New steroid 5alpha-reductase type I (SRD5A1) homologous sequences on human chromosomes 6 and 8.

PubMed

Eminović, I; Liović, M; Prezelj, J; Kocijancic, A; Rozman, D; Komel, R

2001-01-01

To date, two genes encoding 5alpha-reductase isoenzymes are known (type I, type II), and one type I pseudogene. The divergent localization of these genes and the still not fully understood function of the encoded enzymes as well as the perplexing results we obtained after sequencing PCR-amplified SRD5A1 gene fragments (out of genomic DNA), made us assume that, in addition to the known SRD5A1 gene, one or more different human 5alpha-reductase type I coding genes may exist. Our research provide the first evidence for the existence of two new SRD5A1 related, previously unidentified sequences in the human genome. These sequences which were localized to chromosomes 6 and 8 are highly homologous (> 99%) to SRD5A1, and also do not contain any deletions or insertions that are otherwise a characteristic of the SRD5API pseudogene. Our results imply that these sequences may be either coding parts of yet unknown, active SRD5A1 genes, and/or of previously unidentified pseudogenes. These findings additionally support data of Chen et al. who confirmed the existence of various SRD5A1 proteins in cultured human skin cells.

Assignment of the gene encoding the 5-HT{sub 1E} serotonin receptor (S31) (locus HTR1E) to human chromosome 6q14-q15

DOE Office of Scientific and Technical Information (OSTI.GOV)

Levy, F.O.; Tasken, K.; Solberg, R.

1994-08-01

The human gene for the 5-HT{sub 1E} serotonin receptor was recently cloned, but no chromosomal assignment has yet been given to this gene (locus HTR1E). In this work, we demonstrate by two independent polymerase chain reactions on a panel of human-hamster somatic cell hybrid genomic DNA that the 5-HT{sub 1E} serotonin receptor gene is localized on human chromosome 6. Furthermore, by means of in situ hybridization to human metaphase chromosomes, using the cloned 5-HT{sub 1E} receptor gene (phage clone {lambda}-S31) as a probe, we demonstrate that this gene is localized to the q14-q15 region on chromosome 6. Screening of genomicmore » DNA from 15 unrelated Caucasian individuals, using as a probe the open reading frame of the cloned 5-HT{sub 1E} receptor gene, did not reveal any restriction fragment length polymorphisms with the enzymes BamHI, BanII, BglII, EcoRI, HincII, HindIII, HinfI, MspI, PstI, and PvuII. Since the 5-HT{sub 1E} receptor is found mainly in the cerebral cortex and abnormal function of the serotonergic system has been implicated in a variety of neurologic and psychiatric diseases, the precise chromosomal assignment of the 5-HT{sub 1E} receptor gene is the crucial first step toward the evaluation of this locus as a candidate for mutations in such syndromes. 28 refs., 2 figs., 2 tabs.« less

Gametocidal chromosomes enhancing chromosome aberration in common wheat induced by 5-azacytidine.

PubMed

Su, W-Y; Cong, W-W; Shu, Y-J; Wang, D; Xu, G-H; Guo, C-H

2013-07-08

The gametocidal (Gc) chromosome from Aegilops spp induces chromosome mutation, which is introduced into common wheat as a tool of chromosome manipulation for genetic improvement. The Gc chromosome functions similar to a restriction-modification system in bacteria, in which DNA methylation is an important regulator. We treated root tips of wheat carrying Gc chromosomes with the hypomethylation agent 5-azacytidine; chromosome breakage and micronuclei were observed in these root tips. The frequency of aberrations differed in wheat containing different Gc chromosomes, suggesting different functions inducing chromosome breakage. Gc chromosome 3C caused the greatest degree of chromosome aberration, while Gc chromosome 3C(SAT) and 2C caused only slight chromosome aberration. Gc chromosome 3C induced different degrees of chromosome aberration in wheat varieties Triticum aestivum var. Chinese Spring and Norin 26, demonstrating an inhibition function in common wheat.

Characterization of the human lineage-specific pericentric inversion that distinguishes human chromosome 1 from the homologous chromosomes of the great apes.

PubMed

Szamalek, Justyna M; Goidts, Violaine; Cooper, David N; Hameister, Horst; Kehrer-Sawatzki, Hildegard

2006-08-01

The human and chimpanzee genomes are distinguishable in terms of ten gross karyotypic differences including nine pericentric inversions and a chromosomal fusion. Seven of these large pericentric inversions are chimpanzee-specific whereas two of them, involving human chromosomes 1 and 18, were fixed in the human lineage after the divergence of humans and chimpanzees. We have performed detailed molecular and computational characterization of the breakpoint regions of the human-specific inversion of chromosome 1. FISH analysis and sequence comparisons together revealed that the pericentromeric region of HSA 1 contains numerous segmental duplications that display a high degree of sequence similarity between both chromosomal arms. Detailed analysis of these regions has allowed us to refine the p-arm breakpoint region to a 154.2 kb interval at 1p11.2 and the q-arm breakpoint region to a 562.6 kb interval at 1q21.1. Both breakpoint regions contain human-specific segmental duplications arranged in inverted orientation. We therefore propose that the pericentric inversion of HSA 1 was mediated by intra-chromosomal non-homologous recombination between these highly homologous segmental duplications that had themselves arisen only recently in the human lineage by duplicative transposition.

Abnormal chromosome behavior in human oocytes which remained unfertilized during human in vitro fertilization.

PubMed

Spielmann, H; Krüger, C; Stauber, M; Vogel, R

1985-09-01

Chromosomal abnormalities and abnormal embryonic development have previously been observed after human in vitro fertilization (IVF). Chromosomal abnormalities may arise not only after fertilization but even earlier during meiotic maturation of human oocytes in culture. Since chromosomal analysis is simple in oocytes during meiotic maturation, the chromosomal status was analyzed in oocytes which remained unfertilized in a human in vitro fertilization program. In 50 fertilization attempts the chromosomes of 62 unfertilized oocytes could be analyzed; 45 of them were in the process of meiotic maturation. In three oocytes two small polar bodies were observed 16-18 hr after insemination in the absence of fertilization. In one oocyte abnormal chromosome behavior was found during the first meiotic division, and in four oocytes during metaphase of the second meiotic division. These data suggest that chromosomal analysis of unfertilized oocytes in human IVF may improve the understanding human oocyte maturation and fertilization.

Molecular Characterization of the Pericentric Inversion That Causes Differences Between Chimpanzee Chromosome 19 and Human Chromosome 17

PubMed Central

Kehrer-Sawatzki, Hildegard; Schreiner, Bettina; Tänzer, Simone; Platzer, Matthias; Müller, Stefan; Hameister, Horst

2002-01-01

A comparison of the human genome with that of the chimpanzee is an attractive approach to attempts to understand the specificity of a certain phenotype's development. The two karyotypes differ by one chromosome fusion, nine pericentric inversions, and various additions of heterochromatin to chromosomal telomeres. Only the fusion, which gave rise to human chromosome 2, has been characterized at the sequence level. During the present study, we investigated the pericentric inversion by which chimpanzee chromosome 19 differs from human chromosome 17. Fluorescence in situ hybridization was used to identify breakpoint-spanning bacterial artificial chromosomes (BACs) and plasmid artificial chromosomes (PACs). By sequencing the junction fragments, we localized breakpoints in intergenic regions rich in repetitive elements. Our findings suggest that repeat-mediated nonhomologous recombination has facilitated inversion formation. No addition or deletion of any sequence element was detected at the breakpoints or in the surrounding sequences. Next to the break, at a distance of 10.2–39.1 kb, the following genes were found: NGFR and NXPH3 (on human chromosome 17q21.3) and GUC2D and ALOX15B (on human chromosome 17p13). The inversion affects neither the genomic structure nor the gene-activity state with regard to replication timing of these genes. PMID:12094327

Rapid metaphase and interphase detection of radiation-induced chromosome aberrations in human lymphocytes by chromosomal suppression in situ hybridization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cremer, T.; Popp, S.; Emmerich, P.

1990-01-01

Chromosomal in situ suppression (CISS)-hybridization of biotinylated phage DNA-library inserts from sorted human chromosomes was used to decorate chromosomes 1 and 7 specifically from pter to qter and to detect structural aberrations of these chromosomes in irradiated human peripheral lymphocytes. In addition, probe pUC1.77 was used to mark the 1q12 subregion in normal and aberrant chromosomes 1. Low LET radiation (60Co-gamma-rays; 1.17 and 1.33 MeV) of lymphocyte cultures was performed with various doses (D = 0, 2, 4, 8 Gy) 5 h after stimulation with phytohaemagglutinin. Irradiated cells were cultivated for an additional 67 h before Colcemid arrested metaphase spreadsmore » were obtained. Aberrations of the specifically stained chromosomes, such as deletions, dicentrics, and rings, were readily scored after in situ hybridization with either the 1q12 specific probe or DNA-library inserts. By the latter approach, translocations of the specifically stained chromosomes could also be reliably assessed. A linear increase of the percentage of specifically stained aberrant chromosomes was observed when plotted as a function of the square of the dose D. A particular advantage of this new approach is provided by the possibility to delineate numerical and structural chromosome aberrations directly in interphase nuclei. These results indicate that cytogenetic monitoring of ionizing radiation may be considerably facilitated by CISS-hybridization.« less

Effects of hepatitis B virus infection on human sperm chromosomes.

PubMed

Huang, Jian-Min; Huang, Tian-Hua; Qiu, Huan-Ying; Fang, Xiao-Wu; Zhuang, Tian-Gang; Liu, Hong-Xi; Wang, Yong-Hua; Deng, Li-Zhi; Qiu, Jie-Wen

2003-04-01

To evaluate the level of sperm chromosome aberrations in male patients with hepatitis B, and to directly detect whether there are HBV DNA integrations in sperm chromosomes of hepatitis B patients. Sperm chromosomes of 14 tested subjects (5 healthy controls, 9 patients with HBV infection, including 1 with acute hepatitis B, 2 with chronic active hepatitis B, 4 with chronic persistent hepatitis B, 2 chronic HBsAg carriers with no clinical symptoms) were prepared using interspecific in vitro fertilization between zona-free golden hamster ova and human spermatozoa, and the frequencies of aberration spermatozoa were compared between subjects of HBV infection and controls. Fluorescence in situ hybridization (FISH) to sperm chromosome spreads was carried out with biotin-labeled full length HBV DNA probe to detect the specific HBV DNA sequences in the sperm chromosomes. The total frequency of sperm chromosome aberrations in HBV infection group (14.8 %, 33/223) was significantly higher than that in the control group (4.3 %, 5/116). Moreover, the sperm chromosomes in HBV infection patients commonly presented stickiness, clumping, failure to staining, etc, which would affect the analysis of sperm chromosomes. Specific fluorescent signal spots for HBV DNA were seen in sperm chromosomes of one patient with chronic persistent hepatitis. In 9 (9/42) sperm chromosome complements containing fluorescent signal spots, one presented 5 obvious FISH spots, others presented 2 to 4 signals. There was significant difference of fluorescence intensity among the signal spots. The distribution of signal sites among chromosomes was random. HBV infection can bring about mutagenic effects on sperm chromosomes. Integrations of viral DNA into sperm chromosomes which are multisites and nonspecific, can further increase the instability of sperm chromosomes. This study suggested that HBV infection can create extensively hereditary effects by alteration genetic constituent and/or induction chromosome

Human Autoantibodies Reveal Titin as a Chromosomal Protein

PubMed Central

Machado, Cristina; Sunkel, Claudio E.; Andrew, Deborah J.

1998-01-01

Assembly of the higher-order structure of mitotic chromosomes is a prerequisite for proper chromosome condensation, segregation and integrity. Understanding the details of this process has been limited because very few proteins involved in the assembly of chromosome structure have been discovered. Using a human autoimmune scleroderma serum that identifies a chromosomal protein in human cells and Drosophila embryos, we cloned the corresponding Drosophila gene that encodes the homologue of vertebrate titin based on protein size, sequence similarity, developmental expression and subcellular localization. Titin is a giant sarcomeric protein responsible for the elasticity of striated muscle that may also function as a molecular scaffold for myofibrillar assembly. Molecular analysis and immunostaining with antibodies to multiple titin epitopes indicates that the chromosomal and muscle forms of titin may vary in their NH2 termini. The identification of titin as a chromosomal component provides a molecular basis for chromosome structure and elasticity. PMID:9548712

Characterization of a microdissection library from human chromosome region 3p14

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bardenheuer, W.; Szymanski, S.; Lux, A.

1994-01-15

Structural alterations in human chromosome region 3p14-p23 resulting in the inactivation of one or more tumor suppressor genes are thought to play a pathogenic role in small cell lung cancer, renal cell carcinoma, and other human neoplasms. To identify putative tumor suppressor genes, 428 recombinant clones from a microdissection library specific for human chromosome region 3p14 were isolated and characterized. Ninety-six of these (22.5%) were human single-copy DNA sequences, 57 of which were unique sequence clones. Forty-four of these were mapped to the microdissected region using a cell hybrid mapping panel. Within this mapping panel, four probes detected two newmore » chromosome breakpoints that were previously indistinguishable from the translocation breakpoint t(3;8) in 3p14.2 in hereditary renal cell carcinoma. One probe maps to the homozygously deleted region of the small cell lung cancer cell line U2020. In addition, microdissection clones have been shown to be suitable for isolation of yeast artificial chromosomes. 52 refs., 3 figs., 2 tabs.« less

Chimpanzee and human Y chromosomes are remarkably divergent in structure and gene content

PubMed Central

Hughes, Jennifer F.; Skaletsky, Helen; Pyntikova, Tatyana; Graves, Tina A.; van Daalen, Saskia K. M.; Minx, Patrick J.; Fulton, Robert S.; McGrath, Sean D.; Locke, Devin P.; Friedman, Cynthia; Trask, Barbara J.; Mardis, Elaine R.; Warren, Wesley C.; Repping, Sjoerd; Rozen, Steve; Wilson, Richard K.; Page, David C.

2013-01-01

The human Y chromosome began to evolve from an autosome hundreds of millions of years ago, acquiring a sex-determining function and undergoing a series of inversions that suppressed crossing over with the X chromosome1,2. Little is known about the Y chromosome’s recent evolution because only the human Y chromosome has been fully sequenced. Prevailing theories hold that Y chromosomes evolve by gene loss, the pace of which slows over time, eventually leading to a paucity of genes, and stasis3,4. These theories have been buttressed by partial sequence data from newly emergent plant and animal Y chromosomes5-8, but they have not been tested in older, highly evolved Y chromosomes like that of humans. We therefore finished sequencing the male-specific region of the Y chromosome (MSY) in our closest living relative, the chimpanzee, achieving levels of accuracy and completion previously reached for the human MSY. We then compared the MSYs of the two species and found that they differ radically in sequence structure and gene content, implying rapid evolution during the past 6 million years. The chimpanzee MSY harbors twice as many massive palindromes as the human MSY, yet it has lost large fractions of the MSY protein-coding genes and gene families present in the last common ancestor. We suggest that the extraordinary divergence of the chimpanzee and human MSYs was driven by four synergistic factors: the MSY’s prominent role in sperm production, genetic hitchhiking effects in the absence of meiotic crossing over, frequent ectopic recombination within the MSY, and species differences in mating behavior. While genetic decay may be the principal dynamic in the evolution of newly emergent Y chromosomes, wholesale renovation is the paramount theme in the ongoing evolution of chimpanzee, human, and perhaps other older MSYs. PMID:20072128

Chromosomal localization and cDNA cloning of the human DBP and TEF genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khatib, Z.A.; Inaba, T.; Valentine, M.

1994-09-15

The authors have isolated cDNA and genomic clones and determined the human chromosome positions of two genes encoding transcription factors expressed in the liver and the pituitary gland: albumin D-site-binding protein (DBP) and thyrotroph embryonic factor (TEF). Both proteins have been identified as members of the PAR (proline and acidic amino acid-rich) subfamily of bZIP transcription factors in the rat, but human homologues have not been characterized. Using a fluorescence in situ hybridization technique, the DBP locus was assigned to chromosome 19q13, and TEF to chromosome 22q13. Each assignment was confirmed by means of human chromosome segregation in somatic cellmore » hybrids. Coding sequences of DBP and TEF, extending beyond the bZIP domain to the PAR region, were highly conserved in both human-human and interspecies comparisons. Conservation of the exon-intron boundaries of each bZIP domain-encoding exon suggested derivation from a common ancestral gene. DBP and TEF mRNAs were expressed in all tissues and cell lines examined, including brain, lung, liver, spleen, and kidney. Knowledge of the human chromosome locations of these PAR proteins will facilitate studies to assess their involvement in carcinogenesis and other fundamental biological processes. 37 refs., 5 figs., 1 tab.« less

Cytogenetic evaluation of Fansidar on human lymphocyte chromosomes in vitro.

PubMed

Praveen, Nuzhat; Saifi, Muheet Alam; Shadab, G G H A

2011-01-01

Fansidar is a fixed combination of two antimalarial agents a diaminopyrimidine (Pyrimethamine) and a sulphonamide (Sulphadoxine) in the ratio 1:20- that have been used extensively worldwide for the treatment of Chloroquine resistant Plasmodium falciparum malaria, toxoplasmosis and Pneumocystis carinii pneumonia in patients with the acquired immunodeficiency syndrome. This study examined the effect of Fansidar on chromosomes in human lymphocyte culture. Fansidar was added to peripheral blood lymphocyte cultures in vitro at four different concentrations: 5,15, 25 and 50 microl in the ratio 1:20, 3:60, 5:100 and 10:200 microg ml(-1). Result shows that this drug induces moderate increase in the frequency of gaps, breaks and rearrangements. Therefore it can be concluded that Fansidar has moderate clastogenic effect on human chromosomes in vitro.

Paradigm Lost: The Human Chromosome Story.

ERIC Educational Resources Information Center

Unger, Lawrence; Blystone, Robert V.

1996-01-01

Discusses whether the discovery in 1956 that humans have a chromosome number of 46, as opposed to 47 or 48 as previously thought, fits into a paradigm shift of the Kuhnian type. Concludes that Kuhn probably would not have considered the chromosome number shift to be large enough to be a focus for one of his paradigms. (AIM)

Effects of alpha-particles on survival and chromosomal aberrations in human mammary epithelial cells

NASA Technical Reports Server (NTRS)

Durante, M.; Grossi, G. F.; Gialanella, G.; Pugliese, M.; Nappo, M.; Yang, T. C.

1995-01-01

We have studied the radiation responses of a human mammary epithelial cell line, H184B5 F5-1 M/10. This cell line was derived from primary mammary cells after treatment with chemicals and heavy ions. The F5-1 M/10 cells are immortal, density-inhibited in growth, and non-tumorigenic in athymic nude mice and represent an in vitro model of the human epithelium for radiation studies. Because epithelial cells are the target of alpha-particles emitted from radon daughters, we concentrated our studies on the efficiency of alpha-particles. Confluent cultures of M/10 cells were exposed to accelerated alpha-particles [beam energy incident at the cell monolayer = 3.85 MeV, incident linear energy transfer (LET) in cell = 109 keV/microns] and, for comparison, to 80 kVp x-rays. The following endpoints were studied: (1) survival, (2) chromosome aberrations at the first postirradiation mitosis, and (3) chromosome alterations at later passages following irradiation. The survival curve was exponential for alpha-particles (D0 = 0.73 +/- 0.04 Gy), while a shoulder was observed for x-rays (alpha/beta = 2.9 Gy; D0 = 2.5 Gy, extrapolation number 1.6). The relative biological effectiveness (RBE) of high-LET alpha-particles for human epithelial cell killing was 3.3 at 37% survival. Dose-response curves for the induction of chromosome aberrations were linear for alpha-particles and linearquadratic for x-rays. The RBE for the induction of chromosome aberrations varied with the type of aberration scored and was high (about 5) for chromosome breaks and low (about 2) for chromosome exchanges.(ABSTRACT TRUNCATED AT 250 WORDS).

Effects of alpha-particles on survival and chromosomal aberrations in human mammary epithelial cells.

PubMed

Durante, M; Grossi, G F; Gialanella, G; Pugliese, M; Nappo, M; Yang, T C

1995-08-01

We have studied the radiation responses of a human mammary epithelial cell line, H184B5 F5-1 M/10. This cell line was derived from primary mammary cells after treatment with chemicals and heavy ions. The F5-1 M/10 cells are immortal, density-inhibited in growth, and non-tumorigenic in athymic nude mice and represent an in vitro model of the human epithelium for radiation studies. Because epithelial cells are the target of alpha-particles emitted from radon daughters, we concentrated our studies on the efficiency of alpha-particles. Confluent cultures of M/10 cells were exposed to accelerated alpha-particles [beam energy incident at the cell monolayer = 3.85 MeV, incident linear energy transfer (LET) in cell = 109 keV/microns] and, for comparison, to 80 kVp x-rays. The following endpoints were studied: (1) survival, (2) chromosome aberrations at the first postirradiation mitosis, and (3) chromosome alterations at later passages following irradiation. The survival curve was exponential for alpha-particles (D0 = 0.73 +/- 0.04 Gy), while a shoulder was observed for x-rays (alpha/beta = 2.9 Gy; D0 = 2.5 Gy, extrapolation number 1.6). The relative biological effectiveness (RBE) of high-LET alpha-particles for human epithelial cell killing was 3.3 at 37% survival. Dose-response curves for the induction of chromosome aberrations were linear for alpha-particles and linearquadratic for x-rays. The RBE for the induction of chromosome aberrations varied with the type of aberration scored and was high (about 5) for chromosome breaks and low (about 2) for chromosome exchanges.(ABSTRACT TRUNCATED AT 250 WORDS)

Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Potier, M.C.; Dutriaux, A.; Lambolez, B.

1993-03-01

Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

Hierarchical radial and polar organisation of chromosomes in human sperm.

PubMed

Millan, N M; Lau, P; Hann, M; Ioannou, D; Hoffman, D; Barrionuevo, M; Maxson, W; Ory, S; Tempest, H G

2012-10-01

It is well established that chromosomes occupy distinct positions within the interphase nuclei, conferring a potential functional implication to the genome. In addition, alterations in the nuclear organisation patterns have been associated with disease phenotypes (e.g. cancer or laminopathies). The human sperm is the smallest cell in the body with specific DNA packaging and the mission of delivering the paternal genome to the oocyte during fertilisation. Studies of nuclear organisation in the sperm have postulated nonrandom chromosome position and have proposed a chromocentre model with the centromeres facing toward the interior and the telomeres toward the periphery of the nucleus. Most studies have assessed the nuclear address in the sperm longitudinally predominantly using centromeric or telomeric probes and to a lesser extent with whole chromosome paints. To date, studies investigating the radial organisation of human sperm have been limited. The purpose of this study was to utilise whole chromosome paints for six clinically important chromosomes (18, 19, 21, 22, X, and Y) to investigate nuclear address by assessing their radial and longitudinal nuclear organisation. A total of 10,800 sperm were analysed in nine normozoospermic individuals. The results have shown nonrandom chromosome position for all chromosomes using both methods of analysis. We present novel radial and polar analysis of chromosome territory localization within the human sperm nucleus. Specifically, a hierarchical organisation was observed radially with chromosomes organised from the interior to the periphery (chromosomes 22, 21, Y, X, 19, and 18 respectively) and polar organisation from the sperm head to tail (chromosomes X, 19, Y, 22, 21, and 18, respectively). We provide evidence of defined nuclear organisation in the human sperm and discuss the function of organisation and potential possible clinical ramifications of these results in regards to male infertility and early human development.

Human gastrin-releasing peptide gene is located on chromosome 18.

PubMed

Naylor, S L; Sakaguchi, A Y; Spindel, E; Chin, W W

1987-01-01

Gastrin-releasing peptide (GRP), a bombesin-like peptide, increases plasma levels of gastrin, pancreatic polypeptide, glucagon, gastric inhibitory peptide, and insulin. GRP is produced in large quantities by small-cell lung cancer and acts as a growth factor for these cells. To determine if chromosomal changes in small-cell lung cancer are related to the expression of GRP, we chromosomally mapped the gene using human-mouse somatic cell hybrids. Twenty hybrids, characterized for human chromosomes, were analyzed by Southern filter hybridization of DNA digested with EcoRI. Human DNA cut with EcoRI yields a major band of 6.8 kb and a minor band of 11.3 kb. The 6.8 kb band segregated concordantly with chromosome 18 and the marker peptidase A. The chromosome 3 abnormalities seen in small-cell lung cancer do not correlate with the chromosomal location of GRP, suggesting that the elevated expression of this gene may be due to mechanisms other than chromosomal rearrangement.

Human sperm chromosome analysis after subzonal sperm insemination of hamster oocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cozzi, J.

1994-09-01

Sperm microinjection techniques, subzonal sperm insemination (SUZI) and intracytoplasmic sperm injection (ICSI), have achieved a wide spread clinical application for the treatment of male infertility. To date, only one study has focused on sperm karyotypes after microinjection. Martin et al. reported a very high incidence of abnormal human sperm complements after ICSI into hamster oocytes. In the present study, are reported the first human sperm karyotypes after SUZI of hamster oocytes. Spermatozoa from two control donors were treated by calcium ionophore A23187 and injected under the zona of hamster eggs. The microinjected eggs were then cultured for cytogenetic analysis ofmore » the pronuclei. Out of 47 analyzed sperm chromosome metaphases, 5 (10.6%) were abnormal, 4 (8.5%) were hypohaploid and 1 (2.1%) had a structural abnormality. The sex ratio was not significantly different from the expected 1:1 ratio. Rates of chromosomal abnormalities in microinjected spermatozoa were similar to those observed in spermatozoa inseminated with zona free eggs, suggesting that SUZI procedure per se does not increase sperm chromosomal abnormalities.« less

[Human chromosome banding with raw extract of fruits or leaves of papaya].

PubMed

Solís, M V

2001-01-01

One week old human chromosome preparations were treated with filtrate from one liquefied leaf (53 g) of papaya (Carica papaya) in 100 ml of distilled water, and stained with 1.5% Giemsa (pH 6.8). Good chromosome banding was obtained after 2 min of treatment. Solutions that have been frozen even for years are effective and the method is cheaper and easier than others.

Chromosome speciation: Humans, Drosophila, and mosquitoes

PubMed Central

Ayala, Francisco J.; Coluzzi, Mario

2005-01-01

Chromosome rearrangements (such as inversions, fusions, and fissions) may play significant roles in the speciation between parapatric (contiguous) or partly sympatric (geographically overlapping) populations. According to the “hybrid-dysfunction” model, speciation occurs because hybrids with heterozygous chromosome rearrangements produce dysfunctional gametes and thus have low reproductive fitness. Natural selection will, therefore, promote mutations that reduce the probability of intercrossing between populations carrying different rearrangements and thus promote their reproductive isolation. This model encounters a disabling difficulty: namely, how to account for the spread in a population of a chromosome rearrangement after it first arises as a mutation in a single individual. The “suppressed-recombination” model of speciation points out that chromosome rearrangements act as a genetic filter between populations. Mutations associated with the rearranged chromosomes cannot flow from one to another population, whereas genetic exchange will freely occur between colinear chromosomes. Mutations adaptive to local conditions will, therefore, accumulate differentially in the protected chromosome regions so that parapatric or partially sympatric populations will genetically differentiate, eventually evolving into different species. The speciation model of suppressed recombination has recently been tested by gene and DNA sequence comparisons between humans and chimpanzees, between Drosophila species, and between species related to Anopheles gambiae, the vector of malignant malaria in Africa. PMID:15851677

The Human Proteome Organization Chromosome 6 Consortium: integrating chromosome-centric and biology/disease driven strategies.

PubMed

Borchers, C H; Kast, J; Foster, L J; Siu, K W M; Overall, C M; Binkowski, T A; Hildebrand, W H; Scherer, A; Mansoor, M; Keown, P A

2014-04-04

The Human Proteome Project (HPP) is designed to generate a comprehensive map of the protein-based molecular architecture of the human body, to provide a resource to help elucidate biological and molecular function, and to advance diagnosis and treatment of diseases. Within this framework, the chromosome-based HPP (C-HPP) has allocated responsibility for mapping individual chromosomes by country or region, while the biology/disease HPP (B/D-HPP) coordinates these teams in cross-functional disease-based groups. Chromosome 6 (Ch6) provides an excellent model for integration of these two tasks. This metacentric chromosome has a complement of 1002-1034 genes that code for known, novel or putative proteins. Ch6 is functionally associated with more than 120 major human diseases, many with high population prevalence, devastating clinical impact and profound societal consequences. The unique combination of genomic, proteomic, metabolomic, phenomic and health services data being drawn together within the Ch6 program has enormous potential to advance personalized medicine by promoting robust biomarkers, subunit vaccines and new drug targets. The strong liaison between the clinical and laboratory teams, and the structured framework for technology transfer and health policy decisions within Canada will increase the speed and efficacy of this transition, and the value of this translational research. Canada has been selected to play a leading role in the international Human Proteome Project, the global counterpart of the Human Genome Project designed to understand the structure and function of the human proteome in health and disease. Canada will lead an international team focusing on chromosome 6, which is functionally associated with more than 120 major human diseases, including immune and inflammatory disorders affecting the brain, skeletal system, heart and blood vessels, lungs, kidney, liver, gastrointestinal tract and endocrine system. Many of these chronic and persistent

[Research progress in human artificial chromosomes(HACs) and the potentials in application].

PubMed

Zuo, Guo-Wei; Lü, Feng-Lin

2005-11-01

Since the first report of the establishment of human artificial chromosome(HAC) was published in 1997, several types of HAC have been created by different strategies. Compared to other artificial chromosomes, such as yeast artificial chromosome (YAC) and bacterial artificial chromosome(BAC), HAC exists in a cell independently, in other words, HAC does not integrated into the cellular genome, and can undergo normal mitosis and meiosis from generation to generation in vitro and in vivo. Recent results proved that HAC, as a DNA carrier, is able to host a large fragment of DNA or mini-chromosome, thus it could be a very important tool in the study of human gene expression and regulation, human chromosome function and minimum functional elements and animal models for human diseases. In the near future, HAC can also be used in gene therapy for human genetic diseases.

Characterization of a chromosome-specific chimpanzee alpha satellite subset: Evolutionary relationship to subsets on human chromosomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Warburton, P.E.; Gosden, J.; Lawson, D.

1996-04-15

Alpha satellite DNA is a tandemly repeated DNA family found at the centromeres of all primate chromosomes examined. The fundamental repeat units of alpha satellite DNA are diverged 169- to 172-bp monomers, often found to be organized in chromosome-specific higher-order repeat units. The chromosomes of human (Homo sapiens (HSA)), chimpanzee (Pan troglodytes (PTR) and Pan paniscus), and gorilla (Gorilla gorilla) share a remarkable similarity and synteny. It is of interest to ask if alpha satellite arrays at centromeres of homologous chromosomes between these species are closely related (evolving in an orthologous manner) or if the evolutionary processes that homogenize andmore » spread these arrays within and between chromosomes result in nonorthologous evolution of arrays. By using PCR primers specific for human chromosome 17-specific alpha satellite DNA, we have amplified, cloned, and characterized a chromosome-specific subset from the PTR chimpanzee genome. Hybridization both on Southern blots and in situ as well as sequence analysis show that this subset is most closely related, as expected, to sequences on HSA 17. However, in situ hybridization reveals that this subset is not found on the homologous chromosome in chimpanzee (PTR 19), but instead on PTR 12, which is homologous to HSA 2p. 40 refs., 3 figs.« less

Identification of a herpes simplex labialis susceptibility region on human chromosome 21.

PubMed

Hobbs, Maurine R; Jones, Brandt B; Otterud, Brith E; Leppert, Mark; Kriesel, John D

2008-02-01

Most of the United States population is infected with either herpes simplex virus type 1 (HSV-1), herpes simplex virus type 2, or both. Reactivations of HSV-1 infection cause herpes simplex labialis (HSL; cold sores or fever blisters), which is the most common recurring viral infection in humans. To investigate the possibility of a human genetic component conferring resistance or susceptibility to cold sores (i.e., a HSL susceptibility gene), we conducted a genetic linkage analysis that included serotyping and phenotyping 421 individuals from 39 families enrolled in the Utah Genetic Reference Project. Linkage analysis identified a 2.5-Mb nonrecombinant region of interest on the long arm of human chromosome 21, with a multipoint logarithm of odds score of 3.9 noted near marker abmc65 (D21S409). Nonparametric linkage analysis of the data also provided strong evidence for linkage (P = .0005). This region of human chromosome 21 contains 6 candidate genes for herpes susceptibility. The development of frequent cold sores is associated with a region on the long arm of human chromosome 21. This region contains several candidate genes that could influence the frequency of outbreaks of HSL.

The DNA sequence of the human X chromosome

PubMed Central

Ross, Mark T.; Grafham, Darren V.; Coffey, Alison J.; Scherer, Steven; McLay, Kirsten; Muzny, Donna; Platzer, Matthias; Howell, Gareth R.; Burrows, Christine; Bird, Christine P.; Frankish, Adam; Lovell, Frances L.; Howe, Kevin L.; Ashurst, Jennifer L.; Fulton, Robert S.; Sudbrak, Ralf; Wen, Gaiping; Jones, Matthew C.; Hurles, Matthew E.; Andrews, T. Daniel; Scott, Carol E.; Searle, Stephen; Ramser, Juliane; Whittaker, Adam; Deadman, Rebecca; Carter, Nigel P.; Hunt, Sarah E.; Chen, Rui; Cree, Andrew; Gunaratne, Preethi; Havlak, Paul; Hodgson, Anne; Metzker, Michael L.; Richards, Stephen; Scott, Graham; Steffen, David; Sodergren, Erica; Wheeler, David A.; Worley, Kim C.; Ainscough, Rachael; Ambrose, Kerrie D.; Ansari-Lari, M. Ali; Aradhya, Swaroop; Ashwell, Robert I. S.; Babbage, Anne K.; Bagguley, Claire L.; Ballabio, Andrea; Banerjee, Ruby; Barker, Gary E.; Barlow, Karen F.; Barrett, Ian P.; Bates, Karen N.; Beare, David M.; Beasley, Helen; Beasley, Oliver; Beck, Alfred; Bethel, Graeme; Blechschmidt, Karin; Brady, Nicola; Bray-Allen, Sarah; Bridgeman, Anne M.; Brown, Andrew J.; Brown, Mary J.; Bonnin, David; Bruford, Elspeth A.; Buhay, Christian; Burch, Paula; Burford, Deborah; Burgess, Joanne; Burrill, Wayne; Burton, John; Bye, Jackie M.; Carder, Carol; Carrel, Laura; Chako, Joseph; Chapman, Joanne C.; Chavez, Dean; Chen, Ellson; Chen, Guan; Chen, Yuan; Chen, Zhijian; Chinault, Craig; Ciccodicola, Alfredo; Clark, Sue Y.; Clarke, Graham; Clee, Chris M.; Clegg, Sheila; Clerc-Blankenburg, Kerstin; Clifford, Karen; Cobley, Vicky; Cole, Charlotte G.; Conquer, Jen S.; Corby, Nicole; Connor, Richard E.; David, Robert; Davies, Joy; Davis, Clay; Davis, John; Delgado, Oliver; DeShazo, Denise; Dhami, Pawandeep; Ding, Yan; Dinh, Huyen; Dodsworth, Steve; Draper, Heather; Dugan-Rocha, Shannon; Dunham, Andrew; Dunn, Matthew; Durbin, K. James; Dutta, Ireena; Eades, Tamsin; Ellwood, Matthew; Emery-Cohen, Alexandra; Errington, Helen; Evans, Kathryn L.; Faulkner, Louisa; Francis, Fiona; Frankland, John; Fraser, Audrey E.; Galgoczy, Petra; Gilbert, James; Gill, Rachel; Glöckner, Gernot; Gregory, Simon G.; Gribble, Susan; Griffiths, Coline; Grocock, Russell; Gu, Yanghong; Gwilliam, Rhian; Hamilton, Cerissa; Hart, Elizabeth A.; Hawes, Alicia; Heath, Paul D.; Heitmann, Katja; Hennig, Steffen; Hernandez, Judith; Hinzmann, Bernd; Ho, Sarah; Hoffs, Michael; Howden, Phillip J.; Huckle, Elizabeth J.; Hume, Jennifer; Hunt, Paul J.; Hunt, Adrienne R.; Isherwood, Judith; Jacob, Leni; Johnson, David; Jones, Sally; de Jong, Pieter J.; Joseph, Shirin S.; Keenan, Stephen; Kelly, Susan; Kershaw, Joanne K.; Khan, Ziad; Kioschis, Petra; Klages, Sven; Knights, Andrew J.; Kosiura, Anna; Kovar-Smith, Christie; Laird, Gavin K.; Langford, Cordelia; Lawlor, Stephanie; Leversha, Margaret; Lewis, Lora; Liu, Wen; Lloyd, Christine; Lloyd, David M.; Loulseged, Hermela; Loveland, Jane E.; Lovell, Jamieson D.; Lozado, Ryan; Lu, Jing; Lyne, Rachael; Ma, Jie; Maheshwari, Manjula; Matthews, Lucy H.; McDowall, Jennifer; McLaren, Stuart; McMurray, Amanda; Meidl, Patrick; Meitinger, Thomas; Milne, Sarah; Miner, George; Mistry, Shailesh L.; Morgan, Margaret; Morris, Sidney; Müller, Ines; Mullikin, James C.; Nguyen, Ngoc; Nordsiek, Gabriele; Nyakatura, Gerald; O’Dell, Christopher N.; Okwuonu, Geoffery; Palmer, Sophie; Pandian, Richard; Parker, David; Parrish, Julia; Pasternak, Shiran; Patel, Dina; Pearce, Alex V.; Pearson, Danita M.; Pelan, Sarah E.; Perez, Lesette; Porter, Keith M.; Ramsey, Yvonne; Reichwald, Kathrin; Rhodes, Susan; Ridler, Kerry A.; Schlessinger, David; Schueler, Mary G.; Sehra, Harminder K.; Shaw-Smith, Charles; Shen, Hua; Sheridan, Elizabeth M.; Shownkeen, Ratna; Skuce, Carl D.; Smith, Michelle L.; Sotheran, Elizabeth C.; Steingruber, Helen E.; Steward, Charles A.; Storey, Roy; Swann, R. Mark; Swarbreck, David; Tabor, Paul E.; Taudien, Stefan; Taylor, Tineace; Teague, Brian; Thomas, Karen; Thorpe, Andrea; Timms, Kirsten; Tracey, Alan; Trevanion, Steve; Tromans, Anthony C.; d’Urso, Michele; Verduzco, Daniel; Villasana, Donna; Waldron, Lenee; Wall, Melanie; Wang, Qiaoyan; Warren, James; Warry, Georgina L.; Wei, Xuehong; West, Anthony; Whitehead, Siobhan L.; Whiteley, Mathew N.; Wilkinson, Jane E.; Willey, David L.; Williams, Gabrielle; Williams, Leanne; Williamson, Angela; Williamson, Helen; Wilming, Laurens; Woodmansey, Rebecca L.; Wray, Paul W.; Yen, Jennifer; Zhang, Jingkun; Zhou, Jianling; Zoghbi, Huda; Zorilla, Sara; Buck, David; Reinhardt, Richard; Poustka, Annemarie; Rosenthal, André; Lehrach, Hans; Meindl, Alfons; Minx, Patrick J.; Hillier, LaDeana W.; Willard, Huntington F.; Wilson, Richard K.; Waterston, Robert H.; Rice, Catherine M.; Vaudin, Mark; Coulson, Alan; Nelson, David L.; Weinstock, George; Sulston, John E.; Durbin, Richard; Hubbard, Tim; Gibbs, Richard A.; Beck, Stephan; Rogers, Jane; Bentley, David R.

2009-01-01

The human X chromosome has a unique biology that was shaped by its evolution as the sex chromosome shared by males and females. We have determined 99.3% of the euchromatic sequence of the X chromosome. Our analysis illustrates the autosomal origin of the mammalian sex chromosomes, the stepwise process that led to the progressive loss of recombination between X and Y, and the extent of subsequent degradation of the Y chromosome. LINE1 repeat elements cover one-third of the X chromosome, with a distribution that is consistent with their proposed role as way stations in the process of X-chromosome inactivation. We found 1,098 genes in the sequence, of which 99 encode proteins expressed in testis and in various tumour types. A disproportionately high number of mendelian diseases are documented for the X chromosome. Of this number, 168 have been explained by mutations in 113 X-linked genes, which in many cases were characterized with the aid of the DNA sequence. PMID:15772651

Low-frequency chimeric yeast artificial chromosome libraries from flow-sorted human chromosomes 16 and 21.

PubMed Central

McCormick, M K; Campbell, E; Deaven, L; Moyzis, R

1993-01-01

Construction of chromosome-specific yeast artificial chromosome (YAC) libraries from sorted chromosomes was undertaken (i) to eliminate drawbacks associated with first-generation total genomic YAC libraries, such as the high frequency of chimeric YACs, and (ii) to provide an alternative method for generating chromosome-specific YAC libraries in addition to isolating such collections from a total genomic library. Chromosome-specific YAC libraries highly enriched for human chromosomes 16 and 21 were constructed. By maximizing the percentage of fragments with two ligatable ends and performing yeast transformations with less than saturating amounts of DNA in the presence of carrier DNA, YAC libraries with a low percentage of chimeric clones were obtained. The smaller number of YAC clones in these chromosome-specific libraries reduces the effort involved in PCR-based screening and allows hybridization methods to be a manageable screening approach. Images PMID:8430075

Structural analysis of chromosomal rearrangements associated with the developmental mutations Ph, W19H, and Rw on mouse chromosome 5.

PubMed Central

Nagle, D L; Martin-DeLeon, P; Hough, R B; Bućan, M

1994-01-01

We are studying the chromosomal structure of three developmental mutations, dominant spotting (W), patch (Ph), and rump white (Rw) on mouse chromosome 5. These mutations are clustered in a region containing three genes encoding tyrosine kinase receptors (Kit, Pdgfra, and Flk1). Using probes for these genes and for a closely linked locus, D5Mn125, we established a high-resolution physical map covering approximately 2.8 Mb. The entire chromosomal segment mapped in this study is deleted in the W19H mutation. The map indicates the position of the Ph deletion, which encompasses not more than 400 kb around and including the Pdgfra gene. The map also places the distal breakpoint of the Rw inversion to a limited chromosomal segment between Kit and Pdgfra. In light of the structure of the Ph-W-Rw region, we interpret the previously published complementation analyses as indicating that the pigmentation defect in Rw/+ heterozygotes could be due to the disruption of Kit and/or Pdgfra regulatory sequences, whereas the gene(s) responsible for the recessive lethality of Rw/Rw embryos is not closely linked to the Ph and W loci and maps proximally to the W19H deletion. The structural analysis of chromosomal rearrangements associated with W19H, Ph, and Rw combined with the high-resolution physical mapping points the way toward the definition of these mutations in molecular terms and isolation of homologous genes on human chromosome 4. Images PMID:8041773

Polymorphic human somatostatin gene is located on chromosome 3.

PubMed Central

Naylor, S L; Sakaguchi, A Y; Shen, L P; Bell, G I; Rutter, W J; Shows, T B

1983-01-01

Somatostatin is a 14-amino-acid neuropeptide and hormone that inhibits the secretion of several peptide hormones. The human gene for somatostatin SST has been cloned, and the sequence has been determined. This clone was used as a probe in chromosome mapping studies to detect the human somatostatin sequence in human-rodent hybrids. Southern blot analysis of 41 hybrids, including some containing translocations of human chromosomes, placed SST in the q21 leads to qter region of chromosome 3. Human DNAs from unrelated individuals were screened for restriction fragment polymorphisms detectable by the somatostatin gene probe. Two polymorphisms were found: (i) an EcoRI variant located at the 3' end of the gene, found in Caucasian, U.S. Black, and Asian populations with a frequency of approximately 0.10 and (ii) a BamHI variant in the intron, which occurs in Caucasians at a frequency of 0.13. Images PMID:6133281

Large-scale oscillation of structure-related DNA sequence features in human chromosome 21

NASA Astrophysics Data System (ADS)

Li, Wentian; Miramontes, Pedro

2006-08-01

Human chromosome 21 is the only chromosome in the human genome that exhibits oscillation of the (G+C) content of a cycle length of hundreds kilobases (kb) ( 500kb near the right telomere). We aim at establishing the existence of a similar periodicity in structure-related sequence features in order to relate this (G+C)% oscillation to other biological phenomena. The following quantities are shown to oscillate with the same 500kb periodicity in human chromosome 21: binding energy calculated by two sets of dinucleotide-based thermodynamic parameters, AA/TT and AAA/TTT bi- and tri-nucleotide density, 5'-TA-3' dinucleotide density, and signal for 10- or 11-base periodicity of AA/TT or AAA/TTT. These intrinsic quantities are related to structural features of the double helix of DNA molecules, such as base-pair binding, untwisting or unwinding, stiffness, and a putative tendency for nucleosome formation.

Maternal Gametic Transmission of Translocations or Inversions of Human Chromosome 11p15.5 Results in Regional DNA Hypermethylation and Downregulation of CDKN1C Expression

PubMed Central

Smith, Adam C.; Suzuki, Masako; Thompson, Reid; Choufani, Sanaa; Higgins, Michael J.; Chiu, Idy W.; Squire, Jeremy A.; Greally, John M.; Weksberg, Rosanna

2015-01-01

Beckwith-Wiedemann syndrome (BWS) is an overgrowth syndrome associated with genetic or epigenetic alterations in one of two imprinted domains on chromosome 11p15.5. Rarely, chromosomal translocations or inversions of chromosome 11p15.5 are associated with BWS but the molecular pathophysiology in such cases is not understood. In our series of 3 translocation and 2 inversion patients with BWS, the chromosome 11p15.5 breakpoints map within the centromeric imprinted domain, 2. We hypothesized that either microdeletions/microduplications adjacent to the breakpoints could disrupt genomic sequences important for imprinted gene regulation. An alternate hypothesis was that epigenetic alterations of as yet unknown regulatory DNA sequences, result in the BWS phenotype. A high resolution Nimblegen custom microarray was designed representing all non-repetitive sequences in the telomeric 33 MB of the short arm of human chromosome 11. For the BWS-associated chromosome 11p15.5 translocations and inversions, we found no evidence of microdeletions/microduplications. DNA methylation was also tested on this microarray using the HpaII tiny fragment enrichment by ligation-mediated PCR (HELP) assay. This high-resolution DNA methylation microarray analysis revealed a gain of DNA methylation in the translocation/inversion patients affecting the p-ter segment of chromosome 11p15, including both imprinted domains. BWS patients that inherited a maternal translocation or inversion also demonstrated reduced expression of the growth suppressing imprinted gene, CDKN1C in Domain 2. In summary, our data demonstrate that translocations and inversions involving imprinted domain 2 on chromosome 11p15.5, alter regional DNA methylation patterns and imprinted gene expression in cis, suggesting that these epigenetic alterations are generated by an alteration in “chromatin context”. PMID:22079941

Mapping genes to human chromosome 19

DOE Office of Scientific and Technical Information (OSTI.GOV)

Connolly, Sarah

1996-05-01

For this project, 22 Expressed Sequence Tags (ESTs) were fine mapped to regions of human chromosome 19. An EST is a short DNA sequence that occurs once in the genome and corresponds to a single expressed gene. {sup 32}P-radiolabeled probes were made by polymerase chain reaction for each EST and hybridized to filters containing a chromosome 19-specific cosmid library. The location of the ESTs on the chromosome was determined by the location of the ordered cosmid to which the EST hybridized. Of the 22 ESTs that were sublocalized, 6 correspond to known genes, and 16 correspond to anonymous genes. Thesemore » localized ESTs may serve as potential candidates for disease genes, as well as markers for future physical mapping.« less

The study of human Y chromosome variation through ancient DNA.

PubMed

Kivisild, Toomas

2017-05-01

High throughput sequencing methods have completely transformed the study of human Y chromosome variation by offering a genome-scale view on genetic variation retrieved from ancient human remains in context of a growing number of high coverage whole Y chromosome sequence data from living populations from across the world. The ancient Y chromosome sequences are providing us the first exciting glimpses into the past variation of male-specific compartment of the genome and the opportunity to evaluate models based on previously made inferences from patterns of genetic variation in living populations. Analyses of the ancient Y chromosome sequences are challenging not only because of issues generally related to ancient DNA work, such as DNA damage-induced mutations and low content of endogenous DNA in most human remains, but also because of specific properties of the Y chromosome, such as its highly repetitive nature and high homology with the X chromosome. Shotgun sequencing of uniquely mapping regions of the Y chromosomes to sufficiently high coverage is still challenging and costly in poorly preserved samples. To increase the coverage of specific target SNPs capture-based methods have been developed and used in recent years to generate Y chromosome sequence data from hundreds of prehistoric skeletal remains. Besides the prospects of testing directly as how much genetic change in a given time period has accompanied changes in material culture the sequencing of ancient Y chromosomes allows us also to better understand the rate at which mutations accumulate and get fixed over time. This review considers genome-scale evidence on ancient Y chromosome diversity that has recently started to accumulate in geographic areas favourable to DNA preservation. More specifically the review focuses on examples of regional continuity and change of the Y chromosome haplogroups in North Eurasia and in the New World.

Engineering of Systematic Elimination of a Targeted Chromosome in Human Cells.

PubMed

Sato, Hiroshi; Kato, Hiroki; Yamaza, Haruyoshi; Masuda, Keiji; Nguyen, Huong Thi Nguyen; Pham, Thanh Thi Mai; Han, Xu; Hirofuji, Yuta; Nonaka, Kazuaki

2017-01-01

Embryonic trisomy leads to abortion or congenital genetic disorders in humans. The most common autosomal chromosome abnormalities are trisomy of chromosomes 13, 18, and 21. Although alteration of gene dosage is thought to contribute to disorders caused by extra copies of chromosomes, genes associated with specific disease phenotypes remain unclear. To generate a normal cell from a trisomic cell as a means of etiological analysis or candidate therapy for trisomy syndromes, we developed a system to eliminate a targeted chromosome from human cells. Chromosome 21 was targeted by integration of a DNA cassette in HeLa cells that harbored three copies of chromosome 21. The DNA cassette included two inverted loxP sites and a herpes simplex virus thymidine kinase (HSV-tk) gene. This system causes missegregation of chromosome 21 after expression of Cre recombinase and subsequently enables the selection of cells lacking the chromosome by culturing in a medium that includes ganciclovir (GCV). Cells harboring only two copies of chromosome 21 were efficiently induced by transfection of a Cre expression vector, indicating that this approach is useful for eliminating a targeted chromosome.

Genomic structure and paralogous regions of the inversion breakpoint occurring between human chromosome 3p12.3 and orangutan chromosome 2.

PubMed

Yue, Y; Grossmann, B; Tsend-Ayush, E; Grützner, F; Ferguson-Smith, M A; Yang, F; Haaf, T

2005-01-01

Intrachromosomal duplications play a significant role in human genome pathology and evolution. To better understand the molecular basis of evolutionary chromosome rearrangements, we performed molecular cytogenetic and sequence analyses of the breakpoint region that distinguishes human chromosome 3p12.3 and orangutan chromosome 2. FISH with region-specific BAC clones demonstrated that the breakpoint-flanking sequences are duplicated intrachromosomally on orangutan 2 and human 3q21 as well as at many pericentromeric and subtelomeric sites throughout the genomes. Breakage and rearrangement of the human 3p12.3-homologous region in the orangutan lineage were associated with a partial loss of duplicated sequences in the breakpoint region. Consistent with our FISH mapping results, computational analysis of the human chromosome 3 genomic sequence revealed three 3p12.3-paralogous sequence blocks on human chromosome 3q21 and smaller blocks on the short arm end 3p26-->p25. This is consistent with the view that sequences from an ancestral site at 3q21 were duplicated at 3p12.3 in a common ancestor of orangutan and humans. Our results show that evolutionary chromosome rearrangements are associated with microduplications and microdeletions, contributing to the DNA differences between closely related species. Copyright (c) 2005 S. Karger AG, Basel.

Inter- and Intra-Chromosomal Aberrations in Human Cells Exposed in vitro to High and Low LET Radiations

NASA Technical Reports Server (NTRS)

Hada, M.; Wilkins, R.; Saganti, P. B.; Gersey, B.; Cucinotta, F. A.; Wu, H.

2006-01-01

Energetic heavy ions pose a health risk to astronauts in extended ISS and future Mars missions. High-LET heavy ions are particularly effective in causing various biological effects including cell inactivation, genetic mutations and cancer induction. Most of these biological endpoints are closely related to chromosomal damage, which can be utilized as a biomarker for radiation insults. Previously, we had studied chromosome aberrations in human lymphocytes and fibroblasts induced by both low- and high-LET radiation using FISH and multicolor fluorescence in situ hybridization (mFISH) techniques. In this study, we exposed human epithelial cells in vitro to gamma rays and energetic particles of varying types and energies and dose rates, and analyzed chromosomal damages using the multicolor banding in situ hybridization (mBAND) procedure. Confluent human epithelial cells (CH184B5F5/M10) were exposed to energetic heavy ions at NASA Space Radiation Laboratory (NSRL) at the Brookhaven National Laboratory, high energy neutron at the Los Alamos Nuclear Science Center (LANSCE) or Cs-137-gamma radiation source at the University of Texas, MD Anderson Cancer Center. After colcemid and Calyculin A treatment, cells were fixed and painted with XCyte3 mBAND kit (MetaSystems) and chromosome aberrations were analyzed with mBAND analysis system (MetaSystems). With this technique, individually painted chromosomal bands on one chromosome allowed the identification of interchromosomal aberrations (translocation to unpainted chromosomes) and intrachromosomal aberrations (inversions and deletions within a single painted chromosome). The results of the mBAND study showed a higher ratio of inversion involved with interchromosomal exchange in heavy ions compared to -ray irradiation. Analysis of chromosome aberrations using mBAND has the potential to provide useful information on human cell response to space-like radiation.

Assignment of the human type I IMP dehydrogenase gene (IMPDH1) to chromosome 7q31.3-q32

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gu, Jing Jin; Kaiser-Rogers, K.; Rao, K.

Two phage {lambda} clones that contain 5{prime} portion of the human type I inosine 5{prime}-monophosphate dehydrogenase (IMPDH, EC 1.1.1.205) gene were isolated. Both polymerase chain reaction analysis of a panel of human-mouse and human-hamster cell somatic hybrids using primers specific for the type I IMPDH gene and fluorescence in situ hybridization with metaphase human chromosome using type I IMPDH genomic DNA as probes indicate that the type I IMPDH gene (symbol IMPDH1) is located on chromosome 7. Sequential GTG-banding was performed to assign the band location of the type I IMPDH gene to chromosome 7q31.3-q32. 16 refs., 1 fig., 1more » tab.« less

[Intraspecific chromosomal variability in human pathogenic fungi, especially in Histoplasma capsulatum].

PubMed

Romero-Martínez, Rafael; Canteros, Cristina; Taylor, Maria Lucia

2004-12-01

The ploidy, karyotype, and chromosome length polymorphism (CLP) of human pathogenic fungi were revised with emphasis on Histoplasma capsulatum, the causative agent of the systemic mycosis, histoplasmosis. Currently, different systems of gel electrophoresis are being used to determine fungal electrokaryotypes (EK). By renaturation kinetic and genomic reconstruction in H. capsulatum strains (G-186AS and Downs), estimated genome sizes of 23 and 32 Mb were determined for both strains, respectively. The haploid state was proposed for both strains, although aneuploidy was suggested for the Downs strain. Contour-clamped homogeneous electric field (CHEF), field inversion gel electrophoresis (FIGE), and Southern blot using different probes showed the presence of six to seven chromosomes in the Downs strain (low virulence), whereas four chromosomes were identified in the G-186B strain (high virulence). The use of these methods in the three major H. capsulatum reference strains (G-217B and Downs from the United States of America, G-186B from Panama) revealed distinct chromosome sizes, from 0.5 to 5.7 Mb, with CLP associated with chromosomes size and mobility. Recently, by CHEF, using 19 H. capsulatum isolates from Latin-America and the G-186B strain, five to seven chromosomes with 1.1 to 11.2 Mb molecular sizes were revealed, which again suggested CLP in H. capsulatum. However, to elucidate the EKs polymorphism in H. capsulatum and its relationship with the isolates phenotype more studies are needed to understand the mechanisms controlling ploidy variability.

