Science.gov

Sample records for human prostate tissue

  1. Monitoring changes in tissue optical properties following interstitial photothermal therapy of ex vivo human prostate tissue

    NASA Astrophysics Data System (ADS)

    Weersink, Robert A.; He, Jie; Veilleux, Israel; Trachtenberg, John; Wilson, Brian C.

    2013-03-01

    We are developing a method of monitoring treatment progression of interstitial photothermal therapy of focal prostate cancer using transrectal diffuse optical tomography (TRDOT) combined with transrectal 3D ultrasound (3D-TRUS). Measurements of prostate tissue optical properties were made on ex vivo human prostate samples prior to and post coagulation. Interstitial photothermal treatments were delivered to the ex vivo samples and monitored using an interstitial probe near the treatment fiber. After treatment, bulk optical properties were measured on native and coagulated zones of tissue. Changes in optical properties across the boundary between native and coagulated tissues were spatially mapped using a small diffuse reflectance probe. The optical property estimates and spatial information obtained using each method was compared.

  2. Beta-catenin is elevated in human benign prostatic hyperplasia specimens compared to histologically normal prostate tissue

    PubMed Central

    Bauman, Tyler M; Vezina, Chad M; Huang, Wei; Marker, Paul C; Peterson, Richard E; Ricke, William A

    2014-01-01

    Benign prostatic hyperplasia (BPH) is linked to lower urinary tract symptoms (LUTS) such as incomplete bladder emptying, urinary frequency and urgency. Mechanisms responsible for BPH are not fully known. Here, we tested whether beta-catenin (CTNNB1) immunostaining intensity and distribution differ in human glandular BPH tissue specimens compared to normal prostate tissue. Multiplex immunostaining of CTNNB1, its putative transcriptional target gene lymphoid enhancer binding factor 1 (LEF1), and the epithelial marker E-cadherin were examined in clinical human prostate specimens with or without histological BPH (pure epithelial or mixed stromal-epithelial nodules). BPH specimens were obtained from 24 men who experienced LUTS and underwent transurethral resection of the prostate surgery. Control specimens were tumor-adjacent histologically normal prostate tissue from 48 patients who underwent radical prostatectomy. The resulting multispectral images were unmixed and optical densities recorded to quantify staining abundance, cellular (membranous, cytoplasmic, and nuclear) and tissue localization (stromal versus epithelial), and determination of percentage of CTNNB1-positive cells. The following CTNNB1 indices were significantly higher in BPH compared to normal prostate tissue: overall staining intensity, staining intensity in prostate stromal cell membranes, cytoplasm and nuclei, and prostate epithelial cell nuclei. The following LEF1 indices were significantly lower in BPH compared to tumor-adjacent normal prostate tissue: stromal LEF1 staining intensity, percentage of LEF1-positive stromal cells, and intensity of LEF1 staining in stromal cell membranes, cytoplasm, and nuclei. The percentage of stromal cells with CTNNB1+/LEF1- nuclei was higher and percentage of stromal cells with CTNNB1-/LEF1+ nuclei was lower in BPH compared to tumor-adjacent normal prostate tissues. These results support the hypothesis that CTNNB1 expression increases in specific BPH tissue

  3. Obesity and prostate cancer: gene expression signature of human periprostatic adipose tissue

    PubMed Central

    2012-01-01

    Background Periprostatic (PP) adipose tissue surrounds the prostate, an organ with a high predisposition to become malignant. Frequently, growing prostatic tumor cells extend beyond the prostatic organ towards this fat depot. This study aimed to determine the genome-wide expression of genes in PP adipose tissue in obesity/overweight (OB/OW) and prostate cancer patients. Methods Differentially expressed genes in human PP adipose tissue were identified using microarrays. Analyses were conducted according to the donors' body mass index characteristics (OB/OW versus lean) and prostate disease (extra prostatic cancer versus organ confined prostate cancer versus benign prostatic hyperplasia). Selected genes with altered expression were validated by real-time PCR. Ingenuity Pathway Analysis (IPA) was used to investigate gene ontology, canonical pathways and functional networks. Results In the PP adipose tissue of OB/OW subjects, we found altered expression of genes encoding molecules involved in adipogenic/anti-lipolytic, proliferative/anti-apoptotic, and mild immunoinflammatory processes (for example, FADS1, down-regulated, and LEP and ANGPT1, both up-regulated). Conversely, in the PP adipose tissue of subjects with prostate cancer, altered genes were related to adipose tissue cellular activity (increased cell proliferation/differentiation, cell cycle activation and anti-apoptosis), whereas a downward impact on immunity and inflammation was also observed, mostly related to the complement (down-regulation of CFH). Interestingly, we found that the microRNA MIRLET7A2 was overexpressed in the PP adipose tissue of prostate cancer patients. Conclusions Obesity and excess adiposity modified the expression of PP adipose tissue genes to ultimately foster fat mass growth. In patients with prostate cancer the expression profile of PP adipose tissue accounted for hypercellularity and reduced immunosurveillance. Both findings may be liable to promote a favorable environment for

  4. Long term organ culture of human prostate tissue in a NASA-designed rotating wall bioreactor

    NASA Technical Reports Server (NTRS)

    Margolis, L.; Hatfill, S.; Chuaqui, R.; Vocke, C.; Emmert-Buck, M.; Linehan, W. M.; Duray, P. H.

    1999-01-01

    PURPOSE: To maintain ex vivo integral prostatic tissue including intact stromal and ductal elements using the NASA-designed Rotating Wall Vessel (RWV) which maintains colocalized cells in an environment that promotes both three-dimensional cellular interactions together with the uniform mass transfer of nutrients and metabolic wastes. MATERIALS AND METHODS: Samples of normal prostate were obtained as a byproduct of transurethral prostatectomy or needle biopsy. Prostatic tissue dissected into small 1 x 1 mm. blocks was cultured in the Rotating Wall Vessel (RWV) Bioreactor for various time periods and analyzed using histological, immunochemical, and total cell RNA assays. RESULTS: We report the long term maintenance of benign explanted human prostate tissue grown in simple culture medium, under the simulated microgravity conditions afforded by the RWV bioreactor. Mesenchymal stromal elements including blood vessels and architecturally preserved tubuloglandular acini were maintained for a minimum of 28 days. Cytokeratins, vimentin and TGF-beta2 receptor and ligand were preserved through the entire culture period as revealed by immunocytochemistry. Prostatic acid phosphatase (PAP) was continuously expressed during the culture period, although somewhat decreased. Prostatic specific antigen (PSA) and its transcript were down regulated over time of culture. Prostatic carcinoma cells from the TSU cell line were able to invade RWV-cultured benign prostate tissue explants. CONCLUSIONS: The RWV bioreactor represents an additional new technology for culturing prostate tissue for further investigations concerning the basic physiology and pathobiology of this clinically important tissue.

  5. Loss of estrogen receptor beta expression in malignant human prostate cells in primary cultures and in prostate cancer tissues.

    PubMed

    Pasquali, D; Rossi, V; Esposito, D; Abbondanza, C; Puca, G A; Bellastella, A; Sinisi, A A

    2001-05-01

    The aim of this study was to investigate the expression of estrogen receptor (ER) beta and alpha genes in normal (N) and malignant (C) primary cultures of human prostate epithelial cells (PEC) and fibroblasts (PFC) and in the prostate tissue donors. Both ERbeta and ERalpha messenger ribonucleic acids were found by RT-PCR analysis in six NPECs and normal prostate tissues and in only one of six CPECs and in the respective cancer tissue donor. The other five CPECs and related cancer tissue donors and all normal and cancer PFCs expressed ERalpha messenger ribonucleic acid alone. Immunoblot analysis, using a polyclonal anti-ERbeta (C-terminal) antibody, demonstrated ERbeta protein in all NPEC lysates and in one of the six CPECS: ERalpha protein was expressed in both NPECs and CPECs when a polyclonal antibody directed against the ERalpha N-terminal domain was used. In contrast, ERalpha protein was not detected in two of the six CPEC lysates when ERalpha C-terminal monoclonal antibodies were used. Using a set of primers designed to amplify the region from exons 6-8, RT-PCR analysis demonstrated the absence of the expected transcript in these cells. The present study shows that the ERbeta gene is expressed together with ERalpha in normal prostates and NPECs, whereas it is barely detectable in prostate cancer and CPECS: Moreover, in some CPECs, the ERalpha gene may be transcribed in a changed protein, resulting from the expression of a deletion variant. Together, these data suggest that prostate malignancy is associated with a potential disorder of ER-mediated pathways. PMID:11344205

  6. Expression and functional study of estrogen receptor-related receptors in human prostatic cells and tissues.

    PubMed

    Cheung, C P; Yu, Shan; Wong, K B; Chan, L W; Lai, Fernand M M; Wang, Xianghong; Suetsugi, Masatomo; Chen, Shiuan; Chan, Franky L

    2005-03-01

    Estrogen receptor-related receptors (ERRs; alpha, beta, gamma) are orphan nuclear receptors and constitutively active without binding to estrogen. Like estrogen receptors (ERs), ERRs bind to estrogen receptor elements and estrogen receptor element-related repeats. Growing evidence suggests that ERRs can cross-talk with ERs in different cell types via competition for DNA sites and coactivators. We hypothesize that ERRs might play regulatory roles in normal and neoplastic prostatic cells by sharing similar ER-mediated pathways or acting independently. In this study, we investigated mRNA and protein expression patterns of three ERR members in normal human prostate epithelial cells, established cell lines, cancer xenografts, and prostatic tissues. Additionally, effects of transient transfection of ERRs on prostatic cell proliferation and ER expression were also examined. RT-PCR showed that ERRalpha and ERRgamma transcripts were detected in most cell lines and xenografts, whereas ERRbeta was detected in normal epithelial cells and few immortalized cell lines but not in most cancer lines. Similar results were demonstrated in clinical prostatic specimens. Western blottings and immunohistochemistry confirmed similar expression patterns that ERR proteins were detected as nuclear proteins in epithelial cells, whereas their expressions became reduced or undetected in neoplastic prostatic cells. Transient transfection confirmed that ERRs were expressed in prostatic cells as nuclear proteins and transcriptionally active in the absence of estradiol. Transfection results showed that overexpression of ERRs inhibited cell proliferation and repressed ERalpha transcription in PC-3 cells. Our study shows that ERRs, which are coexpressed with ERs in prostatic cells, could regulate cell growth and modulate ER-mediated pathways via interference on ERalpha transcription in prostatic cells. PMID:15598686

  7. Multiphoton gradient index endoscopy for evaluation of diseased human prostatic tissue ex vivo

    NASA Astrophysics Data System (ADS)

    Huland, David M.; Jain, Manu; Ouzounov, Dimitre G.; Robinson, Brian D.; Harya, Diana S.; Shevchuk, Maria M.; Singhal, Paras; Xu, Chris; Tewari, Ashutosh K.

    2014-11-01

    Multiphoton microscopy can instantly visualize cellular details in unstained tissues. Multiphoton probes with clinical potential have been developed. This study evaluates the suitability of multiphoton gradient index (GRIN) endoscopy as a diagnostic tool for prostatic tissue. A portable and compact multiphoton endoscope based on a 1-mm diameter, 8-cm length GRIN lens system probe was used. Fresh ex vivo samples were obtained from 14 radical prostatectomy patients and benign and malignant areas were imaged and correlated with subsequent H&E sections. Multiphoton GRIN endoscopy images of unfixed and unprocessed prostate tissue at a subcellular resolution are presented. We note several differences and identifying features of benign versus low-grade versus high-grade tumors and are able to identify periprostatic tissues such as adipocytes, periprostatic nerves, and blood vessels. Multiphoton GRIN endoscopy can be used to identify both benign and malignant lesions in ex vivo human prostate tissue and may be a valuable diagnostic tool for real-time visualization of suspicious areas of the prostate.

  8. Penetration of piperacillin-tazobactam into human prostate tissue and dosing considerations for prostatitis based on site-specific pharmacokinetics and pharmacodynamics.

    PubMed

    Kobayashi, Ikuo; Ikawa, Kazuro; Nakamura, Kogenta; Nishikawa, Genya; Kajikawa, Keishi; Yoshizawa, Takahiko; Watanabe, Masahito; Kato, Yoshiharu; Zennami, Kenji; Kanao, Kent; Tobiume, Motoi; Yamada, Yoshiaki; Mitsui, Kenji; Narushima, Masahiro; Morikawa, Norifumi; Sumitomo, Makoto

    2015-08-01

    This study aimed to investigate the penetration of PIPC-TAZ into human prostate, and to assess effectiveness of PIPC-TAZ against prostatitis by evaluating site-specific PK-PD. Patients with prostatic hypertrophy (n = 47) prophylactically received a 0.5 h infusion of PIPC-TAZ (8:1.2-0.25 g or 4-0.5 g) before transurethral resection of the prostate. PIPC-TAZ concentrations in plasma (0.5-5 h) and prostate tissue (0.5-1.5 h) were analyzed with a three-compartment PK model. The estimated model parameters were, then used to estimate the drug exposure time above the minimum inhibitory concentration for bacteria (T > MIC, the PD indicator for antibacterial effects) in prostate tissue for six PIPC-TAZ regimens (2.25 or 4.5 g; once, twice, three times or four times daily; 0.5 h infusions). Prostate tissue/plasma ratio of PIPC was about 36% both for the maximum drug concentration (Cmax) and the area under the drug concentration-time curve (AUC). Against MIC distributions for isolates of Escherichia coli, Klebsiella species and Proteus species, regimens of 4.5 g twice daily and 2.25 g three times daily achieved a >90% probability of attaining the bacteriostatic target for PIPC (30% T > MIC) in prostate tissue; regimens of 4.5 g three times daily and 2.25 g four times daily achieved a >90% probability of attaining the bactericidal target for PIPC (50% T > MIC) in prostate tissue. However, against Pseudomonas aeruginosa isolates, none of the tested regimens achieved a >90% probability. PIPC-TAZ is appropriate for the treatment of prostatitis from the site-specific PK-PD perspective. PMID:26050020

  9. Optimization and comprehensive characterization of a faithful tissue culture model of the benign and malignant human prostate.

    PubMed

    Maund, Sophia Lisette; Nolley, Rosalie; Peehl, Donna Mae

    2014-02-01

    Few preclinical models accurately depict normal human prostate tissue or primary prostate cancer (PCa). In vitro systems typically lack complex cellular interactions among structured prostatic epithelia and a stromal microenvironment, and genetic and molecular fidelity are concerns in both in vitro and in vivo models. 'Tissue slice cultures' (TSCs) provide realistic preclinical models of diverse tissues and organs, but have not been fully developed or widely utilized for prostate studies. Problems encountered include degeneration of differentiated secretory cells, basal cell hyperplasia, and poor survival of PCa. Here, we optimized, characterized, and applied a TSC model of primary human PCa and benign prostate tissue that overcomes many deficiencies of current in vitro models. Tissue cores from fresh prostatectomy specimens were precision-cut at 300 μm and incubated in a rotary culture apparatus. The ability of varied culture conditions to faithfully maintain benign and cancer cell and tissue structure and function over time was evaluated by immunohistological and biochemical assays. After optimization of the culture system, molecular and cellular responses to androgen ablation and to piperlongumine (PL), purported to specifically reduce androgen signaling in PCa, were investigated. Optimized culture conditions successfully maintained the structural and functional fidelity of both benign and PCa TSCs for 5 days. TSCs exhibited androgen dependence, appropriately undergoing ductal degeneration, reduced proliferation, and decreased prostate-specific antigen expression upon androgen ablation. Further, TSCs revealed cancer-specific reduction of androgen receptor and increased apoptosis upon treatment with PL, validating data from cell lines. We demonstrate a TSC model that authentically recapitulates the structural, cellular, and genetic characteristics of the benign and malignant human prostate, androgen dependence of the native tissue, and cancer-specific response

  10. Oxidative phosphorylation and mitochondrial function differ between human prostate tissue and cultured cells.

    PubMed

    Schöpf, Bernd; Schäfer, Georg; Weber, Anja; Talasz, Heribert; Eder, Iris E; Klocker, Helmut; Gnaiger, Erich

    2016-06-01

    Altered mitochondrial metabolism plays a pivotal role in the development and progression of various diseases, including cancer. Cell lines are frequently used as models to study mitochondrial (dys)function, but little is known about their mitochondrial respiration and metabolic properties in comparison to the primary tissue of origin. We have developed a method for assessment of oxidative phosphorylation in prostate tissue samples of only 2 mg wet weight using high-resolution respirometry. Reliable protocols were established to investigate the respiratory activity of different segments of the mitochondrial electron transfer system (ETS) in mechanically permeabilized tissue biopsies. Additionally, the widely used immortalized prostate epithelial and fibroblast cell lines, RWPE1 and NAF, representing the major cell types in prostate tissue, were analyzed and compared to the tissue of origin. Our results show that mechanical treatment without chemical permeabilization agents or sample processing constitutes a reliable preparation method for OXPHOS analysis in small amounts of prostatic tissue typically obtained by prostate biopsy. The cell lines represented the bioenergetic properties of fresh tissue to a limited extent only. Particularly, tissue showed a higher oxidative capacity with succinate and glutamate, whereas pyruvate was a substrate supporting significantly higher respiratory activities in cell lines. Several fold higher zinc levels measured in tissue compared to cells confirmed the role of aconitase for prostate-specific metabolism in agreement with observed respiratory properties. In conclusion, combining the flexibility of cell culture models and tissue samples for respirometric analysis are powerful tools for investigation of mitochondrial function and tissue-specific metabolism. PMID:27060259

  11. Human periprostatic white adipose tissue is rich in stromal progenitor cells and a potential source of prostate tumor stroma.

    PubMed

    Ribeiro, Ricardo; Monteiro, Cátia; Silvestre, Ricardo; Castela, Angela; Coutinho, Helena; Fraga, Avelino; Príncipe, Paulo; Lobato, Carlos; Costa, Carla; Cordeiro-da-Silva, Anabela; Lopes, José Manuel; Lopes, Carlos; Medeiros, Rui

    2012-10-01

    A body of growing evidence now implicates white adipose tissue as a relevant source of stromal progenitor cells recruited to the tumor microenvironment to form supportive tumor stroma. While the role of periprostatic (PP) adipose tissue in prostate cancer progression has been barely appreciated, we sought to determine the progenitor cell population in PP adipose tissue and the association with prostate cancer. We isolated and characterized CD31(-)CD34(+)CD45(-)CD146(-) progenitor cells (adipose-derived stem cells [ASC]) in paired samples of PP and preperitoneal visceral adipose tissue from prostate tissue and peripheral blood mononuclear cells of prostate cancer and nodular prostatic hyperplasia patients. ASC were quantified by flow cytometry and confirmed through target gene expression. Here we show a significantly higher amount of ASC in PP than in visceral adipose tissue, independent of body mass index and prostatic disease. In the prostate, ASC are increased in cancer compared with prostatic nodular hyperplasia patients. Concordantly, adipsin gene (CFD) expression, which is known to be up-regulated in adipose stem cells, was overexpressed in PP adipose tissue, in the prostate of cancer patients and in prostate CD31(-)CD34(+)CD45(-)CD146(-) sorted cells. ASC were found at higher levels in the blood of prostate cancer patients simultaneously overweight/obese. Present findings indicate that PP adipose tissue is a reservoir of progenitor cells with the potential to migrate towards prostate tumors, although its clinical significance merits further evaluation. PMID:23038706

  12. Light propagation in paint and prostate human tissues using visible to mid-IR spectroscopy and imaging techniques

    NASA Astrophysics Data System (ADS)

    Ali, Jamal Hafiez

    The topic of the thesis is to understand the structural and molecular changes in scattering media for bio-medical applications such as animal, and human prostate tissues and non-biomedical applications such as corrosion and cracks beneath paint using steady and time-resolved light spectroscopy and imaging techniques in the visible to mid-IR spectral region. The thesis focuses also on understanding the randomization of coherence and polarization in thin scattering paint medium. Temporal polarization emission profiles of Fluorescein dye attached to different molecular weight ranging from 4 K to 500 K were measured. Images of an object containing varying molecular weight of Fluorescein dye embedded inside intralipid media were investigated. The non-invasive spectral polarization difference imaging and the fluorescence polarization difference imaging techniques using Cardio Green dye are introduced in the optical imaging studies to enhance the image quality. The measured transport length for prostate tissues using time-resolved pulse transmission is ℓtr = 0.86 mm. Four modeling samples of human rectum-membrane-prostate tissue were investigated using the near-infrared spectral polarization imaging technique to detect small foreign objects at different depths inside prostate tissues. The content of water in cancerous and normal human prostate tissues was shown to be different using near infrared spectroscopy and imaging techniques. The OH stretching vibrational overtone mode at 980 nm, 1195 nm, 1444 nm and other water overtone modes provide key spectroscopic fingerprints to detect non-invasively cancer in prostate tissue. The value of the transport length (ℓtr) for paint medium obtained from time-resolved pulse transmission, steady state, and degree of polarization measurements is 28mum, 34mu m, and 29mum, respectively. The correlation of time-resolved interference (coherence) and polarization in a scattering thin paint medium has been determined for the first time

  13. Isolation and genome-wide expression and methylation characterization of CD31+ cells from normal and malignant human prostate tissue

    PubMed Central

    Luo, Wei; Hu, Qiang; Wang, Dan; Deeb, Kristin K.; Ma, Yingyu; Morrison, Carl D.; Liu, Song; Johnson, Candace S.; Trump, Donald L.

    2013-01-01

    Endothelial cells (ECs) are an important component involved in the angiogenesis. Little is known about the global gene expression and epigenetic regulation in tumor endothelial cells. The identification of gene expression and epigenetic difference between human prostate tumor-derived endothelial cells (TdECs) and those in normal tissues may uncover unique biological features of TdEC and facilitate the discovery of new anti-angiogenic targets. We established a method for isolation of CD31+ endothelial cells from malignant and normal prostate tissues obtained at prostatectomy. TdECs and normal-derived ECs (NdECs) showed >90% enrichment in primary culture and demonstrated microvascular endothelial cell characteristics such as cobblestone morphology in monolayer culture, diI-acetyl-LDL uptake and capillary-tube like formation in Matrigel®. In vitro primary cultures of ECs maintained expression of endothelial markers such as CD31, von Willebrand factor, intercellular adhesion molecule, vascular endothelial growth factor receptor 1, and vascular endothelial growth factor receptor 2. We then conducted a pilot study of transcriptome and methylome analysis of TdECs and matched NdECs from patients with prostate cancer. We observed a wide spectrum of differences in gene expression and methylation patterns in endothelial cells, between malignant and normal prostate tissues. Array-based expression and methylation data were validated by qRT-PCR and bisulfite DNA pyrosequencing. Further analysis of transcriptome and methylome data revealed a number of differentially expressed genes with loci whose methylation change is accompanied by an inverse change in gene expression. Our study demonstrates the feasibility of isolation of ECs from histologically normal prostate and prostate cancer via CD31+ selection. The data, although preliminary, indicates that there exist widespread differences in methylation and transcription between TdECs and NdECs. Interestingly, only a small

  14. Proteomic Upregulation of Fatty Acid Synthase and Fatty Acid Binding Protein 5 and Identification of Cancer- and Race-Specific Pathway Associations in Human Prostate Cancer Tissues

    PubMed Central

    Myers, Jennifer S.; von Lersner, Ariana K.; Sang, Qing-Xiang Amy

    2016-01-01

    Protein profiling studies of prostate cancer have been widely used to characterize molecular differences between diseased and non-diseased tissues. When combined with pathway analysis, profiling approaches are able to identify molecular mechanisms of prostate cancer, group patients by cancer subtype, and predict prognosis. This strategy can also be implemented to study prostate cancer in very specific populations, such as African Americans who have higher rates of prostate cancer incidence and mortality than other racial groups in the United States. In this study, age-, stage-, and Gleason score-matched prostate tumor specimen from African American and Caucasian American men, along with non-malignant adjacent prostate tissue from these same patients, were compared. Protein expression changes and altered pathway associations were identified in prostate cancer generally and in African American prostate cancer specifically. In comparing tumor to non-malignant samples, 45 proteins were significantly cancer-associated and 3 proteins were significantly downregulated in tumor samples. Notably, fatty acid synthase (FASN) and epidermal fatty acid-binding protein (FABP5) were upregulated in human prostate cancer tissues, consistent with their known functions in prostate cancer progression. Aldehyde dehydrogenase family 1 member A3 (ALDH1A3) was also upregulated in tumor samples. The Metastasis Associated Protein 3 (MTA3) pathway was significantly enriched in tumor samples compared to non-malignant samples. While the current experiment was unable to detect statistically significant differences in protein expression between African American and Caucasian American samples, differences in overrepresentation and pathway enrichment were found. Structural components (Cytoskeletal Proteins and Extracellular Matrix Protein protein classes, and Biological Adhesion Gene Ontology (GO) annotation) were overrepresented in African American but not Caucasian American tumors. Additionally, 5

  15. Organoid culture systems for prostate epithelial tissue and prostate cancer tissue

    PubMed Central

    Drost, Jarno; Karthaus, Wouter R.; Gao, Dong; Driehuis, Else; Sawyers, Charles L.; Chen, Yu; Clevers, Hans

    2016-01-01

    Summary This protocol describes a recently developed strategy to generate 3D prostate organoid cultures from healthy mouse and human prostate (either bulk or FAC-sorted single luminal and basal cells), metastatic prostate cancer lesions and circulating tumour cells. Organoids derived from healthy material contain the differentiated luminal and basal cell types, whereas organoids derived from prostate cancer tissue mimic the histology of the tumour. The stepwise establishment of these cultures and the fully defined serum-free conditioned medium that is required to sustain organoid growth are outlined. Organoids established using this protocol can be used to study many different aspects of prostate biology, including homeostasis, tumorigenesis and drug discovery. PMID:26797458

  16. A Novel Model of Urinary Tract Differentiation, Tissue Regeneration, and Disease: Reprogramming Human Prostate and Bladder Cells into Induced Pluripotent Stem Cells

    PubMed Central

    Moad, Mohammad; Pal, Deepali; Hepburn, Anastasia C.; Williamson, Stuart C.; Wilson, Laura; Lako, Majlinda; Armstrong, Lyle; Hayward, Simon W.; Franco, Omar E.; Cates, Justin M.; Fordham, Sarah E.; Przyborski, Stefan; Carr-Wilkinson, Jane; Robson, Craig N.; Heer, Rakesh

    2013-01-01

    Background Primary culture and animal and cell-line models of prostate and bladder development have limitations in describing human biology, and novel strategies that describe the full spectrum of differentiation from foetal through to ageing tissue are required. Recent advances in biology demonstrate that direct reprogramming of somatic cells into pluripotent embryonic stem cell (ESC)-like cells is possible. These cells, termed induced pluripotent stem cells (iPSCs), could theoretically generate adult prostate and bladder tissue, providing an alternative strategy to study differentiation. Objective To generate human iPSCs derived from normal, ageing, human prostate (Pro-iPSC), and urinary tract (UT-iPSC) tissue and to assess their capacity for lineage-directed differentiation. Design, setting, and participants Prostate and urinary tract stroma were transduced with POU class 5 homeobox 1 (POU5F1; formerly OCT4), SRY (sex determining region Y)-box 2 (SOX2), Kruppel-like factor 4 (gut) (KLF4), and v-myc myelocytomatosis viral oncogene homolog (avian) (MYC, formerly C-MYC) genes to generate iPSCs. Outcome measurements and statistical analysis The potential for differentiation into prostate and bladder lineages was compared with classical skin-derived iPSCs. The student t test was used. Results and limitations Successful reprogramming of prostate tissue into Pro-iPSCs and bladder and ureter into UT-iPSCs was demonstrated by characteristic ESC morphology, marker expression, and functional pluripotency in generating all three germ-layer lineages. In contrast to conventional skin-derived iPSCs, Pro-iPSCs showed a vastly increased ability to generate prostate epithelial-specific differentiation, as characterised by androgen receptor and prostate-specific antigen induction. Similarly, UT-iPSCs were shown to be more efficient than skin-derived iPSCs in undergoing bladder differentiation as demonstrated by expression of urothelial-specific markers: uroplakins, claudins, and

  17. Ultra-high performance liquid chromatographic determination of levofloxacin in human plasma and prostate tissue with use of experimental design optimization procedures.

    PubMed

    Szerkus, O; Jacyna, J; Wiczling, P; Gibas, A; Sieczkowski, M; Siluk, D; Matuszewski, M; Kaliszan, R; Markuszewski, M J

    2016-09-01

    Fluoroquinolones are considered as gold standard for the prevention of bacterial infections after transrectal ultrasound guided prostate biopsy. However, recent studies reported that fluoroquinolone- resistant bacterial strains are responsible for gradually increasing number of infections after transrectal prostate biopsy. In daily clinical practice, antibacterial efficacy is evaluated only in vitro, by measuring the reaction of bacteria with an antimicrobial agent in culture media (i.e. calculation of minimal inhibitory concentration). Such approach, however, has no relation to the treated tissue characteristics and might be highly misleading. Thus, the objective of this study was to develop, with the use of Design of Experiments approach, a reliable, specific and sensitive ultra-high performance liquid chromatography- diode array detection method for the quantitative analysis of levofloxacin in plasma and prostate tissue samples obtained from patients undergoing prostate biopsy. Moreover, correlation study between concentrations observed in plasma samples vs prostatic tissue samples was performed, resulting in better understanding, evaluation and optimization of the fluoroquinolone-based antimicrobial prophylaxis during transrectal ultrasound guided prostate biopsy. Box-Behnken design was employed to optimize chromatographic conditions of the isocratic elution program in order to obtain desirable retention time, peak symmetry and resolution of levofloxacine and ciprofloxacine (internal standard) peaks. Fractional Factorial design 2(4-1) with four center points was used for screening of significant factors affecting levofloxacin extraction from the prostatic tissue. Due to the limited number of tissue samples the prostatic sample preparation procedure was further optimized using Central Composite design. Design of Experiments approach was also utilized for evaluation of parameter robustness. The method was found linear over the range of 0.030-10μg/mL for human

  18. A biospectroscopic analysis of human prostate tissue obtained from different time periods points to a trans-generational alteration in spectral phenotype.

    PubMed

    Theophilou, Georgios; Lima, Kássio M G; Briggs, Matthew; Martin-Hirsch, Pierre L; Stringfellow, Helen F; Martin, Francis L

    2015-01-01

    Prostate cancer is the most commonly-diagnosed malignancy in males worldwide; however, there is marked geographic variation in incidence that may be associated with a Westernised lifestyle. We set out to determine whether attenuated total reflection Fourier-transform infrared (ATR-FTIR) or Raman spectroscopy combined with principal component analysis-linear discriminant analysis or variable selection techniques employing genetic algorithm or successive projection algorithm could be utilised to explore differences between prostate tissues from differing years. In total, 156 prostate tissues from transurethral resection of the prostate procedures for benign prostatic hyperplasia from 1983 to 2013 were collected. These were distributed to form seven categories: 1983-1984 (n = 20), 1988-1989 (n = 25), 1993-1994 (n = 21), 1998-1999 (n = 21), 2003-2004 (n = 21), 2008-2009 (n = 20) and 2012-2013 (n = 21). Ten-μm-thick tissue sections were floated onto Low-E (IR-reflective) slides for ATR-FTIR or Raman spectroscopy. The prostate tissue spectral phenotype altered in a temporal fashion. Examination of the two categories that are at least one generation (30 years) apart indicated highly-significant segregation, especially in spectral regions containing DNA and RNA bands (≈1,000-1,490 cm(-1)). This may point towards alterations that have occurred through genotoxicity or through epigenetic modifications. Immunohistochemical studies for global DNA methylation supported this. This study points to a trans-generational phenotypic change in human prostate. PMID:26310632

  19. A biospectroscopic analysis of human prostate tissue obtained from different time periods points to a trans-generational alteration in spectral phenotype

    PubMed Central

    Theophilou, Georgios; Lima, Kássio M. G.; Briggs, Matthew; Martin-Hirsch, Pierre L.; Stringfellow, Helen F.; Martin, Francis L.

    2015-01-01

    Prostate cancer is the most commonly-diagnosed malignancy in males worldwide; however, there is marked geographic variation in incidence that may be associated with a Westernised lifestyle. We set out to determine whether attenuated total reflection Fourier-transform infrared (ATR-FTIR) or Raman spectroscopy combined with principal component analysis-linear discriminant analysis or variable selection techniques employing genetic algorithm or successive projection algorithm could be utilised to explore differences between prostate tissues from differing years. In total, 156 prostate tissues from transurethral resection of the prostate procedures for benign prostatic hyperplasia from 1983 to 2013 were collected. These were distributed to form seven categories: 1983–1984 (n = 20), 1988–1989 (n = 25), 1993–1994 (n = 21), 1998–1999 (n = 21), 2003–2004 (n = 21), 2008–2009 (n = 20) and 2012–2013 (n = 21). Ten-μm-thick tissue sections were floated onto Low-E (IR-reflective) slides for ATR-FTIR or Raman spectroscopy. The prostate tissue spectral phenotype altered in a temporal fashion. Examination of the two categories that are at least one generation (30 years) apart indicated highly-significant segregation, especially in spectral regions containing DNA and RNA bands (≈1,000–1,490 cm−1). This may point towards alterations that have occurred through genotoxicity or through epigenetic modifications. Immunohistochemical studies for global DNA methylation supported this. This study points to a trans-generational phenotypic change in human prostate. PMID:26310632

  20. Human prostatic carcinoma in tissue culture: correlations between histological diagnosis and in vitro parameters.

    PubMed

    Bologna, M; Vicentini, C; Festuccia, C; Muzi, P; Angeletti, P V; Miano, L

    1985-01-01

    Prostatic cell biology is still largely unknown so that even the natural history of prostatic carcinoma is unpredictable. In order to correlate new observations with the prognosis of patients with prostatic carcinoma of various grades, we followed up 24 in vitro samples from surgical specimens of prostatic carcinoma. Fragments from 7 grade-I, 10 grade-II, 6 grade-III; and 1 grade-IV tumors were cultivated in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, 10% horse serum and 50 ng/ml each of hydrocortisone and insulin. Epithelial cells grown from the explants continued to grow for a maximum of 120 days and their morphology varied from a fairly regular monolayer of polygonal cells to irregular patterns of overlapping growth with many giant multinucleated cells. Although our data need a longer clinical follow-up time and larger numbers to achieve any statistical significance, the present findings seem to indicate rather clearly that a short life span in culture, a regular growth and a positive secretion activity is typical of low-grade tumors and that a longer life span, an irregular growth and a negative secretion in vitro are characteristics of high-grade tumors. A longer clinical follow-up of these patients will be important in the future to indicate whether these findings can be of any real prognostic value. PMID:4076272

  1. Ectopic prostatic tissue in the uterine cervix.

    PubMed

    Larraza-Hernandez, O; Molberg, K H; Lindberg, G; Albores-Saavedra, J

    1997-07-01

    This is the first reported case of ectopic prostatic tissue in the uterine cervix, diagnosed in a 38-year-old woman. A cluster of benign prostatic glands with cribriform and papillary patterns and focal squamous metaplasia occupied the superficial endocervical stroma. The glands were immunoreactive for prostatic specific antigen and prostatic specific acid phosphatase. This lesion, which could be confused with microglandular hyperplasia, mesonephric rests, or adenocarcinoma in situ may represent an embryonic rest. PMID:9421098

  2. Evaluation of discoidin domain receptor-2 (DDR2) expression level in normal, benign, and malignant human prostate tissues

    PubMed Central

    Azemikhah, Mitra; Ashtiani, Hamidreza Ahmadi; Aghaei, Mahmoud; Rastegar, Hosein

    2015-01-01

    Discoidin domain receptor (DDR) is a new member of the receptor tyrosine kinase family. There are two isoforms of discoidin domain receptor (DDR), DDR1 and DDR2. These receptors play a major role in the adhesion, motility and cell proliferation. Due to the important role of DDR2 in the development of tumor extension, this receptor is pivotal in the field of carcinogenesis. The aim of this study was to investigate the mRNA and protein expression of DDR2, in the malignant, benign prostatic hyperplasia (BPH) and normal tissues of patients with prostate cancer. In this study the gene and protein expression of DDR2 in adjacent normal (n=40), BPH (n=40), and malignant (n=40) prostate tissue were measured using real-time PCR and Western blotting. Then, the correlation of DDR2 gene and protein expression with prognostic factors such as age, tumor grade, tumor stage, lymph node involvement, and serum prostate-specific antigen (PSA) concentration were evaluated. The relative mRNA and protein expression level of DDR2 in malignant and benign prostate tissue was significantly higher than those of adjacent normal tissues (P<0.01). This expression was found to increase approximately 3.5 and 2.1 fold for mRNA and protein levels, respectively. Spearman test indicated a significant correlation between DDR2 mRNA and protein expression with prognostic factors such as tumor grade, stage, lymph node involvement, and serum PSA concentration. However, significant correlation with age was not observed. These findings suggest that DDR2 is a cancer-related gene associated with the aggressive progression of prostate cancer patients. PMID:26600862

  3. Evaluation of discoidin domain receptor-2 (DDR2) expression level in normal, benign, and malignant human prostate tissues.

    PubMed

    Azemikhah, Mitra; Ashtiani, Hamidreza Ahmadi; Aghaei, Mahmoud; Rastegar, Hosein

    2015-01-01

    Discoidin domain receptor (DDR) is a new member of the receptor tyrosine kinase family. There are two isoforms of discoidin domain receptor (DDR), DDR1 and DDR2. These receptors play a major role in the adhesion, motility and cell proliferation. Due to the important role of DDR2 in the development of tumor extension, this receptor is pivotal in the field of carcinogenesis. The aim of this study was to investigate the mRNA and protein expression of DDR2, in the malignant, benign prostatic hyperplasia (BPH) and normal tissues of patients with prostate cancer. In this study the gene and protein expression of DDR2 in adjacent normal (n=40), BPH (n=40), and malignant (n=40) prostate tissue were measured using real-time PCR and Western blotting. Then, the correlation of DDR2 gene and protein expression with prognostic factors such as age, tumor grade, tumor stage, lymph node involvement, and serum prostate-specific antigen (PSA) concentration were evaluated. The relative mRNA and protein expression level of DDR2 in malignant and benign prostate tissue was significantly higher than those of adjacent normal tissues (P<0.01). This expression was found to increase approximately 3.5 and 2.1 fold for mRNA and protein levels, respectively. Spearman test indicated a significant correlation between DDR2 mRNA and protein expression with prognostic factors such as tumor grade, stage, lymph node involvement, and serum PSA concentration. However, significant correlation with age was not observed. These findings suggest that DDR2 is a cancer-related gene associated with the aggressive progression of prostate cancer patients. PMID:26600862

  4. Stokes polarimetry imaging of dog prostate tissue

    NASA Astrophysics Data System (ADS)

    Kim, Jihoon; Johnston, William K., III; Walsh, Joseph T., Jr.

    2010-02-01

    Prostate cancer is the second leading cause of death in the United States in 2009. Radical prostatectomy (complete removal of the prostate) is the most common treatment for prostate cancer, however, differentiating prostate tissue from adjacent bladder, nerves, and muscle is difficult. Improved visualization could improve oncologic outcomes and decrease damage to adjacent nerves and muscle important for preservation of potency and continence. A novel Stokes polarimetry imaging (SPI) system was developed and evaluated using a dog prostate specimen in order to examine the feasibility of the system to differentiate prostate from bladder. The degree of linear polarization (DOLP) image maps from linearly polarized light illumination at different visible wavelengths (475, 510, and 650 nm) were constructed. The SPI system used the polarization property of the prostate tissue. The DOLP images allowed advanced differentiation by distinguishing glandular tissue of prostate from the muscular-stromal tissue in the bladder. The DOLP image at 650 nm effectively differentiated prostate and bladder by strong DOLP in bladder. SPI system has the potential to improve surgical outcomes in open or robotic-assisted laparoscopic removal of the prostate. Further in vivo testing is warranted.

  5. Examination of CK2α and NF-κB p65 expression in human benign prostatic hyperplasia and prostate cancer tissues.

    PubMed

    Qaiser, Fatima; Trembley, Janeen H; Sadiq, Sarah; Muhammad, Iqbal; Younis, Rubina; Hashmi, Shoaib Naiyar; Murtaza, Badar; Rector, Thomas S; Naveed, Abdul Khaliq; Ahmed, Khalil

    2016-09-01

    Protein kinase CK2 plays a critical role in cell growth, proliferation, and suppression of cell death. CK2 is overexpressed, especially in the nuclear compartment, in the majority of cancers, including prostate cancer (PCa). CK2-mediated activation of transcription factor nuclear factor kappa B (NF-κB) p65 is a key step in cellular proliferation, resulting in translocation of NF-κB p65 from the cytoplasm to the nucleus. As CK2 expression and activity are also elevated in benign prostatic hyperplasia (BPH), we sought to increase the knowledge of CK2 function in benign and malignant prostate by examination of the relationships between nuclear CK2 and nuclear NF-κB p65 protein expression. The expression level and localization of CK2α and NF-κB p65 proteins in PCa and BPH tissue specimens was determined. Nuclear CK2α and NF-κB p65 protein levels are significantly higher in PCa compared with BPH, and these proteins are positively correlated with each other in both diseases. Nuclear NF-κB p65 levels correlated with Ki-67 or with cytoplasmic NF-κB p65 expression in BPH, but not in PCa. The findings provide information that combined analysis of CK2α and NF-κB p65 expression in prostate specimens relates to the disease status. Increased nuclear NF-κB p65 expression levels in PCa specifically related to nuclear CK2α levels, indicating a possible CK2-dependent relationship in malignancy. In contrast, nuclear NF-κB p65 protein levels related to both Ki-67 and cytoplasmic NF-κB p65 levels exclusively in BPH, suggesting a potential separate impact for NF-κB p65 function in proliferation for benign disease as opposed to malignant disease. PMID:27435858

  6. Lipids and FA analysis of canine prostate tissue.

    PubMed

    Attar-Bashi, Nadia M; Orzeszko, Karyn; Slocombe, Ronald F; Sinclair, Andrew J

    2003-06-01

    It is widely reported that an association exists between dietary fat intake and the incidence of prostate cancer in humans. To study this association, there is a need for an animal model where prostate carcinogenesis occurs spontaneously. The canine prostate is considered a suitable experimental model for prostate cancer in humans since it is morphologically similar to the human prostate and both humans and dogs have a predisposition to benign and malignant prostate disease. In this study, the FA and lipids profiles of the normal canine prostate tissue from nine dogs were examined. The total lipid content of the canine prostate tissue was 1.7 +/- 0.5% (wet weight). The lipid composition analysis using TLC-FID showed that the two major lipid classes were phospholipids and TAG. Total FA, phospholipid, and TAG FA analysis showed that the major FA were palmitic acid (16:0), stearic acid (18:0), oleic acid (18:1), linoleic acid (18:2n-6), and arachidonic acid (20:4n-6). The n-3 FA were present at <3% of total FA and included alpha-linolenic acid (18:3n-3) (in total and TAG tissue FA), EPA (20:5n-3) (not in TAG), and DHA (22:6n-3) (not in TAG). The n-3/n-6 ratio was 1:11, 1:13, and 1:8 in total, phospholipid, and TAG FA, respectively. This study shows the canine prostate has a low level of n-3 FA and a low n-3/n-6 ratio. This is perhaps due to low n-3 content of the diet of the dogs. FA analysis of dogfoods available in Australia showed that the n-3 content in both supermarket and premium brand dogfoods was <3% (wet weight), and the n-3/n-6 ratio was low. PMID:12934677

  7. Metabolomic Imaging for Human Prostate Cancer Detection

    PubMed Central

    Wu, Chin-Lee; Jordan, Kate W.; Ratai, Eva M.; Sheng, Jinhua; Adkins, Christen B.; DeFeo, Elita M; Jenkins, Bruce G.; Ying, Leslie; McDougal, W. Scott; Cheng, Leo L.

    2010-01-01

    As current radiological approaches cannot accurately localize prostate cancer in vivo, biopsies are conducted at random within prostates for at-risk patients, leading to high false-negative rates. Metabolomic imaging can map cancer-specific biomolecular profile values onto anatomical structures to direct biopsy. In this preliminary study, we evaluated five prostatectomy-removed whole prostates from biopsy-proven cancer patients on a 7 Tesla human, whole-body magnetic resonance scanner. Localized, multi-cross-sectional, multi-voxel magnetic resonance spectra were used to construct a malignancy index based on prostate cancer metabolomic profiles obtained from previous, intact tissue analyses by a 14 Tesla spectrometer. This calculated Malignancy Index shows linear correlation with lesion size (p<0.013) and demonstrates a 93–97% overall accuracy for detecting the presence of prostate cancer lesions. PMID:20371475

  8. Does diabetes affect the distribution and number of interstitial cells and neuronal tissue in the ureter, bladder, prostate, and urethra of humans?

