Science.gov

Sample records for human intestinal smooth

  1. Unregulated smooth-muscle myosin in human intestinal neoplasia.

    PubMed

    Alhopuro, Pia; Phichith, Denis; Tuupanen, Sari; Sammalkorpi, Heli; Nybondas, Miranda; Saharinen, Juha; Robinson, James P; Yang, Zhaohui; Chen, Li-Qiong; Orntoft, Torben; Mecklin, Jukka-Pekka; Järvinen, Heikki; Eng, Charis; Moeslein, Gabriela; Shibata, Darryl; Houlston, Richard S; Lucassen, Anneke; Tomlinson, Ian P M; Launonen, Virpi; Ristimäki, Ari; Arango, Diego; Karhu, Auli; Sweeney, H Lee; Aaltonen, Lauri A

    2008-04-01

    A recent study described a recessive ATPase activating germ-line mutation in smooth-muscle myosin (smmhc/myh11) underlying the zebrafish meltdown (mlt) phenotype. The mlt zebrafish develops intestinal abnormalities reminiscent of human Peutz-Jeghers syndrome (PJS) and juvenile polyposis (JP). To examine the role of MYH11 in human intestinal neoplasia, we searched for MYH11 mutations in patients with colorectal cancer (CRC), PJS and JP. We found somatic protein-elongating frameshift mutations in 55% of CRCs displaying microsatellite instability and in the germ-line of one individual with PJS. Additionally, two somatic missense mutations were found in one microsatellite stable CRC. These two missense mutations, R501L and K1044N, and the frameshift mutations were functionally evaluated. All mutations resulted in unregulated molecules displaying constitutive motor activity, similar to the mutant myosin underlying mlt. Thus, MYH11 mutations appear to contribute also to human intestinal neoplasia. Unregulated MYH11 may affect the cellular energy balance or disturb cell lineage decisions in tumor progenitor cells. These data challenge our view on MYH11 as a passive differentiation marker functioning in muscle contraction and add to our understanding of intestinal neoplasia. PMID:18391202

  2. Heparin induces the expression of specific matrix proteins by human intestinal smooth muscle cells

    SciTech Connect

    Cochran, D.L.; Perr, H.; Graham, M.F.; Diegelmann, R.F.

    1986-03-01

    Human intestinal smooth muscle (HISM) cells have recently been identified as the major cell type responsible for stricture formation in Crohn's disease. Heparin, a sulfated glycosaminoglycan, has been shown to be a key modulator of vascular smooth muscle cell (VSMC) growth both in vivo and in vitro and to affect the phenotypic expression of proteins made by VSMC. Heparin has also been shown to effect the growth of HISM cells and in this report the authors demonstrate that heparin also has very specific effects on proteins released by HISM cells in vitro. Examination of the proteins in the culture medium of heparin-treated HISM cells observed at 3 time points following sparse plating and proliferation revealed an increase in /sup 35/S-methionine-labeled 200, 37, and 35 kd proteins. A transient effect on a 48 kd protein was observed in substrate-attached material left on the culture dish after the cells were removed with EGTA. No effects on intracellular labeled proteins could be demonstrated. The protein phenotype of HISM cells exposed to heparin appears very similar to that observed in VSMC. The release of specific proteins following exposure to heparin does not appear to be species specific. This response to heparin may reflect a significant influence of this glycosaminoglycan on the phenotypic expression of these cells.

  3. Heparin modulates human intestinal smooth muscle (HISM) cell proliferation and matrix production

    SciTech Connect

    Graham, M.; Perr, H.; Drucker, D.E.; Diegelmann, R.F.

    1986-03-01

    (HISM) cell proliferation and collagen production may play a role in the pathogenesis of intestinal stricture in Crohn's disease. The present studies were performed to evaluate the effects of heparin, a known modulator of vascular smooth muscle cells, on HISM cell proliferation and collagen production. Heparin (100 ..mu..g/ml) was added daily to HISM cell cultures for cell proliferation studies and for 24 hours at various time points during culture for collagen synthesis studies. Collagen synthesis was determined by the uptake of /sup 3/H proline into collagenase-sensitive protein. Heparin completely inhibited cell proliferation for 7 days, after which cell numbers increased but at a slower rate than controls. Cells released from heparin inhibition demonstrated catch-up growth to control levels. Collagen production was significantly inhibited by 24 hours exposure to heparin but only at those times during culture when collagen synthesis was maximal (8 to 12 days). Non-collagen protein synthesis was inhibited by heparin at all time points during culture. Heparin through its modulation of HISM cells may play an important role in the control of the extracellular matrix of the intestinal wall.

  4. The role of selective cyclooxygenase isoforms in human intestinal smooth muscle cell stimulated prostanoid formation and proliferation.

    PubMed Central

    Longo, W E; Erickson, B; Panesar, N; Mazuski, J E; Robinson, S; Kaminski, D L

    1998-01-01

    Intestinal smooth muscle plays a major role in the repair of injured intestine and contributes to the prostanoid pool during intestinal inflammatory states. Cyclooxygenase (COX), which catalyzes the conversion of arachidonic acid to prostanoids exists in two isoforms, COX-1 and COX-2. The purpose of this study was to determine the relative contributions of COX-1 and COX-2 in the production of prostanoids by human intestinal smooth muscle (HISM) cells when stimulated by interleukin-1beta (IL-1beta) and lipopolysaccharide (LPS). Furthermore the effects of specific COX-1 and COX-2 inhibitors on the proliferation of smooth muscle cells was also evaluated. Confluent monolayer cultures of HISM cells were incubated with IL-1beta or LPS for 0-24h while control cells received medium alone. PGE2 and PGI2 as 6-keto-PGF1alpha and LTB4 were measured by a specific radioimmunoassay. COX enzymes were evaluated by Western immunoblotting. Unstimulated and stimulated cells were exposed to the specific COX-1 inhibitor valerylsalicylic acid (VSA) and the COX-2 inhibitors NS-398 and SC-58125. The effects of serum on proliferation were then evaluated in the presence of each of the specific COX inhibitors by incorporation of 3H-thymidine into DNA. IL-1beta and LPS increased both PGE2 and 6-keto-PGF1alpha in a dose dependent fashion with enhanced production detected two hours following exposure. Neither stimulus stimulated LTB4 release. Immunoblot analysis using isoform-specific antibodies showed that both COX-1 and COX-2 were present constitutively. Furthermore, COX-1 was upregulated by each inflammatory stimulus. In a separate set of experiments cells were pretreated with either the selective COX-1 inhibitor VSA or the selective COX-2 inhibitors NS-398 or SC-58125 prior to treatment with IL-1beta or LPS. The COX-1 and COX-2 inhibitors decreased both basal and IL-1beta and LPS stimulated prostanoid release. Spontaneous DNA synthesis was present and serum consistently increased

  5. Smooth Muscle Strips for Intestinal Tissue Engineering

    PubMed Central

    Walthers, Christopher M.; Lee, Min; Wu, Benjamin M.; Dunn, James C. Y.

    2014-01-01

    Functionally contracting smooth muscle is an essential part of the engineered intestine that has not been replicated in vitro. The purpose of this study is to produce contracting smooth muscle in culture by maintaining the native smooth muscle organization. We employed intact smooth muscle strips and compared them to dissociated smooth muscle cells in culture for 14 days. Cells isolated by enzymatic digestion quickly lost maturity markers for smooth muscle cells and contained few enteric neural and glial cells. Cultured smooth muscle strips exhibited periodic contraction and maintained neural and glial markers. Smooth muscle strips cultured for 14 days also exhibited regular fluctuation of intracellular calcium, whereas cultured smooth muscle cells did not. After implantation in omentum for 14 days on polycaprolactone scaffolds, smooth muscle strip constructs expressed high levels of smooth muscle maturity markers as well as enteric neural and glial cells. Intact smooth muscle strips may be a useful component for engineered intestinal smooth muscle. PMID:25486279

  6. Autonomic Modification of Intestinal Smooth Muscle Contractility

    ERIC Educational Resources Information Center

    Montgomery, Laura E. A.; Tansey, Etain A.; Johnson, Chris D.; Roe, Sean M.; Quinn, Joe G.

    2016-01-01

    Intestinal smooth muscle contracts rhythmically in the absence of nerve and hormonal stimulation because of the activity of pacemaker cells between and within the muscle layers. This means that the autonomic nervous system modifies rather than initiates intestinal contractions. The practical described here gives students an opportunity to observe…

  7. Autonomic modification of intestinal smooth muscle contractility.

    PubMed

    Montgomery, Laura E A; Tansey, Etain A; Johnson, Chris D; Roe, Sean M; Quinn, Joe G

    2016-03-01

    Intestinal smooth muscle contracts rhythmically in the absence of nerve and hormonal stimulation because of the activity of pacemaker cells between and within the muscle layers. This means that the autonomic nervous system modifies rather than initiates intestinal contractions. The practical described here gives students an opportunity to observe this spontaneous activity and its modification by agents associated with parasympathetic and sympathetic nerve activity. A section of the rabbit small intestine is suspended in an organ bath, and the use of a pressure transducer and data-acquisition software allows the measurement of tension generated by the smooth muscle of intestinal walls. The application of the parasympathetic neurotransmitter ACh at varying concentrations allows students to observe an increase in intestinal smooth muscle tone with increasing concentrations of this muscarinic receptor agonist. Construction of a concentration-effect curve allows students to calculate an EC50 value for ACh and consider some basic concepts surrounding receptor occupancy and activation. Application of the hormone epinephrine to the precontracted intestine allows students to observe the inhibitory effects associated with sympathetic nerve activation. Introduction of the drug atropine to the preparation before a maximal concentration of ACh is applied allows students to observe the inhibitory effect of a competitive antagonist on the physiological response to a receptor agonist. The final experiment involves the observation of the depolarizing effect of K(+) on smooth muscle. Students are also invited to consider why the drugs atropine, codeine, loperamide, and botulinum toxin have medicinal uses in the management of gastrointestinal problems. PMID:26873897

  8. Contribution of intestinal smooth muscle to Crohn's disease fibrogenesis.

    PubMed

    Severi, C; Sferra, R; Scirocco, A; Vetuschi, A; Pallotta, N; Pronio, A; Caronna, R; Di Rocco, G; Gaudio, E; Corazziari, E; Onori, P

    2014-01-01

    Mesenchymal cells transdifferentiation and extracellular matrix deposition are involved in the fibrotic process of Crohn's disease (CD). Mesenchymal smooth muscle cells (SMCs) de-differentiation, driven by Platelet-derived growth factor (PDGF) that counteracts Transforming growth factor (TGF-β) has been studied in vascular muscle. The role of SMCs in intestinal fibrogenesis is still not clearly elucidated. Aim of the study was to evaluate the possible myogenic contribution to CD fibrotic process through the comparative analysis of histological, morphometric and molecular alterations occurring in human smooth muscle. Full thickness specimens were obtained from CD (non-involved and stenotic tracts) and healthy (control) ileum. Tissues were processed for histological and immunohistochemical (IHC) analyses and SMCs were isolated from the muscularis propria for morphofunctional and molecular (qPCR) analyses. CD stenotic ileum showed a significant increased thickness of all layers compared to CD non-involved and control ileum. IHC revealed an overexpression of α-smooth muscle actin and collagens I-III throughout all intestinal layers only in stenotic tracts. The two growth factors, PDGF and TGF-β, showed a progressive increase in expression in the muscle layer from CD non-involved to stenotic tracts. Freshly isolated SMCs presented alterations in CD non-involved tracts that progressively increased in the stenotic tracts consisting in a statistical increase in mRNA encoding for PDGF-β and collagen III, paralleled to a decrease in TGF-β and Tribbles-like protein-3 mRNA, and altered morphofunctional parameters consisting in progressive decreases in cell length and contraction to acetylcholine. These findings indicate that intrinsic myogenic alterations occur in CD ileum, that they likely precede stricture formation, and might represent suitable new targets for anti-fibrotic interventions. PMID:25578979

  9. Graded effects of unregulated smooth muscle myosin on intestinal architecture, intestinal motility and vascular function in zebrafish.

    PubMed

    Abrams, Joshua; Einhorn, Zev; Seiler, Christoph; Zong, Alan B; Sweeney, H Lee; Pack, Michael

    2016-05-01

    Smooth muscle contraction is controlled by the regulated activity of the myosin heavy chain ATPase (Myh11). Myh11 mutations have diverse effects in the cardiovascular, digestive and genitourinary systems in humans and animal models. We previously reported a recessive missense mutation, meltdown (mlt), which converts a highly conserved tryptophan to arginine (W512R) in the rigid relay loop of zebrafish Myh11. The mlt mutation disrupts myosin regulation and non-autonomously induces invasive expansion of the intestinal epithelium. Here, we report two newly identified missense mutations in the switch-1 (S237Y) and coil-coiled (L1287M) domains of Myh11 that fail to complement mlt Cell invasion was not detected in either homozygous mutant but could be induced by oxidative stress and activation of oncogenic signaling pathways. The smooth muscle defect imparted by the mlt and S237Y mutations also delayed intestinal transit, and altered vascular function, as measured by blood flow in the dorsal aorta. The cell-invasion phenotype induced by the three myh11 mutants correlated with the degree of myosin deregulation. These findings suggest that the vertebrate intestinal epithelium is tuned to the physical state of the surrounding stroma, which, in turn, governs its response to physiologic and pathologic stimuli. Genetic variants that alter the regulation of smooth muscle myosin might be risk factors for diseases affecting the intestine, vasculature, and other tissues that contain smooth muscle or contractile cells that express smooth muscle proteins, particularly in the setting of redox stress. PMID:26893369

  10. Graded effects of unregulated smooth muscle myosin on intestinal architecture, intestinal motility and vascular function in zebrafish

    PubMed Central

    Abrams, Joshua; Einhorn, Zev; Seiler, Christoph; Zong, Alan B.; Sweeney, H. Lee; Pack, Michael

    2016-01-01

    ABSTRACT Smooth muscle contraction is controlled by the regulated activity of the myosin heavy chain ATPase (Myh11). Myh11 mutations have diverse effects in the cardiovascular, digestive and genitourinary systems in humans and animal models. We previously reported a recessive missense mutation, meltdown (mlt), which converts a highly conserved tryptophan to arginine (W512R) in the rigid relay loop of zebrafish Myh11. The mlt mutation disrupts myosin regulation and non-autonomously induces invasive expansion of the intestinal epithelium. Here, we report two newly identified missense mutations in the switch-1 (S237Y) and coil-coiled (L1287M) domains of Myh11 that fail to complement mlt. Cell invasion was not detected in either homozygous mutant but could be induced by oxidative stress and activation of oncogenic signaling pathways. The smooth muscle defect imparted by the mlt and S237Y mutations also delayed intestinal transit, and altered vascular function, as measured by blood flow in the dorsal aorta. The cell-invasion phenotype induced by the three myh11 mutants correlated with the degree of myosin deregulation. These findings suggest that the vertebrate intestinal epithelium is tuned to the physical state of the surrounding stroma, which, in turn, governs its response to physiologic and pathologic stimuli. Genetic variants that alter the regulation of smooth muscle myosin might be risk factors for diseases affecting the intestine, vasculature, and other tissues that contain smooth muscle or contractile cells that express smooth muscle proteins, particularly in the setting of redox stress. PMID:26893369

  11. Ultrastructural and immunohistochemical analysis of intestinal myofibroblasts during the early organogenesis of the human small intestine.

    PubMed

    Artells, Rosa; Navarro, Alfons; Diaz, Tània; Monzó, Mariano

    2011-03-01

    Intestinal myofibroblasts (IMFs), also known as pericryptal fibroblasts, are found at the basement membrane of the intestinal epithelium. They are characterized by well-developed endoplasmic reticulum, cytoplasmic fibers, and fibrous extensions called fibronexi. IMFs have structural features in common both with fibroblasts and smooth cells. Vimentin, desmin, and α-smooth-muscle actin (α-SM) are markers commonly used to discriminate between IMFs and smooth muscle cells. Immunohistochemical studies have shown that, when α-SM and vimentin are positive in both IMFs and smooth muscle cells, desmin is negative in IMFs but positive in smooth muscle cells. In the adult intestine, IMFs play an important role in various functions, especially in tissue repair and scar formation during wound healing. In the embryonic intestine, however, wound healing does not occur, and to date, no studies have investigated the first appearance and subsequent evolution of IMFs. In this study, we have examined the human small intestine in embryos at 7, 9, and 11 weeks of development by ultrastructural and immunohistochemical analysis to shed light on the formation of IMFs during these early phases of organogenesis. At 7 weeks, the embryonic mesenchymal cells are similar to proto-myofibroblasts and may be the precursors of the IMFs detected at 9 weeks and more abundantly at 11 weeks by immunohistochemistry. These IMFs seem to mediate information flow between the epithelium and the mesenchyme and thus contribute to the development of the small intestine. PMID:21284092

  12. The effects of aluminum, iron, chromium, and yttrium on rat intestinal smooth muscle in vitro.

    PubMed

    Cunat, L; Membre, H; Marchal, L; Chaussidon, M; Burnel, D

    1998-01-01

    The modification of peristaltic activity in the presence of several metal ions has been investigated in the rat intestine by the isolated organ technique. The metals tested modify the intestinal movements: aluminum, chromium, and yttrium cause a decrease of amplitude, while iron showed no effect. By use of microscopic techniques, the presence of yttrium hydroxide was observed in the intestinal tissues. Iron also appears as a precipitate outside of the intestinal serosal, which may explain why iron did not modify the peristaltism. Chromium and aluminum were not apparent to microscope, despite being detected and quantified in the tissues by means of atomic emission spectrometer. We conclude that the trivalent ions of these elements may operate differently on the mechanisms of intestinal contractions: yttrium precipitates in intercellular spaces, iron precipitates outside the intestines, and chromium and aluminum remain in solution and are distributed homogeneously in the smooth intestinal muscle. PMID:9845462

  13. Regeneration and Maintenance of Intestinal Smooth Muscle Phenotypes

    NASA Astrophysics Data System (ADS)

    Walthers, Christopher M.

    Tissue engineering is an emerging field of biomedical engineering that involves growing artificial organs to replace those lost to disease or injury. Within tissue engineering, there is a demand for artificial smooth muscle to repair tissues of the digestive tract, bladder, and vascular systems. Attempts to develop engineered smooth muscle tissues capable of contracting with sufficient strength to be clinically relevant have so far proven unsatisfactory. The goal of this research was to develop and sustain mature, contractile smooth muscle. Survival of implanted SMCs is critical to sustain the benefits of engineered smooth muscle. Survival of implanted smooth muscle cells was studied with layered, electrospun polycaprolactone implants with lasercut holes ranging from 0--25% porosity. It was found that greater angiogenesis was associated with increased survival of implanted cells, with a large increase at a threshold between 20% and 25% porosity. Heparan sulfate coatings improved the speed of blood vessel infiltration after 14 days of implantation. With these considerations, thicker engineered tissues may be possible. An improved smooth muscle tissue culture technique was utilized. Contracting smooth muscle was produced in culture by maintaining the native smooth muscle tissue organization, specifically by sustaining intact smooth muscle strips rather than dissociating tissue in to isolated smooth muscle cells. Isolated cells showed a decrease in maturity and contained fewer enteric neural and glial cells. Muscle strips also exhibited periodic contraction and regular fluctuation of intracellular calclium. The muscle strip maturity persisted after implantation in omentum for 14 days on polycaprolactone scaffolds. A low-cost, disposable bioreactor was developed to further improve maturity of cultured smooth muscle cells in an environment of controlled cyclical stress.The bioreactor consistently applied repeated mechanical strain with controllable inputs for strain

  14. Smooth muscle NOS, colocalized with caveolin-1, modulates contraction in mouse small intestine

    PubMed Central

    El-Yazbi, Ahmed F; Cho, Woo Jung; Cena, Jonathan; Schulz, Richard; Daniel, Edwin E

    2008-01-01

    Neuronal nitric oxide synthase (nNOS) in myenteric neurons is activated during peristalsis to produce nitric oxide which relaxes intestinal smooth muscle. A putative nNOS is also found in the membrane of intestinal smooth muscle cells in mouse and dog. In this study we studied the possible functions of this nNOS expressed in mouse small intestinal smooth muscle colocalized with caveolin-1(Cav-1). Cav-1 knockout mice lacked nNOS in smooth muscle and provided control tissues. 60 mM KCl was used to increase intracellular [Ca2+] through L-type Ca2+ channel opening and stimulate smooth muscle NOS activity in intestinal tissue segments. An additional contractile response to LNNA (100 μM, NOS inhibitor) was observed in KCl-contracted tissues from control mice and was almost absent in tissues from Cav-1 knockout mice. Disruption of caveolae with 40 mM methyl-β cyclodextrin in tissues from control mice led to the loss of Cav-1 and nNOS immunoreactivity from smooth muscle as shown by immunohistochemistry and a reduction in the response of these tissues to N-ω-nitro-L-arginine (LNNA). Reconstitution of membrane cholesterol using water soluble cholesterol in the depleted segments restored the immunoreactivity and the response to LNNA added after KCl. Nicardipine (1 μM) blocked the responses to KCl and LNNA confirming the role of L-type Ca2+ channels. ODQ (1 μM, soluble guanylate cyclase inhibitor) had the same effect as inhibition of NOS following KCl. We conclude that the activation of nNOS, localized in smooth muscle caveolae, by calcium entering through L-type calcium channels triggers nitric oxide production which modulates muscle contraction by a cGMP-dependent mechanism. PMID:18400048

  15. Proliferation modulates intestinal smooth muscle phenotype in vitro and in colitis in vivo.

    PubMed

    Nair, Dileep G; Han, T Y; Lourenssen, S; Blennerhassett, Michael G

    2011-05-01

    Intestinal inflammation causes an increased intestinal wall thickness, in part, due to the proliferation of smooth muscle cells, which impairs the contractile phenotype elsewhere. To study this, cells from the circular muscle layer of the rat colon (CSMC) were isolated and studied, both in primary culture and after extended passage, using quantitative PCR, Western blot analysis, and immunocytochemistry. By 4 days in vitro, both mRNA and protein for the smooth muscle marker proteins α-smooth muscle actin, desmin, and SM22-α were reduced by >50%, and mRNA for cyclin D1 was increased threefold, evidence for modulation to a proliferative phenotype. Continued growth caused significant further decrease in expression, evidence that phenotypic loss in CSMC was proportional to the extent of proliferation. In CSMC isolated at day 2 of trinitrobenzene sulfonic acid-induced colitis, flow cytometry and Western blotting showed that these differentiated markers were reduced in mitotic CSMC, while similar to control in nonmitotic CSMC. By day 35 post-trinitrobenzene sulfonic acid, when inflammation has resolved, CSMC were hypertrophic, but, nonetheless, showed markedly decreased expression of smooth muscle protein markers per cell. In vitro, day 35 CSMC displayed an accelerated loss of phenotype and increased thymidine uptake in response to serum or PDGF-BB. Furthermore, carbachol-induced expression of phospho-AKT (a marker of cholinergic response) was lost from day 35 CSMC in vitro, while retained in control cells. Therefore, proliferation reduces the expression of smooth-muscle-specific markers in CSMC, possibly leading to altered contractility. However, inflammation-induced proliferation in vivo also causes lasting changes that include unexpected priming for an exaggerated response to proliferative stimuli. Identification of the molecular mechanisms of intestinal smooth muscle cell phenotypic modulation will be helpful in reducing the detrimental effects of inflammation. PMID

  16. Direct effect of croton oil on intestinal epithelial cells and colonic smooth muscle cells

    PubMed Central

    Wang, Xin; Lan, Mei; Wu, Han-Ping; Shi, Yong-Quan; Lu, Ju; Ding, Jie; Wu, Kai-Cun; Jin, Jian-Ping; Fan, Dai Ming

    2002-01-01

    AIM: To investigate the direct effect of croton oil (CO) on human intestinal epithelial cell (HIEC) and guinea pig colonic smooth muscle cells in vitro. METHODS: Growth curves of HIEC were drawn by MTT colorimetry. The dynamics of cell proliferation was analyzed with flow cytometry, and morphological changes were observed under light and electron microscopy after long-term (6 weeks) treatment with CO.Expression of cyclooxygenase-2 (COX-2) mRNA was detected by dot blot in HIEC treated with CO. Genes related to CO were screened by DD-PCR, and the direct effect of CO on the contractility of isolated guinea pig colonic smooth muscle cells was observed. RESULTS: High concentration (20-40 mg·L-1) CO inhibited cell growth significantly (1, 3, 5, 7 d OD sequence: (20 mg·L-1 ) 0.040 ± 0.003, 0.081 ± 0.012, 0.147 ± 0.022,0.024 ± 0.016; (40 mg·L-1) 0.033 ± 0.044, 0.056 ± 0.012, 0.104 ± 0.010, 0.189 ± 0.006; OD control 0.031 ± 0.008, 0.096 ± 0.012, 0.173 ± 0.009, 0.300 ± 0.016, P < 0.01), which appeared to be related directly to the dosage. Compared with the control, the fraction number of cells in G1 phase decreased from 0.60 to 0.58, while that in S phase increased from 0.30 to 0.34 and DNA index also increased after 6 weeks of treatment with CO (the dosage was increased gradually from 4 to 40 mg·L-1). Light microscopic observation revealed that cells had karyomegaly, less plasma and karyoplasm lopsidedness. Electron microscopy also showed an increase in cell proliferation and in the quantity of abnormal nuclei with pathologic mitosis. Expression of COX-2 mRNA decreased significantly in HIEC treated with CO. Thirteen differential cDNA fragments were cloned from HIEC treated with CO, one of which was 100 percent homologous with human mitochondrial cytochrome C oxidase subunit II. The length of isolated guinea pig colonic smooth muscle cells was significantly shortened after treatment with CO (P < 0.05). CONCLUSION: At a high CO concentration ( > 20 mg·L-1

  17. Digestive smooth muscle mitochondrial myopathy in patients with mitochondrial-neuro-gastro-intestinal encephalomyopathy (MNGIE).

    PubMed

    Blondon, Hugues; Polivka, Marc; Joly, Francisca; Flourie, Bernard; Mikol, Jacqueline; Messing, Bernard

    2005-01-01

    We report 3 new cases of Mitochondrial-Neuro-Gastro-Intestinal Encephalomyopathy (MNGIE) (or Pseudo-Obstruction-Leukoencephalopathy-Intestinal-Pseudoobstruction Syndrome [POLIP]), a rare disease that associates chronic intestinal pseudo-obstruction (CIPO) and neurological symptoms. A review of the 72 reported cases together with these 3 cases revealed that this condition was associated with (a) a specific cluster of neurological symptoms including leukoencephalopathy (96%), polyneuropathy (96%), ophthalmoplegia (91%) and hearing loss (55%); (b) a CIPO syndrome with the presence of small bowel diverticulae (53%); and (c) mitochondrial cytopathy in 36 of the 37 tested patients (2 of our 3 cases), and thymidine phosphorylase gene mutations in all the 37 tested patients (2 of our cases). The etiology of POLIP/MNGIE syndrome appears therefore to be due to a mitochondrial cytopathy secondary to thymidine phosphorylase gene mutation(s). In 3 cases, including 2 of our 3 patients, mitochondrial abnormalities were evidenced at the ultrastructural level in digestive smooth muscle demonstrating that the pathogenesis of gastrointestinal involvement was directly related to mitochondrial alterations in digestive smooth muscle cells. PMID:16294144

  18. Orthogonally oriented scaffolds with aligned fibers for engineering intestinal smooth muscle

    PubMed Central

    Kobayashi, Masae; Lei, Nan Ye; Wang, Qianqian; Wu, Benjamin M.; Dunn, James C.Y.

    2015-01-01

    Controlling cellular alignment is critical in engineering intestines with desired structure and function. Although previous studies have examined the directional alignment of cells on the surface (x-y plane) of parallel fibers, quantitative analysis of the cellular alignment inside implanted scaffolds with oriented fibers has not been reported. This study examined the cellular alignment in the x-z and y-z planes of scaffolds made with two layers of orthogonally oriented fibers. The cellular orientation inside implanted scaffolds was evaluated with immunofluorescence. Quantitative analysis of coherency between cell orientation and fiber direction confirmed that cells aligned along the fibers not only on the surface (x-y plane) but also inside the scaffolds (x-z & y-z planes). Our study demonstrated that two layers of orthogonally aligned scaffolds can generate the histological organization of cells similar to that of intestinal circular and longitudinal smooth muscle. PMID:26001072

  19. Loss of serum response factor induces microRNA-mediated apoptosis in intestinal smooth muscle cells

    PubMed Central

    Park, C; Lee, M Y; Slivano, O J; Park, P J; Ha, S; Berent, R M; Fuchs, R; Collins, N C; Yu, T J; Syn, H; Park, J K; Horiguchi, K; Miano, J M; Sanders, K M; Ro, S

    2015-01-01

    Serum response factor (SRF) is a transcription factor known to mediate phenotypic plasticity in smooth muscle cells (SMCs). Despite the critical role of this protein in mediating intestinal injury response, little is known about the mechanism through which SRF alters SMC behavior. Here, we provide compelling evidence for the involvement of SRF-dependent microRNAs (miRNAs) in the regulation of SMC apoptosis. We generated SMC-restricted Srf inducible knockout (KO) mice and observed both severe degeneration of SMCs and a significant decrease in the expression of apoptosis-associated miRNAs. The absence of these miRNAs was associated with overexpression of apoptotic proteins, and we observed a high level of SMC death and myopathy in the intestinal muscle layers. These data provide a compelling new model that implicates SMC degeneration via anti-apoptotic miRNA deficiency caused by lack of SRF in gastrointestinal motility disorders. PMID:26633717

  20. Visceral smooth muscle α-actin deficiency associated with chronic intestinal pseudo-obstruction in a Bengal cat (Felis catus x Prionailurus bengalensis).

    PubMed

    Imai, D M; Miller, J L; Leonard, B C; Bach, J; Drees, R; Steinberg, H; Teixeira, L B C

    2014-05-01

    An adult Bengal cat (Felis catus × Prionailurus bengalensis) with a prolonged history of partial anorexia, regurgitation, and weight loss and a clinical, radiographic, and ultrasonographic diagnosis of persistent megaesophagus and gastrointestinal ileus was submitted for necropsy. The intestinal tract was diffusely distended by gas and fluid with appreciable loss of muscle tone and an absence of luminal obstruction, consistent with the clinical history of chronic intestinal pseudo-obstruction. Histologically, the autonomic nervous system was intact, but the smooth muscle within the gastrointestinal wall exhibited a marked basophilia that was most pronounced in the jejunum. Immunohistochemistry for neurofilament, synaptophysin, CD117, and desmin demonstrated that the number of myenteric ganglia, number of interstitial cells, and leiomyocyte desmin content were similar when compared with the unaffected age- and species-matched control. Immunohistochemistry for smooth muscle α-actin demonstrated a striking loss of immunoreactivity, predominantly in the circular layer of the jejunum, that corresponded with the tinctorial change in leiomyocytes. Transmission electron microscopy revealed loss of myofibrils, loss of organelle polarity, and significantly larger central mitochondria (megamitochondria) in affected leiomyocytes, as well as nonspecific degenerative changes. Although the presence of a primary leiomyopathy and a causal relationship could not be confirmed in this case, leiomyopathies are considered a cause of chronic intestinal pseudo-obstruction in human medicine, and loss of smooth muscle α-actin immunoreactivity is one recognized marker for intestinal dysmotility. PMID:23774747

  1. Involvement of Interleukin-17A-Induced Hypercontractility of Intestinal Smooth Muscle Cells in Persistent Gut Motor Dysfunction

    PubMed Central

    Akiho, Hirotada; Tokita, Yohei; Nakamura, Kazuhiko; Satoh, Kazuko; Nishiyama, Mitsue; Tsuchiya, Naoko; Tsuchiya, Kazuaki; Ohbuchi, Katsuya; Iwakura, Yoichiro; Ihara, Eikichi; Takayanagi, Ryoichi; Yamamoto, Masahiro

    2014-01-01

    Background and Aim The etiology of post-inflammatory gastrointestinal (GI) motility dysfunction, after resolution of acute symptoms of inflammatory bowel diseases (IBD) and intestinal infection, is largely unknown, however, a possible involvement of T cells is suggested. Methods Using the mouse model of T cell activation-induced enteritis, we investigated whether enhancement of smooth muscle cell (SMC) contraction by interleukin (IL)-17A is involved in postinflammatory GI hypermotility. Results Activation of CD3 induces temporal enteritis with GI hypomotility in the midst of, and hypermotility after resolution of, intestinal inflammation. Prolonged upregulation of IL-17A was prominent and IL-17A injection directly enhanced GI transit and contractility of intestinal strips. Postinflammatory hypermotility was not observed in IL-17A-deficient mice. Incubation of a muscle strip and SMCs with IL-17A in vitro resulted in enhanced contractility with increased phosphorylation of Ser19 in myosin light chain 2 (p-MLC), a surrogate marker as well as a critical mechanistic factor of SMC contractility. Using primary cultured murine and human intestinal SMCs, IκBζ- and p38 mitogen-activated protein kinase (p38MAPK)-mediated downregulation of the regulator of G protein signaling 4 (RGS4), which suppresses muscarinic signaling of contraction by promoting inactivation/desensitization of Gαq/11 protein, has been suggested to be involved in IL-17A-induced hypercontractility. The opposite effect of L-1β was mediated by IκBζ and c-jun N-terminal kinase (JNK) activation. Conclusions We propose and discuss the possible involvement of IL-17A and its downstream signaling cascade in SMCs in diarrheal hypermotility in various GI disorders. PMID:24796324

  2. A geometric description of human intestine.

    PubMed

    Coşkun, Ihsaniye; Yildiz, Hüseyin; Arslan, Kadri; Yildiz, Bahri

    2007-01-01

    Mathematical models of natural phenomena play a central role in the physical sciences. Moreover, modeling of the organs draws from some beautiful areas of mathematics, such as nonlinear dynamics, multiscale transforms and stability analysis. In this study, a geometric recognition of the separate intestine sections (duodenum, jejunum, ileum, cecum and colon) of the human is presented. The human intestine was considered a tubular shape along a special curve and two male Turkish men were used for the modeling study. The length (cm) and diameter (mm) of the intestines were measured with a digital compass and formulated. These models were compared with their original photographs. It has been concluded that the geometric modeling and experimental work were consistent. These kinds of organ modeling techniques will also profit to medical lecturers to show 3-D figures to their students. PMID:17580658

  3. Icariin Metabolism by Human Intestinal Microflora.

    PubMed

    Wu, Hailong; Kim, Mihyang; Han, Jaehong

    2016-01-01

    Icariin is a major bioactive compound of Epimedii Herba, a traditional oriental medicine exhibiting anti-cancer, anti-inflammatory and anti-osteoporosis activities. Recently, the estrogenic activities of icariin drew significant attention, but the published scientific data seemed not to be so consistent. To provide fundamental information for the study of the icaritin metabolism, the biotransformation of icariin by the human intestinal bacteria is reported for the first time. Together with human intestinal microflora, the three bacteria Streptococcus sp. MRG-ICA-B, Enterococcus sp. MRG-ICA-E, and Blautia sp. MRG-PMF-1 isolated from human intestine were reacted with icariin under anaerobic conditions. The metabolites including icariside II, icaritin, and desmethylicaritin, but not icariside I, were produced. The MRG-ICA-B and E strains hydrolyzed only the glucose moiety of icariin, and icariside II was the only metabolite. However, the MRG-PMF-1 strain metabolized icariin further to desmethylicaritin via icariside II and icaritin. From the results, along with the icariin metabolism by human microflora, it was evident that most icariin is quickly transformed to icariside II before absorption in the human intestine. We propose the pharmacokinetics of icariin should focus on metabolites such as icariside II, icaritin and desmethylicaritin to explain the discrepancy between the in vitro bioassay and pharmacological effects. PMID:27589718

  4. Tipping elements in the human intestinal ecosystem

    PubMed Central

    Lahti, Leo; Salojärvi, Jarkko; Salonen, Anne; Scheffer, Marten; de Vos, Willem M.

    2014-01-01

    The microbial communities living in the human intestine can have profound impact on our well-being and health. However, we have limited understanding of the mechanisms that control this complex ecosystem. Here, based on a deep phylogenetic analysis of the intestinal microbiota in a thousand western adults, we identify groups of bacteria that exhibit robust bistable abundance distributions. These bacteria are either abundant or nearly absent in most individuals, and exhibit decreased temporal stability at the intermediate abundance range. The abundances of these bimodally distributed bacteria vary independently, and their abundance distributions are not affected by short-term dietary interventions. However, their contrasting alternative states are associated with host factors such as ageing and overweight. We propose that the bistable groups reflect tipping elements of the intestinal microbiota, whose critical transitions may have profound health implications and diagnostic potential. PMID:25003530

  5. Sympathetic axonopathies and hyperinnervation in the small intestine smooth muscle of aged Fischer 344 rats

    PubMed Central

    Phillips, Robert J.; Hudson, Cherie N.; Powley, Terry L.

    2013-01-01

    It is well documented that the intrinsic enteric nervous system of the gastrointestinal (GI) tract sustains neuronal losses and reorganizes as it ages. In contrast, age-related remodeling of the extrinsic sympathetic projections to the wall of the gut is poorly characterized. The present experiment, therefore, surveyed the sympathetic projections to the aged small intestine for axonopathies. Furthermore, the experiment evaluated the specific prediction that catecholaminergic inputs undergo hyperplastic changes. Jejunal tissue was collected from 3-, 8-, 16-, and 24-month-old male Fischer 344 rats, prepared as whole mounts consisting of the muscularis, and processed immunohistochemically for tyrosine hydroxylase, the enzymatic marker for norepinephrine, and either the protein CD163 or the protein MHCII, both phenotypical markers for macrophages. Four distinctive sympathetic axonopathy profiles occurred in the small intestine of the aged rat: (1) swollen and dystrophic terminals, (2) tangled axons, (3) discrete hyperinnervated loci in the smooth muscle wall, including at the bases of Peyer's patches, and (4) ectopic hyperplastic or hyperinnervating axons in the serosa/subserosal layers. In many cases, the axonopathies occurred at localized and limited foci, involving only a few axon terminals, in a pattern consistent with incidences of focal ischemic, vascular, or traumatic insult. The present observations underscore the complexity of the processes of aging on the neural circuitry of the gut, with age-related GI functional impairments likely reflecting a constellation of adjustments that range from selective neuronal losses, through accumulation of cellular debris, to hyperplasias and hyperinnervation of sympathetic inputs. PMID:24104187

  6. Effects of trimebutine on cytosolic Ca2+ and force transitions in intestinal smooth muscle.

    PubMed

    Nagasaki, M; Kobayashi, T; Tamaki, H

    1991-04-01

    The effects of trimebutine maleate on cytosolic free Ca2+ and force transitions in the guinea-pig taenia cecum were studied by fura-2 fluorometry and tension recording. The addition of 80 mM K+ induced a transient increase in cytosolic free Ca2+ concentration ([Ca2+]i) and tension, followed by a sustained increase. Trimebutine (10 microM) suppressed both [Ca2+]i elevation and tension development. The tonic responses were more potently inhibited than the phasic responses. Phasic components gradually increased as the added K+ increased (10-40 mM). The relationship between the peak increases in [Ca2+]i and tension was not affected by trimebutine (10 microM). This means that trimebutine does not affect the Ca2+ sensitivity of contractile elements. In a high K+ and Ca(2+)-free medium, carbachol (10 microM) or caffeine (30 mM) caused transient [Ca2+]i elevation and tension development in the smooth muscle. Trimebutine (10 microM) decreased the amplitude of both responses. Trimebutine (10 microM) inhibited the spontaneous fluctuations in [Ca2+]i and motility of taenia cecum in the presence of tetrodotoxin (TTX; 0.3 microM). These results suggest that trimebutine has two types of inhibitory actions on intestinal smooth muscle; one, the inhibition of Ca2+ influx through voltage-dependent calcium channels, and the other, the inhibition of Ca2+ release from intracellular storage sites. PMID:1868878

  7. The Human Intestinal Microbiome: A New Frontier of Human Biology

    PubMed Central

    Hattori, Masahira; Taylor, Todd D.

    2009-01-01

    To analyze the vast number and variety of microorganisms inhabiting the human intestine, emerging metagenomic technologies are extremely powerful. The intestinal microbes are taxonomically complex and constitute an ecologically dynamic community (microbiota) that has long been believed to possess a strong impact on human physiology. Furthermore, they are heavily involved in the maturation and proliferation of human intestinal cells, helping to maintain their homeostasis and can be causative of various diseases, such as inflammatory bowel disease and obesity. A simplified animal model system has provided the mechanistic basis for the molecular interactions that occur at the interface between such microbes and host intestinal epithelia. Through metagenomic analysis, it is now possible to comprehensively explore the genetic nature of the intestinal microbiome, the mutually interacting system comprising the host cells and the residing microbial community. The human microbiome project was recently launched as an international collaborative research effort to further promote this newly developing field and to pave the way to a new frontier of human biology, which will provide new strategies for the maintenance of human health. PMID:19147530

  8. Bioengineering functional human sphincteric and non-sphincteric gastrointestinal smooth muscle constructs.

    PubMed

    Rego, Stephen L; Zakhem, Elie; Orlando, Giuseppe; Bitar, Khalil N

    2016-04-15

    Digestion and motility of luminal content through the gastrointestinal (GI) tract are achieved by cooperation between distinct cell types. Much of the 3 dimensional (3D) in vitro modeling used to study the GI physiology and disease focus solely on epithelial cells and not smooth muscle cells (SMCs). SMCs of the gut function either to propel and mix luminal contents (phasic; non-sphincteric) or to act as barriers to prevent the movement of luminal materials (tonic; sphincteric). Motility disorders including pyloric stenosis and chronic intestinal pseudoobstruction (CIPO) affect sphincteric and non-sphincteric SMCs, respectively. Bioengineering offers a useful tool to develop functional GI tissue mimics that possess similar characteristics to native tissue. The objective of this study was to bioengineer 3D human pyloric sphincter and small intestinal (SI) constructs in vitro that recapitulate the contractile phenotypes of sphincteric and non-sphincteric human GI SMCs. Bioengineered 3D human pylorus and circular SI SMC constructs were developed and displayed a contractile phenotype. Constructs composed of human pylorus SMCs displayed tonic SMC characteristics, including generation of basal tone, at higher levels than SI SMC constructs which is similar to what is seen in native tissue. Both constructs contracted in response to potassium chloride (KCl) and acetylcholine (ACh) and relaxed in response to vasoactive intestinal peptide (VIP). These studies provide the first bioengineered human pylorus constructs that maintain a sphincteric phenotype. These bioengineered constructs provide appropriate models to study motility disorders of the gut or replacement tissues for various GI organs. PMID:26314281

  9. Robust bioengineered 3D functional human intestinal epithelium

    PubMed Central

    Chen, Ying; Lin, Yinan; Davis, Kimberly M.; Wang, Qianrui; Rnjak-Kovacina, Jelena; Li, Chunmei; Isberg, Ralph R.; Kumamoto, Carol A.; Mecsas, Joan; Kaplan, David L.

    2015-01-01

    Intestinal functions are central to human physiology, health and disease. Options to study these functions with direct relevance to the human condition remain severely limited when using conventional cell cultures, microfluidic systems, organoids, animal surrogates or human studies. To replicate in vitro the tissue architecture and microenvironments of native intestine, we developed a 3D porous protein scaffolding system, containing a geometrically-engineered hollow lumen, with adaptability to both large and small intestines. These intestinal tissues demonstrated representative human responses by permitting continuous accumulation of mucous secretions on the epithelial surface, establishing low oxygen tension in the lumen, and interacting with gut-colonizing bacteria. The newly developed 3D intestine model enabled months-long sustained access to these intestinal functions in vitro, readily integrable with a multitude of different organ mimics and will therefore ensure a reliable ex vivo tissue system for studies in a broad context of human intestinal diseases and treatments. PMID:26374193

  10. A functional study on small intestinal smooth muscles in jejunal atresia

    PubMed Central

    Tyagi, Preeti; Mandal, Maloy B.; Gangopadhyay, Ajay N.; Patne, Shashikant C. U.

    2016-01-01

    Aim: The present study was aimed to assess the contractile status of neonatal small intestinal smooth muscle of dilated pre-atretic part of intestinal atresia to resolve debatable issues related to mechanisms of persistent dysmotility after surgical repair. Materials and Methods: A total of 34 longitudinally sectioned strips were prepared from pre-atretic dilated part of freshly excised 8 jejunal atresia type III a cases. Spontaneous as well as acetylcholine- and histamine-induced contractions were recorded in vitro by using organ bath preparations. Chemically evoked contractions were further evaluated after application of atropine (muscarinic blocker), pheniramine (H1 blocker), and lignocaine (neuronal blocker) to ascertain receptors and neuronal involvement. Histological examinations of strips were made by using Masson trichrome stain to assess the fibrotic changes. Results: All 34 strips, except four showed spontaneous contractions with mean frequency and amplitude of 5.49 ± 0.26/min and 24.41 ± 5.26 g/g wet tissue respectively. The response to ACh was nearly twice as compared to histamine for equimolar concentrations (100 μM). ACh (100 μM) induced contractions were attenuated (by 60%) by atropine. Histamine (100 μM)-induced contractions was blocked by pheniramine (0.32 μM) and lignocaine (4 μM) by 74% and 78%, respectively. Histopathological examination showed varying degree of fibrotic changes in muscle layers. Conclusions: Pre-atretic dilated part of jejunal atresia retains functional activity but with definitive histopathologic abnormalities. It is suggested that excision of a length of pre-atretic part and early stimulation of peristalsis by locally acting cholinomimetic or H1 agonist may help in reducing postoperative motility problems in atresia patients. PMID:26862290

  11. Intestinal drug solubility estimation based on simulated intestinal fluids: comparison with solubility in human intestinal fluids.