Establishment of a molecular genetic map of distal mouse chromosome 1: further definition of a conserved linkage group syntenic with human chromosome 1q.

PubMed

Seldin, M F; Morse, H C; LeBoeuf, R C; Steinberg, A D

1988-01-01

A linkage map of distal mouse chromosome 1 was constructed by restriction fragment length polymorphism analysis of DNAs from seven sets of recombinant inbred (RI) strains. The data obtained with seven probes on Southern hybridization combined with data from previous studies suggest the gene order Cfh, Pep-3/Ren-1,2, Ly-5, Lamb-2, At-3, Apoa-2/Ly-17,Spna-1. These results confirm and extend analyses of a large linkage group which includes genes present on a 20-30 cM span of mouse chromosome 1 and those localized to human chromosome 1q21-32. Moreover, the data indicate similar relative positions of human and mouse complement receptor-related genes REN, CD45, LAMB2, AT3, APOA2, and SPTA. These results suggest that mouse gene analyses may help in detailed mapping of human genes within such a syntenic group.

Large-scale polymorphism near the ends of several human chromosomes analyzed by using fluorescence in situ hybridization (FISH)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trask, B.J.; Friedman, C.; Giorgi, D.

1994-09-01

We have discovered a large DNA segment that is polymorphically present at the ends of several human chromosomes. The segment, f7501, was originally derived form a human chromosome 19-specific cosmid library. FISH was used to determine the cosmid`s chromosomal distribution on 44 unrelated humans and several closely related primates. The human subjects represent a diversity of reproductively isolated ethnic populations. FISH analysis revealed that sequences highly homologous to the cosmid`s insert are present on both homologs at 3q, 15q,. and 19p in almost all individuals (88, 85, and 87 of 88 homologs, respectively). Other chromosomes sites were labeled much moremore » rarely in the sampled individuals. For example, 56 of the 88 analyzed chromosomes 11 were labeled (18+/+, 6-/-, and 20+/- individuals). In contrast, 2q was labeled on only 1/88 sampled chromosomes. The termini of 2q, 5q, 6p, 6q, 7p, 8p, 9p, 9q, 11p, 12q, 16p, 19q, and 20q and an interstitial site at 2q13-14 were labeled in at least one individual of the set. EcoR1-fragments derived from the cosmid showed the same hybridization pattern as the entire cosmid, indicating that at least 40 kbp is shared by these chromosome ends. Ethnic differences in the allele frequency of these polymorphic variants was observed. For example, signals were observed on 8/10 and 7/10 of the chromosomes 7p and 16q, respectively, derived form Biakan Pygmies, but these sites were infrequently labeled in non-Pygmy human populations (2/68, respectively). This region has undergone significant changes in chromosome location during human evolution. Strong signal was seen on chimpanzee and gorilla chromosome 3, which is homologous to human chromosome 4, a chromosome unlabeled in any of the humans we have analyzed.« less

Epigenetic Pattern on the Human Y Chromosome Is Evolutionarily Conserved

PubMed Central

Meng, Hao; Agbagwa, Ikechukwu O.; Wang, Ling-Xiang; Wang, Yingzhi; Yan, Shi; Ren, Shancheng; Sun, Yinghao; Pei, Gang; Liu, Xin; Liu, Jiang; Jin, Li; Li, Hui; Sun, Yingli

2016-01-01

DNA methylation plays an important role for mammalian development. However, it is unclear whether the DNA methylation pattern is evolutionarily conserved. The Y chromosome serves as a powerful tool for the study of human evolution because it is transferred between males. In this study, based on deep-rooted pedigrees and the latest Y chromosome phylogenetic tree, we performed epigenetic pattern analysis of the Y chromosome from 72 donors. By comparing their respective DNA methylation level, we found that the DNA methylation pattern on the Y chromosome was stable among family members and haplogroups. Interestingly, two haplogroup-specific methylation sites were found, which were both genotype-dependent. Moreover, the African and Asian samples also had similar DNA methylation pattern with a remote divergence time. Our findings indicated that the DNA methylation pattern on the Y chromosome was conservative during human male history. PMID:26760298

Natural selection reduced diversity on human y chromosomes.

PubMed

Wilson Sayres, Melissa A; Lohmueller, Kirk E; Nielsen, Rasmus

2014-01-01

The human Y chromosome exhibits surprisingly low levels of genetic diversity. This could result from neutral processes if the effective population size of males is reduced relative to females due to a higher variance in the number of offspring from males than from females. Alternatively, selection acting on new mutations, and affecting linked neutral sites, could reduce variability on the Y chromosome. Here, using genome-wide analyses of X, Y, autosomal and mitochondrial DNA, in combination with extensive population genetic simulations, we show that low observed Y chromosome variability is not consistent with a purely neutral model. Instead, we show that models of purifying selection are consistent with observed Y diversity. Further, the number of sites estimated to be under purifying selection greatly exceeds the number of Y-linked coding sites, suggesting the importance of the highly repetitive ampliconic regions. While we show that purifying selection removing deleterious mutations can explain the low diversity on the Y chromosome, we cannot exclude the possibility that positive selection acting on beneficial mutations could have also reduced diversity in linked neutral regions, and may have contributed to lowering human Y chromosome diversity. Because the functional significance of the ampliconic regions is poorly understood, our findings should motivate future research in this area.

Natural Selection Reduced Diversity on Human Y Chromosomes

PubMed Central

Wilson Sayres, Melissa A.; Lohmueller, Kirk E.; Nielsen, Rasmus

2014-01-01

The human Y chromosome exhibits surprisingly low levels of genetic diversity. This could result from neutral processes if the effective population size of males is reduced relative to females due to a higher variance in the number of offspring from males than from females. Alternatively, selection acting on new mutations, and affecting linked neutral sites, could reduce variability on the Y chromosome. Here, using genome-wide analyses of X, Y, autosomal and mitochondrial DNA, in combination with extensive population genetic simulations, we show that low observed Y chromosome variability is not consistent with a purely neutral model. Instead, we show that models of purifying selection are consistent with observed Y diversity. Further, the number of sites estimated to be under purifying selection greatly exceeds the number of Y-linked coding sites, suggesting the importance of the highly repetitive ampliconic regions. While we show that purifying selection removing deleterious mutations can explain the low diversity on the Y chromosome, we cannot exclude the possibility that positive selection acting on beneficial mutations could have also reduced diversity in linked neutral regions, and may have contributed to lowering human Y chromosome diversity. Because the functional significance of the ampliconic regions is poorly understood, our findings should motivate future research in this area. PMID:24415951

Effects of human chromosome 12 on interactions between Tat and TAR of human immunodeficiency virus type 1.

PubMed Central

Alonso, A; Cujec, T P; Peterlin, B M

1994-01-01

Rates of transcriptions of the human immunodeficiency virus are greatly increased by the viral trans activator Tat. In vitro, Tat binds to the 5' bulge of the trans-activation response (TAR) RNA stem-loop, which is present in all viral transcripts. In human cells, the central loop in TAR and its cellular RNA-binding proteins are also critical for the function of Tat. Previously, we demonstrated that in rodent cells (CHO cells), but not in those which contain the human chromosome 12 (CHO12 cells), Tat-TAR interactions are compromised. In this study, we examined the roles of the bulge and loop in TAR in Tat trans activation in these cells. Whereas low levels of trans activation depended solely on interactions between Tat and the bulge in CHO cells, high levels of trans activation depended also on interactions between Tat and the loop in CHO12 cells. Since the TAR loop binding proteins in these two cell lines were identical and different from their human counterpart, the human chromosome 12 does not encode TAR loop binding proteins. In vivo binding competition studies with TAR decoys confirmed that the binding of Tat to TAR is more efficient in CHO12 cells. Thus, the protein(s) encoded on human chromosome 12 helps to tether Tat to TAR via its loop, which results in high levels of trans activation. Images PMID:8083988

The gene for PAX7, a member of the paired-box-containing genes, is localized on human chromosome arm 1p36.

PubMed

Shapiro, D N; Sublett, J E; Li, B; Valentine, M B; Morris, S W; Noll, M

1993-09-01

The murine Pax-7 gene and the cognate human gene, formerly designated HuP1, are members of the multigene paired-box-containing class of developmental regulatory genes first identified in Drosophila. By analysis of somatic cell hybrids segregating human chromosomes, the gene encoding PAX7 was localized to human chromosome 1. Fluorescence in situ hybridization confirmed this assignment and allowed mapping of the gene to the terminal region of the short arm (1p36) of the chromosome. Additionally, these results confirm the extensive homology between human chromosome 1p and the distal segment of mouse chromosome 4, extending from bands C5 through E2.

Structure, organization, and sequence of alpha satellite DNA from human chromosome 17: evidence for evolution by unequal crossing-over and an ancestral pentamer repeat shared with the human X chromosome.

PubMed

Waye, J S; Willard, H F

1986-09-01

The centromeric regions of all human chromosomes are characterized by distinct subsets of a diverse tandemly repeated DNA family, alpha satellite. On human chromosome 17, the predominant form of alpha satellite is a 2.7-kilobase-pair higher-order repeat unit consisting of 16 alphoid monomers. We present the complete nucleotide sequence of the 16-monomer repeat, which is present in 500 to 1,000 copies per chromosome 17, as well as that of a less abundant 15-monomer repeat, also from chromosome 17. These repeat units were approximately 98% identical in sequence, differing by the exclusion of precisely 1 monomer from the 15-monomer repeat. Homologous unequal crossing-over is suggested as a probable mechanism by which the different repeat lengths on chromosome 17 were generated, and the putative site of such a recombination event is identified. The monomer organization of the chromosome 17 higher-order repeat unit is based, in part, on tandemly repeated pentamers. A similar pentameric suborganization has been previously demonstrated for alpha satellite of the human X chromosome. Despite the organizational similarities, substantial sequence divergence distinguishes these subsets. Hybridization experiments indicate that the chromosome 17 and X subsets are more similar to each other than to the subsets found on several other human chromosomes. We suggest that the chromosome 17 and X alpha satellite subsets may be related components of a larger alphoid subfamily which have evolved from a common ancestral repeat into the contemporary chromosome-specific subsets.

Ordered mapping of 3 alphoid DNA subsets on human chromosome 22

DOE Office of Scientific and Technical Information (OSTI.GOV)

Antonacci, R.; Baldini, A.; Archidiacono, N.

1994-09-01

Alpha satellite DNA consists of tandemly repeated monomers of 171 bp clustered in the centromeric region of primate chromosomes. Sequence divergence between subsets located in different human chromosomes is usually high enough to ensure chromosome-specific hybridization. Alphoid probes specific for almost every human chromosome have been reported. A single chromosome can carry different subsets of alphoid DNA and some alphoid subsets can be shared by different chromosomes. We report the physical order of three alphoid DNA subsets on human chromosome 22 determined by a combination of low and high resolution cytological mapping methods. Results visually demonstrate the presence of threemore » distinct alphoid DNA domains at the centromeric region of chromosome 22. We have measured the interphase distances between the three probes in three-color FISH experiments. Statistical analysis of the results indicated the order of the subsets. Two color experiments on prometaphase chromosomes established the order of the three domains relative to the arms of chromosome 22 and confirmed the results obtained using interphase mapping. This demonstrates the applicability of interphase mapping for alpha satellite DNA orderering. However, in our experiments, interphase mapping did not provide any information about the relationship between extremities of the repeat arrays. This information was gained from extended chromatin hybridization. The extremities of two of the repeat arrays were seen to be almost overlapping whereas the third repeat array was clearly separated from the other two. Our data show the value of extended chromatin hybridization as a complement of other cytological techniques for high resolution mapping of repetitive DNA sequences.« less

Three-dimensional positioning and structure of chromosomes in a human prophase nucleus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Bo; Yusuf, Mohammed; Hashimoto, Teruo

The human genetic material is packaged into 46 chromosomes. The structure of chromosomes is known at the lowest level, where the DNA chain is wrapped around a core of eight histone proteins to form nucleosomes. Around a million of these nucleosomes, each about 11 nm in diameter and 6 nm in thickness, are wrapped up into the complex organelle of the chromosome, whose structure is mostly known at the level of visible light microscopy to form a characteristic cross shape in metaphase. However, the higher-order structure of human chromosomes, between a few tens and hundreds of nanometers, has not beenmore » well understood. We show a three-dimensional (3D) image of a human prophase nucleus obtained by serial block-face scanning electron microscopy, with 36 of the complete set of 46 chromosomes captured within it. The acquired image allows us to extract quantitative 3D structural information about the nucleus and the preserved, intact individual chromosomes within it, including their positioning and full spatial morphology at a resolution of around 50 nm in three dimensions. The chromosome positions were found, at least partially, to follow the pattern of chromosome territories previously observed only in interphase. The 3D conformation shows parallel, planar alignment of the chromatids, whose occupied volumes are almost fully accounted for by the DNA and known chromosomal proteins. Here, we also propose a potential new method of identifying human chromosomes in three dimensions, on the basis of the measurements of their 3D morphology.« less

Three-dimensional positioning and structure of chromosomes in a human prophase nucleus

PubMed Central

Chen, Bo; Yusuf, Mohammed; Hashimoto, Teruo; Estandarte, Ana Katrina; Thompson, George; Robinson, Ian

2017-01-01

The human genetic material is packaged into 46 chromosomes. The structure of chromosomes is known at the lowest level, where the DNA chain is wrapped around a core of eight histone proteins to form nucleosomes. Around a million of these nucleosomes, each about 11 nm in diameter and 6 nm in thickness, are wrapped up into the complex organelle of the chromosome, whose structure is mostly known at the level of visible light microscopy to form a characteristic cross shape in metaphase. However, the higher-order structure of human chromosomes, between a few tens and hundreds of nanometers, has not been well understood. We show a three-dimensional (3D) image of a human prophase nucleus obtained by serial block-face scanning electron microscopy, with 36 of the complete set of 46 chromosomes captured within it. The acquired image allows us to extract quantitative 3D structural information about the nucleus and the preserved, intact individual chromosomes within it, including their positioning and full spatial morphology at a resolution of around 50 nm in three dimensions. The chromosome positions were found, at least partially, to follow the pattern of chromosome territories previously observed only in interphase. The 3D conformation shows parallel, planar alignment of the chromatids, whose occupied volumes are almost fully accounted for by the DNA and known chromosomal proteins. We also propose a potential new method of identifying human chromosomes in three dimensions, on the basis of the measurements of their 3D morphology. PMID:28776025

Three-dimensional positioning and structure of chromosomes in a human prophase nucleus

DOE PAGES

Chen, Bo; Yusuf, Mohammed; Hashimoto, Teruo; ...

2017-07-21

The human genetic material is packaged into 46 chromosomes. The structure of chromosomes is known at the lowest level, where the DNA chain is wrapped around a core of eight histone proteins to form nucleosomes. Around a million of these nucleosomes, each about 11 nm in diameter and 6 nm in thickness, are wrapped up into the complex organelle of the chromosome, whose structure is mostly known at the level of visible light microscopy to form a characteristic cross shape in metaphase. However, the higher-order structure of human chromosomes, between a few tens and hundreds of nanometers, has not beenmore » well understood. We show a three-dimensional (3D) image of a human prophase nucleus obtained by serial block-face scanning electron microscopy, with 36 of the complete set of 46 chromosomes captured within it. The acquired image allows us to extract quantitative 3D structural information about the nucleus and the preserved, intact individual chromosomes within it, including their positioning and full spatial morphology at a resolution of around 50 nm in three dimensions. The chromosome positions were found, at least partially, to follow the pattern of chromosome territories previously observed only in interphase. The 3D conformation shows parallel, planar alignment of the chromatids, whose occupied volumes are almost fully accounted for by the DNA and known chromosomal proteins. Here, we also propose a potential new method of identifying human chromosomes in three dimensions, on the basis of the measurements of their 3D morphology.« less

Breakpoint analysis of the pericentric inversion between chimpanzee chromosome 10 and the homologous chromosome 12 in humans.

PubMed

Kehrer-Sawatzki, H; Sandig, C A; Goidts, V; Hameister, H

2005-01-01

During this study, we analysed the pericentric inversion that distinguishes human chromosome 12 (HSA12) from the homologous chimpanzee chromosome (PTR10). Two large chimpanzee-specific duplications of 86 and 23 kb were observed in the breakpoint regions, which most probably occurred associated with the inversion. The inversion break in PTR10p caused the disruption of the SLCO1B3 gene in exon 11. However, the 86-kb duplication includes the functional SLCO1B3 locus, which is thus retained in the chimpanzee, although inverted to PTR10q. The second duplication spans 23 kb and does not contain expressed sequences. Eleven genes map to a region of about 1 Mb around the breakpoints. Six of these eleven genes are not among the differentially expressed genes as determined previously by comparing the human and chimpanzee transcriptome of fibroblast cell lines, blood leukocytes, liver and brain samples. These findings imply that the inversion did not cause major expression differences of these genes. Comparative FISH analysis with BACs spanning the inversion breakpoints in PTR on metaphase chromosomes of gorilla (GGO) confirmed that the pericentric inversion of the chromosome 12 homologs in GGO and PTR have distinct breakpoints and that humans retain the ancestral arrangement. These findings coincide with the trend observed in hominoid karyotype evolution that humans have a karyotype close to an ancestral one, while African great apes present with more derived chromosome arrangements. Copyright (c) 2005 S. Karger AG, Basel.

Human Chromosome 7: DNA Sequence and Biology

PubMed Central

Scherer, Stephen W.; Cheung, Joseph; MacDonald, Jeffrey R.; Osborne, Lucy R.; Nakabayashi, Kazuhiko; Herbrick, Jo-Anne; Carson, Andrew R.; Parker-Katiraee, Layla; Skaug, Jennifer; Khaja, Razi; Zhang, Junjun; Hudek, Alexander K.; Li, Martin; Haddad, May; Duggan, Gavin E.; Fernandez, Bridget A.; Kanematsu, Emiko; Gentles, Simone; Christopoulos, Constantine C.; Choufani, Sanaa; Kwasnicka, Dorota; Zheng, Xiangqun H.; Lai, Zhongwu; Nusskern, Deborah; Zhang, Qing; Gu, Zhiping; Lu, Fu; Zeesman, Susan; Nowaczyk, Malgorzata J.; Teshima, Ikuko; Chitayat, David; Shuman, Cheryl; Weksberg, Rosanna; Zackai, Elaine H.; Grebe, Theresa A.; Cox, Sarah R.; Kirkpatrick, Susan J.; Rahman, Nazneen; Friedman, Jan M.; Heng, Henry H. Q.; Pelicci, Pier Giuseppe; Lo-Coco, Francesco; Belloni, Elena; Shaffer, Lisa G.; Pober, Barbara; Morton, Cynthia C.; Gusella, James F.; Bruns, Gail A. P.; Korf, Bruce R.; Quade, Bradley J.; Ligon, Azra H.; Ferguson, Heather; Higgins, Anne W.; Leach, Natalia T.; Herrick, Steven R.; Lemyre, Emmanuelle; Farra, Chantal G.; Kim, Hyung-Goo; Summers, Anne M.; Gripp, Karen W.; Roberts, Wendy; Szatmari, Peter; Winsor, Elizabeth J. T.; Grzeschik, Karl-Heinz; Teebi, Ahmed; Minassian, Berge A.; Kere, Juha; Armengol, Lluis; Pujana, Miguel Angel; Estivill, Xavier; Wilson, Michael D.; Koop, Ben F.; Tosi, Sabrina; Moore, Gudrun E.; Boright, Andrew P.; Zlotorynski, Eitan; Kerem, Batsheva; Kroisel, Peter M.; Petek, Erwin; Oscier, David G.; Mould, Sarah J.; Döhner, Hartmut; Döhner, Konstanze; Rommens, Johanna M.; Vincent, John B.; Venter, J. Craig; Li, Peter W.; Mural, Richard J.; Adams, Mark D.; Tsui, Lap-Chee

2010-01-01

DNA sequence and annotation of the entire human chromosome 7, encompassing nearly 158 million nucleotides of DNA and 1917 gene structures, are presented. To generate a higher order description, additional structural features such as imprinted genes, fragile sites, and segmental duplications were integrated at the level of the DNA sequence with medical genetic data, including 440 chromosome rearrangement breakpoints associated with disease. This approach enabled the discovery of candidate genes for developmental diseases including autism. PMID:12690205

Cell-autonomous correction of ring chromosomes in human induced pluripotent stem cells

NASA Astrophysics Data System (ADS)

Bershteyn, Marina; Hayashi, Yohei; Desachy, Guillaume; Hsiao, Edward C.; Sami, Salma; Tsang, Kathryn M.; Weiss, Lauren A.; Kriegstein, Arnold R.; Yamanaka, Shinya; Wynshaw-Boris, Anthony

2014-03-01

Ring chromosomes are structural aberrations commonly associated with birth defects, mental disabilities and growth retardation. Rings form after fusion of the long and short arms of a chromosome, and are sometimes associated with large terminal deletions. Owing to the severity of these large aberrations that can affect multiple contiguous genes, no possible therapeutic strategies for ring chromosome disorders have been proposed. During cell division, ring chromosomes can exhibit unstable behaviour leading to continuous production of aneuploid progeny with low viability and high cellular death rate. The overall consequences of this chromosomal instability have been largely unexplored in experimental model systems. Here we generated human induced pluripotent stem cells (iPSCs) from patient fibroblasts containing ring chromosomes with large deletions and found that reprogrammed cells lost the abnormal chromosome and duplicated the wild-type homologue through the compensatory uniparental disomy (UPD) mechanism. The karyotypically normal iPSCs with isodisomy for the corrected chromosome outgrew co-existing aneuploid populations, enabling rapid and efficient isolation of patient-derived iPSCs devoid of the original chromosomal aberration. Our results suggest a fundamentally different function for cellular reprogramming as a means of `chromosome therapy' to reverse combined loss-of-function across many genes in cells with large-scale aberrations involving ring structures. In addition, our work provides an experimentally tractable human cellular system for studying mechanisms of chromosomal number control, which is of critical relevance to human development and disease.

High- and low-LET Radiation-induced Chromosome Aberrations in Human Epithelial Cells Cultured in 3-dimensional Matrices

NASA Technical Reports Server (NTRS)

Hada, M.; George K.; Cucinotta, F. A.; Wu, H.

2008-01-01

Energetic heavy ions pose a great health risk to astronauts who participate in extended ISS missions and will be an even greater concern for future manned lunar and Mars missions. High-LET heavy ions are particularly effective in causing various biological effects, including cell inactivation, genetic mutations, cataracts and cancer induction. Most of these biological endpoints are closely related to chromosomal damage, which can be utilized as a biomarker for radiation insults. Previously, we had studied low- and high-LET radiation-induced chromosome aberrations in human epithelial cells cultured in 2-dimension (2D) using the multicolor banding fluorescence in situ hybridization (mBAND) technique. However, it has been realized that the biological response to radiation insult in a 2D in vitro cellular environment can differ significantly from the response in 3-dimension (3D) or at the actual tissue level. In this study, we cultured human epithelial cells in 3D to provide a more suitable model for human tissue. Human mammary epithelial cells (CH184B5F5/M10) were grown in Matrigel to form 3D structures, and exposed to Fe-ions at NASA Space Radiation Laboratory (NSRL) at the Brookhaven National Laboratory or 137Cs-gamma radiation source at the University of Texas MD Anderson Cancer Center. After exposure, cells were allowed to repair for 16hr before dissociation and subcultured at low density in 2D. G2 and metaphase chromosomes in the first cell cycle were collected in the first cell cycle after irradiation using a chemical-induced premature chromosome condensation (PCC) technique, and chromosome aberrations were analyzed using mBAND technique. With this technique, individually painted chromosomal bands on one chromosome allowed the identification of interchromosomal aberrations (translocation to unpainted chromosomes) and intrachromosomal aberrations (inversions and deletions within a single painted chromosome). Our data indicate a significant difference in the

Efficient identification of Y chromosome sequences in the human and Drosophila genomes.

PubMed

Carvalho, Antonio Bernardo; Clark, Andrew G

2013-11-01

Notwithstanding their biological importance, Y chromosomes remain poorly known in most species. A major obstacle to their study is the identification of Y chromosome sequences; due to its high content of repetitive DNA, in most genome projects, the Y chromosome sequence is fragmented into a large number of small, unmapped scaffolds. Identification of Y-linked genes among these fragments has yielded important insights about the origin and evolution of Y chromosomes, but the process is labor intensive, restricting studies to a small number of species. Apart from these fragmentary assemblies, in a few mammalian species, the euchromatic sequence of the Y is essentially complete, owing to painstaking BAC mapping and sequencing. Here we use female short-read sequencing and k-mer comparison to identify Y-linked sequences in two very different genomes, Drosophila virilis and human. Using this method, essentially all D. virilis scaffolds were unambiguously classified as Y-linked or not Y-linked. We found 800 new scaffolds (totaling 8.5 Mbp), and four new genes in the Y chromosome of D. virilis, including JYalpha, a gene involved in hybrid male sterility. Our results also strongly support the preponderance of gene gains over gene losses in the evolution of the Drosophila Y. In the intensively studied human genome, used here as a positive control, we recovered all previously known genes or gene families, plus a small amount (283 kb) of new, unfinished sequence. Hence, this method works in large and complex genomes and can be applied to any species with sex chromosomes.

Chimpanzee and human Y chromosomes are remarkably divergent in structure and gene content.

PubMed

Hughes, Jennifer F; Skaletsky, Helen; Pyntikova, Tatyana; Graves, Tina A; van Daalen, Saskia K M; Minx, Patrick J; Fulton, Robert S; McGrath, Sean D; Locke, Devin P; Friedman, Cynthia; Trask, Barbara J; Mardis, Elaine R; Warren, Wesley C; Repping, Sjoerd; Rozen, Steve; Wilson, Richard K; Page, David C

2010-01-28

The human Y chromosome began to evolve from an autosome hundreds of millions of years ago, acquiring a sex-determining function and undergoing a series of inversions that suppressed crossing over with the X chromosome. Little is known about the recent evolution of the Y chromosome because only the human Y chromosome has been fully sequenced. Prevailing theories hold that Y chromosomes evolve by gene loss, the pace of which slows over time, eventually leading to a paucity of genes, and stasis. These theories have been buttressed by partial sequence data from newly emergent plant and animal Y chromosomes, but they have not been tested in older, highly evolved Y chromosomes such as that of humans. Here we finished sequencing of the male-specific region of the Y chromosome (MSY) in our closest living relative, the chimpanzee, achieving levels of accuracy and completion previously reached for the human MSY. By comparing the MSYs of the two species we show that they differ radically in sequence structure and gene content, indicating rapid evolution during the past 6 million years. The chimpanzee MSY contains twice as many massive palindromes as the human MSY, yet it has lost large fractions of the MSY protein-coding genes and gene families present in the last common ancestor. We suggest that the extraordinary divergence of the chimpanzee and human MSYs was driven by four synergistic factors: the prominent role of the MSY in sperm production, 'genetic hitchhiking' effects in the absence of meiotic crossing over, frequent ectopic recombination within the MSY, and species differences in mating behaviour. Although genetic decay may be the principal dynamic in the evolution of newly emergent Y chromosomes, wholesale renovation is the paramount theme in the continuing evolution of chimpanzee, human and perhaps other older MSYs.

Comparative mapping of DNA markers from the familial Alzheimer disease and Down syndrome regions of human chromosome 21 to mouse chromosomes 16 and 17.

PubMed

Cheng, S V; Nadeau, J H; Tanzi, R E; Watkins, P C; Jagadesh, J; Taylor, B A; Haines, J L; Sacchi, N; Gusella, J F

1988-08-01

Mouse trisomy 16 has been proposed as an animal model of Down syndrome (DS), since this chromosome contains homologues of several loci from the q22 band of human chromosome 21. The recent mapping of the defect causing familial Alzheimer disease (FAD) and the locus encoding the Alzheimer amyloid beta precursor protein (APP) to human chromosome 21 has prompted a more detailed examination of the extent of conservation of this linkage group between the two species. Using anonymous DNA probes and cloned genes from human chromosome 21 in a combination of recombinant inbred and interspecific mouse backcross analyses, we have established that the linkage group shared by mouse chromosome 16 includes not only the critical DS region of human chromosome 21 but also the APP gene and FAD-linked markers. Extending from the anonymous DNA locus D21S52 to ETS2, the linkage map of six loci spans 39% recombination in man but only 6.4% recombination in the mouse. A break in synteny occurs distal to ETS2, with the homologue of the human marker D21S56 mapping to mouse chromosome 17. Conservation of the linkage relationships of markers in the FAD region suggests that the murine homologue of the FAD locus probably maps to chromosome 16 and that detailed comparison of the corresponding region in both species could facilitate identification of the primary defect in this disorder. The break in synteny between the terminal portion of human chromosome 21 and mouse chromosome 16 indicates, however, that mouse trisomy 16 may not represent a complete model of DS.

Functional gene groups are concentrated within chromosomes, among chromosomes and in the nuclear space of the human genome.

PubMed

Thévenin, Annelyse; Ein-Dor, Liat; Ozery-Flato, Michal; Shamir, Ron

2014-09-01

Genomes undergo changes in organization as a result of gene duplications, chromosomal rearrangements and local mutations, among other mechanisms. In contrast to prokaryotes, in which genes of a common function are often organized in operons and reside contiguously along the genome, most eukaryotes show much weaker clustering of genes by function, except for few concrete functional groups. We set out to check systematically if there is a relation between gene function and gene organization in the human genome. We test this question for three types of functional groups: pairs of interacting proteins, complexes and pathways. We find a significant concentration of functional groups both in terms of their distance within the same chromosome and in terms of their dispersal over several chromosomes. Moreover, using Hi-C contact map of the tendency of chromosomal segments to appear close in the 3D space of the nucleus, we show that members of the same functional group that reside on distinct chromosomes tend to co-localize in space. The result holds for all three types of functional groups that we tested. Hence, the human genome shows substantial concentration of functional groups within chromosomes and across chromosomes in space. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Chromosomal changes in cultured human epithelial cells transformed by low- and high-LET radiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Tracy Chui-hsu; Craise, L.M; Prioleau, J.C.

1990-11-01

For a better assessment of radiation risk in space, an understanding of the responses of human cells, especially the epithelial cells, to low- and high-LET radiation is essential. In our laboratory, we have successfully developed techniques to study the neoplastic transformation of two human epithelial cell systems by ionizing radiation. These cell systems are human mammary epithelial cells (H184B5) and human epidermal keratinocytes (HEK). Both cell lines are immortal, anchorage dependent for growth, and nontumorigenic in athymic nude nice. Neoplastic transformation was achieved by irradiation cells successively. Our results showed that radiogenic cell transformation is a multistep process and thatmore » a single exposure of ionizing radiation can cause only one step of transformation. It requires, therefore, multihits to make human epithelial cells fully tumorigenic. Using a simple karyotyping method, we did chromosome analysis with cells cloned at various stages of transformation. We found no consistent large terminal deletion of chromosomes in radiation-induced transformants. Some changes of total number of chromosomes, however, were observed in the transformed cells. These transformants provide an unique opportunity for further genetic studies at a molecular level. 15 refs., 9 figs., 2 tabs.« less

Chromosomal changes in cultured human epithelial cells transformed by low- and high-let radiation

NASA Astrophysics Data System (ADS)

Chui-Hsu Yang, Tracy; Craise, Laurie M.; Prioleau, John C.; Stampfer, Martha R.; Rhim, Johng S.

1992-07-01

For a better assessment of radiation risk in space, an understanding of the responses of human cells, especially the epithelial cells, to low- and high-LET radiation is essential. In our laboratory, we have successfully developed techniques to study the neoplastic transformation of two human epithelial cell systems by ionizing radiation. These cell systems are human mammary epithelial cells (H184B5) and human epidermal keratinocytes (HEK). Both cell lines are immortal, anchorage dependent for growth, and nontumorigenic in athymic nude mice. Neoplastic transformation was achieved by irradiating cells successively. Our results showed that radiogenic cell transformation is a multistep process and that a single exposure of ionizing radiation can cause only one step of transformation. It requires, therefore, multihits to make human epithelial cells fully tumorigenic. Using a simple karyotyping method, we did chromosome analysis with cells cloned at various stages of transformation. We found no consistent large terminal deletion of chromosomes in radiation-induced transformants. Some changes of total number of chromosomes, however, were observed in the transformed cells. These transformants provide an unique opportunity for further genetic studies at a molecular level.

Chromosomal changes in cultured human epithelial cells transformed by low- and high-LET radiation

NASA Technical Reports Server (NTRS)

Craise, L. M.; Prioleau, J. C.; Stampfer, M. R.; Rhim, J. S.; Yang, TC-H (Principal Investigator)

1992-01-01

For a better assessment of radiation risk in space, an understanding of the responses of human cells, especially the epithelial cells, to low- and high-LET radiation is essential. In our laboratory, we have successfully developed techniques to study the neoplastic transformation of two human epithelial cell systems by ionizing radiation. These cell systems are human mammary epithelial cells (H184B5) and human epidermal keratinocytes (HEK). Both cell lines are immortal, anchorage dependent for growth, and nontumorigenic in athymic nude mice. Neoplastic transformation was achieved by irradiating cells successively. Our results showed that radiogenic cell transformation is a multistep process and that a single exposure of ionizing radiation can cause only one step of transformation. It requires, therefore, multihits to make human epithelial cells fully tumorigenic. Using a simple karyotyping method, we did chromosome analysis with cells cloned at various stages of transformation. We found no consistent large terminal deletion of chromosomes in radiation-induced transformants. Some changes of total number of chromosomes, however, were observed in the transformed cells. These transformants provide an unique opportunity for further genetic studies at a molecular level.

Human chromosome Y and SRY.

PubMed

Shah, V C; Smart, V

1996-01-01

The precise location of the SRY gene on the human Y chromosome has been revealed through studies of sex reversal cases involving deletion, cross-linking and mutations of the SRY gene. Its DNA sequence and mechanism of action are being understood. Similarity of SRY with Sry of mice and its interaction with other genes in male sex determination are discussed.

Human chromokinesins promote chromosome congression and spindle microtubule dynamics during mitosis

PubMed Central

Wandke, Cornelia; Barisic, Marin; Sigl, Reinhard; Rauch, Veronika; Wolf, Frank; Amaro, Ana C.; Tan, Chia H.; Pereira, Antonio J.; Kutay, Ulrike; Maiato, Helder; Meraldi, Patrick

2012-01-01

Chromokinesins are microtubule plus end–directed motor proteins that bind to chromosome arms. In Xenopus egg cell-free extracts, Xkid and Xklp1 are essential for bipolar spindle formation but the functions of the human homologues, hKID (KIF22) and KIF4A, are poorly understood. By using RNAi-mediated protein knockdown in human cells, we find that only co-depletion delayed progression through mitosis in a Mad2-dependent manner. Depletion of hKID caused abnormal chromosome arm orientation, delayed chromosome congression, and sensitized cells to nocodazole. Knockdown of KIF4A increased the number and length of microtubules, altered kinetochore oscillations, and decreased kinetochore microtubule flux. These changes were associated with failures in establishing a tight metaphase plate and an increase in anaphase lagging chromosomes. Co-depletion of both chromokinesins aggravated chromosome attachment failures, which led to mitotic arrest. Thus, hKID and KIF4A contribute independently to the rapid and correct attachment of chromosomes by controlling the positioning of chromosome arms and the dynamics of microtubules, respectively. PMID:22945934

Molecular cloning of metaphase chromosome protein 1 (MCP1), a novel human autoantigen that associates with condensed chromosomes during mitosis.

PubMed

Bronze-da-Rocha, E; Catita, J A; Sunkel, C E

1998-02-01

Systemic lupus erythematosus autoantibodies were used to identify and to characterize new human chromosome-associated proteins. Previous immunolocalization studies in human and murine tissue culture cells showed that some of these monoclonal antibodies recognize nuclear antigens that associate with condensed chromosomes during mitosis. One antibody was selected for screening a human HeLa S3 cDNA expression library, and cDNAs that code for an antigen of 31-33 kDa were isolated. Immunological, biochemical and cell fractionation data indicate that the 31- to 33-kDa antigen corresponds to the chromosome-associated protein recognized by the original monoclonal antibody. Sequence analysis shows that we isolated a novel human gene. Immunolocalization to human tissue culture cells shows that during interphase the antigen is dispersed in the nucleus and that during mitosis it associates exclusively with condensed chromosomes. A similar pattern of localization was also observed in mouse fibroblasts, suggesting that the antigen is conserved among different species. Finally, we show that part of the antigen remains bound to the scaffold/matrix component, even after high salt extraction.

Induction of chromosome aberrations in human cells by charged particles

NASA Technical Reports Server (NTRS)

Wu, H.; Durante, M.; George, K.; Yang, T. C.

1997-01-01

Chromosome aberrations induced by high-energy charged particles in normal human lymphocytes and human fibroblasts have been investigated. The charged particles included 250 MeV/nucleon protons, 290 MeV/nucleon carbon ions and 1 GeV/nucleon iron ions. The energies of the charged particles were higher than in most of the studies reported in the literature. Lymphocytes were stimulated to grow immediately after irradiation, while fibroblasts were incubated at 37 degrees C for 24 h for repair. Chromosomes were collected at the first mitosis after irradiation and chromosome aberrations were scored using the fluorescence in situ hybridization (FISH) technique with a whole-chromosome 4 probe. Chromosome aberrations were classified as reciprocal exchanges, incomplete exchanges, deletions and complex exchanges. The relative biological effectiveness (RBE) for each type of aberration was calculated by dividing a dose of 4 Gy by the dose of the charged particles producing the same effect as 4 Gy of gamma rays. Results of this study showed that complex aberrations have the highest RBE for radiation of high linear energy transfer (LET) for human lymphocytes, but for fibroblasts, the greatest effect was for incomplete exchanges. For both lymphocytes and fibroblasts, iron ions induced a similar fraction of aberrant cells.

Maternal uniparental disomy for human chromosome 14, due to loss of a chromosome 14 from somatic cells with t(13; 14) trisomy 14

DOE Office of Scientific and Technical Information (OSTI.GOV)

Antonarakis, S.E.; Blouin, J.L.; Maher, J.

1993-06-01

Uniparental disomy (UPD) for particular chromosomes is increasingly recognized as a cause of abnormal phenotypes in humans. The authors recently studied a 9-year-old female with a de novo Robertsonian translocation t(13;14), short stature, mild developmental delay, scoliosis, hyperextensible joints, hydrocephalus that resolved spontaneously during the first year of life, and hyperchloesterolemia. To determine the parental origin of chromosomes 13 and 14 in the proband, they have studied the genotypes of DNA polymorphic markers due to (GT)n repeats in the patient and her parents' blood DNA. The genotypes of markers D14S43, D14S45, D14S49, and D14S54 indicated maternal UPD for chromosome 14.more » There was isodisomy for proximal markers and heterodisomy for distal markers, suggesting a recombination event on maternal chromosomes 14. In addition, DNA analysis first revealed -- and subsequent cytogenetic analysis confirmed -- that there was mosaic trisomy 14 in 5% of blood lymphocytes. There was normal (biparental) inheritance for chromosome 13, and there was no evidence of false paternity in genotypes of 11 highly polymorphic markers on human chromosome 21. Two cases of maternal UPD for chromosome 14 have previously been reported, one with a familial rob t(13;14) and the other with a t(14;14). There are several similarities among these patients, and a [open quotes]maternal UPD chromosome 14 syndrome[close quotes] is emerging; however, the contribution of the mosaic trisomy 14 to the phenotype cannot be evaluated. The study of de novo Robertsonian translocations of the type reported here should reveal both the extent of UPD in these events and the contribution of particular chromosomes involved in certain phenotypes. 33 refs., 3 figs., 1 tab.« less

Chromosomal localization of murine and human oligodendrocyte-specific protein genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bronstein, J.M.; Wu, S.; Korenberg, J.R.

1996-06-01

Oligodendrocyte-specific protein (OSP) is a recently described protein present only in myelin of the central nervous system. Several inherited disorders of myelin are caused by mutations in myelin genes but the etiology of many remain unknown. We mapped the location of the mouse OSP gene to the proximal region of chromosome 3 using two sets of multilocus crosses and to human chromosome 3 using somatic cell hybrids. Fine mapping with fluorescence in situ hybridization placed the OSP gene at human chromosome 3q26.2-q26.3. To date, there are no known inherited neurological disorders that localize to these regions. 24 refs., 2 figs.

Chromosomal mutations and chromosome loss measured in a new human-hamster hybrid cell line, ALC: studies with colcemid, ultraviolet irradiation, and 137Cs gamma-rays

NASA Technical Reports Server (NTRS)

Kraemer, S. M.; Waldren, C. A.; Chatterjee, A. (Principal Investigator)

1997-01-01

Small mutations, megabase deletions, and aneuploidy are involved in carcinogenesis and genetic defects, so it is important to be able to quantify these mutations and understand mechanisms of their creation. We have previously quantified a spectrum of mutations, including megabase deletions, in human chromosome 11, the sole human chromosome in a hamster-human hybrid cell line AL. S1- mutants have lost expression of a human cell surface antigen, S1, which is encoded by the M1C1 gene at 11p13 so that mutants can be detected via a complement-mediated cytotoxicity assay in which S1+ cells are killed and S1- cells survive. But loss of genes located on the tip of the short arm of 11 (11p15.5) is lethal to the AL hybrid, so that mutants that have lost the entire chromosome 11 die and escape detection. To circumvent this, we fused AL with Chinese hamster ovary (CHO) cells to produce a new hybrid, ALC, in which the requirement for maintaining 11p15.5 is relieved, allowing us to detect mutations events involving loss of 11p15.5. We evaluated the usefulness of this hybrid by conducting mutagenesis studies with colcemid, 137Cs gamma-radiation and UV 254 nm light. Colcemid induced 1000 more S1- mutants per unit dose in ALC than in AL; the increase for UV 254 nm light was only two-fold; and the increase for 137Cs gamma-rays was 12-fold. The increase in S1- mutant fraction in ALC cells treated with colcemid and 137Cs gamma-rays were largely due to chromosome loss and 11p deletions often containing a breakpoint within the centromeric region.

Chromosome Conformation of Human Fibroblasts Grown in 3-Dimensional Spheroids

PubMed Central

Chen, Haiming; Comment, Nicholas; Chen, Jie; Ronquist, Scott; Hero, Alfred; Ried, Thomas; Rajapakse, Indika

2015-01-01

In the study of interphase chromosome organization, genome-wide chromosome conformation capture (Hi-C) maps are often generated using 2-dimensional (2D) monolayer cultures. These 2D cells have morphological deviations from cells that exist in 3-dimensional (3D) tissues in vivo, and may not maintain the same chromosome conformation. We used Hi-C maps to test the extent of differences in chromosome conformation between human fibroblasts grown in 2D cultures and those grown in 3D spheroids. Significant differences in chromosome conformation were found between 2D cells and those grown in spheroids. Intra-chromosomal interactions were generally increased in spheroid cells, with a few exceptions, while inter-chromosomal interactions were generally decreased. Overall, chromosomes located closer to the nuclear periphery had increased intra-chromosomal contacts in spheroid cells, while those located more centrally had decreased interactions. This study highlights the necessity to conduct studies on the topography of the interphase nucleus under conditions that mimic an in vivo environment. PMID:25738643

Comparative mapping of DNA markers from the familial Alzheimer disease and Down syndrome regions of human chromosome 21 to mouse chromosomes 16 and 17

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheng, S.V.; Nadeau, J.H.; Tanzi, R.E.

1988-08-01

Mouse trisomy 16 has been proposed as an animal model of Down syndrome (DS), since this chromosome contains homologues of several loci from the q22 band of human chromosome 21. The recent mapping of the defect causing familial Alzheimer disease (FAD) and the locus encoding the Alzheimer amyloid {beta} precursor protein (APP) to human chromosome 21 has prompted a more detailed examination of the extent of conservation of this linkage group between the two species. Using anonymous DNA probes and cloned genes from human chromosome 21 in a combination of recombinant inbred and interspecific mouse backcross analyses, the authors havemore » established that the linkage group shared by mouse chromosome 16 includes not only the critical DS region of human chromosome 21 but also the APP gene and FAD-linked markers. Extending from the anonymous DNA locus D21S52 to ETS2, the linkage map of six loci spans 39% recombination in man but only 6.4% recombination in the mouse. A break in synteny occurs distal to ETS2, with the homologue of the human marker D21S56 mapping to mouse chromosome 17. Conservation of the linkage relationships of markers in the FAD region suggests that the murine homologue of the FAD locus probably maps to chromosome 16 and that detailed comparison of the corresponding region in both species could facilitate identification of the primary defect in this disorder. The break in synteny between the terminal portion of human chromosome 21 and mouse chromosome 16 indicates, however, that mouse trisomy 16 may not represent a complete model of DS.« less

Refined human artificial chromosome vectors for gene therapy and animal transgenesis

PubMed Central

Kazuki, Y; Hoshiya, H; Takiguchi, M; Abe, S; Iida, Y; Osaki, M; Katoh, M; Hiratsuka, M; Shirayoshi, Y; Hiramatsu, K; Ueno, E; Kajitani, N; Yoshino, T; Kazuki, K; Ishihara, C; Takehara, S; Tsuji, S; Ejima, F; Toyoda, A; Sakaki, Y; Larionov, V; Kouprina, N; Oshimura, M

2011-01-01

Human artificial chromosomes (HACs) have several advantages as gene therapy vectors, including stable episomal maintenance, and the ability to carry large gene inserts. We previously developed HAC vectors from the normal human chromosomes using a chromosome engineering technique. However, endogenous genes were remained in these HACs, limiting their therapeutic applications. In this study, we refined a HAC vector without endogenous genes from human chromosome 21 in homologous recombination-proficient chicken DT40 cells. The HAC was physically characterized using a transformation-associated recombination (TAR) cloning strategy followed by sequencing of TAR-bacterial artificial chromosome clones. No endogenous genes were remained in the HAC. We demonstrated that any desired gene can be cloned into the HAC using the Cre-loxP system in Chinese hamster ovary cells, or a homologous recombination system in DT40 cells. The HAC can be efficiently transferred to other type of cells including mouse ES cells via microcell-mediated chromosome transfer. The transferred HAC was stably maintained in vitro and in vivo. Furthermore, tumor cells containing a HAC carrying the suicide gene, herpes simplex virus thymidine kinase (HSV-TK), were selectively killed by ganciclovir in vitro and in vivo. Thus, this novel HAC vector may be useful not only for gene and cell therapy, but also for animal transgenesis. PMID:21085194

The TP53 dependence of radiation-induced chromosome instability in human lymphoblastoid cells

NASA Technical Reports Server (NTRS)

Schwartz, Jeffrey L.; Jordan, Robert; Evans, Helen H.; Lenarczyk, Marek; Liber, Howard

2003-01-01

The dose and TP53 dependence for the induction of chromosome instability were examined in cells of three human lymphoblastoid cell lines derived from WIL2 cells: TK6, a TP53-normal cell line, NH32, a TP53-knockout created from TK6, and WTK1, a WIL2-derived cell line that spontaneously developed a TP53 mutation. Cells of each cell line were exposed to (137)Cs gamma rays, and then surviving clones were isolated and expanded in culture for approximately 35 generations before the frequency and characteristics of the instability were analyzed. The presence of dicentric chromosomes, formed by end-to-end fusions, served as a marker of chromosomal instability. Unexposed TK6 cells had low levels of chromosomal instability (0.002 +/- 0.001 dicentrics/cell). Exposure of TK6 cells to doses as low as 5 cGy gamma rays increased chromosome instability levels nearly 10-fold to 0.019 +/- 0.008 dicentrics/cell. There was no further increase in instability levels beyond 5 cGy. In contrast to TK6 cells, unexposed cultures of WTK1 and NH32 cells had much higher levels of chromosome instability of 0.034 +/- 0.007 and 0.041 +/- 0.009, respectively, but showed little if any effect of radiation on levels of chromosome instability. The results suggest that radiation exposure alters the normal TP53-dependent cell cycle checkpoint controls that recognize alterations in telomere structure and activate apoptosis.

M-BAND analysis of chromosome aberration induced by Fe-ions in human epithelial cells cultured in 3-dimensional matrices

NASA Astrophysics Data System (ADS)

Hada, Megumi; Cucinotta, Francis A.; Wu, Honglu

Energetic heavy ions pose a great health risk to astronauts in extended ISS and future lunar and Mars missions. High-LET heavy ions are particularly effective in causing various biological effects, including cell inactivation, genetic mutations, cataracts and cancer induction. Most of these biological endpoints are closely related to chromosomal damage, which can be utilized as a biomarker for radiation insults. Previously, we had studied lowand high-LET radiationinduced chromosome aberrations in human epithelial cells cultured in 2-dimension (2D) using the multicolor banding fluorescence in situ hybridization (mBAND) technique. However, it has been realized that the biological response to radiation insult in a 2D cellular environment in vitro can differ significantly from the response in 3-dimension (3D) or at the actual tissue level. In this study, we cultured human epithelial cells in 3D to provide a more suitable model for human tissue. Human mammary epithelial cells (CH184B5F5/M10) were grown in Matrigel to form 3D structures, and exposed to Fe-ions at NASA Space Radiation Laboratory (NSRL) at the Brookhaven National Laboratory or 137 Cs-gamma radiation source at the University of Texas MD Anderson Cancer Center. After exposure, cells were allowed to repair for 16hr before dissociation and subcultured at low density in 2D. G2 and metaphase chromosomes in the first cell cycle were collected using a chemical-induced premature chromosome condensation (PCC) technique, and chromosome aberrations were analyzed using mBAND technique. With this technique, individually painted chromosomal bands on one chromosome allowed the identification of interchromosomal aberrations (translocation to unpainted chromosomes) and intrachromosomal aberrations (inversions and deletions within a single painted chromosome). Our data indicate a significant difference of the chromosome aberration yield between 2D and 3D cell cultures for gamma exposures, but not for Fe ion exposures

M-BAND Analysis of Chromosome Aberration Induced by Fe-Ions in Human Epithelial Cells Cultured in 3-Dimensional Matrices

NASA Technical Reports Server (NTRS)

Hada, M.; Cucinotta, F. A.; Wu, H.

2008-01-01

Energetic heavy ions pose a great health risk to astronauts in extended ISS and future lunar and Mars missions. High-LET heavy ions are particularly effective in causing various biological effects, including cell inactivation, genetic mutations, cataracts and cancer induction. Most of these biological endpoints are closely related to chromosomal damage, which can be utilized as a biomarker for radiation insults. Previously, we had studied low- and high-LET radiation-induced chromosome aberrations in human epithelial cells cultured in 2-dimension (2D) using the multicolor banding fluorescence in situ hybridization (mBAND) technique. However, it has been realized that the biological response to radiation insult in a 2D cellular environment in vitro can differ significantly from the response in 3-dimension (3D) or at the actual tissue level. In this study, we cultured human epithelial cells in 3D to provide a more suitable model for human tissue. Human mammary epithelia cells (CH184B5F5/M10) were grown in Matrigel to form 3D structures, and exposed to Fe-ions at NASA Space Radiation Laboratory (NSRL) at the Brookhaven National Laboratory or 137Cs-gamma radiation source at the University of Texas MD Anderson Cancer Center. After exposure, cells were allowed to repair for 16hr before dissociation and subcultued at low density in 2D. G2 and metaphase chromosomes in the first cell cycle were collected using a chemical-induced premature chromosome condensation (PCC) technique, and chromosome aberrations were analyzed using mBAND technique. With this technique, individually painted chromosomal bands on one chromosome allowed the identification of interchromosomal aberrations (translocation to unpainted chromosomes) and intrachromosomal aberrations (inversions and deletions within a single painted chromosome). Our data indicate a significant difference of the chromosome aberration yield between 2D and 3D cell cultures for gamma exposures, but not for Fe ion exposures

Chromosomal Rearrangements as Barriers to Genetic Homogenization between Archaic and Modern Humans

PubMed Central

Rogers, Rebekah L.

2015-01-01

Chromosomal rearrangements, which shuffle DNA throughout the genome, are an important source of divergence across taxa. Using a paired-end read approach with Illumina sequence data for archaic humans, I identify changes in genome structure that occurred recently in human evolution. Hundreds of rearrangements indicate genomic trafficking between the sex chromosomes and autosomes, raising the possibility of sex-specific changes. Additionally, genes adjacent to genome structure changes in Neanderthals are associated with testis-specific expression, consistent with evolutionary theory that new genes commonly form with expression in the testes. I identify one case of new-gene creation through transposition from the Y chromosome to chromosome 10 that combines the 5′-end of the testis-specific gene Fank1 with previously untranscribed sequence. This new transcript experienced copy number expansion in archaic genomes, indicating rapid genomic change. Among rearrangements identified in Neanderthals, 13% are transposition of selfish genetic elements, whereas 32% appear to be ectopic exchange between repeats. In Denisovan, the pattern is similar but numbers are significantly higher with 18% of rearrangements reflecting transposition and 40% ectopic exchange between distantly related repeats. There is an excess of divergent rearrangements relative to polymorphism in Denisovan, which might result from nonuniform rates of mutation, possibly reflecting a burst of transposable element activity in the lineage that led to Denisovan. Finally, loci containing genome structure changes show diminished rates of introgression from Neanderthals into modern humans, consistent with the hypothesis that rearrangements serve as barriers to gene flow during hybridization. Together, these results suggest that this previously unidentified source of genomic variation has important biological consequences in human evolution. PMID:26399483

Sex chromosomes: platypus genome suggests a recent origin for the human X.

PubMed

Ellegren, Hans

2008-07-08

The unusual sex chromosomes of platypus are not homologous to the human X and Y chromosomes, implying that the sex chromosomes of placental mammals evolved after the monotreme and placental mammal lineages split about 165 million years ago.

Mapping the stability of human brain asymmetry across five sex-chromosome aneuploidies.

PubMed

Lin, Amy; Clasen, Liv; Lee, Nancy Raitano; Wallace, Gregory L; Lalonde, Francois; Blumenthal, Jonathan; Giedd, Jay N; Raznahan, Armin

2015-01-07

The human brain displays stereotyped and early emerging patterns of cortical asymmetry in health. It is unclear if these asymmetries are highly sensitive to genetic and environmental variation or fundamental features of the brain that can survive severe developmental perturbations. To address this question, we mapped cortical thickness (CT) asymmetry in a group of genetically defined disorders known to impact CT development. Participants included 137 youth with one of five sex-chromosome aneuploidies [SCAs; XXX (n = 28), XXY (n = 58), XYY (n = 26), XXYY (n = 20), and XXXXY (n = 5)], and 169 age-matched typically developing controls (80 female). In controls, we replicated previously reported rightward inferior frontal and leftward lateral parietal CT asymmetry. These opposing frontoparietal CT asymmetries were broadly preserved in all five SCA groups. However, we also detected foci of shifting CT asymmetry with aneuploidy, which fell almost exclusively within regions of significant CT asymmetry in controls. Specifically, X-chromosome aneuploidy accentuated normative rightward inferior frontal asymmetries, while Y-chromosome aneuploidy reversed normative rightward medial prefrontal and lateral temporal asymmetries. These findings indicate that (1) the stereotyped normative pattern of opposing frontoparietal CT asymmetry arises from developmental mechanisms that can withstand gross chromosomal aneuploidy and (2) X and Y chromosomes can exert focal, nonoverlapping and directionally opposed influences on CT asymmetry within cortical regions of significant asymmetry in health. Our study attests to the resilience of developmental mechanisms that support the global patterning of CT asymmetry in humans, and motivates future research into the molecular bases and functional consequences of sex chromosome dosage effects on CT asymmetry. Copyright © 2015 the authors 0270-6474/15/350140-06$15.00/0.

Polymorphism in and localization of the gene LCP2 (SLP-76) to chromosome 5q33.1-qter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sunden, S.L.F.; Carr, L.L.; Clements, J.L.

This report describes the localization of the human LCP2 gene to human chromosome 5q33.1-qter using single-stranded conformation polymorphisms analysis. This gene encodes an SH2 domain containing leukocyte protein of 76 kDa (SLP-76), which plays a functional role in T-cell activation. It remains to be determined whether mutations in this gene or translocations at this chromosome location are the genetic basis for various diseases, including lymphoblastic leukemia. 12 refs., 1 fig.