    PubMed Central

    Dogan, Hayriye; Kandemir, Olcay; Atmaca, Ali Fuat; Akbulut, Ziya; Balbay, Mevlana Derya

    2014-01-01

    Introduction The aim of this study was to investigate and compare the distribution and number of interstitial cells (ICs) and neuronal tissue in the ureter, bladder, prostate, and urethra of human patients with and without diabetes. Material and methods Human tissue was obtained from patients who had undergone radical cystectomy for bladder cancer (10 diabetic and 11 non–diabetic males). Interstitial cells were stained immunohistochemically with anti–human CD117 (c–kit) rabbit polyclonal antibody, Vimentin, and Connexin–43. Neural tissue was stained with synaptophysin. The number of ICs and neurons was evaluated and compared between the groups (diabetic versus non–diabetic). Results The mean number of c–kit (+) ICs in bladder lamina propria was significantly decreased in diabetics (32.40 ±12.96 versus 57.18 ±25.37, p = 0.036). The mean number of ICs in the detrusor muscle was significantly decreased in diabetics (40.50 ±16.79 versus 64.55 ±22.08, p = 0.013). Between the groups, no significant differences were detected regarding the number of ICs at the level of the ureter, urethra, and prostate. No significant differences were detected regarding the number of nerves in the ureter, bladder, prostate, and urethra of both groups. Conclusions The number of ICs may be decreased in the lamina propria and detrusor muscle of the human bladder in diabetes. This can be an underlying cause of lower urinary tract (LUT) dysfunction in diabetics. Research into the development of drugs targeting or stimulating IC function in order to prevent diabetic LUT dysfunction is warranted. PMID:25667756

  9. HUMAN PROSTATE CANCER RISK FACTORS

    EPA Science Inventory

    Prostate cancer has the highest prevalence of any non-skin cancer in the human body, with similar likelihood of neoplastic foci found within the prostates of men around the world regardless of diet, occupation, lifestyle, or other factors. Essentially all men with circulating an...

  10. Human Prostate Cancer Hallmarks Map.

    PubMed

    Datta, Dipamoy; Aftabuddin, Md; Gupta, Dinesh Kumar; Raha, Sanghamitra; Sen, Prosenjit

    2016-01-01

    Human prostate cancer is a complex heterogeneous disease that mainly affects elder male population of the western world with a high rate of mortality. Acquisitions of diverse sets of hallmark capabilities along with an aberrant functioning of androgen receptor signaling are the central driving forces behind prostatic tumorigenesis and its transition into metastatic castration resistant disease. These hallmark capabilities arise due to an intense orchestration of several crucial factors, including deregulation of vital cell physiological processes, inactivation of tumor suppressive activity and disruption of prostate gland specific cellular homeostasis. The molecular complexity and redundancy of oncoproteins signaling in prostate cancer demands for concurrent inhibition of multiple hallmark associated pathways. By an extensive manual curation of the published biomedical literature, we have developed Human Prostate Cancer Hallmarks Map (HPCHM), an onco-functional atlas of human prostate cancer associated signaling and events. It explores molecular architecture of prostate cancer signaling at various levels, namely key protein components, molecular connectivity map, oncogenic signaling pathway map, pathway based functional connectivity map etc. Here, we briefly represent the systems level understanding of the molecular mechanisms associated with prostate tumorigenesis by considering each and individual molecular and cell biological events of this disease process. PMID:27476486

  11. Human Prostate Cancer Hallmarks Map

    PubMed Central

    Datta, Dipamoy; Aftabuddin, Md.; Gupta, Dinesh Kumar; Raha, Sanghamitra; Sen, Prosenjit

    2016-01-01

    Human prostate cancer is a complex heterogeneous disease that mainly affects elder male population of the western world with a high rate of mortality. Acquisitions of diverse sets of hallmark capabilities along with an aberrant functioning of androgen receptor signaling are the central driving forces behind prostatic tumorigenesis and its transition into metastatic castration resistant disease. These hallmark capabilities arise due to an intense orchestration of several crucial factors, including deregulation of vital cell physiological processes, inactivation of tumor suppressive activity and disruption of prostate gland specific cellular homeostasis. The molecular complexity and redundancy of oncoproteins signaling in prostate cancer demands for concurrent inhibition of multiple hallmark associated pathways. By an extensive manual curation of the published biomedical literature, we have developed Human Prostate Cancer Hallmarks Map (HPCHM), an onco-functional atlas of human prostate cancer associated signaling and events. It explores molecular architecture of prostate cancer signaling at various levels, namely key protein components, molecular connectivity map, oncogenic signaling pathway map, pathway based functional connectivity map etc. Here, we briefly represent the systems level understanding of the molecular mechanisms associated with prostate tumorigenesis by considering each and individual molecular and cell biological events of this disease process. PMID:27476486

  12. Androgen Regulated Genes in Human Prostate Xenografts in Mice: Relation to BPH and Prostate Cancer

    PubMed Central

    Love, Harold D.; Booton, S. Erin; Boone, Braden E.; Breyer, Joan P.; Koyama, Tatsuki; Revelo, Monica P.; Shappell, Scott B.; Smith, Jeffrey R.; Hayward, Simon W.

    2009-01-01

    Benign prostatic hyperplasia (BPH) and prostate carcinoma (CaP) are linked to aging and the presence of androgens, suggesting that androgen regulated genes play a major role in these common diseases. Androgen regulation of prostate growth and development depends on the presence of intact epithelial-stromal interactions. Further, the prostatic stroma is implicated in BPH. This suggests that epithelial cell lines are inadequate to identify androgen regulated genes that could contribute to BPH and CaP and which could serve as potential clinical biomarkers. In this study, we used a human prostate xenograft model to define a profile of genes regulated in vivo by androgens, with an emphasis on identifying candidate biomarkers. Benign transition zone (TZ) human prostate tissue from radical prostatectomies was grafted to the sub-renal capsule site of intact or castrated male immunodeficient mice, followed by the removal or addition of androgens, respectively. Microarray analysis of RNA from these tissues was used to identify genes that were; 1) highly expressed in prostate, 2) had significant expression changes in response to androgens, and, 3) encode extracellular proteins. A total of 95 genes meeting these criteria were selected for analysis and validation of expression in patient prostate tissues using quantitative real-time PCR. Expression levels of these genes were measured in pooled RNAs from human prostate tissues with varying severity of BPH pathologic changes and CaP of varying Gleason score. A number of androgen regulated genes were identified. Additionally, a subset of these genes were over-expressed in RNA from clinical BPH tissues, and the levels of many were found to correlate with disease status. Our results demonstrate the feasibility, and some of the problems, of using a mouse xenograft model to characterize the androgen regulated expression profiles of intact human prostate tissues. PMID:20027305

  13. Quantitative Analysis of BTF3, HINT1, NDRG1 and ODC1 Protein Over-Expression in Human Prostate Cancer Tissue

    PubMed Central

    Symes, Andrew J.; Eilertsen, Marte; Millar, Michael; Nariculam, Joseph; Freeman, Alex; Notara, Maria; Feneley, Mark R.; Patel, Hitenedra R. H.; Masters, John R. W.; Ahmed, Aamir

    2013-01-01

    Prostate carcinoma is the most common cancer in men with few, quantifiable, biomarkers. Prostate cancer biomarker discovery has been hampered due to subjective analysis of protein expression in tissue sections. An unbiased, quantitative immunohistochemical approach provided here, for the diagnosis and stratification of prostate cancer could overcome this problem. Antibodies against four proteins BTF3, HINT1, NDRG1 and ODC1 were used in a prostate tissue array (> 500 individual tissue cores from 82 patients, 41 case pairs matched with one patient in each pair had biochemical recurrence). Protein expression, quantified in an unbiased manner using an automated analysis protocol in ImageJ software, was increased in malignant vs non-malignant prostate (by 2-2.5 fold, p<0.0001). Operating characteristics indicate sensitivity in the range of 0.68 to 0.74; combination of markers in a logistic regression model demonstrates further improvement in diagnostic power. Triple-labeled immunofluorescence (BTF3, HINT1 and NDRG1) in tissue array showed a significant (p<0.02) change in co-localization coefficients for BTF3 and NDRG1 co-expression in biochemical relapse vs non-relapse cancer epithelium. BTF3, HINT1, NDRG1 and ODC1 could be developed as epithelial specific biomarkers for tissue based diagnosis and stratification of prostate cancer. PMID:24386364

  14. An unusual case of retrovesical ectopic prostate tissue accompanied by primary prostate cancer.

    PubMed

    Tan, Fu-Qing; Xu, Xin; Shen, Bo-Hua; Qin, Jie; Sun, Ke; You, Qihan; Shang, De-Sheng; Zheng, Xiang-Yi

    2012-01-01

    We report an unusual case of retrovesical ectopic prostate tissue in a 73-year-old man with primary prostate cancer. The man's prostate-specific antigen was 24.66 ng/ml.Transabdominal ultrasonography, pelvic computed tomography,and pelvic magnetic resonance imaging demonstrated a heterogeneous 8.5 × 8.0 × 7.0 cm mass in contact with the posterior wall of the urinary bladder. The patient underwent a retropubic radical prostatectomy and resection of tumor. Pathological examination of prostate revealed a prostatic adenocarcinoma, Gleason score of 4 + 5 = 9, and the retrovesical tumor was confirmed to be a benign prostate tissue. PMID:22966979

  15. Sex steroid receptor expression and localization in benign prostatic hyperplasia varies with tissue compartment.

    PubMed

    Nicholson, Tristan M; Sehgal, Priyanka D; Drew, Sally A; Huang, Wei; Ricke, William A

    2013-01-01

    Androgens and estrogens, acting via their respective receptors, are important in benign prostatic hyperplasia (BPH). The goals of this study were to quantitatively characterize the tissue distribution and staining intensity of androgen receptor (AR) and estrogen receptor-alpha (ERα), and assess cells expressing both AR and ERα, in human BPH compared to normal prostate. A tissue microarray composed of normal prostate and BPH tissue was used and multiplexed immunohistochemistry was performed to detect AR and ERα. We used a multispectral imaging platform for automated scanning, tissue and cell segmentation and marker quantification. BPH specimens had an increased number of epithelial and stromal cells and increased percentage of epithelium. In both stroma and epithelium, the mean nuclear area was decreased in BPH relative to normal prostate. AR expression and staining intensity in epithelial and stromal cells was significantly increased in BPH compared to normal prostate. ERα expression was increased in BPH epithelium. However, stromal ERα expression and staining intensity was decreased in BPH compared to normal prostate. Double positive (AR and ERα) epithelial cells were more prevalent in BPH, and fewer double negative (AR and ERα) stromal and epithelial negative cells were observed in BPH. These data underscore the importance of tissue layer localization and expression of steroid hormone receptors in the prostate. Understanding the tissue-specific hormone action of androgens and estrogens will lead to a better understanding of mechanisms of pathogenesis in the prostate and may lead to better treatment for BPH. PMID:23792768

  16. Sex steroid receptor expression and localization in benign prostatic hyperplasia varies with tissue compartment

    PubMed Central

    Nicholson, Tristan M.; Sehgal, Priyanka D.; Drew, Sally A.; Huang, Wei; Ricke, William A.

    2013-01-01

    Androgens and estrogens, acting via their respective receptors, are important in benign prostatic hyperplasia (BPH). The goal of this study was to quantitatively characterize the tissue distribution and staining intensity of androgen receptor (AR) and estrogen receptor-alpha (ERα), and assess cells expressing both AR and ERα, in human BPH compared to normal prostate. A tissue microarray composed of normal prostate and BPH tissue was used and multiplexed immunohistochemistry was performed to detect AR and ERα. We used a multispectral imaging platform for automated scanning, tissue and cell segmentation and marker quantification. BPH specimens had an increased number of epithelial and stromal cells and increased percentage of epithelium. In both stroma and epithelium, the mean nuclear area was decreased in BPH relative to normal prostate. AR expression and staining intensity in epithelial and stromal cells was significantly increased in BPH compared to normal prostate. ERα expression was increased in BPH epithelium. However, stromal ERα expression and staining intensity was decreased in BPH compared to normal prostate. Double positive (AR & ERα) epithelial cells were more prevalent in BPH, and fewer double negative (AR & ERα) stromal and epithelial negative cells were observed in BPH. These data underscore the importance of tissue layer localization and expression of steroid hormone receptors in the prostate. Understanding the tissue-specific hormone action of androgens and estrogens will lead to a better understanding of mechanisms of pathogenesis in the prostate and may lead to better treatment for BPH. PMID:23792768

  17. Segmentation of prostate cancer tissue microarray images

    NASA Astrophysics Data System (ADS)

    Cline, Harvey E.; Can, Ali; Padfield, Dirk

    2006-02-01

    Prostate cancer is diagnosed by histopathology interpretation of hematoxylin and eosin (H and E)-stained tissue sections. Gland and nuclei distributions vary with the disease grade. The morphological features vary with the advance of cancer where the epithelial regions grow into the stroma. An efficient pathology slide image analysis method involved using a tissue microarray with known disease stages. Digital 24-bit RGB images were acquired for each tissue element on the slide with both 10X and 40X objectives. Initial segmentation at low magnification was accomplished using prior spectral characteristics from a training tissue set composed of four tissue clusters; namely, glands, epithelia, stroma and nuclei. The segmentation method was automated by using the training RGB values as an initial guess and iterating the averaging process 10 times to find the four cluster centers. Labels were assigned to the nearest cluster center in red-blue spectral feature space. An automatic threshold algorithm separated the glands from the tissue. A visual pseudo color representation of 60 segmented tissue microarray image was generated where white, pink, red, blue colors represent glands, epithelia, stroma and nuclei, respectively. The higher magnification images provided refined nuclei morphology. The nuclei were detected with a RGB color space principle component analysis that resulted in a grey scale image. The shape metrics such as compactness, elongation, minimum and maximum diameters were calculated based on the eigenvalues of the best-fitting ellipses to the nuclei.

  18. Role of Plasma Discharge in Division of Prostatic Tissue

    NASA Astrophysics Data System (ADS)

    Ward, Arlen; Almgren, Carl; Yu, Zeng-Qi; Sartor, Joe; Collins, George

    2009-10-01

    During the treatment of benign prostatic hyperplasia electrical energy is used to separate prostatic tissue and remove it as a urinary obstruction. This surgical procedure is often performed in a saline environment, and current paths change as the tissue and fluid are heated. This study shows that a plasma discharge at the electrode is necessary to provide the current densities necessary to vaporize portions of the prostatic tissue in order to facilitate removal. This behavior is predicted in finite element simulations, and verified with color schlieren imaging and ex vivo bovine prostate tests.

  19. Inverse association between gluthathione peroxidase activity and both selenium-binding protein 1 levels and gleason score in human prostate tissue

    Technology Transfer Automated Retrieval System (TEKTRAN)

    BACKGROUND. Data from human epidemiological studies, cultured mammalian cells, and animal models have supported a potentially beneficial role of selenium (Se) in prostate cancer prevention. In addition, Se-containing proteins including members of the gutathione peroxidase (GPx) family and Selenium-B...

  20. Application of vibro-acoustography in prostate tissue imaging

    PubMed Central

    Alizad, Azra; Mehrmohammadi, Mohammad; Mitri, Farid G.; Davis, Brian J.; Sebo, Thomas J.; Mynderse, Lance A.; Kinnick, Randall R.; Greenleaf, James F.; Fatemi, Mostafa

    2013-01-01

    Purpose: To evaluate the potential of the imaging modality vibro-acoustography (VA) for imaging of the prostate. Methods: Excised cadaver prostate specimens were embedded in tissue mimicking gel to simulate the properties of surrounding soft tissues. The samples were imaged at various depths using a laboratory prototyped VA imaging system. The recorded signals were used for offline processing and image reconstruction. In a selected subgroup of tissue samples, conventional ultrasound (B-mode) and x-ray imaging were performed for further analysis, evaluation, and validation of the VA images. Results: The imaging results of prostate tissue samples indicate the capability of VA imaging to detect prostatic nodules and lesions. In the prostate sample with an adenocarcinoma, the lesion appears with a clear contrast with respect to its surrounding tissue. The VA images could also identify the presence of calcifications deep inside the prostate tissue. Further, quantifications of the imaging results demonstrate that VA imaging has higher sensitivity to detect the calcifications compared to conventional ultrasound imaging. VA is also capable of visualizing prostatic tissue structures and in some cases can identify the anatomical zones. More specifically, the observed higher texture level in peripheral zones demonstrates the ability of VA to differentiate between prostatic anatomical zones. Conclusions: Imaging results of ex vivo prostate tissues, reveals the potency of VA as a promising tool to detect abnormalities, delineate tissue structures and anatomical zones, and locate calcifications. The results of this pilot study suggest that in vivo VA imaging of the prostate may be of clinical utility. PMID:23387773

  1. Characterizing the stiffness of Human Prostates using Acoustic Radiation Force

    PubMed Central

    Zhai, Liang; Madden, John; Foo, Wen-Chi; Mouraviev, Vladimir; Polascik, Thomas J.; Palmeri, Mark L.; Nightingale, Kathryn R.

    2012-01-01

    Acoustic Radiation Force Impulse (ARFI) imaging has been previously reported to portray normal anatomic structures and pathologies in ex vivo human prostates with good contrast and resolution. These findings were based on comparison with histological slides and McNeal’s zonal anatomy. In ARFI images, the central zone (CZ) appears darker (smaller displacement) than other anatomic zones, and prostate cancer (PCa) is darker than normal tissue in the peripheral zone (PZ). Since displacement amplitudes in ARFI images are determined by both the underlying tissue stiffness and the amplitude of acoustic radiation force which varies with acoustic attenuation, one question that arises is: how are the relative displacements in prostate ARFI images related to the underlying prostatic tissue stiffness? In linear, isotropic elastic materials and in tissues that are relatively uniform in acoustic attenuation (e.g. liver), relative displacement in ARFI images has been shown to be correlated with underlying tissue stiffness. However, the prostate is known to be heterogeneous. Variations in acoustic attenuation of prostatic structures could confound the interpretation of ARFI images due to the associated variations in the applied acoustic radiation force. Therefore, in this study, co-registered three-dimensional (3D) ARFI datasets and quantitative shear wave elasticity imaging (SWEI) datasets were acquired in freshly excised human prostates to investigate the relationship between displacement amplitudes in ARFI prostate images and the matched reconstructed shear moduli. The lateral time-to-peak (LTTP) algorithm was applied to the SWEI data to compute the shear wave speed and reconstruct the shear moduli. Five types of prostatic tissue (PZ, CZ, transition zone (TZ) and benign prostatic hyperplasia (BPH), PCa, and atrophy) were identified, whose shear moduli were quantified to be 4.1±0.8 kPa, 9.9±0.9 kPa, 4.8±0.6 kPa, 10.0±1.0 kPa and 8.0 kPa, respectively. Linear regression was

  2. Immunochemiluminescent detection of galectin-3 in tumoral tissue from prostate

    PubMed Central

    Araújo-Filho, Jorge Luiz; Melo-Junior, Mário Ribeiro; Beltrão, Eduardo Isidoro Carneiro; de Lima, Luiza Rayanna Amorim; Antunes, Consuelo Barreto Lins; de Carvalho, Luiz Bezerra

    2013-01-01

    This work proposes a chemiluminescent quantitative method for galectin-3 (Gal3) detection in prostate tissues. Monoclonal antibody anti-Gal3 was conjugated to acridinium ester (AE) and the complex formed with Gal3 in the prostate tissue was chemiluminescently detected. The light emission (expressed in Relative Light Unit-RLU) showed mean values higher for benign prostatic hyperplasia than normal tissues and adenocarcinoma. These differences showed to be statistically significant (p < 0.001). There was a linear relationship between RLU and tissue area. Furthermore, these values were dramatically reduced when the tissue samples were previously incubated with non labeled anti-Gal3. Finally, the anti-Gal3-AE solution in buffer stored at 4°C and the treated samples showed to be stable during a year and at least 72 h, respectively. Gal3 content in prostate tissue was higher in benign prostatic hyperplasia than normal tissues and much lower in adenocarcinoma. This quantitative, specific and sensitive method based on labeling antibody to acridinium ester can be applied to detect antigen in tissue. PMID:24040451

  3. Comparison of microscopic vascularity in benign and malignant prostate tissue.

    PubMed

    Bigler, S A; Deering, R E; Brawer, M K

    1993-02-01

    A variety of malignant neoplasms have been shown to induce capillary neovascularization, and in some cases the degree of vascularization appears to correlate with aggressive behavior and risk of metastasis. We hypothesized that carcinoma of the prostate also induces the formation of new capillaries, and we developed a method to quantify the relative density of microscopic vessels in carcinoma of the prostate compared with benign prostatic glandular tissue. The number of microvessel profiles in tissue sections was quantified by marking the vascular endothelial cells with antibodies to factor VIII-related antigen using standard immunohistochemistry techniques and comparing fields of adenocarcinoma with benign glandular tissue in 15 radical prostatectomy specimens. The analysis was facilitated by using the Optimas computerized image analysis system (Bioscan, Seattle, WA) with software written for this investigation. Fourteen of the 15 cases demonstrated significantly higher vascular density in the areas of carcinoma than in the benign tissues. Overall, the ratio of vessels per unit area in sections of carcinoma versus benign tissue was approximately double (ratio = 2.02; P < .001). In benign tissues the capillaries are restricted for the most part to the periglandular stroma immediately adjacent to the epithelium, whereas the distribution in carcinoma appears to be more random. The data demonstrate the increased density of capillaries in prostatic carcinoma when compared with benign prostate tissue. PMID:8432518

  4. The androgen receptor cistrome is extensively reprogrammed in human prostate tumorigenesis

    PubMed Central

    Pomerantz, Mark M.; Li, Fugen; Takeda, David; Lenci, Romina; Chonkar, Apurva; Chabot, Matthew; Cejas, Paloma; Vazquez, Francisca; Cook, Jennifer; Shivdasani, Ramesh A.; Bowden, Michaela; Lis, Rosina; Hahn, William C.; Kantoff, Philip W.; Brown, Myles; Loda, Massimo; Long, Henry W.; Freedman, Matthew L.

    2015-01-01

    Master transcription factors interact with DNA to establish cell-type identity and to regulate gene expression in mammalian cells1,2. The genome-wide map of these transcription factor binding sites has been termed the cistrome3. Here we show that the androgen receptor (AR) cistrome undergoes extensive reprogramming during prostate epithelial transformation in man. Using human prostate tissue, we observed a core set of AR binding sites that are consistently reprogrammed in tumors. FOXA1 and HOXB13, co-localized with the reprogrammed AR sites in human tumor tissue. Introduction of FOXA1 and HOXB13 into an immortalized prostate cell line reprogrammed the AR cistrome to resemble that of a prostate tumor, functionally linking these specific factors to AR reprogramming. These findings offer mechanistic insights into a key set of events that drive normal prostate epithelium towards transformation and establish the centrality of epigenetic reprogramming in human prostate tumorigenesis. PMID:26457646

  5. Presence of calcitonin-like immunoreactivity (iCT) in human prostate gland: evidence for iCT secretion by cultured prostate cells.

    PubMed

    Shah, G V; Noble, M J; Austenfeld, M; Weigel, J; Deftos, L J; Mebust, W K

    1992-01-01

    Immunoreactive calcitonin (iCT) has been detected in human prostate tissue extracts as well as seminal plasma. The present studies were undertaken to examine whether iSCT (immunoreactive salmon CT-like human peptide) co-exists with iHCT (thyroid CT-like substance) in human prostate tissue extracts, and whether these substances are secreted by primary prostate cells in culture. Since the local secretion of these substances seems to increase in some neoplasms, a second objective of the study was to examine whether basal secretion of iCTs from primary prostate cells is increased in carcinoma. The present results have shown that both iHCT and iSCT were present in prostate tissue extracts. The mean iHCT levels in extracts of benign hyperplastic prostates (BPH) were 0.59 ng/g prostate, and these were significantly lower than iHCT concentrations in prostatic carcinoma (PC) (2.53 ng/g). No significant differences in their iSCT contents were observed. However, the results from culture of over 90 individual prostate tissue specimens from BPH or PC indicate that primary prostate cells secreted detectable quantities of iSCT and the basal release of this material from PC prostate cultures was almost four-fold higher than that from BPH prostate cultures. These results suggest that a CT-like immunoreactive material is secreted by primary prostate cells in culture, and the basal secretion of this material is significantly higher in PC cells as compared to BPH cells. Endogenous secretion of prostatic CT, and the elevation of its expression in PC suggest that it may serve as a regulatory factor in the pathophysiology of the prostate gland. PMID:1409122

  6. Which, when and why? Rational use of tissue-based molecular testing in localized prostate cancer.

    PubMed

    Ross, A E; D'Amico, A V; Freedland, S J

    2016-03-01

    An increased molecular understanding of localized prostate cancer and the improved ability for molecular testing of pathologic tissue has led to the development of multiple clinical assays. Here we review the relevant molecular biology of localized prostate cancer, currently available tissue-based tests and describe which is best supported for use in various clinical scenarios. Literature regarding testing of human prostate cancer tissue with Ki-67, PTEN (by immunohistochemistry (IHC) or fluroescence in situ hybridization (FISH)), ProMark, Prolaris, OncotypeDX Prostate and Decipher was reviewed to allow for generation of expert opinions. At diagnosis, evaluation of PTEN status, use of ProMark or OncotypeDX Prostate in men with Gleason 6 or 3+4=7 disease may help guide the use of active surveillance. For men with Gleason 7 or above disease considering watchful waiting, Ki-67 and Prolaris add independent prognostic information. For those men who have undergone prostatectomy and have adverse pathology, Decipher testing may aid in the decision to undergo adjuvant radiation. Newly available molecular tests bring opportunities to improve decision making for men with localized prostate cancer. A review of the currently available data suggests clinical scenarios for which each of these tests may have the greatest utility. PMID:26123120

  7. Influence of zinc deficiency on AKT-MDM2-P53 signaling axes in normal and malignant human prostate cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    With prostate being the highest zinc-accumulating tissue before the onset of cancer, the effects of physiologic levels of zinc on Akt-Mdm2-p53 and Akt-p21 signaling axes in human normal prostate epithelial cells (PrEC) and malignant prostate LNCaP cells were examined. Cells were cultured for 6 d in...

  8. Methylation profiling defines an extensive field defect in histologically normal prostate tissues associated with prostate cancer.

    PubMed

    Yang, Bing; Bhusari, Sachin; Kueck, Jessica; Weeratunga, Pushpa; Wagner, Jennifer; Leverson, Glen; Huang, Wei; Jarrard, David F

    2013-04-01

    Prostate cancer (PCa) is typically found as a multifocal disease suggesting the potential for molecular defects within the morphologically normal tissue. The frequency and spatial extent of DNA methylation changes encompassing a potential field defect are unknown. A comparison of non-tumor-associated (NTA) prostate to histologically indistinguishable tumor-associated (TA) prostate tissues detected a distinct profile of DNA methylation alterations (0.2%) using genome-wide DNA arrays based on the Encyclopedia of DNA Elements 18 sequence that tile both gene-rich and poor regions. Hypomethylation (87%) occurred more frequently than hypermethylation (13%). Several of the most significantly altered loci (CAV1, EVX1, MCF2L, and FGF1) were then used as probes to map the extent of these DNA methylation changes in normal tissues from prostates containing cancer. In TA tissues, the extent of methylation was similar both adjacent (2 mm) and at a distance (>1 cm) from tumor foci. These loci were also able to distinguish NTA from TA tissues in a validation set of patient samples. These mapping studies indicate that a spatially widespread epigenetic defect occurs in the peripheral prostate tissues of men who have PCa that may be useful in the detection of this disease. PMID:23555185

  9. Extracellular Vesicles from Metastatic Rat Prostate Tumors Prime the Normal Prostate Tissue to Facilitate Tumor Growth.

    PubMed

    Halin Bergström, Sofia; Hägglöf, Christina; Thysell, Elin; Bergh, Anders; Wikström, Pernilla; Lundholm, Marie

    2016-01-01

    Accumulating data indicates that tumor-derived extracellular vesicles (EVs) are responsible for tumor-promoting effects. However, if tumor EVs also prepare the tumor-bearing organ for subsequent tumor growth, and if this effect is different in low and high malignant tumors is not thoroughly explored. Here we used orthotopic rat Dunning R-3327 prostate tumors to compare the role of EVs from fast growing and metastatic MatLyLu (MLL) tumors with EVs from more indolent and non-metastatic Dunning G (G) tumors. Prostate tissue pre-conditioned with MLL-EVs in vivo facilitated G tumor establishment compared to G-EVs. MLL-EVs increased prostate epithelial proliferation and macrophage infiltration into the prostate compared to G-EVs. Both types of EVs increased macrophage endocytosis and the mRNA expression of genes associated with M2 polarization in vitro, with MLL-EVs giving the most pronounced effects. MLL-EVs also altered the mRNA expression of growth factors and cytokines in primary rat prostate fibroblasts compared to G-EVs, suggesting fibroblast activation. Our findings propose that EVs from metastatic tumors have the ability to prime the prostate tissue and enhance tumor growth to a higher extent than EVs from non-metastatic tumors. Identifying these differences could lead to novel therapeutic targets and potential prognostic markers for prostate cancer. PMID:27550147

  10. Extracellular Vesicles from Metastatic Rat Prostate Tumors Prime the Normal Prostate Tissue to Facilitate Tumor Growth

    PubMed Central

    Halin Bergström, Sofia; Hägglöf, Christina; Thysell, Elin; Bergh, Anders; Wikström, Pernilla; Lundholm, Marie

    2016-01-01

    Accumulating data indicates that tumor-derived extracellular vesicles (EVs) are responsible for tumor-promoting effects. However, if tumor EVs also prepare the tumor-bearing organ for subsequent tumor growth, and if this effect is different in low and high malignant tumors is not thoroughly explored. Here we used orthotopic rat Dunning R-3327 prostate tumors to compare the role of EVs from fast growing and metastatic MatLyLu (MLL) tumors with EVs from more indolent and non-metastatic Dunning G (G) tumors. Prostate tissue pre-conditioned with MLL-EVs in vivo facilitated G tumor establishment compared to G-EVs. MLL-EVs increased prostate epithelial proliferation and macrophage infiltration into the prostate compared to G-EVs. Both types of EVs increased macrophage endocytosis and the mRNA expression of genes associated with M2 polarization in vitro, with MLL-EVs giving the most pronounced effects. MLL-EVs also altered the mRNA expression of growth factors and cytokines in primary rat prostate fibroblasts compared to G-EVs, suggesting fibroblast activation. Our findings propose that EVs from metastatic tumors have the ability to prime the prostate tissue and enhance tumor growth to a higher extent than EVs from non-metastatic tumors. Identifying these differences could lead to novel therapeutic targets and potential prognostic markers for prostate cancer. PMID:27550147

  11. Radioimmunoassay of tissue steroids in adenocarcinoma of the prostate

    SciTech Connect

    Belis, J.A.; Tarry, W.F.

    1981-12-01

    Tissue steroid levels in 48 needle-biopsy samples of adenocarcinoma of the prostate were quantified by radioimmunoassay (RIA). Tissue levels of dihydrotestosterone (DHT), estradiol-17..beta.., and estrone were correlated with tumor stage, histologic grade, and patient response to endocrine therapy. All patients with well-differentiated carcinoma of the prostate had tissue DHT content greater than 2.0 ng/g while 35% of patients with moderately differentiated or poorly differentiated tumors had tissue DHT content less than 2.0 ng/g. DHT content appeared to be unrelated to tumor stage. Estradiol and estrone content correlated well with tumor grade but not with tumor stage. DHT levels were measured in 17 patients with symptomatic Stage D/sub 2/ carcinoma of the prostate. Thirteen patients with DHT content greater than 2.0 ng/g initially had an objective and/or subjective response to endocrine therapy. Four patients with tissue DHT levels below 2.0 ng/g had no response to hormonal therapy. Quantification of tissue DHT content by RIA is a promising method for predicting initial response to hormonal therapy in adenocarcinoma of the prostate.

  12. Dosimetric effect of tissue heterogeneity for 125I prostate implants

    PubMed Central

    Oliveira, Susana Maria; Teixeira, Nuno José; Fernandes, Lisete; Teles, Pedro; Vaz, Pedro

    2014-01-01

    Aim To use Monte Carlo (MC) together with voxel phantoms to analyze the tissue heterogeneity effect in the dose distributions and equivalent uniform dose (EUD) for 125I prostate implants. Background Dose distribution calculations in low dose-rate brachytherapy are based on the dose deposition around a single source in a water phantom. This formalism does not take into account tissue heterogeneities, interseed attenuation, or finite patient dimensions effects. Tissue composition is especially important due to the photoelectric effect. Materials and methods The computed tomographies (CT) of two patients with prostate cancer were used to create voxel phantoms for the MC simulations. An elemental composition and density were assigned to each structure. Densities of the prostate, vesicles, rectum and bladder were determined through the CT electronic densities of 100 patients. The same simulations were performed considering the same phantom as pure water. Results were compared via dose–volume histograms and EUD for the prostate and rectum. Results The mean absorbed doses presented deviations of 3.3–4.0% for the prostate and of 2.3–4.9% for the rectum, when comparing calculations in water with calculations in the heterogeneous phantom. In the calculations in water, the prostate D90 was overestimated by 2.8–3.9% and the rectum D0.1cc resulted in dose differences of 6–8%. The EUD resulted in an overestimation of 3.5–3.7% for the prostate and of 7.7–8.3% for the rectum. Conclusions The deposited dose was consistently overestimated for the simulation in water. In order to increase the accuracy in the determination of dose distributions, especially around the rectum, the introduction of the model-based algorithms is recommended. PMID:25337412

  13. ICRAC controls the rapid androgen response in human primary prostate epithelial cells and is altered in prostate cancer

    PubMed Central

    Holzmann, Christian; Kilch, Tatiana; Kappel, Sven; Armbrüster, Andrea; Jung, Volker; Stöckle, Michael; Bogeski, Ivan; Schwarz, Eva C.; Peinelt, Christine

    2013-01-01

    Labelled 5α-dihydrotestosterone (DHT) binding experiments have shown that expression levels of (yet unidentified) membrane androgen receptors (mAR) are elevated in prostate cancer and correlate with a negative prognosis. However, activation of these receptors which mediate a rapid androgen response can counteract several cancer hallmark functions such as unlimited proliferation, enhanced migration, adhesion and invasion and the inability to induce apoptosis. Here, we investigate the downstream signaling pathways of mAR and identify rapid DHT induced activation of store-operated Ca2+ entry (SOCE) in primary cultures of human prostate epithelial cells (hPEC) from non-tumorous tissue. Consequently, down-regulation of Orai1, the main molecular component of Ca2+ release-activated Ca2+ (CRAC) channels results in an almost complete loss of DHT induced SOCE. We demonstrate that this DHT induced Ca2+ influx via Orai1 is important for rapid androgen triggered prostate specific antigen (PSA) release. We furthermore identified alterations of the molecular components of CRAC channels in prostate cancer. Three lines of evidence indicate that prostate cancer cells down-regulate expression of the Orai1 homolog Orai3: First, Orai3 mRNA expression levels are significantly reduced in tumorous tissue when compared to non-tumorous tissue from prostate cancer patients. Second, mRNA expression levels of Orai3 are decreased in prostate cancer cell lines LNCaP and DU145 when compared to hPEC from healthy tissue. Third, the pharmacological profile of CRAC channels in prostate cancer cell lines and hPEC differ and siRNA based knock-down experiments indicate changed Orai3 levels are underlying the altered pharmacological profile. The cancer-specific composition and pharmacology of CRAC channels identifies CRAC channels as putative targets in prostate cancer therapy. PMID:24240085

  14. Prostate-specific membrane antigen protein expression in tumor tissue and risk of lethal prostate cancer

    PubMed Central

    Kasperzyk, Julie L.; Finn, Stephen P.; Flavin, Richard; Fiorentino, Michelangelo; Lis, Rosina; Hendrickson, Whitney K.; Clinton, Steven K.; Sesso, Howard D.; Giovannucci, Edward L.; Stampfer, Meir J.; Loda, Massimo; Mucci, Lorelei A.

    2013-01-01

    Background Over-expression of prostate-specific membrane antigen (PSMA) in tumor tissue and serum has been linked to increased risk of biochemical recurrence in surgically treated prostate cancer patients, but no studies have assessed its association with disease-specific mortality. Methods We examined whether high PSMA protein expression in prostate tumor tissue was associated with lethal disease, and with tumor biomarkers of progression, among participants of two US-based cohorts (n=902, diagnosed 1983–2004). We used Cox proportional hazards regression to calculate multivariable hazard ratios (HR) and 95% confidence intervals (CI) of lethal prostate cancer, defined as disease-specific death or development of distant metastases (n=95). Partial Spearman rank correlation coefficients were used to correlate PSMA with tumor biomarkers. Results During an average 13 years of follow-up, higher PSMA expression at prostatectomy was significantly associated with lethal prostate cancer (age-adjusted HRQuartile(Q)4vs.Q1=2.42; p-trend<0.01). This association was attenuated and non-significant (multivariable-adjusted HRQ4vs.Q1=1.01; p-trend=0.52) after further adjusting for Gleason score and PSA at diagnosis. High PSMA expression was significantly (p<0.05) correlated with higher Gleason score and PSA at diagnosis, increased tumor angiogenesis, lower vitamin D receptor and androgen receptor expression, and absence of ERG expression. Conclusions High tumor PSMA expression was not an independent predictor of lethal prostate cancer in the current study. PSMA expression likely captures, in part, malignant features of Gleason grade and tumor angiogenesis. Impact PSMA is not a strong candidate biomarker for predicting prostate cancer-specific mortality in surgically treated patients. PMID:24130224

  15. Prostate cancer outcome and tissue levels of metal ions

    USGS Publications Warehouse

    Sarafanov, A.G.; Todorov, T.I.; Centeno, J.A.; MacIas, V.; Gao, W.; Liang, W.-M.; Beam, C.; Gray, Michael A.; Kajdacsy-Balla, A.

    2011-01-01

    BACKGROUND There are several studies examining prostate cancer and exposure to cadmium, iron, selenium, and zinc. Less data are available on the possible influence of these metal ions on prostate cancer outcome. This study measured levels of these ions in prostatectomy samples in order to examine possible associations between metal concentrations and disease outcome. METHODS We obtained formalin fixed paraffin embedded tissue blocks of prostatectomy samples of 40 patients with PSA recurrence, matched 1:1 (for year of surgery, race, age, Gleason grading, and pathology TNM classification) with tissue blocks from 40 patients without recurrence (n = 80). Case-control pairs were compared for the levels of metals in areas adjacent to tumors. Inductively coupled plasma-mass spectrometry (ICP-MS) was used for quantification of Cd, Fe, Zn, and Se. RESULTS Patients with biochemical (PSA) recurrence of disease had 12% lower median iron (95 ??g/g vs. 111 ??g/g; P = 0.04) and 21% lower zinc (279 ??g/g vs. 346 ??g/g; P = 0.04) concentrations in the normal-appearing tissue immediately adjacent to cancer areas. Differences in cadmium (0.489 ??g/g vs. 0.439 ??g/g; 4% higher) and selenium (1.68 ??g/g vs. 1.58 ??g/g; 5% higher) levels were not statistically significant in recurrence cases, when compared to non-recurrences (P = 0.40 and 0.21, respectively). CONCLUSIONS There is an association between low zinc and low iron prostate tissue levels and biochemical recurrence in prostate cancer. Whether these novel findings are a cause or effect of more aggressive tumors, or whether low zinc and iron prostatic levels raise implications for therapy, remains to be investigated. Copyright ?? 2011 Wiley-Liss, Inc.

  16. Candidate Serum Biomarkers for Prostate Adenocarcinoma Identified by mRNA Differences in Prostate Tissue and Verified with Protein Measurements in Tissue and Blood

    PubMed Central

    Klee, Eric W.; Bondar, Olga P.; Goodmanson, Marcia K.; Dyer, Roy B.; Erdogan, Sibel; Bergstralh, Eric J.; Bergen, H. Robert; Sebo, Thomas J.; Klee, George G.

    2014-01-01

    BACKGROUND Improved tests are needed for detection and management of prostate cancer. We hypothesized that differential gene expression in prostate tissue could help identify candidate blood biomarkers for prostate cancer and that blood from men with advanced prostate disease could be used to verify their presence in circulation. METHODS Candidate markers were identified using mRNA expression patterns from laser-capture microdissected prostate tissue. Tissue expression was confirmed using immunohistochemistry (IHC) for the subset of candidates having commercial antisera. Tissue extracts were analyzed with tandem mass spectrometry (MS/MS). Blood concentrations were measured using immunoassays and MS/MS of trypsin-digested, immuno-extracted peptides. RESULTS Thirty-five novel candidate prostate adenocarcinoma biomarkers were selected. Tissue expression was confirmed for all of the 13 markers having commercial antisera for IHC and six of these markers showed statistical discrimination between normal and malignant tissue. Only 5 of these markers were detected in tissue extracts using MS/MS. Sixteen of the 35 candidate markers were successfully assayed in blood. Four of eight biomarkers measured with ELISA and 3 of 10 biomarkers measured by targeted MS showed statistically significant increases in blood concentrations of advanced prostate cancer cases, compared to controls. CONCLUSION Seven novel biomarkers identified by gene expression profiles in prostate tissue were shown to have statistically significant increased levels in blood from men with advanced prostate adenocarcinoma compared to controls: APOC1, ASPN, COMP, CXCL11, CXCL9, F5, and PCSK6. PMID:22247499

  17. Micro and bulk analysis of prostate tissues classified as hyperplasia

    NASA Astrophysics Data System (ADS)

    Kwiatek, W. M.; Banaś, A.; Banaś, K.; Cinque, G.; Dyduch, G.; Falkenberg, G.; Kisiel, A.; Marcelli, A.; Podgórczyk, M.

    2007-07-01

    BPH (Benign Prostatic Hyperplasia) is the most common benign neoplasm (non cancerous enlargement of the prostate gland), whose prevalence increases with age. The gland, when increased in size, exerts pressure on the urethra, causing obstruction to urine flow. The latter may result in severe urinary tract and kidney conditions. In this work prostate samples from patients diagnosed with BPH were analyzed using synchrotron radiation. Micro-analysis of the hyperplastic samples was carried out on the L-beam line at HASYLAB, DESY (Germany), while bulk analysis on selected samples was performed at the DRX2 beamline at LNF, Frascati (Italy). Microanalysis with a mono-energetic beam 15 μm in diameter confirmed that concentrations of certain elements, such as S, Mn, Cu, Fe and Zn, are good indicators of pathological disorders in prostate tissue that may be considered effective tracers of developing compliant. The concentrations of Mn, Cu, Fe and Zn are higher in hyperplastic tissues, as compared to normal ones, while for sulphur the opposite is observed. Additionally, Fe and S K-edge XANES (X-ray Absorption Near Edge Structure) spectroscopy experiments were carried out in order to determine the chemical speciation of these elements in our samples.

  18. Induced pluripotency of human prostatic epithelial cells.

    PubMed

    Zhao, Hongjuan; Sun, Ning; Young, Sarah R; Nolley, Rosalie; Santos, Jennifer; Wu, Joseph C; Peehl, Donna M

    2013-01-01

    Induced pluripotent stem (iPS) cells are a valuable resource for discovery of epigenetic changes critical to cell type-specific differentiation. Although iPS cells have been generated from other terminally differentiated cells, the reprogramming of normal adult human basal prostatic epithelial (E-PZ) cells to a pluripotent state has not been reported. Here, we attempted to reprogram E-PZ cells by forced expression of Oct4, Sox2, c-Myc, and Klf4 using lentiviral vectors and obtained embryonic stem cell (ESC)-like colonies at a frequency of 0.01%. These E-PZ-iPS-like cells with normal karyotype gained expression of pluripotent genes typical of iPS cells (Tra-1-81, SSEA-3, Nanog, Sox2, and Oct4) and lost gene expression characteristic of basal prostatic epithelial cells (CK5, CK14, and p63). E-PZ-iPS-like cells demonstrated pluripotency by differentiating into ectodermal, mesodermal, and endodermal cells in vitro, although lack of teratoma formation in vivo and incomplete demethylation of pluripotency genes suggested only partial reprogramming. Importantly, E-PZ-iPS-like cells re-expressed basal epithelial cell markers (CD44, p63, MAO-A) in response to prostate-specific medium in spheroid culture. Androgen induced expression of androgen receptor (AR), and co-culture with rat urogenital sinus further induced expression of prostate-specific antigen (PSA), a hallmark of secretory cells, suggesting that E-PZ-iPS-like cells have the capacity to differentiate into prostatic basal and secretory epithelial cells. Finally, when injected into mice, E-PZ-iPS-like cells expressed basal epithelial cell markers including CD44 and p63. When co-injected with rat urogenital mesenchyme, E-PZ-iPS-like cells expressed AR and expression of p63 and CD44 was repressed. DNA methylation profiling identified epigenetic changes in key pathways and genes involved in prostatic differentiation as E-PZ-iPS-like cells converted to differentiated AR- and PSA-expressing cells. Our results suggest that

  19. Epigenetic DNA methylation of antioxidative stress regulator NRF2 in human prostate cancer.

    PubMed

    Khor, Tin Oo; Fuentes, Francisco; Shu, Limin; Paredes-Gonzalez, Ximena; Yang, Anne Yuqing; Liu, Yue; Smiraglia, Dominic J; Yegnasubramanian, Srinivasan; Nelson, William G; Kong, Ah-Ng Tony

    2014-12-01

    Epigenetic control of NRF2, a master regulator of many critical antioxidative stress defense genes in human prostate cancer (CaP), is unknown. Our previous animal study found decreased Nrf2 expression through promoter CpG methylation/histone modifications during prostate cancer progression in TRAMP mice. In this study, we evaluated CpG methylation of human NRF2 promoter in 27 clinical prostate cancer samples and in LNCaP cells using MAQMA analysis and bisulfite genomic DNA sequencing. Prostate cancer tissue microarray (TMA) containing normal and prostate cancer tissues was studied by immunohistochemistry. Luciferase reporter assay using specific human NRF2 DNA promoter segments and chromatin immunoprecipitation (ChIP) assay against histone modifying proteins were performed in LNCaP cells. Three specific CpG sites in the NRF2 promoter were found to be hypermethylated in clinical prostate cancer samples (BPHhuman prostate cancer TMA showed a decreasing trend for both intensity and percentage of positive cells from normal tissues to advanced-stage prostate cancer (Gleason score from 3-9). Reporter assays in the LNCaP cells containing these three CpG sites showed methylation-inhibited transcriptional activity of the NRF2 promoter. LNCaP cells treated with 5-aza/TSA restored the expression of NRF2 and NRF2 downstream target genes, decreased expression levels of DNMT and HDAC proteins, and ChIP assays showed increased RNA Pol II and H3Ac with a concomitant decrease in H3K9me3, MBD2, and MeCP2 at CpG sites of human NRF2 promoter. Taken together, these findings suggest that epigenetic modification may contribute to the regulation of transcription activity of NRF2, which could be used as prevention and treatment target of human prostate cancer. PMID:25266896

  20. Maturation of the developing human fetal prostate in a rodent xenograft model

    PubMed Central

    Saffarini, Camelia M.; McDonnell, Elizabeth V.; Amin, Ali; Spade, Daniel J.; Huse, Susan M.; Kostadinov, Stefan; Hall, Susan J.; Boekelheide, Kim

    2015-01-01

    Background Prostate cancer is the most commonly diagnosed non-skin cancer in men. The etiology of prostate cancer is unknown, although both animal and epidemiologic data suggest that early life exposures to various toxicants, may impact DNA methylation status during development, playing an important role. Methods We have developed a xenograft model to characterize the growth and differentiation of human fetal prostate implants (gestational age 12-24 weeks) that can provide new data on the potential role of early life stressors on prostate cancer. The expression of key immunohistochemical markers responsible for prostate maturation was evaluated, including p63, cytokeratin 18, α-smooth muscle actin, vimentin, caldesmon, Ki-67, prostate specific antigen, estrogen receptor-α, and androgen receptor. Xenografts were separated into epithelial and stromal compartments using laser capture microdissection (LCM), and the DNA methylation status was assessed in >480,000 CpG sites throughout the genome. Results Xenografts demonstrated growth and maturation throughout the 200 days of post-implantation evaluation. DNA methylation profiles of laser capture micro-dissected tissue demonstrated tissue-specific markers clustered by their location in either the epithelium or stroma of human prostate tissue. Differential methylated promoter region CpG-associated gene analysis revealed significantly more stromal than epithelial DNA methylation in the 30 and 90-day xenografts. Functional classification analysis identified CpG-related gene clusters in methylated epithelial and stromal human xenografts. Conclusion This study of human fetal prostate tissue establishes a xenograft model that demonstrates dynamic growth and maturation, allowing for future mechanistic studies of the developmental origins of later life proliferative prostate disease. PMID:24038131

  1. Mutated human androgen receptor gene detected in a prostatic cancer patient is also activated by estradiol

    SciTech Connect

    Elo, J.P.; Kvist, L.; Leinonen, K.; Isomaa, V.