    PubMed

    Clarysse, Sarah; Brouwers, Joachim; Tack, Jan; Annaert, Pieter; Augustijns, Patrick

    2011-07-17

    The purpose of this study was to validate both existing fasted and fed state simulated intestinal fluids (FaSSIF and FeSSIF), and simpler, alternative media for predicting intraluminal drug solubility during drug discovery and early drug development. For 17 model drugs, the solubilizing capacity of FaSSIF(c) and FeSSIF(c) (subscript indicates the use of crude taurocholate) and different concentrations of D-α-tocopheryl polyethylene glycol 1000 succinate (TPGS) in phosphate buffer were correlated with the solubilizing capacity of human intestinal fluids (HIF) in the fasted and the early postprandial state. A good correlation between solubility in fasted HIF and FaSSIF(c) and between solubility in fed HIF and FeSSIF(c) was obtained, indicated by R(2) values of 0.91 and 0.86, respectively. Comparable values were obtained for 0.1% TPGS for the fasted state (R(2)=0.84) and 2% TPGS for the fed state (R(2)=0.84). Direct estimation of intestinal drug solubility by the measured solubilities in FaSSIF(c) and FeSSIF(c) was acceptable. However, better estimates were obtained by calculating solubilities based on the equations describing the relationship between solubilities in FaSSIF(c) and FeSSIF(c) as function of observed solubilities in HIF. Using this approach, the predictive value of the TPGS-based solvent system was also acceptable and comparable to that of FaSSIF(c) and FeSSIF(c). In conclusion, FaSSIF(c) and FeSSIF(c) can be considered biorelevant media for intestinal solubility estimation. A simpler TPGS-based system may be a valuable alternative with improved stability and lower cost. PMID:21570465

  12. Human intestinal microbial metabolism of naringin.

    PubMed

    Zou, Wei; Luo, Yulong; Liu, Menghua; Chen, Si; Wang, Sheng; Nie, Yichu; Cheng, Guohua; Su, Weiwei; Zhang, Kejian

    2015-09-01

    Naringin, a major flavonoid in citrus fruits, has been proved to be a promising antitussive candidate. It undertakes complicated metabolism. In this study, human intestinal microbial metabolism of naringin was studied in vitro. Six persons' fecal water, which have intestinal microbial enzyme, were used in the first experiment. Naringin was metabolized by fecal water into naringenin. Subsequently, 3-(4-hydroxyphenyl)propionic acid (4-HPPA) was produced with naringenin degradation by a person's fecal water. However, 4-HPPA was not detected after naringenin degradation by the other 5 subjects' fecal water and the reason might be that the degrading velocity of 4-HPPA exceeded the producing velocity. To confirm the difference in degrading 4-HPPA among human feces, 22 healthy persons' feces were used for incubation. In this second experiment, 15 persons' feces could degrade 4-HPPA, but the other 7 subjects' could not. Human feces showed different ability of degrading 4-HPPA, and there are no gender differences. These results may be helpful for explaining findings in pharmacological and toxicological studies and are groundwork for clinical studies. PMID:24935725

  13. Inhibitory action of relaxin on human cervical smooth muscle.

    PubMed

    Norström, A; Bryman, I; Wiqvist, N; Sahni, S; Lindblom, B

    1984-09-01

    The influence of purified porcine relaxin on contractility of human cervical smooth muscle was investigated in vitro. Strips of cervical tissue were obtained by needle biopsy from pregnant and nonpregnant women and were mounted in a superfused organ chamber for isometric measurement of contractile activity. Relaxin (0.005-25 micrograms/ml) inhibited the spontaneous contractions in cervical strips from 18% of nonpregnant, 68% of early pregnant, and in 100% of term pregnant women. These results indicate that relaxin has an inhibitory action on cervical smooth muscle and that this effect is more constantly detected as pregnancy proceeds. PMID:6746858

  14. Human vascular smooth muscle cells express a urate transporter.

    PubMed

    Price, Karen L; Sautin, Yuri Y; Long, David A; Zhang, Li; Miyazaki, Hiroki; Mu, Wei; Endou, Hitoshi; Johnson, Richard J

    2006-07-01

    An elevated serum uric acid is associated with the development of hypertension and renal disease. Renal regulation of urate excretion is largely controlled by URAT1 (SLC22A12), a member of the organic anion transporter superfamily. This study reports the specific expression of URAT1 on human aortic vascular smooth muscle cells, as assessed by reverse transcription-PCR and Western blot analysis. Expression of URAT1 was localized to the cell membrane. Evidence that the URAT1 transporter was functional was provided by the finding that uptake of 14C-urate was significantly inhibited in the presence of probenecid, an organic anion transporter inhibitor. It is proposed that URAT1 may provide a mechanism by which uric acid enters the human vascular smooth muscle cell, a finding that may be relevant to the role of uric acid in cardiovascular disease. PMID:16775029

  15. A new approach to predict human intestinal absorption using porcine intestinal tissue and biorelevant matrices.

    PubMed

    Westerhout, Joost; van de Steeg, Evita; Grossouw, Dimitri; Zeijdner, Evelijn E; Krul, Cyrille A M; Verwei, Miriam; Wortelboer, Heleen M

    2014-10-15

    A reliable prediction of the oral bioavailability in humans is crucial and of high interest for pharmaceutical and food industry. The predictive value of currently used in silico methods, in vitro cell lines, ex vivo intestinal tissue and/or in vivo animal studies for human intestinal absorption, however, is often insufficient, especially when food-drug interactions are evaluated. Ideally, for this purpose healthy human intestinal tissue is used, but due to its limited availability there is a need for alternatives. The aim of this study was to evaluate the applicability of healthy porcine intestinal tissue mounted in a newly developed InTESTine™ system to predict human intestinal absorption of compounds with different chemical characteristics, and within biorelevant matrices. To that end, first, a representative set of compounds was chosen of which the apparent permeability (Papp) data in both Caco-2 cells and human intestinal tissue mounted in the Ussing chamber system, and absolute human oral bioavailability were reported. Thereafter, Papp values of the subset were determined in both porcine jejunal tissue and our own Caco-2 cells. In addition, the feasibility of this new approach to study regional differences (duodenum, jejunum, and ileum) in permeability of compounds and to study the effects of luminal factors on permeability was also investigated. For the latter, a comparison was made between the compatibility of porcine intestinal tissue, Caco-2 cells, and Caco-2 cells co-cultured with the mucin producing HT29-MTX cells with biorelevant samples as collected from an in vitro dynamic gastrointestinal model (TIM). The results demonstrated that for the paracellularly transported compounds atenolol, cimetidine, mannitol and ranitidine porcine Papp values are within 3-fold difference of human Papp values, whereas the Caco-2 Papp values are beyond 3-fold difference. Overall, the porcine intestinal tissue Papp values are more comparable to human Papp values (9 out

  16. Generation of tissue-engineered small intestine using embryonic stem cell-derived human intestinal organoids

    PubMed Central

    Finkbeiner, Stacy R.; Freeman, Jennifer J.; Wieck, Minna M.; El-Nachef, Wael; Altheim, Christopher H.; Tsai, Yu-Hwai; Huang, Sha; Dyal, Rachel; White, Eric S.; Grikscheit, Tracy C.; Teitelbaum, Daniel H.; Spence, Jason R.

    2015-01-01

    ABSTRACT Short bowel syndrome (SBS) is characterized by poor nutrient absorption due to a deficit of healthy intestine. Current treatment practices rely on providing supportive medical therapy with parenteral nutrition; while life saving, such interventions are not curative and are still associated with significant co-morbidities. As approaches to lengthen remaining intestinal tissue have been met with only limited success and intestinal transplants have poor survival outcomes, new approaches to treating SBS are necessary. Human intestine derived from embryonic stem cells (hESCs) or induced pluripotent stem cells (iPSCs), called human intestinal organoids (HIOs), have the potential to offer a personalized and scalable source of intestine for regenerative therapies. However, given that HIOs are small three-dimensional structures grown in vitro, methods to generate usable HIO-derived constructs are needed. We investigated the ability of hESCs or HIOs to populate acellular porcine intestinal matrices and artificial polyglycolic/poly L lactic acid (PGA/PLLA) scaffolds, and examined the ability of matrix/scaffolds to thrive when transplanted in vivo. Our results demonstrate that the acellular matrix alone is not sufficient to instruct hESC differentiation towards an endodermal or intestinal fate. We observed that while HIOs reseed acellular porcine matrices in vitro, the HIO-reseeded matrices do not thrive when transplanted in vivo. In contrast, HIO-seeded PGA/PLLA scaffolds thrive in vivo and develop into tissue that looks nearly identical to adult human intestinal tissue. Our results suggest that HIO-seeded PGA/PLLA scaffolds are a promising avenue for developing the mucosal component of tissue engineered human small intestine, which need to be explored further to develop them into fully functional tissue. PMID:26459240

  17. Generation of tissue-engineered small intestine using embryonic stem cell-derived human intestinal organoids.

    PubMed

    Finkbeiner, Stacy R; Freeman, Jennifer J; Wieck, Minna M; El-Nachef, Wael; Altheim, Christopher H; Tsai, Yu-Hwai; Huang, Sha; Dyal, Rachel; White, Eric S; Grikscheit, Tracy C; Teitelbaum, Daniel H; Spence, Jason R

    2015-01-01

    Short bowel syndrome (SBS) is characterized by poor nutrient absorption due to a deficit of healthy intestine. Current treatment practices rely on providing supportive medical therapy with parenteral nutrition; while life saving, such interventions are not curative and are still associated with significant co-morbidities. As approaches to lengthen remaining intestinal tissue have been met with only limited success and intestinal transplants have poor survival outcomes, new approaches to treating SBS are necessary. Human intestine derived from embryonic stem cells (hESCs) or induced pluripotent stem cells (iPSCs), called human intestinal organoids (HIOs), have the potential to offer a personalized and scalable source of intestine for regenerative therapies. However, given that HIOs are small three-dimensional structures grown in vitro, methods to generate usable HIO-derived constructs are needed. We investigated the ability of hESCs or HIOs to populate acellular porcine intestinal matrices and artificial polyglycolic/poly L lactic acid (PGA/PLLA) scaffolds, and examined the ability of matrix/scaffolds to thrive when transplanted in vivo. Our results demonstrate that the acellular matrix alone is not sufficient to instruct hESC differentiation towards an endodermal or intestinal fate. We observed that while HIOs reseed acellular porcine matrices in vitro, the HIO-reseeded matrices do not thrive when transplanted in vivo. In contrast, HIO-seeded PGA/PLLA scaffolds thrive in vivo and develop into tissue that looks nearly identical to adult human intestinal tissue. Our results suggest that HIO-seeded PGA/PLLA scaffolds are a promising avenue for developing the mucosal component of tissue engineered human small intestine, which need to be explored further to develop them into fully functional tissue. PMID:26459240

  18. A Revised Model for Dosimetry in the Human Small Intestine

    SciTech Connect

    John Poston; Nasir U. Bhuiyan; R. Alex Redd; Neil Parham; Jennifer Watson

    2005-02-28

    A new model for an adult human gastrointestinal tract (GIT) has been developed for use in internal dose estimations to the wall of the GIT and to the other organs and tissues of the body from radionuclides deposited in the lumenal contents of the five sections of the GIT. These sections were the esophasgus, stomach, small intestine, upper large intestine, and the lower large intestine. The wall of each section was separated from its lumenal contents.

  19. Grafts of porcine small intestinal submucosa seeded with cultured homologous smooth muscle cells for bladder repair in dogs

    PubMed Central

    2013-01-01

    Background Due to numerous complications associated to gastrointestinal augmented cystoplasty, this study aimed to analyze the anatomic repair of the bladder of 10 female dogs using grafts of porcine small intestinal submucosa (SIS) seeded with cultured homologous smooth muscle cells, and compare them with the acellular SIS grafts. Results We assessed the possible side effects and complications of each type of graft by clinical examination, abdominal ultrasound and laboratory findings. Anatomic repair of neoformed bladder was assessed by histological staining for H/E and Masson's Trichrome, analyzed with a Nikon Photomicroscope connected to the system of image analysis Image J. Conclusions We propose that SIS associated to homologous smooth cells can improve the quality of tissue repair, and consequently decrease the potential complications inherent to acellular SIS. PMID:23651843

  20. Intestinal fructose transport and malabsorption in humans.

    PubMed

    Jones, Hilary F; Butler, Ross N; Brooks, Doug A

    2011-02-01

    Fructose is a hexose sugar that is being increasingly consumed in its monosaccharide form. Patients who exhibit fructose malabsorption can present with gastrointestinal symptoms that include chronic diarrhea and abdominal pain. However, with no clearly established gastrointestinal mechanism for fructose malabsorption, patient analysis by the proxy of a breath hydrogen test (BHT) is controversial. The major transporter for fructose in intestinal epithelial cells is thought to be the facilitative transporter GLUT5. Consistent with a facilitative transport system, we show here by analysis of past studies on healthy adults that there is a significant relationship between fructose malabsorption and fructose dose (r = 0.86, P < 0.001). Thus there is a dose-dependent and limited absorption capacity even in healthy individuals. Changes in fructose malabsorption with age have been observed in human infants, and this may parallel the developmental regulation of GLUT5 expression. Moreover, a GLUT5 knockout mouse has displayed the hallmarks associated with profound fructose malabsorption. Fructose malabsorption appears to be partially modulated by the amount of glucose ingested. Although solvent drag and passive diffusion have been proposed to explain the effect of glucose on fructose malabsorption, this could possibly be a result of the facilitative transporter GLUT2. GLUT5 and GLUT2 mRNA have been shown to be rapidly upregulated by the presence of fructose and GLUT2 mRNA is also upregulated by glucose, but in humans the distribution and role of GLUT2 in the brush border membrane are yet to be definitively decided. Understanding the relative roles of these transporters in humans will be crucial for establishing a mechanistic basis for fructose malabsorption in gastrointestinal patients. PMID:21148401

  1. Transdifferentiation of human endothelial progenitors into smooth muscle cells.

    PubMed

    Ji, HaYeun; Atchison, Leigh; Chen, Zaozao; Chakraborty, Syandan; Jung, Youngmee; Truskey, George A; Christoforou, Nicolas; Leong, Kam W

    2016-04-01

    Access to smooth muscle cells (SMC) would create opportunities for tissue engineering, drug testing, and disease modeling. Herein we report the direct conversion of human endothelial progenitor cells (EPC) to induced smooth muscle cells (iSMC) by induced expression of MYOCD. The EPC undergo a cytoskeletal rearrangement resembling that of mesenchymal cells within 3 days post initiation of MYOCD expression. By day 7, the reprogrammed cells show upregulation of smooth muscle markers ACTA2, MYH11, and TAGLN by qRT-PCR and ACTA2 and MYH11 expression by immunofluorescence. By two weeks, they resemble umbilical artery SMC in microarray gene expression analysis. The iSMC, in contrast to EPC control, show calcium transients in response to phenylephrine stimulation and a contractility an order of magnitude higher than that of EPC as determined by traction force microscopy. Tissue-engineered blood vessels constructed using iSMC show functionality with respect to flow- and drug-mediated vasodilation and vasoconstriction. PMID:26874281

  2. Calcium oscillations in human mesenteric vascular smooth muscle.

    PubMed

    Navarro-Dorado, Jorge; Garcia-Alonso, Mauricio; van Breemen, Cornelis; Tejerina, Teresa; Fameli, Nicola

    2014-02-28

    Phenylephrine (PE)-induced oscillatory fluctuations in intracellular Ca(2+) concentration ([Ca(2+)]i) of vascular smooth muscle have been observed in many blood vessels isolated from a wide variety of mammals. Paradoxically, until recently similar observations in humans have proven elusive. In this study, we report for the first time observations of adrenergically-stimulated [Ca(2+)]i oscillations in human mesenteric artery smooth muscle. In arterial segments preloaded with Fluo-4 AM and mounted on a myograph on the stage of a confocal microscope, we observed PE-induced oscillations in [Ca(2+)]i, which initiated and maintained vasoconstriction. These oscillations present some variability, possibly due to compromised health of the tissue. This view is corroborated by our ultrastructural analysis of the cells, in which we found only (5 ± 2)% plasma membrane-sarcoplasmic reticulum apposition, markedly less than measured in healthy tissue from laboratory animals. We also partially characterized the oscillations by using the inhibitory drugs 2-aminoethoxydiphenyl borate (2-APB), cyclopiazonic acid (CPA) and nifedipine. After PE contraction, all drugs provoked relaxation of the vessel segments, sometimes only partial, and reduced or inhibited oscillations, except CPA, which rarely caused relaxation. These preliminary results point to a potential involvement of the sarcoplasmic reticulum Ca(2+) and inositol 1,4,5-trisphosphate receptor (IP3R) in the maintenance of the Ca(2+) oscillations observed in human blood vessels. PMID:24508261

  3. Endothelin ETA receptor expression in human cerebrovascular smooth muscle cells.

    PubMed Central

    Yu, J. C.; Pickard, J. D.; Davenport, A. P.

    1995-01-01

    1. Endothelin (ET) has been implicated in cerebrovasospasm for example, following subarachnoid haemorrhage, and blocking the interaction of ET with its receptors on cerebral vessels, may be of therapeutic benefit. The aim of our study was to characterize endothelin receptor sub-types on medial smooth muscle cells of human cerebral vessels. Cultures of vascular smooth muscle cells were explanted from human cerebral resistance vessels and characterized as human brain smooth muscle cells (HBSMCs). 2. Over a 48 h incubation period, HBSMC cultures secreted comparable levels of immunoreactive (IR) big endothelin-1 (big ET-1) and IR endothelin (ET): 12.7 +/- 10.3 and 8.3 +/- 5.6 pmol/10(6) cells, respectively (mean +/- s.e. mean from three different individuals), into the culture medium. 3. Total RNA was extracted from cultures of human brain smooth muscle cells. Reverse-transcriptase polymerase chain reaction (RI-PCR) assays and subsequent product separation by agarose gel electrophoresis revealed single bands corresponding to the expected product sizes encoding cDNA for ETA (299 base pairs) and ETB (428 base pairs) (n = 3 different cultures). 4. Autoradiography demonstrated the presence of specific binding sites for [125I]-ET-1 which labels all ET receptors, and [125I]-PD151242, an ETA subtype-selective antagonist which exclusively labels ETA receptors, but no specific-binding was detected using ETB subtype-selective [125I]-BQ3020 (n = 3 different cultures, in duplicate). 5. In saturation binding assays, [123I]-ET-1 bound with high affinity: KD = 0.8 +/- 0.1 nM and Bmax = 690 +/- 108 fmol mg-1. A one-site fit was preferred and Hill slopes were close to unity over the concentration range (10(-12) to 10(-8) M). [125I]-PD151242 also bound with similar affinity: KD = 0.4 +/- 0.1 nM and Bmax = 388 +/- 68 fmol mg-1 (mean +/- s.e. mean, n = 3 different cultures). Again, a one-site fit was preferred and Hill slopes were close to unity over the concentration range. Unlabelled PD

  4. Three-Dimensional Coculture Of Human Small-Intestine Cells

    NASA Technical Reports Server (NTRS)

    Wolf, David; Spaulding, Glen; Goodwin, Thomas J.; Prewett, Tracy

    1994-01-01

    Complex three-dimensional masses of normal human epithelial and mesenchymal small-intestine cells cocultured in process involving specially designed bioreactors. Useful as tissued models for studies of growth, regulatory, and differentiation processes in normal intestinal tissues; diseases of small intestine; and interactions between cells of small intestine and viruses causing disease both in small intestine and elsewhere in body. Process used to produce other tissue models, leading to advances in understanding of growth and differentiation in developing organisms, of renewal of tissue, and of treatment of myriad of clinical conditions. Prior articles describing design and use of rotating-wall culture vessels include "Growing And Assembling Cells Into Tissues" (MSC-21559), "High-Aspect-Ratio Rotating Cell-Culture Vessel" (MSC-21662), and "In Vitro, Matrix-Free Formation Of Solid Tumor Spheroids" (MSC-21843).

  5. Distinct Human Stem Cell Populations in Small and Large Intestine

    PubMed Central

    Cramer, Julie M.; Thompson, Timothy; Geskin, Albert; LaFramboise, William; Lagasse, Eric

    2015-01-01

    The intestine is composed of an epithelial layer containing rapidly proliferating cells that mature into two regions, the small and the large intestine. Although previous studies have identified stem cells as the cell-of-origin for intestinal epithelial cells, no studies have directly compared stem cells derived from these anatomically distinct regions. Here, we examine intrinsic differences between primary epithelial cells isolated from human fetal small and large intestine, after in vitro expansion, using the Wnt agonist R-spondin 2. We utilized flow cytometry, fluorescence-activated cell sorting, gene expression analysis and a three-dimensional in vitro differentiation assay to characterize their stem cell properties. We identified stem cell markers that separate subpopulations of colony-forming cells in the small and large intestine and revealed important differences in differentiation, proliferation and disease pathways using gene expression analysis. Single cells from small and large intestine cultures formed organoids that reflect the distinct cellular hierarchy found in vivo and respond differently to identical exogenous cues. Our characterization identified numerous differences between small and large intestine epithelial stem cells suggesting possible connections to intestinal disease. PMID:25751518

  6. Neurophysiology and Neuroanatomy of Smooth Pursuit in Humans

    ERIC Educational Resources Information Center

    Lencer, Rebekka; Trillenberg, Peter

    2008-01-01

    Smooth pursuit eye movements enable us to focus our eyes on moving objects by utilizing well-established mechanisms of visual motion processing, sensorimotor transformation and cognition. Novel smooth pursuit tasks and quantitative measurement techniques can help unravel the different smooth pursuit components and complex neural systems involved…

  7. Reaction of human smooth muscle antibody with thyroid cells

    PubMed Central

    Biberfeld, Gunnel; Fagraeus, Astrid; Lenkei, Rodica

    1974-01-01

    Sera from cases of active chronic hepatitis or acute hepatitis containing smooth muscle antibodies reacted by immunofluorescence with the membrane region of sectioned thyroid cells from thyrotoxic glands. With non-toxic glands the reaction was negative or weak. The prerequisite for a positive reaction was that the complement of the sera had been heat-inactivated. Absorption with smooth muscle antigen abolished the reaction of smooth muscle antibody positive sera with thyroid cells. Some smooth muscle antibody negative sera from cases with disorders other than liver disease were found to give a similar immunofluorescence staining of the membrane region of sectioned thyroid cells, but these antibodies were not absorbed with smooth muscle antigen. Culture of thyroid cells was found to increase the number of cells reacting with smooth muscle antibody. In contrast, the thyroid cell antigen reacting with smooth muscle antibody negative sera was lost during culture. PMID:4619977

  8. Human intestinal sarcosporidiosis: report of six cases.

    PubMed

    Bunyaratvej, S; Bunyawongwiroj, P; Nitiyanant, P

    1982-01-01

    Specimens of resected small intestine from six patients aged 3 to 70 years with acute enteritis contained sexual forms of sarcosporidia. Histopathologically, the diagnoses were either segmental eosinophilic enteritis or segmental necrotizing enteritis. The presence of sarcosporidia in market beef (Bos indicus), and the patients' habit of eating the beef uncooked in the form of chili-hot dishes, suggest that the species is an ox-man parasite similar to Sarcocystis hominis (Railliet and Lucet, 1891) Dubey, 1976. Presence of numerous Gram-positive bacilli in segmental necrotizing enteritis suggests an interplay between two etiological agents in producing the hosts' inflammatory responses. Five patients recovered after resection, but one died due to extensive necrosis of the intestinal wall and leakage at the site of anastomosis. Only conventional antibiotics were given after the operations. None of the five surviving patients has had recurrent enteritis for at least 1 year. PMID:6800273

  9. Bioengineered Human Pyloric Sphincters Using Autologous Smooth Muscle and Neural Progenitor Cells.

    PubMed

    Rego, Stephen Lee; Zakhem, Elie; Orlando, Giuseppe; Bitar, Khalil N

    2016-01-01

    Gastroparesis leads to inadequate emptying of the stomach resulting in severe negative health impacts. Appropriate long-term treatments for these diseases may require pyloric sphincter tissue replacements that possess functional smooth muscle cell (SMC) and neural components. This study aims to bioengineer, for the first time, innervated human pylorus constructs utilizing autologous human pyloric sphincter SMCs and human neural progenitor cells (NPCs). Autologous SMCs and NPCs were cocultured in dual-layered hydrogels and formed concentrically aligned pylorus constructs. Innervated autologous human pylorus constructs were characterized through biochemical and physiologic assays to assess the phenotype and functionality of SMCs and neurons. SMCs within bioengineered human pylorus constructs displayed a tonic contractile phenotype and maintained circumferential alignment. Neural differentiation within bioengineered constructs was verified by positive expression of βIII-tubulin, neuronal nitric oxide synthase (nNOS), and choline acetyltransferase (ChAT). Autologous bioengineered innervated human pylorus constructs generated a robust spontaneous basal tone and contracted in response to potassium chloride (KCl). Contraction in response to exogenous neurotransmitter acetylcholine (ACh), relaxation in response to vasoactive intestinal peptide (VIP), and electrical field stimulation (EFS) were also observed. Neural network integrity was demonstrated by inhibition of EFS-induced relaxation in the presence of a neurotoxin or nNOS inhibitors. Partial inhibition of ACh-induced contraction and VIP-induced relaxation following neurotoxin treatment was observed. These studies provide a proof of concept for bioengineering functional innervated autologous human pyloric sphincter constructs that generate a robust basal tone and contain circumferentially aligned SMCs, which display a tonic contractile phenotype and functional differentiated neurons. These autologous constructs have

  10. Intestine.

    PubMed

    Smith, J M; Skeans, M A; Horslen, S P; Edwards, E B; Harper, A M; Snyder, J J; Israni, A K; Kasiske, B L

    2016-01-01

    Intestine and intestine-liver transplant plays an important role in the treatment of intestinal failure, despite decreased morbidity associated with parenteral nutrition. In 2014, 210 new patients were added to the intestine transplant waiting list. Among prevalent patients on the list at the end of 2014, 65% were waiting for an intestine transplant and 35% were waiting for an intestine-liver transplant. The pretransplant mortality rate decreased dramatically over time for all age groups. Pretransplant mortality was highest for adult candidates, at 22.1 per 100 waitlist years compared with less than 3 per 100 waitlist years for pediatric candidates, and notably higher for candidates for intestine-liver transplant than for candidates for intestine transplant without a liver. Numbers of intestine transplants without a liver increased from a low of 51 in 2013 to 67 in 2014. Intestine-liver transplants increased from a low of 44 in 2012 to 72 in 2014. Short-gut syndrome (congenital and other) was the main cause of disease leading to both intestine and intestine-liver transplant. Graft survival improved over the past decade. Patient survival was lowest for adult intestine-liver recipients and highest for pediatric intestine recipients. PMID:26755265

  11. Human colonic smooth muscle: electrical and contractile activity in vitro.

    PubMed Central

    Gill, R C; Cote, K R; Bowes, K L; Kingma, Y J

    1986-01-01

    Extracellular electrical and contractile activities were recorded in vitro from strips of human colonic smooth muscle obtained at the time of surgery. Serosal electrical activity of longitudinally oriented strips from the taenia and intertaenial region was characterised by continuous oscillation at a frequency of 28 +/- 1/min. Contractions were marked electrically by a series of oscillations upon which spikes were superimposed. The electrical activity recorded from the submucosal surface of circularly oriented strips exhibited oscillations at 24 +/- 4/min, a frequency significantly lower (p less than 0.001) than that recorded from the serosal surface of similar preparations. The contractile force and frequency was dependent upon the part of the colon from which the strip originated; the most powerful contractions were recorded from strips of sigmoid colon. The contractile frequency of circularly oriented strips from the right colon was 6.3 +/- 0.6/min, significantly higher (p less than 0.001) than that of strips from the left colon (3.4 +/- 0.3/min). Stretching these strips caused an increase in contractile frequency to that of the electrical oscillation. PMID:3699550

  12. Transepithelial Transport of PAMAM Dendrimers Across Isolated Human Intestinal Tissue.

    PubMed

    Hubbard, Dallin; Enda, Michael; Bond, Tanner; Moghaddam, Seyyed Pouya Hadipour; Conarton, Josh; Scaife, Courtney; Volckmann, Eric; Ghandehari, Hamidreza

    2015-11-01

    Poly(amido amine) (PAMAM) dendrimers have shown transepithelial transport across intestinal epithelial barrier in rats and across Caco-2 cell monolayers. Caco-2 models innately lack mucous barriers, and rat isolated intestinal tissue has been shown to overestimate human permeability. This study is the first report of transport of PAMAM dendrimers across isolated human intestinal epithelium. It was observed that FITC labeled G4-NH2 and G3.5-COOH PAMAM dendrimers at 1 mM concentration do not have a statistically higher permeability compared to free FITC controls in isolated human jejunum and colonic tissues. Mannitol permeability was increased at 10 mM concentrations of G3.5-COOH and G4-NH2 dendrimers. Significant histological changes in human colonic and jejunal tissues were observed at G3.5-COOH and G4-NH2 concentrations of 10 mM implying that dose limiting toxicity may occur at similar concentrations in vivo. The permeability through human isolated intestinal tissue in this study was compared to previous rat and Caco-2 permeability data. This study implicates that PAMAM dendrimer oral drug delivery may be feasible, but it may be limited to highly potent drugs. PMID:26414679

  13. Reprogramming of the human intestinal epigenome by surgical tissue transposition

    PubMed Central

    Lay, Fides D.; Triche, Timothy J.; Tsai, Yvonne C.; Su, Sheng-Fang; Martin, Sue Ellen; Daneshmand, Siamak; Skinner, Eila C.; Liang, Gangning; Chihara, Yoshitomo; Jones, Peter A.

    2014-01-01

    Extracellular cues play critical roles in the establishment of the epigenome during development and may also contribute to epigenetic perturbations found in disease states. The direct role of the local tissue environment on the post-development human epigenome, however, remains unclear due to limitations in studies of human subjects. Here, we use an isogenic human ileal neobladder surgical model and compare global DNA methylation levels of intestinal epithelial cells pre- and post-neobladder construction using the Infinium HumanMethylation450 BeadChip. Our study is the first to quantify the effect of environmental cues on the human epigenome and show that the local tissue environment directly modulates DNA methylation patterns in normal differentiated cells in vivo. In the neobladder, the intestinal epithelial cells lose their tissue-specific epigenetic landscape in a time-dependent manner following the tissue’s exposure to a bladder environment. We find that de novo methylation of many intestine-specific enhancers occurs at the rate of 0.41% per month (P < 0.01, Pearson = 0.71), while demethylation of primarily non-intestine-specific transcribed regions occurs at the rate of −0.37% per month (P < 0.01, Pearson = −0.57). The dynamic resetting of the DNA methylome in the neobladder not only implicates local environmental cues in the shaping and maintenance of the epigenome but also illustrates an unexpected cross-talk between the epigenome and the cellular environment. PMID:24515120

  14. Intestinal-fatty acid binding protein and lipid transport in human intestinal epithelial cells

    SciTech Connect

    Montoudis, Alain; Delvin, Edgard; Menard, Daniel

    2006-01-06

    Intestinal-fatty acid binding protein (I-FABP) is a 14-15 kDa cytoplasmic molecule highly expressed in the enterocyte. Although different functions have been proposed for various FABP family members, the specific function of I-FABP in human intestine remains unclear. Here, we studied the role of I-FABP in molecularly modified normal human intestinal epithelial cells (HIEC-6). cDNA transfection resulted in 90-fold I-FABP overexpression compared to cells treated with empty pQCXIP vector. The high-resolution immunogold technique revealed labeling mainly in the cytosol and confirmed the marked phenotype abundance of I-FABP in cDNA transfected cells. I-FABP overexpression was not associated with alterations in cell proliferation and viability. Studies using these transfected cells cultured with [{sup 14}C]oleic acid did not reveal higher efficiency in de novo synthesis or secretion of triglycerides, phospholipids, and cholesteryl esters compared to cells treated with empty pQCXIP vector only. Similarly, the incubation with [{sup 35}S]methionine did not disclose a superiority in the biogenesis of apolipoproteins (apo) A-I, A-IV, B-48, and B-100. Finally, cells transfected with I-FABP did not exhibit an increased production of chylomicrons, VLDL, LDL, and HDL. Our observations establish that I-FABP overexpression in normal HIEC-6 is not related to cell proliferation, lipid esterification, apo synthesis, and lipoprotein assembly, and, therefore, exclude its role in intestinal fat transport.

  15. Quantitation of small intestinal permeability during normal human drug absorption

    PubMed Central

    2013-01-01

    Background Understanding the quantitative relationship between a drug’s physical chemical properties and its rate of intestinal absorption (QSAR) is critical for selecting candidate drugs. Because of limited experimental human small intestinal permeability data, approximate surrogates such as the fraction absorbed or Caco-2 permeability are used, both of which have limitations. Methods Given the blood concentration following an oral and intravenous dose, the time course of intestinal absorption in humans was determined by deconvolution and related to the intestinal permeability by the use of a new 3 parameter model function (“Averaged Model” (AM)). The theoretical validity of this AM model was evaluated by comparing it to the standard diffusion-convection model (DC). This analysis was applied to 90 drugs using previously published data. Only drugs that were administered in oral solution form to fasting subjects were considered so that the rate of gastric emptying was approximately known. All the calculations are carried out using the freely available routine PKQuest Java (http://www.pkquest.com) which has an easy to use, simple interface. Results Theoretically, the AM permeability provides an accurate estimate of the intestinal DC permeability for solutes whose absorption ranges from 1% to 99%. The experimental human AM permeabilities determined by deconvolution are similar to those determined by direct human jejunal perfusion. The small intestinal pH varies with position and the results are interpreted in terms of the pH dependent octanol partition. The permeability versus partition relations are presented separately for the uncharged, basic, acidic and charged solutes. The small uncharged solutes caffeine, acetaminophen and antipyrine have very high permeabilities (about 20 x 10-4 cm/sec) corresponding to an unstirred layer of only 45 μm. The weak acid aspirin also has a large AM permeability despite its low octanol partition at pH 7.4, suggesting

  16. Heterozygous De Novo and Inherited Mutations in the Smooth Muscle Actin (ACTG2) Gene Underlie Megacystis-Microcolon-Intestinal Hypoperistalsis Syndrome

    PubMed Central

    Wangler, Michael F.; Gonzaga-Jauregui, Claudia; Gambin, Tomasz; Penney, Samantha; Moss, Timothy; Chopra, Atul; Probst, Frank J.; Xia, Fan; Yang, Yaping; Werlin, Steven; Eglite, Ieva; Kornejeva, Liene; Bacino, Carlos A.; Baldridge, Dustin; Neul, Jeff; Lehman, Efrat Lev; Larson, Austin; Beuten, Joke; Muzny, Donna M.; Jhangiani, Shalini; Gibbs, Richard A.; Lupski, James R.; Beaudet, Arthur

    2014-01-01

    Megacystis-microcolon-intestinal hypoperistalsis syndrome (MMIHS) is a rare disorder of enteric smooth muscle function affecting the intestine and bladder. Patients with this severe phenotype are dependent on total parenteral nutrition and urinary catheterization. The cause of this syndrome has remained a mystery since Berdon's initial description in 1976. No genes have been clearly linked to MMIHS. We used whole-exome sequencing for gene discovery followed by targeted Sanger sequencing in a cohort of patients with MMIHS and intestinal pseudo-obstruction. We identified heterozygous ACTG2 missense variants in 15 unrelated subjects, ten being apparent de novo mutations. Ten unique variants were detected, of which six affected CpG dinucleotides and resulted in missense mutations at arginine residues, perhaps related to biased usage of CpG containing codons within actin genes. We also found some of the same heterozygous mutations that we observed as apparent de novo mutations in MMIHS segregating in families with intestinal pseudo-obstruction, suggesting that ACTG2 is responsible for a spectrum of smooth muscle disease. ACTG2 encodes γ2 enteric actin and is the first gene to be clearly associated with MMIHS, suggesting an important role for contractile proteins in enteric smooth muscle disease. PMID:24676022

  17. Heterozygous de novo and inherited mutations in the smooth muscle actin (ACTG2) gene underlie megacystis-microcolon-intestinal hypoperistalsis syndrome.

    PubMed

    Wangler, Michael F; Gonzaga-Jauregui, Claudia; Gambin, Tomasz; Penney, Samantha; Moss, Timothy; Chopra, Atul; Probst, Frank J; Xia, Fan; Yang, Yaping; Werlin, Steven; Eglite, Ieva; Kornejeva, Liene; Bacino, Carlos A; Baldridge, Dustin; Neul, Jeff; Lehman, Efrat Lev; Larson, Austin; Beuten, Joke; Muzny, Donna M; Jhangiani, Shalini; Gibbs, Richard A; Lupski, James R; Beaudet, Arthur

    2014-03-01

    Megacystis-microcolon-intestinal hypoperistalsis syndrome (MMIHS) is a rare disorder of enteric smooth muscle function affecting the intestine and bladder. Patients with this severe phenotype are dependent on total parenteral nutrition and urinary catheterization. The cause of this syndrome has remained a mystery since Berdon's initial description in 1976. No genes have been clearly linked to MMIHS. We used whole-exome sequencing for gene discovery followed by targeted Sanger sequencing in a cohort of patients with MMIHS and intestinal pseudo-obstruction. We identified heterozygous ACTG2 missense variants in 15 unrelated subjects, ten being apparent de novo mutations. Ten unique variants were detected, of which six affected CpG dinucleotides and resulted in missense mutations at arginine residues, perhaps related to biased usage of CpG containing codons within actin genes. We also found some of the same heterozygous mutations that we observed as apparent de novo mutations in MMIHS segregating in families with intestinal pseudo-obstruction, suggesting that ACTG2 is responsible for a spectrum of smooth muscle disease. ACTG2 encodes γ2 enteric actin and is the first gene to be clearly associated with MMIHS, suggesting an important role for contractile proteins in enteric smooth muscle disease. PMID:24676022

  18. Molecular Epidemiology of Human Intestinal Amoebas in Iran

    PubMed Central

    Hooshyar, H; Rostamkhani, P; Rezaian, M

    2012-01-01

    Many microscopic-based epidemiological surveys on the prevalence of human intestinal pathogenic and non-pathogenic protozoa including intestinal amoeba performed in Iran show a high prevalence of human intestinal amoeba in different parts of Iran. Such epidemiological studies on amoebiasis are confusing, mainly due to recently appreciated distinction between the Entamoeba histolytica, E. dispar and E. moshkovskii. Differential diagnosis can be done by some methods such as PCR-based methods, monoclonal antibodies and the analysis of isoenzyme typing, however the molecular study of these protozoa in Iran is low. Based on molecular studies, it seems that E. dispar is predominant species especially in the central and northern areas of Iran and amoebiasis due to E. histolytica is a rare infection in the country. It is suggested that infection with E. moshkovskii may be common among Iranians. Considering the importance of molecular epidemiology of amoeba in Iran and also the current data, the present study reviews the data currently available on the molecular distribution of intestinal human amoeba in Iran. PMID:23193500

  19. Solubility profiling of HIV protease inhibitors in human intestinal fluids.

    PubMed

    Wuyts, Benjamin; Brouwers, Joachim; Mols, Raf; Tack, Jan; Annaert, Pieter; Augustijns, Patrick

    2013-10-01

    The present study pursued to profile the intestinal solubility of nine HIV protease inhibitors (PIs) in fasted- and fed-state human intestinal fluids (FaHIF, FeHIF) aspirated from four volunteers. In addition, the ability of fasted- and fed-state simulated intestinal fluids (FaSSIF, FeSSIF) to predict the intestinal solubility was evaluated. All PIs were poorly soluble in FaHIF (from 7 μM for ritonavir to 327 μM for darunavir) and FeHIF (from 15 μM for atazanavir to 409μM for darunavir). For four of nine PIs, food intake significantly enhanced the solubilizing capacity of intestinal fluids (up to 18.4-fold increase for ritonavir). The intersubject variability (average coefficient of variance CVfed = 60.6%, CVfasted = 40.4%) was higher as compared with the intrasubject variability (CVfed = 41.3%, CVfasted = 20.5%). PI solubilities correlated reasonably well between FaSSIF and FaHIF (R = 0.817), but not between FeSSIF and FeHIF (R = 0.617). To conclude, postprandial conditions increased the inter- and intrasubject variability of the PIs. The inability of FeSSIF to accurately predict the FeHIF solubility emphasizes the need for a multivariate approach to determine solubility profiles, taking into account solid-state characteristics, pH, mixed bile acid/phospholipid micelles, and digestive products. PMID:23939880

  20. Relationship between stimulated phosphatidic acid production and inositol lipid hydrolysis in intestinal longitudinal smooth muscle from guinea pig.

    PubMed Central

    Mallows, R S; Bolton, T B

    1987-01-01

    Accumulation of [32P]phosphatidic acid (PA) and total [3H]inositol phosphates (IPs) was measured in the longitudinal smooth-muscle layer from guinea-pig small intestine. Stimulation with carbachol, histamine and substance P produced increases in accumulation of both [3H]IPs and [32P]PA over the same concentration range. The increase in [32P]PA accumulation in response to carbachol (1 microM-0.1 mM) was inhibited in the presence of atropine (0.5 microM). Buffering the external free [Ca2+] to 10 nM did not prevent the carbachol-stimulated increase in [32P]PA accumulation. Carbachol and Ca2+ appear to act synergistically to increase accumulation of [32P]PA. In contrast, although incubation with noradrenaline also increased accumulation of [3H]IPs, no increase in accumulation of [32P]PA could be detected. These results suggest that an increase in formation of IPs is not necessarily accompanied by an increase in PA formation, and imply the existence of receptor-modulated pathways regulating PA concentrations other than by phospholipase-C-catalysed inositol phospholipid hydrolysis. PMID:2451504

  1. Application of the Human Intestinal Tract Chip to the non-human primate gut microbiota.

    PubMed

    Bello González, T D J; van Passel, M W J; Tims, S; Fuentes, S; De Vos, W M; Smidt, H; Belzer, C

    2015-01-01

    The human intestinal microbiota is responsible for various health-related functions, and its diversity can be readily mapped with the 16S ribosomal RNA targeting Human Intestinal Tract (HIT) Chip. Here we characterise distal gut samples from chimpanzees, gorillas and marmosets, and compare them with human gut samples. Our results indicated applicability of the HITChip platform can be extended to chimpanzee and gorilla faecal samples for analysis of microbiota composition and enterotypes, but not to the evolutionary more distant marmosets. PMID:25519524

  2. Localization of human intestinal defensin 5 in Paneth cell granules.

    PubMed Central

    Porter, E M; Liu, L; Oren, A; Anton, P A; Ganz, T

    1997-01-01

    Antibiotic peptides of higher animals include the defensins, first discovered in phagocytic cells but recently also found to be produced by epithelial cells. We biosynthesized recombinant human intestinal defensin 5 (rHD-5) using the baculovirus-insect cell expression system. Since insect cells process defensin incompletely and secrete the precursor proHD-5, we substituted a methionine for an alanine at a likely processing site to allow selective chemical cleavage with cyanogen bromide, and rHD-5 was used to elicit polyclonal antibodies. By the immunoperoxidase-staining technique, the antibodies selectively stained Paneth cells of the normal adult small intestine. Immunogold electron microscopy further localized HD-5 to the Paneth cell secretory granules. Since some defensins exert activity cytotoxic to mammalian cells, we assayed the effect of rHD-5 on the human intestinal cell lines Caco2 and Int407. proHD-5 did not exert cytotoxic activity, and rHD-5 showed only minimal activity against Int407 and was inert against Caco2. Since Paneth cells release their granules adjacent to the mitotic cells of the intestinal crypts, HD could protect this cell population against invasion and parasitization by microbes. PMID:9169779

  3. Short-chain fatty acids induce cytoskeletal and extracellular protein modifications associated with modulation of proliferation on primary culture of rat intestinal smooth muscle cells.

    PubMed

    Le Blay, G; Blottière, H M; Ferrier, L; Le Foll, E; Bonnet, C; Galmiche, J P; Cherbut, C

    2000-08-01

    Short-chain fatty acids are the main end products of bacterial fermentation of carbohydrates. Their role on the metabolism and biology of colonocytes is now well characterized. However, the functional consequences of their presence on intestinal smooth muscle cells remain poorly studied. We aimed to assess the effect of different short-chain fatty acids on ileal and colonic smooth muscle cells in primary culture and on A7R5 line. Butyrate (above 0.1 mM) inhibited A7R5 cell proliferation, while at low concentration (0.05 to 0.5 mM) butyrate significantly stimulated the proliferation of ileal and colonic myocytes in primary culture. An inhibition was observed at higher concentrations. Collagenous and noncollagenous protein synthesis was stimulated by butyrate. Moreover, butyrate stimulated actin and myosin expression. Thus, butyrate, which is produced by dietary fiber fermentation, may affect intestinal muscles by directly acting at the molecular level on myocytes. PMID:11007115

  4. Trimebutine maleate has inhibitory effects on the voltage-dependent Ca2+ inward current and other membrane currents in intestinal smooth muscle cells.

    PubMed

    Shimada, T; Kurachi, Y; Terano, A; Hamada, E; Sugimoto, T

    1990-04-01

    We examined effects of trimebutine maleate on the membrane currents of the intestinal smooth muscle cells by using the tight-seal whole cell clamp technique. Trimebutine suppressed the Ba2+ inward current through voltage-dependent Ca2+ channels in a dose-dependent manner. The inhibitory effect of trimebutine on the Ba2+ inward current was not use-dependent. It shifted the steady-state inactivation curve to the left along the voltage axis. Trimebutine also had inhibitory effects on the other membrane currents of the cells, such as the voltage-dependent K+ current, the Ca2(+)-activated oscillating K+ current and the acetylcholine-induced inward current. These relatively non-specific inhibitory effects of trimebutine on the membrane currents may explain, at least in part, the dual actions of the drug on the intestinal smooth muscle contractility, i.e. inhibitory as well as excitatory. PMID:2161373

  5. Toll like receptor-2 regulates production of glial-derived neurotrophic factors in murine intestinal smooth muscle cells.

    PubMed

    Brun, Paola; Gobbo, Serena; Caputi, Valentina; Spagnol, Lisa; Schirato, Giulia; Pasqualin, Matteo; Levorato, Elia; Palù, Giorgio; Giron, Maria Cecilia; Castagliuolo, Ignazio

    2015-09-01

    Gut microbiota-innate immunity axis is emerging as a key player to guarantee the structural and functional integrity of the enteric nervous system (ENS). Alterations in the composition of the gut microbiota, derangement in signaling of innate immune receptors such as Toll-like receptors (TLRs), and modifications in the neurochemical coding of the ENS have been associated with a variety of gastrointestinal disorders. Indeed, TLR2 activation by microbial products controls the ENS structure and regulates intestinal neuromuscular function. However, the cellular populations and the molecular mechanisms shaping the plasticity of enteric neurons in response to gut microbes are largely unexplored. In this study, smooth muscle cells (SMCs), enteric glial cells (EGCs) and macrophages/dendritic cells (MΦ/DCs) were isolated and cultured from the ileal longitudinal muscle layer of wild-type (WT) and Toll-like receptor-2 deficient (TLR2(-/-)) mice. Quantification of mRNA levels of neurotrophins at baseline and following stimulation with TLR ligands was performed by RT-PCR. To determine the role of neurotrophins in supporting the neuronal phenotype, we performed co-culture experiments of enteric neurons with the conditioned media of cells isolated from the longitudinal muscle layer of WT or TLR2(-/-) mice. The neuronal phenotype was investigated evaluating the expression of βIII-tubulin, HuC/D, and nNOS by immunocytochemistry. As detected by semi-quantitative RT-PCR, SMCs expressed mRNA coding TLR1-9. Among the tested cell populations, un-stimulated SMCs were the most prominent sources of neurotrophins. Stimulation with TLR2, TLR4, TLR5 and TLR9 ligands further increased Gdnf, Ngf, Bdnf and Lif mRNA levels in SMCs. Enteric neurons isolated from TLR2(-/-) mice exhibited smaller ganglia, fewer HuC/D(+ve) and nNOS(+ve) neurons and shorter βIII-tubulin axonal networks as compared to neurons cultured from WT mice. The co-culture with the conditioned media from WT-SMCs but not with

  6. [Algorithm for the coproscopic diagnosis of human intestinal parasites].

    PubMed

    Dolbin, D A; Tiurin, Iu A; Khaĭrullin, R M

    2012-01-01

    The purpose of the study was to elaborate a detection algorithm for human intestinal helminth eggs. There is a broad spectrum ofcoproscopic methods recommended for the detection of Opisthorchis eggs in man and animals; these include Fulleborn's method, formalin-ether method, Goryachev's, Katoh's, Kalantaryan's, Shcherbovich's, and Kotelnikov-Varenichev methods. Combined coproscopic methods are significantly more effective in detecting the causative agents of enteric parasitoses than is Katoh's method. Among the considered coproscopic techniques for the diagnosis of human ascariasis, it is most rational to use a combined method for fecal examination, the basis for which is a multicomponent flotation system (such as the author's one). The Kotelnikov-Varenichev method is optimal for diagnosing opisthorchiasis. It is optimal to use 2-3 methods of different groups simultaneously for the screening diagnosis of intestinal parasitoses. PMID:22774504

  7. Drosophila melanogaster as a model for human intestinal infection and pathology

    PubMed Central

    Apidianakis, Yiorgos; Rahme, Laurence G.

