Science.gov

Sample records for hr mas nmr

  1. Slow-spinning low-sideband HR-MAS NMR spectroscopy: delicate analysis of biological samples

    PubMed Central

    Renault, Marie; Shintu, Laetitia; Piotto, Martial; Caldarelli, Stefano

    2013-01-01

    High-Resolution Magic-Angle Spinning (HR-MAS) NMR spectroscopy has become an extremely versatile analytical tool to study heterogeneous systems endowed with liquid-like dynamics. Spinning frequencies of several kHz are however required to obtain NMR spectra, devoid of spinning sidebands, with a resolution approaching that of purely isotropic liquid samples. An important limitation of the method is the large centrifugal forces that can damage the structure of the sample. In this communication, we show that optimizing the sample preparation, particularly avoiding air bubbles, and the geometry of the sample chamber of the HR-MAS rotor leads to high-quality low-sideband NMR spectra even at very moderate spinning frequencies, thus allowing the use of well-established solution-state NMR procedures for the characterization of small and highly dynamic molecules in the most fragile samples, such as live cells and intact tissues. PMID:24284435

  2. Slow-spinning low-sideband HR-MAS NMR spectroscopy: delicate analysis of biological samples

    NASA Astrophysics Data System (ADS)

    Renault, Marie; Shintu, Laetitia; Piotto, Martial; Caldarelli, Stefano

    2013-11-01

    High-Resolution Magic-Angle Spinning (HR-MAS) NMR spectroscopy has become an extremely versatile analytical tool to study heterogeneous systems endowed with liquid-like dynamics. Spinning frequencies of several kHz are however required to obtain NMR spectra, devoid of spinning sidebands, with a resolution approaching that of purely isotropic liquid samples. An important limitation of the method is the large centrifugal forces that can damage the structure of the sample. In this communication, we show that optimizing the sample preparation, particularly avoiding air bubbles, and the geometry of the sample chamber of the HR-MAS rotor leads to high-quality low-sideband NMR spectra even at very moderate spinning frequencies, thus allowing the use of well-established solution-state NMR procedures for the characterization of small and highly dynamic molecules in the most fragile samples, such as live cells and intact tissues.

  3. Molecular degradation of ancient documents revealed by 1H HR-MAS NMR spectroscopy

    NASA Astrophysics Data System (ADS)

    Corsaro, Carmelo; Mallamace, Domenico; ?ojewska, Joanna; Mallamace, Francesco; Pietronero, Luciano; Missori, Mauro

    2013-10-01

    For centuries mankind has stored its knowledge on paper, a remarkable biomaterial made of natural cellulose fibers. However, spontaneous cellulose degradation phenomena weaken and discolorate paper over time. The detailed knowledge of products arising from cellulose degradation is essential in understanding deterioration pathways and in improving durability of cultural heritage. In this study, for the first time, products of cellulose degradation were individually detected in solid paper samples by means of an extremely powerful proton HR-MAS NMR set-up, in combination to a wise use of both ancient and, as reference, artificially aged paper samples. Carboxylic acids, in addition to more complex dicarboxylic and hydroxy-carboxylic acids, were found in all samples studied. Since these products can catalyze further degradation, their knowledge is fundamental to improve conservation strategies of historical documents. Furthermore, the identification of compounds used in ancient production techniques, also suggests for artifacts dating, authentication and provenance.

  4. High resolution magic angle spinning (HR-MAS) NMR spectroscopy of human osteoarthritic cartilage

    PubMed Central

    Shet, Keerthi; Siddiqui, Sarmad M.; Yoshihara, Hikari; Kurhanewicz, John; Ries, Michael; Li, Xiaojuan

    2011-01-01

    Osteoarthritis (OA) is a degenerative disease of the joint and results in changes in the biochemical composition of cartilage. Studies have been undertaken in the past that have used high resolution NMR spectroscopy to study the biochemical composition of porcine, canine and bovine cartilage. In this study high resolution magical angle spinning (HRMAS) NMR spectroscopy at 11.7 T has been used to characterize metabolites and detect differences in the spectral signature of human knee articular cartilage from non-OA healthy cadaver knees and samples acquired from severe OA patients at the time of total knee replacement surgery. A statistically significant difference in the alanine (1.47 ppm), N-acetyl (2.04 ppm), choline (3.25 ppm) and glycine (3.55 ppm) metabolite levels is observed between healthy and OA specimens. The results of the study indicate that a decrease in the intensity of N-acetyl resonance occurs in later stages of OA. A positive correlation of the N-acetyl levels as measured by 1H HR-MAS NMR spectroscopy with the total proteoglycan content in the same cartilage specimens as measured by the GAG assay was observed. This indicates that N-acetyl can serve as an important bio-marker of OA disease progression. A decrease in the alanine concentration in OA may be attributed to the degradation of the collagen framework with disease progression and eventual loss of the degradation products that are transported from cartilage into the synovial cavity. PMID:21850648

  5. 1H HR-MAS NMR Spectroscopy and the Metabolite Determination of Typical Foods in Mediterranean Diet

    PubMed Central

    Corsaro, Carmelo; Mallamace, Domenico; Vasi, Sebastiano; Ferrantelli, Vincenzo; Dugo, Giacomo; Cicero, Nicola

    2015-01-01

    NMR spectroscopy has become an experimental technique widely used in food science. The experimental procedures that allow precise and quantitative analysis on different foods are relatively simple. For a better sensitivity and resolution, NMR spectroscopy is usually applied to liquid sample by means of extraction procedures that can be addressed to the observation of particular compounds. For the study of semisolid systems such as intact tissues, High-Resolution Magic Angle Spinning (HR-MAS) has received great attention within the biomedical area and beyond. Metabolic profiling and metabolism changes can be investigated both in animal organs and in foods. In this work we present a proton HR-MAS NMR study on the typical vegetable foods of Mediterranean diet such as the Protected Geographical Indication (PGI) cherry tomato of Pachino, the PGI Interdonato lemon of Messina, several Protected Designation of Origin (PDO) extra virgin olive oils from Sicily, and the Traditional Italian Food Product (PAT) red garlic of Nubia. We were able to identify and quantify the main metabolites within the studied systems that can be used for their characterization and authentication. PMID:26495154

  6. The metabolic profile of lemon juice by proton HR-MAS NMR: the case of the PGI Interdonato Lemon of Messina.

    PubMed

    Cicero, Nicola; Corsaro, Carmelo; Salvo, Andrea; Vasi, Sebastiano; Giofré, Salvatore V; Ferrantelli, Vincenzo; Di Stefano, Vita; Mallamace, Domenico; Dugo, Giacomo

    2015-01-01

    We have studied by means of High Resolution Magic Angle Spinning Nuclear Magnetic Resonance (HR-MAS NMR) the metabolic profile of the famous Sicilian lemon known as 'Interdonato Lemon of Messina PGI'. The PGI Interdonato Lemon of Messina possesses high organoleptic and healthy properties and is recognised as one of the most nutrient fruits. In particular, some of its constituents are actively studied for their chemo-preventive and therapeutic properties. In this paper, we have determined by means of HR-MAS NMR spectroscopy the molar concentration of the main metabolites constituent the juice of PGI Interdonato Lemon of Messina in comparison with that of the not-PGI Interdonato Lemon of Turkey. Our aim is to develop an analytical technique, in order to determine a metabolic fingerprint able to reveal commercial frauds in national and international markets. PMID:25702767

  7. 1H HR-MAS NMR Based Metabolic Profiling of Cells in Response to Treatment with a Hexacationic Ruthenium Metallaprism as Potential Anticancer Drug

    PubMed Central

    Vermathen, Martina; Paul, Lydia E. H.; Diserens, Gaëlle

    2015-01-01

    1H high resolution magic angle spinning (HR-MAS) NMR spectroscopy was applied in combination with multivariate statistical analyses to study the metabolic response of whole cells to the treatment with a hexacationic ruthenium metallaprism [1]6+ as potential anticancer drug. Human ovarian cancer cells (A2780), the corresponding cisplatin resistant cells (A2780cisR), and human embryonic kidney cells (HEK-293) were each incubated for 24 h and 72 h with [1]6+ and compared to untreated cells. Different responses were obtained depending on the cell type and incubation time. Most pronounced changes were found for lipids, choline containing compounds, glutamate and glutathione, nucleotide sugars, lactate, and some amino acids. Possible contributions of these metabolites to physiologic processes are discussed. The time-dependent metabolic response patterns suggest that A2780 cells on one hand and HEK-293 cells and A2780cisR cells on the other hand may follow different cell death pathways and exist in different temporal stages thereof. PMID:26024484

  8. 1H HR-MAS NMR spectroscopy of tumor-induced local metabolic "field-effects" enables colorectal cancer staging and prognostication.

    PubMed

    Jiménez, Beatriz; Mirnezami, Reza; Kinross, James; Cloarec, Olivier; Keun, Hector C; Holmes, Elaine; Goldin, Robert D; Ziprin, Paul; Darzi, Ara; Nicholson, Jeremy K

    2013-02-01

    Colorectal cancer (CRC) is a major cause of morbidity and mortality in developed countries. Despite operative advances and the widespread adoption of combined-modality treatment, the 5-year survival rarely exceeds 60%. Improving our understanding of the biological processes involved in CRC development and progression will help generate new diagnostic and prognostic approaches. Previous studies have identified altered metabolism as a common feature in carcinogenesis, and quantitative measurement of this altered activity (metabonomics/metabolomics) has the potential to generate novel metabolite-based biomarkers for CRC diagnosis, staging and prognostication. In the present study we applied high-resolution magic angle spinning nuclear magnetic resonance (HR-MAS NMR) spectroscopy to analyze metabolites in intact tumor samples (n = 83) and samples of adjacent mucosa (n = 87) obtained from 26 patients undergoing surgical resection for CRC. Orthogonal partial least-squares discriminant analysis (OPLS-DA) of metabolic profiles identified marked biochemical differences between cancer tissue and adjacent mucosa (R(2) = 0.72; Q(2) = 0.45; AUC = 0.91). Taurine, isoglutamine, choline, lactate, phenylalanine, tyrosine (increased concentrations in tumor tissue) together with lipids and triglycerides (decreased concentrations in tumor tissue) were the most discriminant metabolites between the two groups in the model. In addition, tumor tissue metabolic profiles were able to distinguish between tumors of different T- and N-stages according to TNM classification. Moreover, we found that tumor-adjacent mucosa (10 cm from the tumor margin) harbors unique metabolic field changes that distinguish tumors according to T- and N-stage with higher predictive capability than tumor tissue itself and are accurately predictive of 5-year survival (AUC = 0.88), offering a highly novel means of tumor classification and prognostication in CRC. PMID:23240862

  9. MAS NMR of HIV-1 protein assemblies

    NASA Astrophysics Data System (ADS)

    Suiter, Christopher L.; Quinn, Caitlin M.; Lu, Manman; Hou, Guangjin; Zhang, Huilan; Polenova, Tatyana

    2015-04-01

    The negative global impact of the AIDS pandemic is well known. In this perspective article, the utility of magic angle spinning (MAS) NMR spectroscopy to answer pressing questions related to the structure and dynamics of HIV-1 protein assemblies is examined. In recent years, MAS NMR has undergone major technological developments enabling studies of large viral assemblies. We discuss some of these evolving methods and technologies and provide a perspective on the current state of MAS NMR as applied to the investigations into structure and dynamics of HIV-1 assemblies of CA capsid protein and of Gag maturation intermediates.

  10. Sealed rotors for in situ high temperature high pressure MAS NMR

    SciTech Connect

    Hu, Jian Z.; Hu, Mary Y.; Zhao, Zhenchao; Xu, Souchang; Vjunov, Aleksei; Shi, Hui; Camaioni, Donald M.; Peden, Charles H. F.; Lercher, Johannes A.

    2015-07-06

    Magic angle spinning (MAS) nuclear magnetic resonance (NMR) investigations on heterogeneous samples containing solids, semi-solids, liquid and gases or a mixture of them under non-conventional conditions of a combined high pressure and high temperature, or cold temperature suffer from the unavailability of a perfectly sealed rotor. Here, we report the design of reusable and perfectly-sealed all-zircornia MAS rotors. The rotors are easy to use and are suitable for operation temperatures from below 0 to 250 °C and pressures up to 100 bar. As an example of potential applications we performed in situ MAS NMR investigations of AlPO?-5 molecular sieve crystallization, a kinetic study of the cyclohexanol dehydration reaction using 13C MAS NMR, and an investigation of the metabolomics of intact biological tissue at low temperature using 1H HR-MAS NMR spectroscopy. The in situ MAS NMR experiments performed using the reported rotors allowed reproduction of the results from traditional batch reactions, while offering more detailed quantitative information at the molecular level, as demonstrated for the molecular sieve synthesis and activation energy measurements for cyclohexanol dehydration. The perfectly sealed rotor also shows promising application for metabolomics studies using 1H HR-MAS NMR.

  11. Rapid 3D MAS NMR Spectroscopy at Critical Sensitivity

    E-print Network

    Matsuki, Yoh

    Sensitive SIFTing: Multidimensional non-uniform sampling (NUS) NMR spectroscopy is extended to the severely sensitivity-limited regime typical of MAS NMR of biomacromolecules by the use of spectroscopy by the integration ...

  12. Protein MAS NMR methodology and structural analysis of protein assemblies

    E-print Network

    Bayro, Marvin J

    2010-01-01

    Methodological developments and applications of solid-state magic-angle spinning nuclear magnetic resonance (MAS NMR) spectroscopy, with particular emphasis on the analysis of protein structure, are described in this thesis. ...

  13. Broadband solid-state MAS NMR of paramagnetic systems.

    PubMed

    Pell, Andrew J; Pintacuda, Guido

    2015-02-01

    The combination of new magnet and probe technology with increasingly sophisticated pulse sequences has resulted in an increase in the number of applications of solid-state nuclear magnetic resonance (NMR) spectroscopy to paramagnetic materials and biomolecules. The interaction between the paramagnetic metal ions and the NMR-active nuclei often yields crucial structural or electronic information about the system. In particular the application of magic-angle spinning (MAS) has been shown to be crucial to obtaining resolution that is sufficiently high for studying complex systems. However such systems are generally extremely difficult to study as the shifts and shift anisotropies resulting from the same paramagnetic interaction broaden the spectrum beyond excitation and detection, and the paramagnetic relaxation enhancement (PRE) shortens the lifetimes of the excited signals considerably. One specific area that has therefore been receiving significant attention in recent years, and for which great improvements have been seen, is the development of broadband NMR sequences. The development of new excitation and inversion sequences for paramagnetic systems under MAS has often made the difference between the spectrum being unobtainable, and a complete NMR study being possible. However the development of the new sequences must explicitly take account of the modulation of the anisotropic shift interactions due to the sample rotation, with the resulting spin dynamics often being complicated considerably. The NMR sequences can either be helped or hindered by MAS, with the efficiency of some pulse schemes being destroyed, and others being greatly enhanced. This review describes the pulse sequences that have recently been proposed for broadband excitation, inversion, and refocussing of the signal components of paramagnetic systems. In doing so we define exactly what is meant by "broadband" under spinning conditions, and what the perfect pulse scheme should deliver. We also give a unified description of the spin dynamics under MAS which highlights the strengths and weaknesses of the various schemes, and which can be used as guidance for future research in this area. All the reviewed pulse schemes are evaluated both with simulations and experimental data obtained on the battery material LiFe(0.5)Mn(0.5)PO(4) which is typical of the complexity of the paramagnetic systems that are currently under study. PMID:25669740

  14. Neutron diffraction and MAS NMR of Cesium Tungstate defect pyrochlores

    SciTech Connect

    Whittle, K.R. . E-mail: kwhi02@esc.cam.ac.uk; Lumpkin, G.R.; Ashbrook, S.E.

    2006-02-15

    Defect-pyrochlores based on the formulation CsM {sub 0.5}W{sub 1.5}O{sub 6} (M=Ti, Ti/Zr, Zr and Hf) have been studied using neutron diffraction and magic-angle spinning nuclear magnetic resonance (MAS NMR). The results show that structural changes are linearly linked to the change in ionic-radius for the B-site, e.g. the unit cell changes from 10.2763 A for CsTi{sub 0.5}W{sub 1.5}O{sub 6} to 10.3820 A for CsZr{sub 0.4}W{sub 1.6}O{sub 6}. Changes in the NMR chemical shift correlate with the change in electronegativity on the B-site, and show the presence of only one Cs crystal site.

  15. A general protocol for temperature calibration of MAS NMR probes at arbitrary spinning speeds.

    PubMed

    Guan, Xudong; Stark, Ruth E

    2010-01-01

    A protocol using (207)Pb NMR of solid lead nitrate was developed to determine the temperature of magic-angle spinning (MAS) NMR probes over a range of nominal set temperatures and spinning speeds. Using BioMAS and FastMAS probes with typical sample spinning rates of 8 and 35 kHz, respectively, empirical equations were devised to predict the respective sample temperatures. These procedures provide a straightforward recipe for temperature calibration of any MAS probe. PMID:21036557

  16. A General Protocol for Temperature Calibration of MAS NMR Probes at Arbitrary Spinning Speeds

    PubMed Central

    Guan, Xudong; Stark, Ruth E.

    2010-01-01

    A protocol using 207Pb NMR of solid lead nitrate was developed to determine the temperature of magic-angle spinning (MAS) NMR probes over a range of nominal set temperatures and spinning speeds. Using BioMAS and fastMAS probes with typical sample spinning rates of 8 and 35 kHz, respectively, empirical equations were devised to predict the respective sample temperatures. These procedures provide a straightforward recipe for temperature calibration of any MAS probe. PMID:21036557

  17. Visibility of lipid resonances in HR-MAS spectra of brain biopsies subject to spinning rate variation.

    PubMed

    Precht, C; Diserens, G; Oevermann, A; Vermathen, M; Lang, J; Boesch, C; Vermathen, P

    2015-12-01

    Lipid resonances from mobile lipids can be observed by ¹H NMR spectroscopy in multiple tissues and have also been associated with malignancy. In order to use lipid resonances as a marker for disease, a reference standard from a healthy tissue has to be established taking the influence of variable factors like the spinning rate into account. The purpose of our study was to investigate the effect of spinning rate variation on the HR-MAS pattern of lipid resonances in non-neoplastic brain biopsies from different regions and visualize polar and non-polar lipids by fluorescence microscopy using Nile Red staining. ¹H HR-MAS NMR spectroscopy demonstrated higher lipid peak intensities in normal sheep brain pure white matter biopsies compared to mixed white and gray matter biopsies and pure gray matter biopsies. High spinning rates increased the visibility particularly of the methyl resonances at 1.3 and the methylene resonance at 0.89 ppm in white matter biopsies stronger compared to thalamus and brainstem biopsies, and gray matter biopsies. The absence of lipid droplets and presence of a large number of myelin sheaths observed in white matter by Nile Red fluorescence microscopy suggest that the observed lipid resonances originate from the macromolecular pool of lipid protons of the myelin sheath's plasma membranes. When using lipid contents as a marker for disease, the variable behavior of lipid resonances in different neuroanatomical regions of the brain and at variable spinning rates should be considered. The findings may open up interesting possibilities for investigating lipids in myelin sheaths. PMID:26391918

  18. Higher Order Amyloid Fibril Structure by MAS NMR and DNP Spectroscopy

    E-print Network

    Debelouchina, Galia Tzvetanova

    Protein magic angle spinning (MAS) NMR spectroscopy has generated structural models of several amyloid fibril systems, thus providing valuable information regarding the forces and interactions that confer the extraordinary ...

  19. MAS NMR studies of nanoporous matrices filled with sodium nitrite

    NASA Astrophysics Data System (ADS)

    Gorchakov, A. G.; Sedykh, P. S.; Charnaya, E. V.; Baryshnikov, S. V.; Tien, Cheng; Michel, D.

    2009-10-01

    The sodium nitrite NaNO2 incorporated into MCM-41 molecular sieves with pore sizes of 20, 26, and 37 Å has been investigated by 23Na magic-angle spinning NMR spectroscopy. It has been demonstrated that the structure of the crystalline phase of the nitrite in a confined geometry is similar to the structure of bulk nitrite NaNO2. The direct proof of the diffuse melting of sodium nitrite in the pores has been obtained. The NMR signal of the molten sodium nitrite phase has been observed at temperatures close to the completion of the melting.

  20. Measuring proton shift tensors with ultrafast MAS NMR.

    PubMed

    Miah, Habeeba K; Bennett, David A; Iuga, Dinu; Titman, Jeremy J

    2013-10-01

    A new proton anisotropic-isotropic shift correlation experiment is described which operates with ultrafast MAS, resulting in good resolution of isotropic proton shifts in the detection dimension. The new experiment makes use of a recoupling sequence designed using symmetry principles which reintroduces the proton chemical shift anisotropy in the indirect dimension. The experiment has been used to measure the proton shift tensor parameters for the OH hydrogen-bonded protons in tyrosine·HCl and citric acid at Larmor frequencies of up to 850 MHz. PMID:23911900

  1. 1H High Resolution Magic-Angle Coil Spinning (HR-MACS) - NMR Metabolic Profiling of whole Saccharomyces cervisiae cells: A Demonstrative Study

    NASA Astrophysics Data System (ADS)

    Wong, Alan; Boutin, Celine; Aguiar, Pedro

    2014-06-01

    The low sensitivity of Nuclear Magnetic Resonance (NMR) is its prime shortcoming compared to other analytical methods for metabolomic studies. It relies on large sample volume (30-50 µl for HR-MAS) for rich metabolic profiling, hindering high-throughput screening especially when the sample requires a labor-intensive preparation or is a sacred specimen. This is indeed the case for some living organisms. This study evaluates a 1H HR-MAS approach for metabolic profiling of small volume (250 nl) whole bacterial cells, Saccharomyces cervisiae, using an emerging micro-NMR technology: high-resolution magic-angle coil spinning (HR-MACS). As a demonstrative study for whole cells, we perform two independent metabolomics studies identifying the significant metabolites associated with osmotic stress and aging.

  2. Optimized multiple quantum MAS lineshape simulations in solid state NMR

    NASA Astrophysics Data System (ADS)

    Brouwer, William J.; Davis, Michael C.; Mueller, Karl T.

    2009-10-01

    The majority of nuclei available for study in solid state Nuclear Magnetic Resonance have half-integer spin I>1/2, with corresponding electric quadrupole moment. As such, they may couple with a surrounding electric field gradient. This effect introduces anisotropic line broadening to spectra, arising from distinct chemical species within polycrystalline solids. In Multiple Quantum Magic Angle Spinning (MQMAS) experiments, a second frequency dimension is created, devoid of quadrupolar anisotropy. As a result, the center of gravity of peaks in the high resolution dimension is a function of isotropic second order quadrupole and chemical shift alone. However, for complex materials, these parameters take on a stochastic nature due in turn to structural and chemical disorder. Lineshapes may still overlap in the isotropic dimension, complicating the task of assignment and interpretation. A distributed computational approach is presented here which permits simulation of the two-dimensional MQMAS spectrum, generated by random variates from model distributions of isotropic chemical and quadrupole shifts. Owing to the non-convex nature of the residual sum of squares (RSS) function between experimental and simulated spectra, simulated annealing is used to optimize the simulation parameters. In this manner, local chemical environments for disordered materials may be characterized, and via a re-sampling approach, error estimates for parameters produced. Program summaryProgram title: mqmasOPT Catalogue identifier: AEEC_v1_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEEC_v1_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 3650 No. of bytes in distributed program, including test data, etc.: 73 853 Distribution format: tar.gz Programming language: C, OCTAVE Computer: UNIX/Linux Operating system: UNIX/Linux Has the code been vectorised or parallelized?: Yes RAM: Example: (1597 powder angles) × (200 Samples) × (81 F2 frequency pts) × (31 F1 frequency points) = 3.5M, SMP AMD opteron Classification: 2.3 External routines: OCTAVE ( http://www.gnu.org/software/octave/), GNU Scientific Library ( http://www.gnu.org/software/gsl/), OPENMP ( http://openmp.org/wp/) Nature of problem: The optimal simulation and modeling of multiple quantum magic angle spinning NMR spectra, for general systems, especially those with mild to significant disorder. The approach outlined and implemented in C and OCTAVE also produces model parameter error estimates. Solution method: A model for each distinct chemical site is first proposed, for the individual contribution of crystallite orientations to the spectrum. This model is averaged over all powder angles [1], as well as the (stochastic) parameters; isotropic chemical shift and quadrupole coupling constant. The latter is accomplished via sampling from a bi-variate Gaussian distribution, using the Box-Muller algorithm to transform Sobol (quasi) random numbers [2]. A simulated annealing optimization is performed, and finally the non-linear jackknife [3] is applied in developing model parameter error estimates. Additional comments: The distribution contains a script, mqmasOpt.m, which runs in the OCTAVE language workspace. Running time: Example: (1597 powder angles) × (200 Samples) × (81 F2 frequency pts) × (31 F1 frequency points) = 58.35 seconds, SMP AMD opteron. References:S.K. Zaremba, Annali di Matematica Pura ed Applicata 73 (1966) 293. H. Niederreiter, Random Number Generation and Quasi-Monte Carlo Methods, SIAM, 1992. T. Fox, D. Hinkley, K. Larntz, Technometrics 22 (1980) 29.

  3. Analysis of electron donors in photosystems in oxygenic photosynthesis by photo-CIDNP MAS NMR.

    PubMed

    Najdanova, M; Janssen, G J; de Groot, H J M; Matysik, J; Alia, A

    2015-11-01

    Both photosystem I and photosystem II are considerably similar in molecular architecture but they operate at very different electrochemical potentials. The origin of the different redox properties of these RCs is not yet clear. In recent years, insight was gained into the electronic structure of photosynthetic cofactors through the application of photochemically induced dynamic nuclear polarization (photo-CIDNP) with magic-angle spinning NMR (MAS NMR). Non-Boltzmann populated nuclear spin states of the radical pair lead to strongly enhanced signal intensities that allow one to observe the solid-state photo-CIDNP effect from both photosystem I and II from isolated reaction center of spinach (Spinacia oleracea) and duckweed (Spirodela oligorrhiza) and from the intact cells of the cyanobacterium Synechocystis by (13)C and (15)N MAS NMR. This review provides an overview on the photo-CIDNP MAS NMR studies performed on PSI and PSII that provide important ingredients toward reconstruction of the electronic structures of the donors in PSI and PSII. PMID:26282679

  4. Lip1 Lip2 Lip3 Naa Cr Cho PCho GPCho Identifying constituent tumor tissues subclasses in HR-MAS spectra using advanced blind source separation techniques

    E-print Network

    to histology. Conclusions Using advanced source separation techniques we can correctly decompose the observed tissues subclasses in HR-MAS spectra using advanced blind source separation techniques A. Croitor Sava, D vivo HR-MAS (high-resolution magic angle spinning spectroscopy) technique can preserve tissue

  5. Study on crystallographically inequivalent protons in RbH2AsO4 using static NMR and MAS NMR

    NASA Astrophysics Data System (ADS)

    Lim, Ae Ran; Lee, Kwang-Sei

    2015-02-01

    Two inequivalent protons from 1H NMR spectra of RbH2AsO4 in the paraelectric phase were distinguished using static NMR and MAS NMR. From the 1H spin-lattice relaxation times in the laboratory frame, T1, and rotating frame, T1?, of the two crystallographically inequivalent hydrogen sites, i.e., H(1) and H(2), the temperature dependences of T1 and T1? for H(1) were related to the reorientational motion. The shorter H(1) bonds give rise to stronger H-bonds, and protons involved in stronger H-bonds have long relaxation times. Consequently, the RbH2AsO4 structure has two crystallographically inequivalent sites with two different hydrogen-bond lengths.

  6. Physical properties of the nonlinear optical material Li2B4O7 studied by static NMR and MAS NMR

    NASA Astrophysics Data System (ADS)

    Lim, Ae Ran

    2015-07-01

    The mechanisms behind the nonlinear optical (NLO) properties of Li2B4O7 are characterized by 7Li static nuclear magnetic resonance (NMR) and magic-angle spinning (MAS) NMR. Furthermore, the structural nature of 3-coordinate BO3 and 4-coordinate BO4 groups is also characterized by the same method. For 7Li and 11B, the spin-lattice relaxation time T1 in laboratory frame gradually decreases with increasing temperature, whereas the spin-lattice relaxation time T1? in rotating frame, which differs from T1, is nearly constant. In addition, the activation energies of 7Li and 11B, which are obtained via the values of T1 and T1?, are also compared.

  7. Effects of nucleotide binding to LmrA: A combined MAS-NMR and solution NMR study.

    PubMed

    Hellmich, Ute A; Mönkemeyer, Leonie; Velamakanni, Saroj; van Veen, Hendrik W; Glaubitz, Clemens

    2015-12-01

    ABC transporters are fascinating examples of fine-tuned molecular machines that use the energy from ATP hydrolysis to translocate a multitude of substrates across biological membranes. While structural details have emerged on many members of this large protein superfamily, a number of functional details are still under debate. High resolution structures yield valuable insights into protein function, but it is the combination of structural, functional and dynamic insights that facilitates a complete understanding of the workings of their complex molecular mechanisms. NMR is a technique well-suited to investigate proteins in atomic resolution while taking their dynamic properties into account. It thus nicely complements other structural techniques, such as X-ray crystallography, that have contributed high-resolution data to the architectural understanding of ABC transporters. Here, we describe the heterologous expression of LmrA, an ABC exporter from Lactococcus lactis, in Escherichia coli. This allows for more flexible isotope labeling for nuclear magnetic resonance (NMR) studies and the easy study of LmrA's multidrug resistance phenotype. We use a combination of solid-state magic angle spinning (MAS) on the reconstituted transporter and solution NMR on its isolated nucleotide binding domain to investigate consequences of nucleotide binding to LmrA. We find that nucleotide binding affects the protein globally, but that NMR is also able to pinpoint local dynamic effects to specific residues, such as the Walker A motif's conserved lysine residue. PMID:26449340

  8. Enhanced sensitivity by nonuniform sampling enables multidimensional MAS NMR spectroscopy of protein assemblies.

    PubMed

    Paramasivam, Sivakumar; Suiter, Christopher L; Hou, Guangjin; Sun, Shangjin; Palmer, Melissa; Hoch, Jeffrey C; Rovnyak, David; Polenova, Tatyana

    2012-06-28

    We report dramatic sensitivity enhancements in multidimensional MAS NMR spectra by the use of nonuniform sampling (NUS) and introduce maximum entropy interpolation (MINT) processing that assures the linearity between the time and frequency domains of the NUS acquired data sets. A systematic analysis of sensitivity and resolution in 2D and 3D NUS spectra reveals that with NUS, at least 1.5- to 2-fold sensitivity enhancement can be attained in each indirect dimension without compromising the spectral resolution. These enhancements are similar to or higher than those attained by the newest-generation commercial cryogenic probes. We explore the benefits of this NUS/MaxEnt approach in proteins and protein assemblies using 1-73-(U-(13)C,(15)N)/74-108-(U-(15)N) Escherichia coli thioredoxin reassembly. We demonstrate that in thioredoxin reassembly, NUS permits acquisition of high-quality 3D-NCACX spectra, which are inaccessible with conventional sampling due to prohibitively long experiment times. Of critical importance, issues that hinder NUS-based SNR enhancement in 3D-NMR of liquids are mitigated in the study of solid samples in which theoretical enhancements on the order of 3-4 fold are accessible by compounding the NUS-based SNR enhancement of each indirect dimension. NUS/MINT is anticipated to be widely applicable and advantageous for multidimensional heteronuclear MAS NMR spectroscopy of proteins, protein assemblies, and other biological systems. PMID:22667827

  9. Rotor-synchronized dipolar-filter sequence at fast MAS in solid-state NMR.

    PubMed

    Liu, Qing-Hua; Ma, Chao; Hu, Bing-Wen; Chen, Qun; Trebosc, Julien; Lafon, Olivier; Amoureux, Jean-Paul

    2011-10-01

    Dipolar filters are of considerable importance for eliminating the (1)H NMR signal of the rigid components of heterogeneous compounds while selecting the signal of their mobile parts. On the basis of such filters, structural and dynamical information of these compounds can often be acquired through further manipulations (e.g. spin diffusion) on the spin systems. To overcome the destructive interferences between the magic angle spinning (MAS) speed and the cycle-time of the widely-used Rotor-Asynchronized Dipolar Filter (RADF) sequence, we introduce a new method called Rotor-Synchronized Dipolar Filter (RSDF). This communication shows that this sequence does not present any interference with the spinning speed and is more compatible than RADF with high MAS frequencies (?(R)>12 kHz). This new pulse sequence will potentially contribute to future researches on heterogeneous materials, such as multiphase polymer and membrane systems. PMID:21889376

  10. Identification of Metastasis-Associated Metabolic Profiles of Tumors by 1H-HR-MAS-MRS123

    PubMed Central

    Gorad, Saurabh S.; Ellingsen, Christine; Bathen, Tone F.; Mathiesen, Berit S.; Moestue, Siver A.; Rofstad, Einar K.

    2015-01-01

    Tumors develop an abnormal microenvironment during growth, and similar to the metastatic phenotype, the metabolic phenotype of cancer cells is tightly linked to characteristics of the tumor microenvironment (TME). In this study, we explored relationships between metabolic profile, metastatic propensity, and hypoxia in experimental tumors in an attempt to identify metastasis-associated metabolic profiles. Two human melanoma xenograft lines (A-07, R-18) showing different TMEs were used as cancer models. Metabolic profile was assessed by proton high resolution magic angle spinning magnetic resonance spectroscopy (1H-HR-MAS-MRS). Tumor hypoxia was detected in immunostained histological preparations by using pimonidazole as a hypoxia marker. Twenty-four samples from 10 A-07 tumors and 28 samples from 10 R-18 tumors were analyzed. Metastasis was associated with hypoxia in both A-07 and R-18 tumors, and 1H-HR-MAS-MRS discriminated between tissue samples with and tissue samples without hypoxic regions in both models, primarily because hypoxia was associated with high lactate resonance peaks in A-07 tumors and with low lactate resonance peaks in R-18 tumors. Similarly, metastatic and non-metastatic R-18 tumors showed significantly different metabolic profiles, but not metastatic and non-metastatic A-07 tumors, probably because some samples from the metastatic A-07 tumors were derived from tumor regions without hypoxic tissue. This study suggests that 1H-HR-MAS-MRS may be a valuable tool for evaluating the role of hypoxia and lactate in tumor metastasis as well as for identification of metastasis-associated metabolic profiles. PMID:26585232

  11. 1H, 13C MAS NMR and GIAO-CPHF calculations of chloramphenicol, thiamphenicol and their pyrrole analogues

    NASA Astrophysics Data System (ADS)

    ?o?ek, Teresa; Paradowska, Katarzyna; Krajewska, Dorota; Ró?a?ski, Andrzej; Wawer, Iwona

    2003-02-01

    The 13C CP MAS and 1H MAS NMR and ab initio (GIAO-CPHF) calculations were used to obtain structural information on two known antibiotics: chloramphenicol, and thiamphenicol, and two new analogues: DL- threo-1-(1-methyl-4-nitro-pyrrole-2-yl)-2-dichloroacetamidopropane-1,3-diol and DL- threo-1-(1-methylsulfonylpyrrole-3-yl)-2-dichloroacetamidopropane-1,3-diol.

  12. Higher order amyloid fibril structure by MAS NMR and DNP spectroscopy.

    PubMed

    Debelouchina, Galia T; Bayro, Marvin J; Fitzpatrick, Anthony W; Ladizhansky, Vladimir; Colvin, Michael T; Caporini, Marc A; Jaroniec, Christopher P; Bajaj, Vikram S; Rosay, Melanie; Macphee, Cait E; Vendruscolo, Michele; Maas, Werner E; Dobson, Christopher M; Griffin, Robert G

    2013-12-26

    Protein magic angle spinning (MAS) NMR spectroscopy has generated structural models of several amyloid fibril systems, thus providing valuable information regarding the forces and interactions that confer the extraordinary stability of the amyloid architecture. Despite these advances, however, obtaining atomic resolution information describing the higher levels of structural organization within the fibrils remains a significant challenge. Here, we detail MAS NMR experiments and sample labeling schemes designed specifically to probe such higher order amyloid structure, and we have applied them to the fibrils formed by an eleven-residue segment of the amyloidogenic protein transthyretin (TTR(105-115)). These experiments have allowed us to define unambiguously not only the arrangement of the peptide ?-strands into ?-sheets but also the ?-sheet interfaces within each protofilament, and in addition to identify the nature of the protofilament-to-protofilament contacts that lead to the formation of the complete fibril. Our efforts have resulted in 111 quantitative distance and torsion angle restraints (10 per residue) that describe the various levels of structure organization. The experiments benefited extensively from the use of dynamic nuclear polarization (DNP), which in some cases allowed us to shorten the data acquisition time from days to hours and to improve significantly the signal-to-noise ratios of the spectra. The ?-sheet interface and protofilament interactions identified here revealed local variations in the structure that result in multiple peaks for the exposed N- and C-termini of the peptide and in inhomogeneous line-broadening for the residues buried within the interior of the fibrils. PMID:24304221

  13. Higher Order Amyloid Fibril Structure by MAS NMR and DNP Spectroscopy

    PubMed Central

    Debelouchina, Galia T.; Bayro, Marvin J.; Fitzpatrick, Anthony W.; Ladizhansky, Vladimir; Colvin, Michael T.; Caporini, Marc A.; Jaroniec, Christopher P.; Bajaj, Vikram S.; Rosay, Melanie; MacPhee, Cait E.; Vendruscolo, Michele; Maas, Werner E.; Dobson, Christopher M.; Griffin, Robert G.

    2014-01-01

    Protein magic angle spinning (MAS) NMR spectroscopy has generated structural models of several amyloid fibril systems, thus providing valuable information regarding the forces and interactions that confer the extraordinary stability of the amyloid architecture. Despite these advances, however, obtaining atomic resolution information describing the higher levels of structural organization within the fibrils remains a significant challenge. Here, we detail MAS NMR experiments and sample labeling schemes designed specifically to probe such higher order amyloid structure and we have applied them to the fibrils formed by an eleven-residue segment of the amyloidogenic protein transthyretin (TTR(105-115)). These experiments have allowed us to define unambiguously not only the arrangement of the peptide ?-strands into ?-sheets but also the ?-sheet interfaces within each protofilament, and in addition to identify the nature of the protofilament-to-protofilament contacts that lead to the formation of the complete fibril. Our efforts have resulted in 111 quantitative distance and torsion angle restraints (10 per residue) that describe the various levels of structure organization. The experiments benefited extensively from the use of dynamic nuclear polarization (DNP), which in some cases allowed us to shorten the data acquisition time from days to hours and to improve significantly the signal-to-noise ratios of the spectra. The ?-sheet interface and protofilament interactions identified here revealed local variations in the structure that result in multiple peaks for the exposed N- and C-termini of the peptide and in inhomogeneous line-broadening for the side-chains buried within the interior of the fibrils. PMID:24304221

  14. Low Temperature 1H MAS NMR Spectroscopy Studies of Proton Motion in Zeolite

    SciTech Connect

    Huo, H.; Peng, L; Grey, C

    2009-01-01

    Low temperature {sup 1}H MAS NMR spectroscopy is used to study protonic motion in zeolite HZSM-5 in both samples that have been dried using procedures that are standard in the literature and samples that have been more carefully dehydrated. A significant enhancement of proton mobility is seen for the ''standard'' dehydrated HZSM-5 sample in comparison to that seen for the much drier sample. This is ascribed to a vehicle-hopping mechanism involving the residual water that is present in these zeolites. A gradual change of the framework structure is observed on cooling to approximately 213 K, as monitored via the change in {sup 1}H chemical shift values of the Broensted acid resonances and by X-ray diffraction. A more sudden change in structure is seen by differential scanning calorimetry and NMR at approximately 220?230 K, which is associated with changes in both the mobility and the modes of binding of the residual water to the Broensted acid sites and the zeolite framework.

  15. Broadband inversion for MAS NMR with single-sideband-selective adiabatic pulses.

    PubMed

    Pell, Andrew J; Kervern, Gwendal; Emsley, Lyndon; Deschamps, Michaäl; Massiot, Dominique; Grandinetti, Philip J; Pintacuda, Guido

    2011-01-14

    We explain how and under which conditions it is possible to obtain an efficient inversion of an entire sideband family of several hundred kHz using low-power, sideband-selective adiabatic pulses, and we illustrate with some experimental results how this framework opens new avenues in solid-state NMR for manipulating spin systems with wide spinning-sideband (SSB) manifolds. This is achieved through the definition of the criteria of phase and amplitude modulation for designing an adiabatic inversion pulse for rotating solids. In turn, this is based on a framework for representing the Hamiltonian of the spin system in an NMR experiment under magic angle spinning (MAS). Following earlier ideas from Caravatti et al. [J. Magn. Reson. 55, 88 (1983)], the so-called "jolting frame" is used, which is the interaction frame of the anisotropic interaction giving rise to the SSB manifold. In the jolting frame, the shift modulation affecting the nuclear spin is removed, while the Hamiltonian corresponding to the RF field is frequency modulated and acquires a spinning-sideband pattern, specific for each crystallite orientation. PMID:21241090

  16. DOI: 10.1002/adsc.201000585 Synthesis, Immobilization, MAS and HR-MAS NMR of a New

    E-print Network

    Bluemel, Janet

    the formation of rhodium nanoparticles with a narrow size distribu- tion around 4 nm has been proven. Keywords nanoparticles Introduction Catalysts immobilized on solid supports are of grow- ing academic and industrial successful immobilized nickel[3] and rhodium[4] catalysts for cyclotrimerizations of acetylenes and olefin

  17. Characterization of cation environments in polycrystalline forsterite by Mg-25 MAS, MQMAS, and QCPMG NMR

    SciTech Connect

    Davis, Michael C.; Brouwer, William J.; Lipton, Andrew S.; Gan, Zhehong; Mueller, Karl T.

    2010-11-01

    Forsterite (Mg2SiO4) is a silicate mineral frequently studied in the Earth sciences as it has a simple crystal structure and fast dissolution kinetics (elemental release rates under typical conditions on the order of 10-7 mol/m2/s1). During the dissolution process, spectroscopic techniques are often utilized to augment solution chemical analysis and to provide data for determining reaction mechanisms. Nuclear magnetic resonance (NMR) is able to interrogate the local bonding arrangement and coordination of a particular nuclide to obtain in structural information. Although previous NMR studies have focused on the silicon and oxygen environments in forsterite, studies focusing on the two nonequivalent magnesium environments in forsterite are limited to a few single-crystal studies. In this study, we present the results of 25Mg MAS, MQMAS, and static QCMG experiments performed on a powdered sample of pure synthetic forsterite. We also present spectral fits obtained from simulation software packages, which directly provide quadrupolar parameters for 25Mg nuclei occupying each of the two nonequivalent magnesium sites in the forsterite structure. These results are compared to calculations of the electric field gradient tenor conducted in previous ab initio studies to make definitive assignments correlating each peak to their respective magnesium site in the forsterite structure. Although previous NMR investigations of forsterite have focused on single-crystal samples, we have focused on powdered forsterite as the increased surface area of powdered samples makes them more amenable to laboratory-scale dissolution studies and, ultimately, the products from chemical weathering may be monitored an quantified.

  18. Magnesium Silicate Dissolution Investigated by 29Si MAS, 1H-29Si CP MAS, 25Mg QCPMG, and 1H-25Mg CP QCPMG NMR

    SciTech Connect

    Davis, Michael C.; Brouwer, William J.; Wesolowski, David J.; Anovitz, Lawrence M.; Lipton, Andrew S.; Mueller, Karl T.

    2009-08-01

    Olivine has been the subject of frequent investigation in the earth sciences because of its simple structure and rapid dissolution kinetics. Several studies have observed a preferential release of magnesium with respect to silica during weathering under acidic conditions, which has been correlated to the formation of a silicon rich leached layer. While leached layer formation has been inferred through the changing solution chemistry, a thorough spectroscopic investigation of olivine reacted under acidic conditions has not been conducted. In particular, the fate of magnesium in the system is not understood and spectroscopic interrogations through nuclear magnetic resonance can elucidate the changing magnesium coordination and bonding environment. In this study, we combine analysis of the changing solution chemistry with advanced spectroscopic techniques (29Si MAS, 1H-29Si CP MAS, 25Mg QCPMG, and 1H-25Mg 2 CP QCPMG NMR) to probe leached layer formation and possible secondary phase precipitation during the dissolution of forsterite at 150 oC.

  19. Proton chemical shift tensors determined by 3D ultrafast MAS double-quantum NMR spectroscopy

    NASA Astrophysics Data System (ADS)

    Zhang, Rongchun; Mroue, Kamal H.; Ramamoorthy, Ayyalusamy

    2015-10-01

    Proton NMR spectroscopy in the solid state has recently attracted much attention owing to the significant enhancement in spectral resolution afforded by the remarkable advances in ultrafast magic angle spinning (MAS) capabilities. In particular, proton chemical shift anisotropy (CSA) has become an important tool for obtaining specific insights into inter/intra-molecular hydrogen bonding. However, even at the highest currently feasible spinning frequencies (110-120 kHz), 1H MAS NMR spectra of rigid solids still suffer from poor resolution and severe peak overlap caused by the strong 1H-1H homonuclear dipolar couplings and narrow 1H chemical shift (CS) ranges, which render it difficult to determine the CSA of specific proton sites in the standard CSA/single-quantum (SQ) chemical shift correlation experiment. Herein, we propose a three-dimensional (3D) 1H double-quantum (DQ) chemical shift/CSA/SQ chemical shift correlation experiment to extract the CS tensors of proton sites whose signals are not well resolved along the single-quantum chemical shift dimension. As extracted from the 3D spectrum, the F1/F3 (DQ/SQ) projection provides valuable information about 1H-1H proximities, which might also reveal the hydrogen-bonding connectivities. In addition, the F2/F3 (CSA/SQ) correlation spectrum, which is similar to the regular 2D CSA/SQ correlation experiment, yields chemical shift anisotropic line shapes at different isotropic chemical shifts. More importantly, since the F2/F1 (CSA/DQ) spectrum correlates the CSA with the DQ signal induced by two neighboring proton sites, the CSA spectrum sliced at a specific DQ chemical shift position contains the CSA information of two neighboring spins indicated by the DQ chemical shift. If these two spins have different CS tensors, both tensors can be extracted by numerical fitting. We believe that this robust and elegant single-channel proton-based 3D experiment provides useful atomistic-level structural and dynamical information for a variety of solid systems that possess high proton density.

  20. Structural investigations of borosilicate glasses containing MoO 3 by MAS NMR and Raman spectroscopies

    NASA Astrophysics Data System (ADS)

    Caurant, D.; Majérus, O.; Fadel, E.; Quintas, A.; Gervais, C.; Charpentier, T.; Neuville, D.

    2010-01-01

    High molybdenum concentration in glass compositions may lead to alkali and alkaline-earth molybdates crystallization during melt cooling that must be controlled particularly during the preparation of highly radioactive nuclear glassy waste forms. To understand the effect of molybdenum addition on the structure of a simplified nuclear glass and to know how composition changes can affect molybdates crystallization tendency, the structure of two glass series belonging to the SiO 2-B 2O 3-Na 2O-CaO-MoO 3 system was studied by 29Si, 11B, 23Na MAS NMR and Raman spectroscopies by increasing MoO 3 or B 2O 3 concentrations. Increasing MoO 3 amount induced an increase of the silicate network reticulation but no significant effect was observed on the proportion of BO4- units and on the distribution of Na + cations in glass structure. By increasing B 2O 3 concentration, a strong evolution of the distribution of Na + cations was observed that could explain the evolution of the nature of molybdate crystals (CaMoO 4 or Na 2MoO 4) formed during melt cooling.

  1. Magnesium silicate dissolution investigated by Si-29 MAS, H-1-Si-29 CPMAS, Mg-25 QCPMG NMR.

    SciTech Connect

    Davis, M C; Wesolowski, David J

    2009-09-01

    Olivine-(Mg,Fe){sub 2}SiO{sub 4}-has been the subject of frequent investigation in the earth sciences because of its simple structure and rapid dissolution kinetics. Several studies have observed a preferential release of the divalent cation with respect to silicon during weathering under acidic conditions, which has been correlated to the formation of a silicon-rich leached layer. While leached layer formation has been inferred through the changing solution chemistry, a thorough spectroscopic investigation of olivine reacted under acidic conditions has not been conducted. The pure magnesium end member of the olivine series (forsterite-Mg{sub 2}SiO{sub 4}) was chosen for detailed investigations in this study because paramagnetic iron hinders NMR investigations by providing an extra mode of relaxation for neighboring nuclei, causing lineshapes to become significantly broadened and unobservable in the NMR spectrum. For reacting forsterite, spectroscopic interrogations using nuclear magnetic resonance (NMR) can elucidate the changing magnesium coordination and bonding environment. In this study, we combine analysis of the changing solution chemistry with advanced NMR techniques ({sup 29}Si MAS, {sup 1}H-{sup 29}Si CP MAS, {sup 25}Mg QCPMG, and {sup 1}H-{sup 25}Mg CP QCPMG NMR) to probe leached layer formation and secondary phase precipitation during the dissolution of forsterite at 150 C.

  2. Proton-detected heteronuclear single quantum correlation NMR spectroscopy in rigid solids with ultra-fast MAS

    NASA Astrophysics Data System (ADS)

    Holland, Gregory P.; Cherry, Brian R.; Jenkins, Janelle E.; Yarger, Jeffery L.

    2010-01-01

    In this article, we show the potential for utilizing proton-detected heteronuclear single quantum correlation (HSQC) NMR in rigid solids under ultra-fast magic angle spinning (MAS) conditions. The indirect detection of carbon-13 from coupled neighboring hydrogen nuclei provides a sensitivity enhancement of 3- to 4-fold in crystalline amino acids over direct-detected versions. Furthermore, the sensitivity enhancement is shown to be significantly larger for disordered solids that display inhomogeneously broadened carbon-13 spectra. Latrodectus hesperus (Black Widow) dragline silk is given as an example where the sample is mass-limited and the sensitivity enhancement for the proton-detected experiment is 8- to 13-fold. The ultra-fast MAS proton-detected HSQC solid-state NMR technique has the added advantage that no proton homonuclear decoupling is applied during the experiment. Further, well-resolved, indirectly observed carbon-13 spectra can be obtained in some cases without heteronuclear proton decoupling.

  3. Proton-detected heteronuclear single quantum correlation NMR spectroscopy in rigid solids with ultra-fast MAS.

    PubMed

    Holland, Gregory P; Cherry, Brian R; Jenkins, Janelle E; Yarger, Jeffery L

    2010-01-01

    In this article, we show the potential for utilizing proton-detected heteronuclear single quantum correlation (HSQC) NMR in rigid solids under ultra-fast magic angle spinning (MAS) conditions. The indirect detection of carbon-13 from coupled neighboring hydrogen nuclei provides a sensitivity enhancement of 3- to 4-fold in crystalline amino acids over direct-detected versions. Furthermore, the sensitivity enhancement is shown to be significantly larger for disordered solids that display inhomogeneously broadened carbon-13 spectra. Latrodectus hesperus (Black Widow) dragline silk is given as an example where the sample is mass-limited and the sensitivity enhancement for the proton-detected experiment is 8- to 13-fold. The ultra-fast MAS proton-detected HSQC solid-state NMR technique has the added advantage that no proton homonuclear decoupling is applied during the experiment. Further, well-resolved, indirectly observed carbon-13 spectra can be obtained in some cases without heteronuclear proton decoupling. PMID:19857977

  4. Thermal maturity of type II kerogen from the New Albany Shale assessed by13C CP/MAS NMR

    USGS Publications Warehouse

    Werner-Zwanziger, U.; Lis, G.; Mastalerz, Maria; Schimmelmann, A.

    2005-01-01

    Thermal maturity of oil and gas source rocks is typically quantified in terms of vitrinite reflectance, which is based on optical properties of terrestrial woody remains. This study evaluates 13C CP/MAS NMR parameters in kerogen (i.e., the insoluble fraction of organic matter in sediments and sedimentary rocks) as proxies for thermal maturity in marine-derived source rocks where terrestrially derived vitrinite is often absent or sparse. In a suite of samples from the New Albany Shale (Middle Devonian to the Early Mississippian, Illinois Basin) the abundance of aromatic carbon in kerogen determined by 13C CP/MAS NMR correlates linearly well with vitrinite reflectance. ?? 2004 Elsevier Inc. All rights reserved.

  5. DETERMINATION OF BRANCHING RATIOS IN STARCH OF INTACT FLOURS BY GEL-STATE 1H MAS NMR SSPECTROSCOPY

    Technology Transfer Automated Retrieval System (TEKTRAN)

    1H MAS NMR was employed to determine the ratio of alpha 1-4 to alpha 1-6 branching in the starch of rice flour. Samples investigated were exchanged (2X) in D2O with freeze drying, gelatinized with 90/10 percent DMSO/ D2O freeze dried again, finally moistened with D2O, and placed in a spherical 4 mm ...

  6. Conversion of propan-2-ol on zeolites LaNaY and HY investigated by gas chromatography and in situ MAS NMR spectroscopy under continuous-flow conditions

    SciTech Connect

    Hunger, M.; Horvath, T.

    1997-04-01

    The conversion of propan-2-ol on zeolites HY and LaNaY has been investigated by gas chromatography (GC) and in situ {sup 1}H and {sup 13}C MAS NMR spectroscopy under continuous-flow conditions using a new MAS NMR microreactor with cylindrical catalyst bed. At reaction temperatures of T = 373 K and T = 393 K a propan-2-ol conversion of 50 and 100%, respectively, and the formation of propene, diisopropyl. ether, and small amounts of acetone was determined by GC. Applying in situ {sup 1}H and {sup 13}C MAS NMR spectroscopy, the initial step of the reaction was found to be the physisorption of propan-2-ol on Bronsted acid sites. A formation of isopropoxy species could be excluded by {sup 13}C MAS NMR spectroscopy. {sup 1}H MAS NMR spectroscopy indicated that the Bronsted acid sites of the zeolites LaNaY and HY were hydrated by water molecules in the first part of the induction period. These water molecules were formed in result of the propan-2-ol dehydration. The strong low-field shift of the {sup 1}H MAS NMR signals of the hydrated Bronsted acid sites is due to a partial protonation of adsorbed water molecules. At T = 393 K, a significant {sup 13}C MAS NMR signal of strongly bonded acetone molecules appeared at 220 ppm in the spectra of zeolites LaNaY and HY. As demonstrated by propan-2-ol conversion on a partially dealuminated zeolite HY, this by-reaction is promoted by extra-framework aluminium species. The formation of coke precursors which caused {sup 13}C MAS NMR signals at 10-50 ppm is explained by an oligomerization of propene. In situ {sup 13}C MAS NMR experiments carried out under a continuous flow of propene showed that the above-mentioned coke precursors are also formed on partially rehydrated zeolite HY. 25 refs., 14 figs., 1 tab.

  7. High field DNP and cryogenic MAS NMR : novel instrumentation and applications

    E-print Network

    Markhasin, Evgeny

    2014-01-01

    Solid State Nuclear Magnetic Resonance (ssNMR) spectroscopy has blossomed over the last two decades. As ssNMR is progressively applied to more challenging systems, the sensitivity remains one of its major limiting factors. ...

  8. Development of a rapid method for the quantification of cellulose in tobacco by (13)C CP/MAS NMR.

    PubMed

    Jiang, Jinhui; Hu, Yonghua; Tian, Zhenfeng; Chen, Kaibo; Ge, Shaolin; Xu, Yingbo; Tian, Dong; Yang, Jun

    2016-01-01

    A method was developed for rapid quantitative determination of cellulose in tobacco by utilizing (13)C cross polarization magic angle spinning NMR spectroscopy ((13)C CP/MAS NMR). Sample powder was loaded into NMR rotor, which was customized rotor containing a matched silicon tube as an intensity reference. (13)C CP/MAS NMR spectra of tobacco samples were processed with spectral deconvolution to obtain the area of the C-1 resonance at 105.5ppm and the internal standard at 0ppm. The ratio between the area of 105.5ppm and 0ppm of a set of standard cellulose samples was used to construct a calibration curve. The cellulose content of a tobacco sample was determined by comparison of the ratio between the area of 105.5ppm and 0ppm to the calibration curve. Results of this developed method showed good agreement with those obtained from chemical analysis. The proposed method has such advantages of accuracy, quickness and efficiency, and could be an alternative to chemical analyses of cellulose. PMID:26453859

  9. Determination of the structural changes by Raman and {sup 13}C CP/MAS NMR spectroscopy on native corn starch with plasticizers

    SciTech Connect

    Cozar, O.; Filip, C.; Tripon, C.; Cioica, N.; Co?a, C.; Nagy, E. M.

    2013-11-13

    The plasticizing - antiplasticizing effect of water and glycerol contents on native corn starch samples is investigated by FT-Raman and {sup 13}C CP/MAS NMR spectroscopy. The presence of both amorphous and crystalline structural phases was evidenced in pure native corn starch and also in the samples containing plasticizers. Among the crystalline starch structures, the A- and V- types were suggested by CP/MAS NMR spectra.

  10. Solid-state dynamics in the closo-carboranes: a (11)B MAS NMR and molecular dynamics study.

    PubMed

    Ahumada, Hernán; Kurkiewicz, Teresa; Thrippleton, Michael J; Wimperis, Stephen

    2015-03-19

    This work explores the dynamic behavior of the three closo-carborane isomers (formula C2B10H12) using modern solid-state magic angle spinning (MAS) NMR techniques and relates the experimental measurements to theoretical results obtained using molecular dynamics simulations. At high temperatures and at B0 = 9.4 T, the (11)B MAS line widths are narrow (40-90 Hz) for the three isomers. The rotational correlation times (?c) calculated by molecular dynamics are on the picosecond time scale, showing a quasi-isotropic rotation at these temperatures, typical for liquid systems. For all three isomers, the values of the (11)B spin-lattice relaxation times (T1) show discontinuities as the temperature is decreased, confirming the phase changes reported in the literature. At low temperatures, the (11)B MAS spectra of all three isomers exhibit much broader lines. The simulations showed that the molecular reorientation was anisotropic around different symmetry axes for each isomer, and this was supported by the values of the reduced quadrupolar parameter PQ(eff) derived from "dynamic shift" measurements using (11)B MQMAS NMR spectroscopy. The behavior of PQ(eff) as a function of temperature for p-carborane suggests that molecular reorientation is about the C5 symmetry axis of the molecule at low temperatures, and this was supported by the molecular dynamics simulations. PMID:25710751

  11. The Effect of Biradical Concentration on the Performance of DNP-MAS-NMR

    E-print Network

    Loening, Niko

    , the combination of these paramagnetic effects (PE; relaxation enhancement, paramagnetic shifts) quenches NMR, like membrane proteins [1-3] and fibrils [4-6]. The intrinsically low sensitivity of this technique can

  12. An investigation into the structure and reactivity of calcium-zinc-silicate ionomer glasses using MAS-NMR spectroscopy.

    PubMed

    Boyd, D; Towler, M R; Law, R V; Hill, R G

    2006-05-01

    The suitability of Glass Polyalkenoate Cements (GPCs) for orthopaedic applications is retarded by the presence in the glass phase of aluminium, a neurotoxin. Unfortunately, the aluminium ion plays an integral role in the setting process of GPCs and its absence is likely to hinder cement formation. However, the authors have previously shown that aluminium-free GPCs may be formulated based on calcium zinc silicate glasses and these novel materials exhibit significant potential as hard tissue biomaterials. However there is no data available on the structure of these glasses. (29)Si MAS-NMR, differential thermal analysis (DTA), X-ray diffraction (XRD), and network crosslink density (CLD) calculations were used to characterize the structure of five calcium zinc silicate glasses and relate glass structure to reactivity. The results indicate that glasses capable of forming Zn-GPCs are predominantly Q(2)/Q(3) in structure with corresponding network crosslink densities greater than 2. The correlation of CLD and MAS-NMR results indicate the primary role of zinc in these simple glass networks is as a network modifier and not an intermediate oxide; this fact will allow for more refined glass compositions, with less reactive structures, to be formulated in the future. PMID:16688578

  13. CaCl 2 -Accelerated Hydration of Tricalcium Silicate: A STXM Study Combined with 29 Si MAS NMR

    DOE PAGESBeta

    Li, Qinfei; Ge, Yong; Geng, Guoqing; Bae, Sungchul; Monteiro, Paulo J. M.

    2015-01-01

    The effect of calcium chloride (CaCl 2 ) on tricalcium silicate (C 3 S) hydration was investigated by scanning transmission X-ray microscopy (STXM) with Near Edge X-ray Absorption Fine Structure (NEXAFS) spectra and 29 Si MAS NMR. STXM is demonstrated to be a powerful tool for studying the chemical composition of a cement-based hydration system. The Ca L 3,2 -edge NEXAFS spectra obtained by examining C 3 S hydration in the presence of CaCl 2 showed that this accelerator does not change the coordination of calcium in the calcium silicate hydrate (C-S-H), which is the primary hydration product. Omore »K-edge NEXAFS is also very useful in distinguishing the chemical components in hydrated C 3 S. Based on the Ca L 3,2 -edge spectra and chemical component mapping, we concluded that CaCl 2 prefers to coexist with unhydrated C 3 S instead of C-S-H. In Si K-edge NEXAFS analysis, CaCl 2 increases the degree of silicate polymerization of C-S-H in agreement with the 29 Si CP/MAS NMR results, which show that the presence of CaCl 2 in hydrated C 3 S considerably accelerates the formation of middle groups ( Q 2 ) and branch sites ( Q 3 ) in the silicate chains of C-S-H gel at 1-day hydration. « less

  14. Sealed rotors for in situ high temperature high pressure MAS NMR.

    PubMed

    Hu, Jian Zhi; Hu, Mary Y; Zhao, Zhenchao; Xu, Suochang; Vjunov, Aleksei; Shi, Hui; Camaioni, Donald M; Peden, Charles H F; Lercher, Johannes A

    2015-09-11

    Here we present the design of reusable and perfectly sealed all-zirconia MAS rotors. The rotors are used to study AlPO4-5 molecular sieve crystallization under hydrothermal conditions, high temperature high pressure cyclohexanol dehydration reaction, and low temperature metabolomics of intact biological tissue. PMID:26171928

  15. Sealed Rotors for In Situ High Temperature High Pressure MAS NMR

    PubMed Central

    Hu, Jian Zhi; Hu, Mary Y.; Zhao, Zhenchao; Xu, Suochang; Vjunov, Aleksei; Shi, Hui; Camaioni, Donald M.; Peden, Charles H. F.; Lercher, Johannes A.

    2015-01-01

    Here we present the design of reusable and perfectly-sealed all-zircornia MAS rotors. The rotors are used to study AlPO4-5 molecular sieve crystallization under hydrothermal conditions, high temperature high pressure cyclohexanol dehydration reaction, and low temperature metabolomics of intact biological tissue. PMID:26171928

  16. Acceleration of Natural-Abundance Solid-State MAS NMR Measurements on Bone by Paramagnetic Relaxation from Gadolinium-DTPA

    PubMed Central

    Mroue, Kamal H.; Zhang, Rongchun; Zhu, Peizhi; McNerny, Erin; Kohn, David H.; Morris, Michael D.; Ramamoorthy, Ayyalusamy

    2014-01-01

    Reducing the data collection time without affecting the signal intensity and spectral resolution is one of the major challenges for the widespread application of multidimensional nuclear magnetic resonance (NMR) spectroscopy, especially in experiments conducted on complex heterogeneous biological systems such as bone. In most of these experiments, the NMR data collection time is ultimately governed by the proton spin-lattice relaxation times (T1). For over two decades, gadolinium(III)-DTPA (Gd-DTPA, DTPA = Diethylenetriamine pentaacetic acid) has been one of the most widely used contrast-enhancement agents in magnetic resonance imaging (MRI). In this study, we demonstrate that Gd-DTPA can also be effectively used to enhance the longitudinal relaxation rates of protons in solid-state NMR experiments conducted on bone without significant line-broadening and chemical-shift-perturbation side effects. Using bovine cortical bone samples incubated in different concentrations of Gd-DTPA complex, the 1H T1 values were calculated from data collected by 1H spin-inversion recovery method detected in natural-abundance 13C cross-polarization magic angle spinning (CPMAS) NMR experiments. Our results reveal that the 1H T1 values can be successfully reduced by a factor of 3.5 using as low as 10 mM Gd-DTPA without reducing the spectral resolution and thus enabling faster data acquisition of the 13C CPMAS spectra. These results obtained from 13C-detected CPMAS experiments were further confirmed using 1H-detected ultrafast MAS experiments on Gd-DTPA doped bone samples. This approach considerably improves the signal-to-noise ratio per unit time of NMR experiments applied to bone samples by reducing the experimental time required to acquire the same number of scans. PMID:24881032

  17. Deuterium MAS NMR studies of dynamics on multiple timescales: histidine and oxalic acid.

    PubMed

    Chan-Huot, Monique; Wimperis, Stephen; Gervais, Christel; Bodenhausen, Geoffrey; Duma, Luminita

    2015-01-12

    Deuterium ((2) H) magic-angle spinning (MAS) nuclear magnetic resonance is applied to monitor the dynamics of the exchanging labile deuterons of polycrystalline L-histidine hydrochloride monohydrate-d7 and ?-oxalic acid dihydrate-d6 . Direct experimental evidence of fast dynamics is obtained from T1Z and T1Q measurements. Further motional information is extracted from two-dimensional single-quantum (SQ) and double-quantum (DQ) MAS spectra. Differences between the SQ and DQ linewidths clearly indicate the presence of motions on intermediate timescales for the carboxylic moiety and the D2 O in ?-oxalic acid dihydrate, and for the amine group and the D2 O in L-histidine hydrochloride monohydrate. Comparison of the relaxation rate constants of Zeeman and quadrupolar order with the relaxation rate constants of the DQ coherences suggests the co-existence of fast and slow motional processes. PMID:25358952

  18. High-resolution proton-detected NMR of proteins at very fast MAS

    NASA Astrophysics Data System (ADS)

    Andreas, Loren B.; Le Marchand, Tanguy; Jaudzems, Kristaps; Pintacuda, Guido

    2015-04-01

    When combined with high-frequency (currently ?60 kHz) magic-angle spinning (MAS), proton detection boosts sensitivity and increases coherence lifetimes, resulting in narrow 1H lines. Herein, we review methods for efficient proton detected techniques and applications in highly deuterated proteins, with an emphasis on 100% selected 1H site concentration for the purpose of sensitivity. We discuss the factors affecting resolution and sensitivity that have resulted in higher and higher frequency MAS. Next we describe the various methods that have been used for backbone and side-chain assignment with proton detection, highlighting the efficient use of scalar-based 13C-13C transfers. Additionally, we show new spectra making use of these schemes for side-chain assignment of methyl 13C-1H resonances. The rapid acquisition of resolved 2D spectra with proton detection allows efficient measurement of relaxation parameters used as a measure of dynamic processes. Under rapid MAS, relaxation times can be measured in a site-specific manner in medium-sized proteins, enabling the investigation of molecular motions at high resolution. Additionally, we discuss methods for measurement of structural parameters, including measurement of internuclear 1H-1H contacts and the use of paramagnetic effects in the determination of global structure.