    1995-12-01

    Androgens are necessary for the development of prostatic cancer. The mechanisms by which the originally androgen-dependent prostatic cancer cells are relieved of the requirement to use androgen for their growth are largely unknown. The human prostatic cancer cell line LNCaP has been shown to contain a point mutation in the human androgen receptor gene (hAR), suggesting that changes in the hAR may contribute to the abnormal hormone response of prostatic cells. To search for point mutations in the hAR, we used single strand conformation polymorphism analysis and a polymerase chain reaction direct sequencing method to screen 23 prostatic cancer specimens from untreated patients, 6 prostatic cancer specimens from treated patients, and 11 benign prostatic hyperplasia specimens. One mutation was identified in DNA isolated from prostatic cancer tissue, and the mutation was also detected in the leukocyte DNA of the patient and his offspring. The mutation changed codon 726 in exon E from arginine to leucine and was a germ line mutation. The mutation we found in exon E of the hAR gene does not alter the ligand binding specificity of the AR, but the mutated receptor was activated by estradiol to a significantly greater extent than the wild-type receptor. The AR gene mutation described in this study might be one explanation for the altered biological activity of prostatic cancer. 36 refs., 4 figs.

  2. Genome-Wide Methylation Analysis of Prostate Tissues Reveals Global Methylation Patterns of Prostate Cancer

    PubMed Central

    Luo, Jian-Hua; Ding, Ying; Chen, Rui; Michalopoulos, George; Nelson, Joel; Tseng, George; Yu, Yan P.

    2014-01-01

    Altered genome methylation is a hallmark of human malignancies. In this study, high-throughput analyses of concordant gene methylation and expression events were performed for 91 human prostate specimens, including prostate tumor (T), matched normal adjacent to tumor (AT), and organ donor (OD). Methylated DNA in genomic DNA was immunoprecipitated with anti-methylcytidine antibodies and detected by Affymetrix human whole genome SNP 6.0 chips. Among the methylated CpG islands, 11,481 islands were found located in the promoter and exon 1 regions of 9295 genes. Genes (7641) were methylated frequently across OD, AT, and T samples, whereas 239 genes were differentially methylated in only T and 785 genes in both AT and T but not OD. Genes with promoter methylation and concordantly suppressed expression were identified. Pathway analysis suggested that many of the methylated genes in T and AT are involved in cell growth and mitogenesis. Classification analysis of the differentially methylated genes in T or OD produced a specificity of 89.4% and a sensitivity of 85.7%. The T and AT groups, however, were only slightly separated by the prediction analysis, indicating a strong field effect. A gene methylation prediction model was shown to predict prostate cancer relapse with sensitivity of 80.0% and specificity of 85.0%. These results suggest methylation patterns useful in predicting clinical outcomes of prostate cancer. PMID:23583283

  3. Orphan nuclear receptor nurr1 as a potential novel marker for progression in human prostate cancer.

    PubMed

    Wang, Jian; Yang, Jing; Zou, Ying; Huang, Guo-Liang; He, Zhi-Wei

    2013-01-01

    A number of studies have indicated that Nurr1, which belongs to a novel class of orphan nuclear receptors (the NR4A family), is important for carcinogenesis. Here we investigated expression of Nurr1 protein in benign and malignant human prostate tissues and association with clinicopathologic features using immunohistochemical techniques. Moreover, we also investigated the ability of Nurr1 to influence proliferation, migration, invasion and apoptosis of human prostate cancer cells using small interfering RNA silencing. Immunohistochemical analysis revealed that the expression of Nurr1 protein was higher in prostate cancer tissues than in benign prostate tissue (P < 0.001), levels being positively correlated with tumor T classification (P = 0.003), N classification (P = 0.017), M classification (P = 0.011) and the Gleason score (P = 0.020) of prostate cancer patients. In vitro, silencing of endogenous Nurr1 attenuated cell proliferation, migration and invasion, and induced apoptosis of prostate cancer cells. These results suggest that Nurr1 may be used as an indicator for prostate cancer progression and be useful for novel potential therapeutic strategies. PMID:23679312

  4. A Balanced Tissue Composition Reveals New Metabolic and Gene Expression Markers in Prostate Cancer

    PubMed Central

    Tessem, May-Britt; Bertilsson, Helena; Angelsen, Anders; Bathen, Tone F.; Drabløs, Finn; Rye, Morten Beck

    2016-01-01

    Molecular analysis of patient tissue samples is essential to characterize the in vivo variability in human cancers which are not accessible in cell-lines or animal models. This applies particularly to studies of tumor metabolism. The challenge is, however, the complex mixture of various tissue types within each sample, such as benign epithelium, stroma and cancer tissue, which can introduce systematic biases when cancers are compared to normal samples. In this study we apply a simple strategy to remove such biases using sample selections where the average content of stroma tissue is balanced between the sample groups. The strategy is applied to a prostate cancer patient cohort where data from MR spectroscopy and gene expression have been collected from and integrated on the exact same tissue samples. We reveal in vivo changes in cancer-relevant metabolic pathways which are otherwise hidden in the data due to tissue confounding. In particular, lowered levels of putrescine are connected to increased expression of SRM, reduced levels of citrate are attributed to upregulation of genes promoting fatty acid synthesis, and increased succinate levels coincide with reduced expression of SUCLA2 and SDHD. In addition, the strategy also highlights important metabolic differences between the stroma, epithelium and prostate cancer. These results show that important in vivo metabolic features of cancer can be revealed from patient data only if the heterogeneous tissue composition is properly accounted for in the analysis. PMID:27100877

  5. A Balanced Tissue Composition Reveals New Metabolic and Gene Expression Markers in Prostate Cancer.

    PubMed

    Tessem, May-Britt; Bertilsson, Helena; Angelsen, Anders; Bathen, Tone F; Drabløs, Finn; Rye, Morten Beck

    2016-01-01

    Molecular analysis of patient tissue samples is essential to characterize the in vivo variability in human cancers which are not accessible in cell-lines or animal models. This applies particularly to studies of tumor metabolism. The challenge is, however, the complex mixture of various tissue types within each sample, such as benign epithelium, stroma and cancer tissue, which can introduce systematic biases when cancers are compared to normal samples. In this study we apply a simple strategy to remove such biases using sample selections where the average content of stroma tissue is balanced between the sample groups. The strategy is applied to a prostate cancer patient cohort where data from MR spectroscopy and gene expression have been collected from and integrated on the exact same tissue samples. We reveal in vivo changes in cancer-relevant metabolic pathways which are otherwise hidden in the data due to tissue confounding. In particular, lowered levels of putrescine are connected to increased expression of SRM, reduced levels of citrate are attributed to upregulation of genes promoting fatty acid synthesis, and increased succinate levels coincide with reduced expression of SUCLA2 and SDHD. In addition, the strategy also highlights important metabolic differences between the stroma, epithelium and prostate cancer. These results show that important in vivo metabolic features of cancer can be revealed from patient data only if the heterogeneous tissue composition is properly accounted for in the analysis. PMID:27100877

  6. Developmental Exposure to Estrogen Alters Differentiation and Epigenetic Programming in a Human Fetal Prostate Xenograft Model

    PubMed Central

    Saffarini, Camelia M.; McDonnell-Clark, Elizabeth V.; Amin, Ali; Huse, Susan M.; Boekelheide, Kim

    2015-01-01

    Prostate cancer is the most frequent non-cutaneous malignancy in men. There is strong evidence in rodents that neonatal estrogen exposure plays a role in the development of this disease. However, there is little information regarding the effects of estrogen in human fetal prostate tissue. This study explored early life estrogen exposure, with and without a secondary estrogen and testosterone treatment in a human fetal prostate xenograft model. Histopathological lesions, proliferation, and serum hormone levels were evaluated at 7, 30, 90, and 200-day time-points after xenografting. The expression of 40 key genes involved in prostatic glandular and stromal growth, cell-cycle progression, apoptosis, hormone receptors and tumor suppressors was evaluated using a custom PCR array. Epigenome-wide analysis of DNA methylation was performed on whole tissue, and laser capture-microdissection (LCM) isolated epithelial and stromal compartments of 200-day prostate xenografts. Combined initial plus secondary estrogenic exposures had the most severe tissue changes as revealed by the presence of hyperplastic glands at day 200. Gene expression changes corresponded with the cellular events in the KEGG prostate cancer pathway, indicating that initial plus secondary exposure to estrogen altered the PI3K-Akt signaling pathway, ultimately resulting in apoptosis inhibition and an increase in cell cycle progression. DNA methylation revealed that differentially methylated CpG sites significantly predominate in the stromal compartment as a result of estrogen-treatment, thereby providing new targets for future investigation. By using human fetal prostate tissue and eliminating the need for species extrapolation, this study provides novel insights into the gene expression and epigenetic effects related to prostate carcinogenesis following early life estrogen exposure. PMID:25799167

  7. Detecting positive surgical margins of prostate tissues using elastic light single-scattering spectroscopy

    NASA Astrophysics Data System (ADS)

    Canpolat, Murat; Denkçeken, Tuba; Başsorgun, Ibrahim; Yücel, Selçuk; Çiftçioğlu, M. A.; Baykara, Mehment

    2011-09-01

    Elastic light single-scattering spectroscopy (ELSSS) system with a single optical fiber probe was employed to differentiate cancerous prostate tissue from non-cancerous prostate tissue ex-vivo just after radical prostatectomy. First, ELSSS spectra were acquired from cancerous prostate tissue to define its spectral features. Then, spectra were acquired from surgical margins of excised prostate tissue to detect positive surgical margins based on the spectral features of the spectra taken from cancerous prostate tissues. Of the total 128 tissue samples were evaluated from 18 patients by ELSSS system. Comparing of histopathology results and ELSSS measurements revealed that sign of the spectral slopes of cancerous prostate tissue is negative and non-cancerous tissue is positive in the wavelength range from 450 to 750 nm. Sign of the spectral slopes were used as a discrimination parameter between cancerous and non-cancerous prostate tissues. Based on the correlation between histopathology results and sign of the spectral slopes, ELSSS system differentiates cancerous prostate tissue from non-cancerous with a sensitivity of 0.97 and a specificity of 0.87.

  8. Detecting positive surgical margins of prostate tissues using elastic light single-scattering spectroscopy

    NASA Astrophysics Data System (ADS)

    Canpolat, Murat; Denkçeken, Tuba; Başsorgun, İbrahim; Yücel, Selçuk; Çiftçioğlu, M. A.; Baykara, Mehment

    2012-02-01

    Elastic light single-scattering spectroscopy (ELSSS) system with a single optical fiber probe was employed to differentiate cancerous prostate tissue from non-cancerous prostate tissue ex-vivo just after radical prostatectomy. First, ELSSS spectra were acquired from cancerous prostate tissue to define its spectral features. Then, spectra were acquired from surgical margins of excised prostate tissue to detect positive surgical margins based on the spectral features of the spectra taken from cancerous prostate tissues. Of the total 128 tissue samples were evaluated from 18 patients by ELSSS system. Comparing of histopathology results and ELSSS measurements revealed that sign of the spectral slopes of cancerous prostate tissue is negative and non-cancerous tissue is positive in the wavelength range from 450 to 750 nm. Sign of the spectral slopes were used as a discrimination parameter between cancerous and non-cancerous prostate tissues. Based on the correlation between histopathology results and sign of the spectral slopes, ELSSS system differentiates cancerous prostate tissue from non-cancerous with a sensitivity of 0.97 and a specificity of 0.87.

  9. Early Growth Response1and Fatty Acid Synthase Expression is Altered in Tumor Adjacent Prostate Tissue and Indicates Field Cancerization

    PubMed Central

    Jones, Anna C.; Trujillo, Kristina A.; Phillips, Genevieve K.; Fleet, Trisha M.; Murton, Jaclyn K.; Severns, Virginia; Shah, Satyan K.; Davis, Michael S.; Smith, Anthony Y.; Griffith, Jeffrey K.; Fischer, Edgar G.; Bisoffi, Marco

    2011-01-01

    BACKGROUND Field cancerization denotes the occurrence of molecular alterations in histologically normal tissues adjacent to tumors. In prostate cancer, identification of field cancerization has several potential clinical applications. However, prostate field cancerization remains ill defined. Our previous work has shown up-regulated mRNA of the transcription factor early growth response 1 (EGR-1) and the lipogenic enzyme fatty acid synthase (FAS) in tissues adjacent to prostate cancer. METHODS Immunofluorescence data were analyzed quantitatively by spectral imaging and linear unmixing to determine the protein expression levels of EGR-1 and FAS in human cancerous, histologically normal adjacent, and disease-free prostate tissues. RESULTS EGR-1 expression was elevated in both structurally intact tumor adjacent (1.6× on average) and in tumor (3.0× on average) tissues compared to disease-free tissues. In addition, the ratio of cytoplasmic versus nuclear EGR-1 expression was elevated in both tumor adjacent and tumor tissues. Similarly, FAS expression was elevated in both tumor adjacent (2.7× on average) and in tumor (2.5× on average) compared to disease-free tissues. CONCLUSIONS EGR-1 and FAS expression is similarly deregulated in tumor and structurally intact adjacent prostate tissues and defines field cancerization. In cases with high suspicion of prostate cancer but negative biopsy, identification of field cancerization could help clinicians target areas for repeat biopsy. Field cancerization at surgical margins on prostatectomy specimen should also be looked at as a predictor of cancer recurrence. EGR-1 and FAS could also serve as molecular targets for chemoprevention. PMID:22127986

  10. Frequency analysis of multispectral photoacoustic images for differentiating malignant region from normal region in excised human prostate

    NASA Astrophysics Data System (ADS)

    Sinha, Saugata; Rao, Navalgund A.; Valluru, Keerthi S.; Chinni, Bhargava K.; Dogra, Vikram S.; Helguera, Maria

    2014-03-01

    Frequency domain analysis of the photoacoustic (PA) radio frequency signals can potentially be used as a tool for characterizing microstructure of absorbers in tissue. This study investigates the feasibility of analyzing the spectrum of multiwavelength PA signals generated by excised human prostate tissue samples to differentiate between malignant and normal prostate regions. Photoacoustic imaging at five different wavelengths, corresponding to peak absorption coefficients of deoxyhemoglobin, whole blood, oxyhemoglobin, water and lipid in the near infrared (NIR) (700 nm - 1000 nm) region, was performed on freshly excised prostate specimens taken from patients undergoing prostatectomy for biopsy confirmed prostate cancer. The PA images were co-registered with the histopathology images of the prostate specimens to determine the region of interest (ROI) corresponding to malignant and normal tissue. The calibrated power spectrum of each PA signal from a selected ROI was fit to a linear model to extract the corresponding slope, midband fit and intercept parameters. The mean value of each parameter corresponding to malignant and adjacent normal prostate ROI was calculated for each of the five wavelengths. The results obtained for 9 different human prostate specimens, show that the mean values of midband fit and intercept are significantly different between malignant and normal regions. In addition, the average midband fit and intercept values show a decreasing trend with increasing wavelength. These preliminary results suggest that frequency analysis of multispectral PA signals can be used to differentiate malignant region from the adjacent normal region in human prostate tissue.

  11. Expression of leukemia/lymphoma related factor (LRF/Pokemon) in human benign prostate hyperplasia and prostate cancer.

    PubMed

    Aggarwal, Himanshu; Aggarwal, Anshu; Hunter, William J; Yohannes, Paulos; Khan, Ansar U; Agrawal, Devendra K

    2011-04-01

    Leukemia/lymphoma related factor (LRF), also known as Pokemon, is a protein that belongs to the POK family of transcriptional repressors. It has an oncogenic role in many different solid tumors. In this study, the expression of LRF was evaluated in benign prostate hyperplastic (BPH) and prostate cancer (PC) tissues. The functional expression of LRF was studied using multiple cellular and molecular methods including RT-PCR, western blotting, immunohistochemistry, and immunofluorescence. Paraffin-embedded human tissues of BPH and PC were used to examine LRF expression. Histological staining of the BPH and PC tissue sections revealed nuclear expression of LRF with minimal expression in the surrounding stroma. The semi-quantitative RT-PCR and western immunoblot analyses demonstrated significantly higher mRNA transcripts and protein expression in PC than BPH. High expression of LRF suggests that it may have a potential role in the pathogenesis of both BPH and prostate cancer. Further studies will help elucidate the mechanisms and signaling pathways that LRF may follow in the pathogenesis of prostate carcinoma. PMID:21251909

  12. AKT1 and MYC Induce Distinctive Metabolic Fingerprints in Human Prostate Cancer

    PubMed Central

    Priolo, Carmen; Pyne, Saumyadipta; Rose, Joshua; Regan, Erzsébet Ravasz; Zadra, Giorgia; Photopoulos, Cornelia; Cacciatore, Stefano; Schultz, Denise; Scaglia, Natalia; McDunn, Jonathan; De Marzo, Angelo M.; Loda, Massimo

    2014-01-01

    Cancer cells may overcome growth factor dependence by deregulating oncogenic and/or tumor suppressor pathways that affect their metabolism, or by activating metabolic pathways de novo with targeted mutations in critical metabolic enzymes. It is unknown whether human prostate tumors develop a similar metabolic response to different oncogenic drivers or a particular oncogenic event results in its own metabolic reprogramming. Akt and Myc are arguably the most prevalent driving oncogenes in prostate cancer. Mass spectrometry-based metabolite profiling was performed on immortalized human prostate epithelial cells transformed by AKT1 or MYC, transgenic mice driven by the same oncogenes under the control of a prostate-specific promoter, and human prostate specimens characterized for the expression and activation of these oncoproteins. Integrative analysis of these metabolomic datasets revealed that AKT1 activation was associated with accumulation of aerobic glycolysis metabolites, whereas MYC overexpression was associated with dysregulated lipid metabolism. Selected metabolites that differentially accumulated in the MYC-high vs. AKT1-high tumors, or in normal vs. tumor prostate tissue by untargeted metabolomics, were validated using absolute quantitation assays. Importantly, the AKT1/MYC status was independent of Gleason grade and pathologic staging. Our findings show how prostate tumors undergo a metabolic reprogramming which reflects their molecular phenotypes, with implications for the development of metabolic diagnostics and targeted therapeutics. PMID:25322691

  13. Optical characteristics of prostate tissues and the key chromophores and fluorophores within tissues related to carcinogenesis

    NASA Astrophysics Data System (ADS)

    Zhou, Kenneth J.; Chen, Jun

    2015-03-01

    Tissues are an impressive complex creation comprised of a vast of assortment of molecules, structures and functional units. Despite this overwhelming complexity, we may still discuss average optical properties as long as we realize the limitations involved. There are five independent macroscopic parameters that are believed to characterize light propagation in tissue: the index of refraction (n), the absorption coefficient (μa), the scattering coefficient (μs), the reduced scattering coefficient (μ's), and the scattering anisotropy (g). This paper summarizes the Optical characteristics of tissue of prostate tissues ex vivo and the key fluorophores related to carcinogenesis. The absorption coefficient (μa) describes the effectiveness of light absorbed by certain chromophore. The key spectra fingerprints of water were introduced to distinguish different water contents in normal and cancerous prostate tissues. Fluorescence occurs when a molecule, atom or nanostructure relaxes to its ground state after being electrically excited. There are three fluorescence parameters of interest we may concern in tissue optics: the fluorescence lifetime (τf), the fluorescence quantum yield (Φ) and the fluorescence emission peak (λmax). The key wavelengths which can be used for cancer detection were reviewed. Scattering of light occurs in media which contains fluctuations in the refractive index n. Tissue ultrastructure extends from membranes to membrane aggregates to collagen fibers to nuclei to cells, which may be an alternative way to detect cancer in tissues.

  14. Analysis of the Human Prostate-Specific Proteome Defined by Transcriptomics and Antibody-Based Profiling Identifies TMEM79 and ACOXL as Two Putative, Diagnostic Markers in Prostate Cancer

    PubMed Central

    O'Hurley, Gillian; Busch, Christer; Fagerberg, Linn; Hallström, Björn M.; Stadler, Charlotte; Tolf, Anna; Lundberg, Emma; Schwenk, Jochen M.; Jirström, Karin; Bjartell, Anders; Gallagher, William M.; Uhlén, Mathias; Pontén, Fredrik

    2015-01-01

    To better understand prostate function and disease, it is important to define and explore the molecular constituents that signify the prostate gland. The aim of this study was to define the prostate specific transcriptome and proteome, in comparison to 26 other human tissues. Deep sequencing of mRNA (RNA-seq) and immunohistochemistry-based protein profiling were combined to identify prostate specific gene expression patterns and to explore tissue biomarkers for potential clinical use in prostate cancer diagnostics. We identified 203 genes with elevated expression in the prostate, 22 of which showed more than five-fold higher expression levels compared to all other tissue types. In addition to previously well-known proteins we identified two poorly characterized proteins, TMEM79 and ACOXL, with potential to differentiate between benign and cancerous prostatic glands in tissue biopsies. In conclusion, we have applied a genome-wide analysis to identify the prostate specific proteome using transcriptomics and antibody-based protein profiling to identify genes with elevated expression in the prostate. Our data provides a starting point for further functional studies to explore the molecular repertoire of normal and diseased prostate including potential prostate cancer markers such as TMEM79 and ACOXL. PMID:26237329

  15. Feature-based analysis of mouse prostatic intraepithelial neoplasia in histological tissue sections

    PubMed Central

    Ruusuvuori, Pekka; Valkonen, Mira; Nykter, Matti; Visakorpi, Tapio; Latonen, Leena

    2016-01-01

    This paper describes work presented at the Nordic Symposium on Digital Pathology 2015, in Linköping, Sweden. Prostatic intraepithelial neoplasia (PIN) represents premalignant tissue involving epithelial growth confined in the lumen of prostatic acini. In the attempts to understand oncogenesis in the human prostate, early neoplastic changes can be modeled in the mouse with genetic manipulation of certain tumor suppressor genes or oncogenes. As with many early pathological changes, the PIN lesions in the mouse prostate are macroscopically small, but microscopically spanning areas often larger than single high magnification focus fields in microscopy. This poses a challenge to utilize full potential of the data acquired in histological specimens. We use whole prostates fixed in molecular fixative PAXgene™, embedded in paraffin, sectioned through and stained with H&E. To visualize and analyze the microscopic information spanning whole mouse PIN (mPIN) lesions, we utilize automated whole slide scanning and stacked sections through the tissue. The region of interests is masked, and the masked areas are processed using a cascade of automated image analysis steps. The images are normalized in color space, after which exclusion of secretion areas and feature extraction is performed. Machine learning is utilized to build a model of early PIN lesions for determining the probability for histological changes based on the calculated features. We performed a feature-based analysis to mPIN lesions. First, a quantitative representation of over 100 features was built, including several features representing pathological changes in PIN, especially describing the spatial growth pattern of lesions in the prostate tissue. Furthermore, we built a classification model, which is able to align PIN lesions corresponding to grading by visual inspection to more advanced and mild lesions. The classifier allowed both determining the probability of early histological changes for uncategorized

  16. Feature-based analysis of mouse prostatic intraepithelial neoplasia in histological tissue sections.

    PubMed

    Ruusuvuori, Pekka; Valkonen, Mira; Nykter, Matti; Visakorpi, Tapio; Latonen, Leena

    2016-01-01

    This paper describes work presented at the Nordic Symposium on Digital Pathology 2015, in Linköping, Sweden. Prostatic intraepithelial neoplasia (PIN) represents premalignant tissue involving epithelial growth confined in the lumen of prostatic acini. In the attempts to understand oncogenesis in the human prostate, early neoplastic changes can be modeled in the mouse with genetic manipulation of certain tumor suppressor genes or oncogenes. As with many early pathological changes, the PIN lesions in the mouse prostate are macroscopically small, but microscopically spanning areas often larger than single high magnification focus fields in microscopy. This poses a challenge to utilize full potential of the data acquired in histological specimens. We use whole prostates fixed in molecular fixative PAXgene™, embedded in paraffin, sectioned through and stained with H&E. To visualize and analyze the microscopic information spanning whole mouse PIN (mPIN) lesions, we utilize automated whole slide scanning and stacked sections through the tissue. The region of interests is masked, and the masked areas are processed using a cascade of automated image analysis steps. The images are normalized in color space, after which exclusion of secretion areas and feature extraction is performed. Machine learning is utilized to build a model of early PIN lesions for determining the probability for histological changes based on the calculated features. We performed a feature-based analysis to mPIN lesions. First, a quantitative representation of over 100 features was built, including several features representing pathological changes in PIN, especially describing the spatial growth pattern of lesions in the prostate tissue. Furthermore, we built a classification model, which is able to align PIN lesions corresponding to grading by visual inspection to more advanced and mild lesions. The classifier allowed both determining the probability of early histological changes for uncategorized

  17. Epidermal growth factor increases LRF/Pokemon expression in human prostate cancer cells.

    PubMed

    Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K

    2011-10-01

    Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. PMID:21640721

  18. Zinc in Specialized Secretory Tissues: Roles in the Pancreas, Prostate, and Mammary Gland12

    PubMed Central

    Kelleher, Shannon L.; McCormick, Nicholas H.; Velasquez, Vanessa; Lopez, Veronica

    2011-01-01

    Zinc (Zn) is an essential micronutrient required for over 300 different cellular processes, including DNA and protein synthesis, enzyme activity, and intracellular signaling. Cellular Zn homeostasis necessitates the compartmentalization of Zn into intracellular organelles, which is tightly regulated through the integration of Zn transporting mechanisms. The pancreas, prostate, and mammary gland are secretory tissues that have unusual Zn requirements and thus must tightly regulate Zn metabolism through integrating Zn import, sequestration, and export mechanisms. Recent findings indicate that these tissues utilize Zn for basic cellular processes but also require Zn for unique cellular needs. In addition, abundant Zn is transported into the secretory pathway and a large amount is subsequently secreted in a tightly regulated manner for unique biological processes. Expression of numerous members of the SLC30A (ZnT) and SLC39A (Zip) gene families has been documented in these tissues, yet there is limited understanding of their precise functional role in Zn metabolism or their regulation. Impairments in Zn secretion from the pancreas, prostate, and mammary gland are associated with disorders such as diabetes, infertility, and cancer, respectively. In this review, we will provide a brief summary of the specific role of Zn in each tissue and describe our current knowledge regarding how Zn metabolism is regulated. Finally, in each instance, we will reflect upon how this information shapes our current understanding of the role of Zn in these secretory tissues with respect to human health and disease. PMID:22332039

  19. Hormonal modulation of invitro biosynthesis of inhibin like peptide by human prostate.

    PubMed

    Vanage, G R; Phadke, M A; Bandivdekar, A H; Sheth, A R

    1990-01-01

    The hormonal regulation of inhibin biosynthesis by human benign hyperplastic prostate tissue was studied by determining the incorporation of 3H-leucine. 3H-inhibin, synthesized de novo, was immunoprecipitated from the culture media using specific antibodies to human prostatic inhibin. Testosterone and estradiol had no effect on inhibin biosynthesis whereas hFSH and PMSG had stimulatory effect. A decrease in inhibin biosynthesis was noticed on the addition of LHRH, TRH, hCG, hLH and human prolactin. PMID:2126421

  20. Methylation Profiling Defines an Extensive Field Defect in Histologically Normal Prostate Tissues Associated with Prostate Cancer12

    PubMed Central

    Yang, Bing; Bhusari, Sachin; Kueck, Jessica; Weeratunga, Pushpa; Wagner, Jennifer; Leverson, Glen; Huang, Wei; Jarrard, David F

    2013-01-01

    Prostate cancer (PCa) is typically found as a multifocal disease suggesting the potential for molecular defects within the morphologically normal tissue. The frequency and spatial extent of DNA methylation changes encompassing a potential field defect are unknown. A comparison of non-tumor-associated (NTA) prostate to histologically indistinguishable tumor-associated (TA) prostate tissues detected a distinct profile of DNA methylation alterations (0.2%) using genome-wide DNA arrays based on the Encyclopedia of DNA Elements 18 sequence that tile both gene-rich and poor regions. Hypomethylation (87%) occurred more frequently than hypermethylation (13%). Several of the most significantly altered loci (CAV1, EVX1, MCF2L, and FGF1) were then used as probes to map the extent of these DNA methylation changes in normal tissues from prostates containing cancer. In TA tissues, the extent of methylation was similar both adjacent (2 mm) and at a distance (>1 cm) from tumor foci. These loci were also able to distinguish NTA from TA tissues in a validation set of patient samples. These mapping studies indicate that a spatially widespread epigenetic defect occurs in the peripheral prostate tissues of men who have PCa that may be useful in the detection of this disease. PMID:23555185

  1. An informatics model for tissue banks – Lessons learned from the Cooperative Prostate Cancer Tissue Resource

    PubMed Central

    Patel, Ashokkumar A; Gilbertson, John R; Parwani, Anil V; Dhir, Rajiv; Datta, Milton W; Gupta, Rajnish; Berman, Jules J; Melamed, Jonathan; Kajdacsy-Balla, Andre; Orenstein, Jan; Becich, Michael J

    2006-01-01

    Background Advances in molecular biology and growing requirements from biomarker validation studies have generated a need for tissue banks to provide quality-controlled tissue samples with standardized clinical annotation. The NCI Cooperative Prostate Cancer Tissue Resource (CPCTR) is a distributed tissue bank that comprises four academic centers and provides thousands of clinically annotated prostate cancer specimens to researchers. Here we describe the CPCTR information management system architecture, common data element (CDE) development, query interfaces, data curation, and quality control. Methods Data managers review the medical records to collect and continuously update information for the 145 clinical, pathological and inventorial CDEs that the Resource maintains for each case. An Access-based data entry tool provides de-identification and a standard communication mechanism between each group and a central CPCTR database. Standardized automated quality control audits have been implemented. Centrally, an Oracle database has web interfaces allowing multiple user-types, including the general public, to mine de-identified information from all of the sites with three levels of specificity and granularity as well as to request tissues through a formal letter of intent. Results Since July 2003, CPCTR has offered over 6,000 cases (38,000 blocks) of highly characterized prostate cancer biospecimens, including several tissue microarrays (TMA). The Resource developed a website with interfaces for the general public as well as researchers and internal members. These user groups have utilized the web-tools for public query of summary data on the cases that were available, to prepare requests, and to receive tissues. As of December 2005, the Resource received over 130 tissue requests, of which 45 have been reviewed, approved and filled. Additionally, the Resource implemented the TMA Data Exchange Specification in its TMA program and created a computer program for

  2. N-Myc Drives Neuroendocrine Prostate Cancer Initiated from Human Prostate Epithelial Cells.

    PubMed

    Lee, John K; Phillips, John W; Smith, Bryan A; Park, Jung Wook; Stoyanova, Tanya; McCaffrey, Erin F; Baertsch, Robert; Sokolov, Artem; Meyerowitz, Justin G; Mathis, Colleen; Cheng, Donghui; Stuart, Joshua M; Shokat, Kevan M; Gustafson, W Clay; Huang, Jiaoti; Witte, Owen N

    2016-04-11

    MYCN amplification and overexpression are common in neuroendocrine prostate cancer (NEPC). However, the impact of aberrant N-Myc expression in prostate tumorigenesis and the cellular origin of NEPC have not been established. We define N-Myc and activated AKT1 as oncogenic components sufficient to transform human prostate epithelial cells to prostate adenocarcinoma and NEPC with phenotypic and molecular features of aggressive, late-stage human disease. We directly show that prostate adenocarcinoma and NEPC can arise from a common epithelial clone. Further, N-Myc is required for tumor maintenance, and destabilization of N-Myc through Aurora A kinase inhibition reduces tumor burden. Our findings establish N-Myc as a driver of NEPC and a target for therapeutic intervention. PMID:27050099

  3. Inhibition of smooth muscle force generation by focal adhesion kinase inhibitors in the hyperplastic human prostate.

    PubMed

    Kunit, Thomas; Gratzke, Christian; Schreiber, Andrea; Strittmatter, Frank; Waidelich, Raphaela; Rutz, Beata; Loidl, Wolfgang; Andersson, Karl-Erik; Stief, Christian G; Hennenberg, Martin

    2014-10-01

    Smooth muscle contraction may be critical for lower urinary tract symptoms (LUTS) in patients with benign prostate hyperplasia and requires stable anchorage of the cytoskeleton to the cell membrane. These connections are regulated by focal adhesion kinase (FAK). Here, we addressed the involvement of FAK in the regulation of smooth muscle contraction in hyperplastic human prostate tissues. Prostate tissues were obtained from radical prostatectomy. Expression of FAK and focal adhesion proteins was assessed by Western blot analysis and immunohistochemical stainings. Effects of the FAK inhibitors PF-573228 and Y-11 on contraction of prostate strips were examined in the organ bath. Expression of FAK and focal adhesion proteins (integrin-5α, paxilin, and c-Src) was detected by Western blot analysis in prostate samples. By double immunofluorescence staining with calponin and pan-cytokeratin, expression of FAK was observed in stromal and epithelial cells. Immunoreactivity for FAK colocalized with integrin-5α, paxilin, talin, and c-Src. Stimulation of prostate tissues with the α1-adrenergic agonist phenylephrine increased the phosphorylation state of FAK at Tyr³⁹⁷ and Tyr⁹²⁵ with different kinetics, which was blocked by the α1-adrenoceptor antagonist tamsulosin. Norepinephrine and phenylephrine induced concentration-dependent contractions of prostate strips. Both FAK inhibitors PF-573228 and Y-11 significantly inhibited norepinephrine- and phenylephrine-induced contractions. Finally, PF-573228 and Y-11 inhibited contractions induced by electric field stimulation, which was significant at the highest frequency. In conclusion, α1-adrenergic smooth muscle contraction or its regulation involves FAK in the human prostate. Consequently, FAK may be involved in the pathophysiology of LUTS and in current or future LUTS therapies. PMID:25056351

  4. Human Tissue Stimulator

    NASA Technical Reports Server (NTRS)

    1982-01-01

    Neurodyne Corporation Human Tissue Stimulator (HTS) is a totally implantable system used for treatment of chronic pain and involuntary motion disorders by electrical stimulation. It was developed by Pacesetter Systems, Inc. in cooperation with the Applied Physics Laboratory. HTS incorporates a nickel cadmium battery, telemetry and command systems technologies of the same type as those used in NASA's Small Astronomy Satellite-3 in microminiature proportions so that the implantable element is the size of a deck of cards. The stimulator includes a rechargeable battery, an antenna and electronics to receive and process commands and to report on its own condition via telemetry, a wireless process wherein instrument data is converted to electrical signals and sent to a receiver where signals are presented as usable information. The HTS is targeted to nerve centers or to particular areas of the brain to provide relief from intractable pain or arrest involuntary motion. The nickel cadmium battery can be recharged through the skin. The first two HTS units were implanted last year and have been successful. Extensive testing is required before HTS can be made available for general use.

  5. Impact of interseed attenuation and tissue composition for permanent prostate implants

    SciTech Connect

    Carrier, Jean-Francois; Beaulieu, Luc; Therriault-Proulx, Francois; Roy, Rene

    2006-03-15

    The purpose is to evaluate the impact of interseed attenuation and prostate composition for prostate treatment plans with {sup 125}I permanent seed implants using the Monte Carlo (MC) method. The effect of seed density (number of seeds per prostate unit volume) is specifically investigated. The study focuses on treatment plans that were generated for clinical cases. For each plan, four different dose calculation techniques are compared: TG-43 based calculation, superposition MC, full MC with water prostate, and full MC with realistic prostate tissue. The prostate tissue description is from the ICRP report 23 (W. S. Snyer, M. J. Cook, E. S. Nasset, L. R. Karkhausen, G. P. Howells, and I. H. Tipton, ''Report of the task group on reference man,'' Technical Report 23, International Commission on Radiological Protection, 1974). According to the comparisons, the seed density has an influence on interseed attenuation. A plan with a typical low seed density (42 0.6 mCi seeds in a 26 cm{sup 3} prostate) suffers a 1.2% drop in the CTV D{sub 90} value due to interseed attenuation. A drop of 3.0% is calculated for a higher seed density (75 0.3 mCi seeds, same prostate). The influence of the prostate composition is similar for all seed densities and prostate sizes. The difference between MC simulations in water and MC simulations in prostate tissue is between 4.4% and 4.8% for the D{sub 90} parameter. Overall, the effect on D{sub 90} is ranging from 5.8% to 12.8% when comparing clinically approved TG-43 and MC simulations in prostate tissue. The impact varies from one patient to the other and depends on the prostate size and the number of seeds. This effect can reach a significant level when reporting correlations between clinical effect and deposited dose.

  6. Human Prostate Side Population Cells Demonstrate Stem Cell Properties in Recombination with Urogenital Sinus Mesenchyme

    PubMed Central

    Foster, Barbara A.; Gangavarapu, Kalyan J.; Mathew, Grinu; Azabdaftari, Gissou; Morrison, Carl D.; Miller, Austin; Huss, Wendy J.

    2013-01-01

    Stem cell enrichment provides a tool to examine prostate stem cells obtained from benign and malignant tissue. Functional assays can enrich stem cells based on common stem cell phenotypes, such as high ATP binding cassette (ABC) transporter mediated efflux of Hoechst substrates (side population assay). This functional assay is based upon mechanisms that protect cells from environmental insult thus contributing to the survival and protection of the stem cell population. We have isolated and analyzed cells digested from twelve clinical prostate specimens based on the side population assay. Prostate stem cell properties of the isolated cells were tested by serial recombination with rat urogenital mesenchyme. Recombinants with side population cells demonstrate an increase in the frequency of human ductal growth and the number of glands per recombinant when compared to recombinants with non-side population cells. Isolated cells were capable of prostatic growth for up to three generations in the recombination assay with as little as 125 sorted prostate cells. The ability to reproducibly use cells isolated by fluorescence activated cell sorting from human prostate tissue is an essential step to a better understanding of human prostate stem cell biology. ABC transporter G2 (ABCG2) was expressed in recombinants from side population cells indicating the side population cells have self-renewal properties. Epithelial cell differentiation of recombinants was determined by immunohistochemical analysis for expression of the basal, luminal, and neuroendocrine markers, p63, androgen receptor, prostate specific antigen, and chromogranin A, respectively. Thus, the ABCG2 expressing side population demonstrates multipotency and self-renewal properties indicating stem cells are within this population. PMID:23383057

  7. Human prostate side population cells demonstrate stem cell properties in recombination with urogenital sinus mesenchyme.

    PubMed

    Foster, Barbara A; Gangavarapu, Kalyan J; Mathew, Grinu; Azabdaftari, Gissou; Morrison, Carl D; Miller, Austin; Huss, Wendy J

    2013-01-01

    Stem cell enrichment provides a tool to examine prostate stem cells obtained from benign and malignant tissue. Functional assays can enrich stem cells based on common stem cell phenotypes, such as high ATP binding cassette (ABC) transporter mediated efflux of Hoechst substrates (side population assay). This functional assay is based upon mechanisms that protect cells from environmental insult thus contributing to the survival and protection of the stem cell population. We have isolated and analyzed cells digested from twelve clinical prostate specimens based on the side population assay. Prostate stem cell properties of the isolated cells were tested by serial recombination with rat urogenital mesenchyme. Recombinants with side population cells demonstrate an increase in the frequency of human ductal growth and the number of glands per recombinant when compared to recombinants with non-side population cells. Isolated cells were capable of prostatic growth for up to three generations in the recombination assay with as little as 125 sorted prostate cells. The ability to reproducibly use cells isolated by fluorescence activated cell sorting from human prostate tissue is an essential step to a better understanding of human prostate stem cell biology. ABC transporter G2 (ABCG2) was expressed in recombinants from side population cells indicating the side population cells have self-renewal properties. Epithelial cell differentiation of recombinants was determined by immunohistochemical analysis for expression of the basal, luminal, and neuroendocrine markers, p63, androgen receptor, prostate specific antigen, and chromogranin A, respectively. Thus, the ABCG2 expressing side population demonstrates multipotency and self-renewal properties indicating stem cells are within this population. PMID:23383057

  8. Organ-wide Telomeric Status in Diseased and Disease-free Prostatic Tissues

    PubMed Central

    Heaphy, Christopher M.; Fleet, Trisha M.; Treat, Eric G.; Lee, Sang-Joon; Smith, Anthony Y.; Davis, Michael S.; Griffith, Jeffrey K.; Fischer, Edgar G.; Bisoffi, Marco

    2012-01-01

    BACKGROUND Telomere attrition occurs early in the development of prostatic adenocarcinoma. However, little is known about either telomere status in benign prostatic hyperplasia (BPH), or the spatial and organ-wide distribution of potential telomere aberrations throughout all areas of prostatic glands affected by cancer or BPH. METHODS Slot blot titration assay was used to determine telomere DNA content (TC), a proxy for telomere length, in macrodissected tissue consisting of 54 normal samples from 5 disease-free prostates, 128 BPH samples from 4 non-cancerous prostates, and 45 tumor, 73 BPH, and 4 prostatic intraepithelial neoplasia (PIN) samples from 5 cancerous prostates. RESULTS Compared to TC in normal prostate samples (n=54; TC mean=0.98), tumor samples displayed telomere attrition (n=45; TC mean=0.67). TC in PIN samples was similar to tumors. BPH samples from cancerous prostates were similar to TC in tumors and also displayed telomere shortening (n=73; TC mean=0.76), whereas BPH samples from non-cancerous prostates displayed longer telomeres (n=128; TC mean=1.06). In prostates affected by adenocarcinoma, areas of potential telomere attrition occurred in histologically normal tissues through the entire gland. However, three-dimensional zoning revealed a pattern of increasing TC as a function of distance from the primary (index) tumor. CONCLUSIONS Spatial distributions of TC in prostate specimens indicate a complex “field effect” with varying contributions from both cancer and BPH. The observation that telomere length variations occur in fields of histologically normal tissues surrounding the tumor is of clinical importance, as it may have implications for the diagnosis and focal therapy of prostate cancer. PMID:20687220

  9. Bauhinia purprea agglutinin-modified liposomes for human prostate cancer treatment.

    PubMed

    Ikemoto, Keisuke; Shimizu, Kosuke; Ohashi, Kento; Takeuchi, Yoshihito; Shimizu, Motohiro; Oku, Naoto

    2016-01-01

    Bauhinia purprea agglutinin (BPA) is a well-known lectin that recognizes galactosyl glycoproteins and glycolipids. In the present study, we firstly found that BPA bound to human prostate cancer specimens but not to normal prostate ones. Therefore, we sought to develop BPA-PEG-modified liposomes (BPA-PEG-LP) encapsulating anticancer drugs for the treatment of prostate cancer. We examined the tumor targetability of BPA-PEG-LP with human prostate cancer DU145 cells, and observed that fluorescently labeled BPA-PEG-LP dominantly associated with the cells via the interaction between liposome-surface BPA and cell-surface galactosyl molecules. We also observed that BPA-PEG-LP accumulated in the prostate cancer tissue after the i.v. injection to DU145 solid cancer-bearing mice, and strongly bound to the cancer cells. In a therapeutic study, DU145 solid cancer-bearing mice were i.v. injected thrice with BPA-PEG-LP encapsulating doxorubicin (BPA-PEG-LPDOX, 2 mg/kg/day as the DOX dosage) or PEG-modified liposomes encapsulating DOX (PEG-LPDOX). As a result, BPA-PEG-LPDOX significantly suppressed the growth of the DU145 cancer cells, whereas PEG-LPDOX at the same dosage as DOX showed little anti-cancer effect. The present study suggested that BPA-PEG-LP could be a useful drug carrier for the treatment of human prostate cancers. PMID:26495901

  10. Fluorescence spectra of benign and malignant prostate tissues

    NASA Astrophysics Data System (ADS)

    AlSalhi, M. S.; Masilamani, V.; Atif, M.; Farhat, K.; Rabah, D.; Turki, M. R. Al

    2012-09-01

    In this study, fluorescence emission spectrum (FES), Stokes' shift spectrum (SSS), and reflectance spectrum (RS) of benign (N = 12) and malignant prostate tissues (N = 8) were investigated to discriminate the two types of tissues. The FES was done with the excitation at 325 nm only; SSS with Δλ = 70 and Δλ = 0, the latter being equivalent to reflectance spectra. Of the three modes of spectra, SSS with Δλ = 70 nm showed the best discrimination. There were four important bands, one at 280 nm (due to tryptophan); 320 nm (due to elastin & tryptophan); 355 and 385 (due to NADH) and 440 nm (due to flavin). From the relative intensities of these bands, three ratios were evaluated. Similarly another two ratios were obtained from reflectance spectra and one more from FES. Thus, there are 6 ratio parameters which represent the relative concentration of tryptophan, elastin, nicotinamide adenine dinucleotide (NADH), and flavin. A statistical analysis showed that benign and malignant tissues could be classified with accuracy greater than 90%. This report is only for in vitro analysis; but employing optical fiber, this can be extended to in vivo analysis too, so that benign tumor could be distinguished without surgery.