    2011-01-01

    Recent findings concerning Drosophila melanogaster intestinal pathology suggest that this model is well suited for the study of intestinal stem cell physiology during aging, stress and infection. Despite the physiological divergence between vertebrates and insects, the modeling of human intestinal diseases is possible in Drosophila because of the high degree of conservation between Drosophila and mammals with respect to the signaling pathways that control intestinal development, regeneration and disease. Furthermore, the genetic amenability of Drosophila makes it an advantageous model species. The well-studied intestinal stem cell lineage, as well as the tools available for its manipulation in vivo, provide a promising framework that can be used to elucidate many aspects of human intestinal pathology. In this Perspective, we discuss recent advances in the study of Drosophila intestinal infection and pathology, and briefly review the parallels and differences between human and Drosophila intestinal regeneration and disease. PMID:21183483

  8. Survivability of Kudoa septempunctata in human intestinal conditions.

    PubMed

    Ohnishi, Takahiro; Fujiwara, Marina; Tomaru, Akiko; Yoshinari, Tomoya; Sugita-Konishi, Yoshiko

    2016-06-01

    To elucidate whether Kudoa septempunctata was able to live in the human intestine, we assessed viability of K. septempunctata sporoplasms under conditions that mimicked human and ragworm digestive tracts. To study the effect of osmotic pressure on viability, sporoplasms were incubated in 0.9 or 3.4 % sodium chloride solutions, which roughly corresponded to the osmotic pressure in human or ragworm tissues, respectively. While viability in 3.4 % sodium chloride did not change after 72 h, it dropped to 21 % in 0.9 % sodium chloride. To study the effect of temperature on viability, sporoplasms were incubated at 37, 15, or 25 °C, which were representative of human, winter ragworm, or summer ragworm temperatures, respectively. Viability decreased sharply to 8.4 % after 48 h at 37 °C, but remained essentially unchanged at 15 and 25 °C. In addition, sporoplasms showed strong susceptibility to bile. These results indicate that K. septempunctata could not live in the human intestine for a long time. PMID:27038250

  9. Absent smooth muscle actin immunoreactivity of the small bowel muscularis propria circular layer in association with chromosome 15q11 deletion in megacystis-microcolon-intestinal hypoperistalsis syndrome.

    PubMed

    Szigeti, Reka; Chumpitazi, Bruno P; Finegold, Milton J; Ranganathan, Sarangarajan; Craigen, William J; Carter, Beth A; Tatevian, Nina

    2010-01-01

    Megacystis-microcolon-intestinal hypoperistalsis syndrome (MMIHS; OMIM%249210) is a rare and severe form of congenital intestinal and urinary dysfunction and malformation. Histologic studies suggest that the predominant intestinal manifestation is smooth muscle myopathy. Molecular observations have linked the disease to the neuronal nicotinic acetylcholine receptor (ηAChR), namely the absence of a functional α3 subunit of the ηAChR in patients with MMIHS. We describe a case of MMIHS in association with a de novo deletion of the proximal long arm of chromosome 15 (15q11.2). Histologic evaluation revealed an appropriate light microscopic appearance of both the circular and longitudinal layers of the small bowel muscularis propria. Immunohistochemical staining for smooth muscle actin, however, was selectively absent in the circular layer, demonstrating isolated absence in a unique and previously undescribed pattern. These observations raise the possibility that the proximal long arm of chromosome 15 (15q11) may be of clinical significance in MMIHS. PMID:20028211

  10. Functional Metagenomic Investigations of the Human Intestinal Microbiota

    PubMed Central

    Moore, Aimee M.; Munck, Christian; Sommer, Morten O. A.; Dantas, Gautam

    2011-01-01

    The human intestinal microbiota encode multiple critical functions impacting human health, including metabolism of dietary substrate, prevention of pathogen invasion, immune system modulation, and provision of a reservoir of antibiotic resistance genes accessible to pathogens. The complexity of this microbial community, its recalcitrance to standard cultivation, and the immense diversity of its encoded genes has necessitated the development of novel molecular, microbiological, and genomic tools. Functional metagenomics is one such culture-independent technique, used for decades to study environmental microorganisms, but relatively recently applied to the study of the human commensal microbiota. Metagenomic functional screens characterize the functional capacity of a microbial community, independent of identity to known genes, by subjecting the metagenome to functional assays in a genetically tractable host. Here we highlight recent work applying this technique to study the functional diversity of the intestinal microbiota, and discuss how an approach combining high-throughput sequencing, cultivation, and metagenomic functional screens can improve our understanding of interactions between this complex community and its human host. PMID:22022321

  11. Age-associated modifications of intestinal permeability and innate immunity in human small intestine.

    PubMed

    Man, Angela L; Bertelli, Eugenio; Rentini, Silvia; Regoli, Mari; Briars, Graham; Marini, Mario; Watson, Alastair J M; Nicoletti, Claudio

    2015-10-01

    The physical and immunological properties of the human intestinal epithelial barrier in aging are largely unknown. Ileal biopsies from young (7-12 years), adult (20-40 years) and aging (67-77 years) individuals not showing symptoms of gastrointestinal (GI) pathologies were used to assess levels of inflammatory cytokines, barrier integrity and cytokine production in response to microbial challenges. Increased expression of interleukin (IL)-6, but not interferon (IFN)γ, tumour necrosis factor (TNF)-α and IL-1β was observed during aging; further analysis showed that cluster of differentiation (CD)11c(+) dendritic cells (DCs) are one of the major sources of IL-6 in the aging gut and expressed higher levels of CD40. Up-regulated production of IL-6 was accompanied by increased expression of claudin-2 leading to reduced transepithelial electric resistance (TEER); TEER could be restored in in vitro and ex vivo cultures by neutralizing anti-IL-6 antibody. In contrast, expression of zonula occludens-1 (ZO-1), occludin and junctional-adhesion molecule-A1 did not vary with age and overall permeability to macromolecules was not affected. Finally, cytokine production in response to different microbial stimuli was assessed in a polarized in vitro organ culture (IVOC). IL-8 production in response to flagellin declined progressively with age although the expression and distribution of toll-like receptor (TLR)-5 on intestinal epithelial cells (IECs) remained unchanged. Also, flagellin-induced production of IL-6 was less pronounced in aging individuals. In contrast, TNF-α production in response to probiotics (VSL#3) did not decline with age; however, in our experimental model probiotics did not down-regulate the production of IL-6 and expression of claudin-2. These data suggested that aging affects properties of the intestinal barrier likely to impact on age-associated disturbances, both locally and systemically. PMID:25948052

  12. Human milk hyaluronan enhances innate defense of the intestinal epithelium.

    PubMed

    Hill, David R; Rho, Hyunjin K; Kessler, Sean P; Amin, Ripal; Homer, Craig R; McDonald, Christine; Cowman, Mary K; de la Motte, Carol A

    2013-10-01

    Breast-feeding is associated with enhanced protection from gastrointestinal disease in infants, mediated in part by an array of bioactive glycan components in milk that act through molecular mechanisms to inhibit enteric pathogen infection. Human milk contains hyaluronan (HA), a glycosaminoglycan polymer found in virtually all mammalian tissues. We have shown that synthetic HA of a specific size range promotes expression of antimicrobial peptides in intestinal epithelium. We hypothesize that hyaluronan from human milk also enhances innate antimicrobial defense. Here we define the concentration of HA in human milk during the first 6 months postpartum. Importantly, HA isolated from milk has a biological function. Treatment of HT-29 colonic epithelial cells with human milk HA at physiologic concentrations results in time- and dose-dependent induction of the antimicrobial peptide human β-defensin 2 and is abrogated by digestion of milk HA with a specific hyaluronidase. Milk HA induction of human β-defensin 2 expression is also reduced in the presence of a CD44-blocking antibody and is associated with a specific increase in ERK1/2 phosphorylation, suggesting a role for the HA receptor CD44. Furthermore, oral administration of human milk-derived HA to adult, wild-type mice results in induction of the murine Hβ D2 ortholog in intestinal mucosa and is dependent upon both TLR4 and CD44 in vivo. Finally, treatment of cultured colonic epithelial cells with human milk HA enhances resistance to infection by the enteric pathogen Salmonella typhimurium. Together, our observations suggest that maternally provided HA stimulates protective antimicrobial defense in the newborn. PMID:23950179

  13. Human Milk Hyaluronan Enhances Innate Defense of the Intestinal Epithelium*

    PubMed Central

    Hill, David R.; Rho, Hyunjin K.; Kessler, Sean P.; Amin, Ripal; Homer, Craig R.; McDonald, Christine; Cowman, Mary K.; de la Motte, Carol A.

    2013-01-01

    Breast-feeding is associated with enhanced protection from gastrointestinal disease in infants, mediated in part by an array of bioactive glycan components in milk that act through molecular mechanisms to inhibit enteric pathogen infection. Human milk contains hyaluronan (HA), a glycosaminoglycan polymer found in virtually all mammalian tissues. We have shown that synthetic HA of a specific size range promotes expression of antimicrobial peptides in intestinal epithelium. We hypothesize that hyaluronan from human milk also enhances innate antimicrobial defense. Here we define the concentration of HA in human milk during the first 6 months postpartum. Importantly, HA isolated from milk has a biological function. Treatment of HT-29 colonic epithelial cells with human milk HA at physiologic concentrations results in time- and dose-dependent induction of the antimicrobial peptide human β-defensin 2 and is abrogated by digestion of milk HA with a specific hyaluronidase. Milk HA induction of human β-defensin 2 expression is also reduced in the presence of a CD44-blocking antibody and is associated with a specific increase in ERK1/2 phosphorylation, suggesting a role for the HA receptor CD44. Furthermore, oral administration of human milk-derived HA to adult, wild-type mice results in induction of the murine Hβ D2 ortholog in intestinal mucosa and is dependent upon both TLR4 and CD44 in vivo. Finally, treatment of cultured colonic epithelial cells with human milk HA enhances resistance to infection by the enteric pathogen Salmonella typhimurium. Together, our observations suggest that maternally provided HA stimulates protective antimicrobial defense in the newborn. PMID:23950179

  14. Nonsteroidal antiinflammatory drug-induced intestinal inflammation in humans

    SciTech Connect

    Bjarnason, I.; Zanelli, G.; Smith, T.; Prouse, P.; Williams, P.; Smethurst, P.; Delacey, G.; Gumpel, M.J.; Levi, A.J.

    1987-09-01

    This study examines the effects of nonsteroidal antiinflammatory drugs on the small intestine in humans. Using an /sup 111/In-leukocyte technique in patients with rheumatoid arthritis (n = 90) and osteoarthritis (n = 7), it appears that nonsteroidal antiinflammatory drugs cause small intestinal inflammation in two-thirds of patients on long-term treatment and on discontinuation, the inflammation may persist for up to 16 mo. The prevalence and magnitude of the intestinal inflammation was unrelated to the type and dose of nonsteroidal drugs and previous or concomitant second-line drug treatment. There was a significant inverse correlation (r = -0.29, p less than 0.05) between fecal /sup 111/In excretion and hemoglobin levels in patients treated with nonsteroidal antiinflammatory drugs. The kinetics of fecal indium 111 excretion in patients treated with nonsteroidal antiinflammatory drugs was almost identical to that of patients with small bowel Crohn's disease. Eighteen patients on nonsteroidal antiinflammatory drugs underwent a radiologic examination of the small bowel and 3 were found to have asymptomatic ileal disease with ulceration and strictures. Nineteen patients on nonsteroidal antiinflammatory drugs, 20 healthy controls, and 13 patients with Crohn's ileitis underwent a dual radioisotopic ileal function test with tauro 23 (/sup 75/Se) selena-25-homocholic acid and cobalt 58-labeled cyanocobalamine. On day 4, more than half of the patients with rheumatoid arthritis had evidence of bile acid malabsorption, but the ileal dysfunction was much milder than seen in patients with Crohn's ileitis.

  15. Diversity of human small intestinal Streptococcus and Veillonella populations.

    PubMed

    van den Bogert, Bartholomeus; Erkus, Oylum; Boekhorst, Jos; de Goffau, Marcus; Smid, Eddy J; Zoetendal, Erwin G; Kleerebezem, Michiel

    2013-08-01

    Molecular and cultivation approaches were employed to study the phylogenetic richness and temporal dynamics of Streptococcus and Veillonella populations in the small intestine. Microbial profiling of human small intestinal samples collected from four ileostomy subjects at four time points displayed abundant populations of Streptococcus spp. most affiliated with S. salivarius, S. thermophilus, and S. parasanguinis, as well as Veillonella spp. affiliated with V. atypica, V. parvula, V. dispar, and V. rogosae. Relative abundances varied per subject and time of sampling. Streptococcus and Veillonella isolates were cultured using selective media from ileostoma effluent samples collected at two time points from a single subject. The richness of the Streptococcus and Veillonella isolates was assessed at species and strain level by 16S rRNA gene sequencing and genetic fingerprinting, respectively. A total of 160 Streptococcus and 37 Veillonella isolates were obtained. Genetic fingerprinting differentiated seven Streptococcus lineages from ileostoma effluent, illustrating the strain richness within this ecosystem. The Veillonella isolates were represented by a single phylotype. Our study demonstrated that the small intestinal Streptococcus populations displayed considerable changes over time at the genetic lineage level because only representative strains of a single Streptococcus lineage could be cultivated from ileostoma effluent at both time points. PMID:23614882

  16. Human milk and infant intestinal mucosal glycans guide succession of the neonatal intestinal microbiota.

    PubMed

    Newburg, David S; Morelli, Lorenzo

    2015-01-01

    Infants begin acquiring intestinal microbiota at parturition. Initial colonization by pioneer bacteria is followed by active succession toward a dynamic ecosystem. Keystone microbes engage in reciprocal transkingdom communication with the host, which is essential for human homeostasis and health; therefore, these bacteria should be considered mutualists rather than commensals. This review discusses the maternal role in providing infants with functional and stable microbiota. The initial fecal inoculum of microbiota results from the proximity of the birth canal and anus; the biological significance of this anatomic proximity could underlie observed differences in microbiota between vaginal and cesarean birth. Secondary sources of inocula include mouths and skin of kin, animals and objects, and the human milk microbiome, but guiding microbial succession may be a primary role of human milk. The unique glycans of human milk cannot be digested by the infant, but are utilized by mutualist bacteria. These prebiotic glycans support expansion of mutualist microbiota, which manifests as differences in microbiota among breastfed and artificially fed infants. Human milk glycans vary by maternal genotype. Milks of genetically distinct mothers and variations in infant mucosal glycan expression support discrete microbiota. Early colonization may permanently influence microbiota composition and function, with ramifications for health. PMID:25356747

  17. Functional Characterization of Cholera Toxin Inhibitors Using Human Intestinal Organoids.

    PubMed

    Zomer-van Ommen, Domenique D; Pukin, Aliaksei V; Fu, Ou; Quarles van Ufford, Linda H C; Janssens, Hettie M; Beekman, Jeffrey M; Pieters, Roland J

    2016-07-28

    Preclinical drug testing in primary human cell models that recapitulate disease can significantly reduce animal experimentation and time-to-the-clinic. We used intestinal organoids to quantitatively study the potency of multivalent cholera toxin inhibitors. The method enabled the determination of IC50 values over a wide range of potencies (15 pM to 9 mM). The results indicate for the first time that an organoid-based swelling assay is a useful preclinical method to evaluate inhibitor potencies of drugs that target pathogen-derived toxins. PMID:27347611

  18. Vasoactive intestinal peptide signaling axis in human leukemia

    PubMed Central

    Dorsam, Glenn Paul; Benton, Keith; Failing, Jarrett; Batra, Sandeep

    2011-01-01

    The vasoactive intestinal peptide (VIP) signaling axis constitutes a master “communication coordinator” between cells of the nervous and immune systems. To date, VIP and its two main receptors expressed in T lymphocytes, vasoactive intestinal peptide receptor (VPAC)1 and VPAC2, mediate critical cellular functions regulating adaptive immunity, including arresting CD4 T cells in G1 of the cell cycle, protection from apoptosis and a potent chemotactic recruiter of T cells to the mucosa associated lymphoid compartment of the gastrointestinal tissues. Since the discovery of VIP in 1970, followed by the cloning of VPAC1 and VPAC2 in the early 1990s, this signaling axis has been associated with common human cancers, including leukemia. This review highlights the present day knowledge of the VIP ligand and its receptor expression profile in T cell leukemia and cell lines. Also, there will be a discussion describing how the anti-leukemic DNA binding transcription factor, Ikaros, regulates VIP receptor expression in primary human CD4 T lymphocytes and T cell lymphoblastic cell lines (e.g. Hut-78). Lastly, future goals will be mentioned that are expected to uncover the role of how the VIP signaling axis contributes to human leukemogenesis, and to establish whether the VIP receptor signature expressed by leukemic blasts can provide therapeutic and/or diagnostic information. PMID:21765981

  19. The Effects of Lactobacillus acidophilus on the Intestinal Smooth Muscle Contraction through PKC/MLCK/MLC Signaling Pathway in TBI Mouse Model

    PubMed Central

    Fang, Huan; Zhu, Lina; Gao, Ning; Zhu, Jingci

    2015-01-01

    Clinical studies have shown that probiotics influence gastrointestinal motility. However, the molecular mechanisms by which probiotic Lactobacillus modulates intestinal motility in traumatic brain injury (TBI) mouse model have not been explored. In the present study, we provided evidence showing that treatment of TBI mice with Lactobacillus acidophilus significantly improved the terminal ileum villus morphology, restored the impaired interstitial cells of Cajal (ICC) and the disrupted ICC networks after TBI, and prevented TBI-mediated inhibition of contractile activity in intestinal smooth muscle. Mechanistically, the decreased concentration of MLCK, phospho-MLC20 and phospho-MYPT1 and increased concentration of MLCP and PKC were observed after TBI, and these events mediated by TBI were efficiently prevented by Lactobacillus acidophilus application. These findings may provide a novel mechanistic basis for the application of Lactobacillus acidophilus in the treatment of TBI. PMID:26030918

  20. SREBP inhibits VEGF expression in human smooth muscle cells

    SciTech Connect

    Motoyama, Koka; Fukumoto, Shinya . E-mail: sfukumoto@med.osaka-cu.ac.jp; Koyama, Hidenori; Emoto, Masanori; Shimano, Hitoshi; Maemura, Koji; Nishizawa, Yoshiki

    2006-03-31

    Sterol regulatory element-binding proteins (SREBPs) are transcription factors that regulate expression of genes encoding enzymes for lipid biosynthesis. SREBPs are activated by HMG-CoA reductase inhibitors (statins). Statins have been also reported to suppress vascular endothelial growth factor (VEGF) expression in vascular smooth muscle cells (VSMCs). Therefore, we hypothesized that SREBPs are involved in statin-mediated regulation of VEGF production in VSMCs. SREBP1 was robustly expressed, and was activated by atorvastatin in VSMCs, as demonstrated by increased levels of the mature nuclear form of SREBP1, and increased promoter activities of a reporter containing sterol regulatory elements by atorvastatin. Moreover, overexpression of SREBP1a dose-dependently suppressed VEGF promoter activity. Site-specific mutation or deletion of the proximal Sp1 sites reduced the inhibitory effects of SREBP1a on VEGF promoter activity. These data demonstrated that SREBP1, activated by atorvastatin, suppressed VEGF expression through the indirect interaction with the proximal tandem Sp1 sites in VSMCs.

  1. Alpha2 adrenoceptors regulate proliferation of human intestinal epithelial cells

    PubMed Central

    Schaak, S; Cussac, D; Cayla, C; Devedjian, J; Guyot, R; Paris, H; Denis, C

    2000-01-01

    BACKGROUND AND AIMS—Previous studies on rodents have suggested that catecholamines stimulate proliferation of the intestinal epithelium through activation of α2 adrenoceptors located on crypt cells. The occurrence of this effect awaits demonstration in humans and the molecular mechanisms involved have not yet been elucidated. Here, we examined the effect of α2 agonists on a clone of Caco2 cells expressing the human α2A adrenoceptor.
METHODS—Cells were transfected with a bicistronic plasmid containing the α2C10 and neomycin phosphotransferase genes. G418 resistant clones were assayed for receptor expression using radioligand binding. Receptor functionality was assessed by testing its ability to couple Gi proteins and to inhibit cAMP production. Mitogen activated protein kinase (MAPK) phosphorylation was followed by western blot, and cell proliferation was estimated by measuring protein and DNA content.
RESULTS—Permanent transfection of Caco2 cells allowed us to obtain a clone (Caco2-3B) expressing α2A adrenoceptors at a density similar to that found in normal human intestinal epithelium. Caco2-3B retained morphological features and brush border enzyme expression characteristic of enterocytic differentiation. The receptor was coupled to Gi2/Gi3 proteins and its stimulation caused marked diminution of forskolin induced cAMP production. Treatment of Caco2-3B with UK14304 (α2 agonist) induced a rapid increase in the phosphorylation state of MAPK, extracellular regulated protein kinase 1 (Erk1), and 2 (Erk2). This event was totally abolished in pertussis toxin treated cells and in the presence of kinase inhibitors (genistein or PD98059). It was unaffected by protein kinase C downregulation but correlated with a transient increase in Shc tyrosine phosphorylation. Finally, sustained exposure of Caco2-3B to UK14304 resulted in modest but significant acceleration of cell proliferation. None of these effects was observed in the parental cell line Caco2.

  2. Multiscale analysis of the murine intestine for modeling human diseases

    PubMed Central

    Lyons, Jesse; Herring, Charles A.; Banerjee, Amrita; Simmons, Alan J.

    2015-01-01

    When functioning properly, the intestine is one of the key interfaces between the human body and its environment. It is responsible for extracting nutrients from our food and excreting our waste products. It provides an environment for a host of healthful microbes and serves as a first defense against pathogenic ones. These processes require tight homeostatic controls, which are provided by the interactions of a complex mix of epithelial, stromal, neural and immune cells, as well as the resident microflora. This homeostasis can be disrupted by invasive microbes, genetic lesions, and carcinogens, resulting in diseases such Clostridium difficile infection, inflammatory bowel disease (IBD) and cancer. Enormous strides have been made in understanding how this important organ functions in health and disease using everything from cell culture systems to animal models to human tissue samples. This has resulted in better therapies for all of these diseases, but there is still significant room for improvement. In the United States alone, 14000 people per year die of C. difficile, up to 1.6 million people suffer from IBD, and more than 50000 people die every year from colon cancer. Because these and other intestinal diseases arise from complex interactions between the different components of the gut ecosystem, we propose that systems approaches that address this complexity in an integrative manner may eventually lead to improved therapeutics that deliver lasting cures. This review will discuss the use of systems biology for studying intestinal diseases in vivo with particular emphasis on mouse models. Additionally, it will focus on established experimental techniques that have been used to drive this systems-level analysis, and emerging techniques that will push this field forward in the future. PMID:26040649

  3. Smooth muscle and purinergic contraction of the human, rabbit, rat, and mouse testicular capsule.

    PubMed

    Banks, Frederick C L; Knight, Gillian E; Calvert, Robert C; Turmaine, Mark; Thompson, Cecil S; Mikhailidis, Dimitri P; Morgan, Robert J; Burnstock, Geoffrey

    2006-03-01

    The smooth-muscle cells of the testicular capsule (tunica albuginea) of man, rat, and mouse were examined by electron microscopy. They were characteristically flattened, elongated, branching cells and diffusely incorporated into the collagenous matrix and did not form a compact muscle layer. Contractile and synthetic smooth-muscle cell phenotypes were identified. Nerve varicosities in close apposition to smooth muscle were seen in human tissue. Contractions induced by adenosine 5'-triphosphate (ATP), alpha, beta-methylene ATP, noradrenaline (NA), acetylcholine (ACh), and electrical field stimulation (EFS) of autonomic nerves were investigated. Nerve-mediated responses of the rabbit and human tunica albuginea were recorded. The EFS-induced human responses were completely abolished by prazosin. In the rabbit, EFS-induced contractile responses were reduced by pyridoxalphosphate-6-azophenyl-2',4'-disulphonic acid by 36% and by prazosin by 77%. Both antagonists together almost completely abolished all EFS-induced contractions. The human tunica albuginea was contracted by NA, ATP, and alpha, beta-methylene ATP, but not by ACh. The rabbit and rat tunica albuginea were contracted by NA, ATP, alpha, beta-methylene ATP, and ACh. The mouse tunica albuginea was contracted by ACh, ATP, and alpha, beta-methylene ATP, but relaxed to NA. Immunohistochemical studies showed that P2X1 (also known as P2RX1) and P2X2 (also known as P2RX2) receptors were expressed on the smooth muscle of the rodent testicular capsule, expression being less pronounced in man. The testicular capsule of the rat, mouse, rabbit, and man all contain contractile smooth muscle. ATP, released as a cotransmitter from sympathetic nerves, can stimulate the contraction of rabbit smooth muscle. Human, rat, and mouse testicular smooth muscle demonstrated purinergic responsiveness, probably mediated through the P2X1 and/or P2X2 receptors. PMID:16280417

  4. Ranolazine inhibits voltage-gated mechanosensitive sodium channels in human colon circular smooth muscle cells.

    PubMed

    Neshatian, Leila; Strege, Peter R; Rhee, Poong-Lyul; Kraichely, Robert E; Mazzone, Amelia; Bernard, Cheryl E; Cima, Robert R; Larson, David W; Dozois, Eric J; Kline, Crystal F; Mohler, Peter J; Beyder, Arthur; Farrugia, Gianrico

    2015-09-15

    Human jejunum smooth muscle cells (SMCs) and interstitial cells of Cajal (ICCs) express the SCN5A-encoded voltage-gated, mechanosensitive sodium channel NaV1.5. NaV1.5 contributes to small bowel excitability, and NaV1.5 inhibitor ranolazine produces constipation by an unknown mechanism. We aimed to determine the presence and molecular identity of Na(+) current in the human colon smooth muscle and to examine the effects of ranolazine on Na(+) current, mechanosensitivity, and smooth muscle contractility. Inward currents were recorded by whole cell voltage clamp from freshly dissociated human colon SMCs at rest and with shear stress. SCN5A mRNA and NaV1.5 protein were examined by RT-PCR and Western blots, respectively. Ascending human colon strip contractility was examined in a muscle bath preparation. SCN5A mRNA and NaV1.5 protein were identified in human colon circular muscle. Freshly dissociated human colon SMCs had Na(+) currents (-1.36 ± 0.36 pA/pF), shear stress increased Na(+) peaks by 17.8 ± 1.8% and accelerated the time to peak activation by 0.7 ± 0.3 ms. Ranolazine (50 μM) blocked peak Na(+) current by 43.2 ± 9.3% and inhibited shear sensitivity by 25.2 ± 3.2%. In human ascending colon strips, ranolazine decreased resting tension (31%), reduced the frequency of spontaneous events (68%), and decreased the response to smooth muscle electrical field stimulation (61%). In conclusion, SCN5A-encoded NaV1.5 is found in human colonic circular smooth muscle. Ranolazine blocks both peak amplitude and mechanosensitivity of Na(+) current in human colon SMCs and decreases contractility of human colon muscle strips. Our data provide a likely mechanistic explanation for constipation induced by ranolazine. PMID:26185330

  5. Transgenic Expression of Human Lysophosphatidic Acid Receptor LPA2 in Mouse Intestinal Epithelial Cells Induces Intestinal Dysplasia

    PubMed Central

    Yoshida, Michihiro; He, Peijian; Yun, C. Chris

    2016-01-01

    Lysophosphatidic acid (LPA) acts on LPA2 receptor to mediate multiple pathological effects that are associated with tumorigenesis. The absence of LPA2 attenuates tumor progression in rodent models of colorectal cancer, but whether overexpression of LPA2 alone can lead to malignant transformation in the intestinal tract has not been studied. In this study, we expressed human LPA2 in intestinal epithelial cells (IECs) under control of the villin promoter. Less than 4% of F1-generation mice had germline transmission of transgenic (TG) human LPA2; as such only 3 F1 mice out of 72 genotyped had TG expression. These TG mice appeared anemic with hematochezia and died shortly after birth. TG mice were smaller in size compared with the wild type mouse of the same age and sex. Morphological analysis showed that TG LPA2 colon had hyper-proliferation of IECs resulting in increased colonic crypt depth. Surprisingly, TG small intestine had villus blunting and decreased IEC proliferation and dysplasia. In both intestine and colon, TG expression of LPA2 compromised the terminal epithelial differentiation, consistent with epithelial dysplasia. Furthermore, we showed that epithelial dysplasia was observed in founder mouse intestine, correlating LPA2 overexpression with epithelial dysplasia. The current study demonstrates that overexpression of LPA2 alone can lead to intestinal dysplasia. PMID:27124742

  6. Adult human arterial smooth muscle cells in primary culture. Modulation from contractile to synthetic phenotype.

    PubMed

    Thyberg, J; Nilsson, J; Palmberg, L; Sjölund, M

    1985-01-01

    Smooth muscle cells were isolated enzymatically from adult human arteries, grown in primary culture in medium containing 10% whole blood serum, and studied by transmission electron microscopy and [3H]thymidine autoradiography. In the intact arterial wall and directly after isolation, each smooth muscle cell had a nucleus with a wide peripheral zone of condensed chromatin and a cytoplasm dominated by myofilament bundles with associated dense bodies. After 1-2 days of culture, the cells had attached to the substrate and started to spread out. At the same time, a characteristic fine-structural modification took place. It included nuclear enlargement, dispersion of the chromatin and formation of large nucleoli. Moreover, myofilament bundles disappeared and an extensive rough endoplasmic reticulum and a large Golgi complex were organized in the cytoplasm. This morphological transformation of the cells was completed in 3-4 days. It was accompanied by initiation of DNA replication and mitosis. The observations demonstrate that adult human arterial smooth muscle cells, when cultivated in vitro, pass through a phenotypic modulation of the same type as arterial smooth muscle cells from experimental animals. This modulation gives the cells morphological and functional properties resembling those of the modified smooth muscle cells found in fibroproliferative lesions of atherosclerosis. Further studies of the regulation of smooth muscle phenotype and growth may provide important clues for a better understanding of the pathogenesis of atherosclerosis. PMID:3967287

  7. Antibiotic residues and drug resistance in human intestinal flora.

    PubMed Central

    Corpet, D E

    1987-01-01

    The effect of residual levels of ampicillin on the drug resistance of fecal flora was studied in human volunteers given 1.5 mg of ampicillin orally per day for 21 days. This treatment failed to have any significant reproducible effect on the number of resistant Escherichia coli in their feces. The effect of continuous administration of small doses of ampicillin, chlortetracycline, or streptomycin in the drinking water was studied in gnotobiotic mice inoculated with a human fecal flora. In this animal model, which is free of many interfering factors, an increase in the fecal concentration of resistant E. coli was observed when the mice were given 0.5 microgram of ampicillin or chlortetracycline per ml of water. This model is therefore a sensitive system for testing the effect of antimicrobial drugs on the resistance characteristics of the intestinal flora. PMID:3300533

  8. Three dimensional human small intestine models for ADME-Tox studies.

    PubMed

    Yu, Jiajie; Carrier, Rebecca L; March, John C; Griffith, Linda G

    2014-10-01

    In vitro human small intestine models play a crucial part in preclinical drug development. Although conventional 2D systems possess many advantages, such as facile accessibility and high-throughput capability, they can also provide misleading results due to their relatively poor recapitulation of in vivo physiology. Significant progress has recently been made in developing 3D human small intestine models, suggesting that more-reliable preclinical results could be obtained by recreating the 3D intestinal microenvironment in vitro. Although there are still many challenges, 3D human small intestine models have the potential to facilitate drug screening and drug development. PMID:24853950

  9. Human and mouse tissue-engineered small intestine both demonstrate digestive and absorptive function.

    PubMed

    Grant, Christa N; Mojica, Salvador Garcia; Sala, Frederic G; Hill, J Ryan; Levin, Daniel E; Speer, Allison L; Barthel, Erik R; Shimada, Hiroyuki; Zachos, Nicholas C; Grikscheit, Tracy C

    2015-04-15

    Short bowel syndrome (SBS) is a devastating condition in which insufficient small intestinal surface area results in malnutrition and dependence on intravenous parenteral nutrition. There is an increasing incidence of SBS, particularly in premature babies and newborns with congenital intestinal anomalies. Tissue-engineered small intestine (TESI) offers a therapeutic alternative to the current standard treatment, intestinal transplantation, and has the potential to solve its biggest challenges, namely donor shortage and life-long immunosuppression. We have previously demonstrated that TESI can be generated from mouse and human small intestine and histologically replicates key components of native intestine. We hypothesized that TESI also recapitulates native small intestine function. Organoid units were generated from mouse or human donor intestine and implanted into genetically identical or immunodeficient host mice. After 4 wk, TESI was harvested and either fixed and paraffin embedded or immediately subjected to assays to illustrate function. We demonstrated that both mouse and human tissue-engineered small intestine grew into an appropriately polarized sphere of intact epithelium facing a lumen, contiguous with supporting mesenchyme, muscle, and stem/progenitor cells. The epithelium demonstrated major ultrastructural components, including tight junctions and microvilli, transporters, and functional brush-border and digestive enzymes. This study demonstrates that tissue-engineered small intestine possesses a well-differentiated epithelium with intact ion transporters/channels, functional brush-border enzymes, and similar ultrastructural components to native tissue, including progenitor cells, whether derived from mouse or human cells. PMID:25573173

  10. Excipient-mediated supersaturation stabilization in human intestinal fluids.

    PubMed

    Bevernage, Jan; Forier, Thomas; Brouwers, Joachim; Tack, Jan; Annaert, Pieter; Augustijns, Patrick

    2011-04-01

    It was the purpose of this study to investigate excipient-mediated precipitation inhibition upon induction of supersaturation of poorly water-soluble drugs in aspirated human intestinal fluids (HIF) representing both the fasted and fed state. Etravirine, ritonavir, loviride, danazol and fenofibrate were selected as model compounds. For comparative purposes, precipitation inhibition was also evaluated in simple aqueous buffer, and in intestinal simulation media representative for the fasted and fed state (FaSSIF and FeSSIF, respectively). Supersaturation was induced in the test media containing predissolved excipient (HPMC-AS, HPMC-E5, HPMC-E50, HPMC-E4M, HPMC-P and PVP) at a defined degree of supersaturation (DS = 20) using the solvent shift method. The results illustrate that cellulosic polymers can reduce the precipitation rate and stabilize supersaturation in HIF. The extent of stabilization was compound and excipient dependent but independent of the nutritional state. Whenever excipient effects were observed, the predictive value of simple buffer or FaSSIF/FeSSIF was rather limited. In general, excipient-mediated precipitation inhibition was less pronounced in HIF compared to simple aqueous buffer or FaSSIF/FeSSIF. However, excipients showing no effect in simple aqueous buffer or FaSSIF/FeSSIF also proved to be ineffective in HIF, indicating the value of these simulation media in the elimination of excipients during formulation development. PMID:21268663

  11. Adherence of Bilophila wadsworthia to cultured human embryonic intestinal cells.

    PubMed

    Gerardo, S H; Garcia, M M; Wexler, H M; Finegold, S M

    1998-02-01

    Adherence of Bilophila wadsworthia to the cultured human embryonic intestinal cell line, Intestine 407 (Int 407), varied among the strains tested from strongly adherent (76-100% cells positive for one or more adherent bacteria) to non- or weakly adherent (0-25% positive cells). Although negative staining revealed that infrequent cells of an adherent strain, WAL 9077, the adherent type-strain, WAL 7959, and a non-adherent strain, WAL 8448, expressed loosely associated fimbrial structures, a role for these structures in adhesion could not be confirmed with either scanning or thin-section electron micrography. Ruthenium red staining of thin-section preparations and subsequent electron microscopy failed to reveal an extensive extracellular polysaccharide layer. SDS-PAGE analysis of crude outer membrane fractions of WAL 9077 and WAL 8448 demonstrated clear differences in their major and minor outer membrane protein components. Thus, we postulate that the adherence of B. wadsworthia to Int 407 cells is mediated by an outer membrane or cell wall component. PMID:16887620

  12. Has cervical smooth muscle any physiological role in the human?

    PubMed

    Bryman, I; Norström, A; Lindblom, B

    1985-01-01

    Strips of human cervical tissue were obtained by needle biopsy and contractile activity was registered isometrically in a tissue chamber perfused by Krebs-Ringer bicarbonate buffer. The most frequently encountered pattern of contractile activity was high frequency-short duration. Prostaglandin (PG)E2, PGI2 and 6-keto-PGF1 alpha had an inhibitory effect on the muscular activity. Cervical muscle from pregnant women was more sensitive to PGE2 than specimens from non-pregnant women. PGF2 alpha had no apparent effect on cervical contractility in non-pregnant and early pregnant patients. In late pregnancy, however, PGF2 alpha inhibited muscle contractions. The present results point to a physiological role of the cervical muscles for the control of cervical competence during pregnancy. The inhibitory effect of PGs on the muscle activity may promote cervical dilatation and retraction. PMID:3893038

  13. Organ culture of mucosal biopsies of human small intestine.

    PubMed

    Browning, T H; Trier, J S

    1969-08-01

    In vitro experiments of small intestinal mucosal function and metabolism utilizing excised tissue have been limited to a few hours by rapid epithelial cell necrosis which occurs with current incubation methods. We describe a method for culturing human mucosal biopsies for up to 24 hr employing organ culture methodology and demonstrate its potential application to studies of mucosal function. Peroral biopsies were placed in organ culture plates and maintained with modified Trowell's medium in 95% O(2)-5% CO(2) at 37 degrees C for 6-24 hr. To study cell proliferation, 2 muc of thymidine-(3)H was added per ml of medium. To study fat absorption, biopsies were exposed to micellar solutions of linolenic acid, monoolein, and taurodeoxycholate in Krebs-Ringer buffer for 15 min after culture in vitro for 24 hr. After 24 hr of culture, villi were shorter and wider. Cells in the lamina were reduced in number. Light and electron microscopic morphology of epithelial cells compared favorably to those of control biopsies except in occasional areas of partial necrosis. Some absorptive cells were more cuboidal and contained more lysosomes; many appeared entirely normal. Most crypt cells appeared normal; some contained increased glycogen and lysosomes. Mitoses were present, and labeled cells were abundant in crypts of biopsies after 6 hr of incubation with thymidine-(3)H-containing medium. By 24 hr. labeled cells migrated to the base of the villi. When biopsies cultured in vitro were subsequently exposed to micellar lipid, numerous lipid droplets were identified in the cytoplasm of absorptive cells. Thus, after 24 hr in vitro under these culture conditions, many human small intestinal epithelial cells maintain near normal morphology, epithelial cell proliferation proceeds, and fat absorption occurs. PMID:5796354

  14. Fluoroquinolone (ciprofloxacin) secretion by human intestinal epithelial (Caco-2) cells

    PubMed Central

    Cavet, M E; West, M; Simmons, N L

    1997-01-01

    Human intestinal epithelial Caco-2 cells were used to investigate the mechanistic basis of transepithelial secretion of the fluoroquinolone antibiotic ciprofloxacin. Net secretion and cellular uptake of ciprofloxacin (at 0.1 mM) were not subject to competitive inhibition by sulphate, thiosulphate, oxalate, succinate and para-amino hippurate, probenecid (10 mM), taurocholate (100 μM) or bromosulphophthalein (100 μM). Similarly tetraethylammonium and N-′methylnicotinamide (10 mM) were without effect. Net secretion of ciprofloxacin was inhibited by the organic exchange inhibitor 4,4′-diisothiocyanostilbene-2-2′-disulphonic acid (DIDS, 400 μM). Net secretion of ciprofloxacin was partially inhibited by 100 μM verapamil, whilst net secretion of the P-glycoprotein substrate vinblastine was totally abolished under these conditions. Ciprofloxacin secretion was unaltered after preincubation of cells with two anti-P-glycoprotein antibodies (UIC2 and MRK16), which both significantly reduced secretory vinblastine flux (measured in the same cell batch). Ciprofloxacin (3 mM) failed to inhibit vinblastine net secretion in Caco-2 epithelia, and was not itself secreted by the P-glycoprotein expressing and vinblastine secreting dog kidney cell line, MDCK. Net secretion and cellular uptake of ciprofloxacin (at 0.1 mM) were not subject to alterations of either cytosolic or medium pH, or dependent on the presence of medium Na+, Cl− or K+ in the bathing media. The substrate specificity of the ciprofloxacin secretory transport in Caco-2 epithelia is distinct from both the renal organic anion and cation transport. A role for P-glycoprotein in ciprofloxacin secretion may also be excluded. A novel transport mechanism, sensitive to both DIDS and verapamil mediates secretion of ciprofloxacin by human intestinal Caco-2 epithelia. PMID:9283689

  15. Human smooth muscle VLA-1 integrin: purification, substrate specificity, localization in aorta, and expression during development.

    PubMed

    Belkin, V M; Belkin, A M; Koteliansky, V E

    1990-11-01

    A membrane glycoprotein complex was isolated and purified from human smooth muscle by detergent solubilization and affinity chromatography on collagen-Sepharose. The complex was identified as VLA-1 integrin and consisted of two subunits of 195 and 130 kD in SDS-PAGE. Liposomes containing the VLA-1 integrin adhered to surfaces coated with type I, II, III, and IV collagens, Clq subcomponent of the first component of the complement, and laminin. The liposomes specifically adhered to these proteins in a Ca2+, Mg2(+)-dependent manner, but did not bind to gelatin, fibronectin, and thrombospondin substrates. The expression of VLA-1 integrin in different human tissues and cell types, and during aorta smooth muscle development was studied by SDS-PAGE, and subsequent quantitative immunoblotting was performed with antibodies recognizing alpha 1 and beta 1 subunits of the VLA-1 integrin. A high level of VLA-1 integrin expression was an exceptional feature of smooth muscles. Fibroblasts, endothelial cells, keratinocytes, striated muscles, and platelets contained trace amounts of VLA-1 integrin. In the 10-wk-old human fetal aorta, VLA-1 integrin was found only in smooth muscle cells whereas mesenchymal cells, surrounding aortic smooth muscle cells, were VLA-1 integrin negative. By the 24th wk of gestation, the amount of VLA-1 integrin was significantly reduced in the aortic media (4.3-fold for alpha 1 subunit and 2.5-fold for beta 1 subunit) compared with that in the 10-wk-old aortic smooth muscle cells. After birth, the expression of VLA-1 integrin increased and in the 1.5-yr-old child aorta the VLA-1 integrin level was almost the same as in adult aortic media. Smooth muscle cells from intimal thickening of adult aorta express five times less alpha 1 subunit of VLA integrin that smooth muscle cells from adult aortic media. In primary culture of aortic smooth muscle cells, the content of the VLA-1 integrin was dramatically reduced and subcultured cells did not contain VLA-1

  16. Human Intestinal Enteroids: a New Model To Study Human Rotavirus Infection, Host Restriction, and Pathophysiology

    PubMed Central

    Saxena, Kapil; Blutt, Sarah E.; Ettayebi, Khalil; Zeng, Xi-Lei; Broughman, James R.; Crawford, Sue E.; Karandikar, Umesh C.; Sastri, Narayan P.; Conner, Margaret E.; Opekun, Antone R.; Graham, David Y.; Qureshi, Waqar; Sherman, Vadim; Foulke-Abel, Jennifer; In, Julie; Kovbasnjuk, Olga; Zachos, Nicholas C.; Donowitz, Mark

    2015-01-01

    ABSTRACT Human gastrointestinal tract research is limited by the paucity of in vitro intestinal cell models that recapitulate the cellular diversity and complex functions of human physiology and disease pathology. Human intestinal enteroid (HIE) cultures contain multiple intestinal epithelial cell types that comprise the intestinal epithelium (enterocytes and goblet, enteroendocrine, and Paneth cells) and are physiologically active based on responses to agonists. We evaluated these nontransformed, three-dimensional HIE cultures as models for pathogenic infections in the small intestine by examining whether HIEs from different regions of the small intestine from different patients are susceptible to human rotavirus (HRV) infection. Little is known about HRVs, as they generally replicate poorly in transformed cell lines, and host range restriction prevents their replication in many animal models, whereas many animal rotaviruses (ARVs) exhibit a broader host range and replicate in mice. Using HRVs, including the Rotarix RV1 vaccine strain, and ARVs, we evaluated host susceptibility, virus production, and cellular responses of HIEs. HRVs infect at higher rates and grow to higher titers than do ARVs. HRVs infect differentiated enterocytes and enteroendocrine cells, and viroplasms and lipid droplets are induced. Heterogeneity in replication was seen in HIEs from different patients. HRV infection and RV enterotoxin treatment of HIEs caused physiological lumenal expansion detected by time-lapse microscopy, recapitulating one of the hallmarks of rotavirus-induced diarrhea. These results demonstrate that HIEs are a novel pathophysiological model that will allow the study of HRV biology, including host restriction, cell type restriction, and virus-induced fluid secretion. IMPORTANCE Our research establishes HIEs as nontransformed cell culture models to understand human intestinal physiology and pathophysiology and the epithelial response, including host restriction of

  17. Quantitative prediction of intestinal metabolism in humans from a simplified intestinal availability model and empirical scaling factor.

    PubMed

    Kadono, Keitaro; Akabane, Takafumi; Tabata, Kenji; Gato, Katsuhiko; Terashita, Shigeyuki; Teramura, Toshio

    2010-07-01

    This study aimed to establish a practical and convenient method of predicting intestinal availability (F(g)) in humans for highly permeable compounds at the drug discovery stage, with a focus on CYP3A4-mediated metabolism. We constructed a "simplified F(g) model," described using only metabolic parameters, assuming that passive diffusion is dominant when permeability is high and that the effect of transporters in epithelial cells is negligible. Five substrates for CYP3A4 (alprazolam, amlodipine, clonazepam, midazolam, and nifedipine) and four for both CYP3A4 and P-glycoprotein (P-gp) (nicardipine, quinidine, tacrolimus, and verapamil) were used as model compounds. Observed fraction of drug absorbed (F(a)F(g)) values for these compounds were calculated from in vivo pharmacokinetic (PK) parameters, whereas in vitro intestinal intrinsic clearance (CL(int,intestine)) was determined using human intestinal microsomes. The CL(int,intestine) for the model compounds corrected with that of midazolam was defined as CL(m,index) and incorporated into a simplified F(g) model with empirical scaling factor. Regardless of whether the compound was a P-gp substrate, the F(a)F(g) could be reasonably fitted by the simplified F(g) model, and the value of the empirical scaling factor was well estimated. These results suggest that the effects of P-gp on F(a) and F(g) are substantially minor, at least in the case of highly permeable compounds. Furthermore, liver intrinsic clearance (CL(int,liver)) can be used as a surrogate index of intestinal metabolism based on the relationship between CL(int,liver) and CL(m,index). F(g) can be easily predicted using a simplified F(g) model with the empirical scaling factor, enabling more confident selection of drug candidates with desirable PK profiles in humans. PMID:20354105

  18. Direct In Vivo Human Intestinal Permeability (Peff ) Determined with Different Clinical Perfusion and Intubation Methods.

