which two BADH2 alleles (8 bp deletion in exon 7 and C/T SNP in exon 13) explain 97% of aroma variation in our germplasm. Theses indicate that there are no overlapping functions between the two homologous genes. In addition, a large LD block was detected in BADH2 region, however, there was no large LD blocks in a 4-Mb region of BADH1. We found that BADH2 region only showed significant bias in Tajima’s D value from the balance. Extended haplotype homozygosity study revealed fragrant accessions had a large LD block that extended around the mutation site (8 bp deletion in exon 7) of BADH2, while both of the BADH1 alleles (T/A in exon 4) did not show large extended LD block. All these results suggested that BADH2 was domesticated during rice evolution, while BADH1 was not selected by human beings. PMID:26258482

  10. Resequencing Reveals Different Domestication Rate for BADH1 and BADH2 in Rice (Oryza sativa).

    PubMed

    He, Qiang; Yu, Jie; Kim, Tae-Sung; Cho, Yoo-Hyun; Lee, Young-Sang; Park, Yong-Jin

    2015-01-01

    BADH1 and BADH2 are two homologous genes, encoding betaine aldehyde dehydrogenase in rice. In the present study, we scanned BADHs sequences of 295 rice cultivars, and 10 wild rice accessions to determine the polymorphisms, gene functions and domestication of these two genes. A total of 16 alleles for BADH1 and 10 alleles for BADH2 were detected in transcribed region of cultivars and wild species. Association study showed that BADH1 has significant correlation with salt tolerance in rice during germination stage, the SNP (T/A) in exon 4 is highly correlated with salt tolerance index (STI) (P<10(-4)). While, BADH2 was only responsible for rice fragrance, of which two BADH2 alleles (8 bp deletion in exon 7 and C/T SNP in exon 13) explain 97% of aroma variation in our germplasm. Theses indicate that there are no overlapping functions between the two homologous genes. In addition, a large LD block was detected in BADH2 region, however, there was no large LD blocks in a 4-Mb region of BADH1. We found that BADH2 region only showed significant bias in Tajima's D value from the balance. Extended haplotype homozygosity study revealed fragrant accessions had a large LD block that extended around the mutation site (8 bp deletion in exon 7) of BADH2, while both of the BADH1 alleles (T/A in exon 4) did not show large extended LD block. All these results suggested that BADH2 was domesticated during rice evolution, while BADH1 was not selected by human beings. PMID:26258482

  11. Altered splicing of ATP6AP2 causes X-linked parkinsonism with spasticity (XPDS)

    PubMed Central

    Korvatska, Olena; Strand, Nicholas S.; Berndt, Jason D.; Strovas, Tim; Chen, Dong-Hui; Leverenz, James B.; Kiianitsa, Konstantin; Mata, Ignacio F.; Karakoc, Emre; Greenup, J. Lynne; Bonkowski, Emily; Chuang, Joseph; Moon, Randall T.; Eichler, Evan E.; Nickerson, Deborah A.; Zabetian, Cyrus P.; Kraemer, Brian C.; Bird, Thomas D.; Raskind, Wendy H.

    2013-01-01

    We report a novel gene for a parkinsonian disorder. X-linked parkinsonism with spasticity (XPDS) presents either as typical adult onset Parkinson's disease or earlier onset spasticity followed by parkinsonism. We previously mapped the XPDS gene to a 28 Mb region on Xp11.2–X13.3. Exome sequencing of one affected individual identified five rare variants in this region, of which none was missense, nonsense or frame shift. Using patient-derived cells, we tested the effect of these variants on expression/splicing of the relevant genes. A synonymous variant in ATP6AP2, c.345C>T (p.S115S), markedly increased exon 4 skipping, resulting in the overexpression of a minor splice isoform that produces a protein with internal deletion of 32 amino acids in up to 50% of the total pool, with concomitant reduction of isoforms containing exon 4. ATP6AP2 is an essential accessory component of the vacuolar ATPase required for lysosomal degradative functions and autophagy, a pathway frequently affected in Parkinson's disease. Reduction of the full-size ATP6AP2 transcript in XPDS cells and decreased level of ATP6AP2 protein in XPDS brain may compromise V-ATPase function, as seen with siRNA knockdown in HEK293 cells, and may ultimately be responsible for the pathology. Another synonymous mutation in the same exon, c.321C>T (p.D107D), has a similar molecular defect of exon inclusion and causes X-linked mental retardation Hedera type (MRXSH). Mutations in XPDS and MRXSH alter binding sites for different splicing factors, which may explain the marked differences in age of onset and manifestations. PMID:23595882

  12. Altered splicing of ATP6AP2 causes X-linked parkinsonism with spasticity (XPDS).

    PubMed

    Korvatska, Olena; Strand, Nicholas S; Berndt, Jason D; Strovas, Tim; Chen, Dong-Hui; Leverenz, James B; Kiianitsa, Konstantin; Mata, Ignacio F; Karakoc, Emre; Greenup, J Lynne; Bonkowski, Emily; Chuang, Joseph; Moon, Randall T; Eichler, Evan E; Nickerson, Deborah A; Zabetian, Cyrus P; Kraemer, Brian C; Bird, Thomas D; Raskind, Wendy H