  11. MOLECULAR EVENTS ASSOCIATED WITH ARSENIC-INDUCED MALIGNANT TRANSFORMATION OF HUMAN PROSTATIC EPITHELIAL CELLS: ABERRANT GENOMIC DNA METHYLATION AND K-RAS ONCOGENE ACTIVATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Numerous studies link arsenic exposure to human cancers in a variety of tissues, including the prostate. Our prior work showed that chronic arsenic exposure of the non-tumorigenic, human prostate epithelial cell line, RWPE-1, to low levels of (5 microM) sodium arsenite for 29 weeks resulted in malig...

  12. Lack of detection of human papillomavirus DNA in prostate carcinomas in patients from northeastern Brazil.

    PubMed

    Araujo-Neto, Ari P; Ferreira-Fernandes, Hygor; Amaral, Carolina M M; Santos, Lina G; Freitas, Antônio C; Silva-Neto, Jacinto C; Rey, Juan A; Burbano, Rommel R; Silva, Benedito B da; Yoshioka, France K N; Pinto, Giovanny R

    2016-03-01

    Prostate cancer is the second most common cancer among men in western populations, and despite its high mortality, its etiology remains unknown. Inflammatory processes are related to the etiology of various types of tumors, and prostate inflammation, in particular, has been associated with prostate cancer carcinogenesis and progression. Human papillomavirus (HPV) is associated with benign and malignant lesions in the anogenital tract of both females and males. The possible role of HPV in prostate carcinogenesis is a subject of great controversy. In this study, we aimed to examine the prevalence of HPV infections in prostate carcinomas of patients from northeastern Brazil. This study included 104 tissue samples from primary prostate carcinoma cases. HPV DNA was purified and then amplified using MY09/11 and GP5+/GP6+ degenerate primer sets that detect a wide range of HPV types, and with specific PCR primers sets for E6 and E7 HPV regions to detect HPV 16. None of the samples showed amplification products of HPV DNA for primer sets MY09/11 and GP5+/GP6+, or the specific primer set for the E6 and E7 HPV regions. HPV infection, thus, does not seem to be one of the causes of prostate cancer in the population studied. PMID:27007894

  13. Lack of detection of human papillomavirus DNA in prostate carcinomas in patients from northeastern Brazil

    PubMed Central

    Araujo-Neto, Ari P.; Ferreira-Fernandes, Hygor; Amaral, Carolina M.M.; Santos, Lina G.; Freitas, Antônio C.; Silva-Neto, Jacinto C.; Rey, Juan A.; Burbano, Rommel R.; da Silva, Benedito B.; Yoshioka, France K.N.; Pinto, Giovanny R.

    2016-01-01

    Abstract Prostate cancer is the second most common cancer among men in western populations, and despite its high mortality, its etiology remains unknown. Inflammatory processes are related to the etiology of various types of tumors, and prostate inflammation, in particular, has been associated with prostate cancer carcinogenesis and progression. Human papillomavirus (HPV) is associated with benign and malignant lesions in the anogenital tract of both females and males. The possible role of HPV in prostate carcinogenesis is a subject of great controversy. In this study, we aimed to examine the prevalence of HPV infections in prostate carcinomas of patients from northeastern Brazil. This study included 104 tissue samples from primary prostate carcinoma cases. HPV DNA was purified and then amplified using MY09/11 and GP5+/GP6+ degenerate primer sets that detect a wide range of HPV types, and with specific PCR primers sets for E6 and E7 HPV regions to detect HPV 16. None of the samples showed amplification products of HPV DNA for primer sets MY09/11 and GP5+/GP6+, or the specific primer set for the E6 and E7 HPV regions. HPV infection, thus, does not seem to be one of the causes of prostate cancer in the population studied. PMID:27007894

  14. Early Human Prostate Adenocarcinomas Harbor Androgen-Independent Cancer Cells

    PubMed Central

    Fiñones, Rita R.; Yeargin, Jo; Lee, Melissa; Kaur, Aman Preet; Cheng, Clari; Sun, Paulina; Wu, Christopher; Nguyen, Catherine; Wang-Rodriguez, Jessica; Meyer, April N.; Baird, Stephen M.; Donoghue, Daniel J.; Haas, Martin

    2013-01-01

    Although blockade of androgen receptor (AR) signaling represents the main treatment for advanced prostate cancer (PrCa), many patients progress to a lethal phenotype of “Castration-Resistant” prostate cancer (CR-PrCa). With the hypothesis that early PrCa may harbor a population of androgen-unresponsive cancer cells as precursors to CR-recurrent disease, we undertook the propagation of androgen-independent cells from PrCa-prostatectomy samples of early, localized (Stage-I) cases. A collection of 120 surgical specimens from prostatectomy cases was established, among which 54 were adenocarcinomas. Hormone-free cell culture conditions were developed allowing routine propagation of cells expressing prostate basal cell markers and stem/progenitor cell markers, and which proliferated as spheres/spheroids in suspension cultures. Colonies of androgen-independent epithelial cells grew out from 30/43 (70%) of the adenocarcinoma cases studied in detail. Fluorescence microscopy and flow cytometry showed that CR-PrCa cells were positive for CD44, CD133, CK5/14, c-kit, integrin α2β1, SSEA4, E-Cadherin and Aldehyde Dehydrogenase (ALDH). All 30 CR-PrCa cell cultures were also TERT-positive, but negative for TMPRSS2-ERG. Additionally, a subset of 22 of these CR-PrCa cell cultures was examined by orthotopic xenografting in intact and castrated SCID mice, generating histologically typical locally-invasive human PrCa or undifferentiated cancers, respectively, in 6–8 weeks. Cultured PrCa cells and orthotopically-induced in vivo cancers lacked PSA expression. We report here the propagation of Cancer Initiating Cells (CIC) directly from Stage I human PrCa tissue without selection or genetic manipulation. The propagation of stem/progenitor-like CR-PrCa cells derived from early human prostate carcinomas suggests the existence of a subpopulation of cells resistant to androgen-deprivation therapy and which may drive the subsequent emergence of disseminated CR-PrCa. PMID:24086346

  15. Trade in human tissue products.

    PubMed

    Tonti-Filippini, Nicholas; Zeps, Nikolajs

    2011-03-01

    Trade in human tissue in Australia is prohibited by state law, and in ethical guidelines by the National Health and Medical Research Council: National statement on ethical conduct in human research; Organ and tissue donation by living donors: guidelines for ethical practice for health professionals. However, trade in human tissue products is a common practice especially for: reconstructive orthopaedic or plastic surgery; novel human tissue products such as a replacement trachea created by using human mesenchymal stem cells; biomedical research using cell lines, DNA and protein provided through biobanks. Cost pressures on these have forced consideration of commercial models to sustain their operations. Both the existing and novel activities require a robust framework to enable commercial uses of human tissue products while maintaining community acceptability of such practices, but to date no such framework exists. In this article, we propose a model ethical framework for ethical governance which identifies specific ethical issues such as: privacy; unique value of a person's tissue; commodification of the body; equity and benefit to the community; perverse incentives; and "attenuation" as a potentially useful concept to help deal with the broad range of subjective views relevant to whether it is acceptable to commercialise certain human tissue products. PMID:21382003

  16. Quantitative Time-Resolved Fluorescence Imaging of Androgen Receptor and Prostate-Specific Antigen in Prostate Tissue Sections.

    PubMed

    Krzyzanowska, Agnieszka; Lippolis, Giuseppe; Helczynski, Leszek; Anand, Aseem; Peltola, Mari; Pettersson, Kim; Lilja, Hans; Bjartell, Anders

    2016-05-01

    Androgen receptor (AR) and prostate-specific antigen (PSA) are expressed in the prostate and are involved in prostate cancer (PCa). The aim of this study was to develop reliable protocols for reproducible quantification of AR and PSA in benign and malignant prostate tissue using time-resolved fluorescence (TRF) imaging techniques. AR and PSA were detected with TRF in tissue microarrays from 91 PCa patients. p63/ alpha-methylacyl-CoA racemase (AMACR) staining on consecutive sections was used to categorize tissue areas as benign or cancerous. Automated image analysis was used to quantify staining intensity. AR intensity was significantly higher in AMACR+ and lower in AMACR- cancer areas as compared with benign epithelium. The PSA intensity was significantly lower in cancer areas, particularly in AMACR- glands. The AR/PSA ratio varied significantly in the AMACR+ tumor cells as compared with benign glands. There was a trend of more rapid disease progression in patients with higher AR/PSA ratios in the AMACR- areas. This study demonstrates the feasibility of developing reproducible protocols for TRF imaging and automated image analysis to study the expression of AR and PSA in benign and malignant prostate. It also highlighted the differences in AR and PSA protein expression within AMACR- and AMACR+ cancer regions. PMID:27026295

  17. Regulation of mRNA and Protein Levels of β1 Integrin Variants in Human Prostate Carcinoma

    PubMed Central

    Perlino, Elda; Lovecchio, Mariarosaria; Vacca, Rosa A.; Fornaro, Mara; Moro, Loredana; Ditonno, Pasquale; Battaglia, Michele; Selvaggi, Francesco P.; Mastropasqua, Mauro G.; Bufo, Pantaleo; Languino, Lucia R.

    2000-01-01

    Alterations of integrin expression levels in cancer cells correlate with changes in invasiveness, tumor progression, and metastatic potential. The β1C integrin, an alternatively spliced form of the human β1 integrin, has been shown to inhibit prostate cell proliferation. Furthermore, β1C protein levels were found to be abundant in normal prostate glandular epithelium and down-regulated in prostatic adenocarcinoma. To gain further insights into the molecular mechanisms underlying abnormal cancer cell proliferation, we have studied β1C and β1 integrin expression at both mRNA and protein levels by Northern and immunoblotting analysis using freshly isolated neoplastic and normal human prostate tissue specimens. Steady-state mRNA levels were evaluated in 38 specimens: 33 prostatic adenocarcinomas exhibiting different Gleason’s grade and five normal tissue specimens that did not show any histological manifestation of benign prostatic hypertrophy. Our results demonstrate that β1C mRNA is expressed in normal prostate and is significantly down-regulated in neoplastic prostate specimens. In addition, using a probe that hybridizes with all β1 variants, mRNA levels of β1 are found reduced in neoplastic versus normal prostate tissues. We demonstrate that β1C mRNA down-regulation does not correlate with either tumor grade or differentiation according to Gleason’s grade and TNM system evaluation, and that β1C mRNA levels are not affected by hormonal therapy. In parallel, β1C protein levels were analyzed. As expected, β1C is found to be expressed in normal prostate and dramatically reduced in neoplastic prostate tissues; in contrast, using an antibody to β1 that recognizes all β1 variants, the levels of β1 are comparable in normal and neoplastic prostate, thus indicating a selective down-regulation of the β1C protein in prostate carcinoma. These results demonstrate for the first time that β1C and β1 mRNA expression is down-regulated in prostate carcinoma

  18. Prostate-specific extracellular vesicles as a novel biomarker in human prostate cancer.

    PubMed

    Park, Yong Hyun; Shin, Hyun Woo; Jung, Ae Ryang; Kwon, Oh Sung; Choi, Yeong-Jin; Park, Jaesung; Lee, Ji Youl

    2016-01-01

    Extracellular vesicles (EVs) may play an important role in cancer development and progression. We aimed to investigate the prognostic potential of prostate-specific EVs in prostate cancer (PCa) patients. Plasma and prostate tissue were collected from patients who underwent surgery for PCa (n = 82) or benign prostatic hyperplasia (BPH, n = 28). To analyze the quantity of EVs in prostate, we performed transmission electron microscopy (TEM), immuno-TEM with CD63 and prostate-specific membrane antigen (PSMA), and immunofluorescence staining. After EV isolation from plasma, CD63 and PSMA concentration was measured using ELISA kits. PSMA-positive areas in prostate differed in patients with BPH, and low-, intermediate-, and high-risk PCa (2.4, 8.2, 17.5, 26.5%, p < 0.001). Plasma PSMA-positive EV concentration differed in patients with BPH, and low-, intermediate-, and high-risk PCa (21.9, 43.4, 49.2, 59.9 ng/mL, p < 0.001), and ROC curve analysis indicated that plasma PSMA-positive EV concentration differentiated PCa from BPH (AUC 0.943). Patients with lower plasma PSMA-positive EV concentration had greater prostate volume (50.2 vs. 33.4 cc, p < 0.001) and lower pathologic Gleason score (p = 0.025). During the median follow-up of 18 months, patients with lower plasma PSMA-positive EV concentration tended to have a lower risk of biochemical failure than those with higher levels of prostate-specific EVs (p = 0.085). PMID:27503267

  19. Prostate-specific extracellular vesicles as a novel biomarker in human prostate cancer

    PubMed Central

    Park, Yong Hyun; Shin, Hyun Woo; Jung, Ae Ryang; Kwon, Oh Sung; Choi, Yeong-Jin; Park, Jaesung; Lee, Ji Youl

    2016-01-01

    Extracellular vesicles (EVs) may play an important role in cancer development and progression. We aimed to investigate the prognostic potential of prostate-specific EVs in prostate cancer (PCa) patients. Plasma and prostate tissue were collected from patients who underwent surgery for PCa (n = 82) or benign prostatic hyperplasia (BPH, n = 28). To analyze the quantity of EVs in prostate, we performed transmission electron microscopy (TEM), immuno-TEM with CD63 and prostate-specific membrane antigen (PSMA), and immunofluorescence staining. After EV isolation from plasma, CD63 and PSMA concentration was measured using ELISA kits. PSMA-positive areas in prostate differed in patients with BPH, and low-, intermediate-, and high-risk PCa (2.4, 8.2, 17.5, 26.5%, p < 0.001). Plasma PSMA-positive EV concentration differed in patients with BPH, and low-, intermediate-, and high-risk PCa (21.9, 43.4, 49.2, 59.9 ng/mL, p < 0.001), and ROC curve analysis indicated that plasma PSMA-positive EV concentration differentiated PCa from BPH (AUC 0.943). Patients with lower plasma PSMA-positive EV concentration had greater prostate volume (50.2 vs. 33.4 cc, p < 0.001) and lower pathologic Gleason score (p = 0.025). During the median follow-up of 18 months, patients with lower plasma PSMA-positive EV concentration tended to have a lower risk of biochemical failure than those with higher levels of prostate-specific EVs (p = 0.085). PMID:27503267

  20. SCRIB expression is deregulated in human prostate cancer, and its deficiency in mice promotes prostate neoplasia

    PubMed Central

    Pearson, Helen B.; Perez-Mancera, Pedro A.; Dow, Lukas E.; Ryan, Andrew; Tennstedt, Pierre; Bogani, Debora; Elsum, Imogen; Greenfield, Andy; Tuveson, David A.; Simon, Ronald; Humbert, Patrick O.

    2011-01-01

    Loss of cellular polarity is a hallmark of epithelial cancers, raising the possibility that regulators of polarity have a role in suppressing tumorigenesis. The Scribble complex is one of at least three interacting protein complexes that have a critical role in establishing and maintaining epithelial polarity. In human colorectal, breast, and endometrial cancers, expression of the Scribble complex member SCRIB is often mislocalized and deregulated. Here, we report that Scrib is indispensable for prostate homeostasis in mice. Scrib heterozygosity initiated prostate hyperplasia, while targeted biallelic Scrib loss predisposed mice to prostate intraepithelial neoplasia. Mechanistically, Scrib was shown to negatively regulate the MAPK cascade to suppress tumorigenesis. Further analysis revealed that prostate-specific loss of Scrib in mice combined with expression of an oncogenic Kras mutation promoted the progression of prostate cancer that recapitulated the human disease. The clinical significance of the work in mice was highlighted by our observation that SCRIB deregulation strongly correlated with poor survival in human prostate cancer. These data suggest that the polarity network could provide a new avenue for therapeutic intervention. PMID:21965329

  1. Magnetic resonance microscopy of prostate tissue: How basic science can inform clinical imaging development

    SciTech Connect

    Bourne, Roger

    2013-03-15

    This commentary outlines how magnetic resonance imaging (MRI) microscopy studies of prostate tissue samples and whole organs have shed light on a number of clinical imaging mysteries and may enable more effective development of new clinical imaging methods.

  2. Agonist and antagonist switch DNA motifs recognized by human androgen receptor in prostate cancer

    PubMed Central

    Chen, Zhong; Lan, Xun; Thomas-Ahner, Jennifer M; Wu, Dayong; Liu, Xiangtao; Ye, Zhenqing; Wang, Liguo; Sunkel, Benjamin; Grenade, Cassandra; Chen, Junsheng; Zynger, Debra L; Yan, Pearlly S; Huang, Jiaoti; Nephew, Kenneth P; Huang, Tim H-M; Lin, Shili; Clinton, Steven K; Li, Wei; Jin, Victor X; Wang, Qianben

    2015-01-01

    Human transcription factors recognize specific DNA sequence motifs to regulate transcription. It is unknown whether a single transcription factor is able to bind to distinctly different motifs on chromatin, and if so, what determines the usage of specific motifs. By using a motif-resolution chromatin immunoprecipitation-exonuclease (ChIP-exo) approach, we find that agonist-liganded human androgen receptor (AR) and antagonist-liganded AR bind to two distinctly different motifs, leading to distinct transcriptional outcomes in prostate cancer cells. Further analysis on clinical prostate tissues reveals that the binding of AR to these two distinct motifs is involved in prostate carcinogenesis. Together, these results suggest that unique ligands may switch DNA motifs recognized by ligand-dependent transcription factors in vivo. Our findings also provide a broad mechanistic foundation for understanding ligand-specific induction of gene expression profiles. PMID:25535248

  3. Agonist and antagonist switch DNA motifs recognized by human androgen receptor in prostate cancer.

    PubMed

    Chen, Zhong; Lan, Xun; Thomas-Ahner, Jennifer M; Wu, Dayong; Liu, Xiangtao; Ye, Zhenqing; Wang, Liguo; Sunkel, Benjamin; Grenade, Cassandra; Chen, Junsheng; Zynger, Debra L; Yan, Pearlly S; Huang, Jiaoti; Nephew, Kenneth P; Huang, Tim H-M; Lin, Shili; Clinton, Steven K; Li, Wei; Jin, Victor X; Wang, Qianben

    2015-02-12

    Human transcription factors recognize specific DNA sequence motifs to regulate transcription. It is unknown whether a single transcription factor is able to bind to distinctly different motifs on chromatin, and if so, what determines the usage of specific motifs. By using a motif-resolution chromatin immunoprecipitation-exonuclease (ChIP-exo) approach, we find that agonist-liganded human androgen receptor (AR) and antagonist-liganded AR bind to two distinctly different motifs, leading to distinct transcriptional outcomes in prostate cancer cells. Further analysis on clinical prostate tissues reveals that the binding of AR to these two distinct motifs is involved in prostate carcinogenesis. Together, these results suggest that unique ligands may switch DNA motifs recognized by ligand-dependent transcription factors in vivo. Our findings also provide a broad mechanistic foundation for understanding ligand-specific induction of gene expression profiles. PMID:25535248

  4. A simple analysis of extinction spectra of cancerous and normal prostate tissues in near infrared range using a size discrete particle distribution and Mie scattering model

    NASA Astrophysics Data System (ADS)

    Zhou, Kenneth J.; Chen, Jun

    2015-03-01

    The extinction spectra and optical coefficients of human cancerous and normal prostate tissues were investigated in the spectral range of 750 nm - 860 nm. The scattering coefficient (μs) was determined from the extinction measurements on thin prostate tissue and Beer's law. The absorption coefficient (μa) and the reduced scattering coefficient (μs') were extracted from integrate sphere intensity measurements on prostate tissue of which the thickness is in the multiple scattering range. The anisotropy factor (g) was calculated using the extracted values of μs and μs'. A micro-optical model of soft biological tissue was introduced to simulate the numerical computation of the absolute magnitudes of its scattering coefficients from the refractive index and a particle distribution function based on the Mie theory. A key assumption of the model is that the refractive index variations caused by microscopic tissue elements can be treated as particles with sizes distributed according to a skewed log-normal distribution function. The particle distribution and mean particle size of the two types of tissues were then calculated. Results show that the mean diameter of the particle size of cancerous tissue is larger than that of the cancerous tissue, which is responsible for larger reduced scattering coefficient of normal tissue in comparison with cancerous tissue. The results can be explained the change of tissue during prostate cancer evolution defined by Gleason Grade. The difference of the particles distribution and optical coefficients of cancerous and normal prostate tissues may present a potential criterion for prostate cancer detection.

  5. Phenotypic characterization of telomerase-immortalized primary non-malignant and malignant tumor-derived human prostate epithelial cell lines

    SciTech Connect

    Gu Yongpeng; Li Hongzhen; Miki, Jun; Kim, Kee-Hong; Furusato, Bungo; Sesterhenn, Isabell A.; Chu, Wei-Sing; McLeod, David G.; Srivastava, Shiv; Ewing, Charles M.; Isaacs, William B.; Rhim, Johng S. . E-mail: jrhim@cpdr.org

    2006-04-01

    In vitro human prostate cell culture models are critical for clarifying the mechanism of prostate cancer progression and for testing preventive and therapeutic agents. Cell lines ideal for the study of human primary prostate tumors would be those derived from spontaneously immortalized tumor cells; unfortunately, explanted primary prostate cells survive only short-term in culture, and rarely immortalize spontaneously. Therefore, we recently have generated five immortal human prostate epithelial cell cultures derived from both the benign and malignant tissues of prostate cancer patients with telomerase, a gene that prevents cellular senescence. Examination of these cell lines for their morphologies and proliferative capacities, their abilities to grow in low serum, to respond to androgen stimulation, to grow above the agar layer, to form tumors in SCID mice, suggests that they may serve as valid, useful tools for the elucidation of early events in prostate tumorigenesis. Furthermore, the chromosome alterations observed in these immortalized cell lines expressing aspects of the malignant phenotypes imply that these cell lines accurately recapitulate the genetic composition of primary tumors. These novel in vitro models may offer unique models for the study of prostate carcinogenesis and also provide the means for testing both chemopreventive and chemotherapeutic agents.

  6. P21-Activated Kinase Inhibitors FRAX486 and IPA3: Inhibition of Prostate Stromal Cell Growth and Effects on Smooth Muscle Contraction in the Human Prostate

    PubMed Central

    Wang, Yiming; Gratzke, Christian; Tamalunas, Alexander; Wiemer, Nicolas; Ciotkowska, Anna; Rutz, Beata; Waidelich, Raphaela; Strittmatter, Frank; Liu, Chunxiao; Stief, Christian G.; Hennenberg, Martin

    2016-01-01

    Prostate smooth muscle tone and hyperplastic growth are involved in the pathophysiology and treatment of male lower urinary tract symptoms (LUTS). Available drugs are characterized by limited efficacy. Patients’ adherence is particularly low to combination therapies of 5α-reductase inhibitors and α1-adrenoceptor antagonists, which are supposed to target contraction and growth simultaneously. Consequently, molecular etiology of benign prostatic hyperplasia (BPH) and new compounds interfering with smooth muscle contraction or growth in the prostate are of high interest. Here, we studied effects of p21-activated kinase (PAK) inhibitors (FRAX486, IPA3) in hyperplastic human prostate tissues, and in stromal cells (WPMY-1). In hyperplastic prostate tissues, PAK1, -2, -4, and -6 may be constitutively expressed in catecholaminergic neurons, while PAK1 was detected in smooth muscle and WPMY-1 cells. Neurogenic contractions of prostate strips by electric field stimulation were significantly inhibited by high concentrations of FRAX486 (30 μM) or IPA3 (300 μM), while noradrenaline- and phenylephrine-induced contractions were not affected. FRAX486 (30 μM) inhibited endothelin-1- and -2-induced contractions. In WPMY-1 cells, FRAX486 or IPA3 (24 h) induced concentration-dependent (1–10 μM) degeneration of actin filaments. This was paralleled by attenuation of proliferation rate, being observed from 1 to 10 μM FRAX486 or IPA3. Cytotoxicity of FRAX486 and IPA3 in WPMY-1 cells was time- and concentration-dependent. Stimulation of WPMY-1 cells with endothelin-1 or dihydrotestosterone, but not noradrenaline induced PAK phosphorylation, indicating PAK activation by endothelin-1. Thus, PAK inhibitors may inhibit neurogenic and endothelin-induced smooth muscle contractions in the hyperplastic human prostate, and growth of stromal cells. Targeting prostate smooth muscle contraction and stromal growth at once by a single compound is principally possible, at least under

  7. A human fetal prostate xenograft model of developmental estrogenization.

    PubMed

    Saffarini, Camelia M; McDonnell-Clark, Elizabeth V; Amin, Ali; Boekelheide, Kim

    2015-01-01

    Prostate cancer is a common disease in older men. Rodent models have demonstrated that an early and later-life exposure to estrogen can lead to cancerous lesions and implicated hormonal dysregulation as an avenue for developing future prostate neoplasia. This study utilizes a human fetal prostate xenograft model to study the role of estrogen in the progression of human disease. Histopathological lesions were assessed in 7-, 30-, 90-, 200-, and 400-day human prostate xenografts. Gene expression for cell cycle, tumor suppressors, and apoptosis-related genes (ie, CDKN1A, CASP9, ESR2, PTEN, and TP53) was performed for 200-day estrogen-treated xenografts. Glandular hyperplasia was observed in xenografts given both an initial and secondary exposure to estradiol in both 200- and 400-day xenografts. Persistent estrogenic effects were verified using immunohistochemical markers for cytokeratin 10, p63, and estrogen receptor α. This model provides data on the histopathological state of the human prostate following estrogenic treatment, which can be utilized in understanding the complicated pathology associated with prostatic disease and early and later-life estrogenic exposures. PMID:25633637

  8. Interleukin-6: a multifunctional targetable cytokine in human prostate cancer.

    PubMed

    Culig, Zoran; Puhr, Martin

    2012-09-01

    Several cytokines are involved in regulation of cellular events in prostate cancer. Interleukin-6 (IL-6) was frequently investigated in prostate cancer models because of its increased expression in cancer tissue at early stages of the disease. In patients with metastatic prostate cancer, it is well-known that IL-6 levels increase in serum. High levels of IL-6 were measured in the supernatants of cells which do not respond to androgenic stimulation. IL-6 expression in prostate cancer increases due to enhanced expression of transforming growth factor-beta, and members of the activating protein-1 complex, and loss of the retinoblastoma tumour suppressor. IL-6 activation of androgen receptor (AR) may contribute to progression of a subgroup of prostate cancers. Results obtained with two prostate cancer cell lines, LNCaP and MDA PCa 2b, indicate that IL-6 activation of AR may cause either stimulatory or inhibitory responses on proliferation. Interestingly, prolonged treatment with IL-6 led to establishment of an IL-6 autocrine loop, suppressed signal transducer and activator of transcription (STAT)3 activation, and increased mitogen-activated protein kinase phosphorylation. In several cell lines IL-6 acts as a survival molecule through activation of the signalling pathway of phosphotidylinositol 3-kinase. Expression of suppressors of cytokine signalling (SOCS) has been studied in prostate cancer. SOCS-3 prevents phosphorylation of STAT3 and is an important anti-apoptotic factor in AR-negative prostate cancer cells. Experimental therapy against IL-6 in prostate cancer is based on the use of the monoclonal antibody siltuximab which may be used for personalised therapy coming in the future. PMID:21664423

  9. Trimodal spectra for high discrimination of benign and malignant prostate tissue

    NASA Astrophysics Data System (ADS)

    Al Salhi, Mohamad; Masilamani, Vadivel; Trinka, Vijmasi; Rabah, Danny; Al Turki, Mohammed R.

    2011-02-01

    High false positives and over diagnosis is a major problem with management of prostate cancer. A non-invasive or a minimally invasive technique to accurately distinguish malignant prostate cancers from benign tumors will be extremely helpful to overcome this problem. In this paper, we had used three different fluorescence spectroscopy techniques viz., Fluorescence Emission Spectrum (FES), Stokes' Shift Spectrum (SSS) and Reflectance Spectrum (RS) to discriminate benign prostate tumor tissues (N=12) and malignant prostate cancer tissues (N=8). These fluorescence techniques were used to determine the relative concentration of naturally occurring biomolecules such as tryptophan, elastin, NADH and flavin which are found to be out of proportion in cancer tissues. Our studies show that combining all three techniques, benign and malignant prostate tissues could be classified with accuracy greater than 90%. This preliminary report is based on in vitro spectroscopy analysis. However, by employing fluorescence endoscopy techniques, this can be extended to in vivo analysis as well. This technique has the potential to identify malignant prostate tissues without surgery.

  10. Hydrogen sulfide mediates the anti-survival effect of sulforaphane on human prostate cancer cells

    SciTech Connect

    Pei, Yanxi; Wu, Bo; Cao, Qiuhui; Wu, Lingyun; Yang, Guangdong

    2011-12-15

    Hydrogen sulfide (H{sub 2}S) is a novel gasotransmitter that regulates cell proliferation and other cellular functions. Sulforaphane (SFN) is a sulfur-containing compound that exhibits anticancer properties, and young sprouts of broccoli are particularly rich in SFN. There is consistent epidemiological evidence that the consumption of sulfur-containing vegetables, such as garlic and cruciferous vegetables, may help reduce the occurrence of prostate cancer. Here we found that a large amount of H{sub 2}S is released when SFN is added into cell culture medium or mixed with mouse liver homogenates, respectively. Both SFN and NaHS (a H{sub 2}S donor) decreased the viability of PC-3 cells (a human prostate cancer cell line) in a dose-dependent manner, and supplement of methemoglobin or oxidized glutathione (two H{sub 2}S scavengers) reversed SFN-reduced cell viability. We further found both cystathionine gamma-lyase (CSE) and cystathionine beta-synthase are expressed in PC-3 cells and mouse prostate tissues. H{sub 2}S production in prostate tissues from CSE knockout mice was only 20% of that from wild-type mice, suggesting CSE is a major H{sub 2}S-producing enzyme in prostate. CSE overexpression enhanced H{sub 2}S production and inhibited cell viability in PC-3 cells. In addition, both SFN and NaHS activated p38 mitogen-activated protein kinases (MAPK) and c-Jun N-terminal kinase (JNK). Pre-treatment of PC-3 cells with methemoglobin decreased SFN-stimulated MAPK activities. Suppression of both p38 MAPK and JNK reversed H{sub 2}S- or SFN-reduced viability of PC-3 cells. Our results demonstrated that H{sub 2}S mediates the inhibitory effect of SFN on the proliferation of PC-3 cells, which suggests that H{sub 2}S-releasing diet or drug might be beneficial in the treatment of prostate cancer. Highlights: Black-Right-Pointing-Pointer A large amount of H{sub 2}S is released from sulforaphane. Black-Right-Pointing-Pointer H{sub 2}S mediates the anti-survival effect of

  11. Xenotransplantation Models to Study the Effects of Toxicants on Human Fetal Tissues1

    PubMed Central

    Spade, Daniel J.; McDonnell, Elizabeth V.; Heger, Nicholas E.; Sanders, Jennifer A.; Saffarini, Camelia M.; Gruppuso, Philip A.; De Paepe, Monique E.; Boekelheide, Kim

    2015-01-01

    Many diseases that manifest throughout the lifetime are influenced by factors affecting fetal development. Fetal exposure to xenobiotics, in particular, may influence the development of adult diseases. Established animal models provide systems for characterizing both developmental biology and developmental toxicology. However, animal model systems do not allow researchers to assess the mechanistic effects of toxicants on developing human tissue. Human fetal tissue xenotransplantation models have recently been implemented to provide human-relevant mechanistic data on the many tissue-level functions that may be affected by fetal exposure to toxicants. This review describes the development of human fetal tissue xenotransplant models for testis, prostate, lung, liver, and adipose tissue, aimed at studying the effects of xenobiotics on tissue development, including implications for testicular dysgenesis, prostate disease, lung disease, and metabolic syndrome. The mechanistic data obtained from these models can complement data from epidemiology, traditional animal models, and in vitro studies to quantify the risks of toxicant exposures during human development. PMID:25477288

  12. Differentially Expressed Genes and Signature Pathways of Human Prostate Cancer

    PubMed Central

    Myers, Jennifer S.; von Lersner, Ariana K.; Robbins, Charles J.; Sang, Qing-Xiang Amy

    2015-01-01

    Genomic technologies including microarrays and next-generation sequencing have enabled the generation of molecular signatures of prostate cancer. Lists of differentially expressed genes between malignant and non-malignant states are thought to be fertile sources of putative prostate cancer biomarkers. However such lists of differentially expressed genes can be highly variable for multiple reasons. As such, looking at differential expression in the context of gene sets and pathways has been more robust. Using next-generation genome sequencing data from The Cancer Genome Atlas, differential gene expression between age- and stage- matched human prostate tumors and non-malignant samples was assessed and used to craft a pathway signature of prostate cancer. Up- and down-regulated genes were assigned to pathways composed of curated groups of related genes from multiple databases. The significance of these pathways was then evaluated according to the number of differentially expressed genes found in the pathway and their position within the pathway using Gene Set Enrichment Analysis and Signaling Pathway Impact Analysis. The “transforming growth factor-beta signaling” and “Ran regulation of mitotic spindle formation” pathways were strongly associated with prostate cancer. Several other significant pathways confirm reported findings from microarray data that suggest actin cytoskeleton regulation, cell cycle, mitogen-activated protein kinase signaling, and calcium signaling are also altered in prostate cancer. Thus we have demonstrated feasibility of pathway analysis and identified an underexplored area (Ran) for investigation in prostate cancer pathogenesis. PMID:26683658

  13. Myeloid sarcoma of the periprostatic tissue and prostate: Case report and review of literature

    PubMed Central

    Koppisetty, Shalini; Edelman, Brain L.; Rajpurkar, Atul

    2016-01-01

    Myeloid sarcoma (MS) is a rare extramedullary tumor composed of immature cells of myeloid lineage that destroy the original tissue architecture in which it is found. It is most commonly identified in patients with acute myelogenous leukemia, and less often in myelodysplastic syndromes (MDSs) and other myeloproliferative disorders. It is most commonly reported in the periosteum, bone, skin, and lymph nodes but has been reported in many other sites of the body. Herein, we describe a case of MS involving the periprostatic tissue and review of literature of MS of the prostate. Our patient was initially diagnosed with MDS and was in remission following successful treatment. Six months later, the patient was diagnosed with prostate adenocarcinoma, and MS of the periprostatic tissue was incidentally discovered in the postprostatectomy pathology specimen. An extensive review of literature from 1997 to 2014 revealed a total of eight cases of MS involving the prostate. Of the eight cases of MS of the prostate, four were primary MS (absence of a history of leukemia) and four were secondary MS. Three received local radiation to the prostate with relief of obstructive symptoms, and one of them had a repeat prostate biopsy negative for leukemic cells. Despite being a rare entity, MS should be considered as a differential diagnosis of soft tissue masses, especially in patients with a history of hematological malignancies. PMID:27453659

  14. Histotripsy Fractionation of Prostate Tissue: Local Effects and Systemic Response in a Canine Model

    PubMed Central

    Hempel, Christopher R.; Hall, Timothy L; Cain, Charles A.; Fowlkes, J. Brian; Xu, Zhen; Roberts, William W.

    2010-01-01

    Purpose Histotripsy is an extracorporeal ultrasound (US) technology that utilizes cavitational mechanisms to produce non-thermal tissue destruction. Previously, we demonstrated the feasibility of histotripsy for fractionation and immediate debulking of prostate tissue. The purpose of this study is to characterize the local effects and systemic response after histotripsy treatment of prostate tissue in an in-vivo canine model. Materials and Methods Histotripsy was applied transabdominally to the prostate in eighteen intact male canine subjects under general anesthesia. Acoustic bursts (4 microseconds) were delivered at 300 Hz pulse repetition rate from a highly focused 750 kHz piezoelectric US transducer (15 cm aperture, 3×3×8 mm focal volume). The prostate and surrounding structures were harvested at prescribed time points (0, 7, 28, or 56 days) following histotripsy. Blood and urine parameters were assessed periodically while clinical evaluation incorporating a validated veterinary pain scale was performed daily. Results Conventional transrectal US imaging facilitated targeting of the focal volume and provided real-time assessment of cavitation activity. Fractionation of the targeted volume and clearance of the resultant debris with urination produced a treatment cavity within each prostate. No acoustic collateral damage was seen and urothelialization of the treatment cavity occurred within 28 days of treatment. Only transient lab abnormalities and minimal hematuria were noted after treatment. Pain scores revealed only mild post treatment discomfort. Conclusions Histotripsy produced consistent tissue fractionation and prostate debulking without collateral acoustic injury or clinical side effects and was well tolerated in the canine model. PMID:21334667

  15. Coagulation of human prostate volumes with MRI-controlled transurethral ultrasound therapy: Results in gel phantoms

    PubMed Central

    N’Djin, William Apoutou; Burtnyk, Mathieu; Kobelevskiy, Ilya; Hadjis, Stefan; Bronskill, Michael; Chopra, Rajiv

    2012-01-01

    Purpose: The feasibility and safety of magnetic resonance imaging (MRI)-controlled transurethral ultrasound therapy were demonstrated recently in a preliminary human study in which a small subvolume of prostate tissue was treated prior to radical prostatectomy. Translation of this technology to full clinical use, however, requires the capability to generate thermal coagulation in a volume up to that of the prostate gland itself. The aim of this study was to investigate the parameters required to treat a full 3D human prostate accurately with a multi-element transurethral applicator and multiplanar MR temperature control. Methods: The approach was a combination of simulations (to select appropriate parameters) followed by experimental confirmation in tissue-mimicking phantoms. A ten-channel, MRI-compatible transurethral ultrasound therapy system was evaluated using six human prostate models (average volume: 36 cm3) obtained from the preliminary human feasibility study. Real-time multiplanar MR thermometry at 3 T was used to control the spatial heating pattern in up to nine planes simultaneously. Treatment strategies incorporated both single (4.6 or 8.1 MHz) and dual (4.6 and 14.4 MHz) frequencies, as well as maximum acoustic surface powers of 10 or 20 W cm−2. Results: Treatments at 4.6 MHz were capable of coagulating a volume equivalent to 97% of the prostate. Increasing power from 10 to 20 W cm−2 reduced treatment times by approximately 50% with full treatments taking 26 ± 3 min at a coagulation rate of 1.8 ± 0.4 cm3 min−1. A dual-frequency 4.6/14.4 MHz treatment strategy was shown to be the most effective configuration for achieving full human prostate treatment while maintaining good treatment accuracy for small treatment radii. The dual-frequency approach reduced overtreatment close to the prostate base and apex, confirming the simulations. Conclusions: This study reinforces the capability of MRI-controlled transurethral ultrasound therapy to treat

  16. The development of common data elements for a multi-institute prostate cancer tissue bank: The Cooperative Prostate Cancer Tissue Resource (CPCTR) experience

    PubMed Central

    Patel, Ashokkumar A; Kajdacsy-Balla, André; Berman, Jules J; Bosland, Maarten; Datta, Milton W; Dhir, Rajiv; Gilbertson, John; Melamed, Jonathan; Orenstein, Jan; Tai, Kuei-Fang; Becich, Michael J

    2005-01-01

    Background The Cooperative Prostate Cancer Tissue Resource (CPCTR) is a consortium of four geographically dispersed institutions that are funded by the U.S. National Cancer Institute (NCI) to provide clinically annotated prostate cancer tissue samples to researchers. To facilitate this effort, it was critical to arrive at agreed upon common data elements (CDEs) that could be used to collect demographic, pathologic, treatment and clinical outcome data. Methods The CPCTR investigators convened a CDE curation subcommittee to develop and implement CDEs for the annotation of collected prostate tissues. The draft CDEs were refined and progressively annotated to make them ISO 11179 compliant. The CDEs were implemented in the CPCTR database and tested using software query tools developed by the investigators. Results By collaborative consensus the CPCTR CDE subcommittee developed 145 data elements to annotate the tissue samples collected. These included for each case: 1) demographic data, 2) clinical history, 3) pathology specimen level elements to describe the staging, grading and other characteristics of individual surgical pathology cases, 4) tissue block level annotation critical to managing a virtual inventory of cases and facilitating case selection, and 5) clinical outcome data including treatment, recurrence and vital status. These elements have been used successfully to respond to over 60 requests by end-users for tissue, including paraffin blocks from cases with 5 to 10 years of follow up, tissue microarrays (TMAs), as well as frozen tissue collected prospectively for genomic profiling and genetic studies. The CPCTR CDEs have been fully implemented in two major tissue banks and have been shared with dozens of other tissue banking efforts. Conclusion The freely available CDEs developed by the CPCTR are robust, based on "best practices" for tissue resources, and are ISO 11179 compliant. The process for CDE development described in this manuscript provides a

  17. Comparison of Prostatic Tissue Processed by Microwave and Conventional Technique Using Morphometry

    PubMed Central

    Jain, Promil; Kumar, Sanjay; Arora, B; Singh, Sneh; Chabbra, Sonia; Sen, Rajeev

    2015-01-01

    Background and Objectives: Rapid processing of histopathological specimens and decreased turnaround time is important to fulfill the needs of clinicians treating sick patients, so the present study was conducted to compare the time taken and quality of sections in processing of prostatic tissue by rapid microwave and conventional techniques using morphometry. Methods: Four to five mm thick paired prostate tissue pieces of fifty cases of prostatectomy specimens were taken. One tissue piece of the pair was processed routinely overnight by conventional tissue processing and the other by microwave processing. Time taken for processing by both conventional technique and microwave technique was noted and compared. Then, both were stained with conventional method of hematoxylin and eosin staining and examined for histological typing and grading. Morphometric study was done on slides of prostatic tissue processed by both conventional and microwave technique. Result: The prostatectomy specimens included both benign (86%) and malignant (14%) prostatic lesions in the age range of 46-85 years. The time taken for steps of dehydration, clearing and impregnation in microwave technique was significantly less as compared to histoprocessing done by conventional technique. Morphology, staining patterns of prostatic tissue processed within minutes by microwave technique, whether benign or malignant, were comparable to those sections which were processed in days using standard technique. Conclusion: Domestic microwave oven can be used for histoprocessing to accelerate the processing with preservation of morphology and is cheaper than commercially available microwave ovens and processing time was considerably reduced from days to minutes. PMID:26516319

  18. Nonylphenol effects on human prostate non tumorigenic cells.

    PubMed

    Forte, Maurizio; Di Lorenzo, Mariana; Carrizzo, Albino; Valiante, Salvatore; Vecchione, Carmine; Laforgia, Vincenza; De Falco, Maria

    2016-05-16

    Nonylphenol (NP) is an industrial chemical with estrogenic activity both in vivo and in vitro; estrogens play a critical role in the development of prostate and may be the cause of some pathological states, including cancer. In this study we examined the effects of NP on human prostate non tumorigenic epithelial cells (PNT1A) investigating on cell proliferation, interaction with estrogen receptors (ERs) and gene expression of genes involved in prostate diseases. We found that NP affects cell proliferation at 10(-6)M, promoting a cytoplasm-nucleus translocation of ERα and not ERβ, like the natural estrogen 17β-estradiol (E2). Moreover, we showed that NP enhances gene expression of key regulators of cell cycle. Estrogen selective antagonist ICI182780 in part reverted the observed effects of NP. These results confirm the estrogenic activity of NP and suggest that other transduction pathways may be involved in NP action on prostate. PMID:27260121

  19. [Brown fat tissue in humans].