    PubMed

    Dahlgren, David; Roos, Carl; Sjögren, Erik; Lennernäs, Hans

    2015-09-01

    Regional in vivo human intestinal effective permeability (Peff ) is calculated by measuring the disappearance rate of substances during intestinal perfusion. Peff is the most relevant parameter in the prediction of rate and extent of drug absorption from all parts of the intestine. Today, human intestinal perfusions are not performed on a routine basis in drug development. Therefore, it would be beneficial to increase the accuracy of the in vitro and in silico tools used to evaluate the intestinal Peff of novel drugs. This review compiles historical Peff data from 273 individual measurements of 80 substances from 61 studies performed in all parts of the human intestinal tract. These substances include: drugs, monosaccharaides, amino acids, dipeptides, vitamins, steroids, bile acids, ions, fatty acids, and water. The review also discusses the determination and prediction of Peff using in vitro and in silico methods such as quantitative structure-activity relationship, Caco-2, Ussing chamber, animal intestinal perfusion, and physiologically based pharmacokinetic (PBPK) modeling. Finally, we briefly outline how to acquire accurate human intestinal Peff data by deconvolution of plasma concentration-time profiles following regional intestinal bolus dosing. PMID:25410736

  19. Human in vivo regional intestinal permeability: quantitation using site-specific drug absorption data.

    PubMed

    Sjögren, Erik; Dahlgren, David; Roos, Carl; Lennernäs, Hans

    2015-06-01

    Application of information on regional intestinal permeability has been identified as a key aspect of successful pharmaceutical product development. This study presents the results and evaluation of an approach for the indirect estimation of site-specific in vivo intestinal effective permeability (Peff) in humans. Plasma concentration-time profiles from 15 clinical studies that administered drug solutions to specific intestinal regions were collected and analyzed. The intestinal absorption rate for each drug was acquired by deconvolution, using historical intravenous data as reference, and used with the intestinal surface area and the dose remaining in the lumen to estimate the Peff. Forty-three new Peff values were estimated (15 from the proximal small intestine, 11 from the distal small intestine, and 17 from the large intestine) for 14 active pharmaceutical ingredients representing a wide range of biopharmaceutical properties. A good correlation (r(2) = 0.96, slope = 1.24, intercept = 0.030) was established between these indirect jejunal Peff estimates and jejunal Peff measurements determined directly using the single-pass perfusion double balloon technique. On average, Peff estimates from the distal small intestine and large intestine were 90% and 40%, respectively, of those from the proximal small intestine. These results support the use of the evaluated deconvolution method for indirectly estimating regional intestinal Peff in humans. This study presents the first comprehensive data set of estimated human regional intestinal permeability values for a range of drugs. These biopharmaceutical data can be used to improve the accuracy of gastrointestinal absorption predictions used in drug development decision-making. PMID:25919764

  20. Cdx2 modulates proliferation in normal human intestinal epithelial crypt cells

    SciTech Connect

    Escaffit, Fabrice; Pare, Frederic; Gauthier, Remy; Rivard, Nathalie; Boudreau, Francois; Beaulieu, Jean-Francois . E-mail: Jean-Francois.Beaulieu@USherbrooke.ca

    2006-03-31

    The homeobox gene Cdx2 is involved in the regulation of the expression of intestine specific markers such as sucrase-isomaltase and lactase-phlorizin hydrolase. Previous studies performed with immortalized or transformed intestinal cell lines have provided evidence that Cdx2 can promote morphological and functional differentiation in these experimental models. However, no data exist concerning the implication of this factor in normal human intestinal cell physiology. In the present work, we have investigated the role of Cdx2 in normal human intestinal epithelial crypt (HIEC) cells that lack this transcription factor. The establishment of HIEC cells expressing Cdx2 in an inducible manner shows that forced expression of Cdx2 significantly alters the proliferation of intestinal crypt cells and stimulates dipeptidylpeptidase IV expression but is not sufficient to trigger intestinal terminal differentiation. These observations suggest that Cdx2 requires additional factors to activate the enterocyte differentiation program in normal undifferentiated cells.

  1. Human blood group activity of human and canine intestinal glycolipids containing fucose

    PubMed Central

    Smith, E. L.; Bowdler, A. J.; Bull, R. W.; McKibbin, J. M.

    1973-01-01

    A number of fucose-containing glycolipids (fuco-lipids), which are similar in composition to those of human normal and malignant gastrointestinal tissue, have been isolated from whole small intestines of individual dogs. Dogs from which these fuco-lipids were isolated fell into two types according to the qualitative sugar composition of their fuco-lipids. Glycolipids from type I dogs contained glucose, galactose, glucosamine, galactosamine and fucose, while those from type II dogs contained the same sugars but lacked galactosamine. Fucolipids isolated from type I and II dogs were tested for both canine blood group and human A, B, H and Lea and Leb blood group activity. At the concentrations tested, only human blood group A activity was found in significant amounts, and only in those fuco-lipids which contained galactosamine (type I dogs). Of the fuco-lipids with human blood group A activity, some had activity comparable to that of glycoprotein blood group substances, while others had lower, but significant, activity. These latter fuco-lipids also had marked chromatographic differences, indicating that they are of several different structural types, a finding similar to the A active glycolipids of human red cell stroma. None of the isolated intestinal fuco-lipids had canine blood group activity. A fuco-lipid with Lea activity was also isolated in relatively large amounts from a normal human whole small intestine. PMID:4753403

  2. Endothelin B receptors on human endothelial and smooth-muscle cells show equivalent binding pharmacology.

    PubMed

    Flynn, M A; Haleen, S J; Welch, K M; Cheng, X M; Reynolds, E E

    1998-07-01

    We have described the pharmacologic profiles of endothelin B receptors in human endothelial cells and vascular and nonvascular smooth-muscle cells. First, by amplifying endothelin B receptor numbers through the use of phosphoramidon and intact cell-binding techniques, we demonstrated the presence of these receptors in human umbilical vein endothelial cells (100% endothelin B receptors), human aortic smooth-muscle cells (22% endothelin B, 78% endothelin A receptors), and human bronchial smooth-muscle cells (55% endothelin B, 45% endothelin A receptors) by using [125I]-endothelin-1 radioligand binding. The typical binding profiles of the endothelin B receptors were established through competition binding curve analysis with endothelin-1, endothelin-3, sarafotoxin 6c, and the endothelin A receptor-selective antagonist BQ-123. In the presence of BQ-123, a diverse group of antagonists, including PD 142893, BQ-788, SB 209670, and Ro 47-0203, were used to probe for binding differences indicative of multiple endothelin B-receptor subtypes. The results indicate a rank order of potency for the antagonists of BQ-788 > SB 209670 > PD 142893 > Ro 47-0203 for each cell line, and that between any of these human cell lines, measurements of [125I]-endothelin-1-binding antagonism for each of the four test compounds differed by less than twofold. Although this study cannot discount the possibility of more than one endothelin B-receptor subtype in humans, it does indicate that these tissues express receptors that show equivalent binding pharmacology. PMID:9676729

  3. Steroid receptors in canine and human female genital tract tumours with smooth muscle differentiation.

    PubMed

    Millán, Y; Gordon, A; de los Monteros, A Espinosa; Reymundo, C; de las Mulas, J Martín

    2007-01-01

    The expression of oestrogen receptor-alpha (ERalpha) and progesterone receptor (PR) was examined in 32 canine genital tract tumours diagnosed as smooth muscle tumours (benign or malignant, pure or mixed). The immunohistochemical expression of calponin was used to assess the smooth muscle differentiation of the tumours. Nineteen human uterine leiomyomas were also examined. Calponin expression was detected in 89.3% of canine and 100% of human genital tract tumours diagnosed as leiomyomas, as well as in the majority of other tumours examined (canine or human, genital or extragenital, benign or malignant) with the exception of canine negative control tumours (cutaneous fibroma and hepatoid gland adenoma). ERalpha was found in 56.3% of canine and 52.6% of human leiomyomas, while PR was found in 84.4% of canine and 94.7% of human tumours. These results indicate that calponin is a good marker for differentiating neoplasia of the canine genital system of uncertain origin, as in human patients. They also show that canine tumours with smooth muscle differentiation of the genital tract of the bitch express steroid hormone receptors, a finding that opens up the possibility of hormone therapy. PMID:17362977

  4. Developmental changes in expression of contractile and cytoskeletal proteins in human aortic smooth muscle.

    PubMed

    Glukhova, M A; Frid, M G; Koteliansky, V E

    1990-08-01

    To describe phenotypic changes of human aortic smooth muscle cells (SMCs), proportion of smooth muscle and nonmuscle variants of actin, myosin heavy chains (MHCs), vinculin, and caldesmon, during prenatal and several months of postnatal development was determined. In aortic SMCs from 9-10-week-old fetus, both nonmuscle and smooth muscle-specific variants of all four proteins were present, however, the nonmuscle forms were more abundant. During development, a shift towards the expression of muscle-specific variants was observed, although the time course of changes in protein variant content was not similar for all the proteins studied. By the 24th week of gestation, fractional content of alpha-smooth muscle actin and smooth muscle MHCs was rather close to that in the mature SMCs, and comprised approximately 80 and 90%, respectively, of the levels characteristic of SMCs from adult aortic media. On the contrary, fractional ratio of meta-vinculin and 150-kDa caldesmon was still rather low in the aorta from the 24-week-old fetus, did not increase in a 2-month-old child aorta, and did not reach the level characteristic of mature SMCs even in the 6-month-old child aorta. Thus changes in alpha-smooth muscle actin and smooth muscle MHC fractional content occur mainly during the prenatal period of development, before the 24th week of gestation; while meta-vinculin and the 150-kDa caldesmon proportion increases mainly in the postnatal period, during several months after birth. In the "Discussion," phenotypes of SMCs from developing aorta were compared to those from different layers of the adult aortic wall. PMID:2376586

  5. BMP-2 gene expression and effects on human vascular smooth muscle cells.

    PubMed

    Willette, R N; Gu, J L; Lysko, P G; Anderson, K M; Minehart, H; Yue, T

    1999-01-01

    Bone morphogenetic proteins (BMPs) and their serine/threonine kinase receptors have been identified in atherosclerotic arteries and vascular smooth muscle cells, respectively. Thus, BMPs (the largest subfamily of the TGF-beta superfamily) have been implicated in the pathogenesis of atherosclerosis. However, the origins of BMP biosynthesis and the functional roles of BMP in blood vessels are unclear. The present study explored BMP-2 gene expression in various human blood vessels and vascular cell types. Functional in vitro studies were also performed to determine the effects of recombinant human BMP-2 on migration (transwell assay) and proliferation ([3H]-thymidine incorporation) of human aortic vascular smooth muscle cells (HASMC). RT-PCR experiments revealed BMP-2 gene expression in normal and atherosclerotic human arteries as well as cultured human aortic and coronary vascular smooth muscle cells, human umbilical vein endothelial cells (HUVECs) and human macrophages. In cellular migration studies, incubation with BMP-2 produced efficacious (smooth muscle cell response to vascular injury. PMID:10213907

  6. Metabolism of green tea catechins by the human small intestine.

    PubMed

    Schantz, Markus; Erk, Thomas; Richling, Elke

    2010-10-01

    Numerous studies have shown that green tea polyphenols can be degraded in the colon, and there is abundant knowledge about the metabolites of these substances that appear in urine and plasma after green tea ingestion. However, there is very little information on the extent and nature of intestinal degradation of green tea catechins in humans. Therefore, the aim of this study was to examine in detail the microbial metabolism and chemical stability of these polyphenols in the small intestine using a well-established ex vivo model. For this purpose, fresh ileostomy fluids from two probands were incubated for 24 h under anaerobic conditions with (+)-catechin (C), (-)-epicatechin (EC), (-)-epicatechin 3-O-gallate (ECG), (-)-epigallocatechin (EGC), (-)-epigallocatchin 3-O-gallate (EGCG) and gallic acid (GA). After lyophilisation and extraction, metabolites were separated, identified and quantified by high performance liquid chromatography-photodiode array detection (HPLC-DAD) and HPLC-ESI-tandem mass spectrometry. Two metabolites of EC and C (3', 4', 5'-trihydroxyphenyl-γ-valerolactone and 3', 4'-dihydroxyphenyl-γ-valerolactone) were identified. In addition, 3', 4', 5'-trihydroxyphenyl-γ-valerolactone was detected as a metabolite of EGC, and (after 24-h incubation) pyrogallol as a degradation product of GA. Cleavage of the GA esters of EGCG and ECG was also observed, with variations dependent on the sources (probands) of the ileal fluids, which differed substantially microbiotically. The results provide new information about the degradation of green tea catechins in the gastrointestinal tract, notably that microbiota-dependent liberation of GA esters may occur before these compounds reach the colon. PMID:20931601

  7. Garlic inhibits microsomal triglyceride transfer protein gene expression in human liver and intestinal cell lines and in rat intestine.

    PubMed

    Lin, Marie C; Wang, Er-Jia; Lee, Catherine; Chin, K T; Liu, Depei; Chiu, Jen-Fu; Kung, Hsiang-Fu

    2002-06-01

    Epidemiologic studies have suggested that fresh garlic has lipid-lowering activity. Because the microsomal triglyceride transfer protein (MTP) plays a pivotal role in the assembly and secretion of apolipoprotein B (apoB)-containing lipoproteins, we evaluated the effect of garlic on the expression of the MTP gene in vitro in cell lines and in vivo in rats. Fresh garlic extract (FGE) reduced MTP mRNA levels in both the human hepatoma HepG2 and intestinal carcinoma Caco-2 cells in dose-dependent fashion; significant reductions were detected with 3 g/L FGE. Maximal 72 and 59% reductions, respectively, were observed with 6 g/L FGE. To evaluate the in vivo effect of garlic on MTP gene expression, rats were given a single oral dose of fresh garlic homogenate (FGH), with hepatic and intestinal MTP mRNA measured 3 h after dosing. Rats fed FGH had significantly (46% of the control) lower intestinal MTP mRNA levels compared with the control rats, whereas hepatic MTP mRNA levels were not affected. These results suggest a new mechanism for the hypolipidemic effect of fresh garlic. Long-term dietary supplementation of fresh garlic may exert a lipid-lowering effect partly through reducing intestinal MTP gene expression, thus suppressing the assembly and secretion of chylomicrons from intestine to the blood circulation. PMID:12042427

  8. Generation of vascular endothelial and smooth muscle cells from human pluripotent stem cells

    PubMed Central

    Patsch, Christoph; Challet-Meylan, Ludivine; Thoma, Eva C.; Urich, Eduard; Heckel, Tobias; O’Sullivan, John F; Grainger, Stephanie J; Kapp, Friedrich G.; Sun, Lin; Christensen, Klaus; Xia, Yulei; Florido, Mary H. C.; He, Wei; Pan, Wei; Prummer, Michael; Warren, Curtis R.; Jakob-Roetne, Roland; Certa, Ulrich; Jagasia, Ravi; Freskgård, Per-Ola; Adatto, Isaac; Kling, Dorothee; Huang, Paul; Zon, Leonard I; Chaikof, Elliot L.; Gerszten, Robert E.; Graf, Martin; Iacone, Roberto; Cowan, Chad A.

    2015-01-01

    The use of human pluripotent stem cells for in vitro disease modeling and clinical applications requires protocols that convert these cells into relevant adult cell types. Here, we report the rapid and efficient differentiation of human pluripotent stem cells into vascular endothelial and smooth muscle cells. We found that GSK3 inhibition and BMP4 treatment rapidly committed pluripotent cells to a mesodermal fate and subsequent exposure to VEGF or PDGF-BB resulted in the differentiation of either endothelial or vascular smooth muscle cells, respectively. Both protocols produced mature cells with efficiencies over 80% within six days. Upon purification to 99% via surface markers, endothelial cells maintained their identity, as assessed by marker gene expression, and showed relevant in vitro and in vivo functionality. Global transcriptional and metabolomic analyses confirmed that the cells closely resembled their in vivo counterparts. Our results suggest that these cells could be used to faithfully model human disease. PMID:26214132

  9. Generation of vascular endothelial and smooth muscle cells from human pluripotent stem cells.

    PubMed

    Patsch, Christoph; Challet-Meylan, Ludivine; Thoma, Eva C; Urich, Eduard; Heckel, Tobias; O'Sullivan, John F; Grainger, Stephanie J; Kapp, Friedrich G; Sun, Lin; Christensen, Klaus; Xia, Yulei; Florido, Mary H C; He, Wei; Pan, Wei; Prummer, Michael; Warren, Curtis R; Jakob-Roetne, Roland; Certa, Ulrich; Jagasia, Ravi; Freskgård, Per-Ola; Adatto, Isaac; Kling, Dorothee; Huang, Paul; Zon, Leonard I; Chaikof, Elliot L; Gerszten, Robert E; Graf, Martin; Iacone, Roberto; Cowan, Chad A

    2015-08-01

    The use of human pluripotent stem cells for in vitro disease modelling and clinical applications requires protocols that convert these cells into relevant adult cell types. Here, we report the rapid and efficient differentiation of human pluripotent stem cells into vascular endothelial and smooth muscle cells. We found that GSK3 inhibition and BMP4 treatment rapidly committed pluripotent cells to a mesodermal fate and subsequent exposure to VEGF-A or PDGF-BB resulted in the differentiation of either endothelial or vascular smooth muscle cells, respectively. Both protocols produced mature cells with efficiencies exceeding 80% within six days. On purification to 99% via surface markers, endothelial cells maintained their identity, as assessed by marker gene expression, and showed relevant in vitro and in vivo functionality. Global transcriptional and metabolomic analyses confirmed that the cells closely resembled their in vivo counterparts. Our results suggest that these cells could be used to faithfully model human disease. PMID:26214132

  10. Modulation of cholinergic neural bronchoconstriction by endogenous nitric oxide and vasoactive intestinal peptide in human airways in vitro.

    PubMed Central

    Ward, J K; Belvisi, M G; Fox, A J; Miura, M; Tadjkarimi, S; Yacoub, M H; Barnes, P J

    1993-01-01

    Human airway smooth muscle possesses an inhibitory nonadrenergic noncholinergic neural bronchodilator response mediated by nitric oxide (NO). In guinea pig trachea both endogenous NO and vasoactive intestinal peptide (VIP) modulate cholinergic neural contractile responses. To identify whether endogenous NO or VIP can modulate cholinergic contractile responses in human airways in vitro, we studied the effects of specific NO synthase inhibitors and the peptidase alpha-chymotrypsin on contractile responses evoked by electrical field stimulation (EFS) at three airway levels. Endogenous NO, but not VIP, was shown to inhibit cholinergic contractile responses at all airway levels but this inhibition was predominantly in trachea and main bronchus and less marked in segmental and subsegmental bronchi. To elucidate the mechanism of this modulation we then studied the effects of endogenous NO on acetylcholine (ACh) release evoked by EFS from tracheal smooth muscle strips. We confirmed that release was neural in origin, frequency dependent, and that endogenous NO did not affect ACh release. These findings show that endogenous NO, but not VIP, evoked by EFS can inhibit cholinergic neural responses via functional antagonism of ACh at the airway smooth muscle and that the contribution of this modulation is less marked in lower airways. PMID:8349813

  11. Rapid effects of phytoestrogens on human colonic smooth muscle are mediated by oestrogen receptor beta.

    PubMed

    Hogan, A M; Collins, D; Sheehan, K; Zierau, O; Baird, A W; Winter, D C

    2010-05-14

    Epidemiological studies have correlated consumption of dietary phytoestrogens with beneficial effects on colon, breast and prostate cancers. Genomic and non-genomic mechanisms are responsible for anti-carcinogenic effects but, until now, the effect on human colon was assumed to be passive and remote. No direct effect on human colonic smooth muscle has previously been described. Institutional research board approval was granted. Histologically normal colon was obtained from the proximal resection margin of colorectal carcinoma specimens. Circular smooth muscle strips were microdissected and suspended under 1g of tension in organ baths containing oxygenated Krebs solution at 37 degrees C. After an equilibration period, tissues were exposed to diarylpropionitrile (DPN) (ER beta agonist) and 1,3,5-tris(4-hydroxyphenyl)-4-propyl-1H-pyrazole (PPT) (ER alpha agonist) or to the synthetic phytoestrogen compounds genistein (n=8), daidzein (n=8), fisetin (n=8) and quercetin (n=8) in the presence or absence of fulvestrant (oestrogen receptor antagonist). Mechanism of action was investigated by inhibition of downstream pathways. The cholinergic agonist carbachol was used to induce contractile activity. Tension was recorded isometrically. Phytoestrogens inhibit carbachol-induced colonic contractility. In keeping with a non-genomic, rapid onset direct action, the effect was within minutes, reversible and similar to previously described actions of 17 beta oestradiol. No effect was seen in the presence of fulvestrant indicating receptor modulation. While the DPN exerted inhibitory effects, PPT did not. The effect appears to be reliant on a p38/mitogen activated protein kinase mediated induction of nitric oxide production in colonic smooth muscle. The present data set provides the first description of a direct effect of genistein, daidzein, fisetin and quercetin on human colonic smooth muscle. The presence of ER in colonic smooth muscle has been functionally proven and the beta

  12. OUABAIN- AND MARINOBUFAGENIN-INDUCED PROLIFERATION OF HUMAN UMBILICAL VEIN SMOOTH MUSCLE CELLS AND A RAT VASCULAR SMOOTH MUSCLE CELL LINE, A7R5

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We studied the growth-promoting effects of 2 sodium pump-selective cardiotonic steroids, ouabain and marinobufagenin, on cultured cells from vascular smooth muscle (VSMCs) from human umbilical vein and a rat VSMC line, A7r5. Both ouabain and marinobufagenin activated proliferation of these cells in...

  13. Differentiation-dependent regulation of intestinal vitamin B2 uptake: studies utilizing human-derived intestinal epithelial Caco-2 cells and native rat intestine

    PubMed Central

    Subramanian, Veedamali S.; Ghosal, Abhisek; Subramanya, Sandeep B.; Lytle, Christian

    2013-01-01

    Intestinal epithelial cells undergo differentiation as they move from the crypt to the villi, a process that is associated with up- and downregulation in expression of a variety of genes, including those involved in nutrient absorption. Whether the intestinal uptake process of vitamin B2 [riboflavin (RF)] also undergoes differentiation-dependent regulation and the mechanism through which this occurs are not known. We used human-derived intestinal epithelial Caco-2 cells and native rat intestine as models to address these issues. Caco-2 cells showed a significantly higher carrier-mediated RF uptake in post- than preconfluent cells. This upregulation was associated with a significantly higher level of protein and mRNA expression of the RF transporters hRFVT-1 and hRFVT-3 in the post- than preconfluent cells; it was also accompanied with a significantly higher rate of transcription of the respective genes (SLC52A1 and SLC52A3), as indicated by the higher level of expression of heterogeneous nuclear RNA and higher promoter activity in post- than preconfluent cells. Studies with native rat intestine also showed a significantly higher RF uptake by epithelial cells of the villus tip than epithelial cells of the crypt; this again was accompanied by a significantly higher level of expression of the rat RFVT-1 and RFVT-3 at the protein, mRNA, and heterogeneous nuclear RNA levels. These findings show, for the first time, that the intestinal RF uptake process undergoes differentiation-dependent upregulation and suggest that this is mediated (at least in part) via transcriptional mechanisms. PMID:23413253

  14. Involvement of Concentrative Nucleoside Transporter 1 in Intestinal Absorption of Trifluridine Using Human Small Intestinal Epithelial Cells.

    PubMed

    Takahashi, Koichi; Yoshisue, Kunihiro; Chiba, Masato; Nakanishi, Takeo; Tamai, Ikumi

    2015-09-01

    TAS-102, which is effective for refractory metastatic colorectal cancer, is a combination drug of anticancer trifluridine (FTD; which is derived from pyrimidine nucleoside) and FTD-metabolizing enzyme inhibitor tipiracil hydrochloride (TPI) at a molecular ratio of 1:0.5. To evaluate the intestinal absorption mechanism of FTD, the uptake and transcellular transport of FTD by human small intestinal epithelial cell (HIEC) monolayer as a model of human intestinal epithelial cells was investigated. The uptake and membrane permeability of FTD by HIEC monolayers were saturable, Na(+) -dependent, and inhibited by nucleosides. These transport characteristics are mostly comparable with those of concentrative nucleoside transporters (CNTs). Moreover, the uptake of FTD by CNT1-expressing Xenopus oocytes was the highest among human CNT transporters. The obtained Km and Vmax values of FTD by CNT1 were 69.0 μM and 516 pmol/oocyte/30 min, respectively. The transcellular transport of FTD by Caco-2 cells, where CNT1 is heterologously expressed, from apical to basolateral side was greater than that by Mock cells. In conclusion, these results demonstrated that FTD exhibits high oral absorption by the contribution of human CNT1. PMID:25900515

  15. The action of acetylcholine and other drugs on the efflux of potassium and rubidium from smooth muscle of the guinea-pig intestine

    PubMed Central

    Burgen, A. S. V.; Spero, L.

    1968-01-01

    1. A method is described for measuring continuously the efflux of potassium or rubidium from smooth muscle of the guinea-pig. 2. Muscarinic drugs cause at maximum a 100-fold increase in the efflux rate, due to a direct increase in permeability and only to a minor extent secondary to depolarization. With acetylcholine the dose response curve for producing efflux is displaced to 1,000 times higher concentrations than that for contraction. 3. The shift varies with different agonists. The efflux and contractile responses to agonists are antagonized to an equivalent extent by atropine and several other reversible antagonists but benzhexol has a relatively greater effect on efflux. An estimate of spare receptors was obtained with benzilylcholine mustard and was similar for both responses. Dibenamine and local anaesthetics led to a parallel shift of the contraction dose response curve but a depression without shift in the efflux response. 4. The most satisfactory explanation of these results is that there are two types of the muscarinic receptor in the smooth muscle of the guinea-pig intestine. PMID:19108279

  16. A new enzymic method for the isolation and culture of human bladder body smooth muscle cells.

    PubMed

    Ma, F -H; Higashira, H; Ukai, Y; Hanai, T; Kiwamoto, H; Park, Y C; Kurita, T

    2002-01-01

    Cultured cells of the human urinary bladder smooth muscle are useful for investigating bladder function, but methods for culturing them are not well developed. We have now established a novel enzymic technique. The smooth muscle layer was separated out and incubated with 0.2% trypsin for 30 min at 37 degrees C. The samples were then minced and incubated with 0.1% collagenase for 30 min and centrifuged at 900 g. The pellets were resuspended in RPMI-1640 medium containing 10% fetal calf serum (FCS) and centrifuged at 250 g. The smooth muscle cells from the supernatant were cultured in RPMI-1640 containing 10% FCS. The cells grew to confluence after 7-10 days, forming the "hills and valleys" growth pattern characteristic of smooth muscle cells. Immunostaining with anti-alpha-actin, anti-myosin, and anti-caldesmon antibodies demonstrated that 99% of the cells were smooth muscle cells. To investigate the pharmacological properties of the cultured cells, we determined the inhibitory effect of muscarinic receptor antagonists on the binding of [3H]N-methylscopolamine to membranes from cultured cells. The pKi values obtained for six antagonists agreed with the corresponding values for transfected cells expressing the human muscarinic M2 subtype. Furthermore, carbachol produced an increase in the concentration of cytoplasmic free Ca2+ an action that was blocked by 4-diphenylacetoxy-N-methylpiperidine methiodide, an M3 selective antagonist. This result suggests that these cells express functional M3 muscarinic receptors, in addition to M2 receptors. The subcultured cells therefore appear to be unaffected by our new isolation method. PMID:11835427

  17. Permeability of rhynchophylline across human intestinal cell in vitro.

    PubMed

    Ma, Bo; Wang, Jing; Sun, Jing; Li, Ming; Xu, Huibo; Sun, Guibo; Sun, Xiaobo

    2014-01-01

    Rhynchophylline (Rhy) is the major component of Uncaria species, which is used in Chinese traditional medicine for the treatment of central nervous system disorders. However, its oral bioavailability has not been known. This study aims to investigate the intestinal permeability and related mechanisms of Rhy using cultured human epithelial Caco-2 cells. The cytotoxicity of Rhy on Caco-2 cells was evaluated with MTT assay. The effect of Rhy on the integrity of Caco-2 cell monolayer was assayed with transepithelial electrical resistance. The permeability of Rhy across cell monolayer was assayed by measuring Rhy quantity in received side with HPLC. The effect of Rhy on the expression of P-glycoprotein and MDR1 was detected with Western blot and flow cytometry, respectively. In the concentration of Rhy, which did not produce toxicity on cell viability and integrity of Caco-2 cell monolayer, Rhy crossed the monolayer with velocity 2.76~5.57×10^-6 cm/sec and 10.68~15.66×10^-6 cm/sec from apical to basolateral side and from basolateral to apical side, respectively. The permeability of Rhy was increased by verapamil, a P-glycoprotein inhibitor, or rhodamine123, a P-glycoprotein substrate. Rhy revealed an induction effect on P-glycoprotein expression in Caco-2 cells. These results demonstrate the low permeability of Rhy in intro, and suggest that P-glycoprotein may underlie the mechanism. PMID:24966905

  18. Cytotoxicity of some oxysterols on human vascular smooth muscle cells was mediated by apoptosis.

    PubMed

    Miyashita, Y; Shirai, K; Ito, Y; Watanabe, J; Urano, Y; Murano, T; Tomioka, H

    1997-01-01

    A decrease in smooth muscle cells is observed in advanced atherosclerotic lesion. To understand this mechanism, we selected oxysterols as candidates for toxic lipid, and examined their cytotoxicity on human cultured vascular smooth muscle cells, together with the manner of cell death. In the presence of 7-ketocholesterol or 7 beta-hydroxycholesterol (50 mumol/L), the percentage of detached cells increased significantly with dose dependency, and an increase in detached cell number and DNA nick detected by terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling study (TUNEL) preceded an increase in lactate dehydrogenase released into the medium. DNA extracted from smooth muscle cells incubated with 7-ketocholesterol or 7 beta-hydroxycholesterol showed a laddering pattern on agarose electrophoresis. In the presence of 7-ketocholesterol or 7 beta-hydroxycholesterol, fragmented DNA quantified by the quantitative sandwich enzyme immunoassay was significantly increased. From these results, it is proposed that 7-ketocholesterol and 7 beta-hydroxycholesterol are toxic to smooth muscle cells, and that this cytotoxicity is mediated by apoptosis. PMID:9638517

  19. The metabolic profile of acteoside produced by human or rat intestinal bacteria or intestinal enzyme in vitro employed UPLC-Q-TOF-MS.

    PubMed

    Cui, Qingling; Pan, Yingni; Xu, Xiaotong; Zhang, Wenjie; Wu, Xiao; Qu, Shouhe; Liu, Xiaoqiu

    2016-03-01

    Acteoside, the main and representative phenylethanoid glycosides of Herba Cistanches, possesses wide bioactivities but low oral bioavailability. It may serve as the prodrug and be converted into the active forms in gastrointestinal tract, which mainly occurred in intestinal tract composed of intestinal bacteria and intestinal enzyme. Intestinal bacteria, a new drug target, take a significant role on exerting pharmacological effects of drugs by oral administration. In this paper, acteoside was incubated with human or rat intestinal bacteria or rat intestinal enzyme for 36 h to seek metabolites responsible for pharmacodynamics. The samples were analyzed by ultra-performance liquid chromatography coupled with quadrupole time-of-flight mass spectrometry. Besides the parent compound, 14 metabolites were detected and identified based on their retention times and fragmentation patterns in their MS spectra including 8 degradation metabolites, 2 isomers in intestinal bacteria and intestinal enzyme samples and 4 parent metabolites only found in intestinal enzymes. The metabolic pathway of acteoside was thus proposed. Identification of these metabolites of acteoside by the intestinal bacteria or intestinal enzyme gave an insight to clarify pharmacological mechanism of traditional Chinese medicines and identify the real active molecules. PMID:26705842

  20. Actin expression in smooth muscle cells of rat aortic intimal thickening, human atheromatous plaque, and cultured rat aortic media.

    PubMed Central

    Gabbiani, G; Kocher, O; Bloom, W S; Vandekerckhove, J; Weber, K

    1984-01-01

    Actin of smooth muscle cells of rat and human aortic media shows a predominance of the alpha-isoform. In experimental rat aortic intimal thickening, in human atheromatous plaque, and in cultured aortic smooth muscle cells, there is a typical switch in actin expression with a predominance of the beta-form and a noticeable amount of gamma-form. This pattern of actin expression represents a new reliable protein-chemical marker of experimental and human atheromatous smooth muscle cells. Images PMID:6690475

  1. Long-Term Expression of Human Adenosine Deaminase in Vascular Smooth Muscle Cells of Rats: A Model for Gene Therapy

    NASA Astrophysics Data System (ADS)

    Lynch, Carmel M.; Clowes, Monika M.; Osborne, William R. A.; Clowes, Alexander W.; Dusty Miller, A.

    1992-02-01

    Gene transfer into vascular smooth muscle cells in animals was examined by using recombinant retroviral vectors containing an Escherichia coli β-galactosidase gene or a human adenosine deaminase (adenosine aminohydrolase, EC 3.5.4.4) gene. Direct gene transfer by infusion of virus into rat carotid arteries was not observed. However, gene transfer by infection of smooth muscle cells in culture and seeding of the transduced cells onto arteries that had been denuded of endothelial cells was successful. Potentially therapeutic levels of human adenosine deaminase activity were detected over 6 months of observation, indicating the utility of vascular smooth muscle cells for gene therapy in humans.

  2. Diet and the development of the human intestinal microbiome

    PubMed Central

    Voreades, Noah; Kozil, Anne; Weir, Tiffany L.

    2014-01-01

    The important role of the gut microbiome in maintaining human health has necessitated a better understanding of the temporal dynamics of intestinal microbial communities as well as the host and environmental factors driving these dynamics. Genetics, mode of birth, infant feeding patterns, antibiotic usage, sanitary living conditions and long term dietary habits contribute to shaping the composition of the gut microbiome. This review focuses primarily on diet, as it is one of the most pivotal factors in the development of the human gut microbiome from infancy to the elderly. The infant gut microbiota is characterized by a high degree of instability, only reaching a state similar to that of adults by 2–3 years of age; consistent with the establishment of a varied solid food diet. The diet-related factors influencing the development of the infant gut microbiome include whether the child is breast or formula-fed as well as how and when solid foods are introduced. In contrast to the infant gut, the adult gut microbiome is resilient to large shifts in community structure. Several studies have shown that dietary changes induce transient fluctuations in the adult microbiome, sometimes in as little as 24 h; however, the microbial community rapidly returns to its stable state. Current knowledge of how long-term dietary habits shape the gut microbiome is limited by the lack of long-term feeding studies coupled with temporal gut microbiota characterization. However, long-term weight loss studies have been shown to alter the ratio of the Bacteroidetes and Firmicutes, the two major bacterial phyla residing in the human gastrointestinal tract. With aging, diet-related factors such as malnutrition are associated with microbiome shifts, although the cause and effect relationship between these factors has not been established. Increased pharmaceutical usage is also more prevalent in the elderly and can contribute to reduced gut microbiota stability and diversity. Foods containing

  3. Transformation of trollioside and isoquercetin by human intestinal flora in vitro.

    PubMed

    Yuan, Ming; Shi, Duo-Zhi; Wang, Teng-Yu; Zheng, Shi-Qi; Liu, Li-Jia; Sun, Zhen-Xiao; Wang, Ru-Feng; Ding, Yi

    2016-03-01

    The present study was designed to determine the intestinal bacterial metabolites of trollioside and isoquercetin and their antibacterial activities. A systematic in vitro biotransformation investigation on trollioside and isoquercetin, including metabolite identification, metabolic pathway deduction, and time course, was accomplished using a human intestinal bacterial model. The metabolites were analyzed and identified by HPLC and HPLC-MS. The antibacterial activities of trollioside, isoquercetin, and their metabolites were evaluated using the broth microdilution method with berberine as a positive control, and their potency was measured as minimal inhibitory concentration (MIC). Our results indicated that trollioside and isoquercetin were metabolized by human intestinal flora through O-deglycosylation, yielding aglycones proglobeflowery acid and quercetin, respectively The antibacterial activities of both metabolites were more potent than that of their parent compounds. In conclusion, trollioside and isoquercetin are totally and rapidly transformed by human intestinal bacteria in vitro and the transformation favors the improvement of the antibacterial activities of the parent compounds. PMID:27025369

  4. Nitric Oxide-mediated Relaxation by High K in Human Gastric Longitudinal Smooth Muscle.

    PubMed

    Kim, Young Chul; Choi, Woong; Yun, Hyo-Young; Sung, Rohyun; Yoo, Ra Young; Park, Seon-Mee; Yun, Sei Jin; Kim, Mi-Jung; Song, Young-Jin; Xu, Wen-Xie; Lee, Sang Jin

    2011-12-01

    This study was designed to elucidate high-K(+)induced response of circular and longitudinal smooth muscle from human gastric corpus using isometric contraction. Contraction from circular and longitudinal muscle stripes of gastric corpus greater curvature and lesser curvature were compared. Circular smooth muscle from corpus greater curvature showed high K(+) (50 mM)-induced tonic contraction. On the contrary, however, longitudinal smooth muscle strips showed high K(+) (50 mM)-induced sustained relaxation. To find out the reason for the discrepancy we tested several relaxation mechanisms. Protein kinase blockers like KT5720, PKA inhibitor, and KT5823, PKG inhibitor, did not affect high K(+)-induced relaxation. K(+) channel blockers like tetraethylammonium (TEA), apamin (APA), glibenclamide (Glib) and barium (Ba(2+)) also had no effect. However, N(G)-nitro-L-arginine (L-NNA) and 1H-(1,2,4) oxadiazolo (4,3-A) quinoxalin-1-one (ODQ), an inhibitor of soluble guanylate cyclase (sGC) and 4-AP (4-aminopyridine), voltage-dependent K(+) channel (K(V)) blocker, inhibited high K(+)-induced relaxation, hence reversing to tonic contraction. High K(+)-induced relaxation was observed in gastric corpus of human stomach, but only in the longitudinal muscles from greater curvature not lesser curvature. L-NNA, ODQ and K(V) channel blocker sensitive high K(+)-induced relaxation in longitudinal muscle of higher portion of corpus was also observed. These results suggest that longitudinal smooth muscle from greater curvature of gastric corpus produced high K(+)-induced relaxation which was activated by NO/sGC pathway and by K(V) channel dependent mechanism. PMID:22359479

  5. Inhibitory effects of SKF96365 on the activities of K+ channels in mouse small intestinal smooth muscle cells

    PubMed Central

    TANAHASHI, Yasuyuki; WANG, Ban; MURAKAMI, Yuri; UNNO, Toshihiro; MATSUYAMA, Hayato; NAGANO, Hiroshi; KOMORI, Seiichi

    2015-01-01

    In order to investigate the effects of SKF96365 (SKF), which is a non-selective cationic channel blocker, on K+ channel currents, we recorded currents through ATP sensitive K+ (IKATP), voltage-gated K+ (IKv) and Ca2+ activated K+ channels (IBK) in the absence and presence of SKF in single small intestinal myocytes of mice with patch-clamp techniques. SKF (10 µM) reversibly abolished IKATP that was induced by cromakalim (10 µM), which is a selective ATP sensitive K+ channel opener. These inhibitory effects were induced in a concentration-dependent and voltage-independent manner. The 50% inhibitory concentration (IC50) was 0.85 µM, which was obviously lower than that reported for the muscarinic cationic current. In addition, SKF (1 µM ≈ the IC50 value in IKATP suppression) reversibly inhibited the IKv that was induced by repetitive depolarizing pulses from −80 to 20 mV. However, the extent of the inhibitory effects was only ~30%. In contrast, SKF (1 µM) had no significant effects on spontaneous transient IBK and caffeine-induced IBK. These results indicated that SKF inhibited ATP sensitive K+ channels and voltage-gated K+ channels, with the ATP sensitive K+ channels being more sensitive than the voltage-gated K+ channels. These inhibitory effects on K+ channels should be considered when SKF is used as a cationic channel blocker. PMID:26498720

  6. Smooth Muscle Precursor Cells Derived from Human Pluripotent Stem Cells for Treatment of Stress Urinary Incontinence.

    PubMed

    Wang, Zhe; Wen, Yan; Li, Yan Hui; Wei, Yi; Green, Morgaine; Wani, Prachi; Zhang, Pengbo; Pera, Renee Reijo; Chen, Bertha

    2016-03-15

    There is great interest in using stem cells (SC) to regenerate a deficient urethral sphincter in patients with urinary incontinence. The smooth muscle component of the sphincter is a significant contributor to sphincter function. However, current translational efforts for sphincter muscle restoration focus only on skeletal muscle regeneration because they rely on adult mesenchymal SC as cell source. These adult SC do not yield sufficient smooth muscle cells (SMCs) for transplantation. We may be able to overcome this limitation by using pluripotent stem cell (PSC) to derive SMCs. Hence, we sought to investigate whether smooth muscle precursor cells (pSMCs) derived from human PSCs can restore urethral function in an animal model generated by surgical urethrolysis and ovariectomy. Rats were divided into four groups: control (no intervention), sham saline (surgery + saline injection), bladder SMC (surgery + human bladder SMC injection), and treatment (surgery + pSMC injection, which includes human embryonic stem cell (hESC) H9-derived pSMC, episomal reprogrammed induced pluripotent stem cells (iPSCs)-derived pSMC, or viral reprogrammed iPSC-derived pSMC). pSMCs (2 × 10(6) cells/rat) were injected periurethrally 3 weeks postsurgery. Leak point pressure (LPP) and baseline external urethral sphincter electromyography were measured 5 weeks postinjection. Both iPSC-derived pSMC treatment groups showed significantly higher LPP compared to the sham saline group, consistent with restoration of urethral sphincter function. While the difference between the H9-derived pSMC treatment and sham saline group was not significant, it did show a trend toward restoration of the LPP to the level of intact controls. Our data indicate that pSMCs derived from human PSCs (hESC and iPSC) can restore sphincter function. PMID:26785911

  7. Smooth Muscle Precursor Cells Derived from Human Pluripotent Stem Cells for Treatment of Stress Urinary Incontinence

    PubMed Central

    Wang, Zhe; Li, Yan Hui; Wei, Yi; Green, Morgaine; Wani, Prachi; Zhang, Pengbo; Pera, Renee Reijo; Chen, Bertha

    2016-01-01

    There is great interest in using stem cells (SC) to regenerate a deficient urethral sphincter in patients with urinary incontinence. The smooth muscle component of the sphincter is a significant contributor to sphincter function. However, current translational efforts for sphincter muscle restoration focus only on skeletal muscle regeneration because they rely on adult mesenchymal SC as cell source. These adult SC do not yield sufficient smooth muscle cells (SMCs) for transplantation. We may be able to overcome this limitation by using pluripotent stem cell (PSC) to derive SMCs. Hence, we sought to investigate whether smooth muscle precursor cells (pSMCs) derived from human PSCs can restore urethral function in an animal model generated by surgical urethrolysis and ovariectomy. Rats were divided into four groups: control (no intervention), sham saline (surgery + saline injection), bladder SMC (surgery + human bladder SMC injection), and treatment (surgery + pSMC injection, which includes human embryonic stem cell (hESC) H9-derived pSMC, episomal reprogrammed induced pluripotent stem cells (iPSCs)-derived pSMC, or viral reprogrammed iPSC-derived pSMC). pSMCs (2 × 106 cells/rat) were injected periurethrally 3 weeks postsurgery. Leak point pressure (LPP) and baseline external urethral sphincter electromyography were measured 5 weeks postinjection. Both iPSC-derived pSMC treatment groups showed significantly higher LPP compared to the sham saline group, consistent with restoration of urethral sphincter function. While the difference between the H9-derived pSMC treatment and sham saline group was not significant, it did show a trend toward restoration of the LPP to the level of intact controls. Our data indicate that pSMCs derived from human PSCs (hESC and iPSC) can restore sphincter function. PMID:26785911

  8. Robust derivation of epicardium and its differentiated smooth muscle cell progeny from human pluripotent stem cells.

    PubMed

    Iyer, Dharini; Gambardella, Laure; Bernard, William G; Serrano, Felipe; Mascetti, Victoria L; Pedersen, Roger A; Talasila, Amarnath; Sinha, Sanjay

    2015-04-15

    The epicardium has emerged as a multipotent cardiovascular progenitor source with therapeutic potential for coronary smooth muscle cell, cardiac fibroblast (CF) and cardiomyocyte regeneration, owing to its fundamental role in heart development and its potential ability to initiate myocardial repair in injured adult tissues. Here, we describe a chemically defined method for generating epicardium and epicardium-derived smooth muscle cells (EPI-SMCs) and CFs from human pluripotent stem cells (HPSCs) through an intermediate lateral plate mesoderm (LM) stage. HPSCs were initially differentiated to LM in the presence of FGF2 and high levels of BMP4. The LM was robustly differentiated to an epicardial lineage by activation of WNT, BMP and retinoic acid signalling pathways. HPSC-derived epicardium displayed enhanced expression of epithelial- and epicardium-specific markers, exhibited morphological features comparable with human foetal epicardial explants and engrafted in the subepicardial space in vivo. The in vitro-derived epicardial cells underwent an epithelial-to-mesenchymal transition when treated with PDGF-BB and TGFβ1, resulting in vascular SMCs that displayed contractile ability in response to vasoconstrictors. Furthermore, the EPI-SMCs displayed low density lipoprotein uptake and effective lowering of lipoprotein levels upon treatment with statins, similar to primary human coronary artery SMCs. Cumulatively, these findings suggest that HPSC-derived epicardium and EPI-SMCs could serve as important tools for studying human cardiogenesis, and as a platform for vascular disease modelling and drug screening. PMID:25813541

  9. Expression of TRPC homologs in endothelial cells and smooth muscle layers of human arteries.

    PubMed

    Yip, Ham; Chan, Wing-Yee; Leung, Pan-Cheung; Kwan, Hiu-Yee; Liu, Cuiling; Huang, Yu; Michel, Villaz; Yew, David Tai-Wai; Yao, Xiaoqiang

    2004-12-01

    TRPC channels are a group of Ca(2+)-permeable nonselective cation channels that mediate store-operated and/or agonist-stimulated Ca(2+) influx in a variety of cell types. In this study, we extensively examined the expression patterns of TRPC homologs in human vascular tissues. RT-PCR amplified cDNA fragments of TRPC1 (505 bp), TRPC3 (372 bp), TRPC4 (499 bp), TRPC5 (325 bp), TRPC6 (509 bp), and TRPC7 (187 bp) from RNA isolated from cultured human coronary artery endothelial cells. In situ hybridization yielded strong labeling of TRPC1,3-6 in the endothelial and smooth muscle cells of human coronary and cerebral arteries. TRPC7 labeling was exclusively found in endothelial cells but not in smooth muscle cells. Results from immunohistochemical staining were consistent with those from in situ hybridization. Similar expression patterns of TRPC homologs were also observed in arterioles and vaso vasora. In conclusion, our study indicates that TRPC homologs are widely expressed in human vessels of all calibers, including medium-sized coronary arteries and cerebral arteries, smaller-sized resistance arteries, and vaso vasora. These results suggest a ubiquitous role of TRPC homologs in regulating blood supply to different regions and in controlling arterial blood pressure. PMID:15538613

  10. Regional distribution of solute carrier mRNA expression along the human intestinal tract.

    PubMed

    Meier, Yvonne; Eloranta, Jyrki J; Darimont, Jutta; Ismair, Manfred G; Hiller, Christian; Fried, Michael; Kullak-Ublick, Gerd A; Vavricka, Stephan R

    2007-04-01

    Intestinal absorption of drugs, nutrients, and other compounds is mediated by uptake transporters expressed at the apical enterocyte membrane. These compounds are returned to the intestinal lumen or released into portal circulation by intestinal efflux transporters expressed at apical or basolateral membranes, respectively. One important transporter superfamily, multiple members of which are intestinally expressed, are the solute carriers (SLCs). SLC expression levels may determine the pharmacokinetics of drugs that are substrates of these transporters. In this study we characterize the distribution of 15 human SLC transporter mRNAs in histologically normal biopsies from five regions of the intestine of 10 patients. The mRNA expression levels of CNT1, CNT2, apical sodium-dependent bile acid transporter (ABST), serotonin transporter (SERT), PEPT1, and OCTN2 exhibit marked differences between different regions of the intestine: the first five are predominantly expressed in the small intestine, whereas OCTN2 exhibits strongest expression in the colon. Two transporter mRNAs studied (OCTN1, OATP2B1) are expressed at similar levels in all gut sections. In addition, ENT2 mRNA is present at low levels across the colon, but not in the small intestine. The other six SLC mRNAs studied are not expressed in the intestine. Quantitative knowledge of transporter expression levels in different regions of the human gastrointestinal tract could be useful for designing intestinal delivery strategies for orally administered drugs. Furthermore, changes in transporter expression that occur in pathological states, such as inflammatory bowel disease, can now be defined more precisely by comparison with the expression levels measured in healthy individuals. PMID:17220238

  11. In vitro effects of bethanechol on specimens of intestinal smooth muscle obtained from the duodenum and jejunum of healthy dairy cows

    PubMed Central

    Pfeiffer, Julia B. R.; Mevissen, Meike; Steiner, Adrian; Portier, Christopher J.; Meylan, Mireille

    2009-01-01

    Objective To describe the in vitro effects of bethanechol on contractility of smooth muscle preparations from the small intestines of healthy cows and define the muscarinic receptor subtypes involved in mediating contraction. Sample Population Tissue samples from the duodenum and jejunum collected immediately after slaughter of 40 healthy cows. Procedures Cumulative concentration-response curves were determined for the muscarinic receptor agonist bethanechol with or without prior incubation with subtype-specific receptor antagonists in an organ bath. Effects of bethanechol and antagonists and the influence of intestinal location on basal tone, maximal amplitude (Amax), and area under the curve (AUC) were evaluated. Results Bethanechol induced a significant, concentration-dependent increase in all preparations and variables. The effect of bethanechol was more pronounced in jejunal than in duodenal samples and in circular than in longitudinal preparations. Significant inhibition of the effects of bethanechol was observed after prior incubation with muscarinic receptor subtype M3 antagonists (more commonly for basal tone than for Amax and AUC). The M2 receptor antagonists partly inhibited the response to bethanechol, especially for basal tone. The M3 receptor antagonists were generally more potent than the M2 receptor antagonists. In a protection experiment, an M3 receptor antagonist was less potent than when used in combination with an M2 receptor antagonist. Receptor antagonists for M1 and M4 did not affect contractility variables. Conclusions and Clinical Relevance Bethanechol acting on muscarinic receptor subtypes M2 and M3 may be of clinical use as a prokinetic drug for motility disorders of the duodenum and jejunum in dairy cows. PMID:17331022

  12. A breakdown in communication? Understanding the effects of aging on the human small intestine epithelium

    PubMed Central

    2015-01-01

    In the intestine, a single layer of epithelial cells sealed together at their apical surfaces by tight junctions helps to prevent the luminal commensal and pathogenic micro-organisms and their toxins from entering host tissues. The intestinal epithelium also helps to maintain homoeostasis in the mucosal immune system by expressing anti-inflammatory cytokines in the steady state and inflammatory cytokines in response to pathogens. Although the function of the mucosal immune system is impaired in elderly humans, the molecular mechanisms which cause this dramatic functional decline are poorly understood. Our current understanding of the effects of aging on the physical and immunological properties of the intestinal epithelial barrier is also very limited. In this issue of Clinical Science, Man et al. provide further insight into the effects of aging on small intestinal barrier function in humans and the influence that gut luminal micro-organisms may have on it. Using human terminal ileal biopsy tissues they show that intestinal permeability to solutes, but not macromolecules, was significantly increased in the intestines of elderly humans. This was accompanied by elevated expression of the pro-inflammatory cytokine interleukin (IL)-6 which appeared to modulate claudin-2 expression and solute permeability in the epithelium. Conversely, IL-8 synthesis in response to flagellin stimulation was reduced in intestines of the elderly subjects, but was not associated with effects on Toll-like receptor 5 (TLR5) expression. These data provide an important advance in our understanding on the effects of aging on intestinal permeability and innate mucosal immune responsiveness in elderly humans. PMID:26186738

  13. Heparin fragments inhibit human vascular smooth muscle cell proliferation in vitro

    SciTech Connect

    Selden, S.C.; Johnson, W.V.; Maciag, T.