  19. Phase cycling schemes for finite-pulse-RFDR MAS solid state NMR experiments

    NASA Astrophysics Data System (ADS)

    Zhang, Rongchun; Nishiyama, Yusuke; Sun, Pingchuan; Ramamoorthy, Ayyalusamy

    2015-03-01

    The finite-pulse radio frequency driven dipolar recoupling (fp-RFDR) pulse sequence is used in 2D homonuclear chemical shift correlation experiments under magic angle spinning (MAS). A recent study demonstrated the advantages of using a short phase cycle, XY4, and its super-cycle, XY414, for the fp-RFDR pulse sequence employed in 2D 1H/1H single-quantum/single-quantum correlation experiments under ultrafast MAS conditions. In this study, we report a comprehensive analysis on the dipolar recoupling efficiencies of XY4, XY412, XY413, XY414, and XY814 phase cycles under different spinning speeds ranging from 10 to 100 kHz. The theoretical calculations reveal the presence of second-order terms (T10T2,±2, T1,±1T2,±1, etc.) in the recoupled homonuclear dipolar coupling Hamiltonian only when the basic XY4 phase cycle is utilized, making it advantageous for proton-proton magnetization transfer under ultrafast MAS conditions. It is also found that the recoupling efficiency of fp-RFDR is quite dependent on the duty factor (?180/?R) as well as on the strength of homonuclear dipolar couplings. The rate of longitudinal magnetization transfer increases linearly with the duty factor of fp-RFDR for all the XY-based phase cycles investigated in this study. Examination of the performances of different phase cycles against chemical shift offset and RF field inhomogeneity effects revealed that XY414 is the most tolerant phase cycle, while the shortest phase cycle XY4 suppressed the RF field inhomogeneity effects most efficiently under slow spinning speeds. Our results suggest that the difference in the fp-RFDR recoupling efficiencies decreases with the increasing MAS speed, while ultrafast (>60 kHz) spinning speed is advantageous as it recouples a large amount of homonuclear dipolar couplings and therefore enable fast magnetization exchange. The effects of higher-order terms and cross terms between various interactions in the effective Hamiltonian of fp-RFDR are also analyzed using numerical simulations for various phase cycles. Results obtained via numerical simulations are in excellent agreement with ultrafast MAS experimental results from the powder samples of glycine and L-alanine.

  20. Imaging of the B1 distribution and background signal in a MAS NMR probehead using inhomogeneous B0 and B1 fields

    NASA Astrophysics Data System (ADS)

    Odedra, Smita; Wimperis, Stephen

    2013-06-01

    Several widely used methods for suppressing the "background" signal in 1H magic angle spinning (MAS) NMR spectroscopy are based on the assumption of a significant difference between the B1 radiofrequency field experienced by the sample (within the MAS rotor) and that felt by static components of the probehead (where the background signal is believed to originate). In this work, a two-dimensional correlation experiment employing inhomogeneous B0 and B1 fields is used to image the B1 distribution in a MAS NMR probehead. The experiment, which can be performed on any spectrometer, allows the distribution of the B1 field to be measured and also correlated with the spatial location of the NMR signal within the probehead. The method can also readily be combined with various "depth pulse" techniques for background suppression, allowing their performances to be more rigorously evaluated.

  1. Imaging of the B1 distribution and background signal in a MAS NMR probehead using inhomogeneous B0 and B1 fields.

    PubMed

    Odedra, Smita; Wimperis, Stephen

    2013-06-01

    Several widely used methods for suppressing the "background" signal in (1)H magic angle spinning (MAS) NMR spectroscopy are based on the assumption of a significant difference between the B1 radiofrequency field experienced by the sample (within the MAS rotor) and that felt by static components of the probehead (where the background signal is believed to originate). In this work, a two-dimensional correlation experiment employing inhomogeneous B0 and B1 fields is used to image the B1 distribution in a MAS NMR probehead. The experiment, which can be performed on any spectrometer, allows the distribution of the B1 field to be measured and also correlated with the spatial location of the NMR signal within the probehead. The method can also readily be combined with various "depth pulse" techniques for background suppression, allowing their performances to be more rigorously evaluated. PMID:23644349

  2. Simple and accurate determination of X-H distances under ultra-fast MAS NMR

    NASA Astrophysics Data System (ADS)

    Paluch, Piotr; Pawlak, Tomasz; Amoureux, Jean-Paul; Potrzebowski, Marek J.

    2013-08-01

    We demonstrate that a very simple experiment, Cross-Polarization with Variable Contact-time (CP-VC), is very efficient at ultra-fast MAS (?R ? 60 kHz) to measure accurately the C-H and N-H distances, and to analyze the dynamics of bio-molecules. This experiment can be performed with samples that are either 13C or 15N labeled or without any labeling. The method is very robust experimentally with respect to imperfect Hartman-Hahn setting, and presents a large scaling factor allowing a better dipolar determination, especially for long C-H or N-H distances, or for CH3 or NH3 moieties with three-site hopping. At ultra-fast MAS, it can be used quantitatively in a 2D way, because its scaling factor is then little dependent on the offsets. This robustness with respect to offset is related to the ultra-fast spinning speed, and hence to the related small rotor diameter. Indeed, these two specifications lead to efficient n = ±1 zero-quantum Hartman-Hahn CP-transfers with large RF-fields on proton and carbon or nitrogen channels, and large dipolar scaling factor.

  3. Sensitivity gains, linearity, and spectral reproducibility in nonuniformly sampled multidimensional MAS NMR spectra of high dynamic range

    PubMed Central

    Suiter, Christopher L.; Paramasivam, Sivakumar; Hou, Guangjin; Sun, Shangjin; Rice, David; Hoch, Jeffrey C.; Rovnyak, David

    2014-01-01

    Recently, we have demonstrated that considerable inherent sensitivity gains are attained in MAS NMR spectra acquired by nonuniform sampling (NUS) and introduced maximum entropy interpolation (MINT) processing that assures the linearity of transformation between the time and frequency domains. In this report, we examine the utility of the NUS/MINT approach in multidimensional datasets possessing high dynamic range, such as homonuclear 13C–13C correlation spectra. We demonstrate on model compounds and on 1–73-(U-13C, 15N)/74–108-(U-15N) E. coli thioredoxin reassembly, that with appropriately constructed 50 % NUS schedules inherent sensitivity gains of 1.7–2.1-fold are readily reached in such datasets. We show that both linearity and line width are retained under these experimental conditions throughout the entire dynamic range of the signals. Furthermore, we demonstrate that the reproducibility of the peak intensities is excellent in the NUS/MINT approach when experiments are repeated multiple times and identical experimental and processing conditions are employed. Finally, we discuss the principles for design and implementation of random exponentially biased NUS sampling schedules for homonuclear 13C–13C MAS correlation experiments that yield high-quality artifact-free datasets. PMID:24752819

  4. Sensitivity Gains, Linearity, and Spectral Reproducibility in Nonuniformly Sampled Multidimensional MAS NMR Spectra of High Dynamic Range.

    SciTech Connect

    Suiter, Christopher L.; Paramasivam, Sivakumar; Hou, Guangjin; Sun, Shangjin; Rice, David M.; Hoch, Jeffrey C.; Rovnyak, David S.; Polenova, Tatyana E.

    2014-04-22

    Recently, we have demonstrated that considerable inherent sensitivity gains are attained in MAS NMR spectra acquired by nonuniform sampling (NUS) and introduced maximum entropy interpolation (MINT) processing that assures the linearity of transformation between the time and frequency domains. In this report, we examine the utility of the NUS/MINT approach in multidimensional datasets possessing high dynamic range, such as homonuclear 13C–13C correlation spectra. We demonstrate on model compounds and on 1–73-(U-13C,15N)/74–108-(U-15N) E. coli thioredoxin reassembly, that with appropriately constructed 50 % NUS schedules inherent sensitivity gains of 1.7–2.1-fold are readily reached in such datasets. We show that both linearity and line width are retained under these experimental conditions throughout the entire dynamic range of the signals. Furthermore, we demonstrate that the reproducibility of the peak intensities is excellent in the NUS/MINT approach when experiments are repeated multiple times and identical experimental and processing conditions are employed. Finally, we discuss the principles for design and implementation of random exponentially biased NUS sampling schedules for homonuclear 13C–13C MAS correlation experiments that yield high quality artifact-free datasets.

  5. Measuring (19)F shift anisotropies and (1)H-(19)F dipolar interactions with ultrafast MAS NMR.

    PubMed

    Martini, Francesca; Miah, Habeeba K; Iuga, Dinu; Geppi, Marco; Titman, Jeremy J

    2015-10-01

    A new (19)F anisotropic-isotropic shift correlation experiment is described that operates with ultrafast MAS, resulting in good resolution of isotropic (19)F shifts in the detection dimension. The new experiment makes use of a recoupling sequence designed using symmetry principles that reintroduces the (19)F chemical shift anisotropy in the indirect dimension. The situations in which the new experiment is appropriate are discussed, and the (19)F shift anisotropy parameters in poly(difluoroethylene) (PVDF) are measured. In addition, similar recoupling sequences are shown to be effective for measuring (1)H-(19)F distances via the heteronuclear dipolar interaction. This is demonstrated by application to a recently synthesized zirconium phosphonate material that contains one-dimensional chains linked by H-F hydrogen bonds. PMID:26318626

  6. A cross-polarization based rotating-frame separated-local-field NMR experiment under ultrafast MAS conditions

    NASA Astrophysics Data System (ADS)

    Zhang, Rongchun; Damron, Joshua; Vosegaard, Thomas; Ramamoorthy, Ayyalusamy

    2015-01-01

    Rotating-frame separated-local-field solid-state NMR experiments measure highly resolved heteronuclear dipolar couplings which, in turn, provide valuable interatomic distances for structural and dynamic studies of molecules in the solid-state. Though many different rotating-frame SLF sequences have been put forth, recent advances in ultrafast MAS technology have considerably simplified pulse sequence requirements due to the suppression of proton-proton dipolar interactions. In this study we revisit a simple two-dimensional 1H-13C dipolar coupling/chemical shift correlation experiment using 13C detected cross-polarization with a variable contact time (CPVC) and systematically study the conditions for its optimal performance at 60 kHz MAS. In addition, we demonstrate the feasibility of a proton-detected version of the CPVC experiment. The theoretical analysis of the CPVC pulse sequence under different Hartmann-Hahn matching conditions confirms that it performs optimally under the ZQ (w1H - w1C = ±wr) condition for polarization transfer. The limits of the cross polarization process are explored and precisely defined as a function of offset and Hartmann-Hahn mismatch via spin dynamics simulation and experiments on a powder sample of uniformly 13C-labeled L-isoleucine. Our results show that the performance of the CPVC sequence and subsequent determination of 1H-13C dipolar couplings are insensitive to 1H/13C frequency offset frequency when high RF fields are used on both RF channels. Conversely, the CPVC sequence is quite sensitive to the Hartmann-Hahn mismatch, particularly for systems with weak heteronuclear dipolar couplings. We demonstrate the use of the CPVC based SLF experiment as a tool to identify different carbon groups, and hope to motivate the exploration of more sophisticated 1H detected avenues for ultrafast MAS.

  7. Red coralline algae assessed as marine pH proxies using 11B MAS NMR

    PubMed Central

    Cusack, M.; Kamenos, N. A.; Rollion-Bard, C.; Tricot, G.

    2015-01-01

    Reconstructing pH from biogenic carbonates using boron isotopic compositions relies on the assumption that only borate, and no boric acid, is present. Red coralline algae are frequently used in palaeoenvironmental reconstruction due to their widespread distribution and regular banding frequency. Prior to undertaking pH reconstructions using red coralline algae we tested the boron composition of the red coralline alga Lithothamnion glaciale using high field NMR. In bulk analysed samples, thirty percent of boron was present as boric acid. We suggest that prior to reconstructing pH using coralline algae 1) species-specific boron compositions and 2) within-skeleton special distributions of boron are determined for multiple species. This will enable site selective boron analyses to be conducted validating coralline algae as palaeo-pH proxies based on boron isotopic compositions. PMID:25640229

  8. Red coralline algae assessed as marine pH proxies using 11B MAS NMR.

    PubMed

    Cusack, M; Kamenos, N A; Rollion-Bard, C; Tricot, G

    2015-01-01

    Reconstructing pH from biogenic carbonates using boron isotopic compositions relies on the assumption that only borate, and no boric acid, is present. Red coralline algae are frequently used in palaeoenvironmental reconstruction due to their widespread distribution and regular banding frequency. Prior to undertaking pH reconstructions using red coralline algae we tested the boron composition of the red coralline alga Lithothamnion glaciale using high field NMR. In bulk analysed samples, thirty percent of boron was present as boric acid. We suggest that prior to reconstructing pH using coralline algae 1) species-specific boron compositions and 2) within-skeleton special distributions of boron are determined for multiple species. This will enable site selective boron analyses to be conducted validating coralline algae as palaeo-pH proxies based on boron isotopic compositions. PMID:25640229

  9. Red coralline algae assessed as marine pH proxies using 11B MAS NMR

    NASA Astrophysics Data System (ADS)

    Cusack, M.; Kamenos, N. A.; Rollion-Bard, C.; Tricot, G.

    2015-02-01

    Reconstructing pH from biogenic carbonates using boron isotopic compositions relies on the assumption that only borate, and no boric acid, is present. Red coralline algae are frequently used in palaeoenvironmental reconstruction due to their widespread distribution and regular banding frequency. Prior to undertaking pH reconstructions using red coralline algae we tested the boron composition of the red coralline alga Lithothamnion glaciale using high field NMR. In bulk analysed samples, thirty percent of boron was present as boric acid. We suggest that prior to reconstructing pH using coralline algae 1) species-specific boron compositions and 2) within-skeleton special distributions of boron are determined for multiple species. This will enable site selective boron analyses to be conducted validating coralline algae as palaeo-pH proxies based on boron isotopic compositions.

  10. Following Solid-Acid-Catalyzed Reactions by MAS NMR Spectroscopy in Liquid Phase -Zeolite-Catalyzed Conversion of Cyclohexanol in Water

    SciTech Connect

    Vjunov, Aleksei; Hu, Mary Y.; Feng, Ju; Camaioni, Donald M.; Mei, Donghai; Hu, Jian Z.; Zhao, Chen; Lercher, Johannes A.

    2014-01-07

    The catalytic conversion of cyclohexanol on zeolite HBEA in hot liquid water leads to dehydration as well as alkylation products. A novel micro autoclave suitable for application in MAS NMR at high temperatures and pressures is developed and successfully applied to obtain new insight into the mechanistic pathway leading to an understanding of the reactions under selected experimental conditions.

  11. FT-RAMAN AND 13C CP-MAS NMR SPECTROSCOPIC ASSESSMENT OF CONFORMATIONAL CHANGES IN PROTEIN AND STARCH UNDER VARIOUS PARABOILING CONDITIONS FOR RICE

    Technology Transfer Automated Retrieval System (TEKTRAN)

    FT-Raman and solid-state 13C CP-MAS NMR spectroscopies were employed to assess the conformational changes to protein and starch in rice under variable conditions of parboiling. TOX 3108 rice from Ghana, was parboiled by the soaking-steaming-drying method under conditions that mimicked various local...

  12. CHANGES IN PROTEIN AND STARCH CONFORMATION DURING VARIABLE TEMPERATURE PARBOILING OF RICE: FT-RAMAN AND 13C CP-MAS NMR SPECTROSCOPIC ASSESSMENT

    Technology Transfer Automated Retrieval System (TEKTRAN)

    FT-Raman and solid-state 13C cross polarization magic-angle spinning (CP-MAS) NMR spectroscopies were employed to assess the conformational changes to protein and starch in paddy rice under variable conditions of parboiling. Rice variety, TOX 3108 from Ghana, was parboiled by the soaking-steaming-d...

  13. The refocused INADEQUATE MAS NMR experiment in multiple spin-systems: interpreting observed correlation peaks and optimising lineshapes.

    PubMed

    Cadars, Sylvian; Sein, Julien; Duma, Luminita; Lesage, Anne; Pham, Tran N; Baltisberger, Jay H; Brown, Steven P; Emsley, Lyndon

    2007-09-01

    The robustness of the refocused INADEQUATE MAS NMR pulse sequence for probing through-bond connectivities has been demonstrated in a large range of solid-state applications. This pulse sequence nevertheless suffers from artifacts when applied to multispin systems, e.g. uniformly labeled (13)C solids, which distort the lineshapes and can potentially result in misleading correlation peaks. In this paper, we present a detailed account that combines product-operator analysis, numerical simulations and experiments of the behavior of a three-spin system during the refocused INADEQUATE pulse sequence. The origin of undesired anti-phase contributions to the spectral lineshapes are described, and we show that they do not interfere with the observation of long-range correlations (e.g. two-bond (13)C-(13)C correlations). The suppression of undesired contributions to the refocused INADEQUATE spectra is shown to require the removal of zero-quantum coherences within a z-filter. A method is proposed to eliminate zero-quantum coherences through dephasing by heteronuclear dipolar couplings, which leads to pure in-phase spectra. PMID:17588789

  14. Spectral editing in 13C solid-state NMR at high magnetic field using fast MAS and spin-echo dephasing.

    PubMed

    Mao, Kanmi; Kennedy, Gordon J; Althaus, Stacey M; Pruski, Marek

    2012-01-01

    A simple method is proposed for separating NMR resonances from protonated and non-protonated aromatic carbons in solids under fast magic angle spinning (MAS). The approach uses a MAS-synchronized spin-echo to exploit the differences in rotational recoupling of the dipolar interactions while fully refocusing the isotropic chemical shifts. This strategy extends the relevant time scale of spin evolution to milliseconds and circumvents the limitation of the traditional dipolar dephasing method, which in fast rotating solids is disrupted by rotational refocusing. The proposed approach can be used for quantitative measurement of carbon aromaticities in complex solids with poorly resolved spectra, as demonstrated for model compounds. PMID:22951436

  15. Magnesium silicate dissolution investigated by 29Si MAS, 1H-29Si CPMAS, 25Mg QCPMG, and 1H-25Mg CP QCPMG NMR.

    PubMed

    Davis, Michael C; Brouwer, William J; Wesolowski, David J; Anovitz, Lawrence M; Lipton, Andrew S; Mueller, Karl T

    2009-08-28

    Olivine-(Mg,Fe)(2)SiO(4)-has been the subject of frequent investigation in the earth sciences because of its simple structure and rapid dissolution kinetics. Several studies have observed a preferential release of the divalent cation with respect to silicon during weathering under acidic conditions, which has been correlated to the formation of a silicon-rich leached layer. While leached layer formation has been inferred through the changing solution chemistry, a thorough spectroscopic investigation of olivine reacted under acidic conditions has not been conducted. The pure magnesium end member of the olivine series (forsterite-Mg(2)SiO(4)) was chosen for detailed investigations in this study because paramagnetic iron hinders NMR investigations by providing an extra mode of relaxation for neighboring nuclei, causing lineshapes to become significantly broadened and unobservable in the NMR spectrum. For reacting forsterite, spectroscopic interrogations using nuclear magnetic resonance (NMR) can elucidate the changing magnesium coordination and bonding environment. In this study, we combine analysis of the changing solution chemistry with advanced NMR techniques ((29)Si MAS, (1)H-(29)Si CP MAS, (25)Mg QCPMG, and (1)H-(25)Mg CP QCPMG NMR) to probe leached layer formation and secondary phase precipitation during the dissolution of forsterite at 150 degrees C. PMID:19652836

  16. Magnesium silicate dissolution investigated by S1-29 MAS, H-1 Si-29 CPMAS, Mg-25 QCPMG, and H-1 Mg-25 CP QCPMG NMR

    SciTech Connect

    Davis, M C; Brouwer, Piet W; Wesolowski, David J; Anovitz, Lawrence {Larry} M

    2009-07-01

    Olivine-(Mg,Fe){sub 2}SiO{sub 4}-has been the subject of frequent investigation in the earth sciences because of its simple structure and rapid dissolution kinetics. Several studies have observed a preferential release of the divalent cation with respect to silicon during weathering under acidic conditions, which has been correlated to the formation of a silicon-rich leached layer. While leached layer formation has been inferred through the changing solution chemistry, a thorough spectroscopic investigation of olivine reacted under acidic conditions has not been conducted. The pure magnesium end member of the olivine series (forsterite-Mg2SiO4) was chosen for detailed investigations in this study because paramagnetic iron hinders NMR investigations by providing an extra mode of relaxation for neighboring nuclei, causing lineshapes to become significantly broadened and unobservable in the NMR spectrum. For reacting forsterite, spectroscopic interrogations using nuclear magnetic resonance (NMR) can elucidate the changing magnesium coordination and bonding environment. In this study, we combine analysis of the changing solution chemistry with advanced NMR techniques ({sup 29}Si MAS, {sup 1}H-{sup 29}Si CP MAS, {sup 25}Mg QCPMG, and {sup 1}H-{sup 25}Mg CP QCPMG NMR) to probe leached layer formation and secondary phase precipitation during the dissolution of forsterite at 150 C.

  17. {sup 13}C chemical shift anisotropies for carbonate ions in cement minerals and the use of {sup 13}C, {sup 27}Al and {sup 29}Si MAS NMR in studies of Portland cement including limestone additions

    SciTech Connect

    Sevelsted, Tine F.; Herfort, Duncan

    2013-10-15

    {sup 13}C isotropic chemical shifts and chemical shift anisotropy parameters have been determined for a number of inorganic carbonates relevant in cement chemistry from slow-speed {sup 13}C MAS or {sup 13}C({sup 1}H) CP/MAS NMR spectra (9.4 T or 14.1 T) for {sup 13}C in natural abundance. The variation in the {sup 13}C chemical shift parameters is relatively small, raising some doubts that different carbonate species in Portland cement-based materials may not be sufficiently resolved in {sup 13}C MAS NMR spectra. However, it is shown that by combining {sup 13}C MAS and {sup 13}C({sup 1}H) CP/MAS NMR carbonate anions in anhydrous and hydrated phases can be distinguished, thereby providing valuable information about the reactivity of limestone in cement blends. This is illustrated for three cement pastes prepared from an ordinary Portland cement, including 0, 16, and 25 wt.% limestone, and following the hydration for up to one year. For these blends {sup 29}Si MAS NMR reveals that the limestone filler accelerates the hydration for alite and also results in a smaller fraction of tetrahedrally coordinated Al incorporated in the C-S-H phase. The latter result is more clearly observed in {sup 27}Al MAS NMR spectra of the cement–limestone blends and suggests that dissolved aluminate species in the cement–limestone blends readily react with carbonate ions from the limestone filler, forming calcium monocarboaluminate hydrate. -- Highlights: •{sup 13}C chemical shift anisotropies for inorganic carbonates from {sup 13}C MAS NMR. •Narrow {sup 13}C NMR chemical shift range (163–171 ppm) for inorganic carbonates. •Anhydrous and hydrated carbonate species by {sup 13}C MAS and {sup 13}C({sup 1}H) CP/MAS NMR. •Limestone accelerates the hydration for alite in Portland – limestone cements. •Limestone reduces the amount of aluminium incorporated in the C-S-H phase.

  18. Efficient resonance assignment of proteins in MAS NMR by simultaneous intra- and inter-residue 3D correlation spectroscopy

    E-print Network

    Daviso, Eugenio

    Resonance assignment is the first step in NMR structure determination. For magic angle spinning NMR, this is typically achieved with a set of heteronuclear correlation experiments (NCaCX, NCOCX, CONCa) that utilize SPECIFIC-CP ...

  19. Identification of lithium-sulfur battery discharge products through 6Li and 33S solid-state MAS and 7Li solution NMR spectroscopy

    NASA Astrophysics Data System (ADS)

    Huff, Laura A.; Rapp, Jennifer L.; Baughman, Jessi A.; Rinaldi, Peter L.; Gewirth, Andrew A.

    2015-01-01

    6Li and 33S solid-state magic angle spinning (MAS) nuclear magnetic resonance (NMR) spectroscopy was used to identify the discharge products in lithium-sulfur (Li-S) battery cathodes. Cathodes were stopped at different potentials throughout battery discharge and measured ex-situ to obtain chemical shifts and T2 relaxation rates of the products formed. The chemical shifts in the spectra of both 6Li and 33S NMR demonstrate that long-chain, soluble lithium polysulfide species formed at the beginning of discharge are indistinguishable from each other (similar chemical shifts), while short-chain, insoluble polysulfide species that form at the end of discharge (presumably Li2S2 and Li2S) have a different chemical shift, thus distinguishing them from the soluble long-chain products. T2 relaxation measurements of discharged cathodes were also performed which resulted in two groupings of T2 rates that follow a trend and support the previous conclusions that long-chain polysulfide species are converted to shorter chain species during discharge. Through the complementary techniques of 1-D 6Li and 33S solid-state MAS NMR spectroscopy, solution 7Li and 1H NMR spectroscopy, and T2 relaxation rate measurements, structural information about the discharge products of Li-S batteries is obtained.

  20. Structural characterization of glass from the inversion of {sup 23}Na and {sup 27}Al 3Q-MAS NMR spectra

    SciTech Connect

    Angeli, F.; Charpentier, T.; Faucon, P.; Petit, J.C.

    1999-11-25

    A spectrum-inversion approach to extract information from MQ-MAS NMR spectra in glasses is presented. This allows the reconstruction of the underlying two-dimensional distribution of the isotropic chemical shift correlated to the quadrupolar interaction. The dependence upon the quadrupolar interaction and the RF field strength of coherence transfers involved in the MQ-MAS experiment are taken into account in the present approach. The performance of the inversion procedure is examined. Thereafter, the authors attempt to correlate the distributions of each interaction to structural local information. Two complex glasses (a borosilicate and a basaltic-like glass) have been studied using {sup 17}Al and {sup 23}Na 3Q-MAS NMR. These two nuclei allowed the investigation of their local environment. The interpretation of the different site distributions is discussed in terms of topological disorder, i.e., the distribution of specific geometrical parameters such as bond distances and angles. Using the empirical relationships previously established with crystalline silicate compounds, the distributions of the Na-O distance and the Al-O-Si bond angle have been determined from the extracted distributions of the isotropic chemical shift. The limits of the interpretation of quadrupolar interaction distributions are also discussed.

  1. FTIR and 1H MAS NMR investigations on the correlation between the frequency of stretching vibration and the chemical shift of surface OH groups of solids

    NASA Astrophysics Data System (ADS)

    Brunner, Eike; Karge, H. G.; Pfeifer, H.

    1992-03-01

    The study of surface hydroxyl groups of solids, especially of zeolites, belongs to the 'classical' topics of IR spectroscopy since physico-chemical information may be derived from the wavenumber (nu) OH of the stretching vibration of the different hydroxyls. On the other hand, the last decade has seen the development of high resolution solid-state NMR spectroscopy and through the use of the so-called magic-angle-spinning technique (MAS) the signals of different hydroxyl species can be resolved in the 1H NMR spectra of solids. The chemical shift (delta) H describing the position of these lines may be used as well as (nu) OH to characterize quantitatively the strength of acidity of surface OH groups of solids. In a first comparison of (nu) OH with (delta) H for several types of surface OH groups, a linear correlation between them could be found. The aim of this paper was to prove the validity of this correlation for a wide variety of hydroxyls. The IR measurements were carried out on a Perkin-Elmer FTIR spectrometer 1800 at the Fritz Haber Institute of the Max Planck Society, Berlin, and the 1H MAS NMR spectra were recorded on a Bruker MSL- 300 at the University of Leipzig.

  2. On the orientational dependence of resolution in 1H solid-state NMR, and its role in MAS, CRAMPS and delayed-acquisition experiments.

    PubMed

    Zorin, Vadim E; Elena, Benedicte; Lesage, Anne; Emsley, Lyndon; Hodgkinson, Paul

    2007-12-01

    Numerical simulations and experiments are used to show that the spin dynamics of the dipolar-coupled networks in solids is often strongly dependent on crystallite orientation. In particular, different rates of dephasing of the magnetisation mean that NMR signals obtained at longer dephasing times are dominated by orientations in which the local dipolar coupling strength is relatively weak. This often leads to a distinct improvement in spectral resolution as the dephasing time is increased. The effects are particularly noticeable under magic-angle spinning (MAS), but are also observed when homonuclear decoupling is used to reduce the rate of dipolar dephasing. Numerical simulation is seen to be a powerful and easily used tool for understanding the behaviour of solid-state NMR experiments involving dipolar-coupled networks. The implications for solid-state NMR spectra of abundant spins acquired under MAS and homonuclear decoupling are discussed, as well as insights provided into the performance of 'delayed-acquisition' and 'constant-time' experiments. PMID:18157810

  3. Rapid quantification of starch molecular order through multivariate modelling of (13)C CP/MAS NMR spectra.

    PubMed

    Flanagan, Bernadine M; Gidley, Michael J; Warren, Frederick J

    2015-10-14

    A partial least squares model has been generated enabling the rapid assessment of ordered molecular structure in a semi-crystalline polymer, starch, directly from solid state NMR spectra. Solid state NMR spectroscopy offers many advantages over conventional analysis tools being non-destructive and functional in complex mixtures. PMID:26299429

  4. Low-power broadband homonuclear dipolar recoupling in MAS NMR by two-fold symmetry pulse schemes for magnetization transfers and double-quantum excitation.

    PubMed

    Teymoori, Gholamhasan; Pahari, Bholanath; Edén, Mattias

    2015-12-01

    We provide an experimental, numerical, and high-order average Hamiltonian evaluation of an open-ended series of homonuclear dipolar recoupling sequences, SR [Formula: see text] with p=1,2,3,…. While operating at a very low radio-frequency (rf) power, corresponding to a nutation frequency of 1/2 of the magic-angle spinning (MAS) rate (?nut=?r/2), these recursively generated double-quantum (2Q) dipolar recoupling schemes offer a progressively improved compensation to resonance offsets and rf inhomogeneity for increasing pulse-sequence order p. The excellent recoupling robustness to these experimental obstacles, as well as to CSA, is demonstrated for 2Q filtering (2QF) experiments and for driving magnetization transfers in 2D NMR correlation spectroscopy, where the sequences may provide either double or zero quantum dipolar Hamiltonians during mixing. Experimental and numerical demonstrations, which mostly target conditions of "ultra-fast" MAS (?50kHz) and high magnetic fields, are provided for recoupling of (13)C across a wide range of isotropic and anisotropic chemical shifts, as well as dipolar coupling constants, encompassing [2,3-(13)C2]alanine, [1,3-(13)C2]alanine, diammonium [1,4-(13)C2]fumarate, and [U-(13)C]tyrosine. When compared at equal power levels, a superior performance is observed for the SR [Formula: see text] sequences with p?3 relative to existing and well-established 2Q recoupling techniques. At ultra-fast MAS, proton decoupling is redundant during the homonuclear dipolar recoupling of dilute spins in organic solids, which renders the family of SR [Formula: see text] schemes the first efficient 2Q recoupling option for general applications, such as 2Q-1Q correlation NMR and high-order multiple-quantum excitation, under truly low-power rf conditions. PMID:26515279

  5. The partial (1)H NMR spectra of Al-OH and molecular H(2)O in hydrous aluminosilicate glasses: Component-Resolved analysis of (27)Al-(1)H cross polarization and (1)H spin-echo MAS NMR spectra.

    PubMed

    Malfait, Wim J; Xue, Xianyu

    2010-01-01

    The Component-Resolved methodology was applied to (1)H spin-echo and (27)Al-(1)H cross polarization (CP) MAS NMR data of aluminosilicate glasses. The method was able to resolve two components with different T2 relaxation rates, hydroxyl groups (OH) and molecular water (H(2)O(mol)), from the spin-echo data and to determine partial spectra and the relative abundances of OH and H(2)O(mol). The algorithm resolved two to three components with different (27)Al-(1)H CP dynamics from the (27)Al-(1)H cross polarization data; the obtained partial NMR spectra for Al-OH are in excellent agreement with those obtained previously from the difference spectra between spectra with various contact times and confirm previous quantitative results and models for the Al-OH, Si-OH and H(2)O(mol) speciation (Malfait and Xue, 2010). PMID:20418075

  6. Resolution and measurement of heteronuclear dipolar couplings of a noncrystalline protein immobilized in a biological supramolecular assembly by proton-detected MAS solid-state NMR spectroscopy

    NASA Astrophysics Data System (ADS)

    Park, Sang Ho; Yang, Chen; Opella, Stanley J.; Mueller, Leonard J.

    2013-12-01

    Two-dimensional 15N chemical shift/1H chemical shift and three-dimensional 1H-15N dipolar coupling/15N chemical shift/1H chemical shift MAS solid-state NMR correlation spectra of the filamentous bacteriophage Pf1 major coat protein show single-site resolution in noncrystalline, intact-phage preparations. The high sensitivity and resolution result from 1H detection at 600 MHz under 50 kHz magic angle spinning using ?0.5 mg of perdeuterated and uniformly 15N-labeled protein in which the exchangeable amide sites are partially or completely back-exchanged (reprotonated). Notably, the heteronuclear 1H-15N dipolar coupling frequency dimension is shown to select among 15N resonances, which will be useful in structural studies of larger proteins where the resonances exhibit a high degree of overlap in multidimensional chemical shift correlation spectra.

  7. Dipolar Assisted Assignment Protocol (DAAP) for MAS solid-state NMR of rotationally aligned membrane proteins in phospholipid bilayers

    NASA Astrophysics Data System (ADS)

    Das, Bibhuti B.; Zhang, Hua; Opella, Stanley J.

    2014-05-01

    A method for making resonance assignments in magic angle spinning solid-state NMR spectra of membrane proteins that utilizes the range of heteronuclear dipolar coupling frequencies in combination with conventional chemical shift based assignment methods is demonstrated. The Dipolar Assisted Assignment Protocol (DAAP) takes advantage of the rotational alignment of the membrane proteins in liquid crystalline phospholipid bilayers. Improved resolution is obtained by combining the magnetically inequivalent heteronuclear dipolar frequencies with isotropic chemical shift frequencies. Spectra with both dipolar and chemical shift frequency axes assist with resonance assignments. DAAP can be readily extended to three- and four-dimensional experiments and to include both backbone and side chain sites in proteins.

  8. Structural elucidation of b-(Y,Sc){sub 2}Si{sub 2}O{sub 7} : combined use of {sub 89}Y MAS NMR and powder diffraction.

    SciTech Connect

    Allix, M.; Alba, M. D.; Florian, P.; Fernandez-Carrion, A. J.; Suchomel, M. R.; Escudero, A.; Suard, E.; Becerro, A. I.

    2011-08-01

    Although the structures of pure Sc{sub 2}Si{sub 2}O{sub 7} and {beta}-Y{sub 2}Si{sub 2}O{sub 7} have been described in the literature using the C2/m space group, {sup 29}Si magic angle spinning (MAS) NMR measurements of the intermediate members of the Sc{sub 2}Si{sub 2}O{sub 7}-{beta}-Y{sub 2}Si{sub 2}O{sub 7} system indicate a lowering of the symmetry to the C2 space group. Indeed, these compositions exhibit a unique Si crystallographic site and an Si-O-Si angle lower than 180{sup o}, incompatible with the C2/m space group. C2 is the only possible alternative. Space group Cm can be discarded with regard to its two different Si sites per unit cell. Moreover, {sup 89}Y MAS NMR data have revealed the existence of two different Y sites in the structure of the intermediate members of the Sc{sub 2}Si{sub 2}O{sub 7}-{beta}-Y{sub 2}Si{sub 2}O{sub 7} system, confirming the lowering of the symmetry to the C2 space group. The viability of the C2 model has therefore been tested and confirmed by refinement of synchrotron and neutron powder diffraction data for the different members of the system. The structural evolutions across the Sc{sub 2}Si{sub 2}O{sub 7}-{beta}-Y{sub 2}Si{sub 2}O{sub 7} system are discussed.

  9. Composite-180° pulse-based symmetry sequences to recouple proton chemical shift anisotropy tensors under ultrafast MAS solid-state NMR spectroscopy

    NASA Astrophysics Data System (ADS)

    Pandey, Manoj Kumar; Malon, Michal; Ramamoorthy, Ayyalusamy; Nishiyama, Yusuke

    2015-01-01

    There is considerable interest in the measurement of proton (1H) chemical shift anisotropy (CSA) tensors to obtain deeper insights into H-bonding interactions which find numerous applications in chemical and biological systems. However, the presence of strong 1H/1H dipolar interaction makes it difficult to determine small size 1H CSAs from the homogeneously broadened NMR spectra. Previously reported pulse sequences for 1H CSA recoupling are prone to the effects of radio frequency field (B1) inhomogeneity. In the present work we have carried out a systematic study using both numerical and experimental approaches to evaluate ?-encoded radio frequency (RF) pulse sequences based on R-symmetries that recouple 1H CSA in the indirect dimension of a 2D 1H/1H anisotropic/isotropic chemical shift correlation experiment under ultrafast magic angle spinning (MAS) frequencies. The spectral resolution and sensitivity can be significantly improved in both frequency dimensions of the 2D 1H/1H correlation spectrum without decoupling 1H/1H dipolar couplings but by using ultrafast MAS rates up to 70 kHz. We successfully demonstrate that with a reasonable RF field requirement (<200 kHz) a set of symmetry-based recoupling sequences, with a series of phase-alternating 270°0-90°180 composite-180° pulses, are more robust in combating B1 inhomogeneity effects. In addition, our results show that the new pulse sequences render remarkable 1H CSA recoupling efficiency and undistorted CSA lineshapes. Experimental results on citric acid and malonic acid comparing the efficiencies of these newly developed pulse sequences with that of previously reported CSA recoupling pulse sequences are also reported under ultrafast MAS conditions.

  10. Composite-180° Pulse-Based Symmetry Sequences to Recouple Proton Chemical Shift Anisotropy Tensors under Ultrafast MAS Solid-State NMR Spectroscopy

    PubMed Central

    Pandey, Manoj Kumar; Malon, Michal; Ramamoorthy, Ayyalusamy; Nishiyama, Yusuke

    2015-01-01

    There is considerable interest in the measurement of proton (1H) chemical shift anisotropy (CSA) tensors to obtain deeper insights into H-bonding interactions which find numerous applications in chemical and biological systems. However, the presence of strong 1H/1H dipolar interaction makes it difficult to determine small size 1H CSAs from the homogeneously broadened NMR spectra. Previously reported pulse sequences for 1H CSA recoupling are prone to the effects of radio frequency field (B1) inhomogeneity. In the present work we have carried out a systematic study using both numerical and experimental approaches to evaluate ?-encoded radio frequency (RF) pulse sequences based on R-symmetries that recouple 1H CSA in the indirect dimension of a 2D 1H/1H anisotropic/isotropic chemical shift correlation experiment under ultrafast magic angle spinning (MAS) frequencies. The spectral resolution and sensitivity can be significantly improved in both frequency dimensions of the 2D 1H/1H correlation spectrum without decoupling 1H/1H dipolar couplings but by using ultrafast MAS rates up to 70 kHz. We successfully demonstrate that with a reasonable RF field requirement (< 200 kHz) a set of symmetry-based recoupling sequences, with a series of phase-alternating 270°0-90°180 composite-180° pulses, are more robust in combating B1 inhomogeneity effects. In addition, our results show that the new pulse sequences render remarkable 1H CSA recoupling efficiency and undistorted CSA lineshapes. Experimental results on citric acid and malonic acid comparing the efficiencies of these newly developed pulse sequences with that of previously reported CSA recoupling pulse sequences are also reported under ultrafast MAS conditions. PMID:25497846

  11. Solid state 31P MAS NMR spectroscopy and conductivity measurements on NbOPO4 and H3PO4 composite materials

    NASA Astrophysics Data System (ADS)

    Risskov Sørensen, Daniel; Nielsen, Ulla Gro; Skou, Eivind M.

    2014-11-01

    A systematic study of composite powders of niobium oxide phosphate (NbOPO4) and phosphoric acid (H3PO4) has been performed in order to characterize the material's ability to perform as an electrolyte material in medium temperature fuel cells and electrolyzers. Powders of H3PO4 contents between 13.1 and 74.2 M% were produced and characterized with powder X-ray diffraction, 31P MAS NMR and impedance spectroscopy. NMR revealed that a significant degree of dehydration and vaporization of H3PO4 takes place above 200 °C, and increases with temperature. At 500 °C the NbOPO4 and H3PO4 has reacted to form niobium pyrophosphate (Nb2P4O15). Impedance spectroscopy showed an increase in conductivity with increasing acid concentration, whereas the conductivity decreased slightly with increasing temperature. The highest conductivity measured was 2.5·10-3 S/cm for a sample containing 74.2 M% of H3PO4. Lastly, it was shown that NbOPO4 has no significant conductivity of its own.

  12. Analysis of mercerization process based on the intensity change of deconvoluted resonances of (13)C CP/MAS NMR: Cellulose mercerized under cooling and non-cooling conditions.

    PubMed

    Miura, Kento; Nakano, Takato

    2015-08-01

    The area intensity change of C1, C4, and C6 in spectrum obtained by (13)C CP/MAS NMR and the mutual relationship between their changes were examined for cellulose samples treated with various concentrations of aqueous NaOH solutions under non-cooling and cooling conditions. The area intensity of C1-up and C6-down changed cooperatively with that of C4-down which corresponds to the crystallinity of samples: "-up" and "-down" are the up- and down- field component in a splitting peak of NMR spectrum, respectively. The intensity change of C1-up starts to decrease with decreasing in that of C4-down after that of C6-down is almost complete. These changes were more clearly observed for samples treated under cooling condition. It can be suggested that their characteristic change relates closely to the change in conformation of cellulose chains by induced decrystallization and the subsequent crystallization of cellulose II, and presumed that their changes at microscopic level relate to the macroscopic morphological changes such as contraction along the length of cellulose chains and recovery along the length. PMID:26042706

  13. Proton-detected MAS NMR experiments based on dipolar transfers for backbone assignment of highly deuterated proteins

    NASA Astrophysics Data System (ADS)

    Chevelkov, Veniamin; Habenstein, Birgit; Loquet, Antoine; Giller, Karin; Becker, Stefan; Lange, Adam

    2014-05-01

    Proton-detected solid-state NMR was applied to a highly deuterated insoluble, non-crystalline biological assembly, the Salmonella typhimurium type iii secretion system (T3SS) needle. Spectra of very high resolution and sensitivity were obtained at a low protonation level of 10-20% at exchangeable amide positions. We developed efficient experimental protocols for resonance assignment tailored for this system and the employed experimental conditions. Using exclusively dipolar-based interspin magnetization transfers, we recorded two sets of 3D spectra allowing for an almost complete backbone resonance assignment of the needle subunit PrgI. The additional information provided by the well-resolved proton dimension revealed the presence of two sets of resonances in the N-terminal helix of PrgI, while in previous studies employing 13C detection only a single set of resonances was observed.

  14. The effectiveness of 1H decoupling in the 13C MAS NMR of paramagnetic solids: an experimental case study incorporating copper(II) amino acid complexes.

    PubMed

    Willans, Mathew J; Sears, Devin N; Wasylishen, Roderick E

    2008-03-01

    The use of continuous-wave (CW) 1H decoupling has generally provided little improvement in the 13C MAS NMR spectroscopy of paramagnetic organic solids. Recent solid-state 13C NMR studies have demonstrated that at rapid magic-angle spinning rates CW decoupling can result in reductions in signal-to-noise and that 1H decoupling should be omitted when acquiring 13C MAS NMR spectra of paramagnetic solids. However, studies of the effectiveness of modern 1H decoupling sequences are lacking, and the performance of such sequences over a variety of experimental conditions must be investigated before 1H decoupling is discounted altogether. We have studied the performance of several commonly used advanced decoupling pulse sequences, namely the TPPM, SPINAL-64, XiX, and eDROOPY sequences, in 13C MAS NMR experiments performed under four combinations of the magnetic field strength (7.05 or 11.75T), rotor frequency (15 or 30kHz), and 1H rf-field strength (71, 100, or 140kHz). The effectiveness of these sequences has been evaluated by comparing the 13C signal intensity, linewidth at half-height, LWHH, and coherence lifetimes, T2('), of the methine carbon of copper(II) bis(dl-alanine) monohydrate, Cu(ala)(2).H2O, and methylene carbon of copper(II) bis(dl-2-aminobutyrate), Cu(ambut)(2), obtained with the advanced sequences to those obtained without 1H decoupling, with CW decoupling, and for fully deuterium labelled samples. The latter have been used as model compounds with perfect 1H decoupling and provide a measure of the efficiency of the 1H decoupling sequence. Overall, the effectiveness of 1H decoupling depends strongly on the decoupling sequence utilized, the experimental conditions and the sample studied. Of the decoupling sequences studied, the XiX sequence consistently yielded the best results, although any of the advanced decoupling sequences strongly outperformed the CW sequence and provided improvements over no 1H decoupling. Experiments performed at 7.05T demonstrate that the XiX decoupling sequence is the least sensitive to changes in the 1H transmitter frequency and may explain the superior performance of this decoupling sequence. Overall, the most important factor in the effectiveness of 1H decoupling was the carbon type studied, with the methylene carbon of Cu(ambut)(2) being substantially more sensitive to 1H decoupling than the methine carbon of Cu(ala)(2).H2O. An analysis of the various broadening mechanisms contributing to 13C linewidths has been performed in order to rationalize the different sensitivities of the two carbon sites under the four experimental conditions. PMID:18086543

  15. 31P MAS-NMR study of flux-grown rare-earth element orthophosphate (monazite/xenotime) solid solutions: Evidence of random cation distribution from paramagnetically shifted NMR resonances

    SciTech Connect

    Palke, A. C.; Stebbins, J. F.; Boatner, Lynn A

    2013-01-01

    We present 31P magic angle spinning nuclear magnetic resonance (MAS-NMR) spectra of flux-grown solid solutions of La1-xCexPO4 ( x between 0.027 and 0.32) having the monoclinic monazite structure, and of Y1-xMxPO4 (M = Vn+, Ce3+, Nd3+, x between 0.001 and 0.014) having the tetragonal zircon structure. Paramagnetically shifted NMR resonances are observed in all samples due to the presence of paramagnetic Vn+, Ce3+, and Nd3+ in the diamagnetic LaPO4 or YPO4. As a first-order observation, the number and relative intensity of these peaks is related to the symmetry and structure of the diamagnetic host phase. The presence of paramagnetic shifts allows for increased resolution between NMR resonances for distinct atomic species which leads to the observation of low intensity peaks related to PO4 species having more than one paramagnetic neighbor two or four atomic bonds away. Through careful analysis of peak areas and comparison with predictions for simple models, it was determined that solid solutions in the systems examined here are characterized by complete disorder (random distribution) of diamagnetic La3+ or Y3+ with the paramagnetic substitutional species Ce3+ and Nd3+. The increased resolution given by the paramagnetic interactions also leads to the observation of splitting of specific resonances in the 31P NMR spectra that may be caused by local, small-scale distortions from the substitution of ions having dissimilar ionic radii.

  16. I: Low Frequency NMR and NQR Using a dc SQUID. II: Variable-temperature 13C CP/MAS of Organometallics

    SciTech Connect

    Ziegeweid, M.A.

    1995-11-29

    NMR and NQR at low frequencies are difficult prospects due to small nuclear spin polarization. Furthermore, the sensitivity'of the inductive pickup circuitry of standard spectrometers is reduced as the frequency is lowered. I have used a cw-SQUID (Superconducting QUantum Interference Device) spectrometer, which has no such frequency dependence, to study the local atomic environment of {sup 14}N via the quadrupolar interaction. Because {sup 14}N has spin I = 1 and a 0-6 MHz frequency range, it is not possible to obtain well-resolved spectra in high magnetic fields. I have used a technique to observe {sup 14}N NQR resonances via their effect on neighboring protons mediated by the heteronuclear dipolar interaction to study peptides and narcotics. The sensitivity of the SQUID is not enough to measure low-frequency surface (or other low spin density) systems. The application of spin-polarized xenon has been previously used to enhance polarization in conventional NMR experiments. Because xenon only polarizes spins with which it is in contact, it is surface selective. While differences in chemical shifts between surface and bulk spins are not large, it is expected that the differences in quadrupole coupling constant should be very large due to the drastic change of the electric field gradient surrounding spins at the surface. With this in mind, I have taken preliminary steps to measure SQUID detected polarization transfer from Xe to another spin species at 4.2 K and in small magnetic fields (<50 G). In this regime, the spin-lattice relaxation of xenon is dependent on the applied magnetic field. The results of our efforts to characterize the relaxation of xenon are presented. The final section describes the solid-state variable-temperature (VT) one- and two-dimensional {sup 13}C cross polarization (CP)/magic angle spinning (MAS) NMR of Hf({eta}{sup 5}-C{sub 5}H{sub 5}){sub 2}({eta}{sup 1}-C{sub 5}H{sub 5}){sub 2}, Zr({eta}{sup 5}-C{sub 5}H{sub 5}){sub 3}({eta}{sup 1}-C{sub 5}H{sub 5}) and Sn({eta}{sup 1}-C{sub 5}H{sub 5}){sub 4}. This work was undertaken in the hope of gaining insight into the intramolecuhrr dynamics, specifically which fluxional processes exist in the solid state, by what mechanism rearrangements are occurring, and the activation energies by which these processes are governed.

  17. Solid-state MAS NMR, TEM, and TGA studies of structural hydroxyl groups and water in nanocrystalline apatites prepared by dry milling.

    PubMed

    Pajchel, Lukasz; Kolodziejski, Waclaw

    2013-01-01

    A series of nanocrystalline calcium hydroxyapatites was prepared by dry milling and characterized using proton and (31)P MAS NMR, TEM, and TGA methods. The samples contained stubby rod-shaped crystals, which length and width varied in the 130-30 and 95-20 nm ranges, respectively. It was confirmed that concentration of structural hydroxyl groups in nanocrystalline apatites decreases with the decreasing crystal size. In the series of the studied apatites, the decrease was from 86 to ca. 50 % in reference to stoichiometric apatite. Water was found in the surface hydrated layer and in the c-axis channels, in which compartments existed as adsorbed and structural, respectively. Molecules of the adsorbed water were capable of moving from the crystal surface into the lattice c-axis channels of apatite. This process introduced considerable structural disorder within and around those channels and reduced the content of the structural hydroxyl groups, particularly in the region underneath the apatite crystal surface. PMID:23990754

  18. Analysis of local molecular motions of aromatic sidechains in proteins by 2D and 3D fast MAS NMR spectroscopy and quantum mechanical calculations.

    PubMed

    Paluch, Piotr; Pawlak, Tomasz; Jeziorna, Agata; Trébosc, Julien; Hou, Guangjin; Vega, Alexander J; Amoureux, Jean-Paul; Dracinsky, Martin; Polenova, Tatyana; Potrzebowski, Marek J

    2015-10-28

    We report a new multidimensional magic angle spinning NMR methodology, which provides an accurate and detailed probe of molecular motions occurring on timescales of nano- to microseconds, in sidechains of proteins. The approach is based on a 3D CPVC-RFDR correlation experiment recorded under fast MAS conditions (?R = 62 kHz), where (13)C-(1)H CPVC dipolar lineshapes are recorded in a chemical shift resolved manner. The power of the technique is demonstrated in model tripeptide Tyr-(d)Ala-Phe and two nanocrystalline proteins, GB1 and LC8. We demonstrate that, through numerical simulations of dipolar lineshapes of aromatic sidechains, their detailed dynamic profile, i.e., the motional modes, is obtained. In GB1 and LC8 the results unequivocally indicate that a number of aromatic residues are dynamic, and using quantum mechanical calculations, we correlate the molecular motions of aromatic groups to their local environment in the crystal lattice. The approach presented here is general and can be readily extended to other biological systems. PMID:26451400

  19. Effects of solvent concentration and composition on protein dynamics: 13C MAS NMR studies of elastin in glycerol-water mixtures.

    PubMed

    Demuth, Dominik; Haase, Nils; Malzacher, Daniel; Vogel, Michael

    2015-08-01

    We use (13)C CP MAS NMR to investigate the dependence of elastin dynamics on the concentration and composition of the solvent at various temperatures. For elastin in pure glycerol, line-shape analysis shows that larger-scale fluctuations of the protein backbone require a minimum glycerol concentration of ~0.6 g/g at ambient temperature, while smaller-scale fluctuations are activated at lower solvation levels of ~0.2 g/g. Immersing elastin in various glycerol-water mixtures, we observe at room temperature that the protein mobility is higher for lower glycerol fractions in the solvent and, thus, lower solvent viscosity. When decreasing the temperature, the elastin spectra approach the line shape for the rigid protein at 245 K for all studied samples, indicating that the protein ceases to be mobile on the experimental time scale of ~10(-5) s. Our findings yield evidence for a strong coupling between elastin fluctuations and solvent dynamics and, hence, such interaction is not restricted to the case of protein-water mixtures. Spectral resolution of different carbon species reveals that the protein-solvent couplings can, however, be different for side chain and backbone units. We discuss these results against the background of the slaving model for protein dynamics. PMID:25917596

  20. Structural investigations of silicate-phosphate glasses containing MoO3 by FTIR, Raman and 31P MAS NMR spectroscopies.

    PubMed

    Szumera, M

    2014-09-15

    Molybdenum is a transition metal (refers to the "d" block of the periodic table) whose atom has an incomplete d sub-shell. It is known that in silicate glasses molybdenum may exist under four oxidation states: Mo6+, Mo5+, Mo4+ and Mo3+, simultaneously molybdenum cations, depending on their content in the glass network, may either be a glass forming component, or act as a modifier. The contemporary literature data show studies conducted mostly on the structure of silicate, phosphate, borate and borosilicate glasses containing molybdenum ions, but not silicate-phosphate glasses. Therefore, the author has undertaken detailed studies using FTIR, Raman and 31P MAS NMR techniques in order to examine the effect of MoO3 addition into the structure of silicate-phosphate glasses from SiO2P2O5K2OCaOMgO system. On the basis of obtained results it was concluded that molybdenum ions in the analysed glasses act as a modifier, which follows from the gradual breakage of oxygen bridges, i.e. POP, SiOSi, and SiOP, and the following formation of connections such as Mo[MoO4]OSi and/or Mo[MoO4]OP. In summary, it is concluded that the increase of MoO3 content (up to 4.4 mol.%) in the structure of glasses of SiO2P2O5K2OMgOCaO system results in weakening of the structure and gradual increase of the degree of silico-oxygen and phosphor-oxygen frameworks depolymerisation. PMID:24759778

  1. {sup 1}H and {sup 23}Na MAS NMR spectroscopy of cationic species in CO{sub 2} selective alkaline earth metal porous silicoaluminophosphates prepared via liquid and solid state ion exchange

    SciTech Connect

    Arevalo-Hidalgo, Ana G.; Dugar, Sneha; Fu, Riqiang; Hernandez-Maldonado, Arturo J.

    2012-07-15

    The location of extraframework cations in Sr{sup 2+} and Ba{sup 2+} ion-exchanged SAPO-34 was estimated by means of {sup 1}H and {sup 23}Na MAS NMR spectroscopy and spectral deconvolution. Incorporation of the alkaline earth metal cations onto the SAPO framework was achieved via liquid state ion exchange, coupled partial detemplation/solid-state ion exchange, and combination of both techniques. MAS NMR revealed that the level of ion exchange was limited by the presence of protons and sodium cations near hexagonal prisms (site SI), which are relatively difficult to exchange with the alkaline earth metal due to steric and charge repulsion criteria. In addition, the presence of ammonium cations in the supercages facilitated the exchange of otherwise tenacious hydrogen as corroborated by unit cell compositional data as well as enhanced CO{sub 2} adsorption at low partial pressures. The extraframework ammonium species were produced from partial detemplation of the structure-directing agent employed for the SAPO-34 synthesis, tetraethylammonium. - Graphical abstract: MAS NMR was used to elucidate the position the cationic species in alkaline earth metal exchanged silicoaluminophosphates. These species played a significant role during the ion exchange process and, therefore, the materials ultimate CO{sub 2} adsorption performance. Highlights: Black-Right-Pointing-Pointer Location of extraframework Sr{sup 2+} or Ba{sup 2+} cations was estimated by means of {sup 1}H and {sup 23}Na MAS NMR. Black-Right-Pointing-Pointer Level of Sr{sup 2+} or Ba{sup 2+} ion exchange was limited by the presence of protons and sodium cations. Black-Right-Pointing-Pointer Presence of ammonium cations in the supercages facilitated the exchange. Black-Right-Pointing-Pointer Sr{sup 2+} and Ba{sup 2+} ion exchanged SAPOs are outstanding CO{sub 2} adsorbents.

  2. High-resolution ¹H magic angle spinning NMR spectroscopy of intact Arctic char (Salvelinus Alpinus) muscle. Quantitative analysis of n-3 fatty acids, EPA and DHA.

    PubMed

    Nestor, Gustav; Bankefors, Johan; Schlechtriem, Christian; Brännäs, Eva; Pickova, Jana; Sandström, Corine

    2010-10-27

    The lipid and small metabolite profiles from intact muscles of Arctic char were investigated using (1)H high-resolution magic angle spinning ((1)H HR-MAS) NMR spectroscopy. Not only the total n-3 fatty acid content but also the eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) contents of the muscle were obtained from the (1)H HR-MAS NMR spectra without pretreatment of the tissue or lipophilic extraction. A number of small metabolites could also be observed, where creatine/phosphocreatine, anserine and taurine were the most abundant. Thus, the use of (1)H HR-MAS NMR led to simplified analysis techniques that can give direct information on the nutritional value of the fish. PMID:20873863

  3. 2H-13C HETCOR MAS NMR for indirect detection of 2H quadrupole patterns and spin-lattice relaxation rates.

    PubMed

    Shi, Xiangyan; Yarger, Jeffery L; Holland, Gregory P

    2013-01-01

    Two-dimensional (2D) cross-polarization magic angle spinning (CP-MAS) (2)H-(13)C heteronuclear correlation (HETCOR) experiments were utilized to indirectly detect site-specific deuterium MAS powder patterns. The (2)H-(13)C cross-polarization efficiency is orientation-dependent and non-uniform for all crystallites. This leads to difficulty in extracting the correct (2)H MAS quadrupole powder patterns. In order to obtain accurate deuterium line shapes, (13)C spin lock rf field, spin lock rf ramp and CP contact time were carefully calibrated with the assistance of theoretical simulations. The extracted quadrupole patterns for U-[(2)H/(13)C/(15)N]-alanine indicate that the methyl deuterium undergoes classic, three-site jumping in the fast motion regime (10(-8)-10(-12)s) and the methine deuterium has a rigid deuterium powder pattern. For U-[(2)H/(13)C/(15)N]-phenylalanine, indirectly detected deuterium line shapes illustrate that the aromatic ring undergoes 180° flips in the fast motion regime while (2)H? and (2)H? are completely rigid. The experimental deuterium line shapes for U-[(2)H/(13)C/(15)N]-proline reflect that (2)H?, (2)H? and (2)H? are subjected to fast, two-site reorientations at an angle of (15±5)°, (30±5)° and (25±10)° respectively. In addition, an approach that combines a composite inversion pulse with (2)H-(13)C CP-MAS is applied to measure (2)H spin-lattice relaxation times in a site-specific, (13)C-detected fashion. PMID:23174312

  4. Towards homonuclear J solid-state NMR correlation experiments for half-integer quadrupolar nuclei: experimental and simulated 11B MAS spin-echo dephasing and calculated 2J(BB) coupling constants for lithium diborate.

    PubMed

    Barrow, Nathan S; Yates, Jonathan R; Feller, Steven A; Holland, Diane; Ashbrook, Sharon E; Hodgkinson, Paul; Brown, Steven P

    2011-04-01

    Magic-angle spinning (MAS) NMR spin-echo dephasing is systematically investigated for the spin I = 3/2 (11)B nucleus in lithium diborate, Li(2)O·2B(2)O(3). A clear dependence on the quadrupolar frequency (?(Q)(PAS)/2? = 3C(Q)/[4I(2I- 1)]) is observed: the B3 (larger C(Q)) site dephases more slowly than the B4 site at all investigated MAS frequencies (5 to 20 kHz) at 14.1 T. Increasing the MAS frequency leads to markedly slower dephasing for the B3 site, while there is a much less evident effect for the B4 site. Considering samples at 5, 25, 80 (natural abundance) and 100% (11)B isotopic abundance, dephasing becomes faster for both sites as the (11)B isotopic abundance increases. The experimental behaviour is rationalised using density matrix simulations for two and three dipolar-coupled (11)B nuclei. The experimentally observed slower dephasing for the larger C(Q) (B3) site is reproduced in all simulations and is explained by the reintroduction of the dipolar coupling by the so-called "spontaneous quadrupolar-driven recoupling mechanism" having a different dependence on the MAS frequency for different quadrupolar frequencies. Specifically, isolated spin-pair simulations show that the spontaneous quadrupolar-driven recoupling mechanism is most efficient when the quadrupolar frequency is equal to twice the MAS frequency. While for isolated spin-pair simulations, increasing the MAS frequency leads to faster dephasing, agreement with experiment is observed for three-spin simulations which additionally include the homogeneous nature of the homonuclear dipolar coupling network. First-principles calculations, using the GIPAW approach, of the (2)J(11B-11B) couplings in lithium diborate, metaborate and triborate are presented: a clear trend is revealed whereby the (2)J(11B-11B) couplings increase with increasing B-O-B bond angle and B-B distance. However, the calculated (2)J(11B-11B) couplings are small (0.95, 1.20 and 2.65 Hz in lithium diborate), thus explaining why no zero crossing due to J modulation is observed experimentally, even for the sample at 25% (11)B where significant spin-echo intensity remains out to durations of ?200 ms. PMID:21321719

  5. Structural characterisation of phosphate materials: new insights into the spatial proximities between phosphorus and quadrupolar nuclei using the D-HMQC MAS NMR technique.

    PubMed

    Tricot, G; Lafon, O; Trébosc, J; Delevoye, L; Méar, F; Montagne, L; Amoureux, J-P

    2011-10-01

    We show in this article how the spatial proximity between phosphorus and quadrupolar nuclei can be efficiently and easily investigated with the D-HMQC (Dipolar Hetero-nuclear Multiple-Quantum Coherences) NMR technique. Compared to the commonly used CP-HETCOR (Cross-Polarisation HETero-nuclear CORrelation) sequence, the D-HMQC pulse scheme exhibits a higher sensitivity and a better robustness with respect to spinning frequency, electronic shielding and quadrupole interaction, and thus does not require time-consuming and complicated optimisation procedures. The advantages of the D-HMQC are demonstrated in this article through the acquisition of (31)P/S through-space two-dimensional correlation NMR spectra providing unreported structural information on (i) a sodium alumino-silicate glass doped with only 3% of P(2)O(5), (ii) a potassium boro-phosphate glass containing BO(3) and BO(4) groups and (iii) a crystalline zirconium vanado-phosphate. All these systems, representative of the most important mixed phosphate network materials, cannot be correctly investigated with the conventional CP-HETCOR NMR technique. PMID:21853181

  6. The Local Structural State of Aluminosilicate Garnet Solid Solutions: An Investigation of Grospydite Garnet from the Roberts Victor Kimberlite Using Paramagnetically Shifted 27Al and 29Si MAS NMR Resonances

    NASA Astrophysics Data System (ADS)

    Geiger, C. A.; Palke, A. C.; Stebbins, J. F.

    2014-12-01

    Most rock-forming silicates are substitutional solid solutions. Over the years extensive research has been done to determine their structural and crystal chemical properties. Here, the distribution of cations, or order-disorder behavior, is of central importance. In the case of aluminosilicate garnet solid solutions (X3Al2Si3O12 with X = Mg, Fe2+, Mn2+ and Ca) it has been shown that both synthetic and natural crystals have random long-range X-cation disorder in space group Ia-3d, as given by X-ray single-crystal diffraction measurements. However, the structural state of natural garnets at the local scale is not known. Garnet from a grospydite xenolith from the Roberts Victor kimberlite, South Africa, was studied by 27Al and 29Si MAS NMR spectroscopy. The research thrust was placed on measuring and analyzing paramagnetically shifted resonances to determine the local (short range) structural state of the X-cations in a grossular-rich ternary aluminosilicate garnet solid solution. The garnet crystals are compositionally homogeneous based on microprobe analysis, showing no measurable zoning, and have the formula Grs46.7Prp30.0Alm23.3. The garnet is cubic with the standard garnet space group Ia-3d. The 27Al MAS NMR spectrum shows a very broad asymmetric resonance located between about 100 and -50 ppm. It consists of a number of individual overlapping paramagnetically shifted resonances, which are difficult to analyze quantitatively. The 29Si MAS NMR spectrum, showing better resolution, has two observable resonances termed S0 and S4. S0 is located between about -60 ppm and -160 ppm and S4 is centered at roughly 95 ppm. Both S0 and S4 are composite resonances in nature containing many overlapping individual peaks. S0 contains information on local cation configurations whereby an isolated SiO4 group in the garnet structure does not have an edge-shared Fe2+-containing dodecahedron. S4 involves local configurations where there is one edge-shared dodecahedron containing Fe2+. The measured intensity of the resonances S0 and S4 are roughly similar to calculated intensities assuming random cation mixing. These first results do not indicate any overt short-range cation order in grossular-rich grospydite garnet.

  7. 13C and 15N—Chemical Shift Anisotropy of Ampicillin and Penicillin-V Studied by 2D-PASS and CP/MAS NMR

    NASA Astrophysics Data System (ADS)

    Antzutkin, Oleg N.; Lee, Young K.; Levitt, Malcolm H.

    1998-11-01

    The principal values of the chemical shift tensors of all13C and15N sites in two antibiotics, ampicillin and penicillin-V, were determined by 2-dimensionalphaseadjustedspinningsideband (2D-PASS) and conventional CP/MAS experiments. The13C and15N chemical shift anisotropies (CSA), and their confidence limits, were evaluated using a Mathematica program. The CSA values suggest a revised assignment of the 2-methyl13C sites in the case of ampicillin. We speculate on a relationship between the chemical shift principal values of many of the13C and15N sites and the ?-lactam ring conformation.

  8. Hyperfine fields at the Li site in LiFePO(4)-type olivine materials for lithium rechargeable batteries: a (7)Li MAS NMR and SQUID study.

    PubMed

    Tucker, Michael C; Doeff, Marca M; Richardson, Thomas J; Fiñones, Rita; Cairns, Elton J; Reimer, Jeffrey A

    2002-04-17

    The (7)Li NMR isotropic shift for olivine LiMPO(4) (M = Fe, Mn, Co, Ni) is assigned to hyperfine coupling between the (7)Li nucleus and the transition metal unpaired electrons on the basis of the Curie-Weiss temperature dependence of the shift. The hyperfine shift arises from a linear combination of Li-O-M through-bond interactions wherein the unpaired A' electrons contribute a negative shift and the unpaired A' ' electrons contribute a positive shift. The hyperfine coupling constant is determined for each composition. PMID:11942811

  9. MAS NMR Study of the Metastable Solid Solutions Found in the LiFePO4/FePO4 System

    SciTech Connect

    Cabana, Jordi; Shirakawa, Junichi; Chen, Guoying; Richardson, Thomas; Grey, Clare P.

    2009-10-09

    Li and 3IP NMR experiments were conducted on a series of single- or two-phase samples in the LiFePCvFePCM system with different overall lithium contents, and containing the two end-members and/or two metastable solid solution hases, Lio.6FeP04 or Lio.34FeP04. These experiments were carried out at different temperatures in order to search for vacancy/charge ordering and ion/electron mobility in the metastable phases. Evidence for Li+-Fe2+ interactions was bserved for both Lio.6FeP04 and Lio.34FePC>4. The strength of this interaction leads to the formation of LiFePCvlike clusters in the latter, as shown by the room temperature data. Different motional processes are proposed to exist as the temperature is increased and various scenarios are discussed. While concerted lithium-electron hopping and/or correlations explains the data below 125C, evidence for some uncorrelated motion is found at higher temperatures, together with the onset of phase mixing.