    PubMed

    Medvedev, L N; Elsukova, E I

    2002-01-01

    Brown adipose tissue (BAT) is universally present in mammals. Thermal production in such tissue is physiologically important for maintaining temperature homeostasis and regulation of body mass in small-size homoiotherms. At present it is clearly established that unlike other large mammals, brown adipose in man and primates is retained throughout the whole postnatal othogenesis. Therefore, BAT appears as a possible effector of pharmacogenetic protection from human excessive adiposis. Systematic reserach of various functioning aspects of this unique organ of mammals were started abroad as early as 1960-es, and are actively developing at present. Domestic research of energy circulation physiology and of thermoregulation developed mostly outside the brown adipose tissue. Therefore, the principal objective of this publication is to draw attention of experimental and clinical researches to an intriguing aspect of the issue of energy circulation in humans--the issue of brown adipose functioning. PMID:12004574

  20. Multiplexed quantum dot labeling of activated c-Met signaling in castration-resistant human prostate cancer.

    PubMed

    Hu, Peizhen; Chu, Gina C-Y; Zhu, Guodong; Yang, Hua; Luthringer, Daniel; Prins, Gail; Habib, Fouad; Wang, Yuzhuo; Wang, Ruoxiang; Chung, Leland W K; Zhau, Haiyen E

    2011-01-01

    The potential application of multiplexed quantum dot labeling (MQDL) for cancer detection and prognosis and monitoring therapeutic responses has attracted the interests of bioengineers, pathologists and cancer biologists. Many published studies claim that MQDL is effective for cancer biomarker detection and useful in cancer diagnosis and prognosis, these studies have not been standardized against quantitative biochemical and molecular determinations. In the present study, we used a molecularly characterized human prostate cancer cell model exhibiting activated c-Met signaling with epithelial to mesenchymal transition (EMT) and lethal metastatic progression to bone and soft tissues as the gold standard, and compared the c-Met cell signaling network in this model, in clinical human prostate cancer tissue specimens and in a castration-resistant human prostate cancer xenograft model. We observed c-Met signaling network activation, manifested by increased phosphorylated c-Met in all three. The downstream survival signaling network was mediated by NF-κB and Mcl-1 and EMT was driven by receptor activator of NF-κB ligand (RANKL), at the single cell level in clinical prostate cancer specimens and the xenograft model. Results were confirmed by real-time RT-PCR and western blots in a human prostate cancer cell model. MQDL is a powerful tool for assessing biomarker expression and it offers molecular insights into cancer progression at both the cell and tissue level with high degree of sensitivity. PMID:22205960

  1. Tubulosquamous polyps in the vagina. Immunohistochemical comparison with ectopic prostatic tissue and Skene glands.

    PubMed

    Roma, Andres A

    2016-06-01

    Two tubulosquamous polyps arising in the vagina are reported. Both were diffusely positive for GATA3 in the squamous component and focally positive for NKX3.1 in the glandular component, prostate acid phosphatase was focally positive in only 1 case in the glandular component. Both cases were negative for PAX2, PAX8, SALL4, and prostate-specific antigen. In addition, we included 3 cases of cervical squamous-lined cysts most likely representing ectopic prostatic tissue in the cervix and 1 case of paraurethral Skene-type glands to compare the immunophenotype. We analyze this immunoprofile, not previously reported. We also suggest unifying the nomenclature because vaginal Brenner tumors are most likely synonymous with tubulosquamous polyp (TSP) of the vagina. Our findings add support to the postulated origin of TSPs and cervical ectopic prostatic tissue from eutopic or misplaced Skene glands, equivalent of the prostate in the female. NKX3.1 seems a better marker to study and diagnose ectopic prostatic tissue in the cervix as well as TSPs. PMID:27180063

  2. The regulation of adiponectin receptors in human prostate cancer cell lines

    SciTech Connect

    Mistry, T.; Digby, J.E.; Chen, J.; Desai, K.M.; Randeva, H.S. . E-mail: H.Randeva@warwick.ac.uk

    2006-09-29

    Obesity is a risk factor for prostate cancer, and plasma levels of the adipokine, adiponectin, are low in the former but high in the latter. Adiponectin has been shown to modulate cell proliferation and apoptosis, suggesting that adiponectin and its receptors (Adipo-R1, Adipo-R2) may provide a molecular association between obesity and prostate carcinogenesis. We show for First time, the protein distribution of Adipo-R1 and Adipo-R2 in LNCaP and PC3 cells, and in human prostate tissue. Using real-time RT-PCR we provide novel data demonstrating the differential regulation of Adipo-R1 and Adipo-R2 mRNA expression by testosterone, 5-{alpha} dihydrotestosterone, {beta}-estradiol, tumour necrosis factor-{alpha}, leptin, and adiponectin in LNCaP and PC3 cells. Our findings suggest that adiponectin and its receptors may contribute to the molecular association between obesity and prostate cancer through a complex interaction with other hormones and cytokines that also play important roles in the pathophysiology of obesity and prostate cancer.

  3. Inter- and Intra-Observer Variability in Prostate Definition With Tissue Harmonic and Brightness Mode Imaging

    SciTech Connect

    Sandhu, Gurpreet Kaur; Dunscombe, Peter; Meyer, Tyler; Pavamani, Simon; Khan, Rao

    2012-01-01

    Purpose: The objective of this study was to compare the relative utility of tissue harmonic (H) and brightness (B) transrectal ultrasound (TRUS) images of the prostate by studying interobserver and intraobserver variation in prostate delineation. Methods and Materials: Ten patients with early-stage disease were randomly selected. TRUS images of prostates were acquired using B and H modes. The prostates on all images were contoured by an experienced radiation oncologist (RO) and five equally trained observers. The observers were blinded to information regarding patient and imaging mode. The volumes of prostate glands and areas of midgland slices were calculated. Volumes contoured were compared among the observers and between observer group and RO. Contours on one patient were repeated five times by four observers to evaluate the intraobserver variability. Results: A one-sample Student t-test showed the volumes outlined by five observers are in agreement (p > 0.05) with the RO. Paired Student t-test showed prostate volumes (p = 0.008) and midgland areas (p = 0.006) with H mode were significantly smaller than that with B mode. Two-factor analysis of variances showed significant interobserver variability (p < 0.001) in prostate volumes and areas. Inter- and intraobserver consistency was quantified as the standard deviation of mean volumes and areas, and concordance indices. It was found that for small glands ({<=}35 cc) H mode provided greater interobserver consistency; however, for large glands ({>=}35 cc), B mode provided more consistent estimates. Conclusions: H mode provided superior inter- and intraobserver agreement in prostate volume definition for small to medium prostates. In large glands, H mode does not exhibit any additional advantage. Although harmonic imaging has not proven advantageous for all cases, its utilization seems to be judicious for small prostates.

  4. Growth inhibition of human prostate cells in vitro by novel inhibitors of androgen synthesis.

    PubMed

    Klus, G T; Nakamura, J; Li, J S; Ling, Y Z; Son, C; Kemppainen, J A; Wilson, E M; Brodie, A M

    1996-11-01

    The long-standing strategy for the treatment of metastatic prostate cancer has been to reduce androgenic stimulation of tumor growth by removal of the testes, the primary site of testosterone synthesis. However, a low level of androgenic stimulation may continue, even after castration, by the conversion of adrenal androgens to 5alpha-dihydrotestosterone (DHT) in the prostate tumor cells. Two important enzymes of the androgen biosynthetic pathway are 17alpha-hydroxylase/C17,20-lyase, which regulates an early step in the synthesis of testosterone and other androgens in both the testes and adrenal glands, and 5alpha-reductase, which converts testosterone to the more potent androgen, DHT, in the prostate. We have identified new inhibitors of these enzymes that may be of use in achieving a more complete ablation of androgens in the treatment of metastatic prostate cancer. Three derivatives of androstene were shown to inhibit 17alpha-hydroxylase/C17,20-lyase with potencies 2-20-fold greater than that of ketoconazole, a previously established inhibitor of this enzyme. Derivatives of pregnane and pregnene displayed activities against 5alpha-reductase that were comparable to that of N-(1,1-dimethyl-ethyl)-3-oxo-4-aza-5alpha-androst-1-ene-17beta-car boxamide. All of the 5alpha-reductase inhibitors were able to at least partially inhibit the mitogenic effect of testosterone in either histocultures of human benign prostatic hypertrophic tissue or in cultures of the LNCaP human prostatic tumor cell line. For these compounds, it appears that this inhibition can be attributed to a reduction of DHT synthesis in these cultures, because no inhibitory effect was observed in DHT-treated cultures, and none of the compounds had a cytotoxic effect. Surprisingly, one of the inhibitors of 17alpha-hydroxylase/C17,20-lyase, 17beta-(4-imidazolyl)-5-pregnen-3beta-ol, was also able to inhibit the mitogenic effect of testosterone in both the histoculture and cell culture assays and had an effect

  5. Hydrogen sulfide mediates the anti-survival effect of sulforaphane on human prostate cancer cells.

    PubMed

    Pei, Yanxi; Wu, Bo; Cao, Qiuhui; Wu, Lingyun; Yang, Guangdong

    2011-12-15

    Hydrogen sulfide (H(2)S) is a novel gasotransmitter that regulates cell proliferation and other cellular functions. Sulforaphane (SFN) is a sulfur-containing compound that exhibits anticancer properties, and young sprouts of broccoli are particularly rich in SFN. There is consistent epidemiological evidence that the consumption of sulfur-containing vegetables, such as garlic and cruciferous vegetables, may help reduce the occurrence of prostate cancer. Here we found that a large amount of H(2)S is released when SFN is added into cell culture medium or mixed with mouse liver homogenates, respectively. Both SFN and NaHS (a H(2)S donor) decreased the viability of PC-3 cells (a human prostate cancer cell line) in a dose-dependent manner, and supplement of methemoglobin or oxidized glutathione (two H(2)S scavengers) reversed SFN-reduced cell viability. We further found both cystathionine gamma-lyase (CSE) and cystathionine beta-synthase are expressed in PC-3 cells and mouse prostate tissues. H(2)S production in prostate tissues from CSE knockout mice was only 20% of that from wild-type mice, suggesting CSE is a major H(2)S-producing enzyme in prostate. CSE overexpression enhanced H(2)S production and inhibited cell viability in PC-3 cells. In addition, both SFN and NaHS activated p38 mitogen-activated protein kinases (MAPK) and c-Jun N-terminal kinase (JNK). Pre-treatment of PC-3 cells with methemoglobin decreased SFN-stimulated MAPK activities. Suppression of both p38 MAPK and JNK reversed H(2)S- or SFN-reduced viability of PC-3 cells. Our results demonstrated that H(2)S mediates the inhibitory effect of SFN on the proliferation of PC-3 cells, which suggests that H(2)S-releasing diet or drug might be beneficial in the treatment of prostate cancer. PMID:22005276

  6. Thioredoxin 1 in Prostate Tissue Is Associated with Gleason Score, Erythrocyte Antioxidant Enzyme Activity, and Dietary Antioxidants

    PubMed Central

    Vance, Terrence M.; Azabdaftari, Gissou; Pop, Elena A.; Lee, Sang Gil; Su, L. Joseph; Fontham, Elizabeth T. H.; Bensen, Jeannette T.; Steck, Susan E.; Arab, Lenore; Mohler, James L.; Chen, Ming-Hui; Koo, Sung I.; Chun, Ock K.

    2015-01-01

    Background. Prostate cancer is the most common noncutaneous cancer and second leading cause of cancer-related mortality in men in the US. Growing evidence suggests that oxidative stress is involved in prostate cancer. Methods. In this study, thioredoxin 1 (Trx 1), an enzyme and subcellular indicator of redox status, was measured in prostate biopsy tissue from 55 men from the North Carolina-Louisiana Prostate Cancer Project. A pathologist blindly scored levels of Trx 1. The association between Trx 1 and the Gleason score, erythrocyte antioxidant enzyme activity, and dietary antioxidant intake was determined using Fisher's exact test. Results. Trx 1 levels in benign prostate tissue in men with incident prostate cancer were positively associated with the Gleason score (P = 0.01) and inversely associated with dietary antioxidant intake (P = 0.03). In prostate cancer tissue, Trx 1 levels were associated with erythrocyte glutathione peroxidase activity (P = 0.01). No association was found for other erythrocyte enzymes. Greater Gleason score of malignant tissue corresponds to a greater difference in Trx 1 levels between malignant and benign tissue (P = 0.04). Conclusion. These results suggest that the redox status of prostate tissue is associated with prostate cancer grade and both endogenous and exogenous antioxidants. PMID:26357575

  7. Thioredoxin 1 in Prostate Tissue Is Associated with Gleason Score, Erythrocyte Antioxidant Enzyme Activity, and Dietary Antioxidants.

    PubMed

    Vance, Terrence M; Azabdaftari, Gissou; Pop, Elena A; Lee, Sang Gil; Su, L Joseph; Fontham, Elizabeth T H; Bensen, Jeannette T; Steck, Susan E; Arab, Lenore; Mohler, James L; Chen, Ming-Hui; Koo, Sung I; Chun, Ock K

    2015-01-01

    Background. Prostate cancer is the most common noncutaneous cancer and second leading cause of cancer-related mortality in men in the US. Growing evidence suggests that oxidative stress is involved in prostate cancer. Methods. In this study, thioredoxin 1 (Trx 1), an enzyme and subcellular indicator of redox status, was measured in prostate biopsy tissue from 55 men from the North Carolina-Louisiana Prostate Cancer Project. A pathologist blindly scored levels of Trx 1. The association between Trx 1 and the Gleason score, erythrocyte antioxidant enzyme activity, and dietary antioxidant intake was determined using Fisher's exact test. Results. Trx 1 levels in benign prostate tissue in men with incident prostate cancer were positively associated with the Gleason score (P = 0.01) and inversely associated with dietary antioxidant intake (P = 0.03). In prostate cancer tissue, Trx 1 levels were associated with erythrocyte glutathione peroxidase activity (P = 0.01). No association was found for other erythrocyte enzymes. Greater Gleason score of malignant tissue corresponds to a greater difference in Trx 1 levels between malignant and benign tissue (P = 0.04). Conclusion. These results suggest that the redox status of prostate tissue is associated with prostate cancer grade and both endogenous and exogenous antioxidants. PMID:26357575

  8. Capillary Force Seeding of Sphere-Templated Hydrogels for Tissue-Engineered Prostate Cancer Xenografts

    PubMed Central

    Long, Thomas J.; Takeno, Marc; Sprenger, Cynthia C.; Plymate, Stephen R.

    2013-01-01

    Biomaterial-based tissue-engineered tumor models are now widely used in cancer biology studies. However, specific methods for efficient and reliable cell seeding into these and tissue-engineering constructs used for regenerative medicine often remain poorly defined. Here, we describe a capillary force-based method for seeding the human prostate cancer cell lines M12 and LNCaP C4-2 into sphere-templated poly(2-hydroxyethyl methacrylate) hydrogels. The capillary force seeding method improved the cell number and distribution within the porous scaffolds compared to well-established protocols such as static and centrifugation seeding. Seeding efficiency was found to be strongly dependent on the rounded cell diameter relative to the pore diameter and pore interconnect size, parameters that can be controllably modulated during scaffold fabrication. Cell seeding efficiency was evaluated quantitatively using a PicoGreen DNA assay, which demonstrated some variation in cell retention using the capillary force method. When cultured within the porous hydrogels, both cell lines attached and proliferated within the network, but histology showed the formation of a necrotic zone by 7 days likely due to oxygen and nutrient diffusional limitations. The necrotic zone thickness was decreased by dynamically culturing cells in an orbital shaker. Proliferation analysis showed that despite a variable seeding efficiency, by 7 days in culture, scaffolds contained a roughly consistent number of cells as they proliferated to fill the pores of the scaffold. These studies demonstrate that sphere-templated polymeric scaffolds have the potential to serve as an adaptable cell culture substrate for engineering a three-dimensional prostate cancer model. PMID:23373788

  9. Human and murine prostate basal/stem cells are not direct targets of prolactin.

    PubMed

    Sackmann-Sala, Lucila; Angelergues, Antoine; Boutillon, Florence; d'Acremont, Bruno; Maidenberg, Marc; Oudard, Stéphane; Goffin, Vincent

    2015-09-01

    Local overexpression of prolactin (PRL) in the prostate of Pb-PRL transgenic mice induces benign prostate tumors exhibiting marked amplification of the epithelial basal/stem cell compartment. However, PRL-activated intracellular signaling seems to be restricted to luminal cells, suggesting that basal/stem cells may not be direct targets of PRL. Given their described role as prostate cancer-initiating cells, it is important to understand the mechanisms that regulate basal/stem cells. In this study, we evaluated whether PRL can act directly on these cells, by growing them as prostaspheres. For this, primary 3D prostasphere cultures were prepared from unfractionated cells isolated from freshly harvested human and mouse benign prostate tissues and subjected to PRL stimulation in vitro. None of the various concentrations of PRL tested showed any effects on the sizes or numbers of the prostaspheres generated. In addition, neither activation of canonical PRL-induced signaling pathways (Stat5, Stat3 or Erk1/2) nor increased expression of the proliferation marker Ki-67 were detected by immunostaining in PRL-stimulated prostaspheres. Consistent with the absence of response, PRL receptor mRNA levels were generally undetectable in mouse sphere cells. We conclude that human and mouse prostate basal/stem cells are not direct targets of PRL action. The observed amplification of basal/stem cells in Pb-PRL prostates might be due to paracrine mechanisms originating from PRL action on other cell compartments. Our current efforts are aimed at unraveling these mechanisms. PMID:25888939

  10. Distribution of miRNA expression across human tissues.

    PubMed

    Ludwig, Nicole; Leidinger, Petra; Becker, Kurt; Backes, Christina; Fehlmann, Tobias; Pallasch, Christian; Rheinheimer, Steffi; Meder, Benjamin; Stähler, Cord; Meese, Eckart; Keller, Andreas

    2016-05-01

    We present a human miRNA tissue atlas by determining the abundance of 1997 miRNAs in 61 tissue biopsies of different organs from two individuals collected post-mortem. One thousand three hundred sixty-four miRNAs were discovered in at least one tissue, 143 were present in each tissue. To define the distribution of miRNAs, we utilized a tissue specificity index (TSI). The majority of miRNAs (82.9%) fell in a middle TSI range i.e. were neither specific for single tissues (TSI > 0.85) nor housekeeping miRNAs (TSI < 0.5). Nonetheless, we observed many different miRNAs and miRNA families that were predominantly expressed in certain tissues. Clustering of miRNA abundances revealed that tissues like several areas of the brain clustered together. Considering -3p and -5p mature forms we observed miR-150 with different tissue specificity. Analysis of additional lung and prostate biopsies indicated that inter-organism variability was significantly lower than inter-organ variability. Tissue-specific differences between the miRNA patterns appeared not to be significantly altered by storage as shown for heart and lung tissue. MiRNAs TSI values of human tissues were significantly (P = 10(-8)) correlated with those of rats; miRNAs that were highly abundant in certain human tissues were likewise abundant in according rat tissues. We implemented a web-based repository enabling scientists to access and browse the data (https://ccb-web.cs.uni-saarland.de/tissueatlas). PMID:26921406

  11. Distribution of miRNA expression across human tissues

    PubMed Central

    Ludwig, Nicole; Leidinger, Petra; Becker, Kurt; Backes, Christina; Fehlmann, Tobias; Pallasch, Christian; Rheinheimer, Steffi; Meder, Benjamin; Stähler, Cord; Meese, Eckart; Keller, Andreas

    2016-01-01

    We present a human miRNA tissue atlas by determining the abundance of 1997 miRNAs in 61 tissue biopsies of different organs from two individuals collected post-mortem. One thousand three hundred sixty-four miRNAs were discovered in at least one tissue, 143 were present in each tissue. To define the distribution of miRNAs, we utilized a tissue specificity index (TSI). The majority of miRNAs (82.9%) fell in a middle TSI range i.e. were neither specific for single tissues (TSI > 0.85) nor housekeeping miRNAs (TSI < 0.5). Nonetheless, we observed many different miRNAs and miRNA families that were predominantly expressed in certain tissues. Clustering of miRNA abundances revealed that tissues like several areas of the brain clustered together. Considering -3p and -5p mature forms we observed miR-150 with different tissue specificity. Analysis of additional lung and prostate biopsies indicated that inter-organism variability was significantly lower than inter-organ variability. Tissue-specific differences between the miRNA patterns appeared not to be significantly altered by storage as shown for heart and lung tissue. MiRNAs TSI values of human tissues were significantly (P = 10−8) correlated with those of rats; miRNAs that were highly abundant in certain human tissues were likewise abundant in according rat tissues. We implemented a web-based repository enabling scientists to access and browse the data (https://ccb-web.cs.uni-saarland.de/tissueatlas). PMID:26921406

  12. Localization and physical mapping of the prostate-specific membrane antigen (PSM) gene to human chromosome 11

    SciTech Connect

    Rinker-Schaeffer, C.W.; Hawkins, A.L.; Griffin, C.A.; Isaacs, J.T.

    1995-11-01

    The prostate-specific membrane antigen (PSM) was identified by the monoclonal antibody 7E11-C5.3, which was raised against the human prostatic carcinoma cell line LNCaP. The PSM antigen is expressed by normal, neoplastic, and metastatic prostatic tissues. The 2.65-kb cDNA encoding the 100-kDa PSM glycoprotein was cloned from LNCaP cells. Studies have shown that the expression of PSM is tissue-specific. In the present study monochromosomal somatic cell hybrids were used to localize the PSM gene to human chromosome 11. Using this information, initial mapping studies identified two potential PSM gene loci at 11p11.1-p13 and 11q14. Further high-stringency analysis using cosmid probes identified the 11q14 region as the location of the PSM gene. 10 refs., 2 figs.

  13. Vitamin D Receptor Protein Expression in Tumor Tissue and Prostate Cancer Progression

    PubMed Central

    Hendrickson, Whitney K.; Flavin, Richard; Kasperzyk, Julie L.; Fiorentino, Michelangelo; Fang, Fang; Lis, Rosina; Fiore, Christopher; Penney, Kathryn L.; Ma, Jing; Kantoff, Philip W.; Stampfer, Meir J.; Loda, Massimo; Mucci, Lorelei A.; Giovannucci, Edward

    2011-01-01

    Purpose Data suggest that circulating 25-hydroxyvitamin D [25(OH)D] interacts with the vitamin D receptor (VDR) to decrease proliferation and increase apoptosis for some malignancies, although evidence for prostate cancer is less clear. How VDR expression in tumor tissue may influence prostate cancer progression has not been evaluated in large studies. Patients and Methods We examined protein expression of VDR in tumor tissue among 841 patients with prostate cancer in relation to risk of lethal prostate cancer within two prospective cohorts, the Physicians' Health Study and Health Professionals Follow-Up Study. We also examined the association of VDR expression with prediagnostic circulating 25(OH)D and 1,25-dihydroxyvitamin D levels and with two VDR single nucleotide polymorphisms, FokI and BsmI. Results Men whose tumors had high VDR expression had significantly lower prostate-specific antigen (PSA) at diagnosis (P for trend < .001), lower Gleason score (P for trend < .001), and less advanced tumor stage (P for trend < .001) and were more likely to have tumors harboring the TMPRSS2:ERG fusion (P for trend = .009). Compared with the lowest quartile, men whose tumors had the highest VDR expression had significantly reduced risk of lethal prostate cancer (hazard ratio [HR], 0.17; 95% CI, 0.07 to 0.41). This association was only slightly attenuated after adjustment for Gleason score and PSA at diagnosis (HR, 0.33; 95% CI, 0.13 to 0.83) or, additionally, for tumor stage (HR, 0.37; 95% CI, 0.14 to 0.94). Neither prediagnostic plasma vitamin D levels nor VDR polymorphisms were associated with VDR expression. Conclusion High VDR expression in prostate tumors is associated with a reduced risk of lethal cancer, suggesting a role of the vitamin D pathway in prostate cancer progression. PMID:21537045

  14. Production and Characterization of Monoclonal Antibodies against Human Prostate Specific Antigen

    PubMed Central

    Bayat, Ali Ahmad; Ghods, Roya; Shabani, Mahdi; Mahmoudi, Ahmad Reza; Yeganeh, Omid; Hassannia, Hadi; Sadeghitabar, Ali; Balay-Goli, Leila; Noutash-Haghighat, Farzaneh; Sarrafzadeh, Ali reza; Jeddi-Tehrani, Mahmood

    2015-01-01

    Background Prostate Specific Antigen (PSA) is an important laboratory marker for diagnosis of prostatic cancer. Thus, development of diagnostic tools specific for PSA plays an important role in screening, monitoring and early diagnosis of prostate cancer. In this paper, the production and characterization of a panel of murine monoclonal antibodies (mAbs) against PSA have been presented. Methods Balb/c mice were immunized with PSA, which was purified from seminal plasma. Splenocytes of hyperimmunized mice were extracted and fused with Sp2/0 cells. By adding selective HAT medium, hybridoma cells were established and positive clones were selected by ELISA after four times of cloning. The isotypes of produced mAbs were determined by ELISA and then purified from ascitic fluids using Hi-Trap protein G column. The reactivities of the mAbs were examined with the purified PSA and seminal plasma by ELISA and western blot techniques. Furthermore, the reactivities of the mAbs were assessed in Prostate Cancer (PCa), Benign Prostatic Hyperplasia (BPH) and brain cancer tissues by Immunohistochemistry (IHC). Results Five anti-PSA mAbs (clones: 2G2-B2, 2F9-F4, 2D6-E8, IgG1/К) and clones (2C8-E9, 2G3-E2, IgG2a/К) were produced and characterized. All mAbs, except 2F9-F4 detected the expression of PSA in PCa and BPH tissues and none of them reacted with PSA in brain cancer tissue in IHC. Besides, all mAbs could detect a protein band around 33 kDa in human seminal plasma in western blot. Conclusion These mAbs can specifically recognize PSA and may serve as a component of PSA diagnostic kit in various biological fluids. PMID:25926946

  15. A Double Blind, Randomized, Neoadjuvant Study of the Tissue effects of POMx Pills in Men with Prostate Cancer Prior to Radical Prostatectomy

    PubMed Central

    Freedland, Stephen J.; Carducci, Michael; Kroeger, Nils; Partin, Alan; Rao, Jian-yu; Jin, Yusheng; Kerkoutian, Susan; Wu, Hong; Li, Yunfeng; Creel, Patricia; Mundy, Kelly; Gurganus, Robin; Fedor, Helen; King, Serina A.; Zhang, Yanjun; Heber, David; Pantuck, Allan J.

    2013-01-01

    Pomegranates slow prostate cancer xenograft growth and prolong PSA doubling times in single-arm human studies. Pomegranates’ effects on human prostate tissue are understudied. We hypothesized orally administered pomegranate extract (POMx; PomWonderful, Los Angeles, CA) would lower tissue 8-hydroxy-2-deoxyguanosine (8-OHdG), an oxidative stress biomarker. 70 men were randomized to 2 tablets POMx or placebo daily up to 4 weeks prior to radical prostatectomy. Tissue was analyzed for intra-prostatic Urolithin A, a pomegranate metabolite, benign and malignant 8-OHdG, and cancer pS6 kinase, NFκB, and Ki67. Primary end-point was differences in 8-OHdG powered to detect 30% reduction. POMx was associated with 16% lower benign tissue 8-OHdG (p=0.095), which was not statistically significant. POMx was well-tolerated with no treatment-related withdrawals. There were no differences in baseline clinicopathological features between arms. Urolithin A was detected in 21/33 patient in the POMx group vs. 12/35 in the placebo group (p=0.031). Cancer pS6 kinase, NFκB, Ki67, and serum PSA changes were similar between arms. POMx prior to surgery results in pomegranate metabolite accumulation in prostate tissues. Our primary end-point in this modest-sized short-term trial was negative. Future larger longer studies are needed to more definitely test whether POMx reduces prostate oxidative stress as well as further animal testing to better understand the multiple mechanisms through which POMx may alter prostate cancer biology. PMID:23985577

  16. Online Image-based Monitoring of Soft-tissue Displacements for Radiation Therapy of the Prostate

    SciTech Connect

    Schlosser, Jeffrey; Salisbury, Kenneth; Hristov, Dimitre

    2012-08-01

    Purpose: Emerging prolonged, hypofractionated radiotherapy regimens rely on high-dose conformality to minimize toxicity and thus can benefit from image guidance systems that continuously monitor target position during beam delivery. To address this need we previously developed, as a potential add-on device for existing linear accelerators, a novel telerobotic ultrasound system capable of real-time, soft-tissue imaging. Expanding on this capability, the aim of this work was to develop and characterize an image-based technique for real-time detection of prostate displacements. Methods and Materials: Image processing techniques were implemented on spatially localized ultrasound images to generate two parameters representing prostate displacements in real time. In a phantom and five volunteers, soft-tissue targets were continuously imaged with a customized robotic manipulator while recording the two tissue displacement parameters (TDPs). Variations of the TDPs in the absence of tissue displacements were evaluated, as was the sensitivity of the TDPs to prostate translations and rotations. Robustness of the approach to probe force was also investigated. Results: With 95% confidence, the proposed method detected in vivo prostate displacements before they exceeded 2.3, 2.5, and 2.8 mm in anteroposterior, superoinferior, and mediolateral directions. Prostate pitch was detected before exceeding 4.7 Degree-Sign at 95% confidence. Total system time lag averaged 173 ms, mostly limited by ultrasound acquisition rate. False positives (FPs) (FP) in the absence of displacements did not exceed 1.5 FP events per 10 min of continuous in vivo imaging time. Conclusions: The feasibility of using telerobotic ultrasound for real-time, soft-tissue-based monitoring of target displacements was confirmed in vivo. Such monitoring has the potential to detect small clinically relevant intrafractional variations of the prostate position during beam delivery.

  17. Effect of anthralin on cell viability in human prostate adenocarcinoma.

    PubMed

    Raevskaya, A A; Gorbunova, S L; Savvateeva, M V; Severin, S E; Kirpichnikov, M P

    2012-07-01

    The study revealed the key role of serine protease hepsin activity in transition of in situ prostate adenocarcinoma into the metastasizing form. Inhibition of hepsin activity suppresses the invasive growth of the tumor. Hepsin is an convenient target for pharmacological agents, so the study of its inhibitory mechanisms is a promising avenue in drug development. Assay of proteolytic activity in various tumor cell lines in vitro showed that this activity in prostate adenocarcinoma cells significantly surpasses proteolytic activity in other examined tumor cell lines. Selective cytotoxic action of anthralin, an inhibitor of hepsin activity, on human adenocarcinoma cells was demonstrated in comparison with other tumor cell lines. PMID:22866312

  18. SEM and X-ray microanalysis of human prostatic calculi

    SciTech Connect

    Vilches, J.; Lopez, A.; De Palacio, L.; Munoz, C.; Gomez, J.

    1982-02-01

    Calculi removed from human prostates affected with nodular hyperplasia were analyzed with scanning electron microscopy and EDAX system. The general spectrum was made up of Na, Al, Mg, S, P, Ca and Zn. Two types of stone were identified morphostructurally and microanalytically: calculi type I of nodular surface with high peaks of S, and calculi type II polyfaceted with high peaks of P and Ca. Their formation from corpora amylacea and/or exogenous constituents is discussed. The superficial deposit of Zn suggests its incorporation from the prostatic liquid and does not seem to play an important role in the genesis.

  19. Diffusion optical spectroscopy of cancerous and normal prostate tissues in time-resolved and frequency domain

    NASA Astrophysics Data System (ADS)

    Zhou, Kenneth J.; Pu, Yang; Chen, Jun

    2014-03-01

    It is well-known that light transport can be well described using Maxwell's electromagnetic theory. In biological tissue, the scattering particles cause the interaction of scattered waves from neighboring particles. Since such interaction cannot be ignored, multiple scattering occurs. The theoretical solution of multiple scattering is complicated. A suitable description is that the wavelike behavior of light is ignored and the transport of an individual photon is considered to be absorbed or scattered. This is known as the Radiative Transfer Equation (RTE) theory. Analytical solutions to the RTE that explicitly describes photon migration can be obtained by introducing some proper approximations. One of the most popular models used in the field of tissue optics is the Diffusion Approximation (DA). In this study, we report on the results of our initial study of optical properties of ex vivo normal and cancerous prostate tissues and how tissue parameters affect the near infrared light transporting in the two types of tissues. The time-resolved transport of light is simulated as an impulse isotropic point source of energy within a homogeneous unbounded medium with different absorption and scattering properties of cancerous and normal prostate tissues. Light source is also modulated sinusoidally to yield a varied fluence rate in frequency domain at a distant observation point within the cancerous and normal prostate tissues. Due to difference of the absorption and scattering coefficients between cancerous and normal tissues, the expansion of light pulse, intensity, phase are found to be different.

  20. Elevated expression of HIF-lα in actively growing prostate tissues is associated with clinical features of benign prostatic hyperplasia

    PubMed Central

    Li, Xin; Wang, Hui; Liu, Shuai; Wu, Haihu; Bi, Dongbin; Ding, Kejia; Lu, Jiaju

    2016-01-01

    Background Benign prostatic hyperplasia (BPH) is one of the most common diseases in middle-age or older men. Increasing evidence has shown that BPH is associated with hypoxia microenvironment. Methods We retrospectively collected patient data and tissue samples from fetal prostates(FP), normal prostates(NP), intra-acinar of BPH, peri-acinar of BPH, prostate cancers and sarcomas of prostate. The expression of HIF-1α, as well as VEGF was visualized by immunohistochemistry and statistically analyzed with clinical parameters. Results Expression of HIF-lα was observed in intra-acinar of BPH (69.5%), prostate cancer (85.7%) and all FPs, while NP and peri-acinar of BPH tissues were all stained negative. HIF-lα levels in FPs and the malignant tumors were higher than BPH tissues(p < 0.05), and the expression of HIF-lα in intra-acinar of BPH was higher than NP and peri-acinar of BPH (p < 0.05). The expression of HIF-lα was correlated with the weight of intra-acinar of prostate (p < 0.05). And patients with prostate weight larger that 72.45g were prone to have HIF-lα moderate-positive expression, according to the ROC curve (AUC = 0.734, 95%CI = 0.630-0.838). Moreover, the risk of acute urine retention (AUR) for HIF-lα moderate-positive patients increased significantly (OR=5.517, 95%CI = 2.434-12.504). Conclusions HIF-lα expression is increased in highly proliferative prostate tissues and correlated with the weight of intra-acinar prostate. Moreover, HIF-lα is also an independent risk factor for AUR occurrence in BPH patients. PMID:26919249

  1. Interaction between high power 532nm laser and prostatic tissue: in vivo evaluation for laser prostatectomy

    NASA Astrophysics Data System (ADS)

    Malek, Reza; Kang, Hyun Wook; Peng, Steven Yihlih; Stinson, Douglas; Beck, Michael; Koullick, Ed

    2011-03-01

    A previous in vitro study demonstrated that 180W was the optimal power to reduce photoselective vaporization of the prostate (PVP) time for larger prostate glands. In this study, we investigated anatomic and histologic outcomes and ablation parameters of 180W laser performed with a new 750-μm side-firing fiber in a survival study of living canines. Eight male canines underwent anterograde PVP with the 180W 532-nm laser. Four each animals were euthanized 3 hours or 8 weeks postoperatively. Prostates were measured and histologically analyzed after hematoxylin and eosin (H&E), triphenyltetrazolium chloride (TTC), or Gomori trichrome (GT) staining. Compared to the previous 120W laser, PVP with the 180W laser bloodlessly created a 76% larger cavity (mean 11.8 vs. 6.7 cm3; p=0.014) and ablated tissue at a 77% higher rate (mean 2.3 vs. 1.3 cm3/min; p=0.03) while H&E- and TTC-staining demonstrated its 33% thicker mean coagulation zone (2.0+/-0.4 vs. 1.5+/-0.3 mm). H&E-stained cross-sectional prostatic tissue specimens from the 3-hour (acute) group showed histologic evolution of concentric non-viable coagulation zone, partially viable hyperemic transition zone of repair, and viable non-treated zone. H&E- and GT-stained specimens from the 8-week (chronic) group revealed healed circumferentially epithelialized, non-edematous, prostatic urethral channels with no increase in collagen in the subjacent prostatic tissue vis-á-vis the normal control. Our canine study demonstrates that 180W 532-nm laser PVP with its new fiber has a significantly higher ablation rate with a more hemostatic coagulation zone, but equally favorable tissue interaction and healing, compared with our previous 120W canine study.

  2. Expression of tmp21 in normal adult human tissues

    PubMed Central

    Xie, Jian; Yang, Yuan; Li, Jianbo; Hou, Jing; Xia, Kun; Song, Weihong; Liu, Shengchun

    2014-01-01

    TMP21, known as p23 protein, is one important member of the p24 protein families. The degradation of TMP21 is mediated by the ubiquitin-proteasome pathway, as with the other presenilin-associated γ-secretase complex members. NFAT plays a very important role in regulation of human TMP21 gene expression. Compared with the function of TMP21, the studies about the distribution of this protein in human tissues are limited. We collected 19 normal adult human tissues from a healthy adult man died in a traffic accident and did examination of all the tissues collected for ICH, western blot and RT-PCR. It was shown that the expression of TMP21 is at high levels in heart, liver, lung, kidney and adrenal gland; moderate levels in brain, pancreas, prostate gland, testicle, small intestine, colon, stomach, gall bladder, thyroid gland and trachea; low levels in skeletal muscle, skin and lymphonodus. TMP21 is widely existed in normal adult human tissues. The current study provided for the first time a comprehensive expression of TMP21 in normal adult human tissues. It will benefit on helping in the design and interpretation of future studies focused on expounding the function of TMP21. PMID:25356171

  3. Tissue composition and density impact on the clinical parameters for (125)I prostate implants dosimetry.

    PubMed

    Oliveira, Susana Maria; Teixeira, Nuno José; Fernandes, Lisete; Teles, Pedro; Vieira, Guy; Vaz, Pedro

    2014-11-01

    The MCNPX code was used to calculate the TG-43U1 recommended parameters in water and prostate tissue in order to quantify the dosimetric impact in 30 patients treated with (125)I prostate implants when replacing the TG-43U1 formalism parameters calculated in water by a prostate-like medium in the planning system (PS) and to evaluate the uncertainties associated with Monte Carlo (MC) calculations. The prostate density was obtained from the CT of 100 patients with prostate cancer. The deviations between our results for water and the TG-43U1 consensus dataset values were -2.6% for prostate V100, -13.0% for V150, and -5.8% for D90; -2.0% for rectum V100, and -5.1% for D0.1; -5.0% for urethra D10, and -5.1% for D30. The same differences between our water and prostate results were all under 0.3%. Uncertainties estimations were up to 2.9% for the gL(r) function, 13.4% for the F(r,θ) function and 7.0% for Λ, mainly due to seed geometry uncertainties. Uncertainties in extracting the TG-43U1 parameters in the MC simulations as well as in the literature comparison are of the same order of magnitude as the differences between dose distributions computed for water and prostate-like medium. The selection of the parameters for the PS should be done carefully, as it may considerably affect the dose distributions. The seeds internal geometry uncertainties are a major limiting factor in the MC parameters deduction. PMID:25239870

  4. Tissue mimicking materials for the detection of prostate cancer using shear wave elastography: A validation study

    PubMed Central

    Cao, Rui; Huang, Zhihong; Varghese, Tomy; Nabi, Ghulam

    2013-01-01

    Purpose: Quantification of stiffness changes may provide important diagnostic information and aid in the early detection of cancers. Shear wave elastography is an imaging technique that assesses tissue stiffness using acoustic radiation force as an alternate to manual palpation reported previously with quasistatic elastography. In this study, the elastic properties of tissue mimicking materials, including agar, polyacrylamide (PAA), and silicone, are evaluated with an objective to determine material characteristics which resemble normal and cancerous prostate tissue. Methods: Acoustic properties and stiffness of tissue mimicking phantoms were measured using compressional mechanical testing and shear wave elastography using supersonic shear imaging. The latter is based on the principles of shear waves generated using acoustic radiation force. The evaluation included tissue mimicking materials (TMMs) within the prostate at different positions and sizes that could mimic cancerous and normal prostate tissue. Patient data on normal and prostate cancer tissues quantified using biopsy histopathology were used to validate the findings. Pathologist reports on histopathology were blinded to mechanical testing and elastographic findings. Results: Young's modulus values of 86.2 ± 4.5 and 271.5 ± 25.7 kPa were obtained for PAA mixed with 2% Al2O3 particles and silicone, respectively. Young's modulus of TMMs from mechanical compression testing showed a clear trend of increasing stiffness with an increasing percentage of agar. The silicone material had higher stiffness values when compared with PAA with Al2O3. The mean Young's modulus value in cancerous tissue was 90.5 ± 4.5 kPa as compared to 93.8 ± 4.4 and 86.2 ± 4.5 kPa obtained with PAA with 2% Al2O3 phantom at a depth of 52.4 and 36.6 mm, respectively. Conclusions: PAA mixed with Al2O3 provides the most suitable tissue mimicking material for prostate cancer tumor material, while agar could form the surrounding

  5. Deep RNA sequencing analysis of readthrough gene fusions in human prostate adenocarcinoma and reference samples

    PubMed Central

    2011-01-01

    Background Readthrough fusions across adjacent genes in the genome, or transcription-induced chimeras (TICs), have been estimated using expressed sequence tag (EST) libraries to involve 4-6% of all genes. Deep transcriptional sequencing (RNA-Seq) now makes it possible to study the occurrence and expression levels of TICs in individual samples across the genome. Methods We performed single-end RNA-Seq on three human prostate adenocarcinoma samples and their corresponding normal tissues, as well as brain and universal reference samples. We developed two bioinformatics methods to specifically identify TIC events: a targeted alignment method using artificial exon-exon junctions within 200,000 bp from adjacent genes, and genomic alignment allowing splicing within individual reads. We performed further experimental verification and characterization of selected TIC and fusion events using quantitative RT-PCR and comparative genomic hybridization microarrays. Results Targeted alignment against artificial exon-exon junctions yielded 339 distinct TIC events, including 32 gene pairs with multiple isoforms. The false discovery rate was estimated to be 1.5%. Spliced alignment to the genome was less sensitive, finding only 18% of those found by targeted alignment in 33-nt reads and 59% of those in 50-nt reads. However, spliced alignment revealed 30 cases of TICs with intervening exons, in addition to distant inversions, scrambled genes, and translocations. Our findings increase the catalog of observed TIC gene pairs by 66%. We verified 6 of 6 predicted TICs in all prostate samples, and 2 of 5 predicted novel distant gene fusions, both private events among 54 prostate tumor samples tested. Expression of TICs correlates with that of the upstream gene, which can explain the prostate-specific pattern of some TIC events and the restriction of the SLC45A3-ELK4 e4-e2 TIC to ERG-negative prostate samples, as confirmed in 20 matched prostate tumor and normal samples and 9 lung cancer

  6. Tookad-mediated photodynamic effects on the prostate and its adjacent tissues: in vivo study in canine models

    NASA Astrophysics Data System (ADS)

    Huang, Zheng; Chen, Qun; Luck, David; Beckers, Jill; Blanc, Dominique; Hetzel, Fred W.

    2005-04-01

    Photodynamic therapy (PDT) mediated with a vascular acting photosensitizer Tookad (pd-bacteriopheophorbide), was investigated as an alternative treatment modality for prostate cancer. Tookad photodynamic effects on the prostate and its adjacent tissues were evaluated in canine models. Interstitial prostate PDT was performed by irradiating individual lobes with a diode laser (763 nm) and 1-cm cylindrical diffuser fibers at various light doses to activate the IV administered photosensitizer Tookad (1 - 2 mg/kg). The sensitivity of the adjacent tissues to Tookad-PDT was determined by superficially irradiating the surfaces of the bladder, colon, abdominal muscle and pelvic plexus with a microlens fiber at various drug/light doses. PDT effect on the prostatic urethra was evaluated by transurethral irradiation. The prostate and adjacent tissues were harvested one-week after the treatment and subjected to histopathologic examination. At one-week post interstitial prostate PDT, the animals recovered well with little or no urethral complications. PDT induced prostate lesions were characterized by marked hemorrhagic necrosis. The bladder, colon, abdominal muscle and pelvic plexus, appeared to also be sensitive to Tookad-PDT at light dose levels greater than 40 Jcm2. Urethral mucosa appeared less sensitive to Tookad-PDT. In conclusion, Tookad-mediated PDT demonstrates very strong vascular effects and can provide an effective alternative for the treatment of localized prostate cancer. Protection of the adjacent tissues should be taken into consideration in the total prostate ablation process due to their sensitivity to the Tookad-mediated PDT.

  7. Glucocorticoid receptor antagonism reverts docetaxel resistance in human prostate cancer

    PubMed Central

    Kroon, Jan; Puhr, Martin; Buijs, Jeroen T; van der Horst, Geertje; Hemmer, Daniëlle M; Marijt, Koen A; Hwang, Ming S; Masood, Motasim; Grimm, Stefan; Storm, Gert; Metselaar, Josbert M; Meijer, Onno C; Culig, Zoran; van der Pluijm, Gabri

    2016-01-01

    Resistance to docetaxel is a major clinical problem in advanced prostate cancer (PCa). Although glucocorticoids (GCs) are frequently used in combination with docetaxel, it is unclear to what extent GCs and their receptor, the glucocorticoid receptor (GR), contribute to the chemotherapy resistance. In this study, we aim to elucidate the role of the GR in docetaxel-resistant PCa in order to improve the current PCa therapies. GR expression was analyzed in a tissue microarray of primary PCa specimens from chemonaive and docetaxel-treated patients, and in cultured PCa cell lines with an acquired docetaxel resistance (PC3-DR, DU145-DR, and 22Rv1-DR). We found a robust overexpression of the GR in primary PCa from docetaxel-treated patients and enhanced GR levels in cultured docetaxel-resistant human PCa cells, indicating a key role of the GR in docetaxel resistance. The capability of the GR antagonists (RU-486 and cyproterone acetate) to revert docetaxel resistance was investigated and revealed significant resensitization of docetaxel-resistant PCa cells for docetaxel treatment in a dose- and time-dependent manner, in which a complete restoration of docetaxel sensitivity was achieved in both androgen receptor (AR)-negative and AR-positive cell lines. Mechanistically, we demonstrated down-regulation of Bcl-xL and Bcl-2 upon GR antagonism, thereby defining potential treatment targets. In conclusion, we describe the involvement of the GR in the acquisition of docetaxel resistance in human PCa. Therapeutic targeting of the GR effectively resensitizes docetaxel-resistant PCa cells. These findings warrant further investigation of the clinical utility of the GR antagonists in the management of patients with advanced and docetaxel-resistant PCa. PMID:26483423

  8. Identification of candidate genes for prostate cancer-risk SNPs utilizing a normal prostate tissue eQTL data set

    PubMed Central

    Thibodeau, S. N.; French, A. J.; McDonnell, S. K.; Cheville, J.; Middha, S.; Tillmans, L.; Riska, S.; Baheti, S.; Larson, M. C.; Fogarty, Z.; Zhang, Y.; Larson, N.; Nair, A.; O'Brien, D.; Wang, L.; Schaid, D J.

