Science.gov

Sample records for helix-loop-helix protein-mediated transcriptional

  1. A Classification of Basic Helix-Loop-Helix Transcription Factors of Soybean

    PubMed Central

    Hudson, Karen A.; Hudson, Matthew E.

    2015-01-01

    The complete genome sequence of soybean allows an unprecedented opportunity for the discovery of the genes controlling important traits. In particular, the potential functions of regulatory genes are a priority for analysis. The basic helix-loop-helix (bHLH) family of transcription factors is known to be involved in controlling a wide range of systems critical for crop adaptation and quality, including photosynthesis, light signalling, pigment biosynthesis, and seed pod development. Using a hidden Markov model search algorithm, 319 genes with basic helix-loop-helix transcription factor domains were identified within the soybean genome sequence. These were classified with respect to their predicted DNA binding potential, intron/exon structure, and the phylogeny of the bHLH domain. Evidence is presented that the vast majority (281) of these 319 soybean bHLH genes are expressed at the mRNA level. Of these soybean bHLH genes, 67% were found to exist in two or more homeologous copies. This dataset provides a framework for future studies on bHLH gene function in soybean. The challenge for future research remains to define functions for the bHLH factors encoded in the soybean genome, which may allow greater flexibility for genetic selection of growth and environmental adaptation in this widely grown crop. PMID:25763382

  2. Basic helix-loop-helix transcription factors and epidermal cell fate determination in Arabidopsis

    PubMed Central

    Zhao, Hongtao; Li, Xia; Ma, Ligeng

    2012-01-01

    Cell fate determination is an important process in multicellular organisms. Plant epidermis is a readily-accessible, well-used model for the study of cell fate determination. Our knowledge of cell fate determination is growing steadily due to genetic and molecular analyses of root hairs, trichomes, and stomata, which are derived from the epidermal cells of roots and aerial tissues. Studies have shown that a large number of factors are involved in the establishment of these cell types, especially members of the basic helix-loop-helix (bHLH) superfamily, which is an important family of transcription factors. In this mini-review, we focus on the role of bHLH transcription factors in cell fate determination in Arabidopsis. PMID:23073001

  3. The Basic Helix-Loop-Helix Transcription Factor PIF5 Acts on Ethylene Biosynthesis and Phytochrome Signaling by Distinct Mechanisms

    Technology Transfer Automated Retrieval System (TEKTRAN)

    HYTOCHROME-INTERACTING FACTOR5 (PIF5), a basic helix-loop-helix transcription factor, interacts specifically with the photoactivated form of phytochrome B (phyB). Here, we report that dark-grown Arabidopsis thaliana seedlings overexpressing PIF5 (PIF5-OX) exhibit exaggerated apical hooks and short h...

  4. Helix-loop-helix transcription factors mediate activation and repression of the p75LNGFR gene.

    PubMed Central

    Chiaramello, A; Neuman, K; Palm, K; Metsis, M; Neuman, T

    1995-01-01

    Sequence analysis of rat and human low-affinity nerve growth factor receptor p75LNGFR gene promoter regions revealed a single E-box cis-acting element, located upstream of the major transcription start sites. Deletion analysis of the E-box sequence demonstrated that it significantly contributes to p75LNGFR promoter activity. This E box has a dual function; it mediates either activation or repression of the p75LNGFR promoter activity, depending on the interacting transcription factors. We showed that the two isoforms of the class A basic helix-loop-helix (bHLH) transcription factor ME1 (ME1a and ME1b), the murine homolog of the human HEB transcription factor, specifically repress p75LNGFR promoter activity. This repression can be released by coexpression of the HLH Id2 transcriptional regulator. In vitro analyses demonstrated that ME1a forms a stable complex with the p75LNGFR E box and likely competes with activating E-box-binding proteins. By using ME1a-overexpressing PC12 cells, we showed that the endogenous p75LNGFR gene is a target of ME1a repression. Together, these data demonstrate that the p75LNGFR E box and the interacting bHLH transcription factors are involved in the regulation of p75LNGFR gene expression. These results also show that class A bHLH transcription factors can repress and Id-like negative regulators can stimulate gene expression. PMID:7565756

  5. The basic helix-loop-helix transcription factor, Mist1, induces maturation of mouse fetal hepatoblasts.

    PubMed

    Chikada, Hiromi; Ito, Keiichi; Yanagida, Ayaka; Nakauchi, Hiromitsu; Kamiya, Akihide

    2015-01-01

    Hepatic stem/progenitor cells, hepatoblasts, have a high proliferative ability and can differentiate into mature hepatocytes and cholangiocytes. Therefore, these cells are considered to be useful for regenerative medicine and drug screening for liver diseases. However, it is problem that in vitro maturation of hepatoblasts is insufficient in the present culture system. In this study, a novel regulator to induce hepatic differentiation was identified and the molecular function of this factor was examined in embryonic day 13 hepatoblast culture with maturation factor, oncostatin M and extracellular matrices. Overexpression of the basic helix-loop-helix type transcription factor, Mist1, induced expression of mature hepatocytic markers such as carbamoyl-phosphate synthetase1 and several cytochrome P450 (CYP) genes in this culture system. In contrast, Mist1 suppressed expression of cholangiocytic markers such as Sox9, Sox17, Ck19, and Grhl2. CYP3A metabolic activity was significantly induced by Mist1 in this hepatoblast culture. In addition, Mist1 induced liver-enriched transcription factors, CCAAT/enhancer-binding protein α and Hepatocyte nuclear factor 1α, which are known to be involved in liver functions. These results suggest that Mist1 partially induces mature hepatocytic expression and function accompanied by the down-regulation of cholangiocytic markers. PMID:26456005

  6. The basic helix-loop-helix transcription factor, Mist1, induces maturation of mouse fetal hepatoblasts

    PubMed Central

    Chikada, Hiromi; Ito, Keiichi; Yanagida, Ayaka; Nakauchi, Hiromitsu; Kamiya, Akihide

    2015-01-01

    Hepatic stem/progenitor cells, hepatoblasts, have a high proliferative ability and can differentiate into mature hepatocytes and cholangiocytes. Therefore, these cells are considered to be useful for regenerative medicine and drug screening for liver diseases. However, it is problem that in vitro maturation of hepatoblasts is insufficient in the present culture system. In this study, a novel regulator to induce hepatic differentiation was identified and the molecular function of this factor was examined in embryonic day 13 hepatoblast culture with maturation factor, oncostatin M and extracellular matrices. Overexpression of the basic helix-loop-helix type transcription factor, Mist1, induced expression of mature hepatocytic markers such as carbamoyl-phosphate synthetase1 and several cytochrome P450 (CYP) genes in this culture system. In contrast, Mist1 suppressed expression of cholangiocytic markers such as Sox9, Sox17, Ck19, and Grhl2. CYP3A metabolic activity was significantly induced by Mist1 in this hepatoblast culture. In addition, Mist1 induced liver-enriched transcription factors, CCAAT/enhancer-binding protein α and Hepatocyte nuclear factor 1α, which are known to be involved in liver functions. These results suggest that Mist1 partially induces mature hepatocytic expression and function accompanied by the down-regulation of cholangiocytic markers. PMID:26456005

  7. Regulatory module network of basic/helix-loop-helix transcription factors in mouse brain

    PubMed Central

    Li, Jing; Liu, Zijing J; Pan, Yuchun C; Liu, Qi; Fu, Xing; Cooper, Nigel GF; Li, Yixue; Qiu, Mengsheng; Shi, Tieliu

    2007-01-01

    Background The basic/helix-loop-helix (bHLH) proteins are important components of the transcriptional regulatory network, controlling a variety of biological processes, especially the development of the central nervous system. Until now, reports describing the regulatory network of the bHLH transcription factor (TF) family have been scarce. In order to understand the regulatory mechanisms of bHLH TFs in mouse brain, we inferred their regulatory network from genome-wide gene expression profiles with the module networks method. Results A regulatory network comprising 15 important bHLH TFs and 153 target genes was constructed. The network was divided into 28 modules based on expression profiles. A regulatory-motif search shows the complexity and diversity of the network. In addition, 26 cooperative bHLH TF pairs were also detected in the network. This cooperation suggests possible physical interactions or genetic regulation between TFs. Interestingly, some TFs in the network regulate more than one module. A novel cross-repression between Neurod6 and Hey2 was identified, which may control various functions in different brain regions. The presence of TF binding sites (TFBSs) in the promoter regions of their target genes validates more than 70% of TF-target gene pairs of the network. Literature mining provides additional support for five modules. More importantly, the regulatory relationships among selected key components are all validated in mutant mice. Conclusion Our network is reliable and very informative for understanding the role of bHLH TFs in mouse brain development and function. It provides a framework for future experimental analyses. PMID:18021424

  8. Phylogenetic analyses of vector mosquito basic helix-loop-helix transcription factors.

    PubMed

    Zhang, D B; Wang, Y; Liu, A K; Wang, X H; Dang, C W; Yao, Q; Chen, K P

    2013-10-01

    Basic helix-loop-helix (bHLH) transcription factors play critical roles in the regulation of a wide range of developmental processes in higher organisms and have been identified in more than 20 organisms. Mosquitoes are important vectors of certain human diseases. In this study, Aedes aegypti, Anopheles gambiae str. PEST and Culex quinquefasciatus genomes were found to encode 55, 55 and 57 bHLH genes, respectively. Further phylogenetic analyses and OrthoDB and Kyoto encyclopedia of genes and genomes orthology database searches led us to define orthology for all the identified mosquito bHLHs successfully. This provides useful information with which to update annotations to 40 Ae. aegypti, 55 An. gambiae and 38 C. quinquefasciatus bHLH genes in VectorBase. The mosquito lineage has more bHLH genes in the Atonal, neurogenin (Ngn) and Hes-related with YRPW motif (Hey) families than do other insect species, suggesting that mosquitoes have evolved to be more sensitive to vibration, light and chemicals. Mosquito bHLH genes generally have higher evolutionary rates than other insect species. However, no pervasive positive selection occurred in the evolution of insect bHLH genes. Only episodic positive selection was found to affect evolution of bHLH genes in 11 families. Besides, coding regions of several Ae. aegypti bHLH motifs have unusually long introns in which multiple copies of transposable elements have been identified. These data provide a solid basis for further studies on structures and functions of bHLH proteins in the regulation of mosquito development and for prevention and control of mosquito-mediated human diseases. PMID:23906262

  9. Basic helix-loop-helix transcription factor gene family phylogenetics and nomenclature.

    PubMed

    Skinner, Michael K; Rawls, Alan; Wilson-Rawls, Jeanne; Roalson, Eric H

    2010-07-01

    A phylogenetic analysis of the basic helix-loop-helix (bHLH) gene superfamily was performed using seven different species (human, mouse, rat, worm, fly, yeast, and plant Arabidopsis) and involving over 600 bHLH genes (Stevens et al., 2008). All bHLH genes were identified in the genomes of the various species, including expressed sequence tags, and the entire coding sequence was used in the analysis. Nearly 15% of the gene family has been updated or added since the original publication. A super-tree involving six clades and all structural relationships was established and is now presented for four of the species. The wealth of functional data available for members of the bHLH gene superfamily provides us with the opportunity to use this exhaustive phylogenetic tree to predict potential functions of uncharacterized members of the family. This phylogenetic and genomic analysis of the bHLH gene family has revealed unique elements of the evolution and functional relationships of the different genes in the bHLH gene family. PMID:20219281

  10. A basic helix-loop-helix transcription factor, PhFBH4, regulates flower senescence by modulating ethylene biosynthesis pathway in petunia

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The basic helix-loop-helix (bHLH) transcription factors (TFs) play important roles in regulating multiple biological processes in plants. However, there are few reports about the function of bHLHs in flower senescence. In this study, a bHLH TF, PhFBH4, was found to be dramatically upregulated during...

  11. Genome-wide features of neuroendocrine regulation in Drosophila by the basic helix-loop-helix transcription factor DIMMED

    PubMed Central

    Hadžić, Tarik; Park, Dongkook; Abruzzi, Katharine C.; Yang, Lin; Trigg, Jennifer S.; Rohs, Remo; Rosbash, Michael; Taghert, Paul H.

    2015-01-01

    Neuroendocrine (NE) cells use large dense core vesicles (LDCVs) to traffic, process, store and secrete neuropeptide hormones through the regulated secretory pathway. The dimmed (DIMM) basic helix-loop-helix transcription factor of Drosophila controls the level of regulated secretory activity in NE cells. To pursue its mechanisms, we have performed two independent genome-wide analyses of DIMM's activities: (i) in vivo chromatin immunoprecipitation (ChIP) to define genomic sites of DIMM occupancy and (ii) deep sequencing of purified DIMM neurons to characterize their transcriptional profile. By this combined approach, we showed that DIMM binds to conserved E-boxes in enhancers of 212 genes whose expression is enriched in DIMM-expressing NE cells. DIMM binds preferentially to certain E-boxes within first introns of specific gene isoforms. Statistical machine learning revealed that flanking regions of putative DIMM binding sites contribute to its DNA binding specificity. DIMM's transcriptional repertoire features at least 20 LDCV constituents. In addition, DIMM notably targets the pro-secretory transcription factor, creb-A, but significantly, DIMM does not target any neuropeptide genes. DIMM therefore prescribes the scale of secretory activity in NE neurons, by a systematic control of both proximal and distal points in the regulated secretory pathway. PMID:25634895

  12. GLABRA2 Directly Suppresses Basic Helix-Loop-Helix Transcription Factor Genes with Diverse Functions in Root Hair Development

    PubMed Central

    Lin, Qing; Ohashi, Yohei; Kato, Mariko; Tsuge, Tomohiko; Gu, Hongya; Qu, Li-Jia; Aoyama, Takashi

    2015-01-01

    The Arabidopsis thaliana GLABRA2 (GL2) gene encodes a transcription factor involved in the cell differentiation of various epidermal tissues. During root hair pattern formation, GL2 suppresses root hair development in non-hair cells, acting as a node between the gene regulatory networks for cell fate determination and cell differentiation. Despite the importance of GL2 function, its molecular basis remains obscure because the GL2 target genes leading to the network for cell differentiation are unknown. We identified five basic helix-loop-helix (bHLH) transcription factor genes—ROOT HAIR DEFECTIVE6 (RHD6), RHD6-LIKE1 (RSL1), RSL2, LjRHL1-LIKE1 (LRL1), and LRL2—as GL2 direct targets using transcriptional and post-translational induction systems. Chromatin immunoprecipitation analysis confirmed GL2 binding to upstream regions of these genes in planta. Reporter gene analyses showed that these genes are expressed in various stages of root hair development and are suppressed by GL2 in non-hair cells. GL2 promoter-driven green fluorescent protein fusions of LRL1 and LRL2, but not those of the other bHLH proteins, conferred root hair development on non-hair cells. These results indicate that GL2 directly suppresses bHLH genes with diverse functions in root hair development. PMID:26486447

  13. The basic helix loop helix transcription factor Twist1 is a novel regulator of ATF4 in osteoblasts.

    PubMed

    Danciu, Theodora E; Li, Yan; Koh, Amy; Xiao, Guozhi; McCauley, Laurie K; Franceschi, Renny T

    2012-01-01

    Parathyroid hormone (PTH) is an essential regulator of endochondral bone formation and an important anabolic agent for the reversal of bone loss. PTH mediates its functions in part by regulating binding of the bone-related activating transcription factor 4 (ATF4) to the osteoblast-specific gene, osteocalcin. The basic helix-loop-helix (bHLH) factors Twist1 and Twist2 also regulate osteocalcin transcription in part through the interaction of the C-terminal "box" domain in these factors and Runx2. In this study, we discovered a novel function of PTH: its ability to dramatically decrease Twist1 transcription. Since ATF4 is a major regulator of the PTH response in osteoblasts, we assessed the mutual regulation between these factors and determined that Twist proteins and ATF4 physically interact in a manner that affects ATF4 DNA binding function. We mapped the interaction domain of Twist proteins to the C-terminal "box" domain and of ATF4, to the N-terminus. Furthermore, we demonstrate that Twist1 overexpression in osteoblasts attenuates ATF4 binding to the osteocalcin promoter in response to PTH. This study thus identifies Twist proteins as novel inhibitory binding partners of ATF4 and explores the functional significance of this interaction. PMID:21866569

  14. The basic helix loop helix transcription factor Twist1 is a novel regulator of ATF4 in osteoblasts

    PubMed Central

    Danciu, Theodora E.; Li, Yan; Koh, Amy; Xiao, Guozhi; McCauley, Laurie K.; Franceschi, Renny T.

    2011-01-01

    Parathyroid hormone (PTH) is an essential regulator of endochondral bone formation and an important anabolic agent for the reversal of bone loss. PTH mediates its functions in part by regulating binding of the bone-related activating transcription factor 4 (ATF4) to the osteoblast-specific gene, osteocalcin. The basic helix-loop-helix (bHLH) factors Twist1 and Twist2 also regulate osteocalcin transcription in part through the interaction of the C-terminal “box” domain in these factors and Runx2. In this study, we discovered a novel function of PTH: its ability to dramatically decrease Twist1 transcription. Since ATF4 is a major regulator of the PTH response in osteoblasts, we assessed the mutual regulation between these factors and determined that Twist proteins and ATF4 physically interact in a manner that affects ATF4 DNA binding function. We mapped the interaction domain of Twist proteins to the C-terminal “box” domain and of ATF4, to the N-terminus. Furthermore, we demonstrate that Twist1 overexpression in osteoblasts attenuates ATF4 binding to the osteocalcin promoter in response to PTH. This study thus identifies Twist proteins as novel inhibitory binding partners of ATF4 and explores the functional significance of this interaction. PMID:21866569

  15. Genome-Wide Analysis of Basic/Helix-Loop-Helix Transcription Factor Family in Rice and Arabidopsis1[W

    PubMed Central

    Li, Xiaoxing; Duan, Xuepeng; Jiang, Haixiong; Sun, Yujin; Tang, Yuanping; Yuan, Zheng; Guo, Jingkang; Liang, Wanqi; Chen, Liang; Yin, Jingyuan; Ma, Hong; Wang, Jian; Zhang, Dabing

    2006-01-01

    The basic/helix-loop-helix (bHLH) transcription factors and their homologs form a large family in plant and animal genomes. They are known to play important roles in the specification of tissue types in animals. On the other hand, few plant bHLH proteins have been studied functionally. Recent completion of whole genome sequences of model plants Arabidopsis (Arabidopsis thaliana) and rice (Oryza sativa) allows genome-wide analysis and comparison of the bHLH family in flowering plants. We have identified 167 bHLH genes in the rice genome, and their phylogenetic analysis indicates that they form well-supported clades, which are defined as subfamilies. In addition, sequence analysis of potential DNA-binding activity, the sequence motifs outside the bHLH domain, and the conservation of intron/exon structural patterns further support the evolutionary relationships among these proteins. The genome distribution of rice bHLH genes strongly supports the hypothesis that genome-wide and tandem duplication contributed to the expansion of the bHLH gene family, consistent with the birth-and-death theory of gene family evolution. Bioinformatics analysis suggests that rice bHLH proteins can potentially participate in a variety of combinatorial interactions, endowing them with the capacity to regulate a multitude of transcriptional programs. In addition, similar expression patterns suggest functional conservation between some rice bHLH genes and their close Arabidopsis homologs. PMID:16896230

  16. Phylogeny, Functional Annotation, and Protein Interaction Network Analyses of the Xenopus tropicalis Basic Helix-Loop-Helix Transcription Factors

    PubMed Central

    Chen, Deyu

    2013-01-01

    The previous survey identified 70 basic helix-loop-helix (bHLH) proteins, but it was proved to be incomplete, and the functional information and regulatory networks of frog bHLH transcription factors were not fully known. Therefore, we conducted an updated genome-wide survey in the Xenopus tropicalis genome project databases and identified 105 bHLH sequences. Among the retrieved 105 sequences, phylogenetic analyses revealed that 103 bHLH proteins belonged to 43 families or subfamilies with 46, 26, 11, 3, 15, and 4 members in the corresponding supergroups. Next, gene ontology (GO) enrichment analyses showed 65 significant GO annotations of biological processes and molecular functions and KEGG pathways counted in frequency. To explore the functional pathways, regulatory gene networks, and/or related gene groups coding for Xenopus tropicalis bHLH proteins, the identified bHLH genes were put into the databases KOBAS and STRING to get the signaling information of pathways and protein interaction networks according to available public databases and known protein interactions. From the genome annotation and pathway analysis using KOBAS, we identified 16 pathways in the Xenopus tropicalis genome. From the STRING interaction analysis, 68 hub proteins were identified, and many hub proteins created a tight network or a functional module within the protein families. PMID:24312906

  17. TCFL4: a gene at 17q21.1 encoding a putative basic helix-loop-helix leucine-zipper transcription factor.

    PubMed

    Bjerknes, M; Cheng, H

    1996-11-28

    TCFL4 (transcription factor like 4) is the HGMW-approved symbol for the gene of a widely expressed putative basic helix-loop-helix leucine-zipper (bHLH-zip) transcription factor which is located 3' to HSD17B1 (17-beta-hydroxysteroid dehydrogenase gene) at 17q21.1, centromeric to the BRCA1 (a gene implicated in familial breast cancer) locus. We report the human gene structure and the murine cDNA sequence of two variants, about 1.5 and 2.2 kb in size. The deduced protein is highly conserved between mouse and man. PMID:8973301

  18. Iron-Binding E3 Ligase Mediates Iron Response in Plants by Targeting Basic Helix-Loop-Helix Transcription Factors1[OPEN

    PubMed Central

    Selote, Devarshi; Samira, Rozalynne; Matthiadis, Anna; Gillikin, Jeffrey W.; Long, Terri A.

    2015-01-01

    Iron uptake and metabolism are tightly regulated in both plants and animals. In Arabidopsis (Arabidopsis thaliana), BRUTUS (BTS), which contains three hemerythrin (HHE) domains and a Really Interesting New Gene (RING) domain, interacts with basic helix-loop-helix transcription factors that are capable of forming heterodimers with POPEYE (PYE), a positive regulator of the iron deficiency response. BTS has been shown to have E3 ligase capacity and to play a role in root growth, rhizosphere acidification, and iron reductase activity in response to iron deprivation. To further characterize the function of this protein, we examined the expression pattern of recombinant ProBTS::β-GLUCURONIDASE and found that it is expressed in developing embryos and other reproductive tissues, corresponding with its apparent role in reproductive growth and development. Our findings also indicate that the interactions between BTS and PYE-like (PYEL) basic helix-loop-helix transcription factors occur within the nucleus and are dependent on the presence of the RING domain. We provide evidence that BTS facilitates 26S proteasome-mediated degradation of PYEL proteins in the absence of iron. We also determined that, upon binding iron at the HHE domains, BTS is destabilized and that this destabilization relies on specific residues within the HHE domains. This study reveals an important and unique mechanism for plant iron homeostasis whereby an E3 ubiquitin ligase may posttranslationally control components of the transcriptional regulatory network involved in the iron deficiency response. PMID:25452667

  19. Dynamic Antagonism between Phytochromes and PIF Family Basic Helix-Loop-Helix Factors Induces Selective Reciprocal Responses to Light and Shade in a Rapidly Responsive Transcriptional Network in Arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Plants respond to shade-modulated light signals via phytochrome (phy)-induced adaptive changes, termed shade avoidance. To examine the roles of Phytochrome-Interacting basic helix-loop-helix Factors, PIF1, 3, 4, and 5, in relaying such signals to the transcriptional network, we compared the shade-re...

  20. MicroRNA-212 Post-Transcriptionally Regulates Oocyte-Specific Basic-Helix-Loop-Helix Transcription Factor, Factor in the Germline Alpha (FIGLA), during Bovine Early Embryogenesis

    PubMed Central

    Tripurani, Swamy K.; Wee, Gabbine; Lee, Kyung-Bon; Smith, George W.; Wang, Lei; JianboYao

    2013-01-01

    Factor in the germline alpha (FIGLA) is an oocyte-specific basic helix-loop-helix transcription factor essential for primordial follicle formation and expression of many genes required for folliculogenesis, fertilization and early embryonic survival. Here we report the characterization of bovine FIGLA gene and its regulation during early embryogenesis. Bovine FIGLA mRNA expression is restricted to gonads and is detected in fetal ovaries harvested as early as 90 days of gestation. FIGLA mRNA and protein are abundant in germinal vesicle and metaphase II stage oocytes, as well as in embryos from pronuclear to eight-cell stage but barely detectable at morula and blastocyst stages, suggesting that FIGLA might be a maternal effect gene. Recent studies in zebrafish and mice have highlighted the importance of non-coding small RNAs (microRNAs) as key regulatory molecules targeting maternal mRNAs for degradation during embryonic development. We hypothesized that FIGLA, as a maternal transcript, is regulated by microRNAs during early embryogenesis. Computational predictions identified a potential microRNA recognition element (MRE) for miR-212 in the 3’ UTR of the bovine FIGLA mRNA. Bovine miR-212 is expressed in oocytes and tends to increase in four-cell and eight-cell stage embryos followed by a decline at morula and blastocyst stages. Transient transfection and reporter assays revealed that miR-212 represses the expression of FIGLA in a MRE dependent manner. In addition, ectopic expression of miR-212 mimic in bovine early embryos dramatically reduced the expression of FIGLA protein. Collectively, our results demonstrate that FIGLA is temporally regulated during bovine early embryogenesis and miR-212 is an important negative regulator of FIGLA during the maternal to zygotic transition in bovine embryos. PMID:24086699

  1. The Basic Helix-Loop-Helix Transcription Factor E47 Reprograms Human Pancreatic Cancer Cells to a Quiescent Acinar State With Reduced Tumorigenic Potential

    PubMed Central

    Kim, SangWun; Lahmy, Reyhaneh; Riha, Chelsea; Yang, Challeng; Jakubison, Brad L.; van Niekerk, Jaco; Staub, Claudio; Wu, Yifan; Gates, Keith; Dong, Duc Si; Konieczny, Stephen F.; Itkin-Ansari, Pamela

    2015-01-01

    Objectives Pancreatic ductal adenocarcinoma (PDA) initiates from quiescent acinar cells that attain a Kras mutation, lose signaling from basic helix-loop-helix (bHLH) transcription factors, undergo acinar-ductal metaplasia, and rapidly acquire increased growth potential. We queried whether PDA cells can be reprogrammed to revert to their original quiescent acinar cell state by shifting key transcription programs. Methods Human PDA cell lines were engineered to express an inducible form of the bHLH protein E47. Gene expression, growth, and functional studies were investigated using microarray, quantitative polymerase chain reaction, immunoblots, immunohistochemistry, small interfering RNA, chromatin immunoprecipitation analyses, and cell transplantation into mice. Results In human PDA cells, E47 activity triggers stable G0/G1 arrest, which requires the cyclin-dependent kinase inhibitor p21 and the stress response protein TP53INP1. Concurrently, E47 induces high level expression of acinar digestive enzymes and feed forward activation of the acinar maturation network regulated by the bHLH factor MIST1. Moreover, induction of E47 in human PDA cells in vitro is sufficient to inhibit tumorigenesis. Conclusions Human PDA cells retain a high degree of plasticity, which can be exploited to induce a quiescent acinar cell state with reduced tumorigenic potential. Moreover, bHLH activity is a critical node coordinately regulating human PDA cell growth versus cell fate. PMID:25894862

  2. Basic helix-loop-helix transcription factor from wild rice (OrbHLH2) improves tolerance to salt- and osmotic stress in Arabidopsis.

    PubMed

    Zhou, Jing; Li, Fei; Wang, Jin-Lan; Ma, Yun; Chong, Kang; Xu, Yun-yuan

    2009-08-15

    Salt stress adversely affects plant growth and development. Some plants reduce the damage of high-salt stress by expressing a series of salt-responsive genes. Studies of the molecular mechanism of the salt-stress response have focused on the characterization of components involved in signal perception and transduction. In the present work, we cloned and characterized a basic helix-loop-helix (bHLH) encoding gene, OrbHLH2, from wild rice (Oryza rufipogon), which encodes a homologue protein of ICE1 in Arabidopsis. OrbHLH2 protein localized in the nucleus. Overexpression of OrbHLH2 in Arabidopsis conferred increased tolerance to salt and osmotic stress, and the stress-responsive genes DREB1A/CBF3, RD29A, COR15A and KIN1 were upregulated in transgenic plants. Abscisic acid (ABA) treatment showed a similar effect on the seed germination or transcriptional expression of stress-responsive genes in both wild type and OrbHLH2-overexpressed plants, which implies that OrbHLH2 does not depend on ABA in responding to salt stress. OrbHLH2 may function as a transcription factor and positively regulate salt-stress signals independent of ABA in Arabidopsis, which provides some useful data for improving salt tolerance in crops. PMID:19324458

  3. Arabidopsis Basic Helix-Loop-Helix Transcription Factors MYC2, MYC3, and MYC4 Regulate Glucosinolate Biosynthesis, Insect Performance, and Feeding Behavior[W][OPEN

    PubMed Central

    Schweizer, Fabian; Fernández-Calvo, Patricia; Zander, Mark; Diez-Diaz, Monica; Fonseca, Sandra; Glauser, Gaétan; Lewsey, Mathew G.; Ecker, Joseph R.; Solano, Roberto; Reymond, Philippe

    2013-01-01

    Arabidopsis thaliana plants fend off insect attack by constitutive and inducible production of toxic metabolites, such as glucosinolates (GSs). A triple mutant lacking MYC2, MYC3, and MYC4, three basic helix-loop-helix transcription factors that are known to additively control jasmonate-related defense responses, was shown to have a highly reduced expression of GS biosynthesis genes. The myc2 myc3 myc4 (myc234) triple mutant was almost completely devoid of GS and was extremely susceptible to the generalist herbivore Spodoptera littoralis. On the contrary, the specialist Pieris brassicae was unaffected by the presence of GS and preferred to feed on wild-type plants. In addition, lack of GS in myc234 drastically modified S. littoralis feeding behavior. Surprisingly, the expression of MYB factors known to regulate GS biosynthesis genes was not altered in myc234, suggesting that MYC2/MYC3/MYC4 are necessary for direct transcriptional activation of GS biosynthesis genes. To support this, chromatin immunoprecipitation analysis showed that MYC2 binds directly to the promoter of several GS biosynthesis genes in vivo. Furthermore, yeast two-hybrid and pull-down experiments indicated that MYC2/MYC3/MYC4 interact directly with GS-related MYBs. This specific MYC–MYB interaction plays a crucial role in the regulation of defense secondary metabolite production and underlines the importance of GS in shaping plant interactions with adapted and nonadapted herbivores. PMID:23943862

  4. Identification and functional analysis of porcine basic helix-loop-helix transcriptional factor 3 (TCF3) and its alternative splicing isoforms.

    PubMed

    Yang, Fan; Wang, Ning; Liu, Yajun; Wang, Huayan

    2016-04-01

    The transcription factor 3 (TCF3) is a basic helix-loop-helix transcription factor and is essential for lymphocyte development and epithelial-mesenchymal transition. The splicing isoform, genomic organization and physiological roles of TCF3 have not been elucidated well in pig. Based on RNA-seq database, four alternative splicing isoforms were identified. Splicing isoforms TCF3(E12), TCF3(E47), and TCF3A expressed globally in porcine tissues, but TCF3B mainly expressed in spleen and endoderm derived tissues, such as pancreas and lung. The functional analysis showed that TCF3(E12), TCF3(E47), and TCF3B were translocated exclusively into nuclei, yet TCF3A was distributed in cytoplasm. The investigation of clinical specimens showed that TCF3 expression was significantly reduced in spleen tissues that were infected by classical swine fever virus (CSFV). This study is for the first time to report two novel splicing isoforms TCF3A and TCF3B, which may play an important role in lymphocyte maturation and have the correlation with CSFV evasion. PMID:27033898

  5. A Divalent Ion Is Crucial in the Structure and Dominant-Negative Function of ID Proteins, a Class of Helix-Loop-Helix Transcription Regulators

    PubMed Central

    Palasingam, Paaventhan; Kolatkar, Prasanna R.

    2012-01-01

    Inhibitors of DNA binding and differentiation (ID) proteins, a dominant-negative group of helix-loop-helix (HLH) transcription regulators, are well-characterized key players in cellular fate determination during development in mammals as well as Drosophila. Although not oncogenes themselves, their upregulation by various oncogenic proteins (such as Ras, Myc) and their inhibitory effects on cell cycle proteins (such as pRb) hint at their possible roles in tumorigenesis. Furthermore, their potency as inhibitors of cellular differentiation, through their heterodimerization with subsequent inactivation of the ubiquitous E proteins, suggest possible novel roles in engineering induced pluripotent stem cells (iPSCs). We present the high-resolution 2.1Å crystal structure of ID2 (HLH domain), coupled with novel biochemical insights in the presence of a divalent ion, possibly calcium (Ca2+), in the loop of ID proteins, which appear to be crucial for the structure and activity of ID proteins. These new insights will pave the way for new rational drug designs, in addition to current synthetic peptide options, against this potent player in tumorigenesis as well as more efficient ways for stem cells reprogramming. PMID:23119064

  6. A basic helix-loop-helix transcription factor, PhFBH4, regulates flower senescence by modulating ethylene biosynthesis pathway in petunia

    PubMed Central

    Yin, Jing; Chang, Xiaoxiao; Kasuga, Takao; Bui, Mai; Reid, Michael S; Jiang, Cai-Zhong

    2015-01-01

    The basic helix-loop-helix (bHLH) transcription factors (TFs) play important roles in regulating multiple biological processes in plants. However, there are few reports about the function of bHLHs in flower senescence. In this study, a bHLH TF, PhFBH4, was found to be dramatically upregulated during flower senescence. Transcription of PhFBH4 is induced by plant hormones and abiotic stress treatments. Silencing of PhFBH4 using virus-induced gene silencing or an antisense approach extended flower longevity, while transgenic petunia flowers with an overexpression construct showed a reduction in flower lifespan. Abundance of transcripts of senescence-related genes (SAG12, SAG29) was significantly changed in petunia PhFBH4 transgenic flowers. Furthermore, silencing or overexpression of PhFBH4 reduced or increased, respectively, transcript abundances of important ethylene biosynthesis-related genes, ACS1 and ACO1, thereby influencing ethylene production. An electrophoretic mobility shift assay showed that the PhFBH4 protein physically interacted with the G-box cis-element in the promoter of ACS1, suggesting that ACS1 was a direct target of the PhFBH4 protein. In addition, ectopic expression of this gene altered plant development including plant height, internode length, and size of leaves and flowers, accompanied by alteration of transcript abundance of the gibberellin biosynthesis-related gene GA2OX3. Our results indicate that PhFBH4 plays an important role in regulating plant growth and development through modulating the ethylene biosynthesis pathway. PMID:26715989

  7. The basic helix-loop-helix transcription factor HEBAlt is expressed in pro-T cells and enhances the generation of T cell precursors.

    PubMed

    Wang, Duncheng; Claus, Carol L; Vaccarelli, Giovanna; Braunstein, Marsela; Schmitt, Thomas M; Zúñiga-Pflücker, Juan Carlos; Rothenberg, Ellen V; Anderson, Michele K

    2006-07-01

    The basic helix-loop-helix (bHLH) transcription factors HEB and E2A are critical mediators of gene regulation during lymphocyte development. We have cloned a new transcription factor, called HEBAlt, from a pro-T cell cDNA library. HEBAlt is generated by alternative transcriptional initiation and splicing from the HEB gene locus, which also encodes the previously characterized E box protein HEBCan. HEBAlt contains a unique N-terminal coding exon (the Alt domain) that replaces the first transactivation domain of HEBCan. Downstream of the Alt domain, HEBAlt is identical to HEBCan, including the DNA binding domain. HEBAlt is induced in early thymocyte precursors and down-regulated permanently at the double negative to double positive (DP) transition, whereas HEBCan mRNA expression peaks at the DP stage of thymocyte development. HEBAlt mRNA is up-regulated synergistically by a combination of HEBCan activity and Delta-Notch signaling. Retroviral transduction of HEBAlt or HEBCan into hemopoietic stem cells followed by OP9-DL1 coculture revealed that HEBAlt-transduced precursors generated more early T lineage precursors and more DP pre-T cells than control transduced cells. By contrast, HEBCan-transduced cells that maintained high level expression of the HEBCan transgene were inhibited in expansion and progression through T cell development. HEB(-/-) fetal liver precursors transduced with HEBAlt were rescued from delayed T cell specification, but HEBCan-transduced HEB(-/-) precursors were not. Therefore, HEBAlt and HEBCan are functionally distinct transcription factors, and HEBAlt is specifically required for the efficient generation of early T cell precursors. PMID:16785505

  8. Basic helix-loop-helix transcription factor BcbHLHpol functions as a positive regulator of pollen development in non-heading Chinese cabbage.

    PubMed

    Liu, Tongkun; Li, Ying; Zhang, Changwei; Duan, Weike; Huang, Feiyi; Hou, Xilin

    2014-12-01

    Cytoplasmic male sterility (CMS) is a common trait in higher plants, and several transcription factors regulate pollen development. Previously, we obtained a basic helix-loop-helix transcription factor, BcbHLHpol, via suppression subtractive hybridization in non-heading Chinese cabbage. However, the regulatory function of BcbHLHpol during anther and pollen development remains unclear. In this study, BcbHLHpol was cloned, and its tissue-specific expression profile was analyzed. The results of real-time polymerase chain reaction showed that BcbHLHpol was highly expressed in maintainer buds and that the transcripts of BcbHLHpol significantly decreased in the buds of pol CMS. A virus-induced gene silencing vector that targets BcbHLHpol was constructed and transformed into Brassica campestris plants to further explore the function of BcbHLHpol. Male sterility and short stature were observed in BcbHLHpol-silenced plants. The degradation of tapetal cells was inhibited in BcbHLHpol-silenced plants, and nutrients were insufficiently supplied to the microspore. These phenomena resulted in pollen abortion. This result indicates that BcbHLHpol functions as a positive regulator in pollen development. Yeast two-hybrid and bimolecular fluorescence complementation assays revealed that BcbHLHpol interacted with BcSKP1 in the nucleus. This finding suggests that BcbHLHpol and BcSKP1 are positive coordinating regulators of pollen development. Quantitative real-time PCR indicated that BcbHLHpol and BcSKP1 can be induced at low temperatures. Thus, we propose that BcbHLHpol is necessary for meiosis. This study provides insights into the regulatory functions of the BcbHLHpol network during anther development. PMID:25147023

  9. The poplar basic helix-loop-helix transcription factor BEE3 – Like gene affects biomass production by enhancing proliferation of xylem cells in poplar

    SciTech Connect

    Noh, Seol Ah Choi, Young-Im Cho, Jin-Seong Lee, Hyoshin

    2015-06-19

    Brassinosteroids (BRs) play important roles in many aspects of plant growth and development, including regulation of vascular cambium activities and cell elongation. BR-induced BEE3 (brassinosteroid enhanced expression 3) is required for a proper BR response. Here, we identified a poplar (Populus alba × Populus glandulosa) BEE3-like gene, PagBEE3L, encoding a putative basic helix-loop-helix (bHLH)-type transcription factor. Expression of PagBEE3L was induced by brassinolide (BL). Transcripts of PagBEE3L were mainly detected in stems, with the internode having a low level of transcription and the node having a relatively higher level. The function of the PagBEE3L gene was investigated through phenotypic analyses with PagBEE3L-overexpressing (ox) transgenic lines. This work particularly focused on a potential role of PagBEE3L in stem growth and development of polar. The PagBEE3L-ox poplar showed thicker and longer stems than wild-type plants. The xylem cells from the stems of PagBEE3L-ox plants revealed remarkably enhanced proliferation, resulting in an earlier thickening growth than wild-type plants. Therefore, this work suggests that xylem development of poplar is accelerated in PagBEE3L-ox plants and PagBEE3L plays a role in stem growth by increasing the proliferation of xylem cells to promote the initial thickening growth of poplar stems. - Highlights: • We identify the BEE3-like gene form hybrid poplar (Populus alba × Populus glandulosa). • We examine effects of overexpression of PagBEE3L on growth in poplar. • We found that 35S:BEE3L transgenic plants showed more rapid growth than wild-type plants. • BEE3L protein plays an important role in the development of plant stem.

  10. The cold-induced basic helix-loop-helix transcription factor gene MdCIbHLH1 encodes an ICE-like protein in apple

    PubMed Central

    2012-01-01

    Background Plant growth is greatly affected by low temperatures, and the expression of a number of genes is induced by cold stress. Although many genes in the cold signaling pathway have been identified in Arabidopsis, little is known about the transcription factors involved in the cold stress response in apple. Results Here, we show that the apple bHLH (basic helix-loop-helix) gene MdCIbHLH1 (Cold-Induced bHLH1), which encodes an ICE-like protein, was noticeably induced in response to cold stress. The MdCIbHLH1 protein specifically bound to the MYC recognition sequences in the AtCBF3 promoter, and MdCIbHLH1 overexpression enhanced cold tolerance in transgenic Arabidopsis. In addition, the MdCIbHLH1 protein bound to the promoters of MdCBF2 and favorably contributed to cold tolerance in transgenic apple plants by upregulating the expression of MdCBF2 through the CBF (C-repeat-binding factor) pathway. Our findings indicate that MdCIbHLH1 functions in stress tolerance in different species. For example, ectopic MdCIbHLH1 expression conferred enhanced chilling tolerance in transgenic tobacco. Finally, we observed that cold induces the degradation of the MdCIbHLH1 protein in apple and that this degradation was potentially mediated by ubiquitination and sumoylation. Conclusions Based on these findings, MdCIbHLH1 encodes a transcription factor that is important for the cold tolerance response in apple. PMID:22336381

  11. A Novel Molecular Recognition Motif Necessary for Targeting Photoactivated Phytochrome Signaling to Specific Basic Helix-Loop-Helix Transcription FactorsW⃞

    PubMed Central

    Khanna, Rajnish; Huq, Enamul; Kikis, Elise A.; Al-Sady, Bassem; Lanzatella, Christina; Quail, Peter H.

    2004-01-01

    The phytochrome (phy) family of sensory photoreceptors (phyA to phyE) in Arabidopsis thaliana control plant developmental transitions in response to informational light signals throughout the life cycle. The photoactivated conformer of the photoreceptor Pfr has been shown to translocate into the nucleus where it induces changes in gene expression by an unknown mechanism. Here, we have identified two basic helix-loop-helix (bHLH) transcription factors, designated PHYTOCHROME-INTERACTING FACTOR5 (PIF5) and PIF6, which interact specifically with the Pfr form of phyB. These two factors cluster tightly with PIF3 and two other phy-interacting bHLH proteins in a phylogenetic subfamily within the large Arabidopsis bHLH (AtbHLH) family. We have identified a novel sequence motif (designated the active phytochrome binding [APB] motif) that is conserved in these phy-interacting AtbHLHs but not in other noninteractors. Using the isolated domain and site-directed mutagenesis, we have shown that this motif is both necessary and sufficient for binding to phyB. Transgenic expression of the native APB-containing AtbHLH protein, PIF4, in a pif4 null mutant, rescued the photoresponse defect in this mutant, whereas mutated PIF4 constructs with site-directed substitutions in conserved APB residues did not. These data indicate that the APB motif is necessary for PIF4 function in light-regulated seedling development and suggest that conformer-specific binding of phyB to PIF4 via the APB motif is necessary for this function in vivo. Binding assays with the isolated APB domain detected interaction with phyB, but none of the other four Arabidopsis phys. Collectively, the data suggest that the APB domain provides a phyB-specific recognition module within the AtbHLH family, thereby conferring photoreceptor target specificity on a subset of these transcription factors and, thus, the potential for selective signal channeling to segments of the transcriptional network. PMID:15486100

  12. Basic Helix-Loop-Helix Transcription Factors JASMONATE-ASSOCIATED MYC2-LIKE1 (JAM1), JAM2, and JAM3 Are Negative Regulators of Jasmonate Responses in Arabidopsis1[W][OPEN

    PubMed Central

    Sasaki-Sekimoto, Yuko; Jikumaru, Yusuke; Obayashi, Takeshi; Saito, Hikaru; Masuda, Shinji; Kamiya, Yuji; Ohta, Hiroyuki; Shirasu, Ken

    2013-01-01

    Jasmonates regulate transcriptional reprogramming during growth, development, and defense responses. Jasmonoyl-isoleucine, an amino acid conjugate of jasmonic acid (JA), is perceived by the protein complex composed of the F-box protein CORONATINE INSENSITIVE1 (COI1) and JASMONATE ZIM DOMAIN (JAZ) proteins, leading to the ubiquitin-dependent degradation of JAZ proteins. This activates basic helix-loop-helix-type MYC transcription factors to regulate JA-responsive genes. Here, we show that the expression of genes encoding other basic helix-loop-helix transcription factors, JASMONATE ASSOCIATED MYC2-LIKE1 (JAM1), JAM2, and JAM3, is positively regulated in a COI1- and MYC2-dependent manner in Arabidopsis (Arabidopsis thaliana). However, contrary to myc2, the jam1jam2jam3 triple mutant exhibited shorter roots when treated with methyl jasmonate (MJ), indicating enhanced responsiveness to JA. Our genome-wide expression analyses revealed that key jasmonate metabolic genes as well as a set of genes encoding transcription factors that regulate the JA-responsive metabolic genes are negatively regulated by JAMs after MJ treatment. Consistently, loss of JAM genes resulted in higher accumulation of anthocyanin in MJ-treated plants as well as higher accumulation of JA and 12-hydroxyjasmonic acid in wounded plants. These results show that JAMs negatively regulate the JA responses in a manner that is mostly antagonistic to MYC2. PMID:23852442

  13. The Rice Basic Helix-Loop-Helix Transcription Factor TDR INTERACTING PROTEIN2 Is a Central Switch in Early Anther Development[C][W

    PubMed Central

    Fu, Zhenzhen; Yu, Jing; Cheng, Xiaowei; Zong, Xu; Xu, Jie; Chen, Mingjiao; Li, Zongyun; Zhang, Dabing; Liang, Wanqi

    2014-01-01

    In male reproductive development in plants, meristemoid precursor cells possessing transient, stem cell–like features undergo cell divisions and differentiation to produce the anther, the male reproductive organ. The anther contains centrally positioned microsporocytes surrounded by four distinct layers of wall: the epidermis, endothecium, middle layer, and tapetum. Here, we report that the rice (Oryza sativa) basic helix-loop-helix (bHLH) protein TDR INTERACTING PROTEIN2 (TIP2) functions as a crucial switch in the meristemoid transition and differentiation during early anther development. The tip2 mutants display undifferentiated inner three anther wall layers and abort tapetal programmed cell death, causing complete male sterility. TIP2 has two paralogs in rice, TDR and EAT1, which are key regulators of tapetal programmed cell death. We revealed that TIP2 acts upstream of TDR and EAT1 and directly regulates the expression of TDR and EAT1. In addition, TIP2 can interact with TDR, indicating a role of TIP2 in later anther development. Our findings suggest that the bHLH proteins TIP2, TDR, and EAT1 play a central role in regulating differentiation, morphogenesis, and degradation of anther somatic cell layers, highlighting the role of paralogous bHLH proteins in regulating distinct steps of plant cell–type determination. PMID:24755456

  14. A Composite Element that Binds Basic Helix Loop Helix and Basic Leucine Zipper Transcription Factors Is Important for Gonadotropin-Releasing Hormone Regulation of the Follicle-Stimulating Hormone β Gene

    PubMed Central

    Ciccone, Nick A.; Lacza, Charlemagne T.; Hou, Melody Y.; Gregory, Susan J.; Kam, Kyung-Yoon; Xu, Shuyun; Kaiser, Ursula B.

    2008-01-01

    Although FSH plays an essential role in controlling gametogenesis, the biology of FSHβ transcription remains poorly understood, but is known to involve the complex interplay of multiple endocrine factors including GnRH. We have identified a GnRH-responsive element within the rat FSHβ promoter containing an E-box and partial cAMP response element site that are bound by the basic helix loop helix transcription factor family members, upstream stimulating factor (USF)-1/USF-2, and the basic leucine zipper member, cAMP response element-binding protein (CREB), respectively. Expression studies with CREB, USF-1/USF-2, and activating protein-1 demonstrated that the USF transcription factors increased basal transcription, an effect not observed if the cognate binding site was mutated. Conversely, expression of a dominant negative CREB mutant or CREB knockdown attenuated induction by GnRH, whereas dominant negative Fos or USF had no effect on the GnRH response. GnRH stimulation specifically induced an increase in phosphorylated CREB occupation of the FSHβ promoter, leading to the recruitment of CREB-binding protein to enhance gene transcription. In conclusion, a composite element bound by both USF and CREB serves to integrate signals for basal and GnRH-stimulated transcription of the rat FSHβ gene. PMID:18550775

  15. Basic Helix-Loop-Helix Transcription Factor Heterocomplex of Yas1p and Yas2p Regulates Cytochrome P450 Expression in Response to Alkanes in the Yeast Yarrowia lipolytica▿

    PubMed Central

    Endoh-Yamagami, Setsu; Hirakawa, Kiyoshi; Morioka, Daisuke; Fukuda, Ryouichi; Ohta, Akinori

    2007-01-01

    The expression of the ALK1 gene, which encodes cytochrome P450, catalyzing the first step of alkane oxidation in the alkane-assimilating yeast Yarrowia lipolytica, is highly regulated and can be induced by alkanes. Previously, we identified a cis-acting element (alkane-responsive element 1 [ARE1]) in the ALK1 promoter. We showed that a basic helix-loop-helix (bHLH) protein, Yas1p, binds to ARE1 in vivo and mediates alkane-dependent transcription induction. Yas1p, however, does not bind to ARE1 by itself in vitro, suggesting that Yas1p requires another bHLH protein partner for its DNA binding, as many bHLH transcription factors function by forming heterodimers. To identify such a binding partner of Yas1p, here we screened open reading frames encoding proteins with the bHLH motif from the Y. lipolytica genome database and identified the YAS2 gene. The deletion of the YAS2 gene abolished the alkane-responsive induction of ALK1 transcription and the growth of the yeast on alkanes. We revealed that Yas2p has transactivation activity. Furthermore, Yas1p and Yas2p formed a protein complex that was required for the binding of these proteins to ARE1. These findings allow us to postulate a model in which bHLH transcription factors Yas1p and Yas2p form a heterocomplex and mediate the transcription induction in response to alkanes. PMID:17322346

  16. The Basic Helix-Loop-Helix Transcription Factor MYC2 Directly Represses PLETHORA Expression during Jasmonate-Mediated Modulation of the Root Stem Cell Niche in Arabidopsis[W][OA

    PubMed Central

    Chen, Qian; Sun, Jiaqiang; Zhai, Qingzhe; Zhou, Wenkun; Qi, Linlin; Xu, Li; Wang, Bao; Chen, Rong; Jiang, Hongling; Qi, Jing; Li, Xugang; Palme, Klaus; Li, Chuanyou

    2011-01-01

    The root stem cell niche, which in the Arabidopsis thaliana root meristem is an area of four mitotically inactive quiescent cells (QCs) and the surrounding mitotically active stem cells, is critical for root development and growth. We report here that during jasmonate-induced inhibition of primary root growth, jasmonate reduces root meristem activity and leads to irregular QC division and columella stem cell differentiation. Consistently, jasmonate reduces the expression levels of the AP2-domain transcription factors PLETHORA1 (PLT1) and PLT2, which form a developmentally instructive protein gradient and mediate auxin-induced regulation of stem cell niche maintenance. Not surprisingly, the effects of jasmonate on root stem cell niche maintenance and PLT expression require the functioning of MYC2/JASMONATE INSENSITIVE1, a basic helix-loop-helix transcription factor that involves versatile aspects of jasmonate-regulated gene expression. Gel shift and chromatin immunoprecipitation experiments reveal that MYC2 directly binds the promoters of PLT1 and PLT2 and represses their expression. We propose that MYC2-mediated repression of PLT expression integrates jasmonate action into the auxin pathway in regulating root meristem activity and stem cell niche maintenance. This study illustrates a molecular framework for jasmonate-induced inhibition of root growth through interaction with the growth regulator auxin. PMID:21954460

  17. The basic helix-loop-helix transcription factor Nex-1/Math-2 promotes neuronal survival of PC12 cells by modulating the dynamic expression of anti-apoptotic and cell cycle regulators

    PubMed Central

    Uittenbogaard, Martine; Chiaramello, Anne

    2006-01-01

    The basic helix-loop-helix transcription factor Nex1/Math-2 belongs to the NeuroD subfamily, which plays a critical role during neuronal differentiation and maintenance of the differentiated state. Previously, we demonstrated that Nex1 is a key regulatory component of the nerve growth factor (NGF) pathway. Further supporting this hypothesis, this study shows that Nex1 has survival-inducing properties similar to NGF, as Nex1-overexpressing PC12 cells survive in the absence of trophic factors. We dissected the molecular mechanism by which Nex1 confers neuroprotection upon serum removal and found that constitutive expression of Nex1 maintained the expression of specific G1 phase cyclin-dependent kinase inhibitors and concomitantly induced a dynamic expression profile of key anti-apoptotic regulators. This study provides the first evidence of the underlying mechanism by which a member of the NeuroD-subfamily promotes an active anti-apoptotic program essential to the survival of neurons. Our results suggest that the survival program may be viewed as an integral component of the intrinsic programming of the differ entiated state. PMID:15659228

  18. Dynamic Antagonism between Phytochromes and PIF Family Basic Helix-Loop-Helix Factors Induces Selective Reciprocal Responses to Light and Shade in a Rapidly Responsive Transcriptional Network in Arabidopsis[C][W

    PubMed Central

    Leivar, Pablo; Tepperman, James M.; Cohn, Megan M.; Monte, Elena; Al-Sady, Bassem; Erickson, Erika; Quail, Peter H.

    2012-01-01

    Plants respond to shade-modulated light signals via phytochrome (phy)-induced adaptive changes, termed shade avoidance. To examine the roles of Phytochrome-Interacting basic helix-loop-helix Factors, PIF1, 3, 4, and 5, in relaying such signals to the transcriptional network, we compared the shade-responsive transcriptome profiles of wild-type and quadruple pif (pifq) mutants. We identify a subset of genes, enriched in transcription factor–encoding loci, that respond rapidly to shade, in a PIF-dependent manner, and contain promoter G-box motifs, known to bind PIFs. These genes are potential direct targets of phy-PIF signaling that regulate the primary downstream transcriptional circuitry. A second subset of PIF-dependent, early response genes, lacking G-box motifs, are enriched for auxin-responsive loci, and are thus potentially indirect targets of phy-PIF signaling, mediating the rapid cell expansion induced by shade. Comparing deetiolation- and shade-responsive transcriptomes identifies another subset of G-box–containing genes that reciprocally display rapid repression and induction in response to light and shade signals. These data define a core set of transcriptional and hormonal processes that appear to be dynamically poised to react rapidly to light-environment changes via perturbations in the mutually antagonistic actions of the phys and PIFs. Comparing the responsiveness of the pifq and triple pif mutants to light and shade confirms that the PIFs act with overlapping redundancy on seedling morphogenesis and transcriptional regulation but that each PIF contributes differentially to these responses. PMID:22517317

  19. Concise review: Blood relatives: formation and regulation of hematopoietic stem cells by the basic helix-loop-helix transcription factors stem cell leukemia and lymphoblastic leukemia-derived sequence 1.

    PubMed

    Curtis, David J; Salmon, Jessica M; Pimanda, John E

    2012-06-01

    The basic helix-loop-helix (bHLH) proteins are a large family of transcription factors that regulate the formation and fate of tissue stem cells. In hematopoiesis, the two major bHLH factors are stem cell leukemia (SCL) and lymphoblastic leukemia-derived sequence 1 (LYL1), both identified more than 20 years ago in chromosomal translocations occurring in T-cell acute lymphoblastic leukemia. SCL was termed the master regulator of hematopoiesis following the observation that SCL knockout mice die from complete lack of blood formation. However, once established, SCL is no longer required for maintenance of hematopoiesis. Pull-down experiments together with add-back experiments in SCL-null embryonic stem cells and generation of mice carrying a germline DNA binding mutation of SCL demonstrates that most of SCL function is mediated through the formation of a large DNA binding multiprotein complex with both repressor and activator potential. Recent genome-wide binding studies in a hematopoietic stem progenitor cell line suggest that SCL and LYL1 preferentially bind target DNA sequences as components of a heptad of transcription factors. LYL1, a paralog of SCL has been the forgotten sibling until recent mouse studies demonstrated that LYL1 replaced the function of SCL in adult hematopoiesis. Why LYL1 can replace the function of SCL for the maintenance but not formation of hematopoiesis remains a fundamental question. This review will compare and contrast the roles of these two transcription factors in hematopoiesis focusing on recent functional and genome-wide binding studies. PMID:22593015

  20. The neurogenic basic helix-loop-helix transcription factor NeuroD6 enhances mitochondrial biogenesis and bioenergetics to confer tolerance of neuronal PC12-NeuroD6 cells to the mitochondrial stressor rotenone

    SciTech Connect

    Baxter, Kristin Kathleen; Uittenbogaard, Martine; Chiaramello, Anne

    2012-10-15

    The fundamental question of how and which neuronal specific transcription factors tailor mitochondrial biogenesis and bioenergetics to the need of developing neuronal cells has remained largely unexplored. In this study, we report that the neurogenic basic helix-loop-helix transcription factor NeuroD6 possesses mitochondrial biogenic properties by amplifying the mitochondrial DNA content and TFAM expression levels, a key regulator for mitochondrial biogenesis. NeuroD6-mediated increase in mitochondrial biogenesis in the neuronal progenitor-like PC12-NEUROD6 cells is concomitant with enhanced mitochondrial bioenergetic functions, including increased expression levels of specific subunits of respiratory complexes of the electron transport chain, elevated mitochondrial membrane potential and ATP levels produced by oxidative phosphorylation. Thus, NeuroD6 augments the bioenergetic capacity of PC12-NEUROD6 cells to generate an energetic reserve, which confers tolerance to the mitochondrial stressor, rotenone. We found that NeuroD6 induces an adaptive bioenergetic response throughout rotenone treatment involving maintenance of the mitochondrial membrane potential and ATP levels in conjunction with preservation of the actin network. In conclusion, our results support the concept that NeuroD6 plays an integrative role in regulating and coordinating the onset of neuronal differentiation with acquisition of adequate mitochondrial mass and energetic capacity to ensure energy demanding events, such as cytoskeletal remodeling, plasmalemmal expansion, and growth cone formation. -- Highlights: Black-Right-Pointing-Pointer NeuroD6 induces mitochondrial biogenesis in neuroprogenitor-like cells. Black-Right-Pointing-Pointer NeuroD6 augments the bioenergetic reserve of the neuronal PC12-NeuroD6 cells. Black-Right-Pointing-Pointer NeuroD6 increases the mitochondrial membrane potential and ATP levels. Black-Right-Pointing-Pointer NeuroD6 confers tolerance to rotenone via an adaptive

  1. A Basic Helix-Loop-Helix Transcription Factor, PtrbHLH, of Poncirus trifoliata Confers Cold Tolerance and Modulates Peroxidase-Mediated Scavenging of Hydrogen Peroxide1[C][W

    PubMed Central

    Huang, Xiao-San; Wang, Wei; Zhang, Qian; Liu, Ji-Hong

    2013-01-01

    The basic helix-loop-helix (bHLH) transcription factors are involved in a variety of physiological processes. However, plant bHLHs functioning in cold tolerance and the underlying mechanisms remain poorly understood. Here, we report the identification and functional characterization of PtrbHLH isolated from trifoliate orange (Poncirus trifoliata). The transcript levels of PtrbHLH were up-regulated under various abiotic stresses, particularly cold. PtrbHLH was localized in the nucleus with transactivation activity. Overexpression of PtrbHLH in tobacco (Nicotiana tabacum) or lemon (Citrus limon) conferred enhanced tolerance to cold under chilling or freezing temperatures, whereas down-regulation of PtrbHLH in trifoliate orange by RNA interference (RNAi) resulted in elevated cold sensitivity. A range of stress-responsive genes was up-regulated or down-regulated in the transgenic lemon. Of special note, several peroxidase (POD) genes were induced after cold treatment. Compared with the wild type, POD activity was increased in the overexpression plants but decreased in the RNAi plants, which was inversely correlated with the hydrogen peroxide (H2O2) levels in the tested lines. Treatment of the transgenic tobacco plants with POD inhibitors elevated the H2O2 levels and greatly compromised their cold tolerance, while exogenous replenishment of POD enhanced cold tolerance of the RNAi line. In addition, transgenic tobacco and lemon plants were more tolerant to oxidative stresses. Yeast one-hybrid assay and transient expression analysis demonstrated that PtrbHLH could bind to the E-box elements in the promoter region of a POD gene. Taken together, these results demonstrate that PtrbHLH plays an important role in cold tolerance, at least in part, by positively regulating POD-mediated reactive oxygen species removal. PMID:23624854

  2. Backbone dynamics of a symmetric calmodulin dimer in complex with the calmodulin-binding domain of the basic-helix-loop-helix transcription factor SEF2-1/E2-2: a highly dynamic complex.

    PubMed

    Larsson, Göran; Schleucher, Jürgen; Onions, Jacqueline; Hermann, Stefan; Grundström, Thomas; Wijmenga, Sybren S

    2005-08-01

    Calmodulin (CaM) interacts specifically as a dimer with some dimeric basic-Helix-Loop-Helix (bHLH) transcription factors via a novel high affinity binding mode. Here we report a study of the backbone dynamics by (15)N-spin relaxation on the CaM dimer in complex with a dimeric peptide that mimics the CaM binding region of the bHLH transcription factor SEF2-1. The relaxation data were measured at multiple magnetic fields, and analyzed in a model-free manner using in-house written software designed to detect nanosecond internal motion. Besides picosecond motions, all residues also experience internal motion with an effective correlation time of approximately 2.5 ns with squared order parameter (S(2)) of approximately 0.75. Hydrodynamic calculations suggest that this can be attributed to motions of the N- and C-terminal domains of the CaM dimer in the complex. Moreover, residues with significant exchange broadening are found. They are clustered in the CaM:SEF2-1mp binding interface, the CaM:CaM dimer interface, and in the flexible helix connecting the CaM N- and C-terminal domains, and have similar exchange times (approximately 50 micros), suggesting a cooperative mechanism probably caused by protein:protein interactions. The dynamic features presented here support the conclusion that the conformationally heterogeneous bHLH mimicking peptide trapped inside the CaM dimer exchanges between different binding sites on both nanosecond and microsecond timescales. Nature has thus found a way to specifically recognize a relatively ill-fitting target. This novel mode of target-specific binding, which neither belongs to lock-and-key nor induced-fit binding, is characterized by dimerization and continuous exchange between multiple flexible binding alternatives. PMID:15894636

  3. Inhibitor of Differentiation 4 (ID4) Acts as an Inhibitor of ID-1, -2 and -3 and Promotes basic Helix Loop Helix (bHLH) E47 DNA Binding and Transcriptional Activity

    PubMed Central

    Sharma, Pankaj; Chinaranagari, Swathi; Chaudhary, Jaideep

    2015-01-01

    The four known ID proteins (ID1-4, Inhibitor of Differentiation) share a homologous helix loop helix (HLH) domain and act as dominant negative regulators of basic-HLH transcription factors. ID proteins also interact with many non-bHLH proteins in complex networks. The expression of ID proteins is increasingly observed in many cancers. Whereas ID-1, ID-2 and ID-3, are generally considered as tumor promoters, ID4 on the contrary has emerged as a tumor suppressor. In this study we demonstrate that ID4 heterodimerizes with ID-1, -2 and -3 and promote bHLH DNA binding, essentially acting as an inhibitor of inhibitors of differentiation proteins. Interaction of ID4 was observed with ID1, ID2 and ID3 that was dependent on intact HLH domain of ID4. Interaction with bHLH protein E47 required almost 3 fold higher concentration of ID4 as compared to ID1. Furthermore, inhibition of E47 DNA binding by ID1 was restored by ID4 in an EMSA binding assay. ID4 and ID1 were also colocalized in prostate cancer cell line LNCaP. The alpha helix forming alanine stretch N-terminal, unique to HLH ID4 domain was required for optimum interaction. Ectopic expression of ID4 in DU145 prostate cancer line promoted E47 dependent expression of CDKNI p21. Thus counteracting the biological activities of ID-1, -2 and -3 by forming inactive heterodimers appears to be a novel mechanism of action of ID4. These results could have far reaching consequences in developing strategies to target ID proteins for cancer therapy and understanding biologically relevant ID- interactions. PMID:25778840

  4. Inhibitor of differentiation 4 (ID4) acts as an inhibitor of ID-1, -2 and -3 and promotes basic helix loop helix (bHLH) E47 DNA binding and transcriptional activity.

    PubMed

    Sharma, Pankaj; Chinaranagari, Swathi; Chaudhary, Jaideep

    2015-05-01

    The four known ID proteins (ID1-4, Inhibitor of Differentiation) share a homologous helix loop helix (HLH) domain and act as dominant negative regulators of basic-HLH transcription factors. ID proteins also interact with many non-bHLH proteins in complex networks. The expression of ID proteins is increasingly observed in many cancers. Whereas ID-1, ID-2 and ID-3, are generally considered as tumor promoters, ID4 on the contrary has emerged as a tumor suppressor. In this study we demonstrate that ID4 heterodimerizes with ID-1, -2 and -3 and promote bHLH DNA binding, essentially acting as an inhibitor of inhibitors of differentiation proteins. Interaction of ID4 was observed with ID1, ID2 and ID3 that was dependent on intact HLH domain of ID4. Interaction with bHLH protein E47 required almost 3 fold higher concentration of ID4 as compared to ID1. Furthermore, inhibition of E47 DNA binding by ID1 was restored by ID4 in an EMSA binding assay. ID4 and ID1 were also colocalized in prostate cancer cell line LNCaP. The alpha helix forming alanine stretch N-terminal, unique to HLH ID4 domain was required for optimum interaction. Ectopic expression of ID4 in DU145 prostate cancer line promoted E47 dependent expression of CDKNI p21. Thus counteracting the biological activities of ID-1, -2 and -3 by forming inactive heterodimers appears to be a novel mechanism of action of ID4. These results could have far reaching consequences in developing strategies to target ID proteins for cancer therapy and understanding biologically relevant ID-interactions. PMID:25778840

  5. Human variants in the neuronal basic helix-loop-helix/Per-Arnt-Sim (bHLH/PAS) transcription factor complex NPAS4/ARNT2 disrupt function.

    PubMed

    Bersten, David C; Bruning, John B; Peet, Daniel J; Whitelaw, Murray L

    2014-01-01

    Neuronal Per-Arnt-Sim homology (PAS) Factor 4 (NPAS4) is a neuronal activity-dependent transcription factor which heterodimerises with ARNT2 to regulate genes involved in inhibitory synapse formation. NPAS4 functions to maintain excitatory/inhibitory balance in neurons, while mouse models have shown it to play roles in memory formation, social interaction and neurodegeneration. NPAS4 has therefore been implicated in a number of neuropsychiatric or neurodegenerative diseases which are underpinned by defects in excitatory/inhibitory balance. Here we have explored a broad set of non-synonymous human variants in NPAS4 and ARNT2 for disruption of NPAS4 function. We found two variants in NPAS4 (F147S and E257K) and two variants in ARNT2 (R46W and R107H) which significantly reduced transcriptional activity of the heterodimer on a luciferase reporter gene. Furthermore, we found that NPAS4.F147S was unable to activate expression of the NPAS4 target gene BDNF due to reduced dimerisation with ARNT2. Homology modelling predicts F147 in NPAS4 to lie at the dimer interface, where it appears to directly contribute to protein/protein interaction. We also found that reduced transcriptional activation by ARNT2 R46W was due to disruption of nuclear localisation. These results provide insight into the mechanisms of NPAS4/ARNT dimerisation and transcriptional activation and have potential implications for cognitive phenotypic variation and diseases such as autism, schizophrenia and dementia. PMID:24465693

  6. Human Variants in the Neuronal Basic Helix-Loop-Helix/Per-Arnt-Sim (bHLH/PAS) Transcription Factor Complex NPAS4/ARNT2 Disrupt Function

    PubMed Central

    Bersten, David C.; Bruning, John B.; Peet, Daniel J.; Whitelaw, Murray L.

    2014-01-01

    Neuronal Per-Arnt-Sim homology (PAS) Factor 4 (NPAS4) is a neuronal activity-dependent transcription factor which heterodimerises with ARNT2 to regulate genes involved in inhibitory synapse formation. NPAS4 functions to maintain excitatory/inhibitory balance in neurons, while mouse models have shown it to play roles in memory formation, social interaction and neurodegeneration. NPAS4 has therefore been implicated in a number of neuropsychiatric or neurodegenerative diseases which are underpinned by defects in excitatory/inhibitory balance. Here we have explored a broad set of non-synonymous human variants in NPAS4 and ARNT2 for disruption of NPAS4 function. We found two variants in NPAS4 (F147S and E257K) and two variants in ARNT2 (R46W and R107H) which significantly reduced transcriptional activity of the heterodimer on a luciferase reporter gene. Furthermore, we found that NPAS4.F147S was unable to activate expression of the NPAS4 target gene BDNF due to reduced dimerisation with ARNT2. Homology modelling predicts F147 in NPAS4 to lie at the dimer interface, where it appears to directly contribute to protein/protein interaction. We also found that reduced transcriptional activation by ARNT2 R46W was due to disruption of nuclear localisation. These results provide insight into the mechanisms of NPAS4/ARNT dimerisation and transcriptional activation and have potential implications for cognitive phenotypic variation and diseases such as autism, schizophrenia and dementia. PMID:24465693

  7. Significant dissociation of expression patterns of the basic helix-loop-helix transcription factors Dec1 and Dec2 in rat kidney.

    PubMed

    Wu, Tao; Ni, Yinhua; Zhuge, Fen; Sun, Lu; Xu, Bin; Kato, Hisanori; Fu, Zhengwei

    2011-04-15

    Dec1 and Dec2 are regulators of the mammalian molecular clock that show robust circadian rhythms in the suprachiasmatic nucleus and various peripheral tissues. Although the expression of Dec1 and Dec2 is altered by multiple stimuli in different organs, their transcriptional regulatory mechanisms have not been fully elucidated for the kidney. In the present study, we describe for the first time significant dissociation of expression patterns with arrhythmic expression of Dec1 and rhythmic expression of Dec2 in rat kidney under a normal light-dark (LD) cycle. Daytime restricted feeding (RF) significantly altered the expression patterns of these two clock genes, and even induced circadian expression of Dec1 with an amplitude of 2.2 on day 3 and 4.2 on day 7. However, when a reversed feeding schedule was coupled with a reversed LD cycle, the expression of Dec1 but not Dec2 reverted to being arrhythmic. Moreover, exogenous injection of the glucocorticoid analogue dexamethasone (Dex) at certain times of the day resulted in rhythmic expression of Dec1, which was similar to that seen following RF for 7 days. In contrast, endogenous disruption of glucocorticoids by adrenalectomy abolished RF-induced rhythmic expression of Dec1 in the kidney. These observations suggest the existence of a glucocorticoid gating mechanism in the circadian expression of Dec1 in rat kidney. PMID:21430201

  8. Differential activities of murine single minded 1 (SIM1) and SIM2 on a hypoxic response element. Cross-talk between basic helix-loop-helix/per-Arnt-Sim homology transcription factors.

    PubMed

    Woods, Susan L; Whitelaw, Murray L

    2002-03-22

    The basic helix-loop-helix/Per-Arnt-Sim homology (bHLH/PAS) protein family comprises a group of transcriptional regulators that often respond to a variety of developmental and environmental stimuli. Two murine members of this family, Single Minded 1 (SIM1) and Single Minded 2 (SIM2), are essential for postnatal survival but differ from other prototypical family members such as the dioxin receptor (DR) and hypoxia-inducible factors, in that they behave as transcriptional repressors in mammalian one-hybrid experiments and have yet to be ascribed a regulating signal. In cell lines engineered to stably express SIM1 and SIM2, we show that both are nuclear proteins that constitutively complex with the general bHLH/PAS partner factor, ARNT. We report that the murine SIM factors, in combination with ARNT, attenuate transcription from the hypoxia-inducible erythropoietin (EPO) enhancer during hypoxia. Such cross-talk between coexpressed bHLH/PAS factors can occur through competition for ARNT, which we find evident in SIM repression of DR-induced transcription from a xenobiotic response element reporter gene. However, SIM1/ARNT, but not SIM2/ARNT, can activate transcription from the EPO enhancer at normoxia, implying that the SIM proteins have the ability to bind hypoxia response elements and affect either activation or repression of transcription. This notion is supported by co-immunoprecipitation of EPO enhancer sequences with the SIM2 protein. SIM protein levels decrease with hypoxia treatment in our stable cell lines, although levels of the transcripts encoding SIM1 and SIM2 and the approximately 2-h half-lives of each protein are unchanged during hypoxia. Inhibition of protein synthesis, known to occur in cells during hypoxic stress in order to decrease ATP utilization, appears to account for the fall in SIM levels. Our data suggest the existence of a hypoxic switch mechanism in cells that coexpress hypoxia-inducible factor and SIM proteins, where up-regulation and

  9. CHUK, a conserved helix-loop-helix ubiquitous kinase, maps to human chromosome 10 and mouse chromosome 19

    SciTech Connect

    Mock, B.A.; McBride, O.W.; Kozak, C.A.

    1995-05-20

    Helix-loop-helix proteins contain stretches of DNA that encode two amphipathic {alpha}-helices joined by a loop structure and are involved in protein dimerization and transcriptional regulation essential to a variety of cellular processes. CHUK, a newly described conserved helix-loop-helix ubiquitous kinase, was mapped by somatic cell hybrid analyses to human Chr 10q24-q25. Chuk and a related sequence, Chuk-rs1, were mapped to mouse chromosomes 19 and 16, respectively, by a combination of somatic cell hybrid, recombinant inbred, and backcross analyses. 17 refs., 2 figs., 1 tab.

  10. E Proteins and ID Proteins: Helix-Loop-Helix Partners in Development and Disease.

    PubMed

    Wang, Lan-Hsin; Baker, Nicholas E

    2015-11-01

    The basic Helix-Loop-Helix (bHLH) proteins represent a well-known class of transcriptional regulators. Many bHLH proteins act as heterodimers with members of a class of ubiquitous partners, the E proteins. A widely expressed class of inhibitory heterodimer partners-the Inhibitor of DNA-binding (ID) proteins-also exists. Genetic and molecular analyses in humans and in knockout mice implicate E proteins and ID proteins in a wide variety of diseases, belying the notion that they are non-specific partner proteins. Here, we explore relationships of E proteins and ID proteins to a variety of disease processes and highlight gaps in knowledge of disease mechanisms. PMID:26555048

  11. Specificity for the Hairy/enhancer of split basic helix-loop-helix (bHLH) proteins maps outside the bHLH domain and suggests two separable modes of transcriptional repression

    SciTech Connect

    Dawson, S.R.; Turner, D.L.; Weintraub, H.; Parkhurst, S.M.

    1995-12-01

    This report investigates transcriptional repressors in Drosophila melanogaster and their function in and effect on developmental processes such as sex determination. Details on the mechanism of function of these transcriptional repressors are also discussed. 50 refs., 3 figs., 4 tabs.

  12. Overexpression of a citrus basic helix-loop-helix transcription factor (CubHLH1), which is homologous to Arabidopsis activation-tagged bri1 suppressor 1 interacting factor genes, modulates carotenoid metabolism in transgenic tomato.

    PubMed

    Endo, Tomoko; Fujii, Hiroshi; Sugiyama, Aiko; Nakano, Michiharu; Nakajima, Naoko; Ikoma, Yoshinori; Omura, Mitsuo; Shimada, Takehiko

    2016-02-01

    To explore the transcription factors associated with carotenoid metabolism in citrus fruit, one transcription factor (CubHLH1) was selected through microarray screening in Satsuma mandarin (Citrus unshiu Marc.) fruit, which was treated with exogenous ethylene or gibberellin (GA), accelerating or retarding carotenoid accumulation in peel, respectively. The amino acid sequence of CubHLH1 has homology to Arabidopsis activation-tagged bri1 suppressor 1 (ATBS1) interacting factor (AIF), which is functionally characterized as a negative regulator of the brassinolide (BR) signalling pathway. Yeast two-hybrid analysis revealed that protein for CubHLH1 could interact with Arabidopsis and tomato ATBS1. Overexpression of CubHLH1 caused a dwarf phenotype in transgenic tomato (Solanum lycopersicum L.), suggesting that CubHLH1 has a similar function to Arabidopsis AIF. In the transgenic tomato fruit at ripening stage, the lycopene content was reduced along with the changes in carotenoid biosynthetic gene expression. The abscisic acid (ABA) content of all the transgenic tomato fruit was higher than that of the wild type. These results implied that CubHLH1 is considered to have a similar function to Arabidopsis AIFs and might be directly involved in carotenoid metabolism in mature citrus fruit. PMID:26795149

  13. Suppression of mammary epithelial cell differentiation by the helix-loop-helix protein Id-1

    SciTech Connect

    Desprez, P.; Hara, E.; Bissell, M.J.

    1995-06-01

    Cell proliferation and differentiation are precisely coordinated during the development and maturation of the mammary gland, and this balance invariably is disrupted during carcinogenesis. Little is known about the cell-specific transcription factors that regulate these processes in the mammary gland. The mouse mammary epithelial cell line SCp2 grows well under standard culture conditions but arrests growth, forms alveolus-like structures, and expresses {beta}-casein, a differentiation marker, 4 to 5 days after exposure to basement membrane and lactogenic hormones (differentiation signals). The authors show that this differentiation entails a marked decline in the expression of Id-1, a helix-loop-helix (HLH) protein that inactivates basic HLH transcription factors in other cell types. SCp2 cells stably transfected with an Id-1 expression vector grew more rapidly than control cells under standard conditions, but in response to differentiation signals, they lost three-dimensional organization, invaded the basement membrane, and then resumed growth. SCp2 cells expressing an Id-1 antisense vector grew more slowly than controls; in response to differentiation signals, they remained stably growth arrested and fully differentiated, as did control cells. The authors suggest that Id-1 renders cells refractory to differentiation signals and receptive to growth signals by inactivating one or more basic HLH proteins that coordinate growth and differentiation in the mammary epithelium. 53 refs., 6 figs.

  14. Salvador-Warts-Hippo pathway in a developmental checkpoint monitoring Helix-Loop-Helix proteins

    PubMed Central

    Wang, Lan-Hsin; Baker, Nicholas E.

    2014-01-01

    The E-proteins and Id-proteins are, respectively, the positive and negative heterodimer partners for the basic-helix-loop-helix protein family, and as such contribute to a remarkably large number of cell fate decisions. E-proteins and Id-proteins also function to inhibit or promote cell proliferation and cancer. Using a genetic modifier screen in Drosophila, we show that the Id-protein Extramacrochaetae enables growth by suppressing activation of the Salvador-Warts-Hippo pathway of tumor suppressors, activation that requires transcriptional activation of the expanded gene by the E-protein Daughterless. Daughterless protein binds to an intronic enhancer in the expanded gene, both activating the SWH pathway independently of the transmembrane protein Crumbs, and bypassing the negative feedback regulation that targets the same expanded enhancer. Thus the Salvador-Warts-Hippo pathway has a cell-autonomous function to prevent inappropriate differentiation due to transcription factor imbalance, and monitors the intrinsic developmental status of progenitor cells, distinct from any responses to cell-cell interactions. PMID:25579975

  15. Origin and Diversification of Basic-Helix-Loop-Helix Proteins in Plants

    PubMed Central

    Pires, Nuno; Dolan, Liam

    2010-01-01

    Basic helix-loop-helix (bHLH) proteins are a class of transcription factors found throughout eukaryotic organisms. Classification of the complete sets of bHLH proteins in the sequenced genomes of Arabidopsis thaliana and Oryza sativa (rice) has defined the diversity of these proteins among flowering plants. However, the evolutionary relationships of different plant bHLH groups and the diversity of bHLH proteins in more ancestral groups of plants are currently unknown. In this study, we use whole-genome sequences from nine species of land plants and algae to define the relationships between these proteins in plants. We show that few (less than 5) bHLH proteins are encoded in the genomes of chlorophytes and red algae. In contrast, many bHLH proteins (100–170) are encoded in the genomes of land plants (embryophytes). Phylogenetic analyses suggest that plant bHLH proteins are monophyletic and constitute 26 subfamilies. Twenty of these subfamilies existed in the common ancestors of extant mosses and vascular plants, whereas six further subfamilies evolved among the vascular plants. In addition to the conserved bHLH domains, most subfamilies are characterized by the presence of highly conserved short amino acid motifs. We conclude that much of the diversity of plant bHLH proteins was established in early land plants, over 440 million years ago. PMID:19942615

  16. Suppression of Chondrogenesis by Id Helix-Loop-Helix Proteins in Murine Embryonic Orofacial Tissue

    PubMed Central

    Mukhopadhyay, Partha; Rezzoug, Francine; Webb, Cynthia L.; Pisano, M. Michele; Greene, Robert M.

    2009-01-01

    Inhibitors of differentiation (Id) proteins are helix-loop-helix (HLH) transcription factors lacking a DNA binding domain. Id proteins modulate cell proliferation, apoptosis, and differentiation in embryonic/fetal tissue. Perturbation of any of these processes in cells of the developing orofacial region results in orofacial anomalies. Chondrogenesis, a process integral to normal orofacial ontogenesis, is known to be modulated, in part, by Id proteins. In the present study, the mRNA and protein expression patterns of Id1, Id2, Id3 and Id4 were examined in developing murine orofacial tissue in vivo, as well as in murine embryonic maxillary mesenchymal cells in vitro. The functional role of Ids during chondrogenesis was also explored in vitro. Results reveal that cells derived from developing murine orofacial tissue: (1) express Id1, Id2, Id3 and Id4 mRNAs and proteins on each of gestational days 12-14, (2) express all four Id proteins in a developmentally regulated manner, (3) undergo chondrogenesis and express genes encoding various chondrogenic marker proteins (e.g. Runx2, Type X collagen, Sox9) when cultured under micromass conditions, and (4) can have their chondrogenic potential regulated via alteration of Id protein function through overexpression of a basic HLH factor. In summary, results from the current report reveal for the first time, the expression of all four Id proteins in cells derived from developing murine orofacial tissue, and demonstrate a functional role for the Ids in regulating the ability of these cells to undergo chondrogenesis. PMID:19349107

  17. Regulation of Arabidopsis Brassinosteroid Signaling by Atypical Basic Helix-Loop-Helix Proteins[C][W

    PubMed Central

    Wang, Hao; Zhu, Yongyou; Fujioka, Shozo; Asami, Tadao; Li, Jiayang; Li, Jianming

    2009-01-01

    Basic helix-loop-helix (bHLH) proteins are highly conserved transcription factors critical for cell proliferation and differentiation. Recent studies have implicated bHLH proteins in many plant signaling processes, including brassinosteroid (BR) signaling. Here, we report identification of two families of atypical bHLH proteins capable of modulating BR signaling. We found that activation-tagged bri1 suppressor 1-Dominant (atbs1-D), previously identified as a dominant suppressor of a weak BR receptor mutant bri1-301, was caused by overexpression of a 93–amino acid atypical bHLH protein lacking amino acids critical for DNA binding. Interestingly, atbs1-D only suppresses weak BR mutants, while overexpression of a truncated ATBS1 lacking the basic motif also rescues bri1-301, suggesting that ATBS1 likely stimulates BR signaling by sequestering negative BR signaling components. A yeast two-hybrid screen using ATBS1 as bait discovered four ATBS1-Interacting Factors (AIFs) that are members of another atypical bHLH protein subfamily. AIF1 exhibits an overlapping expression pattern with ATBS1 and its homologs and interacts with ATBS1 in vitro and in vivo. AIF1 overexpression nullifies the suppressive effect of atbs1-D on bri1-301 and results in dwarf transgenic plants resembling BR mutants. By contrast, silencing of AIF1 partially suppressed the bri1-301 phenotype. Our results suggested that plants use these atypical bHLH proteins to regulate BR signaling. PMID:20023194

  18. The basic helix-loop-helix differentiation factor Nex1/MATH-2 functions as a key activator of the GAP-43 gene

    PubMed Central

    Uittenbogaard, Martine; Martinka, Debra L.; Chiaramello, Anne

    2006-01-01

    Nex1/MATH-2 is a neurogenic basic Helix-Loop-Helix (bHLH) transcription factor that belongs to the NeuroD subfamily. Its expression parallels that of the GAP-43 gene and peaks during brain development, when neurite outgrowth and synaptogenesis are highly active. We previously observed a direct correlation between the levels of expression of Nex1 and GAP-43 proteins, which resulted in extensive neurite outgrowth and neuronal differentiation of PC12 cells in the absence of nerve growth factor. Since the GAP-43 gene is a target for bHLH regulation, we investigated whether Nex1 could regulate the activity of the GAP-43 promoter. We found that among the members of the NeuroD subfamily, Nex1 promoted maximal activity of the GAP-43 promoter. The Nex1-mediated activity is restricted to the conserved E1–E2 cluster located near the major transcription start sites. By electrophoretic mobility shift assay and site-directed mutagenesis, we showed that Nex1 binds as homodimers and that the E1 E-box is a high affinity binding site. We further found that Nex1 released the ME1 E-protein-mediated repression in a concentration dependent manner. Thus, the E1–E2 cluster has a dual function: it can mediate activation or repression depending on the interacting bHLH proteins. Finally, a series of N-terminal and C-terminal deletions revealed that Nex1 transcriptional activity is linked to two distinct transactivation domains, TAD1 and TAD2, with TAD1 being unique to Nex1. Together, our results suggest that Nex1 may engage in selective interactions with components of the core transcriptional machinery whose assembly is dictated by the architecture of the GAP-43 promoter and cellular environment. PMID:12562512

  19. The basic helix-loop-helix differentiation factor Nex1/MATH-2 functions as a key activator of the GAP-43 gene.

    PubMed

    Uittenbogaard, Martine; Martinka, Debra L; Chiaramello, Anne

    2003-02-01

    Nex1/MATH-2 is a neurogenic basic Helix-Loop-Helix (bHLH) transcription factor that belongs to the NeuroD subfamily. Its expression parallels that of the GAP-43 gene and peaks during brain development, when neurite outgrowth and synaptogenesis are highly active. We previously observed a direct correlation between the levels of expression of Nex1 and GAP-43 proteins, which resulted in extensive neurite outgrowth and neuronal differentiation of PC12 cells in the absence of nerve growth factor. Since the GAP-43 gene is a target for bHLH regulation, we investigated whether Nex1 could regulate the activity of the GAP-43 promoter. We found that among the members of the NeuroD subfamily, Nex1 promoted maximal activity of the GAP-43 promoter. The Nex1-mediated activity is restricted to the conserved E1-E2 cluster located near the major transcription start sites. By electrophoretic mobility shift assay and site-directed mutagenesis, we showed that Nex1 binds as homodimers and that the E1 E-box is a high affinity binding site. We further found that Nex1 released the ME1 E-protein-mediated repression in a concentration dependent manner. Thus, the E1-E2 cluster has a dual function: it can mediate activation or repression depending on the interacting bHLH proteins. Finally, a series of N-terminal and C-terminal deletions revealed that Nex1 transcriptional activity is linked to two distinct transactivation domains, TAD1 and TAD2, with TAD1 being unique to Nex1. Together, our results suggest that Nex1 may engage in selective interactions with components of the core transcriptional machinery whose assembly is dictated by the architecture of the GAP-43 promoter and cellular environment. PMID:12562512

  20. Selective utilization of basic helix-loop-helix-leucine zipper proteins at the immunoglobulin heavy-chain enhancer.

    PubMed

    Carter, R S; Ordentlich, P; Kadesch, T

    1997-01-01

    The microE3 E box within the immunoglobulin heavy-chain (IgH) enhancer binds several proteins of the basic helix-loop-helix-leucine zipper (bHLHzip) class, including TFE3, USF1, and Max. Both TFE3 and USF have been described as transcriptional activators, and so we investigated their possible roles in activating the IgH enhancer in vivo. Although TFE3 activated various enhancer-based reporters, both USF1 and Max effectively inhibited transcription. Inhibition by USF correlated with the lack of a strong activation domain and was the result of the protein neutralizing the microE3 site. The effects of dominant-negative derivatives of TFE3 and USF1 confirmed that TFE3, or a TFE3-like protein, is the primary cellular bHLHzip protein that activates the IgH enhancer. In addition to providing a physiological role for TFE3, our results call into question the traditional view of USF1 as an obligate transcriptional activator. PMID:8972181

  1. A novel initiator regulates expression of the nontissue-specific helix-loop-helix gene ME1.

    PubMed Central

    Shain, D H; Neuman, T; Zuber, M X

    1995-01-01

    The mouse ME1 gene (HEB, REB and GE1, homologues in human, rat and chick, respectively) is a member of the nontissue-specific helix-loop-helix (HLH) gene family that includes E2A, E2-2 and Drosophila daughterless. We have examined the factors that control ME1 gene expression. ME1 is a single copy gene that spans > or = 150 kb of DNA and contains > 10 exons. Transcription was directed by an unusual initiator element that contained a 13 bp poly d(A) tract flanked by palindromic and inverted repeat sequences. Both RNase protection and primer extension analyses mapped the ME1 transcriptional start site to the center of the 13 bp poly d(A) tract. The ME1 initiator and its proximal sequences were required for promoter activity, supported basal levels of transcription, and contributed to cell type-specific gene expression. Other cis-elements utilized by the TATA-less ME1 promoter included a cluster of Sp1 response elements, E-boxes and a strong repressor. Collectively, our results suggest that the ME1 initiator and other cis-elements in the proximal promoter play an important role in regulating ME1 gene expression. Images PMID:7784173

  2. Conservation of lotus and Arabidopsis basic helix-loop-helix proteins reveals new players in root hair development.

    PubMed

    Karas, Bogumil; Amyot, Lisa; Johansen, Christopher; Sato, Shusei; Tabata, Satoshi; Kawaguchi, Masayoshi; Szczyglowski, Krzysztof

    2009-11-01

    Basic helix-loop-helix (bHLH) proteins constitute a large family of transcriptional regulators in plants. Although they have been shown to play important roles in a wide variety of developmental processes, relatively few have been functionally characterized. Here, we describe the map-based cloning of the Lotus japonicus ROOTHAIRLESS1 (LjRHL1) locus. Deleterious mutations in this locus prevent root hair development, which also aborts root hair-dependent colonization of the host root by nitrogen-fixing bacteria. We show that the LjRHL1 gene encodes a presumed bHLH transcription factor that functions in a nonredundant manner to control root hair development in L. japonicus. Homology search and cross-species complementation experiments defined three members of the Arabidopsis (Arabidopsis thaliana) bHLH protein family, At2g24260, At4g30980, and At5g58010, as functionally equivalent to LjRHL1. Curiously, At2g24260 and At4g30980 mRNA species accumulate independently from the known positive regulators of root hair cell fate, while all three genes act in a partially redundant manner to regulate root hair development in Arabidopsis. PMID:19675148

  3. A novel basic helix-loop-helix protein is expressed in muscle attachment sites of the Drosophila epidermis.

    PubMed Central

    Armand, P; Knapp, A C; Hirsch, A J; Wieschaus, E F; Cole, M D

    1994-01-01

    We have found that a novel basic helix-loop-helix (bHLH) protein is expressed almost exclusively in the epidermal attachments sites for the somatic muscles of Drosophila melanogaster. A Drosophila cDNA library was screened with radioactively labeled E12 protein, which can dimerize with many HLH proteins. One clone that emerged from this screen encoded a previously unknown protein of 360 amino acids, named delilah, that contains both basic and HLH domains, similar to a group of cellular transcription factors implicated in cell type determination. Delilah protein formed heterodimers with E12 that bind to the muscle creatine kinase promoter. In situ hybridization with the delilah cDNA localized the expression of the gene to a subset of cells in the epidermis which form a distinct pattern involving both the segmental boundaries and intrasegmental clusters. This pattern was coincident with the known sites of attachment of the somatic muscles to tendon cells in the epidermis. delilah expression persists in snail mutant embryos which lack mesoderm, indicating that expression of the gene was not induced by attachment of the underlying muscles. The similarity of this gene to other bHLH genes suggests that it plays an important role in the differentiation of epidermal cells into muscle attachment sites. Images PMID:8196652

  4. Recognition and binding of a helix-loop-helix peptide to carbonic anhydrase occurs via partly folded intermediate structures.