  10. The Amblygonite (LiAlPO{sub 4}F)-Montebrasite (LiAlPO{sub 4}OH) Solid Solution: A Combined powder and single-crystal neutron diffraction and solid-state {sup 6}Li MAS, CP MAS, and REDOR NMR study

    SciTech Connect

    Groat, Lee A.; Chakoumakos, Bryan C.; Brouwer, Darren H.; Hoffman, Christina M.; Fyfe, Colin A.; Morell, Heiko; Schultz, Arthur J.

    2003-01-01

    The amblygonite-montebrasite series of minerals, common constituents of granitic pegmatites and topaz-bearing granites, show complete solid solution with ideal composition LiAlPO{sub 4}(F, OH). These compounds are ideal for studying F {leftrightarrow} OH solid solution in minerals because natural members of the series generally show little deviation from the ideal composition. In this study, we used powder and single-crystal neutron diffraction and solid-state {sup 6}Li MAS, CP MAS, and REDOR NMR techniques to study the effect of F {leftrightarrow} OH substitution on the series. Lattice parameters refined from single-crystal neutron diffraction data show increasing b and decreasing a, c, and V with increasing F/(F + OH). The volume is highest for the OH end-member because of the presence of an additional atom (H). The a and c parameters decrease with increasing F/(F + OH) because the O-H vector is close to the a-c plane and the Al-OH/F vectors are approximately parallel to c. Lattice parameters refined from neutron powder diffraction patterns collected at lower T show that thermal contraction increases with F/(F + OH), presumably because the F anion takes up less space than the OH molecule. The results show that the OH/F position is always fully occupied. The H displacement ellipsoid shows little change with occupancy, which obviously corresponds negatively with increasing F/(F + OH). However, the Li displacement ellipsoid becomes extremely large and anisotropic with increasing F fraction. Most of the distortion is associated with the U{sub 3} eigenvalue, which lies between the c and c* directions. U{sub eq} values corresponding to the Li atom show a greater reduction with decreasing temperature than the other atoms. The temperature dependence of Li is the same regardless of F content. Even when extrapolated to absolute zero the Li displacement ellipsoid is very large, which implies a large static disorder.

  11. Impact of structural differences in carcinopreventive agents indole-3-carbinol and 3,3'-diindolylmethane on biological activity. An X-ray, ¹H-¹?N NQDR, ¹³C CP/MAS NMR, and periodic hybrid DFT study.

    PubMed

    Latosi?ska, Jolanta Natalia; Latosi?ska, Magdalena; Szafra?ski, Marek; Seliger, Janez; Žagar, Veselko; Burchardt, Dorota V

    2015-09-18

    Three experimental techniques (1)H-(14)N NQDR, (13)C CP/MAS NMR and X-ray and Density Functional Theory (GGA/BLYP with PBC) and Hirshfeld surfaces were applied for the structure-activity oriented studies of two phyto-antioxidants and anticarcinogens: indole-3-carbinol, I3C, and 3,3'-diindolylmethane, DIM, (its bioactive metabolite). One set of (14)N NQR frequencies for DIM (2.310, 2.200 and 0.110 MHz at 295K) and I3C (2.315, 1.985 and 0.330 MHz at 160K) was recorded. The multiplicity of NQR lines recorded at RT revealed high symmetry (chemical and physical equivalence) of both methyl indazole rings of DIM. Carbonyl (13)C CSA tensor components were calculated from the (13)C CP/MAS solid state NMR spectrum of I3C recorded under fast and slow spinning. At room temperature the crystal structure of I3C is orthorhombic: space group Pca21, Z=4, a=5.78922(16), b=15.6434(7) and c=8.4405(2)Å. The I3C molecules are aggregated into ribbons stacked along [001]. The oxygen atomsare disorderedbetween the two sites of different occupancy factors. It implies that the crystal is built of about 70% trans and 30% gauche conformers, and apart from the weak OH?O hydrogen bonds (O?O=3.106Å) the formation of alternative O'H?O bonds (O'?O=2.785Å) is possible within the 1D ribbons. The adjacent ribbons are further stabilised by O'H?O bonds (O'?O=2.951Å). The analysis of spectra and intermolecular interactions pattern by experimental techniques was supported by solid (periodic) DFT calculations. The knowledge of the topology and competition of the interactions in crystalline state shed some light on the preferred conformations of CH2OH in I3C and steric hindrance of methyl indole rings in DIM. A comparison of the local environment in gas phase and solid permitted drawing some conclusions on the nature of the interactions required for effective processes of recognition and binding of a given anticarcinogen to the protein or nucleic acid. PMID:26066413

  12. Thermal decomposition of monocalcium aluminate decahydrate (CaAl2O4.10H2O) investigated by in-situ synchrotron X-ray powder diffraction, thermal analysis and 27Al, 2H MAS NMR spectroscopy.

    PubMed

    Christensen, Axel Nørlund; Jensen, Torben R; Lebech, Bente; Hanson, Jonathan C; Jakobsen, Hans J; Skibsted, Jørgen

    2008-01-28

    The stability of monocalcium aluminate decahydrate, with the nominal composition CaAl(2)O(4).10H(2)O (CAH(10)), has a decisive role for the strength development and durability of cementitious materials based on high alumina cements. This has prompted an investigation of the thermal transformation of crystalline monocalcium aluminate decahydrate in air to an amorphous phase by in-situ synchrotron X-ray powder diffraction in the temperature range from 25 to 500 degrees C, by DTA/TGA, and (2)H, (27)Al MAS NMR spectroscopy. The decomposition includes the loss of hydrogen-bonded water molecules in the temperature range up to 175 degrees C, coupled with a reduction of the unit cell volume from 1928 A(3) at 25 degrees C, to 1674 A(3) at 185 degrees C. Furthermore, X-ray diffraction shows that CaAl(2)O(4).10H(2)O starts to transform to an amorphous phase at approximately 65 degrees C. This phase is fully developed at approximately 175 degrees C and it converts to crystalline CaAl(2)O(4) when heated to 1300 degrees C. The thermal decomposition in the temperature range from approximately 65 to approximately 175 degrees C involves both formation of an amorphous phase including AlO(4) tetrahedra and structural changes in the remaining crystalline phase. PMID:18185861

  13. HR, Streamlined

    ERIC Educational Resources Information Center

    Ramaswami, Rama

    2008-01-01

    Human Resources (HR) administrators are finding that as software modules are installed to automate various processes, they have more time to focus on strategic objectives. And as compliance with affirmative action and other employment regulations comes under increasing scrutiny, HR staffers are finding that software can deliver and track data with…

  14. Experimental (X-ray, (13)C CP/MAS NMR, IR, RS, INS, THz) and Solid-State DFT Study on (1:1) Co-Crystal of Bromanilic Acid and 2,6-Dimethylpyrazine.

    PubMed

    ?uczy?ska, Katarzyna; Dru?bicki, Kacper; Lyczko, Krzysztof; Dobrowolski, Jan Cz

    2015-06-01

    A combined structural, vibrational spectroscopy, and solid-state DFT study of the hydrogen-bonded complex of bromanilic acid with 2,6-dimethylpyrazine is reported. The crystallographic structure was determined by means of low-temperature single-crystal X-ray diffraction, which reveals the molecular units in their native protonation states, forming one-dimensional infinite nets of moderate-strength O···H-N hydrogen bonds. The nature of the crystallographic forces, stabilizing the studied structure, has been drawn by employing the noncovalent interactions analysis. It was found that, in addition to the hydrogen bonding, the intermolecular forces are dominated by stacking interactions and C-H···O contacts. The thermal and calorimetric analysis was employed to probe stability of the crystal phase. The structural analysis was further supported by a computationally assisted (13)C CP/MAS NMR study, providing a complete assignment of the recorded resonances. The vibrational dynamics was explored by combining the optical (IR, Raman, TDs-THz) and inelastic neutron scattering (INS) spectroscopy techniques with the state-of-the-art solid-state density functional theory (DFT) computations. Despite the quasi-harmonic approximation assumed throughout the study, an excellent agreement between the theoretical and experimental data was achieved over the entire spectral range, allowing for a deep and possibly thorough understanding of the vibrational characteristics of the system. Particularly, the significant influence of the long-range dipole coupling on the IR spectrum has been revealed. On the basis of a wealth of information gathered, the recent implementation of a dispersion-corrected linear-response scheme has been extensively examined. PMID:25961154

  15. Synthesis, infra-red, MAS-NMR characterization, structural study and electrical properties of the new compound [C5H6ClN2]2Cd3Cl8

    NASA Astrophysics Data System (ADS)

    Karâa, Najla; Hamdi, Besma; Ben Salah, Abdelhamid; Zouari, Ridha

    2012-04-01

    A new organic inorganic compound, octachlorocadmate of bis (4-amino-2-chlorinopyridinium) [CAP]2Cd3Cl8, has been synthesized and is characterized by a single-crystal X-ray diffraction. It crystallizes in monoclinic space group P21/C (N°: 14) with the parameters a = 3.8039 (2) Å, b = 23.26510 (10) Å, c = 12.8800 (2) Å, ? = 95.7100 (10)°, V = 1134.20 (6) Å3, Z = 2. This compound shows the presence of the organic cations as spacers between the inorganic layers that can be visualized as triple chains of edge-shared CdCl6 extending in the ac plane and are combined by static attracting forces in the crystal and ?-? interactions which reinforce the association between cations. The studies by FT-IR and TGA show the presence of the surface water molecule. The MAS-NMR spectra showed two and five isotropic resonances, 111Cd and 13C, respectively. The dielectric conductivity of this compound has been measured in the temperature range 303-418 K and the frequency range 209 Hz-5 MHz. The Cole-Cole (Z' versus Z?) plots are well fitted to an equivalent circuit model. The analysis of the experimental data based on the jump relaxation model, showed that translation motion of the charge carrier and reorientation hopping between equivalent sites of the metal chloride anion and the cation groups are responsible for the observed conductivity in the temperature regions (I) (303-348 K) and (II) (373-413 K).

  16. Metabolite localization in living drosophila using High Resolution Magic Angle Spinning NMR.

    PubMed

    Sarou-Kanian, Vincent; Joudiou, Nicolas; Louat, Fanny; Yon, Maxime; Szeremeta, Frédéric; Même, Sandra; Massiot, Dominique; Decoville, Martine; Fayon, Franck; Beloeil, Jean-Claude

    2015-01-01

    We have developed new methods enabling in vivo localization and identification of metabolites through their (1)H NMR signatures, in a drosophila. Metabolic profiles in localized regions were obtained using HR-MAS Slice Localized Spectroscopy and Chemical Shift Imaging at high magnetic fields. These methods enabled measurement of metabolite contents in anatomic regions of the fly, demonstrated by a decrease in ?-alanine signals in the thorax of flies showing muscle degeneration. PMID:25892587

  17. Studies of Secondary Melanoma on C57BL/6J Mouse Liver Using 1H NMR Metabolomics

    SciTech Connect

    Feng, Ju; Isern, Nancy G.; Burton, Sarah D.; Hu, Jian Z.

    2013-10-31

    NMR metabolomics, consisting of solid state high resolution (hr) magic angle spinning (MAS) 1H NMR (1H hr-MAS), liquid state high resolution 1H-NMR, and principal components analysis (PCA) has been used to study secondary metastatic B16-F10 melanoma in C57BL/6J mouse liver . The melanoma group can be differentiated from its control group by PCA analysis of the absolute concentrations or by the absolute peak intensities of metabolites from either 1H hr-MAS NMR data on intact liver tissues or liquid state 1H-NMR spectra on liver tissue extracts. In particular, we found that the absolute concentrations of alanine, glutamate, creatine, creatinine, fumarate and cholesterol are elevated in the melanoma group as compared to controls, while the absolute concentrations of succinate, glycine, glucose, and the family of linear lipids including long chain fatty acids, total choline and acylglycerol are decreased. The ratio of glycerophosphocholine to phosphocholine is increased by about 1.5 fold in the melanoma group, while the absolute concentration of total choline is actually lower in melanoma mice. These results suggest the following picture in secondary melanoma metastasis: Linear lipid levels are decreased by beta oxidation in the melanoma group, which contributes to an increase in the synthesis of cholesterol, and also provides an energy source input for TCA cycle. These findings suggest a link between lipid oxidation, the TCA cycle and the hypoxia-inducible factors (HIF) signal pathway in tumor metastases. Thus this study indicates that the metabolic profile derived from NMR analysis can provide a valuable bio-signature of malignancy and cell hypoxia in metastatic melanoma.

  18. Exploring abiotic stress on asynchronous protein metabolism in single kernels of wheat studied by NMR spectroscopy and chemometrics

    PubMed Central

    Winning, H.; Viereck, N.; Wollenweber, B.; Larsen, F. H.; Jacobsen, S.; Søndergaard, I.; Engelsen, S. B.

    2009-01-01

    Extreme climate events are being recognized as important factors in the effects on crop growth and yield. Increased climatic variability leads to more frequent extreme conditions which may result in crops being exposed to more than one extreme event within a growing season. The aim of this study was to examine the implications of different drought treatments on the protein fractions in grains of winter wheat using 1H nuclear magnetic resonance spectroscopy followed by chemometric analysis. Triticum aestivum L. cv. Vinjett was studied in a semi-field experiment and subjected to drought episodes either at terminal spikelet, during grain-filling or at both stages. Principal component trajectories of the total protein content and the protein fractions of flour as well as the 1H NMR spectra of single wheat kernels, wheat flour, and wheat methanol extracts were analysed to elucidate the metabolic development during grain-filling. The results from both the 1H NMR spectra of methanol extracts and the 1H HR-MAS NMR of single kernels showed that a single drought event during the generative stage had as strong an influence on protein metabolism as two consecutive events of drought. By contrast, a drought event at the vegetative growth stage had little effect on the parameters investigated. For the first time, 1H HR-MAS NMR spectra of grains taken during grain-filling were analysed by an advanced multiway model. In addition to the results from the chemical protein analysis and the 1H HR-MAS NMR spectra of single kernels indicating that protein metabolism is influenced by multiple drought events, the 1H NMR spectra of the methanol extracts of flour from mature grains revealed that the amount of fumaric acid is particularly sensitive to water deficits. PMID:19213725

  19. Supramolecular self-organisation and conformational isomerism of a binuclear O,O'-dipropyl dithiophosphate gold(I) complex, [Au2{S2P(OC3H7)2}2]: Synthesis, (13)C and (31)P CP/MAS NMR spectroscopy, single-crystal X-ray diffraction study and thermal behaviour.

    PubMed

    Rodina, Tatyana A; Korneeva, Eugenia V; Antzutkin, Oleg N; Ivanov, Alexander V

    2015-10-01

    Crystalline one-dimensional polymeric catena-poly[bis(?2-O,O'-dipropyldithiophosphato-S,S')digold(I)] (Au-Au) (1) was prepared and studied using (13)C and (31)P CP/MAS NMR spectroscopy and single-crystal X-ray diffraction. To elucidate the structural function of Dtph ligands in crystalline gold(I) O,O'-dipropyl dithiophosphate, the chemical shift anisotropy parameters (?aniso and ?) were calculated from spinning sideband manifolds in (31)P MAS NMR spectra. A novel structure of the gold(I) compound comprises two isomeric, non-centrosymmetric binuclear molecules of [Au2{S2P(OC3H7)2}2] (isomers 'A' and 'B'), whose four Dtph groups display structural inequivalence. In each isomeric binuclear molecule of 1, a pair of ?2-bridging dipropyl Dtph ligands almost symmetrically links two neighbouring gold atoms, forming an extensive eight-membered metallocycle [Au2S4P2], while the intramolecular aurophilic Au?Au bond additionally stabilises this central cyclic moiety. At the supramolecular level of complex 1, intermolecular aurophilic Au?Au bonds yield almost linear infinite polymeric chains (?'A'?'B'?'A'?'B'?)n. The thermal behaviour of this compound was studied by the simultaneous thermal analysis (STA) technique (a combination of TG and DSC) under an argon atmosphere. PMID:26004097

  20. 14N overtone NMR under MAS: signal enhancement using symmetry-based sequences and novel simulation strategies† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c4cp03994g Click here for additional data file.

    PubMed Central

    Haies, Ibraheem M.; Jarvis, James A.; Bentley, Harry; Heinmaa, Ivo; Kuprov, Ilya; Williamson, Philip T. F.

    2015-01-01

    Overtone 14N NMR spectroscopy is a promising route for the direct detection of 14N signals with good spectral resolution. Its application is currently limited, however, by the absence of efficient polarization techniques for overtone signal enhancement and the lack of efficient numerical simulation techniques to aid in both the development of new methods and the analysis and interpretation of experimental data. In this paper we report a novel method for the transfer of polarization from 1H to the 14N overtone using symmetry-based R-sequences that overcome many of the limitations of adiabatic approaches that have worked successfully on static samples. Refinement of these sequences and the analysis of the resulting spectra have been facilitated through the development of an efficient simulation strategy for 14N overtone NMR spectroscopy of spinning samples, using effective Hamiltonians on top of Floquet and Fokker–Planck equations. PMID:25662410

  1. Theoretical study of CP-VC: a simple, robust and accurate MAS NMR method for analysis of dipolar C-H interactions under rotation speeds faster than ca. 60 kHz.

    PubMed

    Paluch, P; Trébosc, J; Nishiyama, Y; Potrzebowski, M J; Malon, M; Amoureux, J P

    2015-03-01

    We show that Cross-Polarization with Variable Contact-time (CP-VC) allows an accurate determination of C-H dipolar interactions, which permits an easy detailed analysis of bond lengths and local dynamics, e.g. in biomolecules. The method presents a large dipolar scaling factor of 1/?2, leading to a better determination of dipolar interactions, especially for long C-H distances, and it allows the observation of very small local details such as those related either to CH(2) three spin systems, or even to hydrogen bonds. CP-VC is very simple to set up and very robust with respect to most experimental parameters, such as: rf-offsets, chemical-shift anisotropies, imperfect Hartmann-Hahn setting, and rf-inhomogeneity. The only required condition is the use of a sufficiently fast MAS spinning speed of at least ca. 60 kHz. PMID:25662360

  2. Carbon-13 CP-MAS nuclear magnetic resonance studies of teas.

    PubMed

    Martínez-Richa, Antonio; Joseph-Nathan, Pedro

    2003-05-01

    13C CP-MAS NMR spectra of green and black tea were obtained and assigned based on the solid-state NMR spectra of tropolone, (+)-catechin hydrate, gallic acid, caffeine and flavone derivatives. The peak shape and chemical shifts observed for carbonyl carbons in CP-MAS spectra of teas indicate the existence of different chemical species, mainly free phenollic acids and ester derivatives of flavonoids. The peak patterns allow to establish differences between both teas. PMID:12763559

  3. Determination of relative orientation between (1)H CSA tensors from a 3D solid-state NMR experiment mediated through (1)H/(1)H RFDR mixing under ultrafast MAS.

    PubMed

    Pandey, Manoj Kumar; Nishiyama, Yusuke

    2015-09-01

    To obtain piercing insights into inter and intramolecular H-bonding, and ?-electron interactions measurement of (1)H chemical shift anisotropy (CSA) tensors is gradually becoming an obvious choice. While the magnitude of CSA tensors provides unique information about the local electronic environment surrounding the nucleus, the relative orientation between these tensors can offer further insights into the spatial arrangement of interacting nuclei in their respective three-dimensional (3D) space. In this regard, we present a 3D anisotropic/anisotropic/isotropic proton chemical shift (CSA/CSA/CS) correlation experiment mediated through (1)H/(1)H radio frequency-driven recoupling (RFDR) which enhances spin diffusion through recoupled (1)H-(1)H dipolar couplings under ultrafast magic angle spinning (MAS) frequency (70kHz). Relative orientation between two interacting 1H CSA tensors is obtained by fitting two-interacting (1)H CSA tensors by fitting two-dimensional (2D) (1)H/(1)H CSA/CSA spectral slices through extensive numerical simulations. To recouple (1)H CSAs in the indirect frequency dimensions of a 3D experiment we have employed ?-encoded radio frequency (RF) pulse sequence based on R-symmetry (R188(7)) with a series of phase-alternated 2700(°)-90180(°) composite-180° pulses on citric acid sample. Due to robustness of applied (1)H CSA recoupling sequence towards the presence of RF field inhomogeneity, we have successfully achieved an excellent (1)H/(1)H CSA/CSA cross-correlation efficiency between H-bonded sites of citric acid. PMID:26065628

  4. MAS 05 Informative Path Planning MAS 05.1 Overview

    E-print Network

    Soatto, Stefano

    MAS 05 Informative Path Planning MAS 05.1 Overview My goal is to create path planning algorithms that robots provide, it is necessary to come up with a path planning algorithm that can choose paths which gather the most useful information. Over the past year, I have focused primarily on path planning

  5. 13C CP (cross-polarization) MAS (magic angle spinning) NMR and GIAO-CHF calculations of buspirone analogues. Part 1. 3a,4,7,7a-Tetrahydro-2-[4-[4-(2-quinolinyl)-1-piperazinyl]butyl ]-4,7-ethane-1H-isoindole-1,3(2H)-dione hydrochloride and hydrobromide.

    PubMed

    Szelejewska-Wo?niakowska, A; Chilmonczyk, Z; Le?, A; Wawer, I

    1998-11-01

    13C CP (cross-polarization) MAS (magic angle spinning) solid state NMR spectra of buspirone analogue 3a,4,7,7a-tetrahydro-2-[4-[4-(2-quinolinyl)-1-piperazinyl]butyl]-4,7-eth ane-1H-isoindole-1,3(2H)-dione were recorded. In the spectra of hydrochloride and hydrobromide, two sets of signals appeared, in agreement with single crystal X-ray diffraction data indicating that in each of the salts two independent cations were present in the crystal unit. The largest shielding differences of 3.2-4.6 ppm between two sets of signals were found for quinoline aromatic carbons C3 and C2. Ab initio calculations of the carbon and nitrogen shielding constants were performed with the use of the GIAO-CHF method for structural fragments: N-butylsuccinimide, quinoline-(N-methyl) piperazine hydrochloride and hydrobromide. Linear correlations between theoretical and solid state results were obtained, thus enabling a reasonable assignment of carbon resonances of the conformations present in the solid state. Due to the fast dynamics in solution, the carbon chemical shifts corresponded to the averaged values of the forms present in the solid state. PMID:9875604

  6. HR SERVICES COMMUNICATION SESSION

    E-print Network

    ­ Staff Management Report revamp ­ Staff Profile ­ Externally Funded Cost Centres · HR Services Service · Science · Office of the Registrar · Buildings and Services Aisling Croke Account Lead 1 · Agriculture

  7. Broadband solid-state MAS NMR of paramagnetic systems

    E-print Network

    Pell, Andrew J.; Pintacuda, Guido

    2014-12-26

    -factor ge = 2.0023, the paramagnetic contribution to the chemical shielding is ?p = ? µBgeS (S + 1) 3~?IkT A, (6) which follows the Curie temperature dependence of 1/T . In the absence of spin-orbit coupling effects, the hyperfine tensor can be written...

  8. 1 hr 2 hr 3 hr 4 hr 6 hr 8 hr 1 Day 1 Month Extra km Extra hr Driver batta 2. All the vehicles must have valid documents including driving licenses for drivers.

    E-print Network

    Giri, Ranjit K.

    1 hr 2 hr 3 hr 4 hr 6 hr 8 hr 1 Day 1 Month Extra km Extra hr Driver batta A/c Non A/c A/c Non A for drivers. 3. The rates quoted for monthly contract shall be on the following basis:25 days, 2500 kms

  9. Solid-state NMR analysis of coals and shales from the Mesaverde Group, Green River Basin, Wyoming

    SciTech Connect

    Miknis, F.P.; MacGowan, D.B.

    1993-08-01

    Samples of coals and shales from the Almond Formation of the Mesaverde Group, Greater Green River Basin, Wyoming were analyzed using solid-state {sup 13}C nuclear magnetic resonance (NMR) techniques of cross polarization with magic-angle spinning (CP/MAS). The samples were taken from a present-day depth of burial ranging from {approximately}3,000 to {approximately}15,000 ft. In addition, CP/MAS {sup 13}C NMR measurements were made on residues from the hydrous pyrolysis of Almond coal. The hydrous pyrolysis experiments were conducted isothermally for 72 hr in the temperature range of 290 to 360{degree}C (554 to 680{degree}F). In general, the maturation trends observed by NMR for the naturally and artificially matured samples were in agreement with results obtained from other geochemical analyses. The NMR spectra of the naturally matured shale samples showed only a small aliphatic component at depths greater than about 12,000 ft, indicating little capacity for hydrocarbon generation at depths greater than this. Vitrinite reflectance measurements placed the oil window at between 4,500 and 14,500 ft. NMR measurements of the hydrous pyrolysis residues showed a clear loss of aliphatic carbon, relative to the aromatic carbon, with temperature. For the residue obtained from the highest study temperature (360{degree}C/680{degree}F), there was a 60% depletion of the hydrocarbon-producing aliphatic components. The trends in loss of aliphatic carbon with temperature suggested a means of defining a geochemical transformation ratio in terms of the loss of the aliphatic carbon fraction. A good correlation was found between the NMR transformation ratio and the production index determined by Rock-Eval pyrolysis measurements.

  10. HR Partners: Checklist, Forms & Reports

    E-print Network

    Hammack, Richard

    HR Partners: Checklist, Forms & Reports VCU Human Resources September 17 & 18 #12;Agenda Opening Checklist Review Improvement Areas from HR Operations #12;Purpose of HR Partners Q & A about HR Issues by the 29-hour rule 1. Provide clarity on the purpose, function and changes related to HR checklist, forms

  11. Data provided: "Statistics Tables" by H.R. Neave

    E-print Network

    . (10 marks) (b) A manufacturer produces bolts to the same specication on three machines, each of whichData provided: "Statistics Tables" by H.R. Neave MAS274 SCHOOL OF MATHEMATICS AND STATISTICS Spring Semester 2010­2011 Statistical Reasoning 2 hours RESTRICTED OPEN BOOK EXAMINATION. Candidates may bring

  12. NMR Based Cerebrum Metabonomic Analysis Reveals Simultaneous Interconnected Changes during Chick Embryo Incubation

    PubMed Central

    Feng, Yue; Zhu, Hang; Zhang, Xu; Wang, Xuxia; Xu, Fuqiang; Tang, Huiru; Ye, Chaohui; Liu, Maili

    2015-01-01

    To find out if content changes of the major functional cerebrum metabolites are interconnected and formed a network during the brain development, we obtained high-resolution magic-angle-spinning (HR-MAS) 1H NMR spectra of cerebrum tissues of chick embryo aged from incubation day 10 to 20, and postnatal day 1, and analyzed the data with principal component analysis (PCA). Within the examined time window, 26 biological important molecules were identified and 12 of them changed their relative concentration significantly in a time-dependent manner. These metabolites are generally belonged to three categories, neurotransmitters, nutrition sources, and neuronal or glial markers. The relative concentration changes of the metabolites were interconnected among/between the categories, and, more interestingly, associated with the number and size of Nissl-positive neurons. These results provided valuable biochemical and neurochemical information to understand the development of the embryonic brain. PMID:26485040

  13. NMR Spectroscopy of Human Eye Tissues: A New Insight into Ocular Biochemistry

    PubMed Central

    Kryczka, Tomasz; Wyl?ga?a, Edward; Dobrowolski, Dariusz; Midelfart, Anna

    2014-01-01

    Background. The human eye is a complex organ whose anatomy and functions has been described very well to date. Unfortunately, the knowledge of the biochemistry and metabolic properties of eye tissues varies. Our objective was to reveal the biochemical differences between main tissue components of human eyes. Methods. Corneas, irises, ciliary bodies, lenses, and retinas were obtained from cadaver globes 0-1/2 hours postmortem of 6 male donors (age: 44–61 years). The metabolic profile of tissues was investigated with HR MAS 1H NMR spectroscopy. Results. A total of 29 metabolites were assigned in the NMR spectra of the eye tissues. Significant differences between tissues were revealed in contents of the most distant eye-tissues, while irises and ciliary bodies showed minimal biochemical differences. ATP, acetate, choline, glutamate, lactate, myoinositol, and taurine were identified as the primary biochemical compounds responsible for differentiation of the eye tissues. Conclusions. In this study we showed for the first time the results of the analysis of the main human eye tissues with NMR spectroscopy. The biochemical contents of the selected tissues seemed to correspond to their primary anatomical and functional attributes, the way of the delivery of the nutrients, and the location of the tissues in the eye. PMID:25525621

  14. Application of solids MAS nuclear magnetic resonance to study of diagenetic processes

    SciTech Connect

    Sommer, S.E.; Woessner, D.E.

    1984-04-01

    Magic angle spinning-nuclear magnetic resonance spectroscopy (MAS-NMR) provides the opportunity to probe composition of and ordering in minerals involved in the formation and alteration of sediments. MAS-NMR has the capability to detect a large number of elements, including aluminum, silicon, boron, oxygen, and magnesium. The chemical state, structural location, and with cross polarization, hydration character and surface proximity can also be determined using this method. Although MAS-NMR is relatively new and quantitative methodology is still being developed, a variety of geologic processes have been clarified through its application. Use of /sup 27/Al NMR allows detailed determination of the smectite-illite transformation by monitoring the movements of aluminum into tetrahedral positions and resultant cation ordering. Because /sup 27/Al is detectable to low ppm levels, clay mineral components can be determined well below XRD detection levels. The /sup 29/Si and /sup 27/Al MAS-NMR have sufficient resolution to discriminate between minerals in a natural assemblage but not with the resolution of XRD. Quadrupolar nuclei such as /sup 27/Al have relatively poor spectral resolution as compared to nonquadrupolar nuclei such as /sup 29/Si. However, modern high field instrumentation can discriminate between most aluminum-containing minerals including aluminum oxides, hydroxides, oxyhydroxides, clays, and feldspars, as well as trace aluminum levels in quartz, cristobalite, and tridymite. The combination of /sup 27/Al and /sup 29/Si NMR (and availability of other nuclei) provide a powerful aid to the resolution of exploration and production problems including determination of minor to trace amorphous components, hydration state of elements in cherts and clays, and formation damage.

  15. Expression of MAS1 in breast cancer

    PubMed Central

    Luo, Yi; Tanabe, Eriko; Kitayoshi, Misaho; Nishiguchi, Yukiko; Fujiwara, Rina; Matsushima, Sayako; Sasaki, Takamitsu; Sasahira, Tomonori; Chihara, Yoshitomo; Nakae, Dai; Fujii, Kiyomu; Ohmori, Hitoshi; Kuniyasu, Hiroki

    2015-01-01

    MAS1 is a receptor for angiotensin 1-7 (A1-7), which is derived from angiotensin II (A-II) by the action of angiotensin converting enzyme (ACE) 2. MAS1 induces anti-A-II phenotypes, such as vessel dilation and depression of blood pressure. Using immunohistochemistry, we examined the role of MAS1 in 132 cases of invasive ductal carcinoma (IDC) of the breast. While benign mammary tissues expressed MAS1 at high levels, MAS1 expression was attenuated in all IDC, especially in scirrhous IDC. The decrease in MAS1 expression was associated with tumor growth, lymph node metastasis, and grade. MAS1 expression was inversely associated with the proliferation index and epidermal growth factor receptor and human epidermal growth factor receptor-2 expression. Of the 132 cases, 12 (9.1%) were triple-negative breast cancer (TNBC) cases. All TNBC cases (the 12 cases and the additional 36 cases using a tissue array) expressed MAS1. Using the TNBC cell lines 4T1 and MDA-MB-468, which expresses MAS1, we found that cell growth, anti-apoptotic survival and invasion were suppressed by MAS1 activation with A1-7 treatment and enhanced by MAS1 knockdown. In contrast, synergic effect was found between tamoxifen and A1-7 in a luminal A breast cancer cell line, MCF-7. Combination treatment with cisplatin, an ACE2 activator, and an A-II type 1 receptor blocker showed synergic effects on tumor growth inhibition of 4T1 tumors in a syngeneic mouse model. These findings suggest that MAS1 might act as an inhibitory regulator of breast cancer and may be a possible molecular target for this malignancy. PMID:26080617

  16. HR Public meeting

    SciTech Connect

    2010-10-12

    Cher(e)s collègues, En collaboration avec le Département HR, le Directeur général a le plaisir de vous convier à une réunion publique qui se tiendra le vendredi 25 juin 2010 à 9h30 dans l’Amphithéâtre principal (Bâtiment 500)*. Un café d’accueil y sera servi à partir de 9h. Cette réunion abordera les thèmes suivants : • Valeurs de l’Organisation (Directeur général) • Code de Conduite (Directeur général / Anne-Sylvie Catherin) • Création du nouveau rôle d’Ombudsperson (Vincent Vuillemin) Ces présentations seront suivies d’une séance de questions-réponses. Nous espérons vous retrouver nombreux le 25 juin ! Meilleures salutations, Anne-Sylvie Catherin Chef du Département des Ressources humaines *Cette réunion sera retransmise simultanément dans l’Amphithéâtre BE de Prévessin (Bâtiment 864) et également disponible à l’adresse suivante : http://webcast.cern.ch -------------------------------------------------------- Dear colleagues, In collaboration with HR Department, the Director-General would like to invite you to an information meeting which will be held on Friday 25 June 2010 at 9:30 am in the Main Auditorium (Building 500)*. A welcome coffee will be available from 9:00 am. During this meeting, information will be given about: • Organization’s values (Director-General) • Code of Conduct (Director-General / Anne-Sylvie Catherin) • New Ombudsperson role (Vincent Vuillemin) These presentations will be followed by a questions & answers session. We look forward to seeing you all on 25 June! Best regards, Anne-Sylvie Catherin Head, Human Resources Department *This meeting will be simultaneously retransmitted in BE Auditorium (Building 864) and available at the following address: http://webcast.cern.ch.

  17. HR Public meeting

    SciTech Connect

    2010-06-25

    Cher(e)s collègues, En collaboration avec le Département HR, le Directeur général a le plaisir de vous convier à une réunion publique qui se tiendra le vendredi 25 juin 2010 à 9h30 dans l’Amphithéâtre principal (Bâtiment 500)*. Un café d’accueil y sera servi à partir de 9h. Cette réunion abordera les thèmes suivants : • Valeurs de l’Organisation (Directeur général) • Code de Conduite (Directeur général / Anne-Sylvie Catherin) • Création du nouveau rôle d’Ombudsperson (Vincent Vuillemin) Ces présentations seront suivies d’une séance de questions-réponses. Nous espérons vous retrouver nombreux le 25 juin ! Meilleures salutations, Anne-Sylvie Catherin Chef du Département des Ressources humaines *Cette réunion sera retransmise simultanément dans l’Amphithéâtre BE de Prévessin (Bâtiment 864) et également disponible à l’adresse suivante : http://webcast.cern.ch -------------------------------------------------------- Dear colleagues, In collaboration with HR Department, the Director-General would like to invite you to an information meeting which will be held on Friday 25 June 2010 at 9:30 am in the Main Auditorium (Building 500)*. A welcome coffee will be available from 9:00 am. During this meeting, information will be given about: • Organization’s values (Director-General) • Code of Conduct (Director-General / Anne-Sylvie Catherin) • New Ombudsperson role (Vincent Vuillemin) These presentations will be followed by a questions & answers session. We look forward to seeing you all on 25 June! Best regards, Anne-Sylvie Catherin Head, Human Resources Department *This meeting will be simultaneously retransmitted in BE Auditorium (Building 864) and available at the following address: http://webcast.cern.ch.

  18. HR Public meeting

    ScienceCinema

    None

    2011-10-06

    Cher(e)s collègues, En collaboration avec le Département HR, le Directeur général a le plaisir de vous convier à une réunion publique qui se tiendra le vendredi 25 juin 2010 à 9h30 dans l?Amphithéâtre principal (Bâtiment 500)*. Un café d?accueil y sera servi à partir de 9h. Cette réunion abordera les thèmes suivants : ? Valeurs de l?Organisation (Directeur général) ? Code de Conduite (Directeur général / Anne-Sylvie Catherin) ? Création du nouveau rôle d?Ombudsperson (Vincent Vuillemin) Ces présentations seront suivies d?une séance de questions-réponses. Nous espérons vous retrouver nombreux le 25 juin ! Meilleures salutations, Anne-Sylvie Catherin Chef du Département des Ressources humaines *Cette réunion sera retransmise simultanément dans l?Amphithéâtre BE de Prévessin (Bâtiment 864) et également disponible à l?adresse suivante : http://webcast.cern.ch -------------------------------------------------------- Dear colleagues, In collaboration with HR Department, the Director-General would like to invite you to an information meeting which will be held on Friday 25 June 2010 at 9:30 am in the Main Auditorium (Building 500)*. A welcome coffee will be available from 9:00 am. During this meeting, information will be given about: ? Organization?s values (Director-General) ? Code of Conduct (Director-General / Anne-Sylvie Catherin) ? New Ombudsperson role (Vincent Vuillemin) These presentations will be followed by a questions & answers session. We look forward to seeing you all on 25 June! Best regards, Anne-Sylvie Catherin Head, Human Resources Department *This meeting will be simultaneously retransmitted in BE Auditorium (Building 864) and available at the following address: http://webcast.cern.ch.

  19. NMR imaging

    SciTech Connect

    Andrew, E.R.

    1983-04-01

    Since hydrogen is the most abundant element in all living organisms, proton NMR lends itself well as a method of investigation in biology and medicine. NMR imaging has some special advantages as a diagnostic tool: no ionizing radiation is used, it is noninvasive; it provides a safer means of imaging than the use of x-rays, gamma rays, positrons, or heavy ions. In contrast with ultrasound, the radiation penetrates the bony structures without attenuation. In additional to morphological information, NMR imaging provides additional diagnostic insights through relaxation parameters, which are not available from other imaging methods. In the decade since the first primitive NMR images were obtained, the quality of images now obtained approaches those from CT x-ray scanners. Prototype instruments are being constructed for clinical evaluation and the first whole-body scanners are beginning to appear on the market at costs comparable to CT scanners. Primary differences in equipment for conventional NMR and NMR imaging are the much larger aperture magnets that are required for the examination of human subjects and the addition of coils to generate field gradients and facilities for manipulating the gradients. Early results from clinical trials in many parts of the world are encouraging, and in a few years, the usefuleness of this modality of medical imaging to the medical profession in diagnosis and treatment of disease will be defined. 10 figures.

  20. Réunion publique HR

    SciTech Connect

    2010-04-30

    Chers Collègues,Je me permets de vous rappeler qu'une réunion publique organisée par le Département HR se tiendra aujourd'hui:Vendredi 30 avril 2010 à 9h30 dans l'Amphithéâtre principal (café offert dès 9h00).Durant cette réunion, des informations générales seront données sur:le CERN Admin e-guide, qui est un nouveau guide des procédures administratives du CERN ayant pour but de faciliter la recherche d'informations pratiques et d'offrir un format de lecture convivial;le régime d'Assurance Maladie de l'Organisation (présentation effectuée par Philippe Charpentier, Président du CHIS Board) et;la Caisse de Pensions (présentation effectuée par Théodore Economou, Administrateur de la Caisse de Pensions du CERN).Une transmission simultanée de cette réunion sera assurée dans l'Amphithéâtre BE de Prévessin et également disponible à l'adresse suivante: http://webcast.cern.chJe me réjouis de votre participation!Meilleures salutations,Anne-Sylvie CatherinChef du Département des Ressources humaines__________________________________________________________________________________Dear Colleagues,I should like to remind you that a plublic meeting organised by HR Department will be held today:Friday 30 April 2010 at 9:30 am in the Main Auditorium (coffee from 9:00 am).During this meeting, general information will be given about:the CERN Admin e-guide which is a new guide to the Organization's administrative procedures, drawn up to facilitate the retrieval of practical information and to offer a user-friendly format;the CERN Health Insurance System (presentation by Philippe Charpentier, President of the CHIS Board) and;the Pension Fund (presentation by Theodore Economou, Administrator of the CERN Pension Fund).A simultaneous transmission of this meeting will be broadcast in the BE Auditorium at Prévessin and will also be available at the following address. http://webcast.cern.chI look forward to your participation!Best regards,Anne-Sylvie CatherinHead, Human Resources Department

  1. Réunion publique HR

    ScienceCinema

    None

    2011-10-06

    Chers Collègues,Je me permets de vous rappeler qu'une réunion publique organisée par le Département HR se tiendra aujourd'hui:Vendredi 30 avril 2010 à 9h30 dans l'Amphithéâtre principal (café offert dès 9h00).Durant cette réunion, des informations générales seront données sur:le CERN Admin e-guide, qui est un nouveau guide des procédures administratives du CERN ayant pour but de faciliter la recherche d'informations pratiques et d'offrir un format de lecture convivial;le régime d'Assurance Maladie de l'Organisation (présentation effectuée par Philippe Charpentier, Président du CHIS Board) et;la Caisse de Pensions (présentation effectuée par Théodore Economou, Administrateur de la Caisse de Pensions du CERN).Une transmission simultanée de cette réunion sera assurée dans l'Amphithéâtre BE de Prévessin et également disponible à l'adresse suivante: http://webcast.cern.chJe me réjouis de votre participation!Meilleures salutations,Anne-Sylvie CatherinChef du Département des Ressources humaines__________________________________________________________________________________Dear Colleagues,I should like to remind you that a plublic meeting organised by HR Department will be held today:Friday 30 April 2010 at 9:30 am in the Main Auditorium (coffee from 9:00 am).During this meeting, general information will be given about:the CERN Admin e-guide which is a new guide to the Organization's administrative procedures, drawn up to facilitate the retrieval of practical information and to offer a user-friendly format;the CERN Health Insurance System (presentation by Philippe Charpentier, President of the CHIS Board) and;the Pension Fund (presentation by Theodore Economou, Administrator of the CERN Pension Fund).A simultaneous transmission of this meeting will be broadcast in the BE Auditorium at Prévessin and will also be available at the following address. http://webcast.cern.chI look forward to your participation!Best regards,Anne-Sylvie CatherinHead, Human Resources Department

  2. HR Shared Services and the Realignment of HR.

    ERIC Educational Resources Information Center

    Reilly, P.

    This report examines how adopting the shared services model of human resources (HR) services delivery can help businesses achieve better alignment between their HR service and specific business needs. Chapter 1 provides background information on the research project underlying this report, which included the following data collection activities:…

  3. NMR use to quantify phlorotannins: the case of Cystoseira tamariscifolia, a phloroglucinol-producing brown macroalga in Brittany (France).

    PubMed

    Jégou, Camille; Kervarec, Nelly; Cérantola, Stéphane; Bihannic, Isabelle; Stiger-Pouvreau, Valérie

    2015-04-01

    Among the most renowned natural products from brown algae, phlorotannins are phloroglucinol polymers that have been extensively studied, both for their biotechnological potential and their interest in chemical ecology. The accurate quantification of these compounds is a key point to understand their role as mediators of chemical defense. In recent years, the Folin-Ciocalteu assay has remained a classic protocol for phlorotannin quantification, even though it frequently leads to over-estimations. Furthermore, the quantification of the whole pool of phlorotannins may not be relevant in ecological surveys. In this study, we propose a rapid (1)H qNMR method for the quantification of phlorotannins. We identified phloroglucinol as the main phenolic compound produced by the brown macroalga Cystoseira tamariscifolia. This monomer was detected in vivo using (1)H HR-MAS spectroscopy. We quantified this molecule through (1)H qNMR experiments using TSP as internal standard. The results are discussed by comparison with a standard Folin-Ciocalteu assay performed on purified extracts. The accuracy and simplicity of qNMR makes this method a good candidate as a standard phlorotannin assay. PMID:25640118

  4. Fluid flow dynamics in MAS systems.

    PubMed

    Wilhelm, Dirk; Purea, Armin; Engelke, Frank

    2015-08-01

    The turbine system and the radial bearing of a high performance magic angle spinning (MAS) probe with 1.3mm-rotor diameter has been analyzed for spinning rates up to 67kHz. We focused mainly on the fluid flow properties of the MAS system. Therefore, computational fluid dynamics (CFD) simulations and fluid measurements of the turbine and the radial bearings have been performed. CFD simulation and measurement results of the 1.3mm-MAS rotor system show relatively low efficiency (about 25%) compared to standard turbo machines outside the realm of MAS. However, in particular, MAS turbines are mainly optimized for speed and stability instead of efficiency. We have compared MAS systems for rotor diameter of 1.3-7mm converted to dimensionless values with classical turbomachinery systems showing that the operation parameters (rotor diameter, inlet mass flow, spinning rate) are in the favorable range. This dimensionless analysis also supports radial turbines for low speed MAS probes and diagonal turbines for high speed MAS probes. Consequently, a change from Pelton type MAS turbines to diagonal turbines might be worth considering for high speed applications. CFD simulations of the radial bearings have been compared with basic theoretical values proposing considerably smaller frictional loss values. The discrepancies might be due to the simple linear flow profile employed for the theoretical model. Frictional losses generated inside the radial bearings result in undesired heat-up of the rotor. The rotor surface temperature distribution computed by CFD simulations show a large temperature gradient over the rotor. PMID:26073599

  5. Fluid flow dynamics in MAS systems

    NASA Astrophysics Data System (ADS)

    Wilhelm, Dirk; Purea, Armin; Engelke, Frank

    2015-08-01

    The turbine system and the radial bearing of a high performance magic angle spinning (MAS) probe with 1.3 mm-rotor diameter has been analyzed for spinning rates up to 67 kHz. We focused mainly on the fluid flow properties of the MAS system. Therefore, computational fluid dynamics (CFD) simulations and fluid measurements of the turbine and the radial bearings have been performed. CFD simulation and measurement results of the 1.3 mm-MAS rotor system show relatively low efficiency (about 25%) compared to standard turbo machines outside the realm of MAS. However, in particular, MAS turbines are mainly optimized for speed and stability instead of efficiency. We have compared MAS systems for rotor diameter of 1.3-7 mm converted to dimensionless values with classical turbomachinery systems showing that the operation parameters (rotor diameter, inlet mass flow, spinning rate) are in the favorable range. This dimensionless analysis also supports radial turbines for low speed MAS probes and diagonal turbines for high speed MAS probes. Consequently, a change from Pelton type MAS turbines to diagonal turbines might be worth considering for high speed applications. CFD simulations of the radial bearings have been compared with basic theoretical values proposing considerably smaller frictional loss values. The discrepancies might be due to the simple linear flow profile employed for the theoretical model. Frictional losses generated inside the radial bearings result in undesired heat-up of the rotor. The rotor surface temperature distribution computed by CFD simulations show a large temperature gradient over the rotor.

  6. Access to side-chain carbon information in deuterated solids under fast MAS through non-rotor-synchronized mixing.

    PubMed

    Kulminskaya, Natalia; Vasa, Suresh Kumar; Giller, Karin; Becker, Stefan; Kwan, Ann; Sunde, Margaret; Linser, Rasmus

    2016-01-01

    We demonstrate the accessibility of aliphatic (13)C side chain chemical shift sets for solid-state NMR despite perdeuteration and fast MAS using isotropic, non-rotor-synchronized (13)C-(13)C mixing. Combined with amide proton detection, we unambiguously and sensitively detect whole side chain to backbone correlations for two proteins using around 1 mg of sample. PMID:26541699

  7. Solid State Separated-Local-Field NMR Spectroscopy on Half-Integer Quadrupolar Nuclei: Principles and Applications

    E-print Network

    Frydman, Lucio

    Solid State Separated-Local-Field NMR Spectroscopy on Half-Integer Quadrupolar Nuclei: Principles-mail: lucio.frydman@weizmann.ac.il Abstract: New multidimensional NMR methods correlating the quadrupolar and exemplified. The methods extend separated-local-field magic-angle spinning (SLF MAS) NMR techniques that have

  8. New generation NMR bioreactor coupled with high-resolution NMR spectroscopy leads to novel discoveries in Moorella thermoaceticum metabolic profiles

    SciTech Connect

    Xue, Junfeng; Isern, Nancy G.; Ewing, R James; Liyu, Andrey V.; Sears, Jesse A.; Knapp, Harlan; Iversen, Jens; Sisk, Daniel R.; Ahring, Birgitte K.; Majors, Paul D.

    2014-06-20

    An in-situ nuclear magnetic resonance (NMR) bioreactor was developed and employed to monitor microbial metabolism under batch-growth conditions in real time. We selected Moorella thermoacetica ATCC 49707 as a test case. M. thermoacetica (formerly Clostridium thermoaceticum) is a strictly anaerobic, thermophilic, acetogenic, gram-positive bacterium with potential for industrial production of chemicals. The metabolic profiles of M. thermoacetica were characterized during growth in batch mode on xylose (a component of lignocellulosic biomass) using the new generation NMR bioreactor in combination with high-resolution, high sensitivity NMR (HR-NMR) spectroscopy. In-situ NMR measurements were performed using water-suppressed H-1 NMR spectroscopy at an NMR frequency of 500 MHz, and aliquots of the bioreactor contents were taken for 600 MHz HR-NMR spectroscopy at specific intervals to confirm metabolite identifications and expand metabolite coverage. M. thermoacetica demonstrated the metabolic potential to produce formate, ethanol and methanol from xylose, in addition to its known capability of producing acetic acid. Real-time monitoring of bioreactor conditions showed a temporary pH decrease, with a concomitant increase in formic acid during exponential growth. Fermentation experiments performed outside of the magnet showed that the strong magnetic field employed for NMR detection did not significantly affect cell metabolism. Use of the in-situ NMR bioreactor facilitated monitoring of the fermentation process in real time, enabling identification of intermediate and end-point metabolites and their correlation with pH and biomass produced during culture growth. Real-time monitoring of culture metabolism using the NMR bioreactor in combination with the HR-NMR spectroscopy will allow optimization of the metabolism of microorganisms producing valuable bioproducts.

  9. [superscript 15]N-[superscript 15]N Proton Assisted Recoupling in Magic Angle Spinning NMR

    E-print Network

    Lewandowski, Jozef R.

    We describe a new magic angle spinning (MAS) NMR experiment for obtaining [superscript 15]N?[superscript 15]N correlation spectra. The approach yields direct information about the secondary and tertiary structure of proteins, ...

  10. NMR IN BIOMEDICINE NMR Biomed. in press

    E-print Network

    Loening, Niko

    analyses.22 Unfortunately, present NMR-based in vivo techniques cannot differentiate the methyl protons compounds using high-resolution magic angle spinning proton NMR spec- troscopy. Differentiating betweenNMR IN BIOMEDICINE NMR Biomed. in press Published online in Wiley InterScience (www

  11. RESTRICTED OPEN BOOK EXAMINATION (Not to be removed from the examination hall) Data provided: "Statistics Tables" by H.R. Neave

    E-print Network

    : "Statistics Tables" by H.R. Neave MAS5052 SCHOOL OF MATHEMATICS AND STATISTICS Spring Semester 2012­2013 Basic Statistics 2 hours RESTRICTED OPEN BOOK EXAMINATION. Candidates may bring to the examination lecture notes #12;MAS5052 7 The survival time (in days) of 64 patients with advanced cancer of the stomach, bronchus

  12. In situ NMR analysis of fluids contained in sedimentary rock

    PubMed

    de Swiet TM; Tomaselli; Hurlimann; Pines

    1998-08-01

    Limitations of resolution and absorption in standard chemical spectroscopic techniques have made it difficult to study fluids in sedimentary rocks. In this paper, we show that a chemical characterization of pore fluids may be obtained in situ by magic angle spinning (MAS) nuclear magnetic resonance (NMR), which is normally used for solid samples. 1H MAS-NMR spectra of water and crude oil in Berea sandstone show sufficient chemical shift resolution for a straightforward determination of the oil/water ratio. Copyright 1998 Academic Press. PMID:9716484

  13. A comparative spectroscopic investigation of three pseudopolymorphs of testosterone using solid-state i.r. and high-resolution solid-state NMR

    NASA Astrophysics Data System (ADS)

    Fletton, Richard A.; Harris, Robin K.; Kenwright, Alan M.; Lancaster, Robert W.; Packer, Kenneth J.; Sheppard, Norman

    Three pseudopolymorphic forms of testosterone have been examined by i.r. and CP/MAS NMR spectroscopies. The transmittance i.r. data clearly distinguish the forms. The NMR work also provides clear distinctions and shows crystallographic splittings for the ? form only, in accordance with the X-ray data. The NMR spectra are fully assigned. The effect of crystallisation procedure on the NMR spectra was explored. NMR can be used to quantitatively assess mixtures of the ? and ? forms.

  14. Fundamental Science Tools for Geologic Carbon Sequestration and Mineral Carbonation Chemistry: In Situ Magic Angle Spinning (MAS) Nuclear Magnetic Resonance

    NASA Astrophysics Data System (ADS)

    Hoyt, D. W.; Turcu, R. V.; Sears, J. A.; Rosso, K. M.; Burton, S. D.; Kwak, J.; Felmy, A. R.; Hu, J.

    2010-12-01

    GCS is one of the most promising ways of mitigating atmospheric greenhouse gases. Mineral carbonation reactions are potentially important to the long-term sealing effectiveness of caprock but remain poorly predictable, particularly reactions occurring in low-water supercritical CO2(scCO2)-dominated environments where the chemistry has not been adequately explored. In situ probes that provide molecular-level information is desirable for investigating mechanisms and rates of GCS mineral carbonation reactions. MAS-NMR is a powerful tool for obtaining detailed molecular structure and dynamics information of a system regardless whether the system is in a solid, a liquid, a gaseous, or a supercritical state, or a mixture thereof. However, MAS NMR under scCO2 conditions has never been realized due to the tremendous technical difficulties of achieving and maintaining high pressure within a fast spinning MAS rotor. In this work, we report development of a unique high pressure MAS NMR capability, and its application to mineral carbonation chemistry in scCO2 under geologically relevant temperatures and pressures. Our high pressure MAS rotor has successfully maintained scCO2 conditions with minimal leakage over a period of 72 hours. Mineral carbonation reactions of a model magnesium silicate (forsterite) reacted with 96 bars scCO2 containing varying amounts of H2O (both below and above saturation of the scCO2) were investigated at 50?C. Figure 1 shows typical in situ 13C MAS NMR spectra demonstrating that the peaks corresponding to the reactants, intermediates, and the magnesium carbonation products are all observed in a single spectrum. For example, the scCO2 peak is located at 126.1 ppm. Reaction intermediates include the aqueous species HCO3-(160 ppm), partially hydrated/hydroxylated magnesium carbonates(166-168 ppm), and can easily be distinguished from final product magnesite(170 ppm). The new capability and this model mineral carbonation process will be overviewed in light of fundamental geochemical science needs for GCS implementation. Figure 1. 13C MAS NMR spectra of forsterite exposed to scCO2 300% saturated with water at 96 bars and 50°C. MAS rate=2.1 kHz.

  15. Alloy NASA-HR-1

    NASA Technical Reports Server (NTRS)

    Chen, Po-Shou; Mitchell, Michael

    2005-01-01

    NASA-HR-1 is a high-strength Fe-Ni-base superalloy that resists high-pressure hydrogen environment embrittlement (HEE), oxidation, and corrosion. Originally derived from JBK-75, NASA-HR-1 has exceptional HEE resistance that can be attributed to its gamma-matrix and eta-free (Ni3Ti) grain boundaries. The chemistry was formulated using a design approach capable of accounting for the simultaneous effects of several alloy additions. This approach included: (1) Systematically modifying gamma-matrix compositions based on JBK-75; (2) Increasing gamma (Ni3(Al,Ti)) volume fraction and adding gamma-matrix strengthening elements to obtain higher strength; and (3) Obtaining precipitate-free grain boundaries. The most outstanding attribute of NASA-HR-1 is its ability to resist HEE while showing much improved strength. NASA-HR-1 has approximately 25% higher yield strength than JXK-75 and exhibits tensile elongation of more than 20% with no ductility loss in a hydrogen environment at 5 ksi, an achievement unparalleled by any other commercially available alloy. Its Cr and Ni contents provide exceptional resistance to environments that promote oxidation and corrosion. Microstructural stability was maintained by improved solid solubility of the gamma-matrix, along with the addition of alloying elements to retard eta (Ni3Ti) precipitation. NASA-HR-1 represents a new system that greatly extends the compositional ranges of existing HEE-resistant Fe-Ni-base superalloys.

  16. Mas' Making and Pedagogy: Imagined Possibilities

    ERIC Educational Resources Information Center

    Fournillier, Janice B.

    2009-01-01

    In this article I draw on an ethnographic case study that examined mas' makers' perceptions of the learning/teaching practices at work in the production of costumes for Trinidad and Tobago's annual Carnival celebrations. During the 2005 Carnival season I spent four months in the field, my country of birth, and collected data through participant…

  17. MAS 335 Cryptography Notes 1 Spring 2008

    E-print Network

    Wilson, Robert A.

    MAS 335 Cryptography Notes 1 Spring 2008 Introduction Cryptography refers to the art of protecting, the term cryptography is often used colloquially to include both cryptography and cryptanalysis. In these notes I will use the term cryptography exclusively. Cryptography is closely related to another part

  18. C NMR Spectra C NMR Spectra

    E-print Network

    Collum, David B.

    S16 1 H and 13 C NMR Spectra (see p S3) Me N-i-Pr #12;S17 1 H and 13 C NMR Spectra (see p S3) Me NBn #12;S18 1 H and 13 C NMR Spectra (see p S4) NBn #12;S19 1 H and 13 C NMR Spectra (see p S4) NBn Me Me Me #12;S20 1 H and 13 C NMR Spectra (see p S4) N-n-Bu Me Me Me #12;S21 1 H and 13 C NMR Spectra

  19. ing the starting polarization. NMR resonant energies are proportional to the strength of the

    E-print Network

    Elsner, James B.

    ,andsolid-statespectracanachievea resolutionsimilartothatoftheirsolutionNMR counterparts10 byatrickknownasmagic-angle spinning(MAS),inwhichthesampleisrotated at high speed also allowed for the collection of many NMR spectra simul- taneously9 . As well as being highly in a rotor within a static assembly containing a fixed coil that is some distance from the sample

  20. 1020 MHz single-channel proton fast magic angle spinning solid-state NMR spectroscopy

    NASA Astrophysics Data System (ADS)

    Pandey, Manoj Kumar; Zhang, Rongchun; Hashi, Kenjiro; Ohki, Shinobu; Nishijima, Gen; Matsumoto, Shinji; Noguchi, Takashi; Deguchi, Kenzo; Goto, Atsushi; Shimizu, Tadashi; Maeda, Hideaki; Takahashi, Masato; Yanagisawa, Yoshinori; Yamazaki, Toshio; Iguchi, Seiya; Tanaka, Ryoji; Nemoto, Takahiro; Miyamoto, Tetsuo; Suematsu, Hiroto; Saito, Kazuyoshi; Miki, Takashi; Ramamoorthy, Ayyalusamy; Nishiyama, Yusuke

    2015-12-01

    This study reports a first successful demonstration of a single channel proton 3D and 2D high-throughput ultrafast magic angle spinning (MAS) solid-state NMR techniques in an ultra-high magnetic field (1020 MHz) NMR spectrometer comprised of HTS/LTS magnet. High spectral resolution is well demonstrated.

  1. Asteroseismology across the HR diagram

    E-print Network

    M. J. P. F. G. Monteiro

    2007-02-12

    High precision spectroscopy provides essential information necessary to fully exploit the opportunity of probing the internal structure of stars using Asteroseismology. In this work we discuss how Asteroseismology combined with High Precision Spectroscopy can establish a detailed view on stellar structure and evolution of stars across the HR diagramme.

  2. Zygosity determination in hairless mice by PCR based on Hr(hr) gene analysis.

    PubMed

    Suzuki, Osamu; Koura, Minako; Noguchi, Yoko; Uchio-Yamada, Kozue; Matsuda, Junichiro

    2013-01-01

    We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr(hr) allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr(hr) in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr(hr) allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr(hr) (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr(hr) gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age. PMID:23903062

  3. Moderate MAS enhances local (1)H spin exchange and spin diffusion.

    PubMed

    Roos, Matthias; Micke, Peter; Saalwächter, Kay; Hempel, Günter

    2015-11-01

    Proton NMR spin-diffusion experiments are often combined with magic-angle spinning (MAS) to achieve higher spectral resolution of solid samples. Here we show that local proton spin diffusion can indeed become faster at low (<10kHz) spinning rates as compared to static conditions. Spin diffusion under static conditions can thus be slower than the often referred value of 0.8nm(2)/ms, which was determined using slow MAS (Clauss et al., 1993). The enhancement of spin diffusion by slow MAS relies on the modulation of the orientation-dependent dipolar couplings during sample rotation and goes along with transient level crossings in combination with dipolar truncation. The experimental finding and its explanation is supported by density matrix simulations, and also emphasizes the sensitivity of spin diffusion to the local coupling topology. The amplification of spin diffusion by slow MAS cannot be explained by any model based on independent spin pairs; at least three spins have to be considered. PMID:26397218

  4. Moderate MAS enhances local 1H spin exchange and spin diffusion

    NASA Astrophysics Data System (ADS)

    Roos, Matthias; Micke, Peter; Saalwächter, Kay; Hempel, Günter

    2015-11-01

    Proton NMR spin-diffusion experiments are often combined with magic-angle spinning (MAS) to achieve higher spectral resolution of solid samples. Here we show that local proton spin diffusion can indeed become faster at low (<10 kHz) spinning rates as compared to static conditions. Spin diffusion under static conditions can thus be slower than the often referred value of 0.8 nm2/ms, which was determined using slow MAS (Clauss et al., 1993). The enhancement of spin diffusion by slow MAS relies on the modulation of the orientation-dependent dipolar couplings during sample rotation and goes along with transient level crossings in combination with dipolar truncation. The experimental finding and its explanation is supported by density matrix simulations, and also emphasizes the sensitivity of spin diffusion to the local coupling topology. The amplification of spin diffusion by slow MAS cannot be explained by any model based on independent spin pairs; at least three spins have to be considered.

  5. Performance of RINEPT is amplified by dipolar couplings under ultrafast MAS conditions.

    PubMed

    Zhang, Rongchun; Ramamoorthy, Ayyalusamy

    2014-06-01

    The refocused insensitive nuclei enhanced by polarization transfer (RINEPT) technique is commonly used for heteronuclear polarization transfer in solution and solid-state NMR spectroscopy. Suppression of dipolar couplings, either by fast molecular motions in solution or by a combination of MAS and multiple pulse sequences in solids, enables the polarization transfer via scalar couplings. However, the presence of unsuppressed dipolar couplings could alter the functioning of RINEPT, particularly under fast/ultrafast MAS conditions. In this study, we demonstrate, through experiments on rigid solids complemented by numerical simulations, that the polarization transfer efficiency of RINEPT is dependent on the MAS frequency. In addition, we show that heteronuclear dipolar coupling is the dominant factor in the polarization transfer, which is strengthened by the presence of (1)H-(1)H dipolar couplings. In fact, the simultaneous presence of homonuclear and heteronuclear dipolar couplings is the premise for the polarization transfer by RINEPT, whereas the scalar coupling plays an insignificant role under ultrafast MAS conditions on rigid solids. Our results additionally reveal that the polarization transfer efficiency decreases with the increasing duration of RF pulses used in the RINEPT sequence. PMID:24792960

  6. Revisiting the optical interferometry observations of HR 4049

    NASA Astrophysics Data System (ADS)

    Menut, J.-L.; Chesneau, O.; Bakker, E.; Lopez, B.; Perrin, G.; Leinert, C.; Quirrenbach, A.

    2009-03-01

    Aims: We present high spatial resolution observations in the mid-infrared of the dusty core of the binary system HR 4049. Methods: We used the mid-infrared interferometer MIDI/VLTI with 40 m projected baselines. These observations provided two spectrally dispersed visibility curves at a spatial resolution of ~10 mas. Acquisition images and spectra are in addition obtained with a single telescope spatial resolution of ~250 mas. Results: The MIDI spectra show features due to emission lines (7.9, 8.6 and 11.3 micron) attributed to PAHs. The comparison between ISO and MIDI spectra and dispersed visibility curves allows us to investigate the budget of continuum and PAH emission from distant regions to the inner regions of the compact dusty structure. The flux balance between these different PAH features is different to the one seen in the large beam ISO spectrum, suggesting different contributions at varying locations from the central star for the different PAH species. These features are over-resolved (i.e. their correlated flux is close to zero), placing the bulk of their line forming region at least at 50-70 mas from the central star. The continuum extension is estimated to range between 23 and 27 mas using a Gaussian model, and is very close to the K-band sizes measured with VINCI/VLTI, implying that the emitting regions of the near and mid-IR are similar. The visibilities from the two different baselines do not allow us to constrain the shape of the continuum emitting region but noticeable differences between them suggest that the N band dusty environment is flattened in a direction that coincides with the one suggested by previous polarimetric observations. Based on observations made with the Very Large Telescope Interferometer at Paranal Observatory.

  7. eHR: An Introduction. IES Report.

    ERIC Educational Resources Information Center

    Kettley, P.; Reilly, P.

    This document introduces the concept of electronic human resources (eHR) and its application. Chapter 1 presents a brief overview of the guide's development, purpose, and structure. Chapter 2 defines the concept of eHR as "the application of conventional, Web, and voice technologies to improve HR administration, transactions, and process…

  8. Rapid proton-detected NMR assignment for proteins with fast magic angle spinning.

    PubMed

    Barbet-Massin, Emeline; Pell, Andrew J; Retel, Joren S; Andreas, Loren B; Jaudzems, Kristaps; Franks, W Trent; Nieuwkoop, Andrew J; Hiller, Matthias; Higman, Victoria; Guerry, Paul; Bertarello, Andrea; Knight, Michael J; Felletti, Michele; Le Marchand, Tanguy; Kotelovica, Svetlana; Akopjana, Inara; Tars, Kaspars; Stoppini, Monica; Bellotti, Vittorio; Bolognesi, Martino; Ricagno, Stefano; Chou, James J; Griffin, Robert G; Oschkinat, Hartmut; Lesage, Anne; Emsley, Lyndon; Herrmann, Torsten; Pintacuda, Guido

    2014-09-01

    Using a set of six (1)H-detected triple-resonance NMR experiments, we establish a method for sequence-specific backbone resonance assignment of magic angle spinning (MAS) nuclear magnetic resonance (NMR) spectra of 5-30 kDa proteins. The approach relies on perdeuteration, amide (2)H/(1)H exchange, high magnetic fields, and high-spinning frequencies (?r/2? ? 60 kHz) and yields high-quality NMR data, enabling the use of automated analysis. The method is validated with five examples of proteins in different condensed states, including two microcrystalline proteins, a sedimented virus capsid, and two membrane-embedded systems. In comparison to contemporary (13)C/(15)N-based methods, this approach facilitates and accelerates the MAS NMR assignment process, shortening the spectral acquisition times and enabling the use of unsupervised state-of-the-art computational data analysis protocols originally developed for solution NMR. PMID:25102442

  9. Rock Art Interpretation within Indiana MAS Viviana Mascardi1

    E-print Network

    Deufemia, Vincenzo

    Rock Art Interpretation within Indiana MAS Viviana Mascardi1 , Vincenzo Deufemia2 , Damiano in the domain of Mount Bego's pre- historic rock art (southern French Alps). The way Indiana MAS holons the first results achieved within the project "Indiana MAS and the Digital Preservation of Rock Carvings

  10. NMR Studies of Cartilage Dynamics, Diffusion, Degradation

    NASA Astrophysics Data System (ADS)

    Huster, Daniel; Schiller, Jürgen; Naji, Lama; et al.