    1986-03-01

    The authors have examined the effect of heparin on human abdominal aortic smooth muscle cell growth. Cell proliferation was inhibited by more than 90% at a concentration of 20 ..mu..g/ml in a 12 day growth assay using heparin from Sigma, Upjohn or Calbiochem. Additionally, 200 ..mu..g/ml Upjohn heparin inhibits /sup 3/H-thymidine incorporation by 50% in short term assays using serum or purified platelet-derived growth factor (25-100ng/ml) to initiate the cell cycle. Homogeneous size classes of heparin fragments were prepared by nitrous acid cleavage and BioGel P-10 filtration chromatography. Deca-, octa-, hexa-, tetra-, and di-saccharides inhibited proliferation by 90% at concentrations of 280, 320, 260, 180 and 100 ..mu..g/ml, respectively, in a 12 day growth assay. These data confirm the work of Castellot et.al. and extend the range of inhibitory fragments down to the tetra- and di-saccharide size. These data suggest, therefore, that di-saccharide subunit of heparin is sufficient to inhibit vascular smooth muscle cell proliferation. The authors are now examining the role of the anhydromannose moiety on the reducing end of the nitrous acid generated fragments as a possible mediator of heparin-induced inhibition of vascular smooth muscle cell proliferation.

  14. A Sensitive Medium-Throughput Method to Predict Intestinal Absorption in Humans Using Rat Intestinal Tissue Segments.

    PubMed

    Da Silva, Laís Cristina; Da Silva, Taynara Lourenço; Antunes, Alisson Henrique; Rezende, Kênnia Rocha

    2015-09-01

    A range of in vitro, ex vivo, and in vivo approaches are currently used for drug development. Highly predictive human intestinal absorption models remain lagging behind the times because of numerous variables concerning permeability through gastrointestinal tract in humans. However, there is a clear need for a drug permeability model early in the drug development process that can balance the requirements for high throughput and effective predictive potential. The present study developed a medium throughput screening Snapwell (MTS-Snapwell) ex vivo model to provide an alternative method to classify drug permeability. Rat small intestine tissue segments were mounted in commercial Snapwell™ inserts. Unidirectional drug transport (A-B) was measured by collecting samples at different time points. Viability of intestinal tissue segments was measured by examining transepithelial electric resistance (TEER) and phenol red and caffeine transport. As a result, the apparent permeability (Papp; ×10(-6) cm/s) was determined for atenolol (10.7 ± 1.2), caffeine (17.6 ± 3.1), cimetidine (6.9 ± 0.1), metoprolol (12.6 ± 0.7), theophylline (15.3 ± 1.6) and, ranitidine (3.8 ± 0.4). All drugs were classified in high/low permeability according to Biopharmaceutics Classification System showing high correlation with human data (r = 0.89). These findings showed a high correlation with human data (r = 0.89), suggesting that this model has potential predictive capacity for paracellular and transcellular passively absorbed molecules. PMID:25690454

  15. Fluid flow releases fibroblast growth factor-2 from human aortic smooth muscle cells

    NASA Technical Reports Server (NTRS)

    Rhoads, D. N.; Eskin, S. G.; McIntire, L. V.

    2000-01-01

    This study tested the hypothesis that fluid shear stress regulates the release of fibroblast growth factor (FGF)-2 from human aortic smooth muscle cells. FGF-2 is a potent mitogen that is involved in the response to vascular injury and is expressed in a wide variety of cell types. FGF-2 is found in the cytoplasm of cells and outside cells, where it associates with extracellular proteoglycans. To test the hypothesis that shear stress regulates FGF-2 release, cells were exposed to flow, and FGF-2 amounts were measured from the conditioned medium, pericellular fraction (extracted by heparin treatment), and cell lysate. Results from the present study show that after 15 minutes of shear stress at 25 dyne/cm(2) in a parallel-plate flow system, a small but significant fraction (17%) of the total FGF-2 was released from human aortic smooth muscle cells. FGF-2 levels in the circulating medium increased 10-fold over medium from static controls (P<0.01). A 50% increase in FGF-2 content versus control (P<0.01) was found in the pericellular fraction (extracted by heparin treatment). Furthermore, a significant decrease in FGF-2 was detected in the cell lysate, indicating that FGF-2 was released from inside the cell. Cell permeability studies with fluorescent dextran were performed to examine whether transient membrane disruption caused FGF-2 release. Flow cytometry detected a 50% increase in mean fluorescence of cells exposed to 25 dyne/cm(2) versus control cells. This indicates that the observed FGF-2 release from human aortic smooth muscle cells is likely due to transient membrane disruption on initiation of flow.

  16. Effects of cobalt chloride on phenotypes of normal human saphenous vein smooth muscle cells

    PubMed Central

    Li, Jing; Wang, Huai-Ming

    2014-01-01

    To explore the cellular adaptations and responses to hypoxia in normal human saphenous vein smooth muscle cells (SMCs) and presume what roles phenotypic modulation of normal human saphenous vein SMCs would play in varicose vein of lower extremity, we used cobalt chloride (CoCl2), a hypoxia mimetic, to treat normal human saphenous vein SMCs in vitro. The proliferating ability of cells exposed to serial dilutions of CoCl2 (0, 200, 300, 400 and 500 μM) at 24 h, 48 h and 72 h respectively was detected by MTT assay. Wound healing assay was used to observe the migrating ability of cells under CoCl2 (200 μM) treatment for 8 days continuously. Hoechst 33258 stain was used to determine whether hypoxia induced by CoCl2 could cause apoptosis of normal human saphenous vein SMCs. We found that CoCl2 enhanced the proliferation and inhibited the migration of normal human saphenous vein SMCs. The apparent morphous of normal human saphenous vein SMCs under chronic CoCl2 treatment was significantly changed compared to no CoCl2 treated control, but this process did not relate to cell apoptosis. To conclude, our results support the concept that the phenotypes of normal human saphenous vein SMCs could be influenced by hypoxia stimulus. Cellular structural and functional changes under chronic hypoxia in normal human saphenous vein SMCs might play important roles in the development of varicose veins of lower extremity. PMID:25663990

  17. Effects of cobalt chloride on phenotypes of normal human saphenous vein smooth muscle cells.

    PubMed

    Li, Jing; Wang, Huai-Ming

    2014-01-01

    To explore the cellular adaptations and responses to hypoxia in normal human saphenous vein smooth muscle cells (SMCs) and presume what roles phenotypic modulation of normal human saphenous vein SMCs would play in varicose vein of lower extremity, we used cobalt chloride (CoCl2), a hypoxia mimetic, to treat normal human saphenous vein SMCs in vitro. The proliferating ability of cells exposed to serial dilutions of CoCl2 (0, 200, 300, 400 and 500 μM) at 24 h, 48 h and 72 h respectively was detected by MTT assay. Wound healing assay was used to observe the migrating ability of cells under CoCl2 (200 μM) treatment for 8 days continuously. Hoechst 33258 stain was used to determine whether hypoxia induced by CoCl2 could cause apoptosis of normal human saphenous vein SMCs. We found that CoCl2 enhanced the proliferation and inhibited the migration of normal human saphenous vein SMCs. The apparent morphous of normal human saphenous vein SMCs under chronic CoCl2 treatment was significantly changed compared to no CoCl2 treated control, but this process did not relate to cell apoptosis. To conclude, our results support the concept that the phenotypes of normal human saphenous vein SMCs could be influenced by hypoxia stimulus. Cellular structural and functional changes under chronic hypoxia in normal human saphenous vein SMCs might play important roles in the development of varicose veins of lower extremity. PMID:25663990

  18. The role of disulphide bonds in human intestinal mucin

    PubMed Central

    Forstner, Janet F.; Jabbal, Inderjit; Qureshi, Rauf; Kells, David I. C.; Forstner, Gordon G.

    1979-01-01

    Goblet-cell mucin (mucin 1) was isolated and purified from human small-intestinal scrapings. After application of mucin 1 to DEAE-Bio-Gel (A) columns, most of the glycoprotein (76–94% of hexoses) was eluted in the first peak (designated mucin 2). Minor amounts of acidic glycoproteins were eluted with 0.2m- and 0.4m-NaCl in later peaks. Analyses of mucin 1 and mucin 2 revealed mucin 2 to be a monodisperse highly glycosylated glycoprotein containing 6.3% by wt. of protein, N-acetylgalactosamine, N-acetylglucosamine, galactose and fucose. Mucin 1 was similar in composition, but was polydisperse and contained more protein (12.3% by wt.) as well as N-acetylneuraminic acid. Analytical CsCl-gradient ultracentrifugation showed both mucin 1 and mucin 2 to have a major component with an average buoyant density of 1.47000g/ml. Mucin 1 also contained a slightly less-dense minor glycoprotein component. After exhaustive reduction and alkylation mucin 1 retained its major component, but partly dissociated into two lighter glycoprotein components. Mucin 2, in contrast, did not change its density distribution after reduction. Band ultracentrifugation in 2H2O-containing iso-osmotic buffers showed that mucin 1 contained a major fast-sedimenting component (so=37±2S), and a minor amount of a slower-sedimenting component. After reduction there was an increased quantity of the latter component, for which an so value of 14.5S was calculated. In contrast, mucin 2 was unaltered by reduction (so=33±2S). These findings indicate that the major component of goblet-cell mucin (mucin 2) does not dissociate after S–S-bond reduction, and thus does not apparently rely for its polymeric structure on the association of subunits through covalent disulphide bonds. However, the effects of reduction on mucin 1 suggest that in the native mucin intramolecular disulphide bonds in the minor glycoproteins may stabilize their structure, permitting secondary non-covalent interactions to develop with the

  19. The smooth muscle relaxant effect of hydrogen sulphide in vitro: evidence for a physiological role to control intestinal contractility

    PubMed Central

    Teague, B; Asiedu, S; Moore, P K

    2002-01-01

    Sodium hydrogen sulphide (NaHS), a donor of hydrogen sulphide (H2S), produced dose-related relaxation of the rabbit isolated ileum (EC50, 76.4±7.9 μM) and rat vas deferens (EC50, 64.8±5.4 μM) and reduced ACh-mediated contraction of the guinea-pig isolated ileum. NaHS also reduced the response of the guinea-pig (EC50, 80.0±5.7 μM) and rat (EC50, 108.2±11.2 μM) ileum preparations to electrical stimulation of the intramural nerves. In guinea-pig ileum this effect was spontaneously reversible and mimicked by sodium nitroprusside (SNP, EC50, 2.1 μM). Combination of NaHS (20 μM) with SNP (0.5 μM) produced a greater than additive inhibition of the twitch response of the ileum to electrical stimulation. The inhibitory effect of NaHS on the field-stimulated guinea-pig ileum was unaffected by pretreatment with L-NAME (100 μM), indomethacin (10 μM), naloxone (1 μM) or glibenclamide (100 μM). Furthermore, NaHS (200 μM) did not affect the contractile response of the ileum to KCl (10 to 60 mM). Propargylglycine (PAG, 1 mM) and β-cyanoalanine (BCA, 1 mM) (inhibitors of cystathionine-γ-lyase) but not aminooxyacetic acid (AOAA, 1 mM) (inhibitor of cystathionine-β-synthetase) caused a slowly developing increase in the contraction of the guinea-pig ileum to field stimulation. This effect was reversed by cysteine (1 mM). These results show that NaHS relaxes gastrointestinal and urogenital smooth muscle and suggest that H2S is responsible for these effects. The possibility that endogenous H2S, formed as a consequence of activation of intramural nerves, plays a part in controlling the contractility of the guinea-pig ileum is discussed. PMID:12208769

  20. Immunocytochemical localization of 140 kD cell adhesion molecules in cultured chicken fibroblasts, and in chicken smooth muscle and intestinal epithelial tissues.

    PubMed

    Chen, W T; Greve, J M; Gottlieb, D I; Singer, S J

    1985-06-01

    A monoclonal antibody (JG22 MAb) that was previously raised to a chick embryo myogenic cell preparation had been shown to produce rounding and other morphological changes in myogenic cells in culture, and, in some cases, their detachment from the substratum. In other studies it was shown that the epitope recognized by JG22 was associated with a set of 140 kD cell surface glycoproteins. It is shown that this antigen occurs in a wide variety of cell types; in cultured fibroblasts, it is distributed equally between the dorsal and ventral cell surfaces shortly after plating, but appears to become concentrated on the ventral surface as cell spreading proceeds; by immunoelectron microscopic labeling experiments, it is absent from the focal adhesion contact sites formed by fibroblasts with their substrata and with one another, but is present in clusters at the edge of focal adhesions, and within the close contact sites and extracellular matrix contact sites; in smooth muscle cells, it is absent from the membrane-associated dense plaques, but is located in clusters at adjacent membrane sites; in intestinal epithelium, it is present in clusters at the basolateral membranes, but not at the microvilli or within junctional complexes of the brush border of the cell layers. These and other results are consistent with the suggestion that the antigen recognized by JG22 MAb is important cell adhesion molecules, and performs a characteristic function in a variety of cell-cell contacts and cell adhesions. PMID:3889142

  1. Development of Functional Microfold (M) Cells from Intestinal Stem Cells in Primary Human Enteroids

    PubMed Central

    Rouch, Joshua D.; Scott, Andrew; Lei, Nan Ye; Solorzano-Vargas, R. Sergio; Wang, Jiafang; Hanson, Elaine M.; Kobayashi, Masae; Lewis, Michael; Stelzner, Matthias G.; Dunn, James C. Y.; Eckmann, Lars; Martín, Martín G.

    2016-01-01

    Background & Aims Intestinal microfold (M) cells are specialized epithelial cells that act as gatekeepers of luminal antigens in the intestinal tract. They play a critical role in the intestinal mucosal immune response through transport of viruses, bacteria and other particles and antigens across the epithelium to immune cells within Peyer’s patch regions and other mucosal sites. Recent studies in mice have demonstrated that M cells are generated from Lgr5+ intestinal stem cells (ISCs), and that infection with Salmonella enterica serovar Typhimurium increases M cell formation. However, it is not known whether and how these findings apply to primary human small intestinal epithelium propagated in an in vitro setting. Methods Human intestinal crypts were grown as monolayers with growth factors and treated with recombinant RANKL, and assessed for mRNA transcripts, immunofluorescence and uptake of microparticles and S. Typhimurium. Results Functional M cells were generated by short-term culture of freshly isolated human intestinal crypts in a dose- and time-dependent fashion. RANKL stimulation of the monolayer cultures caused dramatic induction of the M cell-specific markers, SPIB, and Glycoprotein-2 (GP2) in a process primed by canonical WNT signaling. Confocal microscopy demonstrated a pseudopod phenotype of GP2-positive M cells that preferentially take up microparticles. Furthermore, infection of the M cell-enriched cultures with the M cell-tropic enteric pathogen, S. Typhimurium, led to preferential association of the bacteria with M cells, particularly at lower inoculum sizes. Larger inocula caused rapid induction of M cells. Conclusions Human intestinal crypts containing ISCs can be cultured and differentiate into an epithelial layer with functional M cells with characteristic morphological and functional properties. This study is the first to demonstrate that M cells can be induced to form from primary human intestinal epithelium, and that S. Typhimurium

  2. Comparison of human liver and small intestinal glutathione S-transferase-catalyzed busulfan conjugation in vitro.

    PubMed

    Gibbs, J P; Yang, J S; Slattery, J T

    1998-01-01

    The apparent oral clearance of busulfan has been observed to vary as much as 10-fold in the population of children and adults receiving high-dose busulfan. The only identified elimination pathway for busulfan involves glutathione conjugation. The reaction is predominantly catalyzed by glutathione S-transferase (GST) A1-1, which is present in both liver and intestine. The purpose of this study was to compare busulfan Vmax/Km in cytosol prepared from adult human liver and small intestine. Tetrahydrothiophenium ion formation rate per milligram of cytosolic protein was constant along the length (assessed in 30-cm segments) of three individual small intestines. A 30-cm-long intestinal segment 90-180 cm from the pylorus was chosen to be representative of intestinal cytosolic busulfan conjugating activity. Busulfan Vmax/Km (mean +/- SD) in cytosol prepared from 23 livers and 12 small intestines was 0.166 +/- 0.066 and 0.176 +/- 0.085 microl/min/mg cytosolic protein, respectively, in incubations with 5 microM busulfan, 1 mM glutathione, and 2 mg of cytosolic protein. The relative content of GSTalpha (A1-1, A1-2, and A2-2) was compared for human liver and intestinal cytosol using Western blot. The levels of GSTalpha in liver and intestinal cytosol were 1.12 +/- 0.56 and 1.36 +/- 0.32 integrated optimal density units/5 microg cytosolic protein, respectively. Busulfan conjugation in vitro was comparable per milligram of cytosolic protein in liver and intestinal cytosol. PMID:9443852

  3. Enhanced capacitative calcium entry and TRPC channel gene expression in human LES smooth muscle.

    PubMed

    Wang, Jian; Laurier, Lisanne G; Sims, Stephen M; Preiksaitis, Harold G

    2003-06-01

    Transient receptor potential channel (TRPC) genes encode Ca(2+)-permeable channels mediating capacitative Ca(2+) entry (CCE), which maintains intracellular Ca(2+) stores. We compared TRPC gene expression and CCE in human esophageal body (EB) and lower esophageal sphincter (LES), because these smooth muscles have distinct contractile functions that are likely associated with different Ca(2+) regulatory mechanisms. Circular layer smooth muscle cells were grown in primary culture. Transcriptional expression of TRPC genes was compared by semiquantitative RT-PCR. CCE was measured by fura 2 Ca(2+) fluorescence after blockade of sarcoplasmic reticulum Ca(2+)-ATPase with thapsigargin. mRNA for TRPC1, TRPC3, TRPC4, TRPC5, and TRPC6 was identified in EB and LES. TRPC3 and TRPC4 were more abundant in LES than EB. Basal concentration of free intracellular Ca(2+) ([Ca(2+)](i)) was similar in cells from LES (138 +/- 8 nmol/l) and EB (110 +/- 6 nmol/l) and increased with ACh (10 micromol/l; 650 +/- 28 and 590 +/- 21 nmol/l, respectively). With zero Ca(2+) in bath, thapsigargin (2 micromol/l) increased [Ca(2+)](i) more in LES (550 +/- 22 nmol/l) than EB (250 +/- 15 nmol/l, P < 0.001). Subsequent external application of 1 mmol/l Ca(2+) increased [Ca(2+)](i) more in LES (585 +/- 35 nmol/l) than EB (295 +/- 21 nmol/l, P < 0.001), indicating enhanced CCE in LES. This demonstrates CCE and TRPC transcriptional expression in human esophageal smooth muscle. In LES cells, enhanced CCE and expression of TRPC3 and TRPC4 may contribute to the physiological characteristics that distinguish LES from EB. PMID:12736151

  4. Inhibition of smooth muscle force generation by focal adhesion kinase inhibitors in the hyperplastic human prostate.

    PubMed

    Kunit, Thomas; Gratzke, Christian; Schreiber, Andrea; Strittmatter, Frank; Waidelich, Raphaela; Rutz, Beata; Loidl, Wolfgang; Andersson, Karl-Erik; Stief, Christian G; Hennenberg, Martin

    2014-10-01

    Smooth muscle contraction may be critical for lower urinary tract symptoms (LUTS) in patients with benign prostate hyperplasia and requires stable anchorage of the cytoskeleton to the cell membrane. These connections are regulated by focal adhesion kinase (FAK). Here, we addressed the involvement of FAK in the regulation of smooth muscle contraction in hyperplastic human prostate tissues. Prostate tissues were obtained from radical prostatectomy. Expression of FAK and focal adhesion proteins was assessed by Western blot analysis and immunohistochemical stainings. Effects of the FAK inhibitors PF-573228 and Y-11 on contraction of prostate strips were examined in the organ bath. Expression of FAK and focal adhesion proteins (integrin-5α, paxilin, and c-Src) was detected by Western blot analysis in prostate samples. By double immunofluorescence staining with calponin and pan-cytokeratin, expression of FAK was observed in stromal and epithelial cells. Immunoreactivity for FAK colocalized with integrin-5α, paxilin, talin, and c-Src. Stimulation of prostate tissues with the α1-adrenergic agonist phenylephrine increased the phosphorylation state of FAK at Tyr³⁹⁷ and Tyr⁹²⁵ with different kinetics, which was blocked by the α1-adrenoceptor antagonist tamsulosin. Norepinephrine and phenylephrine induced concentration-dependent contractions of prostate strips. Both FAK inhibitors PF-573228 and Y-11 significantly inhibited norepinephrine- and phenylephrine-induced contractions. Finally, PF-573228 and Y-11 inhibited contractions induced by electric field stimulation, which was significant at the highest frequency. In conclusion, α1-adrenergic smooth muscle contraction or its regulation involves FAK in the human prostate. Consequently, FAK may be involved in the pathophysiology of LUTS and in current or future LUTS therapies. PMID:25056351

  5. The role of K+ conductances in regulating membrane excitability in human gastric corpus smooth muscle

    PubMed Central

    Lee, Ji Yeon; Ko, Eun-ju; Ahn, Ki Duck; Kim, Sung

    2015-01-01

    Changes in resting membrane potential (RMP) regulate membrane excitability. K+ conductance(s) are one of the main factors in regulating RMP. The functional role of K+ conductances has not been studied the in human gastric corpus smooth muscles (HGCS). To examine the role of K+ channels in regulation of RMP in HGCS we employed microelectrode recordings, patch-clamp, and molecular approaches. Tetraethylammonium and charybdotoxin did not affect the RMP, suggesting that BK channels are not involved in regulating RMP. Apamin, a selective small conductance Ca2+-activated K+ channel (SK) blocker, did not show a significant effect on the membrane excitability. 4-Aminopyridine, a Kv channel blocker, caused depolarization and increased the duration of slow wave potentials. 4-Aminopyridine also inhibited a delayed rectifying K+ current in isolated smooth muscle cells. End-product RT-PCR gel detected Kv1.2 and Kv1.5 in human gastric corpus muscles. Glibenclamide, an ATP-sensitive K+ channel (KATP) blocker, did not induce depolarization, but nicorandil, a KATP opener, hyperpolarized HGCS, suggesting that KATP are expressed but not basally activated. Kir6.2 transcript, a pore-forming subunit of KATP was expressed in HGCS. A low concentration of Ba2+, a Kir blocker, induced strong depolarization. Interestingly, Ba2+-sensitive currents were minimally expressed in isolated smooth muscle cells under whole-cell patch configuration. KCNJ2 (Kir2.1) transcript was expressed in HGCS. Unique K+ conductances regulate the RMP in HGCS. Delayed and inwardly rectifying K+ channels are the main candidates in regulating membrane excitability in HGCS. With the development of cell dispersion techniques of interstitial cells, the cell-specific functional significance will require further analysis. PMID:25591864

  6. Certain canine weakly beta-hemolytic intestinal spirochetes are phenotypically and genotypically related to spirochetes associated with human and porcine intestinal spirochetosis.

    PubMed Central

    Duhamel, G E; Muniappa, N; Mathiesen, M R; Johnson, J L; Toth, J; Elder, R O; Doster, A R

    1995-01-01

    Four canine weakly beta-hemolytic intestinal spirochetes associated with intestinal spirochetosis (IS-associated WBHIS) were compared with IS-associated human and porcine WBHIS and the type species for Serpulina hyodysenteriae and S. innocens by using phenotypic and genotypic parameters. The IS-associated canine, human, and porcine WBHIS belonged to a phyletic group distinct from but related to previously described Serpulina type species. PMID:7559984

  7. Anti-acids lead to immunological and morphological changes in the intestine of BALB/c mice similar to human food allergy.

    PubMed

    Pali-Schöll, Isabella; Yildirim, Ali O; Ackermann, Ute; Knauer, Tanja; Becker, Christoph; Garn, Holger; Renz, Harald; Jensen-Jarolim, Erika; Fehrenbach, Heinz

    2008-08-01

    We have shown that anti-acid medication for treating dyspeptic disorders can block protein digestion and induce a higher risk for food sensitization. This mechanism was confirmed in human and animal studies on the humoral as well as the cellular level. Here we aimed to investigate the outcome of the treatment with the anti-acid drug sucralfate on the intestine in our murine model, assuming that morphological and immunological changes will occur. BALB/c mice were fed codfish extract plus sucralfate. Antibodies were examined in ELISA, RBL assay and Western blot. Quantitative morphological analysis of the intestine was performed by design-based stereology, focussing on epithelium, lamina propria, smooth muscle, eosinophils and CD3(+) cells. Histological analyses were performed after H&E-, PAS- and Congo red-staining, while immune histochemistry was done for detection of CD3(+) cells. Codfish-specific IgE and its activity in RBL assay confirmed the Th2-response after treatment with sucralfate. The reactivity pattern of murine IgE in Western blot was similar to allergic patients' IgE. Histological examination showed more slender villi in the duodenum, and increased goblet cell mucus in the cecum after sucralfate treatment. Stereological analyses of the intestine revealed higher eosinophil/CD3(+) ratios, decreased mean thickness of the epithelium of duodenum and cecum, and thinner smooth muscle cell layer in the colon of food allergic mice. Anti-acid treatment with sucralfate induces changes in the structure of epithelium and villi, and an increase in eosinophils and mucus-producing cells in the intestine. Therefore, this medication leads to sensitization against food with changes typical for food allergy also in the intestine. PMID:18524557

  8. Histochemical localization of vasoactive intestinal polypeptide and its influence on contractile activity in the non-pregnant and pregnant human cervix.

    PubMed

    Bryman, I; Norström, A; Lindblom, B; Dahlström, A

    1989-01-01

    The distribution of vasoactive intestinal peptide (VIP) was studied by immunofluorescence in cervical tissue of non-pregnant and pregnant women. VIP was localized in connection with blood vessels as well as among collagen fibres and smooth muscle cells. No difference was observed between non-pregnant and term pregnant women. The effect of VIP on cervical contractility was tested on isolated strips by superfusion in a tissue chamber. VIP inhibited contractions at 10(-8)-10(-6) M concentration, strips from term pregnant women responding more frequently at the lower concentration. It is suggested that VIP-containing neurons of the human cervix remain intact throughout pregnancy until term. PMID:2571549

  9. Evidence for 5-HT7 receptors mediating relaxation of human colonic circular smooth muscle

    PubMed Central

    Prins, Nicolaas H; Briejer, Michel R; Van Bergen, Patrick J E; Akkermans, Louis M A; Schuurkes, Jan A J

    1999-01-01

    5-HT4 receptors mediate relaxation of human colon circular muscle. However, after 5-HT4 receptor blockade (SB 204070 10 nM), 5-HT still induced a relaxation (pEC50 6.3). 5-HT4 receptors were sufficiently blocked, as the curves to 5-HT obtained in the presence of 10 and 100 nM SB 204070 were indistinguishable. This 5-HT-induced relaxation was tetrodotoxin-insensitive, indicative of a smooth muscle relaxant 5-HT receptor. This, and the rank order of potency (5-CT=5-MeOT=5-HT) suggested involvement of 5-HT1 or 5-HT7 receptors. Mesulergine, a 5-HT7 receptor antagonist at nanomolar concentrations, and a 5-HT1 receptor antagonist at micromolar concentrations, competitively antagonized the 5-HT-induced relaxation (pKB 8.3) and antagonized the relaxation to 5-CT. Methysergide antagonized the 5-HT-induced relaxation (pA2 7.6). It is concluded that the profile of the smooth muscle inhibitory 5-HT receptor resembles that of the 5-HT7 receptor. These data provide the first evidence for functional human 5-HT7 receptors. PMID:10556917

  10. Proteomic network analysis of human uterine smooth muscle in pregnancy, labor, and preterm labor

    PubMed Central

    Ulrich, Craig; Quilici, David R.; Schlauch, Karen A.; Buxton, Iain L. O.

    2015-01-01

    The molecular mechanisms involved in human uterine quiescence during gestation and the induction of labor at term or preterm are not completely known. Preterm delivery is associated with major morbidity and mortality and current efforts to prevent delivery until term are largely ineffective. Identification and semi-quantification of proteomic changes in uterine smooth muscle during pregnancy will allow for targeted research into how quiescence is maintained and what changes are associated with induction of labor. Examining preterm labor in this context will provide potential therapeutic targets for the management of preterm labor. We have recently performed two dimensional liquid chromatography coupled with tandem mass spectrometry on myometrial proteins isolated from pregnant patients in labor, pregnant patients not in labor, and pregnant patients in labor preterm. Using a conservative false discovery rate of 1% we have identified 2132 protein groups using this method and semi-quantitative spectral counting shows 201 proteins that have disparate levels of expression in preterm laboring samples. To our knowledge this is the first large scale proteomic study examining human uterine smooth muscle and this initial work has provided a target list for future experiments that can address how changing protein levels are involved in the induction of labor at term and preterm. PMID:26413312

  11. Function, expression, and characterization of the serotonin transporter in the native human intestine

    PubMed Central

    Gill, Ravinder K.; Pant, Nitika; Saksena, Seema; Singla, Amika; Nazir, Talat M.; Vohwinkel, Lisa; Turner, Jerrold R.; Goldstein, Jay; Alrefai, Waddah A.; Dudeja, Pradeep K.

    2016-01-01

    The enteric serotonin transporter (SERT) plays a critical role in modulating serotonin availability and thus has been implicated in the pathogenesis of various intestinal disorders. To date, SERT expression and function in the human intestine have not been investigated. Current studies were designed to characterize the function, expression, distribution, and membrane localization of SERT in the native human intestine. Real-time PCR studies showed relatively higher SERT mRNA expression in the human small intestine compared with colon (ileum ≫ duodenum ≫ jejunum). Northern blot analysis revealed three mRNA hybridizing species encoding SERT (3.0, 4.9, and 6.8 kb) in the human ileum. Consistent with SERT mRNA expression, SERT immunostaining was mainly detected in the epithelial cells of human duodenal and ileal resected tissues. Notably, SERT expression was localized predominantly to the apical and intracellular compartments and was distributed throughout the crypt-villus axis. Immunoblotting studies detected a prominent protein band (~70 kDa) in the ileal apical plasma membrane vesicles (AMVs) isolated from mucosa obtained from organ-donor intestine. Functional studies showed that uptake of [3H]serotonin (150 nM) in human ileal AMVs was 1) significantly increased in the presence of both Na+ and Cl−; 2) inhibited (~50%) by the neuronal SERT inhibitor, fluoxetine (10 μM) and by unlabeled 5-HT; and 3) exhibited saturation kinetics indicating the presence of a carrier-mediated process. Our studies demonstrated differential expression of SERT across various regions of the human intestine and provide evidence for the existence of a functional SERT capable of removing intraluminal serotonin in human ileal epithelial cells. PMID:17991706

  12. The nature of the natural killer (NK) cell of human intestinal mucosa and mesenteric lymph node.

    PubMed Central

    Gibson, P R; Jewell, D P

    1985-01-01

    The relationship of the mononuclear cell (MNC) from human intestinal mucosa and mesenteric lymph node mediating anti-K-562 activity with that of peripheral blood has been assessed. Depletion of macrophages did not alter the measured cytotoxicity confirming that the effector cells were lymphocytes. Complement lysis of Leu 7 and Leu 11b coated cells reduced intestinal natural killer (NK) activity by a similar degree to that of peripheral blood but mesenteric lymph node NK activity was affected to a lesser extent. The response in NK activity of mucosal and nodal MNC to short incubation with lymphoblastoid interferon was similar to that for peripheral blood MNC. Twenty-four hours incubation of MNC with low concentrations of purified interleukin-2 (IL-2) consistently augmented intestinal and nodal NK activity but failed to augment that of peripheral blood MNC. No differences between the inhibitory effects of cAMP and prostaglandin E2 on NK activity from the three sites were seen. In addition, inhibition of cyclo-oxygenase activity with indomethacin had no effect on NK activity of intestinal and peripheral blood MNC while the lipoxygenase inhibitor, nordihydroguaiaretic acid, suppressed intestinal and peripheral blood NK activity similarly. In conclusion, anti-K-562 activity by intestinal MNC is mediated by NK cells with similar phenotypic and functional properties to those of peripheral blood. However, the increased sensitivity of mucosal NK cells to IL-2 suggests that higher proportions of NK cell precursors may be present in intestinal MNC populations. PMID:2412737

  13. Expression, Distribution and Role of Aquaporin Water Channels in Human and Animal Stomach and Intestines.

    PubMed

    Zhu, Cui; Chen, Zhuang; Jiang, Zongyong

    2016-01-01

    Stomach and intestines are involved in the secretion of gastrointestinal fluids and the absorption of nutrients and fluids, which ensure normal gut functions. Aquaporin water channels (AQPs) represent a major transcellular route for water transport in the gastrointestinal tract. Until now, at least 11 AQPs (AQP1-11) have been found to be present in the stomach, small and large intestines. These AQPs are distributed in different cell types in the stomach and intestines, including gastric epithelial cells, gastric glands cells, absorptive epithelial cells (enterocytes), goblet cells and Paneth cells. AQP1 is abundantly distributed in the endothelial cells of the gastrointestinal tract. AQP3 and AQP4 are mainly distributed in the basolateral membrane of epithelial cells in the stomach and intestines. AQP7, AQP8, AQP10 and AQP11 are distributed in the apical of enterocytes in the small and large intestines. Although AQP-null mice displayed almost no phenotypes in gastrointestinal tracts, the alterations of the expression and localization of these AQPs have been shown to be associated with the pathology of gastrointestinal disorders, which suggests that AQPs play important roles serving as potential therapeutic targets. Therefore, this review provides an overview of the expression, localization and distribution of AQPs in the stomach, small and large intestine of human and animals. Furthermore, this review emphasizes the potential roles of AQPs in the physiology and pathophysiology of stomach and intestines. PMID:27589719

  14. Tissue-Engineered Vascular Rings from Human iPSC-Derived Smooth Muscle Cells.

    PubMed

    Dash, Biraja C; Levi, Karen; Schwan, Jonas; Luo, Jiesi; Bartulos, Oscar; Wu, Hongwei; Qiu, Caihong; Yi, Ting; Ren, Yongming; Campbell, Stuart; Rolle, Marsha W; Qyang, Yibing

    2016-07-12

    There is an urgent need for an efficient approach to obtain a large-scale and renewable source of functional human vascular smooth muscle cells (VSMCs) to establish robust, patient-specific tissue model systems for studying the pathogenesis of vascular disease, and for developing novel therapeutic interventions. Here, we have derived a large quantity of highly enriched functional VSMCs from human induced pluripotent stem cells (hiPSC-VSMCs). Furthermore, we have engineered 3D tissue rings from hiPSC-VSMCs using a facile one-step cellular self-assembly approach. The tissue rings are mechanically robust and can be used for vascular tissue engineering and disease modeling of supravalvular aortic stenosis syndrome. Our method may serve as a model system, extendable to study other vascular proliferative diseases for drug screening. Thus, this report describes an exciting platform technology with broad utility for manufacturing cell-based tissues and materials for various biomedical applications. PMID:27411102

  15. Molecular constituents of maxi KCa channels in human coronary smooth muscle: predominant alpha + beta subunit complexes.

    PubMed

    Tanaka, Y; Meera, P; Song, M; Knaus, H G; Toro, L

    1997-08-01

    1. Human large-conductance voltage- and calcium-sensitive K+ (maxi KCa) channels are composed of at least two subunits: the pore-forming subunit, alpha, and a modulatory subunit, beta. Expression of the beta subunit induces dramatic changes in alpha subunit function. It increases the apparent Ca2+ sensitivity and it allows dehydrosoyasaponin I (DHS-I) to upregulate the channel. 2. The functional coupling of maxi KCa channel alpha and beta subunits in freshly dissociated human coronary smooth muscle cells was assessed. To distinguish maxi KCa currents modulated by the beta subunit, we examined (a) their apparent Ca2+ sensitivity, as judged from the voltage necessary to half-activate the channel (V1/2), and (b) their activation by DHS-I. 3. In patches with unitary currents, the majority of channels were half-activated near -85 mV at 18 microM Ca2+, a value similar to that obtained when the human KCa channel alpha (HSLO) and beta (HKV,Ca beta) subunits are co-expressed. A small number of channels half-activated around 0 mV, suggesting the activity of the alpha subunit alone. 4. The properties of macroscopic currents were consistent with the view that most pore-forming alpha subunits were coupled to beta subunits, since the majority of currents had values for V1/2 near to -90 mV, and currents were potentiated by DHS-I. 5. We conclude that in human coronary artery smooth muscle cells, most maxi KCa channels are composed of alpha and beta subunits. The higher Ca2+ sensitivity of maxi KCa channels, resulting from their coupling to beta subunits, suggests an important role of this channel in regulating coronary tone. Their massive activation by micromolar Ca2+ concentrations may lead to a large hyperpolarization causing profound changes in coronary blood flow and cardiac function. PMID:9279807

  16. Molecular constituents of maxi KCa channels in human coronary smooth muscle: predominant alpha + beta subunit complexes.

    PubMed Central

    Tanaka, Y; Meera, P; Song, M; Knaus, H G; Toro, L

    1997-01-01

    1. Human large-conductance voltage- and calcium-sensitive K+ (maxi KCa) channels are composed of at least two subunits: the pore-forming subunit, alpha, and a modulatory subunit, beta. Expression of the beta subunit induces dramatic changes in alpha subunit function. It increases the apparent Ca2+ sensitivity and it allows dehydrosoyasaponin I (DHS-I) to upregulate the channel. 2. The functional coupling of maxi KCa channel alpha and beta subunits in freshly dissociated human coronary smooth muscle cells was assessed. To distinguish maxi KCa currents modulated by the beta subunit, we examined (a) their apparent Ca2+ sensitivity, as judged from the voltage necessary to half-activate the channel (V1/2), and (b) their activation by DHS-I. 3. In patches with unitary currents, the majority of channels were half-activated near -85 mV at 18 microM Ca2+, a value similar to that obtained when the human KCa channel alpha (HSLO) and beta (HKV,Ca beta) subunits are co-expressed. A small number of channels half-activated around 0 mV, suggesting the activity of the alpha subunit alone. 4. The properties of macroscopic currents were consistent with the view that most pore-forming alpha subunits were coupled to beta subunits, since the majority of currents had values for V1/2 near to -90 mV, and currents were potentiated by DHS-I. 5. We conclude that in human coronary artery smooth muscle cells, most maxi KCa channels are composed of alpha and beta subunits. The higher Ca2+ sensitivity of maxi KCa channels, resulting from their coupling to beta subunits, suggests an important role of this channel in regulating coronary tone. Their massive activation by micromolar Ca2+ concentrations may lead to a large hyperpolarization causing profound changes in coronary blood flow and cardiac function. Images Figure 1 PMID:9279807

  17. Regulatory mechanism of human vascular smooth muscle cell phenotypic transformation induced by NELIN.

    PubMed

    Pei, Changan; Qin, Shiyong; Wang, Minghai; Zhang, Shuguang

    2015-11-01

    Vascular disorders, including hypertension, atherosclerosis and restenosis, arise from dysregulation of vascular smooth muscle cell (VSMC) differentiation, which can be controlled by regulatory factors. The present study investigated the regulatory mechanism of the phenotypic transformation of human VSMCs by NELIN in order to evaluate its potential as a preventive and therapeutic of vascular disorders. An in vitro model of NELIN‑overexpressing VSMCs was prepared by transfection with a lentiviral (LV) vector (NELIN‑VSMCs) and NELIN was slienced using an a lentiviral vector with small interfering (si)RNA in another group (LV‑NELIN‑siRNA‑VSMCs). The effects of NELIN overexpression or knockdown on the phenotypic transformation of human VSMCs were observed, and its regulatory mechanism was studied. Compared with the control group, cells in the NELIN‑VSMCs group presented a contractile phenotype with a significant increase of NELIN mRNA, NELIN protein, smooth muscle (SM)α‑actin and total Ras homolog gene family member A (RhoA) protein expression. The intra‑nuclear translocation of SMα‑actin‑serum response factor (SMα‑actin‑SRF) occurred in these cells simultaneously. Following exposure to Rho kinsase inhibitor Y‑27632, SRF and SMα‑actin expression decreased. However, cells in the LV‑NELIN‑siRNA‑VSMCs group presented a synthetic phenotype, and the expression of NELIN mRNA, NELIN protein, SMα‑actin protein and total RhoA protein was decreased. The occurrence of SRF extra‑nuclear translocation was observed. In conclusion, the present study suggested that NELIN was able to activate regulatory factors of SMα‑actin, RhoA and SRF successively in human VSMCs cultured in vitro. Furthermore, NELIN‑induced phenotypic transformation of human VSMCs was regulated via the RhoA/SRF signaling pathway. The results of the present study provide a foundation for the use of NELIN in preventive and therapeutic treatment of vascular remodeling

  18. IL-9-mediated induction of eotaxin1/CCL11 in human airway smooth muscle cells.

    PubMed

    Gounni, Abdelilah Soussi; Hamid, Qutayba; Rahman, Sahidur M; Hoeck, Jutta; Yang, Jie; Shan, Lianyu

    2004-08-15

    Recent work has shown the potential importance of IL-9 in allergic diseases. The development of transgenic mice overexpressing IL-9 has suggested a key role for this cytokine in the development of the asthmatic phenotype including airway eosinophilia. In this study, we evaluated the expression of the IL-9R and the effects of IL-9 on human ASM cells by examining the release of Th2-associated chemokines (eotaxin1/CCL11 and thymus- and activation-regulated chemokine (TARC)/CCL17). IL-9R alpha-chain mRNA and surface expression were detected in cultured human airway smooth muscle (ASM) cells. In addition, primary cultured ASM cells, as well as bronchial smooth muscle cells within biopsies of asthmatics and not control subjects, revealed IL-9R protein expression. IL-9 stimulation of human ASM cells resulted in release of eotaxin1/CCL11, but had no effect on the release of TARC/CCL17, in time- and dose-dependent manner. Moreover, in vitro chemotaxis assay demonstrated that conditioned medium from IL-9-stimulated ASM cells attracted human eosinophils. Neutralizing Abs to IL-9, but not to IL-4 or IL-13, reduced significantly IL-9-induced production of eotaxin1/CCL11 from ASM cells. Interestingly, real-time RT-PCR showed that IL-9 up-regulated eotaxin1/CCL11 mRNA expression, but had no effect on TARC/CCL17. Treatment with Act D abrogates IL-9-induced eotaxin1/CCL11 mRNA and protein release by ASM cells. Finally, transfection study using eotaxin1/CCL11 promoter luciferase construct confirmed that IL-9 induced eotaxin1/CCL11 at the transcriptional level. Taken together, these data provide new evidence demonstrating that IL-9-dependent activation of ASM cells contributes to eosinophilic inflammation observed in asthma. PMID:15294996

  19. Circulating intestine-derived exosomal miR-328 in plasma, a possible biomarker for estimating BCRP function in the human intestines.