First Pass Annotation of Promoters on Human Chromosome 22

PubMed Central

Scherf, Matthias; Klingenhoff, Andreas; Frech, Kornelie; Quandt, Kerstin; Schneider, Ralf; Grote, Korbinian; Frisch, Matthias; Gailus-Durner, Valérie; Seidel, Alexander; Brack-Werner, Ruth; Werner, Thomas

2001-01-01

The publication of the first almost complete sequence of a human chromosome (chromosome 22) is a major milestone in human genomics. Together with the sequence, an excellent annotation of genes was published which certainly will serve as an information resource for numerous future projects. We noted that the annotation did not cover regulatory regions; in particular, no promoter annotation has been provided. Here we present an analysis of the complete published chromosome 22 sequence for promoters. A recent breakthrough in specific in silico prediction of promoter regions enabled us to attempt large-scale prediction of promoter regions on chromosome 22. Scanning of sequence databases revealed only 20 experimentally verified promoters, of which 10 were correctly predicted by our approach. Nearly 40% of our 465 predicted promoter regions are supported by the currently available gene annotation. Promoter finding also provides a biologically meaningful method for “chromosomal scaffolding”, by which long genomic sequences can be divided into segments starting with a gene. As one example, the combination of promoter region prediction with exon/intron structure predictions greatly enhances the specificity of de novo gene finding. The present study demonstrates that it is possible to identify promoters in silico on the chromosomal level with sufficient reliability for experimental planning and indicates that a wealth of information about regulatory regions can be extracted from current large-scale (megabase) sequencing projects. Results are available on-line at http://genomatix.gsf.de/chr22/. PMID:11230158

Hexavalent chromium induces chromosome instability in human urothelial cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wise, Sandra S.; Holmes, Amie L.; Department of Radiation Oncology, Dana Farber Cancer Institute, 450 Brookline Ave., Boston, MA 02215

Numerous metals are well-known human bladder carcinogens. Despite the significant occupational and public health concern of metals and bladder cancer, the carcinogenic mechanisms remain largely unknown. Chromium, in particular, is a metal of concern as incidences of bladder cancer have been found elevated in chromate workers, and there is an increasing concern for patients with metal hip implants. However, the impact of hexavalent chromium (Cr(VI)) on bladder cells has not been studied. We compared chromate toxicity in two bladder cell lines; primary human urothelial cells and hTERT-immortalized human urothelial cells. Cr(VI) induced a concentration- and time-dependent increase in chromosome damagemore » in both cell lines, with the hTERT-immortalized cells exhibiting more chromosome damage than the primary cells. Chronic exposure to Cr(VI) also induced a concentration-dependent increase in aneuploid metaphases in both cell lines which was not observed after a 24 h exposure. Aneuploidy induction was higher in the hTERT-immortalized cells. When we correct for uptake, Cr(VI) induces a similar amount of chromosome damage and aneuploidy suggesting that the differences in Cr(VI) sensitivity between the two cells lines were due to differences in uptake. The increase in chromosome instability after chronic chromate treatment suggests this may be a mechanism for chromate-induced bladder cancer, specifically, and may be a mechanism for metal-induced bladder cancer, in general. - Highlights: • Hexavalent chromium is genotoxic to human urothelial cells. • Hexavalent chromium induces aneuploidy in human urothelial cells. • hTERT-immortalized human urothelial cells model the effects seen in primary urothelial cells. • Hexavalent chromium has a strong likelihood of being carcinogenic for bladder tissue.« less

X Chromosome of female cells shows dynamic changes in status during human somatic cell reprogramming.

PubMed

Kim, Kun-Yong; Hysolli, Eriona; Tanaka, Yoshiaki; Wang, Brandon; Jung, Yong-Wook; Pan, Xinghua; Weissman, Sherman Morton; Park, In-Hyun

2014-06-03

Induced pluripotent stem cells (iPSCs) acquire embryonic stem cell (ESC)-like epigenetic states, including the X chromosome. Previous studies reported that human iPSCs retain the inactive X chromosome of parental cells, or acquire two active X chromosomes through reprogramming. Most studies investigated the X chromosome states in established human iPSC clones after completion of reprogramming. Thus, it is still not fully understood when and how the X chromosome reactivation occurs during reprogramming. Here, we report a dynamic change in the X chromosome state throughout reprogramming, with an initial robust reactivation of the inactive X chromosome followed by an inactivation upon generation of nascent iPSC clones. iPSCs with two active X chromosomes or an eroded X chromosome arise in passaging iPSCs. These data provide important insights into the plasticity of the X chromosome of human female iPSCs and will be crucial for the future application of such cells in cell therapy and X-linked disease modeling.

Induction of chromosome aberrations and mitotic arrest by cytomegalovirus in human cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

AbuBakar, S.; Au, W.W.; Legator, M.S.

1988-01-01

Human cytomegalovirus (CMV) is potentially an effective but often overlooked genotoxic agent in humans. We report here evidence that indicates that infection by CMV can induce chromosome alterations and mitotic inhibition. The frequency of chromosome aberrations induced was dependent on the input multiplicity of infection (m.o.i.) for human lung fibroblasts (LU), but not for human peripheral blood lymphocytes (PBLs) when both cell types were infected at the GO phase of the cell cycle. The aberrations induced by CMV were mostly chromatid breaks and chromosome pulverizations that resembled prematurely condensed S-phase chromatin. Pulverized chromosomes were not observed in LU cells infectedmore » with virus stocks that had been rendered nonlytic by UV-irradiation at 24,000 ergs/mm2 or from infection of human lymphocytes. In LU cells infected with UV-irradiated CMV, the frequency of aberrations induced was inversely dependent on the extent of the exposure of the CMV stock to the UV-light. In permissive CMV infection of proliferating LU cells at 24 hr after subculture, a high percentage (greater than 40%) of the metaphase cells were arrested at their first metaphase and displayed severely condensed chromosomes when harvested 48 hr later. A significant increase (p less than 0.05) in the chromosome aberration frequency was also observed. Our study shows that CMV infection is genotoxic to host cells. The types and extent of damage are dependent on the viral genome expression and on the cell cycle stage of the cells at the time of infection. The possible mechanisms for induction of chromosome damage by CMV are discussed.« less

Combinations of chromosome transfer and genome editing for the development of cell/animal models of human disease and humanized animal models.

PubMed

Uno, Narumi; Abe, Satoshi; Oshimura, Mitsuo; Kazuki, Yasuhiro

2018-02-01

Chromosome transfer technology, including chromosome modification, enables the introduction of Mb-sized or multiple genes to desired cells or animals. This technology has allowed innovative developments to be made for models of human disease and humanized animals, including Down syndrome model mice and humanized transchromosomic (Tc) immunoglobulin mice. Genome editing techniques are developing rapidly, and permit modifications such as gene knockout and knockin to be performed in various cell lines and animals. This review summarizes chromosome transfer-related technologies and the combined technologies of chromosome transfer and genome editing mainly for the production of cell/animal models of human disease and humanized animal models. Specifically, these include: (1) chromosome modification with genome editing in Chinese hamster ovary cells and mouse A9 cells for efficient transfer to desired cell types; (2) single-nucleotide polymorphism modification in humanized Tc mice with genome editing; and (3) generation of a disease model of Down syndrome-associated hematopoiesis abnormalities by the transfer of human chromosome 21 to normal human embryonic stem cells and the induction of mutation(s) in the endogenous gene(s) with genome editing. These combinations of chromosome transfer and genome editing open up new avenues for drug development and therapy as well as for basic research.

Hexavalent Chromium Induces Chromosome Instability in Human Urothelial Cells

PubMed Central

Wise, Sandra S.; Holmes, Amie L.; Liou, Louis; Adam, Rosalyn M.; Wise, John Pierce

2016-01-01

Numerous metals are well-known human bladder carcinogens. Despite the significant occupational and public health concern of metals and bladder cancer, the carcinogenic mechanisms remain largely unknown. Chromium, in particular, is a metal of concern as incidences of bladder cancer have been found elevated in chromate workers, and there is an increasing concern for patients with metal hip implants. However, the impact of Cr(VI) on bladder cells has not been studied. We compared chromate toxicity in two bladder cell lines; primary human urothelial cells and hTERT-immortalized human urothelial cells. Hexavalent chromium (Cr(VI)) induced a concentration- and time-dependent increase in chromosome damage in both cell lines, with the hTERT-immortalized cells exhibiting more chromosome damage than the primary cells. Chronic exposure to Cr(VI) also induced a concentration-dependent increase in aneuploid metaphases in both cell lines which was not observed after a 24 h exposure. Aneuploidy induction was higher in the hTERT-immortalized cells. When we correct for uptake, Cr(VI) induces a similar amount of chromosome damage and aneuploidy suggesting that the differences in Cr(VI) sensitivity between the two cells lines were due to differences in uptake. The increase in chromosome instability after chronic chromate treatment suggests this may be a mechanism for chromate-induced bladder cancer specifically and may be a mechanism for metal-induced bladder cancer in general. PMID:26908176

The chorionic gonadotropin alpha-subunit gene is on human chromosome 18 in JEG cells.

PubMed Central

Hardin, J W; Riser, M E; Trent, J M; Kohler, P O

1983-01-01

The gene for the alpha subunit of human chorionic gonadotropin (hCG) has been tentatively assigned to human chromosome 18. This localization was accomplished through the use of Southern blot analysis. A full-length cDNA probe for the hCG alpha subunit and DNA isolated from a series of somatic hybrids between mouse and human cells were utilized to make this assignment. In addition, in situ hybridization with normal human peripheral blood lymphocytes as a source of human chromosomes and with the same cDNA probe confirmed this result. The presence of human chromosome 18 was required for the detection of DNA fragments characteristic of the alpha-hCG gene. These results are consistent with our previous observation that human chromosomes 10 and 18 are required for the production of hCG in cultured cells. Images PMID:6578509

Chromosome segregation regulation in human zygotes: altered mitotic histone phosphorylation dynamics underlying centromeric targeting of the chromosomal passenger complex.

PubMed

van de Werken, C; Avo Santos, M; Laven, J S E; Eleveld, C; Fauser, B C J M; Lens, S M A; Baart, E B

2015-10-01

Are the kinase feedback loops that regulate activation and centromeric targeting of the chromosomal passenger complex (CPC), functional during mitosis in human embryos? Investigation of the regulatory kinase pathways involved in centromeric CPC targeting revealed normal phosphorylation dynamics of histone H2A at T120 (H2ApT120) by Bub1 kinase and subsequent recruitment of Shugoshin, but phosphorylation of histone H3 at threonine 3 (H3pT3) by Haspin failed to show the expected centromeric enrichment on metaphase chromosomes in the zygote. Human cleavage stage embryos show high levels of chromosomal instability. What causes this high error rate is unknown, as mechanisms used to ensure proper chromosome segregation in mammalian embryos are poorly described. In this study, we investigated the pathways regulating CPC targeting to the inner centromere in human embryos. We characterized the distribution of the CPC in relation to activity of its two main centromeric targeting pathways: the Bub1-H2ApT120-Sgo-CPC and Haspin-H3pT3-CPC pathways. The study was conducted between May 2012 and March 2014 on human surplus embryos resulting from in vitro fertilization treatment and donated for research. In zygotes, nuclear envelope breakdown was monitored by time-lapse imaging to allow timed incubations with specific inhibitors to arrest at prometaphase and metaphase, and to interfere with Haspin and Aurora B/C kinase activity. Functionality of the targeting pathways was assessed through characterization of histone phosphorylation dynamics by immunofluorescent analysis, combined with gene expression by RT-qPCR and immunofluorescent localization of key pathway proteins. Immunofluorescent analysis of the CPC subunit Inner Centromere Protein revealed the pool of stably bound CPC proteins was not strictly confined to the inner centromere of prometaphase chromosomes in human zygotes, as observed in later stages of preimplantation development and somatic cells. Investigation of the

Flow analysis of human chromosome sets by means of mixing-stirring device

NASA Astrophysics Data System (ADS)

Zenin, Valeri V.; Aksenov, Nicolay D.; Shatrova, Alla N.; Klopov, Nicolay V.; Cram, L. Scott; Poletaev, Andrey I.

1997-05-01

A new mixing and stirring device (MSD) was used to perform flow karyotype analysis of single human mitotic chromosomes analyzed so as to maintain the identity of chromosomes derived from the same cell. An improved method for cell preparation and intracellular staining of chromosomes was developed. The method includes enzyme treatment, incubation with saponin and separation of prestained cells from debris on a sucrose gradient. Mitotic cells are injected one by one in the MSD which is located inside the flow chamber where cells are ruptured, thereby releasing chromosomes. The set of chromosomes proceeds to flow in single file fashion to the point of analysis. The device works in a stepwise manner. The concentration of cells in the sample must be kept low to ensure that only one cell at a time enters the breaking chamber. Time-gated accumulation of data in listmode files makes it possible to separate chromosome sets comprising of single cells. The software that was developed classifies chromosome sets according to different criteria: total number of chromosomes, overall DNA content in the set, and the number of chromosomes of certain types. This approach combines the high performance of flow cytometry with the advantages of image analysis. Examples obtained with different human cell lines are presented.

Coincidence of synteny breakpoints with malignancy-related deletions on human chromosome 3

PubMed Central

Kost-Alimova, Maria; Kiss, Hajnalka; Fedorova, Ludmila; Yang, Ying; Dumanski, Jan P.; Klein, George; Imreh, Stefan

2003-01-01

We have found previously that during tumor growth intact human chromosome 3 transferred into tumor cells regularly looses certain 3p regions, among them the ≈1.4-Mb common eliminated region 1 (CER1) at 3p21.3. Fluorescence in situ hybridization analysis of 12 mouse orthologous loci revealed that CER1 splits into two segments in mouse and therefore contains a murine/human conservation breakpoint region (CBR). Several breaks occurred in tumors within the region surrounding the CBR, and this sequence has features that characterize unstable chromosomal regions: deletions in yeast artificial chromosome clones, late replication, gene and segment duplications, and pseudogene insertions. Sequence analysis of the entire 3p12-22 revealed that other cancer-associated deletions (regions eliminated from monochromosomal hybrids carrying an intact chromosome 3 during tumor growth and homozygous deletions found in human tumors) colocalized nonrandomly with murine/human CBRs and were characterized by an increased number of local gene duplications and murine/human conservation mismatches (single genes that do not match into the conserved chromosomal segment). The CBR within CER1 contains a simple tandem TATAGA repeat capable of forming a 40-bp-long secondary hairpin-like structure. This repeat is nonrandomly localized within the other tumor-associated deletions and in the vicinity of 3p12-22 CBRs. PMID:12738884

Human sperm sex chromosome disomy and sperm DNA damage assessed by the neutral comet assay.

PubMed

McAuliffe, M E; Williams, P L; Korrick, S A; Dadd, R; Marchetti, F; Martenies, S E; Perry, M J

2014-10-10

Is there an association between human sperm sex chromosome disomy and sperm DNA damage? An increase in human sperm XY disomy was associated with higher comet extent; however, there was no other consistent association of sex chromosome disomies with DNA damage. There is limited published research on the association between sex chromosome disomy and sperm DNA damage and the findings are not consistent across studies. We conducted a cross-sectional study of 190 men (25% ever smoker, 75% never smoker) from subfertile couples presenting at the Massachusetts General Hospital Fertility Clinic from January 2000 to May 2003. Multiprobe fluorescence in situ hybridization for chromosomes X, Y and 18 was used to determine XX, YY, XY and total sex chromosome disomy in sperm nuclei using an automated scoring method. The neutral comet assay was used to measure sperm DNA damage, as reflected by comet extent, percentage DNA in the comet tail, and tail distributed moment. Univariate and multiple linear regression models were constructed with sex chromosome disomy (separate models for each of the four disomic conditions) as the independent variable, and DNA damage parameters (separate models for each measure of DNA damage) as the dependent variable. Men with current or past smoking history had significantly greater comet extent (µm: regression coefficients with 95% CI) [XX18: 15.17 (1.98, 28.36); YY18: 14.68 (1.50, 27.86); XY18: 15.41 (2.37, 28.45); Total Sex Chromosome Disomy: 15.23 (2.09, 28.38)], and tail distributed moment [XX18: 3.01 (0.30, 5.72); YY18: 2.95 (0.24, 5.67); XY18: 3.04 (0.36, 5.72); Total Sex Chromosome Disomy: 3.10 (0.31, 5.71)] than men who had never smoked. In regression models adjusted for age and smoking, there was a positive association between XY disomy and comet extent. For an increase in XY disomy from 0.56 to 1.47% (representing the 25th to 75th percentile), there was a mean increase of 5.08 µm in comet extent. No other statistically significant

Human Artificial Chromosomes with Alpha Satellite-Based De Novo Centromeres Show Increased Frequency of Nondisjunction and Anaphase Lag

PubMed Central

Rudd, M. Katharine; Mays, Robert W.; Schwartz, Stuart; Willard, Huntington F.

2003-01-01

Human artificial chromosomes have been used to model requirements for human chromosome segregation and to explore the nature of sequences competent for centromere function. Normal human centromeres require specialized chromatin that consists of alpha satellite DNA complexed with epigenetically modified histones and centromere-specific proteins. While several types of alpha satellite DNA have been used to assemble de novo centromeres in artificial chromosome assays, the extent to which they fully recapitulate normal centromere function has not been explored. Here, we have used two kinds of alpha satellite DNA, DXZ1 (from the X chromosome) and D17Z1 (from chromosome 17), to generate human artificial chromosomes. Although artificial chromosomes are mitotically stable over many months in culture, when we examined their segregation in individual cell divisions using an anaphase assay, artificial chromosomes exhibited more segregation errors than natural human chromosomes (P < 0.001). Naturally occurring, but abnormal small ring chromosomes derived from chromosome 17 and the X chromosome also missegregate more than normal chromosomes, implicating overall chromosome size and/or structure in the fidelity of chromosome segregation. As different artificial chromosomes missegregate over a fivefold range, the data suggest that variable centromeric DNA content and/or epigenetic assembly can influence the mitotic behavior of artificial chromosomes. PMID:14560014

Human artificial chromosomes with alpha satellite-based de novo centromeres show increased frequency of nondisjunction and anaphase lag.

PubMed

Rudd, M Katharine; Mays, Robert W; Schwartz, Stuart; Willard, Huntington F

2003-11-01

Human artificial chromosomes have been used to model requirements for human chromosome segregation and to explore the nature of sequences competent for centromere function. Normal human centromeres require specialized chromatin that consists of alpha satellite DNA complexed with epigenetically modified histones and centromere-specific proteins. While several types of alpha satellite DNA have been used to assemble de novo centromeres in artificial chromosome assays, the extent to which they fully recapitulate normal centromere function has not been explored. Here, we have used two kinds of alpha satellite DNA, DXZ1 (from the X chromosome) and D17Z1 (from chromosome 17), to generate human artificial chromosomes. Although artificial chromosomes are mitotically stable over many months in culture, when we examined their segregation in individual cell divisions using an anaphase assay, artificial chromosomes exhibited more segregation errors than natural human chromosomes (P < 0.001). Naturally occurring, but abnormal small ring chromosomes derived from chromosome 17 and the X chromosome also missegregate more than normal chromosomes, implicating overall chromosome size and/or structure in the fidelity of chromosome segregation. As different artificial chromosomes missegregate over a fivefold range, the data suggest that variable centromeric DNA content and/or epigenetic assembly can influence the mitotic behavior of artificial chromosomes.

Convergent evolution of chicken Z and human X chromosomes by expansion and gene acquisition.

PubMed

Bellott, Daniel W; Skaletsky, Helen; Pyntikova, Tatyana; Mardis, Elaine R; Graves, Tina; Kremitzki, Colin; Brown, Laura G; Rozen, Steve; Warren, Wesley C; Wilson, Richard K; Page, David C

2010-07-29

In birds, as in mammals, one pair of chromosomes differs between the sexes. In birds, males are ZZ and females ZW. In mammals, males are XY and females XX. Like the mammalian XY pair, the avian ZW pair is believed to have evolved from autosomes, with most change occurring in the chromosomes found in only one sex--the W and Y chromosomes. By contrast, the sex chromosomes found in both sexes--the Z and X chromosomes--are assumed to have diverged little from their autosomal progenitors. Here we report findings that challenge this assumption for both the chicken Z chromosome and the human X chromosome. The chicken Z chromosome, which we sequenced essentially to completion, is less gene-dense than chicken autosomes but contains a massive tandem array containing hundreds of duplicated genes expressed in testes. A comprehensive comparison of the chicken Z chromosome with the finished sequence of the human X chromosome demonstrates that each evolved independently from different portions of the ancestral genome. Despite this independence, the chicken Z and human X chromosomes share features that distinguish them from autosomes: the acquisition and amplification of testis-expressed genes, and a low gene density resulting from an expansion of intergenic regions. These features were not present on the autosomes from which the Z and X chromosomes originated but were instead acquired during the evolution of Z and X as sex chromosomes. We conclude that the avian Z and mammalian X chromosomes followed convergent evolutionary trajectories, despite their evolving with opposite (female versus male) systems of heterogamety. More broadly, in birds and mammals, sex chromosome evolution involved not only gene loss in sex-specific chromosomes, but also marked expansion and gene acquisition in sex chromosomes common to males and females.

Stability of Radiation Induced Chromosome Damage in Human Peripheral Blood Lymphocytes

NASA Technical Reports Server (NTRS)

Cucinotta, F. A.; George, K.; Willingham, V.

2006-01-01

Chromosome damage in an individual's peripheral blood lymphocytes can be an indicator of radiation exposure and this data can be used to evaluate dose after accidental or occupational exposure. Evidence suggests that the yield of chromosome damage in lymphocytes is also a relevant biomarker of cancer risk in humans that reflects individual cancer susceptibility. It follows that biomonitoring studies can be used to uncover subjects who are particularly susceptible to radiation damage and therefore at higher risk of cancer. Translocations and other stable aberrations are commonly believed to persist in peripheral blood cells for many years after exposure, and it has been suggested that translocations can be used for assessing retrospective radiation doses or chronic exposures. However, recent investigations suggest that translocations might not always persist indefinitely. We measured chromosome aberrations in the blood lymphocytes of six astronauts before their respective missions of approximately 3 to 6 months onboard the international space station, and again at various intervals up to 5 years after flight. In samples collected a few days after return to earth, the yield of chromosome translocations had significantly increased compared with preflight values, and results indicate that biodosimetry estimates lie within the range expected from physical dosimetry. However, for five of the astronauts, follow up analysis revealed a temporal decline in translocations with half-lives ranging from 10 to 58 months. The yield of exchanges remained unchanged for the sixth astronaut during an observation period of 5 months post-flight. These results may indicate complications with the use of stable aberrations for retrospective dose reconstruction and could affect cancer risk predictions that are estimated from yields of chromosome damage obtained shortly after exposure.

Systems-level chromosomal parameters represent a suprachromosomal basis for the non-random chromosomal arrangement in human interphase nuclei

PubMed Central

Fatakia, Sarosh N.; Mehta, Ishita S.; Rao, Basuthkar J.

2016-01-01

Forty-six chromosome territories (CTs) are positioned uniquely in human interphase nuclei, wherein each of their positions can range from the centre of the nucleus to its periphery. A non-empirical basis for their non-random arrangement remains unreported. Here, we derive a suprachromosomal basis of that overall arrangement (which we refer to as a CT constellation), and report a hierarchical nature of the same. Using matrix algebra, we unify intrinsic chromosomal parameters (e.g., chromosomal length, gene density, the number of genes per chromosome), to derive an extrinsic effective gene density matrix, the hierarchy of which is dominated largely by extrinsic mathematical coupling of HSA19, followed by HSA17 (human chromosome 19 and 17, both preferentially interior CTs) with all CTs. We corroborate predicted constellations and effective gene density hierarchy with published reports from fluorescent in situ hybridization based microscopy and Hi-C techniques, and delineate analogous hierarchy in disparate vertebrates. Our theory accurately predicts CTs localised to the nuclear interior, which interestingly share conserved synteny with HSA19 and/or HSA17. Finally, the effective gene density hierarchy dictates how permutations among CT position represents the plasticity within its constellations, based on which we suggest that a differential mix of coding with noncoding genome modulates the same. PMID:27845379

Assessment of aneuploidy in human oocytes and preimplantation embryos by chromosome painting

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rougier, N.; Viegas-Pequignot, E.; Plachot, M.

1994-09-01

The poor quality of chromosome preparations often observed after fixation of oocytes and embryos did not usually allow accurate identification of chromosomes involved in non-disjunctions. We, therefore, used chromosome painting to determine the incidence of abnormalities for chromosomes 1 and 7. A total of 50 oocytes inseminated for IVF and showing no signs of fertilization as well as 37 diploid embryos donated for research were fixed according to the Dyban`s technique. Fluorescence in situ hybridization was carried out using whole chromosome painting DNA probes specific for human chromosome 1 and 7. The incidence of aneuploidy was 28%, 10% and 60%more » for metaphase II, polar body and sperm chromosomes, respectively. The high incidence of aneuploidy observed in sperm prematurely condensed sperm chromosomes is due to the fact that usually far less than 23 sperm chromatids are observed, maybe as a consequence of incomplete chromosome condensation. Thirty seven embryos were analyzed with the same probes. 48% of early embryos were either monosomic 1 or 7 or mosaics comprising blastomeres with 1, 2 or 3 signals. Thus, 8 among the 11 abnormal embryos had hypodiploid cells (25 to 37 chromosomes) indicating either an artefactual loss of chromosomes or a complex anomaly of nuclear division (maltinucleated blastomeres, abnormal migration of chromosomes at anaphase). We therefore calculated a {open_quotes}corrected{close_quotes} incidence of aneuploidy for chromosomes 1 or 7 in early embryos: 18%. 86% of the blastocysts showed mosaicism 2n/3 or 4n as a consequence of the formation of the syncitiotrophoblast. To conclude, chromosome painting is an efficient method to accurately identify chromosomes involved in aneuploidy. This technique should allow us to evaluate the incidence of non-disjunction for all chromosome pairs. Our results confirm the high incidence of chromosome abnormalities occurring as a consequence of meiotic or mitotic non-disjunctions in human oocytes and

Human structural variation: mechanisms of chromosome rearrangements

PubMed Central

Weckselblatt, Brooke; Rudd, M. Katharine

2015-01-01

Chromosome structural variation (SV) is a normal part of variation in the human genome, but some classes of SV can cause neurodevelopmental disorders. Analysis of the DNA sequence at SV breakpoints can reveal mutational mechanisms and risk factors for chromosome rearrangement. Large-scale SV breakpoint studies have become possible recently owing to advances in next-generation sequencing (NGS) including whole-genome sequencing (WGS). These findings have shed light on complex forms of SV such as triplications, inverted duplications, insertional translocations, and chromothripsis. Sequence-level breakpoint data resolve SV structure and determine how genes are disrupted, fused, and/or misregulated by breakpoints. Recent improvements in breakpoint sequencing have also revealed non-allelic homologous recombination (NAHR) between paralogous long interspersed nuclear element (LINE) or human endogenous retrovirus (HERV) repeats as a cause of deletions, duplications, and translocations. This review covers the genomic organization of simple and complex constitutional SVs, as well as the molecular mechanisms of their formation. PMID:26209074

Relationships between chromosome structure and chromosomal aberrations

NASA Astrophysics Data System (ADS)

Eidelman, Yuri; Andreev, Sergey

An interphase nucleus of human lymphocyte was simulated by the novel Monte Carlo tech-nique. The main features of interphase chromosome structure and packaging were taken into account: different levels of chromatin organisation; nonrandom localisation of chromosomes within a nucleus; chromosome loci dynamics. All chromosomes in a nucleus were modelled as polymer globules. A dynamic pattern of intra/interchromosomal contacts was simulated. The detailed information about chromosomal contacts, such as distribution of intrachromoso-mal contacts over the length of each chromosome and dependence of contact probability on genomic separation between chromosome loci, were calculated and compared to the new exper-imental data obtained by the Hi-C technique. Types and frequencies of simple and complex radiation-induced chromosomal exchange aberrations (CA) induced by X-rays were predicted with taking formation and decay of chromosomal contacts into account. Distance dependence of exchange formation probability was calculated directly. mFISH data for human lymphocytes were analysed. The calculated frequencies of simple CA agreed with the experimental data. Complex CA were underestimated despite the dense packaging of chromosome territories within a nucleus. Possible influence of chromosome-nucleus structural organisation on the frequency and spectrum of radiation-induced chromosome aberrations is discussed.

Chromosome Aberration in Human Blood Lymphocytes Exposed to Energetic Protons

NASA Technical Reports Server (NTRS)

Hada, M.; George, Kerry A.; Cucinotta, F. A.

2008-01-01

During space flight, astronauts are exposed to a space radiation consisting of high-energy protons, high charge and energy (HZE) nuclei, as well as secondary particles that are generated when the primary particles penetrate the spacecraft shielding. Secondary particles have a higher LET value than primary protons and therefore expected to have a higher relative biological effectiveness (RBE). To investigate this theory, we exposed human peripheral blood lymphocytes to protons with energies of 250 MeV, 800MeV, 2 GeV, or 2.5 GeV. LET values for these protons ranged from 0.4 to 0.2 keV/micrometer. and doses ranged from 0.2 to 3 Gy. Over this energy the probability of nuclear reaction leading to secondary radiation, and the multiplicity of reaction produces such as neutrons and mesons increases substantially. The effect of aluminum and polyethylene shielding was also assessed using the 2 GeV and 2.5GeV proton beams. After exposure lymphocytes were stimulated to divide and chromosomes were collected from cells in the first G2 and metaphase cell cycle after exposure using a chemical induced premature chromosome condensation (PCC) technique. Dose response data for chromosome damage was analyzed using the fluorescence in situ hybridization (FISH) chromosome painting technique. Selected samples were also analyzed with multicolor FISH (mFISH) and multicolor banding FISH (mBAND) techniques. Data indicates that the dose response for simple-type exchanges is similar for proton and gamma exposure, whereas protons induce higher yields of complex exchanges that are LET dependent. RBE values will be presented for each proton energy, and the effects of shielding and possible cytogenetic signatures of proton exposure will be discussed.

Correlation of physical and genetic maps of human chromosome 16

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sutherland, G.R.

1991-01-01

This project aimed to divide chromosome 16 into approximately 50 intervals of {approximately}2Mb in size by constructing a series of mouse/human somatic cell hybrids each containing a rearranged chromosome 16. Using these hybrids, DNA probes would be regionally mapped by Southern blot or PCR analysis. Preference would be given to mapping probes which demonstrated polymorphisms for which the CEPH panel of families had been typed. This would allow a correlation of the physical and linkage maps of this chromosome. The aims have been substantially achieved. 49 somatic cell hybrids have been constructed which have allowed definition of 46, and potentiallymore » 57, different physical intervals on the chromosome. 164 loci have been fully mapped into these intervals. A correlation of the physical and genetic maps of the chromosome is in an advanced stage of preparation. The somatic cell hybrids constructed have been widely distributed to groups working on chromosome 16 and other genome projects.« less

Human cytomegalovirus UL76 induces chromosome aberrations

PubMed Central

2009-01-01

Background Human cytomegalovirus (HCMV) is known to induce chromosome aberrations in infected cells, which can lead to congenital abnormalities in infected fetuses. HCMV UL76 belongs to a conserved protein family from herpesviruses. Some reported roles among UL76 family members include involvement in virulence determination, lytic replication, reactivation of latent virus, modulation of gene expression, induction of apoptosis, and perturbation of cell cycle progression, as well as potential nuclease activity. Previously, we have shown that stable expression of UL76 inhibits HCMV replication in glioblastoma cells. Methods To examine chromosomal integrity and the DNA damage signal γ-H2AX in cells constitutively expressing UL76, immunofluorescent cell staining and Western blotting were performed. The comet assay was employed to assess DNA breaks in cells transiently expressing UL76. Results We report that stably transfected cells expressing UL76 developed chromosome aberrations including micronuclei and misaligned chromosomes, lagging and bridging. In mitotic cells expressing UL76, aberrant spindles were increased compared to control cells. However, cells with supernumerary centrosomes were marginally increased in UL76-expressing cells relative to control cells. We further demonstrated that UL76-expressing cells activated the DNA damage signal γ-H2AX and caused foci formation in nuclei. In addition, the number of cells with DNA breaks increased in proportion to UL76 protein levels. Conclusion Our findings suggest that the virus-associated protein UL76 induces DNA damage and the accumulation of chromosome aberrations. PMID:19930723

Comprehensive genome-wide proteomic analysis of human placental tissue for the Chromosome-Centric Human Proteome Project.

PubMed

Lee, Hyoung-Joo; Jeong, Seul-Ki; Na, Keun; Lee, Min Jung; Lee, Sun Hee; Lim, Jong-Sun; Cha, Hyun-Jeong; Cho, Jin-Young; Kwon, Ja-Young; Kim, Hoguen; Song, Si Young; Yoo, Jong Shin; Park, Young Mok; Kim, Hail; Hancock, William S; Paik, Young-Ki

2013-06-07

As a starting point of the Chromosome-Centric Human Proteome Project (C-HPP), we established strategies of genome-wide proteomic analysis, including protein identification, quantitation of disease-specific proteins, and assessment of post-translational modifications, using paired human placental tissues from healthy and preeclampsia patients. This analysis resulted in identification of 4239 unique proteins with high confidence (two or more unique peptides with a false discovery rate less than 1%), covering 21% of approximately 20, 059 (Ensembl v69, Oct 2012) human proteins, among which 28 proteins exhibited differentially expressed preeclampsia-specific proteins. When these proteins are assigned to all human chromosomes, the pattern of the newly identified placental protein population is proportional to that of the gene count distribution of each chromosome. We also identified 219 unique N-linked glycopeptides, 592 unique phosphopeptides, and 66 chromosome 13-specific proteins. In particular, protein evidence of 14 genes previously known to be specifically up-regulated in human placenta was verified by mass spectrometry. With respect to the functional implication of these proteins, 38 proteins were found to be involved in regulatory factor biosynthesis or the immune system in the placenta, but the molecular mechanism of these proteins during pregnancy warrants further investigation. As far as we know, this work produced the highest number of proteins identified in the placenta and will be useful for annotating and mapping all proteins encoded in the human genome.

Chromosomal intrachanges induced by swift iron ions

NASA Astrophysics Data System (ADS)

Horstmann, M.; Durante, M.; Johannes, C.; Obe, G.

We measured the induction of structural aberrations in human chromosome 5 induced by iron ions using the novel technique of multicolor banding in situ hybridization (mBAND). Human lymphocytes isolated from whole blood were exposed in vitro to 500 MeV/n (LET = 200 keV/μm, doses 1 or 4 Gy) Fe nuclei at the HIMAC accelerator in Chiba (Japan). Chromosomes were prematurely condensed by calyculin A after 48 h in culture and slides were painted by mBAND. We found a frequency of 0.11 and 0.57 residual breakpoints per chromosome 5 after 1 and 4 Gy Fe-ions, respectively. Inter-chromosomal exchanges were the prevalent aberration type measured at both doses, followed by terminal deletions, and by intra-chromosomal exchanges. Among intra-chromosomal exchanges, intra-arm events were more frequent than inter-arm, but a significant number of intra-changes was associated to inter-changes involving the same chromosome after 4 Gy of iron ions. These events show that the complexity of chromosomal exchanges induced by heavy ions can be higher than expected by previous FISH studies.

Labeling and Other Effects of Actinomycin D on Human Chromosomes*

PubMed Central

Miles, Charles P.

1970-01-01

3H-actinomycin D, a guanine-binding agent, labels fixed human chromosomes nonrandomly. Actinomycin D added in G2 inhibits secondary constrictions and breaks chromosomes. There is some tendency for label to be concentrated at the ends of chromosomes and near the centromere. Labeling with 3H-thymidine in the late stage of DNA synthesis shows a different pattern and in general lacks the telomeric concentrations. The sites of actinomycin D-induced breaks do not show good correspondence with the sites of actinomycin D label. Images PMID:5267140

Small Supernumerary Marker Chromosome May Provide Information on Dosage-insensitive Pericentric Regions in Human.

PubMed

Al-Rikabi, Ahmed B Hamid; Pekova, Sona; Fan, Xioabo; Jančušková, Tereza; Liehr, Thomas

2018-04-01

Cytogenetically visible chromosomal imbalances in humans are deleterious and adverse in the majority of the cases. However, healthy persons living with chromosomal imbalances in the range of several megabasepairs (Mbps) in size, like carriers of small Supernumerary Marker Chromosomes (sSMCs) exist. The identification of healthy sSMC carriers with euchromatic centromere-near (ECN) imbalances led to the following proposal: ECN-regions do not contain any dosage sensitive genes. Due to own previous work, dosage-insensitive pericentric ECN-regions were already determined with an accuracy of 0.3 and 5 Mbp. Based on this data we established 43 new pericentromeric probe sets spanning about 3-5 Mbp of each euchromatic human chromosome arm starting from the known insensitive regions towards distal. Such so called pericentromeric-critical region fluorescence in situ hybridization (PeCR-FISH) probe sets were applied exemplarily and successful here in 15 sSMC cases as available from the Else Kröner-Fresenius-sSMC-cellbank . Most of the involved sSMC breakpoints could be characterized as a higher resolution than before. An unexpected result was that in 5/15 cases cryptic mosaicism was characterized. The latter is also to be considered to have potentially an influence on the clinical outcome in these so-called discontinuous sSMCs. Overall, the suitability of PeCR-FISH to characterize sSMCs was proven; the potential of this probe set to further delineate sizes of dosage insensitive pericentric regions is obvious but dependent on suited cases. Furthermore, discontinuous sSMCs can be identified by this approach and this new subtype of sSMC needs to be studied in more detail in future.

Decoding the disease-associated proteins encoded in the human chromosome 4.

PubMed

Chen, Lien-Chin; Liu, Mei-Ying; Hsiao, Yung-Chin; Choong, Wai-Kok; Wu, Hsin-Yi; Hsu, Wen-Lian; Liao, Pao-Chi; Sung, Ting-Yi; Tsai, Shih-Feng; Yu, Jau-Song; Chen, Yu-Ju

2013-01-04

Chromosome 4 is the fourth largest chromosome, containing approximately 191 megabases (~6.4% of the human genome) with 757 protein-coding genes. A number of marker genes for many diseases have been found in this chromosome, including genetic diseases (e.g., hepatocellular carcinoma) and biomedical research (cardiac system, aging, metabolic disorders, immune system, cancer and stem cell) related genes (e.g., oncogenes, growth factors). As a pilot study for the chromosome 4-centric human proteome project (Chr 4-HPP), we present here a systematic analysis of the disease association, protein isoforms, coding single nucleotide polymorphisms of these 757 protein-coding genes and their experimental evidence at the protein level. We also describe how the findings from the chromosome 4 project might be used to drive the biomarker discovery and validation study in disease-oriented projects, using the examples of secretomic and membrane proteomic approaches in cancer research. By integrating with cancer cell secretomes and several other existing databases in the public domain, we identified 141 chromosome 4-encoded proteins as cancer cell-secretable/shedable proteins. Additionally, we also identified 54 chromosome 4-encoded proteins that have been classified as cancer-associated proteins with successful selected or multiple reaction monitoring (SRM/MRM) assays developed. From literature annotation and topology analysis, 271 proteins were recognized as membrane proteins while 27.9% of the 757 proteins do not have any experimental evidence at the protein-level. In summary, the analysis revealed that the chromosome 4 is a rich resource for cancer-associated proteins for biomarker verification projects and for drug target discovery projects.

Isolation, expression, and chromosomal localization of the human mitochondrial capsule selenoprotein gene (MCSP)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aho, Hanne; Schwemmer, M.; Tessmann, D.

1996-03-01

The mitochondrial capsule selenoprotein (MCS) (HGMW-approved symbol MCSP) is one of three proteins that are important for the maintenance and stabilization of the crescent structure of the sperm mitochondria. We describe here the isolation of a cDNA, the exon-intron organization, the expression, and the chromosomal localization of the human MCS gene. Nucleotide sequence analysis of the human and mouse MCS cDNAs reveals that the 5{prime}- and 3{prime}-untranslated sequences are more conserved (71%) than the coding sequences (59%). The open reading frame encodes a 116-amino-acid protein and lacks the UGA codons, which have been reported to encode the selenocysteines in themore » N-terminal of the deduced mouse protein. The deduced human protein shows a low degree of amino acid sequence identity to the mouse protein. The deduced human protein shows a low degree of amino acid sequence identity to the mouse protein (39%). The most striking homology lies in the dicysteine motifs. Northern and Southern zooblot analyses reveal that the MCS gene in human, baboon, and bovine is more conserved than its counterparts in mouse and rat. The single intron in the human MCS gene is approximately 6 kb and interrupts the 5{prime}-untranslated region at a position equivalent to that in the mouse and rat genes. Northern blot and in situ hybridization experiments demonstrate that the expression of the human MCS gene is restricted to haploid spermatids. The human gene was assigned to q21 of chromosome 1. 30 refs., 9 figs.« less

Cytogenetic and molecular genetic characterization of immortalized human ovarian surface epithelial cell lines: consistent loss of chromosome 13 and amplification of chromosome 20.

PubMed

Jin, Yuesheng; Zhang, Hao; Tsao, Sai Wah; Jin, Charlotte; Lv, Mei; Strömbeck, Bodil; Wiegant, Joop; Wan, Thomas Shek Kong; Yuen, Po Wing; Kwong, Yok-Lam

2004-01-01

This study aimed at identifying the genetic events involved in immortalization of ovarian epithelial cells, which might be important steps in ovarian carcinogenesis. The genetic profiles of five human ovarian surface epithelial (HOSE) cell lines immortalized by retroviral transfection of the human papillomavirus (HPV) E6/E7 genes were thoroughly characterized by chromosome banding and fluorescence in situ hybridization (FISH), at various passages pre- and post-crisis. In pre-crisis, most cells had simple, non-clonal karyotypic changes. Telomere association was the commonest aberration, suggesting that tolermase dysfunction might be an important genetic event leading to cellular crisis. After immortalization post-crisis, however, the karyotypic patterns were non-random. Loss of genetic materials was a characteristic feature. The commonest numerical aberrations were -13, -14, -16, -17, -18, and +5. Among them, loss of chromosome 13 was common change observed in all lines. The only recurrent structural aberration was homogeneously staining regions (hsr) observed in three lines. FISH and combined binary ratio labeling (COBRA)-FISH showed in two cases that the hsrs were derived from chromosome 20. Clonal evolution was observed in four of the lines. In one line, hsr was the only change shared by all subclones, suggesting that it might be a primary event in cell immortalization. The results of the present study suggested that loss of chromosome 13 and the amplification of chromosome 20 might be early genetic events involved in ovarian cell immortalization, and might be useful targets for the study of genomic aberrations in ovarian carcinogenesis.

Genomic organization of the human gene (CA5) and pseudogene for mitochondrial carbonic anhydrase V and their localization to chromosomes 16q and 16p

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nagao, Yoshiro; Sly, W.S.; Batanian, J.R.

1995-08-10

Carbonic anhydrase V (CA V) is expressed in mitochondrial matrix in liver and several other tissues. It is of interest for its putative roles in providing bicarbonate to carbamoyl phosphate synthetase for ureagenesis and to pyruvate carboxylase for gluconeogenesis and its possible importance in explaining certain inherited metabolic disorders with hyperammonemia and hypoglycemia. Following the recent characterization of the cDNA for human CA V, we report the isolation of the human gene from two {lambda} genomic libraries and its characterization. The CA V gene (CA5) is approximately 50 kb long and contains 7 exons and 6 introns. The exon-intron boundariesmore » are found in positions identical to those determined for the previously described CA II, CA III, and CA VII genes. Like the CA VII gene, CA5 does not contain typical TATA and CAAT promoter elements in the 5{prime} flanking region but does contain a TTTAA sequence 147 nucleotides upstream of the initiation codon. CA5 also contains a 12-bp GT-rich segment beginning 13 bp downstream of the polyadenylation signal in the 3{prime} untranslated region of exon 7. FISH analysis allowed CA5 to be assigned to chromosome 16q24.3. An unprocessed pseudogene containing sequence homologous to exons 3-7 and introns 3-6 was also isolated and was assigned by FISH analysis to chromosome 16p11.2-p12. 22 refs., 4 figs., 1 tab.« less

Chromosomal intrachanges induced by swift iron ions

NASA Astrophysics Data System (ADS)

Horstmann, M.; Durante, M.; Johannes, C.; Obe, G.

We measured the induction of aberrations in human chromosome 5 by iron ions using the novel technique of multicolor banding in situ hybridization (mBAND). Human lymphocytes isolated from whole blood were exposed in vitro to 500 MeV/n (LET=200 keV/μ m, doses 1 or 4 Gy) 56Fe nuclei at the HIMAC accelerator in Chiba (Japan). Chromosomes were prematurely condensed by calyculin A after 48 h in culture, and slides were painted by mBAND (MetaSystems). We found a frequency of 0.11 and 0.57 residual breakpoints per chromosome 5 after 1 Gy and 4 Gy Fe-ions, respectively. The distribution per unit length were similar in the p- and q-arm of chromosome 5, and >50% of the observed fragments measured <30% of the whole chromosome length. Only small fragments (<40% of the chromosome size) were involved in intra-chromosomal exchanges (interstitial deletions or inversions), whereas fragments up to 75% of the whole chromosome 5 were found in inter-chromosomal exchanges. We measured more inter-changes than intra-changes, and more intra-arm than inter-arm exchanges at both doses. No significant differences in the ratios of these aberrations were detected with respect to X-rays. On the other hand, Fe-ions induced a significantly higher fraction of complex-type exchanges when compared to sparsely ionizing radiation. Work supported by DLR, BMBF, INTAS and NIRS-HIMAC.

Comparative Maps of Human 19p13.3 and Mouse Chromosome 10 Allow Identification of Sequences at Evolutionary Breakpoints

PubMed Central

Puttagunta, Radhika; Gordon, Laurie A.; Meyer, Gary E.; Kapfhamer, David; Lamerdin, Jane E.; Kantheti, Prameela; Portman, Kathleen M.; Chung, Wendy K.; Jenne, Dieter E.; Olsen, Anne S.; Burmeister, Margit

2000-01-01

A cosmid/bacterial artificial chromosome (BAC) contiguous (contig) map of human chromosome (HSA) 19p13.3 has been constructed, and over 50 genes have been localized to the contig. Genes and anonymous ESTs from ≈4000 kb of human 19p13.3 were placed on the central mouse chromosome 10 map by genetic mapping and pulsed-field gel electrophoresis (PFGE) analysis. A region of ∼2500 kb of HSA 19p13.3 is collinear to mouse chromosome (MMU) 10. In contrast, the adjacent ≈1200 kb are inverted. Two genes are located in a 50-kb region after the inversion on MMU 10, followed by a region of homology to mouse chromosome 17. The synteny breakpoint and one of the inversion breakpoints has been localized to sequenced regions in human <5 kb in size. Both breakpoints are rich in simple tandem repeats, including (TCTG)n, (CT)n, and (GTCTCT)n, suggesting that simple repeat sequences may be involved in chromosome breaks during evolution. The overall size of the region in mouse is smaller, although no large regions are missing. Comparing the physical maps to the genetic maps showed that in contrast to the higher-than-average rate of genetic recombination in gene-rich telomeric region on HSA 19p13.3, the average rate of recombination is lower than expected in the homologous mouse region. This might indicate that a hot spot of recombination may have been lost in mouse or gained in human during evolution, or that the position of sequences along the chromosome (telomeric compared to the middle of a chromosome) is important for recombination rates. PMID:10984455

Human-Specific Duplication and Mosaic Transcripts: The Recent Paralogous Structure of Chromosome 22

PubMed Central

Bailey, Jeffrey A. ; Yavor, Amy M. ; Viggiano, Luigi ; Misceo, Doriana ; Horvath, Juliann E. ; Archidiacono, Nicoletta ; Schwartz, Stuart ; Rocchi, Mariano ; Eichler, Evan E. 

2002-01-01

In recent decades, comparative chromosomal banding, chromosome painting, and gene-order studies have shown strong conservation of gross chromosome structure and gene order in mammals. However, findings from the human genome sequence suggest an unprecedented degree of recent (<35 million years ago) segmental duplication. This dynamism of segmental duplications has important implications in disease and evolution. Here we present a chromosome-wide view of the structure and evolution of the most highly homologous duplications (⩾1 kb and ⩾90%) on chromosome 22. Overall, 10.8% (3.7/33.8 Mb) of chromosome 22 is duplicated, with an average sequence identity of 95.4%. To organize the duplications into tractable units, intron-exon structure and well-defined duplication boundaries were used to define 78 duplicated modules (minimally shared evolutionary segments) with 157 copies on chromosome 22. Analysis of these modules provides evidence for the creation or modification of 11 novel transcripts. Comparative FISH analyses of human, chimpanzee, gorilla, orangutan, and macaque reveal qualitative and quantitative differences in the distribution of these duplications—consistent with their recent origin. Several duplications appear to be human specific, including a ∼400-kb duplication (99.4%–99.8% sequence identity) that transposed from chromosome 14 to the most proximal pericentromeric region of chromosome 22. Experimental and in silico data further support a pericentromeric gradient of duplications where the most recent duplications transpose adjacent to the centromere. Taken together, these data suggest that segmental duplications have been an ongoing process of primate genome evolution, contributing to recent gene innovation and the dynamic transformation of genome architecture within and among closely related species. PMID:11731936

The prevalence of chromosomal deletions relating to developmental delay and/or intellectual disability in human euploid blastocysts.

PubMed

He, Wenyin; Sun, Xiaofang; Liu, Lian; Li, Man; Jin, Hua; Wang, Wei-Hua

2014-01-01

Chromosomal anomalies in human embryos produced by in vitro fertilization are very common, which include numerical (aneuploidy) and structural (deletion, duplication or others) anomalies. Our previous study indicated that chromosomal deletion(s) is the most common structural anomaly accounting for approximately 8% of euploid blastocysts. It is still unknown if these deletions in human euploid blastocysts have clinical significance. In this study, we analyzed 15 previously diagnosed euploid blastocysts that had chromosomal deletion(s) using Agilent oligonucleotide DNA microarray platform and localized the gene location in each deletion. Then, we used OMIM gene map and phenotype database to investigate if these deletions are related with some important genes that cause genetic diseases, especially developmental delay or intellectual disability. As results, we found that the detectable chromosomal deletion size with Agilent microarray is above 2.38 Mb, while the deletions observed in human blastocysts are between 11.6 to 103 Mb. With OMIM gene map and phenotype database information, we found that deletions can result in loss of 81-464 genes. Out of these genes, 34-149 genes are related with known genetic problems. Furthermore, we found that 5 out of 15 samples lost genes in the deleted region, which were related to developmental delay and/or intellectual disability. In conclusion, our data indicates that all human euploid blastocysts with chromosomal deletion(s) are abnormal and transfer of these embryos may cause birth defects and/or developmental and intellectual disabilities. Therefore, the embryos with chromosomal deletion revealed by DNA microarray should not be transferred to the patients, or further gene map and/or phenotype seeking is necessary before making a final decision.

Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?

PubMed

Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo

2017-04-15

Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.

Detection and quantitation of chromosomal mosaicism in human blastocysts using copy number variation sequencing.

PubMed

Ruttanajit, Tida; Chanchamroen, Sujin; Cram, David S; Sawakwongpra, Kritchakorn; Suksalak, Wanwisa; Leng, Xue; Fan, Junmei; Wang, Li; Yao, Yuanqing; Quangkananurug, Wiwat

2016-02-01

Currently, our understanding of the nature and reproductive potential of blastocysts associated with trophectoderm (TE) lineage chromosomal mosaicism is limited. The objective of this study was to first validate copy number variation sequencing (CNV-Seq) for measuring the level of mosaicism and second, examine the nature and level of mosaicism in TE biopsies of patient's blastocysts. TE biopy samples were analysed by array comparative genomic hybridization (CGH) and CNV-Seq to discriminate between euploid, aneuploid and mosaic blastocysts. Using artificial models of TE mosaicism for five different chromosomes, CNV-Seq accurately and reproducibly quantitated mosaicism at levels of 50% and 20%. In a comparative 24-chromosome study of 49 blastocysts by array CGH and CNV-Seq, 43 blastocysts (87.8%) had a concordant diagnosis and 6 blastocysts (12.2%) were discordant. The discordance was attributed to low to medium levels of chromosomal mosaicism (30-70%) not detected by array CGH. In an expanded study of 399 blastocysts using CNV-Seq as the sole diagnostic method, the proportion of diploid-aneuploid mosaics (34, 8.5%) was significantly higher than aneuploid mosaics (18, 4.5%) (p < 0.02). Mosaicism is a significant chromosomal abnormality associated with the TE lineage of human blastocysts that can be reliably and accurately detected by CNV-Seq. © 2015 John Wiley & Sons, Ltd.

Early and Late Damages in Chromosome 3 of Human Lymphocytes After Radiation Exposure

NASA Technical Reports Server (NTRS)

Sunagawa, Mayumi; Mangala, Lingegowda; Zhang, Ye; Kahdim, Munira; Wilson, Bobby; Cucinotta, Francis A.; Wu, Honglu

2011-01-01

Tumor formation in humans or animals is a multi-step process. An early stage of cancer development is believed to be genomic instability (GI) which accelerates the mutation rate in the descendants of the cells surviving radiation exposure. GI is defined as elevated or persistent genetic damages occurring many generations after the cells are exposed. While early studies have demonstrated radiation-induced GI in several cell types as detected in endpoints such as mutation, apoptosis and damages in chromosomes, the dependence of GI on the quality of radiation remains uncertain. To investigate GI in human lymphocytes induced by both low- and high-LET radiation, we initially exposed white blood cells collected from healthy subjects to gamma rays in vitro, and cultured the cells for multiple generations. Chromosome aberrations were analyzed in cells collected at first mitosis post irradiation and at several intervals during the culture period. Among a number of biological endpoints planned for the project, the multi-color banding fluorescent in situ hybridization (mBAND) allows identification of inversions that were expected to be stable. We present here early and late chromosome aberrations detected with mBAND in chromosome 3 after gamma exposure. Comparison of chromosome damages in between human lymphocytes and human epithelial cells is also discussed

Highly stable maintenance of a mouse artificial chromosome in human cells and mice.

PubMed

Kazuki, Kanako; Takehara, Shoko; Uno, Narumi; Imaoka, Natsuko; Abe, Satoshi; Takiguchi, Masato; Hiramatsu, Kei; Oshimura, Mitsuo; Kazuki, Yasuhiro

2013-12-06

Human artificial chromosomes (HACs) and mouse artificial chromosomes (MACs) display several advantages as gene delivery vectors, such as stable episomal maintenance that avoids insertional mutations and the ability to carry large gene inserts including the regulatory elements. Previously, we showed that a MAC vector developed from a natural mouse chromosome by chromosome engineering was more stably maintained in adult tissues and hematopoietic cells in mice than HAC vectors. In this study, to expand the utility for a gene delivery vector in human cells and mice, we investigated the long-term stability of the MACs in cultured human cells and transchromosomic mice. We also investigated the chromosomal copy number-dependent expression of genes on the MACs in mice. The MAC was stably maintained in human HT1080 cells in vitro during long-term culture. The MAC was stably maintained at least to the F8 and F4 generations in ICR and C57BL/6 backgrounds, respectively. The MAC was also stably maintained in hematopoietic cells and tissues derived from old mice. Transchromosomic mice containing two or four copies of the MAC were generated by breeding. The DNA contents were comparable to the copy number of the MACs in each tissue examined, and the expression of the EGFP gene on the MAC was dependent on the chromosomal copy number. Therefore, the MAC vector may be useful not only for gene delivery in mammalian cells but also for animal transgenesis. Copyright © 2013 Elsevier Inc. All rights reserved.

[Chromosomal instability in carcinogenesis of cervical cancer.

PubMed

de Los Santos-Munive, Victoria; Alonso-Avelino, Juan Angel

2013-01-01

In order to spot common chromosomal imbalances in early and late lesions of cervical cancer that might be used as progression biomarkers, we made a search of literature in PubMed from 1996 to 2011. The medical subject headings employed were chromosomal alterations, loss of heterozygosis, cervical cancer, cervical tumorigenesis, chromosomal aberrations, cervical intraepithelial neoplasm and low-grade squamous intraepithelial lesion. The common chromosomal imbalances were gains in 8q24 (77.7 %), 20q13 (66.9 %), 3q26 (47.1 %), Xp22 (43.8 %), and 5p15 (60 %), principally. On the other hand, integration of the high-risk human papillomavirus genome into the host chromosome has been associated with the development of neoplasia, but the chromosomal imbalances seem to precede and promote such integration. Chromosomal imbalances in 8q24, 20q13, 3q21-26 and 5p15-Xp22, determined by fluorescent in situ hybridization assay or comparative genomic hybridization assay for early detection of the presence of high-risk human papillomavirus, are promising markers of cervical cancer progression.