    An increasing number of people is suffering from rheumatic diseases, and, therefore, methods of early diagnosis of joint degeneration are urgently required. For their establishment, however, an improved knowledge about the molecular organisation of cartilage would be helpful. Cartilage consists of three main components: Water, collagen and chondroitin sulfate (CS) that is (together with further polysaccharides and proteins) a major constituent of the proteoglycans of cartilage. 1H and 13C MAS (magic-angle spinning) NMR (nuclear magnetic resonance) opened new perspectives for the study of the macromolecular components in cartilage. We have primarily studied the mobilities of CS and collagen in bovine nasal and pig articular cartilage (that differ significantly in their collagen/polysaccharide content) by measuring 13C NMR relaxation times as well as the corresponding 13C CP (cross polarisation) MAS NMR spectra. These data clearly indicate that the mobility of cartilage macromolecules is broadly distributed from almost completely rigid (collagen) to highly mobile (polysaccharides), which lends cartilage its mechanical strength and shock-absorbing properties.

  11. NMR analysis of biodiesel

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Biodiesel is usually analyzed by the various methods called for in standards such as ASTM D6751 and EN 14214. Nuclear magnetic resonance (NMR) is not one of these methods. However, NMR, with 1H-NMR commonly applied, can be useful in a variety of applications related to biodiesel. These include monit...

  12. Studies of minute quantities of natural abundance molecules using 2D heteronuclear correlation spectroscopy under 100kHz MAS

    DOE PAGESBeta

    Nishiyama, Y.; Kobayashi, T.; Malon, M.; Singappuli-Arachchige, D.; Slowing, I. I.; Pruski, M.

    2015-02-16

    Two-dimensional 1H{13C} heteronuclear correlation solid-state NMR spectra of naturally abundant solid materials are presented, acquired using the 0.75-mm magic angle spinning (MAS) probe at spinning rates up to 100 kHz. In spite of the miniscule sample volume (290 nL), high-quality HSQC-type spectra of bulk samples as well as surface-bound molecules can be obtained within hours of experimental time. The experiments are compared with those carried out at 40 kHz MAS using a 1.6-mm probe, which offered higher overall sensitivity due to a larger rotor volume. The benefits of ultrafast MAS in such experiments include superior resolution in 1H dimension withoutmore »resorting to 1H–1H homonuclear RF decoupling, easy optimization, and applicability to mass-limited samples. As a result, the HMQC spectra of surface-bound species can be also acquired under 100 kHz MAS, although the dephasing of transverse magnetization has significant effect on the efficiency transfer under MAS alone.« less

  13. Lipid bilayer-bound conformation of an integral membrane beta barrel protein by multidimensional MAS NMR

    E-print Network

    Eddy, Matthew Thomas

    The human voltage dependent anion channel 1 (VDAC) is a 32 kDa ?-barrel integral membrane protein that controls the transport of ions across the outer mitochondrial membrane. Despite the determination of VDAC solution and ...

  14. Friedel's salt formation in sulfoaluminate cements: A combined XRD and {sup 27}Al MAS NMR study

    SciTech Connect

    Paul, G.; Boccaleri, E.; Buzzi, L.; Canonico, F.; Gastaldi, D.

    2015-01-15

    Four different binders based on calcium sulfoaluminate cements have been submitted to accelerated chlorination through ionic exchange on hydrated pastes, in order to investigate their ability to chemically bind chloride ions that might reduce chloride penetration. The composition of hydrated cements before and after the treatment was evaluated by means of an X-Ray Diffraction–{sup 27}Al Magic Angle Spinning Nuclear Magnetic Resonance Spectroscopy combined study, allowing to take into account even partially amorphous phases and to make quantitative assumption on the relative abundance of the different aluminium-containing phases. It was found that low SO{sub 3} Sulfoaluminate–Portland ternary systems are the most effective in binding chloride ions and the active role played by different members of the AFm family in chloride uptake was confirmed. Moreover, a peculiar behavior related to the formation of Friedel's salt in different pH conditions was also established for the different cements.

  15. Abstract--Given High Resolution Magic Angle Spinning (HR-MAS) signals from several glioblastoma tumor subjects,

    E-print Network

    tumor subjects, the goal is to differentiate between tumor tissue types by separating the different for obtaining characteristic profiles for necrosis, high cellular tumor and border tumor tissue, and providing the contribution (abundance) of each tumor tissue to the profile of the spectra. The problem is formulated as a non

  16. CHHC and [superscript 1]H–[superscript 1]H magnetization exchange: Analysis by experimental solid-state NMR and 11-spin density-matrix simulations

    E-print Network

    Aluas, Mihaela

    A protocol is presented for correcting the effect of non-specific cross-polarization in CHHC solid-state MAS NMR experiments, thus allowing the recovery of the [superscript 1]H–[superscript 1]H magnetization exchange ...

  17. Stationary interphases with extended alkyl chains: a comparative study on chain order by solid-state NMR spectroscopy.

    PubMed

    Pursch, M; Brindle, R; Ellwanger, A; Sander, L C; Bell, C M; Händel, H; Albert, K

    1997-12-01

    Stationary interphases with long n-alkyl chains (n = 18, 22, 30, 34) have been examined by solid-state NMR spectroscopy. The determination of the silane functionality and the degree of cross-linking of silane ligands on the silica surface was performed by 29Si CP/MAS NMR spectroscopy. High-speed 1H MAS and 13C CP/MAS NMR spectroscopy were utilized to assess alkyl chain order and mobility of the different bonded phases. For this purpose, 1H NMR line widths and 13C chemical shifts have been evaluated. It is shown that stationary phase order and rigidity increase with alkyl chain length. In addition, the temperature-dependent trans/gauche conformational change occurs at higher temperatures for a polymeric C34 phase compared with a C30 sorbent. This behaviour is discussed in the context of previously reported chromatographic (HPLC) shape selectivity differences. PMID:9477449

  18. Solid-State NMR Examination of Alteration Layers on a Nuclear Waste Glasses

    SciTech Connect

    Murphy, Kelly A.; Washton, Nancy M.; Ryan, Joseph V.; Pantano, Carlo G.; Mueller, Karl T.

    2013-06-01

    Solid-state NMR is a powerful tool for probing the role and significance of alteration layers in determining the kinetics for the corrosion of nuclear waste glass. NMR methods are used to probe the chemical structure of the alteration layers to elucidate information about their chemical complexity, leading to increased insight into the mechanism of altered layer formation. Two glass compositions were examined in this study: a glass preliminarily designed for nuclear waste immobilization (called AFCI) and a simplified version of this AFCI glass (which we call SA1R). Powdered glasses with controlled and known particles sizes were corroded at 90 °C for periods of one and five months with a surface-area to solution-volume ratio of 100,000 m-1. 1H-29Si CP-CPMG MAS NMR, 1H-27Al CP-MAS NMR, 1H-11B CP-MAS NMR, and 1H-23Na CP-MAS NMR experiments provide isolated structural information about the alteration layers, which differ in structure from that of the pristine glass. Both glasses studied here develop alteration layers composed primarily of [IV]Si species. Aluminum is also retained in the alteration layers, perhaps facilitated by the observed increase in coordination from [IV]Al to [VI]Al, which correlates with a loss of charge balancing cations. 1H-11B CP-MAS NMR observations indicated a retention of boron in hydrated glass layers, which has not been characterized by previous work. For the AFCI glass, secondary phase formation begins during the corrosion times considered here, and these neophases are detected within the alteration layers. We identify precursor phases as crystalline sodium metasilicates. An important finding is that layer thickness depends on the length of the initial alteration stages and varies only with respect to silicon species during the residual rate regime.

  19. Proton-Detected Solid-State NMR Spectroscopy of Bone with Ultrafast Magic Angle Spinning

    PubMed Central

    Mroue, Kamal H.; Nishiyama, Yusuke; Kumar Pandey, Manoj; Gong, Bo; McNerny, Erin; Kohn, David H.; Morris, Michael D.; Ramamoorthy, Ayyalusamy

    2015-01-01

    While obtaining high-resolution structural details from bone is highly important to better understand its mechanical strength and the effects of aging and disease on bone ultrastructure, it has been a major challenge to do so with existing biophysical techniques. Though solid-state NMR spectroscopy has the potential to reveal the structural details of bone, it suffers from poor spectral resolution and sensitivity. Nonetheless, recent developments in magic angle spinning (MAS) NMR technology have made it possible to spin solid samples up to 110?kHz frequency. With such remarkable capabilities, 1H-detected NMR experiments that have traditionally been challenging on rigid solids can now be implemented. Here, we report the first application of multidimensional 1H-detected NMR measurements on bone under ultrafast MAS conditions to provide atomistic-level elucidation of the complex heterogeneous structure of bone. Our investigations demonstrate that two-dimensional 1H/1H chemical shift correlation spectra for bone are obtainable using fp-RFDR (finite-pulse radio-frequency-driven dipolar recoupling) pulse sequence under ultrafast MAS. Our results infer that water exhibits distinct 1H?1H dipolar coupling networks with the backbone and side-chain regions in collagen. These results show the promising potential of proton-detected ultrafast MAS NMR for monitoring structural and dynamic changes caused by mechanical loading and disease in bone. PMID:26153138

  20. Proton-Detected Solid-State NMR Spectroscopy of Bone with Ultrafast Magic Angle Spinning

    NASA Astrophysics Data System (ADS)

    Mroue, Kamal H.; Nishiyama, Yusuke; Kumar Pandey, Manoj; Gong, Bo; McNerny, Erin; Kohn, David H.; Morris, Michael D.; Ramamoorthy, Ayyalusamy

    2015-07-01

    While obtaining high-resolution structural details from bone is highly important to better understand its mechanical strength and the effects of aging and disease on bone ultrastructure, it has been a major challenge to do so with existing biophysical techniques. Though solid-state NMR spectroscopy has the potential to reveal the structural details of bone, it suffers from poor spectral resolution and sensitivity. Nonetheless, recent developments in magic angle spinning (MAS) NMR technology have made it possible to spin solid samples up to 110?kHz frequency. With such remarkable capabilities, 1H-detected NMR experiments that have traditionally been challenging on rigid solids can now be implemented. Here, we report the first application of multidimensional 1H-detected NMR measurements on bone under ultrafast MAS conditions to provide atomistic-level elucidation of the complex heterogeneous structure of bone. Our investigations demonstrate that two-dimensional 1H/1H chemical shift correlation spectra for bone are obtainable using fp-RFDR (finite-pulse radio-frequency-driven dipolar recoupling) pulse sequence under ultrafast MAS. Our results infer that water exhibits distinct 1H-1H dipolar coupling networks with the backbone and side-chain regions in collagen. These results show the promising potential of proton-detected ultrafast MAS NMR for monitoring structural and dynamic changes caused by mechanical loading and disease in bone.

  1. New insights into the bonding arrangements of L- and D-glutamates from solid state 17O NMR

    NASA Astrophysics Data System (ADS)

    Lemaitre, V.; Pike, K. J.; Watts, A.; Anupold, T.; Samoson, A.; Smith, M. E.; Dupree, R.

    2003-03-01

    Magic angle spinning (MAS) from L- and D-glutamic acid-HCl at 14.1 T produces highly structured and very similar NMR spectra. Lines from all 4 oxygen sites are readily distinguished and assigned. These 17O NMR spectra are very different from the previously reported 17O spectrum of the D, L-form presumably because that was a racemic crystal. 17O NMR from L-monosodium glutamate-HCl is very different again requiring the application of double angle rotation and 3 quantum MAS NMR to provide resolution of 5 different sites. Hence high resolution 17O solid state NMR techniques offer possible new insight into biochemical bonding processes.

  2. 48 CFR 538.271 - MAS contract awards.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 4 2011-10-01 2011-10-01 false MAS contract awards. 538.271 Section 538.271 Federal Acquisition Regulations System GENERAL SERVICES ADMINISTRATION SPECIAL CATEGORIES OF CONTRACTING FEDERAL SUPPLY SCHEDULE CONTRACTING Establishing and Administering Federal Supply Schedules 538.271 MAS contract awards....

  3. Game Theory in AI and MAS Dongmo Zhang

    E-print Network

    Zhang, Dongmo

    Game Theory in AI and MAS Dongmo Zhang University of Western Sydney Australia 30 August 2010 Daegu, Korea Dongmo Zhang (UWS, Australia) PRICAI-10 Tutorial: GT in AI and MAS 30 August 2010 1 / 91 #12;AI that plays chess. picture from http://www.thetech.org/ Dongmo Zhang (UWS, Australia) PRICAI-10 Tutorial: GT

  4. MAS275 Probability Modelling Example 21: Dr Jonathan Jordan

    E-print Network

    Jordan, Jonathan

    MAS275 Probability Modelling Example 21: Monopoly Dr Jonathan Jordan School of Mathematics;Monopoly simplified Board game with 40 "squares", which we will number 0 to 39 (or 1 to 40). Most are labelled with a street or other location. Dr Jonathan Jordan MAS275 Probability Modelling #12;Monopoly

  5. Small NMR biomolecular sensors

    NASA Astrophysics Data System (ADS)

    Sun, Nan; Liu, Yong; Qin, Ling; Lee, Hakho; Weissleder, Ralph; Ham, Donhee

    2013-06-01

    By combining the physics of nuclear magnetic resonance (NMR) and silicon radio-frequency (RF) integrated circuits, we recently created progressively smaller NMR systems, which we originally reported in Refs. [1-4]. Our strategy for NMR system miniaturization proved effective, culminating in the smallest prototype [3,4] that weighs 0.1 kg and can be held at the palm of the hand. These small, low-cost NMR systems can be useful as biomolecular sensors in the personalized medicine setting, and we demonstrated their ability to detect proteins, compounds, and human cancer cells. The present paper, which is not a new technical contribution, reviews these developments.

  6. Solid State NMR Studies of the Aluminum Hydride Phases

    NASA Technical Reports Server (NTRS)

    Hwang, Son-Jong; Bowman, R. C., Jr.; Graetz, Jason; Reilly, J. J.

    2006-01-01

    Several solid state NMR techniques including magic-angle-spinning (MAS) and multiple-quantum (MQ) MAS experiments have been used to characterize various AlH3 samples. MAS-NMR spectra for the 1H and 27Al nuclei have been obtained on a variety of AlH3 samples that include the (beta)- and (gamma)- phases as well as the most stable (alpha)-phase. While the dominant components in these NMR spectra correspond to the aluminum hydride phases, other species were found that include Al metal, molecular hydrogen (H2), as well as peaks that can be assigned to Al-O species in different configurations. The occurrence and concentration of these extraneous components are dependent upon the initial AlH3 phase composition and preparation procedures. Both the (beta)-AlH3 and (gamma)-AlH3 phases were found to generate substantial amounts of Al metal when the materials were stored at room temperature while the (alpha)-phase materials do not exhibit these changes.

  7. Please direct questions or requests for HR service to the appropriate HR staff member listed below. HR Director

    E-print Network

    Management Capital Planning & Project Mgmt. Auxiliary Services Addressing & Mailing Bindery Bookstores Campus Grievance Assistance Facilities Management Central Services St. Paul District Energy Management West Bank District East Bank District Health Sciences District Central Services­ IPM HR Departmental Information

  8. The LEECH Exoplanet Imaging Survey. Further constraints on the planet architecture of the HR 8799 system

    NASA Astrophysics Data System (ADS)

    Maire, A.-L.; Skemer, A. J.; Hinz, P. M.; Desidera, S.; Esposito, S.; Gratton, R.; Marzari, F.; Skrutskie, M. F.; Biller, B. A.; Defrère, D.; Bailey, V. P.; Leisenring, J. M.; Apai, D.; Bonnefoy, M.; Brandner, W.; Buenzli, E.; Claudi, R. U.; Close, L. M.; Crepp, J. R.; De Rosa, R. J.; Eisner, J. A.; Fortney, J. J.; Henning, T.; Hofmann, K.-H.; Kopytova, T. G.; Males, J. R.; Mesa, D.; Morzinski, K. M.; Oza, A.; Patience, J.; Pinna, E.; Rajan, A.; Schertl, D.; Schlieder, J. E.; Su, K. Y. L.; Vaz, A.; Ward-Duong, K.; Weigelt, G.; Woodward, C. E.

    2015-04-01

    Context. Astrometric monitoring of directly imaged exoplanets allows the study of their orbital parameters and system architectures. Because most directly imaged planets have long orbital periods (>20 AU), accurate astrometry is challenging when based on data acquired on timescales of a few years and usually with different instruments. The LMIRCam camera on the Large Binocular Telescope is being used for the LBT Exozodi Exoplanet Common Hunt (LEECH) survey to search for and characterize young and adolescent exoplanets in L' band (3.8 ?m), including their system architectures. Aims: We first aim to provide a good astrometric calibration of LMIRCam. Then, we derive new astrometry, test the predictions of the orbital model of 8:4:2:1 mean motion resonance proposed for the system, and perform new orbital fitting of the HR 8799 bcde planets. We also present deep limits on a putative fifth planet inside the known planets. Methods: We use observations of HR 8799 and the ?1 Ori C field obtained during the same run in October 2013. Results: We first characterize the distortion of LMIRCam. We determine a platescale and a true north orientation for the images of 10.707 ± 0.012 mas/pix and -0.430 ± 0.076°, respectively. The errors on the platescale and true north orientation translate into astrometric accuracies at a separation of 1'' of 1.1 mas and 1.3 mas, respectively. The measurements for all planets agree within 3? with a predicted ephemeris. The orbital fitting based on the new astrometric measurements favors an architecture for the planetary system based on 8:4:2:1 mean motion resonance. The detection limits allow us to exclude a fifth planet slightly brighter or more massive than HR 8799 b at the location of the 2:1 resonance with HR 8799 e (~9.5 AU) and about twice as bright as HR 8799 cde at the location of the 3:1 resonance with HR 8799 e (~7.5 AU). The LBT is an international collaboration among institutions in the United States, Italy, and Germany. LBT Corporation partners are: The University of Arizona on behalf of the Arizona university system; Istituto Nazionale di Astrofisica, Italy; LBT Beteiligungsgesellschaft, Germany, representing the Max-Planck Society, the Astrophysical Institute Potsdam, and Heidelberg University; The Ohio State University, and The Research Corporation, on behalf of The University of Notre Dame, University of Minnesota, and University of Virginia.

  9. NMR logging apparatus

    DOEpatents

    Walsh, David O; Turner, Peter

    2014-05-27

    Technologies including NMR logging apparatus and methods are disclosed. Example NMR logging apparatus may include surface instrumentation and one or more downhole probes configured to fit within an earth borehole. The surface instrumentation may comprise a power amplifier, which may be coupled to the downhole probes via one or more transmission lines, and a controller configured to cause the power amplifier to generate a NMR activating pulse or sequence of pulses. Impedance matching means may be configured to match an output impedance of the power amplifier through a transmission line to a load impedance of a downhole probe. Methods may include deploying the various elements of disclosed NMR logging apparatus and using the apparatus to perform NMR measurements.

  10. RHODOPSIN-LIPID INTERACTIONS STUDIED BY NMR

    PubMed Central

    Soubias, Olivier; Gawrisch, Klaus

    2012-01-01

    The biophysical properties of the lipid matrix are known to influence function of integral membrane proteins. We report on a sample preparation method for reconstitution of membrane proteins which uses porous anodic aluminum oxide (AAO) filters with 200 nm-wide pores of high density. The substrate permits formation of tubular, single membranes that line the inner surface of pores. One square centimeter of filter with a thickness of 60 ?m yields on the order of 500 cm2 of solid-supported single bilayer surface, sufficient for NMR studies. The tubular bilayers are free of detergent, fully hydrated and accessible for ligands from one side of the membrane. The use of AAO filters greatly improves reproducibility of the reconstitution process such that the influence of protein on lipid order parameters can be studied with high resolution. As an example, results for the G protein-coupled receptor of class A, bovine rhodopsin, are shown. By 2H NMR order parameter measurements it is detected that rhodopsin insertion elastically deforms membranes near the protein. Furthermore, by 1H saturation-transfer NMR under conditions of magic-angle spinning (MAS), we demonstrate detection of preferences in interactions of rhodopsin with particular lipid species. It is assumed that function of integral membrane proteins depends on both protein-induced elastic deformations of the lipid matrix and preferences for interaction of the protein with particular lipid species in the first layer of lipids surrounding the protein. PMID:23374188

  11. Resolution and Polarization Distribution in Cryogenic DNP/MAS Experiments

    E-print Network

    Barnes, Alexander

    This contribution addresses four potential misconceptions associated with high-resolution dynamic nuclear polarization/magic angle spinning (DNP/MAS) experiments. First, spectral resolution is not generally compromised at ...

  12. Phosphorus NMR of isolated perfused morris hepatomas

    SciTech Connect

    Graham, R.A.; Meyer, R.A.; Brown, T.R.; Sauer, L.A.

    1986-03-05

    The authors are developing techniques for the study of perfused solid tumors by NMR. Tissue-isolated solid hepatomas were grown to 1-2 cm diameter as described previously. The arterial supply was isolated and the tumors perfused (0.5 - 1.0 ml/min) in vitro at 25 C with a 15% suspension of red blood cells in Krebs-Henseliet solution. /sup 31/P-NMR spectra were acquired at 162 MHz in a specially-designed NMR probe using a solenoidal coil. Intracellular pH (monitored from the chemical shift of inorganic phosphate) and ATP levels were stable for up to 6 hrs during perfusion. During 30 min of global ischemia, ATP decreased by 75% and pH fell from 7.0 to 6.7. These changes were reversed by 1 hr reperfusion. In addition to ATP and phosphate, the spectra included a large resonance due to phosphomonoesters, as well as peaks consistent with glycerylphosphocholine, glyceryl-phosphoethanolamine, phosphocreatine, NAD, and UDPG. However, the most novel feature of the spectra was the presence of an unidentified peak in the phosphonate region (+ 16.9 ppm). The peak was not present in spectra of muscle, liver, brain, kidney, or fat tissues excised from the same animals. They are presently attempting to identify the compound that gives rise to this peak and to establish its metabolic origin.

  13. 1H and 13C Solid-state NMR of G. barbadense (Pima) Cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The interaction of water with cellulose and its influence on the nuclear spin dynamics in G. barbadense (Pima) cotton were investigated with 1H and 13C solid-state NMR techniques. 1H spin diffusion results from a Goldman-Shen experiment indicate that the water is multilayered. 1H MAS experiment...

  14. 1H and 13C Solid-state NMR of Gossypium barbadense (Pima) Cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The interaction of water with cellulose and its influence on the nuclear spin dynamics in G. barbadense (Pima) cotton were investigated by 1H and 13C solid-state NMR techniques. 1H spin diffusion results from a Goldman-Shen experiment indicate that the water is multilayered. 1H MAS experiments pro...

  15. Solid State FT-IR and (31)P NMR Spectral Features of Phosphate Compounds

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Solid-state spectroscopic techniques, including Fourier transform infrared (FT-IR) and solid-state 31P magic angle spinning nuclear magnetic resonance (MAS NMR) spectroscopies, are powerful tools for evaluating metal speciation and transformation mechanisms of P compounds in the environment. Studie...

  16. Endothelin-1 downregulates Mas receptor expression in human cardiomyocytes.

    PubMed

    Chen, Zhiheng; Tang, Yamei; Yang, Zuocheng; Liu, Shaojun; Liu, Yong; Li, Yan; He, Wei

    2013-09-01

    Endothelin-1 (ET-1) and the renin-angiotensin system (RAS) are involved in the pathogenesis of cardiac dysfunction. The Mas receptor is a functional binding site for angiotensin (Ang)?(1-7), which is now considered a critical component of the RAS and exerts cardioprotective effects. To the best of our knowledge, the present study aimed to examine, for the first time, the effects of ET-1 on Mas expression in cultured human cardiomyocytes. Human cardiomyocytes were treated with ET-1 at different concentrations (1, 5, 10, 20 and 30 nM) for varied time periods (0.5, 1.5, 3, 4.5 or 6 h) with or without the transcription inhibitor actinomycin D, endothelin A (ETA) receptor blocker BQ123 and ETB receptor blocker BQ788, or different kinase inhibitors. ET-1 decreased the Mas mRNA level in a statistically significant dose- and time-dependent manner within 4.5 h, which was reflected in the dose-dependent downregulation of Mas promoter activity, Mas protein levels and Ang-(1-7) binding on the cell membrane. Actinomycin D (1 mg/ml), BQ123 (1 µM), p38 mitogen-activated protein kinase (MAPK) siRNA and inhibitor PD169316 (25 µM), completely eliminated the inhibitory effects of ET-1 on Mas expression in human cardiomyocytes. In conclusion, the present study demonstrated that ET-1 downregulates Mas expression at the transcription level in human cardiomyocytes via the ETA receptor by a p38 MAPK?dependent mechanism. This study provides novel insights into the function of ET-1 and the Ang?(1-7)/Mas axis in cardiac pathophysiology. PMID:23836146

  17. Bulk magnetization and 1H NMR spectra of magnetically heterogeneous model systems

    SciTech Connect

    Levin, E. M.; Bud' ko, S. L.

    2011-04-28

    Bulk magnetization and {sup 1}H static and magic angle spinning (MAS) nuclear magnetic resonance (NMR) spectra of two magnetically heterogeneous model systems based on laponite (LAP) layered silicate or polystyrene (PS) with low and high proton concentration, respectively, and ferrimagnetic Fe{sub 2}O{sub 3} nano- or micro-particles have been studied. In LAP+Fe{sub 2}O{sub 3}, a major contribution to the NMR signal broadening is due to the dipolar coupling between the magnetic moments of protons and magnetic particles. In PS+Fe{sub 2}O{sub 3}, due to the higher proton concentration in polystyrene and stronger proton–proton dipolar coupling, an additional broadening is observed, i.e. {sup 1}H MAS NMR spectra of magnetically heterogeneous systems are sensitive to both proton–magnetic particles and proton–proton dipolar couplings. An increase of the volume magnetization by ?1 emu/cm{sup 3} affects the {sup 1}H NMR signal width in a way that is similar to an increase of the proton concentration by ?2×10{sup 22}/cm{sup 3}. {sup 1}H MAS NMR spectra, along with bulk magnetization measurements, allow the accurate determination of the hydrogen concentration in magnetically heterogeneous systems.

  18. NMR quantum information processing

    E-print Network

    Dawei Lu; Aharon Brodutch; Jihyun Park; Hemant Katiyar; Tomas Jochym-O'Connor; Raymond Laflamme

    2015-01-07

    Quantum computing exploits fundamentally new models of computation based on quantum mechanical properties instead of classical physics, and it is believed that quantum computers are able to dramatically improve computational power for particular tasks. At present, nuclear magnetic resonance (NMR) has been one of the most successful platforms amongst all current implementations. It has demonstrated universal controls on the largest number of qubits, and many advanced techniques developed in NMR have been adopted to other quantum systems successfully. In this review, we show how NMR quantum processors can satisfy the general requirements of a quantum computer, and describe advanced techniques developed towards this target. Additionally, we review some recent NMR quantum processor experiments. These experiments include benchmarking protocols, quantum error correction, demonstrations of algorithms exploiting quantum properties, exploring the foundations of quantum mechanics, and quantum simulations. Finally we summarize the concepts and comment on future prospects.

  19. The thymus of the hairless rhino-j (hr/hr-j) mice

    PubMed Central

    SAN JOSE, I.; GARCÍA-SUÁREZ, O.; HANNESTAD, J.; CABO, R.; GAUNA, L.; REPRESA, J.; VEGA, J. A.

    2001-01-01

    The hairless (hr) gene is expressed in a large number of tissues, primarily the skin, and a mutation in the hr gene is responsible for the typical cutaneous phenotype of hairless mice. Mutant hr mouse strains show immune defects involving especially T cells and macrophages, as well as an age-related immunodeficiency and an accelerated atrophy of the thymus. These data suggest that the hr mutation causes a defect of this organ, although hr transcripts have not been detected in fetal or adult mice thymus. The present study analyses the thymus of young (3 mo) and adult (9 mo) homozygous hr-rh-j mice (a strain of hairless mice) by means of structural techniques and immunohistochemistry to selectively identify thymic epithelial cells, dendritic cells, and macrophages. There were structural alterations in the thymus of both young and adult rh-rh-j mice, which were more severe in older animals. These alterations consisted of relative cortical atrophy, enlargement of blood vessels, proliferation of perivascular connective tissue, and the appearance of cysts. hr-rh-j mice also showed a decrease in the number of epithelial and dendritic cells, and macrophages. Taken together, present results strongly suggest degeneration and accelerated age-dependent regression of the thymus in hr-rh-j mice, which could explain at least in part the immune defects reported in hairless mouse strains. PMID:11327202

  20. Closed-cycle cold helium magic-angle spinning for sensitivity-enhanced multi-dimensional solid-state NMR

    NASA Astrophysics Data System (ADS)

    Matsuki, Yoh; Nakamura, Shinji; Fukui, Shigeo; Suematsu, Hiroto; Fujiwara, Toshimichi

    2015-10-01

    Magic-angle spinning (MAS) NMR is a powerful tool for studying molecular structure and dynamics, but suffers from its low sensitivity. Here, we developed a novel helium-cooling MAS NMR probe system adopting a closed-loop gas recirculation mechanism. In addition to the sensitivity gain due to low temperature, the present system has enabled highly stable MAS (vR = 4-12 kHz) at cryogenic temperatures (T = 35-120 K) for over a week without consuming helium at a cost for electricity of 16 kW/h. High-resolution 1D and 2D data were recorded for a crystalline tri-peptide sample at T = 40 K and B0 = 16.4 T, where an order of magnitude of sensitivity gain was demonstrated versus room temperature measurement. The low-cost and long-term stable MAS strongly promotes broader application of the brute-force sensitivity-enhanced multi-dimensional MAS NMR, as well as dynamic nuclear polarization (DNP)-enhanced NMR in a temperature range lower than 100 K.

  1. Closed-cycle cold helium magic-angle spinning for sensitivity-enhanced multi-dimensional solid-state NMR.

    PubMed

    Matsuki, Yoh; Nakamura, Shinji; Fukui, Shigeo; Suematsu, Hiroto; Fujiwara, Toshimichi

    2015-10-01

    Magic-angle spinning (MAS) NMR is a powerful tool for studying molecular structure and dynamics, but suffers from its low sensitivity. Here, we developed a novel helium-cooling MAS NMR probe system adopting a closed-loop gas recirculation mechanism. In addition to the sensitivity gain due to low temperature, the present system has enabled highly stable MAS (vR=4-12kHz) at cryogenic temperatures (T=35-120K) for over a week without consuming helium at a cost for electricity of 16kW/h. High-resolution 1D and 2D data were recorded for a crystalline tri-peptide sample at T=40K and B0=16.4T, where an order of magnitude of sensitivity gain was demonstrated versus room temperature measurement. The low-cost and long-term stable MAS strongly promotes broader application of the brute-force sensitivity-enhanced multi-dimensional MAS NMR, as well as dynamic nuclear polarization (DNP)-enhanced NMR in a temperature range lower than 100K. PMID:26302269

  2. Fast automated protein NMR data collection and assignment by ADAPT-NMR on Bruker spectrometers

    NASA Astrophysics Data System (ADS)

    Lee, Woonghee; Hu, Kaifeng; Tonelli, Marco; Bahrami, Arash; Neuhardt, Elizabeth; Glass, Karen C.; Markley, John L.

    2013-11-01

    ADAPT-NMR (Assignment-directed Data collection Algorithm utilizing a Probabilistic Toolkit in NMR) supports automated NMR data collection and backbone and side chain assignment for [U-13C, U-15N]-labeled proteins. Given the sequence of the protein and data for the orthogonal 2D 1H-15N and 1H-13C planes, the algorithm automatically directs the collection of tilted plane data from a variety of triple-resonance experiments so as to follow an efficient pathway toward the probabilistic assignment of 1H, 13C, and 15N signals to specific atoms in the covalent structure of the protein. Data collection and assignment calculations continue until the addition of new data no longer improves the assignment score. ADAPT-NMR was first implemented on Varian (Agilent) spectrometers [A. Bahrami, M. Tonelli, S.C. Sahu, K.K. Singarapu, H.R. Eghbalnia, J.L. Markley, PLoS One 7 (2012) e33173]. Because of broader interest in the approach, we present here a version of ADAPT-NMR for Bruker spectrometers. We have developed two AU console programs (ADAPT_ORTHO_run and ADAPT_NMR_run) that run under TOPSPIN Versions 3.0 and higher. To illustrate the performance of the algorithm on a Bruker spectrometer, we tested one protein, chlorella ubiquitin (76 amino acid residues), that had been used with the Varian version: the Bruker and Varian versions achieved the same level of assignment completeness (98% in 20 h). As a more rigorous evaluation of the Bruker version, we tested a larger protein, BRPF1 bromodomain (114 amino acid residues), which yielded an automated assignment completeness of 86% in 55 h. Both experiments were carried out on a 500 MHz Bruker AVANCE III spectrometer equipped with a z-gradient 5 mm TCI probe. ADAPT-NMR is available at http://pine.nmrfam.wisc.edu/ADAPT-NMR in the form of pulse programs, the two AU programs, and instructions for installation and use.

  3. Variable stars across the observational HR diagram

    E-print Network

    Laurent Eyer; Nami Mowlavi

    2007-12-21

    An overview of pulsating variable stars across the observational Hertzprung-Russel (HR) diagram is presented, together with a summary of their global properties. The HR diagram is presented with a third colour-coded dimension, visualizing the fraction of variable, the amplitude of variability or the period of variability. The distribution of variable stars in the other observational diagrams, such as the Period-Amplitude diagram, is also presented. Some of the progresses performed in the field of variable stars during the last decade are briefly summarized, and future projects that will improve our knowledge of variable stars are mentioned.

  4. Magic-Angle-Spinning NMR of the Drug Resistant S31N M2 Proton Transporter from Influenza A

    E-print Network

    Chou, James

    Magic-Angle-Spinning NMR of the Drug Resistant S31N M2 Proton Transporter from Influenza A Loren B of the drug-resistant S31N mutant of M218-60 determined using 3D magic-angle-spinning (MAS) NMR spectra addition of the inhibitor rimantadine, suggesting that the drug does not bind to S31N M2. The M2 proton

  5. Solid-state NMR characterization of Mowry Formation shales

    SciTech Connect

    Miknis, F.P.

    1992-04-01

    Solid-state [sup 13]C and [sup 29]Si NMR measurements were carried out on a series of petroleum source rocks from the Mowry Formation of the Powder River Basin in Wyoming. The objectives of this study wereto use CP/MAS [sup 13]C NMR measurements to monitor changes in the carbon structure of the kerogen that result from depth of burial, and to examine the feasibility of [sup 29]Si NMR for studying the thermal alteration of clay minerals during diagenesis. Carbon and silicon NMR measurements were made on a suite of samples covering a present-day depth interval of 3,000 to 11,500 ft.In general, the NMR results endorsed other geochemical analyses that were performed on the source rocks as part of another study to examine pressure compartmentalization in the Mowry Formation. The carbon aromaticity of the kerogen increased with depth of burial, and at depths greater that approximately 10,000 ft the kerogen showed little capacity to generate additional oil because of the small fraction of residual aliphatic carbon. By combining NMR and Rock-Eval measurements, an estimate of the hydrogen budget was obtained. The calculations indicated that approximately 20% of the kerogen was converted to hydrocarbons, and that sufficient hydrogen was liberated from aromatization and condensation reactions to stabilize the generated products. The [sup 29]Si NMR spectra were characterized by a relatively sharp quartz resonance and a broad resonance from the clay minerals. With increasing depth of burial, the clay resonance became broader and shifted slightly downfield. These changes qualitatively support X-ray analysis that shows progressive alteration of illite to smectite with depth of burial.

  6. Solid-state NMR characterization of Mowry Formation shales

    SciTech Connect

    Miknis, F.P.

    1992-04-01

    Solid-state {sup 13}C and {sup 29}Si NMR measurements were carried out on a series of petroleum source rocks from the Mowry Formation of the Powder River Basin in Wyoming. The objectives of this study wereto use CP/MAS {sup 13}C NMR measurements to monitor changes in the carbon structure of the kerogen that result from depth of burial, and to examine the feasibility of {sup 29}Si NMR for studying the thermal alteration of clay minerals during diagenesis. Carbon and silicon NMR measurements were made on a suite of samples covering a present-day depth interval of 3,000 to 11,500 ft.In general, the NMR results endorsed other geochemical analyses that were performed on the source rocks as part of another study to examine pressure compartmentalization in the Mowry Formation. The carbon aromaticity of the kerogen increased with depth of burial, and at depths greater that approximately 10,000 ft the kerogen showed little capacity to generate additional oil because of the small fraction of residual aliphatic carbon. By combining NMR and Rock-Eval measurements, an estimate of the hydrogen budget was obtained. The calculations indicated that approximately 20% of the kerogen was converted to hydrocarbons, and that sufficient hydrogen was liberated from aromatization and condensation reactions to stabilize the generated products. The {sup 29}Si NMR spectra were characterized by a relatively sharp quartz resonance and a broad resonance from the clay minerals. With increasing depth of burial, the clay resonance became broader and shifted slightly downfield. These changes qualitatively support X-ray analysis that shows progressive alteration of illite to smectite with depth of burial.

  7. MAS2-8 radar and digital control unit

    NASA Technical Reports Server (NTRS)

    Oberg, J. M.; Ulaby, F. T.

    1974-01-01

    The design of the MAS 2-8 (2 to 8 GHz microwave-active spectrometer), a ground-based sensor system, is presented. A major modification in 1974 to the MAS 2-8, that of a control subsystem to automate the data-taking operation, is the prime focus. The digital control unit automatically changes all system parameters except FM rate and records the return signal on paper tape. The overall system operation and a detailed discussion of the design and operation of the digital control unit are presented.

  8. NMR imaging microscopy

    SciTech Connect

    Not Available

    1986-10-01

    In the past several years, proton nuclear magnetic resonance (NMR) imaging has become an established technique in diagnostic medicine and biomedical research. Although much of the work in this field has been directed toward development of whole-body imagers, James Aguayo, Stephen Blackband, and Joseph Schoeninger of the Johns Hopkins University School of Medicine working with Markus Hintermann and Mark Mattingly of Bruker Medical Instruments, recently developed a small-bore NMR microscope with sufficient resolution to image a single African clawed toad cell (Nature 1986, 322, 190-91). This improved resolution should lead to increased use of NMR imaging for chemical, as well as biological or physiological, applications. The future of NMR microscopy, like that of many other newly emerging techniques, is ripe with possibilities. Because of its high cost, however, it is likely to remain primarily a research tool for some time. ''It's like having a camera,'' says Smith. ''You've got a way to look at things at very fine levels, and people are going to find lots of uses for it. But it is a very expensive technique - it costs $100,000 to add imaging capability once you have a high-resolution NMR, which itself is at least a $300,000 instrument. If it can answer even a few questions that can't be answered any other way, though, it may be well worth the cost.''

  9. THE CHARA ARRAY ANGULAR DIAMETER OF HR 8799 FAVORS PLANETARY MASSES FOR ITS IMAGED COMPANIONS

    SciTech Connect

    Baines, Ellyn K.; White, Russel J.; Jones, Jeremy; Boyajian, Tabetha; McAlister, Harold A.; Ten Brummelaar, Theo A.; Turner, Nils H.; Sturmann, Judit; Sturmann, Laszlo; Goldfinger, P. J.; Farrington, Christopher D.; Riedel, Adric R.; Huber, Daniel; Ireland, Michael; Von Braun, Kaspar; Ridgway, Stephen T.

    2012-12-10

    HR 8799 is an hF0 mA5 {gamma} Doradus-, {lambda} Bootis-, Vega-type star best known for hosting four directly imaged candidate planetary companions. Using the CHARA Array interferometer, we measure HR 8799's limb-darkened angular diameter to be 0.342 {+-} 0.008 mas (an error of only 2%). By combining our measurement with the star's parallax and photometry from the literature, we greatly improve upon previous estimates of its fundamental parameters, including stellar radius (1.44 {+-} 0.06 R{sub Sun }), effective temperature (7193 {+-} 87 K, consistent with F0), luminosity (5.05 {+-} 0.29 L{sub Sun }), and the extent of the habitable zone (HZ; 1.62-3.32 AU). These improved stellar properties permit much more precise comparisons with stellar evolutionary models, from which a mass and age can be determined, once the metallicity of the star is known. Considering the observational properties of other {lambda} Bootis stars and the indirect evidence for youth of HR 8799, we argue that the internal abundance, and what we refer to as the effective abundance, is most likely near solar. Finally, using the Yonsei-Yale evolutionary models with uniformly scaled solar-like abundances, we estimate HR 8799's mass and age considering two possibilities: 1.516{sup +0.038}{sub -0.024} M{sub Sun} and 33{sup +7}{sub -13.2} Myr if the star is contracting toward the zero-age main sequence or 1.513{sup +0.023}{sub -0.024} M{sub Sun} and 90{sup +381}{sub -50} Myr if it is expanding from it. This improved estimate of HR 8799's age with realistic uncertainties provides the best constraints to date on the masses of its orbiting companions, and strongly suggests they are indeed planets. They nevertheless all appear to orbit well outside the HZ of this young star.

  10. Yellow Hypergiants: A Comparative Study of HR 5171A, Rho Cas, and HR 8752

    NASA Astrophysics Data System (ADS)

    Lobel, A.; de Jager, C.; Nieuwenhuijzen, H.; van Genderen, A. M.; Oudmaijer, R.

    2015-12-01

    We present a comparative study of the detailed spectroscopic variability of selected Fe i absorption lines observed between 1991 and 1995 in the optical spectra of the bright yellow hypergiants HR 5171A and Rho Cas. We also compare with the high-resolution spectrum of HR 8752. The three cool hypergiants reveal broad lines with very similar shapes. The variations with time in the line shapes and depths of HR 5171A and Rho Cas are very similar. The spectroscopic variability is caused by quasi-periodic atmospheric pulsations that strongly correlates with the observed radial velocity and V-brightness changes.

  11. High Resolution Magic Angle Spinning 1H-NMR Metabolic Profiling of Nanoliter Biological Tissues at High Magnetic Field

    SciTech Connect

    Feng, Ju; Hu, Jian Z.; Burton, Sarah D.; Hoyt, David W.

    2013-03-05

    It is demonstrated that a high resolution magic angle spinning 1H-NMR spectrum of biological tissue samples with volumes as small as 150 nanoliters, or 0.15 mg in weight, can be acquired in a few minutes at 21.1 T magnetic field using a commercial 1.6 mm fast-MAS probe with minor modification of the MAS rotor. The strategies of sealing the samples inside the MAS rotor to avoid fluid leakage as well as the ways of optimizing the signal to noise are discussed.

  12. 31P Solid-state NMR based monitoring of permeation of cell penetrating peptides into skin

    PubMed Central

    Desai, Pinaki R.; Cormier, Ashley R.; Shah, Punit P.; Patlolla, Ram R.; Paravastu, Anant K.; Singh, Mandip

    2013-01-01

    The main objective of the current study was to investigate penetration of cell penetrating peptides (CPPs: TAT, R8, R11 and YKA) through skin intercellular lipids using 31P magic angle spinning (MAS) solid-state NMR. In vitro skin permeation studies were performed on rat skin, sections (0–60, 61–120 and 121–180 µm) were collected and analyzed for 31P NMR signal. The concentration dependent shift of 0, 25, 50, 100 and 200 mg/ml of TAT on skin layers, diffusion of TAT, R8, R11 and YKA in the skin and time dependent permeation of R11 was measured on various skin sections using 31P solid-state NMR. Further, CPPs and CPP-tagged fluorescent dye encapsulate liposomes (FLip) in skin layers were tagged using confocal microscopy. The change in 31P NMR chemical shift was found to depend monotonically on the amount of CPP applied on skin, with saturation behavior above 100 mg/ml CPP concentration. R11 and TAT caused more shift in solid-state NMR peaks compared to other peptides. Furthermore, NMR spectra showed R11 penetration up to 180 µm within 30 min. The results of the solid-state NMR study were in agreement with confocal microscopy studies. Thus, 31P solid-state NMR can be used to track CPP penetration into different skin layers. PMID:23702274

  13. VINCI-VLTI measurements of HR 4049: the physical size of the circumbinary envelope

    E-print Network

    Simone Antoniucci; Francesco Paresce; Markus Wittkowski

    2004-11-05

    We present the first detection of the envelope which surrounds the post-AGB binary source HR 4049. VINCI-VLTI K-band interferometric observations of this source imply the existence of a large structure with a Gaussian angular FWHM 22.4 +/- 1.4 mas or uniform disk diameter of 34.9 +/- 1.9 mas. With the Hipparcos parallax of 1.50 +/- 0.64 mas these values correspond to a physical size of 14.9 (+11.1,-4.4) AU and 23.3 (+17.3,-7.0) AU, respectively. Our measurements, covering an azimuth range of about 60 degrees, for the sky-projected baseline, provide information on the geometry of the emitting region and show that there is only a slight variation of the measured angular values along the different directions sampled. Thus, our results are consistent with a spherical geometry of the envelope. However, we cannot completely rule out the existence of an asymmetric envelope (like the circumbinary disk envisaged by some recent models) because of the limited spatial frequency and azimuth range covered by the observations.

  14. Resolution and polarization distribution in cryogenic DNP/MAS experiments

    PubMed Central

    Barnes, Alexander B.; Corzilius, Björn; Mak-Jurkauskas, Melody L.; Andreas, Loren B.; Bajaj, Vikram S.; Matsuki, Yoh; Belenky, Marina L.; Lugtenburg, Johan; Sirigiri, Jagadishwar R.; Temkin, Richard J.; Herzfeld, Judith; Griffin, Robert G.

    2014-01-01

    This contribution addresses four potential misconceptions associated with high-resolution dynamic nuclear polarization/magic angle spinning (DNP/MAS) experiments. First, spectral resolution is not generally compromised at the cryogenic temperatures at which DNP experiments are performed. As we demonstrate at a modest field of 9 T (380 MHz 1H), 1 ppm linewidths are observed in DNP/MAS spectra of a membrane protein in its native lipid bilayer, and <0.4 ppm linewidths are reported in a crystalline peptide at 85 K. Second, we address the concerns about paramagnetic broadening in DNP/MAS spectra of proteins by demonstrating that the exogenous radical polarizing agents utilized for DNP are distributed in the sample in such a manner as to avoid paramagnetic broadening and thus maintain full spectral resolution. Third, the enhanced polarization is not localized around the polarizing agent, but rather is effectively and uniformly dispersed throughout the sample, even in the case of membrane proteins. Fourth, the distribution of polarization from the electron spins mediated via spin diffusion between 1H–1H strongly dipolar coupled spins is so rapid that shorter magnetization recovery periods between signal averaging transients can be utilized in DNP/MAS experiments than in typical experiments performed at ambient temperature. PMID:20454732

  15. Juntos, ms fuertes, mas lejos... Toulouse Midi-Pyrenees

    E-print Network

    Bordenave, Charles

    un mismo espacio geográfico para comprender mejor el mundo y darse los medios tecnológicos y humanos proyectos : colaboraciones mas elaboradas con las empresas y el poder público, una acogida optimizada de los nuestra sociedad : calidad y futuro del medio ambiente, riesgos naturales e industriales, biodiversidad

  16. Marker assisted selection (MAS) for breeding high oleic Tifguard

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tifguard, a peanut cultivar released in 2007, has near immunity to root-knot nematode and high resistance to TSWV. However, its oil composition is within the normal O/L range. Pyramiding the disease resistant traits of ‘Tifguard’ and the high O/L trait using MAS is our current goal for breeding. ...

  17. Resolution and polarization distribution in cryogenic DNP/MAS experiments.

    PubMed

    Barnes, Alexander B; Corzilius, Björn; Mak-Jurkauskas, Melody L; Andreas, Loren B; Bajaj, Vikram S; Matsuki, Yoh; Belenky, Marina L; Lugtenburg, Johan; Sirigiri, Jagadishwar R; Temkin, Richard J; Herzfeld, Judith; Griffin, Robert G

    2010-06-14

    This contribution addresses four potential misconceptions associated with high-resolution dynamic nuclear polarization/magic angle spinning (DNP/MAS) experiments. First, spectral resolution is not generally compromised at the cryogenic temperatures at which DNP experiments are performed. As we demonstrate at a modest field of 9 T (380 MHz (1)H), 1 ppm linewidths are observed in DNP/MAS spectra of a membrane protein in its native lipid bilayer, and <0.4 ppm linewidths are reported in a crystalline peptide at 85 K. Second, we address the concerns about paramagnetic broadening in DNP/MAS spectra of proteins by demonstrating that the exogenous radical polarizing agents utilized for DNP are distributed in the sample in such a manner as to avoid paramagnetic broadening and thus maintain full spectral resolution. Third, the enhanced polarization is not localized around the polarizing agent, but rather is effectively and uniformly dispersed throughout the sample, even in the case of membrane proteins. Fourth, the distribution of polarization from the electron spins mediated via spin diffusion between (1)H-(1)H strongly dipolar coupled spins is so rapid that shorter magnetization recovery periods between signal averaging transients can be utilized in DNP/MAS experiments than in typical experiments performed at ambient temperature. PMID:20454732

  18. IN SITU MAGIC ANGLE SPINNING NMR FOR STUDYING GEOLOGICAL CO(2) SEQUESTRATION

    SciTech Connect

    Hoyt, David W.; Turcu, Romulus VF; Sears, Jesse A.; Rosso, Kevin M.; Burton, Sarah D.; Kwak, Ja Hun; Felmy, Andrew R.; Hu, Jian Z.

    2011-03-27

    Geological carbon sequestration (GCS) is one of the most promising ways of mitigating atmospheric greenhouse gases (1-3). Mineral carbonation reactions are potentially important to the long-term sealing effectiveness of caprock but remain poorly predictable, particularly in low-water supercritical CO2 (scCO2)-dominated environments where the chemistry has not been adequately explored. In situ probes that provide molecular-level information is desirable for investigating mechanisms and rates of GCS mineral carbonation reactions. MAS-NMR is a powerful tool for obtaining detailed molecular structure and dynamics information of a system regardless whether the system is in a solid, a liquid, a gaseous, or a supercritical state, or a mixture thereof (4,5). However, MAS NMR under scCO2 conditions has never been realized due to the tremendous technical difficulties of achieving and maintaining high pressure within a fast spinning MAS rotor (6,7), where non-metal materials must be used. In this work, we report development of a unique high pressure MAS NMR capability, and its application to mineral carbonation chemistry in scCO2 under geologically relevant temperatures and pressures.

  19. Quantitative solid-state 13C NMR with signal enhancement by multiple cross polarization

    NASA Astrophysics Data System (ADS)

    Johnson, Robert L.; Schmidt-Rohr, Klaus

    2014-02-01

    A simple new method is presented that yields quantitative solid-state magic-angle spinning (MAS) 13C NMR spectra of organic materials with good signal-to-noise ratios. It achieves long (>10 ms) cross polarization (CP) from 1H without significant magnetization losses due to relaxation and with a moderate duty cycle of the radio-frequency irradiation, by multiple 1-ms CP periods alternating with 1H spin-lattice relaxation periods that repolarize the protons. The new method incorporates previous techniques that yield less distorted CP/MAS spectra, such as a linear variation (“ramp”) of the radio-frequency field strength, and it overcomes their main limitation, which is T1? relaxation of the spin-locked 1H magnetization. The ramp of the radio-frequency field strength and the asymptotic limit of cross polarization makes the spectral intensity quite insensitive to the exact field strengths used. The new multiCP pulse sequence is a “drop-in” replacement for previous CP methods and produces no additional data-processing burden. Compared to the only reliable quantitative 13C NMR method for unlabeled solids previously available, namely direct-polarization NMR, the measuring time is reduced by more than a factor of 50, enabling higher-throughput quantitative NMR studies. The new multiCP technique is validated with 14-kHz MAS on amino-acid derivatives, plant matter, a highly aromatic humic acid, and carbon materials made by low-temperature pyrolysis.

  20. Quantitative identification of metastable magnesium carbonate minerals by solid-state 13C NMR spectroscopy.

    PubMed

    Moore, Jeremy K; Surface, J Andrew; Brenner, Allison; Wang, Louis S; Skemer, Philip; Conradi, Mark S; Hayes, Sophia E

    2015-01-01

    In the conversion of CO2 to mineral carbonates for the permanent geosequestration of CO2, there are multiple magnesium carbonate phases that are potential reaction products. Solid-state (13)C NMR is demonstrated as an effective tool for distinguishing magnesium carbonate phases and quantitatively characterizing magnesium carbonate mixtures. Several of these mineral phases include magnesite, hydromagnesite, dypingite, and nesquehonite, which differ in composition by the number of waters of hydration or the number of crystallographic hydroxyl groups. These carbonates often form in mixtures with nearly overlapping (13)C NMR resonances which makes their identification and analysis difficult. In this study, these phases have been investigated with solid-state (13)C NMR spectroscopy, including both static and magic-angle spinning (MAS) experiments. Static spectra yield chemical shift anisotropy (CSA) lineshapes that are indicative of the site-symmetry variations of the carbon environments. MAS spectra yield isotropic chemical shifts for each crystallographically inequivalent carbon and spin-lattice relaxation times, T1, yield characteristic information that assist in species discrimination. These detailed parameters, and the combination of static and MAS analyses, can aid investigations of mixed carbonates by (13)C NMR. PMID:25437754

  1. The Debris Disk Around HR 8799

    E-print Network

    Su, K Y L; Stapelfeldt, K R; Malhotra, R; Bryden, G; Smith, P S; Misselt, K A; Moro-Martin, A; Williams, J P

    2009-01-01

    We have obtained a full suite of Spitzer observations to characterize the debris disk around HR 8799 and to explore how its properties are related to the recently discovered set of three massive planets orbiting the star. We distinguish three components to the debris system: (1) warm dust (T ~150 K) orbiting within the innermost planet; (2) a broad zone of cold dust (T ~45 K) with a sharp inner edge, orbiting just outside the outermost planet and presumably sculpted by it; and (3) a dramatic halo of small grains originating in the cold dust component. The high level of dynamical activity implied by this halo may arise due to enhanced gravitational stirring by the massive planets. The relatively young age of HR 8799 places it in an important early stage of development and may provide some help in understanding the interaction of planets and planetary debris, an important process in the evolution of our own solar system.

  2. THE DEBRIS DISK AROUND HR 8799

    SciTech Connect

    Su, K. Y. L.; Rieke, G. H.; Smith, P. S.; Misselt, K. A.; Stapelfeldt, K. R.; Bryden, G.; Moro-Martin, A.; Williams, J. P.

    2009-11-01

    We have obtained a full suite of Spitzer observations to characterize the debris disk around HR 8799 and to explore how its properties are related to the recently discovered set of three massive planets orbiting the star. We distinguish three components to the debris system: (1) warm dust (T approx 150 K) orbiting within the innermost planet; (2) a broad zone of cold dust (T approx 45 K) with a sharp inner edge orbiting just outside the outermost planet and presumably sculpted by it; and (3) a dramatic halo of small grains originating in the cold dust component. The high level of dynamical activity implied by this halo may arise due to enhanced gravitational stirring by the massive planets. The relatively young age of HR 8799 places it in an important early stage of development and may provide some help in understanding the interaction of planets and planetary debris, an important process in the evolution of our own solar system.

  3. Water speciation in sodium silicate glasses (quenched melts): A comprehensive NMR study

    NASA Astrophysics Data System (ADS)

    Xue, X.; Kanzaki, M.; Eguchi, J.

    2012-12-01

    Dissolution mechanism of water is an important factor governing how the dissolved water affects the physical and thermodynamic properties of silicate melts and glasses. Our previous studies have demonstrated that 1H MAS NMR in combination with 29Si-1H and 27Al-1H double-resonance NMR experiments is an effective approach for unambiguously differentiating and quantifying different water species in quenched silicate melts (glasses). Several contrasting dissolution mechanisms have been revealed depending on the melt composition: for relatively polymerized melts, the formation of SiOH/AlOH species (plus molecular H2O) and depolymerization of the network structure dominate; whereas for depolymerized Ca-Mg silicate melts, free OH (e.g. MgOH) become increasingly important (cf. [1]). The proportion of free OH species has been shown to decrease with both increasing melt polymerization (silica content) and decreasing field strength of the network modifying cations (from Mg to Ca). Our previous 1H and 29Si MAS NMR results for hydrous Na silicate glasses of limited compositions (Na2Si4O9 and Na2Si2O5) were consistent with negligible free OH (NaOH) species and depolymerizing effect of water dissolution [2]. On the other hand, there were also other studies that proposed the presence of significant NaOH species in hydrous glasses near the Na2Si2O5 composition. The purpose of this study is apply the approach of combined 1H MAS NMR and double-resonance (29Si-1H and 23Na-1H) NMR to gain unambiguous evidence for the OH speciation in Na silicate glasses (melts) as a function of composition. Hydrous Na silicate glasses containing mostly ? 1 wt% H2O for a range of Na/Si ratios from 0.33 to 1.33 have been synthesized by rapidly quenching melts either at 0.2 GPa using an internally heated gas pressure vessel or at 1 GPa using a piston cylinder high-pressure apparatus. NMR spectra have been acquired using a 9.4 T Varian Unity-Inova spectrometer. The 29Si and 1H chemical shifts are reported relative to TMS. The 1H MAS NMR spectra show broad peaks covering a chemical shift range of 1 to 17 ppm, with peak maxima near 4 and 15 ppm for more Si-rich compositions and near 12 ppm for less Si-rich compositions. The 1H-29Si-1H and 23Na-1H cross-polarization (CP) MAS NMR spectra for all the hydrous Na silicate glasses suggest negligible NaOH species, which, if present, should show enhanced relative intensity with 23Na-1H CP and the opposite with 1H-29Si-1H CP. All the observed 1H NMR intensities can be attributed to SiOH species of a range of hydrogen-bonding distances, plus a small amount of molecular H2O for higher water-content samples that contribute to intensities around 6 ppm. In conclusion, our combined 1H MAS NMR and double-resonance (1H-29Si-1H and 23Na-1H CP) MAS NMR study on Na silicate glasses of a range of Na/Si ratios has confirmed that water dissolves predominantly as SiOH and molecular H2O species in Na silicate melts (glasses), consistent with the trend predicted from studies on the Ca-Mg silicate system [1,2]. References:[1] Xue, X. Y.; Kanzaki, M. J. Am. Ceram. Soc. 2009, 92, 2803-2830. [2] Xue, X. Y.; Kanzaki, M. Geochim. Cosmochim. Acta 2004, 68, 5027-5057.

  4. HR 7275 - A new variable star

    NASA Technical Reports Server (NTRS)

    Fried, R. E.; Lovell, L. P.; Krisciunas, K.; Chamblis, C. R.; Detterline, P. K.; Landis, H. J.; Louth, H.; Eaton, J. A.; Hall, D. S.; Henry, G. W.

    1982-01-01

    Three years of photometry in V and B of the UBV system are presented to confirm the suspicion of Herbst (1973) that HR 7275 is a variable star. The photometry is used to derive the photometric period, which proves to be about 3% shorter than the spectroscopically determined optical period of 28.59 d. Total variation observed during the three years was 0.22 m in the V, and the light curve was always asymmetrical.

  5. Enabling quaternion derivatives: the generalized HR calculus

    PubMed Central

    Xu, Dongpo; Jahanchahi, Cyrus; Took, Clive C.; Mandic, Danilo P.

    2015-01-01

    Quaternion derivatives exist only for a very restricted class of analytic (regular) functions; however, in many applications, functions of interest are real-valued and hence not analytic, a typical case being the standard real mean square error objective function. The recent HR calculus is a step forward and provides a way to calculate derivatives and gradients of both analytic and non-analytic functions of quaternion variables; however, the HR calculus can become cumbersome in complex optimization problems due to the lack of rigorous product and chain rules, a consequence of the non-commutativity of quaternion algebra. To address this issue, we introduce the generalized HR (GHR) derivatives which employ quaternion rotations in a general orthogonal system and provide the left- and right-hand versions of the quaternion derivative of general functions. The GHR calculus also solves the long-standing problems of product and chain rules, mean-value theorem and Taylor's theorem in the quaternion field. At the core of the proposed GHR calculus is quaternion rotation, which makes it possible to extend the principle to other functional calculi in non-commutative settings. Examples in statistical learning theory and adaptive signal processing support the analysis. PMID:26361555

  6. Nonthermal Radio Emission and the HR Diagram

    NASA Technical Reports Server (NTRS)

    Gibson, D. M.

    1985-01-01

    Perhaps the most reliable indicator of non-radiative heating/momentum in a stellar atmosphere is the presence of nonthermal radio emission. To date, 77 normal stellar objects have been detected and identified as nonthermal sources. These stellar objects are tabulated herein. It is apparent that non-thermal radio emission is not ubiquitous across the HR diagram. This is clearly the case for the single stars; it is not as clear for the binaries unless the radio emission is associated with their late-type components. Choosing to make this association, the single stars and the late-type components are plotted together. The following picture emerges: (1) there are four locations on the HR diagram where non-thermal radio stars are found; (2) the peak incoherent 5 GHz luminosities show a suprisingly small range for stars within each class; (3) the fraction of stellar energy that escapes as radio emission can be estimated by comparing the integrated maximum radio luminosity to the bolometric luminosity; (4) there are no apparent differences in L sub R between binaries with two cool components, binaries with one hot and one cool component, and single stars for classes C and D; and (5) The late-type stars (classes B, C, and D) are located in parts of the HR diagram where there is reason to suspect that the surfaces of the stars are being braked with respect to their interiors.

  7. Instability Regions in the Upper HR Diagram

    NASA Technical Reports Server (NTRS)

    deJager, Cornelis; Lobel, Alex; Nieuwenhuijzen, Hans; Stothers, Richard; Hansen, James E. (Technical Monitor)

    2001-01-01

    The following instability regions for blueward evolving supergiants are outlined and compared: (1) Areas in the Hertzsprung-Russell(HR) diagram where stars are dynamically unstable. (2) Areas where the effective acceleration in the upper part of the photospheres is negative, hence directed outward. (3) Areas where the sonic points of the stellar wind (Where wind velocity = sound velocity) are situated inside the photospheres, at a level deeper than tau(sub Ross) = 0.01. We compare the results with the positions of actual stars in the HR diagram and we find evidence that the recent strong contraction of the yellow hypergiant HR8752 was initiated in a period during which (g(sub eff)) is less than 0, whereupon the star became dynamically unstable. The instability and extreme shells around IRC+10420 are suggested to be related to three factors: (g(sub eff)) is less than 0; the sonic point is situated inside the photosphere; and the star is dynamically unstable.

  8. Enabling quaternion derivatives: the generalized HR calculus.

    PubMed

    Xu, Dongpo; Jahanchahi, Cyrus; Took, Clive C; Mandic, Danilo P

    2015-08-01

    Quaternion derivatives exist only for a very restricted class of analytic (regular) functions; however, in many applications, functions of interest are real-valued and hence not analytic, a typical case being the standard real mean square error objective function. The recent HR calculus is a step forward and provides a way to calculate derivatives and gradients of both analytic and non-analytic functions of quaternion variables; however, the HR calculus can become cumbersome in complex optimization problems due to the lack of rigorous product and chain rules, a consequence of the non-commutativity of quaternion algebra. To address this issue, we introduce the generalized HR (GHR) derivatives which employ quaternion rotations in a general orthogonal system and provide the left- and right-hand versions of the quaternion derivative of general functions. The GHR calculus also solves the long-standing problems of product and chain rules, mean-value theorem and Taylor's theorem in the quaternion field. At the core of the proposed GHR calculus is quaternion rotation, which makes it possible to extend the principle to other functional calculi in non-commutative settings. Examples in statistical learning theory and adaptive signal processing support the analysis. PMID:26361555

  9. Benford distributions in NMR

    E-print Network

    Gaurav Bhole; Abhishek Shukla; T. S. Mahesh

    2014-06-27

    Benford's Law is an empirical law which predicts the frequency of significant digits in databases corresponding to various phenomena, natural or artificial. Although counter intuitive at the first sight, it predicts a higher occurrence of digit 1, and decreasing occurrences to other larger digits. Here we report the Benford analysis of various NMR databases and draw several interesting inferences. We observe that, in general, NMR signals follow Benford distribution in time-domain as well as in frequency domain. Our survey included NMR signals of various nuclear species in a wide variety of molecules in different phases, namely liquid, liquid-crystalline, and solid. We also studied the dependence of Benford distribution on NMR parameters such as signal to noise ratio, number of scans, pulse angles, and apodization. In this process we also find that, under certain circumstances, the Benford analysis can distinguish a genuine spectrum from a visually identical simulated spectrum. Further we find that chemical-shift databases and amplitudes of certain radio frequency pulses generated using optimal control techniques also satisfy Benford's law to a good extent.

  10. Modern NMR Spectroscopy.

    ERIC Educational Resources Information Center

    Jelinski, Lynn W.

    1984-01-01

    Discusses direct chemical information that can be obtained from modern nuclear magnetic resonance (NMR) methods, concentrating on the types of problems that can be solved. Shows how selected methods provide information about polymers, bipolymers, biochemistry, small organic molecules, inorganic compounds, and compounds oriented in a magnetic…

  11. Magic-Angle-Spinning NMR of the Drug Resistant S31N M2 Proton Transporter from Influenza A

    E-print Network

    Chou, James J.

    We report chemical shift assignments of the drug-resistant S31N mutant of M2[subscript 18–60] determined using 3D magic-angle-spinning (MAS) NMR spectra acquired with a [superscript 15]N–[superscript 13]C ZF-TEDOR transfer ...

  12. NMR Studies of Heat-Induced Transitions in Structure and Cation Binding Environments of a Strontium-Saturated Swelling Mica

    SciTech Connect

    Bowers, Geoffrey M.; Davis, Michael C.; Ravella, Ramesh; Komarneni, S.; Mueller, Karl T.

    2007-12-03

    In this work we combined Al, Si, F, and Na magic-angle spinning (MAS) nuclear magnetic resonance (NMR) to characterize the structure and interlayer cation environments in a strontium-saturated member of the swelling mica family before and after a heat induced collapse of the interlayer space.

  13. NMR in rotating magnetic fields: Magic angle field spinning

    SciTech Connect

    Sakellariou, D.; Meriles, C.; Martin, R.; Pines, A.

    2004-09-10

    Magic angle sample spinning has been one of the cornerstones in high-resolution solid state NMR. Spinning frequencies nowadays have increased by at least one order of magnitude over the ones used in the first experiments and the technique has gained tremendous popularity. It is currently a routine procedure in solid-state NMR, high-resolution liquid-state NMR and solid-state MRI. The technique enhances the spectral resolution by averaging away rank 2 anisotropic spin interactions thereby producing isotropic-like spectra with resolved chemical shifts and scalar couplings. Andrew proposed that it should be possible to induce similar effects in a static sample if the direction of the magnetic field is varied, e.g., magic-angle rotation of the B0 field (B0-MAS) and this has been recently demonstrated using electromagnetic field rotation. Here we discuss on the possibilities to perform field rotation using alternative hardware, together with spectroscopic methods to recover isotropic resolution even in cases where the field is not rotating at the magic angle. Extension to higher magnetic fields would be beneficial in situations where the physical manipulation of the sample is inconvenient or impossible. Such situations occur often in materials or biomedical samples where ''ex-situ'' NMR spectroscopy and imaging analysis is needed.