    2015-01-01

    Multiple studies have identified loci associated with the risk of developing prostate cancer but the associated genes are not well studied. Here we create a normal prostate tissue-specific eQTL data set and apply this data set to previously identified prostate cancer (PrCa)-risk SNPs in an effort to identify candidate target genes. The eQTL data set is constructed by the genotyping and RNA sequencing of 471 samples. We focus on 146 PrCa-risk SNPs, including all SNPs in linkage disequilibrium with each risk SNP, resulting in 100 unique risk intervals. We analyse cis-acting associations where the transcript is located within 2 Mb (±1 Mb) of the risk SNP interval. Of all SNP–gene combinations tested, 41.7% of SNPs demonstrate a significant eQTL signal after adjustment for sample histology and 14 expression principal component covariates. Of the 100 PrCa-risk intervals, 51 have a significant eQTL signal and these are associated with 88 genes. This study provides a rich resource to study biological mechanisms underlying genetic risk to PrCa. PMID:26611117

  9. Radiation Effect on Human Tissue

    NASA Technical Reports Server (NTRS)

    Richmond, Robert C.; Cruz, Angela; Bors, Karen; Curreri, Peter A. (Technical Monitor)

    2002-01-01

    Predicting the occurrence of human cancer following exposure of an epidemiologic population to any agent causing genetic damage is a difficult task. To an approximation, this is because the uncertainty of uniform exposure to the damaging agent, and the uncertainty of uniform processing of that damage within a complex set of biological variables, degrade the confidence of predicting the delayed expression of cancer as a relatively rare event within clinically normal individuals. This situation begs the need for alternate controlled experimental models that are predictive for the development of human cancer following exposures to agents causing genetic damage. Such models historically have not been of substantial proven value. It is more recently encouraging, however, that developments in molecular and cell biology have led to an expanded knowledge of human carcinogenesis, and of molecular markers associated with that process. It is therefore appropriate to consider new laboratory models developed to accomodate that expanded knowledge in order to assess the cancer risks associated with exposures to genotoxic agents. When ionizing radiation of space is the genotoxic agent, then a series of additional considerations for human cancer risk assessment must also be applied. These include the dose of radiation absorbed by tissue at different locations in the body, the quality of the absorbed radiation, the rate at which absorbed dose accumulates in tissue, the way in which absorbed dose is measured and calculated, and the alterations in incident radiation caused by shielding materials. It is clear that human cancer risk assessment for damage caused by ionizing radiation is a multidisciplinary responsibility, and that within this responsibility no single discipline can hold disproportionate sway if a risk assessment model of radiation-induced human cancer is to be developed that has proven value. Biomolecular and cellular markers from the work reported here are considered

  10. Telomerase-immortalized non-malignant human prostate epithelial cells retain the properties of multipotent stem cells

    SciTech Connect

    Li Hongzhen; Zhou Jianjun; Miki, Jun; Furusato, Bungo; Gu Yongpeng; Srivastava, Shiv; McLeod, David G.; Vogel, Jonathan C.; Rhim, Johng S.

    2008-01-01

    Understanding prostate stem cells may provide insight into the origin of prostate cancer. Primary cells have been cultured from human prostate tissue but they usually survive only 15-20 population doublings before undergoing senescence. We report here that RC-170N/h/clone 7 cells, a clonal cell line from hTERT-immortalized primary non-malignant tissue-derived human prostate epithelial cell line (RC170N/h), retain multipotent stem cell properties. The RC-170N/h/clone 7 cells expressed a human embryonic stem cell marker, Oct-4, and potential prostate epithelial stem cell markers, CD133, integrin {alpha}2{beta}1{sup hi} and CD44. The RC-170N/h/clone 7 cells proliferated in KGM and Dulbecco's Modified Eagle Medium with 10% fetal bovine serum and 5 {mu}g/ml insulin (DMEM + 10% FBS + Ins.) medium, and differentiated into epithelial stem cells that expressed epithelial cell markers, including CK5/14, CD44, p63 and cytokeratin 18 (CK18); as well as the mesenchymal cell markers, vimentin, desmin; the neuron and neuroendocrine cell marker, chromogranin A. Furthermore the RC170 N/h/clone 7 cells differentiated into multi tissues when transplanted into the sub-renal capsule and subcutaneously of NOD-SCID mice. The results indicate that RC170N/h/clone 7 cells retain the properties of multipotent stem cells and will be useful as a novel cell model for studying the mechanisms of human prostate stem cell differentiation and transformation.

  11. Impact of pre-treatment prostate tissue androgen content on the prediction of castration-resistant prostate cancer development in patients treated with primary androgen deprivation therapy.

    PubMed

    Shibata, Y; Suzuki, K; Arai, S; Miyoshi, Y; Umemoto, S; Masumori, N; Kamiya, N; Ichikawa, T; Kitagawa, Y; Mizokami, A; Sugimura, Y; Nonomura, N; Sakai, H; Honma, S; Kubota, Y

    2013-05-01

    Great advances in tissue androgen analysis using liquid chromatography-tandem mass spectrometry (LC-MS/MS) have made it possible to evaluate the tissue androgen content from a single needle prostate biopsy specimen. In this study, we investigated if pre-treatment androgen content in prostate biopsy specimens could predict their response to primary androgen deprivation therapy (ADT) and future castration-resistant prostate cancer (CRPC). One-hundred and sixty-five prostate cancer patients who received primary ADT were enrolled. They had received multiple core prostate needle biopsy at diagnosis, and an additional one needle biopsy specimen was obtained for tissue androgen determination using LC-MS/MS. The patients' prostate specific antigen (PSA) values were periodically followed during the treatment and patients were determined to have CRPC when their PSA value increased continuously to 25% above the nadir and a 2.0 ng/mL increase. A significant correlation was found between PSA value decline velocity (PSA half-time) after ADT and pre-ADT tissue androgen content. Twenty-three patients were determined to have CRPC. These CRPC patients had a significantly high concentration of tissue T (p < 0.01) and low concentration of tissue 5α-dihydrotestosterone (DHT) (p < 0.01), resulting in a higher tissue T/DHT ratio (p < 0.001). A multivariate Cox proportional hazard model revealed the pre-ADT tissue T/DHT ratio and Gleason score as independent predictors for CRPC development. By using the two statistically significant variables, the relative risk of CRPC development could be calculated. The results of this study suggest that the evaluation of prostate androgen content in a single needle biopsy specimen may be useful to predict future CRPC development after primary ADT. Further studies are required for the clinical application of T/DHT ratio evaluation. PMID:23444052

  12. Prostate tissue decomposition via DECT using the model based iterative image reconstruction algorithm DIRA

    NASA Astrophysics Data System (ADS)

    Malusek, Alexandr; Magnusson, Maria; Sandborg, Michael; Westin, Robin; Alm Carlsson, Gudrun

    2014-03-01

    Better knowledge of elemental composition of patient tissues may improve the accuracy of absorbed dose delivery in brachytherapy. Deficiencies of water-based protocols have been recognized and work is ongoing to implement patient-specific radiation treatment protocols. A model based iterative image reconstruction algorithm DIRA has been developed by the authors to automatically decompose patient tissues to two or three base components via dual-energy computed tomography. Performance of an updated version of DIRA was evaluated for the determination of prostate calcification. A computer simulation using an anthropomorphic phantom showed that the mass fraction of calcium in the prostate tissue was determined with accuracy better than 9%. The calculated mass fraction was little affected by the choice of the material triplet for the surrounding soft tissue. Relative differences between true and approximated values of linear attenuation coefficient and mass energy absorption coefficient for the prostate tissue were less than 6% for photon energies from 1 keV to 2 MeV. The results indicate that DIRA has the potential to improve the accuracy of dose delivery in brachytherapy despite the fact that base material triplets only approximate surrounding soft tissues.

  13. Simulation and experiment of soft-tissue deformation in prostate brachytherapy.

    PubMed

    Liang, Dong; Jiang, Shan; Yang, Zhiyong; Wang, Xingji

    2016-06-01

    Soft-tissue deformation is one of the major reasons for the inaccurate positioning of percutaneous needle insertion process. In this article, simulations and experiments of the needle insertion soft-tissue process are both applied to study soft-tissue deformation. A needle deflection model based on the mechanics is used to calculate the needle deflection during the interaction process. The obtained needle deflection data are applied into finite element analysis process as the system input. The uniaxial tensile strength tests, compression tests, and static indentation experiments are used to obtain the soft-tissue parameters and choose the best strain-energy function to model in the simulation. Magnetic resonance imaging is used to reconstruct the prostate, establishing both prostate three-dimensional finite element model and artificial prostate model. The needle-soft tissue interaction simulation results are compared with those of the needle insertion experiment. The displacement data of the mark point in the experiment are comparable to the simulation results. It is concluded that, using this simulation method, the surgeon can predict the deformation of the tissue and the displacement of the target in advance. PMID:27129384

  14. Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle

    PubMed Central

    Hennenberg, Martin; Strittmatter, Frank; Beckmann, Christer; Rutz, Beata; Füllhase, Claudius; Waidelich, Raphaela; Montorsi, Francesco; Hedlund, Petter; Andersson, Karl-Erik; Stief, Christian G.; Gratzke, Christian

    2012-01-01

    Background The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. Objective To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Methods Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Results Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Conclusions Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors

  15. [Transurethral prostate resection prior to kidney transplantation leading to urethral cicatricial tissue].

    PubMed

    Schou-Jensen, Katrine; Mohammad, Wael

    2015-01-26

    In Denmark, kidney transplantations in patients above 50 years have increased during the last decade. Consequently, the number of patients with lower urinary tract symptoms due to prostate hypertrophy increases accordingly. We describe two patients, who both had a resection of the prostate while having anuria and waiting for a kidney transplantation from a deceased donor. In both cases it was impossible to place a urethral catheter during the following transplantation due to total urethral occlusion, so a suprapubic catheter was inserted until the scar tissue was dilated or resected by a later transurethral intervention. PMID:25612989

  16. Phenomenological model of laser-tissue interaction with application to Benign Prostatic Hyperplasia (BPH) simulation.

    PubMed

    Zhou, Xiangmin; Zhang, Nan; Shen, Yunhe; Burke, Dan; Konchada, Vamsi; Sweet, Robert

    2011-01-01

    Laser-tissue interaction is a multi-physics phenomenon not yet mathematically describable and computationally predictable. It is a challenge to model the laser-tissue interaction for real time laser Benign Prostatic Hyperplasia (BPH) simulation which requires the laser-tissue interaction model to be computationally efficient and accurate. Under the consideration and enforcement of the thermodynamic first law and treating the laser-tissue interaction as a gray-box, utilizing the sensitivity analysis of some key parameters that will affect the laser intensity on the tissue surface with respect to the tissue vaporization rate, a phenomenological model of laser-tissue interaction is developed. The developed laser-tissue interaction model has been implemented for a laser BPH simulator and achieves real time performance (more than 30 frames per second). The model agrees well with the available experimental data. PMID:21335893

  17. Interaction between high power 532nm laser and prostatic tissue: in vitro evaluation for laser prostatectomy

    NASA Astrophysics Data System (ADS)

    Kang, Hyun Wook; Peng, Yihlih Steven; Stinson, Douglas

    2011-03-01

    Photoselective vaporization of the prostate (PVP) has been developed for effective treatment of obstructive benign prostatic hyperplasia. To maximize tissue ablation for large prostate gland, identifying the optimal power level for PVP is still necessary. We investigated the effect of various power levels on in vitro bovine prostate ablation with a 532-nm laser system. A custom-made 532-nm laser was employed to provide various power levels, delivered through a newly designed 750-μm side-firing fiber. Tissue ablation efficiency was evaluated in terms of power (P; 120~200W), treatment speed of fiber (TS; 2~8 mm/s), and working distance between fiber and tissue surface (WD; 1~5 mm). Coagulation depth was also estimated macroscopically and histologically (H&E) at various Ps. Both 180 and 200W yielded comparable ablated volume (104.3+/-24.7 vs. 104.1+/-23.9 mm3 at TS=4 mm/s and WD=2 mm; p=0.99); thus, 180W was identified as the optimal power to maximize tissue ablation, by removing tissue up to 80% faster than 120W (41.7+/-9.9 vs. 23.2+/-3.4 mm3/s at TS=4 mm/s and WD=2 mm; p<0.005). Tissue ablation was maximized at TS=4 mm/s and ablated equally efficiently at up to 3 mm WD (104.5+/-16.7 mm3 for WD=1 mm vs. 93.4+/-7.4 mm3 for WD=3 mm at 180W; p=0.33). The mean thickness of coagulation zone for 180W was 20% thicker than that for 120W (1.31+/-0.17 vs. 1.09+/-0.16 mm; p<0.005). The current in vitro study demonstrated that 180W was the optimal power to maximize tissue ablation efficiency with enhanced coagulation characteristics.

  18. The efficacy of Stokes Shift Spectroscopy for detecting prostate and breast cancer tissues

    NASA Astrophysics Data System (ADS)

    Pu, Yang; Wang, W. B.; Yang, Yuanlong; Alfano, Robert R.

    2013-03-01

    Stokes Shift Spectroscopy (S3) offers a novel way to rapidly measure spectral fingerprints of complex molecular mixtures in tissue. The changes of key fluorophores from normal state to the malignant state can be reflected by alteration of Stokes Shift Spectra (S3 spectra). S3 measurements can be used to acquire enough information of different key fluorophores from one spectrum to speed up spectral acquisition time. In this study, we demonstrate the usefulness of the S3 technique to distinguish the malignant tissue from the normal prostate and breast tissues. The optimal wavelength shift constant (Δλc) of S3 spectra measurements for prostate/breast cancer detection were determined to be 40 nm. The underlying physical and biological basis for S3 is discussed. For the first time, our work explicitly discloses how and why S3 is supreme in comparison with other conventional spectroscopic techniques.

  19. Collecting and Studying Blood and Tissue Samples From Patients With Locally Recurrent or Metastatic Prostate or Bladder/Urothelial Cancer

    ClinicalTrials.gov

    2016-06-06

    Healthy Control; Localized Urothelial Carcinoma of the Renal Pelvis and Ureter; Metastatic Malignant Neoplasm in the Bone; Metastatic Malignant Neoplasm in the Soft Tissues; Metastatic Urothelial Carcinoma of the Renal Pelvis and Ureter; Recurrent Bladder Carcinoma; Recurrent Prostate Carcinoma; Recurrent Urothelial Carcinoma of the Renal Pelvis and Ureter; Stage IV Bladder Cancer; Stage IV Bladder Urothelial Carcinoma; Stage IV Prostate Cancer

  20. Nd:YAG surgical laser effects in canine prostate tissue: temperature and damage distribution

    NASA Astrophysics Data System (ADS)

    van Nimwegen, S. A.; L'Eplattenier, H. F.; Rem, A. I.; van der Lugt, J. J.; Kirpensteijn, J.

    2009-01-01

    An in vitro model was used to predict short-term, laser-induced, thermal damage in canine prostate tissue. Canine prostate tissue samples were equipped with thermocouple probes to measure tissue temperature at 3, 6, 9 and 12 mm depths. The tissue surface was irradiated with a Nd:YAG laser in contact or non-contact mode for up to 20 s, using powers from 5 to 20 W. Prediction of thermal damage using Arrhenius theory was discussed and compared to the in vitro damage threshold, determined by histological evaluation. The threshold temperature for acute thermal tissue damage was 69 ± 6 °C (means ± SD), irrespective of exposure time. Contact mode laser application caused vaporization of tissue, leaving a crater underneath the fiber tip. The mean extent of tissue damage underneath the vaporization crater floor was 0.9 ± 0.6 mm after 5, 10 or 20 s of contact mode laser irradiation at 10 W, whereas 20 W non-contact exposure up to 20 s causes up to 4.7 ± 0.2 mm coagulation necrosis. It was concluded that short-term acute thermal tissue damage can be comprehensively described by a single threshold temperature.

  1. First Evidence that Sika Deer (Cervus nippon) Velvet Antler Extract Suppresses Migration of Human Prostate Cancer Cells.

    PubMed

    Tang, YuJiao; Jeon, Byong-Tae; Wang, Yanmei; Choi, Eun-Ju; Kim, Yon-Suk; Hwang, Jin-Woo; Park, Pyo-Jam; Moon, Sang Ho; Kim, Eun-Kyung

    2015-01-01

    Deer velvet antler (DVA) is one of the most popular medicines in China. Numerous studies have demonstrated that velvet antler possess biological effects. However, data regarding its anti-migration activity on prostate cancer is scarce. In this study, we investigated the inhibitory effect of top DVA (T-DVA) on the expression of prostate-specific antigen (PSA) and migration-related genes in the human prostate cancer cell, LNCaP. The T-DVA down-regulated the expression of PSA. In addition, the Radius(TM) assay revealed that T-DVA inhibited the migration behavior of prostate cancer cells. Furthermore, the expression of matrix metalloproteinase (MMP)-9 and vascular endothelial growth factor (VEGF) was also decreased with T-DVA. On the contrary, T-DVA increased the tissue inhibition of metalloproteinase (TIMP)-1 and (TIMP)-2. Taken together, our findings indicate that the T-DVA possesses anti-migration activity on prostate cancer cells. This is the first study of DVA to report the anti-migration activity on prostate cancer. PMID:26761873

  2. First Evidence that Sika Deer (Cervus nippon) Velvet Antler Extract Suppresses Migration of Human Prostate Cancer Cells

    PubMed Central

    Tang, YuJiao; Jeon, Byong-Tae; Wang, Yanmei; Choi, Eun-Ju; Kim, Yon-Suk; Hwang, Jin-Woo; Park, Pyo-Jam; Moon, Sang Ho; Kim, Eun-Kyung

    2015-01-01

    Deer velvet antler (DVA) is one of the most popular medicines in China. Numerous studies have demonstrated that velvet antler possess biological effects. However, data regarding its anti-migration activity on prostate cancer is scarce. In this study, we investigated the inhibitory effect of top DVA (T-DVA) on the expression of prostate-specific antigen (PSA) and migration-related genes in the human prostate cancer cell, LNCaP. The T-DVA down-regulated the expression of PSA. In addition, the RadiusTM assay revealed that T-DVA inhibited the migration behavior of prostate cancer cells. Furthermore, the expression of matrix metalloproteinase (MMP)-9 and vascular endothelial growth factor (VEGF) was also decreased with T-DVA. On the contrary, T-DVA increased the tissue inhibition of metalloproteinase (TIMP)-1 and (TIMP)-2. Taken together, our findings indicate that the T-DVA possesses anti-migration activity on prostate cancer cells. This is the first study of DVA to report the anti-migration activity on prostate cancer. PMID:26761873

  3. The bioavailability of different zinc compounds used as human dietary supplements in rat prostate: a comparative study.

    PubMed

    Sapota, Andrzej; Daragó, Adam; Skrzypińska-Gawrysiak, Małgorzata; Nasiadek, Marzenna; Klimczak, Michał; Kilanowicz, Anna

    2014-06-01

    The normal human prostate accumulates the highest levels of zinc (Zn) of any soft tissue in the body. The pool of zinc available to the body is known to significantly decrease with age. It is suggested that dietary Zn supplementation protects against oxidative damage and reduces the risk of cancer. Zinc sulfate and zinc gluconate were the most frequently mentioned in per os administration in studies on Zn supplementation. The major aim of the study was to compare the bioavailability of different Zn compounds (sulfate, gluconate and citrate) in the prostate after their daily administration to male rats at three different doses (3.0; 15.0; and 50.0 mg Zn/kg b.w.) for 30 days. The results show that bioavailability in the prostate differs significantly between individual zinc preparations. A significantly elevated Zn concentration in the dorso-lateral lobe of the prostate, compared to controls, was found in the rats supplemented with two compounds only: zinc gluconate and zinc citrate. However, after administration of zinc gluconate, this effect occurred even at the lowest dose. The lowest zinc bioavailability in the prostate was found in the rats administered zinc sulfate: no significant Zn increase was seen in particular zones of the prostate. To sum up, the use of zinc gluconate is worth considering as a possible means of zinc supplementation in men. PMID:24619814

  4. Expression profiling of prostate cancer tissue delineates genes associated with recurrence after prostatectomy

    PubMed Central

    Mortensen, Martin Mørck; Høyer, Søren; Lynnerup, Anne-Sophie; Ørntoft, Torben Falck; Sørensen, Karina Dalsgaard; Borre, Michael; Dyrskjøt, Lars

    2015-01-01

    Prostate cancer is a leading cause of cancer death amongst males. The main clinical dilemma in treating prostate cancer is the high number of indolent cases that confer a significant risk of overtreatment. In this study, we have performed gene expression profiling of tumor tissue specimens from 36 patients with prostate cancer to identify transcripts that delineate aggressive and indolent cancer. Key genes were validated using previously published data and by tissue microarray analysis. Two molecular subgroups were identified with a significant overrepresentation of tumors from patients with biochemical recurrence in one of the groups. We successfully validated key transcripts association with recurrence using two publically available datasets totaling 669 patients. Twelve genes were found to be independent predictors of recurrence in multivariate logistical regression analysis. SFRP4 gene expression was consistently up regulated in patients with recurrence in all three datasets. Using an independent cohort of 536 prostate cancer patients we showed SFRP4 expression to be an independent predictor of recurrence after prostatectomy (HR = 1.35; p = 0.009). We identified SFRP4 to be associated with disease recurrence. Prospective studies are needed in order to assess the clinical usefulness of the identified key markers in this study. PMID:26522007

  5. Noninvasive surgery of prostate tissue by high-intensity focused ultrasound: an updated report

    NASA Astrophysics Data System (ADS)

    Sanghvi, Narendra T.; Syrus, J.; Foster, Richard S.; Bihrle, Richard; Casey, Richard W.; Uchida, Toyoak

    2000-05-01

    High Intensity Focused Ultrasound (HIFU) has been clinically used for the treatment of benign prostatic hyperplasia (BPH) and it is experimentally applied for the treatment of localized prostate caner (PC). Recent advances in the transducer material and technology have permitted to combine the ultrasound visualization capability and HIFU on the same ceramic crystal. Also, the transducer efficiency has increased to a level that a smaller size intracavity probe can be made to produce sufficient acoustic power required for the focused ultrasound surgery of the prostate. Using this technology, 4 MHz mechanically scanning transrectal ultrasound probes has been designed. The transrectal probes are used with Sonablate (SB-200, manufactured by Focus Surgery, Inc., Indianapolis, IN) device. The SB-200 produces both transverse and longitudinal images of the prostate. The transverse and longitudinal images are used for selection of tissue volume, treatment planning and monitoring of tissue during the HIFU treatment cycle. The paper reviews the present operation of the device and recent clinical protocol that has improved efficiency, efficacy and safety of the device. The two years follow-up clinical results from the multi-site US Pilot Study (USPS) and The Male Health Centre are compared with the Kitasato-study (Kitasato School of Medicine, Sagamihara, Japan).

  6. Targeting Prostate Cancer Cells In Vivo Using a Rapidly Internalizing Novel Human Single-Chain Antibody Fragment

    PubMed Central

    He, Jiang; Wang, Yong; Feng, Jinjin; Zhu, Xiaodong; Lan, Xiaoli; Iyer, Arun K.; Zhang, Niu; Seo, Youngho; VanBrocklin, Henry F.; Liu, Bin

    2010-01-01

    Human antibodies targeting prostate cancer cell surface epitopes may be useful for imaging and therapy. The objective of this study was to evaluate the tumor targeting of an internalizing human antibody fragment, a small-size platform, to provide high contrast in a mouse model of human prostate carcinoma. Methods A prostate tumor-targeting single-chain antibody fragment (scFv), UA20, along with a nonbinding control scFv, N3M2, were labeled with 99mTc and evaluated for binding and rapid internalization into human prostate tumor cells in vitro and tumor homing in vivo using xenograft models. For the in vitro studies, the labeled UA20 scFv was incubated at 37°C for 1 h with metastatic prostate cancer cells (DU145) to assess the total cellular uptake versus intracellular uptake. For the animal studies, labeled UA20 and N3M2 scFvs were administered to athymic mice implanted subcutaneously with DU145 cells. Mice were imaged with small-animal SPECT/CT with concomitant biodistribution at 1 and 3 h after injection. Results The UA20 scFv was labeled in 55%–65% yield and remained stable in phosphate buffer within 24 h. The labeled UA20 scFv was taken up specifically by prostate tumor cells. Internalization was rapid, because incubation at 37°C for less than 1 h resulted in 93% internalization of total cell-associated scFvs. In animal studies, SPECT/CT showed significant tumor uptake as early as 1 h after injection. At 3 h after injection, tumor uptake was 4.4 percentage injected dose per gram (%ID/g), significantly greater than all organs or tissues studied (liver, 2.7 %ID/g; other organs or tissues, <1 %ID/g), except the kidneys (81.4 %ID/g), giving tumor-to-blood and tumor-to-muscle ratios of 12:1 and 70:1, respectively. In contrast, the control antibody exhibited a tumor uptake of only 0.26 %ID/g, similar to that of muscle and fat. Tumor-specific targeting was evidenced by reduced tumor uptake of nearly 70% on administration of a 10-fold excess of unlabeled UA20 sc

  7. Serially heterotransplanted human prostate tumours as an experimental model

    PubMed Central

    Lopez-Barcons, Lluis-A

    2010-01-01

    Abstract Preclinical research on prostate cancer (PC) therapies uses several models to represent the human disease accurately. A common model uses patient prostate tumour biopsies to develop a cell line by serially passaging and subsequent implantation, in immunodeficient mice. An alternative model is direct implantation of patient prostate tumour biopsies into immunodeficient mice, followed by serial passage in vivo. The purpose of this review is to compile data from the more than 30 years of human PC serial heterotransplantation research. Serially heterotransplanted tumours are characterized by evaluating the histopathology of the resulting heterotransplants, including cellular differentiation, karyotype, marker expression, hormone sensitivity, cellular proliferation, metastatic potential and stromal and vascular components. These data are compared with the initial patient tumour specimen and, depending on available information, the patient’s clinical outcome was compared with the heterotransplanted tumour. The heterotansplant model is a more accurate preclinical model than older generation serially passaged or genetic models to investigate current and newly developed androgen-deprivation agents, antitumour compounds, anti-angiogenic drugs and positron emission tomography radiotracers, as well as new therapeutic regimens for the treatment of PC. PMID:19874422

  8. Quantifying Gleason scores with photoacoustic spectral analysis: feasibility study with human tissues

    PubMed Central

    Xu, Guan; Davis, Mandy C.; Siddiqui, Javed; Tomlins, Scott A.; Huang, Shengsong; Kunju, Lakshmi P.; Wei, John T.; Wang, Xueding

    2015-01-01

    Gleason score is a highly prognostic factor for prostate cancer describing the microscopic architecture of the tumor tissue. The standard procedure for evaluating Gleason scores, namely biopsy, is to remove prostate tissue for observation under microscope. Currently, biopsies are guided by transrectal ultrasound (TRUS). Due to the low sensitivity of TRUS to prostate cancer (PCa), non-guided and saturated biopsies are frequently employed, unavoidably causing pain, damage to the normal prostate tissues and other complications. More importantly, due to the limited number of biopsy cores, current procedure could either miss early stage small tumors or undersample aggressive cancers. Photoacoustic (PA) measurement has the unique capability of evaluating tissue microscopic architecture information at ultrasonic resolution. By frequency domain analysis of the broadband PA signal, namely PA spectral analysis (PASA), the microscopic architecture within the assessed tissue can be quantified. This study investigates the feasibility of evaluating Gleason scores by PASA. Simulations with the classic Gleason patterns and experiment measurements from human PCa tissues have demonstrated strong correlation between the PASA parameters and the Gleason scores. PMID:26713193

  9. Influence of trace elements in human tissue in low-energy photon brachytherapy dosimetry

    NASA Astrophysics Data System (ADS)

    White, Shane A.; Landry, Guillaume; van Gils, Francis; Verhaegen, Frank; Reniers, Brigitte

    2012-06-01

    The aim of this paper is to determine the dosimetric impact of trace elements in human tissues for low-energy photon sources used in brachytherapy. Monte Carlo dose calculations were used to investigate the dosimetric effect of trace elements present in normal or cancerous human tissues. The effect of individual traces (atomic number Z = 11-30) was studied in soft tissue irradiated by low-energy brachytherapy sources. Three other tissue types (prostate, adipose and mammary gland) were also simulated with varying trace concentrations to quantify the contribution of each trace to the dose distribution. The dose differences between cancerous and healthy prostate tissues were calculated in single- and multi-source geometries. The presence of traces in a tissue produces a difference in the dose distribution that is dependent on Z and the concentration of the trace. Low-Z traces (Na) have a negligible effect (<0.3%) in all tissues, while higher Z (K) had a larger effect (>3%). There is a potentially significant difference in the dose distribution between cancerous and healthy prostate tissues (4%) and even larger if compared to the trace-free composition (15%) in both single- and multi-sourced geometries. Trace elements have a non-negligible (up to 8% in prostate D90) effect on the dose in tissues irradiated with low-energy photon sources. This study underlines the need for further investigation into accurate determination of the trace composition of tissues associated with low-energy brachytherapy. Alternatively, trace elements could be incorporated as a source of uncertainty in dose calculations. This work was part of an invited presentation at the ‘International Workshop on Recent Advances in Monte Carlo Techniques for Radiation Therapy’, held in Montreal, June 8-10, 2011.

  10. The prostatic acid phosphatase (ACPP) gene is localized to human chromosome 3q21-q23

    SciTech Connect

    Li, S.S.L.; Sharief, F.S. )

    1993-09-01

    Human prostatic acid phosphatase (ACPP) has been used as a diagnostic marker for prostate cancer. It is synthesized under androgen regulation and secreted by the epithelial cells of the prostate gland. The authors have confirmed the previous assignment of the ACPP gene to chromosome 3 by probing a panel of 25 human-Chinese hamster somatic cell hybrids, and they have further localized the ACPP gene to chromosome 3q21-q23 by fluorescence in situ hybridization. 10 refs., 1 fig.

  11. Comprehensively Evaluating cis-Regulatory Variation in the Human Prostate Transcriptome by Using Gene-Level Allele-Specific Expression

    PubMed Central

    Larson, Nicholas B.; McDonnell, Shannon; French, Amy J.; Fogarty, Zach; Cheville, John; Middha, Sumit; Riska, Shaun; Baheti, Saurabh; Nair, Asha A.; Wang, Liang; Schaid, Daniel J.; Thibodeau, Stephen N.

    2015-01-01

    The identification of cis-acting regulatory variation in primary tissues has the potential to elucidate the genetic basis of complex traits and further our understanding of transcriptomic diversity across cell types. Expression quantitative trait locus (eQTL) association analysis using RNA sequencing (RNA-seq) data can improve upon the detection of cis-acting regulatory variation by leveraging allele-specific expression (ASE) patterns in association analysis. Here, we present a comprehensive evaluation of cis-acting eQTLs by analyzing RNA-seq gene-expression data and genome-wide high-density genotypes from 471 samples of normal primary prostate tissue. Using statistical models that integrate ASE information, we identified extensive cis-eQTLs across the prostate transcriptome and found that approximately 70% of expressed genes corresponded to a significant eQTL at a gene-level false-discovery rate of 0.05. Overall, cis-eQTLs were heavily concentrated near the transcription start and stop sites of affected genes, and effects were negatively correlated with distance. We identified multiple instances of cis-acting co-regulation by using phased genotype data and discovered 233 SNPs as the most strongly associated eQTLs for more than one gene. We also noted significant enrichment (25/50, p = 2E−5) of previously reported prostate cancer risk SNPs in prostate eQTLs. Our results illustrate the benefit of assessing ASE data in cis-eQTL analyses by showing better reproducibility of prior eQTL findings than of eQTL mapping based on total expression alone. Altogether, our analysis provides extensive functional context of thousands of SNPs in prostate tissue, and these results will be of critical value in guiding studies examining disease of the human prostate. PMID:25983244

  12. Tissue metabolite profiling identifies differentiating and prognostic biomarkers for prostate carcinoma.

    PubMed

    Jung, Klaus; Reszka, Regina; Kamlage, Beate; Bethan, Bianca; Stephan, Carsten; Lein, Michael; Kristiansen, Glen

    2013-12-15

    Metabolomic research offers a deeper insight into biochemical changes in cancer metabolism and is a promising tool for identifying novel biomarkers. We aimed to evaluate the diagnostic and prognostic potential of metabolites in prostate cancer (PCa) tissue after radical prostatectomy. In matched malignant and nonmalignant prostatectomy samples from 95 PCa patients, aminoadipic acid, cerebronic acid, gluconic acid, glycerophosphoethanolamine, 2-hydroxybehenic acid, isopentenyl pyrophosphate, maltotriose, 7-methylguanine and tricosanoic acid were determined within a global metabolite profiling study using gas chromatography/liquid chromatography-mass spectrometry. The data were related to clinicopathological variables like prostate volume, tumor stage, Gleason score, preoperative prostate-specific antigen and disease recurrence in the follow-up. All nine metabolites showed higher concentrations in malignant than in nonmalignant samples except for gluconic acid and maltotriose, which had lower levels in tumors. Receiver -operating characteristics analysis demonstrated a significant discrimination for all metabolites between malignant and nonmalignant tissue with a maximal area under the curve of 0.86 for tricosanoic acid, whereas no correlation was observed between the metabolite levels and the Gleason score or tumor stage except for gluconic acid. Univariate Cox regression and Kaplan-Meier analyses showed that levels of aminoadipic acid, gluconic acid and maltotriose were associated with the biochemical tumor recurrence (prostate-specific antigen > 0.2 ng/mL). In multivariate Cox regression analyses, aminoadipic acid together with tumor stage and Gleason score remained in a model as independent marker for prediction of biochemical recurrence. This study proved that metabolites in PCa tissue can be used, in combination with traditional clinicopathological factors, as promising diagnostic and prognostic tools. PMID:23737455

  13. Personalized Medicine Approaches in Prostate Cancer Employing Patient Derived 3D Organoids and Humanized Mice

    PubMed Central

    Bartucci, Monica; Ferrari, Anna C.; Kim, Isaac Yi; Ploss, Alexander; Yarmush, Martin; Sabaawy, Hatem E.

    2016-01-01

    Prostate cancer (PCa) is the most common malignancy and the second most common cause of cancer death in Western men. Despite its prevalence, PCa has proven very difficult to propagate in vitro. PCa represents a complex organ-like multicellular structure maintained by the dynamic interaction of tumoral cells with parenchymal stroma, endothelial and immune cells, and components of the extracellular matrix (ECM). The lack of PCa models that recapitulate this intricate system has hampered progress toward understanding disease progression and lackluster therapeutic responses. Tissue slices, monolayer cultures and genetically engineered mouse models (GEMM) fail to mimic the complexities of the PCa microenvironment or reproduce the diverse mechanisms of therapy resistance. Moreover, patient derived xenografts (PDXs) are expensive, time consuming, difficult to establish for prostate cancer, lack immune cell-tumor regulation, and often tumors undergo selective engraftments. Here, we describe an interdisciplinary approach using primary PCa and tumor initiating cells (TICs), three-dimensional (3D) tissue engineering, genetic and morphometric profiling, and humanized mice to generate patient-derived organoids for examining personalized therapeutic responses in vitro and in mice co-engrafted with a human immune system (HIS), employing adaptive T-cell- and chimeric antigen receptor- (CAR) immunotherapy. The development of patient specific therapies targeting the vulnerabilities of cancer, when combined with antiproliferative and immunotherapy approaches could help to achieve the full transformative power of cancer precision medicine. PMID:27446916

  14. Personalized Medicine Approaches in Prostate Cancer Employing Patient Derived 3D Organoids and Humanized Mice.

    PubMed

    Bartucci, Monica; Ferrari, Anna C; Kim, Isaac Yi; Ploss, Alexander; Yarmush, Martin; Sabaawy, Hatem E

    2016-01-01

    Prostate cancer (PCa) is the most common malignancy and the second most common cause of cancer death in Western men. Despite its prevalence, PCa has proven very difficult to propagate in vitro. PCa represents a complex organ-like multicellular structure maintained by the dynamic interaction of tumoral cells with parenchymal stroma, endothelial and immune cells, and components of the extracellular matrix (ECM). The lack of PCa models that recapitulate this intricate system has hampered progress toward understanding disease progression and lackluster therapeutic responses. Tissue slices, monolayer cultures and genetically engineered mouse models (GEMM) fail to mimic the complexities of the PCa microenvironment or reproduce the diverse mechanisms of therapy resistance. Moreover, patient derived xenografts (PDXs) are expensive, time consuming, difficult to establish for prostate cancer, lack immune cell-tumor regulation, and often tumors undergo selective engraftments. Here, we describe an interdisciplinary approach using primary PCa and tumor initiating cells (TICs), three-dimensional (3D) tissue engineering, genetic and morphometric profiling, and humanized mice to generate patient-derived organoids for examining personalized therapeutic responses in vitro and in mice co-engrafted with a human immune system (HIS), employing adaptive T-cell- and chimeric antigen receptor- (CAR) immunotherapy. The development of patient specific therapies targeting the vulnerabilities of cancer, when combined with antiproliferative and immunotherapy approaches could help to achieve the full transformative power of cancer precision medicine. PMID:27446916

  15. Automatic classification of prostate stromal tissue in histological images using Haralick descriptors and Local Binary Patterns

    NASA Astrophysics Data System (ADS)

    Oliveira, D. L. L.; Nascimento, M. Z.; Neves, L. A.; Batista, V. R.; Godoy, M. F.; Jacomini, R. S.; Duarte, Y. A. S.; Arruda, P. F. F.; Neto, D. S.

    2014-03-01

    In this paper we presente a classification system that uses a combination of texture features from stromal regions: Haralick features and Local Binary Patterns (LBP) in wavelet domain. The system has five steps for classification of the tissues. First, the stromal regions were detected and extracted using segmentation techniques based on thresholding and RGB colour space. Second, the Wavelet decomposition was applied in the extracted regions to obtain the Wavelet coefficients. Third, the Haralick and LBP features were extracted from the coefficients. Fourth, relevant features were selected using the ANOVA statistical method. The classication (fifth step) was performed with Radial Basis Function (RBF) networks. The system was tested in 105 prostate images, which were divided into three groups of 35 images: normal, hyperplastic and cancerous. The system performance was evaluated using the area under the ROC curve and resulted in 0.98 for normal versus cancer, 0.95 for hyperplasia versus cancer and 0.96 for normal versus hyperplasia. Our results suggest that texture features can be used as discriminators for stromal tissues prostate images. Furthermore, the system was effective to classify prostate images, specially the hyperplastic class which is the most difficult type in diagnosis and prognosis.

  16. Semiconductor diode lasers in the canine prostate: laser-tissue interaction

    NASA Astrophysics Data System (ADS)

    Perlmutter, Aaron P.; Muschter, Rolf; Anson, K.; Vargas Stuve, Juan C.; Razvi, Hassan A.

    1995-05-01

    We have studied 810 nm (Diomed, Cambridge England), 950 nm (Diolase, Endocare, Irvine CA), 980 nm (Dornier, Munich Germany), and 1000 nm (Cynosure, Bedford MA) using free beam right angle firing fibers in the canine prostate. Because some lasers only accept specific fibers, and each wavelength has its own divergence properties, standardization of fiber and power density was not possible. Power was studied in increments to the maximum output for each laser. Laser-tissue interaction was studied by video endoscopy during lasing, pathology, and real time interstitial thermometry at 3, 7, and 11 mm deep from the prostatic urethra. We found that using the Dornier Sidefocus fiber at 25 W, 810 nm created a small vaporized cavity surrounded by a zone of necrosis, whereas 980 nm at 25 W caused more necrosis but little vaporization. Irradiation with 950 nm and the Prolase II fiber created deeper lesions at 40 W than 25 W. At 1000 nm with the angle delivery device produced by Cynosure, popcorn with the formation of carbonized cavities occurred at both 25 and 40 W. The lesions were only slightly deeper at the higher wattage. We conclude that the high power diode lasers are capable of producing volume lesions in the prostate. The different wavelengths, fibers and power densities lead to different laser-tissue interaction, and thus each wavelength needs to be considered separately.

  17. Worldwide Prevalence of Human Papillomavirus and Relative Risk of Prostate Cancer: A Meta-analysis

    PubMed Central

    Yang, Lin; Xie, Shuanghua; Feng, Xiaoshuang; Chen, Yuheng; Zheng, Tongzhang; Dai, Min; Ke Zhou, Cindy; Hu, Zhibin; Li, Ni; Hang, Dong

    2015-01-01

    Despite the increasing number of studies conducted recently to evaluate the association between HPV infections and the risk of prostate cancer, the results remain inconclusive. Furthermore, the prevalence and distribution of overall and individual HPV types worldwide in prostate cancer has not been reported until now. Therefore, we estimated the prevalence of HPV in prostate cancer by pooling data of 46 studies with 4919 prostate cancer cases, taking into account the heterogeneity of major related parameters, including study region, specimen type, HPV DNA source, detection method, publication calendar period and Gleason score. Moreover, we tested the association of HPV infections with prostate cancer risks by a meta-analysis of 26 tissue-based case-control studies. We found that the prevalence of HPV infection was 18.93% (95% CI = 17.84–20.05%) in prostate cancer cases, and most of which were high-risk HPV types (17.73%, 95% CI = 16.52–18.99%). The prevalence varied by region, PCR primers used, publication calendar period and Gleason score. Our study also showed a significantly increased risk of prostate cancer with the positivity of overall HPV detected in prostate tissues (OR = 1.79, 95% CI = 1.29–2.49) and revealed the geographic variation of association strength (P < 0.001). In conclusion, HPV infections may contribute to the risk of prostate cancer. PMID:26441160

  18. Daytime Blue Light Enhances the Nighttime Circadian Melatonin Inhibition of Human Prostate Cancer Growth

    PubMed Central

    Dauchy, Robert T; Hoffman, Aaron E; Wren-Dail, Melissa A; Hanifin, John P; Warfield, Benjamin; Brainard, George C; Xiang, Shulin; Yuan, Lin; Hill, Steven M; Belancio, Victoria P; Dauchy, Erin M; Smith, Kara; Blask, David E

    2015-01-01

    Light controls pineal melatonin production and temporally coordinates circadian rhythms of metabolism and physiology in normal and neoplastic tissues. We previously showed that peak circulating nocturnal melatonin levels were 7-fold higher after daytime spectral transmittance of white light through blue-tinted (compared with clear) rodent cages. Here, we tested the hypothesis that daytime blue-light amplification of nocturnal melatonin enhances the inhibition of metabolism, signaling activity, and growth of prostate cancer xenografts. Compared with male nude rats housed in clear cages under a 12:12-h light:dark cycle, rats in blue-tinted cages (with increased transmittance of 462–484 nm and decreased red light greater than 640 nm) evinced over 6-fold higher peak plasma melatonin levels at middark phase (time, 2400), whereas midlight-phase levels (1200) were low (less than 3 pg/mL) in both groups. Circadian rhythms of arterial plasma levels of linoleic acid, glucose, lactic acid, pO2, pCO2, insulin, leptin, and corticosterone were disrupted in rats in blue cages as compared with the corresponding entrained rhythms in clear-caged rats. After implantation with tissue-isolated PC3 human prostate cancer xenografts, tumor latency-to-onset of growth and growth rates were markedly delayed, and tumor cAMP levels, uptake–metabolism of linoleic acid, aerobic glycolysis (Warburg effect), and growth signaling activities were reduced in rats in blue compared with clear cages. These data show that the amplification of nighttime melatonin levels by exposing nude rats to blue light during the daytime significantly reduces human prostate cancer metabolic, signaling, and proliferative activities. PMID:26678364

  19. 1H HRMAS NMR Derived Bio-markers Related to Tumor Grade, Tumor Cell Fraction, and Cell Proliferation in Prostate Tissue Samples

    PubMed Central

    Stenman, Katarina; Stattin, Pär; Stenlund, Hans; Riklund, Katrine; Gröbner, Gerhard; Bergh, Anders

    2011-01-01

    A high-resolution magic angle spinning NMR spectroscopic approach is presented for evaluating the occurrence, amount and aggressiveness of cancer in human prostate tissue samples. Using this technique, key metabolites in malignant and non-malignant samples (n = 149) were identified, and patterns of their relative abundance were analyzed by multivariate statistical methods. Ratios of various metabolites – including (glycerophophorylcholine + phosphorylcholine)/creatine, myo-inositol/scyllo-inositol, scyllo-inositol/creatine, choline/creatine, and citrate/creatine – correlated with: i) for non-malignant tissue samples, the distance to the nearest tumor and its Gleason score and; ii) the fraction of tumor cells present in the sample; and iii) tumor cell proliferation (Ki67 labelling index). This NMR-based approach allows the extraction of information that could be useful for developing novel diagnostic methods for prostate cancer. PMID:21499438

  20. Expression and Localization of Aquaporins in Benign Prostate Hyperplasia and Prostate Cancer

    PubMed Central

    Hwang, Insang; Hwang, Eu-Chang; Song, Seung Hee; Lee, Hyun-Suk; Kim, Sun-Ouck; Kang, Taek-Won; Kwon, Dongdeuk; Park, Kwangsung

    2012-01-01

    The aquaporin (AQP) families of water channels are intrinsic membrane proteins that facilitate selective water and small solute movement across the plasma membrane. The purposes of this study were to determine the expression and localization of AQPs in benign prostatic hyperplasia and prostate cancer. Prostatic tissue was collected from patients with benign prostatic hyperplasia or prostate cancer by transurethral resection of the prostate. The expression and cellular localization of the AQPs were determined in the human prostate by Western blot and immunohistochemistry. AQP1, 3, and 9 were expressed in the human prostate. Western blot analysis revealed bands at 28-36 kDa for the AQP1, 3, and 9 proteins. Of these proteins, AQP3 and 9 were expressed in the epithelium. Immunolabeling showed that AQP1 was mainly expressed in the capillaries and venules of the prostate, AQP9 was expressed in the cytoplasm of the epithelium, and AQP3 was mainly associated with the plasma membrane of the prostatic epithelium. Only AQP3 expression was localized in the cell membrane, and expressed AQP3 was translocated to the cytoplasm in prostate cancer. The epithelium in the human prostate expresses AQP3 and 9 proteins, and the capillaries and venules of the prostate express AQP1. Characterizing or modifying the expression of AQP3 may lead to an understanding of the role of the AQPs in human prostatic disease. PMID:23323224

  1. Prostate cancer diagnosis by optical coherence tomography: First results from a needle based optical platform for tissue sampling.