    PubMed

    Lignell, Martin; Becker, Hans-Christian

    2010-02-01

    We have studied the association of a helix-loop-helix peptide scaffold carrying a benzenesulfonamide ligand to carbonic anhydrase using steady-state and time-resolved fluorescence spectroscopy. The helix-loop-helix peptide, developed for biosensing applications, is labeled with the fluorescent probe dansyl, which serves as a polarity-sensitive reporter of the binding event. Using maximum entropy analysis of the fluorescence lifetime of dansyl at 1:1 stoichiometry reveals three characteristic fluorescence lifetime groups, interpreted as differently interacting peptide/protein structures. We characterize these peptide/protein complexes as mostly bound but unfolded, bound and partly folded, and strongly bound and folded. Furthermore, analysis of the fluorescence anisotropy decay resulted in three different dansyl rotational correlation times, namely 0.18, 1.2, and 23 ns. Using the amplitudes of these times, we can correlate the lifetime groups with the corresponding fluorescence anisotropy component. The 23-ns rotational correlation time, which appears with the same amplitude as a 17-ns fluorescence lifetime, shows that the dansyl fluorophore follows the rotational diffusion of carbonic anhydrase when it is a part of the folded peptide/protein complex. A partly folded and partly hydrated interfacial structure is manifested in an 8-ns dansyl fluorescence lifetime and a 1.2-ns rotational correlation time. This structure, we believe, is similar to a molten-globule-like interfacial structure, which allows segmental movement and has a higher degree of solvent exposure of dansyl. Indirect excitation of dansyl on the helix-loop-helix peptide through Förster energy transfer from one or several tryptophans in the carbonic anhydrase shows that the helix-loop-helix scaffold binds to a tryptophan-rich domain of the carbonic anhydrase. We conclude that binding of the peptide to carbonic anhydrase involves a transition from a disordered to an ordered structure of the helix-loop-helix

  5. A genome-wide identification of basic helix-loop-helix motifs in Pediculus humanus corporis (Phthiraptera: Pediculidae).

    PubMed

    Wang, Xu-Hua; Wang, Yong; Zhang, De-Bao; Liu, A-Ke; Yao, Qin; Chen, Ke-Ping

    2014-01-01

    Basic helix-loop-helix (bHLH) proteins comprise a large superfamily of transcription factors, which are involved in the regulation of various developmental processes. bHLH family members are widely distributed in various eukaryotes including yeast, fruit fly, zebrafish, mouse, and human. In this study, we identified 55 bHLH motifs encoded in genome sequence of the human body louse, Pediculus humanus corporis (Phthiraptera: Pediculidae). Phylogenetic analyses of the identified P. humanus corporis bHLH (PhcbHLH) motifs revealed that there are 23, 11, 9, 1, 10, and 1 member(s) in groups A, B, C, D, E, and F, respectively. Examination to GenBank annotations of the 55 PhcbHLH members indicated that 29 PhcbHLH proteins were annotated in consistence with our analytical result, 8 were annotated different with our analytical result, 12 were merely annotated as hypothetical protein, and the rest 6 were not deposited in GenBank. A comparison on insect bHLH gene composition revealed that human body louse possibly has more hairy and E(spl) genes than other insect species. Because hairy and E(spl) genes have been found to negatively regulate the differentiation of insect preneural cells, it is suggested that the existence of additional hairy and E(spl) genes in human body louse is probably the consequence of its long period adaptation to the relatively dark and stable environment. These data provide good references for further studies on regulatory functions of bHLH proteins in the growth and development of human body louse. PMID:25434030

  6. Macrocyclization and labeling of helix-loop-helix peptide with intramolecular bis-thioether linkage.

    PubMed

    Nishihara, Toshio; Kitada, Hidekazu; Fujiwara, Daisuke; Fujii, Ikuo

    2016-11-01

    Conformationally constrained peptides have been developed as an inhibitor for protein-protein interactions (PPIs), and we have de novo designed cyclized helix-loop-helix (cHLH) peptide with a disulfide bond consisting of 40 amino acids to generate molecular-targeting peptides. However, synthesis of long peptides has sometimes resulted in low yield according to the respective amino acid sequences. Here we developed a method for efficient synthesis and labeling for cHLH peptides. First, we synthesized two peptide fragments and connected them by the copper-mediated alkyne and azide cycloaddition (CuAAC) reaction. Cyclization was performed by bis-thioether linkage using 1,3-dibromomethyl-5-propargyloxybenzene, and subsequently, the cHLH peptide was labeled with an azide-labeled probe. Finally, we designed and synthesized a peptide inhibitor for the p53-HDM2 interaction using a structure-guided design and successfully labeled it with a fluorescent probe or a functional peptide, respectively, by click chemistry. This macrocyclization and labeling method for cHLH peptide would facilitate the discovery of de novo bioactive ligands and therapeutic leads. © 2016 Wiley Periodicals, Inc. Biopolymers (Pept Sci) 106: 415-421, 2016. PMID:26917088

  7. Two single nucleotide polymorphisms in the human nescient helix-loop-helix 2 (NHLH2) gene reduce mRNA stability and DNA binding.

    PubMed

    Al Rayyan, Numan; Wankhade, Umesh D; Bush, Korie; Good, Deborah J

    2013-01-01

    Nescient helix-loop-helix-2 (NHLH2) is a basic helix-loop-helix transcription factor, which has been implicated, using mouse knockouts, in adult body weight regulation and fertility. A scan of the known single nucleotide polymorphisms (SNPs) in the NHLH2 gene revealed one in the 3' untranslated region (3'UTR), which lies within an AUUUA RNA stability motif. A second SNP is nonsynonymous within the coding region of NHLH2, and was found in a genome-wide association study for obesity. Both of these SNPs were examined for their effect on NLHL2 by creating mouse mimics and examining mRNA stability, and protein function in mouse hypothalamic cell lines. The 3'UTR SNP causes increased instability and, when the SNP-containing Nhlh2 3'UTR is attached to luciferase mRNA, reduced protein levels in cells. The nonsynonymous SNP at position 83 in the protein changes an alanine residue, conserved in NHLH2 orthologs through the Drosophila sp. to a proline residue. This change affects migration of the protein on an SDS-PAGE gel, and appears to alter secondary structure of the protein, as predicted using in silico methods. These results provide functional information on two rare human SNPs in the NHLH2 gene. One of these has been linked to human obese phenotypes, while the other is present in a relatively high proportion of individuals. Given their effects on NHLH2 protein levels, both SNPs deserve further analysis in whether they are causative and/or additive for human body weight and fertility phenotypes. PMID:23026212

  8. The Basic/Helix-Loop-Helix Protein Family in Gossypium: Reference Genes and Their Evolution during Tetraploidization.

    PubMed

    Yan, Qian; Liu, Hou-Sheng; Yao, Dan; Li, Xin; Chen, Han; Dou, Yang; Wang, Yi; Pei, Yan; Xiao, Yue-Hua

    2015-01-01

    Basic/helix-loop-helix (bHLH) proteins comprise one of the largest transcription factor families and play important roles in diverse cellular and molecular processes. Comprehensive analyses of the composition and evolution of the bHLH family in cotton are essential to elucidate their functions and the molecular basis of cotton development. By searching bHLH homologous genes in sequenced diploid cotton genomes (Gossypium raimondii and G. arboreum), a set of cotton bHLH reference genes containing 289 paralogs were identified and named as GobHLH001-289. Based on their phylogenetic relationships, these cotton bHLH proteins were clustered into 27 subfamilies. Compared to those in Arabidopsis and cacao, cotton bHLH proteins generally increased in number, but unevenly in different subfamilies. To further uncover evolutionary changes of bHLH genes during tetraploidization of cotton, all genes of S5a and S5b subfamilies in upland cotton and its diploid progenitors were cloned and compared, and their transcript profiles were determined in upland cotton. A total of 10 genes of S5a and S5b subfamilies (doubled from A- and D-genome progenitors) maintained in tetraploid cottons. The major sequence changes in upland cotton included a 15-bp in-frame deletion in GhbHLH130D and a long terminal repeat retrotransposon inserted in GhbHLH062A, which eliminated GhbHLH062A expression in various tissues. The S5a and S5b bHLH genes of A and D genomes (except GobHLH062) showed similar transcription patterns in various tissues including roots, stems, leaves, petals, ovules, and fibers, while the A- and D-genome genes of GobHLH110 and GobHLH130 displayed clearly different transcript profiles during fiber development. In total, this study represented a genome-wide analysis of cotton bHLH family, and revealed significant changes in sequence and expression of these genes in tetraploid cottons, which paved the way for further functional analyses of bHLH genes in the cotton genus. PMID:25992947

  9. The Basic/Helix-Loop-Helix Protein Family in Gossypium: Reference Genes and Their Evolution during Tetraploidization

    PubMed Central

    Yan, Qian; Liu, Hou-Sheng; Yao, Dan; Li, Xin; Chen, Han; Dou, Yang; Wang, Yi; Pei, Yan; Xiao, Yue-Hua

    2015-01-01

    Basic/helix-loop-helix (bHLH) proteins comprise one of the largest transcription factor families and play important roles in diverse cellular and molecular processes. Comprehensive analyses of the composition and evolution of the bHLH family in cotton are essential to elucidate their functions and the molecular basis of cotton development. By searching bHLH homologous genes in sequenced diploid cotton genomes (Gossypium raimondii and G. arboreum), a set of cotton bHLH reference genes containing 289 paralogs were identified and named as GobHLH001-289. Based on their phylogenetic relationships, these cotton bHLH proteins were clustered into 27 subfamilies. Compared to those in Arabidopsis and cacao, cotton bHLH proteins generally increased in number, but unevenly in different subfamilies. To further uncover evolutionary changes of bHLH genes during tetraploidization of cotton, all genes of S5a and S5b subfamilies in upland cotton and its diploid progenitors were cloned and compared, and their transcript profiles were determined in upland cotton. A total of 10 genes of S5a and S5b subfamilies (doubled from A- and D-genome progenitors) maintained in tetraploid cottons. The major sequence changes in upland cotton included a 15-bp in-frame deletion in GhbHLH130D and a long terminal repeat retrotransposon inserted in GhbHLH062A, which eliminated GhbHLH062A expression in various tissues. The S5a and S5b bHLH genes of A and D genomes (except GobHLH062) showed similar transcription patterns in various tissues including roots, stems, leaves, petals, ovules, and fibers, while the A- and D-genome genes of GobHLH110 and GobHLH130 displayed clearly different transcript profiles during fiber development. In total, this study represented a genome-wide analysis of cotton bHLH family, and revealed significant changes in sequence and expression of these genes in tetraploid cottons, which paved the way for further functional analyses of bHLH genes in the cotton genus. PMID:25992947

  10. Role of the basic helix-loop-helix protein ITF2 in the hormonal regulation of Sertoli cell differentiation.

    PubMed

    Muir, Terla; Sadler-Riggleman, Ingrid; Stevens, Jeffrey D; Skinner, Michael K

    2006-04-01

    Sertoli cells are a post-mitotic terminally differentiated cell population that forms the seminiferous tubules in the adult testis and provides the microenvironment and structural support for developing germ cells. During pubertal development, Sertoli cells are responsive to follicle-stimulating hormone (FSH) to promote the expression of differentiated gene products. The basic helix-loop-helix (bHLH) and inhibitors of differentiation (Id) transcription factors are involved in the differentiation of a variety of cell lineages during development. Both bHLH and Id transcription factors have been identified in Sertoli cells. A yeast two-hybrid screen was conducted using a rat Sertoli cell cDNA library to identify bHLH dimerization partners for the Id1 transcription factor. The ubiquitous bHLH protein ITF2 (i.e., E2-2) was identified as one of the interacting partners. The current study investigates the expression and function of ITF2 in Sertoli cells. ITF2 was found to be ubiquitously expressed in all testicular cell types including germ cells, peritubular myoid cells, and Sertoli cells. Stimulation of cultured Sertoli cells with FSH or dibutryl cAMP resulted in a transient decrease in expression of ITF2 mRNA levels followed by a rise in expression with FSH treatment. ITF2 expression was at its highest in mid-pubertal 20-day-old rat Sertoli cells. ITF2 was found to directly bind to negative acting Id HLH proteins and positive acting bHLH proteins such as scleraxis. Transient overexpression of ITF2 protein in cultured Sertoli cells stimulated transferrin promoter activity, which is a marker of Sertoli cell differentiation. Co-transfections of ITF2 and Id proteins sequestered the inhibitory effects of the Id family of proteins. Observations suggest ITF2 can enhance FSH actions through suppressing the inhibitory actions of the Id family of proteins and increasing the actions of stimulatory bHLH proteins (i.e., scleraxis) in Sertoli cells. PMID:16425294

  11. Regulation of T cell receptor beta gene rearrangements and allelic exclusion by the helix-loop-helix protein, E47.

    PubMed

    Agata, Yasutoshi; Tamaki, Nobuyuki; Sakamoto, Shuji; Ikawa, Tomokatsu; Masuda, Kyoko; Kawamoto, Hiroshi; Murre, Cornelis

    2007-12-01

    Allelic exclusion of antigen-receptor genes is ensured primarily by monoallelic locus activation upon rearrangement and subsequently by feedback inhibition of continued rearrangement. Here, we demonstrated that the basic helix-loop-helix protein, E47, promoted T cell receptor beta (TCRbeta) gene rearrangement by directly binding to target gene segments to increase chromatin accessibility in a dosage-sensitive manner. Feedback signaling abrogated E47 binding, leading to a decline in accessibility. Conversely, enforced expression of E47 induced TCRbeta gene rearrangement by antagonizing feedback inhibition. Thus, the abundance of E47 is rate limiting in locus activation, and feedback signaling downregulates E47 activity to ensure allelic exclusion. PMID:18093539

  12. Identification of a novel basic helix-loop-helix-PAS factor, NXF, reveals a Sim2 competitive, positive regulatory role in dendritic-cytoskeleton modulator drebrin gene expression.

    PubMed

    Ooe, Norihisa; Saito, Koichi; Mikami, Nobuyoshi; Nakatuka, Iwao; Kaneko, Hideo

    2004-01-01

    Sim2, a basic helix-loop-helix (bHLH)-PAS transcriptional repressor, is thought to be involved in some symptoms of Down's syndrome. In the course of searching for hypothetical Sim2 relatives, we isolated another bHLH-PAS factor, NXF. NXF was a novel gene and was selectively expressed in neuronal tissues. While no striking homolog of NXF was found in vertebrates, a Caenorhabditis elegans putative transcription factor, C15C8.2, showed similarity in the bHLH-PAS domain. NXF had an activation domain as a transcription activator, and Arnt-type bHLH-PAS subfamily members were identified as the heterodimer partners of NXF. The NXF/Arnt heterodimer was capable of binding and activating a subset of Sim2/Arnt target DNA variants, and Sim2 could compete with the NXF activity on the elements. We showed that Drebrin had several such NXF/Arnt binding elements on the promoter, which could be direct or indirect cross talking points between NXF (activation) and Sim2 (repression) action. Drebrin has been reported to be engaged in dendritic-cytoskeleton modulation at synapses, and such a novel NXF signaling system on neural gene promoter may be a molecular target of the adverse effects of Sim2 in the mental retardation of Down's syndrome. PMID:14701734

  13. RETARDED GROWTH OF EMBRYO1, a New Basic Helix-Loop-Helix Protein, Expresses in Endosperm to Control Embryo Growth1[W

    PubMed Central

    Kondou, Youichi; Nakazawa, Miki; Kawashima, Mika; Ichikawa, Takanari; Yoshizumi, Takeshi; Suzuki, Kumiko; Ishikawa, Akie; Koshi, Tomoko; Matsui, Ryo; Muto, Shu; Matsui, Minami

    2008-01-01

    We have isolated two dominant mutants from screening approximately 50,000 RIKEN activation-tagging lines that have short inflorescence internodes. The activation T-DNAs were inserted near a putative basic helix-loop-helix (bHLH) gene and expression of this gene was increased in the mutant lines. Overexpression of this bHLH gene produced the original mutant phenotype, indicating it was responsible for the mutants. Specific expression was observed during seed development. The loss-of-function mutation of the RETARDED GROWTH OF EMBRYO1 (RGE1) gene caused small and shriveled seeds. The embryo of the loss-of-function mutant showed retarded growth after the heart stage although abnormal morphogenesis and pattern formation of the embryo and endosperm was not observed. We named this bHLH gene RGE1. RGE1 expression was determined in endosperm cells using the β-glucuronidase reporter gene and reverse transcription-polymerase chain reaction. Microarray and real-time reverse transcription-polymerase chain reaction analysis showed specific down-regulation of putative GDSL motif lipase genes in the rge1-1 mutant, indicating possible involvement of these genes in seed morphology. These data suggest that RGE1 expression in the endosperm at the heart stage of embryo development plays an important role in controlling embryo growth. PMID:18567831

  14. Endosperm breakdown in Arabidopsis requires heterodimers of the basic helix-loop-helix proteins ZHOUPI and INDUCER OF CBP EXPRESSION 1.

    PubMed

    Denay, Grégoire; Creff, Audrey; Moussu, Steven; Wagnon, Pauline; Thévenin, Johanne; Gérentes, Marie-France; Chambrier, Pierre; Dubreucq, Bertrand; Ingram, Gwyneth

    2014-03-01

    In Arabidopsis seeds, embryo growth is coordinated with endosperm breakdown. Mutants in the endosperm-specific gene ZHOUPI (ZOU), which encodes a unique basic helix-loop-helix (bHLH) transcription factor, have an abnormal endosperm that persists throughout seed development, significantly impeding embryo growth. Here we show that loss of function of the bHLH-encoding gene INDUCER OF CBP EXPRESSION 1 (ICE1) causes an identical endosperm persistence phenotype. We show that ZOU and ICE1 are co-expressed in the endosperm and interact in yeast via their bHLH domains. We show both genetically and in a heterologous plant system that, despite the fact that both ZOU and ICE1 can form homodimers in yeast, their role in endosperm breakdown requires their heterodimerization. Consistent with this conclusion, we confirm that ZOU and ICE1 regulate the expression of common target genes in the developing endosperm. Finally, we show that heterodimerization of ZOU and ICE1 is likely to be necessary for their binding to specific targets, rather than for their nuclear localization in the endosperm. By comparing our results with paradigms of bHLH function and evolution in animal systems we propose that the ZOU/ICE1 complex might have ancient origins, acquiring novel megagametophyte-specific functions in heterosporous land plants that were conserved in the angiosperm endosperm. PMID:24553285

  15. Mutations of TCF12, encoding a basic-helix-loop-helix partner of TWIST1, are a frequent cause of coronal craniosynostosis

    PubMed Central

    Sharma, Vikram P; Fenwick, Aimée L; Brockop, Mia S; McGowan, Simon J; Goos, Jacqueline A C; Hoogeboom, A Jeannette M; Brady, Angela F; Jeelani, N u Owase; Lynch, Sally Ann; Mulliken, John B; Murray, Dylan J; Phipps, Julie M; Sweeney, Elizabeth; Tomkins, Susan E; Wilson, Louise C; Bennett, Sophia; Cornall, Richard J; Broxholme, John; Kanapin, Alexander; Johnson, David; Wall, Steven A; van der Spek, Peter J; Mathijssen, Irene M J; Maxson, Robert E; Twigg, Stephen R F; Wilkie, Andrew O M

    2013-01-01

    Craniosynostosis, the premature fusion of the cranial sutures, is a heterogeneous disorder with a prevalence of ~1 in 2,200 (refs. 1,2). A specific genetic etiology can be identified in ~21% of cases3, including mutations of TWIST1, which encodes a class II basic helix-loop-helix (bHLH) transcription factor, and causes Saethre-Chotzen syndrome, typically associated with coronal synostosis4-6. Starting with an exome sequencing screen, we identified 38 heterozygous TCF12 mutations in 347 samples from unrelated individuals with craniosynostosis. The mutations predominantly occurred in patients with coronal synostosis and accounted for 32% and 10% of subjects with bilateral and unilateral pathology, respectively. TCF12 encodes one of three class I E-proteins that heterodimerize with class II bHLH proteins such as TWIST1. We show that TCF12 and TWIST1 act synergistically in a transactivation assay, and that mice doubly heterozygous for loss-of-function mutations in Tcf12 and Twist1 exhibit severe coronal synostosis. Hence, the dosage of TCF12/TWIST1 heterodimers is critical for coronal suture development. PMID:23354436

  16. Mutations in TCF12, encoding a basic helix-loop-helix partner of TWIST1, are a frequent cause of coronal craniosynostosis.

    PubMed

    Sharma, Vikram P; Fenwick, Aimée L; Brockop, Mia S; McGowan, Simon J; Goos, Jacqueline A C; Hoogeboom, A Jeannette M; Brady, Angela F; Jeelani, Nu Owase; Lynch, Sally Ann; Mulliken, John B; Murray, Dylan J; Phipps, Julie M; Sweeney, Elizabeth; Tomkins, Susan E; Wilson, Louise C; Bennett, Sophia; Cornall, Richard J; Broxholme, John; Kanapin, Alexander; Johnson, David; Wall, Steven A; van der Spek, Peter J; Mathijssen, Irene M J; Maxson, Robert E; Twigg, Stephen R F; Wilkie, Andrew O M

    2013-03-01

    Craniosynostosis, the premature fusion of the cranial sutures, is a heterogeneous disorder with a prevalence of ∼1 in 2,200 (refs. 1,2). A specific genetic etiology can be identified in ∼21% of cases, including mutations of TWIST1, which encodes a class II basic helix-loop-helix (bHLH) transcription factor, and causes Saethre-Chotzen syndrome, typically associated with coronal synostosis. Using exome sequencing, we identified 38 heterozygous TCF12 mutations in 347 samples from unrelated individuals with craniosynostosis. The mutations predominantly occurred in individuals with coronal synostosis and accounted for 32% and 10% of subjects with bilateral and unilateral pathology, respectively. TCF12 encodes one of three class I E proteins that heterodimerize with class II bHLH proteins such as TWIST1. We show that TCF12 and TWIST1 act synergistically in a transactivation assay and that mice doubly heterozygous for loss-of-function mutations in Tcf12 and Twist1 have severe coronal synostosis. Hence, the dosage of TCF12-TWIST1 heterodimers is critical for normal coronal suture development. PMID:23354436

  17. PIL5, a Phytochrome-Interacting Basic Helix-Loop-Helix Protein, Is a Key Negative Regulator of Seed Germination in Arabidopsis thalianaW⃞

    PubMed Central

    Oh, Eunkyoo; Kim, Jonghyun; Park, Eunae; Kim, Jeong-Il; Kang, Changwon; Choi, Giltsu

    2004-01-01

    The first decision made by an angiosperm seed, whether to germinate or not, is based on integration of various environmental signals such as water and light. The phytochromes (Phys) act as red and far-red light (Pfr) photoreceptors to mediate light signaling through yet uncharacterized pathways. We report here that the PIF3-like 5 (PIL5) protein, a basic helix-loop-helix transcription factor, is a key negative regulator of phytochrome-mediated seed germination. PIL5 preferentially interacts with the Pfr forms of Phytochrome A (PhyA) and Phytochrome B (PhyB). Analyses of a pil5 mutant in conjunction with phyA and phyB mutants, a pif3 pil5 double mutant, and PIL5 overexpression lines indicate that PIL5 is a negative factor in Phy-mediated promotion of seed germination, inhibition of hypocotyl negative gravitropism, and inhibition of hypocotyl elongation. Our data identify PIL5 as the first Phy-interacting protein that regulates seed germination. PMID:15486102

  18. The basic helix-loop-helix transcription factor family in the sacred lotus, Nelumbo nucifera

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Nelumbo nucifera (Sacred Lotus) is a basal eudicot with exceptional physiological and metabolic properties including seed longevity, adaptations for an aquatic habit, and floral thermiogenesis. It also occupies a unique position in the phylogeny of land plants and can be a useful species for studies...

  19. Net (ERP/SAP2) one of the Ras-inducible TCFs, has a novel inhibitory domain with resemblance to the helix-loop-helix motif.

    PubMed

    Maira, S M; Wurtz, J M; Wasylyk, B

    1996-11-01

    The three ternary complex factors (TCFs), Net (ERP/ SAP-2), ELK-1 and SAP-1, are highly related ets oncogene family members that participate in the response of the cell to Ras and growth signals. Understanding the different roles of these factors will provide insights into how the signals result in coordinate regulation of the cell. We show that Net inhibits transcription under basal conditions, in which SAP-1a is inactive and ELK-1 stimulates. Repression is mediated by the NID, the Net Inhibitory Domain of about 50 amino acids, which autoregulates the Net protein and also inhibits when it is isolated in a heterologous fusion protein. Net is particularly sensitive to Ras activation. Ras activates Net through the C-domain, which is conserved between the three TCFs, and the NID is an efficient inhibitor of Ras activation. The NID, as well as more C-terminal sequences, inhibit DNA binding. Net is more refractory to DNA binding than the other TCFs, possibly due to the presence of multiple inhibitory elements. The NID may adopt a helix-loop-helix (HLH) structure, as evidenced by homology to other HLH motifs, structure predictions, model building and mutagenesis of critical residues. The sequence resemblance with myogenic factors suggested that Net may form complexes with the same partners. Indeed, we found that Net can interact in vivo with the basic HLH factor, E47. We propose that Net is regulated at the level of its latent DNA-binding activity by protein interactions and/or phosphorylation. Net may form complexes with HLH proteins as well as SRF on specific promotor sequences. The identification of the novel inhibitory domain provides a new inroad into exploring the different roles of the ternary complex factors in growth control and transformation. PMID:8918463

  20. A basic-region helix-loop-helix protein-encoding gene (devR) involved in the development of Aspergillus nidulans.

    PubMed

    Tüncher, André; Reinke, Hans; Martic, Goran; Caruso, Maria Louise; Brakhage, Axel A

    2004-04-01

    Basic-region helix-loop-helix (bHLH) proteins form an interesting class of eukaryotic transcription factors often involved in developmental processes. Here, a so far unknown bHLH protein-encoding gene of the filamentous ascomycete Aspergillus nidulans was isolated and designated devR for regulator of development. Deletion of devR revealed that the gene is non-essential for vegetative growth. However, the deletion mutant produced wrinkled colonies, a yellow pigment and did not form conidia on minimal agar plates. Conidiophore development was initiated normally, and colonies produced conidiophores with metulae and phialides. However, the phialides continued to grow filamentously and produced a second conidiophore with a vesicle at its end. The addition of KCl (0.6 M) to the medium suppressed the knock-out phenotype. The DeltadevR phenotype resembled that of a mutation in the tcsA gene encoding a histidine kinase domain and a response regulator domain. Here, we generated a tcsA deletion mutant. In a DeltatcsA strain, a DevR-Egfp protein fusion was detected in the cytoplasm, whereas in the wild type, the protein fusion was exclusively located in the nuclei, indicating that TcsA is required for nuclear localization of DevR. devR mRNA steady-state levels were similar in sporulating and vegetatively growing mycelia, and independent of a functional brlA gene. Moreover, under all conditions tested, self-crossing of the DeltadevR mutant strain was never observed. Taken together, devR encodes a bHLH regulatory protein that is part of the tcsA signal transduction network and required for development under standard growth conditions. PMID:15049823

  1. Enhancer of splitD, a dominant mutation of Drosophila, and its use in the study of functional domains of a helix-loop-helix protein.

    PubMed Central

    Tietze, K; Oellers, N; Knust, E

    1992-01-01

    Helix-loop-helix proteins play important roles in developmental processes, such as myogenesis, neurogenesis, and sex determination. The gene Enhancer of split [E(spl)] of Drosophila, a member of a gene complex that is involved in early neurogenesis, encodes a protein with a basic domain and a helix-loop-helix motif. We took advantage of a dominant mutation of this gene, E(spl)D, to define in vivo structural features of this protein for proper function. The mutation renders the otherwise recessive eye phenotype of spl dominant. By germ-line transformation of different in vitro mutagenized versions of the E(spl) gene, we could demonstrate that the basic domain of this helix-loop-helix protein is functional and necessary for expression of the dominant phenotype. These results are supported by in vitro DNA-binding assays, which showed that the basic domain is in fact necessary for DNA binding, despite the presence of a proline residue. Furthermore, we could show that the dominant enhancement of spl is caused by truncation of the E(SPL)D protein in combination with deletion of a putative regulatory element. Images PMID:1631102

  2. Peptide and metal ion-dependent association of isolated helix-loop-helix calcium binding domains: studies of thrombic fragments of calmodulin.

    PubMed Central

    Brokx, R. D.; Vogel, H. J.

    2000-01-01

    Calmodulin (CaM), the ubiquitous, eukaryotic, bilobal calcium-binding regulatory protein, has been cleaved by thrombin to create two fragments. TM1 (1-106) and TM2 (107-148). NMR and CD results indicate that TMI and TM2 can associate in the presence of Ca2+ to form a complex similar to native CaM, even though the cleavage site is not in the linker region between two helix-loop-helix domains, but rather within an alpha-helix. Cadmium-113 NMR results show that this complex has enhanced metal-ion binding properties when compared to either TM1 or TM2 alone. This complex can bind several CaM-binding target peptides, as shown by gel bandshift assays, circular dichroism spectra, and 13C NMR spectra of biosynthetically methyl-13C-Met-labeled TM1 and TM2; moreover, gel bandshift assays show that the addition of a target peptide strengthens the interactions between TM1 and TM2 and increases the stability of the complex. Cadmium-113 NMR spectra indicate that the TM1:TM2 complex can also bind the antipsychotic drug trifluoperazine. However, in contrast to CaM:peptide complexes, the TM1:TM2:peptide complexes are disrupted by 4 M urea; moreover, TM1 and TM2 in combination are unable to activate CaM-dependent enzymes. This suggests that TM1:TM2 mixtures cannot bind target molecules as tightly as intact CaM, or perhaps that binding occurs but additional interactions with the target enzymes that are necessary for proper activation are perturbed by the proteolytic cleavage. The results presented here reflect the importance of the existence of helix-loop-helix Ca2+-binding domains in pairs in proteins such as CaM, and extend the understanding of the association of such domains in this class of proteins in general. PMID:10850806

  3. The Drosophila dysfusion basic helix-loop-helix (bHLH)-PAS gene controls tracheal fusion and levels of the trachealess bHLH-PAS protein.

    PubMed

    Jiang, Lan; Crews, Stephen T

    2003-08-01

    The development of the mature insect trachea requires a complex series of cellular events, including tracheal cell specification, cell migration, tubule branching, and tubule fusion. Here we describe the identification of the Drosophila melanogaster dysfusion gene, which encodes a novel basic helix-loop-helix (bHLH)-PAS protein conserved between Caenorhabditis elegans, insects, and humans, and controls tracheal fusion events. The Dysfusion protein functions as a heterodimer with the Tango bHLH-PAS protein in vivo to form a putative DNA-binding complex. The dysfusion gene is expressed in a variety of embryonic cell types, including tracheal-fusion, leading-edge, foregut atrium cells, nervous system, hindgut, and anal pad cells. RNAi experiments indicate that dysfusion is required for dorsal branch, lateral trunk, and ganglionic branch fusion but not for fusion of the dorsal trunk. The escargot gene, which is also expressed in fusion cells and is required for tracheal fusion, precedes dysfusion expression. Analysis of escargot mutants indicates a complex pattern of dysfusion regulation, such that dysfusion expression is dependent on escargot in the dorsal and ganglionic branches but not the dorsal trunk. Early in tracheal development, the Trachealess bHLH-PAS protein is present at uniformly high levels in all tracheal cells, but since the levels of Dysfusion rise in wild-type fusion cells, the levels of Trachealess in fusion cells decline. The downregulation of Trachealess is dependent on dysfusion function. These results suggest the possibility that competitive interactions between basic helix-loop-helix-PAS proteins (Dysfusion, Trachealess, and possibly Similar) may be important for the proper development of the trachea. PMID:12897136

  4. A Cyclized Helix-Loop-Helix Peptide as a Molecular Scaffold for the Design of Inhibitors of Intracellular Protein-Protein Interactions by Epitope and Arginine Grafting.

    PubMed

    Fujiwara, Daisuke; Kitada, Hidekazu; Oguri, Masahiro; Nishihara, Toshio; Michigami, Masataka; Shiraishi, Kazunori; Yuba, Eiji; Nakase, Ikuhiko; Im, Haeri; Cho, Sunhee; Joung, Jong Young; Kodama, Seiji; Kono, Kenji; Ham, Sihyun; Fujii, Ikuo

    2016-08-26

    The design of inhibitors of intracellular protein-protein interactions (PPIs) remains a challenge in chemical biology and drug discovery. We propose a cyclized helix-loop-helix (cHLH) peptide as a scaffold for generating cell-permeable PPI inhibitors through bifunctional grafting: epitope grafting to provide binding activity, and arginine grafting to endow cell-permeability. To inhibit p53-HDM2 interactions, the p53 epitope was grafted onto the C-terminal helix and six Arg residues were grafted onto another helix. The designed peptide cHLHp53-R showed high inhibitory activity for this interaction, and computational analysis suggested a binding mode for HDM2. Confocal microscopy of cells treated with fluorescently labeled cHLHp53-R revealed cell membrane penetration and cytosolic localization. The peptide inhibited the growth of HCT116 and LnCap cancer cells. This strategy of bifunctional grafting onto a well-structured peptide scaffold could facilitate the generation of inhibitors for intracellular PPIs. PMID:27467415

  5. B-lymphocyte development is regulated by the combined dosage of three basic helix-loop-helix genes, E2A, E2-2, and HEB.

    PubMed Central

    Zhuang, Y; Cheng, P; Weintraub, H

    1996-01-01

    B-lymphocyte development requires the basic helix-loop-helix proteins encoded by the E2A gene. In this study, the control mechanism of E2A was further explored by disruption of the E2A-related genes, E2-2 and HEB. In contrast to E2A, E2-2 and HEB are not essential for the establishment of the B-cell lineage. However, both E2-2 and HEB are required for the generation of the normal numbers of pro-B cells in mouse embryos. Breeding tests among mice carrying different mutations revealed that E2-2 and HEB interact with E2A in many developmental processes including generation of B cells. Specifically, mice transheterozygous for any two mutations of these three genes produced fewer pro-B cells than the singly heterozygous littermates. This study indicates that B-cell development is dependent not only on an essential function provided by the E2A gene but also on a combined dosage set by E2A, E2-2, and HEB. PMID:8649400

  6. Effects of postweaning administration of conjugated linoleic acid on development of obesity in nescient basic helix-loop-helix 2 knockout mice.

    PubMed

    Kim, Yoo; Kim, Daeyoung; Good, Deborah J; Park, Yeonhwa

    2015-06-01

    Conjugated linoleic acid (CLA) has been reported to prevent body weight gain and fat accumulation in part by improving physical activity in mice. However, the effects of postweaning administration of CLA on the development of obesity later in life have not yet been demonstrated. The current study investigated the role of postweaning CLA treatment on skeletal muscle energy metabolism in genetically induced inactive adult-onset obese model, nescient basic helix-loop-helix 2 knockout (N2KO) mice. Four-week-old male N2KO and wild type mice were fed either control or a CLA-containing diet (0.5%) for 4 weeks, and then CLA was withdrawn and control diet provided to all mice for the following 8 weeks. Postweaning CLA supplementation in wild type animals, but not N2KO mice, may activate AMP-activated protein kinase (AMPK) and peroxisome proliferator-activated receptor-δ (PPARδ) as well as promote desensitization of phosphatase and tensin homologue (PTEN) and sensitization of protein kinase B (AKT) at threonine 308 in gastrocnemius skeletal muscle, improving voluntary activity and glucose homeostasis. We suggest that postweaning administration of CLA may in part stimulate the underlying molecular targets involved in muscle energy metabolism to reduce weight gain in normal animals, but not in the genetically induced inactive adult-onset animal model. PMID:25976059

  7. Reovirus FAST Proteins Drive Pore Formation and Syncytiogenesis Using a Novel Helix-Loop-Helix Fusion-Inducing Lipid Packing Sensor

    PubMed Central

    Sarker, Muzaddid; de Antueno, Roberto; Langelaan, David N.; Parmar, Hiren B.; Shin, Kyungsoo; Rainey, Jan K.; Duncan, Roy

    2015-01-01

    Pore formation is the most energy-demanding step during virus-induced membrane fusion, where high curvature of the fusion pore rim increases the spacing between lipid headgroups, exposing the hydrophobic interior of the membrane to water. How protein fusogens breach this thermodynamic barrier to pore formation is unclear. We identified a novel fusion-inducing lipid packing sensor (FLiPS) in the cytosolic endodomain of the baboon reovirus p15 fusion-associated small transmembrane (FAST) protein that is essential for pore formation during cell-cell fusion and syncytiogenesis. NMR spectroscopy and mutational studies indicate the dependence of this FLiPS on a hydrophobic helix-loop-helix structure. Biochemical and biophysical assays reveal the p15 FLiPS preferentially partitions into membranes with high positive curvature, and this partitioning is impeded by bis-ANS, a small molecule that inserts into hydrophobic defects in membranes. Most notably, the p15 FLiPS can be functionally replaced by heterologous amphipathic lipid packing sensors (ALPS) but not by other membrane-interactive amphipathic helices. Furthermore, a previously unrecognized amphipathic helix in the cytosolic domain of the reptilian reovirus p14 FAST protein can functionally replace the p15 FLiPS, and is itself replaceable by a heterologous ALPS motif. Anchored near the cytoplasmic leaflet by the FAST protein transmembrane domain, the FLiPS is perfectly positioned to insert into hydrophobic defects that begin to appear in the highly curved rim of nascent fusion pores, thereby lowering the energy barrier to stable pore formation. PMID:26061049

  8. Characterization of npas3, a novel basic helix-loop-helix PAS gene expressed in the developing mouse nervous system.

    PubMed

    Brunskill, E W; Witte, D P; Shreiner, A B; Potter, S S

    1999-11-01

    Here we describe the cloning and expression pattern of a new bHLH-PAS domain gene, Npas3. Npas3 shares 50.2% amino acid sequence identity with Npas1 and a lesser similarity with other members of the bHLH-PAS domain family of transcription factors. Northern blot analysis detected Npas3 mRNA between 11.5 and 17.5 d.p.c. in embryonic development and exclusively in the adult brain. Whole-mount and section in situ hybridization assays revealed expression of Npas3 between 9.5 and 11.5 d.p.c. in the developing neural tube. In addition, Npas3 mRNA was expressed throughout the neuroepithelium of the developing central nervous system between 10. 5 and 12.5 d.p.c. Interestingly, at 14.5 d.p.c., the expression of Npas3 mRNA became restricted to the neopallial layer of the cortex. At 12.5 d.p.c., Npas3 mRNA was evident in nonneural tissues such as the developing dermis and mesenchyme surrounding the otic and nasal placodes. Expression was also detected in the developing cardiac valves, limb and developing kidney. PMID:10534623

  9. Differential transcriptional regulation by mouse single-minded 2s.

    PubMed

    Metz, Richard P; Kwak, Hyeong-Il; Gustafson, Tanya; Laffin, Brian; Porter, Weston W

    2006-04-21

    Single-minded 1 and 2 are unique members of the basic helix-loop-helix Per-Arnt-Sim family as they are transcriptional repressors. Here we report the identification and transcriptional characterization of mouse Sim2s, a splice variant of Sim2, which is missing the carboxyl Pro/Ala-rich repressive domain. Sim2s is expressed at high levels in kidney and skeletal muscle; however, the ratio of Sim2 to Sim2s mRNA differs between these tissues. Similar to full-length Sim2, Sim2s interacts with Arnt and to a lesser extent, Arnt2. The effects of Sim2s on transcriptional regulation through hypoxia, dioxin, and central midline response elements are different than that of full-length Sim2. Specifically, Sim2s exerts a less repressive effect on hypoxia-induced gene expression than full-length Sim2, but is just as effective as Sim2 at repressing TCDD-induced gene expression from a dioxin response element. Interestingly, Sim2s bind to and activates expression from a central midline response element-controlled reporter through an Arnt transactivation domain-dependent mechanism. The differences in expression pattern, protein interactions, and transcriptional activities between Sim2 and Sim2s may reflect differential roles each isoform plays during development or in tissue-specific effects on other protein-mediated pathways. PMID:16484282

  10. Responses of a triple mutant defective in three iron deficiency-induced Basic Helix-Loop-Helix genes of the subgroup Ib(2) to iron deficiency and salicylic acid.

    PubMed

    Maurer, Felix; Naranjo Arcos, Maria Augusta; Bauer, Petra

    2014-01-01

    Plants are sessile organisms that adapt to external stress by inducing molecular and physiological responses that serve to better cope with the adverse growth condition. Upon low supply of the micronutrient iron, plants actively increase the acquisition of soil iron into the root and its mobilization from internal stores. The subgroup Ib(2) BHLH genes function as regulators in this response, however their concrete functions are not fully understood. Here, we analyzed a triple loss of function mutant of BHLH39, BHLH100 and BHLH101 (3xbhlh mutant). We found that this mutant did not have any iron uptake phenotype if iron was provided. However, under iron deficiency the mutant displayed a more severe leaf chlorosis than the wild type. Microarray-based transcriptome analysis revealed that this mutant phenotype resulted in the mis-regulation of 198 genes, out of which only 15% were associated with iron deficiency regulation itself. A detailed analysis revealed potential targets of the bHLH transcription factors as well as genes reflecting an exaggerated iron deficiency response phenotype. Since the BHLH genes of this subgroup have been brought into the context of the plant hormone salicylic acid, we investigated whether the 3xbhlh mutant might have been affected by this plant signaling molecule. Although a very high number of genes responded to SA, also in a differential manner between mutant and wild type, we did not find any indication for an association of the BHLH gene functions in SA responses upon iron deficiency. In summary, our study indicates that the bHLH subgroup Ib(2) transcription factors do not only act in iron acquisition into roots but in other aspects of the adaptation to iron deficiency in roots and leaves. PMID:24919188

  11. Responses of a Triple Mutant Defective in Three Iron Deficiency-Induced BASIC HELIX-LOOP-HELIX Genes of the Subgroup Ib(2) to Iron Deficiency and Salicylic Acid

    PubMed Central

    Maurer, Felix; Naranjo Arcos, Maria Augusta; Bauer, Petra

    2014-01-01

    Plants are sessile organisms that adapt to external stress by inducing molecular and physiological responses that serve to better cope with the adverse growth condition. Upon low supply of the micronutrient iron, plants actively increase the acquisition of soil iron into the root and its mobilization from internal stores. The subgroup Ib(2) BHLH genes function as regulators in this response, however their concrete functions are not fully understood. Here, we analyzed a triple loss of function mutant of BHLH39, BHLH100 and BHLH101 (3xbhlh mutant). We found that this mutant did not have any iron uptake phenotype if iron was provided. However, under iron deficiency the mutant displayed a more severe leaf chlorosis than the wild type. Microarray-based transcriptome analysis revealed that this mutant phenotype resulted in the mis-regulation of 198 genes, out of which only 15% were associated with iron deficiency regulation itself. A detailed analysis revealed potential targets of the bHLH transcription factors as well as genes reflecting an exaggerated iron deficiency response phenotype. Since the BHLH genes of this subgroup have been brought into the context of the plant hormone salicylic acid, we investigated whether the 3xbhlh mutant might have been affected by this plant signaling molecule. Although a very high number of genes responded to SA, also in a differential manner between mutant and wild type, we did not find any indication for an association of the BHLH gene functions in SA responses upon iron deficiency. In summary, our study indicates that the bHLH subgroup Ib(2) transcription factors do not only act in iron acquisition into roots but in other aspects of the adaptation to iron deficiency in roots and leaves. PMID:24919188

  12. Functional diversification of the potato R2R3 MYB anthocyanin activators AN1, MYBA1, and MYB113 and their interaction with basic helix-loop-helix cofactors.

    PubMed

    Liu, Yuhui; Lin-Wang, Kui; Espley, Richard V; Wang, Li; Yang, Hongyu; Yu, Bin; Dare, Andrew; Varkonyi-Gasic, Erika; Wang, Jing; Zhang, Junlian; Wang, Di; Allan, Andrew C

    2016-04-01

    In potato (Solanum tuberosumL.), R2R3 MYBs are involved in the regulation of anthocyanin biosynthesis. We examined sequences of these MYBs in cultivated potatoes, which are more complex than diploid potato due to ploidy and heterozygosity. We found amino acid variants in the C-terminus of the MYB StAN1, termed R0, R1, and R3, due to the presence of a repeated 10-amino acid motif. These variant MYBs showed some expression in both white and pigmented tubers. We found several new alleles or gene family members of R2R3 MYBs,StMYBA1andStMYB113, which were also expressed in white potato tubers. From functional analysis in tobacco, we showed that the presence of a C-terminal 10-amino acid motif is optimal for activating anthocyanin accumulation. Engineering a motif back into a MYB lacking this sequence enhanced its activating ability. Versions ofStMYBA1andStMYB113can also activate anthocyanin accumulation in tobacco leaves, with the exception ofStMYB113-3, which has a partial R2R3 domain. We isolated five family members of potatoStbHLH1, and oneStJAF13, to test their ability to interact with MYB variants. The results showed that two alleles ofStbHLH1from white skin and red skin are non-functional, while three otherStbHLH1s have different co-regulating abilities, and need to be activated by StJAF13. Combined with expression analysis in potato tuber, results suggest thatStbHLH1andStJAF13are key co-regulators of anthocyanin biosynthesis, while the transcripts of MYB variantsStAN1,StMYBA1, andStMYB113are well expressed, even in the absence of pigmentation. PMID:26884602

  13. Functional diversification of the potato R2R3 MYB anthocyanin activators AN1, MYBA1, and MYB113 and their interaction with basic helix-loop-helix cofactors

    PubMed Central

    Liu, Yuhui; Lin-Wang, Kui; Espley, Richard V.; Wang, Li; Yang, Hongyu; Yu, Bin; Dare, Andrew; Varkonyi-Gasic, Erika; Wang, Jing; Zhang, Junlian; Wang, Di; Allan, Andrew C.

    2016-01-01

    In potato (Solanum tuberosum L.), R2R3 MYBs are involved in the regulation of anthocyanin biosynthesis. We examined sequences of these MYBs in cultivated potatoes, which are more complex than diploid potato due to ploidy and heterozygosity. We found amino acid variants in the C-terminus of the MYB StAN1, termed R0, R1, and R3, due to the presence of a repeated 10-amino acid motif. These variant MYBs showed some expression in both white and pigmented tubers. We found several new alleles or gene family members of R2R3 MYBs, StMYBA1 and StMYB113, which were also expressed in white potato tubers. From functional analysis in tobacco, we showed that the presence of a C-terminal 10-amino acid motif is optimal for activating anthocyanin accumulation. Engineering a motif back into a MYB lacking this sequence enhanced its activating ability. Versions of StMYBA1 and StMYB113 can also activate anthocyanin accumulation in tobacco leaves, with the exception of StMYB113-3, which has a partial R2R3 domain. We isolated five family members of potato StbHLH1, and one StJAF13, to test their ability to interact with MYB variants. The results showed that two alleles of StbHLH1 from white skin and red skin are non-functional, while three other StbHLH1s have different co-regulating abilities, and need to be activated by StJAF13. Combined with expression analysis in potato tuber, results suggest that StbHLH1 and StJAF13 are key co-regulators of anthocyanin biosynthesis, while the transcripts of MYB variants StAN1, StMYBA1, and StMYB113 are well expressed, even in the absence of pigmentation. PMID:26884602

  14. Experimental determination of the evolvability of a transcription factor.

    PubMed

    Maerkl, Sebastian J; Quake, Stephen R

    2009-11-01

    Sequence-specific binding of a transcription factor to DNA is the central event in any transcriptional regulatory network. However, relatively little is known about the evolutionary plasticity of transcription factors. For example, the exact functional consequence of an amino acid substitution on the DNA-binding specificity of most transcription factors is currently not predictable. Furthermore, although the major structural families of transcription factors have been identified, the detailed DNA-binding repertoires within most families have not been characterized. We studied the sequence recognition code and evolvability of the basic helix-loop-helix transcription factor family by creating all possible 95 single-point mutations of five DNA-contacting residues of Max, a human helix-loop-helix transcription factor and measured the detailed DNA-binding repertoire of each mutant. Our results show that the sequence-specific repertoire of Max accessible through single-point mutations is extremely limited, and we are able to predict 92% of the naturally occurring diversity at these positions. All naturally occurring basic regions were also found to be accessible through functional intermediates. Finally, we observed a set of amino acids that are functional in vitro but are not found to be used naturally, indicating that functionality alone is not sufficient for selection. PMID:19841254

  15. High mobility group protein-mediated transcription requires DNA damage marker γ-H2AX

    PubMed Central

    Singh, Indrabahadur; Ozturk, Nihan; Cordero, Julio; Mehta, Aditi; Hasan, Diya; Cosentino, Claudia; Sebastian, Carlos; Krüger, Marcus; Looso, Mario; Carraro, Gianni; Bellusci, Saverio; Seeger, Werner; Braun, Thomas; Mostoslavsky, Raul; Barreto, Guillermo

    2015-01-01

    The eukaryotic genome is organized into chromatins, the physiological template for DNA-dependent processes including replication, recombination, repair, and transcription. Chromatin-mediated transcription regulation involves DNA methylation, chromatin remodeling, and histone modifications. However, chromatin also contains non-histone chromatin-associated proteins, of which the high-mobility group (HMG) proteins are the most abundant. Although it is known that HMG proteins induce structural changes of chromatin, the processes underlying transcription regulation by HMG proteins are poorly understood. Here we decipher the molecular mechanism of transcription regulation mediated by the HMG AT-hook 2 protein (HMGA2). We combined proteomic, ChIP-seq, and transcriptome data to show that HMGA2-induced transcription requires phosphorylation of the histone variant H2AX at S139 (H2AXS139ph; γ-H2AX) mediated by the protein kinase ataxia telangiectasia mutated (ATM). Furthermore, we demonstrate the biological relevance of this mechanism within the context of TGFβ1 signaling. The interplay between HMGA2, ATM, and H2AX is a novel mechanism of transcription initiation. Our results link H2AXS139ph to transcription, assigning a new function for this DNA damage marker. Controlled chromatin opening during transcription may involve intermediates with DNA breaks that may require mechanisms that ensure the integrity of the genome. PMID:26045162

  16. Epigenetic regulation of puberty via Zinc finger protein-mediated transcriptional repression

    PubMed Central

    Lomniczi, Alejandro; Wright, Hollis; Castellano, Juan Manuel; Matagne, Valerie; Toro, Carlos A.; Ramaswamy, Suresh; Plant, Tony M.; Ojeda, Sergio R.

    2015-01-01

    In primates, puberty is unleashed by increased GnRH release from the hypothalamus following an interval of juvenile quiescence. GWAS implicates Zinc finger (ZNF) genes in timing human puberty. Here we show that hypothalamic expression of several ZNFs decreased in agonadal male monkeys in association with the pubertal reactivation of gonadotropin secretion. Expression of two of these ZNFs, GATAD1 and ZNF573, also decreases in peripubertal female monkeys. However, only GATAD1 abundance increases when gonadotropin secretion is suppressed during late infancy. Targeted delivery of GATAD1 or ZNF573 to the rat hypothalamus delays puberty by impairing the transition of a transcriptional network from an immature repressive epigenetic configuration to one of activation. GATAD1 represses transcription of two key puberty-related genes, KISS1 and TAC3, directly, and reduces the activating histone mark H3K4me2 at each promoter via recruitment of histone demethylase KDM1A. We conclude that GATAD1 epitomizes a subset of ZNFs involved in epigenetic repression of primate puberty. PMID:26671628

  17. Amino-terminal domains of c-myc and N-myc proteins mediate binding to the retinoblastoma gene product

    NASA Astrophysics Data System (ADS)

    Rustgi, Anil K.; Dyson, Nicholas; Bernards, Rene

    1991-08-01

    THE proteins encoded by the myc gene family are involved in the control of cell proliferation and differentiation, and aberrant expression of myc proteins has been implicated in the genesis of a variety of neoplasms1. In the carboxyl terminus, myc proteins have two domains that encode a basic domain/helix-loop-helix and a leucine zipper motif, respectively. These motifs are involved both in DNA binding and in protein dimerization2-5. In addition, myc protein family members share several regions of highly conserved amino acids in their amino termini that are essential for transformation6,7. We report here that an N-terminal domain present in both the c-myc and N-myc proteins mediates binding to the retinoblastoma gene product, pRb. We show that the human papilloma virus E7 protein competes with c-myc for binding to pRb, indicating that these proteins share overlapping binding sites on pRb. Furthermore, a mutant Rb protein from a human tumour cell line that carried a 35-amino-acid deletion in its C terminus failed to bind to c-myc. Our results suggest that c-myc and pRb cooperate through direct binding to control cell proliferation.

  18. Transcriptome-Wide Identification and Expression Profiling Analysis of Chrysanthemum Trihelix Transcription Factors.

    PubMed

    Song, Aiping; Wu, Dan; Fan, Qingqing; Tian, Chang; Chen, Sumei; Guan, Zhiyong; Xin, Jingjing; Zhao, Kunkun; Chen, Fadi

    2016-01-01

    Trihelix transcription factors are thought to feature a typical DNA-binding trihelix (helix-loop-helix-loop-helix) domain that binds specifically to the GT motif, a light-responsive DNA element. Members of the trihelix family are known to function in a number of processes in plants. Here, we characterize 20 trihelix family genes in the important ornamental plant chrysanthemum (Chrysanthemum morifolium). Based on transcriptomic data, 20 distinct sequences distributed across four of five groups revealed by a phylogenetic tree were isolated and amplified. The phylogenetic analysis also identified four pairs of orthologous proteins shared by Arabidopsis and chrysanthemum and five pairs of paralogous proteins in chrysanthemum. Conserved motifs in the trihelix proteins shared by Arabidopsis and chrysanthemum were analyzed using MEME, and further bioinformatic analysis revealed that 16 CmTHs can be targeted by 20 miRNA families and that miR414 can target 9 CmTHs. qPCR results displayed that most chrysanthemum trihelix genes were highly expressed in inflorescences, while 20 CmTH genes were in response to phytohormone treatments and abiotic stresses. This work improves our understanding of the various functions of trihelix gene family members in response to hormonal stimuli and stress. PMID:26848650

  19. Transcriptome-Wide Identification and Expression Profiling Analysis of Chrysanthemum Trihelix Transcription Factors

    PubMed Central

    Song, Aiping; Wu, Dan; Fan, Qingqing; Tian, Chang; Chen, Sumei; Guan, Zhiyong; Xin, Jingjing; Zhao, Kunkun; Chen, Fadi

    2016-01-01

    Trihelix transcription factors are thought to feature a typical DNA-binding trihelix (helix-loop-helix-loop-helix) domain that binds specifically to the GT motif, a light-responsive DNA element. Members of the trihelix family are known to function in a number of processes in plants. Here, we characterize 20 trihelix family genes in the important ornamental plant chrysanthemum (Chrysanthemum morifolium). Based on transcriptomic data, 20 distinct sequences distributed across four of five groups revealed by a phylogenetic tree were isolated and amplified. The phylogenetic analysis also identified four pairs of orthologous proteins shared by Arabidopsis and chrysanthemum and five pairs of paralogous proteins in chrysanthemum. Conserved motifs in the trihelix proteins shared by Arabidopsis and chrysanthemum were analyzed using MEME, and further bioinformatic analysis revealed that 16 CmTHs can be targeted by 20 miRNA families and that miR414 can target 9 CmTHs. qPCR results displayed that most chrysanthemum trihelix genes were highly expressed in inflorescences, while 20 CmTH genes were in response to phytohormone treatments and abiotic stresses. This work improves our understanding of the various functions of trihelix gene family members in response to hormonal stimuli and stress. PMID:26848650

  20. A juvenile hormone transcription factor Bmdimm-fibroin H chain pathway is involved in the synthesis of silk protein in silkworm, Bombyx mori.

    PubMed

    Zhao, Xiao-Ming; Liu, Chun; Jiang, Li-Jun; Li, Qiong-Yan; Zhou, Meng-Ting; Cheng, Ting-Cai; Mita, Kazuei; Xia, Qing-You

    2015-01-01

    The genes responsible for silk biosynthesis are switched on and off at particular times in the silk glands of Bombyx mori. This switch appears to be under the control of endogenous and exogenous hormones. However, the molecular mechanisms by which silk protein synthesis is regulated by the juvenile hormone (JH) are largely unknown. Here, we report a basic helix-loop-helix transcription factor, Bmdimm, its silk gland-specific expression, and its direct involvement in the regulation of fibroin H-chain (fib-H) by binding to an E-box (CAAATG) element of the fib-H gene promoter. Far-Western blots, enzyme-linked immunosorbent assays, and co-immunoprecipitation assays revealed that Bmdimm protein interacted with another basic helix-loop-helix transcription factor, Bmsage. Immunostaining revealed that Bmdimm and Bmsage proteins are co-localized in nuclei. Bmdimm expression was induced in larval silk glands in vivo, in silk glands cultured in vitro, and in B. mori cell lines after treatment with a JH analog. The JH effect on Bmdimm was mediated by the JH-Met-Kr-h1 signaling pathway, and Bmdimm expression did not respond to JH by RNA interference with double-stranded BmKr-h1 RNA. These data suggest that the JH regulatory pathway, the transcription factor Bmdimm, and the targeted fib-H gene contribute to the synthesis of fibroin H-chain protein in B. mori. PMID:25371208

  1. Id transcriptional regulators in adipogenesis and adipose tissue metabolism

    PubMed Central

    Patil, Mallikarjun; Sharma, Bal Krishan; Satyanarayana, Ande

    2014-01-01

    Id proteins (Id1-Id4) are helix-loop-helix (HLH) transcriptional regulators that lack a basic DNA binding domain. They act as negative regulators of basic helixloop-helix (bHLH) transcription factors by forming heterodimers and inhibit their DNA binding and transcriptional activity. Id proteins are implicated in the regulation of various cellular mechanisms such as cell proliferation, cellular differentiation, cell fate determination, angiogenesis and tumorigenesis. A handful of recent studies also disclosed that Id proteins have critical functions in adipocyte differentiation and adipose tissue metabolism. Here, we reviewed the progress made thus far in understanding the specific functions of Id proteins in adipose tissue differentiation and metabolism. In addition to reviewing the known mechanisms of action, we also discuss possible additional mechanisms in which Id proteins might participate in regulating adipogenic and metabolic pathways. PMID:24896358

  2. The Gαi AND Gαq Proteins Mediate the Effects of Melatonin on Steroid/Thyroid Hormone Receptor Transcriptional Activity and Breast Cancer Cell Proliferation

    PubMed Central

    Lai, Ling; Yuan, Lin; Chen, Qi; Dong, Chunmin; Mao, Lulu; Rowan, Brian; Frasch, Tripp; Hill, Steven M.

    2016-01-01

    Melatonin, via its MT1 receptor, but not the MT2 receptor, can modulate the transcriptional activity of various nuclear receptors (ERα and RARα, but not ERβ) in MCF-7, T47D and ZR-75-1 human breast cancer cell lines. The anti-proliferative and nuclear receptor modulatory actions of melatonin are mediated via the MT1 G protein-coupled receptor expressed in human breast cancer cells. However, the specific G proteins and associated pathways involved in nuclear receptor transcriptional regulation by melatonin are not yet clear. Upon activation, the MT1 receptor specifically couples to the Gαi2, Gαi3, Gαq and Gαll proteins, and via activation of Gαi2 proteins, melatonin suppresses forskolin-induced cyclic AMP (cAMP) production, while melatonin activation of Gαq, is able to inhibit phospholipid hydrolysis and ATP’s induction of inositol triphosphate (IP3) production in MCF-7 breast cancer cells. Employing dominant-negative (DN) and dominant-positive (DP) forms of these G proteins we demonstrate that Gαi2 proteins mediate the suppression of estrogen-induced ERα transcriptional activity by melatonin, while the Gq protein mediates the enhancement of retinoid-induced RARα transcriptional activity by melatonin. However, the growth-inhibitory actions of melatonin are mediated via both Gαi2 and Gαq proteins. PMID:18705646

  3. The Transcriptional Coregulator LEUNIG_HOMOLOG Inhibits Light-Dependent Seed Germination in Arabidopsis.

    PubMed

    Lee, Nayoung; Park, Jeongmoo; Kim, Keunhwa; Choi, Giltsu

    2015-08-01

    PHYTOCHROME-INTERACTING FACTOR1 (PIF1) is a basic helix-loop-helix transcription factor that inhibits light-dependent seed germination in Arabidopsis thaliana. However, it remains unclear whether PIF1 requires other factors to regulate its direct targets. Here, we demonstrate that LEUNIG_HOMOLOG (LUH), a Groucho family transcriptional corepressor, binds to PIF1 and coregulates its targets. Not only are the transcriptional profiles of the luh and pif1 mutants remarkably similar, more than 80% of the seeds of both genotypes germinate in the dark. We show by chromatin immunoprecipitation that LUH binds a subset of PIF1 targets in a partially PIF1-dependent manner. Unexpectedly, we found LUH binds and coregulates not only PIF1-activated targets but also PIF1-repressed targets. Together, our results indicate LUH functions with PIF1 as a transcriptional coregulator to inhibit seed germination. PMID:26276832

  4. Direct detection of transcription factors in cotyledons during seedling development using sensitive silicon-substrate photonic crystal protein arrays.

    PubMed

    Jones, Sarah I; Tan, Yafang; Shamimuzzaman, Md; George, Sherine; Cunningham, Brian T; Vodkin, Lila

    2015-03-01

    Transcription factors control important gene networks, altering the expression of a wide variety of genes, including those of agronomic importance, despite often being expressed at low levels. Detecting transcription factor proteins is difficult, because current high-throughput methods may not be sensitive enough. One-dimensional, silicon-substrate photonic crystal (PC) arrays provide an alternative substrate for printing multiplexed protein microarrays that have greater sensitivity through an increased signal-to-noise ratio of the fluorescent signal compared with performing the same assay upon a traditional aminosilanized glass surface. As a model system to test proof of concept of the silicon-substrate PC arrays to directly detect rare proteins in crude plant extracts, we selected representatives of four different transcription factor families (zinc finger GATA, basic helix-loop-helix, BTF3/NAC [for basic transcription factor of the NAC family], and YABBY) that have increasing transcript levels during the stages of seedling cotyledon development. Antibodies to synthetic peptides representing the transcription factors were printed on both glass slides and silicon-substrate PC slides along with antibodies to abundant cotyledon proteins, seed lectin, and Kunitz trypsin inhibitor. The silicon-substrate PC arrays proved more sensitive than those performed on glass slides, detecting rare proteins that were below background on the glass slides. The zinc finger transcription factor was detected on the PC arrays in crude extracts of all stages of the seedling cotyledons, whereas YABBY seemed to be at the lower limit of their sensitivity. Interestingly, the basic helix-loop-helix and NAC proteins showed developmental profiles consistent with their transcript patterns, indicating proof of concept for detecting these low-abundance proteins in crude extracts. PMID:25635113

  5. Modified bimolecular fluorescence complementation assay to study the inhibition of transcription complex formation by JAZ proteins.

    PubMed

    Qi, Tiancong; Song, Susheng; Xie, Daoxin

    2013-01-01

    The jasmonate (JA) ZIM-domain (JAZ) proteins of Arabidopsis thaliana repress JA signaling and negatively regulate the JA responses. Recently, JAZ proteins have been found to inhibit the transcriptional function of several transcription factors, among which the basic helix-loop-helix (bHLH) (GLABRA3 [GL3], ENHANCER OF GLABRA3 [EGL3], and TRANSPARENT TESTA8 [TT8]) and R2R3-MYB (GL1 and MYB75) that can interact with each other to form bHLH-MYB complexes and further control gene expression. The bimolecular fluorescence complementation (BiFC) assay is a widely used technique to study protein-protein interactions in living cells. Here we describe a modified BiFC experimental procedure to study the inhibition of the formation of the bHLH (GL3)-MYB (GL1) complex by JAZ proteins. PMID:23615997

  6. Unique CCT repeats mediate transcription of the TWIST1 gene in mesenchymal cell lines

    SciTech Connect

    Ohkuma, Mizue; Funato, Noriko; Higashihori, Norihisa; Murakami, Masanori; Ohyama, Kimie; Nakamura, Masataka . E-mail: naka.gene@cmn.tmd.ac.jp

    2007-01-26

    TWIST1, a basic helix-loop-helix transcription factor, plays critical roles in embryo development, cancer metastasis and mesenchymal progenitor differentiation. Little is known about transcriptional regulation of TWIST1 expression. Here we identified DNA sequences responsible for TWIST1 expression in mesenchymal lineage cell lines. Reporter assays with TWIST1 promoter mutants defined the -102 to -74 sequences that are essential for TWIST1 expression in human and mouse mesenchymal cell lines. Tandem repeats of CCT, but not putative CREB and NF-{kappa}B sites in the sequences substantially supported activity of the TWIST1 promoter. Electrophoretic mobility shift assay demonstrated that the DNA sequences with the CCT repeats formed complexes with nuclear factors, containing, at least, Sp1 and Sp3. These results suggest critical implication of the CCT repeats in association with Sp1 and Sp3 factors in sustaining expression of the TWIST1 gene in mesenchymal cells.

  7. Grasses use an alternatively wired bHLH transcription factor network to establish stomatal identity.

    PubMed

    Raissig, Michael T; Abrash, Emily; Bettadapur, Akhila; Vogel, John P; Bergmann, Dominique C

    2016-07-19

    Stomata, epidermal valves facilitating plant-atmosphere gas exchange, represent a powerful model for understanding cell fate and pattern in plants. Core basic helix-loop-helix (bHLH) transcription factors regulating stomatal development were identified in Arabidopsis, but this dicot's developmental pattern and stomatal morphology represent only one of many possibilities in nature. Here, using unbiased forward genetic screens, followed by analysis of reporters and engineered mutants, we show that stomatal initiation in the grass Brachypodium distachyon uses orthologs of stomatal regulators known from Arabidopsis but that the function and behavior of individual genes, the relationships among genes, and the regulation of their protein products have diverged. Our results highlight ways in which a kernel of conserved genes may be alternatively wired to produce diversity in patterning and morphology and suggest that the stomatal transcription factor module is a prime target for breeding or genome modification to improve plant productivity. PMID:27382177

  8. Characterization of msim, a murine homologue of the Drosophila sim transcription factor

    SciTech Connect

    Moffett, P.; Reece, M.; Pelletier, J.

    1996-07-01

    Mutations in the Drosophila single-minded (sim) gene result in loss of precursor cells that give rise to midline cells of the embryonic central nervous system. During the course of an exon-trapping strategy aimed at identifying transcripts that contribute to the etiology and pathophysiology of Down syndrome, we identified a human exon from the Down syndrome, we identified a human exon from the Down syndrome critical region showing significantly homology to the Drosophila sim gene. Using a cross-hybridization approach, we have isolated a murine homolog of Drosophila sim gene, which we designated msim. Nucleotide and predicted amino acid sequence analyses of msim cDNA clones indicate the this gene encodes a member of the basic-helix-loop-helix class of transcription factors. The murine and Drosophila proteins share 88% residues within the basic-helix-loop helix domain, with an overall homology of 92%. In addition, the N-terminal domain of MSIM contains two PAS dimerization motifs also featured in the Drosophila sim gene product, as well as a small number of other transcription factors. Northern blot analysis of adult murine tissues revealed that the msim gene produces a single mRNA species of {approximately}4 kb expressed in a small number of tissues, with the highest levels in the kidneys and lower levels present in skeletal muscle, lung, testis, brain, and heart. In situ hybridization experiments demonstrate that msim is also expressed in early fetal development in the central nervous system and in cartilage primordia. The characteristics of the msim gene are consistent with its putative function as a transcriptional regulator. 51 refs., 6 figs., 1 tab.

  9. Characterization of msim, a murine homologue of the Drosophila sim transcription factor.

    PubMed

    Moffett, P; Dayo, M; Reece, M; McCormick, M K; Pelletier, J

    1996-07-01

    Mutations in the Drosophila single-minded (sim) gene result in loss of precursor cells that give rise to midline cells of the embryonic central nervous system. During the course of an exon-trapping strategy aimed at identifying transcripts that contribute to the etiology and pathophysiology of Down syndrome, we identified a human exon from the Down syndrome critical region showing significant homology to the Drosophila sim gene. Using a cross-hybridization approach, we have isolated a murine homolog of the Drosophila sim gene, which we designated msim. Nucleotide and predicted amino acid sequence analyses of msim cDNA clones indicate that this gene encodes a member of the basic-helix-loop-helix class of transcription factors. The murine and Drosophila proteins share 88% residues within the basic-helix-loop-helix domain, with an overall homology of 92%. In addition, the N-terminal domain of MSIM contains two PAS dimerization motifs also featured in the Drosophila sim gene product, as well as a small number of other transcription factors. Northern blot analysis of adult murine tissues revealed that the msim gene produces a single mRNA species of approximately 4 kb expressed in a small number of tissues, with the highest levels in the kidneys and lower levels present in skeletal muscle, lung, testis, brain, and heart. In situ hybridization experiments demonstrate that msim is also expressed in early fetal development in the central nervous system and in cartilage primordia. The characteristics of the msim gene are consistent with its putative function as a transcriptional regulator. PMID:8661115

  10. Direct Detection of Transcription Factors in Cotyledons during Seedling Development Using Sensitive Silicon-Substrate Photonic Crystal Protein Arrays1[OPEN

    PubMed Central

    Jones, Sarah I.; Tan, Yafang; Shamimuzzaman, Md; George, Sherine; Cunningham, Brian T.; Vodkin, Lila

    2015-01-01

    Transcription factors control important gene networks, altering the expression of a wide variety of genes, including those of agronomic importance, despite often being expressed at low levels. Detecting transcription factor proteins is difficult, because current high-throughput methods may not be sensitive enough. One-dimensional, silicon-substrate photonic crystal (PC) arrays provide an alternative substrate for printing multiplexed protein microarrays that have greater sensitivity through an increased signal-to-noise ratio of the fluorescent signal compared with performing the same assay upon a traditional aminosilanized glass surface. As a model system to test proof of concept of the silicon-substrate PC arrays to directly detect rare proteins in crude plant extracts, we selected representatives of four different transcription factor families (zinc finger GATA, basic helix-loop-helix, BTF3/NAC [for basic transcription factor of the NAC family], and YABBY) that have increasing transcript levels during the stages of seedling cotyledon development. Antibodies to synthetic peptides representing the transcription factors were printed on both glass slides and silicon-substrate PC slides along with antibodies to abundant cotyledon proteins, seed lectin, and Kunitz trypsin inhibitor. The silicon-substrate PC arrays proved more sensitive than those performed on glass slides, detecting rare proteins that were below background on the glass slides. The zinc finger transcription factor was detected on the PC arrays in crude extracts of all stages of the seedling cotyledons, whereas YABBY seemed to be at the lower limit of their sensitivity. Interestingly, the basic helix-loop-helix and NAC proteins showed developmental profiles consistent with their transcript patterns, indicating proof of concept for detecting these low-abundance proteins in crude extracts. PMID:25635113

  11. Homeodomain-Leucine Zipper II family of transcription factors to the limelight: central regulators of plant development.

    PubMed

    Carabelli, Monica; Turchi, Luana; Ruzza, Valentino; Morelli, Giorgio; Ruberti, Ida

    2013-09-01

    The Arabidopsis genome encodes 10 Homeodomain-Leucine Zipper (HD-Zip) II transcription factors that can be subdivided into 4 clades (α-δ). All the γ (ARABIDOPSIS THALIANA HOMEOBOX 2 [ATHB2], HOMEOBOX ARABIDOPSIS THALIANA 1 [HAT1], HAT2) and δ (HAT3, ATHB4) genes are regulated by light quality changes (Low Red [R]/Far-Red [FR]) that induce the shade avoidance response in most of the angiosperms. HD-Zip IIγ and HD-Zip IIδ transcription factors function as positive regulators of shade avoidance, and there is evidence that at least ATHB2 is directly positively regulated by the basic Helix-Loop-Helix (bHLH) proteins PHYTOCHROME INTERACTING FACTOR 4 (PIF4) and PIF5. Recent evidence demonstrate that, in addition to their function in shade avoidance, HD-Zip IIγ and HD-Zip IIδ proteins play an essential role in plant development from embryogenesis onwards in a white light environment. PMID:23838958

  12. The bHLH transcription factor Tcf12 (ME1) mRNA is abundantly expressed in Paneth cells of mouse intestine.

    PubMed

    Tanigawa, Yoko; Yakura, Rieko; Komiya, Tohru

    2007-06-01

    Using a large-scale in situ hybridization screening system, we found that mRNA coding for ME1, a basic helix-loop-helix (bHLH) transcription factor, was abundantly expressed in Paneth cells of adult small intestinal crypts. Other functionally related E-protein mRNAs, ME2, and E2A, however, could not be detected in the cells. ME1 mRNA was first detected in the jejunum and ileum two weeks after birth when the number of Paneth cells starts to increase. ME1 is the first identified bHLH transcription factor expressed in the Paneth cells and may be used as a molecular marker and a key molecule for analyzing transcriptional regulation in the Paneth cell. PMID:17405739

  13. NGF-dependent and tissue-specific transcription of vgf is regulated by a CREB-p300 and bHLH factor interaction.

    PubMed

    Mandolesi, Georgia; Gargano, Silvia; Pennuto, Maria; Illi, Barbara; Molfetta, Rosa; Soucek, Laura; Mosca, Laura; Levi, Andrea; Jucker, Richard; Nasi, Sergio

    2002-01-01

    Neurotrophins support neuronal survival, development, and plasticity through processes requiring gene expression. We studied how vgf target gene transcription is mediated by a critical promoter region containing E-box, CCAAT and cAMP response element (CRE) sites. The p300 acetylase was present in two distinct protein complexes bound to this region. One complex, containing HEB (ubiquitous basic helix-loop-helix (bHLH)), bound the promoter in non-neuronal cells and was involved in repressing vgf expression. Neurotrophin-dependent transcription was mediated by the second complex, specific for neuronal cells, which included CRE binding protein and MASH1 (neuro-specific bHLH), bound the CCAAT motif, and was target of neurotrophin signalling. The interaction, mediated by p300, of different transcription factors may add specificity to the neurotrophin response. PMID:11755530

  14. Mutations in the pho2 (bas2) transcription factor that differentially affect activation with its partner proteins bas1, pho4, and swi5.

    PubMed

    Bhoite, Leena T; Allen, Jason M; Garcia, Emily; Thomas, Lance R; Gregory, I David; Voth, Warren P; Whelihan, Kristen; Rolfes, Ronda J; Stillman, David J

    2002-10-01

    The yeast PHO2 gene encodes a homeodomain protein that exemplifies combinatorial control in transcriptional activation. Pho2 alone binds DNA in vitro with low affinity, but in vivo it activates transcription with at least three disparate DNA-binding proteins: the zinc finger protein Swi5, the helix-loop-helix factor Pho4, and Bas1, an myb-like activator. Pho2 + Swi5 activates HO, Pho2 + Pho4 activates PHO5, and Pho2 + Bas1 activates genes in the purine and histidine biosynthesis pathways. We have conducted a genetic screen and identified 23 single amino acid substitutions in Pho2 that differentially affect its ability to activate its specific target genes. Analysis of the mutations suggests that the central portion of Pho2 serves as protein-protein interactive surface, with a requirement for distinct amino acids for each partner protein. PMID:12145299

  15. Evolution of transcriptional control of the IgH locus: characterization, expression, and function of TF12/HEB homologs of the catfish.

    PubMed

    Hikima, Jun-Ichi; Cioffi, Christopher C; Middleton, Darlene L; Wilson, Melanie R; Miller, Norman W; Clem, L William; Warr, Gregory W

    2004-11-01

    The transcriptional enhancer (Emu3') of the IgH locus of the channel catfish, Ictalurus punctatus, differs from enhancers of the mammalian IgH locus in terms of its position, structure, and function. Transcription factors binding to multiple octamer motifs and a single muE5 motif (an E-box site, consensus CANNTG) interact for its function. E-box binding transcription factors of the class I basic helix-loop-helix family were cloned from a catfish B cell cDNA library in this study, and homologs of TF12/HEB were identified as the most highly represented E-proteins. Two alternatively spliced forms of catfish TF12 (termed CFEB1 and -2) were identified and contained regions homologous to the basic helix-loop-helix and activation domains of other vertebrate E-proteins. CFEB message is widely expressed, with CFEB1 message predominating over that of CFEB2. Both CFEB1 and -2 strongly activated transcription from a muE5-dependent artificial promoter. In catfish B cells, CFEB1 and -2 also activated transcription from the core region of the catfish IgH enhancer (Emu3') in a manner dependent on the presence of the muE5 site. Both CFEB1 and -2 bound the muE5 motif, and formed both homo- and heterodimers. CFEB1 and -2 were weakly active or inactive (in a promoter-dependent fashion) in mammalian B-lineage cells. Although E-proteins have been highly conserved in vertebrate evolution, the present results indicate that, at the phylogenetic level of a teleost fish, the TF12/HEB homolog differs from that of mammals in terms of 1) its high level of expression and 2) the presence of isoforms generated by alternative RNA processing. PMID:15494495

  16. A genomewide survey of bHLH transcription factors in the coral Acropora digitifera identifies three novel orthologous families, pearl, amber, and peridot.

    PubMed

    Gyoja, Fuki; Kawashima, Takeshi; Satoh, Nori

    2012-04-01

    Decoding the genome of the coral, Acropora digitifera, enabled us to characterize a nearly full set of 70 basic helix-loop-helix (bHLH) transcription factors in this organism. This number is comparable to 68 bHLH genes in the sea anemone, Nematostella vectensis, and larger than those in most other invertebrate metazoans. The 70 bHLH genes were assigned to 29 orthologous families previously reported. In addition, we identified three novel HLH orthologous families, which we designated pearl, amber, and peridot, increasing the number of orthologous families to 32. Pearl and amber orthologues were found in genomes and expressed sequenced tags (ESTs) of Mollusca and Annelida in addition to Cnidaria. Peridot orthologues were found in genomes and ESTs of Cephalochordata and Hemichordata in addition to Cnidaria. These three genes were likely lost in the clades of Drosophila melanogaster, Caenorhabditis elegans, and Homo sapiens during animal evolution. PMID:22419240

  17. Transcriptional regulation of secretin gene expression.

    PubMed

    Nishitani, J; Rindi, G; Lopez, M J; Upchurch, B H; Leiter, A B

    1995-01-01

    Expression of the gene encoding the hormone secretin is restricted to a specific enteroendocrine cell type and to beta-cells in developing pancreatic islets. To characterize regulatory elements in the secretin gene responsible for its expression in secretin-producing cells, we used a series of reporter genes for transient expression assays in transfection studies carried out in secretin-producing islet cell lines. Analysis of the transcriptional activity of deletion mutants identified a positive cis regulatory domain between 174 and 53 base pairs upstream from the transcriptional initiation site which was required for secretin gene expression in secretin-producing HIT insulinoma cells. Within this enhancer were sequences resembling two binding sites for the transcription factor Sp1, as well as a consensus sequence for binding to helix-loop-helix proteins. Analysis of these three elements by site-directed mutagenesis suggests that each is important for full transcriptional activity. The role of proximal enhancer sequences in directing secretin gene expression to appropriate tissues is further supported by studies in transgenic mice revealing that 1.6 kilobases of the secretin gene 5' flanking sequence were sufficient to direct the expression of either human growth hormone or simian virus 40 large T-antigen reporter genes to all major secretin-producing tissues. PMID:8774991

  18. NeuroD1/beta2 contributes to cell-specific transcription of the proopiomelanocortin gene.

    PubMed Central

    Poulin, G; Turgeon, B; Drouin, J

    1997-01-01

    NeuroD1/beta2 is a basic helix-loop-helix (bHLH) factor expressed in the endocrine cells of the pancreas and in a subset of neurons as they undergo terminal differentiation. We now show that NeuroD1 is expressed in corticotroph cells of the pituitary gland and that it is involved in cell-specific transcription of the proopiomelanocortin (POMC) gene. It was previously shown that corticotroph-specific POMC transcription depends in part on the action of cell-restricted bHLH factors that were characterized as the CUTE (corticotroph upstream transcription element) (M. Therrien and J. Drouin, Mol. Cell. Biol. 13:2342-2353, 1993) complexes. We now demonstrate that these complexes contain NeuroD1 in association with various ubiquitous bHLH dimerization partners. The NeuroD1-containing heterodimers specifically recognize and activate transcription from the POMC promoter E box that confers transcriptional specificity. Interestingly, the NeuroD1 heterodimers activate transcription in synergy with Ptx1, a Bicoid-related homeodomain protein, which also contributes to corticotroph specificity of POMC transcription. In the adult pituitary gland, NeuroD1 transcripts are detected in POMC-expressing corticotroph cells. Taken together with the restricted pattern of Ptx1 expression, these results suggest that these two factors establish the basis of a combinatorial code for the program of corticotroph-specific gene expression. PMID:9343431

  19. Identifying Novel Helix-Loop-Helix Genes in "Caenorhabditis elegans" through a Classroom Demonstration of Functional Genomics

    ERIC Educational Resources Information Center

    Griffin, Vernetta; McMiller, Tracee; Jones, Erika; Johnson, Casonya M.