Chromosomal duplications in bacteria, fruit flies, and humans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lupski, J.R.; Weinstock, G.M.; Roth, J.R.

1996-01-01

Tandem duplication of chromosomal segments has been recognized as a frequent mutational mechanism in several genetic model systems. In bacteria, fruit flies, and humans, duplications form by similar molecular mechanisms and appear to be important in genome evolution. 80 refs.

The gene coding for glial cell line derived neurotrophic factor (GDNF) maps to chromosome 5p12-p13.1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schindelhauer, D.; Schuffenhauer, S.; Meitinger, T.

1995-08-10

The gene coding for glial cell line derived neurotrophic factor (GDNF) has biological properties that may have potential as a treatment for Parkinson`s and motoneuron diseases. Using the NIGMS Mapping Panel 2, we have localized the GDNF gene to human chromosome 5p12-p13.1. Large NruI and NotI fragments on chromosome 5 will facilitate the construction of a long-range map of the region. 26 refs., 1 fig., 1 tab.

A gene involved in control of human cellular senescence on human chromosome 1q

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hensler, P.J.; Pereira-Smith, O.M.; Annab, L.A.

1994-04-01

Normal cells in culture exhibit limited division potential and have been used as a model for cellular senescence. In contrast, tumor-derived or carcinogen- or virus-transformed cells are capable of indefinite division. Fusion of normal human diploid fibroblasts with immortal human cells yielded hybrids having limited life spans, indicating that cellular senescence was dominant. Fusions of various immortal human cell lines with each other led to the identification of four complementation groups for indefinite division. The purpose of this study was to determine whether human chromosome 1 could complement the recessive immortal defect of human cell lines assigned to one ofmore » the four complementation groups. Using microcell fusion, the authors introduced a single normal human chromosome 1 into immortal human cell lines representing the complementation groups and determined that it caused loss of proliferative potential of an osteosarcoma-derived cell line (TE85), a cytomegalovirus-transformed lung fibroblast cell line (CMV-Mj-HEL-1), and a Ki-ras[sup +]-transformed derivative of TE85 (143B TK[sup [minus

Chromosome aberrations in human blood lymphocytes exposed to energetic protons

NASA Astrophysics Data System (ADS)

Hada, Megumi; George, Ms Kerry; Cucinotta, Francis A.

During space flight, astronauts are exposed to space radiation consisting of high-energy protons, high charge and energy (HZE) nuclei, as well as secondary particles that are generated when the primary particles penetrate the spacecraft shielding. Secondary particles have a higher LET value than primary protons and are therefore expected to have a higher relative biological effectiveness (RBE). To investigate this theory, we exposed human peripheral blood lymphocytes to protons with energies of 250 MeV, 800MeV, 2 GeV, or 2.5 GeV. LET values for these protons ranged from 0.4 to 0.2 keV/µm. and doses ranged from 0.2 to 3 Gy. Over this energy range the probability of nuclear reaction leading to secondary radiation, and the multiplicity of reaction products such as neutrons and mesons increases substantially. The effect of aluminum and polyethylene shielding was also assessed using the 2 GeV and 2.5GeV proton beams. After exposure lymphocytes were stimulated to divide and chromosomes were collected from cells in the first G2 and metaphase cell cycle after exposure using a chemical induced premature chromosome condensation (PCC) technique. Dose response data for chromosome damage was analyzed using the fluorescence in situ hybridization (FISH) chromosome painting technique. Selected samples were also analyzed with multicolor FISH (mFISH) and multicolor banding FISH (mBAND) techniques. Data indicates that the dose response for simple-type exchanges is similar for proton and gamma exposure, whereas protons induce higher yields of complex exchanges that are energy dependent. RBE values will be presented for each proton energy, and the effects of shielding and possible cytogenetic signatures of proton exposure will be discussed.

Structure and chromosomal localization of the human PD-1 gene (PDCD1)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shinohara, T.; Ishida, Y.; Kawaichi, M.

1994-10-01

A cDNA encoding mouse PD-1, a member of the immunoglobulin superfamily, was previously isolated from apoptosis-induced cells by subtractive hybridization. To determine the structure and chromosomal location of the human PD-1 gene, we screened a human T cell cDNA library by mouse PD-1 probe and isolated a cDNA coding for the human PD-1 protein. The deduced amino acid sequence of human PD-1 was 60% identical to the mouse counterpart, and a putative tyrosine kinase-association motif was well conserved. The human PD-1 gene was mapped to 2q37.3 by chromosomal in situ hybridization. 7 refs., 3 figs.

Computer graphics of SEM images facilitate recognition of chromosome position in isolated human metaphase plates.

PubMed

Hodge, L D; Barrett, J M; Welter, D A

1995-04-01

There is general agreement that at the time of mitosis chromosomes occupy precise positions and that these positions likely affect subsequent nuclear function in interphase. However, before such ideas can be investigated in human cells, it is necessary to determine first the precise position of each chromosome with regard to its neighbors. It has occurred to us that stereo images, produced by scanning electron microscopy, of isolated metaphase plates could form the basis whereby these positions could be ascertained. In this paper we describe a computer graphic technique that permits us to keep track of individual chromosomes in a metaphase plate and to compare chromosome positions in different metaphase plates. Moreover, the computer graphics provide permanent, easily manipulated, rapid recall of stored chromosome profiles. These advantages are demonstrated by a comparison of the relative position of group A-specific and groups D- and G-specific chromosomes to the full complement of chromosomes in metaphase plates isolated from a nearly triploid human-derived cell (HeLa S3) to a hypo-diploid human fetal lung cell.

Reactivation of Chromosomally Integrated Human Herpesvirus-6 by Telomeric Circle Formation

PubMed Central

Prusty, Bhupesh K.; Krohne, George; Rudel, Thomas

2013-01-01

More than 95% of the human population is infected with human herpesvirus-6 (HHV-6) during early childhood and maintains latent HHV-6 genomes either in an extra-chromosomal form or as a chromosomally integrated HHV-6 (ciHHV-6). In addition, approximately 1% of humans are born with an inheritable form of ciHHV-6 integrated into the telomeres of chromosomes. Immunosuppression and stress conditions can reactivate latent HHV-6 replication, which is associated with clinical complications and even death. We have previously shown that Chlamydia trachomatis infection reactivates ciHHV-6 and induces the formation of extra-chromosomal viral DNA in ciHHV-6 cells. Here, we propose a model and provide experimental evidence for the mechanism of ciHHV-6 reactivation. Infection with Chlamydia induced a transient shortening of telomeric ends, which subsequently led to increased telomeric circle (t-circle) formation and incomplete reconstitution of circular viral genomes containing single viral direct repeat (DR). Correspondingly, short t-circles containing parts of the HHV-6 DR were detected in cells from individuals with genetically inherited ciHHV-6. Furthermore, telomere shortening induced in the absence of Chlamydia infection also caused circularization of ciHHV-6, supporting a t-circle based mechanism for ciHHV-6 reactivation. PMID:24367281

Characteristics of chromosome instability in the human lymphoblast cell line WTK1

NASA Technical Reports Server (NTRS)

Schwartz, J. L.; Jordan, R.; Evans, H. H.

2001-01-01

The characteristics of spontaneous and radiation-induced chromosome instability were determined in each of 50 individual clones isolated from control populations of human lymphoblasts (WTK1), as well as from populations of these cells previously exposed to two different types of ionizing radiation, Fe-56 and Cs-137. The types of chromosome instability did not appear to change in clones surviving radiation exposure. Aneuploidy, polyploidy, chromosome dicentrics and translocations, and chromatid breaks and gaps were found in both control and irradiated clones. The primary effect of radiation exposure was to increase the number of cells within any one clone that had chromosome alterations. Chromosome instability was associated with telomere shortening and elevated levels of apoptosis. The results suggest that the proximal cause of chromosome instability is telomere shortening.

Termini of human chromosomes display elevated rates of mitotic recombination.

PubMed

Cornforth, M N; Eberle, R L

2001-01-01

The strand-specific in situ hybridization technique of CO-FISH was used to probe telomeres of human mitotic cells in order to determine the spontaneous frequency of crossover. This approach allowed the detection of recombinational crossovers occurring anywhere along the length of individual chromosomes, including reciprocal events taking place between sister chromatids. Although the process of sister chromatid exchange (SCE) is the most prominent type of recombination in somatic mammalian cells, our results show that SCEs accounted for less than a third of the recombinational events revealed by CO-FISH. It is concluded that chromosomal regions near the termini of chromosome arms undergo extraordinarily high rates of spontaneous recombination, producing terminal crossovers whose small size precludes detection by standard cytogenetic methods. That similar results were observed for transformed epithelial cells, as well as primary fibroblasts, suggests that the phenomenon is a common characteristic of human cells. These findings are noteworthy because, although telomeric and subtelomeric DNA is known to be preferentially involved in certain types of recombination, the tips of somatic mammalian chromosomes have not previously been identified as preferred sites for crossover. Implications of these results are discussed in terms of limitations imposed on CO-FISH for its proposed use in directional hybridization mapping.

Inter- and Intraspecies Phylogenetic Analyses Reveal Extensive X–Y Gene Conversion in the Evolution of Gametologous Sequences of Human Sex Chromosomes

PubMed Central

Trombetta, Beniamino; Sellitto, Daniele; Scozzari, Rosaria; Cruciani, Fulvio

2014-01-01

It has long been believed that the male-specific region of the human Y chromosome (MSY) is genetically independent from the X chromosome. This idea has been recently dismissed due to the discovery that X–Y gametologous gene conversion may occur. However, the pervasiveness of this molecular process in the evolution of sex chromosomes has yet to be exhaustively analyzed. In this study, we explored how pervasive X–Y gene conversion has been during the evolution of the youngest stratum of the human sex chromosomes. By comparing about 0.5 Mb of human–chimpanzee gametologous sequences, we identified 19 regions in which extensive gene conversion has occurred. From our analysis, two major features of these emerged: 1) Several of them are evolutionarily conserved between the two species and 2) almost all of the 19 hotspots overlap with regions where X–Y crossing-over has been previously reported to be involved in sex reversal. Furthermore, in order to explore the dynamics of X–Y gametologous conversion in recent human evolution, we resequenced these 19 hotspots in 68 widely divergent Y haplogroups and used publicly available single nucleotide polymorphism data for the X chromosome. We found that at least ten hotspots are still active in humans. Hence, the results of the interspecific analysis are consistent with the hypothesis of widespread reticulate evolution within gametologous sequences in the differentiation of hominini sex chromosomes. In turn, intraspecific analysis demonstrates that X–Y gene conversion may modulate human sex-chromosome-sequence evolution to a greater extent than previously thought. PMID:24817545

Y chromosome diversity, human expansion, drift, and cultural evolution

PubMed Central

Chiaroni, Jacques; Underhill, Peter A.; Cavalli-Sforza, Luca L.

2009-01-01

The relative importance of the roles of adaptation and chance in determining genetic diversity and evolution has received attention in the last 50 years, but our understanding is still incomplete. All statements about the relative effects of evolutionary factors, especially drift, need confirmation by strong demographic observations, some of which are easier to obtain in a species like ours. Earlier quantitative studies on a variety of data have shown that the amount of genetic differentiation in living human populations indicates that the role of positive (or directional) selection is modest. We observe geographic peculiarities with some Y chromosome mutants, most probably due to a drift-related phenomenon called the surfing effect. We also compare the overall genetic diversity in Y chromosome DNA data with that of other chromosomes and their expectations under drift and natural selection, as well as the rate of fall of diversity within populations known as the serial founder effect during the recent “Out of Africa” expansion of modern humans to the whole world. All these observations are difficult to explain without accepting a major relative role for drift in the course of human expansions. The increasing role of human creativity and the fast diffusion of inventions seem to have favored cultural solutions for many of the problems encountered in the expansion. We suggest that cultural evolution has been subrogating biologic evolution in providing natural selection advantages and reducing our dependence on genetic mutations, especially in the last phase of transition from food collection to food production. PMID:19920170

Y chromosome diversity, human expansion, drift, and cultural evolution.

PubMed

Chiaroni, Jacques; Underhill, Peter A; Cavalli-Sforza, Luca L

2009-12-01

The relative importance of the roles of adaptation and chance in determining genetic diversity and evolution has received attention in the last 50 years, but our understanding is still incomplete. All statements about the relative effects of evolutionary factors, especially drift, need confirmation by strong demographic observations, some of which are easier to obtain in a species like ours. Earlier quantitative studies on a variety of data have shown that the amount of genetic differentiation in living human populations indicates that the role of positive (or directional) selection is modest. We observe geographic peculiarities with some Y chromosome mutants, most probably due to a drift-related phenomenon called the surfing effect. We also compare the overall genetic diversity in Y chromosome DNA data with that of other chromosomes and their expectations under drift and natural selection, as well as the rate of fall of diversity within populations known as the serial founder effect during the recent "Out of Africa" expansion of modern humans to the whole world. All these observations are difficult to explain without accepting a major relative role for drift in the course of human expansions. The increasing role of human creativity and the fast diffusion of inventions seem to have favored cultural solutions for many of the problems encountered in the expansion. We suggest that cultural evolution has been subrogating biologic evolution in providing natural selection advantages and reducing our dependence on genetic mutations, especially in the last phase of transition from food collection to food production.

Painting analysis of chromosome aberrations induced by energetic heavy ions in human cells

NASA Astrophysics Data System (ADS)

Wu, H.; Hada, M.; Cucinotta, F. A.

Energetic heavy ions pose a great health risk to astronauts in extended ISS and future exploration missions High-LET heavy ions are particularly effective in causing various biological effects including cell inactivation genetic mutations and cancer induction Most of these biological endpoints are closely related to chromosomal damage which can be utilized as a biomarker for radiation insults Over the years we have studied chromosomal damage in human fibroblast epithelia and lymphocyte cells exposed in vitro to energetic charged particles generated at several accelerator facilities in the world Various fluorescence in situ hybridization painting techniques have been used to identify from only the telomere region of the chromosome to every chromosome in a human cell We will summarize the results of the investigations and discuss the unique radiation signatures and biomarkers for space radiation exposure

Gamma-ray mutagenesis studies in a new human-hamster hybrid, A(L)CD59(+/-), which has two human chromosomes 11 but is hemizygous for the CD59 gene

NASA Technical Reports Server (NTRS)

Kraemer, S. M.; Vannais, D. B.; Kronenberg, A.; Ueno, A.; Waldren, C. A.; Chatterjee, A. (Principal Investigator)

2001-01-01

Kraemer, S. M., Vannais, D. B., Kronenberg, A., Ueno, A. and Waldren, C. A. Gamma-Ray Mutagenesis Studies in a New Human-Hamster Hybrid, A(L)CD59(+/-), which has Two Human Chromosomes 11 but is Hemizygous for the CD59 Gene. Radiat. Res. 156, 10-19 (2001).We have developed a human-CHO hybrid cell line, named A(L)CD59(+/-), which has two copies of human chromosome 11 but is hemizygous for the CD59 gene and the CD59 cell surface antigen that it encodes. Our previous studies used the A(L) and A(L)C hybrids that respectively contain one or two sets of CHO chromosomes plus a single copy of human chromosome 11. The CD59 gene at 11p13.5 and the CD59 antigen encoded by it are the principal markers used in our mutagenesis studies. The hybrid A(L)CD59(+/-) contains two copies of human chromosome 11, only one of which carries the CD59 gene. The incidence of CD59 (-) mutants (formerly called S1(-)) induced by (137)Cs gamma rays is about fivefold greater in A(L)CD59(+/-) cells than in A(L) cells. Evidence is presented that this increase in mutant yield is due to the increased induction of certain classes of large chromosomal mutations that are lethal to A(L) cells but are tolerated in the A(L)CD59(+/-) hybrid. In addition, significantly more of the CD59 (-) mutants induced by (137)Cs gamma rays in A(L)CD59(+/-) cells display chromosomal instability than in A(L) cells. On the other hand, the yield of gamma-ray-induced CD59 (-) mutants in A(L)CD59(+/-) cells is half that of the A(L)C hybrid, which also tolerates very large mutations but has only one copy of human chromosome 11. We interpret the difference in mutability as evidence that repair processes involving the homologous chromosomes 11 play a role in determining mutant yields. The A(L)CD59(+/-) hybrid provides a useful new tool for quantifying mutagenesis and shedding light on mechanisms of genetic instability and mutagenesis.

Assembly of YAC contigs on the long arm of human chromosome 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, J.; Fujiwara, T.M.; Wang, J.X.

1994-09-01

We have previously identified approximately 2,000 chromosome 2-specific YACs by screening the CEPH Mark I YAC library (`Midi- YACs`). Using STS content mapping, we have been able to order groups of these YACs along chromosome 2q. The four biggest YAC groups were associated with VIL (2q35), FN (2q34), PAX3 (2q36), ALPI (2q37) and contained 113, 107, 79, and 63 YACs, respectively. We have identified the minimal tiling paths for most YAC groups and determined the insert sizes of over 300 YACs. Furthermore, on human chromosome 2q31-q37, 15 microsatellite markers were linked to various expressed genes through overlapping YACs and themore » physical distance of microsatellites to expressed genes was determined. The precise mapping of a set of highly informative microsatellite markers with respect to known genes provides a useful tool for linkage studies and the identification of disease genes from the long arm of human chromosome 2.« less

A fresh look at the male-specific region of the human Y chromosome.

PubMed

Jangravi, Zohreh; Alikhani, Mehdi; Arefnezhad, Babak; Sharifi Tabar, Mehdi; Taleahmad, Sara; Karamzadeh, Razieh; Jadaliha, Mahdieh; Mousavi, Seyed Ahmad; Ahmadi Rastegar, Diba; Parsamatin, Pouria; Vakilian, Haghighat; Mirshahvaladi, Shahab; Sabbaghian, Marjan; Mohseni Meybodi, Anahita; Mirzaei, Mehdi; Shahhoseini, Maryam; Ebrahimi, Marzieh; Piryaei, Abbas; Moosavi-Movahedi, Ali Akbar; Haynes, Paul A; Goodchild, Ann K; Nasr-Esfahani, Mohammad Hossein; Jabbari, Esmaiel; Baharvand, Hossein; Sedighi Gilani, Mohammad Ali; Gourabi, Hamid; Salekdeh, Ghasem Hosseini

2013-01-04

The Chromosome-centric Human Proteome Project (C-HPP) aims to systematically map the entire human proteome with the intent to enhance our understanding of human biology at the cellular level. This project attempts simultaneously to establish a sound basis for the development of diagnostic, prognostic, therapeutic, and preventive medical applications. In Iran, current efforts focus on mapping the proteome of the human Y chromosome. The male-specific region of the Y chromosome (MSY) is unique in many aspects and comprises 95% of the chromosome's length. The MSY continually retains its haploid state and is full of repeated sequences. It is responsible for important biological roles such as sex determination and male fertility. Here, we present the most recent update of MSY protein-encoding genes and their association with various traits and diseases including sex determination and reversal, spermatogenesis and male infertility, cancers such as prostate cancers, sex-specific effects on the brain and behavior, and graft-versus-host disease. We also present information available from RNA sequencing, protein-protein interaction, post-translational modification of MSY protein-coding genes and their implications in biological systems. An overview of Human Y chromosome Proteome Project is presented and a systematic approach is suggested to ensure that at least one of each predicted protein-coding gene's major representative proteins will be characterized in the context of its major anatomical sites of expression, its abundance, and its functional relevance in a biological and/or medical context. There are many technical and biological issues that will need to be overcome in order to accomplish the full scale mapping.

M-BAND Study of Radiation-Induced Chromosome Aberrations in Human Epithelial Cells: Radiation Quality and Dose Rate Effects

NASA Technical Reports Server (NTRS)

Hada, Megumi; Cucinotta, Francis; Wu, Honglu

2009-01-01

The advantage of the multicolor banding in situ hybridization (mBAND) technique is its ability to identify both inter- (translocation to unpainted chromosomes) and intra- (inversions and deletions within a single painted chromosome) chromosome aberrations simultaneously. To study the detailed rearrangement of low- and high-LET radiation induced chromosome aberrations in human epithelial cells (CH184B5F5/M10) in vitro, we performed a series of experiments with Cs-137 gamma rays of both low and high dose rates, neutrons of low dose rate and 600 MeV/u Fe ions of high dose rate, with chromosome 3 painted with multi-binding colors. We also compared the chromosome aberrations in both 2- and 3-dimensional cell cultures. Results of these experiments revealed the highest chromosome aberration frequencies after low dose rate neutron exposures. However, detailed analysis of the radiation induced inversions revealed that all three radiation types induced a low incidence of simple inversions. Most of the inversions in gamma-ray irradiated samples were accompanied by other types of intra-chromosomal aberrations but few inversions were accompanied by inter-chromosomal aberrations. In contrast, neutrons and Fe ions induced a significant fraction of inversions that involved complex rearrangements of both inter- and intrachromosomal exchanges. The location of the breaks involved in chromosome exchanges was analyzed along the painted chromosome. The breakpoint distribution was found to be randomly localized on chromosome 3 after neutron or Fe ion exposure, whereas non-random distribution with clustering breakpoints was observed after -ray exposure. Our comparison of chromosome aberration yields between 2- and 3-dimensional cell cultures indicated a significant difference for gamma exposures, but not for Fe ion exposures. These experimental results indicated that the track structure of the radiation and the cellular/chromosome structure can both affect radiation-induced chromosome

17th Chromosome-Centric Human Proteome Project Symposium in Tehran.

PubMed

Meyfour, Anna; Pahlavan, Sara; Sobhanian, Hamid; Salekdeh, Ghasem Hosseini

2018-04-01

This report describes the 17th Chromosome-Centric Human Proteome Project which was held in Tehran, Iran, April 27 and 28, 2017. A brief summary of the symposium's talks including new technical and computational approaches for the identification of novel proteins from non-coding genomic regions, physicochemical and biological causes of missing proteins, and the close interactions between Chromosome- and Biology/Disease-driven Human Proteome Project are presented. A synopsis of decisions made on the prospective programs to maintain collaborative works, share resources and information, and establishment of a newly organized working group, the task force for missing protein analysis are discussed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The Sequence and Analysis of Duplication Rich Human Chromosome 16

DOE R&D Accomplishments Database

Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.

2004-01-01

We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

Genetics of the connective tissue proteins: Assignment of the gene for human type I procollagen to chromosome 17 by analysis of cell hybrids and microcell hybrids*

PubMed Central

Raj, Cholappadi V. Sundar; Church, Robert L.; Klobutcher, Lawrence A.; Ruddle, Frank H.

1977-01-01

Somatic cell hybrids between mouse and human cell lines have been used to identify the specific chromosome that governs the synthesis of type I procollagen. Fourteen hybrid clones and subclones were derived independently from crosses between mouse parents [LM (thymidine kinase-negative) or A9 (hypoxanthine phosphoribosyltransferase-negative)] and human cells (human diploid lung fibroblasts WI-38 or diploid skin fibroblasts GM5, GM17, and GM9). The cultures were labeled with [3H]proline in modified Eagle's medium without serum. Radioactive procollagens were purified from the medium by the method of Church et al. [(1974) J. Mol. Biol. 86, 785-799]. DEAE-cellulose chromatography was used to separate collagen and type I and type III procollagen. Human type I procollagen was assayed by double immunodiffusion analysis with type I procollagen antibodies prepared by immunizing rabbits with purified human type I procollagen. These analyses combined with karyology and isozyme analyses of each hybrid line have produced evidence for the assignment of the gene for human type I procollagen to chromosome 17. A human microcell-mouse hybrid cell line containing only human chromosome 17 was positive for human type I procollagen, lending further support to the assignment of the human type I procollagen gene to chromosome 17. Finally, by using a hybrid line containing only the long arm of human chromosome 17 translocated onto a mouse chromosome, the type I procollagen gene can be assigned more specifically to the long arm of chromosome 17. Images PMID:412188

Identification of human chromosome 22 transcribed sequences with ORF expressed sequence tags

PubMed Central

de Souza, Sandro J.; Camargo, Anamaria A.; Briones, Marcelo R. S.; Costa, Fernando F.; Nagai, Maria Aparecida; Verjovski-Almeida, Sergio; Zago, Marco A.; Andrade, Luis Eduardo C.; Carrer, Helaine; El-Dorry, Hamza F. A.; Espreafico, Enilza M.; Habr-Gama, Angelita; Giannella-Neto, Daniel; Goldman, Gustavo H.; Gruber, Arthur; Hackel, Christine; Kimura, Edna T.; Maciel, Rui M. B.; Marie, Suely K. N.; Martins, Elizabeth A. L.; Nóbrega, Marina P.; Paçó-Larson, Maria Luisa; Pardini, Maria Inês M. C.; Pereira, Gonçalo G.; Pesquero, João Bosco; Rodrigues, Vanderlei; Rogatto, Silvia R.; da Silva, Ismael D. C. G.; Sogayar, Mari C.; de Fátima Sonati, Maria; Tajara, Eloiza H.; Valentini, Sandro R.; Acencio, Marcio; Alberto, Fernando L.; Amaral, Maria Elisabete J.; Aneas, Ivy; Bengtson, Mário Henrique; Carraro, Dirce M.; Carvalho, Alex F.; Carvalho, Lúcia Helena; Cerutti, Janete M.; Corrêa, Maria Lucia C.; Costa, Maria Cristina R.; Curcio, Cyntia; Gushiken, Tsieko; Ho, Paulo L.; Kimura, Elza; Leite, Luciana C. C.; Maia, Gustavo; Majumder, Paromita; Marins, Mozart; Matsukuma, Adriana; Melo, Analy S. A.; Mestriner, Carlos Alberto; Miracca, Elisabete C.; Miranda, Daniela C.; Nascimento, Ana Lucia T. O.; Nóbrega, Francisco G.; Ojopi, Élida P. B.; Pandolfi, José Rodrigo C.; Pessoa, Luciana Gilbert; Rahal, Paula; Rainho, Claudia A.; da Ro's, Nancy; de Sá, Renata G.; Sales, Magaly M.; da Silva, Neusa P.; Silva, Tereza C.; da Silva, Wilson; Simão, Daniel F.; Sousa, Josane F.; Stecconi, Daniella; Tsukumo, Fernando; Valente, Valéria; Zalcberg, Heloisa; Brentani, Ricardo R.; Reis, Luis F. L.; Dias-Neto, Emmanuel; Simpson, Andrew J. G.

2000-01-01

Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central coding regions of the resulting transcripts. They are termed ORF expressed sequence tags (ORESTES). The 250,000 ORESTES were assembled into 81,429 contigs. Of these, 1,181 (1.45%) were found to match sequences in chromosome 22 with at least one ORESTES contig for 162 (65.6%) of the 247 known genes, for 67 (44.6%) of the 150 related genes, and for 45 of the 148 (30.4%) EST-predicted genes on this chromosome. Using a set of stringent criteria to validate our sequences, we identified a further 219 previously unannotated transcribed sequences on chromosome 22. Of these, 171 were in fact also defined by EST or full length cDNA sequences available in GenBank but not utilized in the initial annotation of the first human chromosome sequence. Thus despite representing less than 15% of all expressed human sequences in the public databases at the time of the present analysis, ORESTES sequences defined 48 transcribed sequences on chromosome 22 not defined by other sequences. All of the transcribed sequences defined by ORESTES coincided with DNA regions predicted as encoding exons by genscan. (http://genes.mit.edu/GENSCAN.html). PMID:11070084

A novel autosomal-recessive mutation, whitish chalk-like teeth, resembling amelogenesis imperfecta, maps to rat chromosome 14 corresponding to human 4q21.

PubMed

Masuyama, Taku; Miyajima, Katsuhiro; Ohshima, Hayato; Osawa, Masaru; Yokoi, Norihide; Oikawa, Toshihiro; Taniguchi, Kazuyuki

2005-12-01

A rat mutant, whitish chalk-like teeth (wct), with white, chalk-like abnormal incisors, was discovered and morphologically and genetically characterized. The mutant rats showed tooth enamel defects that were similar to those of human amelogenesis imperfecta. The wct mutation was found to disturb the morphological transition of ameloblasts from secretory to maturation stages and to induce cyst formation. This mutation also disturbs the transfer of iron into the enamel, resulting in the whitish chalk-like incisors. A genetic linkage study indicated that the wct locus maps to a specific interval of rat chromosome 14 between D14Got13 and D14Wox2. Interestingly, the human chromosomal region orthologous to wct, a 5.5-Mb interval in human chromosome 4q21, is a critical region for the locus of human amelogenesis imperfecta AIH2. These results strongly suggest that this wct mutant is a useful model for the identification of genes responsible for amelogenesis imperfecta and molecular mechanisms of tooth development.

X Chromosome Abnormalities and Cognitive Development: Implications for Understanding Normal Human Development.

ERIC Educational Resources Information Center

Walzer, Stanley

1985-01-01

Argues that knowledge from studies of individuals with sex chromosome abnormalities can further understanding of aspects of normal human development. Studies of XO girls, XXY boys, XXX girls, and males with a fragile X chromosome are summarized to demonstrate how results contribute to knowledge about normal cognitive development and about…

Human sperm sex chromosome disomy and sperm DNA damage assessed by the neutral comet assay

PubMed Central

McAuliffe, M.E.; Williams, P.L.; Korrick, S.A.; Dadd, R.; Marchetti, F.; Martenies, S.E.; Perry, M.J.

2014-01-01

STUDY QUESTION Is there an association between human sperm sex chromosome disomy and sperm DNA damage? SUMMARY ANSWER An increase in human sperm XY disomy was associated with higher comet extent; however, there was no other consistent association of sex chromosome disomies with DNA damage. WHAT IS KNOWN ALREADY There is limited published research on the association between sex chromosome disomy and sperm DNA damage and the findings are not consistent across studies. STUDY DESIGN, SIZE, AND DURATION We conducted a cross-sectional study of 190 men (25% ever smoker, 75% never smoker) from subfertile couples presenting at the Massachusetts General Hospital Fertility Clinic from January 2000 to May 2003. PARTICIPANTS/MATERIALS, SETTING, METHODS Multiprobe fluorescence in situ hybridization for chromosomes X, Y and 18 was used to determine XX, YY, XY and total sex chromosome disomy in sperm nuclei using an automated scoring method. The neutral comet assay was used to measure sperm DNA damage, as reflected by comet extent, percentage DNA in the comet tail, and tail distributed moment. Univariate and multiple linear regression models were constructed with sex chromosome disomy (separate models for each of the four disomic conditions) as the independent variable, and DNA damage parameters (separate models for each measure of DNA damage) as the dependent variable. MAIN RESULTS AND THE ROLE OF CHANCE Men with current or past smoking history had significantly greater comet extent (µm: regression coefficients with 95% CI) [XX18: 15.17 (1.98, 28.36); YY18: 14.68 (1.50, 27.86); XY18: 15.41 (2.37, 28.45); Total Sex Chromosome Disomy: 15.23 (2.09, 28.38)], and tail distributed moment [XX18: 3.01 (0.30, 5.72); YY18: 2.95 (0.24, 5.67); XY18: 3.04 (0.36, 5.72); Total Sex Chromosome Disomy: 3.10 (0.31, 5.71)] than men who had never smoked. In regression models adjusted for age and smoking, there was a positive association between XY disomy and comet extent. For an increase in XY

Y-chromosome evolution: emerging insights into processes of Y-chromosome degeneration.

PubMed

Bachtrog, Doris

2013-02-01

The human Y chromosome is intriguing not only because it harbours the master-switch gene that determines gender but also because of its unusual evolutionary history. The Y chromosome evolved from an autosome, and its evolution has been characterized by massive gene decay. Recent whole-genome and transcriptome analyses of Y chromosomes in humans and other primates, in Drosophila species and in plants have shed light on the current gene content of the Y chromosome, its origins and its long-term fate. Furthermore, comparative analysis of young and old Y chromosomes has given further insights into the evolutionary and molecular forces triggering Y-chromosome degeneration and into the evolutionary destiny of the Y chromosome.

Painting Analysis of Chromosome Aberrations Induced by Energetic Heavy Ions in Human Cells

NASA Technical Reports Server (NTRS)

Wu, Honglu

2006-01-01

FISH, mFISH, mBAND, telomere and centromere probes have been used to study chromosome aberrations induced in human cells exposed to low-and high-LET radiation in vitro. High-LET induced damages are mostly a single track effect. Unrejoined chromosome breaks (incomplete exchanges) and complex type aberrations were higher for high-LET. Biosignatures may depend on the method the samples are collected. Recent mBAND analysis has revealed more information about the nature of intra-chromosome exchanges. Whether space flight/microgravity affects radiation-induced chromosome aberration frequencies is still an open question.

A high density of human communication-associated genes in chromosome 7q31-q36: differential expression in human and non-human primate cortices.

PubMed

Schneider, E; Jensen, L R; Farcas, R; Kondova, I; Bontrop, R E; Navarro, B; Fuchs, E; Kuss, A W; Haaf, T

2012-01-01

The human brain is distinguished by its remarkable size, high energy consumption, and cognitive abilities compared to all other mammals and non-human primates. However, little is known about what has accelerated brain evolution in the human lineage. One possible explanation is that the appearance of advanced communication skills and language has been a driving force of human brain development. The phenotypic adaptations in brain structure and function which occurred on the way to modern humans may be associated with specific molecular signatures in today's human genome and/or transcriptome. Genes that have been linked to language, reading, and/or autism spectrum disorders are prime candidates when searching for genes for human-specific communication abilities. The database and genome-wide expression analyses we present here revealed a clustering of such communication-associated genes (COAG) on human chromosomes X and 7, in particular chromosome 7q31-q36. Compared to the rest of the genome, we found a high number of COAG to be differentially expressed in the cortices of humans and non-human primates (chimpanzee, baboon, and/or marmoset). The role of X-linked genes for the development of human-specific cognitive abilities is well known. We now propose that chromosome 7q31-q36 also represents a hot spot for the evolution of human-specific communication abilities. Selective pressure on the T cell receptor beta locus on chromosome 7q34, which plays a pivotal role in the immune system, could have led to rapid dissemination of positive gene variants in hitchhiking COAG. Copyright © 2012 S. Karger AG, Basel.

Comparison of the chromosome maps around a resistance hot spot on chromosome 5 of potato and tomato using BAC-FISH painting.

PubMed

Achenbach, Ute C; Tang, Xiaomin; Ballvora, Agim; de Jong, Hans; Gebhardt, Christiane

2010-02-01

Potato chromosome 5 harbours numerous genes for important qualitative and quantitative traits, such as resistance to the root cyst nematode Globodera pallida and the late blight fungus, Phytophthora infestans. The genes make up part of a "hot spot" for resistances to various pathogens covering a genetic map length of 3 cM between markers GP21 and GP179. We established the physical size and position of this region on chromosome 5 in potato and tomato using fluorescence in situ hybridization (FISH) on pachytene chromosomes. Five potato bacterial artificial chromosome (BAC) clones with the genetically anchored markers GP21, R1-contig (proximal end), CosA, GP179, and StPto were selected, labeled with different fluorophores, and hybridized in a five-colour FISH experiment. Our results showed the location of the BAC clones in the middle of the long arm of chromosome 5 in both potato and tomato. Based on chromosome measurements, we estimate the physical size of the GP21-GP179 interval at 0.85 Mb and 1.2 Mb in potato and tomato, respectively. The GP21-GP179 interval is part of a genome segment known to have inverted map positions between potato and tomato.

Inter- and Intra-Chromosomal Aberrations in Human Cells Exposed in vitro to Space-like Radiations

NASA Technical Reports Server (NTRS)

Hada, Megumi; Cucinotta, F. A.; Gonda, S. R.; Wu, H.

2005-01-01

Energetic heavy ions pose a great health risk to astronauts in extended ISS and future exploration missions. High-LET heavy ions are particularly effective in causing various biological effects, including cell inactivation, genetic mutations and cancer induction. Most of these biological endpoints are closely related to chromosomal damage, which can be utilized as a biomarker for radiation insults. Previously, we had studied chromosome aberrations in human lymphocytes and fibroblasts induced by both low- and high-LET radiation using FISH and multicolor fluorescence in situ hybridization (mFISH) techniques. In this study, we exposed human cells in vitro to gamma rays and energetic particles of varying types and energies and dose rates, and analyzed chromosomal damages using the multicolor banding in situ hybridization (mBAND) procedure. Confluent human epithelial cells and lymphocytes were exposed to energetic heavy ions at NASA Space Radiation Laboratory (NSRL) at the Brookhaven National Laboratory (Upton, NY) or Cs-137 gamma radiation source at the Baylor College (Houston, TX). After colcemid and Calyculin A treatment, cells were fixed and painted with XCyte3 mBAND kit (MetaSystems) and chromosome aberrations were analyzed with mBAND analysis system (MetaSystems). With this technique, individually painted chromosomal bands on one chromosome allowed the identification of interchromosomal aberrations (translocation to unpainted chromosomes) and intrachromosomal aberrations (inversions and deletions within a single painted chromosome). The possible relationship between the frequency of inter- and intra-chromosomal exchanges and the track structure of radiation is discussed. The work was supported by the NASA Space Radiation Health Program.

5meCpG epigenetic marks neighboring a primate-conserved core promoter short tandem repeat indicate X-chromosome inactivation.

PubMed

Machado, Filipe Brum; Machado, Fabricio Brum; Faria, Milena Amendro; Lovatel, Viviane Lamim; Alves da Silva, Antonio Francisco; Radic, Claudia Pamela; De Brasi, Carlos Daniel; Rios, Álvaro Fabricio Lopes; de Sousa Lopes, Susana Marina Chuva; da Silveira, Leonardo Serafim; Ruiz-Miranda, Carlos Ramon; Ramos, Ester Silveira; Medina-Acosta, Enrique

2014-01-01

X-chromosome inactivation (XCI) is the epigenetic transcriptional silencing of an X-chromosome during the early stages of embryonic development in female eutherian mammals. XCI assures monoallelic expression in each cell and compensation for dosage-sensitive X-linked genes between females (XX) and males (XY). DNA methylation at the carbon-5 position of the cytosine pyrimidine ring in the context of a CpG dinucleotide sequence (5meCpG) in promoter regions is a key epigenetic marker for transcriptional gene silencing. Using computational analysis, we revealed an extragenic tandem GAAA repeat 230-bp from the landmark CpG island of the human X-linked retinitis pigmentosa 2 RP2 promoter whose 5meCpG status correlates with XCI. We used this RP2 onshore tandem GAAA repeat to develop an allele-specific 5meCpG-based PCR assay that is highly concordant with the human androgen receptor (AR) exonic tandem CAG repeat-based standard HUMARA assay in discriminating active (Xa) from inactive (Xi) X-chromosomes. The RP2 onshore tandem GAAA repeat contains neutral features that are lacking in the AR disease-linked tandem CAG repeat, is highly polymorphic (heterozygosity rates approximately 0.8) and shows minimal variation in the Xa/Xi ratio. The combined informativeness of RP2/AR is approximately 0.97, and this assay excels at determining the 5meCpG status of alleles at the Xp (RP2) and Xq (AR) chromosome arms in a single reaction. These findings are relevant and directly translatable to nonhuman primate models of XCI in which the AR CAG-repeat is monomorphic. We conducted the RP2 onshore tandem GAAA repeat assay in the naturally occurring chimeric New World monkey marmoset (Callitrichidae) and found it to be informative. The RP2 onshore tandem GAAA repeat will facilitate studies on the variable phenotypic expression of dominant and recessive X-linked diseases, epigenetic changes in twins, the physiology of aging hematopoiesis, the pathogenesis of age-related hematopoietic

5meCpG Epigenetic Marks Neighboring a Primate-Conserved Core Promoter Short Tandem Repeat Indicate X-Chromosome Inactivation

PubMed Central

Machado, Filipe Brum; Machado, Fabricio Brum; Faria, Milena Amendro; Lovatel, Viviane Lamim; Alves da Silva, Antonio Francisco; Radic, Claudia Pamela; De Brasi, Carlos Daniel; Rios, Álvaro Fabricio Lopes; de Sousa Lopes, Susana Marina Chuva; da Silveira, Leonardo Serafim; Ruiz-Miranda, Carlos Ramon; Ramos, Ester Silveira; Medina-Acosta, Enrique

2014-01-01

X-chromosome inactivation (XCI) is the epigenetic transcriptional silencing of an X-chromosome during the early stages of embryonic development in female eutherian mammals. XCI assures monoallelic expression in each cell and compensation for dosage-sensitive X-linked genes between females (XX) and males (XY). DNA methylation at the carbon-5 position of the cytosine pyrimidine ring in the context of a CpG dinucleotide sequence (5meCpG) in promoter regions is a key epigenetic marker for transcriptional gene silencing. Using computational analysis, we revealed an extragenic tandem GAAA repeat 230-bp from the landmark CpG island of the human X-linked retinitis pigmentosa 2 RP2 promoter whose 5meCpG status correlates with XCI. We used this RP2 onshore tandem GAAA repeat to develop an allele-specific 5meCpG-based PCR assay that is highly concordant with the human androgen receptor (AR) exonic tandem CAG repeat-based standard HUMARA assay in discriminating active (Xa) from inactive (Xi) X-chromosomes. The RP2 onshore tandem GAAA repeat contains neutral features that are lacking in the AR disease-linked tandem CAG repeat, is highly polymorphic (heterozygosity rates approximately 0.8) and shows minimal variation in the Xa/Xi ratio. The combined informativeness of RP2/AR is approximately 0.97, and this assay excels at determining the 5meCpG status of alleles at the Xp (RP2) and Xq (AR) chromosome arms in a single reaction. These findings are relevant and directly translatable to nonhuman primate models of XCI in which the AR CAG-repeat is monomorphic. We conducted the RP2 onshore tandem GAAA repeat assay in the naturally occurring chimeric New World monkey marmoset (Callitrichidae) and found it to be informative. The RP2 onshore tandem GAAA repeat will facilitate studies on the variable phenotypic expression of dominant and recessive X-linked diseases, epigenetic changes in twins, the physiology of aging hematopoiesis, the pathogenesis of age-related hematopoietic

Distribution of Chromosome Breakpoints in Human Epithelial Cells Exposed to Low- and High-LET Radiations

NASA Technical Reports Server (NTRS)

Hada, Megumi; Cucinotta, Francis; Wu, Honglu

2009-01-01

The advantage of the multicolor banding in situ hybridization (mBAND) technique is not only its ability to identify simultaneously both inter- and intrachromosome exchanges, but also the ability to measure the breakpoint location along the length of the chromosome in a precision that is unmatched with other traditional banding techniques. Breakpoints on specific regions of a chromosome have been known to associate with specific cancers. The breakpoint distribution in cells after low- and high-LET radiation exposures will also provide the data for biophysical modeling of the chromatin structure, as well as the data for the modeling the formation of radiation-induced chromosome aberrations. In a series of experiments, we studied low- and high-LET radiation-induced chromosome aberrations using the mBAND technique with chromosome 3 painted in 23 different colored bands. Human epithelial cells (CH1 84B5F5/M10) were exposed in vitro to Cs- 137 rays at both low and high dose rates, secondary neutrons with a broad energy spectrum at a low dose rate and 600 MeV/u Fe ions at a high dose rate. The data of both inter- and intrachromosome aberrations involving the painted chromosome have been reported previously. Here we present data of the location of the chromosome breaks along the length of chromosome 3 in the cells after exposures to each of the four radiation scenarios. In comparison to the expected breakpoint distribution based on the length of the bands, the observed distribution appeared to be non-random for both the low- and high-LET radiations. In particular, hot spots towards both ends of the chromosome were found after low-LET irradiations of either low or high dose rates. For both high-LET radiation types (Fe ions and neutrons), the breakpoint distributions were similar, and were much smoother than that for low-LET radiation. The dependence of the breakpoint distribution on the radiation quality requires further investigations.

A First Generation Comparative Chromosome Map between Guinea Pig (Cavia porcellus) and Humans.

PubMed

Romanenko, Svetlana A; Perelman, Polina L; Trifonov, Vladimir A; Serdyukova, Natalia A; Li, Tangliang; Fu, Beiyuan; O'Brien, Patricia C M; Ng, Bee L; Nie, Wenhui; Liehr, Thomas; Stanyon, Roscoe; Graphodatsky, Alexander S; Yang, Fengtang

2015-01-01

The domesticated guinea pig, Cavia porcellus (Hystricomorpha, Rodentia), is an important laboratory species and a model for a number of human diseases. Nevertheless, genomic tools for this species are lacking; even its karyotype is poorly characterized. The guinea pig belongs to Hystricomorpha, a widespread and important group of rodents; so far the chromosomes of guinea pigs have not been compared with that of other hystricomorph species or with any other mammals. We generated full sets of chromosome-specific painting probes for the guinea pig by flow sorting and microdissection, and for the first time, mapped the chromosomal homologies between guinea pig and human by reciprocal chromosome painting. Our data demonstrate that the guinea pig karyotype has undergone extensive rearrangements: 78 synteny-conserved human autosomal segments were delimited in the guinea pig genome. The high rate of genome evolution in the guinea pig may explain why the HSA7/16 and HSA16/19 associations presumed ancestral for eutherians and the three syntenic associations (HSA1/10, 3/19, and 9/11) considered ancestral for rodents were not found in C. porcellus. The comparative chromosome map presented here is a starting point for further development of physical and genetic maps of the guinea pig as well as an aid for genome assembly assignment to specific chromosomes. Furthermore, the comparative mapping will allow a transfer of gene map data from other species. The probes developed here provide a genomic toolkit, which will make the guinea pig a key species to unravel the evolutionary biology of the Hystricomorph rodents.

A First Generation Comparative Chromosome Map between Guinea Pig (Cavia porcellus) and Humans

PubMed Central

Romanenko, Svetlana A.; Perelman, Polina L.; Trifonov, Vladimir A.; Serdyukova, Natalia A.; Li, Tangliang; Fu, Beiyuan; O’Brien, Patricia C. M.; Ng, Bee L.; Nie, Wenhui; Liehr, Thomas; Stanyon, Roscoe; Graphodatsky, Alexander S.; Yang, Fengtang

2015-01-01

The domesticated guinea pig, Cavia porcellus (Hystricomorpha, Rodentia), is an important laboratory species and a model for a number of human diseases. Nevertheless, genomic tools for this species are lacking; even its karyotype is poorly characterized. The guinea pig belongs to Hystricomorpha, a widespread and important group of rodents; so far the chromosomes of guinea pigs have not been compared with that of other hystricomorph species or with any other mammals. We generated full sets of chromosome-specific painting probes for the guinea pig by flow sorting and microdissection, and for the first time, mapped the chromosomal homologies between guinea pig and human by reciprocal chromosome painting. Our data demonstrate that the guinea pig karyotype has undergone extensive rearrangements: 78 synteny-conserved human autosomal segments were delimited in the guinea pig genome. The high rate of genome evolution in the guinea pig may explain why the HSA7/16 and HSA16/19 associations presumed ancestral for eutherians and the three syntenic associations (HSA1/10, 3/19, and 9/11) considered ancestral for rodents were not found in C. porcellus. The comparative chromosome map presented here is a starting point for further development of physical and genetic maps of the guinea pig as well as an aid for genome assembly assignment to specific chromosomes. Furthermore, the comparative mapping will allow a transfer of gene map data from other species. The probes developed here provide a genomic toolkit, which will make the guinea pig a key species to unravel the evolutionary biology of the Hystricomorph rodents. PMID:26010445

Genomic variation within alpha satellite DNA influences centromere location on human chromosomes with metastable epialleles

PubMed Central

Aldrup-MacDonald, Megan E.; Kuo, Molly E.; Sullivan, Lori L.; Chew, Kimberline

2016-01-01

Alpha satellite is a tandemly organized type of repetitive DNA that comprises 5% of the genome and is found at all human centromeres. A defined number of 171-bp monomers are organized into chromosome-specific higher-order repeats (HORs) that are reiterated thousands of times. At least half of all human chromosomes have two or more distinct HOR alpha satellite arrays within their centromere regions. We previously showed that the two alpha satellite arrays of Homo sapiens Chromosome 17 (HSA17), D17Z1 and D17Z1-B, behave as centromeric epialleles, that is, the centromere, defined by chromatin containing the centromeric histone variant CENPA and recruitment of other centromere proteins, can form at either D17Z1 or D17Z1-B. Some individuals in the human population are functional heterozygotes in that D17Z1 is the active centromere on one homolog and D17Z1-B is active on the other. In this study, we aimed to understand the molecular basis for how centromere location is determined on HSA17. Specifically, we focused on D17Z1 genomic variation as a driver of epiallele formation. We found that D17Z1 arrays that are predominantly composed of HOR size and sequence variants were functionally less competent. They either recruited decreased amounts of the centromere-specific histone variant CENPA and the HSA17 was mitotically unstable, or alternatively, the centromere was assembled at D17Z1-B and the HSA17 was stable. Our study demonstrates that genomic variation within highly repetitive, noncoding DNA of human centromere regions has a pronounced impact on genome stability and basic chromosomal function. PMID:27510565

Mapping of aldose reductase gene sequences to human chromosomes 1, 3, 7, 9, 11, and 13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bateman, J.B.; Kojis, T.; Heinzmann, C.

1993-09-01

Aldose reductase (alditol:NAD(P)+ 1-oxidoreductase; EC 1.1.1.21) (AR) catalyzes the reduction of several aldehydes, including that of glucose, to the corresponding sugar alcohol. Using a complementary DNA clone encoding human AR, the authors mapped the gene sequences to human chromosomes 1, 3, 7, 9, 11, 13, 14, and 18 by somatic cell hybridization. By in situ hybridization analysis, sequences were localized to human chromosomes 1q32-q43, 3p12, 7q31-q35, 9q22, 11p14-p15, and 13q14-q21. As a putative functional AR gene has been mapped to chromosome 7 and a putative pseudogene to chromosome 3, the sequences on the other seven chromosomes may represent other activemore » genes, non-aldose reductase homologous sequences, or pseudogenes. 24 refs., 3 figs., 2 tabs.« less

Flow karyotyping and sorting of human chromosomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gray, J.W.; Lucas, J.; Peters, D.

1986-07-16

Flow cytometry and sorting are becoming increasingly useful as tools for chromosome classfication and for the detection of numerical and structural chromosome aberrations. Chromosomes of a single type can be purified with these tools to facilitate gene mapping or production of chromosome specific recombinant DNA libraries. For analysis of chromosomes with flow cytometry, the chromosomes are extracted from mitotic cells, stained with one or more fluorescent dyes and classified one-by-one according to their dye content(s). Thus, the flow approach is fundamentally different than conventional karyotyping where chromosomes are classified within the context of a metaphase spread. Flow sorting allows purificationmore » of chromosomes that can be distinguished flow cytometrically. The authors describe the basic principles of flow cytometric chromosome classification i.e. flow karyotyping, and chromosome sorting and describe several applications. 30 refs., 8 figs.« less

Damage of chromosoms under irradiation of human blood lymphocytes and development of bystander effect.

PubMed

Shemetun, O V

2016-12-01

the research the distribution of radiation induced damages among chromosomes and their bands in irra diated in vitro human blood lymphocytes and in unirradiated bystander cells.Material and methods of research: cultivation of human peripheral blood lymphocytes by semi micromethod D.A. Hungerford, modeling of radiation induced bystander effect in mixed cultures consisting of irradiated in vitro and non irradiated blood lymphocytes from persons of different gender, GTG staining of metaphase chromosomes and their cytogenetic analysis. Break points in chromosomes under the formation of aberrations were identified in exposed in vitro human peripheral blood lymphocytes in doses 0.25 Gy (95 breaks in 1248 cells) and 1.0 Gy (227 breaks in 726 cells) and in non irradiated bystander cells under their joint cultivation with irradiated in vitro human lymphocytes (51 breaks in 1137 cells at irradiation of adjacent populations of lymphocytes in dose 0.25 Gy and 75 breaks in 1321 cells at irradiation of adjacent population of lymphocytes in a dose 1.0 Gy). The distribution of injuries among the chromo somes and their bands was investigated. in radiation exposed in vitro human peripheral blood lymphocytes as well as in bystander cells the fre quency of damaged bands and number of breaks which localized in them exceeded the control value (p < 0.01). As under direct radiation exposure, as under formation of breaks due to induction of bystander effect, chromosomes were damaged according to their relative length. Location of bands with increasing number of breaks coincided with the «hot spots» of chromosome damage following irradiation and fragile sites. More sensitive to damage were G negative euchromatin chromosome bands, in which were localized 82 88 % breaks. Damageability of telomeric regions in the irradiated cells had no significant difference from the control, while in bystander cells was lower than control value (p < 0.05). O. V. Shemetun.

Haplotype analysis of the apolipoprotein gene cluster on human chromosome 11

PubMed Central

Olivier, Michael; Wang, Xujing; Cole, Regina; Gau, Brian; Kim, Jessica; Rubin, Edward M.; Pennacchio, Len A.

2009-01-01

Members of the apolipoprotein gene cluster (APOA1/C3/A4/A5) on human chromosome 11q23 play an important role in lipid metabolism. Polymorphisms in both APOA5 and APOC3 are strongly associated with plasma triglyceride concentrations. The close genomic locations of these two genes as well as their functional similarity have hindered efforts to define whether each gene independently influences human triglyceride concentrations. In this study, we examined the linkage disequilibrium and haplotype structure of 49 SNPs in a 150-kb region spanning the gene cluster. We identified a total of five common APOA5 haplotypes with a frequency of greater than 8% in samples of northern European origin. The APOA5 haplotype block did not extend past the 7 SNPs in the gene and was separated from the other apolipoprotein gene in the cluster by a region of significantly increased recombination. Furthermore, one previously identified triglyceride risk haplotype of APOA5 (APOA5*3) showed no association with three APOC3 SNPs previously associated with triglyceride concentrations, in contrast to the other risk haplotype (APOA5*2), which was associated with all three minor APOC3 SNP alleles. These results highlight the complex genetic relationship between APOA5 and APOC3 and support the notion that APOA5 represents an independent risk gene affecting plasma triglyceride concentrations in humans. PMID:15081120

Mouse model systems to study sex chromosome genes and behavior: relevance to humans

PubMed Central

Cox, Kimberly H.; Bonthuis, Paul J.; Rissman, Emilie F.

2014-01-01

Sex chromosome genes directly influence sex differences in behavior. The discovery of the Sry gene on the Y chromosome (Gubbay et al., 1990; Koopman et al., 1990) substantiated the sex chromosome mechanistic link to sex differences. Moreover, the pronounced connection between X chromosome gene mutations and mental illness produces a strong sex bias in these diseases. Yet, the dominant explanation for sex differences continues to be the gonadal hormones. Here we review progress made on behavioral differences in mouse models that uncouple sex chromosome complement from gonadal sex. We conclude that many social and cognitive behaviors are modified by sex chromosome complement, and discuss the implications for human research. Future directions need to include identification of the genes involved and interactions with these genes and gonadal hormones. PMID:24388960

Protannotator: a semiautomated pipeline for chromosome-wise functional annotation of the "missing" human proteome.

PubMed

Islam, Mohammad T; Garg, Gagan; Hancock, William S; Risk, Brian A; Baker, Mark S; Ranganathan, Shoba

2014-01-03

The chromosome-centric human proteome project (C-HPP) aims to define the complete set of proteins encoded in each human chromosome. The neXtProt database (September 2013) lists 20,128 proteins for the human proteome, of which 3831 human proteins (∼19%) are considered "missing" according to the standard metrics table (released September 27, 2013). In support of the C-HPP initiative, we have extended the annotation strategy developed for human chromosome 7 "missing" proteins into a semiautomated pipeline to functionally annotate the "missing" human proteome. This pipeline integrates a suite of bioinformatics analysis and annotation software tools to identify homologues and map putative functional signatures, gene ontology, and biochemical pathways. From sequential BLAST searches, we have primarily identified homologues from reviewed nonhuman mammalian proteins with protein evidence for 1271 (33.2%) "missing" proteins, followed by 703 (18.4%) homologues from reviewed nonhuman mammalian proteins and subsequently 564 (14.7%) homologues from reviewed human proteins. Functional annotations for 1945 (50.8%) "missing" proteins were also determined. To accelerate the identification of "missing" proteins from proteomics studies, we generated proteotypic peptides in silico. Matching these proteotypic peptides to ENCODE proteogenomic data resulted in proteomic evidence for 107 (2.8%) of the 3831 "missing proteins, while evidence from a recent membrane proteomic study supported the existence for another 15 "missing" proteins. The chromosome-wise functional annotation of all "missing" proteins is freely available to the scientific community through our web server (http://biolinfo.org/protannotator).