  14. NUMBER: HR 1.09 SECTION: Human Resources

    E-print Network

    Almor, Amit

    1 NUMBER: HR 1.09 SECTION: Human Resources SUBJECT: Other Leave with Pay DATE: December 2004 (REV calendar days. 2. Adoption Leave- see University HR Policy 1.06 Sick Leave 3. American Red Cross Certified

  15. MAS 305 Algebraic Structures II Notes 11 Autumn 2006

    E-print Network

    Bailey, R. A.

    MAS 305 Algebraic Structures II Notes 11 Autumn 2006 Ring homomorphisms Definition Let R and S be rings, and let :R S be a function. Then is a ring homomorphism if (r1 +r2) = r1+r2 and (r1r2) = (r1)(r2) for all r1, r2 in R. A ring homomorphism which is a bijection is called an isomorphism

  16. MAS 305 Algebraic Structures II Notes 10 Autumn 2006

    E-print Network

    Bailey, R. A.

    MAS 305 Algebraic Structures II Notes 10 Autumn 2006 Ring Theory A ring is a set R with two binary operations + and satisfying (a) (R,+) is an Abelian group; (b) R is closed under ; (c) is associative; (d) is distributive over +, which means that (a+b)c = ac+bc and c(a+b) = ca+cb for all a, b, c in R. The identity

  17. Combined 17O NMR and 11B-31P double resonance NMR studies of sodium borophosphate glasses.

    PubMed

    Zeyer-Düsterer, Michaela; Montagne, Lionel; Palavit, Gérard; Jäger, Christian

    2005-01-01

    17O enriched sodium borophosphate glasses were prepared from isotopically enriched NaPO3 and H3BO3. These glasses have been studied by 17O, 11B and 31P NMR including 17O and 11B multiple quantum magic angle sample spinning (MQMAS), 11B-31P heteronuclear correlation (HETCOR) NMR and 11B{31P} rotational echo double resonance (REDOR). For comparison, the crystalline borophosphates BPO4 and Na5B2P3O13 were included in the investigations. The latter compound shows three sharp 31P resonances at -0.2, -2 and -8 ppm and two BO4 sites that can only be resolved by MQMAS. The 17O NMR spectra were recorded using both the static echo method at medium magnetic field (9.4 T) as well as MAS and MQMAS methods at high field (17.6 T). In total, five oxygen sites were identified in these borophosphate glasses: P-O-P, Na...O-P, P-O-B, B-O-B, Na...O-B. However, these five sites are not present simultaneously in any of the glasses. The 17O MQMAS spectra prove that P-O-B links play a major role in borophosphate glasses. These results are confirmed by the complementary 11B MAS spectra that show the presence of asymmetric and symmetric trigonal groups BO3a and BO3s and two tetrahedral BO4 units. 11B{31P} REDOR NMR is used to give independent information to assign the 11B lines to structural units present in the glasses. These REDOR measurements reveal that B-O-P bonds are present for each borate unit, including the BO3 groups. Particularly, a structural proposal for the two different BO4 resonances is given in terms of a different number of bonded phosphate tetrahedra. The 31P MAS spectra are usually broad and not well resolved. It is shown by 11B-31P HETCOR NMR that a possible structural assignment of a 31P signal at about -20 ppm to Q2 units as in binary sodium phosphate glasses is wrong and that the phosphate tetrahedron belonging to this resonance must be connected to borate groups. PMID:15589727

  18. Commercial facility site selection simulating based on MAS

    NASA Astrophysics Data System (ADS)

    Chao, Yi; Li, Qingquan; Zheng, Guizhou

    2008-10-01

    The location of commercial facility decides the benefit of the operator to a large degree. Existing location methods can express the static relationships between site selection result and location factors, but there still are some limites when express the dynamic and uncertain relationship between them. Hence, a dynamic, stochastic and forecastable location model should be built which can introduce the customer's behavior into the model and combine the macro pattern and micro spatial interaction. So the authors proposes Geosim-LM based on MAS. Geosim-LM has 3 kinds of agents, CustAgent, SiteAgent and GovAgent. They represent the customers, commercial fercilities and government. The land type, land price and traffic are the model environment. Then Geosim-LM is applied in the bank branches site evaluation and selection in Liwan district, Guangzhou. In existing bank branches site evaluation, there are 70% consistent in score grade between result of Geosim-LM after 200 round runing and actual rebust location. It proves the model is reliable and feasible. The conclusions can be get from the paper. MAS have advantages in location choice than existed methods. The result of Geosim-LM running can powerfully proves that building location model based on MAS is feasible.

  19. The HR SSC in 2020: innovating traditional activities.

    E-print Network

    Vellekoop, Michel

    The HR SSC in 2020: innovating traditional activities. Author: Anne Buningh University of Twente P to increase and hence the HR SSC is expected to grow. However, in relative terms, this research has shown that the future HR SSC is predicted to increase the quantity of traditional instead of transformational activities

  20. MAGNETIC FIELDS IN THE HR DIAGRAM Jeffrey L. Linsky

    E-print Network

    Linsky, Jeffrey L.

    MAGNETIC FIELDS IN THE HR DIAGRAM Jeffrey L. Linsky JILA/University of Colorado and NIST Solar. What are the consequences of this behavior in a dynamic atmosphere? 1 A Tour Through the HR Diagram of the HR Diagram. Questions to ask during our tour: ffl What direct or indirect techniques can measure

  1. Evolution of HR Diagrams So as a cluster ages, the

    E-print Network

    Barnes, Joshua Edward

    Evolution of HR Diagrams So as a cluster ages, the main sequence `burns down' in order. lifetime Diagram to Determine the Age of a Star Cluster #12;Evolution of HR Diagrams So as a cluster ages, the main of plotting stars, we represent them with a line of constant age. Using the H-R Diagram to Determine the Age

  2. The HR Diagram of Globular Clusters: Theorist' view(s)

    E-print Network

    D'Antona, Francesca

    The HR Diagram of Globular Clusters: Theorist' view(s) F. D'Antona Osservatorio Astronomico di Roma, Italy Abstract: I list the characteristic features of Globular Cluster (GC) HR diagrams which provide by looking at the composite HR diagram of the GC NGC 6397 shown in figure 1, and illustrated in figure 2

  3. An alternative solution for computer controlled tuning and matching of existing NMR probes

    NASA Astrophysics Data System (ADS)

    Koczor, Bálint; Sedyó, Inez; Rohonczy, János

    2015-10-01

    Tuning and matching of NMR probes is necessary for many fields of NMR application including temperature dependent NMR, thermoporometry and cryoporometry, or when significantly different types of samples are measured in automation using sample changers. Mismatch of the probe is an especially critical issue in the case of high magnetic fields, polar or ionic solvents, or extreme thermal conditions. Careful tuning is particularly important for quantitative NMR measurements. Manual tuning and matching of the NMR probe is not possible in the case of automated or remotely controlled measurements. Spectrometer manufacturers offer modern probes equipped with automatic tuning/matching mechanics, like Bruker ATM™, suitable for these experiments. The disadvantages of probes with built-in ATM™ are the significantly higher price, and the non-detachable and non-portable construction. Computer controlled tuning and matching is highly desirrable in solid state NMR since no industrial solution has been developed yet for MAS NMR probes. We present an alternative solution for computer controlled tuning and matching of existing Bruker probes. Building costs are significantly lower, since only commercially available components and ICs are used.

  4. Line narrowing in H-1 MAS spectrum of mesoporous silica by removing adsorbed H2O using N-2

    SciTech Connect

    Hu, Jian Zhi; Kwak, Ja Hun; Herrera, Jose E.; Wang, Yong; Peden, Charles HF

    2005-05-01

    The peaks for silanol protons in the high resolution 1H NMR spectrum obtained on mesoporous silica materials may be broadened and shifted downfield by hydrogen bonding with absorbed water molecules. The spectrum may be further complicated by overlapping of the resonance for hydrogen-bonded silanol with the corresponding broad peak due to hydrogen-bonded water. These complications hamper a quantitative analysis of the spectra for these and similar materials. It is demonstrated in this paper that absorbed water can be removed by exposing the sample to dry N2 during magic angle spinning. This results in significantly enhanced spectral resolution for the silanol protons in the 1H MAS spectrum. The enhanced spectral resolution makes it possible to quantify the various hydroxyl groups in a complex metal-oxide catalyst. Results obtained on tungsten oxide supported on SBA-15 mesoporous silica materials are reported.

  5. 224} studied by NMR

    SciTech Connect

    Furukawa, Y; Fang, X; Kögerler, P

    2014-05-14

    7Li nuclear magnetic resonance (NMR) studies have been performed to investigate magnetic properties and spin dynamics of Mn3+ (S = 2) spins in the giant polyoxometalate molecule {Mn40W224}. The 7Li-NMR line width is proportional to the external magnetic field H as expected in a paramagnetic state above 3 K. Below this temperature the line width shows a sudden increase and is almost independent of H, which indicates freezing of the local Mn3+ spins. The temperature dependence of T1 for both 1H and 7Li reveals slow spin dynamics at low temperatures, consistent with spin freezing. The slow spin dynamics is also evidenced by the observation of a peak of 1/T2 around 3 K, where the fluctuation frequency of spins is of the order of ~200 kHz. An explicit form of the temperature dependence of the fluctuation frequency of Mn3+ spins is derived from the nuclear relaxation data.

  6. NMR Studies of Peroxidases.

    NASA Astrophysics Data System (ADS)

    Veitch, Nigel Charles

    Available from UMI in association with The British Library. Requires signed TDF. Peroxidases are a haem-containing group of enzymes with a wide diversity of function within biological systems. While a common characteristic is the ability to catalyse the conversion of hydrogen peroxide to water, it is the accompanying processes of hormone synthesis and degradation which have generated such a high level of interest. However, information at the molecular level is limited to a single well-resolved crystal structure, that of yeast cytochrome c peroxidase. This thesis presents a strategy for the investigation of peroxidase structure and function based on proton nuclear magnetic resonance spectroscopy, a technique which has the ability to address aspects of both protein structure and protein dynamics in solution. The application of one- and two-dimensional NMR techniques has been developed in the context of plant peroxidases, notably the isoenzyme HRP-C derived from the horseradish root. Characterisation of the proton NMR spectra of HRP -C in resting and ligated states provided new information enabling the structure of the binding site for aromatic donor molecules, such as indole-3-propionic, ferulic and benzhydroxamic acids, to be resolved. In order to overcome difficulties encountered with a protein of the complexity of peroxidase, additional information was obtained from chemical shift parameters and the use of peroxidase variants produced by site-directed mutagenesis. A comparative study using NMR spectroscopy was undertaken for wild-type recombinant HRP-C expressed in Escherichia coli, and two protein variants with substitutions made to residues located on the distal side of the haem pocket, Phe41 to Val and Arg38 to Lys. NMR analyses of a plant peroxidase from barley grains and the fungal peroxidase from Coprinus cinereus were also successful using methods conceived with HRP-C. Examination of three specifically constructed recombinant protein variants of C. cinereus peroxidase was essential in confirming the identity of residues participating in the aromatic donor molecule binding site of peroxidases.

  7. NMR imaging of materials

    SciTech Connect

    Vinegar, H.J.; Rothwell, W.P.

    1988-03-01

    A method for obtaining at least one petrophysical property of a porous material containing therein at least one preselected fluid, is described, comprising: NMR imaging the material to generate signals dependent upon both M(0) and T/sub 1/ and M(0) and T/sub 2/, generating separate M(0), T/sub 1/ and T/sub 2/ images from the signals, and determining at least one petrophysical property from at least one of the images.

  8. Investigations of adsorption sites on oxide surfaces using solid-state NMR and TPD-IGC

    NASA Astrophysics Data System (ADS)

    Golombeck, Rebecca A.

    The number and chemical identity of reactive sites on surfaces of glass affects the processing, reliability, and lifetime of a number of important commercial products. Surface site densities, distributions, and structural identities are closely tied to the formation and processing of the glass surface, and exert a direct influence on strength and coating performance. The surface of a glass sample may vary markedly from the composition and chemistry of the bulk glass. We are taking a physicochemical approach to understanding adsorption sites on pristine multicomponent glass fibers surfaces, directly addressing the effect of processing on surface reactivity. This project aimed to understand the energy distributions of surface adsorption sites, the chemical/structural identity of those sites, and the relationship of these glasses to glass composition, thermal history, and in future work, surface coatings. We have studied the bulk and surface structure as well as the surface reactivity of the glass fibers with solid-state nuclear magnetic resonance (NMR) spectroscopy, inverse gas chromatography (IGC), and computational chemistry methods. These methods, solid-state NMR and IGC, typically require high surface area materials; however, by using probe molecules for NMR experiments or packing a column at high density for IGC measurements, lower surface area materials, such as glass fibers, can be investigated. The glasses used within this study were chosen as representative specimens of fibers with potentially different reactive sites on their surfaces. The two glass compositions were centered around a nominal E-glass, which contains very little alkali cations and mainly alkaline earth cations, and wool glass, which contains an abundance of alkali cations. The concentration of boron was varied from 0 to 8 mole % in both fiber compositions. Fibers were drawn from each composition at a variety of temperatures and draw speeds to provide a range of glass samples with varying diameters and thermal histories. The bulk structural features in both compositions of glass fibers were identified using high-resolution 29Si, 27Al, and 11B magic-angle spinning (MAS) NMR spectroscopic measurements. In multi-component glasses, the determination of silicon, aluminum, and boron distributions becomes difficult due to the competitive nature of the network-modifying oxides among the network-forming oxides. In pure silicates, 29Si MAS NMR can often resolve resonances arising from silicate tetrahedron having varying numbers of bridging oxygens. In aluminoborosilicate glasses, aluminum is present in four-, five-, and six- coordination with oxygen as neighbors. The speciation of the aluminum can be determined using 27Al MAS NMR. The fraction of tetrahedral boron species in the glass fibers were measured using 11B MAS NMR, which is typically used to study the short-range structure of borate containing glasses such as alkali borate, borosilicate, and aluminoborosilicate glasses. While solid-state NMR is a powerful tool for elucidating bonding environments and coordination changes in the glass structure, it cannot quantitatively probe low to moderate surface area samples due to insufficient spins. Chemical probes either physisorbed or chemisorbed to the fiber's surface can increase the surface selectivity of NMR for analysis of samples with low surface areas and provide information about the local molecular structure of the reactive surface site. Common chemical probe molecules contain NMR active nuclei such as 19F or may be enriched with 13C. A silyating agent, (3,3,3-trifluoropropyl)dimethylchlorosilane (TFS), reacts with reactive surface hydroxyls, which can be quantified by utilizing the NMR active nucleus (19F) contained in the probe molecule. The observed 19F MAS NMR peak area is integrated and compared against a standard of known fluorine spins (concentration), allowing the number of reactive hydroxyl sites to be quantified. IGC is a method used to study the surface properties of a material by examining the retention behavior of a probe molecule. The I

  9. NMR characterization and sorption behavior of agricultural and forest soil humic substances

    NASA Astrophysics Data System (ADS)

    Li, Chengliang; Berns, Anne E.; Séquaris, Jean-Marie; Klumpp, Erwin

    2010-05-01

    Humic substances are the predominant components of the organic matter in the terrestrial system, which are not only important for the physicochemical properties of soil but are also dominant factors for controlling the environmental behaviors and fates of some organic contaminants, such as hydrophobic compounds. Nonylphenol [4-(1-ethyl-1, 3 dimethylpentyl) phenol] (NP), a ubiquitous hydrophobic pollutant, has recently focused the attention owing to its endocrine disruptors property. Sorption behavior of NP on humic substances, which were isolated from agricultural and forest soils, was investigated by using the dialysis technique at room temperature. 14C-labeled NP was used to quantify the partitioning behavior. Humic substances were characterized by 13C Cross-Polarization/Magic-Angle-Spinning Nuclear Magnetic Resonance (CP/MAS NMR). The results showed that the partition parameters of NP on various humic acids were slightly different. Relationships between partition coefficients and the functional groups of humic substances identified by CP/MAS NMR were analyzed.

  10. Magic-angle-spinning NMR studies of acid sites in zeolite H-ZSM-5

    SciTech Connect

    Brunner, E.; Ernst, H.; Freude, D.; Froehlich, T.; Hunger, M.; Pfeifer, H. )

    1991-01-01

    {sup 1}H, {sup 13}C, {sup 27}Al, and {sup 29}Si magic-angle-spinning (MAS) NMR was used to elucidate the nature of the catalytic activity of zeolite H-ZSM-5. {sup 1}H MAS NMR of sealed samples after mild hydrothermal dealumination shows that the enhanced activity for n-hexane cracking is not due to an enhanced Bronstead acidity. The concentrations of the various OH groups and aluminous species suggest that the reason for the enhanced catalytic activity is the interaction of the n-hexane molecule with a bridging hydroxyl group and with extra-framework aluminium species, which give rise to the enhanced activity, cannot be easily removed from their positions, and are therefore immobilized by the zeolitic framework.

  11. Synthesis and solid state NMR characterization of novel peptide/silica hybrid materials.

    PubMed

    Werner, Mayke; Heil, Andreas; Rothermel, Niels; Breitzke, Hergen; Groszewicz, Pedro Braga; Thankamony, Aany Sofia; Gutmann, Torsten; Buntkowsky, Gerd

    2015-11-01

    The successful synthesis and solid state NMR characterization of silica-based organic-inorganic hybrid materials is presented. For this, collagen-like peptides are immobilized on carboxylate functionalized mesoporous silica (COOH/SiOx) materials. A pre-activation of the silica material with TSTU (O-(N-Succinimidyl)-N,N,N',N'-tetramethyluronium tetrafluoroborate) is performed to enable a covalent binding of the peptides to the linker. The success of the covalent immobilization is indicated by the decrease of the (13)C CP-MAS NMR signal of the TSTU moiety. A qualitative distinction between covalently bound and adsorbed peptide is feasible by (15)N CP-MAS Dynamic Nuclear Polarization (DNP). The low-field shift of the (15)N signal of the peptide's N-terminus clearly identifies it as the binding site. The DNP enhancement allows the probing of natural abundance (15)N nuclei, rendering expensive labeling of peptides unnecessary. PMID:26411982

  12. Soils, Pores, and NMR

    NASA Astrophysics Data System (ADS)

    Pohlmeier, Andreas; Haber-Pohlmeier, Sabina; Haber, Agnes; Sucre, Oscar; Stingaciu, Laura; Stapf, Siegfried; Blümich, Bernhard

    2010-05-01

    Within Cluster A, Partial Project A1, the pore space exploration by means of Nuclear Magnetic Resonance (NMR) plays a central role. NMR is especially convenient since it probes directly the state and dynamics of the substance of interest: water. First, NMR is applied as relaxometry, where the degree of saturation but also the pore geometry controls the NMR signature of natural porous systems. Examples are presented where soil samples from the Selhausen, Merzenhausen (silt loams), and Kaldenkirchen (sandy loam) test sites are investigated by means of Fast Field Cycling Relaxometry at different degrees of saturation. From the change of the relaxation time distributions with decreasing water content and by comparison with conventional water retention curves we conclude that the fraction of immobile water is characterized by T1 < 5 ms. Moreover, the dependence of the relaxation rate on magnetic field strength allows the identification of 2D diffusion at the interfaces as the mechanism which governs the relaxation process (Pohlmeier et al. 2009). T2 relaxation curves are frequently measured for the rapid characterization of soils by means of the CPMG echo train. Basically, they contain the same information about the pore systems like T1 curves, since mostly the overall relaxation is dominated by surface relaxivity and the surface/volume ratio of the pores. However, one must be aware that T2 relaxation is additionally affected by diffusion in internal gradients, and this can be overcome by using sufficiently short echo times and low magnetic fields (Stingaciu et al. 2009). Second, the logic continuation of conventional relaxation measurements is the 2-dimensional experiment, where prior to the final detection of the CPMG echo train an encoding period is applied. This can be T1-encoding by an inversion pulse, or T2 encoding by a sequence of 90 and 180° pulses. During the following evolution time the separately encoded signals can mix and this reveals information about the connectivity of the pore system. Examples are given for T1-T2 correlation of some soil samples (Haber-Pohlmeier et al. 2010). Third, relaxometric information forms the basis of understanding magnetic resonance imaging (MRI) results. The general difficulty of imaging in soils are the inherent fast T2 relaxation times due to i) the small pore sizes, ii) presence of paramagnetic ions in the solid matrix, and iii) diffusion in internal gradients. The last point is important, since echo times can not set shorter than about 1ms for imaging purposes. The way out is either the usage of low fields for imaging in soils or special ultra-short pulse sequences, which do not create echoes. In this presentation we will give examples on conventional imaging of macropore fluxes in soil cores (Haber-Pohlmeier et al. 2010), and the combination with relaxometric imaging, as well as the advantages and drawbacks of low-field and ultra-fast pulse imaging. Also first results on the imaging of soil columns measured by SIP in Project A3 are given. Haber-Pohlmeier, S., S. Stapf, et al. (2010). "Waterflow Monitored by Tracer Transport in Natural Porous Media Using MRI." Vadose Zone J.: submitted. Haber-Pohlmeier, S., S. Stapf, et al. (2010). "Relaxation in a Natural soil: Comparison of Relaxometric Imaging, T1 - T2 Correlation and Fast-Field Cycling NMR." The Open Magnetic Resonance Journal: in print. Pohlmeier, A., S. Haber-Pohlmeier, et al. (2009). "A Fast Field Cycling NMR Relaxometry Study of Natural Soils." Vadose Zone J. 8: 735-742. Stingaciu, L. R., A. Pohlmeier, et al. (2009). "Characterization of unsaturated porous media by high-field and low-field NMR relaxometry." Water Resources Research 45: W08412

  13. A high-resolution sup 13 C solid-state NMR study of meso-tetraphenylporphyrin and its zinc(II) complex

    SciTech Connect

    Rocha, J.; Kolodziejski, W.; Klinowski, J. ); Cavaleiro, J.A.S. )

    1992-01-01

    High-resolution {sup 13}C solid-state NMR spectra of meso-tetraphenylporphyrin (TPP) and its zinc(II) complex (ZnTPP) are assigned by reference to low-temperature solution NMR results and using {sup 1}H- {sup 13}C cross-polarization magic-angle-spinning (CP/MAS). The splittings of the signals from pyrrole carbons in TPP are attributed to kinetic solid-state states involved in the migration of the central hydrogen atom.

  14. Asynchronous through-bond homonuclear isotropic mixing: application to carbon-carbon transfer in perdeuterated proteins under MAS.

    PubMed

    Kulminskaya, Natalia; Vasa, Suresh Kumar; Giller, Karin; Becker, Stefan; Linser, Rasmus

    2015-11-01

    Multiple-bond carbon-carbon homonuclear mixing is a hurdle in extensively deuterated proteins and under fast MAS due to the absence of an effective proton dipolar-coupling network. Such conditions are now commonly employed in solid-state NMR spectroscopy. Here, we introduce an isotropic homonuclear (13)C-(13)C through-bond mixing sequence, MOCCA, for the solid state. Even though applied under MAS, this scheme performs without rotor synchronization and thus does not pose the usual hurdles in terms of power dissipation for fast spinning. We compare its performance with existing homonuclear (13)C-(13)C mixing schemes using a perdeuterated and partially proton-backexchanged protein. Based on the analysis of side chain carbon-carbon correlations, we show that particularly MOCCA with standard 180-degree pulses and delays leading to non-rotor-synchronized spacing performs exceptionally well. This method provides high magnetization transfer efficiency for multiple-bond transfer in the aliphatic region compared with other tested mixing sequences. In addition, we show that this sequence can also be tailor-made for recoupling within a selected spectral region using band-selective pulses. PMID:26319987

  15. A Solid-State NMR Investigation of MQ Silicone Copolymers.

    PubMed

    Vasil'ev, Sergey G; Volkov, Vitaly I; Tatarinova, Elena A; Muzafarov, Aziz M

    2013-01-01

    The structure of MQ copolymers of the general chemical formula [(CH3)3SiO0.5]m [SiO2]n was characterized by means of solid-state magic angle spinning (MAS) nuclear magnetic resonance (NMR) spectroscopy. The MQ copolymers are highly branched polycyclic compounds (densely cross-linked nanosized networks). MQ copolymers were prepared by hydrolytic polycondensation in active medium. (29)Si NMR spectra were obtained by single pulse excitation (or direct polarization, DP) and cross-polarization (CP) (29)Si{(1)H} techniques in concert with MAS. It was shown that material consist of monofunctional M (?SiO Si (CH3)3) and two types of tetrafunctional Q units: Q(4) ((?SiO)4 Si) and Q(3) ((?SiO)3 SiOH). Spin-lattice relaxation times T 1 measurements of (29)Si nuclei and analysis of (29)Si{(1)H} variable contact time signal intensities allowed us to obtain quantitative data on the relative content of different sites in copolymers. These investigations indicate that MQ copolymers represent dense structure with core and shell. PMID:23914072

  16. Horiba iHR550 Spectrometer The iHR550 imaging spectrometer from HORIBA

    E-print Network

    Wolberg, George

    . iHR550 Features: · Up to four ports (two entrance and two exit) · Kinematic turret with easy access to 40 mm with appropriate gratings Grating Size 76 mm x 76 mm Number of Gratings on Turret 3 Flat Field

  17. Solid State NMR Studies of Energy Conversion and Storage Materials

    NASA Astrophysics Data System (ADS)

    Jankuru Hennadige, Sohan Roshel De Silva

    NMR (Nuclear magnetic resonance) spectroscopy is utilized to study energy conversion and storage materials. Different types of NMR techniques including Magic Angle Spinning, Cross-polarization and relaxation measurement experiments were employed. Four different projects are discussed in this dissertation. First, three types of CFx battery materials were investigated. Electrochemical studies have demonstrated different electrochemical performances by one type, delivering superior performance over the other two. 13C and 19F MAS NMR techniques are employed to identify the atomic/molecular structural factors that might account for differences in electrochemical performance among different types. Next as the second project, layered polymer dielectrics were investigated by NMR. Previous studies have shown that thin film capacitors are improved by using alternate layers of two polymers with complementary properties: one with a high breakdown strength and one with high dielectric constant as opposed to monolithic layers. 13C to 1H cross-polarization techniques were used to investigate any inter-layer properties that may cause the increase in the dielectric strength. The third project was to study two types of thermoelectric materials. These samples were made of heavily doped phosphorous and boron in silicon by two different methods: ball-milled and annealed. These samples were investigated by NMR to determine the degree of disorder and obtain insight into the doping efficiency. The last ongoing project is on a lithium-ion battery system. The nature of passivating layers or the solid electrolyte interphase (SEI) formed on the electrodes surface is important because of the direct correlation between the SEI and the battery life time/durability. Multinuclear (7Li, 19F, 31P) techniques are employed to identify the composition of the SEI formation of both positive and negative electrodes.

  18. CHARACTERIZATION OF THE WOUND INDUCED MATERIAL IN CITRUS FRUIT PEEL BY CARBON-13 CP-MAS SOLID STATE NMR SPECTROSCOPY

    Technology Transfer Automated Retrieval System (TEKTRAN)

    There are conflicting views regarding the chemical composition of the induced, phloroglucinol-HCl (PG-HCl) reacting, material accumulating in injured citrus peel tissues. Grapefruit, Citrus paradisi, were injured, inoculated with Peicillium digitatum and incubated under contitions favorable to the a...

  19. H-1 Relaxation Times of Metabolites in Biological Samples Obtained with Nondestructive Ex-vivo Slow-MAS NMR

    SciTech Connect

    Hu, Jian Zhi; Wind, Robert A.; Rommereim, Donald N.

    2006-03-01

    Methods suitable for measuring 1H relaxation times such as T1, T2 and T1p, in small sized biological objects including live cells, excised organs and tissues, oil seeds etc., were developed in this work. This was achieved by combining inversion-recovery, spin-echo, or spin lock segment with the phase-adjusted spinning sideband (PASS) technique that was applied at slow sample spinning rate. Here, 2D-PASS was used to produce a high-resolution 1H spectrum free from the magnetic susceptibility broadening so that the relaxation parameters of individual metabolite can be determined. Because of the slow spinning employed, tissue and cell damage due to sample spinning is minimized. The methodologies were demonstrated by measuring 1H T1, T2 and T1p of metabolites in excised rat livers and sesame seeds at spinning rates of as low as 40 Hz.

  20. 17O and 27Al MAS and 3QMAS NMR Study of Synthetic and Natural Layer Silicates

    E-print Network

    Puglisi, Joseph

    and experi- mental study of their structures, stability, and reactiv- ity.5 The composition and distribution of reactive sites on the grain edges, and key structural characteristics (e.g., bond angle variation),2 and other nanoscale earth materials, such as crystalline and amorphous oxyhy- doxides and oxides

  1. Mg/Al Ordering in Layered Double Hydroxides Revealed by Multinuclear NMR Spectroscopy

    SciTech Connect

    Sideris, Paul J.; Nielsen, Ulla G.; Gan, Zhehong; Grey, Clare P.

    2008-07-04

    The anion-exchange ability of layered double hydroxides (LDHs) has been exploited to create materials for use in catalysis, drug delivery, and environmental remediation. The specific cation arrangements in the hydroxide layers of hydrotalcite-like LDHs, of general formula Mg2+1–xAl3+xOH2(Anionn– x/n)·yH2O, have, however, remained elusive, and their elucidation could enhance the functional optimization of these materials. We applied rapid (60 kilohertz) magic angle spinning (MAS) to obtain high-resolution hydrogen-1 nuclear magnetic resonance (1H NMR) spectra and characterize the magnesium and aluminum distribution. These data, in combination with 1H-27Al double-resonance and 25Mg triple-quantum MAS NMR data, show that the cations are fully ordered for magnesium:aluminum ratios of 2:1 and that at lower aluminum content, a nonrandom distribution of cations persists, with no Al3+-Al3+ close contacts. The application of rapid MAS NMR methods to investigate proton distributions in a wide range of materials is readily envisaged.

  2. The crystallization of hectorite clays as monitored by small angle X-ray scattering and NMR

    SciTech Connect

    Carrado, K. A.; Xu, L.; Seifert, S.; Gregory, D.; Song, K.; Botto, R. E.

    1999-12-13

    The authors have probed the 48-hr crystallization of a magnesium silicate clay called hectorite. Small angle X-ray scattering (SAXS) at the Advanced Photon Source using aliquots ex situ has revealed that data is consistent with ex situ XRD, TGA, AFM, and IR data in that all these techniques see clay crystallite beginning to form in the first few hours of reaction. Tetraethylammonium (TEA) ions are used to aid crystallization and become incorporated as the exchange cations within the interlayers. {sup 13}C NMR shows that 80% of the final TEA loading is accomplished in the first 10 hrs. {sup 29}Si NMR displays a visible clay silicate peak after just 1 hr. In addition, the first in situ study of clay crystallization of any kind was performed by in situ SAXS. Results are consistent with the ex situ data as well as showing the sensitivity of SAXS to sol gel reactions occurring on the order of minutes.

  3. Dynamics of SARS-coronavirus HR2 domain in the prefusion and transition states

    NASA Astrophysics Data System (ADS)

    McReynolds, Susanna; Jiang, Shaokai; Rong, Lijun; Caffrey, Michael

    2009-12-01

    The envelope glycoproteins S1 and S2 of severe acute respiratory syndrome coronavirus (SARS-CoV) mediate viral entry by conformational change from a prefusion state to a postfusion state that enables fusion of the viral and target membranes. In this work we present the characterization of the dynamic properties of the SARS-CoV S2-HR2 domain (residues 1141-1193 of S) in the prefusion and newly discovered transition states by NMR 15N relaxation studies. The dynamic properties of the different states, which are stabilized under different experimental conditions, extend the current model of viral membrane fusion and give insight into the design of structure-based antagonists of SARS-CoV in particular, as well as other enveloped viruses such as HIV.

  4. Achievement of 1020MHz NMR.

    PubMed

    Hashi, Kenjiro; Ohki, Shinobu; Matsumoto, Shinji; Nishijima, Gen; Goto, Atsushi; Deguchi, Kenzo; Yamada, Kazuhiko; Noguchi, Takashi; Sakai, Shuji; Takahashi, Masato; Yanagisawa, Yoshinori; Iguchi, Seiya; Yamazaki, Toshio; Maeda, Hideaki; Tanaka, Ryoji; Nemoto, Takahiro; Suematsu, Hiroto; Miki, Takashi; Saito, Kazuyoshi; Shimizu, Tadashi

    2015-07-01

    We have successfully developed a 1020MHz (24.0T) NMR magnet, establishing the world's highest magnetic field in high resolution NMR superconducting magnets. The magnet is a series connection of LTS (low-Tc superconductors NbTi and Nb3Sn) outer coils and an HTS (high-Tc superconductor, Bi-2223) innermost coil, being operated at superfluid liquid helium temperature such as around 1.8K and in a driven-mode by an external DC power supply. The drift of the magnetic field was initially ±0.8ppm/10h without the (2)H lock operation; it was then stabilized to be less than 1ppb/10h by using an NMR internal lock operation. The full-width at half maximum of a (1)H spectrum taken for 1% CHCl3 in acetone-d6 was as low as 0.7Hz (0.7ppb), which was sufficient for solution NMR. On the contrary, the temporal field stability under the external lock operation for solid-state NMR was 170ppb/10h, sufficient for NMR measurements for quadrupolar nuclei such as (17)O; a (17)O NMR measurement for labeled tri-peptide clearly demonstrated the effect of high magnetic field on solid-state NMR spectra. PMID:25978708

  5. Achievement of 1020 MHz NMR

    NASA Astrophysics Data System (ADS)

    Hashi, Kenjiro; Ohki, Shinobu; Matsumoto, Shinji; Nishijima, Gen; Goto, Atsushi; Deguchi, Kenzo; Yamada, Kazuhiko; Noguchi, Takashi; Sakai, Shuji; Takahashi, Masato; Yanagisawa, Yoshinori; Iguchi, Seiya; Yamazaki, Toshio; Maeda, Hideaki; Tanaka, Ryoji; Nemoto, Takahiro; Suematsu, Hiroto; Miki, Takashi; Saito, Kazuyoshi; Shimizu, Tadashi

    2015-07-01

    We have successfully developed a 1020 MHz (24.0 T) NMR magnet, establishing the world's highest magnetic field in high resolution NMR superconducting magnets. The magnet is a series connection of LTS (low-Tc superconductors NbTi and Nb3Sn) outer coils and an HTS (high-Tc superconductor, Bi-2223) innermost coil, being operated at superfluid liquid helium temperature such as around 1.8 K and in a driven-mode by an external DC power supply. The drift of the magnetic field was initially ± 0.8 ppm/10 h without the 2H lock operation; it was then stabilized to be less than 1 ppb/10 h by using an NMR internal lock operation. The full-width at half maximum of a 1H spectrum taken for 1% CHCl3 in acetone-d6 was as low as 0.7 Hz (0.7 ppb), which was sufficient for solution NMR. On the contrary, the temporal field stability under the external lock operation for solid-state NMR was 170 ppb/10 h, sufficient for NMR measurements for quadrupolar nuclei such as 17O; a 17O NMR measurement for labeled tri-peptide clearly demonstrated the effect of high magnetic field on solid-state NMR spectra.

  6. THz Dynamic Nuclear Polarization NMR.

    PubMed

    Nanni, Emilio A; Barnes, Alexander B; Griffin, Robert G; Temkin, Richard J

    2011-08-29

    Dynamic nuclear polarization (DNP) increases the sensitivity of nuclear magnetic resonance (NMR) spectroscopy by using high frequency microwaves to transfer the polarization of the electrons to the nuclear spins. The enhancement in NMR sensitivity can amount to a factor of well above 100, enabling faster data acquisition and greatly improved NMR measurements. With the increasing magnetic fields (up to 23 T) used in NMR research, the required frequency for DNP falls into the THz band (140-600 GHz). Gyrotrons have been developed to meet the demanding specifications for DNP NMR, including power levels of tens of watts; frequency stability of a few megahertz; and power stability of 1% over runs that last for several days to weeks. Continuous gyrotron frequency tuning of over 1 GHz has also been demonstrated. The complete DNP NMR system must include a low loss transmission line; an optimized antenna; and a holder for efficient coupling of the THz radiation to the sample. This paper describes the DNP NMR process and illustrates the THz systems needed for this demanding spectroscopic application. THz DNP NMR is a rapidly developing, exciting area of THz science and technology. PMID:24639915

  7. THz Dynamic Nuclear Polarization NMR

    PubMed Central

    Nanni, Emilio A.; Barnes, Alexander B.; Griffin, Robert G.; Temkin, Richard J.

    2013-01-01

    Dynamic nuclear polarization (DNP) increases the sensitivity of nuclear magnetic resonance (NMR) spectroscopy by using high frequency microwaves to transfer the polarization of the electrons to the nuclear spins. The enhancement in NMR sensitivity can amount to a factor of well above 100, enabling faster data acquisition and greatly improved NMR measurements. With the increasing magnetic fields (up to 23 T) used in NMR research, the required frequency for DNP falls into the THz band (140–600 GHz). Gyrotrons have been developed to meet the demanding specifications for DNP NMR, including power levels of tens of watts; frequency stability of a few megahertz; and power stability of 1% over runs that last for several days to weeks. Continuous gyrotron frequency tuning of over 1 GHz has also been demonstrated. The complete DNP NMR system must include a low loss transmission line; an optimized antenna; and a holder for efficient coupling of the THz radiation to the sample. This paper describes the DNP NMR process and illustrates the THz systems needed for this demanding spectroscopic application. THz DNP NMR is a rapidly developing, exciting area of THz science and technology. PMID:24639915

  8. CHARACTERIZATION OF THE RED GIANT HR 2582 USING THE CHARA ARRAY

    SciTech Connect

    Baines, Ellyn K.; McAlister, Harold A.; Ten Brummelaar, Theo A.; Turner, Nils H.; Sturmann, Judit; Sturmann, Laszlo; Farrington, Christopher D.; Vargas, Norm; Van Belle, Gerard T.; Ridgway, Stephen T.

    2013-07-20

    We present the fundamental parameters of HR 2582, a high-mass red giant star whose evolutionary state is a mystery. We used the CHARA Array interferometer to directly measure the star's limb-darkened angular diameter (1.006 {+-} 0.020 mas) and combined our measurement with parallax and photometry from the literature to calculate its physical radius (35.76 {+-} 5.31 R{sub Sun }), luminosity (517.8 {+-} 17.5 L{sub Sun }), bolometric flux (14.8 {+-} 0.5 Multiplication-Sign 10{sup -8} erg s{sup -1} cm{sup -2}), and effective temperature (4577 {+-} 60 K). We then determined the star's mass (5.6 {+-} 1.7 M{sub Sun }) using our new values with stellar oscillation results from Baudin et al. Finally, using the Yonsei-Yale evolutionary models, we estimated HR 2582's age to be 165{sup +20}{sub -15} Myr. While our measurements do not provide the precision required to definitively state where the star is in its evolution, it remains an excellent test case for evaluating stellar interior models.

  9. Characterization of Two Distinct Amorphous Forms of Valsartan by Solid-State NMR.

    PubMed

    Skotnicki, Marcin; Apperley, David C; Aguilar, Juan A; Milanowski, Bart?omiej; Pyda, Marek; Hodgkinson, Paul

    2016-01-01

    Valsartan (VAL) is an antihypertensive drug marketed in an amorphous form. Amorphous materials can have different physicochemical properties depending on preparation method, thermal history, etc., but the nature of such materials is difficult to study by diffraction techniques. This study characterizes two different amorphous forms of valsartan (AR and AM) using solid-state NMR (SSNMR) as a primary investigation tool, supported by solution-state NMR, FT-IR, TMDSC, and dissolution tests. The two forms are found to be clearly distinct, with a significantly higher level of structural arrangement in the AR form, as observed in (13)C, (15)N, and (1)H SSNMR. (13)C and (15)N NMR indicates that the fully amorphous material (AM) contains an approximately equal ratio of cis-trans conformers about the amide bond, whereas the AR form exists mainly as one conformer, with minor conformational "defects". (1)H ultrafast MAS NMR shows significant differences in the hydrogen bonding involving the tetrazole and acid hydrogens between the two materials, while (15)N NMR shows that both forms exist as a 1,2,3,4-tetrazole tautomer. NMR relaxation times show subtle differences in local and bulk molecular mobility, which can be connected with the glass transition, the stability of the glassy material, and its response to aging. Counterintuitively the fully amorphous material is found to have a significantly lower dissolution rate than the apparently more ordered AR material. PMID:26602457

  10. Origins of linewidth in 1H magic-angle spinning NMR.

    PubMed

    Zorin, Vadim E; Brown, Steven P; Hodgkinson, Paul

    2006-10-14

    A detailed study of the factors determining the linewidth (and hence resolution) in 1H solid-state magic-angle spinning NMR is described. Although it has been known from the early days of magic-angle spinning (MAS) that resolution of spectra from abundant nuclear spins, such as 1H, increases approximately linearly with increasing sample rotation rate, the difficulty of describing the dynamics of extended networks of coupled spins has made it difficult to predict a priori the resolution expected for a given sample. Using recently developed, highly efficient methods of numerical simulation, together with experimental measurements on a variety of test systems, we propose a comprehensive picture of 1H resolution under MAS. The "homogeneous" component of the linewidth is shown to depend primarily on the ratio between an effective local coupling strength and the spin rate, modified by geometrical factors which loosely correspond to the "dimensionality" of the coupling network. The remaining "inhomogeneous" component of the natural linewidth is confirmed to have the same properties as in dilute-spin NMR. Variations in the NMR frequency due to chemical shift effects are shown to have minimal impact on 1H resolution. The implications of these results for solid-state NMR experiments involving 1H and other abundant-spin nuclei are discussed. PMID:17042610

  11. Two-dimensional NMR spectroscopy

    SciTech Connect

    Croasmun, W.R.; Carlson, R.M.K.

    1987-01-01

    Written for chemists and biochemists who are not NMR spectroscopists, but who wish to use the new techniques of two-dimensional NMR spectroscopy, this book brings together for the first time much of the practical and experimental data needed. It also serves as information source for industrial, academic, and graduate student researchers who already use NMR spectroscopy, but not yet in two dimensions. The authors describe the use of 2-D NMR in a wide variety of chemical and biochemical fields, among them peptides, steroids, oligo- and poly-saccharides, nucleic acids, natural products (including terpenoids, alkaloids, and coal-derived heterocyclics), and organic synthetic intermediates. They consider throughout the book both the advantages and limitations of using 2-D NMR.

  12. Multinuclear NMR approach to coal fly ash characterization

    SciTech Connect

    Netzel, D.A.

    1991-09-01

    This report describes the application of various nuclear magnetic resonance (NMR) techniques to study the hydration kinetics and mechanisms, the structural properties, and the adsorption characteristics of coal fly ash. Coal fly ash samples were obtained from the Dave Johnston and Laramie River electric power generating plants in Wyoming. Hydrogen NMR relaxation times were measured as a function of time to observe the kinetics of hydration for the two coal fly ashes at different temperatures and water-to-cement ration. The kinetic data for the hydrated coal fly ashes were compared to the hydration of portland cement. The mechanism used to describe the kinetic data for the hydration of portland cement was applied, with reservation, to describe the hydration of the coal fly ashes. The results showed that the coal fly ashes differ kinetically from that of portland cement and from each other. Consequently, both coal fly ashes were judged to be poorer cementitious materials than portland cement. Carbon-13 NMR CP/MAS spectra were obtained for the anhydrous coal fly ashes in an effort to determine the type of organic species that may be present, either adsorbed on the surface or entrained.

  13. Genetic algorithm optimized triply compensated pulses in NMR spectroscopy

    NASA Astrophysics Data System (ADS)

    Manu, V. S.; Veglia, Gianluigi

    2015-11-01

    Sensitivity and resolution in NMR experiments are affected by magnetic field inhomogeneities (of both external and RF), errors in pulse calibration, and offset effects due to finite length of RF pulses. To remedy these problems, built-in compensation mechanisms for these experimental imperfections are often necessary. Here, we propose a new family of phase-modulated constant-amplitude broadband pulses with high compensation for RF inhomogeneity and heteronuclear coupling evolution. These pulses were optimized using a genetic algorithm (GA), which consists in a global optimization method inspired by Nature's evolutionary processes. The newly designed ? and ? / 2 pulses belong to the 'type A' (or general rotors) symmetric composite pulses. These GA-optimized pulses are relatively short compared to other general rotors and can be used for excitation and inversion, as well as refocusing pulses in spin-echo experiments. The performance of the GA-optimized pulses was assessed in Magic Angle Spinning (MAS) solid-state NMR experiments using a crystalline U-13C, 15N NAVL peptide as well as U-13C, 15N microcrystalline ubiquitin. GA optimization of NMR pulse sequences opens a window for improving current experiments and designing new robust pulse sequences.

  14. The hot white-dwarf companions of HR 1608, HR 8210, and HD 15638

    NASA Technical Reports Server (NTRS)

    Landsman, Wayne; Simon, Theodore; Bergeron, P.

    1993-01-01

    We have obtained low-dispersion IUE spectra of the late-type stars HD 15638 (F3 V), HR 1608 (=63 Eridani, KO IV), and HR 8210 (A8m). Each of these stars had been detected as a strong EUV source with the Wide Field Camera aboard the ROSAT satellite. The short-wavelength IUE spectrum of each star reveals the presence of a hot white-dwarf companion. We have fit the Lyman-alpha profile and UV continuum of each white dwarf using pure hydrogen models. The excellent fit of the data to the models provides confirmation of the Finley and Koester absolute calibration of the SWP camera of IUE. The UV data alone are insufficient to constrain the model gravity, but an additional constraint is provided by the photometric distance to the late-type primary. The most interesting of the three white dwarfs is the companion to HR 8210 for which our results imply a mass of 1.15 +0.05/-0.15 solar mass. This result is in good agreement with the lower limit on the mass derived from the spectroscopic orbit (greater than 1.1 solar mass), provided that the inclination is close to 90 deg.

  15. MODIS Airborne simulator (MAS) Final Report for CLASIC

    SciTech Connect

    Thomas Arnold; Steven Platnick

    2010-11-24

    The MAS was flown aboard the NASA ER-2 for the CLASIC field experiment, and for all data collected, provided calibrated and geolocated (Level-1B) radiance data for it’s 50 spectral bands (ranging in wavelength for 0.47 to 14.3 µm). From the Level-1B data, as directed in the Statement of Work, higher order (Level-2) data products were derived. The Level-2 products include: a) cloud optical thickness, b) cloud effective radius, c) cloud top height (temperature), d) cloud fraction, e) cloud phase products. Preliminary Level-1B and Level-2 products were provided during the field experiment (typically within one or two days of data collection). Final version data products were made available in December 2008 following considerable calibration analysis. Data collection, data processing (to Level-2), and discussion of the calibration work are summarized below.

  16. Applied computational electromagnetic society Journal, pages: 112-126, March, 2004 A hybrid full MAS and Combined MAS/TSA Algorithm for

    E-print Network

    Shubitidze, Fridon

    full MAS and Combined MAS/TSA Algorithm for Electromagnetic Induction Sensing F. Shubitidze (1) , K. O and Engineering Laboratory, 72, Lyme Road, Hanover NH, 03755, USA Abstract ­Electromagnetic induction (EMI of ultra-wideband (1 Hz- 300 kHz) electromagnetic induction problems [1] - [6]. For a highly conducting

  17. Elemental abundances of the B and A stars Gamma Geminorum, 7 Sextantis, HR 4817, and HR 5780

    NASA Technical Reports Server (NTRS)

    Adelman, Saul J.; Philip, A. G. D.

    1992-01-01

    Fine analyses of the B and A stars, Gamma Geminorum, 7 Sextantis, HR 4817, and HR 5780 are performed. Although the data cover rather limited spectral regions, still useful results were obtained. The data were mostly obtained at the KPNO coude feed telescope with CCD TI No. 3, camera 5, and grating A. The He/H ratio of HR 4817 confirms the similarity of many abundance values with those of the peculiar Mn star 53 Tauri. For the most part Gamma Gem, 7 Sex, and HR 5780 have derived abundances similar to those of other normal sharp-lined stars of similar effective temperature.

  18. The Stoichiometry of Synthetic Alunite as a Function of Hydrothermal Aging Investigated by Solid-State NMR Spectroscopy, Powder X-ray Diffraction and Infrared Spectroscopy

    SciTech Connect

    Grube, Elisabeth; Nielsen, Ulla Gro

    2015-05-01

    The stoichiometry of a series of synthetic alunite [nominally KAl3(SO4)2(OH)6] samples prepared by hydrothermal methods as a function of reaction time (1–31 days) has been investigated by powder X-ray diffraction, Fourier transform infrared spectroscopy as well as solid-state 1H and 27Al magic angle spinning (MAS) nuclear magnetic resonance (NMR) spectroscopy. The 1H MAS NMR spectra recorded at high magnetic field (21.1 T, 900 MHz) allowed for a clear separation of the different proton environments and for quantitative determination of the aluminum vacancy concentration as a function of time. The concentration of structural defects determined from, i.e., aluminum vacancies was reduced from 4 to 1 %, as the reaction time was extended from one to 31 days based on 1H MAS NMR. This was further supported by an increase of the unit cell parameter c, which is indicative of the relative concentration of potassium defects present, from 17.261(1) to 17.324(5) Å. Solid-state 27Al MAS NMR revealed a decrease in the defect concentration as a function of time and showed the presence of 7–10 % impurities in the samples.

  19. The stoichiometry of synthetic alunite as a function of hydrothermal aging investigated by solid-state NMR spectroscopy, powder X-ray diffraction and infrared spectroscopy

    NASA Astrophysics Data System (ADS)

    Grube, Elisabeth; Nielsen, Ulla Gro

    2015-05-01

    The stoichiometry of a series of synthetic alunite [nominally KAl3(SO4)2(OH)6] samples prepared by hydrothermal methods as a function of reaction time (1-31 days) has been investigated by powder X-ray diffraction, Fourier transform infrared spectroscopy as well as solid-state 1H and 27Al magic angle spinning (MAS) nuclear magnetic resonance (NMR) spectroscopy. The 1H MAS NMR spectra recorded at high magnetic field (21.1 T, 900 MHz) allowed for a clear separation of the different proton environments and for quantitative determination of the aluminum vacancy concentration as a function of time. The concentration of structural defects determined from, i.e., aluminum vacancies was reduced from 4 to 1 %, as the reaction time was extended from one to 31 days based on 1H MAS NMR. This was further supported by an increase of the unit cell parameter c, which is indicative of the relative concentration of potassium defects present, from 17.261(1) to 17.324(5) Å. Solid-state 27Al MAS NMR revealed a decrease in the defect concentration as a function of time and showed the presence of 7-10 % impurities in the samples.

  20. MAS C-Terminal Tail Interacting Proteins Identified by Mass Spectrometry- Based Proteomic Approach

    PubMed Central

    Tirupula, Kalyan C.; Zhang, Dongmei; Osbourne, Appledene; Chatterjee, Arunachal; Desnoyer, Russ; Willard, Belinda; Karnik, Sadashiva S.

    2015-01-01

    Propagation of signals from G protein-coupled receptors (GPCRs) in cells is primarily mediated by protein-protein interactions. MAS is a GPCR that was initially discovered as an oncogene and is now known to play an important role in cardiovascular physiology. Current literature suggests that MAS interacts with common heterotrimeric G-proteins, but MAS interaction with proteins which might mediate G protein-independent or atypical signaling is unknown. In this study we hypothesized that MAS C-terminal tail (Ct) is a major determinant of receptor-scaffold protein interactions mediating MAS signaling. Mass-spectrometry based proteomic analysis was used to comprehensively identify the proteins that interact with MAS Ct comprising the PDZ-binding motif (PDZ-BM). We identified both PDZ and non-PDZ proteins from human embryonic kidney cell line, mouse atrial cardiomyocyte cell line and human heart tissue to interact specifically with MAS Ct. For the first time our study provides a panel of PDZ and other proteins that potentially interact with MAS with high significance. A ‘cardiac-specific finger print’ of MAS interacting PDZ proteins was identified which includes DLG1, MAGI1 and SNTA. Cell based experiments with wild-type and mutant MAS lacking the PDZ-BM validated MAS interaction with PDZ proteins DLG1 and TJP2. Bioinformatics analysis suggested well-known multi-protein scaffold complexes involved in nitric oxide signaling (NOS), cell-cell signaling of neuromuscular junctions, synapses and epithelial cells. Majority of these protein hits were predicted to be part of disease categories comprising cancers and malignant tumors. We propose a ‘MAS-signalosome’ model to stimulate further research in understanding the molecular mechanism of MAS function. Identifying hierarchy of interactions of ‘signalosome’ components with MAS will be a necessary step in future to fully understand the physiological and pathological functions of this enigmatic receptor. PMID:26484771

  1. Determination of the Average Aromatic Cluster Size of Fossil Fuels by Solid-State NMR at High Magnetic Field

    SciTech Connect

    Mao, Kanmi; Kennedy, Gordon J.; Althaus, Stacey M.; Pruski, Marek

    2013-01-07

    We show that the average aromatic cluster size in complex carbonaceous materials can be accurately determined using fast magic-angle spinning (MAS) NMR at a high magnetic field. To accurately quantify the nonprotonated aromatic carbon, we edited the 13C spectra using the recently reported MAS-synchronized spin–echo, which alleviated the problem of rotational recoupling of 1H-13C dipolar interactions associated with traditional dipolar dephasing experiments. The dependability of this approach was demonstrated on selected Argonne Premium coal standards, for which full sets of basic structural parameters were determined with high accuracy.

  2. Outsourcing HR Services: The Role of Human Resource Intermediaries

    ERIC Educational Resources Information Center

    Kock, Henrik; Wallo, Andreas; Nilsson, Barbro; Hoglund, Cecilia

    2012-01-01

    Purpose: In this article, the area of interest is an emerging type of organisation called human resource intermediaries (HRIs), which focus on delivering human resource (HR) services to public sector organisations and private companies. The purpose of this article is, thus, to explore HRIs as deliverers of HR services. More specifically, the…

  3. Professional Development of HR Practitioners--A Phenomenographic Study

    ERIC Educational Resources Information Center

    Bailey, Moira

    2015-01-01

    Purpose: The purpose of this paper is an investigation into the experiences of professional development of human resource (HR) practitioners in the North of Scotland, and the use of non-formal learning in that development. Design/methodology/approach: In-depth semi-structured interviews from a purposively selected sample of HR practitioners were…

  4. NMR measurement of pore structure

    SciTech Connect

    Earl, W.L.; Kim, Yong-Wah |; Smith, D.M.

    1993-05-31

    An attempt was made to pursue {sup 129}Xe NMR as a pore measurement technique. Samples studied were synthetic imogolite (tubular aluminosilicate with gibbsite structure), sodium Y-zeolite, and an aerogel and a xerogel. Gases used were normal Xe, {sup 13}CO{sub 2}, and {sup 15}N{sub 2}. Although a completely general NMR technique for measuring pore size distributions may not be possible, information about molecular motion and interactions can be obtained, because NMR is sensitive to short range interactions (1 nm or less) and to molecular dynamics in the range 10{sup {minus}2} to 10{sup {minus}6}s.

  5. Visualizing transient dark states by NMR spectroscopy

    E-print Network

    Clore, G. Marius

    Visualizing transient dark states by NMR spectroscopy Nicholas J. Anthis and G. Marius Clore resonance (NMR) spectroscopy, as long as the dark state is in dynamic equilibrium with an NMR biology techniques, in particular X-ray crystallography and nuclear magnetic resonance (NMR) spectroscopy

  6. Solving structures by NMR Qinghua Wang

    E-print Network

    Hardy, Jeanne

    . Biomol. NMR, 27: 13-39, 2003 #12;If the chemical shift of each proton is known, every off-diagonal peakSolving structures by NMR Qinghua Wang 1232B LGRT 545-3473; qwang@biochem.umass.edu #12;1946 Bloch Fourier transform NMR 1975 Jeener, Ernst 2D NMR 1985 Wüthrich first solution structure of a small protein

  7. Welding Metallurgy of Alloy HR-160

    SciTech Connect

    DuPont, J.N.; Michael, J.R.; Newbury, B.D.

    1999-05-28

    The solidification behavior and resultant solidification cracking susceptibility of autogenous gas tungsten arc fusion welds in alloy HR-160 was investigated by Varestraint testing, differential thermal analysis, and various microstructural characterization techniques. The alloy exhibited a liquidus temperature of 1387 {deg}C and initiated solidification by a primary L - {gamma} reaction in which Ni, Si, and Ti segregated to the interdendritic liquid and Co segregated to the {gamma} dendrite cores. Chromium exhibited no preference for segregation to the solid or liquid phase during solidification. Solidification terminated at {approx} 1162 {deg}C by a eutectic-type L - [{gamma}+ (Ni,Co){sub 16}(Ti,Cr){sub 6}Si{sub 7}] reaction. The (Ni,Co){sub 16}(Ti,Cr){sub 6}Si{sub 7} phase is found to be analogous to the G phase which forms in the Ni-Ti-Si and Co-Ti-Si ternary systems, and similarities are found to exist between the solidification behavior of this commercial multicomponent alloy and the simple Ni-Si and Ni-Ti binary systems. Reasonable agreement is obtained between the calculated and measured volume percent of the [{gamma} +(Ni,Co){sub l6}(Ti,Cr){sub 6}Si{sub 7}] eutectic-typr constituent with the Scheil equation using experimentally determined k values for Si and Ti from electron microprobe data. The alloy exhibited a very high susceptibility to solidification cracking in the Varestraint test. This is attributed to a large solidification temperature range of 225 {deg}C and the presence of 2 to 5 vol% solute rich interdendritic liquid which preferentially wets the grain boundaries and interdendritic regions.

  8. 100 ton/hr fume incinerator recovers 52 million Btu/hr

    SciTech Connect

    Not Available

    1982-05-01

    The fume incinerator at the Neville Island plant of USS Chemicals in Pittsburgh, PA required substantial maintenance and yearly overhaul to keep it operating. Because the plant operates 7 days/week, 24 hours/day, downtime represented a serious problem, and the incinerator used to burn the waste gas from the phthalic anhydride reactor was causing problems. To solve this problem, the plant installed an 80 ft long thermal oxidation system capable of incinerating 100 tons of waste gas maintaining clean exhaust from its 100 ft stack. A heat recovery system added to this incinerator saved approximately 1.5 million Btu/hr by preheating the combustion air. (JMT)

  9. Multiple non-coding exons and alternative splicing in the mouse Mas protooncogene.

    PubMed

    Alenina, Natalia; Böhme, Ilka; Bader, Michael; Walther, Thomas

    2015-09-01

    The Mas protooncogene encodes a G protein-coupled receptor with the common seven transmembrane domains, expressed mainly in the testis and brain. We provided evidence that Mas is a functional angiotensin-(1-7) receptor and can interact with the angiotensin II type 1 (AT1) receptor. The gene is transcriptionally regulated during development in the brain and testis, but its structure was unresolved. In this study we used 5'- and 3'-RACE, RT-PCR, and RNase-protection assays to elucidate the complete Mas gene structure and organization. We identified 12 exons in the mouse Mas gene with 11 in the 5' untranslated mRNA, which can be alternatively spliced. We also showed that Mas transcription can start from 4 tissue-specific promoters, whereby testis-specific Mas mRNA is transcribed from two upstream promoters, and the expression of Mas in the brain starts from two downstream promoters. Alternative splicing and multiple promoter usage result in at least 12 Mas transcripts in which different 5' untranslated regions are fused to a common coding sequence. Moreover, termination of Mas mRNA is regulated by two different polyadenylation signals. The gene spans approximately 27 kb, and the longest detected mRNA contains 2,451 bp. Thus, our results characterize the Mas protooncogene as the gene with the most complex gene structure of all described members of the gene family coding for G protein-coupled receptors. PMID:26003294

  10. Local structure analysis of solid state ionic conductors, perovskite-derived structures by NMR and computational studies

    E-print Network

    Dervisoglu, Riza

    2013-10-08

    occupancies. . . . . . . . . . . . . 8 1.6 A computer simulation of a powder sample with Pake doublet shape with KAX = 1 kHz and ?0 = 0 Hz. . . . . . . . . . . . . . . 17 1.7 A computer simulation of a quadrupolar NMR spectra of a powder sample with ?Q = 0... parameters given in Table 2.2. . . . . . . . . . . . . . . . . . . . . . . . . . . 53 2.7 17O MAS NMR spectrum of 17O enriched Ba2In2O4(OH)2 at 9.4 T obtained using a 3 µs pulse length corresponding to ?2 pulse at a radio frequency field amplitude of 80 k...

  11. Multinuclear Solid-State NMR Studies of Polymers and Immobilized Sonogashira Catalysts for Cross-Coupling Reactions 

    E-print Network

    Pope, Jacqueline Christine

    2014-08-28

    ............................................................................................. 56 Experimental ......................................................................................... 57 III HIGH-TEMPERATURE STEAM-TREATMENT OF MELT- MOLDED PBI, PEEK, AND PEKK WITH H2O AND D2O: A SOLID-STATE NMR STUDY... ................................................................................................................. 284 xii LIST OF FIGURES FIGURE Page 2.1. 13C CP/MAS NMR spectra of PBI (a), PEEK (b), melt-blended PEEK- PBI (c), and a physical mixture of powdered PEEK and PBI (50:50 wt%) (d). The spinning speed is 10 kHz for all spectra...

  12. Applications of high-resolution 1H solid-state NMR.

    PubMed

    Brown, Steven P

    2012-02-01

    This article reviews the large increase in applications of high-resolution (1)H magic-angle spinning (MAS) solid-state NMR, in particular two-dimensional heteronuclear and homonuclear (double-quantum and spin-diffusion NOESY-like exchange) experiments, in the last five years. These applications benefit from faster MAS frequencies (up to 80 kHz), higher magnetic fields (up to 1 GHz) and pulse sequence developments (e.g., homonuclear decoupling sequences applicable under moderate and fast MAS). (1)H solid-state NMR techniques are shown to provide unique structural insight for a diverse range of systems including pharmaceuticals, self-assembled supramolecular structures and silica-based inorganic-organic materials, such as microporous and mesoporous materials and heterogeneous organometallic catalysts, for which single-crystal diffraction structures cannot be obtained. The power of NMR crystallography approaches that combine experiment with first-principles calculations of NMR parameters (notably using the GIPAW approach) are demonstrated, e.g., to yield quantitative insight into hydrogen-bonding and aromatic CH-? interactions, as well as to generate trial three-dimensional packing arrangements. It is shown how temperature-dependent changes in the (1)H chemical shift, linewidth and DQ-filtered signal intensity can be analysed to determine the thermodynamics and kinetics of molecular level processes, such as the making and breaking of hydrogen bonds, with particular application to proton-conducting materials. Other applications to polymers and biopolymers, inorganic compounds and bioinorganic systems, paramagnetic compounds and proteins are presented. The potential of new technological advances such as DNP methods and new microcoil designs is described. PMID:22177472

  13. Compact orthogonal NMR field sensor

    DOEpatents

    Gerald, II, Rex E. (Brookfield, IL); Rathke, Jerome W. (Homer Glen, IL)

    2009-02-03

    A Compact Orthogonal Field Sensor for emitting two orthogonal electro-magnetic fields in a common space. More particularly, a replacement inductor for existing NMR (Nuclear Magnetic Resonance) sensors to allow for NMR imaging. The Compact Orthogonal Field Sensor has a conductive coil and a central conductor electrically connected in series. The central conductor is at least partially surrounded by the coil. The coil and central conductor are electrically or electro-magnetically connected to a device having a means for producing or inducing a current through the coil and central conductor. The Compact Orthogonal Field Sensor can be used in NMR imaging applications to determine the position and the associated NMR spectrum of a sample within the electro-magnetic field of the central conductor.

  14. THz Dynamic Nuclear Polarization NMR

    E-print Network

    Nanni, Emilio Alessandro

    Dynamic nuclear polarization (DNP) increases the sensitivity of nuclear magnetic resonance (NMR) spectroscopy by using high frequency microwaves to transfer the polarization of the electrons to the nuclear spins. The ...

  15. NMR characterization of thin films

    DOEpatents

    Gerald II, Rex E.; Klingler, Robert J.; Rathke, Jerome W.; Diaz, Rocio; Vukovic, Lela

    2010-06-15

    A method, apparatus, and system for characterizing thin film materials. The method, apparatus, and system includes a container for receiving a starting material, applying a gravitational force, a magnetic force, and an electric force or combinations thereof to at least the starting material, forming a thin film material, sensing an NMR signal from the thin film material and analyzing the NMR signal to characterize the thin film of material.

  16. Multispectral Analysis of NMR Imagery

    NASA Technical Reports Server (NTRS)

    Butterfield, R. L.; Vannier, M. W. And Associates; Jordan, D.

    1985-01-01

    Conference paper discusses initial efforts to adapt multispectral satellite-image analysis to nuclear magnetic resonance (NMR) scans of human body. Flexibility of these techniques makes it possible to present NMR data in variety of formats, including pseudocolor composite images of pathological internal features. Techniques do not have to be greatly modified from form in which used to produce satellite maps of such Earth features as water, rock, or foliage.

  17. NMR characterization of thin films

    DOEpatents

    Gerald, II, Rex E. (Brookfield, IL); Klingler, Robert J. (Glenview, IL); Rathke, Jerome W. (Homer Glen, IL); Diaz, Rocio (Chicago, IL); Vukovic, Lela (Westchester, IL)

    2008-11-25

    A method, apparatus, and system for characterizing thin film materials. The method, apparatus, and system includes a container for receiving a starting material, applying a gravitational force, a magnetic force, and an electric force or combinations thereof to at least the starting material, forming a thin film material, sensing an NMR signal from the thin film material and analyzing the NMR signal to characterize the thin film of material.

  18. Optical pumping and xenon NMR

    SciTech Connect

    Raftery, M.D.

    1991-11-01

    Nuclear Magnetic Resonance (NMR) spectroscopy of xenon has become an important tool for investigating a wide variety of materials, especially those with high surface area. The sensitivity of its chemical shift to environment, and its chemical inertness and adsorption properties make xenon a particularly useful NMR probe. This work discusses the application of optical pumping to enhance the sensitivity of xenon NMR experiments, thereby allowing them to be used in the study of systems with lower surface area. A novel method of optically-pumping [sup 129]Xe in low magnetic field below an NMR spectrometer and subsequent transfer of the gas to high magnetic field is described. NMR studies of the highly polarized gas adsorbed onto powdered samples with low to moderate surface areas are now possible. For instance, NMR studies of optically-pumped xenon adsorbed onto polyacrylic acid show that xenon has a large interaction with the surface. By modeling the low temperature data in terms of a sticking probability and the gas phase xenon-xenon interaction, the diffusion coefficient for xenon at the surface of the polymer is determined. The sensitivity enhancement afforded by optical pumping also allows the NMR observation of xenon thin films frozen onto the inner surfaces of different sample cells. The geometry of the thin films results in interesting line shapes that are due to the bulk magnetic susceptibility of xenon. Experiments are also described that combine optical pumping with optical detection for high sensitivity in low magnetic field to observe the quadrupoler evolution of 131 Xe spins at the surface of the pumping cells. In cells with macroscopic asymmetry, a residual quadrupolar interaction causes a splitting in the [sup 131]Xe NMR frequencies in bare Pyrex glass cells and cells with added hydrogen.

  19. Optical pumping and xenon NMR

    SciTech Connect

    Raftery, M.D.