    2003-01-01

    A 14-week, undergraduate-level Genetics and Population Biology course at Morgan State University was modified to include a demonstration of functional genomics in the research laboratory. Students performed a rudimentary sequence analysis of the "Caenorhabditis elegans" genome and further characterized three sequences that were predicted to encode…

  20. The Helix-Loop-Helix Protein ID2 Governs NK Cell Fate by Tuning Their Sensitivity to Interleukin-15.

    PubMed

    Delconte, Rebecca B; Shi, Wei; Sathe, Priyanka; Ushiki, Takashi; Seillet, Cyril; Minnich, Martina; Kolesnik, Tatiana B; Rankin, Lucille C; Mielke, Lisa A; Zhang, Jian-Guo; Busslinger, Meinrad; Smyth, Mark J; Hutchinson, Dana S; Nutt, Stephen L; Nicholson, Sandra E; Alexander, Warren S; Corcoran, Lynn M; Vivier, Eric; Belz, Gabrielle T; Carotta, Sebastian; Huntington, Nicholas D

    2016-01-19

    The inhibitor of DNA binding 2 (Id2) is essential for natural killer (NK) cell development with its canonical role being to antagonize E-protein function and alternate lineage fate. Here we have identified a key role for Id2 in regulating interleukin-15 (IL-15) receptor signaling and homeostasis of NK cells by repressing multiple E-protein target genes including Socs3. Id2 deletion in mature NK cells was incompatible with their homeostasis due to impaired IL-15 receptor signaling and metabolic function and this could be rescued by strong IL-15 receptor stimulation or genetic ablation of Socs3. During NK cell maturation, we observed an inverse correlation between E-protein target genes and Id2. These results shift the current paradigm on the role of ID2, indicating that it is required not only to antagonize E-proteins during NK cell commitment, but constantly required to titrate E-protein activity to regulate NK cell fitness and responsiveness to IL-15. PMID:26795246

  1. Specification of jaw identity by the Hand2 transcription factor.

    PubMed

    Funato, Noriko; Kokubo, Hiroki; Nakamura, Masataka; Yanagisawa, Hiromi; Saga, Yumiko

    2016-01-01

    Acquisition of the lower jaw (mandible) was evolutionarily important for jawed vertebrates. In humans, syndromic craniofacial malformations often accompany jaw anomalies. The basic helix-loop-helix transcription factor Hand2, which is conserved among jawed vertebrates, is expressed in the neural crest in the mandibular process but not in the maxillary process of the first branchial arch. Here, we provide evidence that Hand2 is sufficient for upper jaw (maxilla)-to-mandible transformation by regulating the expression of homeobox transcription factors in mice. Altered Hand2 expression in the neural crest transformed the maxillae into mandibles with duplicated Meckel's cartilage, which resulted in an absence of the secondary palate. In Hand2-overexpressing mutants, non-Hox homeobox transcription factors were dysregulated. These results suggest that Hand2 regulates mandibular development through downstream genes of Hand2 and is therefore a major determinant of jaw identity. Hand2 may have influenced the evolutionary acquisition of the mandible and secondary palate. PMID:27329940

  2. Specification of jaw identity by the Hand2 transcription factor

    PubMed Central

    Funato, Noriko; Kokubo, Hiroki; Nakamura, Masataka; Yanagisawa, Hiromi; Saga, Yumiko

    2016-01-01

    Acquisition of the lower jaw (mandible) was evolutionarily important for jawed vertebrates. In humans, syndromic craniofacial malformations often accompany jaw anomalies. The basic helix-loop-helix transcription factor Hand2, which is conserved among jawed vertebrates, is expressed in the neural crest in the mandibular process but not in the maxillary process of the first branchial arch. Here, we provide evidence that Hand2 is sufficient for upper jaw (maxilla)-to-mandible transformation by regulating the expression of homeobox transcription factors in mice. Altered Hand2 expression in the neural crest transformed the maxillae into mandibles with duplicated Meckel’s cartilage, which resulted in an absence of the secondary palate. In Hand2-overexpressing mutants, non-Hox homeobox transcription factors were dysregulated. These results suggest that Hand2 regulates mandibular development through downstream genes of Hand2 and is therefore a major determinant of jaw identity. Hand2 may have influenced the evolutionary acquisition of the mandible and secondary palate. PMID:27329940

  3. Combinatorial transcriptional interaction within the Cardiac Neural Crest: a pair of HANDs in heart formation

    PubMed Central

    Firulli, Anthony B.; Conway, Simon J.

    2008-01-01

    The cardiac neural crest migrate from rostral dorsal neural folds and populate the branchial arches, which directly contribute to cardiac-outflow structures. Although neural crest cell specification is associated with a number of morphogenic factors, little is understood about the mechanisms by which transcription factors actually implement the transcriptional programs that dictate cell migration and later the differentiation into the proper cell types within the heart. It is clear from genetic evidence that members of the paired box family and basic helix-loop-helix (bHLH) transcription factors from the twist family of proteins are expressed in and play an important function in cardiac neural crest specification and differentiation. Interestingly, both paired box and bHLH factors can function as dimers and in the case of twist family bHLH factors partner choice can clearly dictate a change in transcriptional program. The focus of this review is to consider the role that the protein-protein interactions of these transcription factors may play determining cardiac neural crest specification and differentiation and how genetic alteration of transcription factor stoichiometry within the cell may reflect more than a simple null event. PMID:15269889

  4. Protein kinase C modulates aryl hydrocarbon receptor nuclear translocator protein-mediated transactivation potential in a dimer context.

    PubMed

    Long, W P; Chen, X; Perdew, G H

    1999-04-30

    Protein kinase C (PKC)- and protein kinase A (PKA)-mediated modulation of the transactivation potential of human aryl hydrocarbon receptor nuclear translocator (hARNT), a basic helix-loop-helix (bHLH)-PAS transcription factor, and the bHLH-ZIP transcription factors USF-1 (for upstream regulatory factor 1) and c-Myc were examined. An 81 nM dose of the PKC activator phorbol-12-myristate-13-acetate (PMA), shown here to specifically activate PKC in COS-1 cells, or a 1 nM dose of the PKA activator 8-bromoadenosine-3',5'-cyclic monophosphate (8-Br-cAMP) results in 2. 6- and 1.9-fold enhancements, respectively, in hARNT-mediated transactivation of the class B, E-box-driven reporter pMyc3E1bLuc relative to identically transfected, carrier solvent-treated COS-1 cells. In contrast, 81 nM PMA and 1 nM 8-Br-cAMP did not enhance transactivation of pMyc3E1bLuc-driven by USF-1 and c-Myc expression relative to identically transfected, carrier-treated COS-1 cells. Co-transfection of pcDNA3/ARNT-474-Flag, expressing a hARNT carboxyl-terminal transactivation domain deletion, and pMyc3E1bLuc does not result in induction of reporter activity, suggesting PMA's effects do not involve formation of unknown hARNT-protein heterodimers. Additionally, PMA had no effect on hARNT expression relative to Me2SO-treated cells. Metabolic 32P labeling of hARNT in cells treated with carrier solvent or 81 nM PMA demonstrates that PMA does not increase the overall phosphorylation level of hARNT. These results demonstrate, for the first time, that the transactivation potential of ARNT in a dimer context can be specifically modulated by PKC or PKA stimulation and that the bHLH-PAS and bHLH-ZIP transcription factors are differentially regulated by these pathways in COS-1 cells. PMID:10212212

  5. Determination of specificity influencing residues for key transcription factor families

    PubMed Central

    Patel, Ronak Y.; Garde, Christian; D.Stormo, Gary

    2015-01-01

    Transcription factors (TFs) are major modulators of transcription and subsequent cellular processes. The binding of TFs to specific regulatory elements is governed by their specificity. Considering the gap between known TFs sequence and specificity, specificity prediction frameworks are highly desired. Key inputs to such frameworks are protein residues that modulate the specificity of TF under consideration. Simple measures like mutual information (MI) to delineate specificity influencing residues (SIRs) from alignment fail due to structural constraints imposed by the three-dimensional structure of protein. Structural restraints on the evolution of the amino-acid sequence lead to identification of false SIRs. In this manuscript we extended three methods (Direct Information, PSICOV and adjusted mutual information) that have been used to disentangle spurious indirect protein residue-residue contacts from direct contacts, to identify SIRs from joint alignments of amino-acids and specificity. We predicted SIRs forhomeodomain (HD), helix-loop-helix, LacI and GntR families of TFs using these methods and compared to MI. Using various measures, we show that the performance of these three methods is comparable but better than MI. Implication of these methods in specificity prediction framework is discussed. The methods are implemented as an R package and available along with the alignments at stormo.wustl.edu/SpecPred. PMID:26753103

  6. Transcriptional regulatory networks downstream of TAL1/SCL in T-cell acute lymphoblastic leukemia.

    PubMed

    Palomero, Teresa; Odom, Duncan T; O'Neil, Jennifer; Ferrando, Adolfo A; Margolin, Adam; Neuberg, Donna S; Winter, Stuart S; Larson, Richard S; Li, Wei; Liu, X Shirley; Young, Richard A; Look, A Thomas

    2006-08-01

    Aberrant expression of 1 or more transcription factor oncogenes is a critical component of the molecular pathogenesis of human T-cell acute lymphoblastic leukemia (T-ALL); however, oncogenic transcriptional programs downstream of T-ALL oncogenes are mostly unknown. TAL1/SCL is a basic helix-loop-helix (bHLH) transcription factor oncogene aberrantly expressed in 60% of human T-ALLs. We used chromatin immunoprecipitation (ChIP) on chip to identify 71 direct transcriptional targets of TAL1/SCL. Promoters occupied by TAL1 were also frequently bound by the class I bHLH proteins E2A and HEB, suggesting that TAL1/E2A as well as TAL1/HEB heterodimers play a role in transformation of T-cell precursors. Using RNA interference, we demonstrated that TAL1 is required for the maintenance of the leukemic phenotype in Jurkat cells and showed that TAL1 binding can be associated with either repression or activation of genes whose promoters occupied by TAL1, E2A, and HEB. In addition, oligonucleotide microarray analysis of RNA from 47 primary T-ALL samples showed specific expression signatures involving TAL1 targets in TAL1-expressing compared with -nonexpressing human T-ALLs. Our results indicate that TAL1 may act as a bifunctional transcriptional regulator (activator and repressor) at the top of a complex regulatory network that disrupts normal T-cell homeostasis and contributes to leukemogenesis. PMID:16621969

  7. A transcription factor controlling development of peripheral sense organs in C. elegans.

    PubMed

    Zhao, C; Emmons, S W

    1995-01-01

    The basic-helix-loop-helix (bHLH) proteins constitute a class of transcription factors thought to be important in the control of cell-type determination. These transcription factors are believed to activate the expression of cell-type-specific genes to generate stable differentiated cell types. The expression of bHLH proteins, in turn, is regulated by spatial cues, so that switches in cell type occur in a reproducible pattern. We report here that the lin-32 gene of Caenorhabditis elegans, which encodes a bHLH protein of the Drosophila achaete-scute family of transcription factors, is necessary and in some cells sufficient for specification of the neuroblast cell fate. Similarity in the function and structure of the lin-32 protein (LIN-32) to transcription factors of the achaete-scute gene family in Drosophila and vertebrates implies that this class of transcription factors functioned in a primitive ancestral form to specify neuronal cell fate, supporting the proposition that certain basic mechanisms of cell-type determination have been conserved through metazoan evolution. PMID:7800042

  8. Aspergillus nidulans catalase-peroxidase gene (cpeA) is transcriptionally induced during sexual development through the transcription factor StuA.

    PubMed

    Scherer, Mario; Wei, Huijun; Liese, Ralf; Fischer, Reinhard

    2002-10-01

    Catalases, peroxidases, and catalase-peroxidases are important enzymes to cope with reactive oxygen species in pro- and eukaryotic cells. In the filamentous fungus Aspergillus nidulans three monofunctional catalases have been described, and a fourth catalase activity was observed in native polyacrylamide gels. The latter activity is probably due to the bifunctional enzyme catalase-peroxidase, which we characterized here. The gene, named cpeA, encodes an 81-kDa polypeptide with a conserved motif for heme coordination. The enzyme comprises of two similar domains, suggesting gene duplication and fusion during evolution. The first 439 amino acids share 22% identical residues with the C terminus. Homologous proteins are found in several prokaryotes, such as Escherichia coli and Mycobacterium tuberculosis (both with 61% identity). In fungi the enzyme has been noted in Penicillium simplicissimum, Septoria tritici, and Neurospora crassa (69% identical amino acids) but is absent from Saccharomyces cerevisiae. Expression analysis in A. nidulans revealed that the gene is transcriptionally induced upon carbon starvation and during sexual development, but starvation is not sufficient to reach high levels of the transcript during development. Besides transcriptional activation, we present evidence for posttranscriptional regulation. A green fluorescent protein fusion protein localized to the cytoplasm of Hülle cells. The Hülle cell-specific expression was dependent on the developmental regulator StuA, suggesting an activating function of this helix-loop-helix transcription factor. PMID:12455692

  9. Involvement of microphthalmia-associated transcription factor (MITF) in expression of human melanocortin-1 receptor (MC1R).

    PubMed

    Aoki, Hirofumi; Moro, Osamu

    2002-09-20

    Analysis of the nucleotide sequence of human melanocortin-1 receptor (MC1R) promoter indicated that an E-box (CANNTG) is present immediately upstream of the transcriptional initiation site. The presence of the CATGTG motif suggests that MC1R gene expression may be regulated by a basic helix-loop-helix-leucine-zipper (bHLH-LZ) type transcription factor. The microphthalmia-associated transcription factor (MITF), which belongs to the family of bHLH-LZ type transcription factors, regulates the transcription of melanogenesis-related enzyme genes such as the tyrosinase and TRP-1 genes. We investigated whether MITF regulates human MC1R gene expression through the same transcriptional mechanism as tyrosinase and TRP-1 genes in melanocytes. For this purpose, the effect of co-expression of cDNA encoding MITF on MC1R promoter activity in NIH/3T3 cells was studied. MC1R promoter activity was induced to the extent of approximately 5-fold in the presence of MITF. In addition, electrophoretic mobility shift assay indicated that nuclear extracts of human SK-Mel-2 cells contain a protein that binds specifically to the MC1R promoter region containing the CATGTG motif. These results suggested that MITF regulates not only the expression of enzymes involved in melanin synthesis, but also the expression of a receptor which plays an essential role in melanocyte functions. PMID:12204775

  10. Regulation of the Mechanism of TWIST1 Transcription by BHLHE40 and BHLHE41 in Cancer Cells.

    PubMed

    Asanoma, Kazuo; Liu, Ge; Yamane, Takako; Miyanari, Yoko; Takao, Tomoka; Yagi, Hiroshi; Ohgami, Tatsuhiro; Ichinoe, Akimasa; Sonoda, Kenzo; Wake, Norio; Kato, Kiyoko

    2015-12-01

    BHLHE40 and BHLHE41 (BHLHE40/41) are basic helix-loop-helix type transcription factors that play key roles in multiple cell behaviors. BHLHE40/41 were recently shown to be involved in an epithelial-to-mesenchymal transition (EMT). However, the precise mechanism of EMT control by BHLHE40/41 remains unclear. In the present study, we demonstrated that BHLHE40/41 expression was controlled in a pathological stage-dependent manner in human endometrial cancer (HEC). Our in vitro assays showed that BHLHE40/41 suppressed tumor cell invasion. BHLHE40/41 also suppressed the transcription of the EMT effectors SNAI1, SNAI2, and TWIST1. We identified the critical promoter regions of TWIST1 for its basal transcriptional activity. We elucidated that the transcription factor SP1 was involved in the basal transcriptional activity of TWIST1 and that BHLHE40/41 competed with SP1 for DNA binding to regulate gene transcription. This study is the first to report the detailed functions of BHLHE40 and BHLHE41 in the suppression of EMT effectors in vitro. Our results suggest that BHLHE40/41 suppress tumor cell invasion by inhibiting EMT in tumor cells. We propose that BHLHE40/41 are promising markers to predict the aggressiveness of each HEC case and that molecular targeting strategies involving BHLHE40/41 and SP1 may effectively regulate HEC progression. PMID:26391953

  11. Phosphorylation-Coupled Proteolysis of the Transcription Factor MYC2 Is Important for Jasmonate-Signaled Plant Immunity

    PubMed Central

    Zhai, Qingzhe; Yan, Liuhua; Tan, Dan; Chen, Rong; Sun, Jiaqiang; Gao, Liyan; Dong, Meng-Qiu; Wang, Yingchun; Li, Chuanyou

    2013-01-01

    As a master regulator of jasmonic acid (JA)–signaled plant immune responses, the basic helix-loop-helix (bHLH) Leu zipper transcription factor MYC2 differentially regulates different subsets of JA–responsive genes through distinct mechanisms. However, how MYC2 itself is regulated at the protein level remains unknown. Here, we show that proteolysis of MYC2 plays a positive role in regulating the transcription of its target genes. We discovered a 12-amino-acid element in the transcription activation domain (TAD) of MYC2 that is required for both the proteolysis and the transcriptional activity of MYC2. Interestingly, MYC2 phosphorylation at residue Thr328, which facilitates its turnover, is also required for the MYC2 function to regulate gene transcription. Together, these results reveal that phosphorylation-coupled turnover of MYC2 stimulates its transcription activity. Our results exemplify that, as with animals, plants employ an “activation by destruction” mechanism to fine-tune their transcriptome to adapt to their ever-changing environment. PMID:23593022

  12. Molecular cloning and characterization of a Bombyx mori gene encoding the transcription factor Atonal.

    PubMed

    Hu, Ping; Feng, Fan; Xia, Hengchuan; Chen, Liang; Yao, Qin; Chen, Keping

    2014-01-01

    The atonal genes are an evolutionarily conserved group of genes encoding regulatory basic helix-loop-helix (bHLH) transcription factors. These transcription factors have a critical antioncogenic function in the retina, and are necessary for cell fate determination through the regulation of the cell signal pathway. In this study, the atonal gene was cloned from Bombyx mori, and the transcription factor was named BmAtonal. Sequence analysis showed that the BmAtonal protein shares extensive homology with other invertebrate Atonal proteins with the bHLH motif. Reverse transcription-polymerase chain reaction (RT-PCR) and Western blot analyses revealed that BmAtonal was expressed in all developmental stages of B. mori and various larval tissues. The BmAtonal protein was expressed in Escherichia coli, and polyclonal antibodies were raised against the purified protein. By immunofluorescence, the BmAtonal protein was localized to both the nucleus and cytoplasm of BmN cells. After knocking out nuclear localization signals (NLS), the BmAtonal protein was only detected in the cytoplasm. In addition, using the B. mori nuclear polyhedrosis virus (BmNPV) baculovirus expression system, the recombinant BmAtonal protein was successfully expressed in the B. mori cell line BmN. This work lays the foundation for exploring the biological functions of the BmAtonal protein, such as identifying its potential binding partners and understanding the molecular control of the formation of sensory organs. PMID:24873037

  13. The bHLH/Per-Arnt-Sim transcription factor SIM2 regulates muscle transcript myomesin2 via a novel, non-canonical E-box sequence.

    PubMed

    Woods, Susan; Farrall, Alexandra; Procko, Carl; Whitelaw, Murray L

    2008-06-01

    Despite a growing number of descriptive studies that show Single-minded 2 (Sim2) is not only essential for murine survival, but also upregulated in colon, prostate and pancreatic tumours, there is a lack of direct target genes identified for this basic helix-loop-helix/PAS transcription factor. We have performed a set of microarray experiments aimed at identifying genes that are differentially regulated by SIM2, and successfully verified that the Myomesin2 (Myom2) gene is SIM2-responsive. Although SIM2 has been reported to be a transcription repressor, we find that SIM2 induces transcription of Myom2 and activates the Myom2 promoter sequence when co-expressed with the heterodimeric partner protein, ARNT1, in human embryonic kidney cells. Truncation and mutation of the Myom2 promoter sequence, combined with chromatin immunoprecipitation studies in cells, has lead to the delineation of a non-canonical E-box sequence 5'-AACGTG-3' that is bound by SIM2/ARNT1 heterodimers. Interestingly, in immortalized human myoblasts knock down of Sim2 results in increased levels of Myom2 RNA, suggesting that SIM2 is acting as a repressor in these cells and so its activity is likely to be highly context dependent. This is the first report of a direct SIM2/ARNT1 target gene with accompanying analysis of a functional response element. PMID:18480125

  14. dysfusion Transcriptional Control of Drosophila Tracheal Migration, Adhesion, and Fusion

    PubMed Central

    Jiang, Lan; Crews, Stephen T.

    2006-01-01

    The Drosophila dysfusion basic-helix-loop-helix-PAS transcription factor gene is expressed in specialized fusion cells that reside at the tips of migrating tracheal branches. dysfusion mutants were isolated, and genetic analysis of live embryos revealed that mutant tracheal branches migrate to close proximity but fail to recognize and adhere to each other. Misexpression of dysfusion throughout the trachea further indicated that dysfusion has the ability to both inhibit cell migration and promote ectopic tracheal fusion. Nineteen genes whose expression either increases or decreases in fusion cells during development were analyzed in dysfusion mutant embryos. dysfusion upregulates the levels of four genes, including the shotgun cell adhesion protein gene and the zona pellucida family transmembrane protein gene, CG13196. Misexpression experiments with CG13196 result in ectopic tracheal fusion events, suggesting that it also encodes a cell adhesion protein. Another target gene of dysfusion is members only, which inhibits protein nuclear export and influences tracheal fusion. dysfusion also indirectly downregulates protein levels of Trachealess, an important regulator of tracheal development. These results indicate that fusion cells undergo dynamic changes in gene expression as they switch from migratory to fusion modes and that dysfusion regulates a discrete, but important, set of these genes. PMID:16914738

  15. Nato3 integrates with the Shh-Foxa2 transcriptional network regulating the differentiation of midbrain dopaminergic neurons.

    PubMed

    Nissim-Eliraz, Einat; Zisman, Sophie; Schatz, Omri; Ben-Arie, Nissim

    2013-09-01

    Mesencephalic dopaminergic (mesDA) neurons originate from the floor plate of the midbrain, a transient embryonic organizing center located at the ventral-most midline. Since the loss of mesDA leads to Parkinson's disease, the molecular mechanisms controlling the genesis and differentiation of dopaminergic progenitors are extensively studied and the identification and characterization of new genes is of interest. Here, we show that the expression of the basic helix-loop-helix transcription factor Nato3 (Ferd3l) increases in parallel to the differentiation of SN4741 dopaminergic cells in vitro. Nato3 transcription is directly regulated by the transcription factor Foxa2, a target and effector of the Sonic hedgehog (Shh) signaling cascade. Moreover, pharmacological inhibition of Shh signaling downregulated the expression of Nato3, thus defining Nato3 as a novel component of one of the major pathways controlling cell patterning and generation of mesDA. Furthermore, we show that Nato3 regulated Shh and Foxa2 through a novel feed-backward loop. Up- and downregulation of Nato3 further affected the transcription of Nurr1, implicated in the genesis of mesDA, but not of TH. Taken together, these data shed new light on the transcriptional networks controlling the generation of mesDA and may be utilized in the efforts to direct stem cells towards a dopaminergic fate. PMID:23254923

  16. Brg1 directly regulates Olig2 transcription and is required for oligodendrocyte progenitor cell specification.

    PubMed

    Matsumoto, Steven; Banine, Fatima; Feistel, Kerstin; Foster, Scott; Xing, Rubing; Struve, Jaime; Sherman, Larry S

    2016-05-15

    The Olig2 basic-helix-loop-helix transcription factor promotes oligodendrocyte specification in early neural progenitor cells (NPCs), including radial glial cells, in part by recruiting SWI/SNF chromatin remodeling complexes to the enhancers of genes involved in oligodendrocyte differentiation. How Olig2 expression is regulated during oligodendrogliogenesis is not clear. Here, we find that the Brg1 subunit of SWI/SNF complexes interacts with a proximal Olig2 promoter and represses Olig2 transcription in the mouse cortex at E14, when oligodendrocyte progenitors (OPCs) are not yet found in this location. Brg1 does not interact with the Olig2 promoter in the E14 ganglionic eminence, where NPCs differentiate into Olig2-positive OPCs. Consistent with these findings, Brg1-null NPCs demonstrate precocious expression of Olig2 in the cortex. However, these cells fail to differentiate into OPCs. We further find that Brg1 is necessary for neuroepithelial-to-radial glial cell transition, but not neuronal differentiation despite a reduction in expression of the pro-neural transcription factor Pax6. Collectively, these and earlier findings support a model whereby Brg1 promotes neurogenic radial glial progenitor cell specification but is dispensable for neuronal differentiation. Concurrently, Brg1 represses Olig2 expression and the specification of OPCs, but is required for OPC differentiation and oligodendrocyte maturation. PMID:27067865

  17. Diploidy of Drosophila imaginal cells is maintained by a transcriptional repressor encoded by escargot.

    PubMed

    Fuse, N; Hirose, S; Hayashi, S

    1994-10-01

    The Drosophila escargot (esg) gene encodes a C2-H2-type zinc finger protein that is expressed in the imaginal discs and histoblasts. In some esg mutants, the abdominal histoblasts become polyploid. It has therefore been suggested that the role of esg is to maintain diploidy of the imaginal cells. We show that esg encodes a DNA-binding protein with high affinity for G/ACAGGTG, the consensus-binding sequence for the basic helix-loop-helix (bHLH) family of transcription factors (E2 box). This DNA-binding activity is essential for esg function in vivo as the strong embryonic lethal allele esgVS8 is caused by an amino acid change within the zinc finger region, leading to reduced affinity for DNA. In cultured cells, a heterodimer of the bHLH proteins Scute and Daughterless activates transcription from promoters containing E2 boxes. The esg protein strongly inhibits this activation, suggesting that esg may regulate developmental processes dependent on bHLH proteins. In larvae, esg protein expressed by the heat shock promoter can rescue the polyploid phenotype of abdominal histoblasts, demonstrating that the phenotype is attributable to a loss of esg function. esg must be expressed continuously during the larval period for efficient rescue. Ectopic expression of esg in the salivary glands inhibits endoreplication of DNA. These results suggest that esg is involved in transcriptional inhibition of genes required for endoreplication. PMID:7958894

  18. HEMERA Couples the Proteolysis and Transcriptional Activity of PHYTOCHROME INTERACTING FACTORs in Arabidopsis Photomorphogenesis

    PubMed Central

    Qiu, Yongjian; Li, Meina; Pasoreck, Elise K.; Long, Lingyun; Shi, Yiting; Galvão, Rafaelo M.; Chou, Conrad L.; Wang, He; Sun, Amanda Y.; Zhang, Yiyin C.; Jiang, Anna; Chen, Meng

    2015-01-01

    Phytochromes (phys) are red and far-red photoreceptors that control plant development and growth by promoting the proteolysis of a family of antagonistically acting basic helix-loop-helix transcription factors, the PHYTOCHROME-INTERACTING FACTORs (PIFs). We have previously shown that the degradation of PIF1 and PIF3 requires HEMERA (HMR). However, the biochemical function of HMR and the mechanism by which it mediates PIF degradation remain unclear. Here, we provide genetic evidence that HMR acts upstream of PIFs in regulating hypocotyl growth. Surprisingly, genome-wide analysis of HMR- and PIF-dependent genes reveals that HMR is also required for the transactivation of a subset of PIF direct-target genes. We show that HMR interacts with all PIFs. The HMR-PIF interaction is mediated mainly by HMR’s N-terminal half and PIFs’ conserved active-phytochrome B binding motif. In addition, HMR possesses an acidic nine-amino-acid transcriptional activation domain (9aaTAD) and a loss-of-function mutation in this 9aaTAD impairs the expression of PIF target genes and the destruction of PIF1 and PIF3. Together, these in vivo results support a regulatory mechanism for PIFs in which HMR is a transcriptional coactivator binding directly to PIFs and the 9aaTAD of HMR couples the degradation of PIF1 and PIF3 with the transactivation of PIF target genes. PMID:25944101

  19. Enhanced Generation of Myeloid Lineages in Hematopoietic Differentiation from Embryonic Stem Cells by Silencing Transcriptional Repressor Twist-2

    PubMed Central

    Sharabi, Andrew B.; Lee, Sung-Hyung; Goodell, Margaret A.; Huang, Xue F.

    2009-01-01

    Abstract The self-renewal and multilineage differentiation of embryonic stem cells (ESC) is largely governed by transcription factors or repressors. Extensive efforts have focused on elucidating critical factors that control the differentiation of specific cell lineages, for instance, myeloid lineages in hematopoietic development. In this study, we found that Twist-2, a basic helix-loop-helix (bHLH) transcription factor, plays a critical role in inhibiting the differentiation of ESC. Murine ES cells, in which Twist-2 expression is silenced by lentivirally delivered shRNA, exhibit an enhanced formation of primary embryoid bodies (EB) and enhanced differentiation into mesodermally derived hematopoietic colonies. Furthermore, Twist-2 silenced (LV-siTwist-2) ESC display significantly increased generation of myeloid lineages (Gr-1+ and F4/80+ cells) during in vitro hematopoietic differentiation. Treatment with the Toll-like receptor (TLR) 4 ligand synergistically stimulates the generation of primary EB formation as well as of hematopoietic progenitors differentiated from LV-siTwist-2 ES cells. Thus, this study reveals the critical role of the transcriptional repressor Twist-2 in regulating the development of myeloid lineage in hematopoietic differentiation from ESC. This study also suggests a potential strategy for directional differentiation of ESC by inhibiting a transcriptional repressor. PMID:20025523

  20. ULTRAPETALA trxG Genes Interact with KANADI Transcription Factor Genes to Regulate Arabidopsis Gynoecium Patterning[C][W][OPEN

    PubMed Central

    Monfared, Mona M.; Shemyakina, Elena A.; Fletcher, Jennifer C.

    2014-01-01

    Organ formation relies upon precise patterns of gene expression that are under tight spatial and temporal regulation. Transcription patterns are specified by several cellular processes during development, including chromatin remodeling, but little is known about how chromatin-remodeling factors contribute to plant organogenesis. We demonstrate that the trithorax group (trxG) gene ULTRAPETALA1 (ULT1) and the GARP transcription factor gene KANADI1 (KAN1) organize the Arabidopsis thaliana gynoecium along two distinct polarity axes. We show that ULT1 activity is required for the kan1 adaxialized polarity defect, indicating that ULT1 and KAN1 act oppositely to regulate the adaxial-abaxial axis. Conversely, ULT1 and KAN1 together establish apical-basal polarity by promoting basal cell fate in the gynoecium, restricting the expression domain of the basic helix-loop-helix transcription factor gene SPATULA. Finally, we show that ult alleles display dose-dependent genetic interactions with kan alleles and that ULT and KAN proteins can associate physically. Our findings identify a dual role for plant trxG factors in organ patterning, with ULT1 and KAN1 acting antagonistically to pattern the adaxial-abaxial polarity axis but jointly to pattern the apical-basal axis. Our data indicate that the ULT proteins function to link chromatin-remodeling factors with DNA binding transcription factors to regulate target gene expression. PMID:25381352

  1. An auxiliary peptide required for the function of two activation domains in upstream stimulatory factor 2 (USF2) transcription factor.

    PubMed

    Gourdon, L; Lefrançois-Martinez, A M; Viollet, B; Martinez, A; Kahn, A; Raymondjean, M

    1997-04-01

    Ubiquitous upstream stimulatory factors (USF1, USF2a and USF2b) are members of the basic-helix-loop-helix-leucine-zipper family of transcription factors that have been shown to be involved in the transcriptional response of the L-type pyruvate kinase (L-PK) gene to glucose. To understand the mechanisms of action of the USF2 isoforms, we initiated a series of co-transfection assays with deletion mutants and Ga14-USF2 fusions. The transactivating efficiency of the different native and mutant factors was determined at similar DNA binding activity. We found that: (i) exons 3- and 5-encoded regions are activation domains, (ii) a modulator domain encoded by exon 4 could be necessary to their additive action, (iii) a hexapeptide encoded by the first 5' codons of exon 6 is indispensable for transmitting activation due to both exon 3- and exon 5-encoded domains to the transcriptional machinery. Therefore, USF2 presents a modular structure and mediates transcriptional activation thanks to two non-autonomous activation domains dependent on an auxiliary peptide for expressing their activating potential. PMID:9680311

  2. The Hog1 SAPK controls the Rtg1/Rtg3 transcriptional complex activity by multiple regulatory mechanisms

    PubMed Central

    Ruiz-Roig, Clàudia; Noriega, Núria; Duch, Alba; Posas, Francesc; de Nadal, Eulàlia

    2012-01-01

    Cells modulate expression of nuclear genes in response to alterations in mitochondrial function, a response termed retrograde (RTG) regulation. In budding yeast, the RTG pathway relies on Rtg1 and Rtg3 basic helix-loop-helix leucine Zipper transcription factors. Exposure of yeast to external hyperosmolarity activates the Hog1 stress-activated protein kinase (SAPK), which is a key player in the regulation of gene expression upon stress. Several transcription factors, including Sko1, Hot1, the redundant Msn2 and Msn4, and Smp1, have been shown to be directly controlled by the Hog1 SAPK. The mechanisms by which Hog1 regulates their activity differ from one to another. In this paper, we show that Rtg1 and Rtg3 transcription factors are new targets of the Hog1 SAPK. In response to osmostress, RTG-dependent genes are induced in a Hog1-dependent manner, and Hog1 is required for Rtg1/3 complex nuclear accumulation. In addition, Hog1 activity regulates Rtg1/3 binding to chromatin and transcriptional activity. Therefore Hog1 modulates Rtg1/3 complex activity by multiple mechanisms in response to stress. Overall our data suggest that Hog1, through activation of the RTG pathway, contributes to ensure mitochondrial function as part of the Hog1-mediated osmoadaptive response. PMID:22956768

  3. Testicular Nuclear Receptor 4 (TR4) Regulates UV Light-induced Responses via Cockayne Syndrome B Protein-mediated Transcription-coupled DNA Repair*

    PubMed Central

    Liu, Su; Yan, Shian-Jang; Lee, Yi-Fen; Liu, Ning-Chun; Ting, Huei-Ju; Li, Gonghui; Wu, Qiao; Chen, Lu-Min; Chang, Chawnshang

    2011-01-01

    UV irradiation is one of the major external insults to cells and can cause skin aging and cancer. In response to UV light-induced DNA damage, the nucleotide excision repair (NER) pathways are activated to remove DNA lesions. We report here that testicular nuclear receptor 4 (TR4), a member of the nuclear receptor family, modulates DNA repair specifically through the transcription-coupled (TC) NER pathway but not the global genomic NER pathway. The level of Cockayne syndrome B protein (CSB), a member of the TC-NER pathway, is 10-fold reduced in TR4-deficient mouse tissues, and TR4 directly regulates CSB at the transcriptional level. Moreover, restored CSB expression rescues UV hypersensitivity of TR4-deficient cells. Together, these results indicate that TR4 modulates UV sensitivity by promoting the TC-NER DNA repair pathway through transcriptional regulation of CSB. These results may lead to the development of new treatments for UV light-sensitive syndromes, skin cancer, and aging. PMID:21918225

  4. In vivo Atoh1 targetome reveals how a proneural transcription factor regulates cerebellar development.

    PubMed

    Klisch, Tiemo J; Xi, Yuanxin; Flora, Adriano; Wang, Liguo; Li, Wei; Zoghbi, Huda Y

    2011-02-22

    The proneural, basic helix-loop-helix transcription factor Atoh1 governs the development of numerous key neuronal subtypes, such as cerebellar granule and brainstem neurons, inner ear hair cells, and several neurons of the proprioceptive system, as well as diverse nonneuronal cell types, such as Merkel cells and intestinal secretory lineages. However, the mere handful of targets that have been identified barely begin to account for Atoh1's astonishing range of functions, which also encompasses seemingly paradoxical activities, such as promoting cell proliferation and medulloblastoma formation in the cerebellum and inducing cell cycle exit and suppressing tumorigenesis in the intestine. We used a multipronged approach to create a comprehensive, unbiased list of over 600 direct Atoh1 target genes in the postnatal cerebellum. We found that Atoh1 binds to a 10 nucleotide motif (AtEAM) to directly regulate genes involved in migration, cell adhesion, metabolism, and other previously unsuspected functions. This study expands current thinking about the transcriptional activities driving neuronal differentiation and provides a framework for further neurodevelopmental studies. PMID:21300888

  5. Transcriptional regulation of neuropeptide and peptide hormone expression by the Drosophila dimmed and cryptocephal genes.

    PubMed

    Gauthier, Sebastien A; Hewes, Randall S

    2006-05-01

    The regulation of neuropeptide and peptide hormone gene expression is essential for the development and function of neuroendocrine cells in integrated physiological networks. In insects, a decline in circulating ecdysteroids triggers the activation of a neuroendocrine system to stimulate ecdysis, the behaviors used to shed the old cuticle at the culmination of each molt. Here we show that two evolutionarily conserved transcription factor genes, the basic helix-loop-helix (bHLH) gene dimmed (dimm) and the basic-leucine zipper (bZIP) gene cryptocephal (crc), control expression of diverse neuropeptides and peptide hormones in Drosophila. Central nervous system expression of three neuropeptide genes, Dromyosuppressin, FMRFamide-related and Leucokinin, is activated by dimm. Expression of Ecdysis triggering hormone (ETH) in the endocrine Inka cells requires crc; homozygous crc mutant larvae display markedly reduced ETH levels and corresponding defects in ecdysis. crc activates ETH expression though a 382 bp enhancer, which completely recapitulates the ETH expression pattern. The enhancer contains two evolutionarily conserved regions, and both are imperfect matches to recognition elements for activating transcription factor-4 (ATF-4), the vertebrate ortholog of the CRC protein and an important intermediate in cellular responses to endoplasmic reticulum stress. These regions also contain a putative ecdysteroid response element and a predicted binding site for the products of the E74 ecdysone response gene. These results suggest that convergence between ATF-related signaling and an important intracellular steroid response pathway may contribute to the neuroendocrine regulation of insect molting. PMID:16651547

  6. SUMOylation of DEC1 Protein Regulates Its Transcriptional Activity and Enhances Its Stability

    PubMed Central

    Li, Shujing; Bi, Hailian; Yang, Chunhua; Zhao, Feng; Liu, Ying; Ao, Xiang; Chang, Alan K.; Wu, Huijian

    2011-01-01

    Differentiated embryo-chondrocyte expressed gene 1 (DEC1, also known as sharp2, stra13, or BHLHB2) is a mammalian basic helix-loop-helix protein that is involved in many aspects of gene regulation through acting as a transcription factor. Changes in DEC1 expression levels have been implicated in the development of cancers. Using COS-7 cell, we showed that DEC1 can be modified by the small ubiquitin-like modifiers, SUMO1, 2 and 3. Two major SUMOylation sites (K159 and K279) were identified in the C-terminal domain of DEC1. Substitution of either K159 or K279 with arginine reduced DEC1 SUMOylation, but substitution of both K159 and K279 abolished SUMOylation, and more protein appeared to be retained in the cytoplasm compared to wild-type DEC1. The expression of DEC1 was up-regulated after serum starvation as previously reported, but at the same time, serum starvation also led to more SUMOylation of DEC1. In MCF-7 cells SUMOylation also stabilized DEC1 through inhibiting its ubiquitination. Moreover, SUMOylation of DEC1 promoted its repression of CLOCK/BMAL1-mediated transcriptional activity through recruitment of histone deacetylase1. These findings suggested that posttranslational modification of DEC1 in the form of SUMOylation may serve as a key factor that regulates the function of DEC1 in vivo. PMID:21829689

  7. Overexpression of a transcription factor LYL1 induces T- and B-cell lymphoma in mice.

    PubMed

    Zhong, Y; Jiang, L; Hiai, H; Toyokuni, S; Yamada, Y

    2007-10-18

    LYL1, a member of the class II basic helix-loop-helix transcription factors, is aberrantly expressed in a fraction of human T-cell acute lymphoblastic leukemia. Here, we generated transgenic mice ubiquitously overexpressing LYL1 using a construct expressing full-length cDNA driven by a human elongation factor 1alpha promoter. Four independent lines exhibiting high LYL1 expression were established. Of these transgenic mice, 96% displayed loss of hair with a short kinked tail. Furthermore, 30% of them developed malignant lymphoma, with an average latent period of 352 days. In these mice, histological examination revealed tumor cell infiltration in multiple organs and immunohistochemical analysis showed that the infiltrated tumor cells were either CD3 or CD45R/B220-positive; fluorescence-activated cell sorter analysis indicated that each tumor consisted either of mainly CD4, CD8 double-positive T cells or mature B cells; the clonality of LYL1-induced lymphoma was confirmed by T-cell receptor rearrangement and immunoglobulin heavy-chain gene rearrangement analyses. Mammalian two-hybrid analysis and luciferase assay suggested that excess LYL1 blocked the dimerization of E2A and thus inhibited the regulatory activity of E2A on the CD4 promoter. Reverse transcription-polymerase chain reaction results showed that the expression of certain E2A/HEB target genes was downregulated. Taken together, our results provide direct evidence that aberrant expression of LYL1 plays a role in lymphomagenesis. PMID:17486074

  8. Segregating neural and mechanosensory fates in the developing ear: patterning, signaling, and transcriptional control.

    PubMed

    Raft, Steven; Groves, Andrew K

    2015-01-01

    The vertebrate inner ear is composed of multiple sensory receptor epithelia, each of which is specialized for detection of sound, gravity, or angular acceleration. Each receptor epithelium contains mechanosensitive hair cells, which are connected to the brainstem by bipolar sensory neurons. Hair cells and their associated neurons are derived from the embryonic rudiment of the inner ear epithelium, but the precise spatial and temporal patterns of their generation, as well as the signals that coordinate these events, have only recently begun to be understood. Gene expression, lineage tracing, and mutant analyses suggest that both neurons and hair cells are generated from a common domain of neural and sensory competence in the embryonic inner ear rudiment. Members of the Shh, Wnt, and FGF families, together with retinoic acid signals, regulate transcription factor genes within the inner ear rudiment to establish the axial identity of the ear and regionalize neurogenic activity. Close-range signaling, such as that of the Notch pathway, specifies the fate of sensory regions and individual cell types. We also describe positive and negative interactions between basic helix-loop-helix and SoxB family transcription factors that specify either neuronal or sensory fates in a context-dependent manner. Finally, we review recent work on inner ear development in zebrafish, which demonstrates that the relative timing of neurogenesis and sensory epithelial formation is not phylogenetically constrained. PMID:24902666

  9. Homeodomain-Leucine zipper II family of transcription factors to the limelight

    PubMed Central

    Carabelli, Monica; Turchi, Luana; Ruzza, Valentino; Morelli, Giorgio; Ruberti, Ida

    2013-01-01

    The Arabidopsis genome encodes 10 Homeodomain-Leucine Zipper (HD-Zip) II transcription factors that can be subdivided into 4 clades (α–δ). All the γ (ARABIDOPSIS THALIANA HOMEOBOX 2 [ATHB2], HOMEOBOX ARABIDOPSIS THALIANA 1 [HAT1], HAT2) and δ (HAT3, ATHB4) genes are regulated by light quality changes (Low Red [R]/Far-Red [FR]) that induce the shade avoidance response in most of the angiosperms. HD-Zip IIγ and HD-Zip IIδ transcription factors function as positive regulators of shade avoidance, and there is evidence that at least ATHB2 is directly positively regulated by the basic Helix-Loop-Helix (bHLH) proteins PHYTOCHROME INTERACTING FACTOR 4 (PIF4) and PIF5. Recent evidence demonstrate that, in addition to their function in shade avoidance, HD-Zip IIγ and HD-Zip IIδ proteins play an essential role in plant development from embryogenesis onwards in a white light environment. PMID:23838958

  10. Complex domain interactions regulate stability and activity of closely related proneural transcription factors

    PubMed Central

    McDowell, Gary S.; Hardwick, Laura J.A.; Philpott, Anna

    2014-01-01

    Characterising post-translational regulation of key transcriptional activators is crucial for understanding how cell division and differentiation are coordinated in developing organisms and cycling cells. One important mode of protein post-translational control is by regulation of half-life via ubiquitin-mediated proteolysis. Two key basic Helix-Loop-Helix transcription factors, Neurogenin 2 (Ngn2) and NeuroD, play central roles in development of the central nervous system but despite their homology, Ngn2 is a highly unstable protein whilst NeuroD is, by comparison, very stable. The basis for and the consequences of the difference in stability of these two structurally and functionally related proteins has not been explored. Here we see that ubiquitylation alone does not determine Ngn2 or NeuroD stability. By making chimeric proteins, we see that the N-terminus of NeuroD in particular has a stabilising effect, whilst despite their high levels of homology, the most conserved bHLH domains of these proneural proteins alone can confer significant changes in protein stability. Despite widely differing stabilities of Ngn2, NeuroD and the chimeric proteins composed of domains of both, there is little correlation between protein half-life and ability to drive neuronal differentiation. Therefore, we conclude that despite significant homology between Ngn2 and NeuroD, the regulation of their stability differs markedly and moreover, stability/instability of the proteins is not a direct correlate of their activity. PMID:24998442

  11. Structure, sequence, and chromosomal location of the gene for USF2 transcription factors in mouse.

    PubMed

    Henrion, A A; Martinez, A; Mattei, M G; Kahn, A; Raymondjean, M

    1995-01-01

    The ubiquitously expressed upstream stimulatory factor (USF) involved in the transcription of a wide variety of cellular genes is defined as dimers of c-myc-related proteins, composed of a basic helix-loop-helix/leucine zipper region. The USF family consists of different members that split into two groups: MLTF or USF1 and USF2 or FIP. We present here evidence that USF1 and USF2 are distinct closely related genes in human, rat, and mouse. Based on the recent cloning of rat and human new cDNAs, we have isolated genomic clones encompassing the murine USF2 gene, which consists of at least 10 exons spanning a minimum of 10 kb of genomic DNA. Unexpectedly, the organization of USF2 appears very split up by introns (0.08 to over 6 kb in size), compared to the myc gene structure. The entire gene (but the larger intron) and 1.6 kb of the 5' flanking region were sequenced. This 5' flanking region is GC-rich, contains several putative transcription binding sites, and has no apparent TATA box. Gene mapping of murine USF2 and USF1 has been determined by in situ hybridization, indicating the localization of USF2 on chromosome 7 and of USF1 on chromosomes 1 and 11. PMID:7774954

  12. Phosphatidic acid and phosphoinositides facilitate liposome association of Yas3p and potentiate derepression of ARE1 (alkane-responsive element one)-mediated transcription control.

    PubMed

    Kobayashi, Satoshi; Hirakawa, Kiyoshi; Horiuchi, Hiroyuki; Fukuda, Ryouichi; Ohta, Akinori

    2013-12-01

    In the n-alkane assimilating yeast Yarrowia lipolytica, the expression of ALK1, encoding a cytochrome P450 that catalyzes terminal mono-oxygenation of n-alkanes, is induced by n-alkanes. The transcription of ALK1 is regulated by a heterocomplex that comprises the basic helix-loop-helix transcription activators, Yas1p and Yas2p, and binds to alkane-responsive element 1 (ARE1) in the ALK1 promoter. An Opi1 family transcription repressor, Yas3p, represses transcription by binding to Yas2p. Yas3p localizes in the nucleus when Y. lipolytica is grown on glucose but localizes to the endoplasmic reticulum (ER) upon the addition of n-alkanes. In this study, we showed that recombinant Yas3p binds to the acidic phospholipids, phosphatidic acid (PA) and phosphoinositides (PIPs), in vitro. The ARE1-mediated transcription was enhanced in vivo in mutants defective in an ortholog of the Saccharomyces cerevisiae gene PAH1, encoding PA phosphatase, and in an ortholog of SAC1, encoding PIP phosphatase in the ER. Truncation mutation analyses for Yas3p revealed two regions that bound to PA and PIPs. These results suggest that the interaction with acidic phospholipids is important for the n-alkane-induced association of Yas3p with the ER membrane. PMID:24120453

  13. The bHLH transcription factor Tcf21 is required for lineage-specific EMT of cardiac fibroblast progenitors

    PubMed Central

    Acharya, Asha; Baek, Seung Tae; Huang, Guo; Eskiocak, Banu; Goetsch, Sean; Sung, Caroline Y.; Banfi, Serena; Sauer, Marion F.; Olsen, Gregory S.; Duffield, Jeremy S.; Olson, Eric N.; Tallquist, Michelle D.

    2012-01-01

    The basic helix-loop-helix (bHLH) family of transcription factors orchestrates cell-fate specification, commitment and differentiation in multiple cell lineages during development. Here, we describe the role of a bHLH transcription factor, Tcf21 (epicardin/Pod1/capsulin), in specification of the cardiac fibroblast lineage. In the developing heart, the epicardium constitutes the primary source of progenitor cells that form two cell lineages: coronary vascular smooth muscle cells (cVSMCs) and cardiac fibroblasts. Currently, there is a debate regarding whether the specification of these lineages occurs early in the formation of the epicardium or later after the cells have entered the myocardium. Lineage tracing using a tamoxifen-inducible Cre expressed from the Tcf21 locus demonstrated that the majority of Tcf21-expressing epicardial cells are committed to the cardiac fibroblast lineage prior to initiation of epicardial epithelial-to-mesenchymal transition (EMT). Furthermore, Tcf21 null hearts fail to form cardiac fibroblasts, and lineage tracing of the null cells showed their inability to undergo EMT. This is the first report of a transcription factor essential for the development of cardiac fibroblasts. We demonstrate a unique role for Tcf21 in multipotent epicardial progenitors, prior to the process of EMT that is essential for cardiac fibroblast development. PMID:22573622

  14. Members of the bHLH-PAS family regulate Shh transcription in forebrain regions of the mouse CNS.

    PubMed

    Epstein, D J; Martinu, L; Michaud, J L; Losos, K M; Fan, C; Joyner, A L

    2000-11-01

    The secreted protein sonic hedgehog (Shh) is required to establish patterns of cellular growth and differentiation within ventral regions of the developing CNS. The expression of Shh in the two tissue sources responsible for this activity, the axial mesoderm and the ventral midline of the neural tube, is regulated along the anteroposterior neuraxis. Separate cis-acting regulatory sequences have been identified which direct Shh expression to distinct regions of the neural tube, supporting the view that multiple genes are involved in activating Shh transcription along the length of the CNS. We show here that the activity of one Shh enhancer, which directs reporter expression to portions of the ventral midbrain and diencephalon, overlaps both temporally and spatially with the expression of Sim2. Sim2 encodes a basic helix-loop-helix (bHLH-PAS) PAS domain containing transcriptional regulator whose Drosophila homolog, single-minded, is a master regulator of ventral midline development. Both vertebrate and invertebrate Sim family members were found sufficient for the activation of the Shh reporter as well as endogenous Shh mRNA. Although Shh expression is maintained in Sim2(-)(/)(-) embryos, it was determined to be absent from the rostral midbrain and caudal diencephalon of embryos carrying a dominant-negative transgene that disrupts the function of bHLH-PAS proteins. Together, these results suggest that bHLH-PAS family members are required for the regulation of Shh transcription within aspects of the ventral midbrain and diencephalon. PMID:11023872

  15. Complementary Quantitative Proteomics Reveals that Transcription Factor AP-4 Mediates E-box-dependent Complex Formation for Transcriptional Repression of HDM2*

    PubMed Central

    Ku, Wei-Chi; Chiu, Sung-Kay; Chen, Yi-Ju; Huang, Hsin-Hung; Wu, Wen-Guey; Chen, Yu-Ju

    2009-01-01

    Transcription factor activating enhancer-binding protein 4 (AP-4) is a basic helix-loop-helix protein that binds to E-box elements. AP-4 has received increasing attention for its regulatory role in cell growth and development, including transcriptional repression of the human homolog of murine double minute 2 (HDM2), an important oncoprotein controlling cell growth and survival, by an unknown mechanism. Here we demonstrate that AP-4 binds to an E-box located in the HDM2-P2 promoter and represses HDM2 transcription in a p53-independent manner. Incremental truncations of AP-4 revealed that the C-terminal Gln/Pro-rich domain was essential for transcriptional repression of HDM2. To further delineate the molecular mechanism(s) of AP-4 transcriptional control and its potential implications, we used DNA-affinity purification followed by complementary quantitative proteomics, cICAT and iTRAQ labeling methods, to identify a previously unknown E-box-bound AP-4 protein complex containing 75 putative components. The two labeling methods complementarily quantified differentially AP-4-enriched proteins, including the most significant recruitment of DNA damage response proteins, followed by transcription factors, transcriptional repressors/corepressors, and histone-modifying proteins. Specific interaction of AP-4 with CCCTC binding factor, stimulatory protein 1, and histone deacetylase 1 (an AP-4 corepressor) was validated using AP-4 truncation mutants. Importantly, inclusion of trichostatin A did not alleviate AP-4-mediated repression of HDM2 transcription, suggesting a previously unidentified histone deacetylase-independent repression mechanism. In contrast, the complementary quantitative proteomics study suggested that transcription repression occurs via coordination of AP-4 with other transcription factors, histone methyltransferases, and/or a nucleosome remodeling SWI·SNF complex. In addition to previously known functions of AP-4, our data suggest that AP-4 participates in

  16. DNA binding by the ETS-domain transcription factor PEA3 is regulated by intramolecular and intermolecular protein.protein interactions.

    PubMed

    Greenall, A; Willingham, N; Cheung, E; Boam, D S; Sharrocks, A D

    2001-05-11

    The control of DNA binding by eukaryotic transcription factors represents an important regulatory mechanism. Many transcription factors are controlled by cis-acting autoinhibitory modules that are thought to act by blocking promiscuous DNA binding in the absence of appropriate regulatory cues. Here, we have investigated the determinants and regulation of the autoinhibitory mechanism employed by the ETS-domain transcription factor, PEA3. DNA binding is inhibited by a module composed of a combination of two short motifs located on either side of the ETS DNA-binding domain. A second type of protein, Ids, can act in trans to mimic the effect of these cis-acting inhibitory motifs and reduce DNA binding by PEA3. By using a one-hybrid screen, we identified the basic helix-loop-helix-leucine zipper transcription factor USF-1 as an interaction partner for PEA3. PEA3 and USF-1 form DNA complexes in a cooperative manner. Moreover, the formation of ternary PEA3.USF-1.DNA complexes requires parts of the same motifs in PEA3 that form the autoinhibitory module. Thus the binding of USF-1 to PEA3 acts as a switch that modifies the autoinhibitory motifs in PEA3 to first relieve their inhibitory action, and second, promote ternary nucleoprotein complex assembly. PMID:11278941

  17. The bHLH transcription factor BIS1 controls the iridoid branch of the monoterpenoid indole alkaloid pathway in Catharanthus roseus.

    PubMed

    Van Moerkercke, Alex; Steensma, Priscille; Schweizer, Fabian; Pollier, Jacob; Gariboldi, Ivo; Payne, Richard; Vanden Bossche, Robin; Miettinen, Karel; Espoz, Javiera; Purnama, Purin Candra; Kellner, Franziska; Seppänen-Laakso, Tuulikki; O'Connor, Sarah E; Rischer, Heiko; Memelink, Johan; Goossens, Alain

    2015-06-30

    Plants make specialized bioactive metabolites to defend themselves against attackers. The conserved control mechanisms are based on transcriptional activation of the respective plant species-specific biosynthetic pathways by the phytohormone jasmonate. Knowledge of the transcription factors involved, particularly in terpenoid biosynthesis, remains fragmentary. By transcriptome analysis and functional screens in the medicinal plant Catharanthus roseus (Madagascar periwinkle), the unique source of the monoterpenoid indole alkaloid (MIA)-type anticancer drugs vincristine and vinblastine, we identified a jasmonate-regulated basic helix-loop-helix (bHLH) transcription factor from clade IVa inducing the monoterpenoid branch of the MIA pathway. The bHLH iridoid synthesis 1 (BIS1) transcription factor transactivated the expression of all of the genes encoding the enzymes that catalyze the sequential conversion of the ubiquitous terpenoid precursor geranyl diphosphate to the iridoid loganic acid. BIS1 acted in a complementary manner to the previously characterized ethylene response factor Octadecanoid derivative-Responsive Catharanthus APETALA2-domain 3 (ORCA3) that transactivates the expression of several genes encoding the enzymes catalyzing the conversion of loganic acid to the downstream MIAs. In contrast to ORCA3, overexpression of BIS1 was sufficient to boost production of high-value iridoids and MIAs in C. roseus suspension cell cultures. Hence, BIS1 might be a metabolic engineering tool to produce sustainably high-value MIAs in C. roseus plants or cultures. PMID:26080427

  18. The absence of the transcription activator TFE3 impairs activation of B cells in vivo.

    PubMed Central

    Merrell, K; Wells, S; Henderson, A; Gorman, J; Alt, F; Stall, A; Calame, K

    1997-01-01

    TFE3 is a ubiquitously expressed member of the TFE3/mi family of basic helix loop helix zipper transcription factors. TFE3 binds to muE3 sites located in the immunoglobulin heavy-chain (IgH) intronic enhancer, heavy-chain variable region promoters, the Ig kappa intronic enhancer, and regulatory sites in other genes. To understand the role of TFE3 in Ig expression and lymphoid development, we used embryonic stem (ES) cell-mediated gene targeting and RAG2-/- blastocyst complementation to generate mice which lack TFE3 in their B and T lymphocytes. TFE3- ES cells fully reconstitute the B- and T-cell compartments, giving rise to normal patterns of IgM+ B220+ B cells and CD4+ and CD8+ T cells. However, TFE3- B cells show several defects consistent with poor B-cell activation. Serum IgM levels are reduced twofold and IgG and IgA isotypes are reduced three- to sixfold in the TFE3- chimeras even though in vitro, the TFE3- splenocytes secrete normal levels of all isotypes in response to lipopolysaccharide activation. Peripheral TFE3- B cells also show reduced surface expression of CD23 and CD24 (heat-stable antigen). PMID:9154832

  19. DNazyme-mediated cleavage of Twist transcripts and increase in cellular apoptosis.

    PubMed

    Hjiantoniou, Eleni; Iseki, Sachiko; Uney, James B; Phylactou, Leonidas A

    2003-01-01

    DNazymes is a group of catalytic nucleic acids that can be designed to cleave target mRNA molecules in a base-specific way. Twist is a basic helix-loop-helix transcription factor that is involved in the regulation of cellular differentiation and apoptosis. Moreover, it was shown to function in skull development and cause craniosynostosis. DZ-TWT DNazyme was designed to down-regulate Twist expression. The ability of DZ-TWT to cleave mouse Twist mRNA was first shown in a cell-free environment against full-length Twist mRNA. Following transfections of the DZ-TWT in C3H10T1/2 cells, a significant reduction of Twist mRNA levels was observed. This was accompanied by a significant rise in p21 mRNA levels. Finally, DZ-TWT transfections resulted in an increase of cellular apoptosis, demonstrating the importance of Twist in apoptotic pathways. These results prove the usefulness of DNazymes to characterize Twist gene function and further experiments in animals should demonstrate its complete physiological role. PMID:12480539

  20. The Transcription Factor Hand1 Is Involved In Runx2-Ihh-Regulated Endochondral Ossification

    PubMed Central

    Laurie, Lindsay E.; Kokubo, Hiroki; Nakamura, Masataka; Saga, Yumiko; Funato, Noriko

    2016-01-01

    The developing long bone is a model of endochondral ossification that displays the morphological layers of chondrocytes toward the ossification center of the diaphysis. Indian hedgehog (Ihh), a member of the hedgehog family of secreted molecules, regulates chondrocyte proliferation and differentiation, as well as osteoblast differentiation, through the process of endochondral ossification. Here, we report that the basic helix-loop-helix transcription factor Hand1, which is expressed in the cartilage primordia, is involved in proper osteogenesis of the bone collar via its control of Ihh production. Genetic overexpression of Hand1 in the osteochondral progenitors resulted in prenatal hypoplastic or aplastic ossification in the diaphyses, mimicking an Ihh loss-of-function phenotype. Ihh expression was downregulated in femur epiphyses of Hand1-overexpressing mice. We also confirmed that Hand1 downregulated Ihh gene expression in vitro by inhibiting Runx2 transactivation of the Ihh proximal promoter. These results demonstrate that Hand1 in chondrocytes regulates endochondral ossification, at least in part through the Runx2-Ihh axis. PMID:26918743

  1. An atypical bHLH transcription factor regulates early xylem development downstream of auxin.

    PubMed

    Ohashi-Ito, Kyoko; Matsukawa, Manami; Fukuda, Hiroo

    2013-03-01

    The vascular system in plants, which comprises xylem, phloem and vascular stem cells, originates from provascular cells and forms a continuous network throughout the plant body. Although various aspects of vascular development have been extensively studied, the early process of vascular development remains largely unknown. LONESOME HIGHWAY (LHW), which encodes an atypical basic helix-loop-helix (bHLH) transcription factor, plays an essential role in establishing vascular cells. Here, we report the analysis of LHW homologs in relation to vascular development. Three LHW homologs, LONESOME HIGHWAY LIKE 1-3 (LHL1-LHL3), were preferentially expressed in the plant vasculature. Genetic analysis indicated that, although the LHL3 loss-of-function mutant showed no obvious phenotype, the lhw lhl3 double mutant displayed more severe phenotypic defects in the vasculature of the cotyledons and roots than the lhw single mutant. Only one xylem vessel was formed at the metaxylem position in lhw lhl3 roots, whereas the lhw root formed one protoxylem and one or two metaxylem vessels. Conversely, overexpression of LHL3 enhanced xylem development in the roots. Moreover, N-1-naphthylphthalamic acid caused ectopic LHL3 expression in accordance with induced auxin maximum. These results suggest that LHL3 plays a positive role in xylem differentiation downstream of auxin. PMID:23359424

  2. The Transcriptional Repressor MYB2 Regulates Both Spatial and Temporal Patterns of Proanthocyandin and Anthocyanin Pigmentation in Medicago truncatula.

    PubMed

    Jun, Ji Hyung; Liu, Chenggang; Xiao, Xirong; Dixon, Richard A

    2015-10-01

    Accumulation of anthocyanins and proanthocyanidins (PAs) is limited to specific cell types and developmental stages, but little is known about how antagonistically acting transcriptional regulators work together to determine temporal and spatial patterning of pigmentation at the cellular level, especially for PAs. Here, we characterize MYB2, a transcriptional repressor regulating both anthocyanin and PA biosynthesis in the model legume Medicago truncatula. MYB2 was strongly upregulated by MYB5, a major regulator of PA biosynthesis in M. truncatula and a component of MYB-basic helix loop helix-WD40 (MBW) activator complexes. Overexpression of MYB2 abolished anthocyanin and PA accumulation in M. truncatula hairy roots and Arabidopsis thaliana seeds, respectively. Anthocyanin deposition was expanded in myb2 mutant seedlings and flowers accompanied by increased anthocyanin content. PA mainly accumulated in the epidermal layer derived from the outer integument in the M. truncatula seed coat, starting from the hilum area. The area of PA accumulation and ANTHOCYANIDIN REDUCTASE expression was expanded into the seed body at the early stage of seed development in the myb2 mutant. Genetic, biochemical, and cell biological evidence suggests that MYB2 functions as part of a multidimensional regulatory network to define the temporal and spatial pattern of anthocyanin and PA accumulation linked to developmental processes. PMID:26410301

  3. Ubiquitous expression of the 43- and 44-kDa forms of transcription factor USF in mammalian cells.

    PubMed Central

    Sirito, M; Lin, Q; Maity, T; Sawadogo, M

    1994-01-01

    USF is a helix-loop-helix transcription factor that, like Myc, recognizes the DNA binding motif CACGTG. Two different forms of USF, characterized by apparent molecular weights of 43,000 and 44,000, were originally identified in HeLa cells by biochemical analysis. Clones for the 43-kDa USF were first characterized, but only partial clones for the human 44-kDa USF (USF2, or FIP) have been reported. Here we describe a complete cDNA for the 44-kDa USF from murine cells. Analysis of this clone has revealed that the various USF family members are quite divergent in their N-terminal amino acid sequences, while a high degree of conservation characterizes their dimerization and DNA-binding domains. Interestingly, the 3' noncoding region of the 44-kDa USF cDNAs displayed an unusual degree of conservation between human and mouse. In vitro transcription/translation experiments indicated a possible role for this region in translation regulation. Alternative splicing forms of the 44-kDa USF messages exist in both mouse and human. Examination of the tissue and cell-type distribution of USF by Northern blot and gel retardation assays revealed that while expression of both the 43- and 44-kDa USF species is ubiquitous, different ratios of USF homo- and heterodimers are found in different cells. Images PMID:8127680

  4. A Conserved Network of Transcriptional Activators and Repressors Regulates Anthocyanin Pigmentation in Eudicots[C][W][OPEN

    PubMed Central

    Albert, Nick W.; Davies, Kevin M.; Lewis, David H.; Zhang, Huaibi; Montefiori, Mirco; Brendolise, Cyril; Boase, Murray R.; Ngo, Hanh; Jameson, Paula E.; Schwinn, Kathy E.

    2014-01-01

    Plants require sophisticated regulatory mechanisms to ensure the degree of anthocyanin pigmentation is appropriate to myriad developmental and environmental signals. Central to this process are the activity of MYB-bHLH-WD repeat (MBW) complexes that regulate the transcription of anthocyanin genes. In this study, the gene regulatory network that regulates anthocyanin synthesis in petunia (Petunia hybrida) has been characterized. Genetic and molecular evidence show that the R2R3-MYB, MYB27, is an anthocyanin repressor that functions as part of the MBW complex and represses transcription through its C-terminal EAR motif. MYB27 targets both the anthocyanin pathway genes and basic-helix-loop-helix (bHLH) ANTHOCYANIN1 (AN1), itself an essential component of the MBW activation complex for pigmentation. Other features of the regulatory network identified include inhibition of AN1 activity by the competitive R3-MYB repressor MYBx and the activation of AN1, MYB27, and MYBx by the MBW activation complex, providing for both reinforcement and feedback regulation. We also demonstrate the intercellular movement of the WDR protein (AN11) and R3-repressor (MYBx), which may facilitate anthocyanin pigment pattern formation. The fundamental features of this regulatory network in the Asterid model of petunia are similar to those in the Rosid model of Arabidopsis thaliana and are thus likely to be widespread in the Eudicots. PMID:24642943

  5. Multi-site phospho-regulation of proneural transcription factors controls proliferation versus differentiation in development and reprogramming

    PubMed Central

    Philpott, Anna

    2015-01-01

    During development of the nervous system, it is essential to co-ordinate the processes of proliferation and differentiation. Basic helix-loop-helix transcription factors play a central role in controlling neuronal differentiation and maturation as well as being components of the combinatorial code that determines neuronal identity. We have recently shown that the ability of the proneural proteins Ngn2 and Ascl1 to drive neuronal differentiation is inhibited by cyclin dependent kinase-mediated multi-site phosphorylation. This limits downstream target promoter dwell time, thus demonstrating a direct mechanistic regulatory link between the cell cycle and differentiation machinery.Proneural proteins are key components of transcription factor cocktails that can bring about the direct reprogramming of human fibroblasts into neurons. Building on our observations demonstrating that phospho-mutant proneural proteins show an enhanced ability to drive neuronal differentiation in vivo, we see that replacing wild-type with phospho-mutant proneural proteins in fibroblast reprogramming cocktails significantly enhances the axonal outgrowth, branching and electrophysiological maturity of the neurons generated. A model is presented here that can explain the enhanced ability of dephosphorylated proneural proteins to drive neuronal differentiation, and some unanswered questions in this emerging area are highlighted.

  6. E2F/Rb Family Proteins Mediate Interferon Induced Repression of Adenovirus Immediate Early Transcription to Promote Persistent Viral Infection.

    PubMed

    Zheng, Yueting; Stamminger, Thomas; Hearing, Patrick

    2016-01-01

    Interferons (IFNs) are cytokines that have pleiotropic effects and play important roles in innate and adaptive immunity. IFNs have broad antiviral properties and function by different mechanisms. IFNs fail to inhibit wild-type Adenovirus (Ad) replication in established cancer cell lines. In this study, we analyzed the effects of IFNs on Ad replication in normal human cells. Our data demonstrate that both IFNα and IFNγ blocked wild-type Ad5 replication in primary human bronchial epithelial cells (NHBEC) and TERT-immortalized normal human diploid fibroblasts (HDF-TERT). IFNs inhibited the replication of divergent adenoviruses. The inhibition of Ad5 replication by IFNα and IFNγ is the consequence of repression of transcription of the E1A immediate early gene product. Both IFNα and IFNγ impede the association of the transactivator GABP with the E1A enhancer region during the early phase of infection. The repression of E1A expression by IFNs requires a conserved E2F binding site in the E1A enhancer, and IFNs increased the enrichment of the E2F-associated pocket proteins, Rb and p107, at the E1A enhancer in vivo. PD0332991 (Pabociclib), a specific CDK4/6 inhibitor, dephosphoryles pocket proteins to promote their interaction with E2Fs and inhibited wild-type Ad5 replication dependent on the conserved E2F binding site. Consistent with this result, expression of the small E1A oncoprotein, which abrogates E2F/pocket protein interactions, rescued Ad replication in the presence of IFNα or IFNγ. Finally, we established a persistent Ad infection model in vitro and demonstrated that IFNγ suppresses productive Ad replication in a manner dependent on the E2F binding site in the E1A enhancer. This is the first study that probes the molecular basis of persistent adenovirus infection and reveals a novel mechanism by which adenoviruses utilize IFN signaling to suppress lytic virus replication and to promote persistent infection. PMID:26809031

  7. E2F/Rb Family Proteins Mediate Interferon Induced Repression of Adenovirus Immediate Early Transcription to Promote Persistent Viral Infection

    PubMed Central

    Zheng, Yueting; Stamminger, Thomas; Hearing, Patrick

    2016-01-01

    Interferons (IFNs) are cytokines that have pleiotropic effects and play important roles in innate and adaptive immunity. IFNs have broad antiviral properties and function by different mechanisms. IFNs fail to inhibit wild-type Adenovirus (Ad) replication in established cancer cell lines. In this study, we analyzed the effects of IFNs on Ad replication in normal human cells. Our data demonstrate that both IFNα and IFNγ blocked wild-type Ad5 replication in primary human bronchial epithelial cells (NHBEC) and TERT-immortalized normal human diploid fibroblasts (HDF-TERT). IFNs inhibited the replication of divergent adenoviruses. The inhibition of Ad5 replication by IFNα and IFNγ is the consequence of repression of transcription of the E1A immediate early gene product. Both IFNα and IFNγ impede the association of the transactivator GABP with the E1A enhancer region during the early phase of infection. The repression of E1A expression by IFNs requires a conserved E2F binding site in the E1A enhancer, and IFNs increased the enrichment of the E2F-associated pocket proteins, Rb and p107, at the E1A enhancer in vivo. PD0332991 (Pabociclib), a specific CDK4/6 inhibitor, dephosphoryles pocket proteins to promote their interaction with E2Fs and inhibited wild-type Ad5 replication dependent on the conserved E2F binding site. Consistent with this result, expression of the small E1A oncoprotein, which abrogates E2F/pocket protein interactions, rescued Ad replication in the presence of IFNα or IFNγ. Finally, we established a persistent Ad infection model in vitro and demonstrated that IFNγ suppresses productive Ad replication in a manner dependent on the E2F binding site in the E1A enhancer. This is the first study that probes the molecular basis of persistent adenovirus infection and reveals a novel mechanism by which adenoviruses utilize IFN signaling to suppress lytic virus replication and to promote persistent infection. PMID:26809031

  8. Members of an R2R3-MYB transcription factor family in Petunia are developmentally and environmentally regulated to control complex floral and vegetative pigmentation patterning.

    PubMed

    Albert, Nick W; Lewis, David H; Zhang, Huaibi; Schwinn, Kathy E; Jameson, Paula E; Davies, Kevin M

    2011-03-01

    We present an investigation of anthocyanin regulation over the entire petunia plant, determining the mechanisms governing complex floral pigmentation patterning and environmentally induced vegetative anthocyanin synthesis. DEEP PURPLE (DPL) and PURPLE HAZE (PHZ) encode members of the R2R3-MYB transcription factor family that regulate anthocyanin synthesis in petunia, and control anthocyanin production in vegetative tissues and contribute to floral pigmentation. In addition to these two MYB factors, the basic helix-loop-helix (bHLH) factor ANTHOCYANIN1 (AN1) and WD-repeat protein AN11, are also essential for vegetative pigmentation. The induction of anthocyanins in vegetative tissues by high light was tightly correlated to the induction of transcripts for PHZ and AN1. Interestingly, transcripts for PhMYB27, a putative R2R3-MYB active repressor, were highly expressed during non-inductive shade conditions and repressed during high light. The competitive inhibitor PhMYBx (R3-MYB) was expressed under high light, which may provide feedback repression. In floral tissues DPL regulates vein-associated anthocyanin pigmentation in the flower tube, while PHZ determines light-induced anthocyanin accumulation on exposed petal surfaces (bud-blush). A model is presented suggesting how complex floral and vegetative pigmentation patterns are derived in petunia in terms of MYB, bHLH and WDR co-regulators. PMID:21235651

  9. Arabidopsis MYC Transcription Factors Are the Target of Hormonal Salicylic Acid/Jasmonic Acid Cross Talk in Response to Pieris brassicae Egg Extract.

    PubMed

    Schmiesing, André; Emonet, Aurélia; Gouhier-Darimont, Caroline; Reymond, Philippe

    2016-04-01

    Arabidopsis (Arabidopsis thaliana) plants recognize insect eggs and activate the salicylic acid (SA) pathway. As a consequence, expression of defense genes regulated by the jasmonic acid (JA) pathway is suppressed and larval performance is enhanced. Cross talk between defense signaling pathways is common in plant-pathogen interactions, but the molecular mechanism mediating this phenomenon is poorly understood. Here, we demonstrate that egg-induced SA/JA antagonism works independently of the APETALA2/ETHYLENE RESPONSE FACTOR (AP2/ERF) transcription factor ORA59, which controls the ERF branch of the JA pathway. In addition, treatment with egg extract did not enhance expression or stability of JASMONATE ZIM-domain transcriptional repressors, and SA/JA cross talk did not involve JASMONATE ASSOCIATED MYC2-LIKEs, which are negative regulators of the JA pathway. Investigating the stability of MYC2, MYC3, and MYC4, three basic helix-loop-helix transcription factors that additively control jasmonate-related defense responses, we found that egg extract treatment strongly diminished MYC protein levels in an SA-dependent manner. Furthermore, we identified WRKY75 as a novel and essential factor controlling SA/JA cross talk. These data indicate that insect eggs target the MYC branch of the JA pathway and uncover an unexpected modulation of SA/JA antagonism depending on the biological context in which the SA pathway is activated. PMID:26884488

  10. Overexpression of EcbHLH57 Transcription Factor from Eleusine coracana L. in Tobacco Confers Tolerance to Salt, Oxidative and Drought Stress

    PubMed Central

    Nataraja, Karaba N.; Udayakumar, M.

    2015-01-01

    Basic helix-loop-helix (bHLH) transcription factors constitute one of the largest families in plants and are known to be involved in various developmental processes and stress tolerance. We report the characterization of a stress responsive bHLH transcription factor from stress adapted species finger millet which is homologous to OsbHLH57 and designated as EcbHLH57. The full length sequence of EcbHLH57 consisted of 256 amino acids with a conserved bHLH domain followed by leucine repeats. In finger millet, EcbHLH57 transcripts were induced by ABA, NaCl, PEG, methyl viologen (MV) treatments and drought stress. Overexpression of EcbHLH57 in tobacco significantly increased the tolerance to salinity and drought stress with improved root growth. Transgenic plants showed higher photosynthetic rate and stomatal conductance under drought stress that resulted in higher biomass. Under long-term salinity stress, the transgenic plants accumulated higher seed weight/pod and pod number. The transgenic plants were also tolerant to oxidative stress and showed less accumulation of H202 and MDA levels. The overexpression of EcbHLH57 enhanced the expression of stress responsive genes such as LEA14, rd29A, rd29B, SOD, APX, ADH1, HSP70 and also PP2C and hence improved tolerance to diverse stresses. PMID:26366726

  11. An ABA-increased interaction of the PYL6 ABA receptor with MYC2 Transcription Factor: A putative link of ABA and JA signaling.

    PubMed

    Aleman, Fernando; Yazaki, Junshi; Lee, Melissa; Takahashi, Yohei; Kim, Alice Y; Li, Zixing; Kinoshita, Toshinori; Ecker, Joseph R; Schroeder, Julian I

    2016-01-01

    Abscisic acid (ABA) is a plant hormone that mediates abiotic stress tolerance and regulates growth and development. ABA binds to members of the PYL/RCAR ABA receptor family that initiate signal transduction inhibiting type 2C protein phosphatases. Although crosstalk between ABA and the hormone Jasmonic Acid (JA) has been shown, the molecular entities that mediate this interaction have yet to be fully elucidated. We report a link between ABA and JA signaling through a direct interaction of the ABA receptor PYL6 (RCAR9) with the basic helix-loop-helix transcription factor MYC2. PYL6 and MYC2 interact in yeast two hybrid assays and the interaction is enhanced in the presence of ABA. PYL6 and MYC2 interact in planta based on bimolecular fluorescence complementation and co-immunoprecipitation of the proteins. Furthermore, PYL6 was able to modify transcription driven by MYC2 using JAZ6 and JAZ8 DNA promoter elements in yeast one hybrid assays. Finally, pyl6 T-DNA mutant plants show an increased sensitivity to the addition of JA along with ABA in cotyledon expansion experiments. Overall, the present study identifies a direct mechanism for transcriptional modulation mediated by an ABA receptor different from the core ABA signaling pathway, and a putative mechanistic link connecting ABA and JA signaling pathways. PMID:27357749

  12. An ABA-increased interaction of the PYL6 ABA receptor with MYC2 Transcription Factor: A putative link of ABA and JA signaling

    PubMed Central

    Aleman, Fernando; Yazaki, Junshi; Lee, Melissa; Takahashi, Yohei; Kim, Alice Y.; Li, Zixing; Kinoshita, Toshinori; Ecker, Joseph R.; Schroeder, Julian I.

    2016-01-01

    Abscisic acid (ABA) is a plant hormone that mediates abiotic stress tolerance and regulates growth and development. ABA binds to members of the PYL/RCAR ABA receptor family that initiate signal transduction inhibiting type 2C protein phosphatases. Although crosstalk between ABA and the hormone Jasmonic Acid (JA) has been shown, the molecular entities that mediate this interaction have yet to be fully elucidated. We report a link between ABA and JA signaling through a direct interaction of the ABA receptor PYL6 (RCAR9) with the basic helix-loop-helix transcription factor MYC2. PYL6 and MYC2 interact in yeast two hybrid assays and the interaction is enhanced in the presence of ABA. PYL6 and MYC2 interact in planta based on bimolecular fluorescence complementation and co-immunoprecipitation of the proteins. Furthermore, PYL6 was able to modify transcription driven by MYC2 using JAZ6 and JAZ8 DNA promoter elements in yeast one hybrid assays. Finally, pyl6 T-DNA mutant plants show an increased sensitivity to the addition of JA along with ABA in cotyledon expansion experiments. Overall, the present study identifies a direct mechanism for transcriptional modulation mediated by an ABA receptor different from the core ABA signaling pathway, and a putative mechanistic link connecting ABA and JA signaling pathways. PMID:27357749

  13. An upstream open reading frame represses expression of Lc, a member of the R/B family of maize transcriptional activators

    SciTech Connect

    Damiani, R.D. Jr.; Wessler, S.R. )

    1993-09-01

    The R/B genes of maize encode a family of basic helix-loop-helix proteins that determine where and when the anthocyanin-pigment pathway will be expressed in the plant. Previous studies showed that allelic diversity among family members reflects differences in gene expression, specifically in transcription initiation. The authors present evidence that the R gene Lc is under translational control. They demonstrate that the 235-nt transcript leader of Lc represses expression 25- to 30-fold in an in vivo assay. Repression is mediated by the presence in cis of a 38-codon upstream open reading frame. Furthermore, the coding capacity of the upstream open reading frame influences the magnitude of repression. It is proposed that translational control does not contribute to tissue specificity but prevents overexpression of the Lc protein. The diversity of promoter and 5' untranslated leader sequences among the R/B genes provides an opportunity to study the coevolution of transcriptional and translational mechanisms of gene regulation. 36 refs., 5 figs.

  14. Arabidopsis MYC Transcription Factors Are the Target of Hormonal Salicylic Acid/Jasmonic Acid Cross Talk in Response to Pieris brassicae Egg Extract1[OPEN

    PubMed Central

    Schmiesing, André; Gouhier-Darimont, Caroline

    2016-01-01

    Arabidopsis (Arabidopsis thaliana) plants recognize insect eggs and activate the salicylic acid (SA) pathway. As a consequence, expression of defense genes regulated by the jasmonic acid (JA) pathway is suppressed and larval performance is enhanced. Cross talk between defense signaling pathways is common in plant-pathogen interactions, but the molecular mechanism mediating this phenomenon is poorly understood. Here, we demonstrate that egg-induced SA/JA antagonism works independently of the APETALA2/ETHYLENE RESPONSE FACTOR (AP2/ERF) transcription factor ORA59, which controls the ERF branch of the JA pathway. In addition, treatment with egg extract did not enhance expression or stability of JASMONATE ZIM-domain transcriptional repressors, and SA/JA cross talk did not involve JASMONATE ASSOCIATED MYC2-LIKEs, which are negative regulators of the JA pathway. Investigating the stability of MYC2, MYC3, and MYC4, three basic helix-loop-helix transcription factors that additively control jasmonate-related defense responses, we found that egg extract treatment strongly diminished MYC protein levels in an SA-dependent manner. Furthermore, we identified WRKY75 as a novel and essential factor controlling SA/JA cross talk. These data indicate that insect eggs target the MYC branch of the JA pathway and uncover an unexpected modulation of SA/JA antagonism depending on the biological context in which the SA pathway is activated. PMID:26884488

  15. The Arabidopsis bHLH Transcription Factors MYC3 and MYC4 Are Targets of JAZ Repressors and Act Additively with MYC2 in the Activation of Jasmonate Responses[C][W

    PubMed Central

    Fernández-Calvo, Patricia; Chini, Andrea; Fernández-Barbero, Gemma; Chico, José-Manuel; Gimenez-Ibanez, Selena; Geerinck, Jan; Eeckhout, Dominique; Schweizer, Fabian; Godoy, Marta; Franco-Zorrilla, José Manuel; Pauwels, Laurens; Witters, Erwin; Puga, María Isabel; Paz-Ares, Javier; Goossens, Alain; Reymond, Philippe; De Jaeger, Geert; Solano, Roberto

    2011-01-01

    Jasmonates (JAs) trigger an important transcriptional reprogramming of plant cells to modulate both basal development and stress responses. In spite of the importance of transcriptional regulation, only one transcription factor (TF), the Arabidopsis thaliana basic helix-loop-helix MYC2, has been described so far as a direct target of JAZ repressors. By means of yeast two-hybrid screening and tandem affinity purification strategies, we identified two previously unknown targets of JAZ repressors, the TFs MYC3 and MYC4, phylogenetically closely related to MYC2. We show that MYC3 and MYC4 interact in vitro and in vivo with JAZ repressors and also form homo- and heterodimers with MYC2 and among themselves. They both are nuclear proteins that bind DNA with sequence specificity similar to that of MYC2. Loss-of-function mutations in any of these two TFs impair full responsiveness to JA and enhance the JA insensitivity of myc2 mutants. Moreover, the triple mutant myc2 myc3 myc4 is as impaired as coi1-1 in the activation of several, but not all, JA-mediated responses such as the defense against bacterial pathogens and insect herbivory. Our results show that MYC3 and MYC4 are activators of JA-regulated programs that act additively with MYC2 to regulate specifically different subsets of the JA-dependent transcriptional response. PMID:21335373

  16. Is overexpression of TWIST, a transcriptional factor, a prognostic biomarker of head and neck carcinoma? Evidence from fifteen studies

    PubMed Central

    Zhuo, Xianlu; Luo, Huanli; Chang, Aoshuang; Li, Dairong; Zhao, Houyu; Zhou, Qi

    2015-01-01

    TWIST, a basic helix-loop-helix transcription factor, has been indicated to play a critical role in the progression of numerous malignant disorders. Published data on the significance of TWIST expression in head and neck carcinoma (HNC) risk have yielded conflicting results. Thus, we conducted a quantitative meta-analysis to obtain a precise estimate of this subject. After systematic searching and screening, a total of fifteen studies using immunohistochemistry for TWIST detection were included. The results showed that TWIST positive expression rate in HNC tissues was higher than that in normal tissues. TWIST expression might have a correlation with clinical features such as low differentiation, advanced clinical stage, presence of lymph node metastasis, distant metastasis and local recurrence (P < 0.05) , but not with age, gender, T stage and smoking as well as drinking (P > 0.05). In addition, over-expression of TWIST was a prognostic factor for HNC (HR = 1.92, 95% CI = 1.13–3.25). The data suggested that TWIST might play critical roles in cancer progression and act as a prognostic factor for HNC patients. PMID:26656856

  17. CsICE1 and CsCBF1: two transcription factors involved in cold responses in Camellia sinensis.

    PubMed

    Wang, Yu; Jiang, Chang-Jun; Li, Ye-Yun; Wei, Chao-Ling; Deng, Wei-Wei

    2012-01-01

    C-repeat/dehydration-responsive element binding factors (CBFs) can induce the expression of a suite of cold-responsive genes to increase plant cold tolerance, and inducer of CBF expression 1 (ICE1) is a major activator for CBF. In the present study, we isolated the full-length cDNAs of ICE1 and CBF from Camellia sinensis, designated as CsICE1 and CsCBF1, respectively. The deduced protein CsICE1 contains a highly conserved basic helix-loop-helix (bHLH) domain and C-terminal region of ICE1-like proteins. CsCBF1 contains all conserved domains of CBFs in other plant species and can specifically bind to the C-repeat/dehydration-responsive element (CRT/DRE) as confirmed by electrophoretic mobility shift assay. The transcription of CsICE1 had no apparent alteration after chilling treatment (4°C). CsCBF1 expression was not detected in normal temperature (20°C) but was induced immediately and significantly by low temperature (4°C). Our results suggest that ICE1-CBF cold-response pathway is conserved in tea plants. CsICE1 and CsCBF1, two components of this pathway, play roles in cold responses in tea plants. PMID:21850593

  18. Multiple post-domestication origins of kabuli chickpea through allelic variation in a diversification-associated transcription factor.