Mapping biomedical concepts onto the human genome by mining literature on chromosomal aberrations

PubMed Central

Van Vooren, Steven; Thienpont, Bernard; Menten, Björn; Speleman, Frank; Moor, Bart De; Vermeesch, Joris; Moreau, Yves

2007-01-01

Biomedical literature provides a rich but unstructured source of associations between chromosomal regions and biomedical concepts. By mining MEDLINE abstracts, we annotate the human genome at the level of cytogenetic bands. Our method creates a set of chromosomal aberration maps that associate cytogenetic bands to biomedical concepts from a variety of controlled vocabularies, including disease, dysmorphology, anatomy, development and Gene Ontology branches. The association between a band (e.g. 4p16.3) and a concept (e.g. microcephaly) is assessed by the statistical overrepresentation of this concept in the abstracts relating to this band. Our method is validated using existing genome annotation resources and known chromosomal aberration maps and is further illustrated through a case study on heart disease. Our chromosomal aberration maps provide diagnostics support to clinical geneticists, aid cytogeneticists to interpret and report cytogenetic findings and support researchers interested in human gene function. The method is available as a web application, aBandApart, at http://www.esat.kuleuven.be/abandapart/. PMID:17403693

Repression of hTERT transcription by the introduction of chromosome 3 into human oral squamous cell carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishio, Sachiyo; Department of Biomedical Science, Institute of Regenerative Medicine and Biofunction, Graduate School of Medical Science, Tottori University, Yonago, Tottori, 683-8503; Ohira, Takahito

Telomerase is a ribonucleoprotein enzyme that maintains telomere length. Telomerase activity is primarily attributed to the expression of telomerase reverse transcriptase (TERT). It has been reported that introduction of an intact human chromosome 3 into the human oral squamous cell carcinoma cell line HSC3 suppresses the tumorigenicity of these cells. However, the mechanisms that regulate tumorigenicity have not been elucidated. To determine whether this reduction in tumorigenicity was accompanied by a reduction in telomerase activity, we investigated the transcriptional activation of TERT in HSC3 microcell hybrid clones with an introduced human chromosome 3 (HSC3#3). HSC#3 cells showed inhibition of hTERT transcriptionmore » compared to that of the parental HSC3 cells. Furthermore, cell fusion experiments showed that hybrids of HSC3 cells and cells of the RCC23 renal carcinoma cell line, which also exhibits suppression of TERT transcription by the introduction of human chromosome 3, also displayed suppressed TERT transcription. These results suggested that human chromosome 3 may carry functionally distinct, additional TERT repressor genes. - Highlights: • hTERT mRNA expression level decreased in the chromosome 3 introduced HSC3 clones. • hTERT mRNA expression level was tend to suppressed in HSC3 and RCC23 hybrid cells. • We provide evidence that human chromosome 3 carries at least two distinct hTERT regulatory factors.« less

Construction of a general human chromosome jumping library, with application to cystic fibrosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Collins, F.S.; Drumm, M.L.; Cole, J.L.

1987-02-27

In many genetic disorders, the responsible gene and its protein product are unknown. The technique known as reverse genetics, in which chromosomal map positions and genetically linked DNA markers are used to identify and clone such genes, is complicated by the fact that the molecular distances from the closest DNA markers to the gene itself are often too large to traverse by standard cloning techniques. To address this situation, a general human chromosome jumping library was constructed that allows the cloning of DNA sequences approximately 100 kilobases away from any starting point in genomic DNA. As an illustration of itsmore » usefulness, this library was searched for a jumping clone, starting at the met oncogene, which is a marker tightly linked to the cystic fibrosis gene that is located on human chromosome 7. Mapping of the new genomic fragment by pulsed field gel electrophoresis confirmed that it resides on chromosome 7 within 240 kilobases downstream of the met gene. The use of chromosome jumping should be applicable to any genetic locus for which a closely linked DNA marker is available.« less

A novel tandem repeat sequence located on human chromosome 4p: isolation and characterization.

PubMed

Kogi, M; Fukushige, S; Lefevre, C; Hadano, S; Ikeda, J E

1997-06-01

In an effort to analyze the genomic region of the distal half of human chromosome 4p, to where Huntington disease and other diseases have been mapped, we have isolated the cosmid clone (CRS447) that was likely to contain a region with specific repeat sequences. Clone CRS447 was subjected to detailed analysis, including chromosome mapping, restriction mapping, and DNA sequencing. Chromosome mapping by both a human-CHO hybrid cell panel and FISH revealed that CRS447 was predominantly located in the 4p15.1-15.3 region. CRS447 was shown to consist of tandem repeats of 4.7-kb units present on chromosome 4p. A single EcoRI unit was subcloned (pRS447), and the complete sequence was determined as 4752 nucleotides. When pRS447 was used as a probe, the number of copies of this repeat per haploid genome was estimated to be 50-70. Sequence analysis revealed that it contained two internal CA repeats and one putative ORF. Database search established that this sequence was unreported. However, two homologous STS markers were found in the database. We concluded that CRS447/pRS447 is a novel tandem repeat sequence that is mainly specific to human chromosome 4p.

Chromosome Variations And Human Behavior

ERIC Educational Resources Information Center

Soudek, D.

1974-01-01

Article focused on the science of cytogenetics, which studied the transmission of the units of heredity called chromosomes, and considered the advantage of proper diagnosis of genetic diseases, treated on the chromosomal level. (Author/RK)

Genomic structure and chromosomal mapping of the human CD22 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilson, G.L.; Kozlow, E.; Kehrl, J.H.

1993-06-01

The human CD22 gene is expressed specifically in B lymphocytes and likely has an important function in cell-cell interactions. A nearly full length human CD22 cDNA clone was used to isolate genomic clones that span the CD22 gene. The CD22 gene is spread over 22 kb of DNA and is composed of 15 exons. The first exon contains the major transcriptional start sites. The translation initiation codon is located in exon 3, which also encodes a portion of the signal peptide. Exons 4 to 10 encode the seven Ig domains of CD22, exon 11 encodes the transmembrane domain, exons 12more » to 15 encode the intracytoplasmic domain of CD22, and exon 15 also contains the 3' untranslated region. A minor form of CD22 mRNA likely results from splicing of exon 5 to exon 8, skipping exons 6 and 7. A 4.6-kb Xbal fragment of the CD22 gene was used to map the chromosomal location of CD22 by fluorescence in situ hybridization. The hybridization locus was identified by combining fluorescent images of the probe with the chromosomal banding pattern generated by an Alu probe. The results demonstrate the CD22 is located within the band region q13.1 of chromosome 19. Two closely clustered major transcription start sites and several minor start sites were mapped by primer extension. Similarly to many other lymphoid-specific genes, the CD22 promoter lacks an obvious TATA box. Approximately 4 kb of DNA 5' of the transcription start sites were sequenced and found to contain multiple Alu elements. Potential binding sites for the transcriptional factors NF-kB, AP-1, and Oct-2 are located within 300 bp 5' of the major transcription start sites. A 400-bp fragment (bp -339 through +71) of the CD22 promoter region was subcloned into a pGEM-chloramphenicol acetyltransferase vector and after transfection into B and T cells was found to be active in both B and T cells. 45 refs., 7 figs., 2 tabs.« less

Centromere reference models for human chromosomes X and Y satellite arrays

PubMed Central

Miga, Karen H.; Newton, Yulia; Jain, Miten; Altemose, Nicolas; Willard, Huntington F.; Kent, W. James

2014-01-01

The human genome sequence remains incomplete, with multimegabase-sized gaps representing the endogenous centromeres and other heterochromatic regions. Available sequence-based studies within these sites in the genome have demonstrated a role in centromere function and chromosome pairing, necessary to ensure proper chromosome segregation during cell division. A common genomic feature of these regions is the enrichment of long arrays of near-identical tandem repeats, known as satellite DNAs, which offer a limited number of variant sites to differentiate individual repeat copies across millions of bases. This substantial sequence homogeneity challenges available assembly strategies and, as a result, centromeric regions are omitted from ongoing genomic studies. To address this problem, we utilize monomer sequence and ordering information obtained from whole-genome shotgun reads to model two haploid human satellite arrays on chromosomes X and Y, resulting in an initial characterization of 3.83 Mb of centromeric DNA within an individual genome. To further expand the utility of each centromeric reference sequence model, we evaluate sites within the arrays for short-read mappability and chromosome specificity. Because satellite DNAs evolve in a concerted manner, we use these centromeric assemblies to assess the extent of sequence variation among 366 individuals from distinct human populations. We thus identify two satellite array variants in both X and Y centromeres, as determined by array length and sequence composition. This study provides an initial sequence characterization of a regional centromere and establishes a foundation to extend genomic characterization to these sites as well as to other repeat-rich regions within complex genomes. PMID:24501022

[THE INFLUENCE OF THE PREPARATION PRETREATMENT ON IN SITU DETECTION OF 5-METHYLCYTOSINE IN METAPHASE CHROMOSOMES AND IN INTERPHASE NUCLEI].

PubMed

Grudinina, N A; Sasina, L K; Noniashvili, E M; Neronova, E G; Pavlinova, L I; Suchkova, I O; Sofronov, G A; Patkin, E L

2015-01-01

Qualitative and quantitate analysis of DNA methylation in situ at the level of cells, chromosomes and chromosomal domains is extremely important for the diagnosis and treatment of various diseases, the study of ageing and the consequences of environmental impacts. An important question arises, whether the revealed in situ methylation pattern reflects DNA methylation per se and (or) availability of the DNA for antibodies, which in turn depends on the peculiarities of chromatin structure and chromosome condensation. These events can lead to an incorrect evaluation of the actual pattern of DNA methylation. To avoid this shortcoming as far as possible, we have modified the most widely used method of revealing 5-methylcytosine in situ with monoclonal antibodies. Here we have shown that the detection of DNA methylation staining of chromosomes including C-heterochromatin, chromosomal arms and sister chromatids is drastically dependent on pretreatment of chromosomal preparations for immunocytochemical study using fluorescent antibodies. Using undifferentiated stem cells of mouse embryonal carcinoma line F9, it has been found that change in preparations storage results in a sharp fluorescence decrease up to complete disappearance of the signal in centromeric heterochromatin. With the help of the method described in the work, we have first revealed the asymmetry of sister chromatids methylation in metaphase chromosomes of F9 cell and lymphocytes of human periphery blood. This may lead to asymmetry of transcriptional signature of daughter cells after division. The proposed here modification of 5-methylcytosine detection in situ provides a more complete characterization of methylation of chromosomes and chromosomal domains, compared to previously published methods.

Inferring human history in East Asia from Y chromosomes.

PubMed

Wang, Chuan-Chao; Li, Hui

2013-06-03

East Asia harbors substantial genetic, physical, cultural and linguistic diversity, but the detailed structures and interrelationships of those aspects remain enigmatic. This question has begun to be addressed by a rapid accumulation of molecular anthropological studies of the populations in and around East Asia, especially by Y chromosome studies. The current Y chromosome evidence suggests multiple early migrations of modern humans from Africa via Southeast Asia to East Asia. After the initial settlements, the northward migrations during the Paleolithic Age shaped the genetic structure in East Asia. Subsequently, recent admixtures between Central Asian immigrants and northern East Asians enlarged the genetic divergence between southern and northern East Asia populations. Cultural practices, such as languages, agriculture, military affairs and social prestige, also have impacts on the genetic patterns in East Asia. Furthermore, application of Y chromosome analyses in the family genealogy studies offers successful showcases of the utility of genetics in studying the ancient history.

Inferring human history in East Asia from Y chromosomes

PubMed Central

2013-01-01

East Asia harbors substantial genetic, physical, cultural and linguistic diversity, but the detailed structures and interrelationships of those aspects remain enigmatic. This question has begun to be addressed by a rapid accumulation of molecular anthropological studies of the populations in and around East Asia, especially by Y chromosome studies. The current Y chromosome evidence suggests multiple early migrations of modern humans from Africa via Southeast Asia to East Asia. After the initial settlements, the northward migrations during the Paleolithic Age shaped the genetic structure in East Asia. Subsequently, recent admixtures between Central Asian immigrants and northern East Asians enlarged the genetic divergence between southern and northern East Asia populations. Cultural practices, such as languages, agriculture, military affairs and social prestige, also have impacts on the genetic patterns in East Asia. Furthermore, application of Y chromosome analyses in the family genealogy studies offers successful showcases of the utility of genetics in studying the ancient history. PMID:23731529

Sex chromosome-dependent differential viability of human spermatozoa during prolonged incubation.

PubMed

You, Young-Ah; Kwon, Woo-Sung; Saidur Rahman, Md; Park, Yoo-Jin; Kim, Young-Ju; Pang, Myung-Geol

2017-06-01

Are there significant differences in the ability of X chromosome-bearing (X) spermatozoa and Y chromosome-bearing (Y) spermatozoa to survive incubation under stressful conditions? Y spermatozoa are more vulnerable to stress than their X counterparts depending on culture period and temperature, and show higher expression of apoptotic proteins. The primary sex ratio is determined by there being an equal number of spermatozoa carrying X and Y chromosomes. This balance can be skewed by exposure to stressful environmental conditions such as changes in pH, pollutants or endocrine disruptors. However, less is known about the ability of sperm carrying either sex chromosome to withstand environmental stress. The difference in survival between X and Y spermatozoa was evaluated by measuring motility, viability and Y:X chromosome ratio during incubation for 5 days, at three temperatures (4, 22 and 37°C), and three pH conditions (6.5, 7.5 and 8.5). To identify the critical factors that determine the survival of X and Y bearing spermatozoa, we analysed the expression levels of apoptosis-related proteins (Bcl, Bax and Caspase-3), as well as the extent of DNA damage under a subset of conditions. Semen samples were obtained by masturbation from normozoospermic donors after 3 days of sexual abstinence. Four samples with >60% motility from different donors were mixed to obtain sufficient semen and eliminate sampling-related bias. Data are presented as mean ± SD of three independent experiments. Mean age of donors was 28.7 ± 3.2 years. In total, 58 489 spermatozoa were scored. The viability of Y spermatozoa was lower after exposure to different temperatures and culture periods than that of X spermatozoa (P < 0.05). Increased expression of apoptotic proteins in live Y spermatozoa was observed, despite the addition of tocopherol to the culture medium (P < 0.05). Spermatozoa were cultured in vitro during the treatment period. It is difficult to extrapolate the observed lifespan

Aneuploidy in immortalized human mesenchymal stem cells with non-random loss of chromosome 13 in culture.

PubMed

Takeuchi, Masao; Takeuchi, Kikuko; Ozawa, Yutaka; Kohara, Akihiro; Mizusawa, Hiroshi

2009-01-01

Aneuploidy (an abnormal number of chromosomes) is commonly observed in most human cancer cells, highlighting the need to examine chromosomal instability in tumorigenesis. Previously, the immortalized human mesenchymal stem cell line UE6E7T-3 was shown to undergo a preferential loss of one copy of chromosome 13 after prolonged culture. Here, the loss of chromosome 13 was found to be caused by chromosome missegregation during mitosis, which involved unequal segregation, exclusion of the misaligned chromosome 13 on the metaphase plate, and trapping of chromosome 13 in the midbody region, as observed by fluorescence in situ hybridization. Near-diploid aneuploidy, not tetraploidy, was the direct result. The loss of chromosome 13 was non-random, and was detected by analysis of microsatellites and single nucleotide polymorphism-based loss of heterozygosity (LOH). Of the five microsatellite loci on chromosome 13, four loci showed microsatellite instability at an early stage in culture, and LOH was apparent at a late stage in culture. These results suggest that the microsatellite mutations cause changes in centromere integrity provoking loss of this chromosome in the UE6E7T-3 cell line. Thus, these results support the use of this cell line as a useful model for understanding the mechanism of aneuploid formation in cell cultures.

Genomic organization, complete sequence, and chromosomal location of the gene for human eotaxin (SCYA11), an eosinophil-specific CC chemokine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garcia-Zepeda, E.A.; Sarafi, M.N.; Luster, A.D.

1997-05-01

Eotaxin is a CC chemokine that is a specific chemoattractant for eosinophils and is implicated in the pathogenesis of eosinophilic inflammatory diseases, such as asthma. We describe the genomic organization, complete sequence, including 1354 bp 5{prime} of the RNA initiation site, and chromosomal localization of the human eotaxin gene. Fluorescence in situ hybridization analysis localized eotaxin to human chromosome 17, in the region q21.1-q21.2, and the human gene name SCYA11 was assigned. We also present the 5{prime} flanking sequence of the mouse eotaxin gene and have identified several regulatory elements that are conserved between the murine and the human promoters.more » In particular, the presence of elements such as NF-{Kappa}B, interferon-{gamma} response element, and glucocorticoid response element may explain the observed regulation of the eotaxin gene by cytokines and glucocorticoids. 17 refs., 4 figs., 1 tab.« less

Karyotype evolution of giraffes (Giraffa camelopardalis) revealed by cross-species chromosome painting with Chinese muntjac (Muntiacus reevesi) and human (Homo sapiens) paints.

PubMed

Huang, L; Nesterenko, A; Nie, W; Wang, J; Su, W; Graphodatsky, A S; Yang, F

2008-01-01

Considering the giraffe (Giraffa camelopardalis, GCA, 2n = 30) as a primitive species, its comparative genomic data are critical for our understanding of the karyotype evolution of pecorans. Here, we have established genome-wide chromosomal homologies between giraffe, Chinese muntjac (Muntiacus reevesi, MRE, 2n = 46) and human (Homo sapiens, HSA, 2n = 46) with whole sets of chromosome-specific paints from Chinese muntjac and human, in addition to providing a high-resolution G-banding karyotype of giraffe. Chinese muntjac and human chromosome paints detected 32 and 45 autosomal homologs in the genome of giraffe, respectively. Our results suggest that it would require at least thirteen fissions, six fusions and three intrachromosomal rearrangements to 'transform' the 2n = 44 eutherian ancestral karyotype to the 2n = 58 pecoran ancestral karyotype. During giraffe evolution, some ancestral eutherian syntenies (i.e. association of HSA3/21, 4/8, 7/16, 14/15, 16/19 and two forms of 12/22) have been retained, while several derived syntenies (i.e. associations of human homologous segments 2/1, 2/9, 5/19, 4/12/22, 8/9, and 10/20) have been produced. The reduction of chromosome number in giraffe from the 2n = 58 pecoran ancestral karyotype could be primarily attributed to extensive Robertsonian translocations of ancestral chromosomal segments. More complex chromosomal rearrangements (including tandem fusion, centromere repositioning and pericentric inversion) have happened during the evolution of GCA2 and GCA8. Copyright 2008 S. Karger AG, Basel.

Yleaf: Software for Human Y-Chromosomal Haplogroup Inference from Next-Generation Sequencing Data.

PubMed

Ralf, Arwin; Montiel González, Diego; Zhong, Kaiyin; Kayser, Manfred

2018-05-01

Next-generation sequencing (NGS) technologies offer immense possibilities given the large genomic data they simultaneously deliver. The human Y-chromosome serves as good example how NGS benefits various applications in evolution, anthropology, genealogy, and forensics. Prior to NGS, the Y-chromosome phylogenetic tree consisted of a few hundred branches, based on NGS data, it now contains many thousands. The complexity of both, Y tree and NGS data provide challenges for haplogroup assignment. For effective analysis and interpretation of Y-chromosome NGS data, we present Yleaf, a publically available, automated, user-friendly software for high-resolution Y-chromosome haplogroup inference independently of library and sequencing methods.

Comparative sequence analysis of a region on human chromosome 13q14, frequently deleted in B-cell chronic lymphocytic leukemia, and its homologous region on mouse chromosome 14.

PubMed

Kapanadze, B; Makeeva, N; Corcoran, M; Jareborg, N; Hammarsund, M; Baranova, A; Zabarovsky, E; Vorontsova, O; Merup, M; Gahrton, G; Jansson, M; Yankovsky, N; Einhorn, S; Oscier, D; Grandér, D; Sangfelt, O

2000-12-15

Previous studies have indicated the presence of a putative tumor suppressor gene on human chromosome 13q14, commonly deleted in patients with B-cell chronic lymphocytic leukemia (B-CLL). We have recently identified a minimally deleted region encompassing parts of two adjacent genes, termed LEU1 and LEU2 (leukemia-associated genes 1 and 2), and several additional transcripts. In addition, 50 kb centromeric to this region we have identified another gene, LEU5/RFP2. To elucidate further the complex genomic organization of this region, we have identified, mapped, and sequenced the homologous region in the mouse. Fluorescence in situ hybridization analysis demonstrated that the region maps to mouse chromosome 14. The overall organization and gene order in this region were found to be highly conserved in the mouse. Sequence comparison between the human deletion hotspot region and its homologous mouse region revealed a high degree of sequence conservation with an overall score of 74%. However, our data also show that in terms of transcribed sequences, only two of those, human LEU2 and LEU5/RFP2, are clearly conserved, strengthening the case for these genes as putative candidate B-CLL tumor suppressor genes.

The role of human and mouse Y chromosome genes in male infertility.

PubMed

Affara, N A; Mitchell, M J

2000-11-01

It was suggested by Ronald Fisher in 1931 that genes involved in benefit to the male (including spermatogenesis genes) would accumulate on the Y chromosome. The analysis of mouse Y chromosome deletions and the discovery of microdeletions of the human Y chromosome associated with diverse defective spermatogenic phenotypes has revealed the presence of intervals containing one or more genes controlling male germ cell differentiation. These intervals have been mapped, cloned and examined in detail for functional genes. This review discusses the genes mapping to critical spermatogenesis intervals and the evidence indicating which are the most likely candidates underlying Y-linked male infertility.

The SMC-5/6 Complex and the HIM-6 (BLM) Helicase Synergistically Promote Meiotic Recombination Intermediate Processing and Chromosome Maturation during Caenorhabditis elegans Meiosis

PubMed Central

Hong, Ye; Sonneville, Remi; Agostinho, Ana; Meier, Bettina; Wang, Bin; Blow, J. Julian; Gartner, Anton

2016-01-01

Meiotic recombination is essential for the repair of programmed double strand breaks (DSBs) to generate crossovers (COs) during meiosis. The efficient processing of meiotic recombination intermediates not only needs various resolvases but also requires proper meiotic chromosome structure. The Smc5/6 complex belongs to the structural maintenance of chromosome (SMC) family and is closely related to cohesin and condensin. Although the Smc5/6 complex has been implicated in the processing of recombination intermediates during meiosis, it is not known how Smc5/6 controls meiotic DSB repair. Here, using Caenorhabditis elegans we show that the SMC-5/6 complex acts synergistically with HIM-6, an ortholog of the human Bloom syndrome helicase (BLM) during meiotic recombination. The concerted action of the SMC-5/6 complex and HIM-6 is important for processing recombination intermediates, CO regulation and bivalent maturation. Careful examination of meiotic chromosomal morphology reveals an accumulation of inter-chromosomal bridges in smc-5; him-6 double mutants, leading to compromised chromosome segregation during meiotic cell divisions. Interestingly, we found that the lethality of smc-5; him-6 can be rescued by loss of the conserved BRCA1 ortholog BRC-1. Furthermore, the combined deletion of smc-5 and him-6 leads to an irregular distribution of condensin and to chromosome decondensation defects reminiscent of condensin depletion. Lethality conferred by condensin depletion can also be rescued by BRC-1 depletion. Our results suggest that SMC-5/6 and HIM-6 can synergistically regulate recombination intermediate metabolism and suppress ectopic recombination by controlling chromosome architecture during meiosis. PMID:27010650

The SMC-5/6 Complex and the HIM-6 (BLM) Helicase Synergistically Promote Meiotic Recombination Intermediate Processing and Chromosome Maturation during Caenorhabditis elegans Meiosis.

PubMed

Hong, Ye; Sonneville, Remi; Agostinho, Ana; Meier, Bettina; Wang, Bin; Blow, J Julian; Gartner, Anton

2016-03-01

Meiotic recombination is essential for the repair of programmed double strand breaks (DSBs) to generate crossovers (COs) during meiosis. The efficient processing of meiotic recombination intermediates not only needs various resolvases but also requires proper meiotic chromosome structure. The Smc5/6 complex belongs to the structural maintenance of chromosome (SMC) family and is closely related to cohesin and condensin. Although the Smc5/6 complex has been implicated in the processing of recombination intermediates during meiosis, it is not known how Smc5/6 controls meiotic DSB repair. Here, using Caenorhabditis elegans we show that the SMC-5/6 complex acts synergistically with HIM-6, an ortholog of the human Bloom syndrome helicase (BLM) during meiotic recombination. The concerted action of the SMC-5/6 complex and HIM-6 is important for processing recombination intermediates, CO regulation and bivalent maturation. Careful examination of meiotic chromosomal morphology reveals an accumulation of inter-chromosomal bridges in smc-5; him-6 double mutants, leading to compromised chromosome segregation during meiotic cell divisions. Interestingly, we found that the lethality of smc-5; him-6 can be rescued by loss of the conserved BRCA1 ortholog BRC-1. Furthermore, the combined deletion of smc-5 and him-6 leads to an irregular distribution of condensin and to chromosome decondensation defects reminiscent of condensin depletion. Lethality conferred by condensin depletion can also be rescued by BRC-1 depletion. Our results suggest that SMC-5/6 and HIM-6 can synergistically regulate recombination intermediate metabolism and suppress ectopic recombination by controlling chromosome architecture during meiosis.

Features of the organization of bread wheat chromosome 5BS based on physical mapping.

PubMed

Salina, Elena A; Nesterov, Mikhail A; Frenkel, Zeev; Kiseleva, Antonina A; Timonova, Ekaterina M; Magni, Federica; Vrána, Jan; Šafář, Jan; Šimková, Hana; Doležel, Jaroslav; Korol, Abraham; Sergeeva, Ekaterina M

2018-02-09

The IWGSC strategy for construction of the reference sequence of the bread wheat genome is based on first obtaining physical maps of the individual chromosomes. Our aim is to develop and use the physical map for analysis of the organization of the short arm of wheat chromosome 5B (5BS) which bears a number of agronomically important genes, including genes conferring resistance to fungal diseases. A physical map of the 5BS arm (290 Mbp) was constructed using restriction fingerprinting and LTC software for contig assembly of 43,776 BAC clones. The resulting physical map covered ~ 99% of the 5BS chromosome arm (111 scaffolds, N50 = 3.078 Mb). SSR, ISBP and zipper markers were employed for anchoring the BAC clones, and from these 722 novel markers were developed based on previously obtained data from partial sequencing of 5BS. The markers were mapped using a set of Chinese Spring (CS) deletion lines, and F2 and RICL populations from a cross of CS and CS-5B dicoccoides. Three approaches have been used for anchoring BAC contigs on the 5BS chromosome, including clone-by-clone screening of BACs, GenomeZipper analysis, and comparison of BAC-fingerprints with in silico fingerprinting of 5B pseudomolecules of T. dicoccoides. These approaches allowed us to reach a high level of BAC contig anchoring: 96% of 5BS BAC contigs were located on 5BS. An interesting pattern was revealed in the distribution of contigs along the chromosome. Short contigs (200-999 kb) containing markers for the regions interrupted by tandem repeats, were mainly localized to the 5BS subtelomeric block; whereas the distribution of larger 1000-3500 kb contigs along the chromosome better correlated with the distribution of the regions syntenic to rice, Brachypodium, and sorghum, as detected by the Zipper approach. The high fingerprinting quality, LTC software and large number of BAC clones selected by the informative markers in screening of the 43,776 clones allowed us to significantly increase the

Chromosomal Inversions between Human and Chimpanzee Lineages Caused by Retrotransposons

PubMed Central

Lee, Jungnam; Han, Kyudong; Meyer, Thomas J.; Kim, Heui-Soo; Batzer, Mark A.

2008-01-01

The long interspersed element-1 (LINE-1 or L1) and Alu elements are the most abundant mobile elements comprising 21% and 11% of the human genome, respectively. Since the divergence of human and chimpanzee lineages, these elements have vigorously created chromosomal rearrangements causing genomic difference between humans and chimpanzees by either increasing or decreasing the size of genome. Here, we report an exotic mechanism, retrotransposon recombination-mediated inversion (RRMI), that usually does not alter the amount of genomic material present. Through the comparison of the human and chimpanzee draft genome sequences, we identified 252 inversions whose respective inversion junctions can clearly be characterized. Our results suggest that L1 and Alu elements cause chromosomal inversions by either forming a secondary structure or providing a fragile site for double-strand breaks. The detailed analysis of the inversion breakpoints showed that L1 and Alu elements are responsible for at least 44% of the 252 inversion loci between human and chimpanzee lineages, including 49 RRMI loci. Among them, three RRMI loci inverted exonic regions in known genes, which implicates this mechanism in generating the genomic and phenotypic differences between human and chimpanzee lineages. This study is the first comprehensive analysis of mobile element bases inversion breakpoints between human and chimpanzee lineages, and highlights their role in primate genome evolution. PMID:19112500

Three-Dimensional Maps of All Chromosomes in Human Male Fibroblast Nuclei and Prometaphase Rosettes

PubMed Central

Bolzer, Andreas; Kreth, Gregor; Solovei, Irina; Koehler, Daniela; Saracoglu, Kaan; Fauth, Christine; Müller, Stefan; Eils, Roland; Cremer, Christoph; Speicher, Michael R

2005-01-01

Studies of higher-order chromatin arrangements are an essential part of ongoing attempts to explore changes in epigenome structure and their functional implications during development and cell differentiation. However, the extent and cell-type-specificity of three-dimensional (3D) chromosome arrangements has remained controversial. In order to overcome technical limitations of previous studies, we have developed tools that allow the quantitative 3D positional mapping of all chromosomes simultaneously. We present unequivocal evidence for a probabilistic 3D order of prometaphase chromosomes, as well as of chromosome territories (CTs) in nuclei of quiescent (G0) and cycling (early S-phase) human diploid fibroblasts (46, XY). Radial distance measurements showed a probabilistic, highly nonrandom correlation with chromosome size: small chromosomes—independently of their gene density—were distributed significantly closer to the center of the nucleus or prometaphase rosette, while large chromosomes were located closer to the nuclear or rosette rim. This arrangement was independently confirmed in both human fibroblast and amniotic fluid cell nuclei. Notably, these cell types exhibit flat-ellipsoidal cell nuclei, in contrast to the spherical nuclei of lymphocytes and several other human cell types, for which we and others previously demonstrated gene-density-correlated radial 3D CT arrangements. Modeling of 3D CT arrangements suggests that cell-type-specific differences in radial CT arrangements are not solely due to geometrical constraints that result from nuclear shape differences. We also found gene-density-correlated arrangements of higher-order chromatin shared by all human cell types studied so far. Chromatin domains, which are gene-poor, form a layer beneath the nuclear envelope, while gene-dense chromatin is enriched in the nuclear interior. We discuss the possible functional implications of this finding. PMID:15839726

Higher 5-hydroxymethylcytosine identifies immortal DNA strand chromosomes in asymmetrically self-renewing distributed stem cells.

PubMed

Huh, Yang Hoon; Cohen, Justin; Sherley, James L

2013-10-15

Immortal strands are the targeted chromosomal DNA strands of nonrandom sister chromatid segregation, a mitotic chromosome segregation pattern unique to asymmetrically self-renewing distributed stem cells (DSCs). By nonrandom segregation, immortal DNA strands become the oldest DNA strands in asymmetrically self-renewing DSCs. Nonrandom segregation of immortal DNA strands may limit DSC mutagenesis, preserve DSC fate, and contribute to DSC aging. The mechanisms responsible for specification and maintenance of immortal DNA strands are unknown. To discover clues to these mechanisms, we investigated the 5-methylcytosine and 5-hydroxymethylcytosine (5hmC) content on chromosomes in mouse hair follicle DSCs during nonrandom segregation. Although 5-methylcytosine content did not differ significantly, the relative content of 5hmC was significantly higher in chromosomes containing immortal DNA strands than in opposed mitotic chromosomes containing younger mortal DNA strands. The difference in relative 5hmC content was caused by the loss of 5hmC from mortal chromosomes. These findings implicate higher 5hmC as a specific molecular determinant of immortal DNA strand chromosomes. Because 5hmC is an intermediate during DNA demethylation, we propose a ten-eleven translocase enzyme mechanism for both the specification and maintenance of nonrandomly segregated immortal DNA strands. The proposed mechanism reveals a means by which DSCs "know" the generational age of immortal DNA strands. The mechanism is supported by molecular expression data and accounts for the selection of newly replicated DNA strands when nonrandom segregation is initiated. These mechanistic insights also provide a possible basis for another characteristic property of immortal DNA strands, their guanine ribonucleotide dependency.

Interstitial telomeric repeats are not preferentially involved in radiation-induced chromosome aberrations in human cells.

PubMed

Desmaze, C; Pirzio, L M; Blaise, R; Mondello, C; Giulotto, E; Murnane, J P; Sabatier, L

2004-01-01

Telomeric repeat sequences, located at the end of eukaryotic chromosomes, have been detected at intrachromosomal locations in many species. Large blocks of telomeric sequences are located near the centromeres in hamster cells, and have been reported to break spontaneously or after exposure to ionizing radiation, leading to chromosome aberrations. In human cells, interstitial telomeric sequences (ITS) can be composed of short tracts of telomeric repeats (less than twenty), or of longer stretches of exact and degenerated hexanucleotides, mainly localized at subtelomeres. In this paper, we analyzed the radiation sensitivity of a naturally occurring short ITS localized in 2q31 and we found that this region is not a hot spot of radiation-induced chromosome breaks. We then selected a human cell line in which approximately 800 bp of telomeric DNA had been introduced by transfection into an internal euchromatic chromosomal region in chromosome 4q. In parallel, a cell line containing the plasmid without telomeric sequences was also analyzed. Both regions containing the transfected plasmids showed a higher frequency of radiation-induced breaks than expected, indicating that the instability of the regions containing the transfected sequences is not due to the presence of telomeric sequences. Taken together, our data show that ITS themselves do not enhance the formation of radiation-induced chromosome rearrangements in these human cell lines. Copyright 2003 S. Karger AG, Basel

Developing de novo human artificial chromosomes in embryonic stem cells using HSV-1 amplicon technology.

PubMed

Moralli, Daniela; Monaco, Zoia L

2015-02-01

De novo artificial chromosomes expressing genes have been generated in human embryonic stem cells (hESc) and are maintained following differentiation into other cell types. Human artificial chromosomes (HAC) are small, functional, extrachromosomal elements, which behave as normal chromosomes in human cells. De novo HAC are generated following delivery of alpha satellite DNA into target cells. HAC are characterized by high levels of mitotic stability and are used as models to study centromere formation and chromosome organisation. They are successful and effective as gene expression vectors since they remain autonomous and can accommodate larger genes and regulatory regions for long-term expression studies in cells unlike other viral gene delivery vectors currently used. Transferring the essential DNA sequences for HAC formation intact across the cell membrane has been challenging for a number of years. A highly efficient delivery system based on HSV-1 amplicons has been used to target DNA directly to the ES cell nucleus and HAC stably generated in human embryonic stem cells (hESc) at high frequency. HAC were detected using an improved protocol for hESc chromosome harvesting, which consistently produced high-quality metaphase spreads that could routinely detect HAC in hESc. In tumour cells, the input DNA often integrated in the host chromosomes, but in the host ES genome, it remained intact. The hESc containing the HAC formed embryoid bodies, generated teratoma in mice, and differentiated into neuronal cells where the HAC were maintained. The HAC structure and chromatin composition was similar to the endogenous hESc chromosomes. This review will discuss the technological advances in HAC vector delivery using HSV-1 amplicons and the improvements in the identification of de novo HAC in hESc.

Mapping of the gene for the Mel{sub 1a}-melatonin receptor to human chromosome 4 (MTNR1A) and mouse chromosome 8 (Mtnr1a)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Slaugenhaupt, S.A.; Liebert, C.B.; Altherr, M.R.

The pineal hormone melatonin elicits potent circadian and reproductive effects in mammals. The authors report the chromosomal location of the gene for the Mel{sub 1a}-melatonin receptor that likely mediates these circadian and reproductive actions. PCR analysis of human-rodent somatic cell hybrids showed that the receptor gene (MTNR1A) maps to human chromosome 4q35.1. An interspecific backcross analysis revealed that the mouse gene (Mtnr1a) maps to the proximal portion of chromosome 8. These loci may be involved in genetically based circadian and neuroendocrine disorders. 14 refs., 1 fig.

Replication of alpha-satellite DNA arrays in endogenous human centromeric regions and in human artificial chromosome

PubMed Central

Erliandri, Indri; Fu, Haiqing; Nakano, Megumi; Kim, Jung-Hyun; Miga, Karen H.; Liskovykh, Mikhail; Earnshaw, William C.; Masumoto, Hiroshi; Kouprina, Natalay; Aladjem, Mirit I.; Larionov, Vladimir

2014-01-01

In human chromosomes, centromeric regions comprise megabase-size arrays of 171 bp alpha-satellite DNA monomers. The large distances spanned by these arrays preclude their replication from external sites and imply that the repetitive monomers contain replication origins. However, replication within these arrays has not previously been profiled and the role of alpha-satellite DNA in initiation of DNA replication has not yet been demonstrated. Here, replication of alpha-satellite DNA in endogenous human centromeric regions and in de novo formed Human Artificial Chromosome (HAC) was analyzed. We showed that alpha-satellite monomers could function as origins of DNA replication and that replication of alphoid arrays organized into centrochromatin occurred earlier than those organized into heterochromatin. The distribution of inter-origin distances within centromeric alphoid arrays was comparable to the distribution of inter-origin distances on randomly selected non-centromeric chromosomal regions. Depletion of CENP-B, a kinetochore protein that binds directly to a 17 bp CENP-B box motif common to alpha-satellite DNA, resulted in enrichment of alpha-satellite sequences for proteins of the ORC complex, suggesting that CENP-B may have a role in regulating the replication of centromeric regions. Mapping of replication initiation sites in the HAC revealed that replication preferentially initiated in transcriptionally active regions. PMID:25228468

Altered chromosome 6 in immortal human fibroblasts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hubbard-Smith, K.; Pardinas, J.R.; Jha, K.K.

1992-05-01

Human diploid fibroblasts have a limited life span in vitro, and spontaneous immortalization is an extremely rare event. We have used transformation of human diploid fibroblasts by an origin-defective simian virus 40 genome to develop series of genetically matched immortal cell lines to analyze immortalization. Comparison of a preimmortal transformant (SVtsA/HF-A) with its uncloned and cloned immortalized derivatives (AR5 and HAL) has failed to reveal any major alteration involving the simian virus 40 genome. Karyotypic analysis, however, demonstrated that all of the immortal cell lines in this series have alterations of chromosome 6 involving loss of the portion distal tomore » 6q21. The karyotypic analysis was corroborated by DNA analyses. Southern analysis demonstrated that only one copy of three proto-oncogene loci (ros1, c-myb, and mas1) on 6q was retained in immortal cells. Polymerase chain reaction analysis of the microsatellite polymorphism at 6q22 (D6S87) showed loss of heterozygosity. In addition, elevated expression of c-myb (6q22-23) was observed. We hypothesize that the region at and/or distal to 6q21 plays a role in immortalization, consistent with the presence of a growth suppressor gene. 66 refs., 6 figs., 2 tabs.« less

EFFECTS OF INGESTED ARSENIC ON DNA AND CHROMOSOME IN HUMAN EXFOLIATED EPITHELIA

EPA Science Inventory

Effects of Ingested Arsenic on DNA and Chromosome in Human Exfoliated Epithelia

Judy L. Mumford, Human Studies Division, National Health and Environmental Effects Research Laboratory, U.S. Environmental Protection Agency, Research Triangle Park, NC 27711

Arsenic...

The active gene that encodes human High Mobility Group 1 protein (HMG1) contains introns and maps to chromosome 13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ferrari, S.; Finelli, P.; Rocchi, M.

The human genome contains a large number of sequences related to the cDNA for High Mobility Group 1 protein (HMG1), which so far has hampered the cloning and mapping of the active HMG1 gene. We show that the human HMG1 gene contains introns, while the HMG1-related sequences do not and most likely are retrotransposed pseudogenes. We identified eight YACs from the ICI and CEPH libraries that contain the human HMG1 gene. The HMG1 gene is similar in structure to the previously characterized murine homologue and maps to human chromosome 13 and q12, as determined by in situ hybridization. The mousemore » Hmg1 gene maps to the telomeric region of murine Chromosome 5, which is syntenic to the human 13q12 band. 18 refs., 3 figs.« less

Destabilized SMC5/6 complex leads to chromosome breakage syndrome with severe lung disease

PubMed Central

van der Crabben, Saskia N.; Hennus, Marije P.; McGregor, Grant A.; Ritter, Deborah I.; Nagamani, Sandesh C.S.; Wells, Owen S.; Harakalova, Magdalena; Chinn, Ivan K.; Alt, Aaron; Vondrova, Lucie; Hochstenbach, Ron; van Montfrans, Joris M.; Terheggen-Lagro, Suzanne W.; van Lieshout, Stef; van Roosmalen, Markus J.; Renkens, Ivo; Duran, Karen; Nijman, Isaac J.; Kloosterman, Wigard P.; Hennekam, Eric; van Hasselt, Peter M.; Wheeler, David A.; Palecek, Jan J.; Lehmann, Alan R.; Oliver, Antony W.; Pearl, Laurence H.; Plon, Sharon E.; Murray, Johanne M.

2016-01-01

The structural maintenance of chromosomes (SMC) family of proteins supports mitotic proliferation, meiosis, and DNA repair to control genomic stability. Impairments in chromosome maintenance are linked to rare chromosome breakage disorders. Here, we have identified a chromosome breakage syndrome associated with severe lung disease in early childhood. Four children from two unrelated kindreds died of severe pulmonary disease during infancy following viral pneumonia with evidence of combined T and B cell immunodeficiency. Whole exome sequencing revealed biallelic missense mutations in the NSMCE3 (also known as NDNL2) gene, which encodes a subunit of the SMC5/6 complex that is essential for DNA damage response and chromosome segregation. The NSMCE3 mutations disrupted interactions within the SMC5/6 complex, leading to destabilization of the complex. Patient cells showed chromosome rearrangements, micronuclei, sensitivity to replication stress and DNA damage, and defective homologous recombination. This work associates missense mutations in NSMCE3 with an autosomal recessive chromosome breakage syndrome that leads to defective T and B cell function and acute respiratory distress syndrome in early childhood. PMID:27427983

Destabilized SMC5/6 complex leads to chromosome breakage syndrome with severe lung disease.

PubMed

van der Crabben, Saskia N; Hennus, Marije P; McGregor, Grant A; Ritter, Deborah I; Nagamani, Sandesh C S; Wells, Owen S; Harakalova, Magdalena; Chinn, Ivan K; Alt, Aaron; Vondrova, Lucie; Hochstenbach, Ron; van Montfrans, Joris M; Terheggen-Lagro, Suzanne W; van Lieshout, Stef; van Roosmalen, Markus J; Renkens, Ivo; Duran, Karen; Nijman, Isaac J; Kloosterman, Wigard P; Hennekam, Eric; Orange, Jordan S; van Hasselt, Peter M; Wheeler, David A; Palecek, Jan J; Lehmann, Alan R; Oliver, Antony W; Pearl, Laurence H; Plon, Sharon E; Murray, Johanne M; van Haaften, Gijs

2016-08-01

The structural maintenance of chromosomes (SMC) family of proteins supports mitotic proliferation, meiosis, and DNA repair to control genomic stability. Impairments in chromosome maintenance are linked to rare chromosome breakage disorders. Here, we have identified a chromosome breakage syndrome associated with severe lung disease in early childhood. Four children from two unrelated kindreds died of severe pulmonary disease during infancy following viral pneumonia with evidence of combined T and B cell immunodeficiency. Whole exome sequencing revealed biallelic missense mutations in the NSMCE3 (also known as NDNL2) gene, which encodes a subunit of the SMC5/6 complex that is essential for DNA damage response and chromosome segregation. The NSMCE3 mutations disrupted interactions within the SMC5/6 complex, leading to destabilization of the complex. Patient cells showed chromosome rearrangements, micronuclei, sensitivity to replication stress and DNA damage, and defective homologous recombination. This work associates missense mutations in NSMCE3 with an autosomal recessive chromosome breakage syndrome that leads to defective T and B cell function and acute respiratory distress syndrome in early childhood.

A radiation hybrid map of the distal short arm of human chromosome II, containing the Beckwith-Weidemann and associated embroyonal tumor disease loci

DOE Office of Scientific and Technical Information (OSTI.GOV)

Richard, C.W. III; Berg, D.J.; Meeker, T.C.

1993-05-01

The authors describe a high-resolution radiation hybrid (RH) map of the distal short arm of human chromosome 11 containing the Beckwith-Weidemann gene and the associated embryonal tumor disease loci. Thirteen human 11p15 genes and 17 new anonymous probes were mapped by a statistical analysis of the cosegregation of markers in 102 rodent-human radiation hybrids retaining fragments of human chromosome 11. The 17 anonymous probes were generated from lambda phage containing human 11p15.5 inserts, by using ALU-PCR. A comprehensive map of all 30 loci and a framework map of nine clusters of loci ordered at odds of 1,000:1 were constructed bymore » a multipoint maximum-likelihood approach by using the computer program RHMAP. This RH map localizes one new gene to chromosome 11p15 (WEE1), provides more precise order information for several 11p15 genes (CTSD, H19, HPX,.ST5, RNH, and SMPD1), confirms previous map orders for other 11p15 genes (CALCA, PTH, HBBC, TH, HRAS, and DRD4), and maps 17 new anonymous probes within the 11p15.5 region. This RH map should prove useful in better defining the positions of the Beckwith-Weidemann and associated embryonal tumor disease-gene loci. 41 refs., 1 fig., 2 tabs.« less

Higher 5-hydroxymethylcytosine identifies immortal DNA strand chromosomes in asymmetrically self-renewing distributed stem cells

PubMed Central

Huh, Yang Hoon; Cohen, Justin; Sherley, James L.

2013-01-01

Immortal strands are the targeted chromosomal DNA strands of nonrandom sister chromatid segregation, a mitotic chromosome segregation pattern unique to asymmetrically self-renewing distributed stem cells (DSCs). By nonrandom segregation, immortal DNA strands become the oldest DNA strands in asymmetrically self-renewing DSCs. Nonrandom segregation of immortal DNA strands may limit DSC mutagenesis, preserve DSC fate, and contribute to DSC aging. The mechanisms responsible for specification and maintenance of immortal DNA strands are unknown. To discover clues to these mechanisms, we investigated the 5-methylcytosine and 5-hydroxymethylcytosine (5hmC) content on chromosomes in mouse hair follicle DSCs during nonrandom segregation. Although 5-methylcytosine content did not differ significantly, the relative content of 5hmC was significantly higher in chromosomes containing immortal DNA strands than in opposed mitotic chromosomes containing younger mortal DNA strands. The difference in relative 5hmC content was caused by the loss of 5hmC from mortal chromosomes. These findings implicate higher 5hmC as a specific molecular determinant of immortal DNA strand chromosomes. Because 5hmC is an intermediate during DNA demethylation, we propose a ten-eleven translocase enzyme mechanism for both the specification and maintenance of nonrandomly segregated immortal DNA strands. The proposed mechanism reveals a means by which DSCs “know” the generational age of immortal DNA strands. The mechanism is supported by molecular expression data and accounts for the selection of newly replicated DNA strands when nonrandom segregation is initiated. These mechanistic insights also provide a possible basis for another characteristic property of immortal DNA strands, their guanine ribonucleotide dependency. PMID:24082118

Localization of a renal sodium-phosphate cotransporter gene to human chromosome 5q35

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kos, C.H.; Tenenhouse, H.S.; Tihy, F.

1994-01-01

Several Mendelian disorders of renal phosphate reabsorption, associated with hypophosphatemia and bone disease, have been described. These include X-linked hypophosphatemia (XLH), hereditary hypophosphatemic rickets with hypercalciuria, hypophosphatemic bone disease, and autosomal dominant and autosomal recessive hypophosphatemic rickets. The underlying mechanisms for renal phosphate wasting in these disorders remain unknown. The proximal tubule is the major site of renal phosphate reabsorption. Thus, mutations in genes that participate in the transepithelial transport of phosphate in this segment of the nephron may be responsible for these disorders. Recently, a cDNA encoding a renal proximal tubular, brush-border membrane Na[sup +]-phosphate cotransporter (NaP[sub i]-3) wasmore » cloned from human kidney cortex. As a first step in establishing whether mutations in the NaP[sub i]-3 gene are the cause of inherited disorders in phosphate homeostasis, the authors sought to determine its chromosomal localization. 9 refs., 1 fig.« less

The X chromosome of monotremes shares a highly conserved region with the eutherian and marsupial X chromosomes despite the absence of X chromosome inactivation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watson, J.M.; Spencer, J.A.; Graves, J.A.M.

1990-09-01

Eight genes, located on the long arm of the human X chromosome and present on the marsupial X chromosome, were mapped by in situ hybridization to the chromosomes of the platypus Ornithorhynchus anatinus, one of the three species of monotreme mammals. All were located on the X chromosome. The authors conclude that the long arm of the human X chromosome represents a highly conserved region that formed part of the X chromosome in a mammalian ancestor at least 150 million years ago. Since three of these genes are located on the long arm of the platypus X chromosome, which ismore » G-band homologous to the Y chromosome and apparently exempt from X chromosome inactivation, the conservation of this region has evidently not depended on isolation by X-Y chromosome differentiation and X chromosome inactivation.« less

Association of the Philadelphia chromosome and 5q- in secondary blood disorder

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dastugue, N.; Demur, C.; Pris, F.

1988-02-01

A patient developed a secondary blood disorder 7 years after radiotherapy for a gastric lymphoma. The initial myelodysplastic syndrome evolved to a myeloproliferative phase with transient polycythemia, progressive thrombocythemia, and hyperleukocytosis. Chromosome analysis performed in the terminal phase showed del(5)(q13q31),t(9;22)(q34;q11), and a complex rearrangement involving chromosomes number2 and number3. A correlation between chromosomal abnormalities and hematologic findings could be established. In this case, we have assumed that the Philadelphia translocation is a late event, due to prior mutagen exposure, and its association with a common secondary abnormality (5q-), followed by a progressively developing myeloproliferative phase. Furthermore, the association of Phmore » and 5q- in a single clone seems to indicate that the same stem cell is affected by these two abnormalities.« less

Cryptorchidism due to chromosome 5q inversion duplication.

PubMed

Dutta, M K; Gundgurthi, A; Garg, M K; Pakhetr, R

2013-12-01

We present a 15 year old boy who was born out of a non consanguineous marriage, and presented with bilateral cryptorchidism, mental retardation, facial dysmorphism, hypergonadotrophic hypogonadism with failure of anatomical and biochemical localisation of testes. Karyotype analysis showed 46 XY with inverted duplication on chromosome 5q22-31.

Sialoadhesin (Sn) maps to mouse chromosome 2 and human chromosome 20 and is not linked to the other members of the Sialoadhesin family, CD22, MAG, and CD33

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mucklow, S.; Hartnell, A.; Crocker, P.R.

1995-07-20

Sialoadhesin is a cell-cell interaction molecule expressed by subpopulations of tissue macrophages. It contains 17 immunoglobulin (Ig)-like domains and is structurally related to CD22, MAG, and CD33. These molecules establish a distinct family of sialic acid-dependent adhesion molecules, the sialoadhesin family. We have mapped the rodent sialoadhesin gene, Sn, to chromosome 2F-H1 by in situ hybridization (ISH) and shown linkage to Il1b and four other markers by backcross linkage analysis. We have also used ISH and a human-mouse somatic cell hybrid panel to localize the human sialoadhesin gene, SN, to the conserved syntenic region on human chromosome 20p13. This demonstratesmore » that the sialoadhesin gene is not linked to the other members of the sialoadhesin family, CD22, MAG. and CD33, which have been independently mapped to the distal region of mouse chromosome 7 and to human chromosome 19q13.1-3. 19 refs., 1 fig.« less

Investigation of chromosome 17q as a locus for human essential hypertension in African Caribbeans.

PubMed

Knight, J; Gardner, G T; Clark, A J; Caulfield, M J

2000-06-01

Essential hypertension is a major risk factor for cardiovascular disease in humans, and originates from both genetic and environmental factors. Data from animal and more recently human studies have indicated the presence of a gene influencing blood pressure on human chromosome 17. This study tested for linkage of markers located on chromosome 17q to essential hypertension in African Caribbean hypertensive families. No support of linkage was found between the markers studied and hypertension, however only genes of a lamda sib value of less than 1.8 could be excluded Journal of Human Hypertension (2000) 14, 385-387

Active role of a human genomic insert in replication of a yeast artificial chromosome.

PubMed

van Brabant, A J; Fangman, W L; Brewer, B J

1999-06-01

Yeast artificial chromosomes (YACs) are a common tool for cloning eukaryotic DNA. The manner by which large pieces of foreign DNA are assimilated by yeast cells into a functional chromosome is poorly understood, as is the reason why some of them are stably maintained and some are not. We examined the replication of a stable YAC containing a 240-kb insert of DNA from the human T-cell receptor beta locus. The human insert contains multiple sites that serve as origins of replication. The activity of these origins appears to require the yeast ARS consensus sequence and, as with yeast origins, additional flanking sequences. In addition, the origins in the human insert exhibit a spacing, a range of activation efficiencies, and a variation in times of activation during S phase similar to those found for normal yeast chromosomes. We propose that an appropriate combination of replication origin density, activation times, and initiation efficiencies is necessary for the successful maintenance of YAC inserts.

A Study for the Feature Selection to Identify GIEMSA-Stained Human Chromosomes Based on Artificial Neural Network

DTIC Science & Technology

2001-10-25

neural network (ANN) has been adopted for the human chromosome classification. It is important to select optimum features for training neural network...Many studies for computer-based chromosome analysis have shown that it is possible to classify chromosomes into 24 subgroups. In addition, artificial

Report on the Second International Workshop on Human Chromosome 9

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kwiatkowski, D.J.; Armour, J.; Bale, A.E.

The Second International Workshop on Human Chromosome 9 was held in Chatham, Massachusetts on April 18--20, 1993. Fifty-three abstracts were received and the data presented on posters. The purpose of the meeting was to bring together all interested investigators working on the map of chromosome 9, many of whom had disease-specific interests. After a brief presentation of interests and highlighted results, the meeting broke up into the following subgroups for production of consensus maps: 9p; 9cen-q32; 9q32 ter. A global mapping group also met. Reports of each of these working groups is presented in the summary.