    PubMed

    Gotanda, Keisuke; Hirota, Takeshi; Saito, Jumpei; Fukae, Masato; Egashira, Yu; Izumi, Noritomo; Deguchi, Mariko; Kimura, Miyuki; Matsuki, Shunji; Irie, Shin; Ieiri, Ichiro

    2016-01-01

    A variant in the breast cancer resistance protein (BCRP) gene, 421C> A is a useful biomarker for describing large inter-individual differences in the pharmacokinetics of sulfasalazine (SASP), a BCRP substrate. However, large intra-genotypic variability still exists in spite of the incorporation of this variant into the pharmacokinetics of SASP. Since miR-328 negatively regulates BCRP expression in human tissues, we hypothesized that exosomal miR-328 in plasma, which leaks from the intestines, is a possible biomarker for estimating BCRP activity in the human intestines. We established an immunoprecipitation-based quantitative method for circulating intestine-derived miR-328 in plasma using an anti-glycoprotein A33 antibody. A clinical study was conducted with an open-label, non-randomized, and single-arm design involving 33 healthy participants. Intestine-derived exosomal miR-328 levels positively correlated (P < 0.05) with SASP AUC0-48, suggesting that subjects with high miR-328 levels have low intestinal BCRP activity, resulting in the high AUC of SASP. Circulating intestine-derived exosomal miR-328 in plasma has potential as a possible biomarker for estimating BCRP function in the human intestines. PMID:27571936

  20. Circulating intestine-derived exosomal miR-328 in plasma, a possible biomarker for estimating BCRP function in the human intestines

    PubMed Central

    Gotanda, Keisuke; Hirota, Takeshi; Saito, Jumpei; Fukae, Masato; Egashira, Yu; Izumi, Noritomo; Deguchi, Mariko; Kimura, Miyuki; Matsuki, Shunji; Irie, Shin; Ieiri, Ichiro

    2016-01-01

    A variant in the breast cancer resistance protein (BCRP) gene, 421C> A is a useful biomarker for describing large inter-individual differences in the pharmacokinetics of sulfasalazine (SASP), a BCRP substrate. However, large intra-genotypic variability still exists in spite of the incorporation of this variant into the pharmacokinetics of SASP. Since miR-328 negatively regulates BCRP expression in human tissues, we hypothesized that exosomal miR-328 in plasma, which leaks from the intestines, is a possible biomarker for estimating BCRP activity in the human intestines. We established an immunoprecipitation-based quantitative method for circulating intestine-derived miR-328 in plasma using an anti-glycoprotein A33 antibody. A clinical study was conducted with an open-label, non-randomized, and single-arm design involving 33 healthy participants. Intestine-derived exosomal miR-328 levels positively correlated (P < 0.05) with SASP AUC0-48, suggesting that subjects with high miR-328 levels have low intestinal BCRP activity, resulting in the high AUC of SASP. Circulating intestine-derived exosomal miR-328 in plasma has potential as a possible biomarker for estimating BCRP function in the human intestines. PMID:27571936

  1. The human milk oligosaccharide 2'-fucosyllactose augments the adaptive response to extensive intestinal.

    PubMed

    Mezoff, Ethan A; Hawkins, Jennifer A; Ollberding, Nicholas J; Karns, Rebekah; Morrow, Ardythe L; Helmrath, Michael A

    2016-03-15

    Intestinal resection resulting in short bowel syndrome (SBS) carries a heavy burden of long-term morbidity, mortality, and cost of care, which can be attenuated with strategies that improve intestinal adaptation. SBS infants fed human milk, compared with formula, have more rapid intestinal adaptation. We tested the hypothesis that the major noncaloric human milk oligosaccharide 2'-fucosyllactose (2'-FL) contributes to the adaptive response after intestinal resection. Using a previously described murine model of intestinal adaptation, we demonstrated increased weight gain from 21 to 56 days (P < 0.001) and crypt depth at 56 days (P < 0.0095) with 2'-FL supplementation after ileocecal resection. Furthermore, 2'-FL increased small bowel luminal content microbial alpha diversity following resection (P < 0.005) and stimulated a bloom in organisms of the genus Parabacteroides (log2-fold = 4.1, P = 0.035). Finally, transcriptional analysis of the intestine revealed enriched ontologies and pathways related to antimicrobial peptides, metabolism, and energy processing. We conclude that 2'-FL supplementation following ileocecal resection increases weight gain, energy availability through microbial community modulation, and histological changes consistent with improved adaptation. PMID:26702137

  2. Iptakalim inhibits PDGF-BB-induced human airway smooth muscle cells proliferation and migration

    SciTech Connect

    Liu, Wenrui; Kong, Hui; Zeng, Xiaoning; Wang, Jingjing; Wang, Zailiang; Yan, Xiaopei; Wang, Yanli; Xie, Weiping Wang, Hong

    2015-08-15

    Chronic airway diseases are characterized by airway remodeling which is attributed partly to the proliferation and migration of airway smooth muscle cells (ASMCs). ATP-sensitive potassium (K{sub ATP}) channels have been identified in ASMCs. Mount evidence has suggested that K{sub ATP} channel openers can reduce airway hyperresponsiveness and alleviate airway remodeling. Opening K{sup +} channels triggers K{sup +} efflux, which leading to membrane hyperpolarization, preventing Ca{sup 2+}entry through closing voltage-operated Ca{sup 2+} channels. Intracellular Ca{sup 2+} is the most important regulator of muscle contraction, cell proliferation and migration. K{sup +} efflux decreases Ca{sup 2+} influx, which consequently influences ASMCs proliferation and migration. As a K{sub ATP} channel opener, iptakalim (Ipt) has been reported to restrain the proliferation of pulmonary arterial smooth muscle cells (PASMCs) involved in vascular remodeling, while little is known about its impact on ASMCs. The present study was designed to investigate the effects of Ipt on human ASMCs and the mechanisms underlying. Results obtained from cell counting kit-8 (CCK-8), flow cytometry and 5-ethynyl-2′-deoxyuridine (EdU) incorporation showed that Ipt significantly inhibited platelet-derived growth factor (PDGF)-BB-induced ASMCs proliferation. ASMCs migration induced by PDGF-BB was also suppressed by Ipt in transwell migration and scratch assay. Besides, the phosphorylation of Ca{sup 2+}/calmodulin-dependent kinase II (CaMKII), extracellular regulated protein kinases 1/2 (ERK1/2), protein kinase B (Akt), and cyclic adenosine monophosphate (cAMP) response element binding protein (CREB) were as well alleviated by Ipt administration. Furthermore, we found that the inhibition of Ipt on the PDGF-BB-induced proliferation and migration in human ASMCs was blocked by glibenclamide (Gli), a selective K{sub ATP} channel antagonist. These findings provide a strong evidence to support that Ipt

  3. Fecal transplant: a safe and sustainable clinical therapy for restoring intestinal microbial balance in human disease?

    PubMed

    Vrieze, A; de Groot, P F; Kootte, R S; Knaapen, M; van Nood, E; Nieuwdorp, M

    2013-02-01

    Recent studies have suggested an association between intestinal microbiota composition and human disease, however causality remains to be proven. With hindsight, the application of fecal transplantation (FMT) does indeed suggest a causal relation between interfering with gut microbiota composition and a resultant cure of several disease states. In this review, we aim to show the available evidence regarding the involvement of intestinal microbiota and human (autoimmune) disease. Moreover, we refer to (mostly case report) studies showing beneficial or adverse effects of fecal transplantation on clinical outcomes in some of these disease states. If these findings can be substantiated in larger randomized controlled double blind trials also implementing gut microbiota composition before and after intervention, fecal transplantation might provide us with novel insights into causally related intestinal microbiota, that might be serve as future diagnostic and treatment targets in human disease. PMID:23768558

  4. Essential role for calcium waves in migration of human vascular smooth muscle cells.

    PubMed

    Espinosa-Tanguma, Ricardo; O'Neil, Caroline; Chrones, Tom; Pickering, J Geoffrey; Sims, Stephen M

    2011-08-01

    Vascular smooth muscle cell (SMC) migration is characterized by extension of the lamellipodia at the leading edge, lamellipodial attachment to substrate, and release of the rear (uropod) of the cell, all of which enable forward movement. However, little is known regarding the role of intracellular cytosolic Ca(2+) concentration ([Ca(2+)](i)) in coordinating these distinct activities of migrating SMCs. The objective of our study was to determine whether regional changes of Ca(2+) orchestrate the migratory cycle in human vascular SMCs. We carried out Ca(2+) imaging using digital fluorescence microscopy of fura-2 loaded human smooth muscle cells. We found that motile SMCs exhibited Ca(2+) waves that characteristically swept from the rear of polarized cells toward the leading edge. Ca(2+) waves were less evident in nonpolarized, stationary cells, although acute stimulation of these SMCs with the agonists platelet-derived growth factor-BB or histamine could elicit transient rise of [Ca(2+)](i). To investigate a role for Ca(2+) waves in the migratory cycle, we loaded cells with the Ca(2+) chelator BAPTA, which abolished Ca(2+) waves and significantly reduced retraction, supporting a causal role for Ca(2+) in initiation of retraction. However, lamellipod motility was still evident in BAPTA-loaded cells. The incidence of Ca(2+) oscillations was reduced when Ca(2+) release from intracellular stores was disrupted with the sarcoplasmic reticulum Ca(2+)-ATPase inhibitor thapsigargin or by treatment with the inositol 1,4,5-trisphosphate receptor blocker 2-aminoethoxy-diphenyl borate or xestospongin C, implicating Ca(2+) stores in generation of waves. We conclude that Ca(2+) waves are essential for migration of human vascular SMCs and can encode cell polarity. PMID:21572011

  5. Prostanoid-induced contraction of human bronchial smooth muscle is mediated by TP-receptors.

    PubMed Central

    Coleman, R. A.; Sheldrick, R. L.

    1989-01-01

    1. A range of naturally-occurring prostaglandins sulprostone, 16,16-dimethyl prostaglandin E2 (DME2) and the thromboxane A2 (TXA2)-mimetic, 11 alpha,9 alpha-epoxymethano prostaglandin H2 (U-46619) have been tested for contractile agonist activity on human isolated bronchial smooth muscle. 2. Prostaglandin D2 (PGD2), PGF2 alpha, 9 alpha,11 beta-PGF2 (11 beta-PGF2) and U-46619 all caused concentration-related contractions. U46619 was at least 300 fold more potent than the other prostanoids with a mean EC50 of 12 nM. Sulprostone caused contraction only at the highest concentration tested (30 microM). PGE2 and PGI2 caused relaxations at low concentrations, and only caused contractile responses at high concentrations (greater than or equal to 10 microM). In contrast, DME2 caused small contractions at low concentrations but relaxation at the highest concentration tested (30 microM). 3. The rank order of contractile agonist potency was: U-46619 much greater than 11 beta-PGF2 congruent to PGF2 alpha greater than PGD2 greater than PGE2 greater than PGI2 congruent to sulprostone congruent to DME2. 4. The TP-receptor blocking drug, AH23848 (1 microM) antagonized the contractile effects of U-46619, PGD2, PGF2 alpha and 11 beta-PGF2, but had no effect against contractions to carbachol. In a single experiment, a pA2 of 8.3 (slope = 1.2) was obtained for AH23848 against U-46619. 5. In most preparations, administration of AH23848 (1 microM) to human bronchus resulted in small, transient contractile responses. 6. The results obtained with both the agonists and the antagonist, AH23848 are therefore consistent with prostanoid-induced contractions of human bronchial smooth muscle being mediated by TP-receptors. PMID:2720298

  6. Receptor-based differences in human aortic smooth muscle cell membrane stiffness

    NASA Technical Reports Server (NTRS)

    Huang, H.; Kamm, R. D.; So, P. T.; Lee, R. T.

    2001-01-01

    Cells respond to mechanical stimuli with diverse molecular responses. The nature of the sensory mechanism involved in mechanotransduction is not known, but integrins may play an important role. The integrins are linked to both the cytoskeleton and extracellular matrix, suggesting that probing cells via integrins should yield different mechanical properties than probing cells via non-cytoskeleton-associated receptors. To test the hypothesis that the mechanical properties of a cell are dependent on the receptor on which the stress is applied, human aortic smooth muscle cells were plated, and magnetic beads, targeted either to the integrins via fibronectin or to the transferrin receptor by use of an IgG antibody, were attached to the cell surface. The resistance of the cell to deformation ("stiffness") was estimated by oscillating the magnetic beads at 1 Hz by use of single-pole magnetic tweezers at 2 different magnitudes. The ratio of bead displacements at different magnitudes was used to explore the mechanical properties of the cells. Cells stressed via the integrins required approximately 10-fold more force to obtain the same bead displacements as the cells stressed via the transferrin receptors. Cells stressed via integrins showed stiffening behavior as the force was increased, whereas this stiffening was significantly less for cells stressed via the transferrin receptor (P<0.001). Mechanical characteristics of vascular smooth muscle cells depend on the receptor by which the stress is applied, with integrin-based linkages demonstrating cell-stiffening behavior.

  7. Regulation of actin dynamics by WNT-5A: implications for human airway smooth muscle contraction

    PubMed Central

    Koopmans, Tim; Kumawat, Kuldeep; Halayko, Andrew J; Gosens, Reinoud

    2016-01-01

    A defining feature of asthma is airway hyperresponsiveness (AHR), which underlies the exaggerated bronchoconstriction response of asthmatics. The role of the airway smooth muscle (ASM) in AHR has garnered increasing interest over the years, but how asthmatic ASM differs from healthy ASM is still an active topic of debate. WNT-5A is increasingly expressed in asthmatic ASM and has been linked with Th2-high asthma. Due to its link with calcium and cytoskeletal remodelling, we propose that WNT-5A may modulate ASM contractility. We demonstrated that WNT-5A can increase maximum isometric tension in bovine tracheal smooth muscle strips. In addition, we show that WNT-5A is preferentially expressed in contractile human airway myocytes compared to proliferative cells, suggesting an active role in maintaining contractility. Furthermore, WNT-5A treatment drives actin polymerisation, but has no effect on intracellular calcium flux. Next, we demonstrated that WNT-5A directly regulates TGF-β1-induced expression of α-SMA via ROCK-mediated actin polymerization. These findings suggest that WNT-5A modulates fundamental mechanisms that affect ASM contraction and thus may be of relevance for AHR in asthma. PMID:27468699

  8. beta. -Adrenoceptors in human tracheal smooth muscle: characteristics of binding and relaxation

    SciTech Connect

    van Koppen, C.J.; Hermanussen, M.W.; Verrijp, K.N.; Rodrigues de Miranda, J.F.; Beld, A.J.; Lammers, J.W.J.; van Ginneken, C.A.M.

    1987-06-29

    Specific binding of (/sup 125/I)-(-)-cyanopindolol to human tracheal smooth muscle membranes was saturable, stereo-selective and of high affinity (K/sub d/ = 5.3 +/- 0.9 pmol/l and R/sub T/ = 78 +/- 7 fmol/g tissue). The ..beta../sub 1/-selective antagonists atenolol and LK 203-030 inhibited specific (/sup 125/I)-(-)-cyanopindolol binding according to a one binding site model with low affinity in nearly all subjects, pointing to a homogeneous BETA/sub 2/-adrenoceptor population. In one subject using LK 203-030 a small ..beta../sub 1/-adrenoceptor subpopulation could be demonstrated. The beta-mimetics isoprenaline, fenoterol, salbutamol and terbutaline recognized high and low affinity agonist binding sites. Isoprenaline's pK/sub H/- and pK/sub L/-values for the high and low affinity sites were 8.0 +/- 0.2 and 5.9 +/- 0.3 respectively. In functional experiments isoprenaline relaxed tracheal smooth muscle strips having intrinsic tone with a pD/sub 2/-value of 6.63 +/- 0.19. 32 references, 4 figures, 2 tables.

  9. Differentiation of Human Induced-Pluripotent Stem Cells into Smooth-Muscle Cells: Two Novel Protocols

    PubMed Central

    Yang, Libang; Geng, Zhaohui; Nickel, Thomas; Johnson, Caitlin; Gao, Lin; Dutton, James; Hou, Cody; Zhang, Jianyi

    2016-01-01

    Conventional protocols for differentiating human induced-pluripotent stem cells (hiPSCs) into smooth-muscle cells (SMCs) can be inefficient and generally fail to yield cells with a specific SMC phenotype (i.e., contractile or synthetic SMCs). Here, we present two novel hiPSC-SMC differentiation protocols that yield SMCs with predominantly contractile or synthetic phenotypes. Flow cytometry analyses of smooth-muscle actin (SMA) expression indicated that ~45% of the cells obtained with each protocol assumed an SMC phenotype, and that the populations could be purified to ~95% via metabolic selection. Assessments of cellular mRNA and/or protein levels indicated that SMA, myosin heavy chain II, collagen 1, calponin, transgelin, connexin 43, and vimentin expression in the SMCs obtained via the Contractile SMC protocol and in SMCs differentiated via a traditional protocol were similar, while SMCs produced via the Sythetic SMC protocol expressed less calponin, more collagen 1, and more connexin 43. Differences were also observed in functional assessments of the two SMC populations: the two-dimensional surface area of Contractile SMCs declined more extensively (to 12% versus 44% of original size) in response to carbachol treatment, while quantification of cell migration and proliferation were greater in Synthetic SMCs. Collectively, these data demonstrate that our novel differentiation protocols can efficiently generate SMCs from hiPSCs. PMID:26771193

  10. Human intestinal capillariasis: a rare case report from non-endemic area (Andhra Pradesh, India).

    PubMed

    Vasantha, P L; Girish, N; Leela, K Sai

    2012-01-01

    Human intestinal capillariasis is caused by Capillaria philippinensis. This disease is endemic in Philippines and Thailand. To the best of our knowledge, we report the third case of human intestinal capillariasis from India and the first case from Andhra Pradesh, which is a non-endemic area. A 40-year-old female presented with diarrhoea, vomiting, decreased urinary output, ascitis, pedal oedema, hypoalbuminemia, and electrolyte imbalance. Microscopic examination of stool sample revealed the presence of ova, larvae, and adult worms of C. philippinensis. Patient recovered from the disease after taking albendazole 400 mg daily for 1 month along with supportive treatment. PMID:22664447

  11. Isolation and identification of intestinal CYP3A inhibitors from cranberry (Vaccinium macrocarpon) using human intestinal microsomes.

    PubMed

    Kim, Eunkyung; Sy-Cordero, Arlene; Graf, Tyler N; Brantley, Scott J; Paine, Mary F; Oberlies, Nicholas H

    2011-02-01

    Cranberry juice is used routinely, especially among women and the elderly, to prevent and treat urinary tract infections. These individuals are likely to be taking medications concomitantly with cranberry juice, leading to concern about potential drug-dietary substance interactions, particularly in the intestine, which, along with the liver, is rich in expression of the prominent drug metabolizing enzyme, cytochrome P450 3A (CYP3A). Using a systematic in vitro-in vivo approach, a cranberry juice product was identified recently that elicited a pharmacokinetic interaction with the CYP3A probe substrate midazolam in 16 healthy volunteers. Relative to water, cranberry juice inhibited intestinal first-pass midazolam metabolism. In vitro studies were initiated to identify potential enteric CYP3A inhibitors from cranberry via a bioactivity-directed fractionation approach involving dried whole cranberry [Vaccinium macrocarpon Ait. (Ericaceae)], midazolam, and human intestinal microsomes (HIM). Three triterpenes (maslinic acid, corosolic acid, and ursolic acid) were isolated. The inhibitory potency (IC(50)) of maslinic acid, corosolic acid, and ursolic acid was 7.4, 8.8, and < 10 µM, respectively, using HIM as the enzyme source and 2.8, 4.3, and < 10 µM, respectively, using recombinant CYP3A4 as the enzyme source. These in vitro inhibitory potencies, which are within the range of those reported for two CYP3A inhibitory components in grapefruit juice, suggest that these triterpenes may have contributed to the midazolam-cranberry juice interaction observed in the clinical study. PMID:20717876

  12. Isolation and Identification of Intestinal CYP3A Inhibitors from Cranberry (Vaccinium macrocarpon) using Human Intestinal Microsomes

    PubMed Central

    Kim, Eunkyung; Sy-Cordero, Arlene; Graf, Tyler N.; Brantley, Scott J.; Paine, Mary F.; Oberlies, Nicholas H.

    2010-01-01

    Cranberry juice is used routinely, especially among women and the elderly, to prevent and treat urinary tract infections. These individuals are likely to be taking medications concomitantly with cranberry juice, leading to concern about potential drug-dietary substance interactions, particularly in the intestine, which, along with the liver, is rich in expression of the prominent drug metabolizing enzyme, cytochrome P450 3A (CYP3A). Using a systematic in vitro-in vivo approach, a cranberry juice product was identified recently that elicited a pharmacokinetic interaction with the CYP3A probe substrate midazolam in 16 healthy volunteers. Relative to water, a cranberry juice inhibited intestinal first-pass midazolam metabolism. In vitro studies were initiated to identify potential enteric CYP3A inhibitors from cranberry via a bioactivity-directed fractionation approach involving dried whole cranberry [Vaccinium macrocarpon Ait. (Ericaceae)], midazolam, and human intestinal microsomes (HIM). Three triterpenes (maslinic acid, corosolic acid, and ursolic acid) were isolated. The inhibitory potency (IC50) of maslinic acid, corosolic acid, and ursolic acid was 7.4, 8.8, and <10 μM, respectively, using HIM as the enzyme source and was 2.8, 4.3, and <10 μM, respectively, using recombinant CYP3A4 as the enzyme source. These in vitro inhibitory potencies, which are within the range of those reported for two CYP3A inhibitory components in grapefruit juice, suggest that these triterpenes may have contributed to the midazolam-cranberry juice interaction observed in the clinical study. PMID:20717876

  13. Generating human intestinal tissues from pluripotent stem cells to study development and disease

    PubMed Central

    Sinagoga, Katie L; Wells, James M

    2015-01-01

    As one of the largest and most functionally complex organs of the human body, the intestines are primarily responsible for the breakdown and uptake of macromolecules from the lumen and the subsequent excretion of waste from the body. However, the intestine is also an endocrine organ, regulating digestion, metabolism, and feeding behavior. Intricate neuronal, lymphatic, immune, and vascular systems are integrated into the intestine and are required for its digestive and endocrine functions. In addition, the gut houses an extensive population of microbes that play roles in digestion, global metabolism, barrier function, and host–parasite interactions. With such an extensive array of cell types working and performing in one essential organ, derivation of functional intestinal tissues from human pluripotent stem cells (PSCs) represents a significant challenge. Here we will discuss the intricate developmental processes and cell types that are required for assembly of this highly complex organ and how embryonic processes, particularly morphogenesis, have been harnessed to direct differentiation of PSCs into 3-dimensional human intestinal organoids (HIOs) in vitro. We will further describe current uses of HIOs in development and disease research and how additional tissue complexity might be engineered into HIOs for better functionality and disease modeling. PMID:25792515

  14. Smooth enlargement of human standing sway by instability due to weak reaction floor and noise

    PubMed Central

    Funato, Tetsuro; Aoi, Shinya; Tomita, Nozomi; Tsuchiya, Kazuo

    2016-01-01

    Human quiet standing is accompanied by body sway. The amplitude of this body sway is known to be larger than would be predicted from simple noise effects, and sway characteristics are changed by neurological disorders. This large sway is thought to arise from nonlinear control with prolonged periods of no control (intermittent control), and a nonlinear control system of this kind has been predicted to exhibit bifurcation. The presence of stability-dependent transition enables dynamic reaction that depends on the stability of the environment, and can explain the change in sway characteristics that accompanies some neurological disorders. This research analyses the characteristics of a system model that induces transition, and discusses whether human standing reflects such a mechanism. In mathematical analysis of system models, (intermittent control-like) nonlinear control with integral control is shown to exhibit Hopf bifurcation. Moreover, from the analytical solution of the system model with noise, noise is shown to work to smooth the enlargement of sway around the bifurcation point. This solution is compared with measured human standing sway on floors with different stabilities. By quantitatively comparing the control parameters between human observation and model prediction, enlargement of sway is shown to appear as predicted by the model analysis. PMID:26909186

  15. The rhythmic expression of clock genes attenuated in human plaque-derived vascular smooth muscle cells

    PubMed Central

    2014-01-01

    Background Acute myocardial infarction and stroke are more likely to occur in the early morning. Circadian pacemakers are considered to be involved in the process. Many peripheral tissues and cells also contain clock systems. In this study, we examined whether the primary cultured human plaque-derived vascular smooth muscle cells (VSMCs) process circadian rhythmicity; furthermore, we investigated the expression difference of clock genes between normal human carotid VSMCs and human plaque-derived VSMCs. Methods Fifty-six human carotid plaques provided the atherosclerotic tissue, and 21 samples yielded viable cultured primary VSMCs. The normal carotid VSMCs were cultured from donors’ normal carotids. The mRNA levels of the target genes were measured by Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR). Results After serum shock, both types of cells showed clear circadian expressions of Bmal1, Cry1, Cry2, Per1, Per2, Per3 and Rev-erbα mRNA; meanwhile the Clock mRNA show a rhythmic expression in plaque-derived SMCs but not in normal carotid VSMCs. The expression levels of these main clock genes were significantly attenuated in human plaque-derived VSMCs compared with normal human carotid VSMCs. The rhythm of Bmal1 mRNA in plaque-derived VSMCs was changed. Conclusion The present results demonstrate that the human plaque-derived VSMCs possess different circadian rhythmicity from that of normal carotid VSMCs. The rhythm changes of clock genes in plaque-derived VSMCs may be involved in the process of atherosclerosis and finally promote the rupture of plaque. PMID:24418196

  16. In vivo colonization of the mouse large intestine and in vitro penetration of intestinal mucus by an avirulent smooth strain of Salmonella typhimurium and its lipopolysaccharide-deficient mutant.

    PubMed Central

    Nevola, J J; Laux, D C; Cohen, P S

    1987-01-01

    The relative abilities of an avirulent Salmonella typhimurium strain with wild-type lipopolysaccharide (LPS) character, SL5319, and a nearly isogenic LPS-deficient mutant, SL5325, to colonize the large intestines of streptomycin-treated CD-1 mice in vivo and to penetrate colonic mucus in vitro were studied. Previously it had been shown that, when fed simultaneously to streptomycin-treated mice (approximately 10(10) CFU each), the S. typhimurium strain with wild-type LPS colonized at 10(8) CFU/g of feces indefinitely, whereas the LPS-deficient mutant dropped within 3 days to a level of only 10(4) CFU/g of feces. In the present investigation, when SL5325 was allowed to colonize for 8 days before feeding mice SL5319 or when it was fed to mice simultaneously with an Escherichia coli strain of human fecal origin (10(10) CFU each), both strains colonized indefinitely at 10(7) CFU/g of feces. Moreover, when the wild-type and LPS-deficient mutant strains were fed to mice simultaneously in low numbers (approximately 10(5) CFU each) the strains survived equally well in the large intestines for 8 days, after which the LPS-deficient mutant was eliminated (less than 10(2) CFU/g of feces), whereas the wild-type colonized at a level of 10(7) CFU/g of feces. In addition although both strains were able to adhere to mucus and epithelial cell preparations in vitro, the wild-type strain was shown to have greater motility and chemotactic activity on CD-1 mouse colonic mucus in vitro and to more rapidly penetrate and form a stable association with immobilized colonic mucosal components in vitro. Based on these data, we suggest that the ability of an S. typhimurium strain to colonize the streptomycin-treated mouse large intestine may, in part, depend on its ability to penetrate deeply into the mucus layer on the intestinal wall and subsequently, through growth, colonize the mucosa. PMID:3316026

  17. A review of drug solubility in human intestinal fluids: implications for the prediction of oral absorption.

    PubMed

    Augustijns, Patrick; Wuyts, Benjamin; Hens, Bart; Annaert, Pieter; Butler, James; Brouwers, Joachim

    2014-06-16

    The purpose of this paper is to collate all recently published solubility data of orally administered drugs in human intestinal fluids (HIF) that were aspirated from the upper small intestine (duodenum and jejunum). The data set comprises in total 102 solubility values in fasted state HIF and 37 solubility values in fed state HIF, covering 59 different drugs. Despite differences in the protocol for HIF sampling and subsequent handling, this summary of HIF solubilities provides a critical reference data set to judge the value of simulated media for intestinal solubility estimation. In this regard, the review includes correlations between the reported solubilizing capacity of HIF and fasted or fed state simulated intestinal fluid (FaSSIF/FeSSIF). Correlating with HIF solubilities enables the optimal use of solubility measurements in simulated biorelevant media to obtain accurate estimates of intestinal solubility during drug development. Considering the fraction of poorly soluble new molecular entities in contemporary drug discovery, adequate prediction of intestinal solubility is critical for efficient lead optimization, early candidate profiling, and further development. PMID:23994640

  18. Insights from human congenital disorders of intestinal lipid metabolism

    PubMed Central

    Levy, Emile

    2015-01-01

    The intestine must challenge the profuse daily flux of dietary fat that serves as a vital source of energy and as an essential component of cell membranes. The fat absorption process takes place in a series of orderly and interrelated steps, including the uptake and translocation of lipolytic products from the brush border membrane to the endoplasmic reticulum, lipid esterification, Apo synthesis, and ultimately the packaging of lipid and Apo components into chylomicrons (CMs). Deciphering inherited disorders of intracellular CM elaboration afforded new insight into the key functions of crucial intracellular proteins, such as Apo B, microsomal TG transfer protein, and Sar1b GTPase, the defects of which lead to hypobetalipoproteinemia, abetalipoproteinemia, and CM retention disease, respectively. These “experiments of nature” are characterized by fat malabsorption, steatorrhea, failure to thrive, low plasma levels of TGs and cholesterol, and deficiency of liposoluble vitamins and essential FAs. After summarizing and discussing the functions and regulation of these proteins for reader’s comprehension, the current review focuses on their specific roles in malabsorptions and dyslipidemia-related intestinal fat hyperabsorption while dissecting the spectrum of clinical manifestations and managements. The influence of newly discovered proteins (proprotein convertase subtilisin/kexin type 9 and angiopoietin-like 3 protein) on fat absorption has also been provided. Finally, it is stressed how the overexpression or polymorphism status of the critical intracellular proteins promotes dyslipidemia and cardiometabolic disorders. PMID:25387865

  19. Intestinal Microbiota Distinguish Gout Patients from Healthy Humans.

    PubMed

    Guo, Zhuang; Zhang, Jiachao; Wang, Zhanli; Ang, Kay Ying; Huang, Shi; Hou, Qiangchuan; Su, Xiaoquan; Qiao, Jianmin; Zheng, Yi; Wang, Lifeng; Koh, Eileen; Danliang, Ho; Xu, Jian; Lee, Yuan Kun; Zhang, Heping

    2016-01-01

    Current blood-based approach for gout diagnosis can be of low sensitivity and hysteretic. Here via a 68-member cohort of 33 healthy and 35 diseased individuals, we reported that the intestinal microbiota of gout patients are highly distinct from healthy individuals in both organismal and functional structures. In gout, Bacteroides caccae and Bacteroides xylanisolvens are enriched yet Faecalibacterium prausnitzii and Bifidobacterium pseudocatenulatum depleted. The established reference microbial gene catalogue for gout revealed disorder in purine degradation and butyric acid biosynthesis in gout patients. In an additional 15-member validation-group, a diagnosis model via 17 gout-associated bacteria reached 88.9% accuracy, higher than the blood-uric-acid based approach. Intestinal microbiota of gout are more similar to those of type-2 diabetes than to liver cirrhosis, whereas depletion of Faecalibacterium prausnitzii and reduced butyrate biosynthesis are shared in each of the metabolic syndromes. Thus the Microbial Index of Gout was proposed as a novel, sensitive and non-invasive strategy for diagnosing gout via fecal microbiota. PMID:26852926

  20. Intestinal Microbiota Distinguish Gout Patients from Healthy Humans

    PubMed Central

    Guo, Zhuang; Zhang, Jiachao; Wang, Zhanli; Ang, Kay Ying; Huang, Shi; Hou, Qiangchuan; Su, Xiaoquan; Qiao, Jianmin; Zheng, Yi; Wang, Lifeng; Koh, Eileen; Danliang, Ho; Xu, Jian; Lee, Yuan Kun; Zhang, Heping

    2016-01-01

    Current blood-based approach for gout diagnosis can be of low sensitivity and hysteretic. Here via a 68-member cohort of 33 healthy and 35 diseased individuals, we reported that the intestinal microbiota of gout patients are highly distinct from healthy individuals in both organismal and functional structures. In gout, Bacteroides caccae and Bacteroides xylanisolvens are enriched yet Faecalibacterium prausnitzii and Bifidobacterium pseudocatenulatum depleted. The established reference microbial gene catalogue for gout revealed disorder in purine degradation and butyric acid biosynthesis in gout patients. In an additional 15-member validation-group, a diagnosis model via 17 gout-associated bacteria reached 88.9% accuracy, higher than the blood-uric-acid based approach. Intestinal microbiota of gout are more similar to those of type-2 diabetes than to liver cirrhosis, whereas depletion of Faecalibacterium prausnitzii and reduced butyrate biosynthesis are shared in each of the metabolic syndromes. Thus the Microbial Index of Gout was proposed as a novel, sensitive and non-invasive strategy for diagnosing gout via fecal microbiota. PMID:26852926

  1. Smooth Muscle-Like Cells Generated from Human Mesenchymal Stromal Cells Display Marker Gene Expression and Electrophysiological Competence Comparable to Bladder Smooth Muscle Cells

    PubMed Central

    Brun, Juliane; Lutz, Katrin A.; Neumayer, Katharina M. H.; Klein, Gerd; Seeger, Tanja; Uynuk-Ool, Tatiana; Wörgötter, Katharina; Schmid, Sandra; Kraushaar, Udo; Guenther, Elke; Rolauffs, Bernd; Aicher, Wilhelm K.; Hart, Melanie L.

    2015-01-01

    The use of mesenchymal stromal cells (MSCs) differentiated toward a smooth muscle cell (SMC) phenotype may provide an alternative for investigators interested in regenerating urinary tract organs such as the bladder where autologous smooth muscle cells cannot be used or are unavailable. In this study we measured the effects of good manufacturing practice (GMP)-compliant expansion followed by myogenic differentiation of human MSCs on the expression of a range of contractile (from early to late) myogenic markers in relation to the electrophysiological parameters to assess the functional role of the differentiated MSCs and found that differentiation of MSCs associated with electrophysiological competence comparable to bladder SMCs. Within 1–2 weeks of myogenic differentiation, differentiating MSCs significantly expressed alpha smooth muscle actin (αSMA; ACTA2), transgelin (TAGLN), calponin (CNN1), and smooth muscle myosin heavy chain (SM-MHC; MYH11) according to qRT-PCR and/or immunofluorescence and Western blot. Voltage-gated Na+ current levels also increased within the same time period following myogenic differentiation. In contrast to undifferentiated MSCs, differentiated MSCs and bladder SMCs exhibited elevated cytosolic Ca2+ transients in response to K+-induced depolarization and contracted in response to K+ indicating functional maturation of differentiated MSCs. Depolarization was suppressed by Cd2+, an inhibitor of voltage-gated Ca2+-channels. The expression of Na+-channels was pharmacologically identified as the Nav1.4 subtype, while the K+ and Ca2+ ion channels were identified by gene expression of KCNMA1, CACNA1C and CACNA1H which encode for the large conductance Ca2+-activated K+ channel BKCa channels, Cav1.2 L-type Ca2+ channels and Cav3.2 T-type Ca2+ channels, respectively. This protocol may be used to differentiate adult MSCs into smooth muscle-like cells with an intermediate-to-late SMC contractile phenotype exhibiting voltage-gated ion channel

  2. Smooth Muscle-Like Cells Generated from Human Mesenchymal Stromal Cells Display Marker Gene Expression and Electrophysiological Competence Comparable to Bladder Smooth Muscle Cells.

    PubMed

    Brun, Juliane; Lutz, Katrin A; Neumayer, Katharina M H; Klein, Gerd; Seeger, Tanja; Uynuk-Ool, Tatiana; Wörgötter, Katharina; Schmid, Sandra; Kraushaar, Udo; Guenther, Elke; Rolauffs, Bernd; Aicher, Wilhelm K; Hart, Melanie L

    2015-01-01

    The use of mesenchymal stromal cells (MSCs) differentiated toward a smooth muscle cell (SMC) phenotype may provide an alternative for investigators interested in regenerating urinary tract organs such as the bladder where autologous smooth muscle cells cannot be used or are unavailable. In this study we measured the effects of good manufacturing practice (GMP)-compliant expansion followed by myogenic differentiation of human MSCs on the expression of a range of contractile (from early to late) myogenic markers in relation to the electrophysiological parameters to assess the functional role of the differentiated MSCs and found that differentiation of MSCs associated with electrophysiological competence comparable to bladder SMCs. Within 1-2 weeks of myogenic differentiation, differentiating MSCs significantly expressed alpha smooth muscle actin (αSMA; ACTA2), transgelin (TAGLN), calponin (CNN1), and smooth muscle myosin heavy chain (SM-MHC; MYH11) according to qRT-PCR and/or immunofluorescence and Western blot. Voltage-gated Na+ current levels also increased within the same time period following myogenic differentiation. In contrast to undifferentiated MSCs, differentiated MSCs and bladder SMCs exhibited elevated cytosolic Ca2+ transients in response to K+-induced depolarization and contracted in response to K+ indicating functional maturation of differentiated MSCs. Depolarization was suppressed by Cd2+, an inhibitor of voltage-gated Ca2+-channels. The expression of Na+-channels was pharmacologically identified as the Nav1.4 subtype, while the K+ and Ca2+ ion channels were identified by gene expression of KCNMA1, CACNA1C and CACNA1H which encode for the large conductance Ca2+-activated K+ channel BKCa channels, Cav1.2 L-type Ca2+ channels and Cav3.2 T-type Ca2+ channels, respectively. This protocol may be used to differentiate adult MSCs into smooth muscle-like cells with an intermediate-to-late SMC contractile phenotype exhibiting voltage-gated ion channel

  3. Cigarette smoke enhances proliferation and extracellular matrix deposition by human fetal airway smooth muscle

    PubMed Central

    Vogel, Elizabeth R.; VanOosten, Sarah K.; Holman, Michelle A.; Hohbein, Danielle D.; Thompson, Michael A.; Vassallo, Robert; Pandya, Hitesh C.; Prakash, Y. S.

    2014-01-01

    Cigarette smoke is a common environmental insult associated with increased risk of developing airway diseases such as wheezing and asthma in neonates and children. In adults, asthma involves airway remodeling characterized by increased airway smooth muscle (ASM) cell proliferation and increased extracellular matrix (ECM) deposition, as well as airway hyperreactivity. The effects of cigarette smoke on remodeling and contractility in the developing airway are not well-elucidated. In this study, we used canalicular-stage (18–20 wk gestational age) human fetal airway smooth muscle (fASM) cells as an in vitro model of the immature airway. fASM cells were exposed to cigarette smoke extract (CSE; 0.5–1.5% for 24–72 h), and cell proliferation, ECM deposition, and intracellular calcium ([Ca2+]i) responses to agonist (histamine 10 μM) were used to evaluate effects on remodeling and hyperreactivity. CSE significantly increased cell proliferation and deposition of ECM molecules collagen I, collagen III, and fibronectin. In contrast, [Ca2+]i responses were not significantly affected by CSE. Analysis of key signaling pathways demonstrated significant increase in extracellular signal-related kinase (ERK) and p38 activation with CSE. Inhibition of ERK or p38 signaling prevented CSE-mediated changes in proliferation, whereas only ERK inhibition attenuated the CSE-mediated increase in ECM deposition. Overall, these results demonstrate that cigarette smoke may enhance remodeling in developing human ASM through hyperplasia and ECM production, thus contributing to development of neonatal and pediatric airway disease. PMID:25344066

  4. Biomechanical effects of environmental and engineered particles on human airway smooth muscle cells

    PubMed Central

    Berntsen, P.; Park, C. Y.; Rothen-Rutishauser, B.; Tsuda, A.; Sager, T. M.; Molina, R. M.; Donaghey, T. C.; Alencar, A. M.; Kasahara, D. I.; Ericsson, T.; Millet, E. J.; Swenson, J.; Tschumperlin, D. J.; Butler, J. P.; Brain, J. D.; Fredberg, J. J.; Gehr, P.; Zhou, E. H.

    2010-01-01

    The past decade has seen significant increases in combustion-generated ambient particles, which contain a nanosized fraction (less than 100 nm), and even greater increases have occurred in engineered nanoparticles (NPs) propelled by the booming nanotechnology industry. Although inhalation of these particulates has become a public health concern, human health effects and mechanisms of action for NPs are not well understood. Focusing on the human airway smooth muscle cell, here we show that the cellular mechanical function is altered by particulate exposure in a manner that is dependent upon particle material, size and dose. We used Alamar Blue assay to measure cell viability and optical magnetic twisting cytometry to measure cell stiffness and agonist-induced contractility. The eight particle species fell into four categories, based on their respective effect on cell viability and on mechanical function. Cell viability was impaired and cell contractility was decreased by (i) zinc oxide (40–100 nm and less than 44 μm) and copper(II) oxide (less than 50 nm); cell contractility was decreased by (ii) fluorescent polystyrene spheres (40 nm), increased by (iii) welding fumes and unchanged by (iv) diesel exhaust particles, titanium dioxide (25 nm) and copper(II) oxide (less than 5 μm), although in none of these cases was cell viability impaired. Treatment with hydrogen peroxide up to 500 μM did not alter viability or cell mechanics, suggesting that the particle effects are unlikely to be mediated by particle-generated reactive oxygen species. Our results highlight the susceptibility of cellular mechanical function to particulate exposures and suggest that direct exposure of the airway smooth muscle cells to particulates may initiate or aggravate respiratory diseases. PMID:20356875

  5. Biomechanical effects of environmental and engineered particles on human airway smooth muscle cells.

    PubMed

    Berntsen, P; Park, C Y; Rothen-Rutishauser, B; Tsuda, A; Sager, T M; Molina, R M; Donaghey, T C; Alencar, A M; Kasahara, D I; Ericsson, T; Millet, E J; Swenson, J; Tschumperlin, D J; Butler, J P; Brain, J D; Fredberg, J J; Gehr, P; Zhou, E H

    2010-06-01

    The past decade has seen significant increases in combustion-generated ambient particles, which contain a nanosized fraction (less than 100 nm), and even greater increases have occurred in engineered nanoparticles (NPs) propelled by the booming nanotechnology industry. Although inhalation of these particulates has become a public health concern, human health effects and mechanisms of action for NPs are not well understood. Focusing on the human airway smooth muscle cell, here we show that the cellular mechanical function is altered by particulate exposure in a manner that is dependent upon particle material, size and dose. We used Alamar Blue assay to measure cell viability and optical magnetic twisting cytometry to measure cell stiffness and agonist-induced contractility. The eight particle species fell into four categories, based on their respective effect on cell viability and on mechanical function. Cell viability was impaired and cell contractility was decreased by (i) zinc oxide (40-100 nm and less than 44 microm) and copper(II) oxide (less than 50 nm); cell contractility was decreased by (ii) fluorescent polystyrene spheres (40 nm), increased by (iii) welding fumes and unchanged by (iv) diesel exhaust particles, titanium dioxide (25 nm) and copper(II) oxide (less than 5 microm), although in none of these cases was cell viability impaired. Treatment with hydrogen peroxide up to 500 microM did not alter viability or cell mechanics, suggesting that the particle effects are unlikely to be mediated by particle-generated reactive oxygen species. Our results highlight the susceptibility of cellular mechanical function to particulate exposures and suggest that direct exposure of the airway smooth muscle cells to particulates may initiate or aggravate respiratory diseases. PMID:20356875

  6. Life and death at the mucosal-luminal interface: New perspectives on human intestinal ischemia-reperfusion

    PubMed Central

    Grootjans, Joep; Lenaerts, Kaatje; Buurman, Wim A; Dejong, Cornelis H C; Derikx, Joep P M

    2016-01-01

    Intestinal ischemia is a frequently observed phenomenon. Morbidity and mortality rates are extraordinarily high and did not improve over the past decades. This is in part attributable to limited knowledge on the pathophysiology of intestinal ischemia-reperfusion (IR) in man, the paucity in preventive and/or therapeutic options and the lack of early diagnostic markers for intestinal ischemia. To improve our knowledge and solve clinically important questions regarding intestinal IR, we developed a human experimental intestinal IR model. With this model, we were able to gain insight into the mechanisms that allow the human gut to withstand short periods of IR without the development of severe inflammatory responses. The purpose of this review is to overview the most relevant recent advances in our understanding of the pathophysiology of human intestinal IR, as well as the (potential) future clinical implications. PMID:26973414

  7. Chemical form of selenium affects its uptake, transport and glutathione peroxidase activity in the human intestinal Caco-2 cell model

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Determining the effect of selenium (Se) chemical form on uptake and transport in human intestinal cells is critical to assess Se bioavailability. In the present study, we measured the uptake and transport of various Se compounds in the human intestinal Caco-2 cell model. We found that two sources...

  8. Identification of the transcriptional response of human intestinal mucosa to Lactobacillus plantarum WCFS1 in vivo

    PubMed Central

    Troost, Freddy J; van Baarlen, Peter; Lindsey, Patrick; Kodde, Andrea; de Vos, Willem M; Kleerebezem, Michiel; Brummer, Robert-Jan M

    2008-01-01

    Background There is limited knowledge on the extent and dynamics of the mucosal response to commensal and probiotic species in the human intestinal lumen. This study aimed to identify the acute, time-dependent responses of intestinal mucosa to commensal Lactobacillus plantarum WCFS1 in vivo in two placebo-controlled human intervention studies in healthy volunteers. Transcriptional changes in duodenal mucosa upon continuous intraduodenal infusion of L. plantarum WCFS1 for one- and six h, respectively, were studied using oro- and nasogastric intubations with dedicated orogastric catheters and tissue sampling by standard flexible gastroduodenoscopy. Results One- and six-h exposure of small intestinal mucosa to L. plantarum WCFS1 induced differential expression of 669 and 424 gene reporters, respectively. While short-term exposure to L. plantarum WCFS1 inhibited fatty acid metabolism and cell cycle progression, cells switched to a more proliferative phase after prolonged exposure with an overall expression profile characterized by upregulation of genes involved in lipid metabolism, cellular growth and development. Cell death and immune responses were triggered, but cell death-executing genes or inflammatory signals were not expressed. Proteome analysis showed differential expression of several proteins. Only the microsomal protein 'microsomal triglyceride transfer protein' was regulated on both the transcriptional and the protein level in all subjects. Conclusion Overall, this study showed that intestinal exposure to L. plantarum WCFS1 induced consistent, time-dependent transcriptional responses in healthy intestinal mucosa. This extensive exploration of the human response to L. plantarum WCFS1 could eventually provide molecular support for specific or probiotic activity of this strain or species, and exemplifies the strength of the applied technology to identify the potential bio-activity of microbes in the human intestine. PMID:18681965

  9. Effect of antidiuretic hormone on human small intestinal water and solute transport

    PubMed Central

    Soergel, Konrad H.; Whalen, George E.; Harris, John A.; Geenen, Joseph E.