    PubMed

    Varma Penmetsa, R; Carrasquilla-Garcia, Noelia; Bergmann, Emily M; Vance, Lisa; Castro, Brenna; Kassa, Mulualem T; Sarma, Birinchi K; Datta, Subhojit; Farmer, Andrew D; Baek, Jong-Min; Coyne, Clarice J; Varshney, Rajeev K; von Wettberg, Eric J B; Cook, Douglas R

    2016-09-01

    Chickpea (Cicer arietinum) is among the founder crops domesticated in the Fertile Crescent. One of two major forms of chickpea, the so-called kabuli type, has white flowers and light-colored seed coats, properties not known to exist in the wild progenitor. The origin of the kabuli form has been enigmatic. We genotyped a collection of wild and cultivated chickpea genotypes with 538 single nucleotide polymorphisms (SNPs) and examined patterns of molecular diversity relative to geographical sources and market types. In addition, we examined sequence and expression variation in candidate anthocyanin biosynthetic pathway genes. A reduction in genetic diversity and extensive genetic admixture distinguish cultivated chickpea from its wild progenitor species. Among germplasm, the kabuli form is polyphyletic. We identified a basic helix-loop-helix (bHLH) transcription factor at chickpea's B locus that conditions flower and seed colors, orthologous to Mendel's A gene of garden pea, whose loss of function is associated invariantly with the kabuli type of chickpea. From the polyphyletic distribution of the kabuli form in germplasm, an absence of nested variation within the bHLH gene and invariant association of loss of function of bHLH among the kabuli type, we conclude that the kabuli form arose multiple times during the phase of phenotypic diversification after initial domestication of cultivated chickpea. PMID:27193699

  19. OsPTF1, a Novel Transcription Factor Involved in Tolerance to Phosphate Starvation in Rice1[w

    PubMed Central

    Yi, Keke; Wu, Zhongchang; Zhou, Jie; Du, Liming; Guo, Longbiao; Wu, Yunrong; Wu, Ping

    2005-01-01

    We report here on a novel transcription factor with a basic helix-loop-helix domain for tolerance to inorganic phosphate (Pi) starvation in rice (Oryza sativa). The gene is designated OsPTF1. The expression of OsPTF1 is Pi starvation induced in roots while constitutively expressed in shoots, as shown by northern-blot analysis. Overexpression of OsPTF1 enhanced tolerance to Pi starvation in transgenic rice. Tillering ability, root and shoot biomass, and phosphorus content of transgenic rice plants were about 30% higher than those of the wild-type plants in Pi-deficient conditions in hydroponic experiments. In soil pot and field experiments, more than 20% increase in tiller number, panicle weight, and phosphorus content was observed in transgenic plants compared to wild-type plants at low-Pi levels. In Pi-deficient conditions, transgenic rice plants showed significantly higher total root length and root surface area, which results in a higher instantaneous Pi uptake rate over their wild-type counterparts. Microarray analysis for transgenic plants overexpressing OsPTF1 has been performed to investigate the downstream regulation of OsPTF1. PMID:16006597

  20. The bHLH142 Transcription Factor Coordinates with TDR1 to Modulate the Expression of EAT1 and Regulate Pollen Development in Rice[C][W][OPEN

    PubMed Central

    Ko, Swee-Suak; Li, Min-Jeng; Sun-Ben Ku, Maurice; Ho, Yi-Cheng; Lin, Yi-Jyun; Chuang, Ming-Hsing; Hsing, Hong-Xian; Lien, Yi-Chen; Yang, Hui-Ting; Chang, Hung-Chia; Chan, Ming-Tsair

    2014-01-01

    Male sterility plays an important role in F1 hybrid seed production. We identified a male-sterile rice (Oryza sativa) mutant with impaired pollen development and a single T-DNA insertion in the transcription factor gene bHLH142. Knockout mutants of bHLH142 exhibited retarded meiosis and defects in tapetal programmed cell death. RT-PCR and in situ hybridization analyses showed that bHLH142 is specifically expressed in the anther, in the tapetum, and in meiocytes during early meiosis. Three basic helix-loop-helix transcription factors, UDT1 (bHLH164), TDR1 (bHLH5), and EAT1/DTD1 (bHLH141) are known to function in rice pollen development. bHLH142 acts downstream of UDT1 and GAMYB but upstream of TDR1 and EAT1 in pollen development. In vivo and in vitro assays demonstrated that bHLH142 and TDR1 proteins interact. Transient promoter assays demonstrated that regulation of the EAT1 promoter requires bHLH142 and TDR1. Consistent with these results, 3D protein structure modeling predicted that bHLH142 and TDR1 form a heterodimer to bind to the EAT1 promoter. EAT1 positively regulates the expression of AP37 and AP25, which induce tapetal programmed cell death. Thus, in this study, we identified bHLH142 as having a pivotal role in tapetal programmed cell death and pollen development. PMID:24894043

  1. The Transcriptional Repressor MYB2 Regulates Both Spatial and Temporal Patterns of Proanthocyandin and Anthocyanin Pigmentation in Medicago truncatula[OPEN

    PubMed Central

    2015-01-01

    Accumulation of anthocyanins and proanthocyanidins (PAs) is limited to specific cell types and developmental stages, but little is known about how antagonistically acting transcriptional regulators work together to determine temporal and spatial patterning of pigmentation at the cellular level, especially for PAs. Here, we characterize MYB2, a transcriptional repressor regulating both anthocyanin and PA biosynthesis in the model legume Medicago truncatula. MYB2 was strongly upregulated by MYB5, a major regulator of PA biosynthesis in M. truncatula and a component of MYB-basic helix loop helix-WD40 (MBW) activator complexes. Overexpression of MYB2 abolished anthocyanin and PA accumulation in M. truncatula hairy roots and Arabidopsis thaliana seeds, respectively. Anthocyanin deposition was expanded in myb2 mutant seedlings and flowers accompanied by increased anthocyanin content. PA mainly accumulated in the epidermal layer derived from the outer integument in the M. truncatula seed coat, starting from the hilum area. The area of PA accumulation and ANTHOCYANIDIN REDUCTASE expression was expanded into the seed body at the early stage of seed development in the myb2 mutant. Genetic, biochemical, and cell biological evidence suggests that MYB2 functions as part of a multidimensional regulatory network to define the temporal and spatial pattern of anthocyanin and PA accumulation linked to developmental processes. PMID:26410301

  2. The Origin, Development and Molecular Diversity of Rodent Olfactory Bulb Glutamatergic Neurons Distinguished by Expression of Transcription Factor NeuroD1

    PubMed Central

    Roybon, Laurent; Mastracci, Teresa L.; Li, Joyce; Stott, Simon R. W.; Leiter, Andrew B.; Sussel, Lori; Brundin, Patrik; Li, Jia-Yi

    2015-01-01

    Production of olfactory bulb neurons occurs continuously in the rodent brain. Little is known, however, about cellular diversity in the glutamatergic neuron subpopulation. In the central nervous system, the basic helix-loop-helix transcription factor NeuroD1 (ND1) is commonly associated with glutamatergic neuron development. In this study, we utilized ND1 to identify the different subpopulations of olfactory bulb glutamategic neurons and their progenitors, both in the embryo and postnatally. Using knock-in mice, transgenic mice and retroviral transgene delivery, we demonstrate the existence of several different populations of glutamatergic olfactory bulb neurons, the progenitors of which are ND1+ and ND1- lineage-restricted, and are temporally and regionally separated. We show that the first olfactory bulb glutamatergic neurons produced – the mitral cells – can be divided into molecularly diverse subpopulations. Our findings illustrate the complexity of neuronal diversity in the olfactory bulb and that seemingly homogenous neuronal populations can consist of multiple subpopulations with unique molecular signatures of transcription factors and expressing neuronal subtype-specific markers. PMID:26030886

  3. Overexpression of a bHLH1 Transcription Factor of Pyrus ussuriensis Confers Enhanced Cold Tolerance and Increases Expression of Stress-Responsive Genes

    PubMed Central

    Jin, Cong; Huang, Xiao-San; Li, Kong-Qing; Yin, Hao; Li, Lei-Ting; Yao, Zheng-Hong; Zhang, Shao-Ling

    2016-01-01

    The basic helix-loop-helix (bHLH) transcription factors are involved in arrays of physiological and biochemical processes. However, knowledge concerning the functions of bHLHs in cold tolerance remains poorly understood. In this study, a PubHLH1 gene isolated from Pyrus ussuriensis was characterized for its function in cold tolerance. PubHLH1 was upregulated by cold, salt, and dehydration, with the greatest induction under cold conditions. PubHLH1 had the transactivational activity and localized in the nucleus. Ectopic expression of PubHLH1 in transgenic tobacco conferred enhanced tolerance to cold stress. The transgenic lines had higher survival rates, higher chlorophyll, higher proline contents, lower electrolyte leakages and MDA when compared with wild type (WT). In addition, transcript levels of eight genes associated with ROS scavenging, regulation, and stress defense were higher in the transgenic plants relative to the WT under the chilling stress. Taken together, these results demonstrated that PubHLH1 played a key role in cold tolerance and, at least in part, contributed to activation of stress-responsive genes. PMID:27092159

  4. Overexpression of a bHLH1 Transcription Factor of Pyrus ussuriensis Confers Enhanced Cold Tolerance and Increases Expression of Stress-Responsive Genes.

    PubMed

    Jin, Cong; Huang, Xiao-San; Li, Kong-Qing; Yin, Hao; Li, Lei-Ting; Yao, Zheng-Hong; Zhang, Shao-Ling

    2016-01-01

    The basic helix-loop-helix (bHLH) transcription factors are involved in arrays of physiological and biochemical processes. However, knowledge concerning the functions of bHLHs in cold tolerance remains poorly understood. In this study, a PubHLH1 gene isolated from Pyrus ussuriensis was characterized for its function in cold tolerance. PubHLH1 was upregulated by cold, salt, and dehydration, with the greatest induction under cold conditions. PubHLH1 had the transactivational activity and localized in the nucleus. Ectopic expression of PubHLH1 in transgenic tobacco conferred enhanced tolerance to cold stress. The transgenic lines had higher survival rates, higher chlorophyll, higher proline contents, lower electrolyte leakages and MDA when compared with wild type (WT). In addition, transcript levels of eight genes associated with ROS scavenging, regulation, and stress defense were higher in the transgenic plants relative to the WT under the chilling stress. Taken together, these results demonstrated that PubHLH1 played a key role in cold tolerance and, at least in part, contributed to activation of stress-responsive genes. PMID:27092159

  5. Transcription factor single-minded 2 (SIM2) is ubiquitinated by the RING-IBR-RING-type E3 ubiquitin ligases.

    PubMed

    Okui, Michiyo; Yamaki, Akiko; Takayanagi, Atsushi; Kudoh, Jun; Shimizu, Nobuyoshi; Shimizu, Yoshiko

    2005-09-10

    Human single-minded 2 (SIM2) is a member of the basic helix-loop-helix/Per-Arnt-Sim (bHLH/PAS) family of transcription factors and is associated with the etiology of Down syndrome phenotype. Here, we examined a possibility of the post-translational modification of SIM2 protein by transfecting various expression constructs followed by the analysis with immunoprecipitation and Western blotting. In fact, transient expression of SIM2 cDNA in HEK293 cells revealed poly-ubiquitination of SIM2 protein. In the stable transfectants, a proteasome inhibitor MG132 protected the poly-ubiquitinated SIM2 protein from degradation. Furthermore, in the cells co-transfected with SIM2 and each of four different E3 ubiquitin ligases, SIM2 was immunoprecipitated with the RING-IBR-RING-type E3 ubiquitin ligases, Parkin and HHARI, but it was not immunoprecipitated with other E3 ligases, such as one RING-type Siah-1 and the PHD type AIRE. A series of deletion constructs revealed that Parkin actually binds to SIM2 with the IBR (294-377)-RING2 (378-465) domains and that the sites for poly-ubiquitination of SIM2 reside within the PAS1-PAS2 region (aa 141-289). We postulated that transcription factor SIM2 and E3 ubiquitin ligase Parkin may interact each other to play an important physiological role in the brain development which is controlled by ubiquitination. PMID:15963499

  6. Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1.

    PubMed Central

    Forsythe, J A; Jiang, B H; Iyer, N V; Agani, F; Leung, S W; Koos, R D; Semenza, G L

    1996-01-01

    Expression of vascular endothelial growth factor (VEGF) is induced in cells exposed to hypoxia or ischemia. Neovascularization stimulated by VEGF occurs in several important clinical contexts, including myocardial ischemia, retinal disease, and tumor growth. Hypoxia-inducible factor 1 (HIF-1) is a heterodimeric basic helix-loop-helix protein that activates transcription of the human erythropoietin gene in hypoxic cells. Here we demonstrate the involvement of HIF-1 in the activation of VEGF transcription. VEGF 5'-flanking sequences mediated transcriptional activation of reporter gene expression in hypoxic Hep3B cells. A 47-bp sequence located 985 to 939 bp 5' to the VEGF transcription initiation site mediated hypoxia-inducible reporter gene expression directed by a simian virus 40 promoter element that was otherwise minimally responsive to hypoxia. When reporters containing VEGF sequences, in the context of the native VEGF or heterologous simian virus 40 promoter, were cotransfected with expression vectors encoding HIF-1alpha and HIF-1beta (ARNT [aryl hydrocarbon receptor nuclear translocator]), reporter gene transcription was much greater in both hypoxic and nonhypoxic cells than in cells transfected with the reporter alone. A HIF-1 binding site was demonstrated in the 47-bp hypoxia response element, and a 3-bp substitution eliminated the ability of the element to bind HIF-1 and to activate transcription in response to hypoxia and/or recombinant HIF-1. Cotransfection of cells with an expression vector encoding a dominant negative form of HIF-1alpha inhibited the activation of reporter transcription in hypoxic cells in a dose-dependent manner. VEGF mRNA was not induced by hypoxia in mutant cells that do not express the HIF-1beta (ARNT) subunit. These findings implicate HIF-1 in the activation of VEGF transcription in hypoxic cells. PMID:8756616

  7. Myrosin Idioblast Cell Fate and Development Are Regulated by the Arabidopsis Transcription Factor FAMA, the Auxin Pathway, and Vesicular Trafficking[W

    PubMed Central

    Li, Meng; Sack, Fred D.

    2014-01-01

    Crucifer shoots harbor a glucosinolate-myrosinase system that defends against insect predation. Arabidopsis thaliana myrosinase (thioglucoside glucohydrolase [TGG]) accumulates in stomata and in myrosin idioblasts (MIs). This work reports that the basic helix-loop-helix transcription factor FAMA that is key to stomatal development is also expressed in MIs. The loss of FAMA function abolishes MI fate as well as the expression of the myrosinase genes TGG1 and TGG2. MI cells have previously been reported to be located in the phloem. Instead, we found that MIs arise from the ground meristem rather than provascular tissues and thus are not homologous with phloem. Moreover, MI patterning and morphogenesis are abnormal when the function of the ARF-GEF gene GNOM is lost as well as when auxin efflux and vesicular trafficking are chemically disrupted. Stomata and MI cells constitute part of a wider system that reduces plant predation, the so-called “mustard oil bomb,” in which vacuole breakage in cells harboring myrosinase and glucosinolate yields a brew toxic to many animals, especially insects. This identification of the gene that confers the fate of MIs, as well as stomata, might facilitate the development of strategies for engineering crops to mitigate predation. PMID:25304201

  8. The myogenic repressor gene Holes in muscles is a direct transcriptional target of Twist and Tinman in the Drosophila embryonic mesoderm

    PubMed Central

    Elwell, Jennifer A.; Lovato, TyAnna L.; Adams, Melanie M.; Baca, Erica M.; Lee, Thai; Cripps, Richard M.

    2015-01-01

    Understanding the regulatory circuitry controlling myogenesis is critical to understanding developmental mechanisms and developmentally-derived diseases. We analyzed the transcriptional regulation of a Drosophila myogenic repressor gene, Holes in muscles (Him). Previously, Him was shown to inhibit Myocyte enhancer factor-2 (MEF2) activity, and is expressed in myoblasts but not differentiating myotubes. We demonstrate that different phases of Him embryonic expression arise through the actions of different enhancers, and we characterize the enhancer required for its early mesoderm expression. This Him early mesoderm enhancer contains two conserved binding sites for the basic helix-loop-helix regulator Twist, and one binding site for the NK homeodomain protein Tinman. The sites for both proteins are required for enhancer activity in early embryos. Twist and Tinman activate the enhancer in tissue culture assays, and ectopic expression of either factor is sufficient to direct ectopic expression of a Him-lacZ reporter, or of the endogenous Him gene. Moreover, sustained expression of twist expression in the mesoderm up-regulates mesodermal Him expression in late embryos. Our findings provide a model to define mechanistically how Twist can both promotes myogenesis through direct activation of Mef2, and can place a brake on myogenesis, through direct activation of Him. PMID:25704510

  9. An essential role for the transcription factor HEB in thymocyte survival, Tcra rearrangement and the development of natural killer T cells.

    PubMed

    D'Cruz, Louise M; Knell, Jamie; Fujimoto, Jessica K; Goldrath, Ananda W

    2010-03-01

    E proteins are basic helix-loop-helix transcription factors that regulate many key aspects of lymphocyte development. Thymocytes express multiple E proteins that are thought to provide cooperative and compensatory functions crucial for T cell differentiation. Contrary to that, we report here that the E protein HEB was uniquely required at the CD4(+)CD8(+) double-positive (DP) stage of T cell development. Thymocytes lacking HEB showed impaired survival, failed to make rearrangements of variable-alpha (V(alpha)) segments to distal joining-alpha (J(alpha)) segments in the gene encoding the T cell antigen receptor alpha-chain (Tcra) and had a profound, intrinsic block in the development of invariant natural killer T cells (iNKT cells) at their earliest progenitor stage. Thus, our results show that HEB is a specific and essential factor in T cell development and in the generation of the iNKT cell lineage, defining a unique role for HEB in the regulation of lymphocyte maturation. PMID:20154672

  10. The bHLH Transcription Factor Hand Regulates the Expression of Genes Critical to Heart and Muscle Function in Drosophila melanogaster

    PubMed Central

    Hallier, Benjamin; Hoffmann, Julia; Roeder, Thomas; Tögel, Markus; Meyer, Heiko; Paululat, Achim

    2015-01-01

    Hand proteins belong to the highly conserved family of basic Helix-Loop-Helix transcription factors and are critical to distinct developmental processes, including cardiogenesis and neurogenesis in vertebrates. In Drosophila melanogaster a single orthologous hand gene is expressed with absence of the respective protein causing semilethality during early larval instars. Surviving adult animals suffer from shortened lifespan associated with a disorganized myofibrillar structure being apparent in the dorsal vessel, the wing hearts and in midgut tissue. Based on these data, the major biological significance of Hand seems to be related to muscle development, maintenance or function; however, up to now the physiological basis for Hand functionality remains elusive. Thus, the identification of genes whose expression is, directly or indirectly, regulated by Hand has considerable relevance with respect to understanding its biological functionality in flies and vertebrates. Beneficially, hand mutants are viable and exhibit affected tissues, which renders Drosophila an ideal model to investigate up- or downregulated target genes by a comparative microarray approach focusing on the respective tissues from mutant specimens. Our present work reveals for the first time that Drosophila Hand regulates the expression of numerous genes of diverse physiological relevancy, including distinct factors required for proper muscle development and function such as Zasp52 or Msp-300. These results relate Hand activity to muscle integrity and functionality and may thus be highly beneficial to the evaluation of corresponding hand phenotypes. PMID:26252215

  11. The Drosophila homeodomain transcription factor, Vnd, associates with a variety of co-factors, is extensively phosphorylated and forms multiple complexes in embryos.

    PubMed

    Zhang, Huanqing; Syu, Li-Jyun; Modica, Vicky; Yu, Zhongxin; Von Ohlen, Tonia; Mellerick, Dervla M

    2008-10-01

    Vnd is a dual transcriptional regulator that is essential for Drosophila dorsal-ventral patterning. Yet, our understanding of the biochemical basis for its regulatory activity is limited. Consistent with Vnd's ability to repress target expression in embryos, endogenously expressed Vnd physically associates with the co-repressor, Groucho, in Drosophila Kc167 cells. Vnd exists as a single complex in Kc167 cells, in contrast with embryonic Vnd, which forms multiple high-molecular-weight complexes. Unlike its vertebrate homolog, Nkx2.2, full-length Vnd can bind its target in electrophoretic mobility shift assay, suggesting that co-factor availability may influence Vnd's weak regulatory activity in transient transfections. We identify the high mobility group 1-type protein, D1, and the novel helix-loop-helix protein, Olig, as novel Vnd-interacting proteins using co-immunoprecipitation assays. Furthermore, we demonstrate that both D1 and Olig are co-expressed with Vnd during Drosophila embryogenesis, consistent with a biological basis for this interaction. We also suggest that the phosphorylation state of Vnd influences its ability to interact with co-factors, because Vnd is extensively phosphorylated in embryos and can be phosphorylated by activated mitogen-activated protein kinase in vitro. These results highlight the complexities of Vnd-mediated regulation. PMID:18795949

  12. An RNA Virus-Encoded Zinc-Finger Protein Acts as a Plant Transcription Factor and Induces a Regulator of Cell Size and Proliferation in Two Tobacco Species[C][W

    PubMed Central

    Lukhovitskaya, Nina I.; Solovieva, Anna D.; Boddeti, Santosh K.; Thaduri, Srinivas; Solovyev, Andrey G.; Savenkov, Eugene I.

    2013-01-01

    Plant viruses cause a variety of diseases in susceptible hosts. The disease symptoms often include leaf malformations and other developmental abnormalities, suggesting that viruses can affect plant development. However, little is known about the mechanisms underlying virus interference with plant morphogenesis. Here, we show that a C-4 type zinc-finger (ZF) protein, p12, encoded by a carlavirus (chrysanthemum virus B) can induce cell proliferation, which results in hyperplasia and severe leaf malformation. We demonstrate that the p12 protein activates expression of a regulator of cell size and proliferation, designated upp-L (upregulated by p12), which encodes a transcription factor of the basic/helix-loop-helix family sufficient to cause hyperplasia. The induction of upp-L requires translocation of the p12 protein into the nucleus and ZF-dependent specific interaction with the conserved regulatory region in the upp-L promoter. Our results establish the role of the p12 protein in modulation of host cell morphogenesis. It is likely that other members of the conserved C-4 type ZF family of viral proteins instigate reprogramming of plant development by mimicking eukaryotic transcriptional activators. PMID:23482855

  13. Targeting the bHLH transcriptional networks by mutated E proteins in experimental glioma.

    PubMed

    Beyeler, Sarah; Joly, Sandrine; Fries, Michel; Obermair, Franz-Josef; Burn, Felice; Mehmood, Rashid; Tabatabai, Ghazaleh; Raineteau, Olivier

    2014-10-01

    Glioblastomas (GB) are aggressive primary brain tumors. Helix-loop-helix (HLH, ID proteins) and basic HLH (bHLH, e.g., Olig2) proteins are transcription factors that regulate stem cell proliferation and differentiation throughout development and into adulthood. Their convergence on many oncogenic signaling pathways combined with the observation that their overexpression in GB correlates with poor clinical outcome identifies these transcription factors as promising therapeutic targets. Important dimerization partners of HLH/bHLH proteins are E proteins that are necessary for nuclear translocation and DNA binding. Here, we overexpressed a wild type or a dominant negative form of E47 (dnE47) that lacks its nuclear localization signal thus preventing nuclear translocation of bHLH proteins in long-term glioma cell lines and in glioma-initiating cell lines and analyzed the effects in vitro and in vivo. While overexpression of E47 was sufficient to induce apoptosis in absence of bHLH proteins, dnE47 was necessary to prevent nuclear translocation of Olig2 and to achieve similar proapoptotic responses. Transcriptional analyses revealed downregulation of the antiapoptotic gene BCL2L1 and the proproliferative gene CDC25A as underlying mechanisms. Overexpression of dnE47 in glioma-initiating cell lines with high HLH and bHLH protein levels reduced sphere formation capacities and expression levels of Nestin, BCL2L1, and CDC25A. Finally, the in vivo induction of dnE47 expression in established xenografts prolonged survival. In conclusion, our data introduce a novel approach to jointly neutralize HLH and bHLH transcriptional networks activities, and identify these transcription factors as potential targets in glioma. PMID:24965159

  14. The murine Sim-2 gene product inhibits transcription by active repression and functional interference.

    PubMed

    Moffett, P; Reece, M; Pelletier, J

    1997-09-01

    The Drosophila single-minded (Dsim) gene encodes a master regulatory protein involved in cell fate determination during midline development. This protein is a member of a rapidly expanding family of gene products possessing basic helix-loop-helix (bHLH) and hydrophobic PAS (designated a conserved region among PER, ARNT [aryl hydrocarbon receptor nuclear translocator] and SIM) protein association domains. Members of this family function as central transcriptional regulators in cellular differentiation and in the response to environmental stimuli such as xenobiotics and hypoxia. We have previously identified a murine member of this family, called mSim-2, showing sequence homology to the bHLH and PAS domains of Dsim. Immunoprecipitation experiments with recombinant proteins indicate that mSIM-2 associates with the arnt gene product. In the present work, by using fine-structure mapping we found that the HLH and PAS motifs of both proteins are required for optimal association. Forced expression of GAL4/mSIM-2 fusion constructs in mammalian cells demonstrated the presence of two separable repression domains within the carboxy terminus of mSIM-2. We found that mSIM-2 is capable of repressing ARNT-mediated transcriptional activation in a mammalian two-hybrid system. This effect (i) is dependent on the ability of mSIM-2 and ARNT to heterodimerize, (ii) is dependent on the presence of the mSIM-2 carboxy-terminal repression domain, and (iii) is not specific to the ARNT activation domain. These results suggest that mSIM-2 repression activity can dominantly override the activation potential of adjacent transcription factors. We also demonstrated that mSIM-2 can functionally interfere with hypoxia-inducible factor 1alpha (HIF-1alpha)/ARNT transcription complexes, providing a second mechanism by which mSIM-2 may inhibit transcription. PMID:9271372

  15. Molecular genetics of blood-fleshed peach reveals activation of anthocyanin biosynthesis by NAC transcription factors.

    PubMed

    Zhou, Hui; Lin-Wang, Kui; Wang, Huiliang; Gu, Chao; Dare, Andrew P; Espley, Richard V; He, Huaping; Allan, Andrew C; Han, Yuepeng

    2015-04-01

    Anthocyanin pigmentation is an important consumer trait in peach (Prunus persica). In this study, the genetic basis of the blood-flesh trait was investigated using the cultivar Dahongpao, which shows high levels of cyanidin-3-glucoside in the mesocarp. Elevation of anthocyanin levels in the flesh was correlated with the expression of an R2R3 MYB transcription factor, PpMYB10.1. However, PpMYB10.1 did not co-segregate with the blood-flesh trait. The blood-flesh trait was mapped to a 200-kb interval on peach linkage group (LG) 5. Within this interval, a gene encoding a NAC domain transcription factor (TF) was found to be highly up-regulated in blood-fleshed peaches when compared with non-red-fleshed peaches. This NAC TF, designated blood (BL), acts as a heterodimer with PpNAC1 which shows high levels of expression in fruit at late developmental stages. We show that the heterodimer of BL and PpNAC1 can activate the transcription of PpMYB10.1, resulting in anthocyanin pigmentation in tobacco. Furthermore, silencing the BL gene reduces anthocyanin pigmentation in blood-fleshed peaches. The transactivation activity of the BL-PpNAC1 heterodimer is repressed by a SQUAMOSA promoter-binding protein-like TF, PpSPL1. Low levels of PpMYB10.1 expression in fruit at early developmental stages is probably attributable to lower levels of expression of PpNAC1 plus the presence of high levels of repressors such as PpSPL1. We present a mechanism whereby BL is the key gene for the blood-flesh trait in peach via its activation of PpMYB10.1 in maturing fruit. Partner TFs such as basic helix-loop-helix proteins and NAC1 are required, as is the removal of transcriptional repressors. PMID:25688923

  16. A smallest 6 kda metalloprotease, mini-matrilysin, in living world: a revolutionary conserved zinc-dependent proteolytic domain- helix-loop-helix catalytic zinc binding domain (ZBD)

    PubMed Central

    2012-01-01

    Background The Aim of this study is to study the minimum zinc dependent metalloprotease catalytic folding motif, helix B Met loop-helix C, with proteolytic catalytic activities in metzincin super family. The metzincin super family share a catalytic domain consisting of a twisted five-stranded β sheet and three long α helices (A, B and C). The catalytic zinc is at the bottom of the cleft and is ligated by three His residues in the consensus sequence motif, HEXXHXXGXXH, which is located in helix B and part of the adjacent Met turn region. An interesting question is - what is the minimum portion of the enzyme that still possesses catalytic and inhibitor recognition?” Methods We have expressed a 60-residue truncated form of matrilysin which retains only the helix B-Met turn-helix C region and deletes helix A and the five-stranded β sheet which form the upper portion of the active cleft. This is only 1/4 of the full catalytic domain. The E. coli derived 6 kDa MMP-7 ZBD fragments were purified and refolded. The proteolytic activities were analyzed by Mca-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2 peptide assay and CM-transferrin zymography analysis. SC44463, BB94 and Phosphoramidon were computationally docked into the 3day structure of the human MMP7 ZBD and TAD and thermolysin using the docking program GOLD. Results This minimal 6 kDa matrilysin has been refolded and shown to have proteolytic activity in the Mca-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2 peptide assay. Triton X-100 and heparin are important factors in the refolding environment for this mini-enzyme matrilysin. This minienzyme has the proteolytic activity towards peptide substrate, but the hexamer and octamer of the mini MMP-7 complex demonstrates the CM-transferrin proteolytic activities in zymographic analysis. Peptide digestion is inhibited by SC44463, specific MMP7 inhibitors, but not phosphorimadon. Interestingly, the mini MMP-7 can be processed by autolysis and producing ~ 6 ~ 7 kDa fragments. Thus, many of the functions of the enzyme are retained indicating that the helix B-Met loop-helix C is the minimal functional “domain” found to date for the matrixin family. Conclusions The helix B-Met loop-helix C folding conserved in metalloprotease metzincin super family is able to facilitate proteolytic catalysis for specific substrate and inhibitor recognition. The autolysis processing and producing 6 kDa mini MMP-7 is the smallest metalloprotease in living world. PMID:22642296

  17. A Murine Uterine Transcriptome, Responsive to Steroid Receptor Coactivator-2, Reveals Transcription Factor 23 as Essential for Decidualization of Human Endometrial Stromal Cells1

    PubMed Central

    Kommagani, Ramakrishna; Szwarc, Maria M.; Kovanci, Ertug; Creighton, Chad J.; O'Malley, Bert W.; DeMayo, Francesco J.; Lydon, John P.

    2014-01-01

    ABSTRACT Recent data from human and mouse studies strongly support an indispensable role for steroid receptor coactivator-2 (SRC-2)—a member of the p160/SRC family of coregulators—in progesterone-dependent endometrial stromal cell decidualization, an essential cellular transformation process that regulates invasion of the developing embryo into the maternal compartment. To identify the key progesterone-induced transcriptional changes that are dependent on SRC-2 and required for endometrial decidualization, we performed comparative genome-wide transcriptional profiling of endometrial tissue RNA from ovariectomized SRC-2flox/flox (SRC-2f/f [control]) and PRcre/+/SRC-2flox/flox (SRC-2d/d [SRC-2-depleted]) mice, acutely treated with vehicle or progesterone. Although data mining revealed that only a small subset of the total progesterone-dependent transcriptional changes is dependent on SRC-2 (∼13%), key genes previously reported to mediate progesterone-driven endometrial stromal cell decidualization are present within this subset. Along with providing a more detailed molecular portrait of the decidual transcriptional program governed by SRC-2, the degree of functional diversity of these progesterone mediators underscores the pleiotropic regulatory role of SRC-2 in this tissue. To showcase the utility of this powerful informational resource to uncover novel signaling paradigms, we stratified the total SRC-2-dependent subset of progesterone-induced transcriptional changes in terms of novel gene expression and identified transcription factor 23 (Tcf23), a basic-helix-loop-helix transcription factor, as a new progesterone-induced target gene that requires SRC-2 for full induction. Importantly, using primary human endometrial stromal cells in culture, we demonstrate that TCF23 function is essential for progesterone-dependent decidualization, providing crucial translational support for this transcription factor as a new decidual mediator of progesterone action. PMID

  18. Proteasome-mediated turnover of the transcriptional activator FIT is required for plant iron-deficiency responses.

    PubMed

    Sivitz, Alicia; Grinvalds, Claudia; Barberon, Marie; Curie, Catherine; Vert, Grégory

    2011-06-01

    Plants display a number of responses to low iron availability in order to increase iron uptake from the soil. In the model plant Arabidopsis thaliana, the ferric-chelate reductase FRO2 and the ferrous iron transporter IRT1 control iron entry from the soil into the root epidermis. To maintain iron homeostasis, the expression of FRO2 and IRT1 is tightly controlled by iron deficiency at the transcriptional level. The basic helix-loop-helix (bHLH) transcription factor FIT represents the most upstream actor known in the iron-deficiency signaling pathway, and directly regulates the expression of the root iron uptake machinery genes FRO2 and IRT1. However, how FIT is controlled by iron and acts to activate transcription of its targets remains obscure. Here we show that FIT mRNA and endogenous FIT protein accumulate in Arabidopsis roots upon iron deficiency. However, using plants constitutively expressing FIT, we observed that FIT protein accumulation is reduced in iron-limited conditions. This post-transcriptional regulation of FIT is perfectly synchronized with the accumulation of endogenous FIT and IRT1 proteins, and therefore is part of the early responses to low iron. We demonstrated that such regulation affects FIT protein stability under iron deficiency as a result of 26S proteasome-dependent degradation. In addition, we showed that FIT post-translational regulation by iron is required for FRO2 and IRT1 gene expression. Taken together our results indicate that FIT transcriptional and post-translational regulations are integrated in plant roots to ensure that the positive regulator FIT accumulates as a short-lived protein following iron shortage, and to allow proper iron-deficiency responses. PMID:21426424

  19. Binding of disparate transcriptional activators to nucleosomal DNA is inherently cooperative.

    PubMed Central

    Adams, C C; Workman, J L

    1995-01-01

    To investigate mechanisms by which multiple transcription factors access complex promoters and enhancers within cellular chromatin, we have analyzed the binding of disparate factors to nucleosome cores. We used a purified in vitro system to analyze binding of four activator proteins, two GAL4 derivatives, USF, and NF-kappa B (KBF1), to reconstituted nucleosome cores containing different combinations of binding sites. Here we show that binding of any two or all three of these factors to nucleosomal DNA is inherently cooperative. Thus, the binuclear Zn clusters of GAL4, the helix-loop-helix/basic domains of USF, and the rel domain of NF-kappa B all participated in cooperative nucleosome binding, illustrating that this effect is not restricted to a particular DNA-binding domain. Simultaneous binding by two factors increased the affinity of individual factors for nucleosomal DNA by up to 2 orders of magnitude. Importantly, cooperative binding resulted in efficient nucleosome binding by factors (USF and NF-kappa B) which independently possess little nucleosome-binding ability. The participation of GAL4 derivatives in cooperative nucleosome binding required only DNA-binding and dimerization domains, indicating that disruption of histone-DNA contacts by factor binding was responsible for the increased affinity of additional factors. Cooperative nucleosome binding required sequence-specific binding of all transcription factors, appeared to have spatial constraints, and was independent of the orientation of the binding sites on the nucleosome. These results indicate that cooperative nucleosome binding is a general mechanism that may play a significant role in loading complex enhancer and promoter elements with multiple diverse factors in chromatin and contribute to the generation of threshold responses and transcriptional synergy by multiple activator sites in vivo. PMID:7862134

  20. NLR-Associating Transcription Factor bHLH84 and Its Paralogs Function Redundantly in Plant Immunity

    PubMed Central

    Xu, Fang; Kapos, Paul; Cheng, Yu Ti; Li, Meng; Zhang, Yuelin; Li, Xin

    2014-01-01

    In plants and animals, nucleotide-binding and leucine-rich repeat domain containing (NLR) immune receptors are utilized to detect the presence or activities of pathogen-derived molecules. However, the mechanisms by which NLR proteins induce defense responses remain unclear. Here, we report the characterization of one basic Helix-loop-Helix (bHLH) type transcription factor (TF), bHLH84, identified from a reverse genetic screen. It functions as a transcriptional activator that enhances the autoimmunity of NLR mutant snc1 (suppressor of npr1-1, constitutive 1) and confers enhanced immunity in wild-type backgrounds when overexpressed. Simultaneously knocking out three closely related bHLH paralogs attenuates RPS4-mediated immunity and partially suppresses the autoimmune phenotypes of snc1, while overexpression of the other two close paralogs also renders strong autoimmunity, suggesting functional redundancy in the gene family. Intriguingly, the autoimmunity conferred by bHLH84 overexpression can be largely suppressed by the loss-of-function snc1-r1 mutation, suggesting that SNC1 is required for its proper function. In planta co-immunoprecipitation revealed interactions between not only bHLH84 and SNC1, but also bHLH84 and RPS4, indicating that bHLH84 associates with these NLRs. Together with previous finding that SNC1 associates with repressor TPR1 to repress negative regulators, we hypothesize that nuclear NLR proteins may interact with both transcriptional repressors and activators during immune responses, enabling potentially faster and more robust transcriptional reprogramming upon pathogen recognition. PMID:25144198

  1. Expression and cellular localization of the transcription factor NeuroD1 in the developing and adult rat pineal gland.

    PubMed

    Castro, Analía E; Benitez, Sergio G; Farias Altamirano, Luz E; Savastano, Luis E; Patterson, Sean I; Muñoz, Estela M

    2015-05-01

    Circadian rhythms govern many aspects of mammalian physiology. The daily pattern of melatonin synthesis and secretion is one of the classic examples of circadian oscillations. It is mediated by a class of neuroendocrine cells known as pinealocytes which are not yet fully defined. An established method to evaluate functional and cytological characters is through the expression of lineage-specific transcriptional regulators. NeuroD1 is a basic helix-loop-helix transcription factor involved in the specification and maintenance of both endocrine and neuronal phenotypes. We have previously described developmental and adult regulation of NeuroD1 mRNA in the rodent pineal gland. However, the transcript levels were not influenced by the elimination of sympathetic input, suggesting that any rhythmicity of NeuroD1 might be found downstream of transcription. Here, we describe NeuroD1 protein expression and cellular localization in the rat pineal gland during development and the daily cycle. In embryonic and perinatal stages, protein expression follows the mRNA pattern and is predominantly nuclear. Thereafter, NeuroD1 is mostly found in pinealocyte nuclei in the early part of the night and in cytoplasm during the day, a rhythm maintained into adulthood. Additionally, nocturnal nuclear NeuroD1 levels are reduced after sympathetic disruption, an effect mimicked by the in vivo administration of α- and β-adrenoceptor blockers. NeuroD1 phosphorylation at two sites, Ser(274) and Ser(336) , associates with nuclear localization in pinealocytes. These data suggest that NeuroD1 influences pineal phenotype both during development and adulthood, in an autonomic and phosphorylation-dependent manner. PMID:25752781

  2. Sim2 prevents entry into the myogenic program by repressing MyoD transcription during limb embryonic myogenesis.

    PubMed

    Havis, Emmanuelle; Coumailleau, Pascal; Bonnet, Aline; Bismuth, Keren; Bonnin, Marie-Ange; Johnson, Randy; Fan, Chen-Min; Relaix, Frédéric; Shi, De-Li; Duprez, Delphine

    2012-06-01

    The basic helix-loop-helix transcription factor MyoD is a central actor that triggers the skeletal myogenic program. Cell-autonomous and non-cell-autonomous regulatory pathways must tightly control MyoD expression to ensure correct initiation of the muscle program at different places in the embryo and at different developmental times. In the present study, we have addressed the involvement of Sim2 (single-minded 2) in limb embryonic myogenesis. Sim2 is a bHLH-PAS transcription factor that inhibits transcription by active repression and displays enhanced expression in ventral limb muscle masses during chick and mouse embryonic myogenesis. We have demonstrated that Sim2 is expressed in muscle progenitors that have not entered the myogenic program, in different experimental conditions. MyoD expression is transiently upregulated in limb muscle masses of Sim2(-/-) mice. Conversely, Sim2 gain-of-function experiments in chick and Xenopus embryos showed that Sim2 represses MyoD expression. In addition, we show that Sim2 represses the activity of the mouse MyoD promoter in primary myoblasts and is recruited to the MyoD core enhancer in embryonic mouse limbs. Sim2 expression is non-autonomously and negatively regulated by the dorsalising factor Lmx1b. We propose that Sim2 represses MyoD transcription in limb muscle masses, through Sim2 recruitment to the MyoD core enhancer, in order to prevent premature entry into the myogenic program. This MyoD repression is predominant in ventral limb regions and is likely to contribute to the differential increase of the global mass of ventral muscles versus dorsal muscles. PMID:22513369

  3. bHLH transcription factors that facilitate K⁺ uptake during stomatal opening are repressed by abscisic acid through phosphorylation.

    PubMed

    Takahashi, Yohei; Ebisu, Yuta; Kinoshita, Toshinori; Doi, Michio; Okuma, Eiji; Murata, Yoshiyuki; Shimazaki, Ken-Ichiro

    2013-06-18

    Stomata open in response to light and close after exposure to abscisic acid (ABA). They regulate gas exchange between plants and the atmosphere, enabling plants to adapt to changing environmental conditions. ABA binding to receptors initiates a signaling cascade that involves protein phosphorylation. We show that ABA induced the phosphorylation of three basic helix-loop-helix (bHLH) transcription factors, called AKSs (ABA-responsive kinase substrates; AKS1, AKS2, and AKS3), in Arabidopsis guard cells. In their unphosphorylated state, AKSs facilitated stomatal opening through the transcription of genes encoding inwardly rectifying K⁺ channels. aks1aks2-1 double mutant plants showed decreases in light-induced stomatal opening, K⁺ accumulation in response to light, activity of inwardly rectifying K⁺ channels, and transcription of genes encoding major inwardly rectifying K⁺ channels without affecting ABA-mediated stomatal closure. Overexpression of potassium channel in Arabidopsis thaliana 1 (KAT1), which encodes a major inwardly rectifying K⁺ channel in guard cells, rescued the phenotype of aks1aks2-1 plants. AKS1 bound directly to the promoter of KAT1, an interaction that was attenuated after ABA-induced phosphorylation. The ABA agonist pyrabactin induced phosphorylation of AKSs. Our results demonstrate that the AKS family of bHLH transcription factors facilitates stomatal opening through the transcription of genes encoding inwardly rectifying K⁺ channels and that ABA suppresses the activity of these channels by triggering the phosphorylation of AKS family transcription factors. PMID:23779086

  4. Zinc Finger Transcription Factors Displaced SREBP Proteins as the Major Sterol Regulators during Saccharomycotina Evolution

    PubMed Central

    Maguire, Sarah L.; Wang, Can; Holland, Linda M.; Brunel, François; Neuvéglise, Cécile; Nicaud, Jean-Marc; Zavrel, Martin; White, Theodore C.; Wolfe, Kenneth H.; Butler, Geraldine

    2014-01-01

    In most eukaryotes, including the majority of fungi, expression of sterol biosynthesis genes is regulated by Sterol-Regulatory Element Binding Proteins (SREBPs), which are basic helix-loop-helix transcription activators. However, in yeasts such as Saccharomyces cerevisiae and Candida albicans sterol synthesis is instead regulated by Upc2, an unrelated transcription factor with a Gal4-type zinc finger. The SREBPs in S. cerevisiae (Hms1) and C. albicans (Cph2) have lost a domain, are not major regulators of sterol synthesis, and instead regulate filamentous growth. We report here that rewiring of the sterol regulon, with Upc2 taking over from SREBP, likely occurred in the common ancestor of all Saccharomycotina. Yarrowia lipolytica, a deep-branching species, is the only genome known to contain intact and full-length orthologs of both SREBP (Sre1) and Upc2. Deleting YlUPC2, but not YlSRE1, confers susceptibility to azole drugs. Sterol levels are significantly reduced in the YlUPC2 deletion. RNA-seq analysis shows that hypoxic regulation of sterol synthesis genes in Y. lipolytica is predominantly mediated by Upc2. However, YlSre1 still retains a role in hypoxic regulation; growth of Y. lipolytica in hypoxic conditions is reduced in a Ylupc2 deletion and is abolished in a Ylsre1/Ylupc2 double deletion, and YlSre1 regulates sterol gene expression during hypoxia adaptation. We show that YlSRE1, and to a lesser extent YlUPC2, are required for switching from yeast to filamentous growth in hypoxia. Sre1 appears to have an ancestral role in the regulation of filamentation, which became decoupled from its role in sterol gene regulation by the arrival of Upc2 in the Saccharomycotina. PMID:24453983

  5. Transcription factor 4 (TCF4) and schizophrenia: integrating the animal and the human perspective.

    PubMed

    Quednow, Boris B; Brzózka, Magdalena M; Rossner, Moritz J

    2014-08-01

    Schizophrenia is a genetically complex disease considered to have a neurodevelopmental pathogenesis and defined by a broad spectrum of positive and negative symptoms as well as cognitive deficits. Recently, large genome-wide association studies have identified common alleles slightly increasing the risk for schizophrenia. Among the few schizophrenia-risk genes that have been consistently replicated is the basic Helix-Loop-Helix (bHLH) transcription factor 4 (TCF4). Haploinsufficiency of the TCF4 (formatting follows IUPAC nomenclature: TCF4 protein/protein function, Tcf4 rodent gene cDNA mRNA, TCF4 human gene cDNA mRNA) gene causes the Pitt-Hopkins syndrome-a neurodevelopmental disease characterized by severe mental retardation. Accordingly, Tcf4 null-mutant mice display developmental brain defects. TCF4-associated risk alleles are located in putative coding and non-coding regions of the gene. Hence, subtle changes at the level of gene expression might be relevant for the etiopathology of schizophrenia. Behavioural phenotypes obtained with a mouse model of slightly increased gene dosage and electrophysiological investigations with human risk-allele carriers revealed an overlapping spectrum of schizophrenia-relevant endophenotypes. Most prominently, early information processing and higher cognitive functions appear to be associated with TCF4 risk genotypes. Moreover, a recent human study unravelled gene × environment interactions between TCF4 risk alleles and smoking behaviour that were specifically associated with disrupted early information processing. Taken together, TCF4 is considered as an integrator ('hub') of several bHLH networks controlling critical steps of various developmental, and, possibly, plasticity-related transcriptional programs in the CNS and changes of TCF4 expression also appear to affect brain networks important for information processing. Consequently, these findings support the neurodevelopmental hypothesis of schizophrenia and provide a

  6. An ABA down-regulated bHLH transcription repressor gene, bHLH129 regulates root elongation and ABA response when overexpressed in Arabidopsis

    PubMed Central

    Tian, Hainan; Guo, Hongyan; Dai, Xuemei; Cheng, Yuxin; Zheng, Kaijie; Wang, Xiaoping; Wang, Shucai

    2015-01-01

    Plant hormone abscisic acid (ABA) plays a crucial role in modulating plant responses to environmental stresses. Basic helix-loop-helix (bHLH) transcription factors are one of the largest transcription factor families that regulate multiple aspects of plant growth and development, as well as of plant metabolism in Arabidopsis. Several bHLH transcription factors have been shown to be involved in the regulation of ABA signaling. We report here the characterization of bHLH129, a bHLH transcription factor in Arabidopsis. We found that the expression level of bHLH129 was reduced in response to exogenously applied ABA, and elevated in the ABA biosynthesis mutant aba1-5. Florescence observation of transgenic plants expressing bHLH129-GFP showed that bHLH129 was localized in the nucleus, and transient expression of bHLH129 in protoplasts inhibited reporter gene expression. When expressed in Arabidopsis under the control of the 35S promoter, bHLH129 promoted root elongation, and the transgenic plants were less sensitivity to ABA in root elongation assays. Quantitative RT-PCR results showed that ABA response of several genes involved in ABA signaling, including ABI1, SnRK2.2, SnRK2.3 and SnRK2.6 were altered in the transgenic plants overexpressing bHLH129. Taken together, our study suggests that bHLH129 is a transcription repressor that negatively regulates ABA response in Arabidopsis. PMID:26625868

  7. The bHLH Transcription Factors TSAR1 and TSAR2 Regulate Triterpene Saponin Biosynthesis in Medicago truncatula.

    PubMed

    Mertens, Jan; Pollier, Jacob; Vanden Bossche, Robin; Lopez-Vidriero, Irene; Franco-Zorrilla, José Manuel; Goossens, Alain

    2016-01-01

    Plants respond to stresses by producing a broad spectrum of bioactive specialized metabolites. Hormonal elicitors, such as jasmonates, trigger a complex signaling circuit leading to the concerted activation of specific metabolic pathways. However, for many specialized metabolic pathways, the transcription factors involved remain unknown. Here, we report on two homologous jasmonate-inducible transcription factors of the basic helix-loop-helix family, TRITERPENE SAPONIN BIOSYNTHESIS ACTIVATING REGULATOR1 (TSAR1) and TSAR2, which direct triterpene saponin biosynthesis in Medicago truncatula. TSAR1 and TSAR2 are coregulated with and transactivate the genes encoding 3-HYDROXY-3-METHYLGLUTARYL-COENZYME A REDUCTASE1 (HMGR1) and MAKIBISHI1, the rate-limiting enzyme for triterpene biosynthesis and an E3 ubiquitin ligase that controls HMGR1 levels, respectively. Transactivation is mediated by direct binding of TSARs to the N-box in the promoter of HMGR1. In transient expression assays in tobacco (Nicotiana tabacum) protoplasts, TSAR1 and TSAR2 exhibit different patterns of transactivation of downstream triterpene saponin biosynthetic genes, hinting at distinct functionalities within the regulation of the pathway. Correspondingly, overexpression of TSAR1 or TSAR2 in M. truncatula hairy roots resulted in elevated transcript levels of known triterpene saponin biosynthetic genes and strongly increased the accumulation of triterpene saponins. TSAR2 overexpression specifically boosted hemolytic saponin biosynthesis, whereas TSAR1 overexpression primarily stimulated nonhemolytic soyasaponin biosynthesis. Both TSARs also activated all genes of the precursor mevalonate pathway but did not affect sterol biosynthetic genes, pointing to their specific role as regulators of specialized triterpene metabolism in M. truncatula. PMID:26589673

  8. GmPTF1, a novel transcription factor gene, is involved in conferring soybean tolerance to phosphate starvation.

    PubMed

    Li, X H; Wu, B; Kong, Y B; Zhang, C Y

    2014-01-01

    Phosphorus plays a pivotal role in plant growth and development. In this study, we isolated and characterized GmPTF1, a basic helix-loop-helix (bHLH) transcription factor (TF) gene from soybean (Glycine max) with tolerance to inorganic phosphate (Pi) starvation. Alignment analysis indicated that GmPTF1 and other reported bHLH TFs share significant similarity in the region of the bHLH domain. As with OsPTF1 and other homologous Pi starvation-related bHLH TFs (His-5, Glu-9, Arg-12, and Arg-13), all recognition motifs for the G-box (CACGTG) were present in the GmPTF1 domain. Prokaryotic expression in Escherichia coli strain BL21 (DE3) plysS showed that a novel 40-kDa polypeptide was expressed when cells containing GmPTF1 were induced. The subcellular localization in cells from onion epidermis and Arabidopsis roots demonstrated that the GmPTF1 protein was found in the nucleus. Furthermore, analysis of transcription activity in yeast revealed that full-length GmPTF1 and its N-terminal and C-terminal domains could activate the histidine, adenine, and uracil reporter genes. This suggested that the N-terminal and C-terminal peptides of GmPTF1 act as transcriptional activators. When real-time quantitative polymerase chain reaction was performed, the expression of GmPTF1 under conditions of phosphate starvation was significantly induced in soybean roots of the low-Pi-tolerant variety ZH15. Moreover, the relative level of expression was much higher there than in roots of the sensitive variety NMH from days 7 to 56 of low-Pi stress. These results imply that GmPTF1 is involved in conferring tolerance to phosphate starvation in soybean. PMID:24634113

  9. The bHLH Transcription Factors TSAR1 and TSAR2 Regulate Triterpene Saponin Biosynthesis in Medicago truncatula1[OPEN

    PubMed Central

    2016-01-01

    Plants respond to stresses by producing a broad spectrum of bioactive specialized metabolites. Hormonal elicitors, such as jasmonates, trigger a complex signaling circuit leading to the concerted activation of specific metabolic pathways. However, for many specialized metabolic pathways, the transcription factors involved remain unknown. Here, we report on two homologous jasmonate-inducible transcription factors of the basic helix-loop-helix family, TRITERPENE SAPONIN BIOSYNTHESIS ACTIVATING REGULATOR1 (TSAR1) and TSAR2, which direct triterpene saponin biosynthesis in Medicago truncatula. TSAR1 and TSAR2 are coregulated with and transactivate the genes encoding 3-HYDROXY-3-METHYLGLUTARYL-COENZYME A REDUCTASE1 (HMGR1) and MAKIBISHI1, the rate-limiting enzyme for triterpene biosynthesis and an E3 ubiquitin ligase that controls HMGR1 levels, respectively. Transactivation is mediated by direct binding of TSARs to the N-box in the promoter of HMGR1. In transient expression assays in tobacco (Nicotiana tabacum) protoplasts, TSAR1 and TSAR2 exhibit different patterns of transactivation of downstream triterpene saponin biosynthetic genes, hinting at distinct functionalities within the regulation of the pathway. Correspondingly, overexpression of TSAR1 or TSAR2 in M. truncatula hairy roots resulted in elevated transcript levels of known triterpene saponin biosynthetic genes and strongly increased the accumulation of triterpene saponins. TSAR2 overexpression specifically boosted hemolytic saponin biosynthesis, whereas TSAR1 overexpression primarily stimulated nonhemolytic soyasaponin biosynthesis. Both TSARs also activated all genes of the precursor mevalonate pathway but did not affect sterol biosynthetic genes, pointing to their specific role as regulators of specialized triterpene metabolism in M. truncatula. PMID:26589673

  10. Generation of a Conditional Allele of the Transcription Factor Atonal Homolog 8 (Atoh8)

    PubMed Central

    Ejarque, Miriam; Mir-Coll, Joan; Gomis, Ramon; German, Michael S.; Lynn, Francis C.; Gasa, Rosa

    2016-01-01

    Atonal Homolog 8 (Atoh8) is a basic helix-loop-helix (bHLH) transcription factor that is highly conserved across species and expressed in multiple tissues during embryogenesis. In the developing pancreas, Atoh8 is expressed in endocrine progenitors but declines in hormone-positive cells, suggesting a role during early stages of the endocrine differentiation program. We previously generated a whole-body Atoh8 knockout but early lethality of null embryos precluded assessment of Atoh8 functions during organ development. Here we report the generation of a conditional Atoh8 knockout mouse strain by insertion of two loxP sites flanking exon 1 of the Atoh8 gene. Pancreas-specific Atoh8 knockout (Atoh8 Δpanc) mice were obtained by mating this strain with a Pdx1-Cre transgenic line. Atoh8 Δpanc mice were born at the expected mendelian ratio and showed normal appearance and fertility. Pancreas weight and gross pancreatic morphology were normal. All pancreatic cell lineages were present, although endocrine δ (somatostatin) cells were modestly augmented in Atoh8 Δpanc as compared to control neonates. This increase did not affect whole-body glucose tolerance in adult knockout animals. Gene expression analysis in embryonic pancreases at the time of the major endocrine differentiation wave revealed modest alterations in several early endocrine differentiation markers. Together, these data argue that Atoh8 modulates activation of the endocrine program but it is not essential for pancreas formation or endocrine differentiation in the mouse. Given the ubiquitous expression pattern of Atoh8, the availability of a mouse strain carrying a conditional allele for this gene warrants further studies using temporally regulated Cre transgenic lines to elucidate time or cell-autonomous functions of Atoh8 during development and in the adult. PMID:26752640

  11. Id-1 is induced in MDCK epithelial cells by activated Erk/MAPK pathway in response to expression of the Snail and E47 transcription factors

    SciTech Connect

    Jorda, Mireia; Vinyals, Antonia; Marazuela, Anna; Cubillo, Eva; Olmeda, David; Valero, Eva; Cano, Amparo; Fabra, Angels . E-mail: afabra@idibell.org

    2007-07-01

    Id-1, a member of the helix-loop-helix transcription factor family has been shown to be involved in cell proliferation, angiogenesis and invasion of many types of human cancers. We have previously shown that stable expression of E47 and Snail repressors of the E-cadherin promoter in MDCK epithelial cell line triggers epithelial mesenchymal transition (EMT) concomitantly with changes in gene expression. We show here that both factors activate the Id-1 gene promoter and induce Id-1 mRNA and protein. The upregulation of the Id-1 gene occurs through the transactivation of the promoter by the Erk/MAPK signaling pathway. Moreover, oncogenic Ras is also able to activate Id-1 promoter in MDCK cells in the absence of both E47 and Snail transcription factors. Several transcriptionally active regulatory elements have been identified in the proximal promoter, including AP-1, Sp1 and four putative E-boxes. By EMSA, we only detected an increased binding to Sp1 and AP-1 elements in E47- and Snail-expressing cells. Binding is affected by the treatment of cells with PD 98059 MEK inhibitor, suggesting that MAPK/Erk contributes to the recruitment or assembly of proteins to Id-1 promoter. Small interfering RNA directed against Sp1 reduced Id-1 expression and the upregulation of the promoter, indicating that Sp1 is required for Id-1 induction in E47- and Snail-expressing cells. Our results provide new insights into how some target genes are activated during and/or as a consequence of the EMT triggered by both E47 and Snail transcription factors.

  12. Down-Regulating the Expression of 53 Soybean Transcription Factor Genes Uncovers a Role for SPEECHLESS in Initiating Stomatal Cell Lineages during Embryo Development.

    PubMed

    Danzer, John; Mellott, Eric; Bui, Anhthu Q; Le, Brandon H; Martin, Patrick; Hashimoto, Meryl; Perez-Lesher, Jeanett; Chen, Min; Pelletier, Julie M; Somers, David A; Goldberg, Robert B; Harada, John J

    2015-07-01

    We used an RNA interference screen to assay the function of 53 transcription factor messenger RNAs (mRNAs) that accumulate specifically within soybean (Glycine max) seed regions, subregions, and tissues during development. We show that basic helix-loop-helix (bHLH) transcription factor genes represented by Glyma04g41710 and its paralogs are required for the formation of stoma in leaves and stomatal precursor complexes in mature embryo cotyledons. Phylogenetic analysis indicates that these bHLH transcription factor genes are orthologous to Arabidopsis (Arabidopsis thaliana) SPEECHLESS (SPCH) that initiate asymmetric cell divisions in the leaf protoderm layer and establish stomatal cell lineages. Soybean SPCH (GmSPCH) mRNAs accumulate primarily in embryo, seedling, and leaf epidermal layers. Expression of Glyma04g41710 under the control of the SPCH promoter rescues the Arabidopsis spch mutant, indicating that Glyma04g41710 is a functional ortholog of SPCH. Developing soybean embryos do not form mature stoma, and stomatal differentiation is arrested at the guard mother cell stage. We analyzed the accumulation of GmSPCH mRNAs during soybean seed development and mRNAs orthologous to MUTE, FAMA, and inducer of C-repeat/dehydration responsive element-binding factor expression1/scream2 that are required for stoma formation in Arabidopsis. The mRNA accumulation patterns provide a potential explanation for guard mother cell dormancy in soybean embryos. Our results suggest that variation in the timing of bHLH transcription factor gene expression can explain the diversity of stomatal forms observed during plant development. PMID:25963149

  13. Down-Regulating the Expression of 53 Soybean Transcription Factor Genes Uncovers a Role for SPEECHLESS in Initiating Stomatal Cell Lineages during Embryo Development1[OPEN

    PubMed Central

    Danzer, John; Mellott, Eric; Bui, Anhthu Q.; Le, Brandon H.; Martin, Patrick; Hashimoto, Meryl; Perez-Lesher, Jeanett; Chen, Min; Pelletier, Julie M.; Somers, David A.; Goldberg, Robert B.; Harada, John J.

    2015-01-01

    We used an RNA interference screen to assay the function of 53 transcription factor messenger RNAs (mRNAs) that accumulate specifically within soybean (Glycine max) seed regions, subregions, and tissues during development. We show that basic helix-loop-helix (bHLH) transcription factor genes represented by Glyma04g41710 and its paralogs are required for the formation of stoma in leaves and stomatal precursor complexes in mature embryo cotyledons. Phylogenetic analysis indicates that these bHLH transcription factor genes are orthologous to Arabidopsis (Arabidopsis thaliana) SPEECHLESS (SPCH) that initiate asymmetric cell divisions in the leaf protoderm layer and establish stomatal cell lineages. Soybean SPCH (GmSPCH) mRNAs accumulate primarily in embryo, seedling, and leaf epidermal layers. Expression of Glyma04g41710 under the control of the SPCH promoter rescues the Arabidopsis spch mutant, indicating that Glyma04g41710 is a functional ortholog of SPCH. Developing soybean embryos do not form mature stoma, and stomatal differentiation is arrested at the guard mother cell stage. We analyzed the accumulation of GmSPCH mRNAs during soybean seed development and mRNAs orthologous to MUTE, FAMA, and INDUCER OF C-REPEAT/DEHYDRATION RESPONSIVE ELEMENT-BINDING FACTOR EXPRESSION1/SCREAM2 that are required for stoma formation in Arabidopsis. The mRNA accumulation patterns provide a potential explanation for guard mother cell dormancy in soybean embryos. Our results suggest that variation in the timing of bHLH transcription factor gene expression can explain the diversity of stomatal forms observed during plant development. PMID:25963149

  14. Transcriptional regulation of neuronal genes and its effect on neural functions: gene expression in response to static magnetism in cultured rat hippocampal neurons.

    PubMed

    Hirai, Takao; Yoneda, Yukio

    2005-07-01

    We have previously shown a marked but transient increase in DNA binding of the nuclear transcription factor activator protein-1 after brief exposure to static magnetic fields in cultured rat hippocampal neurons, suggesting that exposure to static magnetism would lead to long-term consolidation as well as amplification of different functional alterations through modulation of de novo protein synthesis at the level of gene transcription in the hippocampus. Hippocampal neurons were cultured under sustained exposure to static magnetic fields at 100 mT, followed by extraction of total RNA for differential display (DD) analysis using random primers. The first and the second DD polymerase chain reaction similarly showed the downregulation of particular genes in response to sustained magnetism. Nucleotide sequence analysis followed by BLASTN homology searching revealed high homology of these 2 DD-PCR products to the 3' non-coding regions of the mouse basic helix-loop-helix transcription factor ALF1 and that of histone H3.3A, respectively. On Northern blot analysis using the 2 cloned differentially expressed fragments labeled with [alpha-(32)P]dCTP by the random primer method, a marked decrease was seen in expression of mRNA for ALF1 and histone H3.3A in hippocampal neurons cultured under sustained exposure to static magnetic fields at 100 mT. It thus appears that static magnetism may modulate cellular integrity and functionality through expression of a variety of responsive genes required for gene transcription and translation, proliferation, differentiation, maturation, survival, and so on in cultured rat hippocampal neurons. PMID:16020920

  15. Cooperative interaction of hypoxia-inducible factor-2alpha (HIF-2alpha ) and Ets-1 in the transcriptional activation of vascular endothelial growth factor receptor-2 (Flk-1).

    PubMed

    Elvert, Gerd; Kappel, Andreas; Heidenreich, Regina; Englmeier, Ursula; Lanz, Stephan; Acker, Till; Rauter, Manuel; Plate, Karl; Sieweke, Michael; Breier, Georg; Flamme, Ingo

    2003-02-28

    Interactions between Ets family members and a variety of other transcription factors serve important functions during development and differentiation processes, e.g. in the hematopoietic system. Here we show that the endothelial basic helix-loop-helix PAS domain transcription factor, hypoxia-inducible factor-2alpha (HIF-2alpha) (but not its close relative HIF-1alpha), cooperates with Ets-1 in activating transcription of the vascular endothelial growth factor receptor-2 (VEGF-2) gene (Flk-1). The receptor tyrosine kinase Flk-1 is indispensable for angiogenesis, and its expression is closely regulated during development. Consistent with the hypothesis that HIF-2alpha controls the expression of Flk-1 in vivo, we show here that HIF-2alpha and Flk-1 are co-regulated in postnatal mouse brain capillaries. A tandem HIF-2alpha/Ets binding site was identified within the Flk-1 promoter that acted as a strong enhancer element. Based on the analysis of transgenic mouse embryos, these motifs are essential for endothelial cell-specific reporter gene expression. A single HIF-2alpha/Ets element conferred strong cooperative induction by HIF-2alpha and Ets-1 when fused to a heterologous promoter and was most active in endothelial cells. The physical interaction of HIF-2alpha with Ets-1 was demonstrated and localized to the HIF-2alpha carboxyl terminus and the autoinhibitory exon VII domain of Ets-1, respectively. The deletion of the DNA binding and carboxyl-terminal transactivation domains of HIF-2alpha, respectively, created dominant negative mutants that suppressed transactivation by the wild type protein and failed to synergize with Ets-1. These results suggest that the interaction between HIF-2alpha and endothelial Ets factors is required for the full transcriptional activation of Flk-1 in endothelial cells and may therefore represent a future target for the manipulation of angiogenesis. PMID:12464608

  16. The study of a SPATULA-like bHLH transcription factor expressed during peach (Prunus persica) fruit development.

    PubMed

    Tani, Eleni; Tsaballa, Aphrodite; Stedel, Catalina; Kalloniati, Chrissanthi; Papaefthimiou, Dimitra; Polidoros, Alexios; Darzentas, Nikos; Ganopoulos, Ioannis; Flemetakis, Emmanouil; Katinakis, Panagiotis; Tsaftaris, Athanasios

    2011-06-01

    Extensive studies on the dry fruits of the model plant arabidopsis (Arabidopsis thaliana) have revealed various gene regulators of the development and dehiscence of the siliques. Peach pericarp is analogous to the valve tissues of the arabidopsis siliques. The stone (otherwise called pit) in drupes is formed through lignification of the fruit endocarp. The lignified endocarp in peach can be susceptible to split-pit formation under certain genetic as well as environmental factors. This phenomenon delays processing of the clingstone varieties of peach and causes economical losses for the peach fruit canning industry. The fruitfull (FUL) and shatterproof (SHP) genes are key MADS-box transcription protein coding factors that control fruit development and dehiscence in arabidopsis by promoting the expression of basic helix-loop-helix (bHLH) transcription factors like Spatula (SPT) and Alcatraz (ALC). Results from our previous studies on peach suggested that temporal regulation of PPERFUL and PPERSHP gene expression may be involved in the regulation of endocarp margin development. In the present study a PPERSPATULA-like (PPERSPT) gene was cloned and characterized. Comparative analysis of temporal regulation of PPERSPT gene expression during pit hardening in a resistant and a susceptible to split-pit variety, suggests that this gene adds one more component to the genes network that controls endocarp margins development in peach. Taking into consideration that no ALC-like genes have been identified in any dicot plant species outside the Brassicaceae family, where arabidopsis belongs, PPERSPT may have additional role(s) in peach that are fulfilled in arabidopsis by ALC. PMID:21324706

  17. Transcription Factor SCL Is Required for c-kit Expression and c-Kit Function in Hemopoietic Cells

    PubMed Central

    Krosl, Gorazd; He, Gang; Lefrancois, Martin; Charron, Frédéric; Roméo, Paul-Henri; Jolicoeur, Paul; Kirsch, Ilan R.; Nemer, Mona; Hoang, Trang

    1998-01-01

    In normal hemopoietic cells that are dependent on specific growth factors for cell survival, the expression of the basic helix-loop-helix transcription factor SCL/Tal1 correlates with that of c-Kit, the receptor for Steel factor (SF) or stem cell factor. To address the possibility that SCL may function upstream of c-kit, we sought to modulate endogenous SCL function in the CD34+ hemopoietic cell line TF-1, which requires SF, granulocyte/macrophage colony–stimulating factor, or interleukin 3 for survival. Ectopic expression of an antisense SCL cDNA (as-SCL) or a dominant negative SCL (dn-SCL) in these cells impaired SCL DNA binding activity, and prevented the suppression of apoptosis by SF only, indicating that SCL is required for c-Kit–dependent cell survival. Consistent with the lack of response to SF, the level of c-kit mRNA and c-Kit protein was significantly and specifically reduced in as-SCL– or dn-SCL– expressing cells. c-kit mRNA, c-kit promoter activity, and the response to SF were rescued by SCL overexpression in the antisense or dn-SCL transfectants. Furthermore, ectopic c-kit expression in as-SCL transfectants is sufficient to restore cell survival in response to SF. Finally, enforced SCL in the pro–B cell line Ba/F3, which is both SCL and c-kit negative is sufficient to induce c-Kit and SF responsiveness. Together, these results indicate that c-kit, a gene that is essential for the survival of primitive hemopoietic cells, is a downstream target of the transcription factor SCL. PMID:9687522

  18. A conserved motif N-terminal to the DNA-binding domains of myogenic bHLH transcription factors mediates cooperative DNA binding with pbx-Meis1/Prep1.

    PubMed

    Knoepfler, P S; Bergstrom, D A; Uetsuki, T; Dac-Korytko, I; Sun, Y H; Wright, W E; Tapscott, S J; Kamps, M P

    1999-09-15

    The t(1;19) chromosomal translocation of pediatric pre-B cell leukemia produces chimeric oncoprotein E2a-Pbx1, which contains the N-terminal transactivation domain of the basic helix-loop-helix (bHLH) transcription factor, E2a, joined to the majority of the homeodomain protein, Pbx1. There are three Pbx family members, which bind DNA as heterodimers with both broadly expressed Meis/Prep1 homeo-domain proteins and specifically expressed Hox homeodomain proteins. These Pbx heterodimers can augment the function of transcriptional activators bound to adjacent elements. In heterodimers, a conserved tryptophan motif in Hox proteins binds a pocket on the surface of the Pbx homeodomain, while Meis/Prep1 proteins bind an N-terminal Pbx domain, raising the possibility that the tryptophan-interaction pocket of the Pbx component of a Pbx-Meis/Prep1 complex is still available to bind trypto-phan motifs of other transcription factors bound to flanking elements. Here, we report that Pbx-Meis1/Prep1 binds DNA cooperatively with heterodimers of E2a and MyoD, myogenin, Mrf-4 or Myf-5. As with Hox proteins, a highly conserved tryptophan motif N-terminal to the DNA-binding domains of each myogenic bHLH family protein is required for cooperative DNA binding with Pbx-Meis1/Prep1. In vivo, MyoD requires this tryptophan motif to evoke chromatin remodeling in the Myogenin promoter and to activate Myogenin transcription. Pbx-Meis/Prep1 complexes, therefore, have the potential to cooperate with the myogenic bHLH proteins in regulating gene transcription. PMID:10471746

  19. Cell-Autonomous and Non-Cell-Autonomous Regulation of a Feeding State-Dependent Chemoreceptor Gene via MEF-2 and bHLH Transcription Factors

    PubMed Central

    Winbush, Ari; van der Linden, Alexander M.

    2016-01-01

    Food and feeding-state dependent changes in chemoreceptor gene expression may allow Caenorhabditis elegans to modify their chemosensory behavior, but the mechanisms essential for these expression changes remain poorly characterized. We had previously shown that expression of a feeding state-dependent chemoreceptor gene, srh-234, in the ADL sensory neuron of C. elegans is regulated via the MEF-2 transcription factor. Here, we show that MEF-2 acts together with basic helix-loop-helix (bHLH) transcription factors to regulate srh-234 expression as a function of feeding state. We identify a cis-regulatory MEF2 binding site that is necessary and sufficient for the starvation-induced down regulation of srh-234 expression, while an E-box site known to bind bHLH factors is required to drive srh-234 expression in ADL. We show that HLH-2 (E/Daughterless), HLH-3 and HLH-4 (Achaete-scute homologs) act in ADL neurons to regulate srh-234 expression. We further demonstrate that the expression levels of srh-234 in ADL neurons are regulated remotely by MXL-3 (Max-like 3 homolog) and HLH-30 (TFEB ortholog) acting in the intestine, which is dependent on insulin signaling functioning specifically in ADL neurons. We also show that this intestine-to-neuron feeding-state regulation of srh-234 involves a subset of insulin-like peptides. These results combined suggest that chemoreceptor gene expression is regulated by both cell-autonomous and non-cell-autonomous transcriptional mechanisms mediated by MEF2 and bHLH factors, which may allow animals to fine-tune their chemosensory responses in response to changes in their feeding state. PMID:27487365

  20. Genome-wide classification and evolutionary analysis of the bHLH family of transcription factors in Arabidopsis, poplar, rice, moss, and algae.

    PubMed

    Carretero-Paulet, Lorenzo; Galstyan, Anahit; Roig-Villanova, Irma; Martínez-García, Jaime F; Bilbao-Castro, Jose R; Robertson, David L

    2010-07-01

    Basic helix-loop-helix proteins (bHLHs) are found throughout the three eukaryotic kingdoms and constitute one of the largest families of transcription factors. A growing number of bHLH proteins have been functionally characterized in plants. However, some of these have not been previously classified. We present here an updated and comprehensive classification of the bHLHs encoded by the whole sequenced genomes of Arabidopsis (Arabidopsis thaliana), Populus trichocarpa, Oryza sativa, Physcomitrella patens, and five algae species. We define a plant bHLH consensus motif, which allowed the identification of novel highly diverged atypical bHLHs. Using yeast two-hybrid assays, we confirm that (1) a highly diverged bHLH has retained protein interaction activity and (2) the two most conserved positions in the consensus play an essential role in dimerization. Phylogenetic analysis permitted classification of the 638 bHLH genes identified into 32 subfamilies. Evolutionary and functional relationships within subfamilies are supported by intron patterns, predicted DNA-binding motifs, and the architecture of conserved protein motifs. Our analyses reveal the origin and evolutionary diversification of plant bHLHs through differential expansions, domain shuffling, and extensive sequence divergence. At the functional level, this would translate into different subfamilies evolving specific DNA-binding and protein interaction activities as well as differential transcriptional regulatory roles. Our results suggest a role for bHLH proteins in generating plant phenotypic diversity and provide a solid framework for further investigations into the role carried out in the transcriptional regulation of key growth and developmental processes. PMID:20472752

  1. Genome-Wide Classification and Evolutionary Analysis of the bHLH Family of Transcription Factors in Arabidopsis, Poplar, Rice, Moss, and Algae1[W

    PubMed Central

    Carretero-Paulet, Lorenzo; Galstyan, Anahit; Roig-Villanova, Irma; Martínez-García, Jaime F.; Bilbao-Castro, Jose R.; Robertson, David L.

    2010-01-01

    Basic helix-loop-helix proteins (bHLHs) are found throughout the three eukaryotic kingdoms and constitute one of the largest families of transcription factors. A growing number of bHLH proteins have been functionally characterized in plants. However, some of these have not been previously classified. We present here an updated and comprehensive classification of the bHLHs encoded by the whole sequenced genomes of Arabidopsis (Arabidopsis thaliana), Populus trichocarpa, Oryza sativa, Physcomitrella patens, and five algae species. We define a plant bHLH consensus motif, which allowed the identification of novel highly diverged atypical bHLHs. Using yeast two-hybrid assays, we confirm that (1) a highly diverged bHLH has retained protein interaction activity and (2) the two most conserved positions in the consensus play an essential role in dimerization. Phylogenetic analysis permitted classification of the 638 bHLH genes identified into 32 subfamilies. Evolutionary and functional relationships within subfamilies are supported by intron patterns, predicted DNA-binding motifs, and the architecture of conserved protein motifs. Our analyses reveal the origin and evolutionary diversification of plant bHLHs through differential expansions, domain shuffling, and extensive sequence divergence. At the functional level, this would translate into different subfamilies evolving specific DNA-binding and protein interaction activities as well as differential transcriptional regulatory roles. Our results suggest a role for bHLH proteins in generating plant phenotypic diversity and provide a solid framework for further investigations into the role carried out in the transcriptional regulation of key growth and developmental processes. PMID:20472752

  2. Overexpression of GmERF5, a new member of the soybean EAR motif-containing ERF transcription factor, enhances resistance to Phytophthora sojae in soybean.

    PubMed

    Dong, Lidong; Cheng, Yingxin; Wu, Junjiang; Cheng, Qun; Li, Wenbin; Fan, Sujie; Jiang, Liangyu; Xu, Zhaolong; Kong, Fanjiang; Zhang, Dayong; Xu, Pengfei; Zhang, Shuzhen

    2015-05-01

    Phytophthora root and stem rot of soybean [Glycine max (L.) Merr.], caused by Phytophthora sojae Kaufmann and Gerdemann, is a destructive disease throughout the soybean planting regions in the world. Here, we report insights into the function and underlying mechanisms of a novel ethylene response factor (ERF) in soybean, namely GmERF5, in host responses to P. sojae. GmERF5-overexpressing transgenic soybean exhibited significantly enhanced resistance to P. sojae and positively regulated the expression of the PR10, PR1-1, and PR10-1 genes. Sequence analysis suggested that GmERF5 contains an AP2/ERF domain of 58 aa and a conserved ERF-associated amphiphilic repression (EAR) motif in its C-terminal region. Following stress treatments, GmERF5 was significantly induced by P. sojae, ethylene (ET), abscisic acid (ABA), and salicylic acid (SA). The activity of the GmERF5 promoter (GmERF5P) was upregulated in tobacco leaves with ET, ABA, Phytophthora nicotianae, salt, and drought treatments, suggesting that GmERF5 could be involved not only in the induced defence response but also in the ABA-mediated pathway of salt and drought tolerance. GmERF5 could bind to the GCC-box element and act as a repressor of gene transcription. It was targeted to the nucleus when transiently expressed in Arabidopsis protoplasts. GmERF5 interacted with a basic helix-loop-helix transcription factor (GmbHLH) and eukaryotic translation initiation factor (GmEIF) both in yeast cells and in planta. To the best of our knowledge, GmERF5 is the first soybean EAR motif-containing ERF transcription factor demonstrated to be involved in the response to pathogen infection. PMID:25779701

  3. Mechanics of Protein-Mediated DNA Looping

    NASA Astrophysics Data System (ADS)

    Meiners, Jens-Christian

    2009-03-01

    The formation of looped DNA-protein complexes in which a protein or protein assembly binds to multiple distant operator sites on the DNA is a common feature for many regulatory schemes on the transcriptional level. In a living cell, a multitude of mechanical forces and constraints act on these complexes, and it is imperative to understand their effects on biological function. For this aim, we study the lactose repressor as a model system for protein-mediated DNA looping in single-molecule experiments. Using a novel axial constant-force optical trapping scheme that allows us to manipulate sub-micron DNA fragments with well-controlled forces down to the 10 fN range, we show that mechanical tension in the substrate DNA of hundred femtonewton is sufficient to disrupt the loop formation process, which suggests that such mechanical tension may provide a mechanical pathway to controlling gene expression in vivo. From the force sensitivity of the loop formation process, we can also infer the topology of the looped complex; in our case an antiparallel conformation. In addition, we will present new tethered-particle microscopy data that shows lifetimes of the looped complexes that are two to three orders of magnitude shorter than those measured in biochemical competition assays and discuss possible interpretations, including the suggestion that operator binding of the lactose repressor tetramer leads to a destabilization of the dimer-dimer interface and that thus the loop breakdown process is mostly a dissociation of the tetramer into two dimers, instead, as widely assumed, an unbinding of the tetramer from the DNA.

  4. The bHLH Transcription Factor NeuroD Governs Photoreceptor Genesis and Regeneration Through Delta-Notch Signaling

    PubMed Central

    Taylor, Scott M.; Alvarez-Delfin, Karen; Saade, Carole J.; Thomas, Jennifer L.; Thummel, Ryan; Fadool, James M.; Hitchcock, Peter F.

    2015-01-01

    Purpose Photoreceptor genesis in the retina requires precise regulation of progenitor cell competence, cell cycle exit, and differentiation, although information around the mechanisms that govern these events currently is lacking. In zebrafish, the basic helix-loop-helix (bHLH) transcription factor NeuroD governs photoreceptor genesis, but the signaling pathways through which NeuroD functions are unknown. The purpose of this study was to identify these pathways, and during photoreceptor genesis, Notch signaling was investigated as the putative mediator of NeuroD function. Methods In embryos, genetic mosaic analysis was used to determine if NeuroD functions is cell- or non–cell-autonomous. Morpholino-induced NeuroD knockdown, CRISPR/Cas9 mutation, and pharmacologic and transgenic approaches were used, followed by in situ hybridization, immunocytochemistry, and quantitative RT-PCR (qRT-PCR), to identify mechanisms through which NeuroD functions. In adults, following photoreceptor ablation and NeuroD knockdown, similar methods as above were used to identify NeuroD function during photoreceptor regeneration. Results In embryos, NeuroD function is non–cell-autonomous, NeuroD knockdown increases Notch pathway gene expression, Notch inhibition rescues the NeuroD knockdown-induced deficiency in cell cycle exit but not photoreceptor maturation, and Notch activation and CRISPR/Cas9 mutation of neurod recapitulate NeuroD knockdown. In adults, NeuroD knockdown prevents cell cycle exit and photoreceptor regeneration and increases Notch pathway gene expression, and Notch inhibition rescues this phenotype. Conclusions These data demonstrate that during embryonic development, NeuroD governs photoreceptor genesis via non–cell-autonomous mechanisms and that, during photoreceptor development and regeneration, Notch signaling is a mechanistic link between NeuroD and cell cycle exit. In contrast, during embryonic development, NeuroD governs photoreceptor maturation via mechanisms

  5. Microphthalmia-associated transcription factor mutations are associated with white-spotted coat color in swamp buffalo.

    PubMed

    Yusnizar, Y; Wilbe, M; Herlino, A O; Sumantri, C; Noor, R Rachman; Boediono, A; Andersson, L; Andersson, G

    2015-12-01

    A candidate gene analysis of the microphthalmia-associated transcription factor (MITF) gene was used in an attempt to identify the genetic basis for a white-spotted coat color phenotype in the Asian swamp buffalo (Bubalus bubalis carabanensis). Ninety-three buffaloes-32 solid, 38 spotted and 23 white individuals-were Sanger-sequenced for all MITF exons as well as highly conserved intronic and flanking regions. MITF cDNA representing skin and iris tissue from six spotted, nine solid and one white buffaloes was also Sanger-sequenced to confirm detected mutations. Two independent loss-of-function mutations, a premature stop codon (c.328C>T, p.Arg110*) and a donor splice-site mutation (c.840+2T>A, p.Glu281_Leu282Ins8), both of which cause white-spotted coat color in swamp buffaloes, were identified. The nonsense mutation leads to a premature stop codon in exon 3, and likely removal of the resulting mRNA via nonsense-mediated decay pathway, whereas the donor splice-site mutation leads to aberrant splicing of exon 8 that encodes part of a highly conserved region of MITF. The resulting insertion of eight amino acid residues is expected to perturb the leucine zipper part in the basic helix-loop-helix leucine zipper (bHLH-Zip) domain and will most likely influence dimerization and DNA binding capacity. Electrophoretic mobility shift assay was performed using mutant and wild-type MITF proteins and showed that the mutant MITF protein resulting from the splice-site mutation decreased in vitro DNA binding capacity compared to wild-type MITF. White-spotted buffalo bulls are sacrificed in funeral ceremonies in Tana Toraja, Indonesia, because they are considered holy, and our results show that genetic variation causes a tie to the cultural use of these buffaloes. PMID:26417640

  6. Regulation of anthocyanin and proanthocyanidin biosynthesis by Medicago truncatula bHLH transcription factor MtTT8.

    PubMed

    Li, Penghui; Chen, Beibei; Zhang, Gaoyang; Chen, Longxiang; Dong, Qiang; Wen, Jiangqi; Mysore, Kirankumar S; Zhao, Jian

    2016-05-01

    The MYB- basic helix-loop-helix (bHLH)-WD40 complexes regulating anthocyanin and proanthocyanidin (PA) biosynthesis in plants are not fully understood. Here Medicago truncatula bHLH MtTT8 was characterized as a central component of these ternary complexes that control anthocyanin and PA biosynthesis. Mttt8 mutant seeds have a transparent testa phenotype with reduced PAs and anthocyanins. MtTT8 restores PA and anthocyanin productions in Arabidopsis tt8 mutant. Ectopic expression of MtTT8 restores anthocyanins and PAs in mttt8 plant and hairy roots and further enhances both productions in wild-type hairy roots. Transcriptomic analyses and metabolite profiling of mttt8 mutant seeds and M. truncatula hairy roots (mttt8 mutant, mttt8 mutant complemented with MtTT8, or MtTT8 overexpression lines) indicate that MtTT8 regulates a subset of genes involved in PA and anthocyanin biosynthesis. MtTT8 is genetically regulated by MtLAP1, MtPAR and MtWD40-1. Combinations of MtPAR, MtLAP1, MtTT8 and MtWD40-1 activate MtTT8 promoter in yeast assay. MtTT8 interacts with these transcription factors to form regulatory complexes. MtTT8, MtWD40-1 and an MYB factor, MtPAR or MtLAP1, interacted and activated promoters of anthocyanidin reductase and anthocyanidin synthase to regulate PA and anthocyanin biosynthesis, respectively. Our results provide new insights into the complex regulation of PA and anthocyanin biosynthesis in M. truncatula. PMID:26725247

  7. NasR, a novel RNA-binding protein, mediates nitrate-responsive transcription antitermination of the Klebsiella oxytoca M5al nasF operon leader in vitro.

    PubMed

    Chai, W; Stewart, V

    1998-10-23

    In Klebsiella oxytoca (pneumoniae), enzymes required for nitrate assimilation are encoded by the nasFEDCBA operon. Previous genetic studies led to the conclusion that nitrate and nitrite induction of nasF operon expression is determined by a transcriptional antitermination mechanism. In the presence of nitrate or nitrite, the nasR gene product is hypothesized to inhibit transcription termination at the factor-independent terminator site located in the nasF operon leader region. To test this model in vitro, we first purified NasR as both a maltose binding protein fusion form (MBP-NasR) and a His6-tagged form (His6-NasR). Templates for in vitro transcription contained the nasF operon leader region, with a substitution of the sigma70-dependent tac promoter for the native sigmaN-dependent promoter. We found that in vitro transcription of the leader template terminated at the terminator site, and that MBP-NasR and His6-NasR proteins both caused transcription readthrough of this site in response to nitrate or nitrite. Half-maximal antitermination required nitrate or nitrite at moderate (1 to 10 microM) concentrations, and several other anions tested, including chlorate, were without effect. Previous in vivo analysis of leader deletions identified regions required for both negative regulation (the terminator) and for positive regulation. Results from in vitro transcription of these deletion templates correlated fully with the in vivo analysis. Finally, electrophoresis mobility shift analysis revealed that His6-NasR bound specifically to nasF leader RNA. This binding was independent of nitrate in vitro. These results strongly support the conclusions drawn from previous in vivo analysis, and establish that NasR mediates ligand-responsive transcription antitermination through interaction with nasF leader RNA. PMID:9769209

  8. Podoplanin-mediated TGF-β-induced epithelial-mesenchymal transition and its correlation with bHLH transcription factor DEC in TE-11 cells

    PubMed Central

    WU, YUNYAN; LIU, QIANG; YAN, XU; KATO, YUKIO; TANAKA, MAKIKO; INOKUCHI, SADAKI; YOSHIZAWA, TADASHI; MOROHASHI, SATOKO; KIJIMA, HIROSHI

    2016-01-01

    Podoplanin is reported involved in the collective cell invasion, another tumor invasion style which is distinct from the single cell invasion, so-called epithelial-mesenchymal transition (EMT). In this study, we investigated the correlation between podoplanin and EMT-related markers in esophageal squamous cell carcinoma (ESCC), and evaluated its linkage with the basic helix-loop-helix (bHLH) transcription factor differentiated embryonic chondrocyte (DEC) 1 and DEC2. Three ESCC cell lines and human squamous cell carcinoma A431 cells were subjected to western blot analyses for podoplanin and EMT markers, as well as the expression of DEC1 and DEC2. By RT-qPCR and western blotting, we found that TGF-β increased the expression of podoplanin and mensenchymal markers (e.g., N-cadherin and vimentin), while decreased the expression of epithelial markers (e.g., Claudin-4 and E-cadherin), accompanied by Smad2 phosphorylation and slug activation. Moreover, TGF-β has different effects on the expression of DEC1 and DEC2, that is, it upregulates DEC1, but downregulates DEC2. Capability of cell proliferation, invasion and migration were further analyzed using CCK-8 assay, Matrigel-invasion assay, and the wound-healing assay, respectively. The proliferation, invasion and migration ability were significantly lost in podoplanin-knockdown cells when compared with the scrambled siRNA group. In addition to these changes, the expression of Claudin-4, but not that of Claudin-1 or E-cadherin, was induced by the siRNA against podoplanin. On the contrary, overexpression of DEC1 and DEC2 exhibits opposite effects on podoplanin, but only slight effect on Claudin-4 was detected. These data indicated that podoplanin is significantly associated with EMT of TE-11 cells, and may be directly or indirectly regulated by bHLH transcription factors DEC1 and DEC2. PMID:27035755

  9. The bHLH Transcription Factor bHLH104 Interacts with IAA-LEUCINE RESISTANT3 and Modulates Iron Homeostasis in Arabidopsis

    PubMed Central

    Zhang, Jie; Liu, Bing; Li, Mengshu; Feng, Dongru; Jin, Honglei; Wang, Peng; Liu, Jun; Xiong, Feng; Wang, Jinfa; Wang, Hong-Bin

    2015-01-01

    Iron (Fe) is an indispensable micronutrient for plant growth and development. The regulation of Fe homeostasis in plants is complex and involves a number of transcription factors. Here, we demonstrate that a basic helix-loop-helix (bHLH) transcription factor, bHLH104, belonging to the IVc subgroup of bHLH family, acts as a key component positively regulating Fe deficiency responses. Knockout of bHLH104 in Arabidopsis thaliana greatly reduced tolerance to Fe deficiency, whereas overexpression of bHLH104 had the opposite effect and led to accumulation of excess Fe in soil-grown conditions. The activation of Fe deficiency-inducible genes was substantially suppressed by loss of bHLH104. Further investigation showed that bHLH104 interacted with another IVc subgroup bHLH protein, IAA-LEUCINE RESISTANT3 (ILR3), which also plays an important role in Fe homeostasis. Moreover, bHLH104 and ILR3 could bind directly to the promoters of Ib subgroup bHLH genes and POPEYE (PYE) functioning in the regulation of Fe deficiency responses. Interestingly, genetic analysis showed that loss of bHLH104 could decrease the tolerance to Fe deficiency conferred by the lesion of BRUTUS, which encodes an E3 ligase and interacts with bHLH104. Collectively, our data support that bHLH104 and ILR3 play pivotal roles in the regulation of Fe deficiency responses via targeting Ib subgroup bHLH genes and PYE expression. PMID:25794933

  10. The bHLH transcription factor bHLH104 interacts with IAA-LEUCINE RESISTANT3 and modulates iron homeostasis in Arabidopsis.