    1991-11-01

    Nuclear Magnetic Resonance (NMR) spectroscopy of xenon has become an important tool for investigating a wide variety of materials, especially those with high surface area. The sensitivity of its chemical shift to environment, and its chemical inertness and adsorption properties make xenon a particularly useful NMR probe. This work discusses the application of optical pumping to enhance the sensitivity of xenon NMR experiments, thereby allowing them to be used in the study of systems with lower surface area. A novel method of optically-pumping {sup 129}Xe in low magnetic field below an NMR spectrometer and subsequent transfer of the gas to high magnetic field is described. NMR studies of the highly polarized gas adsorbed onto powdered samples with low to moderate surface areas are now possible. For instance, NMR studies of optically-pumped xenon adsorbed onto polyacrylic acid show that xenon has a large interaction with the surface. By modeling the low temperature data in terms of a sticking probability and the gas phase xenon-xenon interaction, the diffusion coefficient for xenon at the surface of the polymer is determined. The sensitivity enhancement afforded by optical pumping also allows the NMR observation of xenon thin films frozen onto the inner surfaces of different sample cells. The geometry of the thin films results in interesting line shapes that are due to the bulk magnetic susceptibility of xenon. Experiments are also described that combine optical pumping with optical detection for high sensitivity in low magnetic field to observe the quadrupoler evolution of 131 Xe spins at the surface of the pumping cells. In cells with macroscopic asymmetry, a residual quadrupolar interaction causes a splitting in the {sup 131}Xe NMR frequencies in bare Pyrex glass cells and cells with added hydrogen.

  20. Decentralized method for complex task allocation in massive MAS

    NASA Astrophysics Data System (ADS)

    Brahmi, Zaki; Gammoudi, M. M.

    2008-06-01

    Task allocation is still a fundamental problem in Multi-Agents System (MAS). It allows the formation a coalition of agents to cooperate together in order to carry out a complex task. Generally, the process of task allocation requires calculating the value of all the possible allocations, then determining which optimal. In the context of Massive Multi-Agent Systems (MMAS), one agent generates all the possible coalitions and then calculates the value of each, is inefficient. Moreover, the traditional approaches based on the negotiation between agents, are impractical because of the complexity of communications between agents. In this paper we propose a decentralized method, based on grouping agents using the Formal Concepts Analysis (FCA) approach for the task allocation in MMAS. In our model, agents are fully cooperative and each task is composed of several subtasks. The proposed solution is based on two steps: i) computing groups of agents having similar characteristics in the objective to distribute the task allocation process among agents and minimize the communication between agents. ii) Finding the optimal allocation by sharing the task allocation process among groups of agents.

  1. jsNMR: an embedded platform-independent NMR spectrum viewer.

    PubMed

    Vosegaard, Thomas

    2015-04-01

    jsNMR is a lightweight NMR spectrum viewer written in JavaScript/HyperText Markup Language (HTML), which provides a cross-platform spectrum visualizer that runs on all computer architectures including mobile devices. Experimental (and simulated) datasets are easily opened in jsNMR by (i) drag and drop on a jsNMR browser window, (ii) by preparing a jsNMR file from the jsNMR web site, or (iii) by mailing the raw data to the jsNMR web portal. jsNMR embeds the original data in the HTML file, so a jsNMR file is a self-transforming dataset that may be exported to various formats, e.g. comma-separated values. The main applications of jsNMR are to provide easy access to NMR data without the need for dedicated software installed and to provide the possibility to visualize NMR spectra on web sites. PMID:25641013

  2. Medical applications of NMR imaging and NMR spectroscopy with stable isotopes. Summary

    SciTech Connect

    Matwiyoff, N.A.

    1983-01-01

    The current status of NMR imaging and NMR spectroscopy are summarized. For the most part examples from the March 1983 Puerto Rico symposium are used to illustrate the utility of NMR in medicine. 18 refs., 5 figs.

  3. The use of a selective saturation pulse to suppress t1 noise in two-dimensional (1)H fast magic angle spinning solid-state NMR spectroscopy.

    PubMed

    Robertson, Aiden J; Pandey, Manoj Kumar; Marsh, Andrew; Nishiyama, Yusuke; Brown, Steven P

    2015-11-01

    A selective saturation pulse at fast magic angle spinning (MAS) frequencies (60+kHz) suppresses t1 noise in the indirect dimension of two-dimensional (1)H MAS NMR spectra. The method is applied to a synthetic nucleoside with an intense methyl (1)H signal due to triisopropylsilyl (TIPS) protecting groups. Enhanced performance in terms of suppressing the methyl signal while minimising the loss of signal intensity of nearby resonances of interest relies on reducing spin diffusion - this is quantified by comparing two-dimensional (1)H NOESY-like spin diffusion spectra recorded at 30-70kHz MAS. For a saturation pulse centred at the methyl resonance, the effect of changing the nutation frequency at different MAS frequencies as well as the effect of changing the pulse duration is investigated. By applying a pulse of duration 30ms and nutation frequency 725Hz at 70kHz MAS, a good compromise of significant suppression of the methyl resonance combined with the signal intensity of resonances greater than 5ppm away from the methyl resonance being largely unaffected is achieved. The effectiveness of using a selective saturation pulse is demonstrated for both homonuclear (1)H-(1)H double quantum (DQ)/single quantum (SQ) MAS and (14)N-(1)H heteronuclear multiple quantum coherence (HMQC) two-dimensional solid-state NMR experiments. PMID:26432398

  4. The use of a selective saturation pulse to suppress t1 noise in two-dimensional 1H fast magic angle spinning solid-state NMR spectroscopy

    NASA Astrophysics Data System (ADS)

    Robertson, Aiden J.; Pandey, Manoj Kumar; Marsh, Andrew; Nishiyama, Yusuke; Brown, Steven P.

    2015-11-01

    A selective saturation pulse at fast magic angle spinning (MAS) frequencies (60+ kHz) suppresses t1 noise in the indirect dimension of two-dimensional 1H MAS NMR spectra. The method is applied to a synthetic nucleoside with an intense methyl 1H signal due to triisopropylsilyl (TIPS) protecting groups. Enhanced performance in terms of suppressing the methyl signal while minimising the loss of signal intensity of nearby resonances of interest relies on reducing spin diffusion - this is quantified by comparing two-dimensional 1H NOESY-like spin diffusion spectra recorded at 30-70 kHz MAS. For a saturation pulse centred at the methyl resonance, the effect of changing the nutation frequency at different MAS frequencies as well as the effect of changing the pulse duration is investigated. By applying a pulse of duration 30 ms and nutation frequency 725 Hz at 70 kHz MAS, a good compromise of significant suppression of the methyl resonance combined with the signal intensity of resonances greater than 5 ppm away from the methyl resonance being largely unaffected is achieved. The effectiveness of using a selective saturation pulse is demonstrated for both homonuclear 1H-1H double quantum (DQ)/single quantum (SQ) MAS and 14N-1H heteronuclear multiple quantum coherence (HMQC) two-dimensional solid-state NMR experiments.

  5. Polarization transfer NMR imaging

    DOEpatents

    Sillerud, Laurel O. (Los Alamos, NM); van Hulsteyn, David B. (Santa Fe, NM)

    1990-01-01

    A nuclear magnetic resonance (NMR) image is obtained with spatial information modulated by chemical information. The modulation is obtained through polarization transfer from a first element representing the desired chemical, or functional, information, which is covalently bonded and spin-spin coupled with a second element effective to provide the imaging data. First and second rf pulses are provided at first and second frequencies for exciting the imaging and functional elements, with imaging gradients applied therebetween to spatially separate the nuclei response for imaging. The second rf pulse is applied at a time after the first pulse which is the inverse of the spin coupling constant to select the transfer element nuclei which are spin coupled to the functional element nuclei for imaging. In a particular application, compounds such as glucose, lactate, or lactose, can be labeled with .sup.13 C and metabolic processes involving the compounds can be imaged with the sensitivity of .sup.1 H and the selectivity of .sup.13 C.

  6. EASY-GOING DUMBO on-spectrometer optimisation of phase modulated homonuclear decoupling sequences in solid-state NMR

    NASA Astrophysics Data System (ADS)

    Grimminck, Dennis L. A. G.; Vasa, Suresh K.; Meerts, W. Leo; Kentgens, Arno P. M.; Brinkmann, Andreas

    2011-06-01

    A one-step many-parameter optimisation scheme for phase modulated proton homonuclear decoupling sequences in solid-state NMR is presented. Phase modulations, parameterised by DUMBO Fourier coefficients, were optimised using a Covariance Matrix Adaptation Evolution Strategies algorithm. Our method, denoted EASY-GOING DUMBO, starts with featureless spectra and optimises proton-proton decoupling, during either proton or carbon signal detection. Optimisations at moderate sample magic angle spinning (MAS) frequencies and medium radio-frequency (rf) field strengths resulted in solutions closely resembling (e)DUMBO. Application of EASY-GOING DUMBO for optimisation at very high 680 kHz rf field strength, 12.5 kHz MAS on a 400 MHz NMR spectrometer resulted in a new solution, with competitively resolved proton spectra.

  7. Structure and ionic interactions of organic-inorganic composite polymer electrolytes studied by solid-state NMR and Raman spectroscopy.

    PubMed

    Joo, Chan Gyu; Bronstein, Lyudmila M; Karlinsey, Robert L; Zwanziger, Josef W

    2002-01-01

    Solid-state NMR studies of composite polymer electrolytes are reported. The materials consist of polyethylene oxide and an organic inorganic composite, together with a lithium salt, and are candidates for electrolytes in solid-state lithium ion batteries. Silicon and aluminum MAS and multiple quantum MAS are used to characterize the network character of the organic-inorganic composite, and spin diffusion measurements are used to determine the nanostructure of the polymer/composite blending. Multiple quantum spin counting is used to measure the ion aggregation. The NMR results are supported by Raman spectra, calorimetry, and impedance spectroscopy. From these experiments it is concluded that the composite suppresses polymer crystallization without suppressing its local mobility, and also suppresses the tendency for the ions to aggregate. This polymer composite thus appears very promising for application in lithium ion batteries. PMID:12469813

  8. IMPROVED BALANCED INCOMPLETE FACTORIZATION RAFAEL BRU, JOSE MARIN, JOSE MAS AND MIROSLAV TUMA

    E-print Network

    Bru, Rafael

    IMPROVED BALANCED INCOMPLETE FACTORIZATION RAFAEL BRU, JOS´E MAR´IN, JOS´E MAS AND MIROSLAV T°UMA, J. Mar´in, J. Mas and M. T°uma, SIAM J. Sci. Comput., 30 (2008), pp. 2302­ 2318]. The improvements Prague 8, Czech Republic, (tuma@cs.cas.cz). 1 #12;2 R. BRU, J. MAR´IN, J. MAS AND M. T°UMA

  9. A "special perspectives" issue: Recent achievements and new directions in biomolecular solid state NMR

    NASA Astrophysics Data System (ADS)

    Tycko, Robert

    2015-04-01

    Twenty years ago, applications of solid state nuclear magnetic resonance (NMR) methods to real problems involving biological systems or biological materials were few and far between. Starting in the 1980s, a small number of research groups had begun to explore the possibility of obtaining structural and dynamical information about peptides, proteins, and other biopolymers from solid state NMR spectra. Progress was initially slow due to the relatively primitive state of solid state NMR probes, spectrometers, sample preparation methods, and pulse sequence techniques, coupled with the small number of people contributing to this research area. By the early 1990s, with the advent of new ideas about pulse sequence techniques such as dipolar recoupling, improvements in techniques for orienting membrane proteins and in technology for magic-angle spinning (MAS), improvements in the capabilities of commercial NMR spectrometers, and general developments in multidimensional spectroscopy, it began to appear that biomolecular solid state NMR might have a viable future. It was not until 1993 that the annual number of publications in this area crept above twenty.

  10. How the Fourteen Most Stable CH4P2 Isomers InterconvertsAn ab Initio/NMR Study Alk Dransfeld, Luc Landuyt, Michaela Flock, Minh Tho Nguyen,*, and

    E-print Network

    Nguyen, Minh Tho

    How the Fourteen Most Stable CH4P2 Isomers InterconvertsAn ab Initio/NMR Study Alk Dransfeld, Luc for the parent unsaturated phospho-organic molecules with CP2 backbone. Within the 14 relevant isomers of CH4P2 that this isomer should be kinetically stable as isolated molecule. Introduction In PnCmHr molecules

  11. 93Nb NMR and DFT investigation of the polymorphs of NaNbO3.

    PubMed

    Johnston, Karen E; Griffin, John M; Walton, Richard I; Dawson, Daniel M; Lightfoot, Philip; Ashbrook, Sharon E

    2011-04-28

    Sodium niobate (NaNbO(3)) has a particularly complex phase diagram, with a series of phase transitions as a function of temperature and pressure, and even at room temperature a number of different structural variations have been suggested. Recent work has demonstrated that bulk powders of NaNbO(3), prepared using a variety of synthetic approaches, contain a mixture of perovskite phases; the commonly reported Pbcm phase and a second, polar phase tentatively identified as belonging to space group P2(1)ma. The two phases exhibit very similar (23)Na MAS NMR spectra, although high-resolution MQMAS spectra were able to distinguish between them. Here, we investigate whether different perovskite polymorphs can be distinguished and/or identified using a variety of (93)Nb NMR methods, including MAS, MQMAS and wideline experiments. We compare the experimental results obtained for these more common perovskite materials to those for the metastable ilmenite polymorph of NaNbO(3). Our experimental results are supported by first-principles calculations of NMR parameters using a planewave pseudopotential approach. The calculated NMR parameters appear very different for each of the phases investigated, but high forces on the atoms indicate many of the structural models derived from diffraction require optimisation of the atomic coordinates. After geometry optimisation, most of these perovskite phases exhibit very similar NMR parameters, in contrast to recent work where it was suggested that (93)Nb provides a useful tool for distinguishing NaNbO(3) polymorphs. Finally, we consider the origin of the quadrupolar coupling in these materials, and its dependence on the deviation from ideality of the NbO(6) octahedra. PMID:21423997

  12. NMR Imaging: Instrumentation and Techniques

    NASA Astrophysics Data System (ADS)

    Tingle, Jeremy Mark

    Available from UMI in association with The British Library. This thesis presents three original contributions to the field of Nuclear Magnetic Resonance (NMR): the experimental framework and analysis for the measurement of a new imaging parameter to describe perfusion; the measurement and analysis of magnetic field inhomogeneity and a practical correction system for their reduction; a novel system for the synchronous control of NMR experiments based on the microprogrammed concept. The thesis begins with an introduction to the theory of NMR. The application of NMR to imaging is also introduced with emphasis on the techniques which developed into those in common use today. Inaccurate determination of the traditional NMR parameters (T_1 and T_2 and the molecular diffusion coefficient) can be caused by non-diffusive fluid movement within the sample. The experimental basis for determining a new imaging parameter --the Perfusion coefficient--is presented. This provides a measure of forced isotropic fluid motion through an organ or tissue. The instrumentation required for conducting NMR experiments is described in order to introduce the contribution made in this area during this research: A sequence controller. The controller is based on the concept of microprogramming and enables completely synchronous output of 128 bits of data. The software for the generation and storage of control data and the regulation of the data to provide experimental control is microcomputer based. It affords precise and accurate regulation of the magnetic field gradients, the rf synthesizer and the spectrometer for spectroscopic and imaging applications. Fundamental to the science of NMR is the presence of a magnetic field. A detailed study of the analysis of magnetic field inhomogeneity in terms of spherical harmonics is presented. The field of a whole body imaging system with poor inhomogeneity was measured and analyzed to determine and describe the components of the inhomogeneity. Finally a description is given of the design and application of practical methods for reducing the dominant inhomogeneities.

  13. Structural Analysis of Nanoscale Self-Assembled Discoidal Lipid Bilayers by Solid-State NMR Spectroscopy

    PubMed Central

    Li, Ying; Kijac, Aleksandra Z.; Sligar, Stephen G.; Rienstra, Chad M.

    2006-01-01

    Nanodiscs are an example of discoidal nanoscale self-assembled lipid/protein particles similar to nascent high-density lipoproteins, which reduce the risk of coronary artery disease. The major protein component of high-density lipoproteins is human apolipoprotein A-I, and the corresponding protein component of Nanodiscs is membrane scaffold protein 1 (MSP1), a 200-residue lipid-binding domain of human apolipoprotein A-I. Here we present magic-angle spinning (MAS) solid-state NMR studies of uniformly 13C,15N-labeled MSP1 in polyethylene glycol precipitated Nanodiscs. Two-dimensional MAS 13C-13C correlation spectra show excellent microscopic order of MSP1 in precipitated Nanodiscs. Secondary isotropic chemical shifts throughout the protein are consistent with a predominantly helical structure. Moreover, the backbone conformations of prolines derived from their 13C chemical shifts are consistent with the molecular belt model but not the picket fence model of lipid-bound MSP1. Overall comparison of experimental spectra and 13C chemical shifts predicted from several structural models also favors the belt model. Our study thus supports the belt model of Nanodisc structure and demonstrates the utility of MAS NMR to study the structure of high molecular weight lipid-protein complexes. PMID:16905610

  14. Solid-State NMR Characterization of Aluminum Oxide Nanofibers

    SciTech Connect

    Cross, Jennifer L.; Tuttle, Ricky W.; Ramsier, Rex D.; Espe, Mathew

    2006-07-24

    Aluminum oxide nanofibers have been generated by an electrospinning process, creating fibers with diameters on the nanometer scale and aspect ratios greater than a thousand. These nanofibers have the potential of providing enhanced catalytic properties, due to their large surface area and controllable compositions. Solid-state NMR is being used to investigate both the bulk and surface properties of these materials. 27Al NMR has shown that no chemistry occurs during the electrospinning process, even though potentials in excess of 20 kV are applied to the sample. Thermal treatment of the fibers to convert them to alumina results in the formation of different phases, with the phases identified by the relative populations of 4-, 5-, and 6-coordinate alumina sites. Heating to 525°C or 1200°C produces a species similar to the catalytically active gamma-phase or conversion of the nanofibers into the thermodynamically stable ?-alumina phase, respectively. 1H-27Al CP/MAS has shown that the ?-alumina phase has a low population of surface hydroxyls, whereas the “gamma-alumina” form has a much higher fraction of 5-coordinate sites, compared to materials synthesized by traditional techniques. Organophosphates are being used as molecular probes in the characterization of the nanofiber surfaces. 31P CP/MAS data has revealed the presence of mono-, bi- and tri-denate bound phosphate groups on the surface, with the onset of surface alumina dissolution with sample heating. The application of 1H-31P HETCOR shows that the three different types of bound organophosphates are intermixed, rather than there being separate domains for each type. 31P-27Al CP is also being used to distinguish the types of surface alumina sites bound to the phosphate species.

  15. VCU Human Resources http://hr.vcu.edu/

    E-print Network

    Hammack, Richard

    ; stewardship; compliance; and a commitment to integrity and ethical behavior by example in his/her day web pages. If your department stockpiles copies of Payroll or HR forms they have not used for some

  16. University Policy No.: HR6400 Classification: Human Resources

    E-print Network

    Victoria, University of

    1 University Policy No.: HR6400 Classification: Human Resources PROFESSIONAL DEVELOPMENT Approving eligible for reimbursement, as follows: a) travel (including accommodation), registration fees and other time to pursue professional development activities in accordance with the purpose of this Policy. #12

  17. University Policy No.: HR6420 Classification: Human Resources

    E-print Network

    Victoria, University of

    University Policy No.: HR6420 Classification: Human Resources PROFESSIONAL DEVELOPMENT Approving Expenses The following expenses can be claimed for reimbursement: a. travel (including accommodation guidelines that will be developed and revised from time to time in consultation with the Professional

  18. NUMBER: HR 1.39 SECTION: Human Resources

    E-print Network

    Almor, Amit

    1 NUMBER: HR 1.39 SECTION: Human Resources SUBJECT: Disciplinary Action and Termination for Cause Authorized by: Jane M. Jameson Issued by: Division of Human Resources OF HUMAN RESOURCES HAS THE AUTHORITY TO INTERPRET THE UNIVERSITY'S HUMAN RESOURCES POLICIES

  19. Does HR add value? : diverse perspectives on human capital management

    E-print Network

    Eckman, Jeffrey M

    2006-01-01

    The human resources (HR) function has evolved significantly over the past several decades. It has grown in maturity and influence while simultaneously enduring great criticism from employees and managers. Meanwhile, ...

  20. Combined experimental and computational NMR study of crystalline and amorphous zeolitic imidazolate frameworks.

    PubMed

    Baxter, Emma F; Bennett, Thomas D; Mellot-Draznieks, Caroline; Gervais, Christel; Blanc, Frédéric; Cheetham, Anthony K

    2015-10-14

    Zeolitic imidazolate frameworks (ZIFs) have attracted great interest in recent years due to their high chemical and thermal stability with promising applications in gas storage and separations. We investigate the structures of three different crystalline ZIFs - ZIF-4, ZIF-8, ZIF-zni - and their amorphous counterparts using high field (13)C and (15)N CP MAS NMR. The high field (20 T) allows for the observation of all crystallographically independent carbon and nitrogen atoms in the crystalline ZIFs. Combining our experimental results with density functional theory calculations enabled the assignment of all chemical shifts. The crystalline spectra reveal the potential of high field NMR to distinguish between two ZIF polymorphs, ZIF-4 and ZIF-zni, with identical [Zn(C3H3N2)2] chemical compositions. (13)C and (15)N CP MAS NMR data obtained for the amorphous ZIFs clearly showed signal broadening upon amorphization, confirming the retention of chemical composition and the structural similarity of amorphous ZIF-4 and ZIF-zni. In the case of amorphous ZIF-8, we present evidence for the partial de-coordination of the 2-methyl imidazole linker. PMID:26351979

  1. Molecular ordering of mixed surfactants in mesoporous silicas: A solid-state NMR study

    SciTech Connect

    Kobayashi, Takeshi; Mao, Kanmi; Wang, Shy-Guey; Lin, Victor S.-Y.; Pruski, Marek

    2011-02-17

    The use of mixed surfactants in the synthesis of mesoporous silica nanoparticles (MSNs) is of importance in the context of adjusting pore structures, sizes and morphologies. In the present study, the arrangement of molecules in micelles produced from a mixture of two surfactants, cetyltrimethylammonium bromide (CTAB) and cetylpyridinium bromide (CPB) was detailed by solid-state NMR spectroscopy. Proximities of methyl protons in the trimethylammonium headgroup of CTAB and protons in the pyridinium headgroup of CPB were observed under fast magic angle spinning (MAS) by {sup 1}H-{sup 1}H double quantum (DQ) MAS NMR and NOESY. This result suggested that CTAB and CPB co-exist in the pores without forming significant monocomponent domain structures. {sup 1}H-{sup 29}Si heteronuclear correlation (HETCOR) NMR showed that protons in the headgroups of CTAB are in closer proximity to the silica surface than those in the CPB headgroups. The structural information obtained in this investigation leads to better understanding of the mechanisms of self-assembly and their role in determining the structure and morphology of mesoporous materials.

  2. Mas receptor deficiency exacerbates lipopolysaccharide-induced cerebral and systemic inflammation in mice.

    PubMed

    Oliveira-Lima, Onésia C; Pinto, Mauro C X; Duchene, Johan; Qadri, Fatimunnisa; Souza, Laura L; Alenina, Natalia; Bader, Michael; Santos, Robson A S; Carvalho-Tavares, Juliana

    2015-12-01

    Beyond the classical actions of the renin-angiotensin system on the regulation of cardiovascular homeostasis, several studies have shown its involvement in acute and chronic inflammation. The G protein-coupled receptor Mas is a functional binding site for the angiotensin-(1-7); however, its role in the immune system has not been fully elucidated. In this study, we evaluated the effect of genetic deletion of Mas receptor in lipopolysaccharide (LPS)-induced systemic and cerebral inflammation in mice. Inflammatory response was triggered in Mas deficient (Mas(-/-)) and C57BL/6 wild-type (WT) mice (8-12 weeks-old) by intraperitoneal injection of LPS (5mg/kg). Mas(-/-) mice presented more intense hypothermia compared to WT mice 24h after LPS injection. Systemically, the bone marrow of Mas(-/-) mice contained a lower number of neutrophils and monocytes 3h and 24h after LPS injection, respectively. The plasma levels of inflammatory mediators KC, MCP-1 and IL-10 were higher in Mas(-/-) mice 24h after LPS injection in comparison to WT. In the brain, Mas(-/-) animals had a significant increase in the number of adherent leukocytes to the brain microvasculature compared to WT mice, as well as, increased number of monocytes and neutrophils recruited to the pia-mater. The elevated number of adherent leukocytes on brain microvasculature in Mas(-/-) mice was associated with increased expression of CD11b - the alpha-subunit of the Mac-1 integrin - in bone marrow neutrophils 3h after LPS injection, and with increased brain levels of chemoattractants KC, MIP-2 and MCP-1, 24h later. In conclusion, we demonstrated that Mas receptor deficiency results in exacerbated inflammation in LPS-challenged mice, which suggest a potential role for the Mas receptor as a regulator of systemic and brain inflammatory response induced by LPS. PMID:26297425

  3. NMR characterization of shocked quartz

    SciTech Connect

    Boslough, M.B.; Cygan, R.T.; Assink, R.A.; Kirkpatrick, R.J.

    1994-03-01

    We have characterized experimentally and naturally-shocked quartz (both synthetic and natural samples) by solid state nuclear magnetic resonance (NMR) spectroscopy. Relaxation analysis of experimentally-shocked samples provides a means for quantitative characterization of the amorphous/disordered silica component NMR spectra demonstrate that magnetization in both the amorphous and crystalline components follows power-law behavior as a function of recycle time. This observation is consistent with the relaxation of nuclear spins by paramagnetic impurities. A fractal dimension can be extracted from the power-law exponent associated with each phase, and relative abundances can be extracted from integrated intensities of deconvolved peaks. NMR spectroscopy of naturally-shocked sandstone from Meteor Crater, Arizona (USA) led to the discovery of a new amorphous hydroxylated silica phase. Solid state NMR spectra of both experimentally and naturally shocked quartz were unexpectedly rich in microstructural information, especially when combined with relaxation analysis and cross-polarization studies. We suggest solid state NMR as a potentially useful tool for examining shock-induced microstructural changes in other inorganic compounds, with possible implications for shock processing of structural ceramics.

  4. Coherent and stochastic averaging in solid-state NMR

    NASA Astrophysics Data System (ADS)

    Nevzorov, Alexander A.

    2014-12-01

    A new approach for calculating solid-state NMR lineshapes of uniaxially rotating membrane proteins under the magic-angle spinning conditions is presented. The use of stochastic Liouville equation (SLE) allows one to account for both coherent sample rotation and stochastic motional averaging of the spherical dipolar powder patterns by uniaxial diffusion of the spin-bearing molecules. The method is illustrated via simulations of the dipolar powder patterns of rigid samples under the MAS conditions, as well as the recent method of rotational alignment in the presence of both MAS and rotational diffusion under the conditions of dipolar recoupling. It has been found that it is computationally more advantageous to employ direct integration over a spherical grid rather than to use a full angular basis set for the SLE solution. Accuracy estimates for the bond angles measured from the recoupled amide 1H-15N dipolar powder patterns have been obtained at various rotational diffusion coefficients. It has been shown that the rotational alignment method is applicable to membrane proteins approximated as cylinders with radii of approximately 20 Å, for which uniaxial rotational diffusion within the bilayer is sufficiently fast and exceeds the rate 2 × 105 s-1.

  5. Graduate trainee -Corporate HR The Corporate HR unit at Group level in Statkraft is responsible for Organisational development initiatives,

    E-print Network

    Gerhardy, Philipp

    , and the company's Employer Branding activities. The unit is also overall responsible for strategic HR policies and cultural background Competitive terms of employment and excellent benefit schemes Søknadsfrist: 20

  6. Elemental abundances of the B and A stars. 2: Gamma Geminorum, HD 60825, 7 Sextantis, HR 4817, and HR 5780

    NASA Technical Reports Server (NTRS)

    Adelman, Saul J.; Philip, A. G. Davis

    1994-01-01

    We extend fine analyses of the B and A stars, gamma Geminorum, 7 Sextantis, HR 4817, and HR 5780 using additional spectroscopic data from the Kitt Peak National Observatory (KPNO) coude feed telescope with a TI CCD, camera 5, and grating A, and ATLAS9 model atmospheres. In addition we study HD 60825, which had colors similar to the FHB A stars, but was found to be a Population I star. HD 60825, as is gamma Gem, is a sharp-lined early-A star with nearly solar derived abundances. HR 5780 and 7 Sex are also examples of stars which for the most part have solar abundances. The newly derived abundances for HR 4817 reveal important differences with respect to 53 Tau, a somewhat similar HgMn star.

  7. SCHOOL OF MATHEMATICS AND STATISTICS Spring Semester MAS370 Sampling Theory and Design of

    E-print Network

    MAS370 SCHOOL OF MATHEMATICS AND STATISTICS Spring Semester 2013­2014 MAS370 Sampling Theory on whether they are a current smoker, ex-smoker or have never smoked (labelled 1, 2, 3 respectively). Give 2 design. (4 marks) participant smoking experimental treatment status (1, 2, 3) condition (1, 2, 3) (P, A

  8. An Assistance Infrastructure to Inform Agents for Decision Support in Open MAS

    E-print Network

    López-Sánchez, Maite

    An Assistance Infrastructure to Inform Agents for Decision Support in Open MAS Pablo Almajano1 in Open MAS. Execution infrastructures me- diate agents interactions while enforcing the rules imposed by the organisa- tion. Although infrastructures usually provide open specifications to agents, understanding

  9. SCHOOL OF MATHEMATICS AND STATISTICS Spring Semester MAS422 Magnetohydrodynamics 2 hours

    E-print Network

    " (i) An inviscid, perfectly conducting, incompressible uid, is permeated by a uniform magnetic eld B0) and at (x = /p)? (2 marks) MAS422 4 Continued #12;MAS422 # (i) A magnetic eld is given by B = B0 ( y r2s · )G together with Maxwell's equation · B = 0 and the incompressibility con- dition · u = 0 to show

  10. SCHOOL OF MATHEMATICS AND STATISTICS Spring Semester MAS273 Statistical Modelling 2 hours

    E-print Network

    . The vari- ables are Energy (E) - usable energy recovered from waste (kcal/kg), Plastic (PL) - % plastic. MAS273 1 Turn Over #12;MAS273 1 This question concerns data on the energy content of municipal waste by weight, Water (W) - % moisture by weight. n heaps of municipal waste were obtained and the regression

  11. A generic, computerized nuclear materials accountability system (NucMAS) and its layered products

    SciTech Connect

    Davis, Jr, J M

    1989-01-01

    NucMAS provides a material balance area with a computerized data management system for nuclear materials accountability. NucMAS is a generic application. It handles the data management and reporting functions for different processing facilities by storing all process-specific information as data rather than procedure. A NucMAS application is configured for each facility it supports. NucMAS and its layered products are compatible with three types of data clients. Core NucMAS has a screen-oriented user interface to support the accountability clerk as a client. Accountability clerks enter data from operating logs and laboratory analyses one to three days after actual processing. Layered products support process operators and automated systems as near-real-time and real-time data clients. The core and layered products use a data-driven approach which results in software that is configurable and maintainable. 3 refs., 5 figs.

  12. Push-through Direction Injectin NMR Automation

    EPA Science Inventory

    Nuclear magnetic resonance (NMR) and mass spectrometry (MS) are the two major spectroscopic techniques successfully used in metabolomics studies. The non-invasive, quantitative and reproducible characteristics make NMR spectroscopy an excellent technique for detection of endogeno...

  13. "Solvent Effects" in 1H NMR Spectroscopy.

    ERIC Educational Resources Information Center

    Cavaleiro, Jose A. S.

    1987-01-01

    Describes a simple undergraduate experiment in chemistry dealing with the "solvent effects" in nuclear magnetic resonance (NMR) spectroscopy. Stresses the importance of having students learn NMR spectroscopy as a tool in analytical chemistry. (TW)

  14. Perturbation of nuclear spin polarizations in solid state NMR of nitroxide-doped samples by magic-angle spinning without microwaves

    SciTech Connect

    Thurber, Kent R. Tycko, Robert

    2014-05-14

    We report solid state {sup 13}C and {sup 1}H nuclear magnetic resonance (NMR) experiments with magic-angle spinning (MAS) on frozen solutions containing nitroxide-based paramagnetic dopants that indicate significant perturbations of nuclear spin polarizations without microwave irradiation. At temperatures near 25 K, {sup 1}H and cross-polarized {sup 13}C NMR signals from {sup 15}N,{sup 13}C-labeled L-alanine in trinitroxide-doped glycerol/water are reduced by factors as large as six compared to signals from samples without nitroxide doping. Without MAS or at temperatures near 100 K, differences between signals with and without nitroxide doping are much smaller. We attribute most of the reduction of NMR signals under MAS near 25 K to nuclear spin depolarization through the cross-effect dynamic nuclear polarization mechanism, in which three-spin flips drive nuclear polarizations toward equilibrium with spin polarization differences between electron pairs. When T{sub 1e} is sufficiently long relative to the MAS rotation period, the distribution of electron spin polarization across the nitroxide electron paramagnetic resonance lineshape can be very different from the corresponding distribution in a static sample at thermal equilibrium, leading to the observed effects. We describe three-spin and 3000-spin calculations that qualitatively reproduce the experimental observations.

  15. Advanced NMR approaches in the characterization of coal. Final technical report, September 1, 1990--August 31, 1993

    SciTech Connect

    Maciel, G.E.

    1993-09-30

    This project addressed two main goals and one much smaller one. The main goals were (1) to improve the significance, reliability and information content in high-resolution NMR (nuclear magnetic resonance) characterization of coal samples and (2) to develop chemically informative NMR imaging techniques for coal. The minor goal was to explore advanced features of dynamic nuclear polarization (DNP) as a technique for coal characterization; this included the development of two DNP probes and the examination of DNP characteristics of various carbonaceous samples, including coals. {sup 13}C NMR advances for coal depended on large-sample MAS devices, employing either cross-polarization (CP) or direct polarization (DP) approaches. CP and DP spin dynamics and their relationships to quantitation and spin counting were elucidated. {sup 1}H NMR studies, based on CRAMPS, dipolar dephasing and saturation with perdeuteropyridine, led to a {sup 1}H NMR-based elucidation of chemical functionality in coal. {sup 1}H and {sup 13}C NMR imaging techniques, based on magic-angle spinning and rotating magnetic field gradients, were developed for introducing chemical shift information (hence, chemical detail) into the spatial imaging of coal. The TREV multiple-pulse sequence was found to be useful in the {sup 1}H CRAMPS imaging of samples like coal.

  16. A SENSITIVE NMR THERMOMETER FOR MULTINUCLEI FT NMR

    EPA Science Inventory

    A pernicious problem in multinuclei FT NMR is accurate measurement of sample temperature. This arises from several factors including widespread use of high-power decoupling, large sample tubes (with potentially large temperature gradients across the sample volume), and lack of su...

  17. HR-1 Mice: A New Inflammatory Acne Mouse Model

    PubMed Central

    Jang, Yong Hyun; Lee, Kyou Chae; Lee, Seok-Jong; Kim, Do Won

    2015-01-01

    Background There is no appropriate in vivo animal model that reflects the inflammatory response of human acne. Objective This study investigated the effect of Propionibacterium acnes on the development of inflammatory acne-like lesions in four mouse strains with different degrees of immune response for the development of an optimal mouse model of inflammatory acne. Methods Human P. acnes suspensions (108 and 109 colony forming unit [CFU]/µl) were injected into the backs of HR-1, BALB/c, vitamin D receptor-knockout (VDR k/o), and severe combined immunodeficiency disease mice. Inflammation levels were evaluated two weeks after injection of P. acnes suspensions. In addition, histopathological examination and immunohistochemical staining of the expressions of inflammatory biomarkers (i.e., CD4+/CD8+ T lymphocytes, neutrophils, myeloperoxidase, interleukin-1?, matrix metalloprotease (MMP)-2, MMP-3, MMP-9, toll-like receptor (TLR)-2, LL-37, and integrin ?6) were performed on tissue specimens. Results The HR-1 mouse strain exhibited the most remarkable inflammatory reaction with epithelial proliferation and microcomedone-like cyst formation. HR-1 mice also demonstrated aberrant integrin expression in the epidermis around both inflamed lesions and newly formed microcomedones. These findings were more prominent in the group receiving 109 CFU/µl P. acnes than 108 CFU/µl. MMP-9 expression in HR-1 mice was also upregulated around the microcomedone-like cysts. Finally, expression levels of TLR-2 and LL-37 were higher in HR-1 and BALB/c mice than the VDR k/o and SCID mice strains. Conclusion P. acnes induces acneiform inflammation with small microcomedones in HR-1 mice. Therefore, the HR-1 mouse strain represents a good candidate for the development of a new inflammatory acne mouse model. PMID:26082581

  18. Local environment and composition of magnesium gallium layered double hydroxides determined from solid-state 1H and 71Ga NMR spectroscopy

    NASA Astrophysics Data System (ADS)

    Petersen, Line Boisen; Lipton, Andrew S.; Zorin, Vadim; Nielsen, Ulla Gro

    2014-11-01

    Ordering of gallium(III) in a series of magnesium gallium (MgGa) layered double hydroxides (LDHs), [Mg1-xGax(OH)2(NO3)x·yH2O] was investigated using solid-state 1H and 71Ga NMR spectroscopy as well as powder X-ray diffraction. Three different proton environments from Mg3sbnd OH, Mg2Gasbnd OH and intergallery water molecules were assigned and quantified using {1H,71Ga} HETCOR and 1H MAS NMR. A single 71Ga site originating from the unique Ga site in the MgGa LDH's was observed in 71Ga MAS and 3QMAS NMR spectra. Both 1H MAS NMR spectra recorded at 21.1 T (900 MHz) and elemental analysis show that the synthesized MgGa LDH's had a lower Mg:Ga ratio than that of the starting reactant solution. The origin of this is the formation of soluble [Ga(OH)4]- complexes formed during synthesis, and not due to formation of insoluble gallium (oxy)hydroxides. No sign of Gasbnd Osbnd Ga connectivities or defects were detected for the MgGa LDH's.

  19. Laplace Inversion of Low-Resolution NMR

    E-print Network

    Stanford University

    Laplace Inversion of Low-Resolution NMR Relaxometry Data Using Sparse Representation Methods PAULA and Engineering, Stanford University, Stanford, CA ABSTRACT: Low-resolution nuclear magnetic resonance (LR-NMR of digital images and signals. In this article, a numerical optimization method for analyzing LR- NMR data

  20. Petrophysical applications of NMR imaging

    SciTech Connect

    Rothwell, W.P.; Vinegar, H.J.

    1985-12-01

    A system for obtaining high-resolution NMR images of oil field cores is described. Separate proton density and T/sub 2/ relaxation images are obtained to distinguish spatial variations of fluid-filled porosity and the physical nature of the pores. Results are presented for typical sandstones.

  1. NMR investigations of molecular dynamics

    NASA Astrophysics Data System (ADS)

    Palmer, Arthur

    2011-03-01

    NMR spectroscopy is a powerful experimental approach for characterizing protein conformational dynamics on multiple time scales. The insights obtained from NMR studies are complemented and by molecular dynamics (MD) simulations, which provide full atomistic details of protein dynamics. Homologous mesophilic (E. coli) and thermophilic (T. thermophilus) ribonuclease H (RNase H) enzymes serve to illustrate how changes in protein sequence and structure that affect conformational dynamic processes can be monitored and characterized by joint analysis of NMR spectroscopy and MD simulations. A Gly residue inserted within a putative hinge between helices B and C is conserved among thermophilic RNases H, but absent in mesophilic RNases H. Experimental spin relaxation measurements show that the dynamic properties of T. thermophilus RNase H are recapitulated in E. coli RNase H by insertion of a Gly residue between helices B and C. Additional specific intramolecular interactions that modulate backbone and sidechain dynamical properties of the Gly-rich loop and of the conserved Trp residue flanking the Gly insertion site have been identified using MD simulations and subsequently confirmed by NMR spin relaxation measurements. These results emphasize the importance of hydrogen bonds and local steric interactions in restricting conformational fluctuations, and the absence of such interactions in allowing conformational adaptation to substrate binding.

  2. QUANTITATIVE 15N NMR SPECTROSCOPY

    EPA Science Inventory

    Line intensities in 15N NMR spectra are strongly influenced by spin-lattice and spin-spin relaxation times, relaxation mechanisms and experimental conditions. Special care has to be taken in using 15N spectra for quantitative purposes. Quantitative aspects are discussed for the 1...

  3. Deuterium Exchange Kinetics by NMR.

    ERIC Educational Resources Information Center

    Roper, G. C.

    1985-01-01

    Describes a physical chemistry experiment which allows such concepts as kinetics, catalysis, isotope shifts, coupling constants, and the use of nuclear magnetic resonance (NMR) for quantitative work to be covered in the same exercise. Background information, experimental procedures used, and typical results obtained are included. (JN)

  4. OBSERVATIONS AND ORBITAL ANALYSIS OF THE GIANT WHITE DWARF BINARY SYSTEM HR 5692

    SciTech Connect

    Stefanik, Robert P.; Torres, Guillermo; Latham, David W.; Landsman, Wayne; Craig, Nathaniel; Murrett, James

    2011-05-15

    We report spectroscopic observations of the red giant star HR 5692, previously known to be a binary system both from other spectroscopic work and from deviations in the astrometric motion detected by the Hipparcos satellite. Earlier International Ultraviolet Explorer (IUE) observations had shown the presence of a hot white dwarf companion to the giant primary. We have combined our radial velocity observations with other existing measurements and with the Hipparcos intermediate astrometric data to determine a complete astrometric-spectroscopic orbital solution, providing the inclination angle for the first time. We also determine an improved parallax for the system of 10.12 {+-} 0.67 mas. We derive the physical properties of the primary, and with an estimate of its mass from stellar evolution models (1.84 {+-} 0.40 M{sub sun}), we infer the mass of the white dwarf companion to be M{sub WD} = 0.59 {+-} 0.12 M{sub sun}. An analysis of an IUE white dwarf spectrum, using our parallax, yields T{sub eff} = 30, 400 {+-} 780 K, log g = 8.25 {+-} 0.15, and a mass M{sub WD} = 0.79 {+-} 0.09 M{sub sun}, in marginal agreement with the dynamical mass.

  5. Host-guest interactions in fluorinated polymer electrolytes: A 7Li-13C NMR study

    NASA Astrophysics Data System (ADS)

    Mustarelli, P.; Quartarone, E.; Capiglia, C.; Tomasi, C.; Ferloni, P.; Magistris, A.

    1999-08-01

    Gel-type electrolytes based on fluorinated polymers are of interest for electrochemical devices. We present a 7Li-13C solid-state NMR and modulated differential scanning calorimetry (MDSC) study of gel electrolytes based on a copolymer poly(vinylidene fluoride) (PVdF)-hexafluoropropylene (HFP) activated with a nonaqueous solution ethylene carbonate (EC)-propylene carbonate (PC)-LiN(CF3SO2)2. We show that the narrowing of the Li lineshape is decoupled from the glass transition. The behavior of the longitudinal relaxation times, T1, confirms that the host polymer matrix simply behaves like a quasiinert cage for the solution. These results are confirmed by 13C NMR at the magic angle (MAS) data, which show that the presence of the polymer does not significantly affect the chemical shift changes induced in the EC/PC carbons by the imide salt.

  6. Origin and correction of magnetic field inhomogeneity at the interface in biphasic NMR samples

    NASA Astrophysics Data System (ADS)

    Martin, Bryan T.; Chingas, G. C.; McDougal, Owen M.

    2012-05-01

    The use of susceptibility matching to minimize spectral distortion of biphasic samples layered in a standard 5 mm NMR tube is described. The approach uses magic angle spinning (MAS) to first extract chemical shift differences by suppressing bulk magnetization. Then, using biphasic coaxial samples, magnetic susceptibilities are matched by titration with a paramagnetic salt. The matched phases are then layered in a standard NMR tube where they can be shimmed and examined. Linewidths of two distinct spectral lines, selected to characterize homogeneity in each phase, are simultaneously optimized. Two-dimensional distortion-free, slice-resolved spectra of an octanol/water system illustrate the method. These data are obtained using a 2D stepped-gradient pulse sequence devised for this application. Advantages of this sequence over slice-selective methods are that acquisition efficiency is increased and processing requires only conventional software.

  7. Chronic nerve injury-induced Mas receptor expression in dorsal root ganglion neurons alleviates neuropathic pain

    PubMed Central

    ZHAO, YUANTING; QIN, YUE; LIU, TUANJIANG; HAO, DINGJUN

    2015-01-01

    Neuropathic pain, which is characterized by hyperalgesia, allodynia and spontaneous pain, is one of the most painful symptoms that can be experienced in the clinic. It often occurs as a result of injury to the peripheral nerves, dorsal root ganglion (DRG), spinal cord or brain. The renin-angiotensin system (RAS) plays an important role in nociception. As an essential component of the RAS, the angiotensin (Ang)-(1–7)/Mas axis may be involved in antinociception. The aim of the present study was to explore the expression pattern of Mas in DRG neurons following chronic nerve injury and examine the effects of Mas inhibition and activation on neuropathic pain in a chronic constriction injury (CCI) rat model. The results showed, that compared with the sham group, CCI caused a time-dependent induction of Mas expression at both the mRNA and the protein levels in DRG neurons. Consistent with the results, isolated DRG neurons showed a time-dependent increase in Ang-(1–7) binding on the cell membrane following the CCI surgery, but not the sham surgery. Compared with the sham control groups, CCI significantly decreased the paw withdrawal latency and threshold, and this was markedly improved and aggravated by intrathecal injection of the selective Mas agonist Ang-(1–7) and the selective Mas inhibitor D-Pro7-Ang-(1–7), respectively. In conclusion, this study has provided the first evidence, to the best of our knowledge, that the Mas expression in DRG neurons is time-dependently induced by chronic nerve injury and that the intrathecal activation and inhibition of Mas can improve and aggravate CCI-induced neuropathic pain, respectively. This study has provided novel insights into the pathophysiological process of neuropathic pain and suggests that the Ang-(1–7)/Mas axis could be an effective therapeutic target for neuropathic pain, warranting further study. PMID:26668645

  8. Role for NMR in structural genomics.

    PubMed

    Kennedy, Michael A; Montelione, Gaetano T; Arrowsmith, Cheryl H; Markley, John L

    2002-01-01

    The 2nd EMSL Workshop on Structural Genomics was held on 28th and 29th July 2000 at the Environmental Molecular Sciences Laboratory at the Department of Energy's Pacific Northwest National Laboratory in Richland, WA. The workshop focused on four topics: 1. The role for NMR in structural and functional genomics; 2. The technical challenges NMR faces for structural and functional genomics; 3. The potential need for a national NMR center for structural and functional genomics in the United States; and 4. Organization of the NMR community. This report summarizes the workshop proceedings and conclusions reached regarding the role of NMR in the emerging fields of structural and functional genomics. PMID:12836706

  9. C NMR Spectra (see p S10)

    E-print Network

    Collum, David B.

    S31 1 H and 13 C NMR Spectra (see p S10) NHBn Me Ph 10 #12;S32 1 H and 13 C NMR Spectra (see p S10) NHBn Me Ph 11 #12;S33 1 H and 13 C NMR Spectra (see p S11) NH-i-Pr n-Bu NH-i-Pr n-Bu 12 Me Me 13 #12;S34 1 H and 13 C NMR Spectra (see p S11)NH-i-Pr Me Ph 14 #12;S35 1 H and 13 C NMR Spectra (see p S11

  10. Contribution of first-principles calculations to multinuclear NMR analysis of borosilicate glasses.

    PubMed

    Soleilhavoup, Anne; Delaye, Jean-Marc; Angeli, Frédéric; Caurant, Daniel; Charpentier, Thibault

    2010-12-01

    Boron-11 and silicon-29 NMR spectra of xSiO(2)-(1-x)B(2)O(3) glasses (x=0.40, 0.80 and 0.83) have been calculated using a combination of molecular dynamics (MD) simulations with density functional theory (DFT) calculations of NMR parameters. Structure models of 200 atoms have been generated using classical force fields and subsequently relaxed at the PBE-GGAlevel of DFT theory. The gauge including projector augmented wave (GIPAW) method is then employed for computing the shielding and electric field gradient tensors for each silicon and boron atom. Silicon-29 MAS and boron-11 MQMAS NMR spectra of two glasses (x=0.40 and 0.80) have been acquired and theoretical spectra are found to well agree with the experimental data. For boron-11, the NMR parameter distributions have been analysed using a Kernel density estimation (KDE) approach which is shown to highlight its main features. Accordingly, a new analytical model that incorporates the observed correlations between the NMR parameters is introduced. It significantly improves the fit of the (11)B MQMAS spectra and yields, therefore, more reliable NMR parameter distributions. A new analytical model for a quantitative description of the dependence of the silicon-29 and boron-11 isotropic chemical shift upon the bond angles is proposed, which incorporates possibly the effect of SiO(2)-B(2)O(3) intermixing. Combining all the above procedures, we show how distributions of Si-O-T and B-O-T (T=Si, B) bond angles can be estimated from the distribution of isotropic chemical shift of silicon-29 and boron-11, respectively. PMID:20818801

  11. SIMPSON: A General Simulation Program for Solid-State NMR Spectroscopy

    NASA Astrophysics Data System (ADS)

    Bak, Mads; Rasmussen, Jimmy T.; Nielsen, Niels Chr.

    2000-12-01

    A computer program for fast and accurate numerical simulation of solid-state NMR experiments is described. The program is designed to emulate a NMR spectrometer by letting the user specify high-level NMR concepts such as spin systems, nuclear spin interactions, RF irradiation, free precession, phase cycling, coherence-order filtering, and implicit/explicit acquisition. These elements are implemented using the Tcl scripting language to ensure a minimum of programming overhead and direct interpretation without the need for compilation, while maintaining the flexibility of a full-featured programming language. Basicly, there are no intrinsic limitations to the number of spins, types of interactions, sample conditions (static or spinning, powders, uniaxially oriented molecules, single crystals, or solutions), and the complexity or number of spectral dimensions for the pulse sequence. The applicability ranges from simple 1D experiments to advanced multiple-pulse and multiple-dimensional experiments, series of simulations, parameter scans, complex data manipulation/visualization, and iterative fitting of simulated to experimental spectra. A major effort has been devoted to optimizing the computation speed using state-of-the-art algorithms for the time-consuming parts of the calculations implemented in the core of the program using the C programming language. Modification and maintenance of the program are facilitated by releasing the program as open source software (General Public License) currently at http://nmr.imsb.au.dk. The general features of the program are demonstrated by numerical simulations of various aspects for REDOR, rotational resonance, DRAMA, DRAWS, HORROR, C7, TEDOR, POST-C7, CW decoupling, TPPM, F-SLG, SLF, SEMA-CP, PISEMA, RFDR, QCPMG-MAS, and MQ-MAS experiments.

  12. SIMPSON: A general simulation program for solid-state NMR spectroscopy

    NASA Astrophysics Data System (ADS)

    Bak, Mads; Rasmussen, Jimmy T.; Nielsen, Niels Chr.

    2011-12-01

    A computer program for fast and accurate numerical simulation of solid-state NMR experiments is described. The program is designed to emulate a NMR spectrometer by letting the user specify high-level NMR concepts such as spin systems, nuclear spin interactions, RF irradiation, free precession, phase cycling, coherence-order filtering, and implicit/explicit acquisition. These elements are implemented using the Tel scripting language to ensure a minimum of programming overhead and direct interpretation without the need for compilation, while maintaining the flexibility of a full-featured programming language. Basicly, there are no intrinsic limitations to the number of spins, types of interactions, sample conditions (static or spinning, powders, uniaxially oriented molecules, single crystals, or solutions), and the complexity or number of spectral dimensions for the pulse sequence. The applicability ranges from simple ID experiments to advanced multiple-pulse and multiple-dimensional experiments, series of simulations, parameter scans, complex data manipulation/visualization, and iterative fitting of simulated to experimental spectra. A major effort has been devoted to optimizing the computation speed using state-of-the-art algorithms for the time-consuming parts of the calculations implemented in the core of the program using the C programming language. Modification and maintenance of the program are facilitated by releasing the program as open source software (General Public License) currently at http://nmr.imsb.au.dk. The general features of the program are demonstrated by numerical simulations of various aspects for REDOR, rotational resonance, DRAMA, DRAWS, HORROR, C7, TEDOR, POST-C7, CW decoupling, TPPM, F-SLG, SLF, SEMA-CP, PISEMA, RFDR, QCPMG-MAS, and MQ-MAS experiments.

  13. Structural investigation of aluminium doped ZnO nanoparticles by solid-state NMR spectroscopy.

    PubMed

    Avadhut, Yamini S; Weber, Johannes; Hammarberg, Elin; Feldmann, Claus; Schmedt auf der Günne, Jörn

    2012-09-01

    The electrical conductivity of aluminium doped zinc oxide (AZO, ZnO:Al) materials depends on doping induced defects and grain structure. This study aims at relating macroscopic electrical conductivity of AZO nanoparticles with their atomic structure, which is non-trivial because the derived materials are heavily disordered and heterogeneous in nature. For this purpose we synthesized AZO nanoparticles with different doping levels and narrow size distribution by a microwave assisted polyol method followed by drying and a reductive treatment with forming gas. From these particles electrically conductive, optically transparent films were obtained by spin-coating. Characterization involved energy-dispersive X-ray analysis, wet chemical analysis, X-ray diffraction, electron microscopy and dynamic light scattering, which provided a basis for a detailed structural solid-state NMR study. A multinuclear ((27)Al, (13)C, (1)H) spectroscopic investigation required a number of 1D MAS NMR and 2D MAS NMR techniques (T(1)-measurements, (27)Al-MQMAS, (27)Al-(1)H 2D-PRESTO-III heteronuclear correlation spectroscopy), which were corroborated by quantum chemical calculations with an embedded cluster method (EEIM) at the DFT level. From the combined data we conclude that only a small part of the provided Al is incorporated into the ZnO structure by substitution of Zn. The related (27)Al NMR signal undergoes a Knight shift when the material is subjected to a reductive treatment with forming gas. At higher (formal) doping levels Al forms insulating (Al, H and C containing) side-phases, which cover the surface of the ZnO:Al particles and increase the sheet resistivity of spin-coated material. Moreover, calculated (27)Al quadrupole coupling constants serve as a spectroscopic fingerprint by which previously suggested point-defects can be identified and in their great majority be ruled out. PMID:22801707

  14. NMR Studies of Thermo-responsive Behavior of an Amphiphilic Poly(asparagine) Derivative in Water

    PubMed Central

    Watanabe, Eiji; Boutis, Gregory S.; Sato, Hiroko; Sekine, Sokei; Asakura, Tetsuo

    2014-01-01

    The thermo-responsive behavior of a unique biocompatible polymer, poly(N-substituted ?/?-asparagine) derivative (PAD), has been studied with several NMR methods. The 1H and 13C solution NMR measurements of the PAD in DMSO-d6 were used to investigate the isolated polymer and perform spectral assignments. By systematic addition of D2O we have tracked structural changes due to aggregation and observed contraction of hydrophilic side chains. Solution and cross polarization / magic angle spinning (CP/MAS) 13C NMR approaches were implemented to investigate the aggregates of the PAD aqueous solution during the liquid to gel transition as the temperature was increased. At temperatures near 20 °C, all of the peaks from the PAD were observed in the 13C CP/MAS and 13C solution NMR spectra, indicating the presence of polymer chain nodes. Increasing the temperature to 40 °C resulted in a partial disentanglement of the nodes due to thermal agitation and further heating resulted in little to no additional structural changes. Deuterium T1–T2 and T2–T2 two-dimensional relaxation spectroscopies using an inverse Laplace transform, were also implemented to monitor the water–PAD interaction during the phase transition. At temperatures near 20 °C the dynamical characteristics of water were manifested into one peak in the deuterium T1–T2 map. Increasing the temperature to 40 °C resulted in several distinguishable reservoirs of water with different dynamical characteristics. The observation of several reservoirs of water at the temperature of gel formation at 40 °C is consistent with a physical picture of a gel involving a network of interconnected polymer chains trapping a fluid. Further increase in temperature to 70 °C resulted in two non-exchanging water reservoirs probed by deuterium T2–T2 measurements. PMID:25614708

  15. Double cross polarization /sup 13/C-NMR experiment in solid fossil fuel structure analysis

    SciTech Connect

    Hagaman, E.W.; Woody, M.C.

    1988-01-01

    The Double Cross Polarization /sup 13/C-MAS/NMR experiment has been used to derive a new operational classification of solid fossil fuels based on chemical reactivity. The method requires labeling reactive sites in the organic matrix with a magnetically active isotope not present in the precursor material, and using the local, isolated dipole-dipole interaction between this nucleus and nearby /sup 13/C nuclei to detect via cross polarization the carbon centers in the vicinity of the label. The technique is a marriage of chemistry and spectroscopy and the information content of the DCP spectra is defined by both partners. /sup 1/H-/sup 13/C-/sup 31/P DCP/MAS /sup 13/C-NMR spectroscopy has been used to statistically describe phenolic ortho-substitution patterns of coals via their aryl phosphinate or phosphate derivatives. In these applications of DCP NMR the new, detailed structure and/or reactivity information is realized by detection of carbon resonances one or more bonds removed from the reaction center, but in a volume element of intramolecular dimensions. To the extent that intermolecular contributions to the spectrum are detected, and not recognized as such, the structure/reactivity correlation is weakened. Direct substitution of phosphorus on the aromatic rings in the organic matrix of the coal is not readily accomplished. This environment potentially can be labeled with fluorine in a selective fashion using newly developed reagents. The possibility of determining the changes in average ring substitution patterns as a function of chemical treatment or coal diagenesis emerges. Recent developments in the field of DCP /sup 13/C NMR are presented.

  16. Solid-state NMR characterization of 69Ga and 71Ga in crystalline solids.

    PubMed

    Ash, Jason T; Grandinetti, Philip J

    2006-09-01

    Gallium model systems containing four- and six-coordinate gallium sites have been investigated using solid-state NMR. Measurement of the isotropic chemical shift and electric field gradient (EFG) have been performed at 9.4 T on alpha-Ga2O3, beta-Ga2O3, LiGaO2, NaGaO2, KGaO2, Ga2(SO4)3, and LaGaO3 using a variety of techniques on both NMR active nuclei (69Ga and 71Ga) including static, high speed magic-angle spinning (MAS), satellite transition (ST) spectroscopy, and rotor-assisted population transfer (RAPT). The chemical shift is found to correlate well with the coordination number, with four-coordinate gallium having values of approximately 50 ppm and six-coordinate gallium having values near 225 ppm (referenced to 1 M gallium nitrate solution). The magnitude of the EFG is found to be correlated to the distortion of the gallium polyhedra, with the strained systems having EFGs of 3 x 10(21) Vm(-2) or more, while the less strained systems have values of 1.5 x 10(21) Vm(-2) or less. A plot of chemical shift versus EFG suggests that solid-state NMR of gallium oxyanions can be more discriminating than liquid state NMR chemical shifts alone. PMID:16755602

  17. NMR chemical shift pattern changed by ammonium sulfate precipitation in cyanobacterial phytochrome Cph1

    PubMed Central

    Song, Chen; Lang, Christina; Kopycki, Jakub; Hughes, Jon; Matysik, Jörg

    2015-01-01

    Phytochromes are dimeric biliprotein photoreceptors exhibiting characteristic red/far-red photocycles. Full-length cyanobacterial phytochrome Cph1 from Synechocystis 6803 is soluble initially but tends to aggregate in a concentration-dependent manner, hampering attempts to solve the structure using NMR and crystallization methods. Otherwise, the Cph1 sensory module (Cph1?2), photochemically indistinguishable from the native protein and used extensively in structural and other studies, can be purified to homogeneity in >10 mg amounts at mM concentrations quite easily. Bulk precipitation of full-length Cph1 by ammonium sulfate (AmS) was expected to allow us to produce samples for solid-state magic-angle spinning (MAS) NMR from dilute solutions before significant aggregation began. It was not clear, however, what effects the process of partial dehydration might have on the molecular structure. Here we test this by running solid-state MAS NMR experiments on AmS-precipitated Cph1?2 in its red-absorbing Pr state carrying uniformly 13C/15N-labeled phycocyanobilin (PCB) chromophore. 2D 13C–13C correlation experiments allowed a complete assignment of 13C responses of the chromophore. Upon precipitation, 13C chemical shifts for most of PCB carbons move upfield, in which we found major changes for C4 and C6 atoms associated with the A-ring positioning. Further, the broad spectral lines seen in the AmS 13C spectrum reflect primarily the extensive inhomogeneous broadening presumably due to an increase in the distribution of conformational states in the protein, in which less free water is available to partake in the hydration shells. Our data suggest that the effect of dehydration process indeed leads to changes of electronic structure of the bilin chromophore and a decrease in its mobility within the binding pocket, but not restricted to the protein surface. The extent of the changes induced differs from the freezing process of the solution samples routinely used in previous MAS NMR and crystallographic studies. AmS precipitation might nevertheless provide useful protein structure/functional information for full-length Cph1 in cases where neither X-ray crystallography nor conventional NMR methods are available. PMID:26284254

  18. NMR chemical shift pattern changed by ammonium sulfate precipitation in cyanobacterial phytochrome Cph1.

    PubMed

    Song, Chen; Lang, Christina; Kopycki, Jakub; Hughes, Jon; Matysik, Jörg

    2015-01-01

    Phytochromes are dimeric biliprotein photoreceptors exhibiting characteristic red/far-red photocycles. Full-length cyanobacterial phytochrome Cph1 from Synechocystis 6803 is soluble initially but tends to aggregate in a concentration-dependent manner, hampering attempts to solve the structure using NMR and crystallization methods. Otherwise, the Cph1 sensory module (Cph1?2), photochemically indistinguishable from the native protein and used extensively in structural and other studies, can be purified to homogeneity in >10 mg amounts at mM concentrations quite easily. Bulk precipitation of full-length Cph1 by ammonium sulfate (AmS) was expected to allow us to produce samples for solid-state magic-angle spinning (MAS) NMR from dilute solutions before significant aggregation began. It was not clear, however, what effects the process of partial dehydration might have on the molecular structure. Here we test this by running solid-state MAS NMR experiments on AmS-precipitated Cph1?2 in its red-absorbing Pr state carrying uniformly (13)C/(15)N-labeled phycocyanobilin (PCB) chromophore. 2D (13)C-(13)C correlation experiments allowed a complete assignment of (13)C responses of the chromophore. Upon precipitation, (13)C chemical shifts for most of PCB carbons move upfield, in which we found major changes for C4 and C6 atoms associated with the A-ring positioning. Further, the broad spectral lines seen in the AmS (13)C spectrum reflect primarily the extensive inhomogeneous broadening presumably due to an increase in the distribution of conformational states in the protein, in which less free water is available to partake in the hydration shells. Our data suggest that the effect of dehydration process indeed leads to changes of electronic structure of the bilin chromophore and a decrease in its mobility within the binding pocket, but not restricted to the protein surface. The extent of the changes induced differs from the freezing process of the solution samples routinely used in previous MAS NMR and crystallographic studies. AmS precipitation might nevertheless provide useful protein structure/functional information for full-length Cph1 in cases where neither X-ray crystallography nor conventional NMR methods are available. PMID:26284254

  19. Complex Organic Materials in the HR 4796A Disk?

    E-print Network

    M. Koehler; I. Mann; Aigen Li

    2008-08-29

    The red spectral shape of the visible to near infrared reflectance spectrum of the sharply-edged ring-like disk around the young main sequence star HR 4796A was recently interpreted as the presence of tholin-like complex organic materials which are seen in the atmosphere and surface of Titan and the surfaces of icy bodies in the solar system. However, we show in this Letter that porous grains comprised of common cosmic dust species (amorphous silicate, amorphous carbon, and water ice) also closely reproduce the observed reflectance spectrum, suggesting that the presence of complex organic materials in the HR 4796 disk is still not definitive.

  20. The fate of the solid matter orbiting HR 4796A

    NASA Technical Reports Server (NTRS)

    Jura, M.; Ghez, A. M.; White, Russell J.; Mccarthy, D. W.; Smith, R. C.; Martin, P. G.

    1995-01-01

    We have obtained optical spectra, 2 micrometers speckle images, and an upper limit to the 800 micrometers flux for HR 4796A, and optical spectra for its physical companion separated by 7.7 arcsecs, HR 4796B. We detect H-beta, H-gamma, and the calcium H and K lines in emission from HR 4796B; these data are consistent with the hypothesis that it is later than spectral type M2 and lies substantially above the main-sequence. From the location of HR 4796B on the H-R diagram, the estimated age of this star is 3 x 10(exp 6) yr, and assuming this age for the entire system, we find from our 2 micrometers speckle data that there is no close stellar companion to HR 4796A (M greater than 0.125 solar mass) between 11 and 120 AU from the star. From the IRAS and ground-based photometry, it seems that there is a hole in the dust distribution around HR 4796A with an inner radius of between approximately 40 and approximately 200 AU. The observed circumstellar dust grains, which lie at D greater than 40 AU from the star, are likely to be at least 3 micrometers in radius in order to be gravitationally bound to HR 4796A, if the circumstellar dust cloud is optically thin. Since they are larger than almost all interstellar grains, the circumstellar dust grains probably grew by coalescence. Because the existing grains at D greater than 40 AU have undergone measurable coalescence, it is possible that particles that presumably once existed at D less than 40 AU, where the collision times were shorter than at D greater than 40 AU, grew into macroscopic objects. A likely explanation for the dust hole is that there is a companion located at about half the inner radius of the dust hole, or between 20 and 100 AU from the star. If such a companion exists, it must have a mass less than 0.125 solar mass. Since grain coalescence has occurred, this putative companion possibly could be a planet.

  1. Structure resolution of Ba{sub 5}Al{sub 3}F{sub 19} and Iivestigation of fluorine ion dynamics by synchrotron powder diffraction, variable-temperature solid-state NMR, and quantum computations.

    SciTech Connect

    Martineau, C.; Fayon, F.; Suchomel, M. R.; Allix, M.; Massiot, D.; Taulelle, F.

    2011-02-23

    The room temperature structure of Ba{sub 5}Al{sub 3}F{sub 19} has been solved using electron microscopy and synchrotron powder diffraction data. One-dimensional (1D) {sup 27}Al and ultrafast magic-angle-spinning (MAS) {sup 19}F NMR spectra have been recorded and are in agreement with the proposed structural model for Ba{sub 5}Al{sub 3}F{sub 19}. The {sup 19}F isotropic chemical shift and {sup 27}Al quadrupolar parameters have been calculated using the CASTEP code from the experimental and density functional theory geometry-optimized structures. After optimization, the calculated NMR parameters of both the {sup 19}F and {sup 27}Al nuclei show improved consistency with the experimental values, demonstrating that the geometry optimization step is necessary to obtain more accurate and reliable structural data. This also enables a complete and unambiguous assignment of the {sup 19}F MAS NMR spectrum of Ba{sub 5}Al{sub 3}F{sub 19}. Variable-temperature 1D MAS {sup 19}F NMR experiments have been carried out, showing the occurrence of fluorine ion mobility. Complementary insights were obtained from both two-dimensional (2D) exchange and 2D double-quantum dipolar recoupling NMR experiments, and a detailed analysis of the anionic motion in Ba{sub 5}Al{sub 3}F{sub 19} is proposed, including the distinction between reorientational processes and chemical exchange involving bond breaking and re-formation.