    1968-01-01

    The effect of i.v. Pitressin (ADH) in a dose of 1 U/hr on permeability characteristics and on absorptive capacity of the normal human small intestine was investigated. The method of continuous intestinal perfusion was employed with polyethylene glycol 4000 as a nonabsorbable marker. Unidirectional flux rates of Na and H2O were calculated from the disappearance of 22Na and of 3HOH from isotonic saline solution within the intestinal lumen. Each study consisted of two successive perfusion periods: one while the subject was hydrated, the other during ADH infusion or while the subject was dehydrated. Water and sodium absorption from isotonic NaCl occurred in the hydrated state and was abolished by ADH as well as by dehydration in the jejunum. In some instances, net gain of water and sodium in the lumen occurred. In the ileum, ADH and dehydration caused a decrease in water and sodium absorption rate. By contrast, unidirectional flux into the intestinal lumen of water and sodium, as well as dextrose and D-xylose diffusion, remained unchanged by ADH. During perfusions with hypertonic urea solutions the rates of sodium and water entry into the intestine were greatly increased during i.v. ADH infusion, whereas urea loss from the study segment remained constant. ADH in the dosage used did not affect human intestinal motility. The results suggest that circulating ADH in physiologic concentrations affects the small intestine in one of two ways: increased secretion of water and salt into the lumen or direct interference with the active sodium transport mechanism. PMID:5645853

  10. Identification of Functional Voltage-gated Na+ Channels in Cultured Human Pulmonary Artery Smooth Muscle Cells

    PubMed Central

    Sison, Tiffany; Yuan, Jason X.-J.

    2005-01-01

    Electrical excitability, which plays an important role in excitation-contraction coupling in the pulmonary vasculature, is regulated by transmembrane ion flux in pulmonary artery smooth muscle cells (PASMC). This study aimed to characterize the electrophysiological properties and molecular identities of voltage-gated Na+ channels in cultured human PASMC. We recorded tetrodotoxin-sensitive and rapidly inactivating Na+ currents with properties similar to those described in cardiac myocytes. Using RT-PCR, we detected transcripts of seven Na+ channel α genes (SCN2A, 3A, 4A, 7A, 8A, 9A, and 11A), and two β subunit genes (SCN1B and 2B). Our results demonstrate that human PASMC express TTX-sensitive voltage-gated Na+ channels. Their physiological functions remain unresolved, although our data suggest that Na+ channel activity does not directly influence membrane potential, intracellular Ca2+ release, or proliferation in normal human PASMC. Whether their expression and/or activity are heightened in the pathological state is discussed. PMID:16052353

  11. Derivation of Functional Smooth Muscle Cells from Multipotent Human Hair Follicle Mesenchymal Stem Cells

    PubMed Central

    Liu, Jin Yu; Peng, Hao Fan; Gopinath, Siddhita; Tian, Jun

    2010-01-01

    We investigated the potential of human hair follicle cells for multilineage differentiation and as a source of functional smooth muscle cells (SMCs). We report that human hair follicle stem cells (HFCs) isolated from individual follicles expressed surface markers that are characteristic of mesenchymal stem cells such as CD44, CD49b, CD73, CD90, and CD105 but lacked hematopoietic markers CD45 and CD34. In addition, HFCs differentiated toward adipocytes, chondrocytes, osteoblasts, or SMCs in the appropriate induction medium. Treatment with basic fibroblast growth factor increased proliferation and prevented myogenic differentiation, suggesting that basic fibroblast growth factor can be used to expand the population of undifferentiated HFCs to the large numbers needed for therapeutic applications. SMCs were isolated from HFCs using tissue-specific promoters and flow cytometry sorting. Cylindrical vascular constructs engineered with HF-SMCs showed remarkable contractility in response to receptor and nonreceptor agonists such KCl, endothelin-1, and the thromboxane mimetic, U46619, as well as superior mechanical properties compared to their counterparts with human vascular SMCs. Our results suggest that HF is a rich source of mesenchymal stem cells with great potential for myogenic differentiation providing functional SMCs for tissue regeneration and cell therapies. PMID:20236033

  12. CD4+CD25bright T cells in human intestinal lamina propria as regulatory cells.

    PubMed

    Makita, Shin; Kanai, Takanori; Oshima, Shigeru; Uraushihara, Koji; Totsuka, Teruji; Sawada, Taisuke; Nakamura, Tetsuya; Koganei, Kazutaka; Fukushima, Tsuneo; Watanabe, Mamoru

    2004-09-01

    It is well known that immune responses in the intestine remain in a state of controlled inflammation, suggesting that not only active suppression by regulatory T cells plays an important role in the normal intestinal homeostasis, but also its dysregulation leads to the development of inflammatory bowel disease. In this study, we demonstrate that the CD4(+)CD25(bright) T cells reside in the human intestinal lamina propria (LP) and functionally retain regulatory activities. All human LP CD4(+) T cells regardless of CD25 expression constitutively expressed CTLA-4, glucocorticoid-induced TNFR family-related protein, and Foxp3 and proliferate poorly. Although LP CD4(+)CD25(-) T cells showed an activated and anergic/memory phenotype, they did not retain regulatory activity. In LP CD4(+)CD25(+) T cells, however, cells expressing CD25 at high levels (CD4(+)CD25(bright)) suppressed the proliferation and various cytokine productions of CD4(+)CD25(-) T cells. LP CD4(+)CD25(bright) T cells by themselves produced fewer amounts of IL-2, IFN-gamma, and IL-10. Interestingly, LP CD4(+)CD25(bright) T cells with regulatory T activity were significantly increased in patients with active inflammatory bowel disease. These results suggest that CD4(+)CD25(bright) T cells found in the normal and inflamed intestinal mucosa selectively inhibit the host immune response and therefore may contribute to the intestinal immune homeostasis. PMID:15322172

  13. Glucose induces intestinal human UDP-glucuronosyltransferase (UGT) 1A1 to prevent neonatal hyperbilirubinemia.

    PubMed

    Aoshima, Naoya; Fujie, Yoshiko; Itoh, Tomoo; Tukey, Robert H; Fujiwara, Ryoichi

    2014-01-01

    Inadequate calorie intake or starvation has been suggested as a cause of neonatal jaundice, which can further cause permanent brain damage, kernicterus. This study experimentally investigated whether additional glucose treatments induce the bilirubin-metabolizing enzyme--UDP-glucuronosyltransferase (UGT) 1A1--to prevent the onset of neonatal hyperbilirubinemia. Neonatal humanized UGT1 (hUGT1) mice physiologically develop jaundice. In this study, UGT1A1 expression levels were determined in the liver and small intestine of neonatal hUGT1 mice that were orally treated with glucose. In the hUGT1 mice, glucose induced UGT1A1 in the small intestine, while it did not affect the expression of UGT1A1 in the liver. UGT1A1 was also induced in the human intestinal Caco-2 cells when the cells were cultured in the presence of glucose. Luciferase assays demonstrated that not only the proximal region (-1300/-7) of the UGT1A1 promoter, but also distal region (-6500/-4050) were responsible for the induction of UGT1A1 in the intestinal cells. Adequate calorie intake would lead to the sufficient expression of UGT1A1 in the small intestine to reduce serum bilirubin levels. Supplemental treatment of newborns with glucose solution can be a convenient and efficient method to treat neonatal jaundice while allowing continuous breastfeeding. PMID:25209391

  14. Expression and function of KV2-containing channels in human urinary bladder smooth muscle

    PubMed Central

    Hristov, Kiril L.; Chen, Muyan; Afeli, Serge A. Y.; Cheng, Qiuping; Rovner, Eric S.

    2012-01-01

    The functional role of the voltage-gated K+ (KV) channels in human detrusor smooth muscle (DSM) is largely unexplored. Here, we provide molecular, electrophysiological, and functional evidence for the expression of KV2.1, KV2.2, and the electrically silent KV9.3 subunits in human DSM. Stromatoxin-1 (ScTx1), a selective inhibitor of KV2.1, KV2.2, and KV4.2 homotetrameric channels and of KV2.1/9.3 heterotetrameric channels, was used to examine the role of these channels in human DSM function. Human DSM tissues were obtained during open bladder surgeries from patients without a history of overactive bladder. Freshly isolated human DSM cells were studied using RT-PCR, immunocytochemistry, live-cell Ca2+ imaging, and the perforated whole cell patch-clamp technique. Isometric DSM tension recordings of human DSM isolated strips were conducted using tissue baths. RT-PCR experiments showed mRNA expression of KV2.1, KV2.2, and KV9.3 (but not KV4.2) channel subunits in human isolated DSM cells. KV2.1 and KV2.2 protein expression was confirmed by Western blot analysis and immunocytochemistry. Perforated whole cell patch-clamp experiments revealed that ScTx1 (100 nM) inhibited the amplitude of the voltage step-induced KV current in freshly isolated human DSM cells. ScTx1 (100 nM) significantly increased the intracellular Ca2+ level in DSM cells. In human DSM isolated strips, ScTx1 (100 nM) increased the spontaneous phasic contraction amplitude and muscle force, and enhanced the amplitude of the electrical field stimulation-induced contractions within the range of 3.5–30 Hz stimulation frequencies. These findings reveal that ScTx1-sensitive KV2-containing channels are key regulators of human DSM excitability and contractility and may represent new targets for pharmacological or genetic intervention for bladder dysfunction. PMID:22422395

  15. Evidence of native starch degradation with human small intestinal maltase-glucoamylase (recombinant)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Action of human small intestinal brush border carbohydrate digesting enzymes is thought to involve only final hydrolysis reactions of oligosaccharides to monosaccharides. In vitro starch digestibility assays use fungal amyloglucosidase to provide this function. In this study, recombinant N-terminal ...

  16. Consensus hologram QSAR modeling for the prediction of human intestinal absorption.

    PubMed

    Moda, Tiago L; Andricopulo, Adriano D

    2012-04-15

    Consistent in silico models for ADME properties are useful tools in early drug discovery. Here, we report the hologram QSAR modeling of human intestinal absorption using a dataset of 638 compounds with experimental data associated. The final validated models are consistent and robust for the consensus prediction of this important pharmacokinetic property and are suitable for virtual screening applications. PMID:22425566

  17. Chemokine production by human vascular smooth muscle cells: modulation by IL-13

    PubMed Central

    Jordan, Nicola J; Watson, Malcolm L; Williams, Robert J; Roach, Alan G; Yoshimura, Teizo; Westwick, John

    1997-01-01

    The production of chemokines by vascular smooth muscle cells (SMC) is implicated in the pathogenesis of atherosclerosis, although the factors regulating chemokine production by these cells are incompletely characterized. We describe the differential stimulation of interleukin-(IL)-8, monocyte chemoattractant protein (MCP)-1 and regulated on activation normal T-cell expressed and secreted (RANTES) synthesis following treatment of human vascular SMC with IL-1α or tumour necrosis factor α (TNFα). Under basal conditions, cultured SMC release very low amounts of IL-8, MCP-1 and RANTES as assessed by specific ELISA. Concentration-response studies with IL-1α or TNFα revealed that each stimulus induced a similar amount of MCP-1. In contrast approximately three fold more IL-8 was induced by IL-1α than by TNFα whereas significant RANTES production was induced only by TNFα. These findings point to a divergence in the regulation of synthesis of the different chemokines in response to IL-1α or TNFα stimulation. The T-cell derived cytokines IL-10 and IL-13 were also found to have differential effects on chemokine production by SMC. IL-13, but not IL-10, significantly enhanced IL-8 and MCP-1 release in response to IL-1α or TNFα. This increase in chemokine release appeared to be accounted for by increased mRNA expression. These findings provide support for the concept that smooth muscle cells can have an active role in a local immune response via the production of chemokines which can be selectively modulated by T-cell derived cytokines. PMID:9375973

  18. Smoking and Female Sex: Independent Predictors of Human Vascular Smooth Muscle Cells Stiffening

    PubMed Central

    Dinardo, Carla Luana; Santos, Hadassa Campos; Vaquero, André Ramos; Martelini, André Ricardo; Dallan, Luis Alberto Oliveira; Alencar, Adriano Mesquita; Krieger, José Eduardo; Pereira, Alexandre Costa

    2015-01-01

    Aims Recent evidence shows the rigidity of vascular smooth muscle cells (VSMC) contributes to vascular mechanics. Arterial rigidity is an independent cardiovascular risk factor whose associated modifications in VSMC viscoelasticity have never been investigated. This study’s objective was to evaluate if the arterial rigidity risk factors aging, African ancestry, female sex, smoking and diabetes mellitus are associated with VMSC stiffening in an experimental model using a human derived vascular smooth muscle primary cell line repository. Methods Eighty patients subjected to coronary artery bypass surgery were enrolled. VSMCs were extracted from internal thoracic artery fragments and mechanically evaluated using Optical Magnetic Twisting Cytometry assay. The obtained mechanical variables were correlated with the clinical variables: age, gender, African ancestry, smoking and diabetes mellitus. Results The mechanical variables Gr, G’r and G”r had a normal distribution, demonstrating an inter-individual variability of VSMC viscoelasticity, which has never been reported before. Female sex and smoking were independently associated with VSMC stiffening: Gr (apparent cell stiffness) p = 0.022 and p = 0.018, R2 0.164; G’r (elastic modulus) p = 0.019 and p = 0.009, R2 0.184 and G”r (dissipative modulus) p = 0.011 and p = 0.66, R2 0.141. Conclusion Female sex and smoking are independent predictors of VSMC stiffening. This pro-rigidity effect represents an important element for understanding the vascular rigidity observed in post-menopausal females and smokers, as well as a potential therapeutic target to be explored in the future. There is a significant inter-individual variation of VSMC viscoelasticity, which is slightly modulated by clinical variables and probably relies on molecular factors. PMID:26661469

  19. Olfactory Receptors Modulate Physiological Processes in Human Airway Smooth Muscle Cells.

    PubMed

    Kalbe, Benjamin; Knobloch, Jürgen; Schulz, Viola M; Wecker, Christine; Schlimm, Marian; Scholz, Paul; Jansen, Fabian; Stoelben, Erich; Philippou, Stathis; Hecker, Erich; Lübbert, Hermann; Koch, Andrea; Hatt, Hanns; Osterloh, Sabrina

    2016-01-01

    Pathophysiological mechanisms in human airway smooth muscle cells (HASMCs) significantly contribute to the progression of chronic inflammatory airway diseases with limited therapeutic options, such as severe asthma and COPD. These abnormalities include the contractility and hyperproduction of inflammatory proteins. To develop therapeutic strategies, key pathological mechanisms, and putative clinical targets need to be identified. In the present study, we demonstrated that the human olfactory receptors (ORs) OR1D2 and OR2AG1 are expressed at the RNA and protein levels in HASMCs. Using fluorometric calcium imaging, specific agonists for OR2AG1 and OR1D2 were identified to trigger transient Ca(2+) increases in HASMCs via a cAMP-dependent signal transduction cascade. Furthermore, the activation of OR2AG1 via amyl butyrate inhibited the histamine-induced contraction of HASMCs, whereas the stimulation of OR1D2 with bourgeonal led to an increase in cell contractility. In addition, OR1D2 activation induced the secretion of IL-8 and GM-CSF. Both effects were inhibited by the specific OR1D2 antagonist undecanal. We herein provide the first evidence to show that ORs are functionally expressed in HASMCs and regulate pathophysiological processes. Therefore, ORs might be new therapeutic targets for these diseases, and blocking ORs could be an auspicious strategy for the treatment of early-stage chronic inflammatory lung diseases. PMID:27540365

  20. Nitric oxide production by cultured human aortic smooth muscle cells: stimulation by fluid flow

    NASA Technical Reports Server (NTRS)

    Papadaki, M.; Tilton, R. G.; Eskin, S. G.; McIntire, L. V.

    1998-01-01

    This study demonstrated that exposure of cultured human aortic smooth muscle cells (SMC) to fluid flow resulted in nitric oxide (NO) production, monitored by nitrite and guanosine 3',5'-cyclic monophosphate production. A rapid burst in nitrite production rate was followed by a more gradual increase throughout the period of flow exposure. Neither the initial burst nor the prolonged nitrite production was dependent on the level of shear stress in the range of 1.1-25 dyn/cm2. Repeated exposure to shear stress after a 30-min static period restimulated nitrite production similar to the initial burst. Ca(2+)-calmodulin antagonists blocked the initial burst in nitrite release. An inhibitor of nitric oxide synthase (NOS) blocked nitrite production, indicating that changes in nitrite reflect NO production. Treatment with dexamethasone or cycloheximide had no effect on nitrite production. Monoclonal antibodies directed against the inducible and endothelial NOS isoforms showed no immunoreactivity on Western blots, whereas monoclonal antibodies directed against the neuronal NOS gave specific products. These findings suggest that human aortic SMC express a constitutive neuronal NOS isoform, the enzymatic activity of which is modulated by flow.

  1. Fetal human airway smooth muscle cell production of leukocyte chemoattractants is differentially regulated by fluticasone

    PubMed Central

    Pearson, Helen; Britt, Rodney D.; Pabelick, Christine M.; Prakash, Y.S.; Amrani, Yassine; Pandya, Hitesh C.

    2016-01-01

    Background Adult human airway smooth muscle (ASM) produce cytokines involved in recruitment and survival of leukocytes within airway walls. Cytokine generation by adult ASM is glucocorticoid-sensitive. Whether developing lung ASM produces cytokines in a glucocorticoid-sensitive fashion is unknown. Methods Cultured fetal human ASM cells stimulated with TNF-α (0–20 ng/ml) were incubated with TNF-α receptor-blocking antibodies, fluticasone (1 and 100 nm), or vehicle. Supernatants and cells were assayed for the production of CCL5, CXCL10, and CXCL8 mRNA and protein and glucocorticoid receptor phosphorylation. Results CCL5, CXCL10, and CXCL8 mRNA and protein production by fetal ASM cell was significantly and dose-dependently following TNF-α treatment. Cytokine mRNA and protein production were effectively blocked by TNF-α R1 and R2 receptor neutralizing antibodies but variably inhibited by fluticasone. TNF-α-induced TNF-R1 and R2 receptor mRNA expression was only partially attenuated by fluticasone. Glucocorticoid receptor phosphorylation at serine (Ser) 211 but not at Ser 226 was enhanced by fluticasone. Conclusion Production of CCL5, CXCL10, and CXCL8 by fetal ASM appears to involve pathways that are both qualitatively and mechanistically distinct to those described for adult ASM. The findings imply developing ASM has potential to recruit leukocyte into airways and, therefore, of relevance to childhood airway diseases. PMID:26331770

  2. Olfactory Receptors Modulate Physiological Processes in Human Airway Smooth Muscle Cells

    PubMed Central

    Kalbe, Benjamin; Knobloch, Jürgen; Schulz, Viola M.; Wecker, Christine; Schlimm, Marian; Scholz, Paul; Jansen, Fabian; Stoelben, Erich; Philippou, Stathis; Hecker, Erich; Lübbert, Hermann; Koch, Andrea; Hatt, Hanns; Osterloh, Sabrina

    2016-01-01

    Pathophysiological mechanisms in human airway smooth muscle cells (HASMCs) significantly contribute to the progression of chronic inflammatory airway diseases with limited therapeutic options, such as severe asthma and COPD. These abnormalities include the contractility and hyperproduction of inflammatory proteins. To develop therapeutic strategies, key pathological mechanisms, and putative clinical targets need to be identified. In the present study, we demonstrated that the human olfactory receptors (ORs) OR1D2 and OR2AG1 are expressed at the RNA and protein levels in HASMCs. Using fluorometric calcium imaging, specific agonists for OR2AG1 and OR1D2 were identified to trigger transient Ca2+ increases in HASMCs via a cAMP-dependent signal transduction cascade. Furthermore, the activation of OR2AG1 via amyl butyrate inhibited the histamine-induced contraction of HASMCs, whereas the stimulation of OR1D2 with bourgeonal led to an increase in cell contractility. In addition, OR1D2 activation induced the secretion of IL-8 and GM-CSF. Both effects were inhibited by the specific OR1D2 antagonist undecanal. We herein provide the first evidence to show that ORs are functionally expressed in HASMCs and regulate pathophysiological processes. Therefore, ORs might be new therapeutic targets for these diseases, and blocking ORs could be an auspicious strategy for the treatment of early-stage chronic inflammatory lung diseases. PMID:27540365

  3. CD38 and Airway hyperresponsiveness: Studies on human airway smooth muscle cells and mouse models

    PubMed Central

    Guedes, Alonso GP; Deshpande, Deepak A; Dileepan, Mythili; Walseth, Timothy F; Panettieri, Reynold A; Subramanian, Subbaya; Kannan, Mathur S

    2015-01-01

    Asthma is an inflammatory disease in which altered calcium regulation, contractility and airway smooth muscle (ASM) proliferation contribute to airway hyperresponsiveness and airway wall remodeling. The enzymatic activity of CD38, a cell-surface protein expressed in human ASM cells, generates calcium mobilizing second messenger molecules such as cyclic ADP-ribose. CD38 expression in human ASM cells is augmented by cytokines (e.g. TNF-α) that requires activation of MAP kinases and the transcription factors, NF-ƙB and AP-1 and post-transcriptionally regulated by miR-140-3p and miR-708 by binding to 3’ Untranslated Region of CD38 as well as by modulating the activation of signaling mechanisms involved in its regulation. Mice deficient in CD38 exhibit reduced airway responsiveness to inhaled methacholine relative to response in wild-type mice. Intranasal challenge of CD38 deficient mice with TNF-α or IL-13, or the environmental fungus Alternaria alternata, causes significantly attenuated methacholine responsiveness compared to wild-type mice, with comparable airway inflammation. Reciprocal bone marrow transfer studies revealed partial restoration of airway hyperresponsiveness to inhaled methacholine in the Cd38 deficient mice. These studies provide evidence for CD38 involvement in the development of airway hyperresponsiveness, a hallmark feature of asthma. Future studies aimed at drug discovery and delivery targeting CD38 expression and/or activity are warranted. PMID:25594684

  4. CFTR is a tumor suppressor gene in murine and human intestinal cancer.

    PubMed

    Than, B L N; Linnekamp, J F; Starr, T K; Largaespada, D A; Rod, A; Zhang, Y; Bruner, V; Abrahante, J; Schumann, A; Luczak, T; Niemczyk, A; O'Sullivan, M G; Medema, J P; Fijneman, R J A; Meijer, G A; Van den Broek, E; Hodges, C A; Scott, P M; Vermeulen, L; Cormier, R T

    2016-08-11

    CFTR, the cystic fibrosis (CF) gene, encodes for the CFTR protein that plays an essential role in anion regulation and tissue homeostasis of various epithelia. In the gastrointestinal (GI) tract CFTR promotes chloride and bicarbonate secretion, playing an essential role in ion and acid-base homeostasis. Cftr has been identified as a candidate driver gene for colorectal cancer (CRC) in several Sleeping Beauty DNA transposon-based forward genetic screens in mice. Further, recent epidemiological and clinical studies indicate that CF patients are at high risk for developing tumors in the colon. To investigate the effects of CFTR dysregulation on GI cancer, we generated Apc(Min) mice that carried an intestinal-specific knockout of Cftr. Our results indicate that Cftr is a tumor suppressor gene in the intestinal tract as Cftr mutant mice developed significantly more tumors in the colon and the entire small intestine. In Apc(+/+) mice aged to ~1 year, Cftr deficiency alone caused the development of intestinal tumors in >60% of mice. Colon organoid formation was significantly increased in organoids created from Cftr mutant mice compared with wild-type controls, suggesting a potential role of Cftr in regulating the intestinal stem cell compartment. Microarray data from the Cftr-deficient colon and the small intestine identified dysregulated genes that belong to groups of immune response, ion channel, intestinal stem cell and other growth signaling regulators. These associated clusters of genes were confirmed by pathway analysis using Ingenuity Pathway Analysis and gene set enrichment analysis (GSEA). We also conducted RNA Seq analysis of tumors from Apc(+/+) Cftr knockout mice and identified sets of genes dysregulated in tumors including altered Wnt β-catenin target genes. Finally we analyzed expression of CFTR in early stage human CRC patients stratified by risk of recurrence and found that loss of expression of CFTR was significantly associated with poor disease

  5. CFTR is a tumor suppressor gene in murine and human intestinal cancer

    PubMed Central

    Than, BLN; Linnekamp, JF; Starr, TK; Largaespada, DA; Rod, A; Zhang, Y; Bruner, V; Abrahante, J; Schumann, A; Luczak, T; Niemczyk, A; O’Sullivan, MG; Medema, JP; Fijneman, RJA; Meijer, GA; Van den Broek, E; Hodges, CA; Scott, PM; Vermeulen, L; Cormier, RT

    2016-01-01

    CFTR, the cystic fibrosis (CF) gene, encodes for the CFTR protein that plays an essential role in anion regulation and tissue homeostasis of various epithelia. In the gastrointestinal (GI) tract CFTR promotes chloride and bicarbonate secretion, playing an essential role in ion and acid–base homeostasis. Cftr has been identified as a candidate driver gene for colorectal cancer (CRC) in several Sleeping Beauty DNA transposon-based forward genetic screens in mice. Further, recent epidemiological and clinical studies indicate that CF patients are at high risk for developing tumors in the colon. To investigate the effects of CFTR dysregulation on GI cancer, we generated ApcMin mice that carried an intestinal-specific knockout of Cftr. Our results indicate that Cftr is a tumor suppressor gene in the intestinal tract as Cftr mutant mice developed significantly more tumors in the colon and the entire small intestine. In Apc+/+ mice aged to ~ 1 year, Cftr deficiency alone caused the development of intestinal tumors in >60% of mice. Colon organoid formation was significantly increased in organoids created from Cftr mutant mice compared with wild-type controls, suggesting a potential role of Cftr in regulating the intestinal stem cell compartment. Microarray data from the Cftr-deficient colon and the small intestine identified dysregulated genes that belong to groups of immune response, ion channel, intestinal stem cell and other growth signaling regulators. These associated clusters of genes were confirmed by pathway analysis using Ingenuity Pathway Analysis and gene set enrichment analysis (GSEA). We also conducted RNA Seq analysis of tumors from Apc+/+ Cftr knockout mice and identified sets of genes dysregulated in tumors including altered Wnt β-catenin target genes. Finally we analyzed expression of CFTR in early stage human CRC patients stratified by risk of recurrence and found that loss of expression of CFTR was significantly associated with poor disease

  6. Transcriptional Modulation of Intestinal Innate Defense/Inflammation Genes by Preterm Infant Microbiota in a Humanized Gnotobiotic Mouse Model

    PubMed Central

    Lu, Lei; Yu, Yueyue; Guo, Yuee; Wang, Yunwei; Chang, Eugene B.; Claud, Erika C.

    2015-01-01

    Background and Aims It is known that postnatal functional maturation of the small intestine is facilitated by microbial colonization of the gut. Preterm infants exhibit defects in gut maturation, weak innate immunity against intestinal infection and increased susceptibility to inflammatory disorders, all of which may be related to the inappropriate microbial colonization of their immature intestines. The earliest microbes to colonize the preterm infant gut encounter a naïve, immature intestine. Thus this earliest microbiota potentially has the greatest opportunity to fundamentally influence intestinal development and immune function. The aim of this study was to characterize the effect of early microbial colonization on global gene expression in the distal small intestine during postnatal gut development. Methods Gnotobiotic mouse models with experimental colonization by early (prior to two weeks of life) intestinal microbiota from preterm human infants were utilized. Microarray analysis was used to assess global gene expression in the intestinal epithelium. Results and Conclusion Multiple intestinal genes involved in metabolism, cell cycle regulation, cell-cell or cell-extracellular matrix communication, and immune function are developmental- and intestinal microbiota- regulated. Using a humanized gnotobiotic mouse model, we demonstrate that certain early preterm infant microbiota from prior to 2 weeks of life specifically induce increased NF-κB activation and a phenotype of increased inflammation whereas other preterm microbiota specifically induce decreased NF-κB activation. These fundamental differences correlate with altered clinical outcomes and suggest the existence of optimal early microbial communities to improve health outcomes. PMID:25928420

  7. Assays for in vitro monitoring of proliferation of human airway smooth muscle (ASM) and human pulmonary arterial vascular smooth muscle (VSM) cells.

    PubMed

    Goncharova, Elena A; Lim, Poay; Goncharov, Dmitry A; Eszterhas, Andrew; Panettieri, Reynold A; Krymskaya, Vera P

    2006-01-01

    Vascular and airway remodeling, which are characterized by airway smooth muscle (ASM) and pulmonary arterial vascular smooth muscle (VSM) proliferation, contribute to the pathology of asthma, pulmonary hypertension, restenosis and atherosclerosis. To evaluate the proliferation of VSM and ASM cells in response to mitogens, we perform a [3H]thymidine incorporation assay. The proliferation protocol takes approximately 48 h and includes stimulating cells synchronized in G0/G1 phase of the cell cycle with agonists, labeling cells with [3H]thymidine and examining levels of [3H]thymidine incorporation by scintillation counting. Although using radiolabeled [3H]thymidine incorporation is a limitation, the greatest benefit of the assay is providing reliable and statistically significant data. PMID:17406550

  8. Brachyury identifies a class of enteroendocrine cells in normal human intestinal crypts and colorectal cancer

    PubMed Central

    Pinto, Filipe; Sammut, Stephen J.; Williams, Geraint T.; Gollins, Simon; McFarlane, Ramsay J.; Reis, Rui Manuel; Wakeman, Jane A.

    2016-01-01

    Normal homeostasis of adult intestinal epithelium and repair following tissue damage is maintained by a balance of stem and differentiated cells, many of which are still only poorly characterised. Enteroendocrine cells of the gut are a small population of differentiated, secretory cells that are critical for integrating nutrient sensing with metabolic responses, dispersed amongst other epithelial cells. Recent evidence suggests that sub-sets of secretory enteroendocrine cells can act as reserve stem cells. Given the link between cells with stem-like properties and cancer, it is important that we identify factors that might provide a bridge between the two. Here, we identify a sub-set of chromogranin A-positive enteroendocrine cells that are positive for the developmental and cancer-associated transcription factor Brachyury in normal human small intestinal and colonic crypts. Whilst chromogranin A-positive enteroendocrine cells are also Brachyury-positive in colorectal tumours, expression of Brachyury becomes more diffuse in these samples, suggesting a more widespread function in cancer. The finding of the developmental transcription factor Brachyury in normal adult human intestinal crypts may extend the functional complexity of enteroendocrine cells and serves as a platform for assessment of the molecular processes of intestinal homeostasis that underpins our understanding of human health, cancer and aging. PMID:26862851

  9. Metabolism of heme and bilirubin in rat and human small intestinal mucosa.

    PubMed Central

    Hartmann, F; Bissell, D M

    1982-01-01

    Formation of heme, bilirubin, and bilirubin conjugates has been examined in mucosal cells isolated from the rat upper small intestine. Intact, viable cells were prepared by enzymatic dissociation using a combined vascular and luminal perfusion and incubated with an isotopically labeled precursor, delta-amino-[2,3-3H]levulinic acid. Labeled heme and bile pigment were formed with kinetics similar to those exhibited by hepatocytes. Moreover, the newly formed bilirubin was converted rapidly to both mono- and diglucuronide conjugates. In addition, cell-free extracts of small intestinal mucosa from rats or humans exhibited a bilirubin-UDP-glucuronyl transferase activity that was qualitatively similar to that present in liver. The data suggest that the small intestinal mucosa normally contributes to bilirubin metabolism. PMID:6806320

  10. Recombinant Human Epidermal Growth Factor Accelerates Recovery of Mouse Small Intestinal Mucosa After Radiation Damage

    SciTech Connect

    Lee, Kang Kyoo; Jo, Hyang Jeong; Hong, Joon Pio; Lee, Sang-wook Sohn, Jung Sook; Moon, Soo Young; Yang, Sei Hoon; Shim, Hyeok; Lee, Sang Ho; Ryu, Seung-Hee; Moon, Sun Rock

    2008-07-15

    Purpose: To determine whether systemically administered recombinant human epidermal growth factor (rhEGF) accelerates the recovery of mouse small intestinal mucosa after irradiation. Methods and Materials: A mouse mucosal damage model was established by administering radiation to male BALB/c mice with a single dose of 15 Gy applied to the abdomen. After irradiation, rhEGF was administered subcutaneously at various doses (0.04, 0.2, 1.0, and 5.0 mg/kg/day) eight times at 2- to 3-day intervals. The evaluation methods included histologic changes of small intestinal mucosa, change in body weight, frequency of diarrhea, and survival rate. Results: The recovery of small intestinal mucosa after irradiation was significantly improved in the mice treated with a high dose of rhEGF. In the mice that underwent irradiation without rhEGF treatment, intestinal mucosal ulceration, mucosal layer damage, and severe inflammation occurred. The regeneration of villi was noticeable in mice treated with more than 0.2 mg/kg rhEGF, and the villi recovered fully in mice given more than 1 mg/kg rhEGF. The frequency of diarrhea persisting for more than 3 days was significantly greater in the radiation control group than in the rhEGF-treated groups. Conclusions: Systemic administration of rhEGF accelerates recovery from mucosal damage induced by irradiation. We suggest that rhEGF treatment shows promise for the reduction of small intestinal damage after irradiation.

  11. Human, rat and chicken small intestinal Na+-Cl−-creatine transporter: functional, molecular characterization and localization

    PubMed Central

    Peral, M J; García-Delgado, M; Calonge, M L; Durán, J M; De La Horra, M C; Wallimann, T; Speer, O; Ilundáin, A A

    2002-01-01

    In spite of all the fascinating properties of oral creatine supplementation, the mechanism(s) mediating its intestinal absorption has(have) not been investigated. The purpose of this study was to characterize intestinal creatine transport. [14C]Creatine uptake was measured in chicken enterocytes and rat ileum, and expression of the creatine transporter CRT was examined in human, rat and chicken small intestine by reverse transcription-polymerase chain reaction, Northern blot, in situ hybridization, immunoblotting and immunohistochemistry. Results show that enterocytes accumulate creatine against its concentration gradient. This accumulation was electrogenic, Na+- and Cl−-dependent, with a probable stoichiometry of 2 Na+: 1 Cl−: 1 creatine, and inhibited by ouabain and iodoacetic acid. The kinetic study revealed a Km for creatine of 29 μm. [14C]Creatine uptake was efficiently antagonized by non-labelled creatine, guanidinopropionic acid and cyclocreatine. More distant structural analogues of creatine, such as GABA, choline, glycine, β-alanine, taurine and betaine, had no effect on intestinal creatine uptake, indicating a high substrate specificity of the creatine transporter. Consistent with these functional data, messenger RNA for CRT was detected only in the cells lining the intestinal villus. The sequences of partial clones, and of the full-length cDNA clone, isolated from human and rat small intestine were identical to previously cloned CRT cDNAs. Immunological analysis revealed that CRT protein was mainly associated with the apical membrane of the enterocytes. This study reports for the first time that mammalian and avian enterocytes express CRT along the villus, where it mediates high-affinity, Na+- and Cl−-dependent, apical creatine uptake. PMID:12433955

  12. Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle

    PubMed Central

    Hennenberg, Martin; Strittmatter, Frank; Beckmann, Christer; Rutz, Beata; Füllhase, Claudius; Waidelich, Raphaela; Montorsi, Francesco; Hedlund, Petter; Andersson, Karl-Erik; Stief, Christian G.; Gratzke, Christian

    2012-01-01

    Background The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. Objective To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Methods Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Results Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Conclusions Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors

  13. BMP-2 promotes phosphate uptake, phenotypic modulation, and calcification of human vascular smooth muscle cells.

    PubMed

    Li, Xianwu; Yang, Hsueh-Ying; Giachelli, Cecilia M

    2008-08-01

    Vascular calcification is associated with increased risk of cardiovascular events that are the most common cause of death in patients with end-stage renal disease. Clinical and experimental studies indicate that hyperphosphatemia is a risk factor for vascular calcification and cardiovascular mortality in these patients. Our previous studies demonstrated that phosphate transport through the type III sodium-dependent phosphate cotransporter, Pit-1, was necessary for phosphate-induced calcification and osteochondrogenic phenotypic change in cultured human smooth muscle cells (SMC). BMP-2 is a potent osteogenic protein required for osteoblast differentiation and bone formation that has been implicated in vascular calcification. In the present study, we have examined the effects of BMP-2 on human SMC calcification in vitro. We found that treatment of SMC with BMP-2 enhanced elevated phosphate-induced calcification, but did not induce calcification under normal phosphate conditions. mRNAs for BMP receptors, including ALK2, ALK3, ALK6, BMPR-II, ActR-IIA and ActR-IIB were all detected in human SMCs. Mechanistically, BMP-2 dose-dependently stimulated phosphate uptake in SMC (200 ng/ml BMP-2 vs. vehicle: 13.94 vs. 7.09 nmol/30 min/mg protein, respectively). Real-time PCR and Western blot revealed the upregulation of Pit-1 mRNA and protein levels, respectively, by BMP-2. More importantly, inhibition of phosphate uptake by a competitive inhibitor of sodium-dependent phosphate cotransport, phosphonoformic acid, abrogated BMP-2-induced calcification. These results indicate that phosphate transport via Pit-1 is crucial in BMP-2-regulated SMC calcification. In addition, BMP-2-induced Runx2 and inhibited SM22 expression, indicating that it promotes osteogenic phenotype transition in these cells. Thus, BMP-2 may promote vascular calcification via increased phosphate uptake and induction of osteogenic phenotype modulation in SMC. PMID:18179800

  14. Gax regulates human vascular smooth muscle cell phenotypic modulation and vascular remodeling

    PubMed Central

    Zheng, Hui; Hu, Zhenlei; Zhai, Xinming; Wang, Yongyi; Liu, Jidong; Wang, Weijun; Xue, Song

    2016-01-01

    Abnormal phenotypic modulation of vascular smooth muscle cells (VSMCs) is a hallmark of cardiovascular diseases such as atherosclerosis, hypertension and restenosis after angioplasty. Transcription factors have emerged as critical regulators for VSMCs function, and recently we verified inhibiting transcription factor Gax was important for controlling VSMCs proliferation and migration. This study aimed to determine its role in phenotypic modulation of VSMCs. Western blot revealed that overexpression of Gax increased expression of VSMCs differentiation marker genes such as calponin and SM-MHC 11. Then, Gax overexpression potently suppressed proliferation and migration of VSMCs with or without platelet-derived growth factor-induced-BB (PDGF-BB) stimuli whereas Gax silencing inhibited these processes. Furthermore, cDNA array analysis indicated that Rap1A gene was the downstream target of Gax in human VSMCs. And overexpression of Gax significantly inhibited expression of Rap1A in VSMCs with or without PDGF-BB stimuli. Moreover, overexpression of Rap1A decreased expression of VSMCs differentiation marker genes and increased proliferation and migration of VSMCs with or without PDGF-BB stimuli. Finally, Gax overexpression significantly inhibited the neointimal formation in carotid artery injury of mouse models, specifically through maintaining VSMCs contractile phenotype by decreasing Rap1A expression. In conclusion, these results indicated that Gax was a regulator of human VSMCs phenotypic modulation by targeting Rap1A gene, which suggested that targeting Gax or its downstream targets in human VSMCs may provide an attractive approach for the prevention and treatment of cardiovascular diseases. PMID:27508012

  15. Sex Steroids Influence Brain-Derived Neurotropic Factor Secretion From Human Airway Smooth Muscle Cells.

    PubMed

    Wang, Sheng-Yu; Freeman, Michelle R; Sathish, Venkatachalem; Thompson, Michael A; Pabelick, Christina M; Prakash, Y S

    2016-07-01

    Brain derived neurotropic factor (BDNF) is emerging as an important player in airway inflammation, remodeling, and hyperreactivity. Separately, there is increasing evidence that sex hormones contribute to pathophysiology in the lung. BDNF and sex steroid signaling are thought to be intricately linked in the brain. There is currently little information on BDNF and sex steroid interactions in the airway but is relevant to understanding growth factor signaling in the context of asthma in men versus women. In this study, we assessed the effect of sex steroids on BDNF expression and secretion in human airway smooth muscle (ASM). Human ASM was treated with estrogen (E2 ) or testosterone (T, 10 nM each) and intracellular BDNF and secreted BDNF measured. E2 and T significantly reduced secretion of BDNF; effects prevented by estrogen and androgen receptor inhibitor, ICI 182,780 (1 μM), and flutamide (10 μM), respectively. Interestingly, no significant changes were observed in intracellular BDNF mRNA or protein expression. High affinity BDNF receptor, TrkB, was not altered by E2 or T. E2 (but not T) significantly increased intracellular cyclic AMP levels. Notably, Epac1 and Epac2 expression were significantly reduced by E2 and T. Furthermore, SNARE complex protein SNAP25 was decreased. Overall, these novel data suggest that physiologically relevant concentrations of E2 or T inhibit BDNF secretion in human ASM, suggesting a potential interaction of sex steroids with BDNF in the airway that is different from brain. The relevance of sex steroid-BDNF interactions may lie in their overall contribution to airway diseases such as asthma. J. Cell. Physiol. 231: 1586-1592, 2016. © 2015 Wiley Periodicals, Inc. PMID:26566264

  16. Nitroreduction and formation of hemoglobin adducts in rats with a human intestinal microflora

    SciTech Connect

    Scheepers, P.T.J.; Straetemans, M.M.E.; Koopman, J.P.; Bos, R.P.

    1994-10-01

    In the covalent binding of nitroarenes to macromolecules, nitroreduction is an important step. The intestinal microflora represents an enormous potential of bacterial nitroreductase activity. As a consequence, the in vivo nitroreduction of orally administerednitroarenes is primarily located in the intestine. In this study, we have investigated the nitroreduction of 2-nitrofluorene (2-NF) by a human microflora in female Wistar rats. Germ-free (FG) rats were equipped with a bacterial flora derived from human feces. Nontreated GF rats and GF animals equipped with a conventional rat flora were used as controls. The composition of the human and the conventional microflora isolated from the rats were consistent with the microflora of the administered feces. In the rats receiving only sunflower seed oil, no adducts were detected. The animals equipped with a human or rat microflora that received 2-aminofluorene (2-AF) formed 2-AF hemoglobin (Hb)-adducts at average levels mean {+-} 0.003 and 0.043 {+-} 0.010 {mu}mole/g Hb, respectively. In the FG rats, an adduct level of 0.57 {+-} 0.09 was determined after 2-AF administration and non adducts were detected after 2-NF administration. The results show that nitroreduction by an acquired human intestinal microflora and subsequent adduct formation can be studied in the rate in vivo. 21 refs., 3 tabs.

  17. Lactobacillus reuteri Inhibition of Enteropathogenic Escherichia coli Adherence to Human Intestinal Epithelium.

    PubMed

    Walsham, Alistair D S; MacKenzie, Donald A; Cook, Vivienne; Wemyss-Holden, Simon; Hews, Claire L; Juge, Nathalie; Schüller, Stephanie

    2016-01-01

    Enteropathogenic Escherichia coli (EPEC) is a major cause of diarrheal infant death in developing countries, and probiotic bacteria have been shown to provide health benefits in gastrointestinal infections. In this study, we have investigated the influence of the gut symbiont Lactobacillus reuteri on EPEC adherence to the human intestinal epithelium. Different host cell model systems including non-mucus-producing HT-29 and mucus-producing LS174T intestinal epithelial cell lines as well as human small intestinal biopsies were used. Adherence of L. reuteri to HT-29 cells was strain-specific, and the mucus-binding proteins CmbA and MUB increased binding to both HT-29 and LS174T cells. L. reuteri ATCC PTA 6475 and ATCC 53608 significantly inhibited EPEC binding to HT-29 but not LS174T cells. While pre-incubation of LS174T cells with ATCC PTA 6475 did not affect EPEC attaching/effacing (A/E) lesion formation, it increased the size of EPEC microcolonies. ATCC PTA 6475 and ATCC 53608 binding to the mucus layer resulted in decreased EPEC adherence to small intestinal biopsy epithelium. Our findings show that L. reuteri reduction of EPEC adhesion is strain-specific and has the potential to target either the epithelium or the mucus layer, providing further rationale for the selection of probiotic strains. PMID:26973622

  18. Lactobacillus reuteri Inhibition of Enteropathogenic Escherichia coli Adherence to Human Intestinal Epithelium

    PubMed Central

    Walsham, Alistair D. S.; MacKenzie, Donald A.; Cook, Vivienne; Wemyss-Holden, Simon; Hews, Claire L.; Juge, Nathalie; Schüller, Stephanie

    2016-01-01

    Enteropathogenic Escherichia coli (EPEC) is a major cause of diarrheal infant death in developing countries, and probiotic bacteria have been shown to provide health benefits in gastrointestinal infections. In this study, we have investigated the influence of the gut symbiont Lactobacillus reuteri on EPEC adherence to the human intestinal epithelium. Different host cell model systems including non-mucus-producing HT-29 and mucus-producing LS174T intestinal epithelial cell lines as well as human small intestinal biopsies were used. Adherence of L. reuteri to HT-29 cells was strain-specific, and the mucus-binding proteins CmbA and MUB increased binding to both HT-29 and LS174T cells. L. reuteri ATCC PTA 6475 and ATCC 53608 significantly inhibited EPEC binding to HT-29 but not LS174T cells. While pre-incubation of LS174T cells with ATCC PTA 6475 did not affect EPEC attaching/effacing (A/E) lesion formation, it increased the size of EPEC microcolonies. ATCC PTA 6475 and ATCC 53608 binding to the mucus layer resulted in decreased EPEC adherence to small intestinal biopsy epithelium. Our findings show that L. reuteri reduction of EPEC adhesion is strain-specific and has the potential to target either the epithelium or the mucus layer, providing further rationale for the selection of probiotic strains. PMID:26973622

  19. Human Ghrelin Mitigates Intestinal Injury and Mortality after Whole Body Irradiation in Rats

    PubMed Central

    Wang, Zhimin; Yang, Weng Lang; Jacob, Asha; Aziz, Monowar; Wang, Ping

    2015-01-01

    Widespread use of ionizing radiation has led to the realization of the danger associated with radiation exposure. Although studies in radiation countermeasures were initiated a half century ago, an effective therapy for a radiomitigator has not been identified. Ghrelin is a gastrointestinal hormone, and administration of ghrelin is protective in animal models of injuries including radiation combined injury. To test whether ghrelin can be protective in whole body irradiaton (WBI) alone, male Sprague Dawley (SD) rats were treated with human ghrelin (20 nmol/rat) daily for 6 days starting at either 24 h or 48 h after 10 Gray (Gy) WBI and survival outcome was examined. The 10 Gy WBI produced a LD70/30 model in SD rats (30% survival in 30 days). The survival rate in rats treated with ghrelin starting at 24 h was significantly improved to 63% and when treatment was initiated at 48 h, the survival remained at 61%. At 7 days post WBI, plasma ghrelin was significantly reduced from the control value. Ghrelin treatment starting at 24 h after WBI daily for 6 days improved histological appearance of the intestine, reduced gut permeability, serum endotoxin levels and bacterial translocation to the liver by 38%, 42% and 61%, respectively at day 7 post WBI. Serum glucose and albumin were restored to near control levels with treatment. Ghrelin treatment also attenuated WBI-induced intestinal apoptosis by 62% as evidenced by TUNEL staining. The expression of anti-apoptotic cell regulator Bcl-xl was decreased by 38% in the vehicle and restored to 75% of the control with ghrelin treatment. Increased expression of intestinal CD73 and pAkt were observed with ghrelin treatment, indicating protection of the intestinal epithelium after WBI. These results indicate that human ghrelin attenuates intestinal injury and mortality after WBI. Thus, human ghrelin can be developed as a novel mitigator for radiation injury. PMID:25671547

  20. Human Coronary Artery Smooth Muscle Cell Responses to Bioactive Polyelectrolyte Multilayer Interfaces

    PubMed Central

    Newcomer, Robert G.; Moussallem, Maroun D.; Keller, Thomas C. S.; Schlenoff, Joseph B.; Sang, Qing-Xiang Amy

    2011-01-01

    Under normal physiological conditions, mature human coronary artery smooth muscle cells (hCASMCs) exhibit a “contractile” phenotype marked by low rates of proliferation and protein synthesis, but these cells possess the remarkable ability to dedifferentiate into a “synthetic” phenotype when stimulated by conditions of pathologic stress. A variety of polyelectrolyte multilayer (PEMU) films are shown here to exhibit bioactive properties that induce distinct responses from cultured hCASMCs. Surfaces terminated with Nafion or poly(styrenesulfonic acid) (PSS) induce changes in the expression and organization of intracellular proteins, while a hydrophilic, zwitterionic copolymer of acrylic acid and 3-[2-(acrylamido)-ethyl dimethylammonio] propane sulfonate (PAA-co-PAEDAPS) is resistant to cell attachment and suppresses the formation of key cytoskeletal components. Differential expression of heat shock protein 90 and actin is observed, in terms of both their magnitude and cellular localization, and distinct cytoplasmic patterns of vimentin are seen. The ionophore A23187 induces contraction in confluent hCASMC cultures on Nafion-terminated surfaces. These results demonstrate that PEMU coatings exert direct effects on the cytoskeletal organization of attaching hCASMCs, impeding growth in some cases, inducing changes consistent with phenotypic modulation in others, and suggesting potential utility for PEMU surfaces as a coating for coronary artery stents and other implantable medical devices. PMID:21350669

  1. Spatial and temporal traction response in human airway smooth muscle cells

    NASA Technical Reports Server (NTRS)

    Tolic-Norrelykke, Iva Marija; Butler, James P.; Chen, Jianxin; Wang, Ning

    2002-01-01

    Tractions that cells exert on their substrates are essential in cell spreading, migration, and contraction. These tractions can be determined by plating the cells on a flexible gel and measuring the deformation of the gel by using fluorescent beads embedded just below the surface of the gel. In this article we describe the image correlation method (ICM) optimized for determining the displacement field of the gel under a contracting cell. For the calculation of the traction field from the displacement field we use the recently developed method of Fourier transform traction cytometry (FTTC). The ICM and FTTC methods are applied to human airway smooth muscle cells during stimulation with the contractile agonist histamine or the relaxing agonist isoproterenol. The overall intensity of the cell contraction (the median traction magnitude, the energy transferred from the cell to the gel, and the net contractile moment) increased after activation with histamine, and decreased after treatment with isoproterenol. Cells exhibited regional differences in the time course of traction during the treatment. Both temporal evolution and magnitude of traction increase induced by histamine varied markedly among different cell protrusions, whereas the nuclear region showed the smallest response. These results suggest that intracellular mediators of cell adhesion and contraction respond to contractile stimuli with different rates and intensities in different regions of the cell.