    PubMed

    Zhang, Jie; Liu, Bing; Li, Mengshu; Feng, Dongru; Jin, Honglei; Wang, Peng; Liu, Jun; Xiong, Feng; Wang, Jinfa; Wang, Hong-Bin

    2015-03-01

    Iron (Fe) is an indispensable micronutrient for plant growth and development. The regulation of Fe homeostasis in plants is complex and involves a number of transcription factors. Here, we demonstrate that a basic helix-loop-helix (bHLH) transcription factor, bHLH104, belonging to the IVc subgroup of bHLH family, acts as a key component positively regulating Fe deficiency responses. Knockout of bHLH104 in Arabidopsis thaliana greatly reduced tolerance to Fe deficiency, whereas overexpression of bHLH104 had the opposite effect and led to accumulation of excess Fe in soil-grown conditions. The activation of Fe deficiency-inducible genes was substantially suppressed by loss of bHLH104. Further investigation showed that bHLH104 interacted with another IVc subgroup bHLH protein, IAA-LEUCINE RESISTANT3 (ILR3), which also plays an important role in Fe homeostasis. Moreover, bHLH104 and ILR3 could bind directly to the promoters of Ib subgroup bHLH genes and POPEYE (PYE) functioning in the regulation of Fe deficiency responses. Interestingly, genetic analysis showed that loss of bHLH104 could decrease the tolerance to Fe deficiency conferred by the lesion of BRUTUS, which encodes an E3 ligase and interacts with bHLH104. Collectively, our data support that bHLH104 and ILR3 play pivotal roles in the regulation of Fe deficiency responses via targeting Ib subgroup bHLH genes and PYE expression. PMID:25794933

  11. Podoplanin-mediated TGF-β-induced epithelial-mesenchymal transition and its correlation with bHLH transcription factor DEC in TE-11 cells.

    PubMed

    Wu, Yunyan; Liu, Qiang; Yan, Xu; Kato, Yukio; Tanaka, Makiko; Inokuchi, Sadaki; Yoshizawa, Tadashi; Morohashi, Satoko; Kijima, Hiroshi

    2016-06-01

    Podoplanin is reported involved in the collective cell invasion, another tumor invasion style which is distinct from the single cell invasion, so-called epithelial-mesenchymal transition (EMT). In this study, we investigated the correlation between podoplanin and EMT-related markers in esophageal squamous cell carcinoma (ESCC), and evaluated its linkage with the basic helix-loop-helix (bHLH) transcription factor differentiated embryonic chondrocyte (DEC) 1 and DEC2. Three ESCC cell lines and human squamous cell carcinoma A431 cells were subjected to western blot analyses for podoplanin and EMT markers, as well as the expression of DEC1 and DEC2. By RT-qPCR and western blotting, we found that TGF-β increased the expression of podoplanin and mensenchymal markers (e.g., N-cadherin and vimentin), while decreased the expression of epithelial markers (e.g., Claudin-4 and E-cadherin), accompanied by Smad2 phosphorylation and slug activation. Moreover, TGF-β has different effects on the expression of DEC1 and DEC2, that is, it upregulates DEC1, but downregulates DEC2. Capability of cell proliferation, invasion and migration were further analyzed using CCK-8 assay, Matrigel-invasion assay, and the wound-healing assay, respectively. The proliferation, invasion and migration ability were significantly lost in podoplanin-knockdown cells when compared with the scrambled siRNA group. In addition to these changes, the expression of Claudin-4, but not that of Claudin-1 or E-cadherin, was induced by the siRNA against podoplanin. On the contrary, overexpression of DEC1 and DEC2 exhibits opposite effects on podoplanin, but only slight effect on Claudin-4 was detected. These data indicated that podoplanin is significantly associated with EMT of TE-11 cells, and may be directly or indirectly regulated by bHLH transcription factors DEC1 and DEC2. PMID:27035755

  12. ZINC FINGER OF ARABIDOPSIS THALIANA12 (ZAT12) Interacts with FER-LIKE IRON DEFICIENCY-INDUCED TRANSCRIPTION FACTOR (FIT) Linking Iron Deficiency and Oxidative Stress Responses1[OPEN

    PubMed Central

    Le, Cham Thi Tuyet; Brumbarova, Tzvetina; Ivanov, Rumen; Stoof, Claudia; Mohrbacher, Julia; Fink-Straube, Claudia; Bauer, Petra

    2016-01-01

    Plants grown under iron (Fe)-deficient conditions induce a set of genes that enhance the efficiency of Fe uptake by the roots. In Arabidopsis (Arabidopsis thaliana), the central regulator of this response is the basic helix-loop-helix transcription factor FER-LIKE IRON DEFICIENCY-INDUCED TRANSCRIPTION FACTOR (FIT). FIT activity is regulated by protein-protein interactions, which also serve to integrate external signals that stimulate and possibly inhibit Fe uptake. In the search of signaling components regulating FIT function, we identified ZINC FINGER OF ARABIDOPSIS THALIANA12 (ZAT12), an abiotic stress-induced transcription factor. ZAT12 interacted with FIT, dependent on the presence of the ethylene-responsive element-binding factor-associated amphiphilic repression motif. ZAT12 protein was found expressed in the root early differentiation zone, where its abundance was modulated in a root layer-specific manner. In the absence of ZAT12, FIT expression was upregulated, suggesting a negative effect of ZAT12 on Fe uptake. Consistently, zat12 loss-of-function mutants had higher Fe content than the wild type at sufficient Fe. We found that under Fe deficiency, hydrogen peroxide (H2O2) levels were enhanced in a FIT-dependent manner. FIT protein, in turn, was stabilized by H2O2 but only in the presence of ZAT12, showing that H2O2 serves as a signal for Fe deficiency responses. We propose that oxidative stress-induced ZAT12 functions as a negative regulator of Fe acquisition. A model where H2O2 mediates the negative regulation of plant responses to prolonged stress might be applicable to a variety of stress conditions. PMID:26556796

  13. Multiscale Simulation of Protein Mediated Membrane Remodeling

    PubMed Central

    Ayton, Gary S.; Voth, Gregory A.

    2009-01-01

    Proteins interacting with membranes can result in substantial membrane deformations and curvatures. This effect is known in its broadest terms as membrane remodeling. This review article will survey current multiscale simulation methodologies that have been employed to examine protein-mediated membrane remodeling. PMID:19922811

  14. Severe mental retardation with breathing abnormalities (Pitt-Hopkins syndrome) is caused by haploinsufficiency of the neuronal bHLH transcription factor TCF4.

    PubMed

    Brockschmidt, Antje; Todt, Unda; Ryu, Soojin; Hoischen, Alexander; Landwehr, Christina; Birnbaum, Stefanie; Frenck, Wilhelm; Radlwimmer, Bernhard; Lichter, Peter; Engels, Hartmut; Driever, Wolfgang; Kubisch, Christian; Weber, Ruthild G

    2007-06-15

    Pitt-Hopkins syndrome (PHS) is a rare syndromic mental disorder, which is mainly characterized by severe motor and mental retardation including absent language development, a characteristic facial gestalt and episodes of hyperventilation. We report on a female patient with PHS showing severe mental retardation with absent speech, pronounced muscular hypotonia, ataxia, distinctive facial features, such as a coarse face, a broad nasal bridge and a wide mouth, and hyperventilation attacks. In this patient, genomic profiling by array-based comparative genomic hybridization and fluorescence in situ hybridization studies detected and confirmed a de novo 0.5 Mb deletion in 18q21.2 containing a single gene, the basic helix-loop-helix transcription factor TCF4. cDNA and genomic analyses in the patient and her parents demonstrated TCF4 haploinsufficiency as the underlying cause of the disease. Analysis of the embryonal expression pattern of the Danio rerio ortholog, tcf4, by whole-mount in situ hybridization showed a highly specific expression domain in the pallium of the telencephalon during late somitogenesis, when the patterning of the zebrafish brain is advanced and neural differentiation commences. Later expression domains were restricted to several regions in the central nervous system, including continued expression in the pallium of the telencephalon, and starting expression in the diencephalon (thalamus, ventral thalamus and posterior tuberculum), the midbrain tegmentum, the hindbrain and the branchial arches. This expression pattern correlates with the clinical phenotype. Our results show that haploinsufficiency of TCF4 causes PHS and suggest that D. rerio is a valuable model to study the molecular pathogenesis of PHS and the role of TCF4 in brain development. PMID:17478476

  15. A novel bHLH transcription factor PebHLH35 from Populus euphratica confers drought tolerance through regulating stomatal development, photosynthesis and growth in Arabidopsis

    SciTech Connect

    Dong, Yan; Wang, Congpeng; Han, Xiao; Tang, Sha; Liu, Sha; Xia, Xinli; Yin, Weilun

    2014-07-18

    Highlights: • PebHLH35 is firstly cloned from Populus euphratica and characterized its functions. • PebHLH35 is important for earlier seedling establishment and vegetative growth. • PebHLH35 enhances tolerance to drought by regulating growth. • PebHLH35 enhances tolerance to drought by regulating stomatal development. • PebHLH35 enhances tolerance to drought by regulating photosynthesis and transpiration. - Abstract: Plant basic helix-loop-helix (bHLH) transcription factors (TFs) are involved in a variety of physiological processes including the regulation of plant responses to various abiotic stresses. However, few drought-responsive bHLH family members in Populus have been reported. In this study, a novel bHLH gene (PebHLH35) was cloned from Populus euphratica. Expression analysis in P. euphratica revealed that PebHLH35 was induced by drought and abscisic acid. Subcellular localization studies using a PebHLH35-GFP fusion showed that the protein was localized to the nucleus. Ectopic overexpression of PebHLH35 in Arabidopsis resulted in a longer primary root, more leaves, and a greater leaf area under well-watered conditions compared with vector control plants. Notably, PebHLH35 overexpression lines showed enhanced tolerance to water-deficit stress. This finding was supported by anatomical and physiological analyses, which revealed a reduced stomatal density, stomatal aperture, transpiration rate, and water loss, and a higher chlorophyll content and photosynthetic rate. Our results suggest that PebHLH35 functions as a positive regulator of drought stress responses by regulating stomatal density, stomatal aperture, photosynthesis and growth.

  16. PEROXISOME PROLIFERATOR-ACTIVATED RECEPTORα (PPARα) AGONISTS DIFFERENTIALLY REGULATE INHIBITOR OF DNA BINDING (ID2) EXPRESSION IN RODENTS AND HUMAN CELLS

    EPA Science Inventory

    Abstract Inhibitor of DNA binding (Id2) is a member of the helix-loop-helix (HLH) transcription factor family whose members play important roles in cell differentiation and proliferation. Id2 has been linked to the development of cardiovascular diseases since thiazolidinediones,...

  17. IMMUNOHISTOCHEMICAL DOUBLE-STAINING FOR AH RECEPTOR AND ARNT IN HUMAN EMBRYONIC PALATAL SHELVES

    EPA Science Inventory

    The aryl hydrocarbon receptor (AhR) and the AhR nuclear translocation protein (ARNT) are helix-loop-helix (HLH) proteins involved in transcriptional regulation. olycyclic aromatic halogenated chemicals, of which 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) is the most potent, bind ...

  18. Functional profiling identifies genes involved in organ specific branches of the PIF3 regulatory network in Arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The phytochrome (phy)-interacting basic helix-loop-helix transcription factors (PIFs) constitutively sustain the etiolated state of dark-germinated seedlings by actively repressing deetiolation in darkness. This action is rapidly reversed upon light exposure by phy-induced proteolytic degradation of...

  19. Transcriptional deregulation in hereditary disorders and cancer: the 12th annual CABM symposium, October 21-22, 1998, Piscataway, NJ.

    PubMed

    Rabson, A B

    1999-07-29

    As can be seen from the above descriptions, the presentations at the CABM symposium provided an extraordinarily rich and diverse panorama of some of the most exciting science in current molecular biology. The presentations provided both a general overview and a detailed analysis of multiple biological systems, which despite their specific differences, also generated insights into important common themes. The success of any meeting is most appropriately measured by the kinds of questions that are provoked for future study, not merely by the recitation of past discoveries. In fact, the different presentations often raised highly similar questions for future study. At the most fundamental levels of transcriptional regulation, what are the signals that provide specificity of gene expression? What is the structural basis of specific protein-protein interactions, such as those between homeodomain proteins and beta-catenin-Lef1 interactions, and how are these determinants altered in transcriptional regulation in oncogenesis and in genetic diseases? How is specificity achieved in transcriptional repression, given that the fundamental biochemical reactions often involve modifications of relatively ubiquitous components such as histones? To what extent do changes in specificity of gene activation and repression or in chromosomal architecture mediate the kinds of developmental and oncogenic signals mediated through transcriptional regulators such as Myc, BCL6 and other basic helix-loop-helix proteins and the HMGI proteins? How do altered signaling pathways affect diseases of development and differentiation such as cardiovascular disorders and aging itself? What are the pathways that integrate extracellular signals and transcription during the process of organogenesis? How do fundamental cellular structures such as adhesion junctions, and the interactions of a cell with other cells and extracellular matrix impact on normal and abnormal development and on malignancy, and how do

  20. Armet is an effector protein mediating aphid-plant interactions.

    PubMed

    Wang, Wei; Dai, Huaien; Zhang, Yi; Chandrasekar, Raman; Luo, Lan; Hiromasa, Yasuaki; Sheng, Changzhong; Peng, Gongxin; Chen, Shaoliang; Tomich, John M; Reese, John; Edwards, Owain; Kang, Le; Reeck, Gerald; Cui, Feng

    2015-05-01

    Aphid saliva is predicted to contain proteins that modulate plant defenses and facilitate feeding. Armet is a well-characterized bifunctional protein in mammalian systems. Here we report a new role of Armet, namely as an effector protein in the pea aphid, Acyrthosiphon pisum. Pea aphid Armet's physical and chemical properties and its intracellular role are comparable to those reported for mammalian Armets. Uniquely, we detected Armet in aphid watery saliva and in the phloem sap of fava beans fed on by aphids. Armet's transcript level is several times higher in the salivary gland when aphids feed on bean plants than when they feed on an artificial diet. Knockdown of the Armet transcript by RNA interference disturbs aphid feeding behavior on fava beans measured by the electrical penetration graph technique and leads to a shortened life span. Inoculation of pea aphid Armet protein into tobacco leaves induced a transcriptional response that included pathogen-responsive genes. The data suggest that Armet is an effector protein mediating aphid-plant interactions. PMID:25678626

  1. Inhibitor of differentiation 1 transcription factor promotes metabolic reprogramming in hepatocellular carcinoma cells.

    PubMed

    Sharma, Bal Krishan; Kolhe, Ravindra; Black, Stephen M; Keller, Jonathan R; Mivechi, Nahid F; Satyanarayana, Ande

    2016-01-01

    Reprograming of metabolism is one of the central hallmarks of cancer. The majority of cancer cells depend on high rates of glycolysis and glutaminolysis for their growth and survival. A number of oncogenes and tumor suppressors have been connected to the regulation of altered glucose and glutamine metabolism in cancer cells. For example, the oncogene c-Myc plays vital roles in cancer cell metabolic adaptation by directly regulating various genes that participate in aerobic glycolysis and glutaminolysis. Inhibitor of differentiation 1 (Id1) is a helix-loop-helix transcription factor that plays important roles in cell proliferation, differentiation, and cell fate determination. Overexpression of Id1 causes intestinal adenomas and thymic lymphomas in mice, suggesting that Id1 could function as an oncogene. Despite it being an oncogene, whether Id1 plays any prominent role in cancer cell metabolic reprograming is unknown. Here, we demonstrate that Id1 is strongly expressed in human and mouse liver tumors and in hepatocellular carcinoma (HCC) cell lines, whereas its expression is very low or undetectable in normal liver tissues. In HCC cells, Id1 expression is regulated by the MAPK/ERK pathway at the transcriptional level. Knockdown of Id1 suppressed aerobic glycolysis and glutaminolysis, suggesting that Id1 promotes a metabolic shift toward aerobic glycolysis. At the molecular level, Id1 mediates its metabolic effects by regulating the expression levels of c-Myc. Knockdown of Id1 resulted in down-regulation (∼75%) of c-Myc, whereas overexpression of Id1 strongly induced (3-fold) c-Myc levels. Interestingly, knockdown of c-Myc resulted in down-regulation (∼60%) of Id1, suggesting a positive feedback-loop regulatory mechanism between Id1 and c-Myc. Under anaerobic conditions, both Id1 and c-Myc are down-regulated (50-70%), and overexpression of oxygen-insensitive hypoxia-inducible factor 1α (Hif1α) or its downstream target Mxi1 resulted in a significant reduction

  2. Identification of the bHLH Factor Math6 as a Novel Component of the Embryonic Pancreas Transcriptional Network

    PubMed Central

    Lynn, Francis C.; Sanchez, Lidia; Gomis, Ramon; German, Michael S.; Gasa, Rosa

    2008-01-01

    Background Basic helix-loop-helix (bHLH) transcription factors play important roles in differentiation processes during embryonic development of vertebrates. In the pancreas, the atonal-related bHLH gene Neurogenin3 (Neurog3) controls endocrine cell fate specification in uncommitted progenitor cells. Therefore, it is likely that Neurog3-regulated factors will have important functions during pancreatic endocrine cell differentiation. The gene for the atonal-related bHLH factor Math6 was recognized as a potential target of Neurog3 in a genomic scale profiling during endocrine differentiation. Herein we have explored the role of Math6 during endocrine pancreas development. Results We demonstrate that the Math6 gene is a direct target of Neurog3 in vitro and that, during mouse development, Math6 is expressed in both endocrine and exocrine pancreatic precursor cells. We have investigated the role of Math6 in endocrine differentiation by over-expressing this factor in pancreatic duct cells. Math6 possesses intrinsic transcriptional repressor activity and, in contrast to Neurog3 it does not induce the endocrine differentiation program; however, it can modulate some of the pro-endocrine functions of Neurog3 in this system. In addition, we show that Math6 is broadly expressed in mouse embryonic tissues and its expression is induced by tissue-specific bHLH genes other than Neurog3. Furthermore, inactivation of the Math6 gene in the mouse results in early embryonic lethality demonstrating an essential role of this factor in organismal development. Conclusions These data demonstrate that Math6 is a novel component of the pancreatic transcriptional network during embryonic development and suggest a potential role for Math6 as a modulator of the differentiation program initiated by the pro-endocrine factor Neurog3. Furthermore, our results demonstrate that Math6 is indispensable for early embryonic development and indicate a more widespread function for this factor in tissue

  3. TabHLH1, a bHLH-type transcription factor gene in wheat, improves plant tolerance to Pi and N deprivation via regulation of nutrient transporter gene transcription and ROS homeostasis.

    PubMed

    Yang, Tongren; Hao, Lin; Yao, Sufei; Zhao, Yuanyuan; Lu, Wenjing; Xiao, Kai

    2016-07-01

    Basic helix-loop-helix (bHLH) transcription factors (TFs) comprise a large TF family and act as crucial regulators in various biological processes in plants. Here, we report the functional characterization of TabHLH1, a bHLH TF member in wheat (Triticum aestivum). TabHLH1 shares conserved bHLH domain and targets to nucleus with transactivation activity. Upon Pi and N deprivation, the expression of TabHLH1 was up-regulated in roots and leaves, showing a pattern to be gradually increased within 23-h treatment regimes. The lines with overexpression of TabHLH1 exhibited drastically improved tolerance to Pi and N deprivation, showing larger plant phenotype, more biomass, higher concentration and more accumulation of P and N than wild type (WT) upon the Pi- and N-starvation stresses. NtPT1 and NtNRT2.2, the genes encoding phosphate transporter (PT) and nitrate transporter (NRT) in tobacco, respectively, showed up-regulated expression in TabHLH1-overexpressing plants; knockdown expression of them led to deteriorated growth feature, lowered biomass, and decreased nutrient accumulation of plants under Pi- and N-deficient conditions. Compared with WT, the TabHLH1-overexpressing plants also showed lowered reactive oxygen species (ROS) accumulation and improved antioxidant enzyme (AE) activities, such as those of superoxide dismutase (SOD), catalase (CAT), and peroxidase (POD). NtSOD1, NtCAT1, and NtPOD1;6 that encode SOD, CAT, and POD, respectively, were up-regulated in TabHLH1-overexpressing plants. Further knockdown of these AE gene expression caused reduced antioxidant enzymatic activities, indicative of their crucial roles in mediating cellular ROS homeostasis in Pi- and N-starvation conditions. Together, TabHLH1 plays an important role in mediating adaptation to the Pi- and N-starvation stresses through transcriptional regulation of a set of genes encoding PT, NRT and AEs that mediate the taken up of Pi and N and the cellular homeostasis of ROS initiated by the nutrient

  4. A conserved alternative form of the purple sea urchin HEB/E2-2/E2A transcription factor mediates a switch in E-protein regulatory state in differentiating immune cells.

    PubMed

    Schrankel, Catherine S; Solek, Cynthia M; Buckley, Katherine M; Anderson, Michele K; Rast, Jonathan P

    2016-08-01

    E-proteins are basic helix-loop-helix (bHLH) transcription factors with essential roles in animal development. In mammals, these are encoded by three loci: E2-2 (ITF-2/ME2/SEF2/TCF4), E2A (TCF3), and HEB (ME1/REB/TCF12). The HEB and E2-2 paralogs are expressed as alternative (Alt) isoforms with distinct N-terminal sequences encoded by unique exons under separate regulatory control. Expression of these alternative transcripts is restricted relative to the longer (Can) forms, suggesting distinct regulatory roles, although the functions of the Alt proteins remain poorly understood. Here, we characterize the single sea urchin E-protein ortholog (SpE-protein). The organization of the SpE-protein gene closely resembles that of the extended HEB/E2-2 vertebrate loci, including a transcript that initiates at a homologous alternative transcription start site (SpE-Alt). The existence of an Alt form in the sea urchin indicates that this feature predates the emergence of the vertebrates. We present additional evidence indicating that this transcript was present in the common bilaterian ancestor. In contrast to the widely expressed canonical form (SpE-Can), SpE-Alt expression is tightly restricted. SpE-Alt is expressed in two phases: first in aboral non-skeletogenic mesenchyme (NSM) cells and then in oral NSM cells preceding their differentiation and ingression into the blastocoel. Derivatives of these cells mediate immune response in the larval stage. Inhibition of SpE-Alt activity interferes with these events. Notably, although the two isoforms are initially co-expressed, as these cells differentiate, SpE-Can is excluded from the SpE-Alt(+) cell population. This mutually exclusive expression is dependent on SpE-Alt function, which reveals a previously undescribed negative regulatory linkage between the two E-protein forms. Collectively, these findings reorient our understanding of the evolution of this transcription factor family and highlight fundamental properties of E

  5. Genome-wide characterization and expression analysis of common bean bHLH transcription factors in response to excess salt concentration.

    PubMed

    Kavas, Musa; Baloğlu, Mehmet Cengiz; Atabay, Elif Seda; Ziplar, Ummugulsum Tanman; Daşgan, Hayriye Yıldız; Ünver, Turgay

    2016-02-01

    Members of basic helix-loop-helix (bHLH) gene family found in all eukaryotes play crucial roles in response to stress. Though, most eukaryotes carry the proteins of this family, biological functions of the most bHLH family members are not deeply evaluated in plants. In this study, we conducted a comprehensive genome-wide analysis of bHLH transcription factors in salt tolerant common bean. We identified 155 bHLH protein-encoding genes (PvbHLH) by using in silico comparative genomics tools. Based on the phylogenetic tree, PvbHLH genes were classified into 8 main groups with 21 subfamilies. Exon-intron analysis indicated that proteins belonging to same main groups exhibited a closely related gene structure. While, the PvbHLH gene family has been mainly expanded through segmental duplications, a total of 11 tandem duplication were detected. Genome-wide expression analysis of bHLH genes showed that 63 PvbHLH genes were differentially expressed in at least one tissue. Three of them displayed higher expression values in both leaf and root tissues. The in silico micro-RNA target transcript analyses revealed that totally 100 PvHLH genes targeted by 86 plant miRNAs. The most abundant transcripts, which were targeted by all 18 plant miRNA, were belonging to PvHLH-22 and PvHLH-44 genes. The expression of 16 PvbHLH genes in the root and leaf tissues of salt-stressed common bean was evaluated using qRT-PCR. Among them, two of PvbHLHs, PvbHLH-54, PvbHLH-148, were found to be up-regulated in both tissues in correlation with RNA-seq measurements. The results of this study could help improve understanding of biological functions of common bean bHLH family under salt stress. Additionally, it may provide basic resources for analyzing bHLH protein function for improving economic, agronomic and ecological benefit in common bean and other species. PMID:26193947

  6. Epigenetic role of CCAAT box-binding transcription factor NF-Y on ID gene family in human embryonic carcinoma cells.

    PubMed

    Moeinvaziri, Farideh; Shahhoseini, Maryam

    2015-11-01

    Nuclear factor Y (NF-Y) is a histone substitute protein that specifically binds to the CCAAT box of the target genes and thereby promotes their regulation. NF-Y transcription factor, with defined CCAAT element-binding activities, target a gene family that encodes a group of basic helix-loop-helix ID factors (ID1-ID4), with or without CCAAT box at their promoter region. In this study, the expressions of NF-Y in mRNA and protein level were evaluated in a human embryonic carcinoma cell line, named NTera2, before and after 7 days induction of differentiation. We also looked into expression levels of ID genes in NTera2 cells during differentiation because of their critical role in development. By using chromatin immunoprecipitation coupled with real-time polymerase chain reaction, NF-Y incorporation and acetylation/dimethylation of histone H3 at lysine 9 (H3K9ac/me2) was quantitatively evaluated on the regulatory regions of considered genes to monitor the changes in epigenetic markers at ID gene promoters throughout differentiation. The results demonstrated a marked down-regulation of ID1, ID2, and ID3 genes, parallel to a loss of NF-Y binding to the promoters of these genes. The data show that although the genes encoding NF-Y complex remained expressed at mRNA level, NF-YC is lost at the protein level onset of differentiation. Additionally, the epigenetic marks of H3K9ac and H3K9me2 at the target gene promoters decreased and increased, respectively, after 1 day of differentiation. It is suggested that, in the absence of NF-Y binding, the corresponding regions adopt a heterochromatic nature, whereas when NF-Y comes back after 7 days of differentiation, the ID1-3 promoters become again converted into active chromatin. The ID4 gene, lacking a CCAAT box, behaves differently and does not show any incorporation. This experiment implies for the first time that the presence of NF-Y transcription factor plays a pivotal role in transcriptional regulation of ID genes in

  7. Involvement of transcription factor encoded by the mi locus in the expression of c-kit receptor tyrosine kinase in cultured mast cells of mice.

    PubMed

    Tsujimura, T; Morii, E; Nozaki, M; Hashimoto, K; Moriyama, Y; Takebayashi, K; Kondo, T; Kanakura, Y; Kitamura, Y

    1996-08-15

    The mi locus of mice encodes a member of the basic-helix-loop-helix-leucine zipper (bHLH-Zip) protein family of transcription factors (hereafter called MITF). Cultured mast cells of mi/mi genotype (mi/mi CMCs) did not normally respond to stem cell factor (SCF), a ligand for the c-kit receptor tyrosine kinase. The poor response of mi/mi CMCs to SCF was attributed to the deficient expression of c-kit both the mRNA and protein levels. The purpose of the present study is to investigate the effect of MITF on the transcription of the c-kit gene. First, we introduced cDNA encoding normal (+) MITF or mutant (mi) MITF into mi/mi CMCs using the retroviral vector. Overexpression of (+)-MITF but not mi-MITF normalized the expression of the c-kit and the poor response of mi/mi CMCs to SCF, indicating the involvement of (+)-MITF in the c-kit gene transactivation. Second, we analyzed the promoter of the c-kit gene. Three CANNTG motifs recognized by bHLH-Zip-type transcription factors were conserved between the mouse and human c-kit promoters. Among these three CANNTG motifs, only the CACCTG motif (nt -356 to -351) was specifically bound by (+)-MITF. When the luciferase gene under the control of the c-kit promoter was contransfected into NIH/3T3 fibroblasts with cDNA encoding (+)-MITF or mi-MITF, the luciferase activity significantly increased only when (+)-MITF cDNA was cotransfected. The deletion of the promoter region containing the CACCTG motif or the mutation of the CACCTG to CTCCAG abolished the transactivation effect of (+)-MITF, indicating that (+)-MITF transactivated the c-kit gene through the CACCTG motif. When the luciferase gene under the control of the c-kit promoter was introduced into the FMA3 mastocytoma and FEC-P1 myeloid cell lines, remarkable luciferase activity was observed only in FMA3 cells. Thus, the involvement of (+)-MITF in the c-kit transactivation appeared to be specific to the mast cell lineage. PMID:8695840

  8. Coronary Artery Disease Associated Transcription Factor TCF21 Regulates Smooth Muscle Precursor Cells That Contribute to the Fibrous Cap

    PubMed Central

    Raiesdana, Azad; Kundu, Ramendra; Miller, Clint L.; Kim, Juyong B.; Arora, Komal; Carcamo-Oribe, Ivan; Xiong, Yiqin; Tellakula, Nikhil; Nanda, Vivek; Murthy, Nikitha; Boisvert, William A.; Hedin, Ulf; Perisic, Ljubica; Aldi, Silvia; Maegdefessel, Lars; Pjanic, Milos; Owens, Gary K.; Tallquist, Michelle D.; Quertermous, Thomas

    2015-01-01

    Recent genome wide association studies have identified a number of genes that contribute to the risk for coronary heart disease. One such gene, TCF21, encodes a basic-helix-loop-helix transcription factor believed to serve a critical role in the development of epicardial progenitor cells that give rise to coronary artery smooth muscle cells (SMC) and cardiac fibroblasts. Using reporter gene and immunolocalization studies with mouse and human tissues we have found that vascular TCF21 expression in the adult is restricted primarily to adventitial cells associated with coronary arteries and also medial SMC in the proximal aorta of mouse. Genome wide RNA-Seq studies in human coronary artery SMC (HCASMC) with siRNA knockdown found a number of putative TCF21 downstream pathways identified by enrichment of terms related to CAD, including “vascular disease,” “disorder of artery,” and “occlusion of artery,” as well as disease-related cellular functions including “cellular movement” and “cellular growth and proliferation.” In vitro studies in HCASMC demonstrated that TCF21 expression promotes proliferation and migration and inhibits SMC lineage marker expression. Detailed in situ expression studies with reporter gene and lineage tracing revealed that vascular wall cells expressing Tcf21 before disease initiation migrate into vascular lesions of ApoE-/- and Ldlr-/- mice. While Tcf21 lineage traced cells are distributed throughout the early lesions, in mature lesions they contribute to the formation of a subcapsular layer of cells, and others become associated with the fibrous cap. The lineage traced fibrous cap cells activate expression of SMC markers and growth factor receptor genes. Taken together, these data suggest that TCF21 may have a role regulating the differentiation state of SMC precursor cells that migrate into vascular lesions and contribute to the fibrous cap and more broadly, in view of the association of this gene with human CAD, provide

  9. MYB and bHLH transcription factor transgenes increase anthocyanin pigmentation in petunia and lisianthus plants, and the petunia phenotypes are strongly enhanced under field conditions.

    PubMed

    Schwinn, Kathy E; Boase, Murray R; Bradley, J Marie; Lewis, David H; Deroles, Simon C; Martin, Cathie R; Davies, Kevin M

    2014-01-01

    Petunia line Mitchell [MP, Petunia axillaris × (P. axillaris × P. hybrida)] and Eustoma grandiflorum (lisianthus) plants were produced containing a transgene for over-expression of the R2R3-MYB transcription factor [TF; ROSEA1 (ROS1)] that up-regulates flavonoid biosynthesis in Antirrhinum majus. The petunia lines were also crossed with previously produced MP lines containing a Zea mays flavonoid-related basic helix-loop-helix TF transgene (LEAF COLOR, LC), which induces strong vegetative pigmentation when these 35S:LC plants are exposed to high-light levels. 35S:ROS1 lisianthus transgenics had limited changes in anthocyanin pigmentation, specifically, precocious pigmentation of flower petals and increased pigmentation of sepals. RNA transcript levels for two anthocyanin biosynthetic genes, chalcone synthase and anthocyanidin synthase, were increased in the 35S:ROS1 lisianthus petals compared to those of control lines. With MP, the 35S:ROS1 calli showed novel red pigmentation in culture, but this was generally not seen in tissue culture plantlets regenerated from the calli or young plants transferred to soil in the greenhouse. Anthocyanin pigmentation was enhanced in the stems of mature 35S:ROS1 MP plants, but the MP white-flower phenotype was not complemented. Progeny from a 35S:ROS1 × 35S:LC cross had novel pigmentation phenotypes that were not present in either parental line or MP. In particular, there was increased pigment in the petal throat region, and the anthers changed from yellow to purple pigmentation. An outdoor field trial was conducted with the 35S:ROS1, 35S:LC, 35S:ROS1 × 35S:LC and control MP lines. Field conditions rapidly induced intense foliage pigmentation in 35S:LC plants, a phenotype not observed in control MP or equivalent 35S:LC plants maintained in a greenhouse. No difference in plant stature, seed germination, or plant survival was observed between transgenic and control plants. PMID:25414715

  10. Increased expression of bHLH transcription factor E2A (TCF3) in prostate cancer promotes proliferation and confers resistance to doxorubicin induced apoptosis

    SciTech Connect

    Patel, Divya; Chaudhary, Jaideep

    2012-05-25

    Highlights: Black-Right-Pointing-Pointer E2A, considered as a tumor suppressor is highly expressed in prostate cancer. Black-Right-Pointing-Pointer Silencing of E2A attenuates cell proliferation and promotes apoptosis. Black-Right-Pointing-Pointer E2A regulates c-myc, Id1, Id3 and CDKN1A expression. Black-Right-Pointing-Pointer Loss of E2A promotes doxorubicin dependent apoptosis in prostate cancer cells. Black-Right-Pointing-Pointer Results suggest that E2A acts as a tumor promoter at least in prostate cancer. -- Abstract: E2A (TCF3) is a multifunctional basic helix loop helix (bHLH), transcription factor. E2A regulates transcription of target genes by homo- or heterodimerization with cell specific bHLH proteins. In general, E2A promotes cell differentiation, acts as a negative regulator of cell proliferation in normal cells and cancer cell lines and is required for normal B-cell development. Given the diverse biological pathways regulated/influenced by E2A little is known about its expression in cancer. In this study we investigated the expression of E2A in prostate cancer. Unexpectedly, E2A immuno-histochemistry demonstrated increased E2A expression in prostate cancer as compared to normal prostate. Silencing of E2A in prostate cancer cells DU145 and PC3 led to a significant reduction in proliferation due to G1 arrest that was in part mediated by increased CDKN1A(p21) and decreased Id1, Id3 and c-myc. E2A silencing in prostate cancer cell lines also resulted in increased apoptosis due to increased mitochondrial permeability and caspase 3/7 activation. Moreover, silencing of E2A increased sensitivity to doxorubicin induced apoptosis. Based on our results, we propose that E2A could be an upstream regulator of Id1 and c-Myc which are highly expressed in prostate cancer. These results for the first time demonstrate that E2A could in fact acts as a tumor promoter at least in prostate cancer.

  11. Two LcbHLH Transcription Factors Interacting with LcMYB1 in Regulating Late Structural Genes of Anthocyanin Biosynthesis in Nicotiana and Litchi chinensis During Anthocyanin Accumulation

    PubMed Central

    Lai, Biao; Du, Li-Na; Liu, Rui; Hu, Bing; Su, Wen-Bing; Qin, Yong-Hua; Zhao, Jie-Tang; Wang, Hui-Cong; Hu, Gui-Bing

    2016-01-01

    Anthocyanin biosynthesis requires the MYB-bHLH-WD40 protein complex to activate the late biosynthetic genes. LcMYB1 was thought to act as key regulator in anthocyanin biosynthesis of litchi. However, basic helix-loop-helix proteins (bHLHs) as partners have not been identified yet. The present study describes the functional characterization of three litchi bHLH candidate anthocyanin regulators, LcbHLH1, LcbHLH2, and LcbHLH3. Although these three litchi bHLHs phylogenetically clustered with bHLH proteins involved in anthcoyanin biosynthesis in other plant, only LcbHLH1 and LcbHLH3 were found to localize in the nucleus and physically interact with LcMYB1. The transcription levels of all these bHLHs were not coordinated with anthocyanin accumulation in different tissues and during development. However, when co-infiltrated with LcMYB1, both LcbHLH1 and LcbHLH3 enhanced anthocyanin accumulation in tobacco leaves with LcbHLH3 being the best inducer. Significant accumulation of anthocyanins in leaves transformed with the combination of LcMYB1 and LcbHLH3 were noticed, and this was associated with the up-regulation of two tobacco endogenous bHLH regulators, NtAn1a and NtAn1b, and late structural genes, like NtDFR and NtANS. Significant activity of the ANS promoter was observed in transient expression assays either with LcMYB1-LcbHLH1 or LcMYB1-LcbHLH3, while only minute activity was detected after transformation with only LcMYB1. In contrast, no activity was measured after induction with the combination of LcbHLH2 and LcMYB1. Higher DFR expression was also oberseved in paralleling with higher anthocyanins in co-transformed lines. LcbHLH1 and LcbHLH3 are essential partner of LcMYB1 in regulating the anthocyanin production in tobacco and probably also in litchi. The LcMYB1-LcbHLH complex enhanced anthocyanin accumulation may associate with activating the transcription of DFR and ANS. PMID:26925082

  12. MYB and bHLH transcription factor transgenes increase anthocyanin pigmentation in petunia and lisianthus plants, and the petunia phenotypes are strongly enhanced under field conditions

    PubMed Central

    Schwinn, Kathy E.; Boase, Murray R.; Bradley, J. Marie; Lewis, David H.; Deroles, Simon C.; Martin, Cathie R.; Davies, Kevin M.

    2014-01-01

    Petunia line Mitchell [MP, Petunia axillaris × (P. axillaris × P. hybrida)] and Eustoma grandiflorum (lisianthus) plants were produced containing a transgene for over-expression of the R2R3-MYB transcription factor [TF; ROSEA1 (ROS1)] that up-regulates flavonoid biosynthesis in Antirrhinum majus. The petunia lines were also crossed with previously produced MP lines containing a Zea mays flavonoid-related basic helix-loop-helix TF transgene (LEAF COLOR, LC), which induces strong vegetative pigmentation when these 35S:LC plants are exposed to high-light levels. 35S:ROS1 lisianthus transgenics had limited changes in anthocyanin pigmentation, specifically, precocious pigmentation of flower petals and increased pigmentation of sepals. RNA transcript levels for two anthocyanin biosynthetic genes, chalcone synthase and anthocyanidin synthase, were increased in the 35S:ROS1 lisianthus petals compared to those of control lines. With MP, the 35S:ROS1 calli showed novel red pigmentation in culture, but this was generally not seen in tissue culture plantlets regenerated from the calli or young plants transferred to soil in the greenhouse. Anthocyanin pigmentation was enhanced in the stems of mature 35S:ROS1 MP plants, but the MP white-flower phenotype was not complemented. Progeny from a 35S:ROS1 × 35S:LC cross had novel pigmentation phenotypes that were not present in either parental line or MP. In particular, there was increased pigment in the petal throat region, and the anthers changed from yellow to purple pigmentation. An outdoor field trial was conducted with the 35S:ROS1, 35S:LC, 35S:ROS1 × 35S:LC and control MP lines. Field conditions rapidly induced intense foliage pigmentation in 35S:LC plants, a phenotype not observed in control MP or equivalent 35S:LC plants maintained in a greenhouse. No difference in plant stature, seed germination, or plant survival was observed between transgenic and control plants. PMID:25414715

  13. Computational modeling of the bHLH domain of the transcription factor TWIST1 and R118C, S144R and K145E mutants

    PubMed Central

    2012-01-01

    Background Human TWIST1 is a highly conserved member of the regulatory basic helix-loop-helix (bHLH) transcription factors. TWIST1 forms homo- or heterodimers with E-box proteins, such as E2A (isoforms E12 and E47), MYOD and HAND2. Haploinsufficiency germ-line mutations of the twist1 gene in humans are the main cause of Saethre-Chotzen syndrome (SCS), which is characterized by limb abnormalities and premature fusion of cranial sutures. Because of the importance of TWIST1 in the regulation of embryonic development and its relationship with SCS, along with the lack of an experimentally solved 3D structure, we performed comparative modeling for the TWIST1 bHLH region arranged into wild-type homodimers and heterodimers with E47. In addition, three mutations that promote DNA binding failure (R118C, S144R and K145E) were studied on the TWIST1 monomer. We also explored the behavior of the mutant forms in aqueous solution using molecular dynamics (MD) simulations, focusing on the structural changes of the wild-type versus mutant dimers. Results The solvent-accessible surface area of the homodimers was smaller on wild-type dimers, which indicates that the cleft between the monomers remained more open on the mutant homodimers. RMSD and RMSF analyses indicated that mutated dimers presented values that were higher than those for the wild-type dimers. For a more careful investigation, the monomer was subdivided into four regions: basic, helix I, loop and helix II. The basic domain presented a higher flexibility in all of the parameters that were analyzed, and the mutant dimer basic domains presented values that were higher than the wild-type dimers. The essential dynamic analysis also indicated a higher collective motion for the basic domain. Conclusions Our results suggest the mutations studied turned the dimers into more unstable structures with a wider cleft, which may be a reason for the loss of DNA binding capacity observed for in vitro circumstances. PMID:22839202

  14. Activation of myoD gene transcription by 3,5,3'-triiodo-L-thyronine: a direct role for the thyroid hormone and retinoid X receptors.

    PubMed Central

    Muscat, G E; Mynett-Johnson, L; Dowhan, D; Downes, M; Griggs, R

    1994-01-01

    Thyroid hormones are major determinants of skeletal muscle differentiation in vivo. Triiodo-L-thyronine treatment promotes terminal muscle differentiation and results in increased MyoD gene transcription in myogenic cell lines; furthermore myoD and fast myosin heavy chain gene expression are activated in rodent slow twitch muscle fibers (Molecular Endocrinology 6: 1185-1194, 1992; Development 118: 1137-1147, 1993). We have identified a T3 response element (TRE) in the mouse MyoD promoter between nucleotide positions -337 and -309 (5' CTGAGGTCAGTACAGGCTGGAGGAGTAGA 3'). This sequence conferred an appropriate T3 response to an enhancerless SV40 promoter. In vitro binding studies showed that the thyroid hormone receptor alpha (TR alpha) formed a heterodimeric complex, with either the retinoid X receptor alpha or gamma 1 isoforms (RXR alpha, RXR gamm), on the MyoD TRE that was specifically competed by other well characterised TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides as predicted by the 3-4-5 rule. EMSA experiments demonstrated that the nuclear factor(s) present in muscle cells that bound to the myoD TRE were constitutively expressed during myogenesis; this complex was competed by the myosin heavy chain, DR-4 and PAL-0 TREs in a sequence specific fashion. Western blot analysis indicated that TR alpha 1 was constitutively expressed during C2C12 differentiation. Mutagenesis of the myoD TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4 nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion our data suggest that the TRE in the helix loop helix gene, myoD, is a target for the direct heterodimeric binding of TR alpha and RXR alpha/gamma. These results provide a molecular mechanism/model for the

  15. Differences between MyoD DNA binding and activation site requirements revealed by functional random sequence selection.

    PubMed Central

    Huang, J; Blackwell, T K; Kedes, L; Weintraub, H

    1996-01-01

    A method has been developed for selecting functional enhancer/promoter sites from random DNA sequences in higher eukaryotic cells. Of sequences that were thus selected for transcriptional activation by the muscle-specific basic helix-loop-helix protein MyoD, only a subset are similar to the preferred in vitro binding consensus, and in the same promoter context an optimal in vitro binding site was inactive. Other sequences with full transcriptional activity instead exhibit sequence preferences that, remarkably, are generally either identical or very similar to those found in naturally occurring muscle-specific promoters. This first systematic examination of the relation between DNA binding and transcriptional activation by basic helix-loop-helix proteins indicates that binding per se is necessary but not sufficient for transcriptional activation by MyoD and implies a requirement for other DNA sequence-dependent interactions or conformations at its binding site. PMID:8668207

  16. ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection

    PubMed Central

    Sharkey, Liam K. R.; Edwards, Thomas A.

    2016-01-01

    ABSTRACT Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to an in vitro translation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosome in vitro. To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection. PMID:27006457

  17. Prostacyclin-induced hyperthermia - Implication of a protein mediator

    NASA Technical Reports Server (NTRS)

    Kandasamy, S. B.; Williams, B. A.

    1982-01-01

    The mechanism of the prostacyclin-linked hyperthermia is studied in rabbits. Results show that intracerebroventricular administration of prostacyclin (PGI2) induces dose-related hyperthermia at room temperature (21 C), as well as at low (4 C) and high (30 C) ambient temperatures. It is found that this PGI2-induced hyperthermia is not mediated by its stable metabolite 6-keto prostaglandin F-1(alpha). Only one of the three anion transport systems, the liver transport system, appears to be important to the central inactivation of pyrogen, prostaglandin E2, and PGI2. Phenoxybenzamine and pimozide have no thermolytic effect on PGI2-induced hyperthermia, while PGI2 still induces hyperthermia after norepinephrine (NE) and dopamine levels are depleted by 6-hydroxydopamine. Indomethacin and SC-19220 (a PG antagonist) do not antagonize PGI2 induced hyperthermia, while theophylline does not accentuate the PGI2-induced hyperthermia. However, the hyperthermic response to PGI2 is attenuated by central administration of the protein synthesis inhibitor, anisomycin. It is concluded that PGI2-induced hyperthermia is not induced by NE, dopamine, or cyclic AMP, but rather that a protein mediator is implicated in the induction of fever by PG12.

  18. Transcriptional activation by heterodimers of the achaete-scute and daughterless gene products of Drosophila.

    PubMed Central

    Cabrera, C V; Alonso, M C

    1991-01-01

    The achaete-scute complex (AS-C) and the daughterless (da) genes encode helix-loop-helix proteins which have been shown to interact in vivo and to be required for neurogenesis. We show in vitro that heterodimers of three AS-C products with DA bind DNA strongly, whereas DA homodimers bind weakly and homo or heterocombinations of AS-C products not at all. Proteins unable to dimerize did not bind DNA. Target sequences for the heterodimers were found in the promoters of the hunchback and the achaete genes. Using sequences of the former we show that the DNA binding results obtained in vitro fully correlate with the ability of different combinations to activate the expression of a reporter gene in yeast. Embryos deficient for the lethal of scute gene fail to activate hunchback in some neural lineages in a pattern consistent with the lack of a member of a multigene family. Images PMID:1915272

  19. ATG proteins mediate efferocytosis and suppress inflammation in mammary involution

    PubMed Central

    Teplova, Irina; Lozy, Fred; Price, Sandy; Singh, Sukhwinder; Barnard, Nicola; Cardiff, Robert D.; Birge, Raymond B.; Karantza, Vassiliki

    2013-01-01

    Involution is the process of post-lactational mammary gland regression to quiescence and it involves secretory epithelial cell death, stroma remodeling and gland repopulation by adipocytes. Though reportedly accompanying apoptosis, the role of autophagy in involution has not yet been determined. We now report that autophagy-related (ATG) proteins mediate dead cell clearance and suppress inflammation during mammary involution. In vivo, Becn1+/− and Atg7-deficient mammary epithelial cells (MECs) produced ‘competent’ apoptotic bodies, but were defective phagocytes in association with reduced expression of the MERTK and ITGB5 receptors, thus pointing to defective apoptotic body engulfment. Atg-deficient tissues exhibited higher levels of involution-associated inflammation, which could be indicative of a tumor-modulating microenvironment, and developed ductal ectasia, a manifestation of deregulated post-involution gland remodeling. In vitro, ATG (BECN1 or ATG7) knockdown compromised MEC-mediated apoptotic body clearance in association with decreased RAC1 activation, thus confirming that, in addition to the defective phagocytic processing reported by other studies, ATG protein defects also impair dead cell engulfment.   Using two different mouse models with mammary gland-associated Atg deficiencies, our studies shed light on the essential role of ATG proteins in MEC-mediated efferocytosis during mammary involution and provide novel insights into this important developmental process. This work also raises the possibility that a regulatory feedback loop exists, by which the efficacy of phagocytic cargo processing in turn regulates the rate of engulfment and ultimately determines the kinetics of phagocytosis and dead cell clearance. PMID:23380905

  20. A bile‐inducible membrane protein mediates bifidobacterial bile resistance

    PubMed Central

    Ruiz, Lorena; O'Connell‐Motherway, Mary; Zomer, Aldert; de los Reyes‐Gavilán, Clara G.; Margolles, Abelardo; van Sinderen, Douwe

    2012-01-01

    Summary Bbr_0838 from Bifidobacterium breve UCC2003 is predicted to encode a 683 residue membrane protein, containing both a permease domain that displays similarity to transporters belonging to the major facilitator superfamily, as well as a CBS (cystathionine beta synthase) domain. The high level of similarity to bile efflux pumps from other bifidobacteria suggests a significant and general role for Bbr_0838 in bile tolerance. Bbr_0838 transcription was shown to be monocistronic and strongly induced upon exposure to bile. Further analysis delineated the transcriptional start site and the minimal region required for promoter activity and bile regulation. Insertional inactivation of Bbr_0838 in B. breve UCC2003 resulted in a strain, UCC2003:838800, which exhibited reduced survival upon cholate exposure as compared with the parent strain, a phenotype that was reversed when a functional, plasmid‐encoded Bbr_0838 gene was introduced into UCC2003:838800. Transcriptome analysis of UCC2003:838800 grown in the presence or absence of bile demonstrated that transcription of Bbr_0832, which is predicted to encode a macrolide efflux transporter gene, was significantly increased in the presence of bile, representing a likely compensatory mechanism for bile removal in the absence of Bbr_0838. This study represents the first in‐depth analysis of a bile‐inducible locus in bifidobacteria, identifying a key gene relevant for bifidobacterial bile tolerance. PMID:22296641

  1. The MYB182 Protein Down-Regulates Proanthocyanidin and Anthocyanin Biosynthesis in Poplar by Repressing Both Structural and Regulatory Flavonoid Genes1[OPEN

    PubMed Central

    Yoshida, Kazuko; Ma, Dawei; Constabel, C. Peter

    2015-01-01

    Trees in the genus Populus (poplar) contain phenolic secondary metabolites including the proanthocyanidins (PAs), which help to adapt these widespread trees to diverse environments. The transcriptional activation of PA biosynthesis in response to herbivory and ultraviolet light stress has been documented in poplar leaves, and a regulator of this process, the R2R3-MYB transcription factor MYB134, has been identified. MYB134-overexpressing transgenic plants show a strong high-PA phenotype. Analysis of these transgenic plants suggested the involvement of additional MYB transcription factors, including repressor-like MYB factors. Here, MYB182, a subgroup 4 MYB factor, was found to act as a negative regulator of the flavonoid pathway. Overexpression of MYB182 in hairy root culture and whole poplar plants led to reduced PA and anthocyanin levels as well as a reduction in the expression of key flavonoid genes. Similarly, a reduced accumulation of transcripts of a MYB PA activator and a basic helix-loop-helix cofactor was observed in MYB182-overexpressing hairy roots. Transient promoter activation assays in poplar cell culture demonstrated that MYB182 can disrupt transcriptional activation by MYB134 and that the basic helix-loop-helix-binding motif of MYB182 was essential for repression. Microarray analysis of transgenic plants demonstrated that down-regulated targets of MYB182 also include shikimate pathway genes. This work shows that MYB182 plays an important role in the fine-tuning of MYB134-mediated flavonoid metabolism. PMID:25624398

  2. Targeting ID2 expression triggers a more differentiated phenotype and reduces aggressiveness in human salivary gland cancer cells.

    PubMed

    Sumida, Tomoki; Ishikawa, Akiko; Nakano, Hiroyuki; Yamada, Tomohiro; Mori, Yoshihide; Desprez, Pierre-Yves

    2016-08-01

    Inhibitors of DNA-binding (ID) proteins are negative regulators of basic helix-loop-helix transcription factors and generally stimulate cell proliferation and inhibit differentiation. We previously determined that ID1 was highly expressed in aggressive salivary gland cancer (SGC) cells in culture. Here, we show that ID2 is also expressed in aggressive SGC cells. ID2 knockdown triggers important changes in cell behavior, that is, it significantly reduces the expression of N-cadherin, vimentin and Snail, induces E-cadherin expression and leads to a more differentiated phenotype exemplified by changes in cell shape. Moreover, ID2 knockdown almost completely suppresses invasion and the expression of matrix metalloproteinase 9. In conclusion, ID2 expression maintains an aggressive phenotype in SGC cells, and ID2 repression triggers a reduction in cell aggressiveness. ID2 therefore represents a potential therapeutic target during SGC progression. ID proteins are negative regulators of basic helix-loop-helix transcription factors and generally stimulate cell proliferation and inhibit differentiation. ID2 knockdown triggers important changes in cell behavior, that is, it significantly reduces the expression of N-cadherin, vimentin and Snail, induces E-cadherin expression and leads to a more differentiated phenotype exemplified by changes in cell shape. ID2 therefore represents a potential therapeutic target during SGC progression. PMID:27364596

  3. SPATULA, a gene that controls development of carpel margin tissues in Arabidopsis, encodes a bHLH protein.

    PubMed

    Heisler, M G; Atkinson, A; Bylstra, Y H; Walsh, R; Smyth, D R

    2001-04-01

    Studies involving mutants of the gene SPATULA indicate that it promotes the growth of carpel margins and of pollen tract tissues derived from them. We show that it encodes a new member of the basic-helix-loop-helix family of transcription factors. SPATULA is expressed in marginal and pollen tract tissues throughout their development confirming its role in regulating their growth. It is also expressed in many other tissues where it may act redundantly to control growth, including the peripheral zone of the shoot apical meristem, and specific tissues within leaves, petals, stamens and roots. Expression in the stomium, funiculus and valve dehiscence zone indicates an additional role in abscission. SPATULA expression does not require the function of the other carpel development genes CRABS CLAW and AGAMOUS, although its expression is repressed in first whorl organs by the A function gene APETALA2. Further, we have shown that disruptions to gynoecial pattern formation seen in ettin mutants can largely be attributed to ectopic SPATULA action. ETTIN's role seems to be to negatively regulate SPATULA expression in abaxial regions of the developing gynoecium. SPATULA is the first basic-helix-loop-helix gene in plants known to play a role in floral organogenesis. PMID:11245574

  4. TAL1/SCL induces leukemia by inhibiting the transcriptional activity of E47/HEB.

    PubMed

    O'Neil, Jennifer; Shank, Jennifer; Cusson, Nicole; Murre, Cornelis; Kelliher, Michelle

    2004-06-01

    Activation of the basic-helix-loop-helix (bHLH) gene TAL1 (or SCL) is a frequent gain-of-function mutation in T cell acute lymphoblastic leukemia (T-ALL). To provide genetic evidence that tal1/scl induces leukemia by interfering with E47 and HEB, we expressed tal1/scl in an E2A or HEB heterozygous background. These mice exhibit disease acceleration and perturbed thymocyte development due to repression of E47/HEB target genes. In tal1/scl thymocytes, we find the corepressor mSin3A bound to the CD4 enhancer, whereas an E47/HEB/p300 complex is detected in wild-type thymocytes. Furthermore, tal1/scl tumors are sensitive to pharmacologic inhibition of HDAC and undergo apoptosis. These data demonstrate that tal1/scl induces leukemia by repressing E47/HEB and suggest that HDAC inhibitors may prove efficacious in T-ALL patients who express TAL1/SCL. PMID:15193261

  5. Molecular mechanisms of epithelial–mesenchymal transition

    PubMed Central

    Lamouille, Samy; Xu, Jian; Derynck, Rik

    2014-01-01

    The transdifferentiation of epithelial cells into motile mesenchymal cells, a process known as epithelial–mesenchymal transition (EMT), is integral in development, wound healing and stem cell behaviour, and contributes pathologically to fibrosis and cancer progression. This switch in cell differentiation and behaviour is mediated by key transcription factors, including SNAIL, zinc-finger E-box-binding (ZEB) and basic helix-loop-helix transcription factors, the functions of which are finely regulated at the transcriptional, translational and post-translational levels. The reprogramming of gene expression during EMT, as well as non-transcriptional changes, are initiated and controlled by signalling pathways that respond to extracellular cues. Among these, transforming growth factor-β (TGFβ) family signalling has a predominant role; however, the convergence of signalling pathways is essential for EMT. PMID:24556840

  6. Refractive-Index-Based Screening of Membrane-Protein-Mediated Transfer across Biological Membranes

    PubMed Central

    Brändén, Magnus; Tabaei, Seyed R.; Fischer, Gerhard; Neutze, Richard; Höök, Fredrik

    2010-01-01

    Abstract Numerous membrane-transport proteins are major drug targets, and therefore a key ingredient in pharmaceutical development is the availability of reliable, efficient tools for membrane transport characterization and inhibition. Here, we present the use of evanescent-wave sensing for screening of membrane-protein-mediated transport across lipid bilayer membranes. This method is based on a direct recording of the temporal variations in the refractive index that occur upon a transfer-dependent change in the solute concentration inside liposomes associated to a surface plasmon resonance (SPR) active sensor surface. The applicability of the method is demonstrated by a functional study of the aquaglyceroporin PfAQP from the malaria parasite Plasmodium falciparum. Assays of the temperature dependence of facilitated diffusion of sugar alcohols on a single set of PfAQP-reconstituted liposomes reveal that the activation energies for facilitated diffusion of xylitol and sorbitol are the same as that previously measured for glycerol transport in the aquaglyceroporin of Escherichia coli (5 kcal/mole). These findings indicate that the aquaglyceroporin selectivity filter does not discriminate sugar alcohols based on their length, and that the extra energy cost of dehydration of larger sugar alcohols, upon entering the pore, is compensated for by additional hydrogen-bond interactions within the aquaglyceroporin pore. PMID:20655840

  7. RNA-induced silencing attenuates G protein-mediated calcium signals.

    PubMed

    Philip, Finly; Sahu, Shriya; Golebiewska, Urszula; Scarlata, Suzanne

    2016-05-01

    Phospholipase Cβ (PLCβ) is activated by G protein subunits in response to environmental stimuli to increase intracellular calcium. In cells, a significant portion of PLCβ is cytosolic, where it binds a protein complex required for efficient RNA-induced silencing called C3PO (component 3 promoter of RISC). Binding between C3PO and PLCβ raises the possibility that RNA silencing activity can affect the ability of PLCβ to mediate calcium signals. By use of human and rat neuronal cell lines (SK-N-SH and PC12), we show that overexpression of one of the main components of C3PO diminishes Ca(2+) release in response to Gαq/PLCβ stimulation by 30 to 40%. In untransfected SK-N-SH or PC12 cells, the introduction of siRNA(GAPDH) [small interfering RNA(glyceraldehyde 3-phosphate dehydrogenase)] reduces PLCβ-mediated calcium signals by ∼30%, but addition of siRNA(Hsp90) (heat shock protein 90) had little effect. Fluorescence imaging studies suggest an increase in PLCβ-C3PO association in cells treated with siRNA(GAPDH) but not siRNA(Hsp90). Taken together, our studies raise the possibility that Ca(2+) responses to extracellular stimuli can be modulated by components of the RNA silencing machinery.-Philip, F., Sahu, S., Golebiewska, U., Scarlata, S. RNA-induced silencing attenuates G protein-mediated calcium signals. PMID:26862135

  8. Rhizobium nod factor signaling. Evidence for a g protein-mediated transduction mechanism

    PubMed Central

    Pingret, JL; Journet, EP; Barker, DG

    1998-01-01

    Rhizobium nodulation (Nod) factors are lipochitooligosaccharide signals that elicit key symbiotic developmental responses in the host legume root. In this study, we have investigated Nod factor signal transduction in the Medicago root epidermis by using a pharmacological approach in conjunction with transgenic plants expressing the Nod factor-responsive reporter construct pMtENOD12-GUS. Evidence for the participation of heterotrimeric G proteins in Nod factor signaling has come from three complementary observations: (1) the amphiphilic peptides mastoparan and Mas7, known G protein agonists, are able to mimic Nod factor-induced epidermal MtENOD12 expression; (2) growth of plants in nodulation-inhibiting conditions (10 mM NH4NO3) leads to a dramatic reduction in both Nod factor- and mastoparan-elicited gene expression; and (3) bacterial pertussis toxin, a well-characterized G protein antagonist, blocks the activities of both the Nod factor and mastoparan. In addition, we have found that antagonists that interfere with phospholipase C activity (neomycin and U73122) and Ca2+ influx/release (EGTA, La3+, and ruthenium red) block Nod factor/mastoparan activity. Taken together, these results are consistent with a Nod factor signal transduction mechanism involving G protein mediation coupled to the activation of both phosphoinositide and Ca2+ second messenger pathways. PMID:9596628

  9. Sm-Like Protein-Mediated RNA Metabolism Is Required for Heat Stress Tolerance in Arabidopsis

    PubMed Central

    Okamoto, Masanori; Matsui, Akihiro; Tanaka, Maho; Morosawa, Taeko; Ishida, Junko; Iida, Kei; Mochizuki, Yoshiki; Toyoda, Tetsuro; Seki, Motoaki

    2016-01-01

    Sm-like proteins play multiple functions in RNA metabolism, which is essential for biological processes such as stress responses in eukaryotes. The Arabidopsis thaliana sad1 mutant has a mutation of sm-like protein 5 (LSM5) and shows impaired drought and salt stress tolerances. The lsm5/sad1 mutant also showed hypersensitivity to heat stress. GFP-fused LSM5/SAD1 was localized in the nucleus under optimal growth conditions. After heat stress treatment, GFP-fused LSM5/SAD1 fluorescence was also observed as small cytoplasmic dots, in addition to nuclear localization. Whole genome transcriptome analysis revealed that many genes in Arabidopsis were drastically changed in response to heat stress. More heat-responsive genes were highly expressed in lsm5/sad1 mutant at both 2 and 6 h after heat stress treatment. Additionally, intron-retained and capped transcripts accumulated in the lsm5/sad1 mutant after heat stress treatment. In this study, we also identified non-Arabidopsis Genome Initiative transcripts that were expressed from unannotated regions. Most of these transcripts were antisense transcripts, and many capped non-AGI transcripts accumulated in the lsm5/sad1 mutant during heat stress treatment. These results indicated that LSM5/SAD1 functions to degrade aberrant transcripts through appropriate mRNA splicing and decapping, and precise RNA metabolic machinery is required for heat stress tolerance. PMID:27493656

  10. Effect of Reactor Turbulence on the Binding-Protein-Mediated Aspartate Transport System in Thin Wastewater Biofilms

    PubMed Central

    Eighmy, T. Taylor; Bishop, P. L.

    1985-01-01

    This research documents an effect of reactor turbulence on the ability of gram-negative wastewater biofilm bacteria to actively transport l-aspartate via a binding-protein-mediated transport system. Biofilms which were not preadapted to turbulence and which possessed two separate and distinct aspartate transport systems (systems 1 and 2) were subjected to a turbulent flow condition in a hydrodynamically defined closed-loop reactor system. A shear stress treatment of 3.1 N · m−2 for 10 min at a turbulent Reynolds number (Re = 11,297) inactivated the low-affinity, high-capacity binding-protein-mediated transport system (system 2) and resolved the high-affinity, low-capacity membrane-bound proton symport system (system 1). The Kt and Vmax values for the resolved system were statistically similar to Kt and Vmax values for system 1 when system 2 was inactivated either by osmotic shock or arsenate, two treatments which are known to inactivate binding-protein-mediated transport systems. We hypothesize that shear stress disrupts system 2 by deforming the outer membranes of the firmly adhered gram-negative bacteria. PMID:16346830

  11. Transcriptomic analyses of Hand2 transgenic embryos.

    PubMed

    Funato, Noriko; Kokubo, Hiroki; Saga, Yumiko

    2016-09-01

    In this article, we further provide the data generated for the previously published research article "Specification of jaw identity by the Hand2 transcription factor." To better understand the downstream genes of the basic helix-loop-helix transcription factor Hand2, we generated double-transgenic mice (Hand2 (NC) ) by intercrossing CAG-floxed CAT-Hand2 mice with Wnt1-Cre mice for conditional activation of Hand2 expression in the neural crest. Altered expression of Hand2 induces transformation of the upper jaw to the lower jaw in Hand2 (NC) mutant mice. This data article provides Tables detailing the differentially expressed genes between wild-type and Hand2 (NC) mutant embryos. The raw array data of our transcriptomes as generated using Affymetrix microarrays are available on the NCBI Gene Expression Omnibus (GEO) browser (Reference number GSE75805). PMID:27408813

  12. A novel SREBP-1 splice variant: tissue abundance and transactivation potency.

    PubMed

    Felder, Thomas Klaus; Klein, Kerstin; Patsch, Wolfgang; Oberkofler, Hannes

    2005-10-15

    Sterol regulatory element binding proteins (SREBPs) belong to the family of basic helix-loop-helix-leucine zipper transcription factors. The SREBP-1 gene encodes two different isoforms, SREBP-1a and -1c, that are expressed at varying levels in different tissues and cultured cells and exhibit common and distinct functions. We identified an additional SREBP-1 isoform, termed SREBP-1ac, and determined its mRNA abundance in different human tissues and cell lines. SREBP-1ac mRNA was detectable in all tissues studied, although at lower levels than the major SREBP-1a and -1c isoforms. Transcription of the novel SREBP isoform was not induced by insulin or cholesterol depletion. SREBP-1ac did not transactivate the human LDLR and UCP2 promoters but robustly attenuated the transactivation capacity of SREBP-1a, -1c and -2 in cotransfection experiments. PMID:16153721

  13. Network Theory Inspired Analysis of Time-Resolved Expression Data Reveals Key Players Guiding P. patens Stem Cell Development

    PubMed Central

    Busch, Hauke; Boerries, Melanie; Rensing, Stefan A.

    2013-01-01

    Transcription factors (TFs) often trigger developmental decisions, yet, their transcripts are often only moderately regulated and thus not easily detected by conventional statistics on expression data. Here we present a method that allows to determine such genes based on trajectory analysis of time-resolved transcriptome data. As a proof of principle, we have analysed apical stem cells of filamentous moss (P. patens) protonemata that develop from leaflets upon their detachment from the plant. By our novel correlation analysis of the post detachment transcriptome kinetics we predict five out of 1,058 TFs to be involved in the signaling leading to the establishment of pluripotency. Among the predicted regulators is the basic helix loop helix TF PpRSL1, which we show to be involved in the establishment of apical stem cells in P. patens. Our methodology is expected to aid analysis of key players of developmental decisions in complex plant and animal systems. PMID:23637751

  14. Stress-responsive gene ICE1 from Vitis amurensis increases cold tolerance in tobacco.

    PubMed

    Dong, Chang; Zhang, Zhen; Ren, Junpeng; Qin, Yang; Huang, Jinfeng; Wang, Yan; Cai, Binhua; Wang, Bailin; Tao, Jianmin

    2013-10-01

    We report the identification of the inducer of CBF expression 1 (ICE1) from Vitis amurensis, an upstream transcription factor that regulates the transcription of CBF-like genes. The structure of the basic helix-loop-helix domain of VaICE1 is closely related to that of ICE1 in woody plants. This gene is strongly induced in leaves, roots, stems, and petioles by cold temperature. With longer duration of exposure to cold treatments, the expression patterns of organs exhibit differences, which are not observed in normal condition. Transgenic tobacco over-expressing VaICE1 has higher chilling tolerance and survival ability by improving the activities of superoxide dismutase, peroxidase, and catalase, as well as the chlorophyll yield. PMID:23968929

  15. Network theory inspired analysis of time-resolved expression data reveals key players guiding P. patens stem cell development.

    PubMed

    Busch, Hauke; Boerries, Melanie; Bao, Jie; Hanke, Sebastian T; Hiss, Manuel; Tiko, Theodhor; Rensing, Stefan A

    2013-01-01

    Transcription factors (TFs) often trigger developmental decisions, yet, their transcripts are often only moderately regulated and thus not easily detected by conventional statistics on expression data. Here we present a method that allows to determine such genes based on trajectory analysis of time-resolved transcriptome data. As a proof of principle, we have analysed apical stem cells of filamentous moss (P. patens) protonemata that develop from leaflets upon their detachment from the plant. By our novel correlation analysis of the post detachment transcriptome kinetics we predict five out of 1,058 TFs to be involved in the signaling leading to the establishment of pluripotency. Among the predicted regulators is the basic helix loop helix TF PpRSL1, which we show to be involved in the establishment of apical stem cells in P. patens. Our methodology is expected to aid analysis of key players of developmental decisions in complex plant and animal systems. PMID:23637751

  16. E proteins in lymphocyte development and lymphoid diseases.

    PubMed

    Belle, Ian; Zhuang, Yuan

    2014-01-01

    As members of the basic helix-loop-helix (bHLH) family of transcription factors, E proteins function in the immune system by directing and maintaining a vast transcriptional network that regulates cell survival, proliferation, differentiation, and function. Proper activity of this network is essential to the functionality of the immune system. Aberrations in E protein expression or function can cause numerous defects, ranging from impaired lymphocyte development and immunodeficiency to aberrant function, cancer, and autoimmunity. Additionally, disruption of inhibitor of DNA-binding (Id) proteins, natural inhibitors of E proteins, can induce additional defects in development and function. Although E proteins have been investigated for several decades, their study continues to yield novel and exciting insights into the workings of the immune system. The goal of this chapter is to discuss the various classical roles of E proteins in lymphocyte development and highlight new and ongoing research into how these roles, if compromised, can lead to disease. PMID:25248476

  17. BHLHB3: a candidate tumor suppressor in lung cancer.

    PubMed

    Falvella, F S; Colombo, F; Spinola, M; Campiglio, M; Pastorino, U; Dragani, T A

    2008-06-12

    BHLHB3 is a basic helix-loop-helix (bHLH) domain-containing protein that acts as a transcriptional repressor. We found that BHLHB3 transcript levels were low in three human lung cancer cell lines and downregulated in human lung adenocarcinomas as compared to normal lung tissue. BHLHB3 gene overexpression inhibited colony formation of A549, NCI-H520 and NCI-H596 lung cancer cells. The reduced colony growth was likely due to inhibition of cell proliferation as suggested by the downregulation of cyclin D1 (CCND1) expression in NCI-H520 cells transfected to overexpress the BHLHB3 gene; no evidence of apoptosis was observed. These results point to the potential role of the BHLHB3 protein as a tumor suppressor for lung cancer. PMID:18223678

  18. Phenolic compounds from the bark of Oroxylum indicum activate the Ngn2 promoter.

    PubMed

    Fuentes, Rolly G; Arai, Midori A; Sadhu, Samir K; Ahmed, Firoj; Ishibashi, Masami

    2015-10-01

    A reporter gene assay that detects neurogenin 2 (Ngn2) promoter activity was utilized to identify compounds that induce neuronal differentiation. Ngn2 is a basic helix-loop-helix transcription factor that activates transcription of pro-neural genes. Using this assay system and an activity-guided approach, seven phenolic compounds were isolated from the methanol extract of Oroxylum indicum: 1 oroxylin A, 2 chrysin, 3 hispidulin, 4 baicalein, 5 apigenin, 6 baicalin, and 7 isoverbascoside. Compounds 1 and 2 induced an estimated 2.7-fold increase in Ngn2 promoter activity, whereas 3 increased the activity by 2.5-fold. Furthermore, 1 and 2 enhanced neuronal differentiation of C17.2 cells, which are multipotent stem cells. PMID:26014045

  19. Launching the T-Lineage Developmental Programme

    PubMed Central

    Rothenberg, Ellen V.; Moore, Jonathan E.; Yui, Mary A.

    2011-01-01

    Preface Multipotent blood progenitor cells enter the thymus and begin a protracted differentiation process in which they gradually acquire T-cell characteristics while shedding their legacy of developmental plasticity. Notch signalling and basic helix-loop-helix E-protein transcription factors collaborate repeatedly to trigger and sustain this process throughout the period leading up to T-cell lineage commitment. Nevertheless, the process is discontinuous with separately regulated steps that demand roles for additional collaborating factors. This review discusses new evidence on the coordination of specification and commitment in the early T-cell pathway; effects of microenvironmental signals; the inheritance of stem-cell regulatory factors; and the ensemble of transcription factors that modulate the effects of Notch and E proteins, to distinguish individual stages and to polarize T-lineage fate determination. PMID:18097446

  20. Aryl Hydrocarbon Receptor Control of Adaptive Immunity

    PubMed Central

    2013-01-01

    The aryl hydrocarbon receptor (AhR) is a ligand-activated transcription factor that belongs to the family of basic helix-loop-helix transcription factors. Although the AhR was initially recognized as the receptor mediating the pathologic effects of dioxins and other pollutants, the activation of AhR by endogenous and environmental factors has important physiologic effects, including the regulation of the immune response. Thus, the AhR provides a molecular pathway through which environmental factors modulate the immune response in health and disease. In this review, we discuss the role of AhR in the regulation of the immune response, the source and chemical nature of AhR ligands, factors controlling production and degradation of AhR ligands, and the potential to target the AhR for therapeutic immunomodulation. PMID:23908379

  1. Characterization and developmental expression of xSim, a Xenopus bHLH/PAS gene related to the Drosophila neurogenic master gene single-minded.

    PubMed

    Coumailleau, P; Penrad-Mobayed, M; Lecomte, C; Bollérot, K; Simon, F; Poellinger, L; Angelier, N

    2000-12-01

    We have isolated a novel gene from Xenopus, denominated xSim, which encodes a protein of 760 amino acids containing a basic helix-loop-helix (bHLH) motif contiguous to a PAS domain characteristic of an emerging family of transcriptional regulators so called bHLH/PAS. xSim shares a strong amino acid sequence identity with the Drosophila Single-minded (dSim) and with the murine Sim1 and Sim2 proteins. Phylogenetic analysis reveals that xSim gene is an ortholog gene of the mSim2 gene. Spatio-temporal analysis shows a maternal and a zygotic expression of xSim throughout early Xenopus development. In situ hybridization assays reveal that the transcripts are enriched in the animal hemisphere until blastula stage and extend to the marginal zone at early gastrula stage. As development proceeds, xSim is mainly restricted to the central nervous system. PMID:11091086

  2. Mutations Affecting the BHLHA9 DNA-Binding Domain Cause MSSD, Mesoaxial Synostotic Syndactyly with Phalangeal Reduction, Malik-Percin Type

    PubMed Central

    Malik, Sajid; Percin, Ferda E.; Bornholdt, Dorothea; Albrecht, Beate; Percesepe, Antonio; Koch, Manuela C.; Landi, Antonio; Fritz, Barbara; Khan, Rizwan; Mumtaz, Sara; Akarsu, Nurten A.; Grzeschik, Karl-Heinz

    2014-01-01

    Mesoaxial synostotic syndactyly, Malik-Percin type (MSSD) (syndactyly type IX) is a rare autosomal-recessive nonsyndromic digit anomaly with only two affected families reported so far. We previously showed that the trait is genetically distinct from other syndactyly types, and through autozygosity mapping we had identified a locus on chromosome 17p13.3 for this unique limb malformation. Here, we extend the number of independent pedigrees from various geographic regions segregating MSSD to a total of six. We demonstrate that three neighboring missense mutations affecting the highly conserved DNA-binding region of the basic helix-loop-helix A9 transcription factor (BHLHA9) are associated with this phenotype. Recombinant BHLHA9 generated by transient gene expression is shown to be located in the cytoplasm and the cell nucleus. Transcription factors 3, 4, and 12, members of the E protein (class I) family of helix-loop-helix transcription factors, are highlighted in yeast two-hybrid analysis as potential dimerization partners for BHLHA9. In the presence of BHLHA9, the potential of these three proteins to activate expression of an E-box-regulated target gene is reduced considerably. BHLHA9 harboring one of the three substitutions detected in MSSD-affected individuals eliminates entirely the transcription activation by these class I bHLH proteins. We conclude that by dimerizing with other bHLH protein monomers, BHLHA9 could fine tune the expression of regulatory factors governing determination of central limb mesenchyme cells, a function made impossible by altering critical amino acids in the DNA binding domain. These findings identify BHLHA9 as an essential player in the regulatory network governing limb morphogenesis in humans. PMID:25466284

  3. Cloning and characterization of Fortune-1, a novel gene with enhanced expression in male reproductive organs of Cycas edentata.

    PubMed

    Zhang, Pingyu; Pwee, Keng-Hock; Tan, Hugh T W; Kumar, Prakash P

    2002-06-01

    To better understand the molecular mechanisms controlling development of sexual characters in Cycas edentata, we attempted to clone genes expressed differentially in male or female reproductive organs. We report a novel gene, named Fortune-1 (Ft-1), with enhanced expression in male reproductive organs. The 593-base-pair Ft-1 cDNA is predicted to encode a 77-amino-acid protein, and exists as a single copy gene in the C. edentata genome. Ft-1 expression is enhanced in male cones, including the cone axis, microsporophylls and microsporangia, but is reduced in ovules and undetectable in megasporophylls. Ft-1 is also weakly detectable in leaves. In roots and stems of C. edentata, Ft-1 transcripts are undetectable. The secondary structure prediction and homology search of Ft-1 protein show that it has a helix-loop-helix motif, and is without any homologue in the database. PMID:12175502

  4. Identification and characterization of a twist ortholog in the polychaete annelid Platynereis dumerilii reveals mesodermal expression of Pdu-twist.

    PubMed

    Pfeifer, Kathrin; Schaub, Christoph; Wolfstetter, Georg; Dorresteijn, Adriaan

    2013-09-01

    The basic helix-loop-helix transcription factor twist plays a key role during mesoderm development in Bilateria. In this study, we identified a twist ortholog in the polychaete annelid Platynereis dumerilii and analyze its expression during larval development, postlarval growth up to the adult stage, and caudal regeneration after amputation of posterior segments. At late larval stages, Pdu-twist is expressed in the mesodermal anlagen and in developing muscles. During adulthood and caudal regeneration, Pdu-twist is expressed in the posterior growth zone, in mesodermal cells within the newly forming segments and budding parapodia. Our results indicate that Pdu-twist is involved in mesoderm formation during larval development, posterior growth, and caudal regeneration. PMID:23817621

  5. Direct roles of SPEECHLESS in the specification of stomatal self-renewing cells

    PubMed Central

    Lau, On Sun; Davies, Kelli A.; Chang, Jessica; Adrian, Jessika; Rowe, Matthew H.; Ballenger, Catherine E.; Bergmann, Dominique C.

    2015-01-01

    Lineage-specific stem cells are critical for the production and maintenance of specific cell types and tissues in multicellular organisms. In Arabidopsis, the initiation and proliferation of stomatal lineage cells is controlled by the basic helix-loop-helix transcription factor SPEECHLESS (SPCH). SPCH-driven asymmetric and self-renewing divisions allow flexibility in stomatal production and overall organ growth. How SPCH directs stomatal lineage cell behaviors, however, is unclear. Here, we improved the chromatin immunoprecipitation (ChIP) assay and profiled the genome-wide targets of Arabidopsis SPCH in vivo. We found that SPCH controls key regulators of cell fate and asymmetric cell divisions and modulates responsiveness to peptide and phytohormone-mediated intercellular communication. Our results delineate the molecular pathways that regulate an essential adult stem cell lineage in plants. PMID:25190717

  6. HEB and E2A function as SMAD/FOXH1 cofactors.

    PubMed

    Yoon, Se-Jin; Wills, Andrea E; Chuong, Edward; Gupta, Rakhi; Baker, Julie C

    2011-08-01

    Nodal signaling, mediated through SMAD transcription factors, is necessary for pluripotency maintenance and endoderm commitment. We identified a new motif, termed SMAD complex-associated (SCA), that is bound by SMAD2/3/4 and FOXH1 in human embryonic stem cells (hESCs) and derived endoderm. We demonstrate that two basic helix-loop-helix (bHLH) proteins-HEB and E2A-bind the SCA motif at regions overlapping SMAD2/3 and FOXH1. Furthermore, we show that HEB and E2A associate with SMAD2/3 and FOXH1, suggesting they form a complex at critical target regions. This association is biologically important, as E2A is critical for mesendoderm specification, gastrulation, and Nodal signal transduction in Xenopus tropicalis embryos. Taken together, E proteins are novel Nodal signaling cofactors that associate with SMAD2/3 and FOXH1 and are necessary for mesendoderm differentiation. PMID:21828274

  7. Flavonoids: biosynthesis, biological functions, and biotechnological applications

    PubMed Central

    Falcone Ferreyra, María L.; Rius, Sebastián P.; Casati, Paula

    2012-01-01

    Flavonoids are widely distributed secondary metabolites with different metabolic functions in plants. The elucidation of the biosynthetic pathways, as well as their regulation by MYB, basic helix-loop-helix (bHLH), and WD40-type transcription factors, has allowed metabolic engineering of plants through the manipulation of the different final products with valuable applications. The present review describes the regulation of flavonoid biosynthesis, as well as the biological functions of flavonoids in plants, such as in defense against UV-B radiation and pathogen infection, nodulation, and pollen fertility. In addition, we discuss different strategies and achievements through the genetic engineering of flavonoid biosynthesis with implication in the industry and the combinatorial biosynthesis in microorganisms by the reconstruction of the pathway to obtain high amounts of specific compounds. PMID:23060891

  8. Structural basis of nucleic acid recognition by FK506-binding protein 25 (FKBP25), a nuclear immunophilin

    PubMed Central

    Prakash, Ajit; Shin, Joon; Rajan, Sreekanth; Yoon, Ho Sup

    2016-01-01

    The nuclear immunophilin FKBP25 interacts with chromatin-related proteins and transcription factors and is suggested to interact with nucleic acids. Currently the structural basis of nucleic acid binding by FKBP25 is unknown. Here we determined the nuclear magnetic resonance (NMR) solution structure of full-length human FKBP25 and studied its interaction with DNA. The FKBP25 structure revealed that the N-terminal helix-loop-helix (HLH) domain and C-terminal FK506-binding domain (FKBD) interact with each other and that both of the domains are involved in DNA binding. The HLH domain forms major-groove interactions and the basic FKBD loop cooperates to form interactions with an adjacent minor-groove of DNA. The FKBP25–DNA complex model, supported by NMR and mutational studies, provides structural and mechanistic insights into the nuclear immunophilin-mediated nucleic acid recognition. PMID:26762975

  9. Proprioceptor pathway development is dependent on Math1

    NASA Technical Reports Server (NTRS)

    Bermingham, N. A.; Hassan, B. A.; Wang, V. Y.; Fernandez, M.; Banfi, S.; Bellen, H. J.; Fritzsch, B.; Zoghbi, H. Y.

    2001-01-01

    The proprioceptive system provides continuous positional information on the limbs and body to the thalamus, cortex, pontine nucleus, and cerebellum. We showed previously that the basic helix-loop-helix transcription factor Math1 is essential for the development of certain components of the proprioceptive pathway, including inner-ear hair cells, cerebellar granule neurons, and the pontine nuclei. Here, we demonstrate that Math1 null embryos lack the D1 interneurons and that these interneurons give rise to a subset of proprioceptor interneurons and the spinocerebellar and cuneocerebellar tracts. We also identify three downstream genes of Math1 (Lh2A, Lh2B, and Barhl1) and establish that Math1 governs the development of multiple components of the proprioceptive pathway.

  10. New insights into the role of ID proteins in breast cancer metastasis: a MET affair

    PubMed Central

    2014-01-01

    The establishment of lethal metastases depends on the capacity of a small number of cancer cells to regenerate a tumor after entering a target organ. Stankic and colleagues have identified a role for the inhibitor of differentiation protein, ID1, as a critical regulator of breast cancer stem-like properties and metastatic colonization. Under the control of tumor growth factor-beta signaling, ID1 induces mesenchymal-epithelial transition at the metastatic site by antagonizing the activity of the basic helix-loop-helix transcription factor Twist1. This study sheds light on mechanisms that initiate metastatic outgrowth, and strengthens the concept that epithelial-mesenchymal plasticity is crucial at different stages of metastasis. PMID:25927844

  11. ID Proteins Regulate Diverse Aspects of Cancer Progression and Provide Novel Therapeutic Opportunities

    PubMed Central

    Nair, Radhika; Teo, Wee Siang; Mittal, Vivek; Swarbrick, Alexander

    2014-01-01

    The inhibitor of differentiation (ID) proteins are helix-loop-helix transcriptional repressors with established roles in stem cell self-renewal, lineage commitment, and niche interactions. While deregulated expression of ID proteins in cancer was identified more than a decade ago, emerging evidence has revealed a central role for ID proteins in neoplastic progression of multiple tumor types that often mirrors their function in physiological stem and progenitor cells. ID proteins are required for the maintenance of cancer stem cells, self-renewal, and proliferation in a range of malignancies. Furthermore, ID proteins promote metastatic dissemination through their role in remodeling the tumor microenvironment and by promoting tumor-associated endothelial progenitor cell proliferation and mobilization. Here, we discuss the latest findings in this area and the clinical opportunities that they provide. PMID:24827908

  12. Impaired Thermogenesis and a Molecular Signature for Brown Adipose Tissue in Id2 Null Mice.

    PubMed

    Zhou, Peng; Robles-Murguia, Maricela; Mathew, Deepa; Duffield, Giles E

    2016-01-01

    Inhibitor of DNA binding 2 (ID2) is a helix-loop-helix transcriptional repressor rhythmically expressed in many adult tissues. Our previous studies have demonstrated that Id2 null mice have sex-specific elevated glucose uptake in brown adipose tissue (BAT). Here we further explored the role of Id2 in the regulation of core body temperature over the circadian cycle and the impact of Id2 deficiency on genes involved in insulin signaling and adipogenesis in BAT. We discovered a reduced core body temperature in Id2-/- mice. Moreover, in Id2-/- BAT, 30 genes including Irs1, PPARs, and PGC-1s were identified as differentially expressed in a sex-specific pattern. These data provide valuable insights into the impact of Id2 deficiency on energy homeostasis of mice in a sex-specific manner. PMID:27144179

  13. Impaired Thermogenesis and a Molecular Signature for Brown Adipose Tissue in Id2 Null Mice

    PubMed Central

    Zhou, Peng; Robles-Murguia, Maricela; Mathew, Deepa; Duffield, Giles E.