    PubMed

    Muller, Berrend G; de Bruin, Daniel M; Brandt, Martin J; van den Bos, Willemien; van Huystee, Suzanne; Faber, D J; Savci, Dilaria; Zondervan, Patricia J; de Reijke, Theo M; Laguna-Pes, M Pilar; van Leeuwen, Ton G; de la Rosette, Jean J M C H

    2016-05-01

    The diagnostic accuracy of Optical Coherence Tomography (OCT) based optical attenuation coefficient analysis is assessed for the detection of prostate cancer. Needle-based OCT-measurements were performed on the prostate specimens. Attenuation coefficients were determined by an earlier described in-house developed software package. The mean attenuation coefficients (benign OCT data; malignant OCT data; p-value Mann-Whitney U test) were: (3.56 mm(-1) ; 3.85 mm(-1) ; p < 0.0001) for all patients combined. The area under the ROC curve was 0.64. In order to circumvent the effect of histopathology mismatching, we performed a sub-analysis on only OCT data in which tumor was visible in two subsequent histopathological prostate slices. This analysis could be performed in 3 patients. The mean attenuation coefficients (benign OCT data; malignant OCT data; p-value Mann-Whitney U test) were: (3.23 mm(-1) ; 4.11 mm(-1) ; p < 0.0001) for all patients grouped together. The area under the ROC curve was 0.89. Functional OCT of the prostate has shown to differentiate between cancer and healthy prostate tissue. The optical attenuation coefficient in malignant tissue was significantly higher in malignant tissue compared to benign prostate tissue. Further studies are required to validate these initial results in a larger group of patients with a more tailored histopathology matching protocol. PMID:26856796

  2. Alteration of proliferation and apoptotic markers in normal and premalignant tissue associated with prostate cancer

    PubMed Central

    Ananthanarayanan, Vijayalakshmi; Deaton, Ryan J; Yang, Ximing J; Pins, Michael R; Gann, Peter H

    2006-01-01

    Background Molecular markers identifying alterations in proliferation and apoptotic pathways could be particularly important in characterizing high-risk normal or pre-neoplastic tissue. We evaluated the following markers: Ki67, Minichromosome Maintenance Protein-2 (Mcm-2), activated caspase-3 (a-casp3) and Bcl-2 to determine if they showed differential expression across progressive degrees of intraepithelial neoplasia and cancer in the prostate. To identify field effects, we also evaluated whether high-risk expression patterns in normal tissue were more common in prostates containing cancer compared to those without cancer (supernormal), and in histologically normal glands adjacent to a cancer focus as opposed to equivalent glands that were more distant. Methods The aforementioned markers were studied in 13 radical prostatectomy (RP) and 6 cystoprostatectomy (CP) specimens. Tissue compartments representing normal, low grade prostatic intraepithelial neoplasia (LGPIN), high grade prostatic intraepithelial neoplasia (HGPIN), as well as different grades of cancer were mapped on H&E slides and adjacent sections were analyzed using immunohistochemistry. Normal glands within 1 mm distance of a tumor focus and glands beyond 5 mm were considered "near" and "far", respectively. Randomly selected nuclei and 40 × fields were scored by a single observer; basal and luminal epithelial layers were scored separately. Results Both Ki-67 and Mcm-2 showed an upward trend from normal tissue through HGPIN and cancer with a shift in proliferation from basal to luminal compartment. Activated caspase-3 showed a significant decrease in HGPIN and cancer compartments. Supernormal glands had significantly lower proliferation indices and higher a-casp3 expression compared to normal glands. "Near" normal glands had higher Mcm-2 indices compared to "far" glands; however, they also had higher a-casp3 expression. Bcl-2, which varied minimally in normal tissue, did not show any trend across

  3. α-Klotho Expression in Human Tissues

    PubMed Central

    Lim, Kenneth; Groen, Arnoud; Molostvov, Guerman; Lu, Tzongshi; Lilley, Kathryn S.; Snead, David; James, Sean; Wilkinson, Ian B.; Ting, Stephen

    2015-01-01

    Context: α-Klotho has emerged as a powerful regulator of the aging process. To date, the expression profile of α-Klotho in human tissues is unknown, and its existence in some human tissue types is subject to much controversy. Objective: This is the first study to characterize systemwide tissue expression of transmembrane α-Klotho in humans. We have employed next-generation targeted proteomic analysis using parallel reaction monitoring in parallel with conventional antibody-based methods to determine the expression and spatial distribution of human α-Klotho expression in health. Results: The distribution of α-Klotho in human tissues from various organ systems, including arterial, epithelial, endocrine, reproductive, and neuronal tissues, was first identified by immunohistochemistry. Kidney tissues showed strong α-Klotho expression, whereas liver did not reveal a detectable signal. These results were next confirmed by Western blotting of both whole tissues and primary cells. To validate our antibody-based results, α-Klotho-expressing tissues were subjected to parallel reaction monitoring mass spectrometry (data deposited at ProteomeXchange, PXD002775) identifying peptides specific for the full-length, transmembrane α-Klotho isoform. Conclusions: The data presented confirm α-Klotho expression in the kidney tubule and in the artery and provide evidence of α-Klotho expression across organ systems and cell types that has not previously been described in humans. PMID:26280509

  4. In vivo cryoablation of prostate tissue with temperature monitoring by optoacoustic imaging

    NASA Astrophysics Data System (ADS)

    Petrova, Elena V.; Motamedi, Massoud; Oraevsky, Alexander A.; Ermilov, Sergey A.

    2016-03-01

    Cryoablation of prostate cancer is an FDA approved clinical procedure, which involves repetitive rapid cooling of a lesion to lethal temperatures of -40°C and below. The major drawback of the technique is the insufficient control over the fast thermal processes that may result in severe complications (impotence, incontinence, perforation of the rectal wall) and morbidity. The developed optoacoustic imaging technique provides non-invasive real-time temperature mapping of tissue adjacent to prostate and enables more efficient control over the procedure, which is necessary to reduce side effects and accelerate the physician's learning curve. In these studies we successfully demonstrated real-time transrectal optoacoustic imaging during prostate cryoablation in live canine model focused on optoacoustic thermography of the rectal wall within the depth of 1cm. Our method utilized previously discovered universal thermal dependence of the normalized optoacoustic response of blood. Nanosecond-pulse radiation of Ti-Sapphire laser tuned to the isosbestic point of hemoglobin (802+/-3 nm) was delivered via fiberoptic illuminators assembled on both sides of the linear array of the 128-channel transrectal ultrasound probe. Temperature readouts at discrete locations inside and nearby prostate were also performed using standard transperineal needle sensors. The effect of homeostasis on optoacoustic imaging in live tissue was examined during cooling and shown to be significant only within the range of +/-1.5°C in respect to the body temperature. Accuracy of in vivo optoacoustic temperature measurements was determined as +/-2°C for the range of temperature from +35 to -15°C, which is more than sufficient for tracking the essential isotherms in the course of clinical procedures.

  5. Quantification of phase I / II metabolizing enzyme gene expression and polycyclic aromatic hydrocarbon-DNA adduct levels in human prostate

    PubMed Central

    John, Kaarthik; Ragavan, Narasimhan; Pratt, M. Margaret; Singh, Paras B.; Al-Buheissi, Salah; Matanhelia, Shyam S.; Phillips, David H.; Poirier, Miriam C.; Martin, Francis L.

    2008-01-01

    BACKGROUND Studies of migrant populations suggest that dietary and/or environmental factors play a crucial role in the aetiology of prostatic adenocarcinoma (CaP). The human prostate consists of the peripheral zone (PZ), transition zone (TZ) and central zone (CZ); CaP occurs most often in the PZ. METHODS To investigate the notion that an underlying differential expression of phase I/II genes, and/or the presence of polycyclic aromatic hydrocarbon (PAH)-DNA adducts might explain the elevated PZ susceptibility, we examined prostate tissues (matched tissue sets consisting of PZ and TZ) from men undergoing radical retropubic prostatectomy for CaP (n=26) or cystoprostatectomy (n=1). Quantitative gene expression analysis was employed for cytochrome P450 (CYP) isoforms CYP1A1, CYP1B1 and CYP1A2, as well as N-acetyltransferase 1 and 2 (NAT1 and NAT2) and catechol-O-methyl transferase (COMT). RESULTS CYP1B1, NAT1 and COMT were expressed in all tissue sets; levels of CYP1B1 and NAT1 were consistently higher in the PZ compared to TZ. Immunohistochemistry confirmed the presence of CYP1B1 (nuclear-associated and primarily in basal epithelial cells) and NAT1. Tissue sections from 23 of these aforementioned 27 matched tissue sets were analyzed for PAH-DNA adduct levels using antiserum elicited against DNA modified with r7, t8-dihydroxy-t-9,10-oxy-7,8,9,10-tetrahydro-benzo[a]pyrene (BPDE). PAH-DNA adduct levels were highest in glandular epithelial cells, but a comparison of PZ and TZ showed no significant differences. CONCLUSION Although expression of activating and/or detoxifying enzymes may be higher in the PZ, PAH-DNA adduct levels appear to be similar in both zones. Therefore, factors other than PAH-DNA adducts may be responsible for promotion of tumour formation in the human prostate. PMID:19143007

  6. Dosimetric Coverage of the Prostate, Normal Tissue Sparing, and Acute Toxicity with High-Dose-Rate Brachytherapy for Large Prostate Volumes

    PubMed Central

    Yang, George; Strom, Tobin J.; Wilder, Richard B.; Shrinath, Kushagra; Mellon, Eric A.; Fernandez, Daniel C.; Biagioli, Matthew C.

    2015-01-01

    ABSTRACT Purpose To evaluate dosimetric coverage of the prostate, normal tissue sparing, and acute toxicity with HDR brachytherapy for large prostate volumes. Materials and Methods One hundred and two prostate cancer patients with prostate volumes >50 mL (range: 5-29 mL) were treated with high-dose-rate (HDR) brachytherapy ± intensity modulated radiation therapy (IMRT) to 4,500 cGy in 25 daily fractions between 2009 and 2013. HDR brachytherapy monotherapy doses consisted of two 1,350-1,400 cGy fractions separated by 2-3 weeks, and HDR brachytherapy boost doses consisted of two 950-1,150 cGy fractions separated by 4 weeks. Twelve of 32 (38%) unfavorable intermediate risk, high risk, and very high risk patients received androgen deprivation therapy. Acute toxicity was graded according to the Common Terminology Criteria for Adverse Events (CTCAE) version 4. Results Median follow-up was 14 months. Dosimetric goals were achieved in over 90% of cases. Three of 102 (3%) patients developed Grade 2 acute proctitis. No variables were significantly associated with Grade 2 acute proctitis. Seventeen of 102 (17%) patients developed Grade 2 acute urinary retention. American Urological Association (AUA) symptom score was the only variable significantly associated with Grade 2 acute urinary retention (p=0.04). There was no ≥ Grade 3 acute toxicity. Conclusions Dosimetric coverage of the prostate and normal tissue sparing were adequate in patients with prostate volumes >50 mL. Higher pre-treatment AUA symptom scores increased the relative risk of Grade 2 acute urinary retention. However, the overall incidence of acute toxicity was acceptable in patients with large prostate volumes. PMID:26200536

  7. In vivo determination of the absorption and scattering spectra of the human prostate during photodynamic therapy

    PubMed Central

    Finlay, Jarod C.; Zhu, Timothy C; Dimofte, Andreea; Stripp, Diana; Malkowicz, S. Bruce; Whittington, Richard; Miles, Jeremy; Glatstein, Eli; Hahn, Stephen M.

    2015-01-01

    A continuing challenge in photodynamic therapy is the accurate in vivo determination of the optical properties of the tissue being treated. We have developed a method for characterizing the absorption and scattering spectra of prostate tissue undergoing PDT treatment. Our current prostate treatment protocol involves interstitial illumination of the organ via cylindrical diffusing optical fibers (CDFs) inserted into the prostate through clear catheters. We employ one of these catheters to insert an isotropic white light point source into the prostate. An isotropic detection fiber connected to a spectrograph is inserted into a second catheter a known distance away. The detector is moved along the catheter by a computer-controlled step motor, acquiring diffuse light spectra at 2 mm intervals along its path. We model the fluence rate as a function of wavelength and distance along the detector’s path using an infinite medium diffusion theory model whose free parameters are the absorption coefficient µa at each wavelength and two variables A and b which characterize the reduced scattering spectrum of the form µ’s = Aλ−b. We analyze our spectroscopic data using a nonlinear fitting algorithm to determine A, b, and µa at each wavelength independently; no prior knowledge of the absorption spectrum or of the sample’s constituent absorbers is required. We have tested this method in tissue simulating phantoms composed of intralipid and the photosensitizer motexafin lutetium (MLu). The MLu absorption spectrum recovered from the phantoms agrees with that measured in clear solution, and µa at the MLu absorption peak varies linearly with concentration. The µ’s spectrum reported by the fit is in agreement with the known scattering coefficient of intralipid. We have applied this algorithm to spectroscopic data from human patients sensitized with MLu (2 mg kg−1) acquired before and after PDT. Before PDT, the absorption spectra we measure include the characteristic

  8. Analysis of the Genetic Phylogeny of Multifocal Prostate Cancer Identifies Multiple Independent Clonal Expansions in Neoplastic and Morphologically Normal Prostate Tissue

    PubMed Central

    Gundem, Gunes; Alexandrov, Ludmil B; Kremeyer, Barbara; Butler, Adam; Lynch, Andrew G; Camacho, Niedzica; Massie, Charlie E; Kay, Jonathan; Luxton, Hayley J; Edwards, Sandra; Kote-Jarai, ZSofia; Dennis, Nening; Merson, Sue; Leongamornlert, Daniel; Zamora, Jorge; Corbishley, Cathy; Thomas, Sarah; Nik-Zainal, Serena; O’Meara, Sarah; Matthews, Lucy; Clark, Jeremy; Hurst, Rachel; Mithen, Richard; Bristow, Robert G; Boutros, Paul C; Fraser, Michael; Cooke, Susanna; Raine, Keiran; Jones, David; Menzies, Andrew; Stebbings, Lucy; Hinton, Jon; Teague, Jon; McLaren, Stuart; Mudie, Laura; Hardy, Claire; Anderson, Elizabeth; Joseph, Olivia; Goody, Victoria; Robinson, Ben; Maddison, Mark; Gamble, Stephen; Greenman, Christopher; Berney, Dan; Hazell, Steven; Livni, Naomi; Fisher, Cyril; Ogden, Christopher; Kumar, Pardeep; Thompson, Alan; Woodhouse, Christopher; Nicol, David; Mayer, Erik; Dudderidge, Tim; Shah, Nimish C; Gnanapragasam, Vincent; Voet, Thierry; Campbell, Peter; Futreal, Andrew; Easton, Douglas; Stratton, Michael R

    2015-01-01

    Whole genome DNA sequencing was used to decrypt the phylogeny of multiple samples from distinct areas of cancer and morphologically normal tissue taken from the prostates of three men. Mutations were present at high levels in morphologically normal tissue distant from the cancer reflecting clonal expansions, and the underlying mutational processes at work in morphologically normal tissue were also at work in cancer. Our observations demonstrate the existence of on-going abnormal mutational processes, consistent with field-effects, underlying carcinogenesis. This mechanism gives rise to extensive branching evolution and cancer clone mixing as exemplified by the coexistence of multiple cancer lineages harboring distinct ERG fusions within a single cancer nodule. Subsets of mutations were shared either by morphologically normal and malignant tissue or between different ERG-lineages, indicating earlier or separate clonal cell expansions. Our observations inform on the origin of multifocal disease and have implications for prostate cancer therapy in individual cases. PMID:25730763

  9. Prostate cancer detection using combined auto-fluorescence and light reflectance spectroscopy: ex vivo study of human prostates

    PubMed Central

    Sharma, Vikrant; Olweny, Ephrem O.; Kapur, Payal; Cadeddu, Jeffrey A.; Roehrborn, Claus G.; Liu, Hanli

    2014-01-01

    This study was conducted to evaluate the capability of detecting prostate cancer (PCa) using auto-fluorescence lifetime spectroscopy (AFLS) and light reflectance spectroscopy (LRS). AFLS used excitation at 447 nm with four emission wavelengths (532, 562, 632, and 684 nm), where their lifetimes and weights were analyzed using a double exponent model. LRS was measured between 500 and 840 nm and analyzed by a quantitative model to determine hemoglobin concentrations and light scattering. Both AFLS and LRS were taken on n = 724 distinct locations from both prostate capsular (nc = 185) and parenchymal (np = 539) tissues, including PCa tissue, benign peripheral zone tissue and benign prostatic hyperplasia (BPH), of fresh ex vivo radical prostatectomy specimens from 37 patients with high volume, intermediate-to-high-grade PCa (Gleason score, GS ≥7). AFLS and LRS parameters from parenchymal tissues were analyzed for statistical testing and classification. A feature selection algorithm based on multinomial logistic regression was implemented to identify critical parameters in order to classify high-grade PCa tissue. The regression model was in turn used to classify PCa tissue at the individual aggressive level of GS = 7,8,9. Receiver operating characteristic curves were generated and used to determine classification accuracy for each tissue type. We show that our dual-modal technique resulted in accuracies of 87.9%, 90.1%, and 85.1% for PCa classification at GS = 7, 8, 9 within parenchymal tissues, and up to 91.1%, 91.9%, and 94.3% if capsular tissues were included for detection. Possible biochemical and physiological mechanisms causing signal differences in AFLS and LRS between PCa and benign tissues were also discussed. PMID:24877012

  10. Preliminary results on diode-laser assisted vaporization of prostate tissue

    NASA Astrophysics Data System (ADS)

    Sroka, Ronald; Seitz, Michael; Reich, Oliver; Bachmann, Alexander; Steinbrecher, Verena; Ackermann, Alexander; Stief, Christian

    2007-07-01

    Introduction and objectives: The aim was to identify the capability and the laser parameter of under water tissue vaporisation by means of a diode laser (1470 nm). Afterwards the feasibility and postoperative clinical outcome of vaporization of the prostate was investigated. Method: After acquiring suitable laser parameters in in-vitro experiments using a perfused tissue model patients (n=10) suffering from bladder outlet obstruction due to benign prostatic hyperplasia (BPH) were treated by diode laser. Their clinical outcome, in terms of acceptance and post-operatively voiding were evaluated. The diode laser emitted light of the wavelength of 1470 nm at 50 W (Biolitec GmbH) and delivered to the tissue by means of a side-fire fibre introduced through a 24F continuous-flow cystoscope. Normal saline was used for irrigation with an additive of 1% ethanol. The prostatic lobes (volume range 35-80ml) were vaporized within the prostatic capsular using sweeping and push and pull technique. The mean time of laser application was 2400 sec (1220-4000 sec) resulting in applied energies of 121 kJ in the mean (range: 61-200kJ). Results: During laser treatment none of the 10 patients showed any significant blood loss or any fluid absorption (no ethanol uptake). Foley catheters were removed between 18 and 168 hours postoperatively (mean: 49.8h+/-46h). After removal of the catheter the mean peak urine flow rate increased from 8.9ml/s +/- 2.9ml/s pre-operatively in comparison to 15.7ml/s +/- 5 ml/s (p=0.049) post-operatively. 8/10 patients were satisfied with their voiding outcome. None of the patients showed appearance of urgency, dysuria, hematuria, or incontinence but two patients required re-catheterization. After a follow-up of 1month, 8/10 patients showed evidence of good results and are satisfied with the outcome. Two patients required consecutive TUR-P. After a follow-up of 6-month the 8 patients are still satisfied. Conclusions: This very early and limited experience using

  11. Differential vitamin D 24-hydroxylase/CYP24A1 gene promoter methylation in endothelium from benign and malignant human prostate

    PubMed Central

    Karpf, Adam R; Omilian, Angela R; Bshara, Wiam; Tian, Lili; Tangrea, Michael A; Morrison, Carl D; Johnson, Candace S

    2011-01-01

    Epigenetic alterations occur in tumor-associated vessels in the tumor microenvironment. Methylation of the CYP24A1 gene promoter differs in endothelial cells isolated from tumors and non-tumor microenvironments in mice. The epigenetic makeup of endothelial cells of human tumor-associated vasculature is unknown due to difficulty of isolating endothelial cells populations from a heterogeneous tissue microenvironment. To ascertain CYP24A1 promoter methylation in tumor-associated endothelium, we utilized laser microdissection guided by CD31 immunohistochemistry to procure endothelial cells from human prostate tumor specimens. Prostate tissues were obtained following robotic radical prostatectomy from men with clinically localized prostate cancer. Adjacent histologically benign prostate tissues were used to compare endothelium from benign versus tumor microenvironments. Sodium bisulfite sequencing of CYP24A1 promoter region showed that the average CYP24A1 promoter methylation in the endothelium was 20% from the tumor microenvironment compared with 8.2% in the benign microenvironment (p < 0.05). A 2-fold to 17-fold increase in CYP24A1 promoter methylation was observed in the prostate tumor endothelium compared with the matched benign prostate endothelium in four patient samples, while CYP24A1 promoter methylation remained unchanged in two patient samples. In addition, there is no correlation of the level of CYP24A1 promoter methylation in prostate tumor-associated endothelium with that of epithelium/stroma. This study demonstrates that the CYP24A1 promoter is methylated in tumor-associated endothelium, indicating that epigenetic alterations in CYP24A1 may play a role in determining the phenotype of tumor-associated vasculature in the prostate tumor microenvironment. PMID:21725204

  12. Reference-tissue correction of T2-weighted signal intensity for prostate cancer detection

    NASA Astrophysics Data System (ADS)

    Peng, Yahui; Jiang, Yulei; Oto, Aytekin

    2014-03-01

    The purpose of this study was to investigate whether correction with respect to reference tissue of T2-weighted MRimage signal intensity (SI) improves its effectiveness for classification of regions of interest (ROIs) as prostate cancer (PCa) or normal prostatic tissue. Two image datasets collected retrospectively were used in this study: 71 cases acquired with GE scanners (dataset A), and 59 cases acquired with Philips scanners (dataset B). Through a consensus histology- MR correlation review, 175 PCa and 108 normal-tissue ROIs were identified and drawn manually. Reference-tissue ROIs were selected in each case from the levator ani muscle, urinary bladder, and pubic bone. T2-weighted image SI was corrected as the ratio of the average T2-weighted image SI within an ROI to that of a reference-tissue ROI. Area under the receiver operating characteristic curve (AUC) was used to evaluate the effectiveness of T2-weighted image SIs for differentiation of PCa from normal-tissue ROIs. AUC (+/- standard error) for uncorrected T2-weighted image SIs was 0.78+/-0.04 (datasets A) and 0.65+/-0.05 (datasets B). AUC for corrected T2-weighted image SIs with respect to muscle, bladder, and bone reference was 0.77+/-0.04 (p=1.0), 0.77+/-0.04 (p=1.0), and 0.75+/-0.04 (p=0.8), respectively, for dataset A; and 0.81+/-0.04 (p=0.002), 0.78+/-0.04 (p<0.001), and 0.79+/-0.04 (p<0.001), respectively, for dataset B. Correction in reference to the levator ani muscle yielded the most consistent results between GE and Phillips images. Correction of T2-weighted image SI in reference to three types of extra-prostatic tissue can improve its effectiveness for differentiation of PCa from normal-tissue ROIs, and correction in reference to the levator ani muscle produces consistent T2-weighted image SIs between GE and Phillips MR images.

  13. Use of human tissue explants to study human infectious agents

    PubMed Central

    Grivel, Jean-Charles; Margolis, Leonid

    2012-01-01

    The study of human cell–cell and cell–pathogen interactions that occur in the context of complex tissue cytoarchitecture is critical for deciphering the mechanisms of many normal and pathogenic processes. This protocol describes methods for culturing and infecting explants of human tissues to study the pathogenesis of human infectious agents and their local interactions. The protocol relies on the use of fresh human tissues dissected into small blocks or biopsies that are cultured at the liquid–air interface on collagen rafts. These tissue blocks retain their cytoarchitecture and support productive infection of various pathogens without exogenous stimulation. Experimental details for setting up cultures of human tonsils, lymph nodes and cervicovaginal and rectosigmoid tissues, including protocols for their infection with HIV-1 and other pathogens, are described here. Using this protocol, culture and infections can be set up in 3–6 h and be maintained for 2–3 weeks, depending on the tissue used. PMID:19197269

  14. Pyranocoumarin Tissue Distribution, Plasma Metabolome and Prostate Transcriptome Impacts of Sub-Chronic Exposure to Korean Angelica Supplement in Mice.

    PubMed

    Zhang, Jinhui; Li, Li; Tang, Suni; Zhang, Yong; Markiewski, Maciej; Xing, Chengguo; Jiang, Cheng; Lü, Junxuan

    2016-01-01

    Herbal products containing Korean Angelica gigas Nakai (AGN) root extract are marketed as dietary supplements for memory enhancement, pain killing, and female menopausal symptom relief. We have shown the anticancer activities of AGN supplements in mouse models. To facilitate human anticancer translational research, we characterized the tissue distribution of AGN marker pyranocoumarin compounds decursin (D) and decursinol angelate (DA) ([Formula: see text]% in AGN) and their metabolite decursinol (DOH), assessed the safety of sub-chronic AGN dietary exposure in mice, and explored its impact on plasma aqueous metabolites and the prostate transcriptome. The data show that after a gavage dose, plasma contained readily detectable DOH, but little D and DA, mirroring patterns in the liver. Extra-hepatic tissues retained greater levels of DA and D than the liver did. For sub-chronic exposures, male mice were provided ad libitum AIN93M-pellet diets with 0.5 and 1% AGN for six weeks. No adverse effects were observed on the plasma biochemistry markers of liver and kidney integrity in spite of their enlargement. Histopathological examinations of the liver, kidney and other visceral organs did not reveal tissue abnormalities. Metabolomic assessment of plasma from mice fed the 1%-AGN diet suggested metabolic shifts of key amino acids especially in the methionine-cysteine cycle, purine cycle, and glycolysis-citrate cycle. Prostate transcriptomic profiling identified gene signature changes in the metabolisms of drugs, lipids and cellular energetics, neuro-muscular features, immunity and inflammation, and tumor suppressor/oncogene balance. The safety profile was corroborated with a daily [Formula: see text] injection of AGN extract (100-300[Formula: see text]mg/kg) for four weeks, which resulted in much greater systemic pyranocoumarin exposure than the dietary route did. PMID:27080944

  15. Grating-based tomography of human tissues

    NASA Astrophysics Data System (ADS)

    Müller, Bert; Schulz, Georg; Mehlin, Andrea; Herzen, Julia; Lang, Sabrina; Holme, Margaret; Zanette, Irene; Hieber, Simone; Deyhle, Hans; Beckmann, Felix; Pfeiffer, Franz; Weitkamp, Timm

    2012-07-01

    The development of therapies to improve our health requires a detailed knowledge on the anatomy of soft tissues from the human body down to the cellular level. Grating-based phase contrast micro computed tomography using synchrotron radiation provides a sensitivity, which allows visualizing micrometer size anatomical features in soft tissue without applying any contrast agent. We show phase contrast tomography data of human brain, tumor vessels and constricted arteries from the beamline ID 19 (ESRF) and urethral tissue from the beamline W2 (HASYLAB/DESY) with micrometer resolution. Here, we demonstrate that anatomical features can be identified within brain tissue as well known from histology. Using human urethral tissue, the application of two photon energies is compared. Tumor vessels thicker than 20 μm can be perfectly segmented. The morphology of coronary arteries can be better extracted in formalin than after paraffin embedding.

  16. NCI’s Cooperative Human Tissue Network

    Cancer.gov

    Quality biospecimens are a foundational resource for cancer research. One of NCI’s longest running biospecimen programs is the Cooperative Human Tissue Network, a resource mainly for basic discovery and early translational research.

  17. Detection of cancer cells in prostate tissue with time-resolved fluorescence spectroscopy

    NASA Astrophysics Data System (ADS)

    Gerich, C. E.; Opitz, J.; Toma, M.; Sergon, M.; Füssel, S.; Nanke, R.; Fehre, J.; Wirth, M.; Baretton, G.; Schreiber, J.

    2011-03-01

    Goals: Improving cancer diagnosis is one of the important challenges at this time. The precise differentiation between benign and malignant tissue is in the oncology and oncologic surgery of the utmost significance. A new diagnostic system, that facilitates the decision which tissue has to be removed, would be appreciated. In previous studies many attempts were made to use tissue fluorescence for cancer recognition. However, no clear correlation was found between tissue type and fluorescence parameters like time and wavelength dependent fluorescence intensity I(t, λ). The present study is focused on cooperative behaviour of cells in benign or malignant prostates tissue reflecting differences in their metabolism. Material and Methods: 50 prostate specimens were obtained directly after radical prostatectomy and from each specimen 6 punch biopsies were taken. Time-resolved fluorescence spectra were recorded for 4 different measurement points for each biopsy. The pathologist evaluated each measurement point separately. An algorithm was developed to determine a relevant parameter of the time dependent fluorescence data (fractal dimension DF ). The results of the finding and the DF -value were correlated for each point and then analysed with statistical methods. Results: A total of 1200 measurements points were analysed. The optimal algorithm and conditions for discrimination between malignant and non-malignant tissue areas were found. The correct classification could be stated in 93.4% of analysed points. The ROC-curve (AUC = 0.94) confirms the chosen statistical method as well as it informs about the specificity (0.94) and sensitivity (0.90). Conclusion: The new method seems to offer a very helpful diagnostic tool for pathologists as well as for surgery.

  18. Performance assessment of automated tissue characterization for prostate H and E stained histopathology

    NASA Astrophysics Data System (ADS)

    DiFranco, Matthew D.; Reynolds, Hayley M.; Mitchell, Catherine; Williams, Scott; Allan, Prue; Haworth, Annette

    2015-03-01

    Reliable automated prostate tumor detection and characterization in whole-mount histology images is sought in many applications, including post-resection tumor staging and as ground-truth data for multi-parametric MRI interpretation. In this study, an ensemble-based supervised classification algorithm for high-resolution histology images was trained on tile-based image features including histogram and gray-level co-occurrence statistics. The algorithm was assessed using different combinations of H and E prostate slides from two separate medical centers and at two different magnifications (400x and 200x), with the aim of applying tumor classification models to new data. Slides from both datasets were annotated by expert pathologists in order to identify homogeneous cancerous and non-cancerous tissue regions of interest, which were then categorized as (1) low-grade tumor (LG-PCa), including Gleason 3 and high-grade prostatic intraepithelial neoplasia (HG-PIN), (2) high-grade tumor (HG-PCa), including various Gleason 4 and 5 patterns, or (3) non-cancerous, including benign stroma and benign prostatic hyperplasia (BPH). Classification models for both LG-PCa and HG-PCa were separately trained using a support vector machine (SVM) approach, and per-tile tumor prediction maps were generated from the resulting ensembles. Results showed high sensitivity for predicting HG-PCa with an AUC up to 0.822 using training data from both medical centres, while LG-PCa showed a lower sensitivity of 0.763 with the same training data. Visual inspection of cancer probability heatmaps from 9 patients showed that 17/19 tumors were detected, and HG-PCa generally reported less false positives than LG-PCa.

  19. Prostate cancer specific integrin αvβ3 modulates bone metastatic growth and tissue remodeling

    PubMed Central

    McCabe, NP; De, S; Vasanji, A; Brainard, J; Byzova, TV

    2009-01-01

    The management of pain and morbidity owing to the spreading and growth of cancer within bone remains to be a paramount problem in clinical care. Cancer cells actively transform bone, however, the molecular requirements and mechanisms of this process remain unclear. This study shows that functional modulation of the αvβ3 integrin receptor in prostate cancer cells is required for progression within bone and determines tumor-induced bone tissue transformation. Using histology and quantitative microCT analysis, we show that αvβ3 integrin is required not only for tumor growth within the bone but for tumor-induced bone gain, a response resembling bone lesions in prostate cancer patients. Expression of normal, fully functional αvβ3 enabled tumor growth in bone (incidence: 4/4), whereas αvβ3 (—), inactive or constitutively active mutants of αvβ3 did not (incidence: 0/4, 0/6 and 1/7, respectively) within a 35-day-period. This response appeared to be bone-specific in comparison to the subcutis where tumor incidence was greater than 60% for all groups. Interestingly, bone residing prostate cancer cells expressing normal or dis-regulated αvβ3 (either inactive of constitutively active), but not those lacking β3 promoted bone gain or afforded protection from bone loss in the presence or absence of histologically detectable tumor 35 days following implantation. As bone is replete with ligands for β3 integrin, we next demonstrated that αvβ3 integrin activation on tumor cells is essential for the recognition of key bone-specific matrix proteins. As a result, prostate cancer cells expressing fully functional but not dis-regulated αvβ3 integrin are able to control their own adherence and migration to bone matrix, functions that facilitate tumor growth and control bone lesion development. PMID:17369840

  20. Does Inflammation Mediate the Obesity and BPH Relationship? An Epidemiologic Analysis of Body Composition and Inflammatory Markers in Blood, Urine, and Prostate Tissue, and the Relationship with Prostate Enlargement and Lower Urinary Tract Symptoms

    PubMed Central

    Fowke, Jay H.; Koyama, Tatsuki; Fadare, Oluwole; Clark, Peter E.

    2016-01-01

    Background BPH is a common disease associated with age and obesity. However, the biological pathways between obesity and BPH are unknown. Our objective was to investigate biomarkers of systemic and prostate tissue inflammation as potential mediators of the obesity and BPH association. Methods Participants included 191 men without prostate cancer at prostate biopsy. Trained staff measured weight, height, waist and hip circumferences, and body composition by bioelectric impedance analysis. Systemic inflammation was estimated by serum IL-6, IL-1β, IL-8, and TNF-α; and by urinary prostaglandin E2 metabolite (PGE-M), F2-isoprostane (F2iP), and F2-isoprostane metabolite (F2iP-M) levels. Prostate tissue was scored for grade, aggressiveness, extent, and location of inflammatory regions, and also stained for CD3 and CD20 positive lymphocytes. Analyses investigated the association between multiple body composition scales, systemic inflammation, and prostate tissue inflammation against BPH outcomes, including prostate size at ultrasound and LUTS severity by the AUA-symptom index (AUA-SI). Results Prostate size was significantly associated with all obesity measures. For example, prostate volume was 5.5 to 9.0 mls larger comparing men in the 25th vs. 75th percentile of % body fat, fat mass (kg) or lean mass (kg). However, prostate size was not associated with proinflammatory cytokines, PGE-M, F2iP, F2iP-M, prostate tissue inflammation scores or immune cell infiltration. In contrast, the severity of prostate tissue inflammation was significantly associated with LUTS, such that there was a 7 point difference in AUA-SI between men with mild vs. severe inflammation (p = 0.004). Additionally, men with a greater waist-hip ratio (WHR) were significantly more likely to have severe prostate tissue inflammation (p = 0.02), and a high WHR was significantly associated with moderate/severe LUTS (OR = 2.56, p = 0.03) among those participants with prostate tissue inflammation. Conclusion

  1. Molecular effects of soy phytoalexin glyceollins in human prostate cancer cells LNCaP

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Glyceollins are soy–derived phytoalexins that have been proposed to be candidate cancer preventive compounds. The effect of the glyceollins on prostate cancer is unknown. The present study examined the molecular effects of soy phytoalexins, glyceollins, on the human prostate cancer cell line LNCaP t...

  2. Human Prostatic Acid Phosphatase: Structure, Function and Regulation

    PubMed Central

    Muniyan, Sakthivel; Chaturvedi, Nagendra K.; Dwyer, Jennifer G.; LaGrange, Chad A.; Chaney, William G.; Lin, Ming-Fong

    2013-01-01

    Human prostatic acid phosphatase (PAcP) is a 100 kDa glycoprotein composed of two subunits. Recent advances demonstrate that cellular PAcP (cPAcP) functions as a protein tyrosine phosphatase by dephosphorylating ErbB-2/Neu/HER-2 at the phosphotyrosine residues in prostate cancer (PCa) cells, which results in reduced tumorigenicity. Further, the interaction of cPAcP and ErbB-2 regulates androgen sensitivity of PCa cells. Knockdown of cPAcP expression allows androgen-sensitive PCa cells to develop the castration-resistant phenotype, where cells proliferate under an androgen-reduced condition. Thus, cPAcP has a significant influence on PCa cell growth. Interestingly, promoter analysis suggests that PAcP expression can be regulated by NF-κB, via a novel binding sequence in an androgen-independent manner. Further understanding of PAcP function and regulation of expression will have a significant impact on understanding PCa progression and therapy. PMID:23698773

  3. Melanin content of hamster tissues, human tissues, and various melanomas

    SciTech Connect

    Watts, K.P.; Fairchild, R.G.; Slatkin, D.N.; Greenberg, D.; Packer, S.; Atkins, H.L.; Hannon, S.J.

    1981-02-01

    Melanin content (percentage by weight) was determined in both pigmented and nonpigmented tissues of Syrian golden hamsters bearing Greene melanoma. Melanin content was also measured in various other melanoma models (B-16 in C57 mice, Harding-Passey in BALB/c mice, and KHDD in C3H mice) and in nine human melanomas, as well as in selected normal tissues. The purpose was to evaluate the possible efficacy of chlorpromazine, which is known to bind to melanin, as a vehicle for boron transport in neutron capture therapy. Successful therapy would depend upon selective uptake and absolute concentration of borated compounds in tumors; these parameters will in turn depend upon melanin concentration in melanomas and nonpigmented ''background'' tissues. Hamster whole eyes, hamster melanomas, and other well-pigmented animal melanomas were found to contain 0.3 to 0.8% melanin by weight, whereas human melanomas varied from 0.1 to 0.9% (average, 0.35%). Other tissues, with the exception of skin, were lower in content by a factor of greater than or equal to30. Melanin pigment was extracted from tissues, and the melanin content was determined spectrophotometrically. Measurements were found to be sensitive to the presence of other proteins. Previous procedures for isolating and quantifying melanin often neglected the importance of removing proteins and other interfering nonmelanic substances.

  4. Variation in alternative splicing across human tissues

    PubMed Central

    Yeo, Gene; Holste, Dirk; Kreiman, Gabriel; Burge, Christopher B

    2004-01-01

    Background Alternative pre-mRNA splicing (AS) is widely used by higher eukaryotes to generate different protein isoforms in specific cell or tissue types. To compare AS events across human tissues, we analyzed the splicing patterns of genomically aligned expressed sequence tags (ESTs) derived from libraries of cDNAs from different tissues. Results Controlling for differences in EST coverage among tissues, we found that the brain and testis had the highest levels of exon skipping. The most pronounced differences between tissues were seen for the frequencies of alternative 3' splice site and alternative 5' splice site usage, which were about 50 to 100% higher in the liver than in any other human tissue studied. Quantifying differences in splice junction usage, the brain, pancreas, liver and the peripheral nervous system had the most distinctive patterns of AS. Analysis of available microarray expression data showed that the liver had the most divergent pattern of expression of serine-arginine protein and heterogeneous ribonucleoprotein genes compared to the other human tissues studied, possibly contributing to the unusually high frequency of alternative splice site usage seen in liver. Sequence motifs enriched in alternative exons in genes expressed in the brain, testis and liver suggest specific splicing factors that may be important in AS regulation in these tissues. Conclusions This study distinguishes the human brain, testis and liver as having unusually high levels of AS, highlights differences in the types of AS occurring commonly in different tissues, and identifies candidate cis-regulatory elements and trans-acting factors likely to have important roles in tissue-specific AS in human cells. PMID:15461793

  5. Effects of a human plasma membrane-associated sialidase siRNA on prostate cancer invasion

    SciTech Connect

    Li, Xiaojie; Zhang, Ling; Shao, Yueting; Liang, Zuowen; Shao, Chen; Wang, Bo; Guo, Baofeng; Li, Na; Zhao, Xuejian; Li, Yang; Xu, Deqi

    2011-12-16

    Highlights: Black-Right-Pointing-Pointer Neu3 is as one of the sialidases and regulates cell surface functions. Black-Right-Pointing-Pointer A Neu3-specific siRNA inhibited prostrate cancer cell invasion and migration. Black-Right-Pointing-Pointer The Neu3-specific siRNA inhibited prostate cancer metastasis in mice. Black-Right-Pointing-Pointer Targeting Neu3 may have utility for gene-based therapy of human cancer metastasis. -- Abstract: Human plasma membrane-associated sialidase (Neu3) is one of several sialidases that hydrolyze sialic acids in the terminal position of the carbohydrate groups of glycolipids and glycoproteins. Neu3 is mainly localized in plasma membranes and plays crucial roles in the regulation of cell surface functions. In this study, we investigated the effects and molecular mechanisms of Neu3 on cell invasion and migration in vivo and in vitro. Initially, we found that the levels of Neu3 expression were higher in prostate cancer tissues and cell lines than in normal prostate tissues based on RT-PCR and Western blotting analyses. We then applied a Neu3 siRNA approach to block Neu3 signaling using PC-3M cells as model cells. Transwell invasion assays and wound assays showed significantly decreased invasion and migration potential in the Neu3 siRNA-transfected cells. RT-PCR and Western blotting analyses revealed that Neu3 knockdown decreased the expressions of the matrix metalloproteinases MMP-2 and MMP-9. In vivo, mice injected with PC-3M cell tumors were evaluated by SPECT/CT to determine the presence of bone metastases. Mice treated with attenuated Salmonella carrying the Neu3 siRNA developed fewer bone metastases than mice treated with attenuated Salmonella carrying a control Scramble siRNA, attenuated Salmonella alone or PBS. The results for bone metastasis detection by pathology were consistent with the data obtained by SPECT/CT. Tumor blocks were evaluated by histochemical, RT-PCR and Western blotting analyses. The results revealed

  6. Prediction of alpha1-adrenoceptor occupancy in the human prostate from plasma concentrations of silodosin, tamsulosin and terazosin to treat urinary obstruction in benign prostatic hyperplasia.

    PubMed

    Yamada, Shizuo; Kato, Yasuhiro; Okura, Takashi; Kagawa, Yoshiyuki; Kawabe, Kazuki

    2007-07-01

    Alpha1-adrenoceptor antagonists are clinically useful for the improvement of urinary obstruction due to benign prostatic hyperplasia (BPH), and their therapeutic effects are mediated through the blockade of prostatic alpha(1)-adrenoceptors. The present study was undertaken to predict the magnitude and duration of alpha(1)-adrenoceptor occupancy in the human prostate after oral alpha(1)-adrenoceptor antagonists. Prostatic alpha(1)-adrenoceptor-binding parameters of silodosin were estimated by measuring specific [(3)H]prazosin binding in rat prostate after oral administration of this drug. The plasma concentration of silodosin after oral administration in rats and healthy volunteers was measured using a high-performance liquid chromatographic method. The alpha(1)-adrenoceptor-binding affinities (K(i)) of silodosin, tamsulosin, and terazosin in the human prostate and plasma concentrations of tamsulosin and terazosin were obtained from the literature. Using the alpha(1)-adrenoceptor binding parameters of silodosin in rat prostate, alpha(1)-adrenoceptor occupancy in the human prostate was estimated to be around 60-70% at 1-6 h after oral administration of silodosin at doses of 3.0, 8.1, and 16.1 micromol. Thereafter, the receptor occupancy was periodically decreased, to 24% (8.1 micromol) and 54% (16.1 micromol) 24 h later. A similar magnitude and time course of alpha(1)-adrenoceptor occupancy by silodosin in the human prostate were estimated using alpha(1)-adrenoceptor-binding affinities (K(i)) in the human prostate. Despite about two orders of differences in the plasma unbound concentrations after clinically effective oral dosages of silodosin, tamsulosin, and terazosin, there was a comparable magnitude of prostatic alpha(1)-adrenoceptor occupancy by these drugs. In conclusion, the prediction of alpha(1)-adrenoceptor occupancy in the human prostate by alpha(1)-adrenoceptor antagonists may provide the rationale for the optimum dosage regimen of these drugs in the

  7. The effect of Tookad-mediated photodynamic ablation of the prostate gland on adjacent tissues - in vivo study in a canine model

    PubMed Central

    Huang, Zheng; Chen, Qun; Dole, Kenneth C.; Barqawi, Al B.; Chen, Yang K.; Blanc, Dominique; Wilson, Brian C.; Hetzel, Fred W.