  2. Coherent anti-Stokes Raman scattering microscopy of human smooth muscle cells in bioengineered tissue scaffolds

    NASA Astrophysics Data System (ADS)

    Brackmann, Christian; Esguerra, Maricris; Olausson, Daniel; Delbro, Dick; Krettek, Alexandra; Gatenholm, Paul; Enejder, Annika

    2011-02-01

    The integration of living, human smooth muscle cells in biosynthesized cellulose scaffolds was monitored by nonlinear microscopy toward contractile artificial blood vessels. Combined coherent anti-Stokes Raman scattering (CARS) and second harmonic generation (SHG) microscopy was applied for studies of the cell interaction with the biopolymer network. CARS microscopy probing CH2-groups at 2845 cm-1 permitted three-dimensional imaging of the cells with high contrast for lipid-rich intracellular structures. SHG microscopy visualized the fibers of the cellulose scaffold, together with a small signal obtained from the cytoplasmic myosin of the muscle cells. From the overlay images we conclude a close interaction between cells and cellulose fibers. We followed the cell migration into the three-dimensional structure, illustrating that while the cells submerge into the scaffold they extrude filopodia on top of the surface. A comparison between compact and porous scaffolds reveals a migration depth of <10 μm for the former, whereas the porous type shows cells further submerged into the cellulose. Thus, the scaffold architecture determines the degree of cell integration. We conclude that the unique ability of nonlinear microscopy to visualize the three-dimensional composition of living, soft matter makes it an ideal instrument within tissue engineering.

  3. Endothelin receptors and their cellular signal transduction mechanism in human cultured prostatic smooth muscle cells.

    PubMed

    Saita, Y; Koizumi, T; Yazawa, H; Morita, T; Takenaka, T; Honda, K

    1997-06-01

    1. Endothelin (ET) receptors, and their cellular signal transduction mechanism, were characterized in a primary culture of human prostatic smooth muscle cells (HP cell). 2. [125I]-ET-1 and [125I]-ET-3 binding studies revealed that both ETA and ETB receptors were present in the HP cells, and the ratio of ETA to ETB receptors was 1.4:1. 3. Analysis of ET receptor mRNA by reverse transcription-polymerase chain reaction also demonstrated that HP cells express both ETA and ETB receptors. 4. ET-1 and ET-3 increased intracellular free Ca2+ concentration ([Ca2+]i) in the HP cells in a concentration-dependent manner. Use of subtype selective antagonists BQ-123 and BQ-788, indicated that both ETA and ETB receptors were coupled to an increase in [Ca2+]i. 5. Pretreatment of the cells with pertussis toxin resulted in a significant but partial attenuation of the [Ca2+]i increase mediated through the ETA and ETB receptors. However, sensitivity to pertussis toxin (PTX) was significantly different between them. 6. In conclusion, HP cells possess ETA and ETB receptors. Further, these two endothelin receptor subtypes evoke an increase in [Ca2+]i possibly via the action of different GTP-binding proteins. PMID:9208135

  4. Mechanical stretch regulates TRPC expression and calcium entry in human myometrial smooth muscle cells.

    PubMed

    Dalrymple, A; Mahn, K; Poston, L; Songu-Mize, E; Tribe, R M

    2007-03-01

    Stretch is known to stimulate myometrial hyperplasia and hypertrophy in early pregnancy and uterine contraction at term. We propose that transduction of the stretch signal involves alteration of intracellular calcium signalling, including changes in transient receptor potential canonical (TRPC) isoform expression. The aim of the present study was to investigate the effect of prolonged mechanical (tonic) stretch in vitro on human myometrial smooth muscle cell calcium signalling and TRPC expression. Cells were cultured from myometrial biopsies, obtained from women undergoing elective Caesarean section at term, grown on Flexiplates and subjected to 25% tonic mechanical stretch for 1, 4 and 14 h. Time-matched control cells were not stretched. Mechanical stretch (14 h) increased basal calcium entry and cyclopiazonic acid (CPA)-induced calcium/Mn(2+) entry (P < 0.05) in Fura-2 loaded cells. The calcium selectivity of CPA-thapsigarin induced inward currents, measured by patch clamp electrophysiology, was also increased in stretched cells compared with control cells (P < 0.05). Real time PCR and Western blot data demonstrated that TRPC3 and TRPC4 mRNA and TRPC3 protein expression were increased by stretch (P < 0.05), respectively. These data support the hypothesis that uterine stretch modulates uterine growth and contractility in pregnancy via alterations in calcium signalling. PMID:17208928

  5. Transcriptional profiling of human smooth muscle cells infected with gingipain and fimbriae mutants of Porphyromonas gingivalis.

    PubMed

    Zhang, Boxi; Sirsjö, Allan; Khalaf, Hazem; Bengtsson, Torbjörn

    2016-01-01

    Porphyromonas gingivalis (P. gingivalis) is considered to be involved in the development of atherosclerosis. However, the role of different virulence factors produced by P. gingivalis in this process is still uncertain. The aim of this study was to investigate the transcriptional profiling of human aortic smooth muscle cells (AoSMCs) infected with wild type, gingipain mutants or fimbriae mutants of P. gingivalis. AoSMCs were exposed to wild type (W50 and 381), gingipain mutants (E8 and K1A), or fimbriae mutants (DPG-3 and KRX-178) of P. gingivalis. We observed that wild type P. gingivalis changes the expression of a considerable larger number of genes in AoSMCs compare to gingipain and fimbriae mutants, respectively. The results from pathway analysis revealed that the common differentially expressed genes for AoSMCs infected by 3 different wild type P. gingivalis strains were enriched in pathways of cancer, cytokine-cytokine receptor interaction, regulation of the actin cytoskeleton, focal adhesion, and MAPK signaling pathway. Disease ontology analysis showed that various strains of P. gingivalis were associated with different disease profilings. Our results suggest that gingipains and fimbriae, especially arginine-specific gingipain, produced by P. gingivalis play important roles in the association between periodontitis and other inflammatory diseases, including atherosclerosis. PMID:26907358

  6. Diversity of Potassium Channels in Human Umbilical Artery Smooth Muscle Cells

    PubMed Central

    Martín, Pedro; Rebolledo, Alejandro; Palomo, Ana Rocio Roldán; Moncada, Melisa; Piccinini, Luciano

    2014-01-01

    Through their control of cell membrane potential, potassium (K+) channels are among the best known regulators of vascular tone. This article discusses the expression and function of K+ channels in human umbilical artery smooth muscle cells (HUASMCs). We review the bibliographic reports and also present single-channel data recorded in freshly isolated cells. Electrophysiological properties of big conductance, voltage- and Ca2+-sensitive K+ channel and voltage-dependent K+ channels are clearly established in this vessel, where they are involved in contractile state regulation. Their role in the maintenance of membrane potential is an important control mechanism in the determination of the vessel diameter. Additionally, small conductance Ca2+-sensitive K+ channels, 2-pore domains K+ channels and inward rectifier K+ channels also appear to be present in HUASMCs, while intermediate conductance Ca2+-sensitive K+ channels and ATP-sensitive K+ channels could not be identified. In both cases, additional investigation is necessary to reach conclusive evidence of their expression and/or functional role in HUASMCs. Finally, we discuss the role of K+ channels in pregnancy-related pathologies like gestational diabetes and preeclampsia. PMID:24084522

  7. Effects of cigarette smoke extract on human airway smooth muscle cells in COPD.

    PubMed

    Chen, Ling; Ge, Qi; Tjin, Gavin; Alkhouri, Hatem; Deng, Linghong; Brandsma, Corry-Anke; Adcock, Ian; Timens, Wim; Postma, Dirkje; Burgess, Janette K; Black, Judith L; Oliver, Brian G G

    2014-09-01

    We hypothesised that the response to cigarette smoke in airway smooth muscle (ASM) cells from smokers with chronic obstructive pulmonary disease (COPD) would be intrinsically different from smokers without COPD, producing greater pro-inflammatory mediators and factors relating to airway remodelling. ASM cells were obtained from smokers with or without COPD, and then stimulated with cigarette smoke extract (CSE) or transforming growth factor-β1. The production of chemokines and matrix metalloproteinases (MMPs) were measured by ELISA, and the deposition of collagens by extracellular matrix ELISA. The effects of CSE on cell attachment and wound healing were measured by toluidine blue attachment and cell tracker green wound healing assays. CSE increased the release of CXCL8 and CXCL1 from human ASM cells, and cells from smokers with COPD produced more CSE-induced CXCL1. The production of MMP-1, -3 and -10, and the deposition of collagen VIII alpha 1 (COL8A1) were increased by CSE, especially in the COPD group which had higher production of MMP-1 and deposition of COL8A1. CSE decreased ASM cell attachment and wound healing in the COPD group only. ASM cells from smokers with COPD were more sensitive to CSE stimulation, which may explain, in part, why some smokers develop COPD. PMID:24969654

  8. Human discrimination of visual direction of motion with and without smooth pursuit eye movements

    NASA Technical Reports Server (NTRS)

    Krukowski, Anton E.; Pirog, Kathleen A.; Beutter, Brent R.; Brooks, Kevin R.; Stone, Leland S.

    2003-01-01

    It has long been known that ocular pursuit of a moving target has a major influence on its perceived speed (Aubert, 1886; Fleischl, 1882). However, little is known about the effect of smooth pursuit on the perception of target direction. Here we compare the precision of human visual-direction judgments under two oculomotor conditions (pursuit vs. fixation). We also examine the impact of stimulus duration (200 ms vs. 800 ms) and absolute direction (cardinal vs. oblique). Our main finding is that direction discrimination thresholds in the fixation and pursuit conditions are indistinguishable. Furthermore, the two oculomotor conditions showed oblique effects of similar magnitudes. These data suggest that the neural direction signals supporting perception are the same with or without pursuit, despite remarkably different retinal stimulation. During fixation, the stimulus information is restricted to large, purely peripheral retinal motion, while during steady-state pursuit, the stimulus information consists of small, unreliable foveal retinal motion and a large efference-copy signal. A parsimonious explanation of our findings is that the signal limiting the precision of direction judgments is a neural estimate of target motion in head-centered (or world-centered) coordinates (i.e., a combined retinal and eye motion signal) as found in the medial superior temporal area (MST), and not simply an estimate of retinal motion as found in the middle temporal area (MT).

  9. Endothelin receptors and their cellular signal transduction mechanism in human cultured prostatic smooth muscle cells

    PubMed Central

    Saita, Yuji; Koizumi, Tomonobu; Yazawa, Hidenori; Morita, Takashi; Takenaka, Toichi; Honda, Kazuo

    1997-01-01

    Endothelin (ET) receptors, and their cellular signal transduction mechanism, were characterized in a primary culture of human prostatic smooth muscle cells (HP cell). [125I]-ET-1 and [125I]-ET-3 binding studies revealed that both ETA and ETB receptors were present in the HP cells, and the ratio of ETA to ETB receptors was 1.4:1. Analysis of ET receptor mRNA by reverse transcription-polymerase chain reaction also demonstrated that HP cells express both ETA and ETB receptors. ET-1 and ET-3 increased intracellular free Ca2+ concentration ([Ca2+]i) in the HP cells in a concentration-dependent manner. Use of subtype selective antagonists BQ-123 and BQ-788, indicated that both ETA and ETB receptors were coupled to an increase in [Ca2+]i. Pretreatment of the cells with pertussis toxin resulted in a significant but partial attenuation of the [Ca2+]i increase mediated through the ETA and ETB receptors. However, sensitivity to pertussis toxin (PTX) was significantly different between them. In conclusion, HP cells possess ETA and ETB receptors. Further, these two endothelin receptor subtypes evoke an increase in [Ca2+]i possibly via the action of different GTP-binding proteins. PMID:9208135

  10. Transcriptional profiling of human smooth muscle cells infected with gingipain and fimbriae mutants of Porphyromonas gingivalis

    PubMed Central

    Zhang, Boxi; Sirsjö, Allan; Khalaf, Hazem; Bengtsson, Torbjörn

    2016-01-01

    Porphyromonas gingivalis (P. gingivalis) is considered to be involved in the development of atherosclerosis. However, the role of different virulence factors produced by P. gingivalis in this process is still uncertain. The aim of this study was to investigate the transcriptional profiling of human aortic smooth muscle cells (AoSMCs) infected with wild type, gingipain mutants or fimbriae mutants of P. gingivalis. AoSMCs were exposed to wild type (W50 and 381), gingipain mutants (E8 and K1A), or fimbriae mutants (DPG-3 and KRX-178) of P. gingivalis. We observed that wild type P. gingivalis changes the expression of a considerable larger number of genes in AoSMCs compare to gingipain and fimbriae mutants, respectively. The results from pathway analysis revealed that the common differentially expressed genes for AoSMCs infected by 3 different wild type P. gingivalis strains were enriched in pathways of cancer, cytokine-cytokine receptor interaction, regulation of the actin cytoskeleton, focal adhesion, and MAPK signaling pathway. Disease ontology analysis showed that various strains of P. gingivalis were associated with different disease profilings. Our results suggest that gingipains and fimbriae, especially arginine-specific gingipain, produced by P. gingivalis play important roles in the association between periodontitis and other inflammatory diseases, including atherosclerosis. PMID:26907358

  11. Smooth muscle in human bronchi is disposed to resist airway distension.

    PubMed

    Gazzola, Morgan; Henry, Cyndi; Couture, Christian; Marsolais, David; King, Gregory G; Fredberg, Jeffrey J; Bossé, Ynuk

    2016-07-15

    Studying airway smooth muscle (ASM) in conditions that emulate the in vivo environment within which the bronchi normally operate may provide important clues regarding its elusive physiological function. The present study examines the effect of lengthening and shortening of ASM on tension development in human bronchial segments. ASM from each bronchial segment was set at a length approximating in situ length (Linsitu). Bronchial tension was then measured during a slow cyclical strain (0.004Hz, from 0.7Linsitu to 1.3Linsitu) in the relaxed state and at graded levels of activation by methacholine. In all cases, tension was greater at longer ASM lengths, and greater during lengthening than shortening. The threshold of methacholine concentration that was required for ASM to account for bronchial tension across the entire range of ASM lengths tested was on average smaller by 2.8 logs during lengthening than during shortening. The length-dependency of ASM tension, together with this lower threshold of methacholine concentration during lengthening versus shortening, suggest that ASM has a greater ability to resist airway dilation during lung inflation than to narrow the airways during lung deflation. More than serving to narrow the airway, as has long been thought, these data suggest that the main function of ASM contraction is to limit airway wall distension during lung inflation. PMID:27095271

  12. Cigarette smoke-induced mitochondrial fragmentation and dysfunction in human airway smooth muscle

    PubMed Central

    Aravamudan, Bharathi; Kiel, Alexander; Freeman, Michelle; Delmotte, Philippe; Thompson, Michael; Vassallo, Robert; Sieck, Gary C.; Pabelick, Christina M.

    2014-01-01

    The balance between mitochondrial fission and fusion is crucial for mitochondria to perform its normal cellular functions. We hypothesized that cigarette smoke (CS) disrupts this balance and enhances mitochondrial dysfunction in the airway. In nonasthmatic human airway smooth muscle (ASM) cells, CS extract (CSE) induced mitochondrial fragmentation and damages their networked morphology in a concentration-dependent fashion, via increased expression of mitochondrial fission protein dynamin-related protein 1 (Drp1) and decreased fusion protein mitofusin (Mfn) 2. CSE effects on Drp1 vs. Mfn2 and mitochondrial network morphology involved reactive oxygen species (ROS), activation of extracellular signal-regulated kinase (ERK), phosphatidylinositol 3-kinase (PI3K)/protein kinase B (Akt), protein kinase C (PKC) and proteasome pathways, as well as transcriptional regulation via factors such as NF-κB and nuclear erythroid 2-related factor 2. Inhibiting Drp1 prevented CSE effects on mitochondrial networks and ROS generation, whereas blocking Mfn2 had the opposite, detrimental effect. In ASM from asmatic patients, mitochondria exhibited substantial morphological defects at baseline and showed increased Drp1 but decreased Mfn2 expression, with exacerbating effects of CSE. Overall, these results highlight the importance of mitochondrial networks and their regulation in the context of cellular changes induced by insults such as inflammation (as in asthma) or CS. Altered mitochondrial fission/fusion proteins have a further potential to influence parameters such as ROS and cell proliferation and apoptosis relevant to airway diseases. PMID:24610934

  13. On the Visual Input Driving Human Smooth-Pursuit Eye Movements

    NASA Technical Reports Server (NTRS)

    Stone, Leland S.; Beutter, Brent R.; Lorenceau, Jean

    1996-01-01

    Current computational models of smooth-pursuit eye movements assume that the primary visual input is local retinal-image motion (often referred to as retinal slip). However, we show that humans can pursue object motion with considerable accuracy, even in the presence of conflicting local image motion. This finding indicates that the visual cortical area(s) controlling pursuit must be able to perform a spatio-temporal integration of local image motion into a signal related to object motion. We also provide evidence that the object-motion signal that drives pursuit is related to the signal that supports perception. We conclude that current models of pursuit should be modified to include a visual input that encodes perceived object motion and not merely retinal image motion. Finally, our findings suggest that the measurement of eye movements can be used to monitor visual perception, with particular value in applied settings as this non-intrusive approach would not require interrupting ongoing work or training.

  14. Puerarin Induces Mitochondria-Dependent Apoptosis in Hypoxic Human Pulmonary Arterial Smooth Muscle Cells

    PubMed Central

    Chen, Chan; Chen, Chun; Wang, Zhiyi; Wang, Liangxing; Yang, Lehe; Ding, Minjiao; Ding, Cheng; Sun, Yu; Lin, Quan; Huang, Xiaoying; Du, Xiaohong; Zhao, Xiaowei; Wang, Chuangyi

    2012-01-01

    Background Pulmonary vascular medial hypertrophy in hypoxic pulmonary arterial hypertension (PAH) is caused in part by decreased apoptosis in pulmonary artery smooth muscle cells (PASMCs). Puerarin, an isoflavone purified from the Chinese medicinal herb kudzu, ameliorates chronic hypoxic PAH in animal models. Here we investigated the effects of puerarin on apoptosis of hypoxic human PASMCs (HPASMCs), and to determine the possible underlying mechanisms. Methodology/Principal Findings HPASMCs were cultured for 24 h in normoxia or hypoxia (5% O2) conditions with and without puerarin. Cell number and viability were determined with a hemacytometer or a cell counting kit. Apoptosis was detected with a TUNEL test, rhodamine-123 (R-123) fluorescence, a colorimetric assay, western blots, immunohistochemical staining and RT-PCR. Hypoxia inhibited mitochondria-dependent apoptosis and promoted HPASMC growth. In contrast, after puerarin (50 µM or more) intervention, cell growth was inhibited and apoptosis was observed. Puerarin-induced apoptosis in hypoxic HPASMCs was accompanied by reduced mitochondrial membrane potential, cytochrome c release from the mitochondria, caspase-9 activation, and Bcl-2 down-regulation with concurrent Bax up-regulation. Conclusions/Significance Puerarin promoted apoptosis in hypoxic HPASMCs by acting on the mitochondria-dependent pathway. These results suggest a new mechanism of puerarin relevant to the management of clinical hypoxic pulmonary hypertension. PMID:22457823

  15. A critical role of nicotinamide phosphoribosyltransferase in human telomerase reverse transcriptase induction by resveratrol in aortic smooth muscle cells

    PubMed Central

    Huang, Peixin; Riordan, Sean M.; Heruth, Daniel P.; Grigoryev, Dmitry N.; Zhang, Li Qin; Ye, Shui Qing

    2015-01-01

    Aging is the predominant risk factor for cardiovascular diseases and contributes to a considerably more severe outcome in patients with acute myocardial infarction. Resveratrol, a polyphenol found in red wine, is a caloric restriction mimetic with potential anti-aging properties which has emerged as a beneficial nutraceutical for patients with cardiovascular disease. Although resveratrol is widely consumed as a nutritional supplement, its mechanism of action remains to be elucidated fully. Here, we report that resveratrol activates human nicotinamide phosphoribosyltransferase (NAMPT), SIRT4 and telomerase reverse transcriptase (hTERT) in human aortic smooth muscle cells. Similar observations were obtained in resveratrol treated C57BL/6J mouse heart and liver tissues. Resverotrol can also augment telomerase activity in both human pulmonary microvascular endothelial cells and A549 cells. Blocking NAMPT and SIRT4 expression prevents induction of hTERT in human aortic smooth muscle cells while overexpression of NAMPT elevates the telomerase activity induced by resveratrol in A549 cells. Together, these results identify a NAMPT-SIRT4-hTERT axis as a novel mechanism by which resveratrol may affect the anti-aging process in human aortic smooth muscle cells, mouse hearts and other cells. These findings enrich our understanding of the positive effects of resveratrol in human cardiovascular diseases. PMID:25926556

  16. The human uterine smooth muscle S-nitrosoproteome fingerprint in pregnancy, labor, and preterm labor

    PubMed Central

    Ulrich, Craig; Quilici, David R.; Schlauch, Karen A.

    2013-01-01

    Molecular mechanisms involved in uterine quiescence during gestation and those responsible for induction of labor at term are incompletely known. More than 10% of babies born worldwide are premature and 1,000,000 die annually. Preterm labor results in preterm delivery in 50% of cases in the United States explaining 75% of fetal morbidity and mortality. There is no Food and Drug Administration-approved treatment to prevent preterm delivery. Nitric oxide-mediated relaxation of human uterine smooth muscle is independent of global elevation of cGMP following activation of soluble guanylyl cyclase. S-nitrosation is a likely mechanism to explain cGMP-independent relaxation to nitric oxide and may reveal S-nitrosated proteins as new therapeutic targets for the treatment of preterm labor. Employing S-nitrosoglutathione as an nitric oxide donor, we identified 110 proteins that are S-nitrosated in 1 or more states of human pregnancy. Using area under the curve of extracted ion chromatograms as well as normalized spectral counts to quantify relative expression levels for 62 of these proteins, we show that 26 proteins demonstrate statistically significant S-nitrosation differences in myometrium from spontaneously laboring preterm patients compared with nonlaboring patients. We identified proteins that were up-S-nitrosated as well as proteins that were down-S-nitrosated in preterm laboring tissues. Identification and relative quantification of the S-nitrosoproteome provide a fingerprint of proteins that can form the basis of hypothesis-directed efforts to understand the regulation of uterine contraction-relaxation and the development of new treatment for preterm labor. PMID:23948706

  17. Bidirectional counter-regulation of human lung mast cell and airway smooth muscle β2-adrenoceptors

    PubMed Central

    Newby, Chris; Amrani, Yassine; Bradding, Peter

    2015-01-01

    Human lung mast cells (HLMCs) play a central role in asthma pathogenesis through their relocation to the airway smooth muscle (ASM) bundles. β2 adrenoceptor (β2-AR)-agonists are used to relieve bronchoconstriction in asthma, but may reduce asthma control, particularly when used as monotherapy. We hypothesised that HLMC and human ASM cell (HASMC) responsiveness to β2-AR agonists would be attenuated when HLMCs are in contact with HASMCs. Cells were cultured in the presence of the short-acting β2-agonist albuterol, and the long-acting β2-agonists formoterol and olodaterol. Constitutive and FcεRI-dependent HLMC histamine release, HASMC contraction, and β2-AR phosphorylation at tyrosine 350 (Tyr350) were assessed. Constitutive HLMC histamine release was increased in HLMC-HASMC co-culture and this was enhanced by β2-AR agonists. Inhibition of FcεRI-dependent HLMC mediator release by β2-agonists was greatly reduced in HLMC-HASMC co-culture. These effects were reversed by neutralisation of stem cell factor (SCF) or cell adhesion molecule 1 (CADM1). β2-AR agonists did not prevent HASMC contraction when HLMCs were present, but this was reversed by fluticasone. β2-AR phosphorylation at Tyr350 occurred within 5 minutes in both HLMCs and HASMCs when the cells were co-cultured, and was inhibited by neutralising SCF or CADM1. HLMC interactions with HASMCs via CADM1 and Kit inhibit the potentially beneficial effects of β2-AR agonists on these cells via phosphorylation of the β2-AR. These results may explain the potentially adverse effects of β2-ARs agonists when used for asthma therapy. Targeting SCF and CADM1 may enhance β2-AR efficacy, particularly in corticosteroid-resistant patients. PMID:26608913

  18. TLR3 activation increases chemokine expression in human fetal airway smooth muscle cells.

    PubMed

    Faksh, Arij; Britt, Rodney D; Vogel, Elizabeth R; Thompson, Michael A; Pandya, Hitesh C; Martin, Richard J; Pabelick, Christina M; Prakash, Y S

    2016-01-15

    Viral infections, such as respiratory syncytial virus and rhinovirus, adversely affect neonatal and pediatric populations, resulting in significant lung morbidity, including acute asthma exacerbation. Studies in adults have demonstrated that human airway smooth muscle (ASM) cells modulate inflammation through their ability to secrete inflammatory cytokines and chemokines. The role of ASM in the developing airway during infection remains undefined. In our study, we used human fetal ASM cells as an in vitro model to examine the effect of Toll-like receptor (TLR) agonists on chemokine secretion. We found that fetal ASM express multiple TLRs, including TLR3 and TLR4, which are implicated in the pathogenesis of respiratory syncytial virus and rhinovirus infection. Cells were treated with TLR agonists, polyinosinic-polycytidylic acid [poly(I:C)] (TLR3 agonist), lipopolysaccharide (TLR4 agonist), or R848 (TLR7/8 agonist), and IL-8 and chemokine (C-C motif) ligand 5 (CCL5) secretion were evaluated. Interestingly, poly(I:C), but neither lipopolysaccharide nor R848, increased IL-8 and chemokine (C-C motif) ligand 5 secretion. Examination of signaling pathways suggested that the poly(I:C) effects in fetal ASM involve TLR and ERK signaling, in addition to another major inflammatory pathway, NF-κB. Moreover, there are variations between fetal and adult ASM with respect to poly(I:C) effects on signaling pathways. Pharmacological inhibition suggested that ERK pathways mediate poly(I:C) effects. Overall, our data show that poly(I:C) initiates activation of proinflammatory pathways in developing ASM, which may contribute to immune responses to infection and exacerbation of asthma. PMID:26589477

  19. Bidirectional Counterregulation of Human Lung Mast Cell and Airway Smooth Muscle β2 Adrenoceptors.

    PubMed

    Lewis, Rebecca J; Chachi, Latifa; Newby, Chris; Amrani, Yassine; Bradding, Peter

    2016-01-01

    Human lung mast cells (HLMCs) play a central role in asthma pathogenesis through their relocation to the airway smooth muscle (ASM) bundles. β2 adrenoceptor (β2-AR)-agonists are used to relieve bronchoconstriction in asthma, but may reduce asthma control, particularly when used as monotherapy. We hypothesized that HLMC and human ASM cell (HASMC) responsiveness to β2-AR agonists would be attenuated when HLMCs are in contact with HASMCs. Cells were cultured in the presence of the short-acting β2-agonist albuterol, and the long-acting β2-agonists formoterol and olodaterol. Constitutive and FcεRI-dependent HLMC histamine release, HASMC contraction, and β2-AR phosphorylation at Tyr(350) were assessed. Constitutive HLMC histamine release was increased in HLMC-HASMC coculture and this was enhanced by β2-AR agonists. Inhibition of FcεRI-dependent HLMC mediator release by β2-agonists was greatly reduced in HLMC-HASMC coculture. These effects were reversed by neutralization of stem cell factor (SCF) or cell adhesion molecule 1 (CADM1). β2-AR agonists did not prevent HASMC contraction when HLMCs were present, but this was reversed by fluticasone. β2-AR phosphorylation at Tyr(350) occurred within 5 min in both HLMCs and HASMCs when the cells were cocultured, and was inhibited by neutralizing SCF or CADM1. HLMC interactions with HASMCs via CADM1 and Kit inhibit the potentially beneficial effects of β2-AR agonists on these cells via phosphorylation of the β2-AR. These results may explain the potentially adverse effects of β2-ARs agonists when used for asthma therapy. Targeting SCF and CADM1 may enhance β2-AR efficacy, particularly in corticosteroid-resistant patients. PMID:26608913

  20. Ardipusilloside-I Metabolites from Human Intestinal Bacteria and Their Antitumor Activity.

    PubMed

    Cao, Wei-Yu; Wang, Ya-Nan; Wang, Peng-Yuan; Lei, Wan; Feng, Bin; Wang, Xiao-Juan

    2015-01-01

    Ardipusilloside-I (ADS-I) is a triterpenoid saponin extracted from Ardisia pusilla DC, and has been demonstrated to have potent antitumor activity. However, ADS-I metabolism in humans has not been investigated. In this study, we studied the biotransformation of ADS-I in human intestinal bacteria, and examined the in vitro antitumor activity of the major metabolites. Ultra-high performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS) was used to detect ADS-I biotransformation products, and their chemical structures were identified by high performance liquid chromatography-nuclear magnetic resonance (HPLC-NMR). The antitumor activity of the major metabolites was determined by the MTT assay. Here, we show that main reaction seen in the metabolism of ADS-I in human intestinal bacteria was deglycosylation, which produced a total of four metabolites. The structures of the two major metabolites M1 and M2 were confirmed by using NMR. MTT assay showed that ADS-I metabolites M1 and M2 have the same levels of inhibitory activities as ADS-I in cultured SMMC-7721 cells and MCF-7 cells. In conclusion, this study demonstrates deglycosylation as a primary pathway of ADS-I metabolism in human intestinal bacteria, and suggests that the pharmacological activity of ADS-I may be mediated, at least in part, by its metabolites. PMID:26610438

  1. Human airway smooth muscle maintain in situ cell orientation and phenotype when cultured on aligned electrospun scaffolds

    PubMed Central

    Morris, G. E.; Bridge, J. C.; Eltboli, O. M. I.; Lewis, M. P.; Knox, A. J.; Aylott, J. W.; Brightling, C. E.; Ghaemmaghami, A. M.

    2014-01-01

    Human airway smooth muscle (HASM) contraction plays a central role in regulating airway resistance in both healthy and asthmatic bronchioles. In vitro studies that investigate the intricate mechanisms that regulate this contractile process are predominantly conducted on tissue culture plastic, a rigid, 2D geometry, unlike the 3D microenvironment smooth muscle cells are exposed to in situ. It is increasingly apparent that cellular characteristics and responses are altered between cells cultured on 2D substrates compared with 3D topographies. Electrospinning is an attractive method to produce 3D topographies for cell culturing as the fibers produced have dimensions within the nanometer range, similar to cells' natural environment. We have developed an electrospun scaffold using the nondegradable, nontoxic, polymer polyethylene terephthalate (PET) composed of uniaxially orientated nanofibers and have evaluated this topography's effect on HASM cell adhesion, alignment, and morphology. The fibers orientation provided contact guidance enabling the formation of fully aligned sheets of smooth muscle. Moreover, smooth muscle cells cultured on the scaffold present an elongated cell phenotype with altered contractile protein levels and distribution. HASM cells cultured on this scaffold responded to the bronchoconstrictor bradykinin. The platform presented provides a novel in vitro model that promotes airway smooth muscle cell development toward a more in vivo-like phenotype while providing topological cues to ensure full cell alignment. PMID:24793171

  2. Hydrolysis of pyrethroids by human and rat tissues: Examination of intestinal, liver and serum carboxylesterases

    SciTech Connect

    Crow, J. Allen; Borazjani, Abdolsamad; Potter, Philip M.; Ross, Matthew K. . E-mail: mross@cvm.msstate.edu

    2007-05-15

    Hydrolytic metabolism of pyrethroid insecticides in humans is one of the major catabolic pathways that clear these compounds from the body. Rodent models are often used to determine the disposition and clearance rates of these esterified compounds. In this study the distribution and activities of esterases that catalyze pyrethroid metabolism have been investigated in vitro using several human and rat tissues, including small intestine, liver and serum. The major esterase in human intestine is carboxylesterase 2 (hCE2). We found that the pyrethroid trans-permethrin is effectively hydrolyzed by a sample of pooled human intestinal microsomes (5 individuals), while deltamethrin and bioresmethrin are not. This result correlates well with the substrate specificity of recombinant hCE2 enzyme. In contrast, a sample of pooled rat intestinal microsomes (5 animals) hydrolyze trans-permethrin 4.5-fold slower than the sample of human intestinal microsomes. Furthermore, it is demonstrated that pooled samples of cytosol from human or rat liver are {approx} 2-fold less hydrolytically active (normalized per mg protein) than the corresponding microsomal fraction toward pyrethroid substrates; however, the cytosolic fractions do have significant amounts ({approx} 40%) of the total esteratic activity. Moreover, a 6-fold interindividual variation in carboxylesterase 1 protein expression in human hepatic cytosols was observed. Human serum was shown to lack pyrethroid hydrolytic activity, but rat serum has hydrolytic activity that is attributed to a single CE isozyme. We purified the serum CE enzyme to homogeneity to determine its contribution to pyrethroid metabolism in the rat. Both trans-permethrin and bioresmethrin were effectively cleaved by this serum CE, but deltamethrin, esfenvalerate, alpha-cypermethrin and cis-permethrin were slowly hydrolyzed. Lastly, two model lipase enzymes were examined for their ability to hydrolyze pyrethroids. However, no hydrolysis products could be

  3. Human small intestinal and colonic tissue mounted in the Ussing chamber as a tool for characterizing the intestinal absorption of drugs.

    PubMed

    Rozehnal, Veronika; Nakai, Daisuke; Hoepner, Ursula; Fischer, Thomas; Kamiyama, Emi; Takahashi, Masayuki; Yasuda, Satoru; Mueller, Juergen

    2012-08-15

    The purpose of this study was to validate human small intestinal and colonic tissue mounted in the Ussing chamber as a tool for predicting the oral drug absorption in humans with the main focus on moderately and poorly permeable compounds. The obtained apparent permeability coefficient (P(app)) of eleven test compounds was compared to their fraction absorbed (Fa) in humans taken from the literature. Beside the conventional P(app) a new parameter, the apparent permeability coefficient total (P(app,total)), involving both the apical-to-basolateral permeability and the time-dependent compound accumulation in the tissue was established. The permeability of lucifer yellow (LY), a fluorescent marker of the paracellular pathway and the test compounds showed no obvious differences between small intestine and colon. Furthermore, small intestinal and colonic tissue from a single donor showed similar permeability of both LY and a transcellularly transported compound metoprolol. All test compounds including low molecular weight hydrophilic compounds such as metformin, atenolol, sulpiride and famotidine showed adequate permeability reflecting human Fa values (R(2)=0.87). The P(app) values of digoxin, a P-glycoprotein (P-gp) substrate, were not significantly affected by the addition of verapamil, a P-gp inhibitor. In contrast, the P(app,total) values of digoxin increased approximately threefold in the presence of verapamil. In conclusion, both small intestinal and colonic tissue mounted in the Ussing chamber provide a good opportunity to predict the oral drug absorption rate in humans even for moderately and poorly absorbed compounds. The novel calculation of P(app,total) allows the study of the carrier-mediated drug-drug interactions in human intestine. PMID:22418036

  4. Comparative Genomics Analysis of Streptococcus Isolates from the Human Small Intestine Reveals their Adaptation to a Highly Dynamic Ecosystem

    PubMed Central

    Van den Bogert, Bartholomeus; Boekhorst, Jos; Herrmann, Ruth; Smid, Eddy J.; Zoetendal, Erwin G.; Kleerebezem, Michiel

    2013-01-01

    The human small-intestinal microbiota is characterised by relatively large and dynamic Streptococcus populations. In this study, genome sequences of small-intestinal streptococci from S. mitis, S. bovis, and S. salivarius species-groups were determined and compared with those from 58 Streptococcus strains in public databases. The Streptococcus pangenome consists of 12,403 orthologous groups of which 574 are shared among all sequenced streptococci and are defined as the Streptococcus core genome. Genome mining of the small-intestinal streptococci focused on functions playing an important role in the interaction of these streptococci in the small-intestinal ecosystem, including natural competence and nutrient-transport and metabolism. Analysis of the small-intestinal Streptococcus genomes predicts a high capacity to synthesize amino acids and various vitamins as well as substantial divergence in their carbohydrate transport and metabolic capacities, which is in agreement with observed physiological differences between these Streptococcus strains. Gene-specific PCR-strategies enabled evaluation of conservation of Streptococcus populations in intestinal samples from different human individuals, revealing that the S. salivarius strains were frequently detected in the small-intestine microbiota, supporting the representative value of the genomes provided in this study. Finally, the Streptococcus genomes allow prediction of the effect of dietary substances on Streptococcus population dynamics in the human small-intestine. PMID:24386196

  5. Biorelevant media resistant co-culture model mimicking permeability of human intestine.

    PubMed

    Antoine, Delphine; Pellequer, Yann; Tempesta, Camille; Lorscheidt, Stefan; Kettel, Bernadette; Tamaddon, Lana; Jannin, Vincent; Demarne, Frédéric; Lamprecht, Alf; Béduneau, Arnaud

    2015-03-15

    Cell culture models are currently used to predict absorption pattern of new compounds and formulations in the human gastro-intestinal tract (GIT). One major drawback is the lack of relevant apical incubation fluids allowing mimicking luminal conditions in the GIT. Here, we suggest a culture model compatible with biorelevant media, namely Fasted State Simulated Intestinal Fluid (FaSSIF) and Fed State Simulated Intestinal Fluid (FeSSIF). Co-culture was set up from Caco-2 and mucus-secreting HT29-MTX cells using an original seeding procedure. Viability and cytotoxicity assays were performed following incubation of FeSSIF and FaSSIF with co-culture. Influence of biorelevant fluids on paracellular permeability or transporter proteins were also evaluated. Results were compared with Caco-2 and HT29-MTX monocultures. While Caco-2 viability was strongly affected with FeSSIF, no toxic effect was detected for the co-cultures in terms of viability and lactate dehydrogenase release. The addition of FeSSIF to the basolateral compartment of the co-culture induced cytotoxic effects which suggested the apical mucus barrier being cell protective. In contrast to FeSSIF, FaSSIF induced a slight increase of the paracellular transport and both tested media inhibited partially the P-gp-mediated efflux in the co-culture. Additionally, the absorptive transport of propranolol hydrochloride, a lipophilic β-blocker, was strongly affected by biorelevant fluids. This study demonstrated the compatibility of the Caco-2/HT29-MTX model with some of the current biorelevant media. Combining biorelevant intestinal fluids with features such as mucus secretion, adjustable paracellular and P-gp mediated transports, is a step forward to more realistic in-vitro models of the human intestine. PMID:25601199

  6. Diagnosis of edema and inflammation in human intestines using ultrawideband radar

    NASA Astrophysics Data System (ADS)

    Smith, Sonny; Narayanan, Ram M.; Messaris, Evangelos

    2015-05-01

    Human intestines are vital organs, which are often subjected to chronic issues. In particular, Crohn's disease is a bowel aliment resulting in inflammation along the lining of one's digestive tract. Moreover, such an inflammatory condition causes changes in the thickness of the intestines; and we posit induce changes in the dielectric properties detectable by radar. This detection hinges on the increase in fluid content in the afflicted area, which is described by effective medium approximations (EMA). In this paper, we consider one of the constitutive parameters (i.e. relative permittivity) of different human tissues and introduce a simple numerical, electromagnetic multilayer model. We observe how the increase in water content in one layer can be approximated to predict the effective permittivity of that layer. Moreover, we note trends in how such an accumulation can influence the total effective reflection coefficient of the multiple layers.

  7. Metabolomics analysis of Cistus monspeliensis leaf extract on energy metabolism activation in human intestinal cells.

    PubMed

    Shimoda, Yoichi; Han, Junkyu; Kawada, Kiyokazu; Smaoui, Abderrazak; Isoda, Hiroko

    2012-01-01

    Energy metabolism is a very important process to improve and maintain health from the point of view of physiology. It is well known that the intracellular ATP production is contributed to energy metabolism in cells. Cistus monspeliensis is widely used as tea, spices, and medical herb; however, it has not been focusing on the activation of energy metabolism. In this study, C. monspeliensis was investigated as the food resources by activation of energy metabolism in human intestinal epithelial cells. C. monspeliensis extract showed high antioxidant ability. In addition, the promotion of metabolites of glycolysis and TCA cycle was induced by C. monspeliensis treatment. These results suggest that C. monspeliensis extract has an ability to enhance the energy metabolism in human intestinal cells. PMID:22523469

  8. Generation of L-cells in mouse and human small intestine organoids

    PubMed Central

    Petersen, Natalia; Reimann, Frank; Bartfeld, Sina; Farin, Henner F.; Ringnalda, Femke C.; Vries, Robert G. J.; van den Brink, Stieneke; Clevers, Hans; Gribble, Fiona M.; de Koning, Eelco J. P.

    2015-01-01

    Upon a nutrient challenge, L-cells produce glucagon-like peptide 1 (GLP-1), a powerful stimulant of insulin release. Strategies to augment endogenous GLP-1 production include promoting L-cell differentiation and increasing L-cell number. Here we present a novel in vitro platform to generate functional L-cells from 3D cultures of mouse and human intestinal crypts. We show that short-chain fatty acids (SCFAs) selectively increase the number of L-cells resulting in an elevation of GLP-1 release. This is accompanied by up-regulation of transcription factors, associated with the endocrine lineage of intestinal stem cell development. Thus, our platform allows us to study and modulate the development of L-cells in mouse and human crypts as a potential basis for novel therapeutic strategies in type 2 diabetes. PMID:24130334

  9. Metabolomics Analysis of Cistus monspeliensis Leaf Extract on Energy Metabolism Activation in Human Intestinal Cells

    PubMed Central

    Shimoda, Yoichi; Han, Junkyu; Kawada, Kiyokazu; Smaoui, Abderrazak; Isoda, Hiroko

    2012-01-01

    Energy metabolism is a very important process to improve and maintain health from the point of view of physiology. It is well known that the intracellular ATP production is contributed to energy metabolism in cells. Cistus monspeliensis is widely used as tea, spices, and medical herb; however, it has not been focusing on the activation of energy metabolism. In this study, C. monspeliensis was investigated as the food resources by activation of energy metabolism in human intestinal epithelial cells. C. monspeliensis extract showed high antioxidant ability. In addition, the promotion of metabolites of glycolysis and TCA cycle was induced by C. monspeliensis treatment. These results suggest that C. monspeliensis extract has an ability to enhance the energy metabolism in human intestinal cells. PMID:22523469

  10. Pharmacological evidence for a novel cysteinyl-leukotriene receptor subtype in human pulmonary artery smooth muscle

    PubMed Central

    Walch, Laurence; Norel, Xavier; Bäck, Magnus; Gascard, Jean-Pierre; Dahlén, Sven-Erik; Brink, Charles

    2002-01-01

    To characterize the cysteinyl-leukotriene receptors (CysLT receptors) in isolated human pulmonary arteries, ring preparations were contracted with leukotriene C4 (LTC4) and leukotriene D4 (LTD4) in either the absence or presence of the selective CysLT1 receptor antagonists, ICI 198615, MK 571 or the dual CysLT1/CysLT2 receptor antagonist, BAY u9773. Since the contractions induced by the cysteinyl-leukotrienes (cysLTs) in intact preparations failed to attain a plateau response over the concentration range studied, the endothelium was removed and the tissue treated continuously with indomethacin (Rubbed+INDO). In these latter preparations, the pEC50 for LTC4 and LTD4 were not significantly different (7.61±0.07, n=20 and 7.96±0.09, n=22, respectively). However, the LTC4 and LTD4 contractions were markedly potentiated when compared with data from intact tissues. Leukotriene E4 (LTE4) did not contract human isolated pulmonary arterial preparations. In addition, treatment of preparations with LTE4 (1 μM; 30 min) did not modify either the LTC4 or LTD4 contractions. Treatment of preparations with the S-conjugated glutathione (S-hexyl-GSH; 100 μM, 30 min), an inhibitor of the metabolism of LTC4 to LTD4, did not modify LTC4 contractions. The pEC50 values for LTC4 were significantly reduced by treatment of the preparations with either ICI 198615, MK 571 or BAY u9773 and the pKB values were: 7.20, 7.02 and 6.26, respectively. In contrast, these antagonists did not modify the LTD4 pEC50 values. These findings suggest the presence of two CysLT receptors on human pulmonary arterial vascular smooth muscle. A CysLT1 receptor with a low affinity for CysLT1 antagonists and a novel CysLT receptor subtype, both responsible for vasoconstriction. Activation of this latter receptor by LTC4 and LTD4 induced a contractile response which was resistant to the selective CysLT1 antagonists (ICI 198615 and MK 571) as well as the non-selective (CysLT1/CysLT2) antagonist, BAY u9773. PMID