    2016-01-01

    Inhibitor of DNA binding 2 (ID2) is a helix-loop-helix transcriptional repressor rhythmically expressed in many adult tissues. Our previous studies have demonstrated that Id2 null mice have sex-specific elevated glucose uptake in brown adipose tissue (BAT). Here we further explored the role of Id2 in the regulation of core body temperature over the circadian cycle and the impact of Id2 deficiency on genes involved in insulin signaling and adipogenesis in BAT. We discovered a reduced core body temperature in Id2−/− mice. Moreover, in Id2−/− BAT, 30 genes including Irs1, PPARs, and PGC-1s were identified as differentially expressed in a sex-specific pattern. These data provide valuable insights into the impact of Id2 deficiency on energy homeostasis of mice in a sex-specific manner. PMID:27144179

  14. A Mitogen-Activated Protein Kinase Cascade Module, MKK3-MPK6 and MYC2, Is Involved in Blue Light-Mediated Seedling Development in Arabidopsis[C][W

    PubMed Central

    Sethi, Vishmita; Raghuram, Badmi; Sinha, Alok Krishna; Chattopadhyay, Sudip

    2014-01-01

    Mitogen-activated protein kinase (MAPK) pathways are involved in several signal transduction processes in eukaryotes. Light signal transduction pathways have been extensively studied in plants; however, the connection between MAPK and light signaling pathways is currently unknown. Here, we show that MKK3-MPK6 is activated by blue light in a MYC2-dependent manner. MPK6 physically interacts with and phosphorylates a basic helix-loop-helix transcription factor, MYC2, and is phosphorylated by a MAPK kinase, MKK3. Furthermore, MYC2 binds to the MPK6 promoter and regulates its expression in a feedback regulatory mechanism in blue light signaling. We present mutational and physiological studies that illustrate the function of the MKK3-MPK6-MYC2 module in Arabidopsis thaliana seedling development and provide a revised mechanistic view of photomorphogenesis. PMID:25139007

  15. Trimeric association of Hox and TALE homeodomain proteins mediates Hoxb2 hindbrain enhancer activity.

    PubMed

    Jacobs, Y; Schnabel, C A; Cleary, M L

    1999-07-01

    Pbx/exd proteins modulate the DNA binding affinities and specificities of Hox proteins and contribute to the execution of Hox-dependent developmental programs in arthropods and vertebrates. Pbx proteins also stably heterodimerize and bind DNA with Meis and Pknox1-Prep1, additional members of the TALE (three-amino-acid loop extension) superclass of homeodomain proteins that function on common genetic pathways with a subset of Hox proteins. In this study, we demonstrated that Pbx and Meis bind DNA as heterotrimeric complexes with Hoxb1 on a genetically defined Hoxb2 enhancer, r4, that mediates the cross-regulatory transcriptional effects of Hoxb1 in vivo. The DNA binding specificity of the heterotrimeric complex for r4 is mediated by a Pbx-Hox site in conjunction with a distal Meis site, which we showed to be required for ternary complex formation and Meis-enhanced transcription. Formation of heterotrimeric complexes in which all three homeodomains bind their cognate DNA sites is topologically facilitated by the ability of Pbx and Meis to interact through their amino termini and bind DNA without stringent half-site orientation and spacing requirements. Furthermore, Meis site mutation in the Hoxb2 enhancer phenocopies Pbx-Hox site mutation to abrogate enhancer-directed expression of a reporter transgene in the murine embryonic hindbrain, demonstrating that DNA binding by all three proteins is required for trimer function in vivo. Our data provide in vitro and in vivo evidence for the combinatorial regulation of Hox and TALE protein functions that are mediated, in part, by their interdependent DNA binding activities as ternary complexes. As a consequence, Hoxb1 employs Pbx and Meis-related proteins, as a pair of essential cofactors in a higher-order molecular complex, to mediate its transcriptional effects on an endogenous Hox response element. PMID:10373562

  16. Trimeric Association of Hox and TALE Homeodomain Proteins Mediates Hoxb2 Hindbrain Enhancer Activity

    PubMed Central

    Jacobs, Yakop; Schnabel, Catherine A.; Cleary, Michael L.

    1999-01-01

    Pbx/exd proteins modulate the DNA binding affinities and specificities of Hox proteins and contribute to the execution of Hox-dependent developmental programs in arthropods and vertebrates. Pbx proteins also stably heterodimerize and bind DNA with Meis and Pknox1-Prep1, additional members of the TALE (three-amino-acid loop extension) superclass of homeodomain proteins that function on common genetic pathways with a subset of Hox proteins. In this study, we demonstrated that Pbx and Meis bind DNA as heterotrimeric complexes with Hoxb1 on a genetically defined Hoxb2 enhancer, r4, that mediates the cross-regulatory transcriptional effects of Hoxb1 in vivo. The DNA binding specificity of the heterotrimeric complex for r4 is mediated by a Pbx-Hox site in conjunction with a distal Meis site, which we showed to be required for ternary complex formation and Meis-enhanced transcription. Formation of heterotrimeric complexes in which all three homeodomains bind their cognate DNA sites is topologically facilitated by the ability of Pbx and Meis to interact through their amino termini and bind DNA without stringent half-site orientation and spacing requirements. Furthermore, Meis site mutation in the Hoxb2 enhancer phenocopies Pbx-Hox site mutation to abrogate enhancer-directed expression of a reporter transgene in the murine embryonic hindbrain, demonstrating that DNA binding by all three proteins is required for trimer function in vivo. Our data provide in vitro and in vivo evidence for the combinatorial regulation of Hox and TALE protein functions that are mediated, in part, by their interdependent DNA binding activities as ternary complexes. As a consequence, Hoxb1 employs Pbx and Meis-related proteins, as a pair of essential cofactors in a higher-order molecular complex, to mediate its transcriptional effects on an endogenous Hox response element. PMID:10373562

  17. Transcription factor network downstream of protease activated receptors (PARs) modulating mouse bladder inflammation

    PubMed Central

    Saban, Ricardo; Simpson, Cindy; Davis, Carole A; Dozmorov, Igor; Maier, Julie; Fowler, Ben; Ihnat, Michael A; Hurst, Robert E; Wershil, Barry K; Saban, Marcia R

    2007-01-01

    Background All four PARs are present in the urinary bladder, and their expression is altered during inflammation. In order to search for therapeutic targets other than the receptors themselves, we set forth to determine TFs downstream of PAR activation in the C57BL/6 urinary bladders. Methods For this purpose, we used a protein/DNA combo array containing 345 different TF consensus sequences. Next, the TF selected was validated by EMSA and IHC. As mast cells seem to play a fundamental role in bladder inflammation, we determined whether c-kit receptor deficient (Kitw/Kitw-v) mice have an abrogated response to PAR stimulation. Finally, TFEB antibody was used for CHIP/Q-PCR assay and revealed up-regulation of genes known to be downstream of TFEB. Results TFEB, a member of the MiTF family of basic helix-loop-helix leucine zipper, was the only TF commonly up-regulated by all PAR-APs. IHC results confirm a correlation between inflammation and TFEB expression in C57BL/6 mice. In contrast, Kitw/Kitw-v mice did not exhibit inflammation in response to PAR activation. EMSA results confirmed the increased TFEB binding activity in C57BL/6 but not in Kitw/Kitw-v mice. Conclusion This is the first report describing the increased expression of TFEB in bladder inflammation in response to PAR activation. As TFEB belongs to a family of TFs essential for mast cell survival, our findings suggest that this molecule may influence the participation of mast cells in PAR-mediated inflammation and that targeting TFEB/MiTF activity may be a novel approach for the treatment of bladder inflammatory disorders. PMID:17705868

  18. Hepatitis B virus X protein mediates yes-associated protein 1 upregulation in hepatocellular carcinoma

    PubMed Central

    Wu, Yuzhuo; Zhang, Junhe; Zhang, Huaihong; Zhai, Yufeng

    2016-01-01

    Hepatitis B virus (HBV) X protein (HBx) is implicated in the development of hepatocellular carcinoma (HCC). Yes-associated protein 1 (YAP) is an important proto-oncogene, which is a downstream effector molecule in the Hippo signaling pathway. The aim of the present study was to investigate the association between HBx expression in HCC samples and YAP expression in the Hippo pathway. A total of 20 pathologically confirmed HCC samples, 20 corresponding adjacent non-tumor liver tissues and 5 normal liver tissue samples were collected. The expression of HBx and YAP in the tissues was analyzed by quantitative reverse transcription-polymerase chain reaction and western blot analysis. The intensity and location of YAP expression were analyzed by immunohistochemistry. YAP mRNA and protein expression levels in HCC samples infected with HBV were significantly higher than those of normal liver tissues. Furthermore, YAP expression was positively correlated with HBx expression in HBV-positive HCC samples. Immunohistochemical staining revealed that YAP was predominantly expressed in the nuclei in HBV-positive HCC tissues. YAP expression was significantly decreased in the normal liver tissue and corresponding adjacent liver tissue when compared with the HCC tissues and by contrast to HCC tissues, YAP was predominantly located in the cytoplasm. In conclusion, these results indicate that the YAP gene is a key driver of HBx-induced liver cancer. Therefore, YAP may present a novel target in the treatment of HBV-associated HCC.

  19. The Human Metapneumovirus Fusion Protein Mediates Entry via an Interaction with RGD-Binding Integrins

    PubMed Central

    Cox, Reagan G.; Livesay, S. Brent; Johnson, Monika; Ohi, Melanie D.

    2012-01-01

    Paramyxoviruses use a specialized fusion protein to merge the viral envelope with cell membranes and initiate infection. Most paramyxoviruses require the interaction of two viral proteins to enter cells; an attachment protein binds cell surface receptors, leading to the activation of a fusion (F) protein that fuses the viral envelope and host cell plasma membrane. In contrast, human metapneumovirus (HMPV) expressing only the F protein is replication competent, suggesting a primary role for HMPV F in attachment and fusion. We previously identified an invariant arginine-glycine-aspartate (RGD) motif in the HMPV F protein and showed that the RGD-binding integrin αVβ1-promoted HMPV infection. Here we show that both HMPV F-mediated binding and virus entry depend upon multiple RGD-binding integrins and that HMPV F can mediate binding and fusion in the absence of the viral attachment (G) protein. The invariant F-RGD motif is critical for infection, as an F-RAE virus was profoundly impaired. Further, F-integrin binding is required for productive viral RNA transcription, indicating that RGD-binding integrins serve as receptors for the HMPV fusion protein. Thus, HMPV F is triggered to induce virus-cell fusion by interactions with cellular receptors in a manner that is independent of the viral G protein. These results suggest a stepwise mechanism of HMPV entry mediated by the F protein through its interactions with cellular receptors, including RGD-binding integrins. PMID:22933271

  20. Eya1 and Six1 are essential for early steps of sensory neurogenesis in mammalian cranial placodes.

    PubMed

    Zou, Dan; Silvius, Derek; Fritzsch, Bernd; Xu, Pin-Xian

    2004-11-01

    Eya1 encodes a transcriptional co-activator and is expressed in cranial sensory placodes. It interacts with and functions upstream of the homeobox gene Six1 during otic placodal development. Here, we have examined their role in cranial sensory neurogenesis. Our data show that the initial cell fate determination for the vestibuloacoustic neurons and their delamination appeared to be unaffected in the absence of Eya1 or Six1 as judged by the expression of the basic helix-loop-helix genes, Neurog1 that specifies the neuroblast cell lineage, and Neurod that controls neuronal differentiation and survival. However, both genes are necessary for normal maintenance of neurogenesis. During the development of epibranchial placode-derived distal cranial sensory ganglia, while the phenotype appears less severe in Six1 than in Eya1 mutants, an early arrest of neurogenesis was observed in the mutants. The mutant epibranchial progenitor cells fail to express Neurog2 that is required for the determination of neuronal precursors, and other basic helix-loop-helix as well as the paired homeobox Phox2 genes that are essential for neural differentiation and maintenance. Failure to activate their normal differentiation program resulted in abnormal apoptosis of the progenitor cells. Furthermore, we show that disruption of viable ganglion formation leads to pathfinding errors of branchial motoneurons. Finally, our results suggest that the Eya-Six regulatory hierarchy also operates in the epibranchial placodal development. These findings uncover an essential function for Eya1 and Six1 as critical determination factors in acquiring both neuronal fate and neuronal subtype identity from epibranchial placodal progenitors. These analyses define a specific role for both genes in early differentiation and survival of the placodally derived cranial sensory neurons. PMID:15496442

  1. E2A promotes the survival of precursor and mature B lymphocytes.

    PubMed

    Lazorchak, Adam S; Wojciechowski, Jason; Dai, Meifang; Zhuang, Yuan

    2006-08-15

    The basic helix-loop-helix transcription factor E2A is an essential regulator of B lymphocyte lineage commitment and is required to activate the expression of numerous B lineage-specific genes. Studies involving ectopic expression of Id proteins, which inhibit E2A as well as other basic helix-loop-helix proteins such as HEB, suggest additional roles of E2A at later stages of B cell development. We use E2A-deficient and E2A and HEB double-deficient pre-B cell lines to directly assess the function of E2A and HEB in B cell development after lineage commitment. We show that, in contrast to the established role of E2A in lineage commitment, elimination of E2A and HEB in pre-B cell lines has only a modest negative impact on B lineage gene expression. However, E2A single and E2A and HEB double-deficient but not HEB single-deficient cell lines show dramatically enhanced apoptosis upon growth arrest. To address the possible role of E2A in the regulation of B cell survival in vivo, we crossed IFN-inducible Cre-transgenic mice to E2A conditional mice. Cre-mediated E2A deletion resulted in a block in bone marrow B cell development and a significant reduction in the proportion and total number of splenic B cells in these mice. We show that Cre-mediated deletion of E2A in adoptively transferred mature B cells results in the rapid depletion of the transferred population within 24 h of Cre induction. These results reveal that E2A is not required to maintain B cell fate but is essential in promoting pre-B and B cell survival. PMID:16888011

  2. Phosphorylation in intrinsically disordered regions regulates the activity of Neurogenin2

    PubMed Central

    2014-01-01

    Background Neuronal differentiation is largely under the control of basic Helix-Loop-Helix (bHLH) proneural transcription factors that play key roles during development of the embryonic nervous system. In addition to well-characterised regulation of their expression, increasing evidence is emerging for additional post-translational regulation of proneural protein activity. Of particular interest is the bHLH proneural factor Neurogenin2 (Ngn2), which orchestrates progression from neural progenitor to differentiated neuron in several regions of the central nervous system. Previous studies have demonstrated a key role for cell cycle-dependent multi-site phosphorylation of Ngn2 protein at Serine-Proline (SP) sites for regulation of its neuronal differentiation activity, although the potential structural and functional consequences of phosphorylation at different regions of the protein are unclear. Results Here we characterise the role of phosphorylation of specific regions of Ngn2 on the stability of Ngn2 protein and on its neuronal differentiation activity in vivo in the developing embryo, demonstrating clearly that the location of SP sites is less important than the number of SP sites available for control of Ngn2 activity in vivo. We also provide structural evidence that Ngn2 contains large, intrinsically disordered regions that undergo phosphorylation by cyclin-dependent kinases (cdks). Conclusions Phosphorylation of Ngn2 occurs in both the N- and C-terminal regions, either side of the conserved basic Helix-Loop-Helix domain. While these phosphorylation events do not change the intrinsic stability of Ngn2, phosphorylation on multiple sites acts to limit its ability to drive neuronal differentiation in vivo. Phosphorylated regions of Ngn2 are predicted to be intrinsically disordered and cdk-dependent phosphorylation of these intrinsically disordered regions contributes to Ngn2 regulation. PMID:25374254

  3. The genetics of rhizosheath size in a multiparent mapping population of wheat

    PubMed Central

    Delhaize, Emmanuel; Rathjen, Tina M.; Cavanagh, Colin R.

    2015-01-01

    Rhizosheaths comprise soil that adheres to plant roots and, in some species, are indicative of root hair length. In this study, the genetics of rhizosheath size in wheat was investigated by screening the progeny of multiparent advanced generation intercrosses (MAGIC). Two MAGIC populations were screened for rhizosheath size using a high throughput method. One MAGIC population was developed from intercrosses between four parents (4-way) and the other from intercrosses between eight parents (8-way). Transgressive segregation for rhizosheath size was observed in both the 4-way and 8-way MAGIC populations. A quantitative trait loci (QTL) analysis of the 4-way population identified six major loci located on chromosomes 2B, 4D, 5A, 5B, 6A, and 7A together accounting for 42% of the variation in rhizosheath size. Rhizosheath size was strongly correlated with root hair length and was robust across different soil types in the absence of chemical constraints. Rhizosheath size in the MAGIC populations was a reliable surrogate for root hair length and, therefore, the QTL identified probably control root hair elongation. Members of the basic helix-loop-helix family of transcription factors have previously been identified to regulate root hair length in Arabidopsis and rice. Since several wheat members of the basic helix-loop-helix family of genes are located within or near the QTL, these genes are candidates for controlling the long root hair trait. The QTL for rhizosheath size identified in this study provides the opportunity to implement marker-assisted selection to increase root hair length for improved phosphate acquisition in wheat. PMID:25969556

  4. Ret finger protein mediates Pax7-induced ubiquitination of MyoD in skeletal muscle atrophy.

    PubMed

    Joung, Hosouk; Eom, Gwang Hyeon; Choe, Nakwon; Lee, Hye Mi; Ko, Jeong-Hyeon; Kwon, Duk-Hwa; Nam, Yoon Seok; Min, Hyunki; Shin, Sera; Kook, Jeewon; Cho, Young Kuk; Kim, Jeong Chul; Seo, Sang Beom; Baik, Yung Hong; Nam, Kwang-Il; Kook, Hyun

    2014-10-01

    Skeletal muscle atrophy results from the net loss of muscular proteins and organelles and is caused by pathologic conditions such as nerve injury, immobilization, cancer, and other metabolic diseases. Recently, ubiquitination-mediated degradation of skeletal-muscle-specific transcription factors was shown to be involved in muscle atrophy, although the mechanisms have yet to be defined. Here we report that ret finger protein (RFP), also known as TRIM27, works as an E3 ligase in Pax7-induced degradation of MyoD. Muscle injury induced by sciatic nerve transection up-regulated RFP and RFP physically interacted with both Pax7 and MyoD. RFP and Pax7 synergistically reduced the protein amounts of MyoD but not the mRNA. RFP-induced reduction of MyoD protein was blocked by proteasome inhibitors. The Pax7-induced reduction MyoD was attenuated by RFP siRNA and by MG132, a proteasome inhibitor. RFPΔR, an RFP construct that lacks the RING domain, failed to reduce MyoD amounts. RFP ubiquitinated MyoD, but RFPΔR failed to do so. Forced expression of RFP, but not RFPΔR, enhanced Pax7-induced ubiquitination of MyoD, whereas RFP siRNA blocked the ubiquitination. Sciatic nerve injury-induced muscle atrophy as well the reduction in MyoD was attenuated in RFP knockout mice. Taken together, our results show that RFP works as a novel E3 ligase in the Pax7-mediated degradation of MyoD in response to skeletal muscle atrophy. PMID:25025573

  5. Cold-inducible RNA-binding protein mediates airway inflammation and mucus hypersecretion through a post-transcriptional regulatory mechanism under cold stress.

    PubMed

    Juan, Yang; Haiqiao, Wu; Xie, Wenyao; Huaping, Huang; Zhong, Han; Xiangdong, Zhou; Kolosov, Victor P; Perelman, Juliy M

    2016-09-01

    Acute or chronic cold exposure exacerbates chronic inflammatory airway diseases, such as chronic obstructive pulmonary disease (COPD) and asthma. Cold-inducible RNA-binding protein (CIRP) is a cold-shock protein and is induced by various environmental stressors, such as hypothermia and hypoxia. In this study, we showed that CIRP gene and protein levels were significantly increased in patients with COPD and in rats with chronic airway inflammation compared with healthy subjects. Similarly, inflammatory cytokine production and MUC5AC secretion were up-regulated in rats following cigarette smoke inhalation. Cold temperature-induced CIRP overexpression and translocation were shown to be dependent on arginine methylation in vitro. CIRP overexpression promoted stress granule (SG) assembly. In the cytoplasm, the stability of pro-inflammatory cytokine mRNAs was increased through specific interactions between CIRP and mediator mRNA 3'-UTRs; these interactions increased the mRNA translation, resulting in MUC5AC overproduction in response to cold stress. Conversely, CIRP silencing and a methyltransferase inhibitor (adenosine dialdehyde) promoted cytokine mRNA degradation and inhibited the inflammatory response and mucus hypersecretion. These findings indicate that cold temperature can induce an airway inflammatory response and excess mucus production via a CIRP-mediated increase in mRNA stability and protein translation. PMID:27477308

  6. Alcohol oxidase protein mediated in-situ synthesized and stabilized gold nanoparticles for developing amperometric alcohol biosensor.

    PubMed

    Chinnadayyala, Somasekhar R; Santhosh, Mallesh; Singh, Naveen K; Goswami, Pranab

    2015-07-15

    A simple one step method for the alcohol oxidases (AOx) protein mediated synthesis of gold nano-particles (AuNPs) in alkaline (pH 8.5) condition with simultaneous stabilization of the nanoparticles on the AOx protein surface under native environment has been developed. The formation of the AOx conjugated AuNPs was confirmed by advanced analytical and spectroscopic techniques. The significant increase in zeta potential (ζ) value of -57mV for the synthesized AOx-AuNPs conjugate from the AOx (pI 4.5) protein (ζ, -30mV) implied good stability of the in-situ synthesized nano-conjugate. The AOx-AuNPs conjugate showed steady stability in alkaline (upto pH 8.5) and NaCl (up to 10(-1)M) solutions. The efficiency (Kcat/Km) of the AuNP conjugated AOx was increased by 18% from the free enzyme confirming the activating role of the surface stabilized AuNPs for the enzyme. The AuNPs-AOx conjugate was encapsulated with polyaniline (PANI) synthesized by oxidative polymerization of aniline using H2O2 generated in-situ from the AOx catalysed oxidation of alcohol. The PANI encapsulated AuNPs-AOx assembly was stabilized on a glassy carbon electrode (GCE) by chitosan-Nafion mixture and then utilized the fabricated bioelectrode for detection of alcohol amperometrically using H2O2 as redox indicator at +0.6V. The constructed biosensor showed high operational stability (6.3% loss after 25 measurements), wide linear detection range of 10µM-4.7mM (R(2)=0.9731), high sensitivity of 68.3±0.35µAmM(-1) and low detection limit of 7±0.027µM for ethanol. The fabricated bioelectrode was successfully used for the selective determination of alcohol in beverage samples. PMID:25725464

  7. Protein mediated membrane adhesion

    NASA Astrophysics Data System (ADS)

    Carlson, Andreas; Mahadevan, L.

    2015-05-01

    Adhesion in the context of mechanical attachment, signaling, and movement in cellular dynamics is mediated by the kinetic interactions between membrane-embedded proteins in an aqueous environment. Here, we present a minimal theoretical framework for the dynamics of membrane adhesion that accounts for the kinetics of protein binding, the elastic deformation of the membrane, and the hydrodynamics of squeeze flow in the membrane gap. We analyze the resulting equations using scaling estimates to characterize the spatiotemporal features of the adhesive patterning and corroborate them using numerical simulations. In addition to characterizing aspects of cellular dynamics, our results might also be applicable to a range of phenomena in physical chemistry and materials science where flow, deformation, and kinetics are coupled to each other in slender geometries.

  8. A Large Insertion in bHLH Transcription Factor BrTT8 Resulting in Yellow Seed Coat in Brassica rapa

    PubMed Central

    Li, Xia; Chen, Li; Hong, Meiyan; Zhang, Yan; Zu, Feng; Wen, Jing; Yi, Bin; Ma, Chaozhi; Shen, Jinxiong; Tu, Jinxing; Fu, Tingdong

    2012-01-01

    Yellow seed is a desirable quality trait of the Brassica oilseed species. Previously, several seed coat color genes have been mapped in the Brassica species, but the molecular mechanism is still unknown. In the present investigation, map-based cloning method was used to identify a seed coat color gene, located on A9 in B. rapa. Blast analysis with the Arabidopsis genome showed that there were 22 Arabidopsis genes in this region including at4g09820 to at4g10620. Functional complementation test exhibited a phenotype reversion in the Arabidopsis thaliana tt8-1 mutant and yellow-seeded plant. These results suggested that the candidate gene was a homolog of TRANSPARENT TESTA8 (TT8) locus. BrTT8 regulated the accumulation of proanthocyanidins (PAs) in the seed coat. Sequence analysis of two alleles revealed a large insertion of a new class of transposable elements, Helitron in yellow sarson. In addition, no mRNA expression of BrTT8 was detected in the yellow-seeded line. It indicated that the natural transposon might have caused the loss in function of BrTT8. BrTT8 encodes a basic/helix-loop-helix (bHLH) protein that shares a high degree of similarity with other bHLH proteins in the Brassica. Further expression analysis also revealed that BrTT8 was involved in controlling the late biosynthetic genes (LBGs) of the flavonoid pathway. Our present findings provided with further studies could assist in understanding the molecular mechanism involved in seed coat color formation in Brassica species, which is an important oil yielding quality trait. PMID:22984469

  9. Muscleblind-like 1 suppresses breast cancer metastatic colonization and stabilizes metastasis suppressor transcripts.

    PubMed

    Fish, Lisa; Pencheva, Nora; Goodarzi, Hani; Tran, Hien; Yoshida, Mitsukuni; Tavazoie, Sohail F

    2016-02-15

    Post-transcriptional deregulation is a defining feature of metastatic cancer. While many microRNAs have been implicated as regulators of metastatic progression, less is known about the roles and mechanisms of RNA-binding proteins in this process. We identified muscleblind-like 1 (MBNL1), a gene implicated in myotonic dystrophy, as a robust suppressor of multiorgan breast cancer metastasis. MBNL1 binds the 3' untranslated regions (UTRs) of DBNL (drebrin-like protein) and TACC1 (transforming acidic coiled-coil containing protein 1)-two genes that we implicate as metastasis suppressors. By enhancing the stability of these genes' transcripts, MBNL1 suppresses cell invasiveness. Consistent with these findings, elevated MBNL1 expression in human breast tumors is associated with reduced metastatic relapse likelihood. Our findings delineate a post-transcriptional network that governs breast cancer metastasis through RNA-binding protein-mediated transcript stabilization. PMID:26883358

  10. Integrin αvβ1 Modulation Affects Subtype B Avian Metapneumovirus Fusion Protein-mediated Cell-Cell Fusion and Virus Infection.

    PubMed

    Yun, Bing-Ling; Guan, Xiao-Lu; Liu, Yong-Zhen; Zhang, Yao; Wang, Yong-Qiang; Qi, Xiao-Le; Cui, Hong-Yu; Liu, Chang-Jun; Zhang, Yan-Ping; Gao, Hong-Lei; Gao, Li; Li, Kai; Gao, Yu-Long; Wang, Xiao-Mei

    2016-07-01

    Avian metapneumovirus (aMPV) fusion (F) protein mediates virus-cell membrane fusion to initiate viral infection, which requires F protein binding to its receptor(s) on the host cell surface. However, the receptor(s) for aMPV F protein is still not identified. All known subtype B aMPV (aMPV/B) F proteins contain a conserved Arg-Asp-Asp (RDD) motif, suggesting that the aMPV/B F protein may mediate membrane fusion via the binding of RDD to integrin. When blocked with integrin-specific peptides, aMPV/B F protein fusogenicity and viral replication were significantly reduced. Specifically we identified integrin αv and/or β1-mediated F protein fusogenicity and viral replication using antibody blocking, small interfering RNAs (siRNAs) knockdown, and overexpression. Additionally, overexpression of integrin αv and β1 in aMPV/B non-permissive cells conferred aMPV/B F protein binding and aMPV/B infection. When RDD was altered to RAE (Arg-Ala-Glu), aMPV/B F protein binding and fusogenic activity were profoundly impaired. These results suggest that integrin αvβ1 is a functional receptor for aMPV/B F protein-mediated membrane fusion and virus infection, which will provide new insights on the fusogenic mechanism and pathogenesis of aMPV. PMID:27226547

  11. Role of hypoxia-inducible factor-{alpha} in hepatitis-B-virus X protein-mediated MDR1 activation

    SciTech Connect

    Han, Hyo-Kyung; Han, Chang Yeob; Cheon, Eun-Pa; Lee, Jaewon; Kang, Keon Wook . E-mail: kwkang@chosun.ac.kr

    2007-06-01

    The transition from chemotherapy-responsive cancer cells to chemotherapy-resistant cancer cells is mainly accompanied by the increased expression of multi-drug resistance 1 (MDR1). We found that hepatitis-B-virus X protein (HBx) increases the transcriptional activity and protein level of MDR1 in a hepatoma cell line, H4IIE. In addition, HBx overexpression made H4IIE cells more resistant to verapamil-uptake. HBx stabilized hypoxia-inducible factor-1{alpha} (HIF-1{alpha}) and induced the nuclear translocation of C/EBP{beta}. Reporter gene analyses showed that HBx increased the reporter activity in the cells transfected with the reporter containing MDR1 gene promoter. Moreover, the luciferase reporter gene activity was significantly inhibited by HIF-1{alpha} siRNA but not by overexpression of C/EBP dominant negative mutant. These results imply that HBx increases the MDR1 transporter activity through the transcriptional activation of the MDR1 gene with HIF-1{alpha} activation, and suggest HIF-1{alpha} for the therapeutic target of HBV-mediated chemoresistance.

  12. Role of arabidopsis MYC and MYB homologs in drought- and abscisic acid-regulated gene expression.

    PubMed Central

    Abe, H; Yamaguchi-Shinozaki, K; Urao, T; Iwasaki, T; Hosokawa, D; Shinozaki, K

    1997-01-01

    In Arabidopsis, the induction of a dehydration-responsive gene, rd22, is mediated by abscisic acid (ABA) and requires protein biosynthesis for ABA-dependent gene expression. Previous experiments established that a 67-bp DNA fragment of the rd22 promoter is sufficient for dehydration- and ABA-induced gene expression and that this DNA fragment contains two closely located putative recognition sites for the basic helix-loop-helix protein MYC and one putative recognition site for MYB. We have carefully analyzed the 67-bp region of the rd22 promoter in transgenic tobacco plants and found that both the first MYC site and the MYB recognition site function as cis-acting elements in the dehydration-induced expression of the rd22 gene. A cDNA encoding a MYC-related DNA binding protein was isolated by DNA-ligand binding screening, using the 67-bp region as a probe, and designated rd22BP1. The rd22BP1 cDNA encodes a 68-kD protein that has a typical DNA binding domain of a basic region helix-loop-helix leucine zipper motif in MYC-related transcription factors. The rd22BP1 protein binds specifically to the first MYC recognition site in the 67-bp fragment. RNA gel blot analysis revealed that transcription of the rd22BP1 gene is induced by dehydration stress and ABA treatment, and its induction precedes that of rd22. We have reported a drought- and ABA-inducible gene that encodes the MYB-related protein ATMYB2. In a transient transactivation experiment using Arabidopsis leaf protoplasts, we demonstrated that both the rd22BP1 and ATMYB2 proteins activate transcription of the rd22 promoter fused to the beta-glucuronidase reporter gene. These results indicate that both the rd22BP1 (MYC) and ATMYB2 (MYB) proteins function as transcriptional activators in the dehydration- and ABA-inducible expression of the rd22 gene. PMID:9368419

  13. Molecular characterization of SIG1, a Saccharomyces cerevisiae gene involved in negative regulation of G-protein-mediated signal transduction.

    PubMed Central

    Leberer, E; Dignard, D; Harcus, D; Whiteway, M; Thomas, D Y

    1994-01-01

    Two recessive mutations in the Saccharomyces cerevisiae SIG1 (suppressor of inhibitory G-protein) gene have been identified by their ability to suppress the signalling defect of dominant-negative variants of the mating response G-protein beta-subunit. The mutations and deletion of SIG1 enhance the sensitivity of the cells to pheromone and stimulate the basal transcription of a mating specific gene, FUS1, suggesting that Sig1p plays a negatively regulatory role in G beta gamma-mediated signal transduction. An additional function of Sig1p in vegetatively growing cells is suggested by the finding that the mutations and deletion of SIG1 cause temperature-sensitive growth defects. The SIG1 gene encodes a protein with a molecular weight of 65 kDa that contains at the amino-terminus two zinc finger-like sequence motifs. Epistasis experiments localize the action of Sig1p within the pheromone signalling pathway at a position at or shortly after the G-protein. We propose that Sig1p represents a novel negative regulator of G beta gamma-mediated signal transduction. Images PMID:8039500

  14. Boosting transcription by transcription: enhancer-associated transcripts.

    PubMed

    Darrow, Emily M; Chadwick, Brian P

    2013-12-01

    Enhancers are traditionally viewed as DNA sequences located some distance from a promoter that act in cis and in an orientation-independent fashion to increase utilization of specific promoters and thereby regulate gene expression. Much progress has been made over the last decade toward understanding how these distant elements interact with target promoters, but how transcription is enhanced remains an object of active inquiry. Recent reports convey the prevalence and diversity of enhancer transcription and transcripts and support both as key factors with mechanistically distinct, but not mutually exclusive roles in enhancer function. Decoupling the causes and effects of transcription on the local chromatin landscape and understanding the role of enhancer transcripts in the context of long-range interactions are challenges that require additional attention. In this review, we focus on the possible functions of enhancer transcription by highlighting several recent enhancer RNA papers and, within the context of other enhancer studies, speculate on the role of enhancer transcription in regulating differential gene expression. PMID:24178450

  15. Cloning of the sea urchin mitochondrial RNA polymerase and reconstitution of the transcription termination system

    PubMed Central

    Polosa, Paola Loguercio; Deceglie, Stefania; Falkenberg, Maria; Roberti, Marina; Di Ponzio, Barbara; Gadaleta, Maria Nicola; Cantatore, Palmiro

    2007-01-01

    Termination of transcription is a key process in the regulation of mitochondrial gene expression in animal cells. To investigate transcription termination in sea urchin mitochondria, we cloned the mitochondrial RNA polymerase (mtRNAP) of Paracentrotus lividus and used a recombinant form of the enzyme in a reconstituted transcription system, in the presence of the DNA-binding protein mtDBP. Cloning of mtRNAP was performed by a combination of PCR with degenerate primers and library screening. The enzyme contains 10 phage-like conserved motifs, two pentatricopeptide motifs and a serine-rich stretch. The protein expressed in insect cells supports transcription elongation in a promoter-independent assay. Addition of recombinant mtDBP caused arrest of the transcribing mtRNAP when the enzyme approached the mtDBP-binding site in the direction of transcription of mtDNA l-strand. When the polymerase encountered the protein-binding site in the opposite direction, termination occurred in a protein-independent manner, inside the mtDBP-binding site. Pulse-chase experiments show that mtDBP caused true transcription termination rather than pausing. These data indicate that mtDBP acts as polar termination factor and suggest that transcription termination in sea urchin mitochondria could take place by two alternative modes based on protein-mediated or sequence-dependent mechanisms. PMID:17392338

  16. Transcriptional regulation of mammalian autophagy at a glance.

    PubMed

    Füllgrabe, Jens; Ghislat, Ghita; Cho, Dong-Hyung; Rubinsztein, David C

    2016-08-15

    Macroautophagy, hereafter referred to as autophagy, is a catabolic process that results in the lysosomal degradation of cytoplasmic contents ranging from abnormal proteins to damaged cell organelles. It is activated  under diverse conditions, including nutrient deprivation and hypoxia. During autophagy, members of the core autophagy-related (ATG) family of proteins mediate membrane rearrangements, which lead to the engulfment and degradation of cytoplasmic cargo. Recently, the nuclear regulation of autophagy, especially by transcription factors and histone modifiers, has gained increased attention. These factors are not only involved in rapid responses to autophagic stimuli, but also regulate the long-term outcome of autophagy. Now there are more than 20 transcription factors that have been shown to be linked to the autophagic process. However, their interplay and timing appear enigmatic as several have been individually shown to act as major regulators of autophagy. This Cell Science at a Glance article and the accompanying poster highlights the main cellular regulators of transcription involved in mammalian autophagy and their target genes. PMID:27528206

  17. Evolutionarily conserved repressive activity of WOX proteins mediates leaf blade outgrowth and floral organ development in plants

    PubMed Central

    Lin, Hao; Niu, Lifang; McHale, Neil A.; Ohme-Takagi, Masaru; Mysore, Kirankumar S.; Tadege, Million

    2013-01-01

    The WUSCHEL related homeobox (WOX) genes play key roles in stem cell maintenance, embryonic patterning, and lateral organ development. WOX genes have been categorized into three clades—ancient, intermediate, and modern/WUS—based on phylogenetic analysis, but a functional basis for this classification has not been established. Using the classical bladeless lam1 mutant of Nicotiana sylvestris as a genetic tool, we examined the function of the Medicago truncatula WOX gene, STENOFOLIA (STF), in controlling leaf blade outgrowth. STF and LAM1 are functional orthologs. We found that the introduction of mutations into the WUS-box of STF (STFm1) reduces its ability to complement the lam1 mutant. Fusion of an exogenous repressor domain to STFm1 restores complementation, whereas fusion of an exogenous activator domain to STFm1 enhances the narrow leaf phenotype. These results indicate that transcriptional repressor activity mediated by the WUS-box of STF acts to promote blade outgrowth. With the exception of WOX7, the WUS-box is conserved in the modern clade WOX genes, but is not found in members of the intermediate or ancient clades. Consistent with this, all members of the modern clade except WOX7 can complement the lam1 mutant when expressed using the STF promoter, but members of the intermediate and ancient clades cannot. Furthermore, we found that fusion of either the WUS-box or an exogenous repressor domain to WOX7 or to members of intermediate and ancient WOX clades results in a gain-of-function ability to complement lam1 blade outgrowth. These results suggest that modern clade WOX genes have evolved for repressor activity through acquisition of the WUS-box. PMID:23248305

  18. An Arabidopsis mitochondria-localized RRL protein mediates abscisic acid signal transduction through mitochondrial retrograde regulation involving ABI4

    PubMed Central

    Yao, Xuan; Li, Juanjuan; Liu, Jianping; Liu, Kede

    2015-01-01

    The molecular mechanisms of abscisic acid (ABA) signalling have been studied for many years; however, how mitochondria-localized proteins play roles in ABA signalling remains unclear. Here an Arabidopsis mitochondria-localized protein RRL (RETARDED ROOT GROWTH-LIKE) was shown to function in ABA signalling. A previous study had revealed that the Arabidopsis mitochondria-localized protein RRG (RETARDED ROOT GROWTH) is required for cell division in the root meristem. RRL shares 54% and 57% identity at the nucleotide and amino acid sequences, respectively, with RRG; nevertheless, RRL shows a different function in Arabidopsis. In this study, disruption of RRL decreased ABA sensitivity whereas overexpression of RRL increased ABA sensitivity during seed germination and seedling growth. High expression levels of RRL were found in germinating seeds and developing seedlings, as revealed by β-glucuronidase (GUS) staining of ProRRL–GUS transgenic lines. The analyses of the structure and function of mitochondria in the knockout rrl mutant showed that the disruption of RRL causes extensively internally vacuolated mitochondria and reduced ABA-stimulated reactive oxygen species (ROS) production. Previous studies have revealed that the expression of alternative oxidase (AOX) in the alternative respiratory pathway is increased by mitochondrial retrograde regulation to regain ROS levels when the mitochondrial electron transport chain is impaired. The APETALA2 (AP2)-type transcription factor ABI4 is a regulator of ALTERNATIVE OXIDASE1a (AOX1a) in mitochondrial retrograde signalling. This study showed that ABA-induced AOX1a and ABI4 expression was inhibited in the rrl mutant, suggesting that RRL is probably involved in ABI4-mediated mitochondrial retrograde signalling. Furthermore, the results revealed that ABI4 is a downstream regulatory factor in RRL-mediated ABA signalling in seed germination and seedling growth. PMID:26163700

  19. Restricted leucine zipper dimerization and specificity of DNA recognition of the melanocyte master regulator MITF.

    PubMed

    Pogenberg, Vivian; Ogmundsdóttir, Margrét H; Bergsteinsdóttir, Kristín; Schepsky, Alexander; Phung, Bengt; Deineko, Viktor; Milewski, Morlin; Steingrímsson, Eiríkur; Wilmanns, Matthias

    2012-12-01

    Microphthalmia-associated transcription factor (MITF) is a master regulator of melanocyte development and an important oncogene in melanoma. MITF heterodimeric assembly with related basic helix-loop-helix leucine zipper transcription factors is highly restricted, and its binding profile to cognate DNA sequences is distinct. Here, we determined the crystal structure of MITF in its apo conformation and in the presence of two related DNA response elements, the E-box and M-box. In addition, we investigated mouse and human Mitf mutations to dissect the functional significance of structural features. Owing to an unusual three-residue shift in the leucine zipper register, the MITF homodimer shows a marked kink in one of the two zipper helices to allow an out-of-register assembly. Removal of this insertion relieves restricted heterodimerization by MITF and permits assembly with the transcription factor MAX. Binding of MITF to the M-box motif is mediated by an unusual nonpolar interaction by Ile212, a residue that is mutated in mice and humans with Waardenburg syndrome. As several related transcription factors have low affinity for the M-box sequence, our analysis unravels how these proteins discriminate between similar target sequences. Our data provide a rational basis for targeting MITF in the treatment of important hereditary diseases and cancer. PMID:23207919

  20. Wnt9a deficiency discloses a repressive role of Tcf7l2 on endocrine differentiation in the embryonic pancreas

    PubMed Central

    Pujadas, G.; Cervantes, S.; Tutusaus, A.; Ejarque, M.; Sanchez, L.; García, A.; Esteban, Y.; Fargas, L.; Alsina, B.; Hartmann, C.; Gomis, R.; Gasa, R.

    2016-01-01

    Transcriptional and signaling networks establish complex cross-regulatory interactions that drive cellular differentiation during development. Using microarrays we identified the gene encoding the ligand Wnt9a as a candidate target of Neurogenin3, a basic helix-loop-helix transcription factor that functions as a master regulator of pancreatic endocrine differentiation. Here we show that Wnt9a is expressed in the embryonic pancreas and that its deficiency enhances activation of the endocrine transcriptional program and increases the number of endocrine cells at birth. We identify the gene encoding the endocrine transcription factor Nkx2-2 as one of the most upregulated genes in Wnt9a-ablated pancreases and associate its activation to reduced expression of the Wnt effector Tcf7l2. Accordingly, in vitro studies confirm that Tcf7l2 represses activation of Nkx2-2 by Neurogenin3 and inhibits Nkx2-2 expression in differentiated β-cells. Further, we report that Tcf7l2 protein levels decline upon initiation of endocrine differentiation in vivo, disclosing the downregulation of this factor in the developing endocrine compartment. These findings highlight the notion that modulation of signalling cues by lineage-promoting factors is pivotal for controlling differentiation programs. PMID:26771085

  1. Disease-Related Growth Factor and Embryonic Signaling Pathways Modulate an Enhancer of TCF21 Expression at the 6q23.2 Coronary Heart Disease Locus

    PubMed Central

    Miller, Clint L.; Anderson, D. Ryan; Kundu, Ramendra K.; Raiesdana, Azad; Nürnberg, Sylvia T.; Diaz, Roxanne; Cheng, Karen; Leeper, Nicholas J.; Chen, Chung-Hsing; Chang, I-Shou; Schadt, Eric E.; Hsiung, Chao Agnes; Assimes, Themistocles L.; Quertermous, Thomas

    2013-01-01

    Coronary heart disease (CHD) is the leading cause of mortality in both developed and developing countries worldwide. Genome-wide association studies (GWAS) have now identified 46 independent susceptibility loci for CHD, however, the biological and disease-relevant mechanisms for these associations remain elusive. The large-scale meta-analysis of GWAS recently identified in Caucasians a CHD-associated locus at chromosome 6q23.2, a region containing the transcription factor TCF21 gene. TCF21 (Capsulin/Pod1/Epicardin) is a member of the basic-helix-loop-helix (bHLH) transcription factor family, and regulates cell fate decisions and differentiation in the developing coronary vasculature. Herein, we characterize a cis-regulatory mechanism by which the lead polymorphism rs12190287 disrupts an atypical activator protein 1 (AP-1) element, as demonstrated by allele-specific transcriptional regulation, transcription factor binding, and chromatin organization, leading to altered TCF21 expression. Further, this element is shown to mediate signaling through platelet-derived growth factor receptor beta (PDGFR-β) and Wilms tumor 1 (WT1) pathways. A second disease allele identified in East Asians also appears to disrupt an AP-1-like element. Thus, both disease-related growth factor and embryonic signaling pathways may regulate CHD risk through two independent alleles at TCF21. PMID:23874238

  2. Partial deletion of TCF4 in three generation family with non-syndromic intellectual disability, without features of Pitt-Hopkins syndrome.

    PubMed

    Kharbanda, Mira; Kannike, Kaja; Lampe, Anne; Berg, Jonathan; Timmusk, Tõnis; Sepp, Mari

    2016-06-01

    Mutations in TCF4 (basic helix-loop-helix transcription factor 4), a gene with complex organization and multiple transcription initiation sites, are usually associated with Pitt-Hopkins syndrome (PTHS). However, a translocation encompassing the 5' end of TCF4 and several point mutations have been linked to non-syndromic intellectual disability (NSID). Here we describe a family with autosomal dominantly inherited NSID in seven relatives with a partial deletion of TCF4, disrupting the 5' end of the gene, predicted to result in the reduction of the number of mRNAs that can be produced by alternative transcription initiation. Functional studies indicate that it leads to reduced levels of transcripts coding for TCF4 protein isoforms with a nuclear localization signal, which may be relevant to the phenotype. The findings in our family support the notion that the position of the mutation in TCF4 is relevant to the phenotype, with those mutations in the 5' region, cassette exons and regions not affecting the important functional domains being linked to NSID rather than PTHS. We suggest that screening for mutations in TCF4 could be considered in the investigation of NSID. PMID:27132474

  3. INDEHISCENT and SPATULA Interact to Specify Carpel and Valve Margin Tissue and Thus Promote Seed Dispersal in Arabidopsis[W

    PubMed Central

    Girin, Thomas; Paicu, Teodora; Stephenson, Pauline; Fuentes, Sara; Körner, Evelyn; O’Brien, Martin; Sorefan, Karim; Wood, Thomas A.; Balanzá, Vicente; Ferrándiz, Cristina; Smyth, David R.; Østergaard, Lars

    2011-01-01

    Structural organization of organs in multicellular organisms occurs through intricate patterning mechanisms that often involve complex interactions between transcription factors in regulatory networks. For example, INDEHISCENT (IND), a basic helix-loop-helix (bHLH) transcription factor, specifies formation of the narrow stripes of valve margin tissue, where Arabidopsis thaliana fruits open on maturity. Another bHLH transcription factor, SPATULA (SPT), is required for reproductive tissue development from carpel margins in the Arabidopsis gynoecium before fertilization. Previous studies have therefore assigned the function of SPT to early gynoecium stages and IND to later fruit stages of reproductive development. Here we report that these two transcription factors interact genetically and via protein–protein contact to mediate both gynoecium development and fruit opening. We show that IND directly and positively regulates the expression of SPT, and that spt mutants have partial defects in valve margin formation. Careful analysis of ind mutant gynoecia revealed slight defects in apical tissue formation, and combining mutations in IND and SPT dramatically enhanced both single-mutant phenotypes. Our data show that SPT and IND at least partially mediate their joint functions in gynoecium and fruit development by controlling auxin distribution and suggest that this occurs through cooperative binding to regulatory sequences in downstream target genes. PMID:21990939

  4. Amyloid protein-mediated differential DNA methylation status regulates gene expression in Alzheimer's disease model cell line

    SciTech Connect

    Sung, Hye Youn; Choi, Eun Nam; Ahn Jo, Sangmee; Oh, Seikwan; Ahn, Jung-Hyuck

    2011-11-04

    Highlights: Black-Right-Pointing-Pointer Genome-wide DNA methylation pattern in Alzheimer's disease model cell line. Black-Right-Pointing-Pointer Integrated analysis of CpG methylation and mRNA expression profiles. Black-Right-Pointing-Pointer Identify three Swedish mutant target genes; CTIF, NXT2 and DDR2 gene. Black-Right-Pointing-Pointer The effect of Swedish mutation on alteration of DNA methylation and gene expression. -- Abstract: The Swedish mutation of amyloid precursor protein (APP-sw) has been reported to dramatically increase beta amyloid production through aberrant cleavage at the beta secretase site, causing early-onset Alzheimer's disease (AD). DNA methylation has been reported to be associated with AD pathogenesis, but the underlying molecular mechanism of APP-sw-mediated epigenetic alterations in AD pathogenesis remains largely unknown. We analyzed genome-wide interplay between promoter CpG DNA methylation and gene expression in an APP-sw-expressing AD model cell line. To identify genes whose expression was regulated by DNA methylation status, we performed integrated analysis of CpG methylation and mRNA expression profiles, and identified three target genes of the APP-sw mutant; hypomethylated CTIF (CBP80/CBP20-dependent translation initiation factor) and NXT2 (nuclear exporting factor 2), and hypermethylated DDR2 (discoidin domain receptor 2). Treatment with the demethylating agent 5-aza-2 Prime -deoxycytidine restored mRNA expression of these three genes, implying methylation-dependent transcriptional regulation. The profound alteration in the methylation status was detected at the -435, -295, and -271 CpG sites of CTIF, and at the -505 to -341 region in the promoter of DDR2. In the promoter region of NXT2, only one CpG site located at -432 was differentially unmethylated in APP-sw cells. Thus, we demonstrated the effect of the APP-sw mutation on alteration of DNA methylation and subsequent gene expression. This epigenetic regulatory mechanism may

  5. Transcription in archaea

    NASA Technical Reports Server (NTRS)

    Kyrpides, N. C.; Ouzounis, C. A.; Woese, C. R. (Principal Investigator)

    1999-01-01

    Using the sequences of all the known transcription-associated proteins from Bacteria and Eucarya (a total of 4,147), we have identified their homologous counterparts in the four complete archaeal genomes. Through extensive sequence comparisons, we establish the presence of 280 predicted transcription factors or transcription-associated proteins in the four archaeal genomes, of which 168 have homologs only in Bacteria, 51 have homologs only in Eucarya, and the remaining 61 have homologs in both phylogenetic domains. Although bacterial and eukaryotic transcription have very few factors in common, each exclusively shares a significantly greater number with the Archaea, especially the Bacteria. This last fact contrasts with the obvious close relationship between the archaeal and eukaryotic transcription mechanisms per se, and in particular, basic transcription initiation. We interpret these results to mean that the archaeal transcription system has retained more ancestral characteristics than have the transcription mechanisms in either of the other two domains.

  6. Control of lysosomal biogenesis and Notch-dependent tissue patterning by components of the TFEB-V-ATPase axis in Drosophila melanogaster

    PubMed Central

    Tognon, Emiliana; Kobia, Francis; Busi, Ilaria; Fumagalli, Arianna; De Masi, Federico; Vaccari, Thomas

    2016-01-01

    ABSTRACT In vertebrates, TFEB (transcription factor EB) and MITF (microphthalmia-associated transcription factor) family of basic Helix-Loop-Helix (bHLH) transcription factors regulates both lysosomal function and organ development. However, it is not clear whether these 2 processes are interconnected. Here, we show that Mitf, the single TFEB and MITF ortholog in Drosophila, controls expression of vacuolar-type H+-ATPase pump (V-ATPase) subunits. Remarkably, we also find that expression of Vha16-1 and Vha13, encoding 2 key components of V-ATPase, is patterned in the wing imaginal disc. In particular, Vha16-1 expression follows differentiation of proneural regions of the disc. These regions, which will form sensory organs in the adult, appear to possess a distinctive endolysosomal compartment and Notch (N) localization. Modulation of Mitf activity in the disc in vivo alters endolysosomal function and disrupts proneural patterning. Similar to our findings in Drosophila, in human breast epithelial cells we observe that impairment of the Vha16-1 human ortholog ATP6V0C changes the size and function of the endolysosomal compartment and that depletion of TFEB reduces ligand-independent N signaling activity. Our data suggest that lysosomal-associated functions regulated by the TFEB-V-ATPase axis might play a conserved role in shaping cell fate. PMID:26727288

  7. MITF mutations associated with pigment deficiency syndromes and melanoma have different effects on protein function.

    PubMed

    Grill, Christine; Bergsteinsdóttir, Kristín; Ogmundsdóttir, Margrét H; Pogenberg, Vivian; Schepsky, Alexander; Wilmanns, Matthias; Pingault, Veronique; Steingrímsson, Eiríkur

    2013-11-01

    The basic-helix-loop-helix-leucine zipper (bHLHZip) protein MITF (microphthalmia-associated transcription factor) is a master regulator of melanocyte development. Mutations in the MITF have been found in patients with the dominantly inherited hypopigmentation and deafness syndromes Waardenburg syndrome type 2A (WS2A) and Tietz syndrome (TS). Additionally, both somatic and germline mutations have been found in MITF in melanoma patients. Here, we characterize the DNA-binding and transcription activation properties of 24 MITF mutations found in WS2A, TS and melanoma patients. We show that most of the WS2A and TS mutations fail to bind DNA and activate expression from melanocyte-specific promoters. Some of the mutations, especially R203K and S298P, exhibit normal activity and may represent neutral variants. Mutations found in melanomas showed normal DNA-binding and minor variations in transcription activation properties; some showed increased potential to form colonies. Our results provide molecular insights into how mutations in a single gene can lead to such different phenotypes. PMID:23787126

  8. An alternative pathway for gene regulation by Myc.

    PubMed Central

    Peukert, K; Staller, P; Schneider, A; Carmichael, G; Hänel, F; Eilers, M

    1997-01-01

    The c-Myc protein activates transcription as part of a heteromeric complex with Max. However, Myc-transformed cells are characterized by loss of expression of several genes, suggesting that Myc may also repress gene expression. Two-hybrid cloning identifies a novel POZ domain Zn finger protein (Miz-1; Myc-interacting Zn finger protein-1) that specifically interacts with Myc, but not with Max or USF. Miz-1 binds to start sites of the adenovirus major late and cyclin D1 promoters and activates transcription from both promoters. Miz-1 has a potent growth arrest function. Binding of Myc to Miz-1 requires the helix-loop-helix domain of Myc and a short amphipathic helix located in the carboxy-terminus of Miz-1. Expression of Myc inhibits transactivation, overcomes Miz-1-induced growth arrest and renders Miz-1 insoluble in vivo. These processes depend on Myc and Miz-1 association and on the integrity of the POZ domain of Miz-1, suggesting that Myc binding activates a latent inhibitory function of this domain. Fusion of a nuclear localization signal induces efficient nuclear transport of Miz-1 and impairs the ability of Myc to overcome transcriptional activation and growth arrest by Miz-1. Our data suggest a model for how gene repression by Myc may occur in vivo. PMID:9312026

  9. A wheat R2R3-MYB protein PURPLE PLANT1 (TaPL1) functions as a positive regulator of anthocyanin biosynthesis.

    PubMed

    Shin, Dong Ho; Choi, Myoung-Goo; Kang, Chon-Sik; Park, Chul-Soo; Choi, Sang-Bong; Park, Youn-Il

    2016-01-15

    Transcriptional activation of anthocyanin biosynthesis genes in vegetative tissues of monocotyledonous plants is mediated by cooperative activity of one component from each of the following two transcription factor families: MYB encoded by PURPLE PLANT1/COLORED ALEURONE1 (PL1/C1), and basic helix-loop-helix (bHLH) encoded by RED/BOOSTER (R1/B1). In the present study, putative PL cDNA was cloned from the wheat (Triticum aestivum) cultivar Iksan370, which preferentially expresses anthocyanins in coleoptiles. Phylogenetic tree analysis of deduced amino acid sequences showed that a putative TaPL1 is highly homologous to barley (Hordeum vulgare) HvPL1, but is distinct from wheat TaC1. Transgenic Arabidopsis thaliana stably expressing putative TaPL1 accumulated anthocyanin pigments in leaves and up-regulated structural genes involved in both early and late anthocyanin biosynthesis steps. TaPL1 transcript levels in Iksan370 were more prominent in vegetative tissues such as young coleoptiles than in reproductive tissues such as spikelets. TaPL1 expression was significantly up-regulated by environmental stresses including cold, salt, and light, which are known to induce anthocyanin accumulation. These combined results suggest that TaPL1 is an active positive regulator of anthocyanin biosynthesis in wheat coleoptiles. PMID:26692488

  10. CCAR1 is required for Ngn3-mediated endocrine differentiation

    SciTech Connect

    Lu, Chung-Kuang; Lai, Yi-Chyi; Lin, Yung-Fu; Chen, Hau-Ren; Chiang, Ming-Ko

    2012-02-10

    Highlights: Black-Right-Pointing-Pointer We identify CCAR1 to directly interact with Ngn3. Black-Right-Pointing-Pointer CCAR1 is co-localized with Ngn3 in the nucleus. Black-Right-Pointing-Pointer CCAR1 cooperates with Ngn3 in activating NeuroD expression. Black-Right-Pointing-Pointer CCAR1 is required for Ngn3-mediated PANC-1 transdifferentiation. -- Abstract: Neurogenin3 (Ngn3) is a basic helix-loop-helix transcription factor that specifies pancreatic endocrine cell fates during pancreas development. It can also initiate a transdifferentiation program when expressed in pancreatic exocrine and ductal cells. However, how Ngn3 initiates a transcriptional cascade to achieve endocrine differentiation is still poorly understood. Here, we show that cell cycle and apoptosis regulator 1 (CCAR1), which is a transcriptional coactivator for nuclear receptors, also interacts with Ngn3. The association between Ngn3 and CCAR1 was verified by pull-down assays and co-immunoprecipitation analyses. Using gene reporter assays, we found that CCAR1 is essential for Ngn3 to activate the expression of the reporter genes containing the NeuroD promoter. Moreover, down-regulation of endogenous CCAR1 in the PANC-1 pancreatic ductal cell line inhibits the transdifferentiation program initiated by Ngn3. CCAR1 is, therefore, a novel partner of Ngn3 in mediating endocrine differentiation.

  11. Ribosomal protein S14 negatively regulates c-Myc activity.

    PubMed

    Zhou, Xiang; Hao, Qian; Liao, Jun-Ming; Liao, Peng; Lu, Hua

    2013-07-26

    The ribosomal gene RPS14 is associated with the cancer-prone 5q-syndrome, which is caused by an interstitial deletion of the long arm of human chromosome 5. Previously, we found that ribosomal protein S14 (RPS14) binds to and inactivates MDM2, consequently leading to p53-dependent cell-cycle arrest and growth inhibition. However, it remains elusive whether RPS14 regulates cell proliferation in a p53-independent manner. Here, we show that RPS14 interacts with the Myc homology box II (MBII) and the C-terminal basic helix-loop-helix leucine zipper (bHLH-LZ) domains of the oncoprotein c-Myc. Further, RPS14 inhibited c-Myc transcriptional activity by preventing the recruitment of c-Myc and its cofactor, TRRAP, to the target gene promoters, as thus suppressing c-Myc-induced cell proliferation. Also, siRNA-mediated RPS14 depletion elevated c-Myc transcriptional activity determined by its target gene, Nucleolin, expression. Interestingly, RPS14 depletion also resulted in the induction of c-Myc mRNA and subsequent protein levels. Consistent with this, RPS14 promoted c-Myc mRNA turnover through an Argonaute 2 (Ago2)- and microRNA-mediated pathway. Taken together, our study demonstrates that RPS14 negates c-Myc functions by directly inhibiting its transcriptional activity and mediating its mRNA degradation via miRNA. PMID:23775087

  12. Altered melanocyte differentiation and retinal pigmented epithelium transdifferentiation induced by Mash1 expression in pigment cell precursors.

    PubMed

    Lanning, Jessica L; Wallace, Jaclyn S; Zhang, Deming; Diwakar, Ganesh; Jiao, Zhongxian; Hornyak, Thomas J

    2005-10-01

    Transcription factor genes governing pigment cell development that are associated with spotting mutations in mice include members of several structural transcription factor classes but not members of the basic helix-loop-helix (bHLH) class, important for neurogenesis and myogenesis. To determine the effects of bHLH factor expression on pigment cell development, the neurogenic bHLH factor Mash1 was expressed early in pigment cell development in transgenic mice from the dopachrome tautomerase (Dct) promoter. Dct:Mash1 transgenic founders exhibit variable microphthalmia and patchy coat color hypopigmentation. Transgenic F1 mice exhibit microphthalmia with complete coat color dilution. Marker analysis demonstrates that Mash1 expression in the retinal pigmented epithelium (RPE) initiates neurogenesis in this cell layer, whereas expression in remaining neural crest-derived melanocytes alters their differentiation, in part by profoundly downregulating expression of the p (pink-eyed dilution) gene, while maintaining their cell fate. The effects of transcriptional perturbation of pigment cell precursors by Mash1 further highlight differences between pigment cells of distinct developmental origins, and suggest a mechanism for the alteration of melanogenesis to result in marked coat color dilution. PMID:16185282

  13. The Role of Atonal Factors in Mechanosensory Cell Specification and Function.

    PubMed

    Cai, Tiantian; Groves, Andrew K

    2015-12-01

    Atonal genes are basic helix-loop-helix transcription factors that were first identified as regulating the formation of mechanoreceptors and photoreceptors in Drosophila. Isolation of vertebrate homologs of atonal genes has shown these transcription factors to play diverse roles in the development of neurons and their progenitors, gut epithelial cells, and mechanosensory cells in the inner ear and skin. In this article, we review the molecular function and regulation of atonal genes and their targets, with particular emphasis on the function of Atoh1 in the development, survival, and function of hair cells of the inner ear. We discuss cell-extrinsic signals that induce Atoh1 expression and the transcriptional networks that regulate its expression during development. Finally, we discuss recent work showing how identification of Atoh1 target genes in the cerebellum, spinal cord, and gut can be used to propose candidate Atoh1 targets in tissues such as the inner ear where cell numbers and biochemical material are limiting. PMID:25339580

  14. Pbx acts with Hand2 in early myocardial differentiation

    PubMed Central

    Maves, Lisa; Tyler, Ashlee; Moens, Cecilia B.; Tapscott, Stephen J.

    2009-01-01

    Transcription factors of the basic helix-loop-helix (bHLH) family are critical regulators of muscle cell differentiation. For example, Myod drives skeletal muscle differentiation, and Hand2 potentiates cardiac muscle differentiation. Understanding how these bHLH factors regulate distinct transcriptional targets in a temporally and spatially controlled manner is critical for understanding their activity in cellular differentiation. We previously showed that Pbx homeodomain proteins modulate the activity of Myod to promote the differentiation of fast-twitch skeletal muscle. Here, we test the hypothesis that Pbx proteins are also necessary for cardiac muscle differentiation through interacting with Hand2. We show that Pbx proteins are required for the activation of cardiac muscle differentiation in zebrafish embryos. Loss of Pbx activity leads to delay of myocardial differentiation and subsequent defective cardiac morphogenesis, similar to reduced Hand2 activity. Genetic interaction experiments support the hypothesis that Pbx proteins modulate the activity of Hand2 in myocardial differentiation. Furthermore, we show that Pbx proteins directly bind the promoter of the myocardial differentiation gene myl7 in vitro, supporting a direct role for Pbx proteins in promoting cardiac muscle differentiation. Our findings demonstrate new roles for Pbx proteins in vertebrate cardiac development and also provide new insight into connections between the transcriptional regulation of skeletal and cardiac muscle differentiation programs. PMID:19607825

  15. MyoD synergizes with the E-protein HEB beta to induce myogenic differentiation.

    PubMed

    Parker, Maura H; Perry, Robert L S; Fauteux, Mélanie C; Berkes, Charlotte A; Rudnicki, Michael A

    2006-08-01

    The MyoD family of basic helix-loop-helix transcription factors function as heterodimers with members of the E-protein family to induce myogenic gene activation. The E-protein HEB is alternatively spliced to generate alpha and beta isoforms. While the function of these molecules has been studied in other cell types, questions persist regarding the molecular functions of HEB proteins in skeletal muscle. Our data demonstrate that HEB alpha expression remains unchanged in both myoblasts and myotubes, whereas HEB beta is upregulated during the early phases of terminal differentiation. Upon induction of differentiation, a MyoD-HEB beta complex bound the E1 E-box of the myogenin promoter leading to transcriptional activation. Importantly, forced expression of HEB beta with MyoD synergistically lead to precocious myogenin expression in proliferating myoblasts. However, after differentiation, HEB alpha and HEB beta synergized with myogenin, but not MyoD, to activate the myogenin promoter. Specific knockdown of HEB beta by small interfering RNA in myoblasts blocked differentiation and inhibited induction of myogenin transcription. Therefore, HEB alpha and HEB beta play novel and central roles in orchestrating the regulation of myogenic factor activity through myogenic differentiation. PMID:16847330

  16. NRPB3, the third largest subunit of RNA polymerase II, is essential for stomatal patterning and differentiation in Arabidopsis

    PubMed Central

    Chen, Liang; Guan, Liping; Qian, Pingping; Xu, Fan; Wu, Zhongliang; Wu, Yujun; He, Kai; Gou, Xiaoping; Li, Jia; Hou, Suiwen

    2016-01-01

    ABSTRACT Stomata are highly specialized epidermal structures that control transpiration and gas exchange between plants and the environment. Signal networks underlying stomatal development have been previously uncovered but much less is known about how signals involved in stomatal development are transmitted to RNA polymerase II (Pol II or RPB), which plays a central role in the transcription of mRNA coding genes. Here, we identify a partial loss-of-function mutation of the third largest subunit of nuclear DNA-dependent Pol II (NRPB3) that exhibits an increased number of stomatal lineage cells and paired stomata. Phenotypic and genetic analyses indicated that NRPB3 is not only required for correct stomatal patterning, but is also essential for stomatal differentiation. Protein-protein interaction assays showed that NRPB3 directly interacts with two basic helix-loop-helix (bHLH) transcription factors, FAMA and INDUCER OF CBF EXPRESSION1 (ICE1), indicating that NRPB3 serves as an acceptor for signals from transcription factors involved in stomatal development. Our findings highlight the surprisingly conserved activating mechanisms mediated by the third largest subunit of Pol II in eukaryotes. PMID:26989174

  17. The mammalian single-minded (SIM) gene: Mouse cDNA structure and diencephalic expression indicate a candidate gene for Down syndrome

    SciTech Connect

    Yamaki, Akiko |; Kudoh, Jun; Shindoh, Nobuaki

    1996-07-01

    We have recently isolated a human homolog (hSIM) of the Drosophila single-minded (sim) gene from the Down syndrome critical region of chromosome 21 using the exon trapping method. The Drosophila sim gene encodes a transcription factor that regulates the development of the central nervous system midline cell lineage. To elucidate the structure of the mammalian SIM protein, we have isolated cDNA clones from a mouse embryo cDNA library. The cDNA clones encode a polypeptide of 657 amino acids with a bHLH (basic-helix-loop-helix) domain, characteristic of a large family of transcription factors, and a PAS (Per-Arnt-Sim) domain in the amino-terminal half region. Both of these domains have striking sequence homology with human SIM and Drosophila SIM proteins. In contrast, the carboxy-terminal half of the mouse SIM protein consists of a proline-rich region with no sequence homology to the Drosophila SIM provator domain of a number of transcription factors. Whole-mount embryo in situ hybridization experiments revealed that the SIM mRNA is expressed prominently in the diencephalon during embryogenesis strongly suggest that the newly isolated mammalian SIM homolog may play a critical role in the development of the mammalian central nervous system. We propose that the human SIM gene may be one of the pathogenic genes of Down syndrome. 36 refs., 6 figs.

  18. NRPB3, the third largest subunit of RNA polymerase II, is essential for stomatal patterning and differentiation in Arabidopsis.

    PubMed

    Chen, Liang; Guan, Liping; Qian, Pingping; Xu, Fan; Wu, Zhongliang; Wu, Yujun; He, Kai; Gou, Xiaoping; Li, Jia; Hou, Suiwen

    2016-05-01

    Stomata are highly specialized epidermal structures that control transpiration and gas exchange between plants and the environment. Signal networks underlying stomatal development have been previously uncovered but much less is known about how signals involved in stomatal development are transmitted to RNA polymerase II (Pol II or RPB), which plays a central role in the transcription of mRNA coding genes. Here, we identify a partial loss-of-function mutation of the third largest subunit of nuclear DNA-dependent Pol II (NRPB3) that exhibits an increased number of stomatal lineage cells and paired stomata. Phenotypic and genetic analyses indicated that NRPB3 is not only required for correct stomatal patterning, but is also essential for stomatal differentiation. Protein-protein interaction assays showed that NRPB3 directly interacts with two basic helix-loop-helix (bHLH) transcription factors, FAMA and INDUCER OF CBF EXPRESSION1 (ICE1), indicating that NRPB3 serves as an acceptor for signals from transcription factors involved in stomatal development. Our findings highlight the surprisingly conserved activating mechanisms mediated by the third largest subunit of Pol II in eukaryotes. PMID:26989174

  19. Multiprotein bridging factor 2 regulates the expression of the fibroin heavy chain gene by interacting with Bmdimmed in the silkworm Bombyx mori.

    PubMed

    Zhou, C; Zha, X; Shi, P; Wei, S; Wang, H; Zheng, R; Xia, Q

    2016-08-01

    Multiprotein bridging factor 2 (MBF2) was first isolated from the posterior silk gland of Bombyx mori. However, its function in B. mori is still unknown. Herein, MBF2 transcripts were detected mainly in the posterior silk gland and Malpighian tubules of B. mori larvae via a quantitative PCR analysis. An analysis of temporal expression patterns showed that the expression pattern of MBF2 was the opposite of that of the fibroin heavy chain (fibH) gene, as its expression was high during the fourth-instar moulting stage, decreased gradually during the fifth-instar feeding stage and disappeared at the end of the fifth-instar phase. Furthermore, bimolecular fluorescent complementation and Far-Western blot assays showed that MBF2 interacted with the basic helix-loop-helix transcription factor Bmdimmed. Dual luciferase reporter assays showed that MBF2 down-regulated the promoter activity of fibH and inhibited the effect of Bmdimmed (Bmdimm) on fibH expression. MBF2 expression was induced in silk glands after treatment with 20-hydroxyecdysone in vivo and in vitro. These findings suggest that MBF2 is a transcriptional repressor that is involved in controlling the regulation of the fibH gene in the posterior silk gland by interacting with Bmdimm. PMID:27110998

  20. The role of Atonal factors in mechanosensory cell specification and function

    PubMed Central

    Cai, Tiantian; Groves, Andrew K.

    2015-01-01

    atonal genes are basic helix-loop-helix transcription factors that were first identified as regulating the formation of mechanoreceptors and photoreceptors in Drosophila. Isolation of vertebrate homologs of atonal genes has shown these transcription factors to play diverse roles in the development of neurons and their progenitors, gut epithelial cells and mechanosensory cells in the inner ear and skin. In this article, we review the molecular function and regulation of atonal genes and their targets, with particular emphasis on the function of Atoh1 in the development, survival and function of hair cells of the inner ear. We discuss cell-extrinsic signals that induce Atoh1 expression, and the transcriptional networks that regulate its expression during development. Finally, we discuss recent work showing how identification of Atoh1 target genes in the cerebellum, spinal cord and gut can be used to propose candidate Atoh1 targets in tissues such as the inner ear where cell numbers and biochemical material are limiting. PMID:25339580

  1. PIFs: Systems Integrators in Plant Development[W

    PubMed Central

    Leivar, Pablo; Monte, Elena

    2014-01-01

    Phytochrome-interacting factors (PIFs) are members of the Arabidopsis thaliana basic helix-loop-helix family of transcriptional regulators that interact specifically with the active Pfr conformer of phytochrome (phy) photoreceptors. PIFs are central regulators of photomorphogenic development that act to promote stem growth, and this activity is reversed upon interaction with phy in response to light. Recently, significant progress has been made in defining the transcriptional networks directly regulated by PIFs, as well as the convergence of other signaling pathways on the PIFs to modulate growth. Here, we summarize and highlight these findings in the context of PIFs acting as integrators of light and other signals. We discuss progress in our understanding of the transcriptional and posttranslational regulation of PIFs that illustrates the integration of light with hormonal pathways and the circadian clock, and we review seedling hypocotyl growth as a paradigm of PIFs acting at the interface of these signals. Based on these advances, PIFs are emerging as required factors for growth, acting as central components of a regulatory node that integrates multiple internal and external signals to optimize plant development. PMID:24481072

  2. Protein-mediated adhesion of the dissimilatory Fe(III)-reducing bacterium Shewanella alga BrY to hydrous ferric oxide

    SciTech Connect

    Caccavo, F. Jr.

    1999-11-01

    The rate and extent of bacterial Fe(III) mineral reduction are governed by molecular-scale interactions between the bacterial cell surface and the mineral surface. These interactions are poorly understood. This study examined the role of surface proteins in the adhesion of Shewanella alga BrY to hydrous ferric oxide (HFO). Enzymatic degradation of cell surface polysaccharides had no effect on cell adhesion to HFO. The proteolytic enzymes Streptomyces griseus protease and chymotrypsin inhibited the adhesion of S. alga BrY cells to HFO through catalytic degradation of surface proteins. Trypsin inhibited S. alga BrY adhesion solely through surface-coating effects. Protease and chymotrypsin also mediated desorption of adhered S. alga BrY cells from HFO while trypsin did not mediate cell desorption. Protease removed a single peptide band that represented a protein with an apparent molecular mass of 50 kDa. Chymotrypsin removed two peptide bands that represented proteins with apparent molecular masses of 60 and 31 kDa. These proteins represent putative HGO adhesion molecules. A. alga BrY adhesion was inhibited by up to 46% when cells were cultured at sub-MICs of chloramphenicol, suggesting that protein synthesis is necessary for adhesion. Proteins extracted from the surface of S. alga BrY cells inhibited adhesion to HFO by up to 41%. A number of these proteins bound specifically to HFO, suggesting that a complex system of surface proteins mediates S. alga BrY adhesion to HFO.

  3. Cytotoxicity of carteolol to human corneal epithelial cells by inducing apoptosis via triggering the Bcl-2 family protein-mediated mitochondrial pro-apoptotic pathway.

    PubMed

    Shan, Ming; Fan, Ting-Jun

    2016-09-01

    Carteolol is a frequently used nonselective β-adrenoceptor antagonist for glaucoma and ocular hypertension treatment, and its repeated/prolonged usage might be cytotoxic to the cornea, especially the outmost human corneal epithelium (HCEP). The aim of the present study was to characterize the cytotoxicity of carteolol to HCEP and its underlying cellular and molecular mechanisms using an in vitro model of HCEP cells. After HCEP cells were treated with carteolol at concentrations varying from 2% to 0.015625%, the cytotoxicity, apoptosis-inducing effect and pro-apoptotic pathway was investigated, respectively. Our results showed that carteolol at concentrations above 0.03125% induced time- and dose-dependent growth retardation, cytopathic morphological changes and viability decline of HCEP cells. Moreover, carteolol induced G1 phase arrest, plasma membrane permeability elevation, phosphatidylserine externalization, DNA fragmentation, and apoptotic body formation of HCEP cells. Furthermore, carteolol also induced activation of caspase-9 and -3, disruption of mitochondrial transmembrane potential, up-regulation the cytoplasmic amount of cytochrome c and apoptosis-inducing factor, and up-regulation of pro-apoptotic Bax and Bad, down-regulation of anti-apoptotic Bcl-2 and Bcl-xL. In conclusion, carteolol above 1/64 of its clinical therapeutic dosage has a time- and dose-dependent cytotoxicity to HCEP cells, which is achieved by inducing apoptosis via triggering Bcl-2 family protein-mediated mitochondrial pro-apoptotic pathway. PMID:27216471

  4. Gq protein mediates UVB-induced cyclooxygenase-2 expression by stimulating HB-EGF secretion from HaCaT human keratinocytes

    SciTech Connect

    Seo, MiRan; Juhnn, Yong-Sung

    2010-03-05

    Ultraviolet (UV) radiation induces cyclooxygenase-2 expression to produce cellular responses including aging and carcinogenesis in skin. We hypothesised that heterotrimeric G proteins mediate UV-induced COX-2 expression by stimulating secretion of soluble HB-EGF (sHB-EGF). In this study, we aimed to elucidate the role and underlying mechanism of the {alpha} subunit of Gq protein (G{alpha}q) in UVB-induced HB-EGF secretion and COX-2 induction. We found that expression of constitutively active G{alpha}q (G{alpha}qQL) augmented UVB-induced HB-EGF secretion, which was abolished by knockdown of G{alpha}q with shRNA in HaCaT human keratinocytes. G{alpha}q was found to mediate the UVB-induced HB-EGF secretion by sequential activation of phospholipase C (PLC), protein kinase C{delta} (PKC{delta}), and matrix metaloprotease-2 (MMP-2). Moreover, G{alpha}qQL mediated UVB-induced COX-2 expression in an HB-EGF-, EGFR-, and p38-dependent manner. From these results, we concluded that G{alpha}q mediates UV-induced COX-2 expression through activation of EGFR by HB-EGF, of which ectodomain shedding was stimulated through sequential activation of PLC, PKC{delta} and MMP-2 in HaCaT cells.

  5. Protein-mediated layer-by-layer synthesis of TiO₂(B)/anatase/carbon coating on nickel foam as negative electrode material for lithium-ion battery.

    PubMed

    Wang, Xiaobo; Yan, Yong; Hao, Bo; Chen, Ge

    2013-05-01

    Through an aqueous, protein-mediated layer-by-layer titania deposition process, we have fabricated a protamine/titania composite layer on nickel foam. The coating was composed of amorphous carbon and TiO2(B)/anatase nanoparticles and formed upon organic pyrolysis under a reducing atmosphere (5% H2-Ar mixture). X-ray diffraction analyses, Auger electron spectroscopy, and high-resolution transmission electron microscopy revealed that the obtained coatings contained fine monoclinic TiO2(B) and anatase nanocrystals, along with amorphous carbon. Moreover, the coating can be used as a binder-free negative electrode material for lithium-ion batteries and exhibits high reversible capacity and fast charge-discharge properties; a reversible capacity of 245 mAh g(-1) was obtained at a current density of 50 mA g(-1), and capacities of 167 and 143 mAh g(-1) were obtained at current densities of 1 and 2 A g(-1), respectively. PMID:23597025

  6. Transcription Regulation in Archaea.

    PubMed

    Gehring, Alexandra M; Walker, Julie E; Santangelo, Thomas J

    2016-07-15

    The known diversity of metabolic strategies and physiological adaptations of archaeal species to extreme environments is extraordinary. Accurate and responsive mechanisms to ensure that gene expression patterns match the needs of the cell necessitate regulatory strategies that control the activities and output of the archaeal transcription apparatus. Archaea are reliant on a single RNA polymerase for all transcription, and many of the known regulatory mechanisms employed for archaeal transcription mimic strategies also employed for eukaryotic and bacterial species. Novel mechanisms of transcription regulation have become apparent by increasingly sophisticated in vivo and in vitro investigations of archaeal species. This review emphasizes recent progress in understanding archaeal transcription regulatory mechanisms and highlights insights gained from studies of the influence of archaeal chromatin on transcription. PMID:27137495

  7. Signaling mechanisms of plant cryptochromes in Arabidopsis thaliana.

    PubMed

    Liu, Bobin; Yang, Zhaohe; Gomez, Adam; Liu, Bin; Lin, Chentao; Oka, Yoshito

    2016-03-01

    Cryptochromes (CRY) are flavoproteins that direct a diverse array of developmental processes in response to blue light in plants. Conformational changes in CRY are induced by the absorption of photons and result in the propagation of light signals to downstream components. In Arabidopsis, CRY1 and CRY2 serve both distinct and partially overlapping functions in regulating photomorphogenic responses and photoperiodic flowering. For example, both CRY1 and CRY2 regulate the abundance of transcription factors by directly reversing the activity of E3 ubiquitin ligase on CONSTITUTIVE PHOTOMORPHOGENIC 1 and SUPPRESSOR OF PHYA-105 1 complexes in a blue light-dependent manner. CRY2 also specifically governs a photoperiodic flowering mechanism by directly interacting with a transcription factor called CRYPTOCHROME-INTERACTING BASIC-HELIX-LOOP-HELIX. Recently, structure/function analysis of CRY1 revealed that the CONSTITUTIVE PHOTOMORPHOGENIC 1 independent pathway is also involved in CRY1-mediated inhibition of hypocotyl elongation. CRY1 and CRY2 thus not only share a common pathway but also relay light signals through distinct pathways, which may lead to altered developmental programs in plants. PMID:26810763

  8. Neurogenic differentiation factor NeuroD confers protection against radiation-induced intestinal injury in mice.

    PubMed

    Li, Ming; Du, Aonan; Xu, Jing; Ma, Yanchao; Cao, Han; Yang, Chao; Yang, Xiao-Dong; Xing, Chun-Gen; Chen, Ming; Zhu, Wei; Zhang, Shuyu; Cao, Jianping

    2016-01-01

    The gastrointestinal tract, especially the small intestine, is particularly sensitive to radiation, and is prone to radiation-induced injury as a result. Neurogenic differentiation factor (NeuroD) is an evolutionarily-conserved basic helix-loop-helix (bHLH) transcription factor. NeuroD contains a protein transduction domain (PTD), which allows it to be exogenously delivered across the membrane of mammalian cells, whereupon its transcription activity can be unleashed. Whether NeuroD has therapeutic effects for radiation-induced injury remains unclear. In the present study, we prepared a NeuroD-EGFP recombinant protein, and explored its protective effects on the survival and intestinal damage induced by ionizing radiation. Our results showed that NeuroD-EGFP could be transduced into small intestine epithelial cells and tissues. NeuroD-EGFP administration significantly increased overall survival of mice exposed to lethal total body irradiation (TBI). This recombinant NeuroD also reduced radiation-induced intestinal mucosal injury and apoptosis, and improved crypt survival. Expression profiling of NeuroD-EGFP-treated mice revealed upregulation of tissue inhibitor of metalloproteinase 1 (TIMP-1), a known inhibitor of apoptosis in mammalian cells. In conclusion, NeuroD confers protection against radiation-induced intestinal injury, and provides a novel therapeutic clinical option for the prevention of intestinal side effects of radiotherapy and the treatment of victims of incidental exposure. PMID:27436572

  9. Mechanism of dioxin action: receptor-enhancer interactions in intact cells.

    PubMed Central

    Wu, L; Whitlock, J P

    1993-01-01

    We have used a ligation-mediated polymerase chain reaction technique to analyze protein-DNA interactions at a dioxin-responsive enhancer upstream of the CYP1A1 gene in intact mouse hepatoma cells. In its inactive state, the enhancer binds few, if any, proteins within the major DNA groove in vivo. Thus, the inactive enhancer is relatively inaccessible to DNA-binding proteins. Exposure of cells to 2,3,7,8-tetrachlorodibenzo-p-dioxin leads to the binding of the liganded Ah receptor at six sites within the major DNA groove of the enhancer. The receptor-enhancer interactions occur rapidly and do not require ongoing transcription, consistent with their role in regulating CYP1A1 gene expression. The liganded receptor, which is a heteromer composed of at least two basic helix-loop-helix proteins, is probably the only DNA-binding transcription factor necessary to activate the enhancer in vivo. The small size and irregular distribution of receptor binding sites suggest that chromatin structure imposes substantial steric constraints upon the function of the receptor-enhancer system in intact cells. Images PMID:8382788

  10. Novel and recurrent non-truncating mutations of the MITF basic domain: genotypic and phenotypic variations in Waardenburg and Tietz syndromes.

    PubMed

    Léger, Sandy; Balguerie, Xavier; Goldenberg, Alice; Drouin-Garraud, Valérie; Cabot, Annick; Amstutz-Montadert, Isabelle; Young, Paul; Joly, Pascal; Bodereau, Virginie; Holder-Espinasse, Muriel; Jamieson, Robyn V; Krause, Amanda; Chen, Hongsheng; Baumann, Clarisse; Nunes, Luis; Dollfus, Hélène; Goossens, Michel; Pingault, Véronique

    2012-05-01

    The microphthalmia-associated transcription factor (MITF) is a basic helix-loop-helix leucine zipper transcription factor, which regulates melanocyte development and the biosynthetic melanin pathway. A notable relationship has been described between non-truncating mutations of its basic domain and Tietz syndrome, which is characterized by albinoid-like hypopigmentation of the skin and hair, rather than the patchy depigmentation seen in Waardenburg syndrome, and severe hearing loss. Twelve patients with new or recurrent non-truncating mutations of the MITF basic domain from six families were enrolled in this study. We observed a wide range of phenotypes and some unexpected features. All the patients had blue irides and pigmentation abnormalities that ranged from diffuse hypopigmentation to Waardenburg-like patches. In addition, they showed congenital complete hearing loss, diffuse hypopigmentation of the skin, freckling and ocular abnormalities, more frequently than patients with MITF mutations outside the basic domain. In conclusion, the non-truncating mutations of the basic domain do not always lead to Tietz syndrome but rather to a large range of phenotypes. Sun-exposed freckles are interestingly observed more frequently in Asian populations. This variability argues for the possible interaction with modifier loci. PMID:22258527

  11. An essential role for chaperone-mediated autophagy in cell cycle progression

    PubMed Central

    Hubbi, Maimon E; Semenza, Gregg L

    2015-01-01

    Hypoxia has long been known to serve as a stimulus for cell cycle arrest. Hypoxia-mediated cell cycle arrest is mediated through the actions of HIF1α (hypoxia inducible factor 1, α subunit [basic helix-loop-helix transcription factor]), which has a nontranscriptional role as an inhibitor of MCM (minichromosome maintenance complex component) helicase activity. We identified chaperone-mediated autophagy as a pathway for selective degradation of HIF1α through lysosomes prior to the onset of DNA replication. CDK2 (cyclin-dependent kinase 2) mediates degradation of HIF1α at the G1/S transition, whereas CDK1 (cyclin-dependent kinase 1) increases HIF1α levels and transcriptional activity prior to the onset of G1 phase. Lysosomal inhibitors induce cell cycle arrest, which is recovered by knockdown of HIF1α and EPAS1/HIF2α. These findings establish lysosomes as essential regulators of cell cycle progression through the degradation of HIF1α. PMID:25945892

  12. ICE1 of Poncirus trifoliata functions in cold tolerance by modulating polyamine levels through interacting with arginine decarboxylase.

    PubMed

    Huang, Xiao-San; Zhang, Qinghua; Zhu, Dexin; Fu, Xingzheng; Wang, Min; Zhang, Qian; Moriguchi, Takaya; Liu, Ji-Hong

    2015-06-01

    ICE1 (Inducer of CBF Expression 1) encodes a MYC-like basic helix-loop-helix transcription factor that acts as a central regulator of cold response. In this study, we elucidated the function and underlying mechanisms of PtrICE1 from trifoliate orange [Poncirus trifoliata (L.) Raf.]. PtrICE1 was upregulated by cold, dehydration, and salt, with the greatest induction under cold conditions. PtrICE1 was localized in the nucleus and could bind to a MYC-recognizing sequence. Ectopic expression of PtrICE1 in tobacco and lemon conferred enhanced tolerance to cold stresses at either chilling or freezing temperatures. Yeast two-hybrid screening revealed that 21 proteins belonged to the PtrICE1 interactome, in which PtADC (arginine decarboxylase) was confirmed as a bona fide protein interacting with PtrICE1. Transcript levels of ADC genes in the transgenic lines were slightly elevated under normal growth condition but substantially increased under cold conditions, consistent with changes in free polyamine levels. By contrast, accumulation of the reactive oxygen species, H2O2 and O2 (-), was appreciably alleviated in the transgenic lines under cold stress. Higher activities of antioxidant enzymes, such as superoxide dismutase and catalase, were detected in the transgenic lines under cold conditions. Taken together, these results demonstrated that PtrICE1 plays a positive role in cold tolerance, which may be due to modulation of polyamine levels through interacting with the ADC gene. PMID:25873670

  13. Complement Component 3 Is Regulated by TWIST1 and Mediates Epithelial-Mesenchymal Transition.

    PubMed

    Cho, Min Soon; Rupaimoole, Rajesha; Choi, Hyun-Jin; Noh, Kyunghee; Chen, Jichao; Hu, Qianghua; Sood, Anil K; Afshar-Kharghan, Vahid

    2016-02-01

    We have previously shown that complement component 3 (C3) is secreted by malignant epithelial cells. To understand the mechanism of upregulation of C3 expression in tumor cells, we studied the C3 promoter and identified that twist basic helix-loop-helix transcription factor 1 (TWIST1) binds to the C3 promoter and enhances its expression. Because TWIST1 mediates epithelial-mesenchymal transition (EMT), we studied the effect of C3 on EMT and found that C3 decreased E-cadherin expression on cancer cells and promoted EMT. We showed that C3-induced reduction in E-cadherin expression in ovarian cancer cells was mediated by C3a and is Krüppel-like factor 5 dependent. We investigated the association between TWIST1 and C3 in malignant tumors and in murine embryos. TWIST1 and C3 colocalized at the invasive tumor edges, and in the neural crest and limb buds of mouse embryos. Our results identified TWIST1 as a transcription factor that regulates C3 expression during pathologic and physiologic EMT. PMID:26718342

  14. Neurogenic differentiation factor NeuroD confers protection against radiation-induced intestinal injury in mice

    PubMed Central

    Li, Ming; Du, Aonan; Xu, Jing; Ma, Yanchao; Cao, Han; Yang, Chao; Yang, Xiao-Dong; Xing, Chun-Gen; Chen, Ming; Zhu, Wei; Zhang, Shuyu; Cao, Jianping

    2016-01-01

    The gastrointestinal tract, especially the small intestine, is particularly sensitive to radiation, and is prone to radiation-induced injury as a result. Neurogenic differentiation factor (NeuroD) is an evolutionarily-conserved basic helix-loop-helix (bHLH) transcription factor. NeuroD contains a protein transduction domain (PTD), which allows it to be exogenously delivered across the membrane of mammalian cells, whereupon its transcription activity can be unleashed. Whether NeuroD has therapeutic effects for radiation-induced injury remains unclear. In the present study, we prepared a NeuroD-EGFP recombinant protein, and explored its protective effects on the survival and intestinal damage induced by ionizing radiation. Our results showed that NeuroD-EGFP could be transduced into small intestine epithelial cells and tissues. NeuroD-EGFP administration significantly increased overall survival of mice exposed to lethal total body irradiation (TBI). This recombinant NeuroD also reduced radiation-induced intestinal mucosal injury and apoptosis, and improved crypt survival. Expression profiling of NeuroD-EGFP-treated mice revealed upregulation of tissue inhibitor of metalloproteinase 1 (TIMP-1), a known inhibitor of apoptosis in mammalian cells. In conclusion, NeuroD confers protection against radiation-induced intestinal injury, and provides a novel therapeutic clinical option for the prevention of intestinal side effects of radiotherapy and the treatment of victims of incidental exposure. PMID:27436572

  15. Novel JAZ co-operativity and unexpected JA dynamics underpin Arabidopsis defence responses to Pseudomonas syringae infection.