An Allometric Analysis of Sex and Sex Chromosome Dosage Effects on Subcortical Anatomy in Humans

PubMed Central

Clasen, Liv; Giedd, Jay N.; Blumenthal, Jonathan; Lerch, Jason P.; Chakravarty, M. Mallar; Raznahan, Armin

2016-01-01

Structural neuroimaging of humans with typical and atypical sex-chromosome complements has established the marked influence of both Yand X-/Y-chromosome dosage on total brain volume (TBV) and identified potential cortical substrates for the psychiatric phenotypes associated with sex-chromosome aneuploidy (SCA). Here, in a cohort of 354 humans with varying karyotypes (XX, XY, XXX, XXY, XYY, XXYY, XXXXY), we investigate sex and SCA effects on subcortical size and shape; focusing on the striatum, pallidum and thalamus. We find large effect-size differences in the volume and shape of all three structures as a function of sex and SCA. We correct for TBV effects with a novel allometric method harnessing normative scaling rules for subcortical size and shape in humans, which we derive here for the first time. We show that all three subcortical volumes scale sublinearly with TBV among healthy humans, mirroring known relationships between subcortical volume and TBV among species. Traditional TBV correction methods assume linear scaling and can therefore invert or exaggerate sex and SCA effects on subcortical anatomy. Allometric analysis restricts sex-differences to: (1) greater pallidal volume (PV) in males, and (2) relative caudate head expansion and ventral striatum contraction in females. Allometric analysis of SCA reveals that supernumerary X- and Y-chromosomes both cause disproportionate reductions in PV, and coordinated deformations of striatopallidal shape. Our study provides a novel understanding of sex and sex-chromosome dosage effects on subcortical organization, using an allometric approach that can be generalized to other basic and clinical structural neuroimaging settings. SIGNIFICANCE STATEMENT Sex and sex-chromosome dosage (SCD) are known to modulate human brain size and cortical anatomy, but very little is known regarding their impact on subcortical structures that work with the cortex to subserve a range of behaviors in health and disease. Moreover

Chromosome painting in the manatee supports Afrotheria and Paenungulata

PubMed Central

Kellogg, Margaret E; Burkett, Sandra; Dennis, Thomas R; Stone, Gary; Gray, Brian A; McGuire, Peter M; Zori, Roberto T; Stanyon, Roscoe

2007-01-01

Background Sirenia (manatees, dugongs and Stellar's sea cow) have no evolutionary relationship with other marine mammals, despite similarities in adaptations and body shape. Recent phylogenomic results place Sirenia in Afrotheria and with elephants and rock hyraxes in Paenungulata. Sirenia and Hyracoidea are the two afrotherian orders as yet unstudied by comparative molecular cytogenetics. Here we report on the chromosome painting of the Florida manatee. Results The human autosomal and X chromosome paints delimited a total of 44 homologous segments in the manatee genome. The synteny of nine of the 22 human autosomal chromosomes (4, 5, 6, 9, 11, 14, 17, 18 and 20) and the X chromosome were found intact in the manatee. The syntenies of other human chromosomes were disrupted in the manatee genome into two to five segments. The hybridization pattern revealed that 20 (15 unique) associations of human chromosome segments are found in the manatee genome: 1/15, 1/19, 2/3 (twice), 3/7 (twice), 3/13, 3/21, 5/21, 7/16, 8/22, 10/12 (twice), 11/20, 12/22 (three times), 14/15, 16/19 and 18/19. Conclusion There are five derived chromosome traits that strongly link elephants with manatees in Tethytheria and give implicit support to Paenungulata: the associations 2/3, 3/13, 8/22, 18/19 and the loss of the ancestral eutherian 4/8 association. It would be useful to test these conclusions with chromosome painting in hyraxes. The manatee chromosome painting data confirm that the associations 1/19 and 5/21 phylogenetically link afrotherian species and show that Afrotheria is a natural clade. The association 10/12/22 is also ubiquitous in Afrotheria (clade I), present in Laurasiatheria (clade IV), only partially present in Xenarthra (10/12, clade II) and absent in Euarchontoglires (clade III). If Afrotheria is basal to eutherians, this association could be part of the ancestral eutherian karyotype. If afrotherians are not at the root of the eutherian tree, then the 10/12/22 association

Y chromosome evolution: emerging insights into processes of Y chromosome degeneration

PubMed Central

Bachtrog, Doris

2014-01-01

The human Y chromosome is intriguing not only because it harbours the master-switch gene determining gender but also because of its unusual evolutionary trajectory. Previously an autosome, Y chromosome evolution has been characterized by massive gene decay. Recent whole-genome and transcriptome analyses of Y chromosomes in humans and other primates, in Drosophila species as well as in plants have shed light on the current gene content of the Y, its origins and its long-term fate. Comparative analysis of young and old Y chromosomes have given further insights into the evolutionary and molecular forces triggering Y degeneration and its evolutionary destiny. PMID:23329112

Integration sites of Epstein-Barr virus genome on chromosomes of human lymphoblastoid cell lines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wuu, K.D.; Chen, Y.J.; Wang-Wuu, S.

1994-09-01

Epstein-Barr virus (EBV) is the pathogen of infectious mononucleosis. The viral genome is present in more than 95% of the African cases of Burkitt lymphoma and it is usually maintained in episomal form in the tumor cells. Viral integration has been described only for Nanalwa which is a Burkitt lymphoma cell line lacking episomes. In order to examine the role of EBV in the immortalization of human Blymphocytes, we investigated whether the EBV integration into the human genome is essential. If the integration does occur, we would like to know whether the integration is randomly distributed or whether the viralmore » DNA integrates preferentially at certain sites. Fourteen in vitro immortalized human lymphoblastoid cell lines (LCLs) were examined by fluorescence in situ hybridization (FISH) with a biotinylated EBV BamHI w DNA fragment as probe. The episomal form of EBV DNA was found in all cells of these cell lines, while only about 65% of the cells have the integrated viral DNA. This might suggest that integration is not a pre-requisite for cell immortalization. Although all chromosomes, except Y, have been found with integrated viral genome, chromsomes 1 and 5 are the most frequent EBV DNA carrier (p<0.05). Nine chromosome bands, namely, 1p31, 1q31, 2q32, 3q13, 3q26, 5q14, 6q24, 7q31 and 12q21, are preferential targets for EBV integration (p<0.001). Eighty percent of the total 938 EBV hybridization signals were found to be at G-band-positive area. This suggests that the mechanism of EBV integration might be different from that of the retroviruses, which specifically integrate to G-band-negative areas. Thus, we conclude that the integration of EBV to host genome is non-random and it may have something to do with the structure of chromosome and DNA sequences.« less

Four chromosome-specific (Gossypium barbadense chromosome 5sh) Upland cotton RILs with improved elongation

USDA-ARS?s Scientific Manuscript database

A chromosome specific recombinant inbred line (CS-B05shRIL) population was created from a cross of TM-1, the genetic standard line of Gossypium hirsutum L. and CS-B05sh, a previously released interspecific chromosome substitution line in which all of the chromosome pairs are genetically similar to T...

Molecular and cytogenetic characterization of a chinese hamster/human hybrid cell line containing a der (21)t(Ypter [yields] cenY::cen21 [yields] 21qter) chromosome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patterson, D.; Hart, I.; Jones, C.

1993-01-01

Human/rodent somatic cell hybrids have been exceedingly useful in assigning human genes and DNA sequences to specific human chromosomes. As new technologies for analyzing the human chromosome complement of such human/rodent hybrid cells become available, it is of critical importance that these be applied to enhance characterization of existing hybrids. This is particularly important since human chromosomes in such hybrids have been observed to rearrange with time. We report here the use of fluorescence in situ hybridization of DNA probes to metaphase chromosomes to analyze one hybrid designated 72532X6. This analysis shows that the chromosome suspected to be a normalmore » human chromosome 21 in this hybrid is actually a translocation chromosome containing Yp and 21 q. In addition, the hybrid contains a fragment of human chromosome 9 translocated to a Chinese hamster chromosome. Analysis of the chromosomes from the human donor indicates that his chromosomes are normal. Thus, this translocation chromosome appears to have arisen after formation of the hybrid. 14 refs., 2 figs.« less

Direct and inverted reciprocal chromosome insertions between chromosomes 7 and 14 in a woman with recurrent miscarriages

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ying-Tai Wang; Zhao-Cai Wang; Bajalica, S.

We present the first case of direct and inverted reciprocal chromosome insertions between human chromosomes 7 and 14, ascertained because of repeated spontaneous abortions. Prometaphase GTG banding analysis showed the karyotype to be 46, XX, inv ins (7;14)(7pter {yields} 7q11.23::14q32.2 {yields} 14q22::7q21.2 {yields} 7qter), dir ins(14;7)(14pter {yields} 14q22::7q11.23 {yields} 7q21.2::14q32.2 {yields} 14qter). Origins of the insertion have been confirmed by chromosome painting with libraries specific for chromosomes 7 and 14 using fluorescence in situ hybridization. 5 refs., 3 figs.

Assignment of the structural gene for human beta glucuronidase to chromosome 7 and tetrameric association of subunits in the enzyme molecule.

PubMed Central

Chern, C J; Croce, C M

1976-01-01

The structural locus for human beta glucuronidase is assigned to chromosome 7, a localization based upon concordant segregation of the expression of the human enzyme and the presence of human chromosome 7 in somatic cell hybrid clones derived independently from fusions of different human and mouse cells. Hybrid clones containing only human chromosome 7 are included in this study. Electrophoresis of beta glucuronidase also has revealed that human beta glucuronidase has a tetrametric structure. Images Fig. 1 Fig. 2 Fig. 3 PMID:941902

Localization of the human indoleamine 2,3-dioxygenase (IDO) gene to the pericentromeric region of human chromosome 8

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burkin, D.J.; Jones, C.; Kimbro, K.S.

1993-07-01

Indoleamine 2,3-dioxygenase (IDO) is the first enzyme in the catabolic pathway for tryptophan. This extrahepatic enzyme differs from the hepatic enzyme, tryptophan 2,3-dioxygenase (TDO), in molecular as well as enzymatic characteristics, although both enzymes catalyze the same reaction: cleavage of tryptophan into N-formylkynurenine. The induction of IDO by IFN-[gamma] plays a role in the antigrowth effect of IFN-[gamma] in cell cultures and in the inhibition of intracellular pathogens, e.g., Toxoplasma gondii and Chlamydia psittaci. Tryptophan is also the precursor for the synthesis of serotonin, and reduced levels of tryptophan and serotonin found in AIDS patients have been correlated with themore » presence of IFN-[gamma] and consequent elevation of IDO activity. The IDO enzyme has been purified and characterized, and its cDNA and genomic DNA clones have been isolated and analyzed. DNA from hybrid cells containing fragments of human chromosome 8 was used to determine the regional localization of the IDO gene on chromosome 8. The hybrids R30-5B and R30-2A contain 8p11 [yields] qter and 8q13 [yields] qter, respectively. Hybrid 229-3A contains the 8pter [yields] q11. The hybrid R30-2A was negative for the IDO gene, whereas R30-5B and 229-3A were positive as analyzed by PCR and verified by Southern blotting. Only the region close to the centromere is shared by R30-5B and 229-3A hybrids. The results indicate that the IDO gene is located on chromosome 8p11 [yields] q11.« less

The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

PubMed

Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

2016-08-01

The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

Students as "Humans Chromosomes" in Role-Playing Mitosis and Meiosis

ERIC Educational Resources Information Center

Chinnici, Joseph P.; Yue, Joyce W.; Torres, Kieron M.

2004-01-01

Students often find it challenging to understand mitosis and meiosis and determine their processes. To develop an easier way to understand these terms, students are asked to role-play mitosis and meiosis and students themselves act as human chromosomes, which help students to learn differences between mitosis and meiosis.

Assignment of chromosomal locus and evidence for alternatively spliced mRNAs of a human sperm membrane protein (hSMP-1).

PubMed

Wang, H; Miao, S; Chen, D; Wang, L; Koide, S S

1999-10-06

The gene (HSD-1) coding a human sperm membrane protein (hSMP-1) was isolated from a human testis cDNA expression library using antibodies found in the serum of an infertile woman. HSD-1 was localized to a single locus on chromosome 9 and assigned to band 9p12-p13 by fluorescent in situ hybridization (FISH) mapping and DAPI (4,6-diamidino-2-phenylindole) banding, using rat/human somatic cell hybrids and metaphase chromosomes of human lymphocytes. In rescreening a testis lambdagt10 cDNA expression library, the full-length cDNA (HSD-1) and several truncated cDNAs with heterologous regions were isolated from positive clones. The heterology consisted of deletion, insertion and alteration of the 5'-end. These heterologous truncated fragments may be produced by alternative splicing of mRNAs. Two recombinant prokaryotic expression vectors were constructed with one of the heterologous fragment (clone #26) with and without the alternative 5'-end. Escherichia coli transfected with the construct containing the alternative 5'-end failed to produce the recombinant product, whereas those transfected with the vector lacking the 5'-end produced hSMP-1. DNASIS analysis of the structure of #26 mRNA suggests that the 5'-end has a stable secondary configuration that may maintain the mRNA in an inactivated state, whereby hindering its translation and preventing the expression of the gene.

Topology, structures, and energy landscapes of human chromosomes

PubMed Central

Zhang, Bin; Wolynes, Peter G.

2015-01-01

Chromosome conformation capture experiments provide a rich set of data concerning the spatial organization of the genome. We use these data along with a maximum entropy approach to derive a least-biased effective energy landscape for the chromosome. Simulations of the ensemble of chromosome conformations based on the resulting information theoretic landscape not only accurately reproduce experimental contact probabilities, but also provide a picture of chromosome dynamics and topology. The topology of the simulated chromosomes is probed by computing the distribution of their knot invariants. The simulated chromosome structures are largely free of knots. Topologically associating domains are shown to be crucial for establishing these knotless structures. The simulated chromosome conformations exhibit a tendency to form fibril-like structures like those observed via light microscopy. The topologically associating domains of the interphase chromosome exhibit multistability with varying liquid crystalline ordering that may allow discrete unfolding events and the landscape is locally funneled toward “ideal” chromosome structures that represent hierarchical fibrils of fibrils. PMID:25918364

Effect of borax on immune cell proliferation and sister chromatid exchange in human chromosomes

PubMed Central

Pongsavee, Malinee

2009-01-01

Background Borax is used as a food additive. It becomes toxic when accumulated in the body. It causes vomiting, fatigue and renal failure. Methods The heparinized blood samples from 40 healthy men were studied for the impact of borax toxicity on immune cell proliferation (lymphocyte proliferation) and sister chromatid exchange in human chromosomes. The MTT assay and Sister Chromatid Exchange (SCE) technic were used in this experiment with the borax concentrations of 0.1, 0.15, 0.2, 0.3 and 0.6 mg/ml. Results It showed that the immune cell proliferation (lymphocyte proliferation) was decreased when the concentrations of borax increased. The borax concentration of 0.6 mg/ml had the most effectiveness to the lymphocyte proliferation and had the highest cytotoxicity index (CI). The borax concentrations of 0.15, 0.2, 0.3 and 0.6 mg/ml significantly induced sister chromatid exchange in human chromosomes (P < 0.05). Conclusion Borax had effects on immune cell proliferation (lymphocyte proliferation) and induced sister chromatid exchange in human chromosomes. Toxicity of borax may lead to cellular toxicity and genetic defect in human. PMID:19878537

Mutagenicity and human chromosomal effect of stevioside, a sweetener from Stevia rebaudiana Bertoni.

PubMed Central

Suttajit, M; Vinitketkaumnuen, U; Meevatee, U; Buddhasukh, D

1993-01-01

Leaves of Stevia rebaudiana Bertoni have been popularly used as a sweetener in foods and beverages for diabetics and obese people due to their potent sweetener stevioside. In this report, stevioside and steviol were tested for mutagenicity in Salmonella typhimurium strains TA98 and TA100 and for chromosomal effects on cultured human lymphocytes. Stevioside was not mutagenic at concentrations up to 25 mg/plate, but showed direct mutagenicity to only TA98 at 50 mg/plate. However, steviol did not exhibit mutagenicity in either TA98 or TA100, with or without metabolic activation. No significant chromosomal effect of stevioside and steviol was observed in cultured blood lymphocytes from healthy donors (n = 5). This study indicates that stevioside and steviol are neither mutagenic nor clastogenic in vitro at the limited doses; however, in vivo genotoxic tests and long-term effects of stevioside and steviol are yet to be investigated. PMID:8143647

Comparative linkage mapping of genes on sheep chromosome 3 provides evidence of chromosomal rearrangements in the evolution of the Bovidae.

PubMed

Jenkins, Z A; Henry, H M; Galloway, S M; Dodds, K G; Montgomery, G W

1997-01-01

Three genes--parathyroid hormone-like hormone (PTHLH), insulin-like growth factor 1 (IGF 1), and retinoic acid receptor gamma (RARG)--have been mapped to sheep (Ovis aries) chromosome 3 (OAR 3). The order and genetic distances between loci on OAR 3 are similar to those on cattle (Bos taurus) chromosome 5, as expected from their close evolutionary relationship. The OAR 3 linkage map shows conserved synteny with human chromosome 12, but there are at least two rearrangements in gene order between the species.

The morbid anatomy of the human genome: chromosomal location of mutations causing disease.

PubMed Central

McKusick, V A; Amberger, J S

1993-01-01

Information is given in tabular form derived from a synopsis of the human gene map which has been updated continuously since 1973 as part of Mendelian Inheritance in Man (Johns Hopkins University Press, 10th ed, 1992) and of OMIM (Online Mendelian Inheritance in Man, available generally since 1987). The part of the synopsis reproduced here consists of chromosome by chromosome gene lists of loci for which there are associated disorders (table 1), a pictorial representation of this information (fig 1a-d), and an index of disorders for which the causative mutations have been mapped (table 2). In table 1, information on genes that have been located to specific chromosomal positions and are also the site of disease producing mutations is arranged by chromosome, starting with chromosome 1 and with the end of the short arm of the chromosome in each case. In table 2 an alphabetized list of these disorders and the chromosomal location of the mutation in each case are provided. Both in the 'Disorder' field of table 1 and in table 2, the numbers 1, 2, or 3 in parentheses after the name of the disorder indicate that its chromosomal location was determined by mapping of the wildtype gene (1), by mapping of the clinical phenotype (2), or by both strategies (3). PMID:8423603

Painting Analysis of Chromosome Aberrations Induced by Energetic Heavy Ions in Human Cells

NASA Technical Reports Server (NTRS)

Wu, Honglu; Hada, Megumi; Cucinotta, Francis

2007-01-01

This viewgraph presentation reviews some of the techniques used to analyze the damage done to chromosome from ion radiation. Fluorescence in situ hybridization (FISH), mFISH, mBAND, telomere and centromereprobes have been used to study chromosome aberrations induced in human cells exposed to low-and high-LET radiation in vitro. There is some comparison of the different results from the various techniques. The results of the study are summarized.

Hi-C-constrained physical models of human chromosomes recover functionally-related properties of genome organization

NASA Astrophysics Data System (ADS)

di Stefano, Marco; Paulsen, Jonas; Lien, Tonje G.; Hovig, Eivind; Micheletti, Cristian

2016-10-01

Combining genome-wide structural models with phenomenological data is at the forefront of efforts to understand the organizational principles regulating the human genome. Here, we use chromosome-chromosome contact data as knowledge-based constraints for large-scale three-dimensional models of the human diploid genome. The resulting models remain minimally entangled and acquire several functional features that are observed in vivo and that were never used as input for the model. We find, for instance, that gene-rich, active regions are drawn towards the nuclear center, while gene poor and lamina associated domains are pushed to the periphery. These and other properties persist upon adding local contact constraints, suggesting their compatibility with non-local constraints for the genome organization. The results show that suitable combinations of data analysis and physical modelling can expose the unexpectedly rich functionally-related properties implicit in chromosome-chromosome contact data. Specific directions are suggested for further developments based on combining experimental data analysis and genomic structural modelling.

Hi-C-constrained physical models of human chromosomes recover functionally-related properties of genome organization.

PubMed

Di Stefano, Marco; Paulsen, Jonas; Lien, Tonje G; Hovig, Eivind; Micheletti, Cristian

2016-10-27

Combining genome-wide structural models with phenomenological data is at the forefront of efforts to understand the organizational principles regulating the human genome. Here, we use chromosome-chromosome contact data as knowledge-based constraints for large-scale three-dimensional models of the human diploid genome. The resulting models remain minimally entangled and acquire several functional features that are observed in vivo and that were never used as input for the model. We find, for instance, that gene-rich, active regions are drawn towards the nuclear center, while gene poor and lamina associated domains are pushed to the periphery. These and other properties persist upon adding local contact constraints, suggesting their compatibility with non-local constraints for the genome organization. The results show that suitable combinations of data analysis and physical modelling can expose the unexpectedly rich functionally-related properties implicit in chromosome-chromosome contact data. Specific directions are suggested for further developments based on combining experimental data analysis and genomic structural modelling.

DNA Secondary Structure at Chromosomal Fragile Sites in Human Disease

PubMed Central

Thys, Ryan G; Lehman, Christine E; Pierce, Levi C. T; Wang, Yuh-Hwa

2015-01-01

DNA has the ability to form a variety of secondary structures that can interfere with normal cellular processes, and many of these structures have been associated with neurological diseases and cancer. Secondary structure-forming sequences are often found at chromosomal fragile sites, which are hotspots for sister chromatid exchange, chromosomal translocations, and deletions. Structures formed at fragile sites can lead to instability by disrupting normal cellular processes such as DNA replication and transcription. The instability caused by disruption of replication and transcription can lead to DNA breakage, resulting in gene rearrangements and deletions that cause disease. In this review, we discuss the role of DNA secondary structure at fragile sites in human disease. PMID:25937814

Chromosome Connections: Compelling Clues to Common Ancestry

ERIC Educational Resources Information Center

Flammer, Larry

2013-01-01

Students compare banding patterns on hominid chromosomes and see striking evidence of their common ancestry. To test this, human chromosome no. 2 is matched with two shorter chimpanzee chromosomes, leading to the hypothesis that human chromosome 2 resulted from the fusion of the two shorter chromosomes. Students test that hypothesis by looking for…

The chromosomal constitution of fish hybrid lineage revealed by 5S rDNA FISH.

PubMed

Zhang, Chun; Ye, Lihai; Chen, Yiyi; Xiao, Jun; Wu, Yanhong; Tao, Min; Xiao, Yamei; Liu, Shaojun

2015-12-03

The establishment of the bisexual fertile fish hybrid lineage including the allodiploid and allotetraploid hybrids, from interspecific hybridization of red crucian carp (Carassius auratus red var. 2n = 100, 2n = AA) (♀) × common carp (Cyprinus carpio L. 2n = 100, 2n = BB) (♂), provided a good platform to investigate genetic relationship between the parents and their hybrid progenies. The chromosomal inheritance of diploid and allotetraploid hybrid progenies in successive generations, was studied by applying 5S rDNA fluorescence in situ hybridization. Signals of 5S rDNA distinguished the chromosomal constitution of common carp (B-genome) from red crucian carp (A-genome), in which two strong signals were observed on the first submetacentric chromosome, while no major signal was found in common carp. After fish hybridization, one strong signal of 5S rDNA was detected in the same locus on the chromosome of diploid hybrids. As expected, two strong signals were observed in 4nF3 tetraploid hybrids offspring and it is worth mentioning that two strong signals were detected in a separating bivalent of a primary spermatocyte in 4nF3. Furthermore, the mitosis of heterozygous chromosomes was shown normal and stable with blastular tissue histological studies. We revealed that 5S rDNA signal can be applied to discern A-genome from B-genome, and that 5S rDNA bearing chromosomes can be stably passed down in successive generations. Our work provided a significant method in fish breeding and this is important for studies in fish evolutionary biology.

Chromosomal Aberrations in Canine Gliomas Define Candidate Genes and Common Pathways in Dogs and Humans.

PubMed

Dickinson, Peter J; York, Dan; Higgins, Robert J; LeCouteur, Richard A; Joshi, Nikhil; Bannasch, Danika

2016-07-01

Spontaneous gliomas in dogs occur at a frequency similar to that in humans and may provide a translational model for therapeutic development and comparative biological investigations. Copy number alterations in 38 canine gliomas, including diffuse astrocytomas, glioblastomas, oligodendrogliomas, and mixed oligoastrocytomas, were defined using an Illumina 170K single nucleotide polymorphism array. Highly recurrent alterations were seen in up to 85% of some tumor types, most notably involving chromosomes 13, 22, and 38, and gliomas clustered into 2 major groups consisting of high-grade IV astrocytomas, or oligodendrogliomas and other tumors. Tumor types were characterized by specific broad and focal chromosomal events including focal loss of the INK4A/B locus in glioblastoma and loss of the RB1 gene and amplification of the PDGFRA gene in oligodendrogliomas. Genes associated with the 3 critical pathways in human high-grade gliomas (TP53, RB1, and RTK/RAS/PI3K) were frequently associated with canine aberrations. Analysis of oligodendrogliomas revealed regions of chromosomal losses syntenic to human 1p involving tumor suppressor genes, such as CDKN2C, as well as genes associated with apoptosis, autophagy, and response to chemotherapy and radiation. Analysis of high frequency chromosomal aberrations with respect to human orthologues may provide insight into both novel and common pathways in gliomagenesis and response to therapy. © 2016 American Association of Neuropathologists, Inc. All rights reserved.

Chromosomal Aberrations in Canine Gliomas Define Candidate Genes and Common Pathways in Dogs and Humans

PubMed Central

York, Dan; Higgins, Robert J.; LeCouteur, Richard A.; Joshi, Nikhil; Bannasch, Danika

2016-01-01

Spontaneous gliomas in dogs occur at a frequency similar to that in humans and may provide a translational model for therapeutic development and comparative biological investigations. Copy number alterations in 38 canine gliomas, including diffuse astrocytomas, glioblastomas, oligodendrogliomas, and mixed oligoastrocytomas, were defined using an Illumina 170K single nucleotide polymorphism array. Highly recurrent alterations were seen in up to 85% of some tumor types, most notably involving chromosomes 13, 22, and 38, and gliomas clustered into 2 major groups consisting of high-grade IV astrocytomas, or oligodendrogliomas and other tumors. Tumor types were characterized by specific broad and focal chromosomal events including focal loss of the INK4A/B locus in glioblastoma and loss of the RB1 gene and amplification of the PDGFRA gene in oligodendrogliomas. Genes associated with the 3 critical pathways in human high-grade gliomas (TP53, RB1, and RTK/RAS/PI3K) were frequently associated with canine aberrations. Analysis of oligodendrogliomas revealed regions of chromosomal losses syntenic to human 1p involving tumor suppressor genes, such as CDKN2C, as well as genes associated with apoptosis, autophagy, and response to chemotherapy and radiation. Analysis of high frequency chromosomal aberrations with respect to human orthologues may provide insight into both novel and common pathways in gliomagenesis and response to therapy. PMID:27251041

Comprehensive analysis of CpG islands in human chromosomes 21 and 22

NASA Astrophysics Data System (ADS)

Takai, Daiya; Jones, Peter A.

2002-03-01

CpG islands are useful markers for genes in organisms containing 5-methylcytosine in their genomes. In addition, CpG islands located in the promoter regions of genes can play important roles in gene silencing during processes such as X-chromosome inactivation, imprinting, and silencing of intragenomic parasites. The generally accepted definition of what constitutes a CpG island was proposed in 1987 by Gardiner-Garden and Frommer [Gardiner-Garden, M. & Frommer, M. (1987) J. Mol. Biol. 196, 261-282] as being a 200-bp stretch of DNA with a C+G content of 50% and an observed CpG/expected CpG in excess of 0.6. Any definition of a CpG island is somewhat arbitrary, and this one, which was derived before the sequencing of mammalian genomes, will include many sequences that are not necessarily associated with controlling regions of genes but rather are associated with intragenomic parasites. We have therefore used the complete genomic sequences of human chromosomes 21 and 22 to examine the properties of CpG islands in different sequence classes by using a search algorithm that we have developed. Regions of DNA of greater than 500 bp with a G+C equal to or greater than 55% and observed CpG/expected CpG of 0.65 were more likely to be associated with the 5' regions of genes and this definition excluded most Alu-repetitive elements. We also used genome sequences to show strong CpG suppression in the human genome and slight suppression in Drosophila melanogaster and Saccharomyces cerevisiae. This finding is compatible with the recent detection of 5-methylcytosine in Drosophila, and might suggest that S. cerevisiae has, or once had, CpG methylation.

Identification of the genomic locus for the human Rieske Fe-S Protein gene on Chromosome 19q12

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pennacchio, L.A.

1994-05-06

We have identified the chromosomal location of the human Rieske Iron-Sulfur Protein (UQCRFS1) gene. Mapping by hybridization to a panel of monochromosomal hybrid cell lines indicated that the gene was either on chromosome 19 or 22. By screening a human chromosome 19 specific genomic cosmid library with an oligonucleotide probe made from the published Rieske cDNA sequence, we identified a corresponding cosmid. Portions of this cosmid were sequenced directly. The exon, exon:intron junction, and flanking sequences verified that this cosmid contains the genomic locus. Fluorescent in situ hybridization (FISH) was performed to localize this cosmid to chromosome band 19q12.

A complex chromosomal rearrangement involving chromosomes 2, 5, and X in autism spectrum disorder.

PubMed

Griesi-Oliveira, Karina; Moreira, Danielle de Paula; Davis-Wright, Nicole; Sanders, Stephan; Mason, Christopher; Orabona, Guilherme Müller; Vadasz, Estevão; Bertola, Débora Romeo; State, Matthew W; Passos-Bueno, Maria Rita

2012-07-01

Here, we describe a female patient with autism spectrum disorder and dysmorphic features that harbors a complex genetic alteration, involving a de novo balanced translocation t(2;X)(q11;q24), a 5q11 segmental trisomy and a maternally inherited isodisomy on chromosome 5. All the possibly damaging genetic effects of such alterations are discussed. In light of recent findings on ASD genetic causes, the hypothesis that all these alterations might be acting in orchestration and contributing to the phenotype is also considered. Copyright © 2012 Wiley Periodicals, Inc.

The Biological Effectiveness of Different Radiation Qualities for the Induction of Chromosome Damage in Human Lymphocytes

NASA Technical Reports Server (NTRS)

Hada, M.; George, K.; Cucinotta, F. A.

2010-01-01

Chromosome aberrations were measured in human peripheral blood lymphocytes after in vitro exposure to 28Si- ions with energies ranging from 90 to 600 MeV/u, or to 56Fe-ions with energies ranging from 200 to 5,000 MeV/u. The LET of the various Fe beams in this study ranged from 145 to 440 keV/micron and the LET of the Si ions ranged from 48 to 158 keV/ m. Doses delivered were in the 10- to 200-cGy range. Dose-response curves for chromosome exchanges in cells at first division after exposure, measured using fluorescence in situ hybridization (FISH) with whole-chromosome probes, were fitted with linear or linear-quadratic functions. The relative biological effectiveness (RBE) was estimated from the initial slope of the dose-response curve for chromosome damage with respect to -rays. The estimates of RBE(sub max) values for total chromosome exchanges ranged from 4.4+/-0.4 to 31.5+/-2.6 for Fe ions, and 11.8+/-1.0 to 42.2+/-3.3 for Si ions. The highest RBE(sub max) value for Fe ions was obtained with the 600-Mev/u beam, and the highest RBE(sub max) value for Si ions was obtained with the 170 MeV/u beam. For both ions the RBEmax values increased with LET, reaching a maximum at about 180 keV/micron for Fe and about 100 keV/ m for Si, and decreasing with further increase in LET. Additional studies for low doses 28Si-ions down to 0.02 Gy will be discussed.

An Allometric Analysis of Sex and Sex Chromosome Dosage Effects on Subcortical Anatomy in Humans.

PubMed

Reardon, Paul Kirkpatrick; Clasen, Liv; Giedd, Jay N; Blumenthal, Jonathan; Lerch, Jason P; Chakravarty, M Mallar; Raznahan, Armin

2016-02-24

Structural neuroimaging of humans with typical and atypical sex-chromosome complements has established the marked influence of both Yand X-/Y-chromosome dosage on total brain volume (TBV) and identified potential cortical substrates for the psychiatric phenotypes associated with sex-chromosome aneuploidy (SCA). Here, in a cohort of 354 humans with varying karyotypes (XX, XY, XXX, XXY, XYY, XXYY, XXXXY), we investigate sex and SCA effects on subcortical size and shape; focusing on the striatum, pallidum and thalamus. We find large effect-size differences in the volume and shape of all three structures as a function of sex and SCA. We correct for TBV effects with a novel allometric method harnessing normative scaling rules for subcortical size and shape in humans, which we derive here for the first time. We show that all three subcortical volumes scale sublinearly with TBV among healthy humans, mirroring known relationships between subcortical volume and TBV among species. Traditional TBV correction methods assume linear scaling and can therefore invert or exaggerate sex and SCA effects on subcortical anatomy. Allometric analysis restricts sex-differences to: (1) greater pallidal volume (PV) in males, and (2) relative caudate head expansion and ventral striatum contraction in females. Allometric analysis of SCA reveals that supernumerary X- and Y-chromosomes both cause disproportionate reductions in PV, and coordinated deformations of striatopallidal shape. Our study provides a novel understanding of sex and sex-chromosome dosage effects on subcortical organization, using an allometric approach that can be generalized to other basic and clinical structural neuroimaging settings. Copyright © 2016 the authors 0270-6474/16/362438-11$15.00/0.

Ethiopians and Khoisan Share the Deepest Clades of the Human Y-Chromosome Phylogeny

PubMed Central

Semino, Ornella; Santachiara-Benerecetti, A. Silvana; Falaschi, Francesco; Cavalli-Sforza, L. Luca; Underhill, Peter A.

2002-01-01

The genetic structure of 126 Ethiopian and 139 Senegalese Y chromosomes was investigated by a hierarchical analysis of 30 diagnostic biallelic markers selected from the worldwide Y-chromosome genealogy. The present study reveals that (1) only the Ethiopians share with the Khoisan the deepest human Y-chromosome clades (the African-specific Groups I and II) but with a repertoire of very different haplotypes; (2) most of the Ethiopians and virtually all the Senegalese belong to Group III, whose precursor is believed to be involved in the first migration out of Africa; and (3) the Ethiopian Y chromosomes that fall into Groups VI, VIII, and IX may be explained by back migrations from Asia. The first observation confirms the ancestral affinity between the Ethiopians and the Khoisan, which has previously been suggested by both archaeological and genetic findings. PMID:11719903

Twenty-seven nonoverlapping zinc finger cDNAs from human T cells map to nine different chromosomes with apparent clustering.

PubMed Central

Huebner, K; Druck, T; Croce, C M; Thiesen, H J

1991-01-01

cDNA clones encoding zinc finger structures were isolated by screening Molt4 and Jurkat cDNA libraries with zinc finger consensus sequences. Candidate clones were partially sequenced to verify the presence of zinc finger-encoding regions; nonoverlapping cDNA clones were chosen on the basis of sequences and genomic hybridization pattern. Zinc finger structure-encoding clones, which were designated by the term "Kox" and a number from 1 to 32 and which were apparently unique (i.e., distinct from each other and distinct from those isolated by other laboratories), were chosen for mapping in the human genome. DNAs from rodent-human somatic cell hybrids retaining defined complements of human chromosomes were analyzed for the presence of each of the Kox genes. Correlation between the presence of specific human chromosome regions and specific Kox genes established the chromosomal locations. Multiple Kox loci were mapped to 7q (Kox 18 and 25 and a locus detected by both Kox 8 cDNA and Kox 27 cDNA), 8q24 5' to the myc locus (Kox 9 and 32), 10cen----q24 (Kox 2, 15, 19, 21, 30, and 31), 12q13-qter (Kox 1 and 20), 17p13 (Kox 11 and 26), and 19q (Kox 5, 6, 10, 22, 24, and 28). Single Kox loci were mapped to 7p22 (Kox 3), 18q12 (Kox 17), 19p (Kox 13), 22q11 between IG lambda and BCR-1 (locus detected by both Kox 8 cDNA and Kox 27 cDNA), and Xp (Kox 14). Several of the Kox loci map to regions in which other zinc finger structure-encoding loci have already been localized, indicating possible zinc finger gene clusters. In addition, Kox genes at 8q24, 17p13, and 22q11--and perhaps other Kox genes--are located near recurrent chromosomal translocation breakpoints. Others, such as those on 7p and 7q, may be near regions specifically active in T cells. Images Figure 4 Figure 5 Figure 2 Figure 3 PMID:2014798

Localization of the panhypopituitary dwarf mutation (df) on mouse chromosome 11 in an intersubspecific backcross.

PubMed

Buckwalter, M S; Katz, R W; Camper, S A

1991-07-01

Ames dwarf (df) is an autosomal recessive mutation characterized by severe dwarfism and infertility. This mutation provides a mouse model for panhypopituitarism. The dwarf phenotype results from failure in the differentiation of the cells which produce growth hormone, prolactin, and thyroid stimulating hormone. Using the backcross (DF/B-df/df X CASA/Rk) X DF/B-df/df, we confirmed the assignment of df to mouse chromosome 11 and demonstrated recombination between df and the growth hormone gene. This backcross is an invaluable resource for screening candidate genes for the df mutation. The df locus maps to less than 1 cM distal to Pad-1 (0.85 +/- 0.85 cM). Two new genes localized on mouse chromosome 11, Rpo2-1, and Edp-1, map to a region of conserved synteny with human chromosome 17. The localization of the alpha 1 adrenergic receptor, Adra-1, extends a known region of synteny conservation between mouse chromosome 11 and human chromosome 5, and suggests that a human counterpart to df would map to human chromosome 5.

[Analysis on genetic polymorphism of 5 STR loci selected from X chromosome].

PubMed

Liu, Qi-ji; Gong, Yao-qin; Zhang, Xi-yu; Gao, Gui-min; Li, Jiang-xia; Guo, Yi-shou

2005-02-01

To select short tandem repeats(STR) from X chromosome. STR is a universal genetic marker that has changeable polymorphism and stable heredity in human genome. It is a specific DNA segment composed of 2-6 base pairs as its core sequence. It is an ideal DNA marker used in linkage analysis and gene mapping. In this study, 8 short tandem repeats were selected from two genomic clones on X chromosome by using BCM Search Launcher. Primers amplifying the STR loci were designed by using Primer 3.0 according to the unique sequence flanking the STRs. Polymorphisms of the short tandem repeats in Chinese population were evaluated by PCR amplification and PAGE. Five of these STRs were polymorphic. Chi-square test indicated that the distribution of genotypes agreed with Hardy-Weinberg equilibrium (P>0.05). Five polymorphic short tandem repeats have been identified on chromosome X and will be useful for linkage analysis and gene mapping.

Regional assignment of seven genes on chromosome 1 of man by use of man-Chinese hamster somatic cell hybrids. I. Results obtained after hybridization of human cells carrying reciprocal translocations involving chromosome 1.

PubMed

Jongsma, A P; Burgerhout, W G

1977-01-01

Regional localization studies of genes coding for human PGD, PPH1, PGM1, UGPP, GuK1, Pep-C, and FH, which have been assigned to chromosome 1, were performed with man-Chinese hamster somatic cell hybrids, Informative hybrids that retained fragments of the human chromosome 1 were produced by fusion of hamster cells with human cells carrying reciprocal translocations involving chromosome 1. Analysis of the hybrids that retained one of the translocation chromosomes or de novo rearrangements involving the human 1 revealed the following gene positions: PGD and PPH1 in 1pter leads to 1p32, PGM1 in 1p32 leads to 1p22, UGPP and GuK1 in 1q21 leads to 1q42, FH in 1qter leads to 1q42, and Pep-C probably in 1q42.

Chromosome congression by kinesin-5 motor-mediated disassembly of longer kinetochore microtubules

PubMed Central

Gardner, Melissa K; Bouck, David C.; Paliulis, Leocadia V.; Meehl, Janet B.; O’Toole, Eileen T.; Haase, Julian; Soubry, Adelheid; Joglekar, Ajit P.; Winey, Mark; Salmon, Edward D.; Bloom, Kerry; Odde, David J.

2008-01-01

Summary During mitosis, sister chromatids congress to the spindle equator and are subsequently segregated via attachment to dynamic kinetochore microtubule (kMT) plus-ends. A major question is how kMT plus-end assembly is spatially regulated to achieve chromosome congression. Here we find in budding yeast that the widely-conserved kinesin-5 sliding motor proteins, Cin8p and Kip1p, mediate chromosome congression by suppressing kMT plus-end assembly of longer kMTs. Of the two, Cin8p is the major effector and its activity requires a functional motor domain. In contrast, the depolymerizing kinesin-8 motor Kip3p plays a minor role in spatial regulation of yeast kMT assembly. Our analysis identified a model where kinesin-5 motors bind to kMTs, move to kMT plus ends, and upon arrival at a growing plus-end promote net kMT plus-end disassembly. In conclusion, we find that length-dependent control of net kMT assembly by kinesin-5 motors yields a simple and stable self-organizing mechanism for chromosome congression. PMID:19041752

Chromosomal localization and sequence analysis of a human episomal sequence with in vitro differentiating activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boccaccio, C.; Deshatrette, J.; Meunier-Rotival, M.

1994-05-01

The genomic fragment carrying the human activator of liver function, previously described as an episome capable of inducing differentiation upon transfection into a dedifferentiated rat hepatoma cell line, was mapped on human chromosome 12q24.2-12q24.3. This chromosomal location was indistinguishable by in situ hybridization from that of the gene coding for the hepatic transcription factor HNF1. The sequence of the integrated form of the episome as well as its flanking sequences show that it is rich in retroposons. It contains a human ribosomal protein L21 processed pseudogene, one truncated L1Hs sequence, and 10 Alu repeats, which belong to different subfamilies.

GTG banding pattern on human metaphase chromosomes revealed by high resolution atomic-force microscopy.

PubMed

Thalhammer, S; Koehler, U; Stark, R W; Heckl, W M

2001-06-01

Surface topography of human metaphase chromosomes following GTG banding was examined using high resolution atomic force microscopy (AFM). Although using a completely different imaging mechanism, which is based on the mechanical interaction of a probe tip with the chromosome, the observed banding pattern is comparable to results from light microscopy and a karyotype of the AFM imaged metaphase spread can be generated. The AFM imaging process was performed on a normal 2n = 46, XX karyotype and on a 2n = 46, XY, t(2;15)(q23;q15) karyotype as an example of a translocation of chromosomal bands.

Chromosomal rearrangements and karyotype evolution in carnivores revealed by chromosome painting

PubMed Central

Nie, W; Wang, J; Su, W; Wang, D; Tanomtong, A; Perelman, P L; Graphodatsky, A S; Yang, F

2012-01-01

Chromosomal evolution in carnivores has been revisited extensively using cross-species chromosome painting. Painting probes derived from flow-sorted chromosomes of the domestic dog, which has one of the most rearranged karyotypes in mammals and the highest dipoid number (2n=78) in carnivores, are a powerful tool in detecting both evolutionary intra- and inter-chromosomal rearrangements. However, only a few comparative maps have been established between dog and other non-Canidae species. Here, we extended cross-species painting with dog probes to seven more species representing six carnivore families: Eurasian lynx (Lynx lynx), the stone marten (Martes foina), the small Indian civet (Viverricula indica), the Asian palm civet (Paradoxurus hermaphrodites), Javan mongoose (Hepestes javanicas), the raccoon (Procyon lotor) and the giant panda (Ailuropoda melanoleuca). The numbers and positions of intra-chromosomal rearrangements were found to differ among these carnivore species. A comparative map between human and stone marten, and a map among the Yangtze finless porpoise (Neophocaena phocaenoides asiaeorientalis), stone marten and human were also established to facilitate outgroup comparison and to integrate comparative maps between stone marten and other carnivores with such maps between human and other species. These comparative maps give further insight into genome evolution and karyotype phylogenetic relationships among carnivores, and will facilitate the transfer of gene mapping data from human, domestic dog and cat to other species. PMID:22086079

Chromosome Aberrations in Human Epithelial Cells Exposed Los Alamos High-Energy Secondary Neutrons: M-BAND Analysis

NASA Technical Reports Server (NTRS)

Hada, M.; Saganti, P. B.; Gersey, B.; Wilkins, R.; Cucinotta, F. A.; Wu, H.

2007-01-01

High-energy secondary neutrons, produced by the interaction of galactic cosmic rays (GCR) with the atmosphere, spacecraft structure and planetary surfaces, contribute a significant fraction to the dose equivalent radiation measurement in crew members and passengers of commercial aviation travel as well as astronauts in space missions. The Los Alamos Nuclear Science Center (LANSCE) neutron facility's 30L beam line (4FP30L-A/ICE House) is known to generate neutrons that simulate the secondary neutron spectrum of the Earth's atmosphere at high altitude. The neutron spectrum is also similar to that measured onboard spacecrafts like the MIR and the International Space Station (ISS). To evaluate the biological damage, we exposed human epithelial cells in vitro to the LANSCE neutron beams with an entrance dose rate of 2.5 cGy/hr, and studied the induction of chromosome aberrations that were identified with multicolor-banding in situ hybridization (mBAND) technique. With this technique, individually painted chromosomal bands on one chromosome allowed the identification of inter-chromosomal aberrations (translocation to unpainted chromosomes) and intra-chromosomal aberrations (inversions and deletions within a single painted chromosome). Compared to our previous results with gamma-rays and 600 MeV/nucleon Fe ions of high dose rate at NSRL (NASA Space Radiation Laboratory at Brookhaven National Laboratory), the neutron data from the LANSCE experiments showed significantly higher frequency of chromosome aberrations. However, detailed analysis of the inversion type revealed that all of the three radiation types in the study induced a low incidence of simple inversions. Most of the inversions in gamma-ray irradiated samples were accompanied by other types of intrachromosomal aberrations but few inversions were accompanied by interchromosomal aberrations. In contrast, neutrons and Fe ions induced a significant fraction of inversions that involved complex rearrangements of both

Biological dosimetry by interphase chromosome painting.

PubMed

Durante, M; George, K; Yang, T C

1996-01-01

Both fluorescence in situ hybridization of metaphase spreads with whole-chromosome probes and premature chromosome condensation in interphase nuclei have been used in the past to estimate the radiation dose to lymphocytes. We combined these techniques to evaluate the feasibility of using painted interphase chromosomes for biodosimetry. Human peripheral lymphocytes were exposed to gamma rays and fused to mitotic Chinese hamster cells either immediately after irradiation or after 8 h incubation at 37 degrees C. Interphase or metaphase human chromosomes were hybridized with a composite probe specific for human chromosomes 3 and 4. The dose-response curve for fragment induction immediately after irradiation was linear; these results reflected breakage frequency in the total genome in terms of DNA content per chromosome. At 8 h after irradiation, the dose-response curve for chromosome interchanges, the prevalent aberration in interphase chromosomes, was linear-quadratic and similar to that observed for metaphase chromosomes. These results suggest that painting prematurely condensed chromosomes can be useful for biological dosimetry when blood samples are available shortly after the exposure, or when interphase cells are to be scored instead of mitotic cells.

Biological dosimetry by interphase chromosome painting

NASA Technical Reports Server (NTRS)

Durante, M.; George, K.; Yang, T. C.

1996-01-01

Both fluorescence in situ hybridization of metaphase spreads with whole-chromosome probes and premature chromosome condensation in interphase nuclei have been used in the past to estimate the radiation dose to lymphocytes. We combined these techniques to evaluate the feasibility of using painted interphase chromosomes for biodosimetry. Human peripheral lymphocytes were exposed to gamma rays and fused to mitotic Chinese hamster cells either immediately after irradiation or after 8 h incubation at 37 degrees C. Interphase or metaphase human chromosomes were hybridized with a composite probe specific for human chromosomes 3 and 4. The dose-response curve for fragment induction immediately after irradiation was linear; these results reflected breakage frequency in the total genome in terms of DNA content per chromosome. At 8 h after irradiation, the dose-response curve for chromosome interchanges, the prevalent aberration in interphase chromosomes, was linear-quadratic and similar to that observed for metaphase chromosomes. These results suggest that painting prematurely condensed chromosomes can be useful for biological dosimetry when blood samples are available shortly after the exposure, or when interphase cells are to be scored instead of mitotic cells.

New Insights in the Cytogenetic Practice: Karyotypic Chaos, Non-Clonal Chromosomal Alterations and Chromosomal Instability in Human Cancer and Therapy Response

PubMed Central

Rangel, Nelson; Forero-Castro, Maribel; Rondón-Lagos, Milena

2017-01-01

Recently, non-clonal chromosomal alterations previously unappreciated are being proposed to be included in cytogenetic practice. The aim of this inclusion is to obtain a greater understanding of chromosomal instability (CIN) and tumor heterogeneity and their role in cancer evolution and therapy response. Although several genetic assays have allowed the evaluation of the variation in a population of cancer cells, these assays do not provide information at the level of individual cells, therefore limiting the information of the genomic diversity within tumors (heterogeneity). The karyotype is one of the few available cytogenetic techniques that allow us not only to identify the chromosomal alterations present within a single cell, but also allows us to profile both clonal (CCA) and non-clonal chromosomal alterations (NCCAs). A greater understanding of CIN and tumor heterogeneity in cancer could not only improve existing therapeutic regimens but could also be used as targets for the design of new therapeutic approaches. In this review we indicate the importance and significance of karyotypic chaos, NCCAs and CIN in the prognosis of human cancers. PMID:28587191

Reduced chromosome aberration complexity in normal human bronchial epithelial cells exposed to low-LET γ-rays and high-LET α-particles

PubMed Central

2013-01-01

Purpose: Cells of the lung are at risk from exposure to low and moderate doses of ionizing radiation from a range of environmental and medical sources. To help assess human health risks from such exposures, a better understanding of the frequency and types of chromosome aberration initially-induced in human lung cell types is required to link initial DNA damage and rearrangements with transmission potential and, to assess how this varies with radiation quality. Materials and methods: We exposed normal human bronchial lung epithelial (NHBE) cells in vitro to 0.5 and 1 Gy low-linear energy transfer (LET) γ-rays and a low fluence of high-LET α-particles and assayed for chromosome aberrations in premature chromosome condensation (PCC) spreads by 24-color multiplex-fluorescence in situ hybridization (M-FISH). Results: Both simple and complex aberrations were induced in a LET and dose-dependent manner; however, the frequency and complexity observed were reduced in comparison to that previously reported in spherical cell types after exposure to comparable doses or fluence of radiation. Approximately 1–2% of all exposed cells were categorized as being capable of transmitting radiation-induced chromosomal damage to future NHBE cell generations, irrespective of dose. Conclusion: One possible mechanistic explanation for this reduced complexity is the differing geometric organization of chromosome territories within ellipsoid nuclei compared to spherical nuclei. This study highlights the need to better understand the role of nuclear organization in the formation of exchange aberrations and, the influence three-dimensional (3D) tissue architecture may have on this in vivo. PMID:23679558

Molecular cloning and chromosomal localization of a pseudogene related to the human Acyl-CoA binding protein/diazepam binding inhibitor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gersuk, V.H.; Rose, T.M.; Todaro, G.J.

The acyl-CoA binding protein (ACBP) and the diazepam binding inhibitor (DBI) or endozepine are independent isolates of a single 86-amino-acid, 10-kDa protein. ACBP/DBI is highly conserved between species and has been identified in several diverse organisms, including human, cow, rat, frog, duck, insects, plants, and yeast. Although the genomic locus has not yet been cloned in humans, complementary DNA clones with different 5{prime} ends have been isolated and characterized. These cDNA clones appear to be encoded by a single gene. However, Southern blot analyses, in situ hybridizations, and somatic cell hybrid chromosomal mapping all suggest that there are multiple ACBP/DBI-relatedmore » sequences in the genome. To identify potential members of this gene family, degenerate oligonucleotides corresponding to highly conserved regions of ACBP/DBI were used to screen a human genomic DNA library using the polymerase chain reaction. A novel gene, DBIP1, that is closely related to ACBP/DBI but is clearly distinct was identified. DBIP1 bears extensive sequence homology to ACBP/DBI but lacks the introns predicted by rat and duck genomic sequence studies. A 1-base deletion in the coding region results in a frameshift and, along with the absence of introns and the lack of a detectable transcript, suggests that DBIP1 is a pseudogene. ACBP/DBI has previously been mapped to chromosome 2, although this was recently disputed, and a chromosome 6 location was suggested. We show that ACBP/DBI is correctly placed on chromosome 2 and that the gene identified on chromosome 6 is DBIP1. 33 refs., 3 figs., 1 tab.« less

Moderate Ovarian Stimulation Does Not Increase the Incidence of Human Embryo Chromosomal Abnormalities in in Vitro Fertilization Cycles

PubMed Central

Bosch, Ernesto; Alamá, Pilar; Rubio, Carmen; Rodrigo, Lorena; Pellicer, Antonio

2012-01-01

Context: A high chromosomal abnormalities rate has been observed in human embryos derived from in vitro fertilization (IVF) treatments. The real incidence in natural cycles has been poorly studied, so whether this frequency may be induced by external factors, such as use of gonadotropins for ovarian stimulation, remains unknown. Design: We conducted a prospective cohort study in a University-affiliated private infertility clinic with a comparison between unstimulated and stimulated ovarian cycles in the same women. Preimplantation genetic screening by fluorescence in situ hybridization was performed in all viable d 3 embryos. Objective: The primary objective was to compare the incidence of embryo chromosomal abnormalities in an unstimulated cycle and in an ulterior moderate ovarian stimulated cycle. Secondary outcome measures were embryo quality, blastocyst rate of biopsied embryos, number of normal blastocysts per donor, type of chromosomal abnormalities, and clinical outcome. Results: One hundred eighty-five oocyte donors were initially recruited for the unstimulated cycle, and preimplantation genetic screening could be performed in 51 of them, showing 35.3% of embryo chromosomal abnormalities. Forty-six of them later completed a stimulated cycle. The sperm donor sample was the same for both cycles. The proportion of embryos displaying abnormalities in the unstimulated cycle was 34.8% (16 of 46), whereas it was 40.6% (123 of 303) in the stimulated cycle with risk difference = 5.8 [95% confidence interval (CI) = −20.6–9.0], and relative risk = 1.17 (95% CI = 0.77–1.77) (P = 0.45). When an intrasubject comparison was made, the abnormalities rate was 34.8% (95% CI = 20.5–49.1) in the unstimulated cycle and 38.2% (95% CI = 30.5–45.8) in the stimulated cycle [risk difference = 3.4 (95% CI = −17.9–11.2); P = 0.64]. No differences were observed for embryo quality and type of chromosomal abnormalities. Conclusions: Moderate ovarian stimulation in young

A cluster of novel serotonin receptor 3-like genes on human chromosome 3.

PubMed

Karnovsky, Alla M; Gotow, Lisa F; McKinley, Denise D; Piechan, Julie L; Ruble, Cara L; Mills, Cynthia J; Schellin, Kathleen A B; Slightom, Jerry L; Fitzgerald, Laura R; Benjamin, Christopher W; Roberds, Steven L

2003-11-13

The ligand-gated ion channel family includes receptors for serotonin (5-hydroxytryptamine, 5-HT), acetylcholine, GABA, and glutamate. Drugs targeting subtypes of these receptors have proven useful for the treatment of various neuropsychiatric and neurological disorders. To identify new ligand-gated ion channels as potential therapeutic targets, drafts of human genome sequence were interrogated. Portions of four novel genes homologous to 5-HT(3A) and 5-HT(3B) receptors were identified within human sequence databases. We named the genes 5-HT(3C1)-5-HT(3C4). Radiation hybrid (RH) mapping localized these genes to chromosome 3q27-28. All four genes shared similar intron-exon organizations and predicted protein secondary structure with 5-HT(3A) and 5-HT(3B). Orthologous genes were detected by Southern blotting in several species including dog, cow, and chicken, but not in rodents, suggesting that these novel genes are not present in rodents or are very poorly conserved. Two of the novel genes are predicted to be pseudogenes, but two other genes are transcribed and spliced to form appropriate open reading frames. The 5-HT(3C1) transcript is expressed almost exclusively in small intestine and colon, suggesting a possible role in the serotonin-responsiveness of the gut.

ARKS: chromosome-scale scaffolding of human genome drafts with linked read kmers.

PubMed

Coombe, Lauren; Zhang, Jessica; Vandervalk, Benjamin P; Chu, Justin; Jackman, Shaun D; Birol, Inanc; Warren, René L

2018-06-20

The long-range sequencing information captured by linked reads, such as those available from 10× Genomics (10xG), helps resolve genome sequence repeats, and yields accurate and contiguous draft genome assemblies. We introduce ARKS, an alignment-free linked read genome scaffolding methodology that uses linked reads to organize genome assemblies further into contiguous drafts. Our approach departs from other read alignment-dependent linked read scaffolders, including our own (ARCS), and uses a kmer-based mapping approach. The kmer mapping strategy has several advantages over read alignment methods, including better usability and faster processing, as it precludes the need for input sequence formatting and draft sequence assembly indexing. The reliance on kmers instead of read alignments for pairing sequences relaxes the workflow requirements, and drastically reduces the run time. Here, we show how linked reads, when used in conjunction with Hi-C data for scaffolding, improve a draft human genome assembly of PacBio long-read data five-fold (baseline vs. ARKS NG50 = 4.6 vs. 23.1 Mbp, respectively). We also demonstrate how the method provides further improvements of a megabase-scale Supernova human genome assembly (NG50 = 14.74 Mbp vs. 25.94 Mbp before and after ARKS), which itself exclusively uses linked read data for assembly, with an execution speed six to nine times faster than competitive linked read scaffolders (~ 10.5 h compared to 75.7 h, on average). Following ARKS scaffolding of a human genome 10xG Supernova assembly (of cell line NA12878), fewer than 9 scaffolds cover each chromosome, except the largest (chromosome 1, n = 13). ARKS uses a kmer mapping strategy instead of linked read alignments to record and associate the barcode information needed to order and orient draft assembly sequences. The simplified workflow, when compared to that of our initial implementation, ARCS, markedly improves run time performances on experimental human genome

Noninvasive chromosome screening of human embryos by genome sequencing of embryo culture medium for in vitro fertilization.