    2013-08-15

    We report a novel gene for a parkinsonian disorder. X-linked parkinsonism with spasticity (XPDS) presents either as typical adult onset Parkinson's disease or earlier onset spasticity followed by parkinsonism. We previously mapped the XPDS gene to a 28 Mb region on Xp11.2-X13.3. Exome sequencing of one affected individual identified five rare variants in this region, of which none was missense, nonsense or frame shift. Using patient-derived cells, we tested the effect of these variants on expression/splicing of the relevant genes. A synonymous variant in ATP6AP2, c.345C>T (p.S115S), markedly increased exon 4 skipping, resulting in the overexpression of a minor splice isoform that produces a protein with internal deletion of 32 amino acids in up to 50% of the total pool, with concomitant reduction of isoforms containing exon 4. ATP6AP2 is an essential accessory component of the vacuolar ATPase required for lysosomal degradative functions and autophagy, a pathway frequently affected in Parkinson's disease. Reduction of the full-size ATP6AP2 transcript in XPDS cells and decreased level of ATP6AP2 protein in XPDS brain may compromise V-ATPase function, as seen with siRNA knockdown in HEK293 cells, and may ultimately be responsible for the pathology. Another synonymous mutation in the same exon, c.321C>T (p.D107D), has a similar molecular defect of exon inclusion and causes X-linked mental retardation Hedera type (MRXSH). Mutations in XPDS and MRXSH alter binding sites for different splicing factors, which may explain the marked differences in age of onset and manifestations. PMID:23595882

  13. TP53 PIN3 and PEX4 polymorphisms and infertility associated with endometriosis or with post-in vitro fertilization implantation failure

    PubMed Central

    Paskulin, D D; Cunha-Filho, J S L; Souza, C A B; Bortolini, M C; Hainaut, P; Ashton-Prolla, P

    2012-01-01

    p53 has a crucial role in human fertility by regulating the expression of leukemia inhibitory factor (LIF), a secreted cytokine critical for blastocyst implantation. To examine whether TP53 polymorphisms may be involved with in vitro fertilization (IVF) failure and endometriosis (END), we have assessed the associations between TP53 polymorphism in intron 2 (PIN2; G/C, intron 2), PIN3 (one (N, non-duplicated) or two (D, duplicated) repeats of a 16-bp motif, intron 3) and polymorphism in exon 4 (PEX4; C/G, p.P72R, exon 4) in 98 women with END and 115 women with post-IVF failure. In addition, 134 fertile women and 300 women unselected with respect to fertility-related features were assessed. TP53 polymorphisms and haplotypes were identified by amplification refractory mutation system polymerase chain reaction. TP53 PIN3 and PEX4 were associated with both END (P=0.042 and P=0.007, respectively) and IVF (P=0.004 and P=0.009, respectively) when compared with women both selected and unselected for fertility-related features. Haplotypes D-C and N-C were related to higher risk for END (P=0.002, P=0.001, respectively) and failure of IVF (P=0.018 and P=0.002, respectively) when compared with the Fertile group. These results support that specific TP53 haplotypes are associated with an increased risk of END-associated infertility and with post-IVF failure. PMID:23013791

  14. TP53 PIN3 and PEX4 polymorphisms and infertility associated with endometriosis or with post-in vitro fertilization implantation failure.

    PubMed

    Paskulin, D D; Cunha-Filho, J S L; Souza, C A B; Bortolini, M C; Hainaut, P; Ashton-Prolla, P

    2012-01-01

    p53 has a crucial role in human fertility by regulating the expression of leukemia inhibitory factor (LIF), a secreted cytokine critical for blastocyst implantation. To examine whether TP53 polymorphisms may be involved with in vitro fertilization (IVF) failure and endometriosis (END), we have assessed the associations between TP53 polymorphism in intron 2 (PIN2; G/C, intron 2), PIN3 (one (N, non-duplicated) or two (D, duplicated) repeats of a 16-bp motif, intron 3) and polymorphism in exon 4 (PEX4; C/G, p.P72R, exon 4) in 98 women with END and 115 women with post-IVF failure. In addition, 134 fertile women and 300 women unselected with respect to fertility-related features were assessed. TP53 polymorphisms and haplotypes were identified by amplification refractory mutation system polymerase chain reaction. TP53 PIN3 and PEX4 were associated with both END (P=0.042 and P=0.007, respectively) and IVF (P=0.004 and P=0.009, respectively) when compared with women both selected and unselected for fertility-related features. Haplotypes D-C and N-C were related to higher risk for END (P=0.002, P=0.001, respectively) and failure of IVF (P=0.018 and P=0.002, respectively) when compared with the Fertile group. These results support that specific TP53 haplotypes are associated with an increased risk of END-associated infertility and with post-IVF failure. PMID:23013791

  15. CRISPR/Cas9-Mediated Genome Editing of Herpesviruses Limits Productive and Latent Infections

    PubMed Central

    van Diemen, Ferdy R.; Bruggeling, Carlijn E.; Schürch, Anita C.; van Ham, Petra M.; Imhof, Saskia M.; Nijhuis, Monique; Wiertz, Emmanuel J. H. J.; Lebbink, Robert Jan

    2016-01-01