    PubMed

    de Torres Zabala, Marta; Zhai, Bing; Jayaraman, Siddharth; Eleftheriadou, Garoufalia; Winsbury, Rebecca; Yang, Ron; Truman, William; Tang, Saijung; Smirnoff, Nicholas; Grant, Murray

    2016-02-01

    Pathogens target phytohormone signalling pathways to promote disease. Plants deploy salicylic acid (SA)-mediated defences against biotrophs. Pathogens antagonize SA immunity by activating jasmonate signalling, for example Pseudomonas syringae pv. tomato DC3000 produces coronatine (COR), a jasmonic acid (JA) mimic. This study found unexpected dynamics between SA, JA and COR and co-operation between JAZ jasmonate repressor proteins during DC3000 infection. We used a systems-based approach involving targeted hormone profiling, high-temporal-resolution micro-array analysis, reverse genetics and mRNA-seq. Unexpectedly, foliar JA did not accumulate until late in the infection process and was higher in leaves challenged with COR-deficient P. syringae or in the more resistant JA receptor mutant coi1. JAZ regulation was complex and COR alone was insufficient to sustainably induce JAZs. JAZs contribute to early basal and subsequent secondary plant defence responses. We showed that JAZ5 and JAZ10 specifically co-operate to restrict COR cytotoxicity and pathogen growth through a complex transcriptional reprogramming that does not involve the basic helix-loop-helix transcription factors MYC2 and related MYC3 and MYC4 previously shown to restrict pathogen growth. mRNA-seq predicts compromised SA signalling in a jaz5/10 mutant and rapid suppression of JA-related components on bacterial infection. PMID:26428397

  16. MicroRNA 146 (Mir146) modulates spermatogonial differentiation by retinoic acid in mice.

    PubMed

    Huszar, Jessica M; Payne, Christopher J

    2013-01-01

    Impaired biogenesis of microRNAs disrupts spermatogenesis and leads to infertility in male mice. Spermatogonial differentiation is a key step in spermatogenesis, yet the mechanisms that control this event remain poorly defined. In this study, we discovered microRNA 146 (Mir146) to be highly regulated during spermatogonial differentiation, a process dependent on retinoic acid (RA) signaling. Mir146 transcript levels were diminished nearly 180-fold in differentiating spermatogonia when compared with undifferentiated spermatogonia. Luciferase assays revealed the direct binding of Mir146 to the 3' untranslated region of the mediator complex subunit 1 (Med1), a coregulator of retinoid receptors (RARs and RXRs). Overexpression of Mir146 in cultured undifferentiated spermatogonia reduced Med1 transcript levels, as well as those of differentiation marker kit oncogene (Kit). MED1 protein was also diminished. Conversely, inhibition of Mir146 increased the levels of Kit. When undifferentiated spermatogonia were exposed to RA, Mir146 was downregulated along with a marker for undifferentiated germ cells, zinc finger and BTB domain containing 16 (Zbtb16; Plzf); Kit was upregulated. Overexpression of Mir146 in RA-treated spermatogonia inhibited the upregulation of Kit, stimulated by retinoic acid gene 8 (Stra8), and spermatogenesis- and oogenesis-specific basic helix-loop-helix 2 (Sohlh2). Inhibition of Mir146 in RA-treated spermatogonia greatly enhanced the upregulation of these genes. We conclude that Mir146 modulates the effects of RA on spermatogonial differentiation. PMID:23221399

  17. MicroRNA 146 (Mir146) Modulates Spermatogonial Differentiation by Retinoic Acid in Mice1

    PubMed Central

    Huszar, Jessica M.; Payne, Christopher J.

    2012-01-01

    ABSTRACT Impaired biogenesis of microRNAs disrupts spermatogenesis and leads to infertility in male mice. Spermatogonial differentiation is a key step in spermatogenesis, yet the mechanisms that control this event remain poorly defined. In this study, we discovered microRNA 146 (Mir146) to be highly regulated during spermatogonial differentiation, a process dependent on retinoic acid (RA) signaling. Mir146 transcript levels were diminished nearly 180-fold in differentiating spermatogonia when compared with undifferentiated spermatogonia. Luciferase assays revealed the direct binding of Mir146 to the 3′ untranslated region of the mediator complex subunit 1 (Med1), a coregulator of retinoid receptors (RARs and RXRs). Overexpression of Mir146 in cultured undifferentiated spermatogonia reduced Med1 transcript levels, as well as those of differentiation marker kit oncogene (Kit). MED1 protein was also diminished. Conversely, inhibition of Mir146 increased the levels of Kit. When undifferentiated spermatogonia were exposed to RA, Mir146 was downregulated along with a marker for undifferentiated germ cells, zinc finger and BTB domain containing 16 (Zbtb16; Plzf); Kit was upregulated. Overexpression of Mir146 in RA-treated spermatogonia inhibited the upregulation of Kit, stimulated by retinoic acid gene 8 (Stra8), and spermatogenesis- and oogenesis-specific basic helix-loop-helix 2 (Sohlh2). Inhibition of Mir146 in RA-treated spermatogonia greatly enhanced the upregulation of these genes. We conclude that Mir146 modulates the effects of RA on spermatogonial differentiation. PMID:23221399

  18. TRANSPARENT TESTA GLABRA1 and GLABRA1 Compete for Binding to GLABRA3 in Arabidopsis

    PubMed Central

    Pesch, Martina; Schultheiß, Ilka; Klopffleisch, Karsten; Clemen, Christoph S.; Hülskamp, Martin

    2015-01-01

    The MBW (for R2R3MYB, basic helix-loop-helix [bHLH], and WD40) genes comprise an evolutionarily conserved gene cassette that regulates several traits such as (pro)anthocyanin and anthocyanin biosynthesis and epidermal cell differentiation in plants. Trichome differentiation in Arabidopsis (Arabidopsis thaliana) is governed by GLABRA1 (GL1; R2R3MYB), GL3 (bHLH), and TRANSPARENT TESTA GLABRA1 (TTG1; WD40). They are thought to form a trimeric complex that acts as a transcriptional activation complex. We provide evidence that these three MBW proteins form either GL1 GL3 or GL3 TTG1 dimers. The formation of each dimer is counteracted by the respective third protein in yeast three-hybrid assays, pulldown experiments (luminescence-based mammalian interactome), and fluorescence lifetime imaging microscopy-fluorescence resonance energy transfer studies. We further show that two target promoters, TRIPTYCHON (TRY) and CAPRICE (CPC), are differentially regulated: GL1 represses the activation of the TRY promoter by GL3 and TTG1, and TTG1 suppresses the activation of the CPC promoter by GL1 and GL3. Our data suggest that the transcriptional activation by the MBW complex involves alternative complex formation and that the two dimers can differentially regulate downstream genes. PMID:25926482

  19. Synergy between IL-15 and Id2 promotes the expansion of human NK progenitor cells, which can be counteracted by the E protein HEB required to drive T cell development.

    PubMed

    Schotte, Remko; Dontje, Wendy; Nagasawa, Maho; Yasuda, Yuko; Bakker, Arjen Q; Spits, Hergen; Blom, Bianca

    2010-06-15

    The cytokine IL-15 and the inhibitor of DNA binding (Id)2, which negatively regulates the activity of basic helix-loop-helix transcription factors, have been shown to play key roles in NK cell development. Consistent with this, exogenous IL-15 added to human thymic progenitor cells stimulated their development into NK cells at the expense of T cells both in fetal thymic organ culture and in coculture with stromal cells expressing the Notch ligand Delta-like 1. Overexpression of Id2 in thymic progenitor cells stimulated NK cell development and blocked T cell development. This, in part, is attributed to inhibition of the transcriptional activity of the E protein HEB, which we show in this study is the only E protein that enhanced T cell development. Notably, Id2 increased a pool of lineage CD1a-CD5+ progenitor cells that in synergy with IL-15 furthered expansion and differentiation into NK cells. Taken together, our findings point to a dualistic function of Id2 in controlling T/NK cell lineage decisions; T cell development is impaired by Id2, most likely by sequestering HEB, whereas NK cell development is promoted by increasing a pool of CD1a-CD5+ NK cell progenitors, which together with IL-15 differentiate into mature NK cells. PMID:20483740

  20. Hyperresponse to T-cell receptor signaling and apoptosis of Id1 transgenic thymocytes.

    PubMed

    Qi, Zengbiao; Sun, Xiao-Hong

    2004-09-01

    The basic helix-loop-helix transcription factors, E2A and HEB, play important roles in T-cell development at multiple checkpoints. Expression of their inhibitor, Id1, abolishes the function of both transcription factors in a dose-dependent manner. The Id1 transgenic thymus is characterized by an accumulation of CD4- CD8- CD44+ CD25- thymocytes, a dramatic reduction of CD4+ CD8+ thymocytes, and an abundance of apoptotic cells. Here we show that these apoptotic cells carry functional T-cell receptors (TCRs), suggesting that apoptosis occurs during T-cell maturation. In contrast, viable Id1 transgenic CD4 single positive T cells exhibit costimulation-independent proliferation upon treatment with anti-CD3 antibody, probably due to a hyperresponse to TCR signaling. Furthermore, Id1 expression causes apoptosis of CD4 and CD8 double- or single-positive thymocytes in HY- or AND-TCR transgenic mice under conditions that normally support positive selection. Collectively, these results suggest that E2A and HEB proteins are crucial for controlling the threshold for TCR signaling, and Id1 expression lowers the threshold, resulting in apoptosis of developing thymocytes. PMID:15314144

  1. Differential cooperation between dHAND and three different E-proteins.

    PubMed

    Murakami, Masao; Kataoka, Keiichiro; Tominaga, Junji; Nakagawa, Osamu; Kurihara, Hiroki

    2004-10-01

    dHAND is a transcription factor belonging to the class B basic helix-loop-helix protein family and is expressed during embryogenesis in the heart, branchial arches, limb buds, and neural crest derivatives. Despite much study, the molecular mechanisms involved in the regulation of dHAND activity are not well understood. We therefore carried out yeast two-hybrid screening using full-length dHAND as bait, which led to identification of several dHAND-binding proteins, including three E-proteins: E2A, ME2, and ALF1. Subsequent analysis revealed that although their heterodimerization and transcriptional activities were similar, dHAND/E-protein heterodimers bind to an E-box element with differing affinities, suggesting they have distinct DNA binding specificities. Moreover, in situ hybridization showed that E-protein genes are expressed fairly ubiquitously among embryonic tissues, including the branchial arches and limb buds. By contrast, little signal was detected in the heart, suggesting that dHAND complexes with partners other than E-proteins in cardiac tissue. PMID:15351717

  2. MyoD induces myogenic differentiation through cooperation of its NH2- and COOH-terminal regions

    PubMed Central

    Ishibashi, Jeff; Perry, Robert L.; Asakura, Atsushi; Rudnicki, Michael A.

    2005-01-01

    MyoD and Myf5 are basic helix-loop-helix transcription factors that play key but redundant roles in specifying myogenic progenitors during embryogenesis. However, there are functional differences between the two transcription factors that impact myoblast proliferation and differentiation. Target gene activation could be one such difference. We have used microarray and polymerase chain reaction approaches to measure the induction of muscle gene expression by MyoD and Myf5 in an in vitro model. In proliferating cells, MyoD and Myf5 function very similarly to activate the expression of likely growth phase target genes such as L-myc, m-cadherin, Mcpt8, Runx1, Spp1, Six1, IGFBP5, and Chrnβ1. MyoD, however, is strikingly more effective than Myf5 at inducing differentiation-phase target genes. This distinction between MyoD and Myf5 results from a novel and unanticipated cooperation between the MyoD NH2- and COOH-terminal regions. Together, these results support the notion that Myf5 functions toward myoblast proliferation, whereas MyoD prepares myoblasts for efficient differentiation. PMID:16275751

  3. Nuclear translocation of Hand-1 acts as a molecular switch to regulate vascular radiosensitivity in medulloblastoma tumors: the protein uPAR is a cytoplasmic sequestration factor for Hand-1.

    PubMed

    Asuthkar, Swapna; Gogineni, Venkateswara Rao; Rao, Jasti S; Velpula, Kiran Kumar

    2014-05-01

    Urokinase-type plasminogen activator receptor (uPAR) is overexpressed in the tumor-stromal invasive microenvironment in many human cancers, including medulloblastoma. The role of uPAR in tumor progression and angiogenesis has been well characterized. Previously, in medulloblastoma cells, we showed that ionizing radiation (IR)-induced uPAR is a potent activator of cancer stem cell (CSC)-like properties and is associated with various transcription factors that are involved during embryonic development and cancer. In the present study, we show that uPAR protein acts as a cytoplasmic sequestration factor for a novel basic helix-loop-helix transcription factor, Hand-1. The Hand-1 protein plays an essential role in the differentiation of trophoblast giant cells and cardiac morphogenesis, and yet its precise cellular function and its contribution to cancer remain mostly unknown. We also observed that the Hand-1 protein is upregulated in uPAR short hairpin RNA-treated medulloblastoma cells and accompanies sustained cell growth and angiogenesis. Furthermore, IR-induced uPAR overexpression negatively regulates Hand-1 activity and results in the stabilization of angiogenesis-promoting molecules, including hypoxia-inducible factor-1α. Finally, uPAR overexpression and its association with Hand-1 after IR treatment indicate that uPAR is capable of regulating Hand-1 and that uPAR has a role in the process of IR-induced tumor angiogenesis. PMID:24623737

  4. scratch, a pan-neural gene encoding a zinc finger protein related to snail, promotes neuronal development.

    PubMed

    Roark, M; Sturtevant, M A; Emery, J; Vaessin, H; Grell, E; Bier, E

    1995-10-01

    The Drosophila scratch (scrt) gene is expressed in most or all neuronal precursor cells and encodes a predicted zinc finger transcription factor closely related to the product of the mesoderm determination gene snail (sna). Adult flies homozygous for scrt null alleles have a reduced number of photoreceptors in the eye, and embryos lacking the function of both scrt and the pan-neural gene deadpan (dpn), which encodes a basic helix-loop-helix (bHLH) protein, exhibit a significant loss of neurons. Conversely, ectopic expression of a scrt transgene during embryonic and adult development leads to the production of supernumerary neurons. Consistent with scrt functioning as a transcription factor, various genes are more broadly expressed than normal in scrt null mutants. Reciprocally, these same genes are expressed at reduced levels in response to ectopic scrt expression. We propose that scrt promotes neuronal cell fates by suppressing expression of genes promoting non-neuronal cell fates. We discuss the similarities between the roles of the ancestrally related scrt, sna, and escargot (esc) genes in regulating cell fate choices. PMID:7557390

  5. Twist1 Controls a Cell-Specification Switch Governing Cell Fate Decisions within the Cardiac Neural Crest

    PubMed Central

    Vincentz, Joshua W.; Firulli, Beth A.; Lin, Andrea; Spicer, Douglas B.; Howard, Marthe J.; Firulli, Anthony B.

    2013-01-01

    Neural crest cells are multipotent progenitor cells that can generate both ectodermal cell types, such as neurons, and mesodermal cell types, such as smooth muscle. The mechanisms controlling this cell fate choice are not known. The basic Helix-loop-Helix (bHLH) transcription factor Twist1 is expressed throughout the migratory and post-migratory cardiac neural crest. Twist1 ablation or mutation of the Twist-box causes differentiation of ectopic neuronal cells, which molecularly resemble sympathetic ganglia, in the cardiac outflow tract. Twist1 interacts with the pro-neural factor Sox10 via its Twist-box domain and binds to the Phox2b promoter to repress transcriptional activity. Mesodermal cardiac neural crest trans-differentiation into ectodermal sympathetic ganglia-like neurons is dependent upon Phox2b function. Ectopic Twist1 expression in neural crest precursors disrupts sympathetic neurogenesis. These data demonstrate that Twist1 functions in post-migratory neural crest cells to repress pro-neural factors and thereby regulate cell fate determination between ectodermal and mesodermal lineages. PMID:23555309

  6. Silencing of AP-4 inhibits proliferation, induces cell cycle arrest and promotes apoptosis in human lung cancer cells

    PubMed Central

    HU, XUANYU; GUO, WEI; CHEN, SHANSHAN; XU, YIZHUO; LI, PING; WANG, HUAQI; CHU, HEYING; LI, JUAN; DU, YUWEN; CHEN, XIAONAN; ZHANG, GUOJUN; ZHAO, GUOQIANG

    2016-01-01

    Activating enhancer-binding protein (AP)-4 is a member of the basic helix-loop-helix transcription factors, and is involved in tumor biology. However, the role of AP-4 in human lung cancer remains to be fully elucidated. In the present study, the expression of AP-4 in human lung cancer tissues and cells was investigated by reverse transcription-quantitative polymerase chain reaction, and it was observed that the level of AP-4 was increased in tumor tissues and cells compared with their normal counterparts. AP-4 expression was knocked down by transfection with a specific small interfering RNA (siRNA) in lung cancer cells, and this indicated that siRNA-mediated silencing of AP-4 inhibited cell proliferation, arrested the cell cycle at the G0/G1 phase and induced apoptosis by modulating the expression of p21 and cyclin D1. The results of the present study suggest that AP-4 may be an oncoprotein that has a significant role in lung cancer, and that siRNA-mediated silencing of AP-4 may have therapeutic potential as a strategy for the treatment of lung cancer. PMID:27313685

  7. Program specificity for Ptf1a in pancreas versus neural tube development correlates with distinct collaborating cofactors and chromatin accessibility.

    PubMed

    Meredith, David M; Borromeo, Mark D; Deering, Tye G; Casey, Bradford H; Savage, Trisha K; Mayer, Paul R; Hoang, Chinh; Tung, Kuang-Chi; Kumar, Manonmani; Shen, Chengcheng; Swift, Galvin H; Macdonald, Raymond J; Johnson, Jane E

    2013-08-01

    The lineage-specific basic helix-loop-helix transcription factor Ptf1a is a critical driver for development of both the pancreas and nervous system. How one transcription factor controls diverse programs of gene expression is a fundamental question in developmental biology. To uncover molecular strategies for the program-specific functions of Ptf1a, we identified bound genomic regions in vivo during development of both tissues. Most regions bound by Ptf1a are specific to each tissue, lie near genes needed for proper formation of each tissue, and coincide with regions of open chromatin. The specificity of Ptf1a binding is encoded in the DNA surrounding the Ptf1a-bound sites, because these regions are sufficient to direct tissue-restricted reporter expression in transgenic mice. Fox and Sox factors were identified as potential lineage-specific modifiers of Ptf1a binding, since binding motifs for these factors are enriched in Ptf1a-bound regions in pancreas and neural tube, respectively. Of the Fox factors expressed during pancreatic development, Foxa2 plays a major role. Indeed, Ptf1a and Foxa2 colocalize in embryonic pancreatic chromatin and can act synergistically in cell transfection assays. Together, these findings indicate that lineage-specific chromatin landscapes likely constrain the DNA binding of Ptf1a, and they identify Fox and Sox gene families as part of this process. PMID:23754747

  8. Recurrent Mutations in the Basic Domain of TWIST2 Cause Ablepharon Macrostomia and Barber-Say Syndromes.

    PubMed

    Marchegiani, Shannon; Davis, Taylor; Tessadori, Federico; van Haaften, Gijs; Brancati, Francesco; Hoischen, Alexander; Huang, Haigen; Valkanas, Elise; Pusey, Barbara; Schanze, Denny; Venselaar, Hanka; Vulto-van Silfhout, Anneke T; Wolfe, Lynne A; Tifft, Cynthia J; Zerfas, Patricia M; Zambruno, Giovanna; Kariminejad, Ariana; Sabbagh-Kermani, Farahnaz; Lee, Janice; Tsokos, Maria G; Lee, Chyi-Chia R; Ferraz, Victor; da Silva, Eduarda Morgana; Stevens, Cathy A; Roche, Nathalie; Bartsch, Oliver; Farndon, Peter; Bermejo-Sanchez, Eva; Brooks, Brian P; Maduro, Valerie; Dallapiccola, Bruno; Ramos, Feliciano J; Chung, Hon-Yin Brian; Le Caignec, Cédric; Martins, Fabiana; Jacyk, Witold K; Mazzanti, Laura; Brunner, Han G; Bakkers, Jeroen; Lin, Shuo; Malicdan, May Christine V; Boerkoel, Cornelius F; Gahl, William A; de Vries, Bert B A; van Haelst, Mieke M; Zenker, Martin; Markello, Thomas C

    2015-07-01

    Ablepharon macrostomia syndrome (AMS) and Barber-Say syndrome (BSS) are rare congenital ectodermal dysplasias characterized by similar clinical features. To establish the genetic basis of AMS and BSS, we performed extensive clinical phenotyping, whole exome and candidate gene sequencing, and functional validations. We identified a recurrent de novo mutation in TWIST2 in seven independent AMS-affected families, as well as another recurrent de novo mutation affecting the same amino acid in ten independent BSS-affected families. Moreover, a genotype-phenotype correlation was observed, because the two syndromes differed based solely upon the nature of the substituting amino acid: a lysine at TWIST2 residue 75 resulted in AMS, whereas a glutamine or alanine yielded BSS. TWIST2 encodes a basic helix-loop-helix transcription factor that regulates the development of mesenchymal tissues. All identified mutations fell in the basic domain of TWIST2 and altered the DNA-binding pattern of Flag-TWIST2 in HeLa cells. Comparison of wild-type and mutant TWIST2 expressed in zebrafish identified abnormal developmental phenotypes and widespread transcriptome changes. Our results suggest that autosomal-dominant TWIST2 mutations cause AMS or BSS by inducing protean effects on the transcription factor's DNA binding. PMID:26119818

  9. Integrated Expression Profiling and Genome-Wide Analysis of ChREBP Targets Reveals the Dual Role for ChREBP in Glucose-Regulated Gene Expression

    PubMed Central

    Lee, Yong Seok; Kim, Ha-Jung; Han, Jung-Youn; Im, Seung-Soon; Chong, Hansook Kim; Kwon, Je-Keun; Cho, Yun-Ho; Kim, Woo Kyung; Osborne, Timothy F.; Horton, Jay D.; Jun, Hee-Sook; Ahn, Yong-Ho; Ahn, Sung-Min; Cha, Ji-Young

    2011-01-01

    The carbohydrate response element binding protein (ChREBP), a basic helix-loop-helix/leucine zipper transcription factor, plays a critical role in the control of lipogenesis in the liver. To identify the direct targets of ChREBP on a genome-wide scale and provide more insight into the mechanism by which ChREBP regulates glucose-responsive gene expression, we performed chromatin immunoprecipitation-sequencing and gene expression analysis. We identified 1153 ChREBP binding sites and 783 target genes using the chromatin from HepG2, a human hepatocellular carcinoma cell line. A motif search revealed a refined consensus sequence (CABGTG-nnCnG-nGnSTG) to better represent critical elements of a functional ChREBP binding sequence. Gene ontology analysis shows that ChREBP target genes are particularly associated with lipid, fatty acid and steroid metabolism. In addition, other functional gene clusters related to transport, development and cell motility are significantly enriched. Gene set enrichment analysis reveals that ChREBP target genes are highly correlated with genes regulated by high glucose, providing a functional relevance to the genome-wide binding study. Furthermore, we have demonstrated that ChREBP may function as a transcriptional repressor as well as an activator. PMID:21811631

  10. Scaffold protein enigma homolog 1 overcomes the repression of myogenesis activation by inhibitor of DNA binding 2.

    PubMed

    Nakatani, Miyuki; Ito, Jumpei; Koyama, Riko; Iijima, Masumi; Yoshimoto, Nobuo; Niimi, Tomoaki; Kuroda, Shun'ichi; Maturana, Andrés D

    2016-05-27

    Enigma Homolog 1 (ENH1) is a scaffold protein for signaling proteins and transcription factors. Previously, we reported that ENH1 overexpression promotes the differentiation of C2C12 myoblasts. However, the molecular mechanism underlying the role of ENH1 in the C2C12 cells differentiation remains elusive. ENH1 was shown to inhibit the proliferation of neuroblastoma cells by sequestering Inhibitor of DNA binding protein 2 (Id2) in the cytosol. Id2 is a repressor of basic Helix-Loop-Helix transcription factors activity and prevents myogenesis. Here, we found that ENH1 overcome the Id2 repression of C2C12 cells myogenic differentiation and that ENH1 overexpression promotes mice satellite cells activation, the first step toward myogenic differentiation. In addition, we show that ENH1 interacted with Id2 in C2C12 cells and mice satellite cells. Collectively, our results suggest that ENH1 plays an important role in the activation of myogenesis through the repression of Id2 activity. PMID:27114303

  11. Bhlhe40 Represses PGC-1α Activity on Metabolic Gene Promoters in Myogenic Cells

    PubMed Central

    Chung, Shih Ying; Kao, Chien Han; Villarroya, Francesc; Chang, Hsin Yu; Chang, Hsuan Chia; Hsiao, Sheng Pin; Liou, Gunn-Guang

    2015-01-01

    PGC-1α is a transcriptional coactivator promoting oxidative metabolism in many tissues. Its expression in skeletal muscle (SKM) is induced by hypoxia and reactive oxidative species (ROS) generated during exercise, suggesting that PGC-1α might mediate the cross talk between oxidative metabolism and cellular responses to hypoxia and ROS. Here we found that PGC-1α directly interacted with Bhlhe40, a basic helix-loop-helix (bHLH) transcriptional repressor induced by hypoxia, and protects SKM from ROS damage, and they cooccupied PGC-1α-targeted gene promoters/enhancers, which in turn repressed PGC-1α transactivational activity. Bhlhe40 repressed PGC-1α activity through recruiting histone deacetylases (HDACs) and preventing the relief of PGC-1α intramolecular repression caused by its own intrinsic suppressor domain. Knockdown of Bhlhe40 mRNA increased levels of ROS, fatty acid oxidation, mitochondrial DNA, and expression of PGC-1α target genes. Similar effects were also observed when the Bhlhe40-mediated repression was rescued by a dominantly active form of the PGC-1α-interacting domain (PID) from Bhlhe40. We further found that Bhlhe40-mediated repression can be largely relieved by exercise, in which its recruitment to PGC-1α-targeted cis elements was significantly reduced. These observations suggest that Bhlhe40 is a novel regulator of PGC-1α activity repressing oxidative metabolism gene expression and mitochondrion biogenesis in sedentary SKM. PMID:25963661

  12. Arabidopsis MYC2 Interacts with DELLA Proteins in Regulating Sesquiterpene Synthase Gene Expression[W][OA

    PubMed Central

    Hong, Gao-Jie; Xue, Xue-Yi; Mao, Ying-Bo; Wang, Ling-Jian; Chen, Xiao-Ya

    2012-01-01

    Arabidopsis thaliana flowers emit volatile terpenes, which may function in plant–insect interactions. Here, we report that Arabidopsis MYC2, a basic helix-loop-helix transcription factor, directly binds to promoters of the sesquiterpene synthase genes TPS21 and TPS11 and activates their expression. Expression of TPS21 and TPS11 can be induced by the phytohormones gibberellin (GA) and jasmonate (JA), and both inductions require MYC2. The induction of TPS21 and TPS11 results in increased emission of sesquiterpene, especially (E)-β-caryophyllene. DELLAs, the GA signaling repressors, negatively affect sesquiterpene biosynthesis, as the sesquiterpene synthase genes were repressed in plants overaccumulating REPRESSOR OF GA1-3 (RGA), one of the Arabidopsis DELLAs, and upregulated in a penta DELLA-deficient mutant. Yeast two-hybrid and coimmunoprecipitation assays demonstrated that DELLAs, represented by RGA, directly interact with MYC2. In yeast cells, the N terminus of MYC2 was responsible for binding to RGA. MYC2 has been proposed as a major mediator of JA signaling and crosstalk with abscisic acid, ethylene, and light signaling pathways. Our results demonstrate that MYC2 is also connected to GA signaling in regulating a subset of genes. In Arabidopsis inflorescences, it integrates both GA and JA signals into transcriptional regulation of sesquiterpene synthase genes and promotes sesquiterpene production. PMID:22669881

  13. MK615, a Prunus mume Steb. Et Zucc ('Ume') extract, attenuates the growth of A375 melanoma cells by inhibiting the ERK1/2-Id-1 pathway.

    PubMed

    Tada, Ko-ichi; Kawahara, Ko-ichi; Matsushita, Shigeto; Hashiguchi, Teruto; Maruyama, Ikuro; Kanekura, Takuro

    2012-06-01

    The Japanese apricot, a commonly consumed food called 'Ume' in Japan, has been used for a traditional Japanese medicine for centuries. MK615, an extract of compounds from 'Ume', has strong antitumorigenic and antiinflammatory effects including the induction of apoptosis and autophagy, and inhibition of cytokine production mediated via the inhibition of MAPKs signaling including ERK-1/2, JNK and p38MAPK. The inhibitor of DNA binding 1 (Id-1), a basic helix-loop-helix (bHLH) transcription factor family, is essential for DNA binding and the transcriptional regulation of various proteins that play important roles in the development, progression and invasion of tumors. In melanoma, Id-1 is constitutively expressed in the late and early stages, suggesting it as a therapeutic target in patients with melanoma. This study reports that MK615 profoundly reduced both the mRNA- and protein expression levels of Id-1 and inhibited cell growth in A375 melanoma cells. MK615 markedly inhibited the phosphorylation of ERK1/2, which is associated with Id-1 protein expression in A375 cells. Id-1-specific RNAi induced the death of A375 cells. Moreover, the expression of Bcl-2 was decreased by both MK615 and Id-1-specific RNAi in A375 cells. The results suggest that MK615 is a potential therapeutic agent for treating malignant melanoma. PMID:22076920

  14. BARREN STALK FASTIGIATE1 Is an AT-Hook Protein Required for the Formation of Maize Ears[W][OA

    PubMed Central

    Gallavotti, Andrea; Malcomber, Simon; Gaines, Craig; Stanfield, Sharon; Whipple, Clinton; Kellogg, Elizabeth; Schmidt, Robert J.

    2011-01-01

    Ears are the seed-bearing inflorescences of maize (Zea mays) plants and represent a crucial component of maize yield. The first step in the formation of ears is the initiation of axillary meristems in the axils of developing leaves. In the classic maize mutant barren stalk fastigiate1 (baf1), first discovered in the 1950s, ears either do not form or, if they do, are partially fused to the main stalk. We positionally cloned Baf1 and found that it encodes a transcriptional regulator containing an AT-hook DNA binding motif. Single coorthologs of Baf1 are found in syntenic regions of brachypodium (Brachypodium distachyon), rice (Oryza sativa), and sorghum (Sorghum bicolor), suggesting that the gene is likely present in all cereal species. Protein–protein interaction assays suggest that BAF1 is capable of forming homodimers and heterodimers with other members of the AT-hook family. Another transcriptional regulator required for ear initiation is the basic helix-loop-helix protein BARREN STALK1 (BA1). Genetic and expression analyses suggest that Baf1 is required to reach a threshold level of Ba1 expression for the initiation of maize ears. We propose that Baf1 functions in the demarcation of a boundary region essential for the specification of a stem cell niche. PMID:21540434

  15. Enhancer mutations of Akv murine leukemia virus inhibit the induction of mature B-cell lymphomas and shift disease specificity towards the more differentiated plasma cell stage

    SciTech Connect

    Sorensen, Karina Dalsgaard; Kunder, Sandra; Quintanilla-Martinez, Leticia; Sorensen, Jonna; Schmidt, Joerg; Pedersen, Finn Skou . E-mail: fsp@mb.au.dk

    2007-05-25

    This study investigates the role of the proviral transcriptional enhancer for B-lymphoma induction by exogenous Akv murine leukemia virus. Infection of newborn inbred NMRI mice with Akv induced 35% plasma cell proliferations (PCPs) (consistent with plasmacytoma), 33% diffuse large B-cell lymphomas, 25% follicular B-cell lymphomas and few splenic marginal zone and small B-cell lymphomas. Deleting one copy of the 99-bp proviral enhancer sequence still allowed induction of multiple B-cell tumor types, although PCPs dominated (77%). Additional mutation of binding sites for the glucocorticoid receptor, Ets, Runx, or basic helix-loop-helix transcription factors in the proviral U3 region, however, shifted disease induction to almost exclusively PCPs, but had no major influence on tumor latency periods. Southern analysis of immunoglobulin rearrangements and ecotropic provirus integration patterns showed that many of the tumors/cell proliferations induced by each virus were polyclonal. Our results indicate that enhancer mutations weaken the ability of Akv to induce mature B-cell lymphomas prior to the plasma cell stage, whereas development of plasma cell proliferations is less dependent of viral enhancer strength.

  16. C. elegans SoxB genes are dispensable for embryonic neurogenesis but required for terminal differentiation of specific neuron types

    PubMed Central

    Vidal, Berta; Santella, Anthony; Serrano-Saiz, Esther; Bao, Zhirong; Chuang, Chiou-Fen; Hobert, Oliver

    2015-01-01

    Neurogenesis involves deeply conserved patterning molecules, such as the proneural basic helix-loop-helix transcription factors. Sox proteins and specifically members of the SoxB and SoxC groups are another class of conserved transcription factors with an important role in neuronal fate commitment and differentiation in various species. In this study, we examine the expression of all five Sox genes of the nematode C. elegans and analyze the effect of null mutant alleles of all members of the SoxB and SoxC groups on nervous system development. Surprisingly, we find that, unlike in other systems, neither of the two C. elegans SoxB genes sox-2 (SoxB1) and sox-3 (SoxB2), nor the sole C. elegans SoxC gene sem-2, is broadly expressed throughout the embryonic or adult nervous system and that all three genes are mostly dispensable for embryonic neurogenesis. Instead, sox-2 is required to maintain the developmental potential of blast cells that are generated in the embryo but divide only postembryonically to give rise to differentiated neuronal cell types. Moreover, sox-2 and sox-3 have selective roles in the terminal differentiation of specific neuronal cell types. Our findings suggest that the common themes of SoxB gene function across phylogeny lie in specifying developmental potential and, later on, in selectively controlling terminal differentiation programs of specific neuron types, but not in broadly controlling neurogenesis. PMID:26153233

  17. Peroxisome Proliferator-Activated Receptorα Agonists Differentially Regulate Inhibitor of DNA Binding Expression in Rodents and Human Cells

    PubMed Central

    González, María del Carmen; Corton, J. Christopher; Acero, Nuria; Muñoz-Mingarro, Dolores; Quirós, Yolanda; Álvarez-Millán, Juan José; Herrera, Emilio; Bocos, Carlos

    2012-01-01

    Inhibitor of DNA binding (Id2) is a helix-loop-helix (HLH) transcription factor that participates in cell differentiation and proliferation. Id2 has been linked to the development of cardiovascular diseases since thiazolidinediones, antidiabetic agents and peroxisome proliferator-activated receptor (PPAR) gamma agonists, have been reported to diminish Id2 expression in human cells. We hypothesized that PPARα activators may also alter Id2 expression. Fenofibrate diminished hepatic Id2 expression in both late pregnant and unmated rats. In 24 hour fasted rats, Id2 expression was decreased under conditions known to activate PPARα. In order to determine whether the fibrate effects were mediated by PPARα, wild-type mice and PPARα-null mice were treated with Wy-14,643 (WY). WY reduced Id2 expression in wild-type mice without an effect in PPARα-null mice. In contrast, fenofibrate induced Id2 expression after 24 hours of treatment in human hepatocarcinoma cells (HepG2). MK-886, a PPARα antagonist, did not block fenofibrate-induced activation of Id2 expression, suggesting a PPARα-independent effect was involved. These findings confirm that Id2 is a gene responsive to PPARα agonists. Like other genes (apolipoprotein A-I, apolipoprotein A-V), the opposite directional transcriptional effect in rodents and a human cell line further emphasizes that PPARα agonists have different effects in rodents and humans. PMID:22701468

  18. Peroxisome proliferator-activated receptorα agonists differentially regulate inhibitor of DNA binding expression in rodents and human cells.

    PubMed

    González, María Del Carmen; Corton, J Christopher; Acero, Nuria; Muñoz-Mingarro, Dolores; Quirós, Yolanda; Alvarez-Millán, Juan José; Herrera, Emilio; Bocos, Carlos

    2012-01-01

    Inhibitor of DNA binding (Id2) is a helix-loop-helix (HLH) transcription factor that participates in cell differentiation and proliferation. Id2 has been linked to the development of cardiovascular diseases since thiazolidinediones, antidiabetic agents and peroxisome proliferator-activated receptor (PPAR) gamma agonists, have been reported to diminish Id2 expression in human cells. We hypothesized that PPARα activators may also alter Id2 expression. Fenofibrate diminished hepatic Id2 expression in both late pregnant and unmated rats. In 24 hour fasted rats, Id2 expression was decreased under conditions known to activate PPARα. In order to determine whether the fibrate effects were mediated by PPARα, wild-type mice and PPARα-null mice were treated with Wy-14,643 (WY). WY reduced Id2 expression in wild-type mice without an effect in PPARα-null mice. In contrast, fenofibrate induced Id2 expression after 24 hours of treatment in human hepatocarcinoma cells (HepG2). MK-886, a PPARα antagonist, did not block fenofibrate-induced activation of Id2 expression, suggesting a PPARα-independent effect was involved. These findings confirm that Id2 is a gene responsive to PPARα agonists. Like other genes (apolipoprotein A-I, apolipoprotein A-V), the opposite directional transcriptional effect in rodents and a human cell line further emphasizes that PPARα agonists have different effects in rodents and humans. PMID:22701468

  19. Ccndbp1 is a new positive regulator of skeletal myogenesis.

    PubMed

    Huang, Yan; Chen, Bohong; Ye, Miaoman; Liang, Puping; Zhangfang, Yingnan; Huang, Junjiu; Liu, Mingyao; Songyang, Zhou; Ma, Wenbin

    2016-07-15

    Skeletal myogenesis is a multistep process in which basic helix-loop-helix (bHLH) transcription factors, such as MyoD (also known as MyoD1), bind to E-boxes and activate downstream genes. Ccndbp1 is a HLH protein that lacks a DNA-binding region, and its function in skeletal myogenesis is currently unknown. We generated Ccndbp1-null mice by using CRISPR-Cas9. Notably, in Ccndbp1-null mice, the cross sectional area of the skeletal tibialis anterior muscle was smaller, and muscle regeneration ability and grip strength were impaired, compared with those of wild type. This phenotype resembled that of myofiber hypotrophy in some human myopathies or amyoplasia. Ccndbp1 expression was upregulated during C2C12 myogenesis. Ccndbp1 overexpression promoted myogenesis, whereas knockdown of Ccndbp1 inhibited myogenic differentiation. Co-transfection of Ccndbp1 with MyoD and/or E47 (encoded by TCF3) significantly enhanced E-box-dependent transcription. Furthermore, Ccndbp1 physically associated with MyoD but not E47. These data suggest that Ccndbp1 regulates muscle differentiation by interacting with MyoD and enhancing its binding to target genes. Our study newly identifies Ccndbp1 as a positive modulator of skeletal myogenic differentiation in vivo and in vitro, providing new insights in order to decipher the complex network involved in skeletal myogenic development and related diseases. PMID:27235421

  20. Myelinogenesis and axonal recognition by oligodendrocytes in brain are uncoupled in Olig1-null mice.

    PubMed

    Xin, Mei; Yue, Tao; Ma, Zhenyi; Wu, Fen-fen; Gow, Alexander; Lu, Q Richard

    2005-02-01

    Myelin-forming oligodendrocytes facilitate saltatory nerve conduction and support neuronal functions in the mammalian CNS. Although the processes of oligodendrogliogenesis and differentiation from neural progenitor cells have come to light in recent years, the molecular mechanisms underlying oligodendrocyte myelinogenesis are poorly defined. Herein, we demonstrate the pivotal role of the basic helix-loop-helix transcription factor, Olig1, in oligodendrocyte myelinogenesis in brain development. Mice lacking a functional Olig1 gene develop severe neurological deficits and die in the third postnatal week. In the brains of these mice, expression of myelin-specific genes is abolished, whereas the formation of oligodendrocyte progenitors is not affected. Furthermore, multilamellar wrapping of myelin membranes around axons does not occur, despite recognition and contact of axons by oligodendrocytes, and Olig1-null mice develop widespread progressive axonal degeneration and gliosis. In contrast, myelin sheaths are formed in the spinal cord, although the extent of myelination is severely reduced. At the molecular level, we find that Olig1 regulates transcription of the major myelin-specific genes, Mbp, Plp1, and Mag, and suppresses expression of a major astrocyte-specific gene, Gfap. Together, our data indicate that Olig1 is a central regulator of oligodendrocyte myelinogenesis in brain and that axonal recognition and myelination by oligodendrocytes are separable processes. PMID:15703389

  1. SIM2 maintains innate host defense of the small intestine.

    PubMed

    Chen, Kuan-Jung; Lizaso, Analyn; Lee, Ying-Hue

    2014-12-01

    The single-minded 2 (SIM2) protein is a basic helix-loop-helix transcription factor regulating central nervous system (CNS) development in Drosophila. In humans, SIM2 is located within the Down syndrome critical region on chromosome 21 and may be involved in the development of mental retardation phenotype in Down syndrome. In this study, knockout of SIM2 expression in mice resulted in a gas distention phenotype in the gastrointestinal tract. We found that SIM2 is required for the expression of all cryptdins and numerous other antimicrobial peptides (AMPs) expressed in the small intestine. The mechanism underlying how SIM2 controls AMP expression involves both direct and indirect regulations. For the cryptdin genes, SIM2 regulates their expression by modulating transcription factor 7-like 2, a crucial regulator in the Wnt/β-catenin signaling pathway, while for other AMP genes, such as RegIIIγ, SIM2 directly activates their promoter activity. Our results establish that SIM2 is a crucial regulator in controlling expression of intestinal AMPs to maintain intestinal innate immunity against microbes. PMID:25277798

  2. Structure and Dimerization Properties of the Aryl Hydrocarbon Receptor PAS-A Domain

    PubMed Central

    Wu, Dalei; Potluri, Nalini; Kim, Youngchang

    2013-01-01

    The aryl hydrocarbon receptor (AHR) is a ligand-dependent transcription factor that binds to xenobiotics and responds by regulating the expression of gene programs required for detoxification and metabolism. AHR and its heterodimerization partner aryl hydrocarbon receptor nuclear translocator (ARNT) belong to the basic helix-loop-helix (bHLH)–PER-ARNT-SIM (PAS) family of transcription factors. Here we report the 2.55-Å-resolution crystal structure of the mouse AHR PAS-A domain, which represents the first AHR-derived protein structure. The AHR PAS-A domain forms a helix-swapped homodimer in the crystal and also in solution. Through a detailed mutational analysis of all interface residues, we identified several hydrophobic residues that are important for AHR dimerization and function. Our crystallographic visualization of AHR PAS-A dimerization leads us to propose a mode of heterodimerization with ARNT that is supported by both biochemical and cell-based data. Our studies also highlight the residues of other mammalian bHLH-PAS proteins that are likely involved in their homo- or heterodimerization. PMID:24001774

  3. WRKY transcription factors

    PubMed Central

    Bakshi, Madhunita; Oelmüller, Ralf

    2014-01-01

    WRKY transcription factors are one of the largest families of transcriptional regulators found exclusively in plants. They have diverse biological functions in plant disease resistance, abiotic stress responses, nutrient deprivation, senescence, seed and trichome development, embryogenesis, as well as additional developmental and hormone-controlled processes. WRKYs can act as transcriptional activators or repressors, in various homo- and heterodimer combinations. Here we review recent progress on the function of WRKY transcription factors in Arabidopsis and other plant species such as rice, potato, and parsley, with a special focus on abiotic, developmental, and hormone-regulated processes. PMID:24492469

  4. Plant transcription factors.

    PubMed

    Meshi, T; Iwabuchi, M

    1995-12-01

    Transcriptional regulation of gene expression relies on the recognition of promoter elements by transcription factors. In the past several years, a considerable number of (putative) transcription factors have been identified in plants. Some genes coding for these factors were isolated by south-western screening with oligonucleotides as a probe or by homology-based screening, and others were initially isolated by genetic means and subsequently identified as the genes for transcription factors. These transcription factors often form families of structurally related proteins with similar DNA-binding specificities and in addition, they are sometimes involved in related phenomena. Some groups of factors homo- and/or heterodimerize to increase the length and variability of the target sequences. Transcriptional activators, in general, comprise a modular activation domain. The activities of the transcription factors are controlled by post-translational modification, like phosphorylation and glycosylation, as well as at the levels of nuclear transport, oligomerization, etc. In this review, we will summarize the current knowledge of plant transcription factors to help understand the mechanistic aspects of the transcriptional regulation of genes. PMID:8589926

  5. Transcriptional activators in yeast

    PubMed Central

    2006-01-01

    Eukaryotic transcription activation domains (ADs) are not well defined on the proteome scale. We systematicallly tested ∼6000 yeast proteins for transcriptional activity using a yeast one-hybrid system and identified 451 transcriptional activators. We then determined their transcription activation strength using fusions to the Gal4 DNA-binding domain and a His3 reporter gene which contained a promoter with a Gal4-binding site. Among the 132 strongest activators 32 are known transcription factors while another 35 have no known function. Although zinc fingers, helix–loop–helix domains and several other domains are highly overrepresented among the activators, only few contain characterized ADs. We also found some striking correlations: the stronger the activation activity, the more acidic, glutamine-rich, proline-rich or asparagine-rich the activators were. About 29% of the activators have been found previously to specifically interact with the transcription machinery, while 10% are known to be components of transcription regulatory complexes. Based on their transcriptional activity, localization and interaction patterns, at least six previously uncharacterized proteins are suggested to be bona fide transcriptional regulators (namely YFL049W, YJR070C, YDR520C, YGL066W/Sgf73, YKR064W and YCR082W/Ahc2). PMID:16464826

  6. Divergent RNA transcription

    PubMed Central

    Naughton, Catherine; Corless, Samuel; Gilbert, Nick

    2013-01-01

    New approaches using biotinylated-psoralen as a probe for investigating DNA structure have revealed new insights into the relationship between DNA supercoiling, transcription and chromatin compaction. We explore a hypothesis that divergent RNA transcription generates negative supercoiling at promoters facilitating initiation complex formation and subsequent promoter clearance. PMID:23863199

  7. Direct effects of vitamin D3 analogues on G-protein mediated signalling systems in rat osteosarcoma cells and rat pituitary adenoma cells.

    PubMed

    Mortensen, B M; Lund, H W; Jablonski, G; Paulssen, R H; Gordeladze, J O

    1995-06-01

    In normal rats treated with 1,25(OH)2D3 or 24,25(OH)2D3, serum Ca2+, ALP, PRL and GH are significantly altered. In order to study the primary effect of vitamin D3 analogues on target organ function, rat UMR 106 osteosarcoma and GH3 pituitary adenoma cells in monolayer culture were exposed accordingly. Surprisingly, prolonged exposure of these cell lines to physiological levels of either 1,25(OH)2D3 or 24,25(OH)2D3 did not significantly affect the secretory parameters (ALP, PRL or GH) tested. However, 1,25(OH)2D3 exposure significantly reduced PTH- and Gpp(NH)p-elicited AC as well as Gpp(NH)p-stimulated PLC activities in the UMR 106 cells. These changes were accompanied by an increase and decrease in the membrane contents of the G-protein subunits G36 beta and Gq/11 alpha, respectively. In contrast, 24,25(OH)2D3 remained without significant biological effect on these signalling systems despite concomitantly augmented levels of G36 beta. TRH- and Gpp(NH)p-elicited PLC activities in the GH3 cells were significantly reduced by 1,25(OH)2D3 with a concurrent reduction in cellular amounts of Gq/11 alpha, however, 24,25(OH)2D3 did not significantly alter any signalling systems nor G-proteins analyzed. It is concluded that the osteoblastic and pituitary cell secretion of ALP, PRL and GH remain unaffected by the presence of 1,25(OH)2D3 and 24,25(OH)2D3, despite distinct alterations in components of G-protein mediated signalling pathways. Hence, other factors like ambient Ca2+ may be responsible for the perturbed secretory patterns of ALP and PRL seen in vitamin D3 treated rats. PMID:7579039

  8. Attenuation of G protein-mediated inhibition of N-type calcium currents by expression of caveolins in mammalian NG108–15 cells

    PubMed Central

    Toselli, M; Taglietti, V; Parente, V; Flati, S; Pavan, A; Guzzi, F; Parenti, M

    2001-01-01

    Caveolins are integral proteins of glycolipid/cholesterol-rich plasmalemmal caveolae domains, where, they may function as a plasma membrane scaffold onto which many classes of signalling molecules, including receptors and heterotrimeric G proteins, can assemble. To ascertain whether caveolins influence G protein-mediated signal transduction, we stably expressed caveolin-1 and −3 isoforms in the neuroblastoma × glioma NG108–15 hybrid cell line, lacking endogenous caveolins. Subsequently, using whole-cell voltage clamp methods, we examined whether the modulation of N-type voltage-gated Ca2+ channels by Go protein-coupled, δ-type opioid receptors might be affected by recombinant caveolin expression. In transfected NG108–15 cells, caveolins localized at the plasma membrane and, upon subcellular fractionation on sucrose density gradients, they co-localized in Triton-resistant, low buoyancy fractions, with endogenous Go protein α-subunits. The voltage-dependent inhibition of ω-conotoxin GVIA-sensitive Ba2+ currents following either activation of δ-opioid receptors by the agonist [o-pen2,o-pen5]-enkephalin (DPDPE), or direct stimulation of G proteins with guanosine 5′-O-(thiotriphosphate) (GTPγS) was significantly attenuated in caveolin-expressing cells. The kinetics of Ca2+ channel inhibition were also modified by caveolins. Overall, these results suggest that caveolins may negatively affect G protein-dependent regulation of voltage-gated N-type Ca2+ channels, presumably by causing a reduction of the available pool of activated G proteins. PMID:11600672

  9. Inhibitory PAS domain protein is a negative regulator of hypoxia-inducible gene expression

    NASA Astrophysics Data System (ADS)

    Makino, Yuichi; Cao, Renhai; Svensson, Kristian; Bertilsson, Göran; Asman, Mikael; Tanaka, Hirotoshi; Cao, Yihai; Berkenstam, Anders; Poellinger, Lorenz

    2001-11-01

    Alteration of gene expression is a crucial component of adaptive responses to hypoxia. These responses are mediated by hypoxia-inducible transcription factors (HIFs). Here we describe an inhibitory PAS (Per/Arnt/Sim) domain protein, IPAS, which is a basic helix-loop-helix (bHLH)/PAS protein structurally related to HIFs. IPAS contains no endogenous transactivation function but demonstrates dominant negative regulation of HIF-mediated control of gene expression. Ectopic expression of IPAS in hepatoma cells selectively impairs induction of genes involved in adaptation to a hypoxic environment, notably the vascular endothelial growth factor (VEGF) gene, and results in retarded tumour growth and tumour vascular density in vivo. In mice, IPAS was predominantly expressed in Purkinje cells of the cerebellum and in corneal epithelium of the eye. Expression of IPAS in the cornea correlates with low levels of expression of the VEGF gene under hypoxic conditions. Application of an IPAS antisense oligonucleotide to the mouse cornea induced angiogenesis under normal oxygen conditions, and demonstrated hypoxia-dependent induction of VEGF gene expression in hypoxic corneal cells. These results indicate a previously unknown mechanism for negative regulation of angiogenesis and maintenance of an avascular phenotype.

  10. Identification and characterization of an anti-oxidative stress-associated mutant of Aspergillus fumigatus transformed by Agrobacterium tumefaciens

    PubMed Central

    FAN, ZHONGQI; YU, HUIMEI; GUO, QI; HE, DAN; XUE, BAIJI; XIE, XIANGLI; YOKOYAMA, KOJI; WANG, LI

    2016-01-01

    Aspergillus fumigatus is one of the most common opportunistic pathogenic fungi, surviving in various environmental conditions. Maintenance of the redox homeostasis of the fungus relies upon the well-organized regulation between reactive oxygen species generated by immune cells or its own organelles, and the activated anti-oxidative stress mechanism. To investigate such a mechanism, the present study obtained a number of randomly-inserted mutants of A. fumigatus, mediated by Agrobacterium tumefaciens. In addition, a high throughput hydrogen peroxide screening system was established to examine ~1,000 mutants. A total of 100 mutants exhibited changes in hydrogen peroxide sensitivity, among which a significant increase in sensitivity was observed in the AFM2658 mutant. Further investigations of the mutant were also performed, in which the sequence of this mutant was characterized using thermal asymmetric interlaced-polymerase chain reaction. This revealed that the insertion site was located on chromosome 2 afu1_92, and the 96 bp sequence was knocked out, which partially comprised a sequence localized between the integral membrane protein coding region and the helix-loop-helix transcription factor coding region. A decrease in the levels of anti-oxidative stress-associated mRNAs were observed, and an increase in reactive oxygen species were detected using fluorescence. The results of the present study demonstrated that this sequence may have a protective role in A. fumigatus in the presence of oxidative stress. PMID:26847000

  11. DAPT mediates atoh1 expression to induce hair cell-like cells

    PubMed Central

    Ren, Hongmiao; Guo, Weiwei; Liu, Wei; Gao, Weiqiang; Xie, Dinghua; Yin, Tuanfang; Yang, Shiming; Ren, Jihao

    2016-01-01

    Hearing loss is currently an incurable degenerative disease characterized by a paucity of hair cells (HCs), which cannot be spontaneously replaced in mammals. Recent technological advancements in gene therapy and local drug delivery have shed new light for hearing loss. Atoh1, also known as Math1, Hath1, and Cath1, is a proneural basic helix-loop-helix (bHLH) transcription factor that is essential for HC differentiation. At various stages in development, Atoh1 activity is sufficient to drive HC differentiation in the cochlea. Thus, Atoh1 related gene therapy is the most promising option for HC induction. DAPT, an inhibitor of Notch signaling, enhances the expression of Atoh1 indirectly, which in turn promotes the induction of a HC fate. Here, we show that DAPT cooperates with Atoh1 to synergistically promote HC fate in ependymal cells in vitro and promote hair cell regeneration in the cultured basilar membrane (BM) which mimics the microenvironment in vivo. Taken together, our findings demonstrated that DAPT is sufficient to induce HC-like cells via enhancing of the expression of Atoh1 to inhibit the progression of HC apoptosis and to induce new HC formation. PMID:27158355

  12. Mga is essential for the survival of pluripotent cells during peri-implantation development.

    PubMed

    Washkowitz, Andrew J; Schall, Caroline; Zhang, Kun; Wurst, Wolfgang; Floss, Thomas; Mager, Jesse; Papaioannou, Virginia E

    2015-01-01

    The maintenance and control of pluripotency is of great interest in stem cell biology. The dual specificity T-box/basic-helix-loop-helix-zipper transcription factor Mga is expressed in the pluripotent cells of the inner cell mass (ICM) and epiblast of the peri-implantation mouse embryo, but its function has not been investigated previously. Here, we use a loss-of-function allele and RNA knockdown to demonstrate that Mga depletion leads to the death of proliferating pluripotent ICM cells in vivo and in vitro, and the death of embryonic stem cells (ESCs) in vitro. Additionally, quiescent pluripotent cells lacking Mga are lost during embryonic diapause. Expression of Odc1, the rate-limiting enzyme in the conversion of ornithine into putrescine in the synthesis of polyamines, is reduced in Mga mutant cells, and the survival of mutant ICM cells as well as ESCs is rescued in culture by the addition of exogenous putrescine. These results suggest a mechanism whereby Mga influences pluripotent cell survival through regulation of the polyamine pool in pluripotent cells of the embryo, whether they are in a proliferative or quiescent state. PMID:25516968

  13. Hesr1 knockout mice exhibit behavioral alterations through the dopaminergic nervous system.

    PubMed

    Fuke, Satoshi; Minami, Natsumi; Kokubo, Hiroki; Yoshikawa, Ayumu; Yasumatsu, Hiroshi; Sasagawa, Noboru; Saga, Yumiko; Tsukahara, Toshifumi; Ishiura, Shoichi

    2006-11-15

    The basic helix-loop-helix (bHLH) transcriptional factor Hesr1 gene (hairy and enhancer of split-related 1, also called Hey1/HRT1/CHF2/HERP2) has been identified and characterized as a member of the subfamily of hairy/Enhancer of split, and shown to be involved in cardiovascular and neural development. We report that HESR1 binds directly to a part of the 3' non-coding region of the human dopamine transporter (DAT1) gene and represses the endogenous DAT1 gene in HEK293 cells. To investigate functions of the HESR1 gene in the dopaminergic nervous system in vivo, we analyzed the expressions of dopamine-related genes in the postnatal day 0 whole brains of Hesr1 knockout mice by real-time RT-PCR analysis. Several dopamine-related genes, such as DAT, dopamine receptors D1, D2, D4, and D5, were significantly upregulated. Moreover, young adults of Hesr1 knockout mice showed a decrease in spontaneous locomotor activity and a reduction in exploratory behavior or behavioral responses to novelty in the open-field, and elevated plus-maze tests. These results indicate that the HESR1 gene is related to neuropsychiatric disorders and behavioral traits through the dopaminergic nervous system. PMID:16998899

  14. Rice Undeveloped Tapetum1 Is a Major Regulator of Early Tapetum DevelopmentW⃞

    PubMed Central

    Jung, Ki-Hong; Han, Min-Jung; Lee, Yang-Seok; Kim, Yong-Woo; Hwang, Inhwan; Kim, Min-Jeong; Kim, Yeon-Ki; Nahm, Baek Hie; An, Gynheung

    2005-01-01

    The tapetum, the innermost of four sporophytic layers in the anther wall, comes in direct contact with the developing male gametophyte and is thought to play a crucial role in the development and maturation of microspores. Here, we report the identification of rice (Oryza sativa) Undeveloped Tapetum1 (Udt1), which is required for the differentiation of secondary parietal cells to mature tapetal cells. T-DNA or retrotransposon Tos17 insertions in the Udt1 gene caused male sterility. The anther walls and meiocytes of the mutants were normal during the early premeiosis stage, but their tapeta failed to differentiate and became vacuolated during the meiotic stage. In addition, meiocytes did not develop to microspores, and middle layer degeneration was inhibited. Consequently, the anther locules contained no pollen. The UDT1:green fluorescent protein fusion protein was localized to the nucleus. This, together with its homology with other basic helix-loop-helix proteins, suggests that UDT1 is a transcription factor. DNA microarray analysis identified 958 downregulated and 267 upregulated genes in the udt1-1 anthers, suggesting that Udt1 plays a major role in maintaining tapetum development, starting in early meiosis. PMID:16141453

  15. Tfe3 expression is closely associated to macrophage terminal differentiation of human hematopoietic myeloid precursors

    SciTech Connect

    Zanocco-Marani, Tommaso; Vignudelli, Tatiana; Gemelli, Claudia; Pirondi, Sara; Testa, Anna; Montanari, Monica; Parenti, Sandra; Tenedini, Elena; Grande, Alexis; Ferrari, Sergio . E-mail: sergio@unimo.it

    2006-12-10

    The MItf-Tfe family of basic helix-loop-helix leucine zipper (bHLH-Zip) transcription factors encodes four family members: MItf, Tfe3, TfeB and TfeC. In vitro, each protein of the family binds DNA in a homo- or heterodimeric form with other family members. Tfe3 is involved in chromosomal translocations recurrent in different tumors and it has been demonstrated, by in vivo studies, that it plays, redundantly with MItf, an important role in the process of osteoclast formation, in particular during the transition from mono-nucleated to multi-nucleated osteoclasts. Since mono-nucleated osteoclasts derive from macrophages we investigated whether Tfe3 might play a role upstream during hematopoietic differentiation. Here we show that Tfe3 is able to induce mono-macrophagic differentiation of U937 cells, in association with a decrease of cell proliferation and an increase of apoptosis. We also show that Tfe3 does not act physiologically during commitment of CD34+ hematopoietic stem cells (HSCs), since it is not able to direct HSCs toward a specific lineage as observed by clonogenic assay, but is a strong actor of terminal differentiation since it allows human primary myeloblasts' maturation toward the macrophage lineage.

  16. Mga is essential for the survival of pluripotent cells during peri-implantation development

    PubMed Central

    Washkowitz, Andrew J.; Schall, Caroline; Zhang, Kun; Wurst, Wolfgang; Floss, Thomas; Mager, Jesse; Papaioannou, Virginia E.

    2015-01-01

    The maintenance and control of pluripotency is of great interest in stem cell biology. The dual specificity T-box/basic-helix-loop-helix-zipper transcription factor Mga is expressed in the pluripotent cells of the inner cell mass (ICM) and epiblast of the peri-implantation mouse embryo, but its function has not been investigated previously. Here, we use a loss-of-function allele and RNA knockdown to demonstrate that Mga depletion leads to the death of proliferating pluripotent ICM cells in vivo and in vitro, and the death of embryonic stem cells (ESCs) in vitro. Additionally, quiescent pluripotent cells lacking Mga are lost during embryonic diapause. Expression of Odc1, the rate-limiting enzyme in the conversion of ornithine into putrescine in the synthesis of polyamines, is reduced in Mga mutant cells, and the survival of mutant ICM cells as well as ESCs is rescued in culture by the addition of exogenous putrescine. These results suggest a mechanism whereby Mga influences pluripotent cell survival through regulation of the polyamine pool in pluripotent cells of the embryo, whether they are in a proliferative or quiescent state. PMID:25516968

  17. Arabidopsis thaliana ICE2 gene: phylogeny, structural evolution and functional diversification from ICE1.

    PubMed

    Kurbidaeva, Amina; Ezhova, Tatiana; Novokreshchenova, Maria

    2014-12-01

    The ability to tolerate environmental stresses is crucial for all living organisms, and gene duplication is one of the sources for evolutionary novelties. Arabidopsis thaliana INDUCER OF CBF EXPRESSION1 and 2 (ICE1 and ICE2) encode MYC-type bHLH (basic helix-loop-helix) transcription factors. They confer cold stress tolerance by induction of the CBF/DREB1 regulon and regulate stomata formation. Although ICE2 is closely related to ICE1, its origin and role in cold response remains uncertain. Here, we used a bioinformatics/phylogenetic approach to uncover the ICE2 evolutionary history, structural evolution and functional divergence from the putative ancestral gene. Sequence diversification from ICE1 included the gain of cis-acting elements in ICE2 promoter sequence that may provide meristem-specific and defense-related gene expression. By analyzing transgenic Arabidopsis lines with ICE2 over-expression we showed that it contributes to stomata formation, flowering time regulation and cold response. Constitutive ICE2 expression led to induced meristem freezing tolerance, resulting from activation of CBF1 and CBF3 genes and ABA biosynthesis by NCED3 induction. We presume that ICE2 gene has originated from a duplication event about 17.9MYA followed by sub- and neofunctionalization of the ancestral ICE1 gene. Moreover, we predict its role in pathogen resistance and flowering time regulation. PMID:25443829

  18. Mutations within Helix I of Twist1 Result in Distinct Limb Defects and Variation of DNA-Binding Affinities

    PubMed Central

    Firulli, Beth A.; Redick, Bradley A.; Conway, Simon J.; Firulli, Anthony B.

    2008-01-01

    Twist1 is a basic helix-loop-helix (bHLH) factor that plays an important role in limb development. Haploinsufficiency of Twist1 results in polydactyly via the inability of Twist1 to antagonistically regulate the related factor Hand2. The mechanism modulating Twist1-Hand2 antagonism is via phosphoregulation of conserved threonine and serine residues in helix I of the bHLH domain. Phosphoregulation alters the dimerization affinities for both proteins. Here we show that the expression of Twist1 and Twist1 phosphoregulation mutants result in distinct limb phenotypes in mice. In addition to dimer regulation, Twist1 phosphoregulation affects the DNA-binding affinities of Twist1 in a partner dependent and cis-element dependent manner. In order to gain a better understanding of the specific Twist1 transcriptional complexes that function during limb morphogensis, we employ a series of Twist1-tethered dimers that include the known Twist1 partners, E12 and Hand2, as well as a tethered Twist1 homodimer. We show that these dimers behave in a manner similar to monomerically expressed bHLH factors and result in distinct limb phenotypes that correlate well with those observed from the limb expression of Twist1 and Twist1 phosphoregulation mutants. Taken together, this study shows that the Twist1 dimer affinity for a given partner can modulate the DNA binding affinity and that Twist1 dimer choice determines phenotypic outcome during limb development. PMID:17652084

  19. SOHLH2 is essential for synaptonemal complex formation during spermatogenesis in early postnatal mouse testes

    PubMed Central

    Park, Miree; Lee, Youngeun; Jang, Hoon; Lee, Ok-Hee; Park, Sung-Won; Kim, Jae-Hwan; Hong, Kwonho; Song, Hyuk; Park, Se-Pill; Park, Yun-Yong; Ko, Jung Jae; Choi, Youngsok

    2016-01-01

    Spermatogenesis- and oogenesis-specific helix-loop-helix transcription factor 2 (SOHLH2) is exclusively expressed in germ cells of the gonads. Previous studies show that SOHLH2 is critical for spermatogenesis in mouse. However, the regulatory mechanism of SOHLH2 during early spermatogenesis is poorly understood. In the present study, we analyzed the gene expression profile of the Sohlh2-deficient testis and examined the role of SOHLH2 during spermatogenesis. We found 513 genes increased in abundance, while 492 genes decreased in abundance in 14-day-old Sohlh2-deficient mouse testes compared to wildtype mice. Gene ontology analysis revealed that Sohlh2 disruption effects the relative abundance of various meiotic genes during early spermatogenesis, including Spo11, Dmc1, Msh4, Prdm9, Sycp1, Sycp2, Sycp3, Hormad1, and Hormad2. Western blot analysis and immunostaining showed that SYCP3, a component of synaptonemal complex, was significantly less abundant in Sohlh2-deficient spermatocytes. We observed a lack of synaptonemal complex formation during meiosis in Sohlh2-deficient spermatocytes. Furthermore, we found that SOHLH2 interacted with two E-boxes on the mouse Sycp1 promoter and Sycp1 promoter activity increased with ectopically expressed SOHLH2. Taken together, our data suggest that SOHLH2 is critical for the formation of synaptonemal complexes via its regulation of Sycp1 expression during mouse spermatogonial differentiation. PMID:26869299

  20. Genetic basis for glandular trichome formation in cotton.

    PubMed

    Ma, Dan; Hu, Yan; Yang, Changqing; Liu, Bingliang; Fang, Lei; Wan, Qun; Liang, Wenhua; Mei, Gaofu; Wang, Lingjian; Wang, Haiping; Ding, Linyun; Dong, Chenguang; Pan, Mengqiao; Chen, Jiedan; Wang, Sen; Chen, Shuqi; Cai, Caiping; Zhu, Xiefei; Guan, Xueying; Zhou, Baoliang; Zhu, Shuijin; Wang, Jiawei; Guo, Wangzhen; Chen, Xiaoya; Zhang, Tianzhen

    2016-01-01

    Trichomes originate from epidermal cells and can be classified as either glandular or non-glandular. Gossypium species are characterized by the presence of small and darkly pigmented lysigenous glands that contain large amounts of gossypol. Here, using a dominant glandless mutant, we characterize GoPGF, which encodes a basic helix-loop-helix domain-containing transcription factor, that we propose is a positive regulator of gland formation. Silencing GoPGF leads to a completely glandless phenotype. A single nucleotide insertion in GoPGF, introducing a premature stop codon is found in the duplicate recessive glandless mutant (gl2gl3). The characterization of GoPGF helps to unravel the regulatory network of glandular structure biogenesis, and has implications for understanding the production of secondary metabolites in glands. It also provides a potential molecular basis to generate glandless seed and glanded cotton to not only supply fibre and oil but also provide a source of protein for human consumption. PMID:26795254

  1. Crystal Structure of the Minimalist Max-E47 Protein Chimera

    SciTech Connect

    Ahmadpour, Faraz; Ghirlando, Rodolfo; De Jong, Antonia T.; Gloyd, Melanie; Shin, Jumi A.; Guarné, Alba

    2012-02-28

    Max-E47 is a protein chimera generated from the fusion of the DNA-binding basic region of Max and the dimerization region of E47, both members of the basic region/helix-loop-helix (bHLH) superfamily of transcription factors. Like native Max, Max-E47 binds with high affinity and specificity to the E-box site, 5'-CACGTG, both in vivo and in vitro. We have determined the crystal structure of Max-E47 at 1.7 Å resolution, and found that it associates to form a well-structured dimer even in the absence of its cognate DNA. Analytical ultracentrifugation confirms that Max-E47 is dimeric even at low micromolar concentrations, indicating that the Max-E47 dimer is stable in the absence of DNA. Circular dichroism analysis demonstrates that both non-specific DNA and the E-box site induce similar levels of helical secondary structure in Max-E47. These results suggest that Max-E47 may bind to the E-box following the two-step mechanism proposed for other bHLH proteins. In this mechanism, a rapid step where protein binds to DNA without sequence specificity is followed by a slow step where specific protein:DNA interactions are fine-tuned, leading to sequence-specific recognition. Collectively, these results show that the designed Max-E47 protein chimera behaves both structurally and functionally like its native counterparts.

  2. Isolated pancreatic aplasia due to a hypomorphic PTF1A mutation

    PubMed Central

    Flanagan, Sarah E.; de Franco, Elisa; Caswell, Richard; Hussain, Khalid; Mohamed, Sarar; Abdulrasoul, Majedah; Hattersley, Andrew T.; MacDonald, Raymond J.; Ellard, Sian

    2016-01-01

    Homozygous truncating mutations in the helix-loop-helix transcription factor PTF1A are a rare cause of pancreatic and cerebellar agenesis. The correlation of Ptf1a dosage with pancreatic phenotype in a mouse model suggested the possibility of finding hypomorphic PTF1A mutations in patients with pancreatic agenesis or neonatal diabetes but no cerebellar phenotype. Genome wide SNP typing in two siblings with neonatal diabetes from a consanguineous pedigree revealed a large shared homozygous region (31 Mb) spanning PTF1A. Sanger sequencing of PTF1A identified a novel missense mutation, p.P191T. Testing of 259 additional patients using a targeted next generation sequencing assay for 23 neonatal diabetes genes detected one additional proband and an affected sibling with the same homozygous mutation. All 4 cases were diagnosed with diabetes at birth and are insulin treated. Two of the 4 had exocrine pancreatic insufficiency requiring replacement but none of the affected individuals have neurodevelopmental delay. Transient transfection assays of the mutant protein demonstrated a 75% reduction in transactivation activity. This study shows that the functional severity of a homozygous mutation impacts on the severity of clinical features found in patients. PMID:27284104

  3. Molecular Characterisation, Evolution and Expression of Hypoxia-Inducible Factor in Aurelia sp.1

    PubMed Central

    Wang, Guoshan; Yu, Zhigang; Zhen, Yu; Mi, Tiezhu; Shi, Yan; Wang, Jianyan; Wang, Minxiao; Sun, Song

    2014-01-01

    The maintenance of physiological oxygen homeostasis is mediated by hypoxia-inducible factor (HIF), a key transcriptional factor of the PHD-HIF system in all metazoans. However, the molecular evolutionary origin of this central physiological regulatory system is not well characterized. As the earliest eumetazoans, Cnidarians can be served as an interesting model for exploring the HIF system from an evolutionary perspective. We identified the complete cDNA sequence of HIF-1α (ASHIF) from the Aurelia sp.1, and the predicted HIF-1α protein (pASHIF) was comprised of 674 amino acids originating from 2,025 bp nucleotides. A Pairwise comparison revealed that pASHIF not only possessed conserved basic helix-loop-helix (bHLH) and Per-Arnt-Sim (PAS) domains but also contained the oxygen dependent degradation (ODD) and the C-terminal transactivation domains (C-TAD), the key domains for hypoxia regulation. As indicated by sequence analysis, the ASHIF gene contains 8 exons interrupted by 7 introns. Western blot analysis indicated that pASHIF that existed in the polyps and medusa of Aurelia. sp.1 was more stable for a hypoxic response than normoxia. PMID:24926666

  4. Identification, molecular and functional characterization of calmodulin gene of Phytomonas serpens 15T that shares high similarity with its pathogenic counterparts Trypanosoma cruzi.

    PubMed

    de Souza, Tatiana de Arruda Campos Brasil; Graça-de Souza, Viviane Krominski; Lancheros, César Armando Contreras; Monteiro-Góes, Viviane; Krieger, Marco Aurélio; Goldenberg, Samuel; Yamauchi, Lucy Megumi; Yamada-Ogatta, Sueli Fumie

    2011-03-01

    In trypanosomatids, Ca²+-binding proteins can affect parasite growth, differentiation and invasion. Due to their importance for parasite maintenance, they become an attractive target for drug discovery and design. Phytomonas serpens 15T is a non-human pathogenic trypanosomatid that expresses important protein homologs of human pathogenic trypanosomatids. In this study, the coding sequence of calmodulin, a Ca²+-binding protein, of P. serpens 15T was cloned and characterized. The encoded polypeptide (CaMP) displayed high amino acid identity to homolog protein of Trypanosoma cruzi and four helix-loop-helix motifs were found. CaMP sequence analysis showed 20 amino acid substitutions compared to its mammalian counterparts. This gene is located on a chromosomal band with estimated size of 1,300 kb and two transcripts were detected by Northern blot analysis. A polyclonal antiserum raised against the recombinant protein recognized a polypeptide with an estimated size of 17 kDa in log-phase promastigote extracts. The recombinant CaMP retains its Ca²+-binding capacity. PMID:21431874

  5. Correct Timing of Proliferation and Differentiation is Necessary for Normal Inner Ear Development and Auditory Hair Cell Viability

    PubMed Central

    Kopecky, Benjamin J.; Jahan, Israt; Fritzsch, Bernd

    2013-01-01

    Background Hearing restoration through hair cell regeneration will require revealing the dynamic interactions between proliferation and differentiation during development to avoid the limited viability of regenerated hair cells. Pax2-Cre N-Myc conditional knockout (CKO) mice highlighted the need of N-Myc for proper neurosensory development and possible redundancy with L-Myc. The late-onset hair cell death in the absence of early N-Myc expression could be due to mis-regulation of genes necessary for neurosensory formation and maintenance, such as Neurod1, Atoh1, Pou4f3, and Barhl1. Results Pax2-Cre N-Myc L-Myc double CKO mice show that proliferation and differentiation are linked together through Myc and in the absence of both Mycs, altered proliferation and differentiation results in morphologically abnormal ears. In particular, the organ of Corti apex is re-patterned into a vestibular-like organization and the base is truncated and fused with the saccule. Conclusions These data indicate that therapeutic approaches to restore hair cells must take into account a dynamic interaction of proliferation and differentiation regulation of basic Helix-Loop-Helix transcription factors in attempts to stably replace lost cochlear hair cells. In addition, our data indicate that Myc is an integral component of the evolutionary transformation process that resulted in the organ of Corti development. PMID:23193000

  6. DEC1 and DEC2 Crosstalk between Circadian Rhythm and Tumor Progression

    PubMed Central

    Sato, Fuyuki; Bhawal, Ujjal K.; Yoshimura, Tomohiro; Muragaki, Yasuteru

    2016-01-01

    Clock genes, major regulators of circadian rhythm, are involved in tumor progression. We have shown that clock genes basic helix-loop-helix (BHLH) transcription factors, differentiated embryonic chondrocyte gene 1 (DEC1/BHLHE40/Sharp2/Stra13) and DEC2 (BHLHE41/Sharp1) play important roles in circadian rhythm, cell proliferation, apoptosis, hypoxia response, various stresses, and epithelial-to-mesenchymal transition (EMT) of tumor cells. Various stresses, such as exposure to transforming growth factor-beta (TGF-β), hypoxia, cytokines, serum-free, and anti-tumor drugs affect DEC1 and DEC2 expression. An increased or decreased expression of DEC1 and DEC2 regulated tumor progression. However, DEC1 and DEC2 have opposite effects in tumor progression, where the reason behind remains unclear. We found that DEC2 has circadian expression in implanted mouse sarcoma cells, suggesting that DEC2 regulates tumor progression under circadian rhythm. In addition to that, we showed that DEC1 and DEC2 regulate target genes via positive or negative feedback system in tumor progression. We propose that DEC1 and DEC2 act as an accelerator or a brake in tumor progression. In this review, we summarize current progress of knowledge in the function of DEC1 and DEC2 genes in tumor progression. PMID:26819638

  7. Disruption of Neurogenesis and Cortical Development in Transgenic Mice Misexpressing Olig2, A Gene In The Down Syndrome Critical Region

    PubMed Central

    Liu, Wei; Zhou, Hui; Liu, Lei; Zhao, Chuntao; Deng, Yaqi; Chen, Lina; Wu, Laiman; Mandrycky, Nicole; McNabb, Christopher T.; Peng, Yuanbo; Fuchs, Perry N; Lu, Jie; Sheen, Volney; Qiu, Mengsheng; Mao, Meng; Lu, Q. Richard

    2015-01-01

    The basic helix-loop-helix (bHLH) transcription factor Olig2 is crucial for mammalian central nervous system development. Human ortholog OLIG2 is located in the Down syndrome critical region in trisomy 21. To investigate the effect of Olig2 misexpression on brain development, we generated a developmentally regulated Olig2-overexpressing transgenic line with a Cre/loxP system. The transgenic mice with Olig2 misexpression in cortical neural stem/progenitor cells exhibited microcephaly, cortical dyslamination, hippocampus malformation, and profound motor deficits. Ectopic misexpression of Olig2 impaired cortical progenitor proliferation and caused precocious cell cycle exit. Massive neuronal cell death was detected in the developing cortex of Olig2-misexpressing mice. In addition, Olig2 misexpression led to a significant downregulation of neuronal specification factors including Ngn1, Ngn2 and Pax6, and a defect in cortical neurogenesis. Chromatin-immunoprecipitation and sequencing (ChIP-Seq) analysis indicates that Olig2 directly targets the promoter and/or enhancer regions of Nfatc4, Dscr1/Rcan1 and Dyrk1a, the critical neurogenic genes that contribute to Down syndrome phenotypes, and inhibits their expression. Together, our study suggests that Olig2 misexpression in neural stem cells elicits neurogenesis defects and neuronal cell death, which may contribute to developmental disorders including Down syndrome, where OLIG2 is triplicated on chromosomal 21. PMID:25747816

  8. [Molecular cloning and characterization of a novel ice gene from Capsella bursapastoris].

    PubMed

    Wang, Xinglong; Sun, Xiaoqing; Liu, Sixiu; Liu, Li; Liu, Xiaojun; Sun, Xiaofen; Tang, Kexuan

    2005-01-01

    A new ice gene (designated as Cbice53, an inducer of CBF expression) was cloned from Capsella bursa-pastoris by rapid amplification of cDNA ends (RACE). The full-length cDNA of Cbice53 was 1811 bp long with a 1476 bp open reading frame (ORF) encoding a Myc-like protein of 492 amino acids. The predicted CbICE53 protein contained a potential basic helix-loop-helix, a nuclear localization signal (NLS), a RNA-binding regions RGG box, N-glycosylation and kinase phosphorylation sites. Bioinformatic analysis revealed that CbICE53 was highly homologous to ICE1 from Arabidopsis thaliana. Transcription of Cbice53 gene was induced transiently during salt and cold treatments, suggesting that it was involved in someway in cold-acclimation process. Our study implies that the Cbice53 gene is a new member of the ice gene family and may exert functions in cold- and salt-responsiveness in C. bursa-pastoris. PMID:15773544

  9. SCREAM/ICE1 and SCREAM2 specify three cell-state transitional steps leading to arabidopsis stomatal differentiation.

    PubMed

    Kanaoka, Masahiro M; Pillitteri, Lynn Jo; Fujii, Hiroaki; Yoshida, Yuki; Bogenschutz, Naomi L; Takabayashi, Junji; Zhu, Jian-Kang; Torii, Keiko U

    2008-07-01

    Differentiation of specialized cell types in multicellular organisms requires orchestrated actions of cell fate determinants. Stomata, valves on the plant epidermis, are formed through a series of differentiation events mediated by three closely related basic-helix-loop-helix proteins: SPEECHLESS (SPCH), MUTE, and FAMA. However, it is not known what mechanism coordinates their actions. Here, we identify two paralogous proteins, SCREAM (SCRM) and SCRM2, which directly interact with and specify the sequential actions of SPCH, MUTE, and FAMA. The gain-of-function mutation in SCRM exhibited constitutive stomatal differentiation in the epidermis. Conversely, successive loss of SCRM and SCRM2 recapitulated the phenotypes of fama, mute, and spch, indicating that SCRM and SCRM2 together determined successive initiation, proliferation, and terminal differentiation of stomatal cell lineages. Our findings identify the core regulatory units of stomatal differentiation and suggest a model strikingly similar to cell-type differentiation in animals. Surprisingly, map-based cloning revealed that SCRM is INDUCER OF CBF EXPRESSION1, a master regulator of freezing tolerance, thus implicating a potential link between the transcriptional regulation of environmental adaptation and development in plants. PMID:18641265

  10. FAMA is an essential component for the differentiation of two distinct cell types, myrosin cells and guard cells, in Arabidopsis.

    PubMed

    Shirakawa, Makoto; Ueda, Haruko; Nagano, Atsushi J; Shimada, Tomoo; Kohchi, Takayuki; Hara-Nishimura, Ikuko

    2014-10-01

    Brassicales plants, including Arabidopsis thaliana, have an ingenious two-compartment defense system, which sequesters myrosinase from the substrate glucosinolate and produces a toxic compound when cells are damaged by herbivores. Myrosinase is stored in vacuoles of idioblast myrosin cells. The molecular mechanism that regulates myrosin cell development remains elusive. Here, we identify the basic helix-loop-helix transcription factor FAMA as an essential component for myrosin cell development along Arabidopsis leaf veins. FAMA is known as a regulator of stomatal development. We detected FAMA expression in myrosin cell precursors in leaf primordia in addition to stomatal lineage cells. FAMA deficiency caused defects in myrosin cell development and in the biosynthesis of myrosinases THIOGLUCOSIDE GLUCOHYDROLASE1 (TGG1) and TGG2. Conversely, ectopic FAMA expression conferred myrosin cell characteristics to hypocotyl and root cells, both of which normally lack myrosin cells. The FAMA interactors ICE1/SCREAM and its closest paralog SCREAM2/ICE2 were essential for myrosin cell development. DNA microarray analysis identified 32 candidate genes involved in myrosin cell development under the control of FAMA. This study provides a common regulatory pathway that determines two distinct cell types in leaves: epidermal guard cells and inner-tissue myrosin cells. PMID:25304202

  11. Stomatal Development in Arabidopsis

    PubMed Central

    Pillitteri, Lynn Jo; Dong, Juan

    2013-01-01

    Stomata consist of two guard cells that function as turgor-operated valves that regulate gas exchange in plants. In Arabidopsis, a dedicated cell lineage is initiated and undergoes a series of cell divisions and cell-state transitions to produce a stoma. A set of basic helix-loop-helix (bHLH) transcription factors regulates the transition and differentiation events through the lineage, while the placement of stomata relative to each other is controlled by intercellular signaling via peptide ligands, transmembrane receptors, and mitogen-activated protein kinase (MAPK) modules. Some genes involved in regulating stomatal differentiation or density are also involved in hormonal and environmental stress responses, which may provide a link between modulation of stomatal development or function in response to changes in the environment. Premitotic polarlylocalized proteins provide an added layer of regulation, which can be addressed more thoroughly with the identification of additional proteins in this pathway. Linking the networks that control stomatal development promises to bring advances to our understanding of signal transduction, cell polarity, and cell-fate specification in plants. PMID:23864836

  12. AP4 is a mediator of epithelial–mesenchymal transition and metastasis in colorectal cancer

    PubMed Central

    Jackstadt, Rene; Röh, Simone; Neumann, Jens; Jung, Peter; Hoffmann, Reinhard; Horst, David; Berens, Christian; Bornkamm, Georg W.; Kirchner, Thomas; Menssen, Antje

    2013-01-01

    The basic helix-loop-helix transcription factor AP4/TFAP4/AP-4 is encoded by a c-MYC target gene and displays up-regulation concomitantly with c-MYC in colorectal cancer (CRC) and numerous other tumor types. Here a genome-wide characterization of AP4 DNA binding and mRNA expression was performed using a combination of microarray, genome-wide chromatin immunoprecipitation, next-generation sequencing, and bioinformatic analyses. Thereby, hundreds of induced and repressed AP4 target genes were identified. Besides many genes involved in the control of proliferation, the AP4 target genes included markers of stemness (LGR5 and CD44) and epithelial–mesenchymal transition (EMT) such as SNAIL, E-cadherin/CDH1, OCLN, VIM, FN1, and the Claudins 1, 4, and 7. Accordingly, activation of AP4 induced EMT and enhanced migration and invasion of CRC cells. Conversely, down-regulation of AP4 resulted in mesenchymal–epithelial transition and inhibited migration and invasion. In addition, AP4 induction was required for EMT, migration, and invasion caused by ectopic expression of c-MYC. Inhibition of AP4 in CRC cells resulted in decreased lung metastasis in mice. Elevated AP4 expression in primary CRC significantly correlated with liver metastasis and poor patient survival. These findings imply AP4 as a new regulator of EMT that contributes to metastatic processes in CRC and presumably other carcinomas. PMID:23752226

  13. Glutathione-peroxidase-1 null muscle progenitor cells are globally defective.

    PubMed

    Lee, Sukkyoo; Shin, H Stella; Shireman, Paula K; Vasilaki, Aphrodite; Van Remmen, Holly; Csete, Marie E

    2006-10-01

    Mice lacking glutathione peroxidase-1 (Gpx1) have decreased resistance to systemically administered oxidants as well as infections, and sustain increased damage after ischemia-reperfusion injuries. However, stem or progenitor cell function in these animals has not been studied. We characterized patterns of proliferation, apoptosis, and differentiation of primary muscle progenitor cells (myoblasts) from Gpx1(-/-) mice. Myoblasts are the transit amplifying compartment of skeletal muscle. All aspects of myoblast biology are negatively affected by deletion of Gpx1. In particular, passaged, proliferating Gpx1(-/-) myoblasts, when induced to differentiate into fused multinucleated myotubes, show significant impairment, and form only a few immature myotubes. This defect occurs despite increased expression of the core regulators of muscle differentiation, the myogenic basic helix-loop-helix (bHLH) transcription factors, in the Gpx1(-/-) myoblasts. Furthermore, Gpx1(-/-) myoblasts exhibited decreased proliferation and increased apoptosis compared to wild-type cells. In vivo, muscle fiber areas are decreased in Gpx1(-/-) vs wild-type mice. These data suggest that Gpx1 is important for adult muscle progenitor cell function at many levels, is necessary for integrity of muscle differentiation, and that quiescent resident stem cell populations may be particularly vulnerable to peroxide-mediated damage. PMID:16962942

  14. To proliferate or to die: role of Id3 in cell cycle progression and survival of neural crest progenitors

    PubMed Central

    Kee, Yun; Bronner-Fraser, Marianne

    2005-01-01

    The neural crest is a unique population of mitotically active, multipotent progenitors that arise at the vertebrate neural plate border. Here, we show that the helix-loop-helix transcriptional regulator Id3 has a novel role in cell cycle progression and survival of neural crest progenitors in Xenopus. Id3 is localized at the neural plate border during gastrulation and neurulation, overlapping the domain of neural crest induction. Morpholino oligonucleotide-mediated depletion of Id3 results in the absence of neural crest precursors and a resultant loss of neural crest derivatives. This appears to be mediated by cell cycle inhibition followed by cell death of the neural crest progenitor pool, rather than a cell fate switch. Conversely, overexpression of Id3 increases cell proliferation and results in expansion of the neural crest domain. Our data suggest that Id3 functions by a novel mechanism, independent of cell fate determination, to mediate the decision of neural crest precursors to proliferate or die. PMID:15769946

  15. NeuroD1 mediates nicotine-induced migration and invasion via regulation of the nicotinic acetylcholine receptor subunits in a subset of neural and neuroendocrine carcinomas

    PubMed Central

    Osborne, Jihan K.; Guerra, Marcy L.; Gonzales, Joshua X.; McMillan, Elizabeth A.; Minna, John D.; Cobb, Melanie H.