PubMed

Xu, Juanjuan; Fang, Rui; Chen, Li; Chen, Daozhen; Xiao, Jian-Ping; Yang, Weimin; Wang, Honghua; Song, Xiaoqing; Ma, Ting; Bo, Shiping; Shi, Chong; Ren, Jun; Huang, Lei; Cai, Li-Yi; Yao, Bing; Xie, X Sunney; Lu, Sijia

2016-10-18

Preimplantation genetic screening (PGS) is widely used to select in vitro-fertilized embryos free of chromosomal abnormalities and to improve the clinical outcome of in vitro fertilization (IVF). A disadvantage of PGS is that it requires biopsy of the preimplantation human embryo, which can limit the clinical applicability of PGS due to the invasiveness and complexity of the process. Here, we present and validate a noninvasive chromosome screening (NICS) method based on sequencing the genomic DNA secreted into the culture medium from the human blastocyst. By using multiple annealing and looping-based amplification cycles (MALBAC) for whole-genome amplification (WGA), we performed next-generation sequencing (NGS) on the spent culture medium used to culture human blastocysts (n = 42) and obtained the ploidy information of all 24 chromosomes. We validated these results by comparing each with their corresponding whole donated embryo and obtained a high correlation for identification of chromosomal abnormalities (sensitivity, 0.882, and specificity, 0.840). With this validated NICS method, we performed chromosome screening on IVF embryos from seven couples with balanced translocation, azoospermia, or recurrent pregnancy loss. Six of them achieved successful clinical pregnancies, and five have already achieved healthy live births thus far. The NICS method avoids the need for embryo biopsy and therefore substantially increases the safety of its use. The method has the potential of much wider chromosome screening applicability in clinical IVF, due to its high accuracy and noninvasiveness.

Human X chromosome inactivation and reactivation: implications for cell reprogramming and disease.

PubMed

Cantone, Irene; Fisher, Amanda G

2017-11-05

X-chromosome inactivation (XCI) is an exemplar of epigenetic regulation that is set up as pluripotent cells differentiate. Once established, XCI is stably propagated, but can be reversed in vivo or by pluripotent reprogramming in vitro Although reprogramming provides a useful model for inactive X (Xi) reactivation in mouse, the relative instability and heterogeneity of human embryonic stem (ES) cells and induced pluripotent stem cells hampers comparable progress in human. Here we review studies aimed at reactivating the human Xi using different reprogramming strategies. We outline our recent results using mouse ES cells to reprogramme female human fibroblasts by cell-cell fusion. We show that pluripotent reprogramming induces widespread and rapid chromatin remodelling in which the human Xi loses XIST and H3K27m3 enrichment and selected Xi genes become reactivated, ahead of mitotic division. Using RNA sequencing to map the extent of human Xi reactivation, and chromatin-modifying drugs to potentiate reactivation, we outline how this approach could be used to better design strategies to re-express human X-linked loci. As cell fusion induces the expression of human pluripotency genes that represent both the 'primed' and 'naive' states, this approach may also offer a fresh opportunity to segregate human pluripotent states with distinct Xi expression profiles, using single-cell-based approaches.This article is part of the themed issue 'X-chromosome inactivation: a tribute to Mary Lyon'. © 2017 The Author(s).

Repetitive telomeric sequences in chromosomal translocations involving chromosome 21

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qu, J.; Dallaire, L.; Fetni, R.

Telomeres perform key functions in maintaining chromosome integrity. In some structural rearrangements the structure and polymorphism in human telomeres may play a significant role. However, of all the telomeric and subtelomeric sequences, only the terminal TTAGGG repeats are believed essential for telomere function. During the course of a study on the role of telomere structure and polymorphism in chromosomal rearrangements observed in families referred for prenatal diagnosis, we studied three cases in which chromosome 21 was involved. Repetitive TTAGGG sequences for all human chromosomes were used as probes (Oncor). Case 1, a de novo cryptic translocation (2;21) was initially identifiedmore » as monosomy 21 in a child with psychomotor delay and mild dysmorphism. Using a cosmid probe specific for region 21q22.3 and whole chromosome 21 specific painting probe, the long arm of 21 was found on the short arm of chromosome 2 with an interstitial telomere at the breakpoint junction. All the cells were monosomic for 21pter{yields}q21. Case 2 is a familial (19;21) translocation. GTG-banding and FISH with a satellite probe showed no apparent loss of material at the end of either 19q or 21q, with an interstitial telomere at the fusion site of the two intact chromosomes. In case 3, a four generation reciprocal (20;21) translocation, there was no interstitial telomere. The persistence of an interstitial telomere is a relatively rare event which can now be observed with in situ hybridization. Its study may lead to a better understanding of the dynamics of translocations and of chromosome imbalance.« less

Fine organization of genomic regions tagged to the 5S rDNA locus of the bread wheat 5B chromosome.

PubMed

Sergeeva, Ekaterina M; Shcherban, Andrey B; Adonina, Irina G; Nesterov, Michail A; Beletsky, Alexey V; Rakitin, Andrey L; Mardanov, Andrey V; Ravin, Nikolai V; Salina, Elena A

2017-11-14

The multigene family encoding the 5S rRNA, one of the most important structurally-functional part of the large ribosomal subunit, is an obligate component of all eukaryotic genomes. 5S rDNA has long been a favored target for cytological and phylogenetic studies due to the inherent peculiarities of its structural organization, such as the tandem arrays of repetitive units and their high interspecific divergence. The complex polyploid nature of the genome of bread wheat, Triticum aestivum, and the technically difficult task of sequencing clusters of tandem repeats mean that the detailed organization of extended genomic regions containing 5S rRNA genes remains unclear. This is despite the recent progress made in wheat genomic sequencing. Using pyrosequencing of BAC clones, in this work we studied the organization of two distinct 5S rDNA-tagged regions of the 5BS chromosome of bread wheat. Three BAC-clones containing 5S rDNA were identified in the 5BS chromosome-specific BAC-library of Triticum aestivum. Using the results of pyrosequencing and assembling, we obtained six 5S rDNA- containing contigs with a total length of 140,417 bp, and two sets (pools) of individual 5S rDNA sequences belonging to separate, but closely located genomic regions on the 5BS chromosome. Both regions are characterized by the presence of approximately 70-80 copies of 5S rDNA, however, they are completely different in their structural organization. The first region contained highly diverged short-type 5S rDNA units that were disrupted by multiple insertions of transposable elements. The second region contained the more conserved long-type 5S rDNA, organized as a single tandem array. FISH using probes specific to both 5S rDNA unit types showed differences in the distribution and intensity of signals on the chromosomes of polyploid wheat species and their diploid progenitors. A detailed structural organization of two closely located 5S rDNA-tagged genomic regions on the 5BS chromosome of bread

Micromechanical study of mitotic chromosome structure

NASA Astrophysics Data System (ADS)

Marko, John

2011-03-01

Our group has developed micromanipulation techniques for study of the highly compacted mitotic form of chromosome found in eukaryote cells during cell division. Each metaphase chromosome contains two duplicate centimeter-long DNA molecules, folded up by proteins into cylindrical structures several microns in length. Native chromosomes display linear and reversible stretching behavior over a wide range of extensions (up to 5x native length for amphibian chromosomes), described by a Young modulus of about 300 Pa. Studies using DNA-cutting and protein-cutting enzymes have revealed that metaphase chromosomes behave as a network of chromatin fibers held together by protein-based isolated crosslinks. Our results are not consistent with the more classical model of loops of chromatin attached to a protein-based structural organizer or ``scaffold". In short, our experiments indicate that metaphase chromosomes can be considered to be ``gels" of chromatin; the stretching modulus of a whole chromosome is consistent with stretching of the chromatin fibers contained within it. Experiments using topoisomerases suggest that topological constraints may play an appreciable role in confining chromatin in the metaphase chromosome. Finally, recent experiments on human chromosomes will be reviewed, including results of experiments where chromosome-folding proteins are specifically depleted using siRNA methods. Supported by NSF-MCB-1022117, DMR-0715099, PHY-0852130, DMR-0520513, NCI 1U54CA143869-01 (NU-PS-OC), and the American Heart Association.

Towards the delineation of the ancestral eutherian genome organization: comparative genome maps of human and the African elephant (Loxodonta africana) generated by chromosome painting.

PubMed Central

Frönicke, Lutz; Wienberg, Johannes; Stone, Gary; Adams, Lisa; Stanyon, Roscoe

2003-01-01

This study presents a whole-genome comparison of human and a representative of the Afrotherian clade, the African elephant, generated by reciprocal Zoo-FISH. An analysis of Afrotheria genomes is of special interest, because recent DNA sequence comparisons identify them as the oldest placental mammalian clade. Complete sets of whole-chromosome specific painting probes for the African elephant and human were constructed by degenerate oligonucleotide-primed PCR amplification of flow-sorted chromosomes. Comparative genome maps are presented based on their hybridization patterns. These maps show that the elephant has a moderately rearranged chromosome complement when compared to humans. The human paint probes identified 53 evolutionary conserved segments on the 27 autosomal elephant chromosomes and the X chromosome. Reciprocal experiments with elephant probes delineated 68 conserved segments in the human genome. The comparison with a recent aardvark and elephant Zoo-FISH study delineates new chromosomal traits which link the two Afrotherian species phylogenetically. In the absence of any morphological evidence the chromosome painting data offer the first non-DNA sequence support for an Afrotherian clade. The comparative human and elephant genome maps provide new insights into the karyotype organization of the proto-afrotherian, the ancestor of extant placental mammals, which most probably consisted of 2n=46 chromosomes. PMID:12965023

Genetic analysis of indefinite division in human cells: Evidence for a cell senescence-related gene(s) on human chromosome 4

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yi Ning; Ledbetter, D.H.; Smith, J.R.

1991-07-01

Earlier studies had demonstrated that fusion of normal with immortal human cells yielded hybrids having limited division potential. This indicated that the phenotype of limited proliferation (cellular senescence) is dominant and that immortal cells result from recessive changes in normal growth-regulatory genes. In additional studies, the authors exploited the fact that the immortal phenotype is recessive and, by fusing various immortal human cell lines with each other, identified four complementation groups for indefinite division. Assignment of cell lines to specific groups allowed us to take a focused approach to identify the chromosomes and genes involved in growth regulation that havemore » been modified in immortal cells. They report here that introduction of a normal human chromosome 4 into three immortal cell lines (HeLa, J82, T98G) assigned to complementation group B resulted in loss of proliferation and reversal of the immortal phenotype. No effect on the proliferation potential of cell lines representative of the other complementation groups was observed. This result suggests that a gene(s) involved in cellular senescence and normal growth regulation resides on chromosome 4.« less

Molecular organization and chromosomal localization of 5S rDNA in Amazonian Engystomops (Anura, Leiuperidae)

PubMed Central

2012-01-01

Background For anurans, knowledge of 5S rDNA is scarce. For Engystomops species, chromosomal homeologies are difficult to recognize due to the high level of inter- and intraspecific cytogenetic variation. In an attempt to better compare the karyotypes of the Amazonian species Engystomops freibergi and Engystomops petersi, and to extend the knowledge of 5S rDNA organization in anurans, the 5S rDNA sequences of Amazonian Engystomops species were isolated, characterized, and mapped. Results Two types of 5S rDNA, which were readily differentiated by their NTS (non-transcribed spacer) sizes and compositions, were isolated from specimens of E. freibergi from Brazil and E. petersi from two Ecuadorian localities (Puyo and Yasuní). In the E. freibergi karyotypes, the entire type I 5S rDNA repeating unit hybridized to the pericentromeric region of 3p, whereas the entire type II 5S rDNA repeating unit mapped to the distal region of 6q, suggesting a differential localization of these sequences. The type I NTS probe clearly detected the 3p pericentromeric region in the karyotypes of E. freibergi and E. petersi from Puyo and the 5p pericentromeric region in the karyotype of E. petersi from Yasuní, but no distal or interstitial signals were observed. Interestingly, this probe also detected many centromeric regions in the three karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. The type II NTS probe detected only distal 6q regions in the three karyotypes, corroborating the differential distribution of the two types of 5S rDNA. Conclusions Because the 5S rDNA types found in Engystomops are related to those of Physalaemus with respect to their nucleotide sequences and chromosomal locations, their origin likely preceded the evolutionary divergence of these genera. In addition, our data indicated homeology between Chromosome 5 in E. petersi from Yasuní and Chromosomes 3 in E. freibergi and E. petersi from Puyo. In addition, the chromosomal location

Molecular organization and chromosomal localization of 5S rDNA in Amazonian Engystomops (Anura, Leiuperidae).

PubMed

Rodrigues, Débora Silva; Rivera, Miryan; Lourenço, Luciana Bolsoni

2012-03-20

For anurans, knowledge of 5S rDNA is scarce. For Engystomops species, chromosomal homeologies are difficult to recognize due to the high level of inter- and intraspecific cytogenetic variation. In an attempt to better compare the karyotypes of the Amazonian species Engystomops freibergi and Engystomops petersi, and to extend the knowledge of 5S rDNA organization in anurans, the 5S rDNA sequences of Amazonian Engystomops species were isolated, characterized, and mapped. Two types of 5S rDNA, which were readily differentiated by their NTS (non-transcribed spacer) sizes and compositions, were isolated from specimens of E. freibergi from Brazil and E. petersi from two Ecuadorian localities (Puyo and Yasuní). In the E. freibergi karyotypes, the entire type I 5S rDNA repeating unit hybridized to the pericentromeric region of 3p, whereas the entire type II 5S rDNA repeating unit mapped to the distal region of 6q, suggesting a differential localization of these sequences. The type I NTS probe clearly detected the 3p pericentromeric region in the karyotypes of E. freibergi and E. petersi from Puyo and the 5p pericentromeric region in the karyotype of E. petersi from Yasuní, but no distal or interstitial signals were observed. Interestingly, this probe also detected many centromeric regions in the three karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. The type II NTS probe detected only distal 6q regions in the three karyotypes, corroborating the differential distribution of the two types of 5S rDNA. Because the 5S rDNA types found in Engystomops are related to those of Physalaemus with respect to their nucleotide sequences and chromosomal locations, their origin likely preceded the evolutionary divergence of these genera. In addition, our data indicated homeology between Chromosome 5 in E. petersi from Yasuní and Chromosomes 3 in E. freibergi and E. petersi from Puyo. In addition, the chromosomal location of the type II 5S r

The human gene for alkaptonuria (AKU) maps to chromosome 3q

DOE Office of Scientific and Technical Information (OSTI.GOV)

Janocha, S.; Wolz, W.; Grimm, T.

1994-01-01

Alkaptonuria (AKU; McKusick no. 203500) is a rare autosomal recessive disorder caused by the lack of homogentisic acid oxidase activity. Patients excrete large amounts of homogentisic acid in their urine and a black ochronotic pigment is deposited in their cartilage and collagenous tissues. Ochronosis is the predominant clinical complication of the disease leading to ochronotic arthropathy, dark urine, pigment changes of the skin, and other clinical features. A mutation causing alkaptonuria in the mouse has mapped to chromosome 16. Considering conserved synteny, the authors were able to map the human gene to chromosome 3q in six alkaptonuria pedigrees of Slovakmore » origin. 22 refs., 3 figs., 1 tab.« less

Assignment of xeroderma pigmentosum group C(XPC) gene to chromosome 3p25

DOE Office of Scientific and Technical Information (OSTI.GOV)

Legerski, R.J.; Liu, P.; Li, L.

1994-05-01

The human gene XPC (formerly designated XPCC), which corrects the repair deficiency of xeroderma pigmentosum (XP) group C cells, was mapped to 3p25. A cDNA probe for Southern blot hybridization and diagnostic PCR analyses of hybrid clone panels informative for human chromosomes in general and portions of chromosome 3 in particular produced the initial results. Fluorescence in situ hybridization utilizing both a yeast artificial chromosome DNA containing the gene and XPC cDNA as probes provided verification and specific regional assignment. A conflicting assignment of XPC to chromosome 5 is discussed in light of inadequacies in the exclusive use of microcell-mediatedmore » chromosome transfer for gene mapping. 12 refs., 3 figs.« less

Chromosome surveys of human populations: between epidemiology and anthropology.

PubMed

de Chadarevian, Soraya

2014-09-01

It is commonly held that after 1945 human genetics turned medical and focussed on the individual rather than on the study of human populations that had become discredited. However, a closer look at the research practices at the time quickly reveals that human population studies, using old and new tools, prospered in this period. The essay focuses on the rise of chromosome analysis as a new tool for the study of human populations. It reviews a broad array of population studies ranging from newborn screening programmes to studies of isolated or 'primitive' people. Throughout, it highlights the continuing role of concerns and opportunities raised by the propagation of atomic energy for civilian and military uses, the collection of large data bases and computers, and the role of international organisations like the World Health Organisation and the International Biological Programme in shaping research agendas and carving out a space for human heredity in the postwar era. Copyright © 2014 Elsevier Ltd. All rights reserved.

The Chromosomal Association of the Smc5/6 Complex Depends on Cohesion and Predicts the Level of Sister Chromatid Entanglement

PubMed Central

Jeppsson, Kristian; Carlborg, Kristian K.; Nakato, Ryuichiro; Berta, Davide G.; Lilienthal, Ingrid; Kanno, Takaharu; Lindqvist, Arne; Brink, Maartje C.; Dantuma, Nico P.; Katou, Yuki; Shirahige, Katsuhiko; Sjögren, Camilla

2014-01-01

The cohesin complex, which is essential for sister chromatid cohesion and chromosome segregation, also inhibits resolution of sister chromatid intertwinings (SCIs) by the topoisomerase Top2. The cohesin-related Smc5/6 complex (Smc5/6) instead accumulates on chromosomes after Top2 inactivation, known to lead to a buildup of unresolved SCIs. This suggests that cohesin can influence the chromosomal association of Smc5/6 via its role in SCI protection. Using high-resolution ChIP-sequencing, we show that the localization of budding yeast Smc5/6 to duplicated chromosomes indeed depends on sister chromatid cohesion in wild-type and top2-4 cells. Smc5/6 is found to be enriched at cohesin binding sites in the centromere-proximal regions in both cell types, but also along chromosome arms when replication has occurred under Top2-inhibiting conditions. Reactivation of Top2 after replication causes Smc5/6 to dissociate from chromosome arms, supporting the assumption that Smc5/6 associates with a Top2 substrate. It is also demonstrated that the amount of Smc5/6 on chromosomes positively correlates with the level of missegregation in top2-4, and that Smc5/6 promotes segregation of short chromosomes in the mutant. Altogether, this shows that the chromosomal localization of Smc5/6 predicts the presence of the chromatid segregation-inhibiting entities which accumulate in top2-4 mutated cells. These are most likely SCIs, and our results thus indicate that, at least when Top2 is inhibited, Smc5/6 facilitates their resolution. PMID:25329383

Biomarker for Space Radiation Risk: Painting Analysis of Chromosome Aberrations Induced by Energetic Heavy Ions in Human Cells

NASA Technical Reports Server (NTRS)

Hada, Megumi; George, Kerry; Cucinotta, Francis A.; Wu, Honglu

2007-01-01

Energetic heavy ions pose a great health risk to astronauts in extended ISS and future Lunar and Mars missions. High-LET heavy ions are particularly effective in causing various biological effects, including cell inactivation, genetic mutations, cataracts and cancer induction. Most of these biological endpoints are closely related to chromosomal damage, which can be utilized as a biomarker for radiation insults. Over the years, we have studied chromosomal damage in human fibroblast, epithelia and lymphocyte cells exposed in vitro to energetic charged particles generated at several accelerator facilities in the world. We have also studied chromosome aberrations in astronaut s peripheral blood lymphocytes before and after space flight. Various fluorescence in situ hybridization painting techniques have been used to identify from only the telomere region of the chromosome to every chromosome in a human cell. We will summarize the results of the investigations, and discuss the unique radiation signatures and biomarkers for space radiation exposure.

The human chromosomal fragile sites more often involved in constitutional deletions and duplications - A genetic and statistical assessment

NASA Astrophysics Data System (ADS)

Gomes, Dora Prata; Sequeira, Inês J.; Figueiredo, Carlos; Rueff, José; Brás, Aldina

2016-12-01

Human chromosomal fragile sites (CFSs) are heritable loci or regions of the human chromosomes prone to exhibit gaps, breaks and rearrangements. Determining the frequency of deletions and duplications in CFSs may contribute to explain the occurrence of human disease due to those rearrangements. In this study we analyzed the frequency of deletions and duplications in each human CFS. Statistical methods, namely data display, descriptive statistics and linear regression analysis were applied to analyze this dataset. We found that FRA15C, FRA16A and FRAXB are the most frequently involved CFSs in deletions and duplications occurring in the human genome.

Genealogical and evolutionary inference with the human Y chromosome.

PubMed

Stumpf, M P; Goldstein, D B

2001-03-02

Population genetics has emerged as a powerful tool for unraveling human history. In addition to the study of mitochondrial and autosomal DNA, attention has recently focused on Y-chromosome variation. Ambiguities and inaccuracies in data analysis, however, pose an important obstacle to further development of the field. Here we review the methods available for genealogical inference using Y-chromosome data. Approaches can be divided into those that do and those that do not use an explicit population model in genealogical inference. We describe the strengths and weaknesses of these model-based and model-free approaches, as well as difficulties associated with the mutation process that affect both methods. In the case of genealogical inference using microsatellite loci, we use coalescent simulations to show that relatively simple generalizations of the mutation process can greatly increase the accuracy of genealogical inference. Because model-free and model-based approaches have different biases and limitations, we conclude that there is considerable benefit in the continued use of both types of approaches.

Allometric Analysis Detects Brain Size-Independent Effects of Sex and Sex Chromosome Complement on Human Cerebellar Organization

PubMed Central

Mankiw, Catherine; Park, Min Tae M.; Reardon, P.K.; Fish, Ari M.; Clasen, Liv S.; Greenstein, Deanna; Blumenthal, Jonathan D.; Lerch, Jason P.; Chakravarty, M. Mallar

2017-01-01

The cerebellum is a large hindbrain structure that is increasingly recognized for its contribution to diverse domains of cognitive and affective processing in human health and disease. Although several of these domains are sex biased, our fundamental understanding of cerebellar sex differences—including their spatial distribution, potential biological determinants, and independence from brain volume variation—lags far behind that for the cerebrum. Here, we harness automated neuroimaging methods for cerebellar morphometrics in 417 individuals to (1) localize normative male–female differences in raw cerebellar volume, (2) compare these to sex chromosome effects estimated across five rare sex (X/Y) chromosome aneuploidy (SCA) syndromes, and (3) clarify brain size-independent effects of sex and SCA on cerebellar anatomy using a generalizable allometric approach that considers scaling relationships between regional cerebellar volume and brain volume in health. The integration of these approaches shows that (1) sex and SCA effects on raw cerebellar volume are large and distributed, but regionally heterogeneous, (2) human cerebellar volume scales with brain volume in a highly nonlinear and regionally heterogeneous fashion that departs from documented patterns of cerebellar scaling in phylogeny, and (3) cerebellar organization is modified in a brain size-independent manner by sex (relative expansion of total cerebellum, flocculus, and Crus II-lobule VIIIB volumes in males) and SCA (contraction of total cerebellar, lobule IV, and Crus I volumes with additional X- or Y-chromosomes; X-specific contraction of Crus II-lobule VIIIB). Our methods and results clarify the shifts in human cerebellar organization that accompany interwoven variations in sex, sex chromosome complement, and brain size. SIGNIFICANCE STATEMENT Cerebellar systems are implicated in diverse domains of sex-biased behavior and pathology, but we lack a basic understanding of how sex differences in the

Allometric Analysis Detects Brain Size-Independent Effects of Sex and Sex Chromosome Complement on Human Cerebellar Organization.

PubMed

Mankiw, Catherine; Park, Min Tae M; Reardon, P K; Fish, Ari M; Clasen, Liv S; Greenstein, Deanna; Giedd, Jay N; Blumenthal, Jonathan D; Lerch, Jason P; Chakravarty, M Mallar; Raznahan, Armin

2017-05-24

The cerebellum is a large hindbrain structure that is increasingly recognized for its contribution to diverse domains of cognitive and affective processing in human health and disease. Although several of these domains are sex biased, our fundamental understanding of cerebellar sex differences-including their spatial distribution, potential biological determinants, and independence from brain volume variation-lags far behind that for the cerebrum. Here, we harness automated neuroimaging methods for cerebellar morphometrics in 417 individuals to (1) localize normative male-female differences in raw cerebellar volume, (2) compare these to sex chromosome effects estimated across five rare sex (X/Y) chromosome aneuploidy (SCA) syndromes, and (3) clarify brain size-independent effects of sex and SCA on cerebellar anatomy using a generalizable allometric approach that considers scaling relationships between regional cerebellar volume and brain volume in health. The integration of these approaches shows that (1) sex and SCA effects on raw cerebellar volume are large and distributed, but regionally heterogeneous, (2) human cerebellar volume scales with brain volume in a highly nonlinear and regionally heterogeneous fashion that departs from documented patterns of cerebellar scaling in phylogeny, and (3) cerebellar organization is modified in a brain size-independent manner by sex (relative expansion of total cerebellum, flocculus, and Crus II-lobule VIIIB volumes in males) and SCA (contraction of total cerebellar, lobule IV, and Crus I volumes with additional X- or Y-chromosomes; X-specific contraction of Crus II-lobule VIIIB). Our methods and results clarify the shifts in human cerebellar organization that accompany interwoven variations in sex, sex chromosome complement, and brain size. SIGNIFICANCE STATEMENT Cerebellar systems are implicated in diverse domains of sex-biased behavior and pathology, but we lack a basic understanding of how sex differences in the human

Arrested human embryos are more likely to have abnormal chromosomes than developing embryos from women of advanced maternal age.

PubMed

Qi, Shu-Tao; Liang, Li-Feng; Xian, Ye-Xing; Liu, Jian-Qiao; Wang, Weihua

2014-01-01

Aneuploidy is one of the major factors that result in low efficiency in human infertility treatment by in vitro fertilization (IVF). The development of DNA microarray technology allows for aneuploidy screening by analyzing all 23 pairs of chromosomes in human embryos. All chromosome screening for aneuploidy is more accurate than partial chromosome screening, as errors can occur in any chromosome. Currently, chromosome screening for aneuploidy is performed in developing embryos, mainly blastocysts. It has not been performed in arrested embryos and/or compared between developing embryos and arrested embryos from the same IVF cycle. The present study was designed to examine all chromosomes in blastocysts and arrested embryos from the same cycle in patients of advanced maternal ages. Embryos were produced by routine IVF procedures. A total of 90 embryos (45 blastocysts and 45 arrested embryos) from 17 patients were biopsied and analyzed by the Agilent DNA array platform. It was found that 50% of the embryos developed to blastocyst stage; however, only 15.6% of the embryos (both blastocyst and arrested) were euploid, and most (84.4%) of the embryos had chromosomal abnormalities. Further analysis indicated that 28.9% of blastocysts were euploid and 71.1% were aneuploid. By contrast, only one (2.2%) arrested embryo was euploid while others (97.8%) were aneuploid. The prevalence of multiple chromosomal abnormalities in the aneuploid embryos was also higher in the arrested embryos than in the blastocysts. These results indicate that high proportions of human embryos from patients of advanced maternal age are aneuploid, and the arrested embryos are more likely to have abnormal chromosomes than developing embryos.

Unrepaired DNA damage facilitates elimination of uniparental chromosomes in interspecific hybrid cells

PubMed Central

Wang, Zheng; Yin, Hao; Lv, Lei; Feng, Yingying; Chen, Shaopeng; Liang, Junting; Huang, Yun; Jiang, Xiaohua; Jiang, Hanwei; Bukhari, Ihtisham; Wu, Lijun; Cooke, Howard J; Shi, Qinghua

2014-01-01

Elimination of uniparental chromosomes occurs frequently in interspecific hybrid cells. For example, human chromosomes are always eliminated during clone formation when human cells are fused with mouse cells. However, the underlying mechanisms are still elusive. Here, we show that the elimination of human chromosomes in human–mouse hybrid cells is accompanied by continued cell division at the presence of DNA damage on human chromosomes. Deficiency in DNA damage repair on human chromosomes occurs after cell fusion. Furthermore, increasing the level of DNA damage on human chromosomes by irradiation accelerates human chromosome loss in hybrid cells. Our results indicate that the elimination of human chromosomes in human–mouse hybrid cells results from unrepaired DNA damage on human chromosomes. We therefore provide a novel mechanism underlying chromosome instability which may facilitate the understanding of carcinogenesis. PMID:24608870

Sodium arsenite induces chromosome endoreduplication and inhibits protein phosphatase activity in human fibroblasts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rong-Nan Huang; I-Ching Ho; Ling-Hui Yih

Arsenic, strongly associated with increased risks of human cancers, is a potent clastogen in a variety of mammalian cell systems. The effect of sodium arsenite (a trivalent arsenic compound) on chromatid separation was studied in human skin fibroblasts (HFW). Human fibroblasts were arrested in S phase by the aid of serum starvation and aphidicolin blocking and then these cells were allowed to synchronously progress into G2 phase. Treatment of the G2-enriched HFW cells with sodium arsenite (0-200 {mu}M) resulted in arrest of cells in the G2 phase, interference with mitotic division, inhibition of spindle assembly, and induction of chromosome endoreduplicationmore » in their second mitosis. Sodium arsenite treatment also inhibited the activities of serine/threonine protein phosphatases and enhanced phosphorylation levels of a small heat shock protein (HSP27). These results suggest that sodium arsenite may mimic okadaic acid to induce chromosome endoreduplication through its inhibitory effect on protein phosphatase activity. 61 refs., 6 figs., 2 tabs.« less

Clinical and molecular cytogenetic studies in ring chromosome 5: report of a child with congenital abnormalities.

PubMed

Basinko, Audrey; Giovannucci Uzielli, Maria Luisa; Scarselli, Gloria; Priolo, Manuela; Timpani, Giuseppina; De Braekeleer, Marc

2012-02-01

We report here a child with a ring chromosome 5 (r(5)) associated with facial dysmorphology and multiple congenital abnormalities. Fluorescent in situ hybridization (FISH) using bacterial artificial chromosome (BAC) clones was performed to determine the breakpoints involved in the r(5). The 5p deletion extended from 5p13.2-3 to 5pter and measured 34.61 Mb (range: 33.7-35.52 Mb) while the 5q deletion extended from 5q35.3 to 5qter and measured 2.44 Mb (range: 2.31-2.57 Mb). The patient presented signs such as microcephaly, hypertelorism, micrognathia and epicanthal folds, partially recalling those of a deletion of the short arm of chromosome 5 and the "cri-du-chat" syndrome. The most striking phenotypic features were the congenital heart abnormalities which have been frequently reported in deletions of the distal part of the long arm of chromosome 5 and in rings leading to a 5q35-5qter deletion. However, the NKX2-5 gene, which has been related to congenital heart defects, was not deleted in our patient, nor presumably to some other patients with 5q35.3-5qter deletion. We propose that VEGFR3, deleted in our patient, could be a candidate gene for the congenital heart abnormalities observed. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

Analysis of Heavy Ion-Induced Chromosome Aberrations in Human Fibroblast Cells Using In Situ Hybridization

NASA Technical Reports Server (NTRS)

Wu, Honglu; Durante, Marco; Furusawa, Yoshiya; George, Kerry; Kawata, Tetsuya; Cucinotta, Francis A.

2003-01-01

Confluent human fibroblast cells (AG1522) were irradiated with gamma rays, 490 MeV/nucleon Si, or with Fe ions at either 200 or 500 MeV/nucleon. The cells were allowed to repair at 37 0 C for 24 hours after exposure, and a chemically induced premature chromosome condensation (PCC) technique was used to condense chromosomes in the G2 phase of the cell cycle. Unrejoined chromosomal breaks and complex exchanges were analyzed in the irradiated samples. In order to verify that chromosomal breaks were truly unrejoined, chromosome aberrations were analyzed using a combination of whole chromosome specific probes and probes specific for the telomere region of the chromosome. Results showed that the frequency of unrejoined chromosome breaks was higher after high-LET radiation, and consequently, the ratio of incomplete to complete exchanges increased steadily with LET up to 440 keV/micron, the highest LET value in the present study. For samples exposed to 200 MeV/nucleon Fe ions, chromosome aberrations were analyzed using the multicolor FISH (mFISH) technique that allows identification of both complex and truly incomplete exchanges. Results of the mFISH study showed that 0.7 and 3 Gy dose of the Fe ions produced similar ratios of complex to simple exchanges and incomplete to complete exchanges, values for which were higher than those obtained after a 6 Gy gamma exposure. After 0.7 Gy of Fe ions, most complex aberrations were found to involve three or four chromosomes, indicating the maximum number of chromosome domains traversed by a single Fe ion track. 2

Karyotyping of Chromosomes in Human Bronchial Epithelial Cells Transformed by High Energy Fe Ions

NASA Technical Reports Server (NTRS)

Yeshitla, Samrawit; Zhang, Ye; Park, Seongmi; Story, Michael D.; Wilson, Bobby; Wu, Honglu

2015-01-01

Lung cancer induced from exposures to space radiation is one of the most significant health risks for long-term space travels. Evidences show that low- and high- Linear energy transfer (LET)-induced transformation of normal human bronchial epithelial cells (HBEC) that are immortalized through the expression of Cdk4 and hTERT. The cells were exposed to gamma rays and high-energy Fe ions for the selection of transformed clones. Transformed HBEC are identified and analyzed chromosome aberrations (i.e. genomic instability) using the multi-color fluorescent in situ hybridization (mFISH), as well as the multi-banding in situ hybridization (mBAND) techniques. Our results show chromosomal translocations between different chromosomes and several of the breaks occurred in the q-arm of chromosome 3. We also identified copy number variations between the transformed and the parental HBEC regardless of the exposure conditions. We observed chromosomal aberrations in the lowand high-LET radiation-induced transformed clones and they are imperfectly different from clones obtain in spontaneous soft agar growth.

Human RECQL5: guarding the crossroads of DNA replication and transcription and providing backup capability.

PubMed

Popuri, Venkateswarlu; Tadokoro, Takashi; Croteau, Deborah L; Bohr, Vilhelm A

2013-01-01

DNA helicases are ubiquitous enzymes that catalyze unwinding of duplex DNA and function in all metabolic processes in which access to single-stranded DNA is required, including DNA replication, repair, recombination and RNA transcription. RecQ helicases are a conserved family of DNA helicases that display highly specialized and vital roles in the maintenance of genome stability. Mutations in three of the five human RecQ helicases, BLM, WRN and RECQL4 are associated with the genetic disorders Bloom syndrome, Werner syndrome and Rothmund-Thomson syndrome that are characterized by chromosomal instability, premature aging and predisposition to cancer. The biological role of human RECQL5 is only partially understood and RECQL5 has not yet been associated with any human disease. Illegitimate recombination and replication stress are hallmarks of human cancers and common instigators for genomic instability and cell death. Recql5 knockout mice are cancer prone and show increased chromosomal instability. Recql5-deficient mouse embryonic fibroblasts are sensitive to camptothecin and display elevated levels of sister chromatid exchanges. Unlike other human RecQ helicases, RECQL5 is recruited to single-stranded DNA breaks and is also proposed to play an essential role in RNA transcription. Here, we review the established roles of RECQL5 at the cross roads of DNA replication, recombination and transcription, and propose that human RECQL5 provides important backup functions in the absence of other DNA helicases.

Localization of the human mitochondrial citrate transporter protein gene to chromosome 22q11 in the DiGeorge syndrome critical region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Heisterkamp, N.; Hoeve, J.T.; Groffen, J.

A high percentage of patients with DiGeorge syndrome and velo-cardio-facial syndrome have interstitial deletions on chromosome 22q11. The shortest region of overlap is currently estimated to be around 500 kb. Two segments of DNA from chromosome 22q11, located 160 kb apart, were cloned because they contained NotI restriction enzyme sites. In the current study we demonstrate that these segments are absent from chromosomes 22 carrying microdeletions of two different DiGeorge patients. Fluorescence in situ and Southern blot hybridization was further used to show that this locus is within the DiGeorge critical region. Phylogenetically conserved sequences adjacent to one of themore » two NotI sites hybridized to mRNAs in different human cell lines. cDNAs isolated with a probe from this segment showed it to contain the gene for the human mitochondrial citrate transporter protein. Deletion of this gene in DiGeorge may contribute to the mental deficiency seen in the patients. 35 refs., 5 figs.« less

Preimplantation diagnosis of repeated miscarriage due to chromosomal translocations using metaphase chromosomes of a blastomere biopsied from 4- to 6-cell-stage embryos.

PubMed

Tanaka, Atsushi; Nagayoshi, Motoi; Awata, Shoichiro; Mawatari, Yoshifumi; Tanaka, Izumi; Kusunoki, Hiroshi

2004-01-01

To evaluate the safety and accuracy of karyotyping the blastomere chromosomes at metaphase in the natural cell cycle for preimplantation diagnosis. A pilot study. A private infertility clinic and a university laboratory. Eleven patients undergoing IVF and preimplantation diagnosis. Intact human embryos at the 4- to 6-cell stage and human-mouse heterokaryons were cultured and checked hourly for disappearance of the nuclear envelope. After it disappeared, the metaphase chromosomes were analyzed by fluorescence in situ hybridization. Percentage of analyzable metaphase plates and safety and accuracy of the method. The success rate of electrofusion to form human-mouse heterokaryons was 87.1% (27/31), and analyzable chromosomes were obtained from 77.4% (24/31) of the heterokaryons. On the other hand, disappearance of the nuclear envelope occurred in 89.5% (17/19) of the human embryos and it began earlier than that in the heterokaryons. Analyzable chromosomes were obtained and their translocation sites were identified in all blastomeres biopsied from the 17 embryos. After the biopsy, 67.0% of the embryos could develop to the blastocyst stage. The natural cell cycle method reported herein requires frequent observation, but it is safe, with no artificial effects on the chromosomes and without loss of or damage to blastomeres, which occurred with the electrofusion method. Using the natural cell cycle method, we could perform preimplantation diagnosis with nearly 100% accuracy.

Identification and genetic mapping of a homeobox gene to the 4p16. 1 region of human chromosome 4

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stadler, H.S.; Padanilam, B.J.; Solursh, M.

1992-12-01

A human craniofacial cDNA library was screened with a degenerate oligonucleotide probe based on the conserved third helix of homeobox genes. From this screening, we identified a homeobox gene, H6, which shared only 57-65% amino acid identity to previously reported homeodomains. H6 was physically mapped to the 4P16.1 region by using somatic cell hybrids containing specific deletions of human chromosome 4. Linkage data from a single-stranded conformational polymorphism derived from the 3[prime] untranslated region of the H6 cDNA placed this homeobox gene more than 20 centimorgans proximal of the previously mapped HOX7 gene on chromosome 4. Identity comparisons of themore » H6 Homeodomain with previously reported homeodomains reveal the highest identities to be with the Nk class of homeobox genes in Drosophila melanogaster. 53 refs., 5 figs., 2 tabs.« less

Unique and conserved microRNAs in wheat chromosome 5D revealed by next-generation sequencing.

PubMed

Kurtoglu, Kuaybe Yucebilgili; Kantar, Melda; Lucas, Stuart J; Budak, Hikmet

2013-01-01

MicroRNAs are a class of short, non-coding, single-stranded RNAs that act as post-transcriptional regulators in gene expression. miRNA analysis of Triticum aestivum chromosome 5D was performed on 454 GS FLX Titanium sequences of flow-sorted chromosome 5D with a total of 3,208,630 good quality reads representing 1.34x and 1.61x coverage of the short (5DS) and long (5DL) arms of the chromosome respectively. In silico and structural analyses revealed a total of 55 miRNAs; 48 and 42 miRNAs were found to be present on 5DL and 5DS respectively, of which 35 were common to both chromosome arms, while 13 miRNAs were specific to 5DL and 7 miRNAs were specific to 5DS. In total, 14 of the predicted miRNAs were identified in wheat for the first time. Representation (the copy number of each miRNA) was also found to be higher in 5DL (1,949) compared to 5DS (1,191). Targets were predicted for each miRNA, while expression analysis gave evidence of expression for 6 out of 55 miRNAs. Occurrences of the same miRNAs were also found in Brachypodium distachyon and Oryza sativa genome sequences to identify syntenic miRNA coding sequences. Based on this analysis, two other miRNAs: miR1133 and miR167 were detected in B. distachyon syntenic region of wheat 5DS. Five of the predicted miRNA coding regions (miR6220, miR5070, miR169, miR5085, miR2118) were experimentally verified to be located to the 5D chromosome and three of them : miR2118, miR169 and miR5085, were shown to be 5D specific. Furthermore miR2118 was shown to be expressed in Chinese Spring adult leaves. miRNA genes identified in this study will expand our understanding of gene regulation in bread wheat.

An integrated approach of comparative genomics and heritability analysis of pig and human on obesity trait: evidence for candidate genes on human chromosome 2.

PubMed

Kim, Jaemin; Lee, Taeheon; Kim, Tae-Hun; Lee, Kyung-Tai; Kim, Heebal

2012-12-19

Traditional candidate gene approach has been widely used for the study of complex diseases including obesity. However, this approach is largely limited by its dependence on existing knowledge of presumed biology of the phenotype under investigation. Our combined strategy of comparative genomics and chromosomal heritability estimate analysis of obesity traits, subscapular skinfold thickness and back-fat thickness in Korean cohorts and pig (Sus scrofa), may overcome the limitations of candidate gene analysis and allow us to better understand genetic predisposition to human obesity. We found common genes including FTO, the fat mass and obesity associated gene, identified from significant SNPs by association studies of each trait. These common genes were related to blood pressure and arterial stiffness (P = 1.65E-05) and type 2 diabetes (P = 0.00578). Through the estimation of variance of genetic component (heritability) for each chromosome by SNPs, we observed a significant positive correlation (r = 0.479) between genetic contributions of human and pig to obesity traits. Furthermore, we noted that human chromosome 2 (syntenic to pig chromosomes 3 and 15) was most important in explaining the phenotypic variance for obesity. Obesity genetics still awaits further discovery. Navigating syntenic regions suggests obesity candidate genes on chromosome 2 that are previously known to be associated with obesity-related diseases: MRPL33, PARD3B, ERBB4, STK39, and ZNF385B.

The gene coding for the B cell surface protein CD19 is localized on human chromosome 16p11.

PubMed

Stapleton, P; Kozmik, Z; Weith, A; Busslinger, M

1995-02-01

The CD19 gene codes for one of the earliest markers of the human B cell lineage and is a target for the B lymphoid-specific transcription factor BSAP (Pax-5). The transmembrane protein CD19 has been implicated in controlling proliferation of mature B lymphocytes by modulating signal transduction through the antigen receptor. In this study, we have employed Southern blot and fluorescence in situ hybridization analyses to localize the CD19 gene to human chromosome 16p11.

Primary structure, expression and chromosomal locus of a human homolog of rat ERK3.

PubMed

Meloche, S; Beatty, B G; Pellerin, J

1996-10-03

We report the cloning and characterization of a human cDNA encoding a novel homolog of rat extracellular signal-regulated kinase 3 (ERK3). The cDNA encodes a predicted protein of 721 amino acids which shares 92% amino acid identity with rat ERK3 over their shared length. Interestingly, the human protein contains a unique extension of 178 amino acids at its carboxy terminal extremity. The human ERK3 protein also displays various degrees of homology to other members of the MAP kinases family, but does not contain the typical TXY regulatory motif between subdomains VII and VIII. Northern blot analysis revealed that ERK3 mRNA is widely distributed in human tissues, with the highest expression detected in skeletal muscle. The human ERK3 gene was mapped by fluorescence in situ hybridization to chromosome 15q21, a region associated with chromosomal abnormalities in acute nonlymphoblastic leukemias. This information should prove valuable in designing studies to define the cellular function of the ERK3 protein kinase.

Cytological and cytogenetical studies on brain tumors. V. Preferential loss of sex chromosomes in human meningiomas.

PubMed

Zankl, H; Seidel, H; Zang, K D

1975-01-01

Twelve out of 88 cytogenetically examined meningiomas of female patients showed, in addition to the typical loss of a chromosome 22, a loss of 1 or more chromosomes of group C. Among them 8 tumors had less than 8% cells with Barr-body-like particles, whereas in one tumor 12% and in 3 others over 20% Barr bodies were found, which, based on control studies, were classified as sex-chromatin negative, partly positive, and positive, respectively. In one case the loss of an X chromosome was verified by Giemsa banding. In 6 out of 24 meningiomas of male origin, the chromosomal morphology and association pattern strongly indicated that besides the loss of a chromosome 22, the Y chromosome was also missing. Moreover, the loss of the male sex chromosome could be ascertained in 4 tumors by the conspicuous absence of Y fluorescence in interphase nuclei and in metaphase plates after fluorescence staining. The findings are discussed in connection with the gonosomal loss in other human tumors and in old age.

Genomic Instability in Human Pluripotent Stem Cells Arises from Replicative Stress and Chromosome Condensation Defects.

PubMed

Lamm, Noa; Ben-David, Uri; Golan-Lev, Tamar; Storchová, Zuzana; Benvenisty, Nissim; Kerem, Batsheva

2016-02-04

Human pluripotent stem cells (hPSCs) frequently acquire chromosomal aberrations such as aneuploidy in culture. These aberrations progressively increase over time and may compromise the properties and clinical utility of the cells. The underlying mechanisms that drive initial genomic instability and its continued progression are largely unknown. Here, we show that aneuploid hPSCs undergo DNA replication stress, resulting in defective chromosome condensation and segregation. Aneuploid hPSCs show altered levels of actin cytoskeletal genes controlled by the transcription factor SRF, and overexpression of SRF rescues impaired chromosome condensation and segregation defects in aneuploid hPSCs. Furthermore, SRF downregulation in diploid hPSCs induces replication stress and perturbed condensation similar to that seen in aneuploid cells. Together, these results suggest that decreased SRF expression induces replicative stress and chromosomal condensation defects that underlie the ongoing chromosomal instability seen in aneuploid hPSCs. A similar mechanism may also operate during initiation of instability in diploid cells. Copyright © 2016 Elsevier Inc. All rights reserved.

Chromosome aberrations in human lymphocytes induced by 250 MeV protons: effects of dose, dose rate and shielding.

PubMed

George, K; Willingham, V; Wu, H; Gridley, D; Nelson, G; Cucinotta, F A

2002-01-01

Although the space radiation environment consists predominantly of energetic protons, astronauts inside a spacecraft are chronically exposed to both primary particles as well as secondary particles that are generated when the primary particles penetrate the spacecraft shielding. Secondary neutrons and secondary charged particles can have an LET value that is greater than the primary protons and, therefore, produce a higher relative biological effectiveness (RBE). Using the accelerator facility at Loma Linda University, we exposed human lymphocytes in vitro to 250 MeV protons with doses ranging from 0 to 60 cGy at three different dose rates: a low dose rate of 7.5 cGy/h, an intermediate dose rate of 30 cGy/h and a high dose rate of 70 cGy/min. The effect of 15 g/cm2 aluminum shielding on the induction of chromosome aberrations was investigated for each dose rate. After exposure, lymphocytes were incubated in growth medium containing phytohemagglutinin (PHA) and chromosome spreads were collected using a chemical-induced premature chromosome condensation (PCC) technique. Aberrations were analyzed using the fluorescence in situ hybridization (FISH) technique with three different colored chromosome-painting probes. The frequency of reciprocal and complex-type chromosome exchanges were compared in shielded and unshielded samples. c2002 COSPAR. Published by Elsevier Science Ltd. All rights reserved.

Chromosome aberrations in human lymphocytes induced by 250 MeV protons: effects of dose, dose rate and shielding

NASA Technical Reports Server (NTRS)

George, K.; Willingham, V.; Wu, H.; Gridley, D.; Nelson, G.; Cucinotta, F. A.

2002-01-01

Although the space radiation environment consists predominantly of energetic protons, astronauts inside a spacecraft are chronically exposed to both primary particles as well as secondary particles that are generated when the primary particles penetrate the spacecraft shielding. Secondary neutrons and secondary charged particles can have an LET value that is greater than the primary protons and, therefore, produce a higher relative biological effectiveness (RBE). Using the accelerator facility at Loma Linda University, we exposed human lymphocytes in vitro to 250 MeV protons with doses ranging from 0 to 60 cGy at three different dose rates: a low dose rate of 7.5 cGy/h, an intermediate dose rate of 30 cGy/h and a high dose rate of 70 cGy/min. The effect of 15 g/cm2 aluminum shielding on the induction of chromosome aberrations was investigated for each dose rate. After exposure, lymphocytes were incubated in growth medium containing phytohemagglutinin (PHA) and chromosome spreads were collected using a chemical-induced premature chromosome condensation (PCC) technique. Aberrations were analyzed using the fluorescence in situ hybridization (FISH) technique with three different colored chromosome-painting probes. The frequency of reciprocal and complex-type chromosome exchanges were compared in shielded and unshielded samples. c2002 COSPAR. Published by Elsevier Science Ltd. All rights reserved.

The effects of severe mixed environmental pollution on human chromosomes.

PubMed Central

Katsantoni, A; Nakou, S; Antoniadou-Koumatou, I; Côté, G B

1986-01-01

Cytogenetic studies were conducted on healthy young mothers, shortly after child birth, in two residential areas each with an approximate population of 20,000, situated about 25 km from Athens, Greece. One of the areas, Elefsis, is subject to severe mixed industrial pollution, and the other, Koropi, is relatively free of pollution. Chromosomal aberrations were investigated in 16 women from each area in 72 hour lymphocyte cultures treated with gentian violet to enhance any chromosomal instability induced by the pollution. The women were of a comparable socioeconomic level, aged between 20 and 31 years, and with no history of factors associated with mutagenesis. Venous blood samples were taken from the two groups and processed concurrently. The slides were coded and examined independently by two observers, who were unaware of the source of the samples. A total of 100 cells was examined on each sample. The two observers obtained highly comparable results. Women from Elefsis had an average of 0.42 anomalies per cell and those from Koropi had 0.39. The absence of a statistically significant difference between the two groups clearly shows that the severe mixed environmental pollution of Elefsis has no significant visible effect on human chromosomes in most residents. However, two Elefsis women had abnormal results and could be at risk. Their presence is not sufficient to raise significantly their group's average, but the induction by pollution of an increased rate of chromosomal anomalies in only a few people at risk could account for the known association between urban residence and cancer mortality. PMID:3783622

X chromosome inactivation in human pluripotent stem cells as a model for human development: back to the drawing board?

PubMed

Geens, Mieke; Chuva De Sousa Lopes, Susana M

2017-09-01

Human pluripotent stem cells (hPSC), both embryonic and induced (hESC and hiPSC), are regarded as a valuable in vitro model for early human development. In order to fulfil this promise, it is important that these cells mimic as closely as possible the in vivo molecular events, both at the genetic and epigenetic level. One of the most important epigenetic events during early human development is X chromosome inactivation (XCI), the transcriptional silencing of one of the two X chromosomes in female cells. XCI is important for proper development and aberrant XCI has been linked to several pathologies. Recently, novel data obtained using high throughput single-cell technology during human preimplantation development have suggested that the XCI mechanism is substantially different from XCI in mouse. It has also been suggested that hPSC show higher complexity in XCI than the mouse. Here we compare the available recent data to understand whether XCI during human preimplantation can be properly recapitulated using hPSC. We will summarize what is known on the timing and mechanisms of XCI during human preimplantation development. We will compare this to the XCI patterns that are observed during hPSC derivation, culture and differentiation, and comment on the cause of the aberrant XCI patterns observed in hPSC. Finally, we will discuss the implications of the aberrant XCI patterns on the applicability of hPSC as an in vitro model for human development and as cell source for regenerative medicine. Combinations of the following keywords were applied as search criteria in the PubMed database: X chromosome inactivation, preimplantation development, embryonic stem cells, induced pluripotent stem cells, primordial germ cells, differentiation. Recent single-cell RNASeq data have shed new light on the XCI process during human preimplantation development. These indicate a gradual inactivation on both XX chromosomes, starting from Day 4 of development and followed by a random choice

Sequence conservation on the Y chromosome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gibson, L.H.; Yang-Feng, L.; Lau, C.

The Y chromosome is present in all mammals and is considered to be essential to sex determination. Despite intense genomic research, only a few genes have been identified and mapped to this chromosome in humans. Several of them, such as SRY and ZFY, have been demonstrated to be conserved and Y-located in other mammals. In order to address the issue of sequence conservation on the Y chromosome, we performed fluorescence in situ hybridization (FISH) with DNA from a human Y cosmid library as a probe to study the Y chromosomes from other mammalian species. Total DNA from 3,000-4,500 cosmid poolsmore » were labeled with biotinylated-dUTP and hybridized to metaphase chromosomes. For human and primate preparations, human cot1 DNA was included in the hybridization mixture to suppress the hybridization from repeat sequences. FISH signals were detected on the Y chromosomes of human, gorilla, orangutan and baboon (Old World monkey) and were absent on those of squirrel monkey (New World monkey), Indian munjac, wood lemming, Chinese hamster, rat and mouse. Since sequence analysis suggested that specific genes, e.g. SRY and ZFY, are conserved between these two groups, the lack of detectable hybridization in the latter group implies either that conservation of the human Y sequences is limited to the Y chromosomes of the great apes and Old World monkeys, or that the size of the syntenic segment is too small to be detected under the resolution of FISH, or that homologeous sequences have undergone considerable divergence. Further studies with reduced hybridization stringency are currently being conducted. Our results provide some clues as to Y-sequence conservation across species and demonstrate the limitations of FISH across species with total DNA sequences from a particular chromosome.« less

Human Y Chromosome Haplogroup N: A Non-trivial Time-Resolved Phylogeography that Cuts across Language Families.

PubMed

Ilumäe, Anne-Mai; Reidla, Maere; Chukhryaeva, Marina; Järve, Mari; Post, Helen; Karmin, Monika; Saag, Lauri; Agdzhoyan, Anastasiya; Kushniarevich, Alena; Litvinov, Sergey; Ekomasova, Natalya; Tambets, Kristiina; Metspalu, Ene; Khusainova, Rita; Yunusbayev, Bayazit; Khusnutdinova, Elza K; Osipova, Ludmila P; Fedorova, Sardana; Utevska, Olga; Koshel, Sergey; Balanovska, Elena; Behar, Doron M; Balanovsky, Oleg; Kivisild, Toomas; Underhill, Peter A; Villems, Richard; Rootsi, Siiri

2016-07-07

The paternal haplogroup (hg) N is distributed from southeast Asia to eastern Europe. The demographic processes that have shaped the vast extent of this major Y chromosome lineage across numerous linguistically and autosomally divergent populations have previously been unresolved. On the basis of 94 high-coverage re-sequenced Y chromosomes, we establish and date a detailed hg N phylogeny. We evaluate geographic structure by using 16 distinguishing binary markers in 1,631 hg N Y chromosomes from a collection of 6,521 samples from 56 populations. The more southerly distributed sub-clade N4 emerged before N2a1 and N3, found mostly in the north, but the latter two display more elaborate branching patterns, indicative of regional contrasts in recent expansions. In particular, a number of prominent and well-defined clades with common N3a3'6 ancestry occur in regionally dissimilar northern Eurasian populations, indicating almost simultaneous regional diversification and expansion within the last 5,000 years. This patrilineal genetic affinity is decoupled from the associated higher degree of language diversity. Copyright © 2016 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Bird-like sex chromosomes of platypus imply recent origin of mammal sex chromosomes.