  2. SEnD NMR: Sensitivity Enhanced n-Dimensional NMR

    PubMed Central

    Gledhill, John M.; Wand, A. Joshua

    2009-01-01

    Sparse sampling offers tremendous potential for overcoming the time limitations imposed by traditional Cartesian sampling of indirectly detected dimensions of multidimensional NMR data. However, in many instances sensitivity rather than time remains of foremost importance when collecting data on protein samples. Here we explore how to optimize the collection of radial sampled multidimensional NMR data to achieve maximal signal-to-noise. A method is presented that exploits a rigorous definition of the minimal set of radial sampling angles required to resolve all peaks of interest in combination with a fundamental statistical property of radial sampled data. The approach appears general and can achieve a substantial sensitivity advantage over Cartesian sampling for the same total data acquisition time. Termed Sensitivity Enhanced n-Dimensional or SEnD NMR, the method involves three basic steps. First, data collection is optimized using routines to determine a minimal set of radial sampling angles required to resolve frequencies in the radially sampled chemical shift evolution dimensions. Second, appropriate combinations of experimental parameters (transients and increments) are defined by simple statistical considerations in order to optimize signal-to-noise in single angle frequency domain spectra. Finally, the data is processed with a direct multidimensional Fourier transform and a statistical artifact and noise removal step is employed. PMID:20004602

  3. Cassini's Maneuver Automation Software (MAS) Process: How to Successfully Command 200 Navigation Maneuvers

    NASA Technical Reports Server (NTRS)

    Yang, Genevie Velarde; Mohr, David; Kirby, Charles E.

    2008-01-01

    To keep Cassini on its complex trajectory, more than 200 orbit trim maneuvers (OTMs) have been planned from July 2004 to July 2010. With only a few days between many of these OTMs, the operations process of planning and executing the necessary commands had to be automated. The resulting Maneuver Automation Software (MAS) process minimizes the workforce required for, and maximizes the efficiency of, the maneuver design and uplink activities. The MAS process is a well-organized and logically constructed interface between Cassini's Navigation (NAV), Spacecraft Operations (SCO), and Ground Software teams. Upon delivery of an orbit determination (OD) from NAV, the MAS process can generate a maneuver design and all related uplink and verification products within 30 minutes. To date, all 112 OTMs executed by the Cassini spacecraft have been successful. MAS was even used to successfully design and execute a maneuver while the spacecraft was in safe mode.

  4. MAS461 1 Turn Over PLEASE LEAVE THIS EXAM PAPER ON YOUR DESK.

    E-print Network

    Provided: Neaves Tables Graph Paper SCHOOL OF MATHEMATICS AND STATISTICS MAS461 Autumn Semester 2011-2012 2 with kidney tumours who were randomized to receive either radiation therapy alone or radiation plus

  5. MAS6012 1 Turn Over PLEASE LEAVE THIS EXAM PAPER ON YOUR DESK.

    E-print Network

    Provided: Neaves Tables Graph Paper SCHOOL OF MATHEMATICS AND STATISTICS MAS6012 Session 2011 2012 3 Hours of 28 patients with kidney tumours who were randomized to receive either radiation therapy alone

  6. BOREAS Level-1B MAS Imagery At-sensor Radiance, Relative X and Y Coordinates

    NASA Technical Reports Server (NTRS)

    Strub, Richard; Strub, Richard; Newcomer, Jeffrey A.; Ungar, Stephen

    2000-01-01

    For BOReal Ecosystem-Atmosphere Study (BOREAS), the MODIS Airborne Simulator (MAS) images, along with the other remotely sensed data, were collected to provide spatially extensive information over the primary study areas. This information includes detailed land cover and biophysical parameter maps such as fraction of Photosynthetically Active Radiation (fPAR) and Leaf Area Index (LAI). Collection of the MAS images occurred over the study areas during the 1994 field campaigns. The level-1b MAS data cover the dates of 21-Jul-1994, 24-Jul-1994, 04-Aug-1994, and 08-Aug-1994. The data are not geographically/geometrically corrected; however, files of relative X and Y coordinates for each image pixel were derived by using the C-130 INS data in a MAS scan model. The data are provided in binary image format files.

  7. BOREAS Level-2 MAS Surface Reflectance and Temperature Images in BSQ Format

    NASA Technical Reports Server (NTRS)

    Hall, Forrest G. (Editor); Newcomer, Jeffrey (Editor); Lobitz, Brad; Spanner, Michael; Strub, Richard; Lobitz, Brad

    2000-01-01

    The BOReal Ecosystem-Atmosphere Study (BOREAS) Staff Science Aircraft Data Acquisition Program focused on providing the research teams with the remotely sensed aircraft data products they needed to compare and spatially extend point results. The MODIS Airborne Simulator (MAS) images, along with other remotely sensed data, were collected to provide spatially extensive information over the primary study areas. This information includes biophysical parameter maps such as surface reflectance and temperature. Collection of the MAS images occurred over the study areas during the 1994 field campaigns. The level-2 MAS data cover the dates of 21-Jul-1994, 24-Jul-1994, 04-Aug-1994, and 08-Aug-1994. The data are not geographically/geometrically corrected; however, files of relative X and Y coordinates for each image pixel were derived by using the C130 navigation data in a MAS scan model. The data are provided in binary image format files.

  8. Possible functional co-operation of palindromes hr3 and hr4 in the genome of Cydia pomonella granulovirus affects viral replication capacity.

    PubMed

    Elmenofy, Wael H; Jehle, Johannes A

    2015-09-01

    After previous studies had shown that natural transposon insertion between the two homologous regions hr3 and hr4 of the genome of the Mexican (M) strain of Cydia pomonella granulovirus (CpGV-M) resulted in a loss of viral competitiveness, the function of these homologous regions was investigated. A CpGV-based bacmid (CpBAC) was constructed and mutants with deleted hr3 and hr4 palindromes (CpBAChr3/hr4KO) and a construct (CpBAChr3-kan-hr4) with physically separated hr3 and hr4 repeats were generated to investigate their involvement in in vivo replication. Based on median lethal concentration (LC50) and median survival time (ST50) of the mutant viruses vCpBAChr3/hr4KO and vCpBAChr3-kan-hr4 it was found that the infectivity of both mutants for codling moth Cydia pomonella L. (Lep.: Tortricidae) larvae was not influenced compared with the parental virus vCpBAC. Co-infection experiments with vCpBAChr3-kan-hr4 and vCpBAC using different virus ratios revealed that vCpBAChr3-kan-hr4 was efficiently out-competed by vCpBAC during in vivo replication. These findings suggested that the separation of hr3 and hr4 resulted in a replication disadvantage of the mutant similar to the observation made in previous co-infection experiments using the transposon-carrying mutant CpGV-MCp5 and WT CpGV-M. It was concluded that the palindromes hr3 and hr4 may play a non-essential but co-functional role in the replication of CpGV-M. PMID:26002301

  9. Advanced solid-state NMR characterization of marine dissolved organic matter isolated using the coupled reverse osmosis/electrodialysis method.

    PubMed

    Mao, Jingdong; Kong, Xueqian; Schmidt-Rohr, Klaus; Pignatello, Joseph J; Perdue, E Michael

    2012-06-01

    Advanced (13)C solid-state techniques were employed to investigate the major structural characteristics of two surface-seawater dissolved organic matter (DOM) samples isolated using the novel coupled reverse osmosis/electrodialysis method. The NMR techniques included quantitative (13)C direct polarization/magic angle spinning (DP/MAS) and DP/MAS with recoupled dipolar dephasing, (13)C cross-polarization/total sideband suppression (CP/TOSS), (13)C chemical shift anisotropy filter, CH, CH(2), and CH(n) selection, two-dimensional (1)H-(13)C heteronuclear correlation NMR (2D HETCOR), 2D HETCOR combined with dipolar dephasing, and (15)N cross-polarization/magic angle spinning (CP/MAS). The two samples (Coastal and Marine DOM) were collected at the mouth of the Ogeechee River and in the Gulf Stream, respectively. The NMR results indicated that they were structurally distinct. Coastal DOM contained significantly more aromatic and carbonyl carbons whereas Marine DOM was markedly enriched in alkoxy carbon (e.g., carbohydrate-like moieties). Both samples contained significant amide N, but Coastal DOM had nitrogen bonded to aromatic carbons. Our dipolar-dephased spectra indicated that a large fraction of alkoxy carbons were not protonated. For Coastal DOM, our NMR results were consistent with the presence of the major structural units of (1) carbohydrate-like moieties, (2) lignin residues, (3) peptides or amino sugars, and (4) COO-bonded alkyls. For Marine DOM, they were (1) carbohydrate-like moieties, (2) peptides or amino sugars, and (3) COO-bonded alkyls. In addition, both samples contained significant amounts of nonpolar alkyl groups. The potential sources of the major structural units of DOM were discussed in detail. Nonprotonated O-alkyl carbon content was proposed as a possible index of humification. PMID:22553962

  10. Magic-angle-spinning NMR on solid biological systems. Analysis Of the origin of the spectral linewidths

    NASA Astrophysics Data System (ADS)

    Hemminga, M. A.; de Jager, P. A.; Krüse, J.; Lamerichs, R. M. J. N.

    Magic-angle-spinning (MAS) high-power 1H-decoupled 13C and 31P NMR has been applied to solid biological materials to obtain information about the mechanisms that determine the spectral linewidths. The line broadening in MAS 31P NMR spectra of solid tobacco mosaic virus (TMV) has been investigated by selective saturation and T2 measurements. About 90 Hz stems from homogeneous effects, whereas the inhomogeneous contribution is approximately 100 Hz. The inhomogeneous line broadening is assigned to macroscopic inhomogeneities in the sample and not to variations in the nucleotide bases along the RNA strand in TMV. It is concluded that sample preparation is of vital importance for obtaining well-resolved spectra. Under optimal preparation techniques the isotropic values of the chemical shift of the different 31P sites have been determined to obtain information about the secondary structure of the viral RNA. The chemical shift anisotropy has been determined from the relative intensities of the spinning side bands in the spectra. The chemical shift information is used to make a tentative assignment of the resonance in terms of the three structurally distinguishable phosphate groups in TMV. The origin of the linewidths in MAS NMR has been examined further by 13C NMR of approximately 10% 13C-enriched coat protein of cowpea chlorotic mottle virus, using selective excitation and saturation techniques, as well as measurements of the relaxation times T1 ? and T2. The C?O resonance in the spectrum is composed of an inhomogeneous and homogeneous part with a total linewidth of 700 Hz. The homogeneous linewidth, contributing with 200 Hz, is found to arise from slow molecular motions in the solid on a millisecond timescale.

  11. BALANCED INCOMPLETE FACTORIZATION RAFAEL BRU, JOSE MARIN, JOSE MAS AND M. TUMA

    E-print Network

    Tùma, Miroslav

    BALANCED INCOMPLETE FACTORIZATION RAFAEL BRU, JOS´E MAR´IN, JOS´E MAS AND M. T°UMA Abstract Republic, Pod vod´arenskou vez´i 2, 182 07 Prague 8, Czech Republic, (tuma@cs.cas.cz). 1 #12;2 R. BRU, J. MAR´IN, J. MAS AND M. T°UMA decomposition which is in the SPD case inherently breakdown

  12. University of Calgary Human Resources Accessing HR Manager Reports

    E-print Network

    Calgary, University of

    University of Calgary ­ Human Resources Accessing HR Manager Reports For those who are Reports to Managers (i.e. those who have employees reporting to them), use this guide to access Manager Reports, which provide information on those employees within your reporting structure. Note: Access to Manager Reports

  13. HR Student Forms Checklist Undergraduate/Graduate CSM Student Employees

    E-print Network

    's/Cashier's, HR, Legal, Museum, Payroll, Public Safety, Res. Life, Registrar, operate a motor vehicle, or works of the United States (See instructions) ! A lawfut permanent resident (Alien Registration Number/USCIS Number) f An alien authorized to work until (expiration

  14. Discovery of a Low-mass Companion Around HR 3549

    NASA Astrophysics Data System (ADS)

    Mawet, D.; David, T.; Bottom, M.; Hinkley, S.; Stapelfeldt, K.; Padgett, D.; Mennesson, B.; Serabyn, E.; Morales, F.; Kuhn, J.

    2015-10-01

    We report the discovery of a low-mass companion to HR 3549, an A0V star surrounded by a debris disk with a warm excess detected by WISE at 22 ?m (10? significance). We imaged HR 3549 B in the L band with NAOS-CONICA, the adaptive optics infrared camera of the Very Large Telescope, in January 2013 and confirmed its common proper motion in 2015 January. The companion is at a projected separation of ?80 AU and position angle of ?157°, so it is orbiting well beyond the warm disk inner edge of r > 10 AU. Our age estimate for this system corresponds to a companion mass in the range 15-80 MJ, spanning the brown dwarf regime, and so HR 3549 B is another recent addition to the growing list of brown dwarf desert objects with extreme mass ratios. The simultaneous presence of a warm disk and a brown dwarf around HR 3549 provides interesting empirical constraints on models of the formation of substellar companions.

  15. HR Manager Leadership in Quality Improvement in a College Environment

    ERIC Educational Resources Information Center

    Sharabi, Moshe

    2010-01-01

    Purpose: The purpose of this paper is to present the influence of the human resource (HR) manager on the quality of service in an academic college, and the human resource management (HRM) outcomes of the process. Design/methodology/approach: The paper relates to a customer satisfaction survey. More than 120 questionnaires were completed by the…

  16. University Policy No.: HR6305 Classification: Human Resources

    E-print Network

    Victoria, University of

    University Policy No.: HR6305 Classification: Human Resources EMPLOYMENT UNDER EXTERNALLY Approving. PROCEDURES The Department of Human Resources shall process all employment and related documents' letter will be prepared for the grantee by the Department of Human Resources. The grantee will sign

  17. University Policy No.: HR6315 Classification: Human Resources

    E-print Network

    Victoria, University of

    University Policy No.: HR6315 Classification: Human Resources SPECIALIST/INSTRUCTIONAL Approving is available from Human Resources. #12;1.4.3 Forty-eight hours written notice should be provided in the event the classification, the duties and responsibilities of the position, the education and experience required

  18. University Policy No.: HR6115 Classification: Human Resources

    E-print Network

    Victoria, University of

    University Policy No.: HR6115 Classification: Human Resources Approving Authority: Board and job applicants with regard to matters that are governed by the BC Human Rights Code, unless it would to the principles and spirit of employment equity and the provisions of the BC Human Rights Code. 3.1.2 The process

  19. University Policy No.: HR6105 Classification: Human Resources

    E-print Network

    Victoria, University of

    University Policy No.: HR6105 Classification: Human Resources EQUITY POLICY FOR FEMALE Approving faculty at UVic and at most other Canadian universities. Some departments in the Humanities and Fine Arts equity. Some departments and faculties within the University such as Law, Fine Arts and Human and Social

  20. University Policy No.: HR6320 Classification: Human Resources

    E-print Network

    Victoria, University of

    University Policy No.: HR6320 Classification: Human Resources GUIDELINES FOR THE APPOINTMENT only under strictly prescribed conditions and according to procedures that are acceptable to Human the offer of employment to a foreign worker requires validation by Human Resources Development Canada (HRDC

  1. Bumping HR: Giving Principals More Say over Staffing

    ERIC Educational Resources Information Center

    National Council on Teacher Quality, 2010

    2010-01-01

    In what may come as a surprise to many, principals have remarkably little control over who teaches in their schools. For the most part, the human resources (HR) department in a district's central office, not individual school principals, makes the final call about when to hire teachers, whom to hire and in which schools they are placed.…

  2. VCU Human Resources Instant HR October 6, 2011

    E-print Network

    Hammack, Richard

    VCU Human Resources Instant HR ­ October 6, 2011 TOPIC: Important Reminder: Classified Performance-8250) or ImageNow Email (hrdocs@vcu.edu). If you are unable to fax or email to ImageNow, you can hand@vcu.edu. Thank you. Cindy H. Andrews Assistant Vice President for Human Resources Virginia Commonwealth

  3. The Energy Policy Act of 2005: (H.R. 1640)

    E-print Network

    Smerdon, Jason E.

    1 The Energy Policy Act of 2005: (H.R. 1640) A Policy Analysis "To enact an energy research and development program to ensure reliable energy and job security" School of International and Public Affairs..........................................................................................5 A History of Energy Policies in the U.S.........................................................6

  4. NUMBER: HR 1.21 SECTION: Human Resources

    E-print Network

    Almor, Amit

    two classes provided the time is made up or charged to leave. E. Leave Without Pay for EducationalNUMBER: HR 1.21 SECTION: Human Resources SUBJECT: Educational Leave DATE: August 1988 REVISED. This document sets forth the policy for educational leave to provide employees the opportunity to further

  5. NUMBER: HR 1.95 (NEW) SECTION: Human Resources

    E-print Network

    Almor, Amit

    but not limited to narcotics, hallucinogens, cocaine, marijuana, and designer drugs, and any controlled substances1 NUMBER: HR 1.95 (NEW) SECTION: Human Resources SUBJECT: Drug and Alcohol Testing Policy DATE THE UNIVERSITY'S HUMAN RESOURCES POLICIES. I. Policy A. Purpose The purpose of drug and alcohol testing

  6. Differential Rotation of Close Binary Stars : Application to HR 1099

    E-print Network

    Donati, Jean-François

    propose a new method for estimating differential rotation in binary stars, for which only moderate to poor of conventional cross­correlation methods. Assuming a solar­like differential rotation law with two independant is poor, provided the total data set is long enough. From observations of the HR 1099 K1 subgiant secured

  7. An Ounce of Prevention: The Benefits of an HR Audit

    ERIC Educational Resources Information Center

    Seals, Brenda

    2011-01-01

    During her 13 years leading a school district human resources office, the author came to recognize that managing human capital is much more than recruiting, hiring, managing personnel records, and handling performance issues. In addition to implementing initiatives to increase the efficiency with which HR officers and staff perform those tasks,…

  8. VCU Human Resources Instant HR June 17, 2013

    E-print Network

    Hammack, Richard

    VCU Human Resources Instant HR ­ June 17, 2013 TOPIC - Enhancements to New Hire Onboarding internal stakeholders, VCU Human Resources has created an onboarding process to meet employee, supervisor to assist supervisors with onboarding new hires and will offer the first supervisor training this month. We

  9. University Policy No.: HR6415 Classification: Human Resources

    E-print Network

    Victoria, University of

    University Policy No.: HR6415 Classification: Human Resources TRAVEL ALLOWANCE FOR VISITING: December/68 Last Editorial Change: Mandated Review: 1. Newly appointed members of the full-time teaching staff whose appointments are for less than two years will be eligible for a travel allowance. 2

  10. University Policy No.: HR6405 Classification: Human Resources

    E-print Network

    Victoria, University of

    University Policy No.: HR6405 Classification: Human Resources Approving Authority: Board.1 Reasonable travel costs, not exceeding the amount of economy air fares or equivalent public transportation, of moving the individual and her or his family from the place of residence (at the time of appointment

  11. Lymphedema Treatment Act (H.R.1608; 114th Congress)

    Cancer.gov

    The bill would require Medicare to cover certain lymphedema compression treatment items as “durable medical equipment.” H.R. 1608 was introduced by Rep. David Reichert (R-GA) on 3/25/15 and was referred to the Committees on Energy and Commerce and Ways

  12. Discovery of a low-mass companion around HR3549

    E-print Network

    Mawet, Dimitri; Bottom, Michael; Hinkley, Sasha; Stapelfeldt, Karl; Padgett, Deborah; Mennesson, Bertrand; Serabyn, Eugene; Morales, Farisa; Kuhn, Jonas

    2015-01-01

    We report the discovery of a low-mass companion to HR3549, an A0V star surrounded by a debris disk with a warm excess detected by WISE at 22 $\\mu$m ($10\\sigma$ significance). We imaged HR3549 B in the L-band with NAOS-CONICA, the adaptive optics infrared camera of the Very Large Telescope, in January 2013 and confirmed its common proper motion in January 2015. The companion is at a projected separation of $\\simeq 80$ AU and position angle of $\\simeq 157^\\circ$, so it is orbiting well beyond the warm disk inner edge of $r > 10$ AU. Our age estimate for this system corresponds to a companion mass in the range 15-80 $M_J$, spanning the brown dwarf regime, and so HR3549 B is another recent addition to the growing list of brown dwarf desert objects with extreme mass ratios. The simultaneous presence of a warm disk and a brown dwarf around HR3549 provides interesting empirical constraints on models of the formation of substellar companions.

  13. The Description Logic ALCN HR+ Extended with Concrete Domains

    E-print Network

    Hamburg,.Universität

    The Description Logic ALCN HR+ Extended with Concrete Domains: A Practically Motivated Approach, role hierarchies, transitively closed roles, generalized concept inclusions, and concrete domains. As in other languages based on concrete domains (e.g. ALC(D)) a so-called ex- istential predicate restriction

  14. REDOR NMR for Drug Discovery

    PubMed Central

    Cegelski, Lynette

    2014-01-01

    Rotational-Echo DOuble-Resonance (REDOR) NMR is a powerful and versatile solid-state NMR measurement that has been recruited to elucidate drug modes of action and to drive the design of new therapeutics. REDOR has been implemented to examine composition, structure, and dynamics in diverse macromolecular and whole-cell systems, including taxol-bound microtubules, enzyme-cofactor-inhibitor ternary complexes, and antibiotic-whole-cell complexes. The REDOR approach involves the integrated design of specific isotopic labeling strategies and the selection of appropriate REDOR experiments. By way of example, this digest illustrates the versatility of the REDOR approach, with an emphasis on the practical considerations of experimental design and data interpretation. PMID:24035486

  15. Measuring material susceptibility using NMR

    NASA Astrophysics Data System (ADS)

    SanGiorgio, Paul; Zens, Albert

    2015-06-01

    We report on a method of measuring the high-field susceptibilities of paramagnetic and diamagnetic materials using only a standard NMR system equipped with pulsed field gradients. We demonstrate the accuracy and sensitivity of the technique by measuring a series of 99.9% copper wires with diameters between 0.16 mm and 0.79 mm. We measured the volumetric susceptibility of the copper to be ? = - 9.5 ± 0.2 ·10-6 , which agrees with the literature value of pure copper, - 9.6 ·10-6 . In addition to making quantitative measurements, this technique can also be used to evaluate the effectiveness of compensation schemes used to produce "zero-susceptibility" materials needed for construction of high-resolution NMR probes.

  16. A novel ?/?-hydrolase gene IbMas enhances salt tolerance in transgenic sweetpotato.

    PubMed

    Liu, Degao; Wang, Lianjun; Zhai, Hong; Song, Xuejin; He, Shaozhen; Liu, Qingchang

    2014-01-01

    Salt stress is one of the major environmental stresses in agriculture worldwide and affects crop productivity and quality. The development of crops with elevated levels of salt tolerance is therefore highly desirable. In the present study, a novel maspardin gene, named IbMas, was isolated from salt-tolerant sweetpotato (Ipomoea batatas (L.) Lam.) line ND98. IbMas contains maspardin domain and belongs to ?/?-hydrolase superfamily. Expression of IbMas was up-regulated in sweetpotato under salt stress and ABA treatment. The IbMas-overexpressing sweetpotato (cv. Shangshu 19) plants exhibited significantly higher salt tolerance compared with the wild-type. Proline content was significantly increased, whereas malonaldehyde content was significantly decreased in the transgenic plants. The activities of superoxide dismutase (SOD) and photosynthesis were significantly enhanced in the transgenic plants. H2O2 was also found to be significantly less accumulated in the transgenic plants than in the wild-type. Overexpression of IbMas up-regulated the salt stress responsive genes, including pyrroline-5-carboxylate synthase, pyrroline-5-carboxylate reductase, SOD, psbA and phosphoribulokinase genes, under salt stress. These findings suggest that overexpression of IbMas enhances salt tolerance of the transgenic sweetpotato plants by regulating osmotic balance, protecting membrane integrity and photosynthesis and increasing reactive oxygen species scavenging capacity. PMID:25501819

  17. A Novel ?/?-Hydrolase Gene IbMas Enhances Salt Tolerance in Transgenic Sweetpotato

    PubMed Central

    Song, Xuejin; He, Shaozhen; Liu, Qingchang

    2014-01-01

    Salt stress is one of the major environmental stresses in agriculture worldwide and affects crop productivity and quality. The development of crops with elevated levels of salt tolerance is therefore highly desirable. In the present study, a novel maspardin gene, named IbMas, was isolated from salt-tolerant sweetpotato (Ipomoea batatas (L.) Lam.) line ND98. IbMas contains maspardin domain and belongs to ?/?-hydrolase superfamily. Expression of IbMas was up-regulated in sweetpotato under salt stress and ABA treatment. The IbMas-overexpressing sweetpotato (cv. Shangshu 19) plants exhibited significantly higher salt tolerance compared with the wild-type. Proline content was significantly increased, whereas malonaldehyde content was significantly decreased in the transgenic plants. The activities of superoxide dismutase (SOD) and photosynthesis were significantly enhanced in the transgenic plants. H2O2 was also found to be significantly less accumulated in the transgenic plants than in the wild-type. Overexpression of IbMas up-regulated the salt stress responsive genes, including pyrroline-5-carboxylate synthase, pyrroline-5-carboxylate reductase, SOD, psbA and phosphoribulokinase genes, under salt stress. These findings suggest that overexpression of IbMas enhances salt tolerance of the transgenic sweetpotato plants by regulating osmotic balance, protecting membrane integrity and photosynthesis and increasing reactive oxygen species scavenging capacity. PMID:25501819

  18. Advanced NMR technology for bioscience and biotechnology

    SciTech Connect

    Hammel, P.C.; Hernandez, G.; Trewhella, J.; Unkefer, C.J.; Boumenthal, D.K.; Kennedy, M.A.; Moore, G.J.

    1998-11-01

    This is the final report of a three-year, Laboratory Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). NMR plays critical roles in bioscience and biotechnology in both imaging and structure determination. NMR is limited, however, by the inherent low sensitivity of the NMR experiment and the demands for spectral resolution required to study biomolecules. The authors addressed both of these issues by working on the development of NMR force microscopy for molecular imaging, and high field NMR with isotope labeling to overcome limitations in the size of biomolecules that can be studied using NMR. A novel rf coil design for NMR force microscopy was developed that increases the limits of sensitivity in magnetic resonance detection for imaging, and the authors demonstrated sub-surface spatial imaging capabilities. The authors also made advances in the miniaturization of two critical NMR force microscope components. They completed high field NMR and isotope labeling studies of a muscle protein complex which is responsible for regulating muscle contraction and is too large for study using conventional NMR approaches.

  19. Scalable NMR spectroscopy with semiconductor chips

    PubMed Central

    Ha, Dongwan; Paulsen, Jeffrey; Sun, Nan; Song, Yi-Qiao; Ham, Donhee

    2014-01-01

    State-of-the-art NMR spectrometers using superconducting magnets have enabled, with their ultrafine spectral resolution, the determination of the structure of large molecules such as proteins, which is one of the most profound applications of modern NMR spectroscopy. Many chemical and biotechnological applications, however, involve only small-to-medium size molecules, for which the ultrafine resolution of the bulky, expensive, and high-maintenance NMR spectrometers is not required. For these applications, there is a critical need for portable, affordable, and low-maintenance NMR spectrometers to enable in-field, on-demand, or online applications (e.g., quality control, chemical reaction monitoring) and co-use of NMR with other analytical methods (e.g., chromatography, electrophoresis). As a critical step toward NMR spectrometer miniaturization, small permanent magnets with high field homogeneity have been developed. In contrast, NMR spectrometer electronics capable of modern multidimensional spectroscopy have thus far remained bulky. Complementing the magnet miniaturization, here we integrate the NMR spectrometer electronics into 4-mm2 silicon chips. Furthermore, we perform various multidimensional NMR spectroscopies by operating these spectrometer electronics chips together with a compact permanent magnet. This combination of the spectrometer-electronics-on-a-chip with a permanent magnet represents a useful step toward miniaturization of the overall NMR spectrometer into a portable platform. PMID:25092330

  20. Measurement of deformations by NMR

    NASA Astrophysics Data System (ADS)

    Bytchenkoff, Dimitri; Rodts, Stéphane

    2015-12-01

    Two NMR data acquisition protocols together with corresponding data processing algorithms for locating macroscopic objects, measuring distances between them or monitoring their displacements or deformations with microscopic precision are presented and discussed. The performance of the methods is demonstrated by applying them to the measurement of deformations of a freely supported beam under loading. We believe that our methods will find their applications in mechanics, civil engineering and medicine.

  1. Measurement of deformations by NMR.

    PubMed

    Bytchenkoff, Dimitri; Rodts, Stéphane

    2015-12-01

    Two NMR data acquisition protocols together with corresponding data processing algorithms for locating macroscopic objects, measuring distances between them or monitoring their displacements or deformations with microscopic precision are presented and discussed. The performance of the methods is demonstrated by applying them to the measurement of deformations of a freely supported beam under loading. We believe that our methods will find their applications in mechanics, civil engineering and medicine. PMID:26529203

  2. NMR-Based Milk Metabolomics

    PubMed Central

    Sundekilde, Ulrik K.; Larsen, Lotte B.; Bertram, Hanne C.

    2013-01-01

    Milk is a key component in infant nutrition worldwide and, in the Western parts of the world, also in adult nutrition. Milk of bovine origin is both consumed fresh and processed into a variety of dairy products including cheese, fermented milk products, and infant formula. The nutritional quality and processing capabilities of bovine milk is closely associated to milk composition. Metabolomics is ideal in the study of the low-molecular-weight compounds in milk, and this review focuses on the recent nuclear magnetic resonance (NMR)-based metabolomics trends in milk research, including applications linking the milk metabolite profiling with nutritional aspects, and applications which aim to link the milk metabolite profile to various technological qualities of milk. The metabolite profiling studies encompass the identification of novel metabolites, which potentially can be used as biomarkers or as bioactive compounds. Furthermore, metabolomics applications elucidating how the differential regulated genes affects milk composition are also reported. This review will highlight the recent advances in NMR-based metabolomics on milk, as well as give a brief summary of when NMR spectroscopy can be useful for gaining a better understanding of how milk composition is linked to nutritional or quality traits. PMID:24957988

  3. NMR Measures of Heterogeneity Length

    NASA Astrophysics Data System (ADS)

    Spiess, Hans W.

    2002-03-01

    Advanced solid state NMR spectroscopy provides a wealth of information about structure and dynamics of complex systems. On a local scale, multidimensional solid state NMR has elucidated the geometry and the time scale of segmental motions at the glass transition. The higher order correlation functions which are provided by this technique led to the notion of dynamic heterogeneities, which have been characterized in detail with respect to their rate memory and length scale. In polymeric and low molar mass glass formers of different fragility, length scales in the range 2 to 4 nm are observed. In polymeric systems, incompatibility of backbone and side groups as in polyalkylmethacrylates leads to heteogeneities on the nm scale, which manifest themselves in unusual chain dynamics at the glass transition involving extended chain conformations. References: K. Schmidt-Rohr and H.W. Spiess, Multidimensional Solid-State NMR and Polymers,Academic Press, London (1994). U. Tracht, M. Wilhelm, A. Heuer, H. Feng, K. Schmidt-Rohr, H.W. Spiess, Phys. Rev. Lett. 81, 2727 (1998). S.A. Reinsberg, X.H. Qiu, M. Wilhelm, M.D. Ediger, H.W. Spiess, J.Chem.Phys. 114, 7299 (2001). S.A. Reinsberg, A. Heuer, B. Doliwa, H. Zimmermann, H.W. Spiess, J. Non-Crystal. Solids, in press (2002)

  4. Hyperpolarized 131Xe NMR spectroscopy

    PubMed Central

    Stupic, Karl F.; Cleveland, Zackary I.; Pavlovskaya, Galina E.; Meersmann, Thomas

    2011-01-01

    Hyperpolarized (hp) 131Xe with up to 2.2% spin polarization (i.e., 5000-fold signal enhancement at 9.4 T) was obtained after separation from the rubidium vapor of the spin-exchange optical pumping (SEOP) process. The SEOP was applied for several minutes in a stopped-flow mode, and the fast, quadrupolar-driven T1 relaxation of this spin I = 3/2 noble gas isotope required a rapid subsequent rubidium removal and swift transfer into the high magnetic field region for NMR detection. Because of the xenon density dependent 131Xe quadrupolar relaxation in the gas phase, the SEOP polarization build-up exhibits an even more pronounced dependence on xenon partial pressure than that observed in 129Xe SEOP. 131Xe is the only stable noble gas isotope with a positive gyromagnetic ratio and shows therefore a different relative phase between hp signal and thermal signal compared to all other noble gases. The gas phase 131Xe NMR spectrum displays a surface and magnetic field dependent quadrupolar splitting that was found to have additional gas pressure and gas composition dependence. The splitting was reduced by the presence of water vapor that presumably influences xenon-surface interactions. The hp 131Xe spectrum shows differential line broadening, suggesting the presence of strong adsorption sites. Beyond hp 131Xe NMR spectroscopy studies, a general equation for the high temperature, thermal spin polarization, P, for spin I?1/2 nuclei is presented. PMID:21051249

  5. NMR-Based Milk Metabolomics.

    PubMed

    Sundekilde, Ulrik K; Larsen, Lotte B; Bertram, Hanne C

    2013-01-01

    Milk is a key component in infant nutrition worldwide and, in the Western parts of the world, also in adult nutrition. Milk of bovine origin is both consumed fresh and processed into a variety of dairy products including cheese, fermented milk products, and infant formula. The nutritional quality and processing capabilities of bovine milk is closely associated to milk composition. Metabolomics is ideal in the study of the low-molecular-weight compounds in milk, and this review focuses on the recent nuclear magnetic resonance (NMR)-based metabolomics trends in milk research, including applications linking the milk metabolite profiling with nutritional aspects, and applications which aim to link the milk metabolite profile to various technological qualities of milk. The metabolite profiling studies encompass the identification of novel metabolites, which potentially can be used as biomarkers or as bioactive compounds. Furthermore, metabolomics applications elucidating how the differential regulated genes affects milk composition are also reported. This review will highlight the recent advances in NMR-based metabolomics on milk, as well as give a brief summary of when NMR spectroscopy can be useful for gaining a better understanding of how milk composition is linked to nutritional or quality traits. PMID:24957988

  6. Why doesn't this HR department get any respect?

    PubMed

    Galford, R

    1998-01-01

    Since becoming managing partner of human resources at Loft Securities more than a year ago, Luke Robinson has tried everything he can think of to change his department's reputation as an administrative backwater. But he's swimming against the tide. Ever since the retirement of a charismatic CEO in 1995, the firm has suffered a slow bleed of good people. The new CEO doesn't have a flair for attracting and retaining talented people, and the HR department hasn't been able to pick up the slack. Robinson has done his best to turn things around. He's met with just about everyone, from senior executives to administrative assistants to external contacts. And, when he found out that recruiting wasn't Loft's only problem, he took a variety of concrete steps. Among other things, he established internal service standards and performance guarantees for his department. He created "listening posts" and implemented and "HR ambassador" program. And he drafted plans for a program to help educate all the company's employees about the role of HR--specifically, how it can contribute to creating and upholding the firm's strategy for success. But Robinson has run over some major speed bumps. Just before he joined the company, HR sullied its reputation by mishandling the investigation of a discrimination charge. And while on Robinson's watch, HR botched the issuance of year-end bonus checks for the managing directors and vice presidents. The frustrations are piling up, leading Robinson to entertain thoughts of bailing out. Five commentators on this fictional case study explain why he should avoid quitting and how he can help his department earn new respect. PMID:10177864

  7. Relative utility of 1-hr Oral Glucose Tolerance Test as a measure of abnormal glucose homeostasis

    PubMed Central

    Joshipura, K.J.; Andriankaja, M. O.; Hu, F.B.; Ritchie, C.S.

    2011-01-01

    Background and Aims Impaired glucose tolerance based on 2-hr glucose levels is more predictive of future cardiovascular disease and more sensitive in detecting earlier diabetes compared to impaired fasting glucose. However, the 1-hr OGTT may be even more sensitive than the 2-hr. We assessed the relative value of 1-hr OGTT by exploring its relationship with adiposity and other measures of glucose homeostasis. Methods and Results Ninety four overweight/obese individuals free of diabetes and major cardiovascular conditions were included in the analyses. We adjusted for age, gender, smoking status and physical activity. One-hr OGTT showed similar partial correlations with fasting glucose and 2-hr OGTT (r= 0.60 and 0.64 respectively). Fasting glucose, fasting insulin and HOMA correlated better with 1-hr OGTT (r= 0.60, 0.47 and 0.52) than with 2-hr OGTT (r= 0.50, 0.41, and 0.45). BMI and waist circumference also showed stronger correlation with 1-hr (r= 0.31, 0.29), compared to 2-hr OGTT (r= 0.16, 0.16) or fasting glucose (r= 0.23, 0.22). Metabolic syndrome was associated similarly with 1-hr and 2-hr OGTT. Conclusions The 1-hr OGTT correlates well with both fasting glucose and 2-hr OGTT and shows similar or higher associations with obesity measures. The 1-hr OGTT has potential utility in epidemiologic studies. PMID:21775009

  8. Detecting substrates bound to the secondary multidrug efflux pump EmrE by DNP-enhanced solid-state NMR.

    PubMed

    Ong, Yean Sin; Lakatos, Andrea; Becker-Baldus, Johanna; Pos, Klaas M; Glaubitz, Clemens

    2013-10-23

    Escherichia coli EmrE, a homodimeric multidrug antiporter, has been suggested to offer a convenient paradigm for secondary transporters due to its small size. It contains four transmembrane helices and forms a functional dimer. We have probed the specific binding of substrates TPP(+) and MTP(+) to EmrE reconstituted into 1,2-dimyristoyl-sn-glycero-3-phosphocholine liposomes by (31)P MAS NMR. Our NMR data show that both substrates occupy the same binding pocket but also indicate some degree of heterogeneity of the bound ligand population, reflecting the promiscuous nature of ligand binding by multidrug efflux pumps. Direct interaction between (13)C-labeled TPP(+) and key residues within the EmrE dimer has been probed by through-space (13)C-(13)C correlation spectroscopy. This was made possible by the use of solid-state NMR enhanced by dynamic nuclear polarization (DNP) through which a 19-fold signal enhancement was achieved. Our data provide clear evidence for the long assumed direct interaction between substrates such as TPP(+) and the essential residue E14 in transmembrane helix 1. Our work also demonstrates the power of DNP-enhanced solid-state NMR at low temperatures for the study for secondary transporters, which are highly challenging for conventional NMR detection. PMID:24047229

  9. Development of LC-13C NMR

    NASA Technical Reports Server (NTRS)

    Dorn, H. C.; Wang, J. S.; Glass, T. E.

    1986-01-01

    This study involves the development of C-13 nuclear resonance as an on-line detector for liquid chromatography (LC-C-13 NMR) for the chemical characterization of aviation fuels. The initial focus of this study was the development of a high sensitivity flow C-13 NMR probe. Since C-13 NMR sensitivity is of paramount concern, considerable effort during the first year was directed at new NMR probe designs. In particular, various toroid coil designs were examined. In addition, corresponding shim coils for correcting the main magnetic field (B sub 0) homogeneity were examined. Based on these initial probe design studies, an LC-C-13 NMR probe was built and flow C-13 NMR data was obtained for a limited number of samples.

  10. Analytical Applications of NMR: Summer Symposium on Analytical Chemistry.

    ERIC Educational Resources Information Center

    Borman, Stuart A.

    1982-01-01

    Highlights a symposium on analytical applications of nuclear magnetic resonance spectroscopy (NMR), discussing pulse Fourier transformation technique, two-dimensional NMR, solid state NMR, and multinuclear NMR. Includes description of ORACLE, an NMR data processing system at Syracuse University using real-time color graphics, and algorithms for…

  11. Interactions of lipopolysaccharide with lipid membranes, raft models - a solid state NMR study.

    PubMed

    Ciesielski, Filip; Griffin, David C; Rittig, Michael; Moriyón, Ignacio; Bonev, Boyan B

    2013-08-01

    Lipopolysaccharide (LPS) is a major component of the external leaflet of bacterial outer membranes, key pro-inflammatory factor and an important mediator of host-pathogen interactions. In host cells it activates the complement along with a pro-inflammatory response via a TLR4-mediated signalling cascade and shows preference for cholesterol-containing membranes. Here, we use solid state (13)C and (31)P MAS NMR to investigate the interactions of LPS from three bacterial species, Brucella melitensis, Klebsiella pneumoniae and Escherichia coli, with mixed lipid membranes, raft models. All endotoxin types are found to be pyrophosphorylated and Klebsiellar LPS is phosphonylated, as well. Carbon-13 MAS NMR indicates an increase in lipid order in the presence of LPS. Longitudinal (31)P relaxation, providing a direct probe of LPS molecular and segmental mobility, reveals a significant reduction in (31)P T1 times and lower molecular mobility in the presence of ternary lipid mixtures. Along with the ordering effect on membrane lipid, this suggests a preferential partitioning of LPS into ordered bilayer sphingomyelin/cholesterol-rich domains. We hypothesise that this is an important evolutionary drive for the selection of GPI-anchored raft-associated LPS-binding proteins as a first line of response to membrane-associated LPS. PMID:23567915

  12. Structural Characterization of GNNQQNY Amyloid Fibrils by Magic Angle Spinning NMR. †

    PubMed Central

    van der Wel, Patrick C.A.; Lewandowski, Józef R.; Griffin, Robert G.

    2010-01-01

    Several human diseases are associated with the formation of amyloid aggregates, but experimental characterization of these amyloid fibrils and their oligomeric precursors has remained challenging. Experimental and computational analysis of simpler model systems has therefore been necessary, for instance on the peptide fragment GNNQQNY7-13 of yeast prion protein Sup35p. Expanding on a previous publication, we report here a detailed structural characterization of GNNQQNY fibrils using magic angle spinning (MAS) NMR. Based on additional chemical shift assignments we confirm the coexistence of three distinct peptide conformations within the fibrillar samples, as reflected in substantial chemical shift differences. Backbone torsion angle measurements indicate that the basic structure of these co-existing conformers is an extended ?-sheet. We structurally characterize a previously identified localized distortion of the ?-strand backbone specific to one of the conformers. Intermolecular contacts are consistent with each of the conformers being present in its own parallel and in-register sheet. Overall the MAS NMR data indicate a substantial difference between the structure of the fibrillar and crystalline forms of these peptides, with a clear increased complexity in the GNNQQNY fibril structure. These experimental data can provide guidance for future work, both experimental and theoretical, and provide insights into the distinction between fibril growth and crystal formation. PMID:20695483

  13. High Resolution NMR Spectroscopy of Nanocrystalline Proteins at Ultra-High Magnetic Field

    PubMed Central

    Sperling, Lindsay J.; Nieuwkoop, Andrew J.; Lipton, Andrew S.; Berthold, Deborah A.; Rienstra, Chad M.

    2010-01-01

    Magic-angle spinning (MAS) solid-state NMR (SSNMR) spectroscopy of uniformly-13C,15N labeled protein samples provides insight into atomic-resolution chemistry and structure. Data collection efficiency has advanced remarkably in the last decade; however, the study of larger proteins is still challenged by relatively low resolution in comparison to solution NMR. In this study, we present a systematic analysis of SSNMR protein spectra acquired at 11.7, 17.6 and 21.1 Tesla (1H frequencies of 500, 750, and 900 MHz). For two protein systems—GB1, a 6 kDa nanocrystalline protein and DsbA, a 21 kDa nanocrystalline protein—line narrowing is demonstrated in all spectral regions with increasing field. Resolution enhancement is greatest in the aliphatic region, including methine, methylene and methyl sites. The resolution for GB1 increases markedly as a function of field, and for DsbA, resolution in the C-C region increases by 42%, according to the number of peaks that can be uniquely picked and integrated in the 900 MHz spectra when compared to the 500 MHz spectra. Additionally, chemical exchange is uniquely observed in the highest field spectra for at least two isoleucine C?1 sites in DsbA. These results further illustrate the benefits of high-field MAS SSNMR spectroscopy for protein structural studies. PMID:19953303

  14. Correlating fast and slow chemical shift spinning sideband patterns in solid-state NMR

    NASA Astrophysics Data System (ADS)

    Orr, Robin M.; Duer, Melinda J.; Ashbrook, Sharon E.

    2005-06-01

    An experiment is presented that enables the measurement of small chemical shift anisotropy tensors under fast magic-angle spinning (MAS). The two-dimensional spectra obtained give a fast MAS sideband pattern in the directly observed dimension with the spinning sideband intensities equivalent to the chemical shift anisotropy scaled by a factor of N, or equivalently the sample spinning frequency scaled by 1/ N, in the indirectly observed dimension. The scaling factor may be arbitrarily varied by changing the number and timings of the rotor synchronized ?-pulses used. Desirable features of the experiment include a fixed length pulse sequence and efficient sampling of the indirectly observed dimension. In addition, neither quadrature detection in the indirect dimension nor storage periods are required, consequently no signal intensity is discarded by the pulse sequence. The experiment is demonstrated using 31P NMR of sodium phosphate and 13C NMR of fumaric acid monoethyl ester for which a scaling factor of N = 10.2 was employed.

  15. 29Si NMR study of structural ordering in aluminosilicate geopolymer gels.

    PubMed

    Duxson, Peter; Provis, John L; Lukey, Grant C; Separovic, Frances; van Deventer, Jannie S J

    2005-03-29

    A systematic series of aluminosilicate geopolymer gels was synthesized and then analyzed using 29Si magic-angle spinning nuclear magnetic resonance (MAS NMR) in combination with Gaussian peak deconvolution to characterize the short-range ordering in terms of T-O-T bonds (where T is Al or Si). The effect of nominal Na2O/(Na2O + K2O) and Si/Al ratios on short-range network ordering was quantified by deconvolution of the 29Si MAS NMR spectra into individual Gaussian peaks representing different Q4(mAl) silicon centers. The deconvolution procedure developed in this work is applicable to other aluminosilicate gel systems. The short-range ordering observed here indicates that Loewenstein's Rule of perfect aluminum avoidance may not apply strictly to geopolymeric gels, although further analyses are required to quantify the degree of aluminum avoidance. Potassium geopolymers appeared to exhibit a more random Si/Al distribution compared to that of mixed-alkali and sodium systems. This work provides a quantitative account of the silicon and aluminum ordering in geopolymers, which is essential for extending our understanding of the mechanical strength, chemical and thermal stability, and fundamental structure of these systems. PMID:15779981

  16. DRAMAtic transforms in magic angle spinning recoupling NMR: The Bessel function pathway.

    PubMed

    Goodman, Russell; Hancock, Jason; Siemens, Mark; Jarrell, Harold; Siminovitch, David

    2005-07-01

    In magic angle spinning (MAS) NMR recoupling experiments, the extraction of multiple couplings or a coupling distribution from the observed dephasing signals remains a challenging problem. At least for REDOR experiments, the REDOR transform solves this problem, enabling the simultaneous measurement of multiple dipolar couplings. Focusing on the quadrupolar dephasing observed in QUADRAMA experiments as a representative example, we demonstrate that the same analytical form used for the mathematical description of REDOR dephasing also describes the dephasing observed in a wide variety of MAS NMR recoupling experiments. This fact immediately extends REDOR transform techniques to a much broader suite of recoupling experiments than had previously been realized, including those of DRAMA, MELODRAMA and QUADRAMA. As an illustration, we use the DRAMAtic transform to provide the first inversion of a QUADRAMA dephasing signal to extract the quadrupole coupling distribution. Using a complete elliptic integral of the first kind, we further develop a novel expression for the Pake-spun powder patterns of the corresponding recoupled lineshapes. Our methods and results reinforce the central role that Bessel functions can play in simplifying the integrals that define both the dephasing signals in the time domain, and their Fourier transforms in the frequency domain. PMID:16026688

  17. Applications of Concatenated Composite Pulses to NMR

    E-print Network

    Bando, Masamitsu; Kondo, Yasushi; Nemoto, Nobuaki; Nakahara, Mikio; Shikano, Yutaka

    2015-01-01

    ConCatenated Composite Pulses (CCCPs) are derived from various composite pulses widely employed in NMR and have been developed as high-precision unitary operations in Quantum Information Processing (QIP). CCCPs are robust against two systematic errors, pulse-length and off-resonance errors, in NMR simultaneously. We show experiments that demonstrate CCCPs are powerful and versatile tools not only in QIP but also in NMR measurements.

  18. Applications of Concatenated Composite Pulses to NMR

    E-print Network

    Masamitsu Bando; Tsubasa Ichikawa; Yasushi Kondo; Nobuaki Nemoto; Mikio Nakahara; Yutaka Shikano

    2015-08-12

    ConCatenated Composite Pulses (CCCPs) are derived from various composite pulses widely employed in NMR and have been developed as high-precision unitary operations in Quantum Information Processing (QIP). CCCPs are robust against two systematic errors, pulse-length and off-resonance errors, in NMR simultaneously. We show experiments that demonstrate CCCPs are powerful and versatile tools not only in QIP but also in NMR measurements.

  19. High-temperature steam-treatment of PBI, PEEK, and PEKK polymers with H2O and D2O: A solid-state NMR study

    E-print Network

    Bluemel, Janet

    High-temperature steam-treatment of PBI, PEEK, and PEKK polymers with H2O and D2O: A solid 2014 Keywords: Steam-treatment of PBI, PEEK, PEKK Solid-state NMR Water and D2O uptake polymers a b with D2O steam at temperatures of 150 and 315 C. All samples are studied by TGA, IR, 13 C CP/MAS, 1 H

  20. Solid-state NMR and membrane proteins

    NASA Astrophysics Data System (ADS)

    Opella, Stanley J.

    2015-04-01

    The native environment for a membrane protein is a phospholipid bilayer. Because the protein is immobilized on NMR timescales by the interactions within a bilayer membrane, solid-state NMR methods are essential to obtain high-resolution spectra. Approaches have been developed for both unoriented and oriented samples, however, they all rest on the foundation of the most fundamental aspects of solid-state NMR, and the chemical shift and homo- and hetero-nuclear dipole-dipole interactions. Solid-state NMR has advanced sufficiently to enable the structures of membrane proteins to be determined under near-native conditions in phospholipid bilayers.

  1. Access to NMR Spectroscopy for Two-Year College Students: The NMR Site at Trinity University

    ERIC Educational Resources Information Center

    Mills, Nancy S.; Shanklin, Michael

    2011-01-01

    Students at two-year colleges and small four-year colleges have often obtained their exposure to NMR spectroscopy through "canned" spectra because the cost of an NMR spectrometer, particularly a high-field spectrometer, is prohibitive in these environments. This article describes the design of a NMR site at Trinity University in which spectral…

  2. Environmental Weathering of Aluminosilicate Clay Minerals: Solid-State NMR Studies of Transformations Leading to Radionuclide Sequestration

    SciTech Connect

    Mueller, Karl T.; Crosson, Garry; Chorover, Jon; Choi, Sunkyung

    2004-03-28

    Mobilities of radionuclides (such as 137Cs and 90Sr) are governed by their interactions with natural soil particles in the saturated and unsaturated zones at Department of Energy sites. High surface area aluminosilicate clay minerals are a component of the natural soils beneath the leaking waste tanks at these sites and serve as possible radionuclide sorbents. However, due to the characteristics of the contaminant medium (high pH, high Al and high ionic strength), clay minerals are susceptible to transformations during exposure to tank waste leachates. We are currently studying the transformation of clays under specific chemical conditions that mimic the composition of known contaminant solutions. In these studies, specimen clay samples are reacted for varying time periods (up to one year) with simulated tank waste leachate solutions. Mineral dissolution and transformation are followed with solution analysis, x-ray diffraction and a number of other analytical methods. We report here results from 27Al MAS NMR at variable magnetic field strengths (up to 18.8 T), 29Si MAS NMR and 1H/29Si CPMAS NMR and evaluate these results along with those of other parallel analytic studies.

  3. Characterization of a Mixture of CO2 Adsorption Products in Hyperbranched Aminosilica Adsorbents by (13)C Solid-State NMR.

    PubMed

    Moore, Jeremy K; Sakwa-Novak, Miles A; Chaikittisilp, Watcharop; Mehta, Anil K; Conradi, Mark S; Jones, Christopher W; Hayes, Sophia E

    2015-11-17

    Hyperbranched amine polymers (HAS) grown from the mesoporous silica SBA-15 (hereafter "SBA-15-HAS") exhibit large capacities for CO2 adsorption. We have used static in situ and magic-angle spinning (MAS) ex situ (13)C nuclear magnetic resonance (NMR) to examine the adsorption of CO2 by SBA-15-HAS. (13)C NMR distinguishes the signal of gas-phase (13)CO2 from that of the chemisorbed species. HAS polymers possess primary, secondary, and tertiary amines, leading to multiple chemisorption reaction outcomes, including carbamate (RnNCOO(-)), carbamic acid (RnNCOOH), and bicarbonate (HCO3(-)) moieties. Carbamates and bicarbonate fall within a small (13)C chemical shift range (162-166 ppm), and a mixture was observed including carbamic acid and carbamate, the former disappearing upon evacuation of the sample. By examining the (13)C-(14)N dipolar coupling through low-field (B0 = 3 T) (13)C{(1)H} cross-polarization MAS NMR, carbamate is confirmed through splitting of the (13)C resonance. A third species that is either bicarbonate or a second carbamate is evident from bimodal T2 decay times of the ?163 ppm peak, indicating the presence of two species comprising that single resonance. The mixture of products suggests that (1) the presence of amines and water leads to bicarbonate being present and/or (2) the multiple types of amine sites in HAS permit formation of chemically distinct carbamates. PMID:26477882

  4. 15N NMR investigation of the reduction and binding of TNT in an aerobic bench scale reactor simulating windrow composting

    USGS Publications Warehouse

    Thorn, K.A.; Pennington, J.C.; Hayes, C.A.

    2002-01-01

    T15NT was added to a soil of low organic carbon content and composted for 20 days in an aerobic bench scale reactor. The finished whole compost and fulvic acid, humic acid, humin, and lignocellulose fractions extracted from the compost were analyzed by solid-state CP/MAS and DP/MAS 15N NMR. 15N NMR spectra provided direct spectroscopic evidence for reduction of TNT followed by covalent binding of the reduced metabolites to organic matter of the composted soil, with the majority of metabolite found in the lignocellulose fraction, by mass also the major fraction of the compost. In general, the types of bonds formed between soil organic matter and reduced TNT amines in controlled laboratory reactions were observed in the spectra of the whole compost and fractions, confirming that during composting TNT is reduced to amines that form covalent bonds with organic matter through aminohydroquinone, aminoquinone, heterocyclic, and imine linkages, among others. Concentrations of imine nitrogens in the compost spectra suggestthat covalent binding bythe diamines 2,4DANT and 2,6DANT is a significant process in the transformation of TNT into bound residues. Liquid-phase 15N NMR spectra of the fulvic acid and humin fractions provided possible evidence for involvement of phenoloxidase enzymes in covalent bond formation.

  5. Synthesis and evaluation of nitroxide-based oligoradicals for low-temperature dynamic nuclear polarization in solid state NMR.

    PubMed

    Yau, Wai-Ming; Thurber, Kent R; Tycko, Robert

    2014-07-01

    We describe the synthesis of new nitroxide-based biradical, triradical, and tetraradical compounds and the evaluation of their performance as paramagnetic dopants in dynamic nuclear polarization (DNP) experiments in solid state nuclear magnetic resonance (NMR) spectroscopy with magic-angle spinning (MAS). Under our experimental conditions, which include temperatures in the 25-30 K range, a 9.4 T magnetic field, MAS frequencies of 6.2-6.8 kHz, and microwave irradiation at 264.0 GHz from a 800 mW extended interaction oscillator source, the most effective compounds are triradicals that are related to the previously-described compound DOTOPA-TEMPO (see Thurber et al., 2010), but have improved solubility in glycerol/water solvent near neutral pH. Using these compounds at 30 mM total nitroxide concentration, we observe DNP enhancement factors of 92-128 for cross-polarized (13)C NMR signals from (15)N,(13)C-labeled melittin in partially protonated glycerol/water, and build-up times of 2.6-3.8s for (1)H spin polarizations. Net sensitivity enhancements with biradical and tetraradical dopants, taking into account absolute (13)C NMR signal amplitudes and build-up times, are approximately 2-4 times lower than with the best triradicals. PMID:24887201

  6. Synthesis and evaluation of nitroxide-based oligoradicals for low-temperature dynamic nuclear polarization in solid state NMR

    NASA Astrophysics Data System (ADS)

    Yau, Wai-Ming; Thurber, Kent R.; Tycko, Robert

    2014-07-01

    We describe the synthesis of new nitroxide-based biradical, triradical, and tetraradical compounds and the evaluation of their performance as paramagnetic dopants in dynamic nuclear polarization (DNP) experiments in solid state nuclear magnetic resonance (NMR) spectroscopy with magic-angle spinning (MAS). Under our experimental conditions, which include temperatures in the 25-30 K range, a 9.4 T magnetic field, MAS frequencies of 6.2-6.8 kHz, and microwave irradiation at 264.0 GHz from a 800 mW extended interaction oscillator source, the most effective compounds are triradicals that are related to the previously-described compound DOTOPA-TEMPO (see Thurber et al., 2010), but have improved solubility in glycerol/water solvent near neutral pH. Using these compounds at 30 mM total nitroxide concentration, we observe DNP enhancement factors of 92-128 for cross-polarized 13C NMR signals from 15N,13C-labeled melittin in partially protonated glycerol/water, and build-up times of 2.6-3.8 s for 1H spin polarizations. Net sensitivity enhancements with biradical and tetraradical dopants, taking into account absolute 13C NMR signal amplitudes and build-up times, are approximately 2-4 times lower than with the best triradicals.

  7. In-situ NMR study of molecular and ionic processes inside carbon nanopores

    NASA Astrophysics Data System (ADS)

    Luo, Zhixiang

    Interactions of simple ions with water and interfaces play critical roles in many electrochemical and biological processes. They are especially significant in nanoconfined regions and have a profound impact in many applications, for instance nanofluidics and supercapacitors. This dissertation employs a nuclear magnetic resonance (NMR) technique to study their influence on the ionic processes inside carbon nanopores. To characterize the carbon micropore structure, a convenient NMR method is established by taking a 1H magic angle spinning (MAS) spectrum of the adsorbed water. A density functional theory (DFT) computation of the nucleus-independent chemical shift (NICS) yields a quantitative relationship between the NICS values and the micropore sizes. The carbon micropore size and distribution are derived from the chemical shift and the spectrum lineshape. For aqueous electrolytes inside uncharged carbon nanopores, the measurement of ion concentrations reveals a substantial electroneutrality breakdown. The specific ion effects and ion-ion correlations are shown to play crucial roles in determining the degree of electroneutrality breakdown. The importance of those interactions is further revealed by the asymmetric and nonlinear responses of ion concentrations to the charging of the confining carbon walls. Such information is obtained with a carbon supercapacitor built into the NMR probe. The NMR observations are validated by a numerical calculation of the ion distribution in the nanopores using the generalized Poisson-Boltzmann (PB) equation, demonstrating that the nonelectrostatic interfacial interactions can indeed dominate the electrostatic interactions and lead to the breakdown of electroneutrality inside nanoconfined regions. Interfacial ion hydration is an essential part of the specific ion effects. Using in-situ 23Na and 19F NMR on carbon supercapacitors with different carbon pore sizes, I provide a molecular-scale understanding of the permeation and dehydration of ions in voltage-gated carbon nanopores.

  8. Resolving the Planetesimal Belt of HR 8799 with ALMA

    NASA Astrophysics Data System (ADS)

    Booth, Mark; Jordan, Andres; Hales, Antonio; Casassus, Simon; Dent, Bill; Faramaz, Virginie; Matrà, Luca

    2015-12-01

    HR 8799 is well known for being the only star to host multiple planets discovered through direct imaging. HR 8799 also hosts a debris disc first discovered by IRAS. This disc was one of the few resolved by Spitzer showing that dust is present out to a few thousand AU. The Spitzer data also showed that there must be multiple components to the dust both inside and outside the orbits of the planets. Naturally, this system has been a prime target for observations from various telescopes in recent years. We have observed the system with ALMA in band 6 (1340µm), detecting the disc at high resolution. For the first time we resolve the inner edge of the cold planetesimal belt and can determine its inclination at much higher precision than previous observations. I will discuss how these results compare to the previous observations and what these new results can tell us about the planets in the system.

  9. Modeling the Asteroseismic Surface Term across the HR Diagram

    E-print Network

    Schmitt, Joseph R

    2015-01-01

    Asteroseismology is a powerful tool that can precisely characterize the mass, radius, and other properties of field stars. However, our inability to properly model the near-surface layers of stars creates a frequency-dependent frequency difference between the observed and the modeled frequencies, usually referred to as the "surface term". This surface term can add significant errors to the derived stellar properties unless removed properly. In this paper we simulate surface terms across a significant portion of the HR diagram, exploring four different masses ($M=0.8, 1.0, 1.2$, and $1.5$ M$_\\odot$) at five metallicities ($[\\rm{Fe/H}]=0.5, 0.0, -0.5 ,-1.0, and -1.5$) from main sequence to red giants for stars with $T_{\\rm{eff}}HR diagram, including the red giants, lea...

  10. Ring Nebulae around Massive Stars throughout the HR Diagram

    E-print Network

    You-Hua Chu

    2002-08-07

    Massive stars evolve across the HR diagram, losing mass along the way and forming a variety of ring nebulae. During the main sequence stage, the fast stellar wind sweeps up the ambient interstellar medium to form an interstellar bubble. After a massive star evolves into a red giant or a luminous blue variable, it loses mass copiously to form a circumstellar nebula. As it evolves further into a WR star, the fast WR wind sweeps up the previous mass loss and forms a circumstellar bubble. Observations of ring nebulae around massive stars not only are fascinating, but also are useful in providing templates to diagnose the progenitors of supernovae from their circumstellar nebulae. In this review, I will summarize the characteristics of ring nebulae around massive stars throughout the HR diagram, show recent advances in X-ray observations of bubble interiors, and compare supernovae's circumstellar nebulae with known types of ring nebulae around massive stars.

  11. Ultraviolet, optical, infrared, and microwave observations of HR 5110

    NASA Technical Reports Server (NTRS)

    Little-Marenin, I. R.; Simon, T.; Ayres, T. R.; Cohen, N. L.; Feldman, P. A.

    1986-01-01

    Near-IR JHKLM photometric data and VLBI and IUE radio burst data collected on the short-period spectroscopic binary HR 5110 are analyzed to classify the object. The observed broadband colors were indicative of an F2 IV primary and a spotted K0 IV secondary. The system is being viewed pole-on, so is observable in the UV since the K companion has filled its Roche lobe. In comparisons of such features of Algol and RS VCn stars as the mass ratio, orbital inclination, presence or absence of evidence for mass streams, accretion disks, and active regions, spectral signatures, etc., sufficient similarities are found to classify HR 5110 as an Algol system.

  12. The development of the ProMAS: a Probabilistic Medication Adherence Scale.

    PubMed

    Kleppe, Mieke; Lacroix, Joyca; Ham, Jaap; Midden, Cees

    2015-01-01

    Current self-report medication adherence measures often provide heavily skewed results with limited variance, suggesting that most participants are highly adherent. This contrasts with findings from objective adherence measures. We argue that one of the main limitations of these self-report measures is the limited range covered by the behaviors assessed. That is, the items do not match the adherence behaviors that people perform, resulting in a ceiling effect. In this paper, we present a new self-reported medication adherence scale based on the Rasch model approach (the ProMAS), which covers a wide range of adherence behaviors. The ProMAS was tested with 370 elderly receiving medication for chronic conditions. The results indicated that the ProMAS provided adherence scores with sufficient fit to the Rasch model. Furthermore, the ProMAS covered a wider range of adherence behaviors compared to the widely used Medication Adherence Report Scale (MARS) instrument, resulting in more variance and less skewness in adherence scores. We conclude that the ProMAS is more capable of discriminating between people with different adherence rates than the MARS. PMID:25784791

  13. NMR data-driven structure determination using NMR-I-TASSER in the CASD-NMR experiment

    E-print Network

    Zhang, Yang

    to a single structure is not required. Retroactive and blind tests of the CASD- NMR targets from Rounds 1 structures from the Protein Data Bank (PDB), which can implement the re- straints derived from NMR (&) School of Software Engineering, Huazhong University of Science and Technology, Wuhan 430074, Hubei, China

  14. The Dynamical Structure of HR 8799's Inner Debris Disk.

    PubMed

    Contro, B; Wittenmyer, Robert A; Horner, J; Marshall, Jonathan P

    2015-06-01

    The HR 8799 system, with its four giant planets and two debris belts, has an architecture closely mirroring that of our Solar system where the inner, warm asteroid belt and outer, cool Edgeworth-Kuiper belt bracket the giant planets. As such, it is a valuable laboratory for examining exoplanetary dynamics and debris disk-exoplanet interactions. Whilst the outer debris belt of HR 8799 has been well resolved by previous observations, the spatial extent of the inner disk remains unknown. This leaves a significant question mark over both the location of the planetesimals responsible for producing the belt's visible dust and the physical properties of those grains. We have performed the most extensive simulations to date of the inner, unresolved debris belt around HR 8799, using UNSW Australia's Katana supercomputing facility to follow the dynamical evolution of a model inner disk comprising 300,298 particles for a period of 60 Ma. These simulations have enabled the characterisation of the extent and structure of the inner disk in detail, and will in future allow us to provide a first estimate of the small-body impact rate and water delivery prospects for possible (as-yet undetected) terrestrial planet (s) in the inner system. PMID:25862330

  15. The Dynamical Structure of HR 8799's Inner Debris Disk

    NASA Astrophysics Data System (ADS)

    Contro, B.; Wittenmyer, Robert A.; Horner, J.; Marshall, Jonathan P.

    2015-06-01

    The HR 8799 system, with its four giant planets and two debris belts, has an architecture closely mirroring that of our Solar system where the inner, warm asteroid belt and outer, cool Edgeworth-Kuiper belt bracket the giant planets. As such, it is a valuable laboratory for examining exoplanetary dynamics and debris disk-exoplanet interactions. Whilst the outer debris belt of HR 8799 has been well resolved by previous observations, the spatial extent of the inner disk remains unknown. This leaves a significant question mark over both the location of the planetesimals responsible for producing the belt's visible dust and the physical properties of those grains. We have performed the most extensive simulations to date of the inner, unresolved debris belt around HR 8799, using UNSW Australia's Katana supercomputing facility to follow the dynamical evolution of a model inner disk comprising 300,298 particles for a period of 60 Ma. These simulations have enabled the characterisation of the extent and structure of the inner disk in detail, and will in future allow us to provide a first estimate of the small-body impact rate and water delivery prospects for possible (as-yet undetected) terrestrial planet (s) in the inner system.

  16. The dynamical structure of HR 8799's inner debris disk

    E-print Network

    Contro, Bruna; Horner, Jonti; Marshall, Jonathan P

    2015-01-01

    The HR 8799 system, with its four giant planets and two debris belts, has an architecture closely mirroring that of our Solar system where the inner, warm asteroid belt and outer, cool Edgeworth-Kuiper belt bracket the giant planets. As such, it is a valuable laboratory for examining exoplanetary dynamics and debris disk-exoplanet interactions. Whilst the outer debris belt of HR 8799 has been well resolved by previous observations, the spatial extent of the inner disk remains unknown. This leaves a significant question mark over both the location of the planetesimals responsible for producing the belt's visible dust and the physical properties of those grains. We have performed the most extensive simulations to date of the inner, unresolved debris belt around HR 8799, using UNSW Australia's Katana supercomputing facility to follow the dynamical evolution of a model inner disk comprising 300,298 particles for a period of 60 million years. These simulations have enabled the characterisation of the extent and st...