    2014-01-01

    Cigarette smoking is a major risk factor for acquisition of small cell lung cancer (SCLC). A role has been demonstrated for the basic helix-loop-helix transcription factor NeuroD1 in the pathogenesis of neural and neuroendocrine lung cancer, including SCLC. In the present study we investigate the possible function of NeuroD1 in established tumors, as well as actions early on in pathogenesis, in response to nicotine. We demonstrate that nicotine up-regulates NeuroD1 in immortalized normal bronchial epithelial cells and a subset of undifferentiated carcinomas. Increased expression of NeuroD1 subsequently leads to regulation of expression and function of the nicotinic acetylcholine receptor subunit cluster of α3, α5, and β4. In addition, we find that coordinated expression of these subunits by NeuroD1 leads to enhanced nicotine-induced migration and invasion, likely through changes in intracellular calcium. These findings suggest that aspects of the pathogenesis of neural and neuroendocrine lung cancers may be affected by a nicotine- and NeuroD1-induced positive feedback loop. PMID:24719457

  16. Auxin signaling modules regulate maize inflorescence architecture

    PubMed Central

    Galli, Mary; Liu, Qiujie; Moss, Britney L.; Malcomber, Simon; Li, Wei; Gaines, Craig; Federici, Silvia; Roshkovan, Jessica; Meeley, Robert; Nemhauser, Jennifer L.; Gallavotti, Andrea

    2015-01-01

    In plants, small groups of pluripotent stem cells called axillary meristems are required for the formation of the branches and flowers that eventually establish shoot architecture and drive reproductive success. To ensure the proper formation of new axillary meristems, the specification of boundary regions is required for coordinating their development. We have identified two maize genes, BARREN INFLORESCENCE1 and BARREN INFLORESCENCE4 (BIF1 and BIF4), that regulate the early steps required for inflorescence formation. BIF1 and BIF4 encode AUXIN/INDOLE-3-ACETIC ACID (Aux/IAA) proteins, which are key components of the auxin hormone signaling pathway that is essential for organogenesis. Here we show that BIF1 and BIF4 are integral to auxin signaling modules that dynamically regulate the expression of BARREN STALK1 (BA1), a basic helix-loop-helix (bHLH) transcriptional regulator necessary for axillary meristem formation that shows a striking boundary expression pattern. These findings suggest that auxin signaling directly controls boundary domains during axillary meristem formation and define a fundamental mechanism that regulates inflorescence architecture in one of the most widely grown crop species. PMID:26464512

  17. Slow transition between two beta-strand registers is dictated by protein unfolding.

    PubMed

    Evans, Matthew R; Gardner, Kevin H

    2009-08-19

    The aryl hydrocarbon receptor nuclear translocator (ARNT) is a promiscuous, basic helix-loop-helix Period/ARNT/Single-minded protein that forms dimeric transcriptional regulator complexes with other bHLH-PAS proteins to regulate various biological pathways. Intriguingly, the introduction of a single point mutation into the C-terminal PAS-B domain resulted in a protein that can simultaneously exist in two distinct conformations. The difference between these two structures is a +3 slip and inversion of a central Ibeta-strand and an accompanying N448-P449 peptide bond isomerization in the preceding HI loop. Previous studies have indicated these two forms of Y456T interconvert on the approximate time scale of tens of minutes, allowing these two conformations to be separated by ion exchange chromatography. Here, we use time-resolved solution NMR spectroscopy to quantitatively characterize this rate and its temperature dependence, providing information into the transition state. When compared with fluorescence measurements of protein unfolding rates, we find data that suggest a linkage between interconversion and unfolding based on comparable temperature dependence and corresponding energetics of these processes. Notably, the N448-P449 peptide bond also plays a critical role for the interconversion between states, with a mutant unable to adopt a cis configuration at this bond (P449A/Y456T) being kinetically trapped under nondenaturing conditions. Taken together, these data provide information about a rare equilibrium model system for beta-strand slippage. PMID:19722642

  18. Hemovascular Progenitors in the Kidney Require Sphingosine-1-Phosphate Receptor 1 for Vascular Development.

    PubMed

    Hu, Yan; Li, Minghong; Göthert, Joachim R; Gomez, R Ariel; Sequeira-Lopez, Maria Luisa S

    2016-07-01

    The close relationship between endothelial and hematopoietic precursors during early development of the vascular system suggested the possibility of a common yet elusive precursor for both cell types. Whether similar or related progenitors for endothelial and hematopoietic cells are present during organogenesis is unclear. Using inducible transgenic mice that specifically label endothelial and hematopoietic precursors, we performed fate-tracing studies combined with colony-forming assays and crosstransplantation studies. We identified a progenitor, marked by the expression of helix-loop-helix transcription factor stem cell leukemia (SCL/Tal1). During organogenesis of the kidney, SCL/Tal1(+) progenitors gave rise to endothelium and blood precursors with multipotential colony-forming capacity. Furthermore, appropriate morphogenesis of the kidney vasculature, including glomerular capillary development, arterial mural cell coating, and lymphatic vessel development, required sphingosine 1-phosphate (S1P) signaling via the G protein-coupled S1P receptor 1 in these progenitors. Overall, these results show that SCL/Tal1(+) progenitors with hemogenic capacity originate and differentiate within the early embryonic kidney by hemovasculogenesis (the concomitant formation of blood and vessels) and underscore the importance of the S1P pathway in vascular development. PMID:26534925

  19. Virulence Factors of Geminivirus Interact with MYC2 to Subvert Plant Resistance and Promote Vector Performance[C][W

    PubMed Central

    Li, Ran; Weldegergis, Berhane T.; Li, Jie; Jung, Choonkyun; Qu, Jing; Sun, Yanwei; Qian, Hongmei; Tee, ChuanSia; van Loon, Joop J.A.; Dicke, Marcel; Chua, Nam-Hai; Liu, Shu-Sheng

    2014-01-01

    A pathogen may cause infected plants to promote the performance of its transmitting vector, which accelerates the spread of the pathogen. This positive effect of a pathogen on its vector via their shared host plant is termed indirect mutualism. For example, terpene biosynthesis is suppressed in begomovirus-infected plants, leading to reduced plant resistance and enhanced performance of the whiteflies (Bemisia tabaci) that transmit these viruses. Although begomovirus-whitefly mutualism has been known, the underlying mechanism is still elusive. Here, we identified βC1 of Tomato yellow leaf curl China virus, a monopartite begomovirus, as the viral genetic factor that suppresses plant terpene biosynthesis. βC1 directly interacts with the basic helix-loop-helix transcription factor MYC2 to compromise the activation of MYC2-regulated terpene synthase genes, thereby reducing whitefly resistance. MYC2 associates with the bipartite begomoviral protein BV1, suggesting that MYC2 is an evolutionarily conserved target of begomoviruses for the suppression of terpene-based resistance and the promotion of vector performance. Our findings describe how this viral pathogen regulates host plant metabolism to establish mutualism with its insect vector. PMID:25490915

  20. Overexpression of MdbHLH104 gene enhances the tolerance to iron deficiency in apple.

    PubMed

    Zhao, Qiang; Ren, Yi-Ran; Wang, Qing-Jie; Yao, Yu-Xin; You, Chun-Xiang; Hao, Yu-Jin

    2016-07-01

    Fe deficiency is a widespread nutritional disorder in plants. The basic helix-loop-helix (bHLH) transcription factors (TFs), especially Ib subgroup bHLH TFs which are involved in iron uptake, have been identified. In this study, an IVc subgroup bHLH TF MdbHLH104 was identified and characterized as a key component in the response to Fe deficiency in apple. The overexpression of the MdbHLH104 gene noticeably increased the H(+) -ATPase activity under iron limitation conditions and the tolerance to Fe deficiency in transgenic apple plants and calli. Further investigation showed that MdbHLH104 proteins bonded directly to the promoter of the MdAHA8 gene, thereby positively regulating its expression, the plasma membrane (PM) H(+) -ATPase activity and Fe uptake. Similarly, MdbHLH104 directly modulated the expression of three Fe-responsive bHLH genes, MdbHLH38, MdbHLH39 and MdPYE. In addition, MdbHLH104 interacted with 5 other IVc subgroup bHLH proteins to coregulate the expression of the MdAHA8 gene, the activity of PM H(+) -ATPase and the content of Fe in apple calli. Therefore, MdbHLH104 acts together with other apple bHLH TFs to regulate Fe uptake by modulating the expression of the MdAHA8 gene and the activity of PM H(+) -ATPase in apple. PMID:26801352

  1. Opposite roles of MRF4 and MyoD in cell proliferation and myogenic differentiation

    SciTech Connect

    Jin Xun; Kim, Jong-Gun; Oh, Myung-Joo; Oh, Ho-Yeon; Sohn, Young-Woo; Pian, Xumin; Yin, Jin Long; Beck, Samuel; Lee, Namkyung; Son, Jeesoo; Kim, Hyunggee; Yan Changguo; Wang Jihui; Choi, Yun-Jaie; Whang, Kwang Youn

    2007-12-21

    The basic helix-loop-helix myogenic regulatory factors play critical roles in skeletal myogenesis. Among the myogenic regulatory factors (MRFs), MRF4 shows a biphasic expression pattern during the formation of myotomes, although its function remains unclear. In this study, we used BEF (spontaneously immortalized bovine embryonic fibroblast that shows myogenic differentiation by overexpression of MyoD) and C2C12 cells to investigate the function of MRF4. Ectopic expressions of MRF4 did not stimulate myogenic differentiation in the BEF and C2C12 cells, but did show a marked increase of cell proliferation, upregulation of cyclin E, and downregulation of p21{sup WAF1}. Furthermore, MRF4 was found to induce degradation of the MyoD protein, which acts as a transcriptional activator for p21{sup WAF1}, and thus indicates that MRF4 accelerates cell proliferation by suppressing MyoD-dependent p21{sup WAF1} expression. However, forced expression of MyoD in the MRF4-overexpressing cells inhibited cell proliferation and partially induced myogenic differentiation, which suggests that MyoD is a potential negative intercessor of MRF4 in the regulation of the cell cycle. Taken together, these results indicate that MRF4 and MyoD play competitive roles in myogenesis by stimulating cell proliferation and differentiation, respectively.

  2. E2A and HEB are required to block thymocyte proliferation prior to pre-TCR expression.

    PubMed

    Wojciechowski, Jason; Lai, Anne; Kondo, Motonari; Zhuang, Yuan

    2007-05-01

    Thymocytes undergoing TCRbeta gene rearrangements are maintained in a low or nonproliferating state during early T cell development. This block in cell cycle progression is not released until the expression of a functional pre-TCR, which is composed of a successfully rearranged TCRbeta-chain and the Pre-Talpha-chain. The regulatory molecules responsible for the coordination of these differentiation and proliferation events are currently unknown. E2A and HEB are structurally and functionally related basic helix-loop-helix transcription factors involved in T cell development. To reveal the function of E2A and HEB through the stage of pre-TCR expression and alleviate functional compensation between E2A and HEB, we use a double-conditional knockout model. The simultaneous deletion of E2A and HEB in developing thymocytes leads to a severe developmental block before pre-TCR expression and a dramatic reduction of Pre-Talpha expression. These developmentally arrested thymocytes exhibit increased proliferation in vivo and dramatic expansion ex vivo in response to IL-7 signaling. These results suggest that E2A and HEB are not only critical for T cell differentiation but also necessary to retain developing thymocytes in cell cycle arrest before pre-TCR expression. PMID:17442955

  3. Enforced expression of E47 has differential effects on Lmo2-induced T-cell leukemias.

    PubMed

    Goodings, Charnise; Tripathi, Rati; Cleveland, Susan M; Elliott, Natalina; Guo, Yan; Shyr, Yu; Davé, Utpal P

    2015-01-01

    LIM domain only-2 (LMO2) overexpression in T cells induces leukemia but the molecular mechanism remains to be elucidated. In hematopoietic stem and progenitor cells, Lmo2 is part of a protein complex comprised of class II basic helix loop helix proteins, Tal1and Lyl1. The latter transcription factors heterodimerize with E2A proteins like E47 and Heb to bind E boxes. LMO2 and TAL1 or LYL1 cooperate to induce T-ALL in mouse models, and are concordantly expressed in human T-ALL. Furthermore, LMO2 cooperates with the loss of E2A suggesting that LMO2 functions by creating a deficiency of E2A. In this study, we tested this hypothesis in Lmo2-induced T-ALL cell lines. We transduced these lines with an E47/estrogen receptor fusion construct that could be forced to homodimerize with 4-hydroxytamoxifen. We discovered that forced homodimerization induced growth arrest in 2 of the 4 lines tested. The lines sensitive to E47 homodimerization accumulated in G1 and had reduced S phase entry. We analyzed the transcriptome of a resistant and a sensitive line to discern the E47 targets responsible for the cellular effects. Our results suggest that E47 has diverse effects in T-ALL but that functional deficiency of E47 is not a universal feature of Lmo2-induced T-ALL. PMID:25499232

  4. E protein dosage influences brain development more than family member identity.

    PubMed

    Ravanpay, Ali C; Olson, James M

    2008-05-15

    Loss-of-function studies have revealed the role of many basic helix-loop-helix (bHLH) transcription factors at specific points during development; however, the role of E proteins in the development of the nervous system has not been experimentally addressed. E proteins have been speculated to interact selectively with class II bHLH factors to form different neurogenic complexes. In this study, using coimmunoprecipitation in a culture model of neurogenesis (P19 cells), we show that E proteins E12, HEB, and E2-2 interact with neuroD2. Using electrophoretic mobility shift assay and P19 cell culture, we show that these heterodimers bind a neuroD2 preferred E box and induce neurogenesis equally well. We examine the mRNA levels of the three E proteins at 10 time points during brain development and show that E protein gene expression is regulated such that at certain times during development selective interaction between neuroD2 and a single E protein (HEB) is a possibility. This led us to study the brains of HEB and E2A knockout mice, which manifest no gross neuroanatomical, cellular, or behavioral deficits. These findings, together with homology in the primary peptide sequence of E proteins, suggest functional compensation among E proteins during development of the nervous system. PMID:18214987

  5. Organ-specific effects of brassinosteroids on stomatal production coordinate with the action of Too Many Mouths.

    PubMed

    Wang, Ming; Yang, Kezhen; Le, Jie

    2015-03-01

    In Arabidopsis, stomatal development initiates after protodermal cells acquire stomatal lineage cell fate. Stomata or their precursors communicate with their neighbor epidermal cells to ensure the "one cell spacing" rule. The signals from EPF/EPFL peptide ligands received by Too Many Mouths (TMM) and ERECTA-family receptors are supposed to be transduced by YODA MAPK cascade. A basic helix-loop-helix transcription factor SPEECHLESS (SPCH) is another key regulator of stomatal cell fate determination and asymmetric entry divisions, and SPCH activity is regulated by YODA MAPK cascade. Brassinosteroid (BR) signaling, one of the most well characterized signal transduction pathways in plants, contributes to the control of stomatal production. But opposite organ-specific effects of BR on stomatal production were reported. Here we confirm that stomatal production in hypocotyls is controlled by BR levels. YODA and CYCD4 are not essential for BR stomata-promoting function. Furthermore, we found that BR could confer tmm hypocotyls clustered stomatal phenotype, indicating that the BR organ-specific effects on stomatal production might coordinate with the TMM organ-specific actions. PMID:25234048

  6. A Role for Id2 in Regulating Photic Entrainment of the Mammalian Circadian System

    PubMed Central

    Duffield, Giles E.; Watson, Nathan P.; Mantani, Akio; Peirson, Stuart N.; Robles-Murguia, Maricela; Loros, Jennifer J.; Israel, Mark A.; Dunlap, Jay C.

    2009-01-01

    Summary Inhibitor of DNA binding genes (Id1–Id4) encode helix-loop-helix (HLH) transcriptional repressors associated with development and tumorigenesis [1, 2], but little is known concerning the function(s) of these genes in normal adult animals. Id2 was identified in DNA microarray screens for rhythmically expressed genes [3–5], and further analysis revealed a circadian pattern of expression of all four Id genes in multiple tissues including the suprachiasmatic nucleus. To explore an in vivo function, we generated and characterized deletion mutations of Id2 and of Id4. Id2−/− mice exhibit abnormally rapid entrainment and an increase in the magnitude of the phase shift of the pacemaker. A significant proportion of mice also exhibit disrupted rhythms when maintained under constant darkness. Conversely, Id4−/− mice did not exhibit a noticeable circadian phenotype. In vitro studies using an mPer1 and an AVP promoter reporter revealed the potential for ID1, ID2, and ID3 proteins to interact with the canonical basic HLH clock proteins BMAL1 and CLOCK. These data suggest that the Id genes may be important for entrainment and operation of the mammalian circadian system, potentially acting through BMAL1 and CLOCK targets. PMID:19217292

  7. Lineage-Restricted OLIG2-RTK Signaling Governs the Molecular Subtype of Glioma Stem-like Cells.

    PubMed

    Kupp, Robert; Shtayer, Lior; Tien, An-Chi; Szeto, Emily; Sanai, Nader; Rowitch, David H; Mehta, Shwetal

    2016-09-13

    The basic helix-loop-helix (bHLH) transcription factor OLIG2 is a master regulator of oligodendroglial fate decisions and tumorigenic competence of glioma stem-like cells (GSCs). However, the molecular mechanisms underlying dysregulation of OLIG2 function during gliomagenesis remains poorly understood. Here, we show that OLIG2 modulates growth factor signaling in two distinct populations of GSCs, characterized by expression of either the epidermal growth factor receptor (EGFR) or platelet-derived growth factor receptor alpha (PDGFRα). Biochemical analyses of OLIG2 function in normal and malignant neural progenitors reveal a positive feedforward loop between OLIG2 and EGFR to sustain co-expression. Furthermore, loss of OLIG2 function results in mesenchymal transformation in PDGFRα(HIGH) GSCs, a phenomenon that appears to be circumscribed in EGFR(HIGH) GSCs. Exploitation of OLIG2's dual and antithetical, pro-mitotic (EGFR-driven), and lineage-specifying (PDGFRα-driven) functions by glioma cells appears to be critical for sustaining growth factor signaling and GSC molecular subtype. PMID:27626655

  8. Id2 Mediates Differentiation of Labyrinthine Placental Progenitor Cell Line, SM10.

    PubMed

    Selesniemi, Kaisa; Albers, Renee E; Brown, Thomas L

    2016-07-01

    The placenta is an organ that is formed transiently during pregnancy, and appropriate placental development is necessary for fetal survival and growth. Proper differentiation of the labyrinthine layer of the placenta is especially crucial, as it establishes the fetal-maternal interface that is involved in physiological exchange processes. Although previous studies have indicated the importance of inhibitor of differentiation/inhibitor of DNA binding-2 (Id2) helix-loop-helix transcriptional regulator in mediating cell differentiation, the ability of Id2 to regulate differentiation toward the labyrinthine (transport) lineage of the placenta has yet to be determined. In the current study, we have generated labyrinthine trophoblast progenitor cells with increased (SM10-Id2) or decreased (SM10-Id2-shRNA) Id2 expression and determined the effect on TGF-β-induced differentiation. Our Id2 overexpression and knockdown analyses indicate that Id2 mediates TGF-β-induced morphological differentiation of labyrinthine trophoblast cells, as Id2 overexpression prevents differentiation and Id2 knockdown results in differentiation. Thus, our data indicate that Id2 is an important molecular mediator of labyrinthine trophoblast differentiation. An understanding of the regulators of trophoblast progenitor differentiation toward the labyrinthine lineage may offer insights into events governing pregnancy-associated disorders, such as placental insufficiency, fetal growth restriction, and preeclampsia. PMID:27168216

  9. Insight into the mechanism of end-of-day far-red light (EODFR)-induced shade avoidance responses in Arabidopsis thaliana.

    PubMed

    Mizuno, Takeshi; Oka, Haruka; Yoshimura, Fumi; Ishida, Kai; Yamashino, Takafumi

    2015-01-01

    Shade avoidance responses are changes in plant architecture to reduce the part of a body that is in the shade in natural habitats. The most common warning signal that induces shade avoidance responses is reduction of red/far-red light ratio perceived by phytochromes. A pair of basic helix-loop-helix transcription factors, named PHYTOCHROME-INTERACTING FACTOR 4 (PIF4) and PIF5, is crucially involved in the shade avoidance-induced hypocotyl elongation in Arabidopsis thaliana. It has been recently reported that PIF7 also plays a role in this event. Here, we examined the involvement of these PIFs in end-of-day far-red light (EODFR) responses under light and dark cycle conditions. It was shown that PIF7 played a predominant role in the EODFR-dependent hypocotyl elongation. We propose the mechanism by which PIF7 together with PIF4 and PIF5 coordinately transcribes a set of downstream genes to promote elongation of hypocotyls in response to the EODFR treatment. PMID:26193333

  10. Differential Expression between Human Dermal Papilla Cells from Balding and Non-Balding Scalps Reveals New Candidate Genes for Androgenetic Alopecia.

    PubMed

    Chew, Elaine G Y; Tan, Joanna H J; Bahta, Adiam W; Ho, Bryan S-Y; Liu, Xingliang; Lim, Tze Chiun; Sia, Yee Yen; Bigliardi, Paul L; Heilmann, Stefanie; Wan, Andrew C A; Nöthen, Markus M; Philpott, Michael P; Hillmer, Axel M

    2016-08-01

    Androgenetic alopecia (AGA) is a common heritable and androgen-dependent hair loss condition in men. Twelve genetic risk loci are known to date, but it is unclear which genes at these loci are relevant for AGA. Dermal papilla cells (DPCs) located in the hair bulb are the main site of androgen activity in the hair follicle. Widely used monolayer-cultured primary DPCs in hair-related studies often lack dermal papilla characteristics. In contrast, immortalized DPCs have high resemblance to intact dermal papilla. We derived immortalized human DPC lines from balding (BAB) and non-balding (BAN) scalp. Both BAB and BAN retained high proportions of dermal papilla signature gene and versican protein expression. We performed expression analysis of BAB and BAN and annotated AGA risk loci with differentially expressed genes. We found evidence for AR but not EDA2R as the candidate gene at the AGA risk locus on chromosome X. Further, our data suggest TWIST1 (twist family basic helix-loop-helix transcription factor 1) and SSPN (sarcospan) to be the functionally relevant AGA genes at the 7p21.1 and 12p12.1 risk loci, respectively. Down-regulated genes in BAB compared to BAN were highly enriched for vasculature-related genes, suggesting that deficiency of DPC from balding scalps in fostering vascularization around the hair follicle may contribute to the development of AGA. PMID:27060448

  11. Olig1 Acetylation and Nuclear Export Mediate Oligodendrocyte Development.

    PubMed

    Dai, Jinxiang; Bercury, Kathryn K; Jin, Weilin; Macklin, Wendy B

    2015-12-01

    The oligodendrocyte transcription factor Olig1 is critical for both oligodendrocyte development and remyelination in mice. Nuclear to cytoplasmic translocation of Olig1 protein occurs during brain development and in multiple sclerosis, but the detailed molecular mechanism of this translocation remains elusive. Here, we report that Olig1 acetylation and deacetylation drive its active translocation between the nucleus and the cytoplasm in both mouse and rat oligodendrocytes. We identified three functional nuclear export sequences (NES) localized in the basic helix-loop-helix domain and one specific acetylation site at Lys 150 (human Olig1) in NES1. Olig1 acetylation and deacetylation are regulated by the acetyltransferase CREB-binding protein and the histone deacetylases HDAC1, HDAC3, and HDAC10. Acetylation of Olig1 decreased its chromatin association, increased its interaction with inhibitor of DNA binding 2 and facilitated its retention in the cytoplasm of mature oligodendrocytes. These studies establish that acetylation of Olig1 regulates its chromatin dissociation and subsequent translocation to the cytoplasm and is required for its function in oligodendrocyte maturation. PMID:26631469

  12. Inhibition of endothelial cell activation by bHLH protein E2-2 and its impairment of angiogenesis.

    PubMed

    Tanaka, Aya; Itoh, Fumiko; Nishiyama, Koichi; Takezawa, Toshiaki; Kurihara, Hiroki; Itoh, Susumu; Kato, Mitsuyasu

    2010-05-20

    E2-2 belongs to the basic helix-loop-helix (bHLH) family of transcription factors. E2-2 associates with inhibitor of DNA binding (Id) 1, which is involved in angiogenesis. In this paper, we demonstrate that E2-2 interacts with Id1 and provide evidence that this interaction potentiates angiogenesis. Mutational analysis revealed that the HLH domain of E2-2 is required for the interaction with Id1 and vice versa. In addition, Id1 interfered with E2-2-mediated effects on luciferase reporter activities. Interestingly, injection of E2-2-expressing adenoviruses into Matrigel plugs implanted under the skin blocked in vivo angiogenesis. In contrast, the injection of Id1-expressing adenoviruses rescued E2-2-mediated inhibition of in vivo angiogenic reaction. Consistent with the results of the Matrigel plug assay, E2-2 could inhibit endothelial cell (EC) migration, network formation, and proliferation. On the other hand, knockdown of E2-2 in ECs increased EC migration. The blockade of EC migration by E2-2 was relieved by exogenous expression of Id1. We also demonstrated that E2-2 can perturb VEGFR2 expression via inhibition of VEGFR2 promoter activity. This study suggests that E2-2 can maintain EC quiescence and that Id1 can counter this effect. PMID:20231428

  13. Phosphorylation Regulates OLIG2 Cofactor Choice and the Motor Neuron-Oligodendrocyte Fate Switch

    PubMed Central

    Li, Huiliang; Paes de Faria, Joana; Andrew, Paul; Nitarska, Justyna; Richardson, William D.

    2011-01-01

    Summary A fundamental feature of central nervous system development is that neurons are generated before glia. In the embryonic spinal cord, for example, a group of neuroepithelial stem cells (NSCs) generates motor neurons (MNs), before switching abruptly to oligodendrocyte precursors (OLPs). We asked how transcription factor OLIG2 participates in this MN-OLP fate switch. We found that Serine 147 in the helix-loop-helix domain of OLIG2 was phosphorylated during MN production and dephosphorylated at the onset of OLP genesis. Mutating Serine 147 to Alanine (S147A) abolished MN production without preventing OLP production in transgenic mice, chicks, or cultured P19 cells. We conclude that S147 phosphorylation, possibly by protein kinase A, is required for MN but not OLP genesis and propose that dephosphorylation triggers the MN-OLP switch. Wild-type OLIG2 forms stable homodimers, whereas mutant (unphosphorylated) OLIG2S147A prefers to form heterodimers with Neurogenin 2 or other bHLH partners, suggesting a molecular basis for the switch. PMID:21382552

  14. A DELLA in Disguise: SPATULA Restrains the Growth of the Developing Arabidopsis Seedling[C][W

    PubMed Central

    Josse, Eve-Marie; Gan, Yinbo; Bou-Torrent, Jordi; Stewart, Kelly L.; Gilday, Alison D.; Jeffree, Christopher E.; Vaistij, Fabián E.; Martínez-García, Jaime F.; Nagy, Ferenc; Graham, Ian A.; Halliday, Karen J.

    2011-01-01

    The period following seedling emergence is a particularly vulnerable stage in the plant life cycle. In Arabidopsis thaliana, the phytochrome-interacting factor (PIF) subgroup of basic-helix-loop-helix transcription factors has a pivotal role in regulating growth during this early phase, integrating environmental and hormonal signals. We previously showed that SPATULA (SPT), a PIF homolog, regulates seed dormancy. In this article, we establish that unlike PIFs, which mainly promote hypocotyl elongation, SPT is a potent regulator of cotyledon expansion. Here, SPT acts in an analogous manner to the gibberellin-dependent DELLAs, REPRESSOR OF GA1-3 and GIBBERELLIC ACID INSENSITIVE, which restrain cotyledon expansion alongside SPT. However, although DELLAs are not required for SPT action, we demonstrate that SPT is subject to negative regulation by DELLAs. Cross-regulation of SPT by DELLAs ensures that SPT protein levels are limited when DELLAs are abundant but rise following DELLA depletion. This regulation provides a means to prevent excessive growth suppression that would result from the dual activity of SPT and DELLAs, yet maintain growth restraint under DELLA-depleted conditions. We present evidence that SPT and DELLAs regulate common gene targets and illustrate that the balance of SPT and DELLA action depends on light quality signals in the natural environment. PMID:21478445

  15. Twist1 Is Essential for Tooth Morphogenesis and Odontoblast Differentiation.

    PubMed

    Meng, Tian; Huang, Yanyu; Wang, Suzhen; Zhang, Hua; Dechow, Paul C; Wang, Xiaofang; Qin, Chunlin; Shi, Bing; D'Souza, Rena N; Lu, Yongbo

    2015-12-01

    Twist1 is a basic helix-loop-helix-containing transcription factor that is expressed in the dental mesenchyme during the early stages of tooth development. To better delineate its roles in tooth development, we generated Twist1 conditional knockout embryos (Twist2(Cre) (/+);Twist1(fl/fl)) by breeding Twist1 floxed mice (Twist1(fl/fl)) with Twist2-Cre recombinase knockin mice (Twist2(Cre) (/+)). The Twist2(Cre) (/+);Twist1(fl/fl) embryos formed smaller tooth germs and abnormal cusps during early tooth morphogenesis. Molecular and histological analyses showed that the developing molars of the Twist2(Cre) (/+);Twist1(fl/fl) embryos had reduced cell proliferation and expression of fibroblast growth factors 3, 4, 9, and 10 and FGF receptors 1 and 2 in the dental epithelium and mesenchyme. In addition, 3-week-old renal capsular transplants of embryonic day 18.5 Twist2(Cre) (/+);Twist1(fl/fl) molars showed malformed crowns and cusps with defective crown dentin and enamel. Immunohistochemical analyses revealed that the implanted mutant molars had defects in odontoblast differentiation and delayed ameloblast differentiation. Furthermore, in vitro ChIP assays demonstrated that Twist1 was able to bind to a specific region of the Fgf10 promoter. In conclusion, our findings suggest that Twist1 plays crucial roles in regulating tooth development and that it may exert its functions through the FGF signaling pathway. PMID:26487719

  16. Math5 is required for retinal ganglion cell and optic nerve formation

    PubMed Central

    Brown, Nadean L.; Patel, Sima; Brzezinski, Joseph; Glaser, Tom

    2006-01-01

    SUMMARY The vertebrate retina contains seven major neuronal and glial cell types in an interconnected network that collects, processes and sends visual signals through the optic nerve to the brain. Retinal neuron differentiation is thought to require both intrinsic and extrinsic factors, yet few intrinsic gene products have been identified that direct this process. Math5 (Atoh7) encodes a basic helix-loop-helix (bHLH) transcription factor that is specifically expressed by mouse retinal progenitors. Math5 is highly homologous to atonal, which is critically required for R8 neuron formation during Drosophila eye development. Like R8 cells in the fly eye, retinal ganglion cells (RGCs) are the first neurons in the vertebrate eye. Here we show that Math5 mutant mice are fully viable, yet lack RGCs and optic nerves. Thus, two evolutionarily diverse eye types require atonal gene family function for the earliest stages of retinal neuron formation. At the same time, the abundance of cone photoreceptors is significantly increased in Math5−/− retinae, suggesting a binary change in cell fate from RGCs to cones. A small number of nascent RGCs are detected during embryogenesis, but these fail to develop further, suggesting that committed RGCs may also require Math5 function. PMID:11493566

  17. Genetic Factors for Enhancement of Nicotine Levels in Cultivated Tobacco

    PubMed Central

    Wang, Bingwu; Lewis, Ramsey S.; Shi, Junli; Song, Zhongbang; Gao, Yulong; Li, Wenzheng; Chen, Hongxia; Qu, Rongda

    2015-01-01

    Nicotine has practical applications relating to smoking cessation devices and alternative nicotine products. Genetic manipulation for increasing nicotine content in cultivated tobacco (Nicotiana tabacum L.) may be of value for industrial purposes, including the possibility of enhancing the efficiency of nicotine extraction. Biotechnological approaches have been evaluated in connection with this objective, but field-based results are few. Here, we report characterization of two genes encoding basic-helix-loop-helix (bHLH) transcription factors (TFs), NtMYC2a and NtMYC2b from tobacco. Overexpression of NtMYC2a increased leaf nicotine levels in T1 transgenic lines approximately 2.3-fold in greenhouse-grown plants of tobacco cultivar ‘NC 95′. Subsequent field testing of T2 and T3 generations of transgenic NtMYC2a overexpression lines showed nicotine concentrations were 76% and 58% higher than control lines, respectively. These results demonstrated that the increased nicotine trait was stably inherited to the T2 and T3 generations, indicating the important role that NtMYC2a plays in regulating nicotine accumulation in N. tabacum and the great potential of NtMYC2a overexpression in tobacco plants for industrial nicotine production. Collected data in this study also indicated a negative feedback inhibition of nicotine biosynthesis. Further enhancement of nicotine accumulation in tobacco leaf may require modification of the processes of nicotine transport and deposition. PMID:26626731

  18. Rhythmic expression of DEC2 protein in vitro and in vivo

    PubMed Central

    SATO, FUYUKI; MURAGAKI, YASUTERU; KAWAMOTO, TAKESHI; FUJIMOTO, KATSUMI; KATO, YUKIO; ZHANG, YANPING

    2016-01-01

    Basic helix-loop-helix (bHLH) transcription factor DEC2 (bHLHE41/Sharp1) is one of the clock genes that show a circadian rhythm in various tissues. DEC2 regulates differentiation, sleep length, tumor cell invasion and apoptosis. Although studies have been conducted on the rhythmic expression of DEC2 mRNA in various tissues, the precise molecular mechanism of DEC2 expression is poorly understood. In the present study, we examined whether DEC2 protein had a rhythmic expression. Western blot analysis for DEC2 protein revealed a rhythmic expression in mouse liver, lung and muscle and in MCF-7 and U2OS cells. In addition, AMP-activated protein kinase (AMPK) activity (phosphorylation of AMPK) in mouse embryonic fibroblasts (MEFs) exhibited a rhythmic expression under the condition of medium change or glucose-depleted medium. However, the rhythmic expression of DEC2 in MEF gradually decreased in time under these conditions. The medium change affected the levels of DEC2 protein and phosphorylation of AMPK. In addition, the levels of DEC2 protein showed a rhythmic expression in vivo and in MCF-7 and U2OS cells. The results showed that the phosphorylation of AMPK immunoreactivity was strongly detected in the liver and lung of DEC2 knockout mice compared with that of wild-type mice. These results may provide new insights into rhythmic expression and the regulation between DEC2 protein and AMPK activity. PMID:27284410

  19. Elevated ASCL2 expression is associated with metastasis of osteosarcoma and predicts poor prognosis of the patients.

    PubMed

    Liu, Ming-Han; Cui, You-Hong; Guo, Qiao-Nan; Zhou, Yue

    2016-01-01

    Achaetescute-like 2 (ASCL2), a basic helix-loop-helix (bHLH) transcription factor, plays an important role in the determination of neuronal precursors in the central and peripheral nervous system and involves in tumor progression. However, the role of ASCL2 expression in the osteosarcoma prognosis has not been elaborated. This study aimed to evaluate ASCL2 expression level in osteosarcoma and assess its prognostic value for patients. ASCL2 protein expression was detected by immunohistochemistry (IHC) in 73 cases of osteosarcoma. Kaplan-Meier analysis and Cox regression analysis were performed to evaluate the prognostic significance of ASCL2. Immunohistochemistry analysis showed that the overall survival and metastasis-free survival of patients with positive ASCL2 expression were significantly shorter than patients with negative expression (both P<0.01). Multivariate Cox analysis identified ASCL2 expression as an independent prognostic factor to predict poor overall survival and metastasis-free survival (both P<0.01). Overexpression of ASCL2 expression greatly promoted cell proliferation and enhanced migration and invasion in vitro. This study indicates that increased expression of ASCL2 in primary osteosarcoma is a novel biomarker for predicting the development of metastases and poor outcomes of the patients. PMID:27429855

  20. CPF1, a yeast protein which functions in centromeres and promoters.

    PubMed Central

    Mellor, J; Jiang, W; Funk, M; Rathjen, J; Barnes, C A; Hinz, T; Hegemann, J H; Philippsen, P

    1990-01-01

    Centromeres and several promoters of Saccharomyces cerevisiae contain a highly conserved octanucleotide, RTCACRTG, called CDEI. Using biochemical, genetic and structural analyses, we show that the same protein binds in vivo to CDEI sites in centromeres and in promoters. This protein, called CPF1 for centromere promoter factor, binds DNA as a dimer. Inactivation of the gene is not lethal but leads to a partial loss of the centromere function and to a Met- phenotype. Changes of the chromatin structure due to inactivation of CPF1 are seen at centromeres and at several CDEI-carrying promoters (e.g. MET25, TRP1, GAL2). However promoter activities are affected in diverse ways making it presently difficult to describe a function for CPF1 in gene expression. The sequence of the cloned gene reveals in the carboxy-terminal part two potential amphipathic helices preceded by a positively charged stretch of amino acids very similar to the helix-loop-helix domains recently identified in factors controlling tissue specific transcription in higher eukaryotes. Carboxy-terminal truncations of CPF1 lacking this domain no longer bind to CDEI. The amino-terminal half of CPF1 carries two clusters of negatively charged amino acid residues. Surprisingly, deletions of these clusters still render cells Met+ and lead only to a marginal decrease in centromere activity. Images Fig. 1. Fig. 2. Fig. 3. Fig. 3. Fig. 4. PMID:2249662

  1. DEC2 is a negative regulator for the proliferation and differentiation of chondrocyte lineage-committed mesenchymal stem cells.

    PubMed

    Sasamoto, Tomoko; Fujimoto, Katsumi; Kanawa, Masami; Kimura, Junko; Takeuchi, Junpei; Harada, Naoko; Goto, Noriko; Kawamoto, Takeshi; Noshiro, Mitsuhide; Suardita, Ketut; Tanne, Kazuo; Kato, Yukio

    2016-09-01

    Differentiated embryo chondrocyte 2 (DEC2) is a basic helix-loop-helix-Orange transcription factor that regulates cell differentiation in various mammalian tissues. DEC2 has been shown to suppress the differentiation of mesenchymal stem cells (MSCs) into myocytes and adipocytes. In the present study, we examined the role of DEC2 in the chondrogenic differentiation of human MSCs. The overexpression of DEC2 exerted minimal effects on the proliferation of MSCs in monolayer cultures with the growth medium under undifferentiating conditions, whereas it suppressed increases in DNA content, glycosaminoglycan content, and the expression of several chondrocyte-related genes, including aggrecan and type X collagen alpha 1, in MSC pellets in centrifuge tubes under chondrogenic conditions. In the pellets exposed to chondrogenesis induction medium, DEC2 overexpression downregulated the mRNA expression of fibroblast growth factor 18, which is involved in the proliferation and differentiation of chondrocytes, and upregulated the expression of p16INK4, which is a cell cycle inhibitor. These findings suggest that DEC2 is a negative regulator of the proliferation and differentiation of chondrocyte lineage-committed mesenchymal cells. PMID:27430159

  2. Isolated Pancreatic Aplasia Due to a Hypomorphic PTF1A Mutation.

    PubMed

    Houghton, Jayne A L; Swift, Galvin H; Shaw-Smith, Charles; Flanagan, Sarah E; de Franco, Elisa; Caswell, Richard; Hussain, Khalid; Mohamed, Sarar; Abdulrasoul, Majedah; Hattersley, Andrew T; MacDonald, Raymond J; Ellard, Sian

    2016-09-01

    Homozygous truncating mutations in the helix-loop-helix transcription factor PTF1A are a rare cause of pancreatic and cerebellar agenesis. The correlation of Ptf1a dosage with pancreatic phenotype in a mouse model suggested the possibility of finding hypomorphic PTF1A mutations in patients with pancreatic agenesis or neonatal diabetes but no cerebellar phenotype. Genome-wide single nucleotide polymorphism typing in two siblings with neonatal diabetes from a consanguineous pedigree revealed a large shared homozygous region (31 Mb) spanning PTF1A Sanger sequencing of PTF1A identified a novel missense mutation, p.P191T. Testing of 259 additional patients using a targeted next-generation sequencing assay for 23 neonatal diabetes genes detected one additional proband and an affected sibling with the same homozygous mutation. All four patients were diagnosed with diabetes at birth and were treated with insulin. Two of the four patients had exocrine pancreatic insufficiency requiring replacement therapy but none of the affected individuals had neurodevelopmental delay. Transient transfection assays of the mutant protein demonstrated a 75% reduction in transactivation activity. This study shows that the functional severity of a homozygous mutation impacts the severity of clinical features found in patients. PMID:27284104

  3. Genetic basis for glandular trichome formation in cotton

    PubMed Central

    Ma, Dan; Hu, Yan; Yang, Changqing; Liu, Bingliang; Fang, Lei; Wan, Qun; Liang, Wenhua; Mei, Gaofu; Wang, Lingjian; Wang, Haiping; Ding, Linyun; Dong, Chenguang; Pan, Mengqiao; Chen, Jiedan; Wang, Sen; Chen, Shuqi; Cai, Caiping; Zhu, Xiefei; Guan, Xueying; Zhou, Baoliang; Zhu, Shuijin; Wang, Jiawei; Guo, Wangzhen; Chen, Xiaoya; Zhang, Tianzhen

    2016-01-01

    Trichomes originate from epidermal cells and can be classified as either glandular or non-glandular. Gossypium species are characterized by the presence of small and darkly pigmented lysigenous glands that contain large amounts of gossypol. Here, using a dominant glandless mutant, we characterize GoPGF, which encodes a basic helix-loop-helix domain-containing transcription factor, that we propose is a positive regulator of gland formation. Silencing GoPGF leads to a completely glandless phenotype. A single nucleotide insertion in GoPGF, introducing a premature stop codon is found in the duplicate recessive glandless mutant (gl2gl3). The characterization of GoPGF helps to unravel the regulatory network of glandular structure biogenesis, and has implications for understanding the production of secondary metabolites in glands. It also provides a potential molecular basis to generate glandless seed and glanded cotton to not only supply fibre and oil but also provide a source of protein for human consumption. PMID:26795254

  4. Conserved regulatory mechanism controls the development of cells with rooting functions in land plants.

    PubMed

    Tam, Thomas Ho Yuen; Catarino, Bruno; Dolan, Liam

    2015-07-21

    Land plants develop filamentous cells-root hairs, rhizoids, and caulonemata-at the interface with the soil. Members of the group XI basic helix-loop-helix (bHLH) transcription factors encoded by LOTUS JAPONICUS ROOTHAIRLESS1-LIKE (LRL) genes positively regulate the development of root hairs in the angiosperms Lotus japonicus, Arabidopsis thaliana, and rice (Oryza sativa). Here we show that auxin promotes rhizoid and caulonema development by positively regulating the expression of PpLRL1 and PpLRL2, the two LRL genes in the Physcomitrella patens genome. Although the group VIII bHLH proteins, AtROOT HAIR DEFECTIVE6 and AtROOT HAIR DEFECTIVE SIX-LIKE1, promote root-hair development by positively regulating the expression of AtLRL3 in A. thaliana, LRL genes promote rhizoid development independently of PpROOT HAIR DEFECTIVE SIX-LIKE1 and PpROOT HAIR DEFECITVE SIX-LIKE2 (PpRSL1 and PpRSL2) gene function in P. patens. Together, these data demonstrate that both LRL and RSL genes are components of an ancient auxin-regulated gene network that controls the development of tip-growing cells with rooting functions among most extant land plants. Although this network has diverged in the moss and the angiosperm lineages, our data demonstrate that the core network acted in the last common ancestor of the mosses and angiosperms that existed sometime before 420 million years ago. PMID:26150509

  5. The rice RING finger E3 ligase, OsHCI1, drives nuclear export of multiple substrate proteins and its heterogeneous overexpression enhances acquired thermotolerance

    PubMed Central

    Lim, Sung Don; Cho, Hyun Yong; Park, Yong Chan; Ham, Deok Jae; Lee, Ju Kyong; Jang, Cheol Seong

    2013-01-01

    Thermotolerance is very important for plant survival when plants are subjected to lethally high temperature. However, thus far little is known about the functions of RING E3 ligase in response to heat shock in plants. This study found that one rice gene encoding the RING finger protein was specifically induced by heat and cold stress treatments but not by salinity or dehydration and named it OsHCI1 (Oryza sativa heat and cold induced 1). Subcellular localization results showed that OsHCI1 was mainly associated with the Golgi apparatus and moved rapidly and extensively along the cytoskeleton. In contrast, OsHCI1 may have accumulated in the nucleus under high temperatures. OsHCI1 physically interacted with nuclear substrate proteins including a basic helix-loop-helix transcription factor. Transient co-overexpression of OsHCI1 and each of three nuclear proteins showed that their fluorescent signals moved into the cytoplasm as punctuate formations. Heterogeneous overexpression of OsHCI1 in Arabidopsis highly increased survival rate through acquired thermotolerance. It is proposed that OsHCI1 mediates nuclear–cytoplasmic trafficking of nuclear substrate proteins via monoubiquitination and drives an inactivation device for the nuclear proteins under heat shock. PMID:23698632

  6. Tissue-Specific Regulation of Gibberellin Signaling Fine-Tunes Arabidopsis Iron-Deficiency Responses.

    PubMed

    Wild, Michael; Davière, Jean-Michel; Regnault, Thomas; Sakvarelidze-Achard, Lali; Carrera, Esther; Lopez Diaz, Isabel; Cayrel, Anne; Dubeaux, Guillaume; Vert, Grégory; Achard, Patrick

    2016-04-18

    Iron is an essential element for most living organisms. Plants acquire iron from the rhizosphere and have evolved different biochemical and developmental responses to adapt to a low-iron environment. In Arabidopsis, FIT encodes a basic helix-loop-helix transcription factor that activates the expression of iron-uptake genes in root epidermis upon iron deficiency. Here, we report that the gibberellin (GA)-signaling DELLA repressors contribute substantially in the adaptive responses to iron-deficient conditions. When iron availability decreases, DELLAs accumulate in the root meristem, thereby restraining root growth, while being progressively excluded from epidermal cells in the root differentiation zone. Such DELLA exclusion from the site of iron acquisition relieves FIT from DELLA-dependent inhibition and therefore promotes iron uptake. Consistent with this mechanism, expression of a non-GA-degradable DELLA mutant protein in root epidermis interferes with iron acquisition. Hence, spatial distribution of DELLAs in roots is essential to fine-tune the adaptive responses to iron availability. PMID:27093087

  7. Environmental and seasonal influences on red raspberry anthocyanin antioxidant contents and identification of quantitative traits loci (QTL).

    PubMed

    Kassim, Angzzas; Poette, Julie; Paterson, Alistair; Zait, Dzeti; McCallum, Susan; Woodhead, Mary; Smith, Kay; Hackett, Christine; Graham, Julie

    2009-05-01

    Consumption of raspberries promotes human health through intake of pharmaceutically active antioxidants, including cyanidin and pelargonidin anthocyanins; products of flavonoid metabolism and also pigments conferring colour to fruit. Raspberry anthocyanin contents could be enhanced for nutritional health and quality benefits utilising DNA polymorphisms in modern marker assisted breeding. The objective was to elucidate factors determining anthocyanin production in these fruits. HPLC quantified eight anthocyanin cyanidin and pelargonidin glycosides: -3-sophoroside, -3-glucoside, -3-rutinoside and -3-glucosylrutinoside across two seasons and two environments in progeny from a cross between two Rubus subspecies, Rubus idaeus (cv. Glen Moy)xRubus strigosus (cv. Latham). Significant seasonal variation was detected across pigments less for different growing environments within seasons. Eight antioxidants mapped to the same chromosome region on linkage group (LG) 1, across both years and from fruits grown in field and under protected cultivation. Seven antioxidants also mapped to a region on LG 4 across years and for both growing sites. A chalcone synthase (PKS 1) gene sequence mapped to LG 7 but did not underlie the anthocyanin quantitative traits loci (QTL) identified. Other candidate genes including basic-helix-loop-helix (bHLH), NAM/CUC2-like protein and bZIP transcription factor underlying the mapped anthocyanins were identified. PMID:19156716

  8. MYC-driven aggressive B-cell lymphomas: biology, entity, differential diagnosis and clinical management

    PubMed Central

    Cai, Qingqing; Medeiros, L. Jeffrey; Xu, Xiaolu; Young, Ken H.

    2015-01-01

    MYC, a potent oncogene located at chromosome locus 8q24.21, was identified initially by its involvement in Burkitt lymphoma with t(8;14)(q24;q32). MYC encodes a helix-loop-helix transcription factor that accentuates many cellular functions including proliferation, growth and apoptosis. MYC alterations also have been identified in other mature B-cell neoplasms and are associated with aggressive clinical behavior. There are several regulatory factors and dysregulated signaling that lead to MYC up-regulation in B-cell lymphomas. One typical example is the failure of physiological repressors such as Bcl6 or BLIMP1 to suppress MYC over-expression. In addition, MYC alterations are often developed concurrently with other genetic alterations that counteract the proapoptotic function of MYC. In this review, we discuss the physiologic function of MYC and the role that MYC likely plays in the pathogenesis of B-cell lymphomas. We also summarize the role MYC plays in the diagnosis, prognostication and various strategies to detect MYC rearrangement and expression. PMID:26416427

  9. RSL Class I Genes Controlled the Development of Epidermal Structures in the Common Ancestor of Land Plants.

    PubMed

    Proust, Hélène; Honkanen, Suvi; Jones, Victor A S; Morieri, Giulia; Prescott, Helen; Kelly, Steve; Ishizaki, Kimitsune; Kohchi, Takayuki; Dolan, Liam

    2016-01-11

    The colonization of the land by plants, sometime before 470 million years ago, was accompanied by the evolution tissue systems [1-3]. Specialized structures with diverse functions-from nutrient acquisition to reproduction-derived from single cells in the outermost layer (epidermis) were important sources of morphological innovation at this time [2, 4, 5]. In extant plants, these structures may be unicellular extensions, such as root hairs or rhizoids [6-9], or multicellular structures, such as asexual propagules or secretory hairs (papillae) [10-12]. Here, we show that a ROOTHAIR DEFECTIVE SIX-LIKE (RSL) class I basic helix-loop-helix transcription factor positively regulates the development of the unicellular and multicellular structures that develop from individual cells that expand out of the epidermal plane of the liverwort Marchantia polymorpha; mutants that lack MpRSL1 function do not develop rhizoids, slime papillae, mucilage papillae, or gemmae. Furthermore, we discovered that RSL class I genes are also required for the development of multicellular axillary hairs on the gametophyte of the moss Physcomitrella patens. Because class I RSL proteins also control the development of rhizoids in mosses and root hairs in angiosperms [13, 14], these data demonstrate that the function of RSL class I genes was to control the development of structures derived from single epidermal cells in the common ancestor of the land plants. Class I RSL genes therefore controlled the generation of adaptive morphological diversity as plants colonized the land from the water. PMID:26725198

  10. Organization of the R chromosome region in maize

    SciTech Connect

    Kermicle, J.

    1992-07-01

    R-r controls the production of anthocyanin pigment in plant parts and the aleurone layer of seeds through the production of a family of transcriptional activating proteins of the helix-loop-helix type. A series of mutant derivatives of R-r which have lost portions of the complex through unequal crossing over or intrachromosomal rearrangements have been examined to elucidate the molecular structure of the complex. The complex comprises a series of repeated, homologous components arranged in both direct and inverted orientations. These include the (P) component which causes pigmentation of plant parts and consists of a simple R gene; the (Q) component which is a truncated and, therefore, an inactive R gene, and the (S) subcomplex which consists of two functional R components that pigment the aleurone. The identity of each functional component was confirmed by microprojectile bombardment of intact maize tissues with cloned genomic DNA. Analysis of high molecular weight DNA has shown that the R-r complex spans more than 250 kb of DNA with the (P) component separated from the others by 190 kb, and the (Q) component separated from the (S) subcomplex by 20 kb. Sequence analysis shows that the R-r elements, (Q), (Sl) and (S2) were derived through the rearrangement of a simple (P)-like progenitor element. We present molecular evidence that the complex arose through a series of transposon-mediated rearrangements.

  11. Organization of the R chromosome region in maize. Triennial report

    SciTech Connect

    Kermicle, J.

    1992-07-01

    R-r controls the production of anthocyanin pigment in plant parts and the aleurone layer of seeds through the production of a family of transcriptional activating proteins of the helix-loop-helix type. A series of mutant derivatives of R-r which have lost portions of the complex through unequal crossing over or intrachromosomal rearrangements have been examined to elucidate the molecular structure of the complex. The complex comprises a series of repeated, homologous components arranged in both direct and inverted orientations. These include the (P) component which causes pigmentation of plant parts and consists of a simple R gene; the (Q) component which is a truncated and, therefore, an inactive R gene, and the (S) subcomplex which consists of two functional R components that pigment the aleurone. The identity of each functional component was confirmed by microprojectile bombardment of intact maize tissues with cloned genomic DNA. Analysis of high molecular weight DNA has shown that the R-r complex spans more than 250 kb of DNA with the (P) component separated from the others by 190 kb, and the (Q) component separated from the (S) subcomplex by 20 kb. Sequence analysis shows that the R-r elements, (Q), (Sl) and (S2) were derived through the rearrangement of a simple (P)-like progenitor element. We present molecular evidence that the complex arose through a series of transposon-mediated rearrangements.

  12. Orchestration of Invariant Natural Killer T cell development by E and Id proteins

    PubMed Central

    Roy, Sumedha; Zhuang, Yuan

    2015-01-01

    Natural Killer T (NKT) cells are αβ T cells that express a semi-invariant T cell receptor (TCR) along with Natural Killer (NK) cell markers, and have an innate cell-like ability to produce a myriad of cytokines very quickly upon antigen exposure and subsequent activation. These cells are diverted from conventional single positive (SP) T cell fate at the double positive (DP) stage where TCR-mediated recognition of a lipid antigen presented on a CD1d molecule promotes their selection into the NKT lineage. Although many key regulatory molecules have been shown to play important roles in the development of NKT cells, the mechanism of lineage specification and acquisition of effector functions in these cells still remain to be fully addressed. In this review we specifically discuss the role of a family of class I Helix Loop Helix proteins known as E proteins, and of their antagonists Id proteins in NKT cell development. Recent works have shown that these proteins play key roles in iNKT development, from the invariant TCR rearrangement to terminal differentiation and maturation. Elucidating these roles provides an opportunity to uncover the transcriptional network that separates NKT cells from the concurrently developed conventional αβ T cells. PMID:25746046

  13. Deficits in trace fear memory in a mouse model of the schizophrenia risk gene TCF4.

    PubMed

    Brzózka, Magdalena M; Rossner, Moritz J

    2013-01-15

    The basic helix-loop-helix (bHLH) transcription factor TCF4 was confirmed in the combined analysis of several large genome-wide association studies (GWAS) as one of the rare highly replicated significant schizophrenia (SZ) susceptibility genes in large case-control cohorts. Focused genetic association studies showed that TCF4 influences verbal learning and memory, and modulates sensorimotor gating. Mice overexpressing Tcf4 in the forebrain (Tcf4tg) display cognitive deficits in hippocampus-dependent learning tasks and impairment of prepulse inhibition, a well-established endophenotype of SZ. The spectrum of cognitive deficits in SZ subjects, however, is broad and covers attention, working memory, and anticipation. Collectively, these higher order cognitive processes and the recall of remote memories are thought to depend mainly on prefrontal cortical networks. To further investigate cognitive disturbances in Tcf4tg mice, we employed the trace fear conditioning paradigm that requires attention and critically depends on the anterior cingulate cortex (ACC). We show that Tcf4tg mice display deficits in recent and remote trace fear memory and are impaired at anticipating aversive stimuli. We also assessed mRNA expression of the neuronal activity-regulated gene Fos in the ACC and hippocampus. Upon trace conditioning, Fos expression is reduced in Tcf4tg mice as compared to controls, which parallels cognitive impairments in this learning paradigm. Collectively, these data indicate that the reduced cognitive performance in Tcf4tg mice includes deficits at the level of attention and behavioral anticipation. PMID:23069005

  14. RICE SALT SENSITIVE3 Forms a Ternary Complex with JAZ and Class-C bHLH Factors and Regulates Jasmonate-Induced Gene Expression and Root Cell Elongation[C][W

    PubMed Central

    Toda, Yosuke; Tanaka, Maiko; Ogawa, Daisuke; Kurata, Kyo; Kurotani, Ken-ichi; Habu, Yoshiki; Ando, Tsuyu; Sugimoto, Kazuhiko; Mitsuda, Nobutaka; Katoh, Etsuko; Abe, Kiyomi; Miyao, Akio; Hirochika, Hirohiko; Hattori, Tsukaho; Takeda, Shin

    2013-01-01

    Plasticity of root growth in response to environmental cues and stresses is a fundamental characteristic of land plants. However, the molecular basis underlying the regulation of root growth under stressful conditions is poorly understood. Here, we report that a rice nuclear factor, RICE SALT SENSITIVE3 (RSS3), regulates root cell elongation during adaptation to salinity. Loss of function of RSS3 only moderately inhibits cell elongation under normal conditions, but it provokes spontaneous root cell swelling, accompanied by severe root growth inhibition, under saline conditions. RSS3 is preferentially expressed in the root tip and forms a ternary complex with class-C basic helix-loop-helix (bHLH) transcription factors and JASMONATE ZIM-DOMAIN proteins, the latter of which are the key regulators of jasmonate (JA) signaling. The mutated protein arising from the rss3 allele fails to interact with bHLH factors, and the expression of a significant portion of JA-responsive genes is upregulated in rss3. These results, together with the known roles of JAs in root growth regulation, suggest that RSS3 modulates the expression of JA-responsive genes and plays a crucial role in a mechanism that sustains root cell elongation at appropriate rates under stressful conditions. PMID:23715469

  15. A Light-Regulated Genetic Module Was Recruited to Carpel Development in Arabidopsis following a Structural Change to SPATULA[W

    PubMed Central

    Reymond, Mathieu C.; Brunoud, Géraldine; Chauvet, Aurélie; Martínez-Garcia, Jaime F.; Martin-Magniette, Marie-Laure; Monéger, Françoise; Scutt, Charles P.

    2012-01-01

    A key innovation of flowering plants is the female reproductive organ, the carpel. Here, we show that a mechanism that regulates carpel margin development in the model flowering plant Arabidopsis thaliana was recruited from light-regulated processes. This recruitment followed the loss from the basic helix-loop-helix transcription factor SPATULA (SPT) of a domain previously responsible for its negative regulation by phytochrome. We propose that the loss of this domain was a prerequisite for the light-independent expression in female reproductive tissues of a genetic module that also promotes shade avoidance responses in vegetative organs. Striking evidence for this proposition is provided by the restoration of wild-type carpel development to spt mutants by low red/far-red light ratios, simulating vegetation shade, which we show to occur via phytochrome B, PHYTOCHROME INTERACTING FACTOR4 (PIF4), and PIF5. Our data illustrate the potential of modular evolutionary events to generate rapid morphological change and thereby provide a molecular basis for neo-Darwinian theories that describe this nongradualist phenomenon. Furthermore, the effects shown here of light quality perception on carpel development lead us to speculate on the potential role of light-regulated mechanisms in plant organs that, like the carpel, form within the shade of surrounding tissues. PMID:22851763

  16. Discrete Levels of Twist Activity Are Required to Direct Distinct Cell Functions during Gastrulation and Somatic Myogenesis

    PubMed Central

    Wong, Ming-Ching; Dobi, Krista C.; Baylies, Mary K.

    2014-01-01

    Twist (Twi), a conserved basic helix-loop-helix transcriptional regulator, directs the epithelial-to-mesenchymal transition (EMT), and regulates changes in cell fate, cell polarity, cell division and cell migration in organisms from flies to humans. Analogous to its role in EMT, Twist has been implicated in metastasis in numerous cancer types, including breast, pancreatic and prostate. In the Drosophila embryo, Twist is essential for discrete events in gastrulation and mesodermal patterning. In this study, we derive a twi allelic series by examining the various cellular events required for gastrulation in Drosophila. By genetically manipulating the levels of Twi activity during gastrulation, we find that coordination of cell division is the most sensitive cellular event, whereas changes in cell shape are the least sensitive. Strikingly, we show that by increasing levels of Snail expression in a severe twi hypomorphic allelic background, but not a twi null background, we can reconstitute gastrulation and produce viable adult flies. Our results demonstrate that the level of Twi activity determines whether the cellular events of ventral furrow formation, EMT, cell division and mesodermal migration occur. PMID:24915423

  17. Association Between Seed Dormancy and Pericarp Color Is Controlled by a Pleiotropic Gene That Regulates Abscisic Acid and Flavonoid Synthesis in Weedy Red Rice

    PubMed Central

    Gu, Xing-You; Foley, Michael E.; Horvath, David P.; Anderson, James V.; Feng, Jiuhuan; Zhang, Lihua; Mowry, Chase R.; Ye, Heng; Suttle, Jeffrey C.; Kadowaki, Koh-ichi; Chen, Zongxiang

    2011-01-01

    Seed dormancy has been associated with red grain color in cereal crops for a century. The association was linked to qSD7-1/qPC7, a cluster of quantitative trait loci for seed dormancy/pericarp color in weedy red rice. This research delimited qSD7-1/qPC7 to the Os07g11020 or Rc locus encoding a basic helix-loop-helix family transcription factor by intragenic recombinants and provided unambiguous evidence that the association arises from pleiotropy. The pleiotropic gene expressed in early developing seeds promoted expression of key genes for biosynthesis of abscisic acid (ABA), resulting in an increase in accumulation of the dormancy-inducing hormone; activated a conserved network of eight genes for flavonoid biosynthesis to produce the pigments in the lower epidermal cells of the pericarp tissue; and enhanced seed weight. Thus, the pleiotropic locus most likely controls the dormancy and pigment traits by regulating ABA and flavonoid biosynthetic pathways, respectively. The dormancy effect could be eliminated by a heat treatment, but could not be completely overcome by gibberellic acid or physical removal of the seed maternal tissues. The dormancy-enhancing alleles differentiated into two groups basically associated with tropical and temperate ecotypes of weedy rice. Of the pleiotropic effects, seed dormancy could contribute most to the weed adaptation. Pleiotropy prevents the use of the dormancy gene to improve resistance of white pericarp cultivars against pre-harvest sprouting through conventional breeding approaches. PMID:21954164

  18. Suppression of invasion and metastasis in aggressive salivary cancer cells through targeted inhibition of ID1 gene expression.

    PubMed

    Murase, Ryuichi; Sumida, Tomoki; Kawamura, Rumi; Onishi-Ishikawa, Akiko; Hamakawa, Hiroyuki; McAllister, Sean D; Desprez, Pierre-Yves

    2016-07-10

    Salivary gland cancer (SGC) represents the most common malignancy in the head and neck region, and often metastasizes to the lungs. The helix-loop-helix ID1 protein has been shown to control metastatic progression in many types of cancers. Using two different approaches to target the expression of ID1 (genetic knockdown and progesterone receptor introduction combined with progesterone treatment), we previously determined that the aggressiveness of salivary gland tumor ACCM cells in culture was suppressed. Here, using the same approaches to target ID1 expression, we investigated the ability of ACCM cells to generate lung metastatic foci in nude mice. Moreover, since both approaches would be challenging for applications in humans, we added a third approach, i.e., treatment of mice with a non-toxic cannabinoid compound known to down-regulate ID1 gene expression. All approaches aimed at targeting the pro-metastatic ID1 gene led to a significant reduction in the formation of lung metastatic foci. Therefore, targeting a key transcriptional regulator using different means results in the same reduction of the metastatic spread of SGC cells in animal models, suggesting a novel approach for the treatment of patients with aggressive SGC. PMID:27087608

  19. Up-regulation of the Sirtuin 1 (Sirt1) and peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α) genes in white adipose tissue of Id1 protein-deficient mice: implications in the protection against diet and age-induced glucose intolerance.

    PubMed

    Zhao, Ying; Ling, Flora; Griffin, Timothy M; He, Ting; Towner, Rheal; Ruan, Hong; Sun, Xiao-Hong

    2014-10-17

    Id1, a helix-loop-helix (HLH) protein that inhibits the function of basic HLH E protein transcription factors in lymphoid cells, has been implicated in diet- and age-induced obesity by unknown mechanisms. Here we show that Id1-deficient mice are resistant to a high fat diet- and age-induced obesity, as revealed by reduced weight gain and body fat, increased lipid oxidation, attenuated hepatosteatosis, lower levels of lipid droplets in brown adipose tissue, and smaller white adipocytes after a high fat diet feeding or in aged animals. Id1 deficiency improves glucose tolerance, lowers serum insulin levels, and reduces TNFα gene expression in white adipose tissue. Id1 deficiency also increased expression of Sirtuin 1 and peroxisome proliferator-activated receptor γ coactivator 1α, regulators of mitochondrial biogenesis and energy expenditure, in the white adipose tissue. This effect was accompanied by the elevation of several genes encoding proteins involved in oxidative phosphorylation and fatty acid oxidation, such as cytochrome c, medium-chain acyl-CoA dehydrogenase, and adipocyte protein 2. Moreover, the phenotype for Id1 deficiency was similar to that of mice expressing an E protein dominant-positive construct, ET2, suggesting that the balance between Id and E proteins plays a role in regulating lipid metabolism and insulin sensitivity. PMID:25190816

  20. A bHLH gene from Tamarix hispida improves abiotic stress tolerance by enhancing osmotic potential and decreasing reactive oxygen species accumulation.

    PubMed

    Ji, Xiaoyu; Nie, Xianguang; Liu, Yujia; Zheng, Lei; Zhao, Huimin; Zhang, Bing; Huo, Lin; Wang, Yucheng

    2016-02-01

    Basic helix-loop-helix (bHLH) leucine-zipper transcription factors play important roles in abiotic stress responses. However, their specific roles in abiotic stress tolerance are not fully known. Here, we functionally characterized a bHLH gene, ThbHLH1, from Tamarix hispida in abiotic stress tolerance. ThbHLH1 specifically binds to G-box motif with the sequence of 'CACGTG'. Transiently transfected T. hispida plantlets with transiently overexpressed ThbHLH1 and RNAi-silenced ThbHLH1 were generated for gain- and loss-of-function analysis. Transgenic Arabidopsis thaliana lines overexpressing ThbHLH1 were generated to confirm the gain- and loss-of-function analysis. Overexpression of ThbHLH1 significantly elevates glycine betaine and proline levels, increases Ca(2+) concentration and enhances peroxidase (POD) and superoxide dismutase (SOD) activities to decrease reactive oxygen species (ROS) accumulation. Additionally, ThbHLH1 regulates the expression of the genes including P5CS, BADH, CaM, POD and SOD, to activate the above physiological changes, and also induces the expression of stress tolerance-related genes LEAs and HSPs. These data suggest that ThbHLH1 induces the expression of stress tolerance-related genes to improve abiotic stress tolerance by increasing osmotic potential, improving ROS scavenging capability and enhancing second messenger in stress signaling cascades. PMID:26786541

  1. Take a deep breath: peptide signalling in stomatal patterning and differentiation.

    PubMed

    Richardson, Lynn G L; Torii, Keiko U

    2013-12-01

    Stomata are pores in the leaf surface that open and close to regulate gas exchange and minimize water loss. In Arabidopsis, a pair of guard cells surrounds each stoma and they are derived from precursors distributed in an organized pattern on the epidermis. Stomatal differentiation follows a well-defined developmental programme, regulated by stomatal lineage-specific basic helix-loop-helix transcription factors, and stomata are consistently separated by at least one epidermal cell (referred to as the 'one-cell-spacing rule') to allow for proper opening and closure of the stomatal aperture. Peptide signalling is involved in regulating stomatal differentiation and in enforcing the one-cell-spacing rule. The cysteine-rich peptides EPIDERMAL PATTERNING FACTOR 1 (EPF1) and EPF2 negatively regulate stomatal differentiation in cells adjacent to stomatal precursors, while STOMAGEN/EPFL9 is expressed in the mesophyll of developing leaves and positively regulates stomatal development. These peptides work co-ordinately with the ERECTA family of leucine-rich repeat (LRR) receptor-like kinases and the LRR receptor-like protein TOO MANY MOUTHS. Recently, specific ligand-receptor pairs were identified that function at two different stages of stomatal development to restrict entry into the stomatal lineage, and later to orient precursor division away from existing stomata. These studies have provided the groundwork to begin to understand the molecular mechanisms involved in cell-cell communication during stomatal development. PMID:23997204

  2. Functional Profiling Identifies Genes Involved in Organ-Specific Branches of the PIF3 Regulatory Network in Arabidopsis[C][W

    PubMed Central

    Sentandreu, Maria; Martín, Guiomar; González-Schain, Nahuel; Leivar, Pablo; Soy, Judit; Tepperman, James M.; Quail, Peter H.; Monte, Elena

    2011-01-01

    The phytochrome (phy)-interacting basic helix-loop-helix transcription factors (PIFs) constitutively sustain the etiolated state of dark-germinated seedlings by actively repressing deetiolation in darkness. This action is rapidly reversed upon light exposure by phy-induced proteolytic degradation of the PIFs. Here, we combined a microarray-based approach with a functional profiling strategy and identified four PIF3-regulated genes misexpressed in the dark (MIDAs) that are novel regulators of seedling deetiolation. We provide evidence that each one of these four MIDA genes regulates a specific facet of etiolation (hook maintenance, cotyledon appression, or hypocotyl elongation), indicating that there is branching in the signaling that PIF3 relays. Furthermore, combining inferred MIDA gene function from mutant analyses with their expression profiles in response to light-induced degradation of PIF3 provides evidence consistent with a model where the action of the PIF3/MIDA regulatory network enables an initial fast response to the light and subsequently prevents an overresponse to the initial light trigger, thus optimizing the seedling deetiolation process. Collectively, the data suggest that at least part of the phy/PIF system acts through these four MIDAs to initiate and optimize seedling deetiolation, and that this mechanism might allow the implementation of spatial (i.e., organ-specific) and temporal responses during the photomorphogenic program. PMID:22108407

  3. RSL Class I Genes Controlled the Development of Epidermal Structures in the Common Ancestor of Land Plants

    PubMed Central

    Proust, Hélène; Honkanen, Suvi; Jones, Victor A.S.; Morieri, Giulia; Prescott, Helen; Kelly, Steve; Ishizaki, Kimitsune; Kohchi, Takayuki; Dolan, Liam

    2016-01-01

    Summary The colonization of the land by plants, sometime before 470 million years ago, was accompanied by the evolution tissue systems [1, 2, 3]. Specialized structures with diverse functions—from nutrient acquisition to reproduction—derived from single cells in the outermost layer (epidermis) were important sources of morphological innovation at this time [2, 4, 5]. In extant plants, these structures may be unicellular extensions, such as root hairs or rhizoids [6, 7, 8, 9], or multicellular structures, such as asexual propagules or secretory hairs (papillae) [10, 11, 12]. Here, we show that a ROOTHAIR DEFECTIVE SIX-LIKE (RSL) class I basic helix-loop-helix transcription factor positively regulates the development of the unicellular and multicellular structures that develop from individual cells that expand out of the epidermal plane of the liverwort Marchantia polymorpha; mutants that lack MpRSL1 function do not develop rhizoids, slime papillae, mucilage papillae, or gemmae. Furthermore, we discovered that RSL class I genes are also required for the development of multicellular axillary hairs on the gametophyte of the moss Physcomitrella patens. Because class I RSL proteins also control the development of rhizoids in mosses and root hairs in angiosperms [13, 14], these data demonstrate that the function of RSL class I genes was to control the development of structures derived from single epidermal cells in the common ancestor of the land plants. Class I RSL genes therefore controlled the generation of adaptive morphological diversity as plants colonized the land from the water. PMID:26725198

  4. FAMA Is an Essential Component for the Differentiation of Two Distinct Cell Types, Myrosin Cells and Guard Cells, in Arabidopsis[W

    PubMed Central

    Shirakawa, Makoto; Ueda, Haruko; Nagano, Atsushi J.; Shimada, Tomoo; Kohchi, Takayuki; Hara-Nishimura, Ikuko

    2014-01-01

    Brassicales plants, including Arabidopsis thaliana, have an ingenious two-compartment defense system, which sequesters myrosinase from the substrate glucosinolate and produces a toxic compound when cells are damaged by herbivores. Myrosinase is stored in vacuoles of idioblast myrosin cells. The molecular mechanism that regulates myrosin cell development remains elusive. Here, we identify the basic helix-loop-helix transcription factor FAMA as an essential component for myrosin cell development along Arabidopsis leaf veins. FAMA is known as a regulator of stomatal development. We detected FAMA expression in myrosin cell precursors in leaf primordia in addition to stomatal lineage cells. FAMA deficiency caused defects in myrosin cell development and in the biosynthesis of myrosinases THIOGLUCOSIDE GLUCOHYDROLASE1 (TGG1) and TGG2. Conversely, ectopic FAMA expression conferred myrosin cell characteristics to hypocotyl and root cells, both of which normally lack myrosin cells. The FAMA interactors ICE1/SCREAM and its closest paralog SCREAM2/ICE2 were essential for myrosin cell development. DNA microarray analysis identified 32 candidate genes involved in myrosin cell development under the control of FAMA. This study provides a common regulatory pathway that determines two distinct cell types in leaves: epidermal guard cells and inner-tissue myrosin cells. PMID:25304202

  5. The aryl hydrocarbon receptor: Regulation of hematopoiesis and involvement in the progression of blood diseases

    PubMed Central

    Casado, Fanny L.; Singh, Kameshwar P.; Gasiewicz, Thomas A.

    2010-01-01

    The aryl hydrocarbon receptor (AhR) is a basic helix-loop-helix protein that belongs to the superfamily of environment-sensing PAS (Per-ARNT-Sim) proteins. A large number of ligands have been described to bind AhR and promote its nuclear translocation. In the nucleus, the AhR and its dimerization partner the AhR nuclear translocase (ARNT), also known as HIF1β, form a DNA-binding complex that acts as a transcriptional regulator. Animal and human data suggest that, beyond its mediating responses to xenobiotic and/or unknown endogenous ligands, the AhR has a role, although as yet undefined, in the regulation of cell cycle and inflammation. The AhR also appears to regulate the hematopoietic and immune systems during development and adult life in a cell-specific manner. While accidental exposure to xenobiotic AhR ligands has been associated with leukemia in humans, the specific mechanisms of AhR involvement are still not completely understood. However, recent data are consistent with a functional role of the AhR in the maintenance of hematopoietic stem and/or progenitor cells (HSCs/HPCs). Studies highlighting AhR-regulation of HSCs/HPCs provide a rational framework to understand their biology, a role of the AhR in hematopoietic diseases, and a means to develop interventions for these diseases. PMID:20171126

  6. Crystal structure of inhibitor of ;#954;B kinase [beta

    SciTech Connect

    Xu, Guozhou; Lo, Yu-Chih; Li, Qiubai; Napolitano, Gennaro; Wu, Xuefeng; Jiang, Xuliang; Dreano, Michel; Karin, Michael; Wu, Hao

    2011-07-26

    Inhibitor of {kappa}B (I{kappa}B) kinase (IKK) phosphorylates I{kappa}B proteins, leading to their degradation and the liberation of nuclear factor {kappa}B for gene transcription. Here we report the crystal structure of IKK{beta} in complex with an inhibitor, at a resolution of 3.6 {angstrom}. The structure reveals a trimodular architecture comprising the kinase domain, a ubiquitin-like domain (ULD) and an elongated, {alpha}-helical scaffold/dimerization domain (SDD). Unexpectedly, the predicted leucine zipper and helix-loop-helix motifs do not form these structures but are part of the SDD. The ULD and SDD mediate a critical interaction with I{kappa}B{alpha} that restricts substrate specificity, and the ULD is also required for catalytic activity. The SDD mediates IKK{beta} dimerization, but dimerization per se is not important for maintaining IKK{beta} activity and instead is required for IKK{beta} activation. Other IKK family members, IKK{alpha}, TBK1 and IKK-i, may have a similar trimodular architecture and function.

  7. The pro-apoptotic protein death-associated protein 3 (DAP3) interacts with the glucocorticoid receptor and affects the receptor function.

    PubMed Central

    Hulkko, S M; Wakui, H; Zilliacus, J

    2000-01-01

    The yeast two-hybrid system was used to isolate cDNAs encoding proteins that interact with the glucocorticoid receptor (GR) ligand-binding domain in a ligand-dependent manner. One isolated cDNA encoded a fragment of death-associated protein 3 (DAP3), which has been implicated as a positive mediator of apoptosis. In vitro experiments showed that the full-length DAP3 also interacted with GR. The main interaction domain was mapped to the N-terminal region of DAP3 that had previously been shown to function in a dominant-negative fashion, protecting cells from apoptosis. Co-transfection experiments in COS-7 cells showed that DAP3 had a stimulatory effect on the ligand-induced transcriptional activation by GR and also increased the steroid-sensitivity. Furthermore, DAP3 formed a complex with several other nuclear receptors and some basic helix-loop-helix/Per-Arnt-Sim proteins, as well as with heat-shock protein 90 (hsp90) (Arnt is the aryl-hydrocarbon-receptor nuclear translocator, and Per and Sim are the Drosophila proteins Period and Single-minded). The results suggest that DAP3 could have an important role in GR action, possibly by modulating the cytoplasmic GR-hsp90 complex. Since glucocorticoids can induce apoptosis, the pro-apoptotic DAP3 protein may be involved in this function of GR. PMID:10903152

  8. The pro-apoptotic protein death-associated protein 3 (DAP3) interacts with the glucocorticoid receptor and affects the receptor function.

    PubMed

    Hulkko, S M; Wakui, H; Zilliacus, J

    2000-08-01

    The yeast two-hybrid system was used to isolate cDNAs encoding proteins that interact with the glucocorticoid receptor (GR) ligand-binding domain in a ligand-dependent manner. One isolated cDNA encoded a fragment of death-associated protein 3 (DAP3), which has been implicated as a positive mediator of apoptosis. In vitro experiments showed that the full-length DAP3 also interacted with GR. The main interaction domain was mapped to the N-terminal region of DAP3 that had previously been shown to function in a dominant-negative fashion, protecting cells from apoptosis. Co-transfection experiments in COS-7 cells showed that DAP3 had a stimulatory effect on the ligand-induced transcriptional activation by GR and also increased the steroid-sensitivity. Furthermore, DAP3 formed a complex with several other nuclear receptors and some basic helix-loop-helix/Per-Arnt-Sim proteins, as well as with heat-shock protein 90 (hsp90) (Arnt is the aryl-hydrocarbon-receptor nuclear translocator, and Per and Sim are the Drosophila proteins Period and Single-minded). The results suggest that DAP3 could have an important role in GR action, possibly by modulating the cytoplasmic GR-hsp90 complex. Since glucocorticoids can induce apoptosis, the pro-apoptotic DAP3 protein may be involved in this function of GR. PMID:10903152

  9. HES1 in immunity and cancer.

    PubMed

    Rani, Aradhana; Greenlaw, Roseanna; Smith, Richard A; Galustian, Christine

    2016-08-01

    Hairy and enhancer of split homolog-1 (HES1) is a part of an extensive family of basic helix-loop-helix (bHLH) proteins and plays a crucial role in the control and regulation of cell cycle, proliferation, cell differentiation, survival and apoptosis in neuronal, endocrine, T-lymphocyte progenitors as well as various cancers. HES1 is a transcription factor which is regulated by the NOTCH, Hedgehog and Wnt signalling pathways. Aberrant expression of these pathways is a common feature of cancerous cells. There appears to be a fine and complicated crosstalk at the molecular level between the various signalling pathways and HES1, which contributes to its effects on the immune response and cancers such as leukaemia. Several mechanisms have been proposed, including an enhanced invasiveness and metastasis by inducing epithelial mesenchymal transition (EMT), in addition to its strict requirement for tumour cell survival. In this review, we summarize the current biology and molecular mechanisms as well as its use as a clinical target in cancer therapeutics. PMID:27066918

  10. CD26-mediated regulation of periostin expression contributes to migration and invasion of malignant pleural mesothelioma cells

    SciTech Connect

    Komiya, Eriko; Ohnuma, Kei; Yamazaki, Hiroto; Hatano, Ryo; Iwata, Satoshi; Okamoto, Toshihiro; Dang, Nam H.; Morimoto, Chikao

    2014-05-16

    Highlights: • CD26-expressing MPM cells upregulate production of periostin. • The intracytoplasmic region of CD26 mediates the upregulation of periostin. • CD26 expression leads to nuclear translocation of Twist1 via phosphorylation of Src. • Secreted periostin enhances migration and invasion of MPM cells. - Abstract: Malignant pleural mesothelioma (MPM) is an aggressive malignancy arising from mesothelial lining of pleura. It is generally associated with a history of asbestos exposure and has a very poor prognosis, partly due to the lack of a precise understanding of the molecular mechanisms associated with its malignant behavior. In the present study, we expanded on our previous studies on the enhanced motility and increased CD26 expression in MPM cells, with a particular focus on integrin adhesion molecules. We found that expression of CD26 upregulates periostin secretion by MPM cells, leading to enhanced MPM cell migratory and invasive activity. Moreover, we showed that upregulation of periostin expression results from the nuclear translocation of the basic helix-loop-helix transcription factor Twist1, a process that is mediated by CD26-associated activation of Src phosphorylation. While providing new and profound insights into the molecular mechanisms involved in MPM biology, these findings may also lead to the development of novel therapeutic strategies for MPM.

  11. Constitutively active Notch1 induces growth arrest of HPV-positive cervical cancer cells via separate signaling pathways

    SciTech Connect

    Talora, Claudio; Cialfi, Samantha; Segatto, Oreste; Morrone, Stefania; Kim Choi, John; Frati, Luigi; Paolo Dotto, Gian; Gulino, Alberto; Screpanti, Isabella . E-mail: isabella.screpanti@uniroma1.it

    2005-05-01

    Notch signaling plays a key role in cell-fate determination and differentiation in different organisms and cell types. Several reports suggest that Notch signaling may be involved in neoplastic transformation. However, in primary keratinocytes, Notch1 can function as a tumor suppressor. Similarly, in HPV-positive cervical cancer cells, constitutively active Notch1 signaling was found to cause growth suppression. Activated Notch1 in these cells represses viral E6/E7 expression through AP-1 down-modulation, resulting in increased p53 expression and a block of pRb hyperphosphorylation. Here we show that in cervical cancer cell lines in which Notch1 ability to repress AP-1 activity is impaired, Notch1-enforced expression elicits an alternative pathway leading to growth arrest. Indeed, activated Notch1 signaling suppresses activity of the helix-loop-helix transcription factor E47, via ERK1/2 activation, resulting in inhibition of cell cycle progression. Moreover, we found that RBP-J{kappa}-dependent Notch signaling is specifically repressed in cervical cancer cells and this repression could provide one such mechanism that needs to be activated for cervical carcinogenesis. Finally, we show that inhibition of endogenous Notch1 signaling, although results in a proliferative advantage, sensitizes cervical cancer cell lines to drug-induced apoptosis. Together, our results provide novel molecular insights into Notch1-dependent growth inhibitory effects, counteracting the transforming potential of HPV.

  12. Up-regulation of the Sirtuin 1 (Sirt1) and Peroxisome Proliferator-activated Receptor γ Coactivator-1α (PGC-1α) Genes in White Adipose Tissue of Id1 Protein-deficient Mice

    PubMed Central

    Zhao, Ying; Ling, Flora; Griffin, Timothy M.; He, Ting; Towner, Rheal; Ruan, Hong; Sun, Xiao-Hong

    2014-01-01

    Id1, a helix-loop-helix (HLH) protein that inhibits the function of basic HLH E protein transcription factors in lymphoid cells, has been implicated in diet- and age-induced obesity by unknown mechanisms. Here we show that Id1-deficient mice are resistant to a high fat diet- and age-induced obesity, as revealed by reduced weight gain and body fat, increased lipid oxidation, attenuated hepatosteatosis, lower levels of lipid droplets in brown adipose tissue, and smaller white adipocytes after a high fat diet feeding or in aged animals. Id1 deficiency improves glucose tolerance, lowers serum insulin levels, and reduces TNFα gene expression in white adipose tissue. Id1 deficiency also increased expression of Sirtuin 1 and peroxisome proliferator-activated receptor γ coactivator 1α, regulators of mitochondrial biogenesis and energy expenditure, in the white adipose tissue. This effect was accompanied by the elevation of several genes encoding proteins involved in oxidative phosphorylation and fatty acid oxidation, such as cytochrome c, medium-chain acyl-CoA dehydrogenase, and adipocyte protein 2. Moreover, the phenotype for Id1 deficiency was similar to that of mice expressing an E protein dominant-positive construct, ET2, suggesting that the balance between Id and E proteins plays a role in regulating lipid metabolism and insulin sensitivity. PMID:25190816

  13. DAPT mediates atoh1 expression to induce hair cell-like cells.

    PubMed

    Ren, Hongmiao; Guo, Weiwei; Liu, Wei; Gao, Weiqiang; Xie, Dinghua; Yin, Tuanfang; Yang, Shiming; Ren, Jihao

    2016-01-01

    Hearing loss is currently an incurable degenerative disease characterized by a paucity of hair cells (HCs), which cannot be spontaneously replaced in mammals. Recent technological advancements in gene therapy and local drug delivery have shed new light for hearing loss. Atoh1, also known as Math1, Hath1, and Cath1, is a proneural basic helix-loop-helix (bHLH) transcription factor that is essential for HC differentiation. At various stages in development, Atoh1 activity is sufficient to drive HC differentiation in the cochlea. Thus, Atoh1 related gene therapy is the most promising option for HC induction. DAPT, an inhibitor of Notch signaling, enhances the expression of Atoh1 indirectly, which in turn promotes the induction of a HC fate. Here, we show that DAPT cooperates with Atoh1 to synergistically promote HC fate in ependymal cells in vitro and promote hair cell regeneration in the cultured basilar membrane (BM) which mimics the microenvironment in vivo. Taken together, our findings demonstrated that DAPT is sufficient to induce HC-like cells via enhancing of the expression of Atoh1 to inhibit the progression of HC apoptosis and to induce new HC formation. PMID:27158355

  14. Transposon-mediated chromosomal rearrangements and gene duplications i