PubMed

Veyrunes, Frédéric; Waters, Paul D; Miethke, Pat; Rens, Willem; McMillan, Daniel; Alsop, Amber E; Grützner, Frank; Deakin, Janine E; Whittington, Camilla M; Schatzkamer, Kyriena; Kremitzki, Colin L; Graves, Tina; Ferguson-Smith, Malcolm A; Warren, Wes; Marshall Graves, Jennifer A

2008-06-01

In therian mammals (placentals and marsupials), sex is determined by an XX female: XY male system, in which a gene (SRY) on the Y affects male determination. There is no equivalent in other amniotes, although some taxa (notably birds and snakes) have differentiated sex chromosomes. Birds have a ZW female: ZZ male system with no homology with mammal sex chromosomes, in which dosage of a Z-borne gene (possibly DMRT1) affects male determination. As the most basal mammal group, the egg-laying monotremes are ideal for determining how the therian XY system evolved. The platypus has an extraordinary sex chromosome complex, in which five X and five Y chromosomes pair in a translocation chain of alternating X and Y chromosomes. We used physical mapping to identify genes on the pairing regions between adjacent X and Y chromosomes. Most significantly, comparative mapping shows that, contrary to earlier reports, there is no homology between the platypus and therian X chromosomes. Orthologs of genes in the conserved region of the human X (including SOX3, the gene from which SRY evolved) all map to platypus chromosome 6, which therefore represents the ancestral autosome from which the therian X and Y pair derived. Rather, the platypus X chromosomes have substantial homology with the bird Z chromosome (including DMRT1) and to segments syntenic with this region in the human genome. Thus, platypus sex chromosomes have strong homology with bird, but not to therian sex chromosomes, implying that the therian X and Y chromosomes (and the SRY gene) evolved from an autosomal pair after the divergence of monotremes only 166 million years ago. Therefore, the therian X and Y are more than 145 million years younger than previously thought.

Isolation of the human chromosomal band Xq28 within somatic cell hybrids by fragile X site breakage.

PubMed Central

Warren, S T; Knight, S J; Peters, J F; Stayton, C L; Consalez, G G; Zhang, F P

1990-01-01

The chromosomal fragile-site mapping to Xq27.3 is associated with a frequent form of mental retardation and is prone to breakage after induced deoxyribonucleotide pool perturbation. The human hypoxanthine phosphoribosyltransferase (HPRT) and glucose-6-phosphate dehydrogenase (G6PD) genes flank the fragile X chromosome site and can be used to monitor integrity of the site in human-hamster somatic cell hybrids deficient in the rodent forms of these activities. After induction of the fragile X site, negative selection for HPRT and positive enrichment for G6PD resulted in 31 independent colonies of HPRT-,G6PD+ phenotype. Southern blot analysis demonstrated the loss of all tested markers proximal to the fragile X site with retention of all tested human Xq28 loci in a majority of the hybrids. In situ hybridization with a human-specific probe demonstrated the translocation of a small amount of human DNA to rodent chromosomes in these hybrids, suggesting chromosome breakage at the fragile X site and the subsequent translocation of Xq28. Southern blot hybridization of hybrid-cell DNA, resolved by pulsed-field gel electrophoresis, for human-specific repetitive sequences revealed abundant CpG-islands within Xq28, consistent with its known gene density. The electrophoretic banding patterns of human DNA among the hybrids were remarkably consistent, suggesting that fragile X site breakage is limited to a relatively small region in Xq27-28. These somatic cell hybrids, containing Xq27.3-qter as the sole human DNA, will aid the search for DNA associated with the fragile X site and will augment the high resolution genomic analysis of Xq28, including the identification of candidate genes for genetic-disease loci mapping to this region. Images PMID:2339126

Aneuploidy detection for chromosomes 1, X and Y by fluorescence in situ hybridization in human sperm from oligoasthenoteratozoospermic patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pang, M.G.; Zackowski, J.L.; Acosta, A.A.

1994-09-01

Oligoasthenoteratozoospermic males (n=15) were investigated for infertility as compared with proven fertile donors. The oligoasthenoteratozoospermic population showed a mean sperm concentration of 9.7 x 10{sup 6}/ml (Range 4.2-19.7), mean motility of 38.5% (Range 10.6-76.8) and morphology (measured by the percentage of normal forms evaluated by strict criteria) with a mean of 3.49% (Range 1.5-5.0). Fluorescence in situ hybridization (FISH) using satellite DNA probes specific for chromosomes 1 (puc 1.77), X (alpha satellite), and Y (satellite-III at Yqh) was performed on human interphase sperm nuclei. DNA probes were either directly labelled with rhodamine-dUTP, FITC-dUTP, or biotinylated by nick translation. Hybridization andmore » signal detection were done by routine laboratory protocols. Microscopic analysis was performed using a cooled CCD camera attached to an epi-fluorescent microscope. After hybridization, fertile donors yielded a frequency of 0.96% (n=12) nullisomic, 98.5% (n=1231) monosomic and 0.96% (n=12) disomic for chromosome 1, whereas oligoasthenoteratozoospermic males yielded a frequency of 16% (n=600) nullisomic, 74.5% (n=2792) monosomic and 9.9% (n=370) disomic. In addition, fertile donors yielded a frequency of 45.7% (n=633) monosomic and 0.7% (n=11) disomic for chromosome X, whereas oligoasthenoteratozoospermic males yielded a frequency of 38.7% (n=760) monosomic and 0.8% (n=13) disomic. Chromosome Y frequencies for fertile donors showed 44.6% (n=614) monosomic and 0.6% (n=2) disomic, whereas oligoasthenoteratozoospermic males yielded a frequency of 33.2% (n=701) monosomic and 0.8% (n=15) disomic. This suggests that the frequency of nullisomy for chromosome 1 is significantly higher (p<0.001) in sperm from oligoasthenoteratozoospermic makes versus sperm from our fertile donors. We conclude that FISH is a powerful tool to determine the frequency of aneuploidy in sperm from oligoasthenoteratozoospermic patients.« less

Chromosomal mutagenesis in human somatic cells: 30-year cytogenetic monitoring after Chornobyl accident.

PubMed

Pilinska, M A; Shemetun, G M; Shemetun, O V; Dybsky, S S; Dybska, O B; Talan, O O; Pedan, L R; Kurinnyi, D А

2016-12-01

In the lecture we have generalized and analyzed the data of cytogenetic laboratory of National Research Center for Radiation Medicine of the National Academy of Medical Sciences of Ukraine on 30-year selective cytogenetic monitoring among the priority contingents of different ages exposed to radiation after Chornobyl accident in Ukraine. It is highlighted that not only targeted but also untargeted radiation-induced cytogenetic effects should be explored, especially in delayed terms following radiation exposure. The new methodical approaches for studying "bystander effect", individual radiosensitivity, and various forms of radiation-induced chromosomal instability (delayed, hidden, transmissible) have been proposed. These approaches proved to be advantageous for analyzing cytogenetic patterns of induction and persistence of chromosomal instability in human somatic cells because of "bystander effect" and "bystander type effect". The phenomenon of positive "reverse" bystander effect has been found. The possibility of modifying the inherited individual human susceptibility to mutagenic exposure by ionizing radiation has been estimated. Finally, the association between hypersensitivity to radiation exposure and realization of oncopathology in exposed individuals has been revealed. The increased intensity of human somatic chromosomal mutagenesis was confirmed not only in the nearest but in the delayed terms following Chornobyl accident as a result of radiation-induced both targeted and untargeted cytogenetic effects. Such effects can be considered as risk factors for malignant transformation of cells, hereditary diseases, birth defects, and multifactorial somatic pathology. This article is a part of a Special Issue entitled "The Chornobyl Nuclear Accident: Thirty Years After".

Reconstruction and evolutionary history of eutherian chromosomes

PubMed Central

Kim, Jaebum; Auvil, Loretta; Capitanu, Boris; Larkin, Denis M.; Ma, Jian; Lewin, Harris A.

2017-01-01

Whole-genome assemblies of 19 placental mammals and two outgroup species were used to reconstruct the order and orientation of syntenic fragments in chromosomes of the eutherian ancestor and six other descendant ancestors leading to human. For ancestral chromosome reconstructions, we developed an algorithm (DESCHRAMBLER) that probabilistically determines the adjacencies of syntenic fragments using chromosome-scale and fragmented genome assemblies. The reconstructed chromosomes of the eutherian, boreoeutherian, and euarchontoglires ancestor each included >80% of the entire length of the human genome, whereas reconstructed chromosomes of the most recent common ancestor of simians, catarrhini, great apes, and humans and chimpanzees included >90% of human genome sequence. These high-coverage reconstructions permitted reliable identification of chromosomal rearrangements over ∼105 My of eutherian evolution. Orangutan was found to have eight chromosomes that were completely conserved in homologous sequence order and orientation with the eutherian ancestor, the largest number for any species. Ruminant artiodactyls had the highest frequency of intrachromosomal rearrangements, and interchromosomal rearrangements dominated in murid rodents. A total of 162 chromosomal breakpoints in evolution of the eutherian ancestral genome to the human genome were identified; however, the rate of rearrangements was significantly lower (0.80/My) during the first ∼60 My of eutherian evolution, then increased to greater than 2.0/My along the five primate lineages studied. Our results significantly expand knowledge of eutherian genome evolution and will facilitate greater understanding of the role of chromosome rearrangements in adaptation, speciation, and the etiology of inherited and spontaneously occurring diseases. PMID:28630326

A chromosome painting test of the basal eutherian karyotype.

PubMed

Svartman, Marta; Stone, Gary; Page, John E; Stanyon, Roscoe

2004-01-01

We studied the chromosomes of an Afrotherian species, the short-eared elephant shrew Macroscelides proboscideus with traditional banding techniques and mapped the homology to human chromosomes by in-situ hybridization of human chromosome paints. Here we present for the first time the karyotype of this species, including banding patterns. The chromosome painting allowed us to test various hypotheses of the ancestral Eutherian karyotype, the validity of the radical taxonomic assemblage known as Afrotheria and the phylogenetic position of the elephant shrew within the Afrotheria. Current hypotheses concerning the Eutherian ancestral karyotype include diploid numbers ranging from 2n = 44 to 50 while molecular studies have proposed a new superordinal grouping of extant Eutherians. In particular, the Afrotheria is hotly debated, as it appears to be an odd mixture of species from Ungulata, Tubulidentata, Macroscelidea and Lipotyphla, which have no apparent morphological traits to unite them. The hybridization pattern delimited a total of 37 segments in the elephant shrew genome and revealed 21 different associations of human chromosome segments. Associations 1/19 and 5/21 link all Afrotheria so far studied and support the Afrotheria assemblage. Associations 2/8, 3/20, and 10/17 strongly link aardvarks and elephant shrews after the divergence of the line leading to elephants. The most likely ancestral Eutherian karyotype would be 2n = 48 chromosomes. However, the lack of comparative chromosome painting data between Eutherians and an appropriate outgroup is a severe limitation on attempts to delineate the ancestral genome of Eutherians. Current attempts lack legitimacy until this situation is corrected.

Human female meiosis revised: new insights into the mechanisms of chromosome segregation and aneuploidies from advanced genomics and time-lapse imaging.

PubMed

Capalbo, Antonio; Hoffmann, Eva R; Cimadomo, Danilo; Ubaldi, Filippo Maria; Rienzi, Laura

2017-11-01

The unbalanced transmission of chromosomes in human gametes and early preimplantation embryos causes aneuploidy, which is a major cause of infertility and pregnancy failure. A baseline of 20% of human oocytes are estimated to be aneuploid and this increases exponentially from 30 to 35 years, reaching on average 80% by 42 years. As a result, reproductive senescence in human females is predominantly determined by the accelerated decline in genetic quality of oocytes from 30 years of age. Understanding mechanisms of chromosome segregation and aneuploidies in the female germline is a crucial step towards the development of new diagnostic approaches and, possibly, for the development of therapeutic targets and molecules. Here, we have reviewed emerging mechanisms that may drive human aneuploidy, in particular the maternal age effect. We conducted a systematic search in PubMed Central of the primary literature from 1990 through 2016 following the PRISMA guidelines, using MeSH terms related to human aneuploidy. For model organism research, we conducted a literature review based on references in human oocytes manuscripts and general reviews related to chromosome segregation in meiosis and mitosis. Advances in genomic and imaging technologies are allowing unprecedented insight into chromosome segregation in human oocytes. This includes the identification of a novel chromosome segregation error, termed reverse segregation, as well as sister kinetochore configurations that were not predicted based on murine models. Elucidation of mechanisms that result in errors in chromosome segregation in meiosis may lead to therapeutic developments that could improve reproductive outcomes by reducing aneuploidy. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com

The Biological Effectiveness of Different Radiation Qualities for the Induction of Chromosome Damage in Human Lymphocytes

NASA Technical Reports Server (NTRS)

Hada, M.; George, Kerry; Cucinotta, F. A.

2011-01-01

Chromosome aberrations were measured in human peripheral blood lymphocytes after in vitro exposure to Si-28-ions with energies ranging from 90 to 600 MeV/u, Ti-48-ions with energies ranging from 240 to 1000 MeV/u, or to Fe-56-ions with energies ranging from 200 to 5,000 MeV/u. The LET of the various Si beams in this study ranged from 48 to 158 keV/ m, the LET of the Ti ions ranged from 107 to 240 keV/micron, and the LET of the Fe-ions ranged from 145 to 440 keV/ m. Doses delivered were in the 10- to 200-cGy range. Dose-response curves for chromosome exchanges in cells at first division after exposure, measured using fluorescence in situ hybridization (FISH) with whole-chromosome probes, were fitted with linear or linear-quadratic functions. The relative biological effectiveness (RBE) was estimated from the initial slope of the dose-response curve for chromosome damage with respect to gamma-rays. The estimates of RBEmax values for total chromosome exchanges ranged from 4.4+/-0.4 to 31.5+/-2.6 for Fe ions, 21.4+/-1.7 to 28.3+/-2.4 for Ti ions, and 11.8+/-1.0 to 42.2+/-3.3 for Si ions. The highest RBEmax value for Fe ions was obtained with the 600 MeV/u beam, the highest RBEmax value for Ti ions was obtained 1000 MeV/u beam, and the highest RBEmax value for Si ions was obtained with the 170 MeV/u beam. For Si and Fe ions the RBEmax values increased with LET, reaching a maximum at about 180 keV/micron for Fe and about 100 keV/micron for Si, and decreasing with further increase in LET. Additional studies for low doses Si-28-ions down to 0.02 Gy will be discussed.

Chromosomal localization of seven PAX genes and cloning of a novel family member, PAX-9.

PubMed

Stapleton, P; Weith, A; Urbánek, P; Kozmik, Z; Busslinger, M

1993-04-01

In the human paired box-containing (PAX) gene family, only two members, PAX-3 and PAX-6, which are associated with Waardenburg's syndrome and aniridia, respectively have been mapped to human chromosomes. We have now isolated cosmids for six additional human PAX genes (PAX-1,-2,-5,-7,-8,-9) and a polymerase chain reaction fragment for PAX-4. PAX-9 is a novel family member which is closely related in its paired domain to PAX-1. The chromosomal location of all cloned PAX genes was determined by analysis of somatic cell hybrids and (except PAX-4) by fluorescence in situ hybridization to metaphase chromosomes. PAX-1 and PAX-7 map to chromosomal regions containing previously assigned disease loci.

Karyotyping of Chromosomes in Human Bronchial Epithelial Cells Transformed by High Energy Fe Ions

NASA Technical Reports Server (NTRS)

Yeshitla, Samrawit; Zhang, Ye; Park, Seongmi; Story, Michael T.; Wilson, Bobby; Wu, Honglu

2014-01-01

Lung cancer induced from exposure to space radiation is believed to be one of the most significant health risks for long-term space travels. In a previous study, normal human bronchial epithelial cells (HBECs), immortalized through the expression of Cdk4 and hTERT, were exposed to gamma rays and high energy Fe ions for the selection of transformed clones induced by low- and high-LET radiation. In this research, we analyzed chromosome aberrations in these selected clones for genomic instability using the multi-color fluorescent in situ hybridization (mFISH), as well as the multi-banding in situ hybridization (mBAND) techniques. In most of the clones, we found chromosomal aberrations involving translocations between different chromosomes, with several of the breaks occurred in the q-arm of chromosome 3. We also identified copy number variations between the transformed clones and the parental HBEC cells regardless of the exposure condition. Our results indicated that the chromosomal aberrations in low- and high radiation-induced transformed clones are inadequately different from spontaneous soft agar growth. Further analysis is underway to reveal the genomic instability in more transformed clones

Comprehensive annotated STR physical map of the human Y chromosome: Forensic implications.

PubMed

Hanson, Erin K; Ballantyne, Jack

2006-03-01

A plethora of Y-STR markers from diverse sources have been deposited in public databases and represent potential candidates for incorporation into the next generation of Y-STR multiplexes for forensic use. Here, based upon all of the Y-STR loci that have been deposited in the human genome database (>400), we have sequentially positioned each one along the Y chromosome using the most current human genome sequencing data (NCBI Build 35). The information derived from this work defines the number and relative position of all potentially forensically relevant Y-STR loci, their location within the physical linkage map of the Y chromosome and their relationship to structural genes. We conclude that there exists at present at least 417 separate Y-STR markers available for potential forensic use, although many of these will be found to be unsuitable for other reasons. However, from this data, we were able to identify 28 pairs of duplicated loci that were given separate DYS designations and four pairs of loci with overlapping flanking regions. Removing one locus from each set of duplicates reduced the number of potentially useful loci from 417 to 389. The derived information should be useful for workers who are designing novel Y-STR multiplexes to ensure the presence of non-synonymous loci and, if so desired, to avoid loci that lie within structural genes. It may also be useful for forensic casework practitioners (or molecular anthropologists) to aid in distinguishing between chromosomal rearrangements (such as duplications and deletions) and bona fide DNA admixtures or null alleles caused by primer binding site mutations. We illustrate the practical usefulness of the chromosomal positioning data in the design of eight multiplex systems using 94 Y-STR loci.

Chromosome painting reveals specific patterns of chromosome occurrence in mitomycin C- and diethylstilboestrol-induced micronuclei.

PubMed

Fauth, E; Scherthan, H; Zankl, H

2000-11-01

Cultures of human blood lymphocytes from three subjects were incubated with the clastogen mitomycin C (MMC, 500 ng/ml) and the aneugen diethylstilboestrol (DES, 80 microM) 23 h before harvesting, to induce formation of micronuclei (MN) and numerical and structural alterations in metaphase chromosomes. We used fluorescence in situ hybridization (FISH) with painting probes for all human chromosomes to determine which chromosomes had contributed material to the induced MN. MMC treatment induced an approximately 18-fold increase in MN and led to a significant increase in hypodiploidy and structural chromosome aberrations in metaphase preparations. Undercondensation of pericentromeric heterochromatin of chromosomes 9 and 1 occurred in 20-75% of metaphases and FISH disclosed an abundance of material from these chromosomes in induced MN (62-69% from chromosome 9 and 7-12% from chromosome 1). DES treatment of lymphocytes induced a seven-fold increase in MN frequency and four-fold increase in the frequency of numerical aberrations; structural aberrations were not significantly increased. FISH analysis showed that material from all chromosomes was present in DES-induced MN, with material from chromosome 1 present in 16% of MN and material from each other chromosomes being present in 2-10% of MN. Material from chromosomes 14, 19 and 21 was significantly more frequent material from chromosome Y significantly less frequent in DES-treated cells than in controls. The findings of the MMC studies indicate that the heterochromatin block of chromosome 9 is a specific target for MMC-induced undercondensation, which induces a preferential occurrence of chromosome 9 material in MN. DES, in contrast, does not trigger heterochromatin decondensation and fails to induce such a significant appearance of material of particular chromosomes in MN.

Analysis of unrejoined chromosomal breakage in human fibroblast cells exposed to low- and high-LET radiation

NASA Technical Reports Server (NTRS)

Wu, Honglu; Furusawa, Yoshiya; George, Kerry; Kawata, Tetsuya; Cucinotta, Francis A.

2002-01-01

Reported studies of DNA breakage induced by radiation of various qualities have generally shown a higher fraction of unrejoined residual breaks after high-LET exposure. This observation is supported by the argument that high-LET radiation induced DNA breaks that are more complex in nature and, thus, less likely to be repaired. In most cases the doses used in these studies were very high. We have studied unrejoined chromosome breaks by analyzing chromosome aberrations using a fluorescence in situ hybridization (FISH) technique with a combination of whole chromosome specific probes and probes specific for the telomere region of the chromosomes. Confluent human fibroblast cells (AG1522) were irradiated with gamma rays, 490 MeV/nucleon Si, or with Fe ions at either 200 and 500 MeV/nucleon, and were allowed to repair at 37 degrees C for 24 hours after exposure. A chemically induced premature chromosome condensation (PCC) technique was used to condense chromosomes in the G2 phase of the cell cycle. Results showed that the frequency of unrejoined chromosome breaks was higher after high-LET radiation, and the ratio of unrejoined to misrejoined chromosome breaks increased steadily with LET up a peak value at 440 keV/microm.

Induction of chromosome aberrations in cultured human lymphocytes treated with sand dust storm fine particles (PM2.5).

PubMed

Wei, Aili; Meng, Ziqiang

2006-09-30

The clastogenic activity of airborne air fine particulate matter (PM2.5, particulates with an aerodynamic diameter < or =2.5 microm) has already been demonstrated. However little is known about the health risks associated with sand dust storm PM2.5 and its extract. In order to investigate the clastogenic activity of sand dust storm PM2.5 (include its organic and inorganic extract) on human lymphocytes, the normal PM2.5 and sand dust storm PM2.5 samples were collected in Wuwei city (Gansu Province) and Baotou city (Inner Mongolia), China. The chromosomal aberration (CA) test was employed and the cells were treated with 0, 33, 100, 300 microg ml(-1) sand dust storm or normal ambient air PM2.5 suspension (physiological saline as solvent control), or inorganic extract (0, 75, 150, 300 microg ml(-1), physiological saline as solvent control) or organic extract (0, 20, 40, 80 microg ml(-1), DMSO as solvent control) at the beginning of the cell culture. The results indicated that sand dust storm PM2.5 and its extract as well as normal samples can induce increase in CA frequency. With the increase of treatment concentrations the CA frequency increased and the mitotic index (MI) values declined in a dose-response manner. In the same concentrates, the CA frequency of normal ambient air PM2.5 and its extract were significant higher than those of sand dust storm PM2.5 (P<0.05 or 0.01) except the treatment of Wuwei sample at higher doses (100, 300 microg ml(-1)), the treatment of inorganic extract of PM2.5 at the highest dose (300 microg ml(-1)) and the treatment of organic extract of PM2.5 at the higher dose (40 and 80 microg ml(-1)) either in Baotou or in Wuwei (P>0.05). The toxicity of sand dust storm PM2.5 and its extract at high dose is very potent. CA frequency of normal PM2.5 (include its organic extract) from Baotou were higher than those of Wuwei especially in low and middle dose (P<0.05), but the treatment results of sand dust storm PM2.5 (include its all extract) was

Isolation and characterization of 21 novel expressed DNA sequences from the distal region of human chromosome 4p

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ishida, Yoshikazu; Hadano, Shinji; Nagayama, Tomiko

1994-07-15

The authors have established an approach to the isolation of expressed DNA sequences from a defined region of the human chromosome. The method relies on the direct screening of cDNA libraries using pooled single-copy microclones generated by a laser chromosome microdissection in conjunction with a single unique primer polymerase chain reaction (SUP-PCR) procedure. They applied this method to the distal region of human chromosome 4p (4p15-4pter), which contains the Huntington disease (HD) and the Wolf-Hirschhorn syndrome (WHS) loci. Twenty-one nonoverlapping and region-specific cDNA clones encoding novel genes were isolated in this manner. Ten of 21 clones were subregionally assigned tomore » 4p16.1-4pter, and the remainder mapped to the region proximal to 4p16.1. Northern blot and reverse transcription followed by the PCR (RT-PCR) analysis revealed that 16 of these 21 clones detected transcripts in total RNA from human tissues. The method is applicable to other chromosomal regions and is a powerful approach to the isolation of region-specific cDNA clones. 44 refs., 3 figs., 3 tabs.« less

Complementary DNA characterization and chromosomal localization of a human gene related to the poliovirus receptor-encoding gene.

PubMed

Lopez, M; Eberlé, F; Mattei, M G; Gabert, J; Birg, F; Bardin, F; Maroc, C; Dubreuil, P

1995-04-03

The human poliovirus (PV) receptor (PVR) is a member of the immunoglobulin (Ig) superfamily with unknown cellular function. We have isolated a human PVR-related (PRR) cDNA. The deduced amino acid (aa) sequence of PRR showed, in the extracellular region, 51.7 and 54.3% similarity with human PVR and with the murine PVR homolog, respectively. The cDNA coding sequence is 1.6-kb long and encodes a deduced 57-kDa protein; this protein has a structural organization analogous to that of PVR, that is, one V- and two C-set Ig domains, with a conserved number of aa. Northern blot analysis indicated that a major 5.9-kb transcript is present in all normal human tissues tested. In situ hybridization showed that the PRR gene is located at bands q23-q24 of human chromosome 11.

Human Y chromosome copy number variation in the next generation sequencing era and beyond.

PubMed

Massaia, Andrea; Xue, Yali

2017-05-01

The human Y chromosome provides a fertile ground for structural rearrangements owing to its haploidy and high content of repeated sequences. The methodologies used for copy number variation (CNV) studies have developed over the years. Low-throughput techniques based on direct observation of rearrangements were developed early on, and are still used, often to complement array-based or sequencing approaches which have limited power in regions with high repeat content and specifically in the presence of long, identical repeats, such as those found in human sex chromosomes. Some specific rearrangements have been investigated for decades; because of their effects on fertility, or their outstanding evolutionary features, the interest in these has not diminished. However, following the flourishing of large-scale genomics, several studies have investigated CNVs across the whole chromosome. These studies sometimes employ data generated within large genomic projects such as the DDD study or the 1000 Genomes Project, and often survey large samples of healthy individuals without any prior selection. Novel technologies based on sequencing long molecules and combinations of technologies, promise to stimulate the study of Y-CNVs in the immediate future.

Gender-Specific Gene Expression in Post-Mortem Human Brain: Localization to Sex Chromosomes

PubMed Central

Vawter, Marquis P; Evans, Simon; Choudary, Prabhakara; Tomita, Hiroaki; Meador-Woodruff, Jim; Molnar, Margherita; Li, Jun; Lopez, Juan F; Myers, Rick; Cox, David; Watson, Stanley J; Akil, Huda; Jones, Edward G; Bunney, William E

2011-01-01

Gender differences in brain development and in the prevalence of neuropsychiatric disorders such as depression have been reported. Gender differences in human brain might be related to patterns of gene expression. Microarray technology is one useful method for investigation of gene expression in brain. We investigated gene expression, cell types, and regional expression patterns of differentially expressed sex chromosome genes in brain. We profiled gene expression in male and female dorsolateral prefrontal cortex, anterior cingulate cortex, and cerebellum using the Affymetrix oligonucleotide microarray platform. Differentially expressed genes between males and females on the Y chromosome (DBY, SMCY, UTY, RPS4Y, and USP9Y) and X chromosome (XIST) were confirmed using real-time PCR measurements. In situ hybridization confirmed the differential expression of gender-specific genes and neuronal expression of XIST, RPS4Y, SMCY, and UTY in three brain regions examined. The XIST gene, which silences gene expression on regions of the X chromosome, is expressed in a subset of neurons. Since a subset of neurons express gender-specific genes, neural subpopulations may exhibit a subtle sexual dimorphism at the level of differences in gene regulation and function. The distinctive pattern of neuronal expression of XIST, RPS4Y, SMCY, and UTY and other sex chromosome genes in neuronal subpopulations may possibly contribute to gender differences in prevalence noted for some neuropsychiatric disorders. Studies of the protein expression of these sex- chromosome-linked genes in brain tissue are required to address the functional consequences of the observed gene expression differences. PMID:14583743

Effects of sex chromosome dosage on corpus callosum morphology in supernumerary sex chromosome aneuploidies

PubMed Central

2014-01-01

Background Supernumerary sex chromosome aneuploidies (sSCA) are characterized by the presence of one or more additional sex chromosomes in an individual’s karyotype; they affect around 1 in 400 individuals. Although there is high variability, each sSCA subtype has a characteristic set of cognitive and physical phenotypes. Here, we investigated the differences in the morphometry of the human corpus callosum (CC) between sex-matched controls 46,XY (N =99), 46,XX (N =93), and six unique sSCA karyotypes: 47,XYY (N =29), 47,XXY (N =58), 48,XXYY (N =20), 47,XXX (N =30), 48,XXXY (N =5), and 49,XXXXY (N =6). Methods We investigated CC morphometry using local and global area, local curvature of the CC boundary, and between-landmark distance analysis (BLDA). We hypothesized that CC morphometry would vary differentially along a proposed spectrum of Y:X chromosome ratio with supernumerary Y karyotypes having the largest CC areas and supernumerary X karyotypes having significantly smaller CC areas. To investigate this, we defined an sSCA spectrum based on a descending Y:X karyotype ratio: 47,XYY, 46,XY, 48,XXYY, 47,XXY, 48,XXXY, 49,XXXXY, 46,XX, 47,XXX. We similarly explored the effects of both X and Y chromosome numbers within sex. Results of shape-based metrics were analyzed using permutation tests consisting of 5,000 iterations. Results Several subregional areas, local curvature, and BLDs differed between groups. Moderate associations were found between area and curvature in relation to the spectrum and X and Y chromosome counts. BLD was strongly associated with X chromosome count in both male and female groups. Conclusions Our results suggest that X- and Y-linked genes have differential effects on CC morphometry. To our knowledge, this is the first study to compare CC morphometry across these extremely rare groups. PMID:25780557

Effects of sex chromosome dosage on corpus callosum morphology in supernumerary sex chromosome aneuploidies.

PubMed

Wade, Benjamin S C; Joshi, Shantanu H; Reuter, Martin; Blumenthal, Jonathan D; Toga, Arthur W; Thompson, Paul M; Giedd, Jay N

2014-01-01

Supernumerary sex chromosome aneuploidies (sSCA) are characterized by the presence of one or more additional sex chromosomes in an individual's karyotype; they affect around 1 in 400 individuals. Although there is high variability, each sSCA subtype has a characteristic set of cognitive and physical phenotypes. Here, we investigated the differences in the morphometry of the human corpus callosum (CC) between sex-matched controls 46,XY (N =99), 46,XX (N =93), and six unique sSCA karyotypes: 47,XYY (N =29), 47,XXY (N =58), 48,XXYY (N =20), 47,XXX (N =30), 48,XXXY (N =5), and 49,XXXXY (N =6). We investigated CC morphometry using local and global area, local curvature of the CC boundary, and between-landmark distance analysis (BLDA). We hypothesized that CC morphometry would vary differentially along a proposed spectrum of Y:X chromosome ratio with supernumerary Y karyotypes having the largest CC areas and supernumerary X karyotypes having significantly smaller CC areas. To investigate this, we defined an sSCA spectrum based on a descending Y:X karyotype ratio: 47,XYY, 46,XY, 48,XXYY, 47,XXY, 48,XXXY, 49,XXXXY, 46,XX, 47,XXX. We similarly explored the effects of both X and Y chromosome numbers within sex. Results of shape-based metrics were analyzed using permutation tests consisting of 5,000 iterations. Several subregional areas, local curvature, and BLDs differed between groups. Moderate associations were found between area and curvature in relation to the spectrum and X and Y chromosome counts. BLD was strongly associated with X chromosome count in both male and female groups. Our results suggest that X- and Y-linked genes have differential effects on CC morphometry. To our knowledge, this is the first study to compare CC morphometry across these extremely rare groups.

Complete nucleotide sequence of the gene for human heparin cofactor II and mapping to chromosomal band 22q11

DOE Office of Scientific and Technical Information (OSTI.GOV)

Herzog, R.; Lutz, S.; Blin, N.

1991-02-05

Heparin cofactor II (HCII) is a 66-kDa plasma glycoprotein that inhibits thrombin rapidly in the presence of dermatan sulfate or heparin. Clones comprising the entire HCII gene were isolated from a human leukocyte genomic library in EMBL-3 {lambda} phage. The sequence of the gene was determined on both strands of DNA (15,849 bp) and included 1,749 bp of 5{prime}-flanking sequence, five exons, four introns, and 476 bp of DNA 3{prime} to the polyadenylation site. Ten complete and one partial Alu repeats were identified in the introns and 5{prime}-flanking region. The HCII gene was regionally mapped on chromosome 22 using rodent-humanmore » somatic cell hybrids, carrying only parts of human chromosome 22, and the chronic myelogenous leukemia cell line K562. With the cDNA probe HCII7.2, containing the entire coding region of the gene, the HCII gene was shown to be amplified 10-20-fold in K562 cells by Southern analysis and in situ hybridization. From these data, the authors concluded that the HCII gene is localized on the chromosomal band 22q11 proximal to the breakpoint cluster region (BCR). Analysis by pulsed-field gel electrophoresis indicated that the amplified HCII gene in K562 cells maps at least 2 Mbp proximal to BCR-1. Furthermore, the HCII7.2 cDNA probe detected two frequent restriction fragment length polymorphisms with the restriction enzymes BamHI and Hind III.« less

Chromosomal localization and partial genomic structure of the human peroxisome proliferator activated receptor-gamma (hPPAR gamma) gene.

PubMed

Beamer, B A; Negri, C; Yen, C J; Gavrilova, O; Rumberger, J M; Durcan, M J; Yarnall, D P; Hawkins, A L; Griffin, C A; Burns, D K; Roth, J; Reitman, M; Shuldiner, A R

1997-04-28

We determined the chromosomal localization and partial genomic structure of the coding region of the human PPAR gamma gene (hPPAR gamma), a nuclear receptor important for adipocyte differentiation and function. Sequence analysis and long PCR of human genomic DNA with primers that span putative introns revealed that intron positions and sizes of hPPAR gamma are similar to those previously determined for the mouse PPAR gamma gene[13]. Fluorescent in situ hybridization localized hPPAR gamma to chromosome 3, band 3p25. Radiation hybrid mapping with two independent primer pairs was consistent with hPPAR gamma being within 1.5 Mb of marker D3S1263 on 3p25-p24.2. These sequences of the intron/exon junctions of the 6 coding exons shared by hPPAR gamma 1 and hPPAR gamma 2 will facilitate screening for possible mutations. Furthermore, D3S1263 is a suitable polymorphic marker for linkage analysis to evaluate PPAR gamma's potential contribution to genetic susceptibility to obesity, lipoatrophy, insulin resistance, and diabetes.

Unprecedented large inverted repeats at the replication terminus of circular bacterial chromosomes suggest a novel mode of chromosome rescue

PubMed Central

El Kafsi, Hela; Loux, Valentin; Mariadassou, Mahendra; Blin, Camille; Chiapello, Hélène; Abraham, Anne-Laure; Maguin, Emmanuelle; van de Guchte, Maarten

2017-01-01

The first Lactobacillus delbrueckii ssp. bulgaricus genome sequence revealed the presence of a very large inverted repeat (IR), a DNA sequence arrangement which thus far seemed inconceivable in a non-manipulated circular bacterial chromosome, at the replication terminus. This intriguing observation prompted us to investigate if similar IRs could be found in other bacteria. IRs with sizes varying from 38 to 76 kbp were found at the replication terminus of all 5 L. delbrueckii ssp. bulgaricus chromosomes analysed, but in none of 1373 other chromosomes. They represent the first naturally occurring very large IRs detected in circular bacterial genomes. A comparison of the L. bulgaricus replication terminus regions and the corresponding regions without IR in 5 L. delbrueckii ssp. lactis genomes leads us to propose a model for the formation and evolution of the IRs. The DNA sequence data are consistent with a novel model of chromosome rescue after premature replication termination or irreversible chromosome damage near the replication terminus, involving mechanisms analogous to those proposed in the formation of very large IRs in human cancer cells. We postulate that the L. delbrueckii ssp. bulgaricus-specific IRs in different strains derive from a single ancestral IR of at least 93 kbp. PMID:28281695

Assignment of the {beta}-arrestin 1 gene (ARRB1) to human chromosome 11q13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Calabrese, G.; Morizio, E.; Palka, G.

1994-11-01

Two types of proteins play a major role in determining homologous desensitization of G-coupled receptors: {beta}-adrenergic receptor kinase ({beta}ARK), which phosphorylates the agonist-occupied receptor, and its functional cofactor, {beta}-arrestin. {beta}ARK is a member of a multigene family, consisting of six known subtypes, which have also been named G-protein-coupled receptor kinases (GRK 1 to 6) due to the apparently unique functional association of such kinases with this receptor family. The gene for {beta}ARK1 has been localized to human chromosome 11q13. The four members of the arrestin/{beta}-arrestin gene family identified so far are arrestin, X-arrestin, {beta}-arrestin 1, and {beta}-arrestin 2. Here themore » authors report the chromosome mapping of the human gene for {beta}-arrestin 1 (ARRB1) to chromosome 11q13 by fluorescence in situ hybridization (FISH). Two-color FISH confirmed that the two genes coding for the functionally related proteins {beta}ARK1 and {beta}arrestin 1 both map to 11q13. 16 refs., 1 fig., 1 tab.« less

"Mitochondrial Eve", "Y Chromosome Adam", testosterone, and human evolution.

PubMed

Howard, James Michael

2002-01-01

I suggest primate evolution began as a consequence of increased testosterone in males which increased aggression and sexuality, therefore, reproduction and success. With time, negative effects of excessive testosterone reduced spermatogenesis and started a decline of the group. Approximately 30-40 million years ago, the gene DAZ (Deleted in AZoospermia) appeared on the Y chromosome, increased spermatogenesis, and rescued the early primates from extinction. (Note: DAZ is considered by some to specifically, positively affect spermatogenesis; others suggest it has no effect on spermatogenesis.) Hominid evolution continued with increasing testosterone. The advent of increased testosterone in females of Homo erectus (or Homo ergaster) increased the female-to-male body size ratio, and eventually produced another era of excessive testosterone. Excessive testosterone caused a reduction in population size (bottleneck) that produced the "Mitochondrial Eve" (ME) mechanism. (Only certain females continued during the bottleneck to transmit their mitochondrial DNA.) That is, the ME mechanism culminated, again, in excessive testosterone and reduced spermatogenesis in the hominid line. Approximately 50,000 to 200,000 years ago, a "doubling" of the DAZ gene occurred on the Y chromosome in hominid males which rescued the hominid line with increased spermatogenesis in certain males. This produced the "Y Chromosome Adam" event. The doubling of DAZ allowed further increases in testosterone in hominids that resulted in the increased size and development of the brain. Modern humans periodically fluctuate between the positive and negative consequences of increased levels of testosterone, currently identifiable as the secular trend, increased infections, and reduced spermatogenesis.

Comparative mapping of DNA probes derived from the V{sub k} immunoglobulin gene regions on human and great ape chromosomes by fluorescence in situ hybridization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arnold, N.; Wienberg, J.; Ermert, K.

Fluorescence in situ hybridization (FISH) of cosmid clones of human V{sub K} gene regions to human and primate chromosomes contributed to the dating of chromosome reorganizations in evolution. A clone from the K locus at 2p11-p12 (cos 106) hybridized to the assumed homologous chromosome bands in the chimpanzees Pan troglodytes (PTR) and P. paniscus (PPA), the Gorilla gorilla (GGO), and the orangutan Pongo Pygmaeus (PPY). Human and both chimpanzees differed from gorilla and orangutan by the mapping of cos 170, a clone derived from chromosome 2cen-q11.2; the transposition of this orphon to the other side of the centromere can, therefore,more » be dated after the human/chimpanzee and gorilla divergence. Hybridization to homologous bands was also found with a cosmid clone containing a V{sub K}I orphon located on chromosome 1 (cos 115, main signal at 1q31-q32), although the probe is not fully unique. Also, a clone derived from the orphon V{sub K} region on chromosome 22q11 (cos 121) hybridized to the homologous bands in the great apes. This indicates that the orphons on human chromosomes 1 and 22 had been translocated early in primate evolution. 18 refs., 2 figs.« less

IRS-PCR-based genetic mapping of the huntingtin interacting protein gene (HIP1) on mouse chromosome 5.

PubMed

Himmelbauer, H; Wedemeyer, N; Haaf, T; Wanker, E E; Schalkwyk, L C; Lehrach, H

1998-01-01

Huntington's disease (HD) is a devastating central nervous system disorder. Even though the gene responsible has been positionally cloned recently, its etiology has remained largely unclear. To investigate potential disease mechanisms, we conducted a search for binding partners of the HD-protein huntingtin. With the yeast two-hybrid system, one such interacting factor, the huntingtin interacting protein-1 (HIP-1), was identified (Wanker et al. 1997; Kalchman et al. 1997) and the human gene mapped to 7q11.2. In this paper we demonstrate the localization of the HIP1 mouse homologue (Hip1) into a previously identified region of human-mouse synteny on distal mouse Chromosome (Chr) 5, both employing an IRS-PCR-based mapping strategy and traditional fluorescent in situ hybridization (FISH) mapping.

Interphase Chromosome Conformation and Chromatin-Chromatin Interactions in Human Epithelial Cells Cultured Under Different Gravity Conditions

NASA Technical Reports Server (NTRS)

Zhang, Ye; Wong, Michael; Hada, Megumi; Wu, Honglu

2015-01-01

Microgravity has been shown to alter global gene expression patterns and protein levels both in cultured cells and animal models. It has been suggested that the packaging of chromatin fibers in the interphase nucleus is closely related to genome function, and the changes in transcriptional activity are tightly correlated with changes in chromatin folding. This study explores the changes of chromatin conformation and chromatin-chromatin interactions in the simulated microgravity environment, and investigates their correlation to the expression of genes located at different regions of the chromosome. To investigate the folding of chromatin in interphase under various culture conditions, human epithelial cells, fibroblasts, and lymphocytes were fixed in the G1 phase. Interphase chromosomes were hybridized with a multicolor banding in situ hybridization (mBAND) probe for chromosome 3 which distinguishes six regions of the chromosome as separate colors. After images were captured with a laser scanning confocal microscope, the 3-dimensional structure of interphase chromosome 3 was reconstructed at multi-mega base pair scale. In order to determine the effects of microgravity on chromosome conformation and orientation, measures such as distance between homologous pairs, relative orientation of chromosome arms about a shared midpoint, and orientation of arms within individual chromosomes were all considered as potentially impacted by simulated microgravity conditions. The studies revealed non-random folding of chromatin in interphase, and suggested an association of interphase chromatin folding with radiation-induced chromosome aberration hotspots. Interestingly, the distributions of genes with expression changes over chromosome 3 in cells cultured under microgravity environment are apparently clustered on specific loci and chromosomes. This data provides important insights into how mammalian cells respond to microgravity at molecular level.

Biodosimetry of ionizing radiation by selective painting of prematurely condensed chromosomes in human lymphocytes

NASA Technical Reports Server (NTRS)

Durante, M.; George, K.; Yang, T. C.

1997-01-01

Painting of interphase chromosomes can be useful for biodosimetric purposes in particular cases such as radiation therapy, accidental exposure to very high radiation doses and exposure to densely ionizing radiation, for example during space missions. Biodosimetry of charged-particle radiation is analyzed in the present paper. Target cells were human peripheral blood lymphocytes irradiated in vitro with gamma rays, protons and iron ions. After exposure, lymphocytes were incubated for different times to allow repair of radiation-induced damage and then fused to mitotic hamster cells to promote premature condensation in the interphase chromosomes. Chromosome spreads were then hybridized with whole-chromosome DNA probes labeled with fluorescent stains. Dose-response curves for the induction of chromatin fragments shortly after exposure, as well as the kinetics of rejoining and misrejoining, were not markedly dependent on linear energy transfer. However, after exposure to heavy ions, more aberrations were scored in the interphase cells after incubation for repair than in metaphase samples harvested at the first postirradiation mitosis. On the other hand, no significant differences were observed in the two samples after exposure to sparsely ionizing radiation. These results suggest that interphase chromosome painting can be a useful tool for biodosimetry of particle radiation.

Biodosimetry of ionizing radiation by selective painting of prematurely condensed chromosomes in human lymphocytes.

PubMed

Durante, M; George, K; Yang, T C

1997-11-01

Painting of interphase chromosomes can be useful for biodosimetric purposes in particular cases such as radiation therapy, accidental exposure to very high radiation doses and exposure to densely ionizing radiation, for example during space missions. Biodosimetry of charged-particle radiation is analyzed in the present paper. Target cells were human peripheral blood lymphocytes irradiated in vitro with gamma rays, protons and iron ions. After exposure, lymphocytes were incubated for different times to allow repair of radiation-induced damage and then fused to mitotic hamster cells to promote premature condensation in the interphase chromosomes. Chromosome spreads were then hybridized with whole-chromosome DNA probes labeled with fluorescent stains. Dose-response curves for the induction of chromatin fragments shortly after exposure, as well as the kinetics of rejoining and misrejoining, were not markedly dependent on linear energy transfer. However, after exposure to heavy ions, more aberrations were scored in the interphase cells after incubation for repair than in metaphase samples harvested at the first postirradiation mitosis. On the other hand, no significant differences were observed in the two samples after exposure to sparsely ionizing radiation. These results suggest that interphase chromosome painting can be a useful tool for biodosimetry of particle radiation.

Generation of an approximately 2.4 Mb human X centromere-based minichromosome by targeted telomere-associated chromosome fragmentation in DT40.

PubMed

Mills, W; Critcher, R; Lee, C; Farr, C J

1999-05-01

A linear mammalian artificial chromosome (MAC) will require at least three types of functional element: a centromere, two telomeres and origins of replication. As yet, our understanding of these elements, as well as many other aspects of structure and organization which may be critical for a fully functional mammalian chromosome, remains poor. As a way of defining these various requirements, minichromosome reagents are being developed and analysed. Approaches for minichromosome generation fall into two broad categories: de novo assembly from candidate DNA sequences, or the fragmentation of an existing chromosome to reduce it to a minimal size. Here we describe the generation of a human minichromosome using the latter, top-down, approach. A human X chromosome, present in a DT40-human microcell hybrid, has been manipulated using homologous recombination and the targeted seeding of a de novo telomere. This strategy has generated a linear approximately 2.4 Mb human X centromere-based minichromosome capped by two artificially seeded telomeres: one immediately flanking the centromeric alpha-satellite DNA and the other targeted to the zinc finger gene ZXDA in Xp11.21. The chromosome retains an alpha-satellite domain of approximately 1. 8 Mb, a small array of gamma-satellite repeat ( approximately 40 kb) and approximately 400 kb of Xp proximal DNA sequence. The mitotic stability of this minichromosome has been examined, both in DT40 and following transfer into hamster and human cell lines. In all three backgrounds, the minichromosome is retained efficiently, but in the human and hamster microcell hybrids its copy number is poorly regulated. This approach of engineering well-defined chromosome reagents will allow key questions in MAC development (such as whether a lower size limit exists) to be addressed. In addition, the 2.4 Mb minichromosome described here has potential to be developed as a vector for gene delivery.

Condensation patterns of prophase/prometaphase chromosome are correlated with H4K5 histone acetylation and genomic DNA contents in plants.

PubMed

Feitoza, Lidiane; Costa, Lucas; Guerra, Marcelo

2017-01-01

Mitotic prophase chromosome condensation plays an essential role in nuclear division being therefore regulated by highly conserved mechanisms. However, degrees of chromatin condensation in prophase-prometaphase cells may vary along the chromosomes resulting in specific condensation patterns. We examined different condensation patterns (CPs) of prophase and prometaphase chromosomes and investigated their relationship with genome size and distribution of histone H4 acetylated at lysine 5 (H4K5ac) in 17 plant species. Our results showed that most species with small genomes (2C < 5 pg) (Arachis pusilla, Bixa orellana, Costus spiralis, Eleutherine bulbosa, Indigofera campestris, Phaseolus lunatus, P. vulgaris, Poncirus trifoliata, and Solanum lycopersicum) displayed prophase chromosomes with late condensing terminal regions that were highly enriched in H4K5ac, and early condensing regions with apparently non-acetylated proximal chromatin. The species with large genomes (Allium cepa, Callisia repens, Araucaria angustifolia and Nothoscordum pulchellum) displayed uniformly condensed and acetylated prophase/prometaphase chromosomes. Three species with small genomes (Eleocharis geniculata, Rhynchospora pubera, and R. tenuis) displayed CP and H4K5ac labeling patterns similar to species with large genomes, whereas a forth species (Emilia sonchifolia) exhibited a gradual chromosome labeling, being more acetylated in the terminal regions and less acetylated in the proximal ones. The nucleolus organizer chromatin was the only chromosomal region that in prometaphase or metaphase could be hyperacetylated, hypoacetylated or non-acetylated, depending on the species. Our data indicate that the CP of a plant chromosome complement is influenced but not exclusively determined by nuclear and chromosomal DNA contents, whereas the CP of individual chromosomes is clearly correlated with H4K5ac distribution.

Condensation patterns of prophase/prometaphase chromosome are correlated with H4K5 histone acetylation and genomic DNA contents in plants

PubMed Central

Feitoza, Lidiane; Costa, Lucas

2017-01-01

Mitotic prophase chromosome condensation plays an essential role in nuclear division being therefore regulated by highly conserved mechanisms. However, degrees of chromatin condensation in prophase-prometaphase cells may vary along the chromosomes resulting in specific condensation patterns. We examined different condensation patterns (CPs) of prophase and prometaphase chromosomes and investigated their relationship with genome size and distribution of histone H4 acetylated at lysine 5 (H4K5ac) in 17 plant species. Our results showed that most species with small genomes (2C < 5 pg) (Arachis pusilla, Bixa orellana, Costus spiralis, Eleutherine bulbosa, Indigofera campestris, Phaseolus lunatus, P. vulgaris, Poncirus trifoliata, and Solanum lycopersicum) displayed prophase chromosomes with late condensing terminal regions that were highly enriched in H4K5ac, and early condensing regions with apparently non-acetylated proximal chromatin. The species with large genomes (Allium cepa, Callisia repens, Araucaria angustifolia and Nothoscordum pulchellum) displayed uniformly condensed and acetylated prophase/prometaphase chromosomes. Three species with small genomes (Eleocharis geniculata, Rhynchospora pubera, and R. tenuis) displayed CP and H4K5ac labeling patterns similar to species with large genomes, whereas a forth species (Emilia sonchifolia) exhibited a gradual chromosome labeling, being more acetylated in the terminal regions and less acetylated in the proximal ones. The nucleolus organizer chromatin was the only chromosomal region that in prometaphase or metaphase could be hyperacetylated, hypoacetylated or non-acetylated, depending on the species. Our data indicate that the CP of a plant chromosome complement is influenced but not exclusively determined by nuclear and chromosomal DNA contents, whereas the CP of individual chromosomes is clearly correlated with H4K5ac distribution. PMID:28854212

A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

PubMed

Yu, Shoukai; Lemos, Bernardo

2016-12-31

Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome

PubMed Central

Yu, Shoukai; Lemos, Bernardo

2016-01-01

Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. PMID:27797956

Phylogeography of human Y-chromosome haplogroup Q3-L275 from an academic/citizen science collaboration.

PubMed

Balanovsky, Oleg; Gurianov, Vladimir; Zaporozhchenko, Valery; Balaganskaya, Olga; Urasin, Vadim; Zhabagin, Maxat; Grugni, Viola; Canada, Rebekah; Al-Zahery, Nadia; Raveane, Alessandro; Wen, Shao-Qing; Yan, Shi; Wang, Xianpin; Zalloua, Pierre; Marafi, Abdullah; Koshel, Sergey; Semino, Ornella; Tyler-Smith, Chris; Balanovska, Elena

2017-02-07

The Y-chromosome haplogroup Q has three major branches: Q1, Q2, and Q3. Q1 is found in both Asia and the Americas where it accounts for about 90% of indigenous Native American Y-chromosomes; Q2 is found in North and Central Asia; but little is known about the third branch, Q3, also named Q1b-L275. Here, we combined the efforts of population geneticists and genetic genealogists to use the potential of full Y-chromosome sequencing for reconstructing haplogroup Q3 phylogeography and suggest possible linkages to events in population history. We analyzed 47 fully sequenced Y-chromosomes and reconstructed the haplogroup Q3 phylogenetic tree in detail. Haplogroup Q3-L275, derived from the oldest known split within Eurasian/American haplogroup Q, most likely occurred in West or Central Asia in the Upper Paleolithic period. During the Mesolithic and Neolithic epochs, Q3 remained a minor component of the West Asian Y-chromosome pool and gave rise to five branches (Q3a to Q3e), which spread across West, Central and parts of South Asia. Around 3-4 millennia ago (Bronze Age), the Q3a branch underwent a rapid expansion, splitting into seven branches, some of which entered Europe. One of these branches, Q3a1, was acquired by a population ancestral to Ashkenazi Jews and grew within this population during the 1st millennium AD, reaching up to 5% in present day Ashkenazi. This study dataset was generated by a massive Y-chromosome genotyping effort in the genetic genealogy community, and phylogeographic patterns were revealed by a collaboration of population geneticists and genetic genealogists. This positive experience of collaboration between academic and citizen science provides a model for further joint projects. Merging data and skills of academic and citizen science promises to combine, respectively, quality and quantity, generalization and specialization, and achieve a well-balanced and careful interpretation of the paternal-side history of human populations.

Karyotyping human chromosomes by optical and x-ray ptychography methods

DOE PAGES

Shemilt, Laura; Verbanis, Ephanielle; Schwenke, Joerg; ...

2015-02-01

Sorting and identifying chromosomes, a process known as karyotyping, is widely used to detect changes in chromosome shapes and gene positions. In a karyotype the chromosomes are identified by their size and therefore this process can be performed by measuring macroscopic structural variables. Chromosomes contain a specific number of basepairs that linearly correlate with their size; therefore, it is possible to perform a karyotype on chromosomes using their mass as an identifying factor. Here, we obtain the first images, to our knowledge, of chromosomes using the novel imaging method of ptychography. We can use the images to measure the massmore » of chromosomes and perform a partial karyotype from the results. Lastly, we also obtain high spatial resolution using this technique with synchrotron source x-rays.« less

Karyotyping human chromosomes by optical and x-ray ptychography methods

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shemilt, Laura; Verbanis, Ephanielle; Schwenke, Joerg

Sorting and identifying chromosomes, a process known as karyotyping, is widely used to detect changes in chromosome shapes and gene positions. In a karyotype the chromosomes are identified by their size and therefore this process can be performed by measuring macroscopic structural variables. Chromosomes contain a specific number of basepairs that linearly correlate with their size; therefore, it is possible to perform a karyotype on chromosomes using their mass as an identifying factor. Here, we obtain the first images, to our knowledge, of chromosomes using the novel imaging method of ptychography. We can use the images to measure the massmore » of chromosomes and perform a partial karyotype from the results. Lastly, we also obtain high spatial resolution using this technique with synchrotron source x-rays.« less

Defects in the cappuccino (cno) gene on mouse chromosome 5 and human 4p cause Hermansky-Pudlak syndrome by an AP-3-independent mechanism.

PubMed

Gwynn, B; Ciciotte, S L; Hunter, S J; Washburn, L L; Smith, R S; Andersen, S G; Swank, R T; Dell'Angelica, E C; Bonifacino, J S; Eicher, E M; Peters, L L

2000-12-15

Defects in a triad of organelles (melanosomes, platelet granules, and lysosomes) result in albinism, prolonged bleeding, and lysosome abnormalities in Hermansky-Pudlak syndrome (HPS). Defects in HPS1, a protein of unknown function, and in components of the AP-3 complex cause some, but not all, cases of HPS in humans. There have been 15 inherited models of HPS described in the mouse, underscoring its marked genetic heterogeneity. Here we characterize a new spontaneous mutation in the mouse, cappuccino (cno), that maps to mouse chromosome 5 in a region conserved with human 4p15-p16. Melanosomes of cno/cno mice are immature and dramatically decreased in number in the eye and skin, resulting in severe oculocutaneous albinism. Platelet dense body contents (adenosine triphosphate, serotonin) are markedly deficient, leading to defective aggregation and prolonged bleeding. Lysosomal enzyme concentrations are significantly elevated in the kidney and liver. Genetic, immunofluorescence microscopy, and lysosomal protein trafficking studies indicate that the AP-3 complex is intact in cno/cno mice. It was concluded that the cappuccino gene encodes a product involved in an AP-3-independent mechanism critical to the biogenesis of lysosome-related organelles. (Blood. 2000;96:4227-4235)