  17. New SPHERE results on the planetary system around HR8799

    NASA Astrophysics Data System (ADS)

    Zurlo, Alice; Bonnefoy, Mickaël

    2015-12-01

    Since its discovery in 2008, the multi-planetary system around HR8799 has become a unique testbed for planet formation theories at large orbital radii and the study of non-irradiated planetary atmospheres. We present new SPHERE/IRDIS data in J, H, and K band, for the four planets HR8799bcde with SPHERE/IRDIS and YH-band spectra for planets d and e with SPHERE/IFS. We detect the closest planet HR8799e in J band for the first time. The astrometry gathered for three epochs of observation set new constraints on a hypothetical planet f. We combine the SPHERE photometry and spectra to demonstrate that the 1-5 µm spectral-energy distribution (SED) of the planets e and d can be represented by those of dusty -and young - L7 dwarfs. We show that the two outermost planet SEDs are well reproduced by the spectra of peculiar early-T dwarfs reddened by refractory grain opacities. This demonstrates that the planet peculiar photometric properties are dominated by the effect of dust, and suggests that the planets c, and then b, are less massive that the two innermost ones.

  18. Recoupling of chemical shift anisotropy by R-symmetry sequences in magic angle spinning NMR spectroscopy

    NASA Astrophysics Data System (ADS)

    Hou, Guangjin; Byeon, In-Ja L.; Ahn, Jinwoo; Gronenborn, Angela M.; Polenova, Tatyana

    2012-10-01

    13C and 15N chemical shift (CS) interaction is a sensitive probe of structure and dynamics in a wide variety of biological and inorganic systems, and in the recent years several magic angle spinning NMR approaches have emerged for residue-specific measurements of chemical shift anisotropy (CSA) tensors in uniformly and sparsely enriched proteins. All of the currently existing methods are applicable to slow and moderate magic angle spinning (MAS) regime, i.e., MAS frequencies below 20 kHz. With the advent of fast and ultrafast MAS probes capable of spinning frequencies of 40-100 kHz, and with the superior resolution and sensitivity attained at such high frequencies, development of CSA recoupling techniques working under such conditions is necessary. In this work, we present a family of R-symmetry based pulse sequences for recoupling of 13C/15N CSA interactions that work well in both natural abundance and isotopically enriched systems. We demonstrate that efficient recoupling of either first-rank (?1) or second-rank (?2) spatial components of CSA interaction is attained with appropriately chosen ?-encoded RNnv symmetry sequences. The advantage of these ?-encoded RNnv-symmetry based CSA (RNCSA) recoupling schemes is that they are suitable for CSA recoupling under a wide range of MAS frequencies, including fast MAS regime. Comprehensive analysis of the recoupling properties of these RNnv symmetry sequences reveals that the ?1-CSA recoupling symmetry sequences exhibit large scaling factors; however, the partial homonuclear dipolar Hamiltonian components are symmetry allowed, which makes this family of sequences suitable for CSA measurements in systems with weak homonuclear dipolar interactions. On the other hand, the ?-encoded symmetry sequences for ?2-CSA recoupling have smaller scaling factors but they efficiently suppress the homonuclear dipole-dipole interactions. Therefore, the latter family of sequences is applicable for measurements of CSA parameters in systems with strong homonuclear dipolar couplings, such as uniformly-13C labeled biological solids. We demonstrate RNCSA NMR experiments and numerical simulations establishing the utility of this approach to the measurements of 13C and 15N CSA parameters in model compounds, [15N]-N-acetyl-valine (NAV), [U-13C, 15N]-alanine, [U-13C,15N]-histidine, and present the application of this approach to [U-13C/15N]-Tyr labeled C-terminal domain of HIV-1 CA protein.

  19. High-resolution proton CRAMPS NMR using narrowband analog filters and postponed data acquisition

    NASA Astrophysics Data System (ADS)

    Wang, Liying; Zhou, Donghua H.

    2013-09-01

    Proton linewidths decrease with increasing magic-angle spinning (MAS) rates. However, without spin dilution by deuteration, even with the fastest MAS rates available today, the narrowest proton linewidths are obtained by using the combined rotation and multiple pulse spectroscopy (CRAMPS) method. Direct observation under windowed CRAMPS typically introduces several tens of times more noise, partly because wideband analog filters (e.g. 5 MHz) must be used or sometimes even bypassed. Here we report that it is possible to keep using narrowband analog filters (about 50 kHz cutoff frequency) in CRAMPS by taking advantage of the time delay caused by the filters, which is inversely proportional to the cutoff frequency. This delay coincides with typical CRAMPS cycle times, enabling acquisition of the data point in the next detection window. The noise of such CRAMPS spectra is only about 5 times larger than MAS-only spectra. This new method allows CRAMPS to be performed on systems that lack wideline hardware (wideband filters and fast ADCs), for example, older spectrometers originally intended for solution NMR.

  20. Cryogenic sample exchange NMR probe for magic angle spinning dynamic nuclear polarization

    PubMed Central

    Barnes, Alexander B.; Mak-Jurkauskas, Melody L.; Matsuki, Yoh; Bajaj, Vikram S.; van der Wel, Patrick C. A.; DeRocher, Ronald; Bryant, Jeffrey; Sirigiri, Jagadishwar R.; Temkin, Richard J.; Lugtenburg, Johan; Herzfeld, Judith; Griffin, Robert G.

    2009-01-01

    We describe a cryogenic sample exchange system that dramatically improves the efficiency of magic angle spinning (MAS) dynamic nuclear polarization (DNP) experiments by reducing the time required to change samples and by improving long-term instrument stability. Changing samples in conventional cryogenic MAS DNP/NMR experiments involves warming the probe to room temperature, detaching all cryogenic, RF, and microwave connections, removing the probe from the magnet, replacing the sample, and reversing all the previous steps, with the entire cycle requiring a few hours. The sample exchange system described here — which relies on an eject pipe attached to the front of the MAS stator and a vacuum jacketed dewar with a bellowed hole — circumvents these procedures. To demonstrate the excellent sensitivity, resolution, and stability achieved with this quadruple resonance sample exchange probe, we have performed high precision distance measurements on the active site of the membrane protein bacteriorhodopsin. We also include a spectrum of the tripeptide N-f-MLF-OH at 100 K which shows 30 Hz linewidths. PMID:19356957

  1. Cornus mas (Linnaeus) Novel Devised Medicinal Preparations: Bactericidal Effect against Staphylococcus aureus and Pseudomonas aeruginosa.

    PubMed

    Kyriakopoulos, Anthony M; Dinda, Biswanath

    2015-01-01

    The medicinal properties of Cornus mas L. (=Cornus mascula L.), Cornaceae, are well described in Hippocratian documents, and recent research provides experimental evidence for some of these properties. However, the chemical components of Cornus mas L. that may be of pharmaceutical importance are relatively unstable. In this respect a novel methodology for plant nutrient element extraction that provides favorable conditions for simultaneous stabilization of such fragile and unstable structures has been devised. Using this methodology, medicinal preparations derived from Cornus mas L. fresh fruits, proved to possess significant antimicrobial activity selective against S. aureus and P. aeruginosa. This effect became apparent with the addition of sodium bromide in the extraction procedure and varied with the ion availability during extraction. The identification of novel agents with potent antimicrobial activity against these species is of medical importance to overcome the problem of universal antibiotic resistance. PMID:26091077

  2. Technology Enhanced Learning for People with Intellectual Disabilities and Cerebral Paralysis: The MAS Platform

    NASA Astrophysics Data System (ADS)

    Colomo-Palacios, Ricardo; Paniagua-Martín, Fernando; García-Crespo, Ángel; Ruiz-Mezcua, Belén

    Education for students with disabilities now takes place in a wide range of settings, thus, including a wider range of assistive tools. As a result of this, one of the most interesting application domains of technology enhanced learning is related to the adoption of learning technologies and designs for people with disabilities. Following this unstoppable trend, this paper presents MAS, a software platform aimed to help people with severe intellectual disabilities and cerebral paralysis in their learning processes. MAS, as a technology enhanced learning platform, provides several tools that supports learning and monitoring for people with special needs, including adaptative games, data processing and monitoring tools. Installed in a special needs education institution in Madrid, Spain, MAS provides special educators with a tool that improved students education processes.

  3. Assignment of congested NMR spectra: Carbonyl backbone enrichment via the Entner Doudoroff pathway

    NASA Astrophysics Data System (ADS)

    Goldbourt, Amir; Day, Loren A.; McDermott, Ann E.

    2007-12-01

    In NMR spectra of complex proteins, sparse isotope enrichment can be important, in that the removal of many 13C- 13C homonuclear J-couplings can narrow the lines and thereby facilitate the process of spectral assignment and structure elucidation. We present a simple scheme for selective yet extensive isotopic enrichment applicable for production of proteins in organisms utilizing the Entner-Doudoroff (ED) metabolic pathway. An enrichment scheme so derived is demonstrated in the context of a magic-angle spinning solid-state NMR (MAS SSNMR) study of Pf1 bacteriophage, the host of which is Pseudomonas aeruginosa, strain K (PAK), an organism that uses the ED pathway for glucose catabolism. The intact and infectious Pf1 phage in this study was produced by infected PAK cells grown on a minimal medium containing 1- 13C D-glucose ( 13C in position 1) as the sole carbon source, as well as 15NH 4Cl as the only nitrogen source. The 37 MDa Pf1 phage consists of about 93% major coat protein, 1% minor coat proteins, and 6% single-stranded, circular DNA. As a consequence of this composition and the enrichment scheme, the resonances in the MAS SSNMR spectra of the Pf1 sample were almost exclusively due to carbonyl carbons in the major coat protein. Moreover, 3D heteronuclear NCOCX correlation experiments also show that the amino acids leucine, serine, glycine, and tyrosine were not isotopically enriched in their carbonyl positions (although most other amino acids were), which is as expected based upon considerations of the ED metabolic pathway. 3D NCOCX NMR data and 2D 15N- 15N data provided strong verification of many previous assignments of 15N amide and 13C carbonyl shifts in this highly congested spectrum; both the semi-selective enrichment patterns and the narrowed linewidths allowed for greater certainty in the assignments as compared with use of uniformly enriched samples alone.

  4. Study of flow and particle distribution in a bifurcation using dynamic NMR Microscopy

    NASA Astrophysics Data System (ADS)

    Fridjonsson, E. O.; Seymour, J. D.; Codd, S. L.; Cokelet, G. R.

    2007-11-01

    The flow and distribution of Newtonian, polymeric and colloid suspension fluids at low Reynolds numbers in bifurcations has importance in a wide range of disciplines, including microvascular physiology and microfluidic devices. A bifurcation consisting of circular capillaries laser etched in a hard polymer with inlet diameter 2.64 mm, bifurcating to a small diameter outlet of 0.76 mm, and a large outlet of 1.35 mm diameter is examined using four distinct fluids (Water, 0.25 percent (w/w) Xanthan Gum, 8 and 22 percent (v/v) polydisperse oil inside core-shell latex particles) at different flow rates from 5mL/hr to 30mL/hr covering a range of Reynolds numbers based on the entry flow from 0.3 to 8. A Bruker DRX250 NMR system is used with PGSE techniques to obtain dynamic images of the fluids inside the bifurcation. Velocity in all three spatial directions is examined to determine the impact of secondary flows and characterize the transport in the bifurcation. The velocity data provides direct measurement of the volumetric distribution of the flow between the two channels. For the colloidal particle flow the distribution of colloid particles down the capillary is determined by examining the spectrally resolved propagator for the oil inside the core-shell particles in the direction perpendicular to the axial flow. Using dynamic NMR Microscopy the potential for using magnetic resonance for particle counting in a microscale bifurcation is thus demonstrated.

  5. Robust, integrated computational control of NMR experiments to achieve optimal assignment by ADAPT-NMR.

    PubMed

    Bahrami, Arash; Tonelli, Marco; Sahu, Sarata C; Singarapu, Kiran K; Eghbalnia, Hamid R; Markley, John L

    2012-01-01

    ADAPT-NMR (Assignment-directed Data collection Algorithm utilizing a Probabilistic Toolkit in NMR) represents a groundbreaking prototype for automated protein structure determination by nuclear magnetic resonance (NMR) spectroscopy. With a [(13)C,(15)N]-labeled protein sample loaded into the NMR spectrometer, ADAPT-NMR delivers complete backbone resonance assignments and secondary structure in an optimal fashion without human intervention. ADAPT-NMR achieves this by implementing a strategy in which the goal of optimal assignment in each step determines the subsequent step by analyzing the current sum of available data. ADAPT-NMR is the first iterative and fully automated approach designed specifically for the optimal assignment of proteins with fast data collection as a byproduct of this goal. ADAPT-NMR evaluates the current spectral information, and uses a goal-directed objective function to select the optimal next data collection step(s) and then directs the NMR spectrometer to collect the selected data set. ADAPT-NMR extracts peak positions from the newly collected data and uses this information in updating the analysis resonance assignments and secondary structure. The goal-directed objective function then defines the next data collection step. The procedure continues until the collected data support comprehensive peak identification, resonance assignments at the desired level of completeness, and protein secondary structure. We present test cases in which ADAPT-NMR achieved results in two days or less that would have taken two months or more by manual approaches. PMID:22427982

  6. NMR quantum gate factorization through canonical cosets

    E-print Network

    Renan Cabrera; Denys I. Bondar; Herschel A. Rabitz

    2012-10-29

    The block canonical coset decomposition is developed as a universal algorithmic tool to synthesize n-qubit quantum gates out of experimentally realizable NMR elements. The two-, three-, and four-qubit quantum Fourier transformations are worked out as examples. The proposed decomposition bridges the state of the art numerical analysis with NMR quantum gate synthesis.

  7. NMR Spectroscopy and Its Value: A Primer

    ERIC Educational Resources Information Center

    Veeraraghavan, Sudha

    2008-01-01

    Nuclear magnetic resonance (NMR) spectroscopy is widely used by chemists. Furthermore, the use of NMR spectroscopy to solve structures of macromolecules or to examine protein-ligand interactions is popular. Yet, few students entering graduate education in biological sciences have been introduced to this method or its utility. Over the last six…

  8. An Inversion Recovery NMR Kinetics Experiment

    ERIC Educational Resources Information Center

    Williams, Travis J.; Kershaw, Allan D.; Li, Vincent; Wu, Xinping

    2011-01-01

    A convenient laboratory experiment is described in which NMR magnetization transfer by inversion recovery is used to measure the kinetics and thermochemistry of amide bond rotation. The experiment utilizes Varian spectrometers with the VNMRJ 2.3 software, but can be easily adapted to any NMR platform. The procedures and sample data sets in this…

  9. Liquid-State NMR Quantum Computing

    E-print Network

    Liquid-State NMR Quantum Computing Lieven M. K. Vandersypen TU Delft, Delft, the Netherlands Isaac, Dortmund, Germany 1 Introduction 1 2 Quantum Computation 1 3 NMR Quantum Computers 5 4 Summary of doing computation becomes possible, which is known as quantum computation (QC). Quantum computing

  10. An Integrated Laboratory Project in NMR Spectroscopy.

    ERIC Educational Resources Information Center

    Hudson, Reggie L.; Pendley, Bradford D.

    1988-01-01

    Describes an advanced NMR project that can be done with a 60-MHz continuous-wave proton spectrometer. Points out the main purposes are to give students experience in second-order NMR analysis, the simplification of spectra by raising the frequency, and the effect of non-hydrogen nuclei on proton resonances. (MVL)

  11. Using Cloud Storage for NMR Data Distribution

    ERIC Educational Resources Information Center

    Soulsby, David

    2012-01-01

    An approach using Google Groups as method for distributing student-acquired NMR data has been implemented. We describe how to configure NMR spectrometer software so that data is uploaded to a laboratory section specific Google Group, thereby removing bottlenecks associated with printing and processing at the spectrometer workstation. Outside of…

  12. NMR studies of oriented molecules

    SciTech Connect

    Sinton, S.W.

    1981-11-01

    Deuterium and proton magnetic resonance are used in experiments on a number of compounds which either form liquid crystal mesophases themselves or are dissolved in a liquid crystal solvent. Proton multiple quantum NMR is used to simplify complicated spectra. The theory of nonselective multiple quantum NMR is briefly reviewed. Benzene dissolved in a liquid crystal are used to demonstrate several outcomes of the theory. Experimental studies include proton and deuterium single quantum (..delta..M = +-1) and proton multiple quantum spectra of several molecules which contain the biphenyl moiety. 4-Cyano-4'-n-pentyl-d/sub 11/-biphenyl (5CB-d/sub 11/) is studied as a pure compound in the nematic phase. The obtained chain order parameters and dipolar couplings agree closely with previous results. Models for the effective symmetry of the biphenyl group in 5CB-d/sub 11/ are tested against the experimental spectra. The dihedral angle, defined by the planes containing the rings of the biphenyl group, is found to be 30 +- 2/sup 0/ for 5DB-d/sub 11/. Experiments are also described for 4,4'-d/sub 2/-biphenyl, 4,4' - dibromo-biphenyl, and unsubstituted biphenyl.

  13. Picoliter H-1 NMR Spectroscopy

    SciTech Connect

    Minard, Kevin R.); Wind, Robert A.)

    2002-02-01

    A RF probe that fits inside the bore of a small gradient coil package is described for routine 1H-NMR microscopy measurements on small samples. The probe operates at 500 MHz and houses a 267-um-diameter solenoid transceiver. When used in three dimensional chemical shift imaging (3D-CSI) experiments, the measured signal-to-noise ratio (SNR) is shown to be within 20-30 percent of theoretical limits formulated by only considering the solenoid's resistive losses. This is illustrated using a 100-um-diameter globule of triacylglycerols ({approx}900mM) that may be an oocyte precursor in young Xenopus Laevis frogs, and water sample containing choline at a concentration often found in live cells ({approx}33mM). In chemical shift images generated using a few thousand scans, the choline methyl line is found to have an acceptable SNR in resolved from just 5 picoliters in the Xenopus globule. It is concluded that the probe's sensitivity is sufficient for performing 1H-NMR on picoliter-scale volumes in biological cells and tissues.

  14. NEW PRECISION ORBITS OF BRIGHT DOUBLE-LINED SPECTROSCOPIC BINARIES. IV. 66 ANDROMEDAE, HR 6979, AND HR 9059

    SciTech Connect

    Fekel, Francis C.; Williamson, Michael H.; Tomkin, Jocelyn E-mail: jt@alexis.as.utexas.edu

    2010-04-15

    We have determined improved spectroscopic orbits for three double-lined binaries, 66 And (F4 V), HR 6979 (Am), and HR 9059 (F5 IV) using radial velocities from the 2.1 m telescope at McDonald Observatory, the coude feed telescope at Kitt Peak National Observatory, and 2 m telescope at Fairborn Observatory. The orbital periods range from 11.0 to 14.3 days, and all three systems have eccentric orbits. The new orbital dimensions (a {sub 1} sin i and a {sub 2} sin i) and minimum masses (m {sub 1} sin{sup 3} i and m {sub 2} sin{sup 3} i) have accuracies of 0.2% or better. All six components of the three binary systems are rotating more slowly than their predicted pseudosynchronous rotational velocities. Hipparcos photometry of HR 9059 shows that this system has partial eclipses. Its components are nearly identical in mass and are at the very end of their main-sequence lifetimes or perhaps have just begun to traverse the Hertsprung gap.

  15. NMR and MRI apparatus and method

    DOEpatents

    Clarke, John; Kelso, Nathan; Lee, SeungKyun; Moessle, Michael; Myers, Whittier; McDermott, Robert; ten Haken, Bernard; Pines, Alexander; Trabesinger, Andreas

    2007-03-06

    Nuclear magnetic resonance (NMR) signals are detected in microtesla fields. Prepolarization in millitesla fields is followed by detection with an untuned dc superconducting quantum interference device (SQUID) magnetometer. Because the sensitivity of the SQUID is frequency independent, both signal-to-noise ratio (SNR) and spectral resolution are enhanced by detecting the NMR signal in extremely low magnetic fields, where the NMR lines become very narrow even for grossly inhomogeneous measurement fields. Additional signal to noise benefits are obtained by use of a low noise polarization coil, comprising litz wire or superconducting materials. MRI in ultralow magnetic field is based on the NMR at ultralow fields. Gradient magnetic fields are applied, and images are constructed from the detected NMR signals.

  16. Thermoresponsive gold nanoshell@mesoporous silica nano-assemblies: an XPS/NMR survey.

    PubMed

    Soulé, S; Allouche, J; Dupin, J-C; Courrèges, C; Plantier, F; Ojo, W-S; Coppel, Y; Nayral, C; Delpech, F; Martinez, H

    2015-10-28

    This work provides a detailed study on the physico-chemical characterization of a mechanized silver-gold alloy@mesoporous silica shell/pseudorotaxane nano-assembly using two main complementary techniques: XPS and NMR (liquid- and solid-state). The pseudorotaxane nanovalve is composed of a stalk (N-(6-aminohexyl)-aminomethyltriethoxysilane)/macrocycle (cucurbit[6]uril (CB6)) complex anchored to the silica shell leading to a silica/nanovalve hybrid organic-inorganic interface that has been fully characterized. The stalk introduction in the silica network was clearly demonstrated by XPS measurements, with the Si 2p peak shifting to lower energy after grafting, and through the analysis of the C 1s and N 1s core peaks, which indicated the presence of CB6 on the nanoparticle surface. For the first time, the complex formation on nanoparticles was proved by high speed (1)H MAS NMR experiments. However, these solid state NMR analyses have shown that the majority of the stalk does not interact with the CB6 macrocycle when formulated in powder after removing the solvent. This can be related to the large number of possible organizations and interactions between the stalk, the CB6 and the silica surface. These results highlight the importance of using a combination of adapted and complementary highly sensitive surface and volume characterization techniques to design tailor-made hybrid hierarchical structured nano-assemblies with controlled and efficient properties for potential biological purposes. PMID:26447146

  17. Magic angle spinning NMR experiments for structural studies of differentially enriched protein interfaces and protein assemblies.

    PubMed

    Yang, Jun; Tasayco, Maria Luisa; Polenova, Tatyana

    2008-04-30

    Protein-protein interactions play vital roles in numerous biological processes. These interactions often result in formation of insoluble and noncrystalline protein assemblies. Solid-state NMR spectroscopy is rapidly emerging as a premier method for structural analysis of such systems. We introduce a family of two-dimensional magic angle spinning (MAS) NMR experiments for structural studies of differentially isotopically enriched protein assemblies. Using 1-73((13)C,(15)N)/74-108((15)N) labeled thioredoxin reassembly, we demonstrate that dipolar dephasing followed by proton-assisted heteronuclear magnetization transfer yields long-range (15)N-(13)C correlations arising exclusively from the interfaces formed by the pair of differentially enriched complementary fragments of thioredoxin. Incorporation of dipolar dephasing into the (15)N proton-driven spin diffusion and into the (1)H-(15)N FSLG-HETCOR sequences permits (1)H and (15)N resonance assignments of the 74-108((15)N) enriched C-terminal fragment of thioredoxin alone. The differential isotopic labeling scheme and the NMR experiments demonstrated here allow for structural analysis of both the interface and each interacting protein. Isotope editing of the magnetization transfers results in spectral simplification, and therefore larger protein assemblies are expected to be amenable to these experiments. PMID:18393505

  18. Solid-state NMR studies and DFT calculations of flavonoids: baicalein, baicalin and wogonoside.

    PubMed

    Wolniak, Micha?; Oszmia?ski, Jan; Wawer, Iwona

    2008-03-01

    Three flavonoids of pharmaceutical importance-baicalein, baicalin, and wogonoside-were isolated from a Chinese medicinal plant Scutellaria baicalensis Georgi and studied by 13C NMR in solution and solid state. Two-dimensional (2D) NMR spectroscopy in the liquid phase and dipolar dephasing (DD) experiments in magic-angle spinning (MAS) spectra enabled the assignment of 13C resonances. The cross-polarization (CP) time constants T(CH) and relaxation times T(H) (1rho) were obtained from the variable-contact time experiments. The principal elements of the 13C chemical shift tensor were determined in the spectra recorded under slow sample spinning (2 kHz) using phase-adjusted spinning sideband (PASS)-2D NMR technique, and were verified by density functional theory gauge-independent atomic orbital (DFT GIAO) calculations of shielding constants. Analysis of the 13C delta(ii) and comparison with shielding parameters calculated for different conformers of compounds 1-3 enabled the selection of the most reliable geometry in the solid phase. In all three compounds, an intramolecular hydrogen bond C5--OH...=C4 is formed; the existence of baicalein and baicalin with 'anticlockwise' orientation of OH groups is more probable. PMID:18098151

  19. Multiple-pulse and magic-angle spinning aided double-quantum proton solid-state NMR spectroscopy

    NASA Astrophysics Data System (ADS)

    Madhu, P. K.; Vinogradov, Elena; Vega, Shimon

    2004-08-01

    We here report on a high-resolution pulse scheme for double-quantum (DQ) proton NMR spectroscopy in the solid-state. The pulse scheme employs a combination of multiple-pulses and magic-angle spinning (MAS) for both the excitation and conversion of DQ coherences and their evolution under homonuclear dipolar decoupling. This is made possible in this two-dimensional experiment by an effective combination of homonuclear dipolar decoupling method of phase modulated Lee-Goldburg and symmetry adapted sequence for homonuclear dipolar recoupling under MAS. DQ spectra of monoethyl fumaric acid, glycine, and histidine are presented to highlight the utility of the pulse scheme together with some of the existing drawbacks.

  20. Quantitative solid state {sup 13}C NMR measurements on kerogens

    SciTech Connect

    Maroto-Valer, M.M.; Love, G.D.; Snape, C.E.

    1996-12-31

    The use of the well-established techniques of high power decoupling, magic angle spinning (MAS) and cross-polarisation (CP) are used routinely to obtain high resolution {sup 13}C spectra of kerogens. However, due to unfortunate spin dynamics in CP, not all the carbons are observed. Results on a selection of type I sand II kerogens will be presented to demonstrate that the best strategy to obtain quantitative {sup 13}C NMR results is offered by a combination of a low magnetic field strength to minimize problems with spinning sidebands and the simple, albeit insensitive, Bloch decay or single pulse excitation (SPE) technique. Virtually all of the carbon in the type I and II kerogens and a wide range of coals has been observed using the SPE technique with the aromaticity and non-protonated aromatic carbon concentrations being invariably higher than those derived by the more rapid, but quantitatively unreliable CP method. Further, an extremely good correlation has been obtained between the carbon aromaticities and atomic H/C ratios for the samples investigated. The methodology has also been used to estimate the long methylene chain contents of kerogens and the extent of aromatisation that occurs in normal pyrolysis and pyrolysis under high hydrogen pressure (hydropyrolysis).

  1. Employee Returns: Linking HR Performance Indicators to Business Strategy. IES Report 365.

    ERIC Educational Resources Information Center

    Carter, Alison; Robinson, Dilys

    This document is a practical guide that demonstrates how human resource (HR) professionals can use performance measurement to link HR to organizational strategy and business objectives, and thereby raise the profile of HR within their organization. The following are among the topics examined: (1) the strategic context of measurement (the role…

  2. C h a p t e r 8 Construction and Analysis of HR Diagrams

    E-print Network

    Hillenbrand, Lynne

    C h a p t e r 8 Construction and Analysis of HR Diagrams In this Chapter we combine our optical photometric and spectroscopic datasets to assemble HR diagrams for several Ae/Be regions. We begin of Young Stars in the log T eff ­ log (L= L fi ) Plane To place the stars in an HR diagram, effective

  3. The Role of MAS as a Decision Support Tool in a Water-Rights Market

    E-print Network

    Garrido, Antonio

    The Role of MAS as a Decision Support Tool in a Water-Rights Market Vicente Botti1 , Antonio@iiia.csic.es Abstract. Water is getting a more and more scarce resource, which motivates the idea of designing a framework where water rights may be exchanged more freely, thus leading to a more efficient use of water

  4. Commitment-based Protocols with Behavioral Rules and Correctness Properties of MAS

    E-print Network

    Torino, Università di

    is just a formal definition of what is lawful for its player to do or to expect at any possible state in the social state of the system. It represents the fact that a debtor commits to a credi- tor to bring aboutCommitment-based Protocols with Behavioral Rules and Correctness Properties of MAS Matteo Baldoni

  5. Pharmacy Residency Applications Felix K. Yam, Pharm.D., M.A.S., BCPS

    E-print Network

    Gleeson, Joseph G.

    , work and clinical settings · Ask your letter writers early · Pharmacy is a small world #12;PotentialPharmacy Residency Applications Felix K. Yam, Pharm.D., M.A.S., BCPS Postgraduate Preparation need to be organized · Clearly written and concise #12;Curriculum Vitae · Work experience · Pharmacy

  6. Managing water demand as a regulated open MAS. (Work in progress)

    E-print Network

    Garrido, Antonio

    1 Managing water demand as a regulated open MAS. (Work in progress) Vicente Botti 1 , Antonio Scientific Research Council, {vbotti,agarridot,agiret}@dsic.upv.es, pablo@iiia.csic.es I. WATER MANAGEMENT of water policy is the need to foster a more rational use of the resource and this may be addressed

  7. Managing water demand as a regulated open MAS. (Work in progress)

    E-print Network

    Garrido, Antonio

    1 Managing water demand as a regulated open MAS. (Work in progress) Vicente Botti1 , Antonio Scientific Research Council, {vbotti,agarridot,agiret}@dsic.upv.es, pablo@iiia.csic.es I. WATER MANAGEMENT of water policy is the need to foster a more rational use of the resource and this may be addressed

  8. An Analysis of the Rise and Fall of the AA-MAS Policy

    ERIC Educational Resources Information Center

    Lazarus, Sheryl S.; Thurlow, Martha L.; Ysseldyke, James E.; Edwards, Lynn M.

    2015-01-01

    In 2005, to address concerns about students who might fall in the "gap" between the regular assessment and the alternate assessment based on alternate achievement standards (AA-AAS), the U.S. Department of Education announced that states could develop alternate assessments based on modified achievement standards (AA-MAS). This article…

  9. Considerations for Consortia as States Transition Away from AA-MAS. NCEO Brief. Number 7

    ERIC Educational Resources Information Center

    National Center on Educational Outcomes, 2014

    2014-01-01

    States with an alternate assessment based on modified achievement standards (AA-MAS) that received a flexibility waiver from some of the requirements of No Child Left Behind are required to phase out their use of this assessment. And, on August 23, 2013, the U.S. Department of Education published a proposed rollback of regulation that allowed the…

  10. Successfully Transitioning from the AA-MAS to the General Assessment. NCEO Policy Directions. Number 22

    ERIC Educational Resources Information Center

    Lazarus, Sheryl; Thurlow, Martha; Christensen, Laurene; Shyyan, Vitaliy

    2014-01-01

    Federal policy initiatives such as the flexibility waivers for accountability are requiring that states transition away from the use of an alternate assessment based on modified achievement standards (AA-MAS). It is expected that those students who had participated in that assessment will instead participate in the state's general assessment…

  11. The RoboCup Soccer Server and CMUnited Clients: Implemented Infrastructure for MAS Research

    E-print Network

    Stone, Peter

    The RoboCup Soccer Server and CMUnited Clients: Implemented Infrastructure for MAS Research ItsukiCup Soccer Server (Noda et al., 1998; Noda and Frank, 1998) and associated client code. The Robot Soccer World Cup, or RoboCup, is an international research initiative that uses the game of soccer as a domain

  12. School of Marine and Atmospheric Sciences (SoMAS) Strategic Plan --2008

    E-print Network

    Zhang, Minghua

    with the Brookhaven National Laboratory (BNL) including the National Synchrotron Light Source, the Blue Gene Computer York City, such as the United Nations, American Museum of Natural History, Goddard Institute for Space vessels. Linkage to Southampton School of Sustainability: SoMAS ties to the Southampton facility provides

  13. MAS 01 Autonomous Underwater Vehicle Path Planning and Navigation Based upon Ocean Model Predictions

    E-print Network

    Soatto, Stefano

    MAS 01 Autonomous Underwater Vehicle Path Planning and Navigation Based upon Ocean Model understand the feature under investigation. In this study, we examine the use of ocean model predictions measurements to a large-scale ocean model to increase the skill of future predictions, b) to utilize ocean

  14. Dynamic Nuclear Polarization NMR of Low-? Nuclei: Structural Insights into Hydrated Yttrium-Doped BaZrO3.

    PubMed

    Blanc, Frédéric; Sperrin, Luke; Lee, Daniel; Dervi?o?lu, R?za; Yamazaki, Yoshihiro; Haile, Sossina M; De Paëpe, Gaël; Grey, Clare P

    2014-07-17

    We demonstrate that solid-state NMR spectra of challenging nuclei with a low gyromagnetic ratio such as yttrium-89 can be acquired quickly with indirect dynamic nuclear polarization (DNP) methods. Proton to (89)Y cross polarization (CP) magic angle spinning (MAS) spectra of Y(3+) in a frozen aqueous solution were acquired in minutes using the AMUPol biradical as a polarizing agent. Subsequently, the detection of the (89)Y and (1)H NMR signals from technologically important hydrated yttrium-doped zirconate ceramics, in combination with DFT calculations, allows the local yttrium and proton environments present in these protonic conductors to be detected and assigned to different hydrogen-bonded environments. PMID:26277811

  15. Characterization by solid-state NMR and selective dissolution techniques of anhydrous and hydrated CEM V cement pastes

    SciTech Connect

    Brunet, F.; Charpentier, T.; Chao, C.N.; Peycelon, H.; Nonat, A.

    2010-02-15

    The long term behaviour of cement based materials is strongly dependent on the paste microstructure and also on the internal chemistry. A CEM V blended cement containing pulverised fly ash (PFA) and blastfurnace slag (BFS) has been studied in order to understand hydration processes which influence the paste microstructure. Solid-state NMR spectroscopy with complementary X-ray diffraction analysis and selective dissolution techniques have been used for the characterization of the various phases (C{sub 3}S, C{sub 2}S, C{sub 3}A and C{sub 4}AF) of the clinker and additives and then for estimation of the degree of hydration of these same phases. Their quantification after simulation of experimental {sup 29}Si and {sup 27}Al MAS NMR spectra has allowed us to follow the hydration of recent (28 days) and old (10 years) samples that constitutes a basis of experimental data for the prediction of hydration model.

  16. Effect of a Selective Mas Receptor Agonist in Cerebral Ischemia In Vitro and In Vivo

    PubMed Central

    Lee, Seyoung; Evans, Megan A.; Chu, Hannah X.; Kim, Hyun Ah; Widdop, Robert E.; Drummond, Grant R.; Sobey, Christopher G.

    2015-01-01

    Functional modulation of the non-AT1R arm of the renin-angiotensin system, such as via AT2R activation, is known to improve stroke outcome. However, the relevance of the Mas receptor, which along with the AT2R forms the protective arm of the renin-angiotensin system, as a target in stroke is unclear. Here we tested the efficacy of a selective MasR agonist, AVE0991, in in vitro and in vivo models of ischemic stroke. Primary cortical neurons were cultured from E15-17 mouse embryos for 7–9 d, subjected to glucose deprivation for 24 h alone or with test drugs, and percentage cell death was determined using trypan blue exclusion assay. Additionally, adult male mice were subjected to 1 h middle cerebral artery occlusion and were administered either vehicle or AVE0991 (20 mg/kg i.p.) at the commencement of 23 h reperfusion. Some animals were also treated with the MasR antagonist, A779 (80 mg/kg i.p.) 1 h prior to surgery. Twenty-four h after MCAo, neurological deficits, locomotor activity and motor coordination were assessed in vivo, and infarct and edema volumes estimated from brain sections. Following glucose deprivation, application of AVE0991 (10?8 M to 10?6 M) reduced neuronal cell death by ~60% (P<0.05), an effect prevented by the MasR antagonist. By contrast, AVE0991 administration in vivo had no effect on functional or histological outcomes at 24 h following stroke. These findings indicate that the classical MasR agonist, AVE0991, can directly protect neurons from injury following glucose-deprivation. However, this effect does not translate into an improved outcome in vivo when administered systemically following stroke. PMID:26540167

  17. Ligand orientation in a membrane-embedded receptor site revealed by solid-state NMR with paramagnetic relaxation enhancement.

    PubMed

    Whittaker, Christopher A P; Patching, Simon G; Esmann, Mikael; Middleton, David A

    2015-03-01

    NMR relaxation enhancement by paramagnetic metals provides powerful restraints on the three-dimensional structures of proteins in solution, and this approach has recently been utilized in several NMR structural investigations of proteins in the solid-state. Here we utilize paramagnetic relaxation enhancement (PRE) by Mn(2+) with cross-polarization magic-angle spinning (CP-MAS) solid-state NMR to investigate the interaction of a membrane-embedded protein the Na,K-ATPase (NKA) with a cardiotonic steroid inhibitor. The inhibitor, a diacetonide derivate of the cardiac glycoside ouabain, with (13)C labelled acetonide groups in the rhamnose sugar and steroid moieties ([(13)C2]ODA), is 1000-fold less potent than the parent compound. It is shown that the (13)C CP-MAS solid-state NMR spectra of the NKA-[(13)C2]ODA complex exhibit distinct signals for the two (13)C labels of the inhibitor when bound to the ouabain site of membrane-embedded NKA. Recent crystal structures of NKA indicate that the catalytic ?-subunit binds a single Mn(2+) in a transmembrane site close to the high-affinity ouabain site. Here, complexation of NKA with Mn(2+) broadens the resonance line from the rhamnose group substantially more than the steroid peak, indicating that the rhamnose group is closer to the Mn(2+) site than is the steroid group. These observations agree with computational molecular docking simulations and are consistent with ODA adopting an inverted orientation compared to ouabain in the cardiac glycoside site, with the modified rhamnose group drawn toward the transmembrane centre of the protein. This work demonstrates that PRE can provide unique information on the positions and orientations of ligands within their binding pockets of transmembrane proteins. PMID:25582619

  18. An introduction to biological NMR spectroscopy.

    PubMed

    Marion, Dominique

    2013-11-01

    NMR spectroscopy is a powerful tool for biologists interested in the structure, dynamics, and interactions of biological macromolecules. This review aims at presenting in an accessible manner the requirements and limitations of this technique. As an introduction, the history of NMR will highlight how the method evolved from physics to chemistry and finally to biology over several decades. We then introduce the NMR spectral parameters used in structural biology, namely the chemical shift, the J-coupling, nuclear Overhauser effects, and residual dipolar couplings. Resonance assignment, the required step for any further NMR study, bears a resemblance to jigsaw puzzle strategy. The NMR spectral parameters are then converted into angle and distances and used as input using restrained molecular dynamics to compute a bundle of structures. When interpreting a NMR-derived structure, the biologist has to judge its quality on the basis of the statistics provided. When the 3D structure is a priori known by other means, the molecular interaction with a partner can be mapped by NMR: information on the binding interface as well as on kinetic and thermodynamic constants can be gathered. NMR is suitable to monitor, over a wide range of frequencies, protein fluctuations that play a crucial role in their biological function. In the last section of this review, intrinsically disordered proteins, which have escaped the attention of classical structural biology, are discussed in the perspective of NMR, one of the rare available techniques able to describe structural ensembles. This Tutorial is part of the International Proteomics Tutorial Programme (IPTP 16 MCP). PMID:23831612

  19. Silicon carbide polytype characterisation in coated fuel particles by Raman spectroscopy and 29Si magic angle spinning NMR

    NASA Astrophysics Data System (ADS)

    López-Honorato, E.; Brigden, C.; Shatwell, R. A.; Zhang, H.; Farnan, I.; Xiao, P.; Guillermier, P.; Somers, J.

    2013-02-01

    The silicon carbide layer of a batch of as-produced TRISO (tristructural isotropic) coated fuel particles with zirconia kernels was characterised by Raman spectroscopy and magic angle spinning nuclear magnetic resonance (MAS-NMR). The techniques were evaluated as a probe for the evolution of SiC local structure as a function of chemical vapour deposition processing. Nuclear magnetic resonance resolved 29Si resonances for multiple hexagonal or cubic silicon local environments, consistent with a mixture of 6H, 15R and 4H polytypes, within a majority (36%) 3C-SiC target structure. Polarised Raman spectroscopy by contrast, showed some evidence of hexagonal and cubic local environments but no evidence for clearly defined hexagonal or orthorhombic polytypes. It was clear from the Raman that there was significant scattering from q > 0 regions of the Brillouin zone, consistent with a loss of translational symmetry associated with stacking faults. Simulation and TEM images suggested that the signals observed in Raman and NMR correspond closer to a random arrangement of SiC layers in which structures similar to the various polytypes occur over short distances. As NMR is a probe of local environment, the signals obtained were similar to those that would come from a mixture of crystallites, each of a well-defined polytype. The NMR data was analysed quantitatively by fitting the spectra of known polytypes and by using a simple model to represent the random arrangement of layers in a heavily faulted crystal.

  20. Scalar operators in solid-state NMR

    SciTech Connect

    Sun, Boqin

    1991-11-01

    Selectivity and resolution of solid-state NMR spectra are determined by dispersion of local magnetic fields originating from relaxation effects and orientation-dependent resonant frequencies of spin nuclei. Theoretically, the orientation-dependent resonant frequencies can be represented by a set of irreducible tensors. Among these tensors, only zero rank tensors (scalar operators) are capable of providing high resolution NMR spectra. This thesis presents a series of new developments in high resolution solid-state NMR concerning the reconstruction of various scalar operators motion in solid C{sub 60} is analyzed.

  1. Probing porous media with gas diffusion NMR

    NASA Technical Reports Server (NTRS)

    Mair, R. W.; Wong, G. P.; Hoffmann, D.; Hurlimann, M. D.; Patz, S.; Schwartz, L. M.; Walsworth, R. L.

    1999-01-01

    We show that gas diffusion nuclear magnetic resonance (GD-NMR) provides a powerful technique for probing the structure of porous media. In random packs of glass beads, using both laser-polarized and thermally polarized xenon gas, we find that GD-NMR can accurately measure the pore space surface-area-to-volume ratio, S/V rho, and the tortuosity, alpha (the latter quantity being directly related to the system's transport properties). We also show that GD-NMR provides a good measure of the tortuosity of sandstone and complex carbonate rocks.

  2. Images of a fourth planet orbiting HR 8799.

    PubMed

    Marois, Christian; Zuckerman, B; Konopacky, Quinn M; Macintosh, Bruce; Barman, Travis

    2010-12-23

    High-contrast near-infrared imaging of the nearby star HR 8799 has shown three giant planets. Such images were possible because of the wide orbits (>25?astronomical units, where 1?au is the Earth-Sun distance) and youth (<100?Myr) of the imaged planets, which are still hot and bright as they radiate away gravitational energy acquired during their formation. An important area of contention in the exoplanet community is whether outer planets (>10?au) more massive than Jupiter form by way of one-step gravitational instabilities or, rather, through a two-step process involving accretion of a core followed by accumulation of a massive outer envelope composed primarily of hydrogen and helium. Here we report the presence of a fourth planet, interior to and of about the same mass as the other three. The system, with this additional planet, represents a challenge for current planet formation models as none of them can explain the in situ formation of all four planets. With its four young giant planets and known cold/warm debris belts, the HR 8799 planetary system is a unique laboratory in which to study the formation and evolution of giant planets at wide (>10?au) separations. PMID:21150902

  3. Classification of ischaemic episodes with ST/HR diagrams.

    PubMed

    Faganeli Pucer, Jana; Demšar, Janez; Kukar, Matjaž

    2012-01-01

    Coronary artery disease is the developed world's premier cause of mortality and the most probable cause of myocardial ischaemia. More advanced diagnostic tests aside, in electrocardiogram (ECG) analysis it manifests itself as a ST segment deviation, targeted by both exercise ECG and ambulatory ECG. In ambulatory ECG, besides ischaemic ST segment deviation episodes there are also non-ischaemic heart rate related episodes which aggravate real ischaemia detection. We present methods to transform the features developed for the heart rate adjustment of ST segment depression in exercise ECG for use in ambulatory ECG. We use annotations provided by the Long-Term ST Database to plot the ST/HR diagrams and then estimate the overall and maximal slopes of the diagrams in the exercise and recovery phase for each ST segment deviation episode. We also estimate the angle at the extrema of the ST/HR diagrams. Statistical analysis shows that ischaemic ST segment deviation episodes have significantly steeper overall and maximal slopes than heart rate related episodes, which indicates the explored features' utility for distinguishing between the two types of episodes. This makes the proposed features very useful in automated ECG analysis. PMID:22874369

  4. Modeling the Asteroseismic Surface Term across the HR Diagram

    NASA Astrophysics Data System (ADS)

    Schmitt, Joseph R.; Basu, Sarbani

    2015-08-01

    Asteroseismology is a powerful tool that can precisely characterize the mass, radius, and other properties of field stars. However, our inability to properly model the near-surface layers of stars creates a frequency-dependent frequency difference between the observed and the modeled frequencies, usually referred to as the “surface term.” This surface term can add significant errors to the derived stellar properties unless removed properly. In this paper, we simulate surface terms across a significant portion of the HR diagram, exploring four different masses (M=0.8,1.0,1.2, and 1.5 {M}? ) at five metallicities ([{Fe}/{{H}}]=0.5,0.0,-0.5,-1.0, and -1.5) from the main sequence to red giants for stars with {T}{eff}\\lt 6500 K and explore how well the most common ways of fitting and removing the surface term actually perform. We find that the two-term model proposed by Ball & Gizon works much better than other models across a large portion of the HR diagram, including the red giants, leading us to recommend its use for future asteroseismic analyses.

  5. NMR Spectroscopy DOI: 10.1002/anie.201210070

    E-print Network

    Frydman, Lucio

    NMR Spectroscopy DOI: 10.1002/anie.201210070 Multiple Parallel 2D NMR Acquisitions in a Single Scan the boundary separating magnetic resonance imaging from nuclear magnetic resonance (NMR) spectroscopy with all other advances of contemporary NMR spectroscopy promises to open even further synergies in terms

  6. Multidimensional NMR Spectroscopy DOI: 10.1002/anie.200805612

    E-print Network

    Frydman, Lucio

    Multidimensional NMR Spectroscopy DOI: 10.1002/anie.200805612 Single-Scan 2D Hadamard NMR, are described. 2D NMR spectroscopy probes molecular structure and dynamics by correlating shifts along acquisitions into a single scan.[3] Single- scan 2D NMR spectroscopy replaces the indirect-domain time variable

  7. Communication Ultrafast 2D NMR spectroscopy using a continuous spatial

    E-print Network

    Frydman, Lucio

    Communication Ultrafast 2D NMR spectroscopy using a continuous spatial encoding of the spin by ultrafast 2D NMR spectroscopy. It is found that when dealing with 2D NMR experiments involving a t1 NMR spectra within a single scan is introduced and illustrated. The approach relies on applying a pair

  8. The hypergiant HR 8752 evolving through the yellow evolutionary void

    NASA Astrophysics Data System (ADS)

    Nieuwenhuijzen, H.; De Jager, C.; Kolka, I.; Israelian, G.; Lobel, A.; Zsoldos, E.; Maeder, A.; Meynet, G.

    2012-10-01

    Context. We study the time history of the yellow hypergiant HR 8752 based on high-resolution spectra (1973-2005), the observed MK spectral classification data, B - V- and V-observations (1918-1996) and yet earlier V-observations (1840-1918). Aims: Our local thermal equilibrium analysis of the spectra yields accurate values of the effective temperature (Teff), the acceleration of gravity (g), and the turbulent velocity (vt) for 26 spectra. The standard deviations average are 82 K for Teff, 0.23 for log g, and 1.1 km s-1 for vt. Methods: A comparison of B - V observations, MK spectral types, and Teff-data yields E(B - V), "intrinsic" B - V, Teff, absorption AV, and the bolometric correction BC. With the additional information from simultaneous values of B - V, V, and an estimated value of R, the ratio of specific absorption to the interstellar absorption parameter E(B - V), the "unreddened" bolometric magnitude mbol,0 can be determined. With Hipparcos distance measurements of HR 8752, the absolute bolometric magnitude Mbol,0 can be determined. Results: Over the period of our study, the value of Teff gradually increased during a number of downward excursions that were observable over the period of sufficient time coverage. These observations, together with those of the effective acceleration g and the turbulent velocity vt, suggest that the star underwent a number of successive gas ejections. During each ejection, a pseudo photosphere was produced of increasingly smaller g and higher vt values. After the dispersion into space of the ejected shells and after the restructuring of the star's atmosphere, a hotter and more compact photosphere became visible. From the B - V and V observations, the basic stellar parameters, Teff, log M/M?, log L/L?, and log R/R? are determined for each of the observational points. The results show the variation in these basic stellar parameters over the past near-century. Conclusions: We show that the atmospheric instability region in the HR-diagram that we baptize the yellow evolutionary void actually consists of two parts. We claim that the present observations show that HR 8752 is presently climbing out of the "first" instability region and that it is on its way to stability, but in the course of its future evolution it still has to go through the second potential unstable region. Appendix A is available in electronic form at http://www.aanda.orgTables A.x and B.x are available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/546/A105, and at the external site http://www.aai.ee/HR~8752

  9. Time Series Analysis of the A0 Supergiant HR 1040

    NASA Astrophysics Data System (ADS)

    Corliss, David J.

    A time series analysis of spectroscopic and photometric observables of the A0Ia supergiant HR 1040 has been performed. The data, obtained from 1993 through 2007, include 152 spectroscopic observations from the Ritter Observatory and 269 Stromgren photometric observations from the Four College Automated Photoelectric Telescope (FCAPT). A number of spectroscopic and photometric features have been analyzed and compared, including Wlambda, radial velocities and Stromgren photometric indices. Typical of late B- and early A-type supergiants, HR 1040 has a highly variable stellar wind including High Velocity Absorption (HVA) events. The star was found to have an active phase with large variation in the physical characteristics of the wind and with the potential for HVAs. During the active phase, correlation between the H-alpha absorption equivalent width and blue-edge radial velocity was observed. If an HVA was present, the active phase was found to begin before the onset of the HVA and continue after the end of the event by as much as several weeks. This active phase alternated with a more common quiescent phase marked by little variability and equivalent width - radial velocity correlation and no HVAs. The active phase and HVAs were found to exhibit important connections to photospheric activity. Increases in H-alpha absorption and blue-edge radial velocity at the onset of HVAs was preceded by correlated increases in Si II Wlambda and second moment, with the atmospheric changes indicated by the H-alpha line lagging the photospheric changes seen in Si II by an interval of 13 to 23 days. The observed HVAs were found to be preceded by Si II radial velocity oscillations by an interval of 19 to 42 days. The equivalent width and second moment of the photospheric Si II lambdalambda6347, 6371 lines were found to be highly variable and strongly correlated throughout the two active phases when an HVA is observed but not during the quiescent phase or in the one active phase where no HVA was seen. The Si II Wlambda and second moment showed a short-lived increase during the first few weeks of an HVA and then quickly dropped back to quiescent phase levels. Time series cluster analysis of the two HVAs observed on HR 1040, in addition to three HVAs in alpha Orionis, identified four distinct stages in the development of these events. Possible factors contributing to HVA are discussed, including gas ejection and microturbulence at the photosphere, as well as co-rotation interaction regions (CIR) in the wind. HR 1040 exhibits a broad emission feature near Halpha commonly found in late B- and early A-type supergiants. The broad emission in HR 1040 was found to be variable and not correlated to photospheric or wind observables associated with the active phase. Some indication was found that this feature is limited to a wavelength range of 6532 A to 6597 A. While the wavelength range extends roughly the same amount to either side of H-alpha line center, an asymmetry in the flux of the broad emission is observed, with a local maximum in the flux varying between 6555 A to 6564 A. If this asymmetry is real and not an instrumental effect, it argues against a photospheric origin for this broad emission feature as it would require radial velocities up to -300 km/s, well in excess of the terminal wind speed.

  10. Fusogenic Alzheimer's peptide fragment Abeta (29-42) in interaction with lipid bilayers: secondary structure, dynamics, and specific interaction with phosphatidyl ethanolamine polar heads as revealed by solid-state NMR.

    PubMed

    Ravault, Stéphanie; Soubias, Olivier; Saurel, Olivier; Thomas, Annick; Brasseur, Robert; Milon, Alain

    2005-05-01

    The interaction of the native Alzheimer's peptide C-terminal fragment Abeta (29-42), and two mutants (G33A and G37A) with neutral lipid bilayers made of POPC and POPE in a 9:1 molar ratio was investigated by solid-state NMR. This fragment and the lipid composition were selected because they represent the minimum requirement for the fusogenic activity of the Alzheimer's peptide. The chemical shifts of alanine methyl isotropic carbon were determined by MAS NMR, and they clearly demonstrated that the major form of the peptide equilibrated in membrane is not in a helical conformation. (2)H NMR, performed with acyl chain deuterated POPC, demonstrated that there is no perturbation of the acyl chain's dynamics and of the lipid phase transition temperature. (2)H NMR, performed with alanine methyl-deuterated peptide demonstrated that the peptide itself has a limited mobility below and above the lipid phase transition temperature (molecular order parameter equal to 0.94). MAS (31)P NMR revealed a specific interaction with POPE polar head as seen by the enhancement of POPE phosphorus nuclei T(2) relaxation. All these results are in favor of a beta-sheet oligomeric association of the peptide at the bilayer interface, preferentially recruiting phosphatidyl ethanolamine polar heads. PMID:15840826

  11. NMR data-driven structure determination using NMR-I-TASSER in the CASD-NMR experiment

    PubMed Central

    Jang, Richard; Wang, Yan

    2015-01-01

    NMR-I-TASSER, an adaption of the I-TASSER algorithm combining NMR data for protein structure determination, recently joined the second round of the CASD-NMR experiment. Unlike many molecular dynamics-based methods, NMR-I-TASSER takes a molecular replacement-like approach to the problem by first threading the target through the PDB to identify structural templates which are then used for iterative NOE assignments and fragment structure assembly refinements. The employment of multiple templates allows NMR-I-TASSER to sample different topologies while convergence to a single structure is not required. Retroactive and blind tests of the CASD-NMR targets from Rounds 1 and 2 demonstrate that even without using NOE peak lists I-TASSER can generate correct structure topology with 15 of 20 targets having a TM-score above 0.5. With the addition of NOE-based distance restraints, NMR-I-TASSER significantly improved the I-TASSER models with all models having the TM-score above 0.5. The average RMSD was reduced from 5.29 to 2.14 Å in Round 1 and 3.18 to 1.71 Å in Round 2. There is no obvious difference in the modeling results with using raw and refined peak lists, indicating robustness of the pipeline to the NOE assignment errors. Overall, despite the low-resolution modeling the current NMR-I-TASSER pipeline provides a coarse-grained structure folding approach complementary to traditional molecular dynamics simulations, which can produce fast near-native frameworks for atomic-level structural refinement. PMID:25737244

  12. Hyperspectral Microwave Atmospheric Sounder (HyMAS) Architecture and Design Accommodations

    NASA Technical Reports Server (NTRS)

    Hilliard, Lawrence; Racette, Paul; Blackwell, William; Galbraith, Christopher; Thompson, Erik

    2013-01-01

    The Hyperspectral Microwave Atmospheric Sounder (HyMAS) is being developed at Lincoln Laboratories and accommodated by the Goddard Space Flight Center for a flight opportunity on a NASA research aircraft. The term "hyperspectral microwave" is used to indicate an all-weather sounding that performs equivalent to hyperspectral infrared sounders in clear air with vertical resolution of approximately 1 km. Deploying the HyMAS equipped scanhead with the existing Conical Scanning Microwave Imaging Radiometer (CoSMIR) shortens the path to a flight demonstration. Hyperspectral microwave is achieved through the use of independent RF antennas that sample the volume of the Earth s atmosphere through various levels of frequencies, thereby producing a set of dense, spaced vertical weighting functions. The simulations proposed for HyMAS 118/183-GHz system should yield surface precipitation rate and water path retrievals for small hail, soft hail, or snow pellets, snow, rainwater, etc. with accuracies comparable to those of the Advanced Technology Microwave Sounder. Further improvements in retrieval methodology (for example, polarization exploitation) are expected. The CoSMIR instrument is a packaging concept re-used on HyMAS to ease the integration features of the scanhead. The HyMAS scanhead will include an ultra-compact Intermediate Frequency Processor (IFP) module that is mounted inside the door to improve thermal management. The IFP is fabricated with materials made of Low-Temperature Co-fired Ceramic (LTCC) technology integrated with detectors, amplifiers, A/D conversion and data aggregation. The IFP will put out 52 channels of 16 bit data comprised of 4-9 channel data streams for temperature profiles and 2-8 channel streams for water vapor. With the limited volume of the existing CoSMIR scanhead and new HyMAS front end components, the HyMAS team at Goddard began preliminary layout work inside the new drum. Importing and re-using models of the shell, the scan head computer, and the slip rings developed for CoSMIR was the starting point. The next step was to modify the antenna faceplate to accommodate the dimensions of the three dual polarization Gaussian Optics Antenna (GOA) assemblies. Two mechanical concepts for the core technology, the hyperspectral IFP, were captured in a design tradeoff. Connector models considered minimum bend radii for the IFP analog connectors. Hyperspectral imaging is accomplished by strategically using a short wavelength intermediate frequency of 18-29 GHz, and thus reducing the size of components in the connection of the front end to the IFP. The SMK (2.92mm) Series connector will lay near the hinge line to minimize its flexing. The digital output of the IFP will use a Serial Peripheral Interface (SPI) that must be accommodated by the scan head computer. To make that computer more reliable, maintainable, and forward compatible with the 52 HyMAS channels, a testbed of the scan head, calibration, and archive computers and the PIC24 microprocessor that resides on the IFP is in development. The computers will be programmed using a new framework application called Interoperable Remote Component (IRC). This software allows flexibility to program computers that communicate with each other and can adapt easily to the emerging HyMAS requirements for data format, algorithms, and graphical user interface (GUI). It is expected that the CoSMIR instrument will cut over to the IRC after it is adapted on an updated CoSMIR testbed.

  13. Hyperspectral Microwave Atmospheric Sounder (HyMAS) architecture and design accommodations

    NASA Astrophysics Data System (ADS)

    Hilliard, L.; Racette, P.; Blackwell, W.; Galbraith, C.; Thompson, E.

    The Hyperspectral Microwave Atmospheric Sounder (HyMAS) is being developed at Lincoln Laboratories and accommodated by the Goddard Space Flight Center for a flight opportunity on a NASA research aircraft. The term “ hyperspectral microwave” is used to indicate an all-weather sounding that performs equivalent to hyperspectral infrared sounders in clear air with vertical resolution of approximately 1 km. Deploying the HyMAS equipped scanhead with the existing Conical Scanning Microwave Imaging Radiometer (CoSMIR) shortens the path to a flight demonstration. Hyperspectral microwave is achieved through the use of independent RF antennas that sample the volume of the Earth's atmosphere through various levels of frequencies, thereby producing a set of dense, spaced vertical weighting functions. The simulations proposed for HyMAS 118/183-GHz system should yield surface precipitation rate and water path retrievals for small hail, soft hail, or snow pellets, snow, rainwater, etc. with accuracies comparable to those of the Advanced Technology Microwave Sounder. Further improvements in retrieval methodology (for example, polarization exploitation) are expected. The CoSMIR instrument is a packaging concept re-used on HyMAS to ease the integration features of the scanhead. The HyMAS scanhead will include an ultra-compact Intermediate Frequency Processor (IFP) module that is mounted inside the door to improve thermal management. The IFP is fabricated with materials made of Low-Temperature Co-fired Ceramic (LTCC) technology integrated with detectors, amplifiers, A/D conversion and data aggregation. The IFP will put out 52 channels of 16 bit data comprised of 4 - 9 channel data streams for temperature profiles and 2-8 channel streams for water vapor. With the limited volume of the existing CoSMIR scanhead and new HyMAS front end components, the HyMAS team at Goddard began preliminary layout work inside the new drum. Importing and re-using models of the shell, the s- an head computer, and the slip rings developed for CoSMIR was the starting point. The next step was to modify the antenna faceplate to accommodate the dimensions of the three dual polarization Gaussian Optics Antenna (GOA) assemblies. Two mechanical concepts for the core technology, the hyperspectral IFP, were captured in a design tradeoff. Connector models considered minimum bend radii for the IFP analog connectors. Hyperspectral imaging is accomplished by strategically using a short wavelength intermediate frequency of 18-29 GHz, and thus reducing the size of components in the connection of the front end to the IFP. The SMK (2.92mm) Series connector will lay near the hinge line to minimize its' flexing. The digital output of the IFP will use a Serial Peripheral Interface (SPI) that must be accommodated by the scan head computer. To make that computer more reliable, maintainable, and forward compatible with the 52 HyMAS channels, a testbed of the scan head, calibration, and archive computers and the PIC24 microprocessor that resides on the IFP is in development. The computers will be programmed using a new framework application called Interoperable Remote Component (IRC). This software allows flexibility to program computers that communicate with each other and can adapt easily to the emerging HyMAS requirements for data format, algorithms, and graphical user interface (GUI). It is expected that the CoSMIR instrument will cut over to the IRC after it is adapted on an updated CoSMIR testbed.

  14. NMR Analysis of Unknowns: An Introduction to 2D NMR Spectroscopy

    ERIC Educational Resources Information Center

    Alonso, David E.; Warren, Steven E.

    2005-01-01

    A study combined 1D (one-dimensional) and 2D (two-dimensional) NMR spectroscopy to solve structural organic problems of three unknowns, which include 2-, 3-, and 4-heptanone. Results showed [to the first power]H NMR and [to the thirteenth power]C NMR signal assignments for 2- and 3-heptanone were more challenging than for 4-heptanone owing to the…

  15. CROSS POLARIZATION/MAGIC ANGLE SAMPLE (CP/MAS) NUCLEAR MAGNETIC RESONANCE (NMR) ANALYSIS OF CELLULASE TREATED BLEACHED SOFTWOOD KRAFT PULP

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fully bleached softwood pulp cellulosic materials were hydrolyzed with cellulase (1,4-(1,3:1,4)-beta-D-glucan 4-glucano-hydrolase, EC 3.2.1.4) from Trichoderma reesei. Supermolecular structural features of cellulose during enzymatic hydrolysis were examined by using Cross Polarization/Magic Angle Sa...

  16. NMR crystallography: The effect of deuteration on high resolution 13 state NMR spectra of a 7-TM protein

    E-print Network

    Watts, Anthony

    NMR crystallography: The effect of deuteration on high resolution 13 C solid state NMR spectra, and indirect, 9­17 ppm, dimensions). The measured 13 C NMR line-widths observed for both protonated. Introduction Perdeuteration has been used routinely in solution NMR for 13 C, 15 N labeled protein assignment

  17. Random-walk technique for simulating NMR measurements and 2D NMR maps of porous media with relaxing and

    E-print Network

    Torres-Verdín, Carlos

    Random-walk technique for simulating NMR measurements and 2D NMR maps of porous media with relaxing online 17 June 2007 Abstract We revisit random-walk methods to simulate the NMR response of fluids from those of classical NMR models. In addition, our random-walk formulation accurately reproduces

  18. 342 IEEE JOURNAL OF SOLID-STATE CIRCUITS, VOL. 46, NO. 1, JANUARY 2011 Palm NMR and 1-Chip NMR

    E-print Network

    Ham, Donhee

    342 IEEE JOURNAL OF SOLID-STATE CIRCUITS, VOL. 46, NO. 1, JANUARY 2011 Palm NMR and 1-Chip NMR Nan in the palm of a hand, is the smallest NMR system ever built, and is 1200 lighter, 1200 smaller, yet 150 more, such as biomolecular sensing, medical imaging, and oil detection, to name a few. The benefits of NMR would be broadly

  19. Study of the Cardiotoxicity of Venenum Bufonis in Rats using an 1H NMR-Based Metabolomics Approach

    PubMed Central

    Wang, Junsong; Guo, Pingping; Li, Minghui; Yang, Minghua; Kong, Lingyi

    2015-01-01

    Venenum Bufonis, a well-known traditional Chinese medicine, has been widely used in Asia and has gained popularity in Western countries over the last decade. Venenum Bufonis has obvious side effects that have been observed in clinical settings, but few studies have reported on its cardiotoxicity. In this work, the cardiotoxicity of Venenum Bufonis was investigated using a 11H NMR-based metabolomics approach. The 1H NMR profiles of the serum, myocardial extracts and liver extracts of specific-pathogen-free rats showed that Venenum Bufonis produced significant metabolic perturbations dose-dependently with a distinct time effect, peaking at 2 hr after dosing and attenuating gradually. Clinical chemistry, electrocardiographic recordings, and histopathological evaluation provided additional evidence of Venenum Bufonis-induced cardiac damage that complemented and supported the metabolomics findings. The combined results demonstrated that oxidative stress, mitochondrial dysfunction, and energy metabolism perturbations were associated with the cardiac damage that results from Venenum Bufonis. PMID:25781638

  20. LyMAS: Predicting large-scale Ly? forest statistics from the dark matter density field

    SciTech Connect

    Peirani, Sébastien; Colombi, Stéphane; Dubois, Yohan; Pichon, Christophe; Weinberg, David H.; Blaizot, Jérémy

    2014-03-20

    We describe Ly? Mass Association Scheme (LyMAS), a method of predicting clustering statistics in the Ly? forest on large scales from moderate-resolution simulations of the dark matter (DM) distribution, with calibration from high-resolution hydrodynamic simulations of smaller volumes. We use the 'Horizon-MareNostrum' simulation, a 50 h {sup –1} Mpc comoving volume evolved with the adaptive mesh hydrodynamic code RAMSES, to compute the conditional probability distribution P(F{sub s} |? {sub s}) of the transmitted flux F{sub s} , smoothed (one-dimensionally, 1D) over the spectral resolution scale, on the DM density contrast ? {sub s}, smoothed (three-dimensionally, 3D) over a similar scale. In this study we adopt the spectral resolution of the SDSS-III Baryon Oscillation Spectroscopic Survey (BOSS) at z = 2.5, and we find optimal results for a DM smoothing length ? = 0.3 h {sup –1} Mpc (comoving). In its simplest form, LyMAS draws randomly from the hydro-calibrated P(F{sub s} |? {sub s}) to convert DM skewers into Ly? forest pseudo-spectra, which are then used to compute cross-sightline flux statistics. In extended form, LyMAS exactly reproduces both the 1D power spectrum and one-point flux distribution of the hydro simulation spectra. Applied to the MareNostrum DM field, LyMAS accurately predicts the two-point conditional flux distribution and flux correlation function of the full hydro simulation for transverse sightline separations as small as 1 h {sup –1} Mpc, including redshift-space distortion effects. It is substantially more accurate than a deterministic density-flux mapping ({sup F}luctuating Gunn-Peterson Approximation{sup )}, often used for large-volume simulations of the forest. With the MareNostrum calibration, we apply LyMAS to 1024{sup 3} N-body simulations of a 300 h {sup –1} Mpc and 1.0 h {sup –1} Gpc cube to produce large, publicly available catalogs of mock BOSS spectra that probe a large comoving volume. LyMAS will be a powerful tool for interpreting 3D Ly? forest data, thereby transforming measurements from BOSS and other massive quasar absorption surveys into constraints on dark energy, DM, space geometry, and intergalactic medium physics.