    2008-01-01

    Summary Photodynamic therapy (PDT) mediated with vascular acting photosensitizer Tookad (pd-bacteriopheophorbide) was investigated as an alternative modality for treating prostate cancer. Photodynamic effects on the prostate gland and its adjacent tissues were evaluated in a canine model. Interstitial prostate PDT was performed by irradiating individual lobes with a cylindrical diffuser fiber at various drug/light doses. The sensitivity of the adjacent tissues to Tookad PDT was determined by directly irradiating the surface of the bladder, colon, abdominal muscle and pelvic plexus with a microlens fiber at various drug/light doses. The prostate and adjacent tissues were harvested one-week after the treatment and subjected to histopathological examination. PDT-induced prostate lesions were characterized by marked hemorrhagic necrosis. The bladder, colon, abdominal muscle and pelvic plexus appeared to be sensitive to PDT although the Tookad PDT-induced responses in these tissues were minimal compared to that of the prostate gland at the same dose levels. Nevertheless, the protection of the adjacent tissues should be taken into consideration during the total prostate ablation process due to their sensitivity to PDT. The sensitivity of the prostatic urethra is worth further investigation. Direct intraurethral irradiation might provide an ideal means to determine the sensitivity of the prostatic urethra and might lead to transurethral PDT protocols for the management of benign prostatic hyperplasia. PMID:18046488

  8. The proportion of prostate biopsy tissue with Gleason pattern 4 or 5 predicts for biochemical and clinical outcome after radiotherapy for prostate cancer

    SciTech Connect

    D'Ambrosio, David J.; Hanlon, Alexandra L.; Al-Saleem, Tahseen; Feigenberg, Steven J.; Horwitz, Eric M.; Uzzo, Robert G.; Pollack, Alan; Buyyounouski, Mark K. . E-mail: mark.buyyounouski@fccc.edu

    2007-03-15

    Purpose: To investigate the prognostic utility of the proportion of prostate biopsy tissue containing Gleason pattern 4 or 5 (GP4/5) after definitive radiotherapy (RT) for prostate cancer. Methods and Materials: A total of 568 patients with T1c-3 Nx/0 prostate cancer who received three-dimensional conformal RT alone between May 1989 and August 2001 were studied. There were 161 men with Gleason score 7-10 disease. The GP4/5 was defined as the percentage of biopsy tissue containing Gleason pattern 4 or 5. A Cox proportional hazards model was used for univariate and multivariate analyses (MVA) for biochemical failure (BF) (American Society of Therapeutic Radiology and Oncology definition) and distant metastasis (DM). A recursive partitioning analysis was done using the results of the MVA to identify a cutpoint for GP4/5. Results: The median follow-up was 46 (range, 13-114) months and median RT dose was 76 (range, 65-82) Gy. On MVA, increasing initial prostate-specific antigen (p = 0.0248) decreasing RT dose (continuous, p = 0.0022), T stage (T1/2 vs. T3) (p = 0.0136) and GP4/5 (continuous, p < 0.0001) were significant predictors of BF in a model also containing GS. GP4/5 was the only significant predictor of DM in the same model (p < 0.0001). Conclusion: The GP4/5 in prostate biopsy specimens is a predictor of BF and DM after RT independent of Gleason score. This parameter should be reported by the pathologist when reviewing prostatic biopsy specimens.

  9. Antiinflammatory effect of androgen receptor activation in human benign prostatic hyperplasia cells.

    PubMed

    Vignozzi, Linda; Cellai, Ilaria; Santi, Raffaella; Lombardelli, Letizia; Morelli, Annamaria; Comeglio, Paolo; Filippi, Sandra; Logiodice, Federica; Carini, Marco; Nesi, Gabriella; Gacci, Mauro; Piccinni, Marie-Pierre; Adorini, Luciano; Maggi, Mario

    2012-07-01

    Progression of benign prostatic hyperplasia (BPH) involves chronic inflammation and immune dysregulation. Preclinical studies have demonstrated that prostate inflammation and tissue remodeling are exacerbated by hypogonadism and prevented by testosterone supplementation. We now investigated whether, in humans, hypogonadism was associated with more severe BPH inflammation and the in vitro effect of the selective androgen receptor agonist dihydrotestosterone (DHT) on cultures of stromal cells derived from BPH patients (hBPH). Histological analysis of inflammatory infiltrates in prostatectomy specimens from a cohort of BPH patients and correlation with serum testosterone level was performed. Even after adjusting for confounding factors, hypogonadism was associated with a fivefold increased risk of intraprostatic inflammation, which was also more severe than that observed in eugonadal BPH patients. Triggering hBPH cells by inflammatory stimuli (tumor necrosis factor α, lipopolysaccharide, or CD4(+)T cells) induced abundant secretion of inflammatory/growth factors (interleukin 6 (IL6), IL8, and basic fibroblast growth factor (bFGF)). Co-culture of CD4(+)T cells with hBPH cells induced secretion of Th1 inducer (IL12), Th1-recruiting chemokine (interferon γ inducible protein 10, IP10), and Th2 (IL9)- and Th17 (IL17)-specific cytokines. Pretreatment with DHT inhibited NF-κB activation and suppressed secretion of several inflammatory/growth factors, with the most pronounced effects on IL8, IL6, and bFGF. Reduced inflammatory cytokine production by T-cells, an increase in IL10, and a significant reduction of T cells proliferation suggested that DHT exerted a broad anti inflammatory effect on testosterone cells [corrected]. In conclusion, our data demonstrate that DHT exerts an immune regulatory role on human prostatic stromal cells, inhibiting their potential to actively induce and/or sustain autoimmune and inflammatory responses. PMID:22562653

  10. Automated high-throughput assessment of prostate biopsy tissue using infrared spectroscopic chemical imaging

    NASA Astrophysics Data System (ADS)

    Bassan, Paul; Sachdeva, Ashwin; Shanks, Jonathan H.; Brown, Mick D.; Clarke, Noel W.; Gardner, Peter

    2014-03-01

    Fourier transform infrared (FT-IR) chemical imaging has been demonstrated as a promising technique to complement histopathological assessment of biomedical tissue samples. Current histopathology practice involves preparing thin tissue sections and staining them using hematoxylin and eosin (H&E) after which a histopathologist manually assess the tissue architecture under a visible microscope. Studies have shown that there is disagreement between operators viewing the same tissue suggesting that a complementary technique for verification could improve the robustness of the evaluation, and improve patient care. FT-IR chemical imaging allows the spatial distribution of chemistry to be rapidly imaged at a high (diffraction-limited) spatial resolution where each pixel represents an area of 5.5 × 5.5 μm2 and contains a full infrared spectrum providing a chemical fingerprint which studies have shown contains the diagnostic potential to discriminate between different cell-types, and even the benign or malignant state of prostatic epithelial cells. We report a label-free (i.e. no chemical de-waxing, or staining) method of imaging large pieces of prostate tissue (typically 1 cm × 2 cm) in tens of minutes (at a rate of 0.704 × 0.704 mm2 every 14.5 s) yielding images containing millions of spectra. Due to refractive index matching between sample and surrounding paraffin, minimal signal processing is required to recover spectra with their natural profile as opposed to harsh baseline correction methods, paving the way for future quantitative analysis of biochemical signatures. The quality of the spectral information is demonstrated by building and testing an automated cell-type classifier based upon spectral features.

  11. Prostate Field Cancerization: Deregulated Expression of Macrophage Inhibitory Cytokine 1 (MIC-1) and Platelet Derived Growth Factor A (PDGF-A) in Tumor Adjacent Tissue

    PubMed Central

    Jones, Anna C.; Shoshan, Dor S.; Fischer, Edgar G.; Trujillo, Kristina A.; Bisoffi, Marco

    2015-01-01

    Prostate field cancerization denotes molecular alterations in histologically normal tissues adjacent to tumors. Such alterations include deregulated protein expression, as we have previously shown for the key transcription factor early growth response 1 (EGR-1) and the lipogenic enzyme fatty acid synthase (FAS). Here we add the two secreted factors macrophage inhibitory cytokine 1 (MIC-1) and platelet derived growth factor A (PDGF-A) to the growing list of protein markers of prostate field cancerization. Expression of MIC-1 and PDGF-A was measured quantitatively by immunofluorescence and comprehensively analyzed using two methods of signal capture and several groupings of data generated in human cancerous (n = 25), histologically normal adjacent (n = 22), and disease-free (n = 6) prostate tissues. A total of 208 digitized images were analyzed. MIC-1 and PDGF-A expression in tumor tissues were elevated 7.1x to 23.4x and 1.7x to 3.7x compared to disease-free tissues, respectively (p<0.0001 to p = 0.08 and p<0.01 to p = 0.23, respectively). In support of field cancerization, MIC-1 and PDGF-A expression in adjacent tissues were elevated 7.4x to 38.4x and 1.4x to 2.7x, respectively (p<0.0001 to p<0.05 and p<0.05 to p = 0.51, respectively). Also, MIC-1 and PDGF-A expression were similar in tumor and adjacent tissues (0.3x to 1.0x; p<0.001 to p = 0.98 for MIC-1; 0.9x to 2.6x; p<0.01 to p = 1.00 for PDGF-A). All analyses indicated a high level of inter- and intra-tissue heterogeneity across all types of tissues (mean coefficient of variation of 86.0%). Our data shows that MIC-1 and PDGF-A expression is elevated in both prostate tumors and structurally intact adjacent tissues when compared to disease-free specimens, defining field cancerization. These secreted factors could promote tumorigenesis in histologically normal tissues and lead to tumor multifocality. Among several clinical applications, they could also be exploited as indicators of disease in false negative

  12. Long non-coding RNA ATB promotes growth and epithelial-mesenchymal transition and predicts poor prognosis in human prostate carcinoma.

    PubMed

    Xu, Song; Yi, Xiao-Ming; Tang, Chao-Peng; Ge, Jing-Ping; Zhang, Zheng-Yu; Zhou, Wen-Quan

    2016-07-01

    Long non-coding RNAs (lncRNAs) have been identified to be critical mediators in various tumors associated with cancer progression. Long non-coding RNA activated by TGF-β (lncRNA-ATB) is a stimulator of epithelial-mesenchymal transition (EMT) and serves as a novel prognostic biomarker for hepatocellular carcinoma. However, the biological role and clinical significance of lncRNA-ATB in human prostate cancer have yet to be fully elucidated. The present study was designed to explore the expression of lncRNA-ATB in human prostate cancer patients and the role of lncRNA-ATB in prostate cancer cells. We showed that lncRNA-ATB expression was significantly upregulated in tumor tissues in patients with prostate cancer in comparison with adjacent non-tumor tissues. Further analysis indicted that high lncRNA-ATB expression may be an independent prognostic factor for biochemical recurrence (BCR)-free survival in prostate cancer patients. Overexpression of lncRNA-ATB promoted, and knockdown of lncRNA-ATB inhibited the growth of prostate cancer cells via regulations of cell cycle regulatory protein expression levels. In addition, lncRNA-ATB stimulated epithelial-mesenchymal transition (EMT) associated with ZEB1 and ZNF217 expression levels via ERK and PI3K/AKT signaling pathways. These results indicated that lncRNA-ATB may be considered as a new predictor in the clinical prognosis of patients with prostate cancer. Overexpression of lncRNA-ATB exerts mitogenic and EMT effects of prostate cancer via activation of ERK and PI3K/AKT signaling pathways. PMID:27176634

  13. Long non-coding RNA ATB promotes growth and epithelial-mesenchymal transition and predicts poor prognosis in human prostate carcinoma

    PubMed Central

    XU, SONG; YI, XIAO-MING; TANG, CHAO-PENG; GE, JING-PING; ZHANG, ZHENG-YU; ZHOU, WEN-QUAN

    2016-01-01

    Long non-coding RNAs (lncRNAs) have been identified to be critical mediators in various tumors associated with cancer progression. Long non-coding RNA activated by TGF-β (lncRNA-ATB) is a stimulator of epithelial-mesenchymal transition (EMT) and serves as a novel prognostic biomarker for hepatocellular carcinoma. However, the biological role and clinical significance of lncRNA-ATB in human prostate cancer have yet to be fully elucidated. The present study was designed to explore the expression of lncRNA-ATB in human prostate cancer patients and the role of lncRNA-ATB in prostate cancer cells. We showed that lncRNA-ATB expression was significantly upregulated in tumor tissues in patients with prostate cancer in comparison with adjacent non-tumor tissues. Further analysis indicted that high lncRNA-ATB expression may be an independent prognostic factor for biochemical recurrence (BCR)-free survival in prostate cancer patients. Overexpression of lncRNA-ATB promoted, and knockdown of lncRNA-ATB inhibited the growth of prostate cancer cells via regulations of cell cycle regulatory protein expression levels. In addition, lncRNA-ATB stimulated epithelial-mesenchymal transition (EMT) associated with ZEB1 and ZNF217 expression levels via ERK and PI3K/AKT signaling pathways. These results indicated that lncRNA-ATB may be considered as a new predictor in the clinical prognosis of patients with prostate cancer. Overexpression of lncRNA-ATB exerts mitogenic and EMT effects of prostate cancer via activation of ERK and PI3K/AKT signaling pathways. PMID:27176634

  14. Protective effects of different antioxidants against cadmium induced oxidative damage in rat testis and prostate tissues.

    PubMed

    Jahan, Sarwat; Zahra, Asia; Irum, Umaira; Iftikhar, Natasha; Ullah, Hizb

    2014-08-01

    The present study was performed to determine the effects of different antioxidants on testicular histopathology and oxidative damage induced by cadmium (Cd) in rat testis and prostate. Twenty five rats were equally divided into five groups (n = 5/group). The control group was injected subcutaneously with saline while the Cd alone treated group received a subcutaneous injection of 0.2 mg/kg CdCl(2). Other groups were treated with sulphoraphane (25 µg/rat), vitamin E (75 mg/kg), and Ficus Religiosa plant extract (100 mg/kg) orally along with subcutaneous injections of 0.2 mg/kg CdCl(2) for fifteen days. Oxidative damage in the testicular and prostate tissues were assessed by the estimation of catalase (CAT), peroxidase (POD), superoxide dismutase (SOD), and glutathione reductase (GSR) activity. Lipid peroxidation (TBARS), protein estimation, and histomorphology were also assessed. Cadmium exposure caused a significant decrease in antioxidant enzymes like CAT, POD, SOD, GSR, protein concentrations, and a marked increase in TBARS activity in rat testis and prostate. Histological examination of adult male rat testes showed a disruption in the arrangement of seminiferous tubules along with a reduction in the number of germ cells, Leydig cells, tunica albuginea thickness, diameter of seminiferous tubules, and height of germinal epithelium. Co-treatment with vitamin E, sulphoraphane, and Ficus religiosa were found to be effective in reversing Cd induced toxicity, representing potential therapeutic options to protect the reproductive tissues from the detrimental effects of Cd toxicity. PMID:24758558

  15. Complex degree of mutual anisotropy of linear birefringence and optical activity of biological tissues in diagnostics of prostate cancer

    NASA Astrophysics Data System (ADS)

    Ushenko, V. A.; Gorsky, M. P.

    2013-08-01

    We present theoretical fundamentals of polarization and correlation analysis of the optical anisotropy of biological tissues. Results of measurements of coordinate distributions of the complex degree of mutual anisotropy (CDMA) that are formed by birefringent structures of the prostate tissue with benign and malignant changes are compared. Magnitudes and ranges of variation of statistical (the firstto fourth-order distribution moments) and correlation (excess of autocorrelation functions) parameters of the coordinate CDMA distributions of histological sections of the prostate postoperative bioptic material are studied. Objective criteria of the diagnostics of the appearance of pathology and of the differentiation of the degree of its severity are determined.

  16. Role of androgen and vitamin D receptors in endothelial cells from benign and malignant human prostate

    PubMed Central

    Chung, Ivy; Montecinos, Viviana P.; Buttyan, Ralph; Johnson, Candace S.; Smith, Gary J.

    2013-01-01

    Forty years ago, Judah Folkman (Folkman. N Engl J Med 285: 1182–1186, 1971) proposed that tumor growth might be controlled by limiting formation of new blood vessels (angiogenesis) needed to supply a growing tumor with oxygen and nutrients. To this end, numerous “antiangiogenic” agents have been developed and tested for therapeutic efficacy in cancer patients, including prostate cancer (CaP) patients, with limited success. Despite the lack of clinical efficacy of lead anti-angiogenic therapeutics in CaP patients, recent published evidence continues to support the idea that prostate tumor vasculature provides a reasonable target for development of new therapeutics. Particularly relevant to antiangiogenic therapies targeted to the prostate is the observation that specific hormones can affect the survival and vascular function of prostate endothelial cells within normal and malignant prostate tissues. Here, we review the evidence demonstrating that both androgen(s) and vitamin D significantly impact the growth and survival of endothelial cells residing within prostate cancer and that systemic changes in circulating androgen or vitamin D drastically affect blood flow and vascularity of prostate tissue. Furthermore, recent evidence will be discussed about the expression of the receptors for both androgen and vitamin D in prostate endothelial cells that argues for direct effects of these hormone-activated receptors on the biology of endothelial cells. Based on this literature, we propose that prostate tumor vasculature represents an unexplored target for modulation of tumor growth. A better understanding of androgen and vitamin D effects on prostate endothelial cells will support development of more effective angiogenesis-targeting therapeutics for CaP patients. PMID:23548616

  17. Carbogen breathing increases prostate cancer oxygenation: a translational MRI study in murine xenografts and humans

    PubMed Central

    Alonzi, R; Padhani, A R; Maxwell, R J; Taylor, N J; Stirling, J J; Wilson, J I; d′Arcy, J A; Collins, D J; Saunders, M I; Hoskin, P J

    2009-01-01

    Hypoxia has been associated with poor local tumour control and relapse in many cancer sites, including carcinoma of the prostate. This translational study tests whether breathing carbogen gas improves the oxygenation of human prostate carcinoma xenografts in mice and in human patients with prostate cancer. A total of 23 DU145 tumour-bearing mice, 17 PC3 tumour-bearing mice and 17 human patients with prostate cancer were investigated. Intrinsic susceptibility-weighted MRI was performed before and during a period of carbogen gas breathing. Quantitative R2* pixel maps were produced for each tumour and at each time point and changes in R2* induced by carbogen were determined. There was a mean reduction in R2* of 6.4% (P=0.003) for DU145 xenografts and 5.8% (P=0.007) for PC3 xenografts. In all, 14 human subjects were evaluable; 64% had reductions in tumour R2* during carbogen inhalation with a mean reduction of 21.6% (P=0.0005). Decreases in prostate tumour R2* in both animal models and human patients as a result of carbogen inhalation suggests the presence of significant hypoxia. The finding that carbogen gas breathing improves prostate tumour oxygenation provides a rationale for testing the radiosensitising effects of combining carbogen gas breathing with radiotherapy in prostate cancer patients. PMID:19190629

  18. Antitumor effects of methotrexate-monoclonal anti-prostatic acid phosphatase antibody conjugate on human prostate tumor

    SciTech Connect

    Deguchi, T.; Chu, T.M.; Leong, S.S.; Horoszewicz, J.S.; Lee, C.L.

    1986-03-01

    Methotrexate (MTX) was conjugated to an IgG/sub 1/ monoclonal antibody (MCA) specific for human prostatic acid phosphatase (PAP) by an active ester method, resulting in a molar ratio of MTX to IgG/sub 1/ of 14. MTX-MCA conjugate retained 94% of free antibody activity and preserved 90% of dihydrofolate reductase inhibitory activity of free MTX. MTX-MCA conjugate was shown to be accumulated in vitro by prostate tumor cells (LNCaP) 1.3 times higher than that of MTX conjugate to normal mouse IgG (NIgG) and 6.2 times higher than that of free MTX. Antitumor activity in vitro exhibited that MTX-MCA conjugate is more effective on inhibition (52%) of /sup 3/H-deoxyuridine incorporation into LNCaP cells than that of MTX-NIgG (39%), but both were less effective than free MTX (70%). The in vivo distribution of /sup 3/H-MTX-MCA conjugate in human prostate tumor xenograft (tumor: blood ratio 5.1) was higher than those of /sup 3/H-MTX-NIgG conjugate (1.1) and of free /sup 3/H-MTX (1.5). Anti-tumor activity in vivo demonstrated that MTX-MCA conjugate retarded the growth of xenografted human prostate tumor greatly and persistently, as compared with the control groups. These results suggested that MTX-monoclonal anti-PAP antibody conjugate represents a potential reagent for immunochemotherapy of human prostate tumor (NIH CA-34536, CA-15437 and ACS CH-269.

  19. Aminomethylphosphonic acid inhibits growth and metastasis of human prostate cancer in an orthotopic xenograft mouse model.

    PubMed

    Parajuli, Keshab Raj; Zhang, Qiuyang; Liu, Sen; You, Zongbing

    2016-03-01

    Aminomethylphosphonic acid (AMPA) has been shown to inhibit prostate cancer cell growth in vitro. The purpose of the present study was to determine if AMPA could inhibit growth and metastasis of prostate cancer in vivo. Human prostate cancer PC-3-LacZ-luciferase cells were implanted into the ventral lateral lobes of the prostate in 39 athymic Nu/Nu nude male mice. Seven days later, mice were randomized into the control group (n = 14, treated intraperitoneally with phosphate buffered saline), low dose group (n = 10, treated intraperitoneally with AMPA at 400 mg/kg body weight/day), and high dose group (n = 15, treated intraperitoneally with AMPA at 800 mg/kg body weight/day). Tumor growth and metastasis were examined every 4-7 days by bioluminescence imaging of live mice. We found that AMPA treatment significantly inhibited growth and metastasis of orthotopic xenograft prostate tumors and prolonged the survival time of the mice. AMPA treatment decreased expression of BIRC2 and activated caspase 3, leading to increased apoptosis in the prostate tumors. AMPA treatment decreased expression of cyclin D1. AMPA treatment also reduced angiogenesis in the prostate tumors. Taken together, these results demonstrate that AMPA can inhibit prostate cancer growth and metastasis, suggesting that AMPA may be developed into a therapeutic agent for the treatment of prostate cancer. PMID:26840261

  20. Aminomethylphosphonic acid inhibits growth and metastasis of human prostate cancer in an orthotopic xenograft mouse model

    PubMed Central

    Parajuli, Keshab Raj; Zhang, Qiuyang; Liu, Sen; You, Zongbing

    2016-01-01

    Aminomethylphosphonic acid (AMPA) has been shown to inhibit prostate cancer cell growth in vitro. The purpose of the present study was to determine if AMPA could inhibit growth and metastasis of prostate cancer in vivo. Human prostate cancer PC-3-LacZ-luciferase cells were implanted into the ventral lateral lobes of the prostate in 39 athymic Nu/Nu nude male mice. Seven days later, mice were randomized into the control group (n = 14, treated intraperitoneally with phosphate buffered saline), low dose group (n = 10, treated intraperitoneally with AMPA at 400 mg/kg body weight/day), and high dose group (n = 15, treated intraperitoneally with AMPA at 800 mg/kg body weight/day). Tumor growth and metastasis were examined every 4-7 days by bioluminescence imaging of live mice. We found that AMPA treatment significantly inhibited growth and metastasis of orthotopic xenograft prostate tumors and prolonged the survival time of the mice. AMPA treatment decreased expression of BIRC2 and activated caspase 3, leading to increased apoptosis in the prostate tumors. AMPA treatment decreased expression of cyclin D1. AMPA treatment also reduced angiogenesis in the prostate tumors. Taken together, these results demonstrate that AMPA can inhibit prostate cancer growth and metastasis, suggesting that AMPA may be developed into a therapeutic agent for the treatment of prostate cancer. PMID:26840261

  1. Human histocultures (tissue explants) in retrovirology

    PubMed Central

    Arakelyan, Anush; Fitzgerald, Wendy; Grivel, Jean-Charles; Vanpouille, Christophe; Margolis, Leonid

    2014-01-01

    Summary Viral pathogenesis is studied predominantly in cultures of primary isolated cells or cell lines. Many retroviruses efficiently replicate only in activated cells. Therefore, in order to become efficient viral producers cells should be artificially activated, a procedure which significantly changes cell physiology. However, for many viral diseases, like HIV-1 and other retroviruses’ diseases, critical pathogenic events occur in tissues and cell isolation from their native microenvironment prevents single cell cultures from faithfully reflecting important aspects of cell-cell and cell-pathogen interactions that occur in the context of complex tissue cytoarchitecture. Tissue explants (histocultures) that retain tissue cytoarchitecture and many aspects of cell-cell interactions more faithfully represent in vivo tissue features. Human histocultures constitute an adequate model for studying viral pathogenesis under controlled laboratory conditions. Protocols for various human histocultures as applied to study retroviral pathogenesis, in particular of HIV-1, have been refined by our laboratory and are described in the present publication. Human histocultures of human tonsils and lymph nodes, as well as of recto-sigmoid and cervico-vaginal tissues can be used to study viral transmission, pathogenesis and as a pre-clinical platform for antivirals evaluation. PMID:24158827

  2. Increased Expression of Herpes Virus-Encoded hsv1-miR-H18 and hsv2-miR-H9-5p in Cancer-Containing Prostate Tissue Compared to That in Benign Prostate Hyperplasia Tissue

    PubMed Central

    Shinn, Helen Ki; Yan, Chunri; Kim, Tae-Hwan; Kim, Sang Tae; Kim, Won Tae; Lee, Ok-Jun; Moon, Sung-Kwon; Kim, Nam-Hyung; Kim, Jayoung; Cha, Eun-Jong

    2016-01-01

    Purpose: Previously, we reported the presence of virus-encoded microRNAs (miRNAs) in the urine of prostate cancer (CaP) patients. In this study, we investigated the expression of two herpes virus-encoded miRNAs in prostate tissue. Methods: A total of 175 tissue samples from noncancerous benign prostatic hyperplasia (BPH), 248 tissue samples from patients with CaP and BPH, and 50 samples from noncancerous surrounding tissues from these same patients were analyzed for the expression of two herpes virus-encoded miRNAs by real-time polymerase chain reaction (PCR) and immunocytochemistry using nanoparticles as molecular beacons. Results: Real-time reverse transcription-PCR results revealed significantly higher expression of hsv1-miR-H18 and hsv2-miRH9- 5p in surrounding noncancerous and CaP tissues than that in BPH tissue (each comparison, P<0.001). Of note, these miRNA were expressed equivalently in the CaP tissues and surrounding noncancerous tissues. Moreover, immunocytochemistry clearly demonstrated a significant enrichment of both hsv1-miR-H18 and hsv2-miR-H9 beacon-labeled cells in CaP and surrounding noncancerous tissue compared to that in BPH tissue (each comparison, P<0.05 for hsv1-miR-H18 and hsv2- miR-H9). Conclusions: These results suggest that increased expression of hsv1-miR-H18 and hsv2-miR-H95p might be associated with tumorigenesis in the prostate. Further studies will be required to elucidate the role of these miRNAs with respect to CaP and herpes viral infections. PMID:27377944

  3. How does performance of ultrasound tissue typing affect design of prostate IMRT dose-painting protocols?

    SciTech Connect

    Zhang Pengpeng . E-mail: pz2010@columbia.edu; Osterman, K. Sunshine; Liu Tian; Li Xiang; Kessel, Jack; Wu, Leester; Schiff, Peter; Kutcher, Gerald J.

    2007-02-01

    Purpose: To investigate how the performance characteristics of ultrasound tissue typing (UTT) affect the design of a population-based prostate dose-painting protocol. Methods and Materials: The performance of UTT is evaluated using the receiver operating characteristic curve. As the imager's sensitivity increases, more tumors are detected, but the specificity worsens, causing more false-positive results. The UTT tumor map, obtained with a specific sensitivity and specificity setup, was used with the patient's CT image to guide intensity-modulated radiotherapy (IMRT) planning. The optimal escalation dose to the UTT positive region, as well as the safe dose to the negative background, was obtained by maximizing the uncomplicated control (i.e., a combination of tumor control probability and weighted normal tissue complication probability). For high- and low-risk tumors, IMRT plans guided by conventional ultrasound or UTT with a one-dimensional or two-dimensional spectrum analysis technique were compared with an IMRT plan in which the whole prostate was dose escalated. Results: For all imaging modalities, the specificity of 0.9 was chosen to reduce complications resulting from high false-positive results. If the primary tumors were low risk, the IMRT plans guided by all imaging modalities achieved high tumor control probability and reduced the normal tissue complication probability significantly compared with the plan with whole gland dose escalation. However, if the primary tumors were high risk, the accuracy of the imaging modality was critical to maintain the tumor control probability and normal tissue complication probability at acceptable levels. Conclusion: The performance characteristics of an imager have important implications in dose painting and should be considered in the design of dose-painting protocols.

  4. Automated segmentation of reference tissue for prostate cancer localization in dynamic contrast enhanced MRI

    NASA Astrophysics Data System (ADS)

    Vos, Pieter C.; Hambrock, Thomas; Barentsz, Jelle O.; Huisman, Henkjan J.

    2010-03-01

    For pharmacokinetic (PK) analysis of Dynamic Contrast Enhanced (DCE) MRI the arterial input function needs to be estimated. Previously, we demonstrated that PK parameters have a significant better discriminative performance when per patient reference tissue was used, but required manual annotation of reference tissue. In this study we propose a fully automated reference tissue segmentation method that tackles this limitation. The method was tested with our Computer Aided Diagnosis (CADx) system to study the effect on the discriminating performance for differentiating prostate cancer from benign areas in the peripheral zone (PZ). The proposed method automatically segments normal PZ tissue from DCE derived data. First, the bladder is segmented in the start-to-enhance map using the Otsu histogram threshold selection method. Second, the prostate is detected by applying a multi-scale Hessian filter to the relative enhancement map. Third, normal PZ tissue was segmented by threshold and morphological operators. The resulting segmentation was used as reference tissue to estimate the PK parameters. In 39 consecutive patients carcinoma, benign and normal tissue were annotated on MR images by a radiologist and a researcher using whole mount step-section histopathology as reference. PK parameters were computed for each ROI. Features were extracted from the set of ROIs using percentiles to train a support vector machine that was used as classifier. Prospective performance was estimated by means of leave-one-patient-out cross validation. A bootstrap resampling approach with 10,000 iterations was used for estimating the bootstrap mean AUCs and 95% confidence intervals. In total 42 malignant, 29 benign and 37 normal regions were annotated. For all patients, normal PZ was successfully segmented. The diagnostic accuracy obtained for differentiating malignant from benign lesions using a conventional general patient plasma profile showed an accuracy of 0.64 (0.53-0.74). Using the

  5. Role of IAPs in prostate cancer progression: immunohistochemical study in normal and pathological (benign hyperplastic, prostatic intraepithelial neoplasia and cancer) human prostate

    PubMed Central

    2010-01-01

    Background In this study was investigate IAPs in normal human prostate (NP), benign prostatic hyperplasia (BPH), prostatic intraepithelial neoplasia (PIN) and prostatic carcinoma (PC), and their involvement in apoptosis/proliferation via NF-kB (TNF-α, IL-1) stimulation. Methods Immunohistochemical and Western blot analyses were performed in 10 samples of normal prostates, 35 samples of BPH, 27 samples diagnosis of PIN (with low-grade PIN or high-grade PIN) and 95 samples of PC (with low, medium or high Gleason grades). Results In NP, cytoplasm of epithelial cells were positive to c-IAP1/2 (80% of samples), c-IAP-2 (60%), ILP (20%), XIAP (20%); negative to NAIP and survivin. In BPH, epithelial cells were immunostained to c-IAP1/2 (57.57%), c-IAP-2 (57.57%), ILP (66.6%), NAIP (60.6%), XIAP (27.27%), survivin (9.1%). Whereas low-grade PIN showed intermediate results between NP and BPH; results in high-grade PIN were similar to those found in PC. In PC, epithelial cells were immunostained to c-IAP1/2, c-IAP-2, ILP, NAIP, XIAP (no Gleason variation) and survivin (increasing with Gleason). Conclusions IAPs could be involved in prostate disorder (BPH, PIN and PC) development since might be provoke inhibition of apoptosis and subsequently cell proliferation. At the same time, different transduction pathway such as IL-1/NIK/NF-kB or TNF/NF-kB (NIK or p38) also promotes proliferation. Inhibitions of IAPs, IL-1α and TNFα might be a possible target for PC treatment since IAPs are the proteins that inhibited apoptosis (favour proliferation) and IL-1α and TNFα would affect all the transduction pathway involucrate in the activation of transcription factors related to survival or proliferation (NF-kB, Elk-1 or ATF-2). PMID:20078866

  6. Prostate PDT dosimetry

    PubMed Central

    Zhu, Timothy C.; Finlay, Jarod C.

    2015-01-01

    Summary We provide a review of the current state of dosimetry in prostate photodynamic therapy (PDT). PDT of the human prostate has been performed with a number of different photosensitizers and with a variety of dosimetry schemes. The simplest clinical light dose prescription is to quantify the total light energy emitted per length (J/cm) of cylindrical diffusing fibers (CDF) for patients treated with a defined photosensitizer injection per body weight. However, this approach does not take into account the light scattering by tissue and usually underestimates the local light fluence rate, and consequently the fluence. Techniques have been developed to characterize tissue optical properties and light fluence rates in vivo using interstitial measurements during prostate PDT. Optical methods have been developed to characterize tissue absorption and scattering spectra, which in turn provide information about tissue oxygenation and drug concentration. Fluorescence techniques can be used to quantify drug concentrations and photobleaching rates of photosensitizers. PMID:25046988

  7. The cancer-promoting gene fatty acid-binding protein 5 (FABP5) is epigenetically regulated during human prostate carcinogenesis.

    PubMed

    Kawaguchi, Koichiro; Kinameri, Ayumi; Suzuki, Shunsuke; Senga, Shogo; Ke, Youqiang; Fujii, Hiroshi

    2016-02-15

    FABPs (fatty-acid-binding proteins) are a family of low-molecular-mass intracellular lipid-binding proteins consisting of ten isoforms. FABPs are involved in binding and storing hydrophobic ligands such as long-chain fatty acids, as well as transporting these ligands to the appropriate compartments in the cell. FABP5 is overexpressed in multiple types of tumours. Furthermore, up-regulation of FABP5 is strongly associated with poor survival in triple-negative breast cancer. However, the mechanisms underlying the specific up-regulation of the FABP5 gene in these cancers remain poorly characterized. In the present study, we determined that FABP5 has a typical CpG island around its promoter region. The DNA methylation status of the CpG island in the FABP5 promoter of benign prostate cells (PNT2), prostate cancer cells (PC-3, DU-145, 22Rv1 and LNCaP) and human normal or tumour tissue was assessed by bisulfite sequencing analysis, and then confirmed by COBRA (combined bisulfite restriction analysis) and qAMP (quantitative analysis of DNA methylation using real-time PCR). These results demonstrated that overexpression of FABP5 in prostate cancer cells can be attributed to hypomethylation of the CpG island in its promoter region, along with up-regulation of the direct trans-acting factors Sp1 (specificity protein 1) and c-Myc. Together, these mechanisms result in the transcriptional activation of FABP5 expression during human prostate carcinogenesis. Importantly, silencing of Sp1, c-Myc or FABP5 expression led to a significant decrease in cell proliferation, indicating that up-regulation of FABP5 expression by Sp1 and c-Myc is critical for the proliferation of prostate cancer cells. PMID:26614767

  8. Towards 3D ultrasound image based soft tissue tracking: a transrectal ultrasound prostate image alignment system.

    PubMed

    Baumann, Michael; Mozer, Pierre; Daanen, Vincent; Troccaz, Jocelyne

    2007-01-01

    The emergence of real-time 3D ultrasound (US) makes it possible to consider image-based tracking of subcutaneous soft tissue targets for computer guided diagnosis and therapy. We propose a 3D transrectal US based tracking system for precise prostate biopsy sample localisation. The aim is to improve sample distribution, to enable targeting of unsampled regions for repeated biopsies, and to make post-interventional quality controls possible. Since the patient is not immobilized, since the prostate is mobile and due to the fact that probe movements are only constrained by the rectum during biopsy acquisition, the tracking system must be able to estimate rigid transformations that are beyond the capture range of common image similarity measures. We propose a fast and robust multi-resolution attribute-vector registration approach that combines global and local optimization methods to solve this problem. Global optimization is performed on a probe movement model that reduces the dimensionality of the search space and thus renders optimization efficient. The method was tested on 237 prostate volumes acquired from 14 different patients for 3D to 3D and 3D to orthogonal 2D slices registration. The 3D-3D version of the algorithm converged correctly in 96.7% of all cases in 6.5s with an accuracy of 1.41mm (r.m.s.) and 3.84mm (max). The 3D to slices method yielded a success rate of 88.9% in 2.3s with an accuracy of 1.37mm (r.m.s.) and 4.3mm (max). PMID:18044549

  9. Cadmium Levels in Tissue and Plasma as a Risk Factor for Prostate Carcinoma: a Meta-Analysis.

    PubMed

    Zhang, Liang; Zhu, Yi; Hao, Rui; Shao, Mengmeng; Luo, Yunbo

    2016-07-01

    Cadmium is a heavy metal that has been suggested to be a carcinogen by evidence. A number of published studies have investigated the association between cadmium levels and prostate cancer, but the results were inconsistent. Thus, we conducted a meta-analysis to get a precise estimate of this subject. After a careful searching and screening, a total of 11 publications containing 14 separated studies were included. Based on a random-effect model, the pooled data showed that cadmium levels of prostate tissues (standard mean difference (SMD) = 3.17, 95 % confidence interval (CI) = 0.60-5.74, P < 0.05) and plasma (SMD = 4.07, 95 % CI = 2.01-6.13, P < 0.05) were significantly higher in prostate cancer patients than those in the healthy controls. No difference of hair and nail cadmium levels between the prostate cancer cases and the controls was found. The data suggested that cadmium exposure might exert an influence on the tumorigenesis of prostate tissues. Future investigations with large sample sizes are needed to verify the results. PMID:26631052

  10. Time-resolved fluorescence imaging (TRFI) for direct immunofluorescence of PSA and alpha-1-antichymotrypsin in prostatic tissue sections.

    PubMed

    Bjartell, A; Siivola, P; Hulkko, S; Pettersson, K; Rundt, K; Lilja, H; Lövgren, T

    1999-05-01

    We have developed a direct immunofluorescence technique utilising chelates of the lanthanide ions europium and terbium conjugated to monoclonal IgGs (Mabs) against prostate-specific antigen (PSA) and alpha-1-antichymotrypsin (ACT) for the detection and quantification on the same tissue section. Strong signals without disturbance from tissue autofluorescence were demonstrated in paraffin sections of ten benign and six malignant prostate tissue specimens. The signal intensity increased linearly with the amount of labelled Mab until epitope saturation began. The highest concentrations of bound IgG in tissue sections were 27.3 fmol/pixel for ACT and 7.2 for PSA. Time-resolved fluorescence imaging (TRFI) offers an attractive method for histochemical studies based on specific and quantitative detection of fluorescent lanthanide chelates. PMID:12496823

  11. Distribution of somatostatin receptors in normal and neoplastic human tissues: recent advances and potential relevance.

    PubMed Central

    Reubi, J. C.; Schaer, J. C.; Markwalder, R.; Waser, B.; Horisberger, U.; Laissue, J.

    1997-01-01

    This short review describes the localization of somatostatin receptors with in vitro receptor autoradiography techniques in several non-classical, normal human somatostatin target tissues as well as in selected human tumors. In addition to brain, gut and neuroendocrine localizations, somatostatin receptors are expressed in most lymphatic tissues, including gut-associated lymphatic tissue, spleen and thymus; in the cortical and medullary area of the kidney; in the stroma of the prostate and in the epithelial cells of the thyroid. Among human tumors, the extremely high density of somatostatin receptors in medulloblastomas should be stressed as well as the favorable prognostic role of the presence of somatostatin receptors in neuroblastomas. Moreover, several types of mesenchymal tumors have somatostatin receptors as well. The receptor subtypes expressed by distinct tumors may vary: Whereas medulloblastomas and neuroblastomas predominantly express sst2, prostate cancers express sst1 rather than sst2. A further emerging somatostatin target is represented by the peritumoral veins, also known to express sst2 receptors. The multiple somatostatin targets in normal and pathological human tissues represents the basis for potential diagnostic and clinical applications of somatostatin analogs. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:9825475

  12. Glycoproteomic Analysis of Prostate Cancer Tissues by SWATH Mass Spectrometry Discovers N-acylethanolamine Acid Amidase and Protein Tyrosine Kinase 7 as Signatures for Tumor Aggressiveness*

    PubMed Central

    Liu, Yansheng; Chen, Jing; Sethi, Atul; Li, Qing K.; Chen, Lijun; Collins, Ben; Gillet, Ludovic C. J.; Wollscheid, Bernd; Zhang, Hui; Aebersold, Ruedi

    2014-01-01

    The identification of biomarkers indicating the level of aggressiveness of prostate cancer (PCa) will address the urgent clinical need to minimize the general overtreatment of patients with non-aggressive PCa, who account for the majority of PCa cases. Here, we isolated formerly N-linked glycopeptides from normal prostate (n = 10) and from non-aggressive (n = 24), aggressive (n = 16), and metastatic (n = 25) PCa tumor tissues and analyzed the samples using SWATH mass spectrometry, an emerging data-independent acquisition method that generates a single file containing fragment ion spectra of all ionized species of a sample. The resulting datasets were searched using a targeted data analysis strategy in which an a priori spectral reference library representing known N-glycosites of the human proteome was used to identify groups of signals in the SWATH mass spectrometry data. On average we identified 1430 N-glycosites from each sample. Out of those, 220 glycoproteins showed significant quantitative changes associated with diverse biological processes involved in PCa aggressiveness and metastasis and indicated functional relationships. Two glycoproteins, N-acylethanolamine acid amidase and protein tyrosine kinase 7, that were significantly associated with aggressive PCa in the initial sample cohort were further validated in an independent set of patient tissues using tissue microarray analysis. The results suggest that N-acylethanolamine acid amidase and protein tyrosine kinase 7 may be used as potential tissue biomarkers to avoid overtreatment of non-aggressive PCa. PMID:24741114

  13. Synchrotron FTIR Imaging For The Identification Of Cell Types Within Human Tissues

    SciTech Connect

    Walsh, Michael J.; Pounder, F. Nell; Nasse, Michael J.; Macias, Virgilia; Kajdacsy-Balla, Andre; Hirschmugl, Carol; Bhargava, Rohit

    2010-02-03

    The use of synchrotron Fourier Transform Infrared spectroscopy (S-FTIR) has been shown to be a very promising tool for biomedical research. S-FTIR spectroscopy allows for the fast acquisition of infrared (IR) spectra at a spatial resolution approaching the IR diffraction limit. The development of the Infrared Environmental Imaging (IRENI) beamline at the Synchrotron Radiation Center (SRC) at the University of Wisconsin-Madison has allowed for diffraction limited imaging measurements of cells in human prostate and breast tissues. This has allowed for the identification of cell types within tissues that would otherwise not have been resolvable using conventional FTIR sources.

  14. SPOCK1 promotes tumor growth and metastasis in human prostate cancer

    PubMed Central

    Chen, Qi; Yao, Yuan-ting; Xu, Huan; Chen, Yan-bo; Gu, Meng; Cai, Zhi-kang; Wang, Zhong

    2016-01-01

    Prostate cancer is the most diagnosed noncutaneous cancer and ranks as the second leading cause of cancer-related deaths in American males. Metastasis is the primary cause of prostate cancer mortality. Survival rate is only 28% for metastatic patients, but is nearly 100% for patients with localized prostate cancers. Molecular mechanisms that underlie this malignancy remain obscure, and this study investigated the role of SPARC/osteonectin, cwcv, and kazal-like domain proteoglycan 1 (SPOCK1) in prostate cancer progression. Initially, we found that SPOCK1 expression was significantly higher in prostate cancer tissues relative to noncancerous tissues. In particular, SPOCK1 expression was also markedly high in metastatic tissues compared with nonmetastatic cancerous tissues. SPOCK1 expression knockdown by specific short hairpin RNA in PC3 cells was significantly inhibited, whereas SPOCK1 overexpression in RWPE-1 cells promoted cell viability, colony formation in vitro, and tumor growth in vivo. Moreover, the SPOCK1 knockdown in PC3 cells was associated with cell cycle arrest in G0/G1 phase, while the SPOCK1 overexpression in RWPE-1 cells induced cell cycle arrest in S phase. The SPOCK1 knockdown in PC3 cells even increased cell apoptosis. SPOCK1 modulation was also observed to affect cancerous cell proliferation and apoptotic processes in the mouse model of prostate cancer. Additionally, the SPOCK1 knockdown decreased, whereas the SPOCK1 overexpression increased cell migration and invasion abilities in vitro. Injection of SPOCK1-depleted PC3 cells significantly decreased metastatic nodules in mouse lungs. These findings suggest that SPOCK1 is a critical mediator of tumor growth and metastasis in prostate cancer. PMID:27486308

  15. Tissue Specificity of Human Angiotensin I-Converting Enzyme

    PubMed Central

    Kryukova, Olga V.; Tikhomirova, Victoria E.; Golukhova, Elena Z.; Evdokimov, Valery V.; Kalantarov, Gavreel F.; Trakht, Ilya N.; Schwartz, David E.; Dull, Randal O.; Gusakov, Alexander V.; Uporov, Igor V.; Kost, Olga A.; Danilov, Sergei M.

    2015-01-01

    Background Angiotensin-converting enzyme (ACE), which metabolizes many peptides and plays a key role in blood pressure regulation and vascular remodeling, as well as in reproductive functions, is expressed as a type-1 membrane glycoprotein on the surface of endothelial and epithelial cells. ACE also presents as a soluble form in biological fluids, among which seminal fluid being the richest in ACE content - 50-fold more than that in blood. Methods/Principal Findings We performed conformational fingerprinting of lung and seminal fluid ACEs using a set of monoclonal antibodies (mAbs) to 17 epitopes of human ACE and determined the effects of potential ACE-binding partners on mAbs binding to these two different ACEs. Patterns of mAbs binding to ACEs from lung and from seminal fluid dramatically differed, which reflects difference in the local conformations of these ACEs, likely due to different patterns of ACE glycosylation in the lung endothelial cells and epithelial cells of epididymis/prostate (source of seminal fluid ACE), confirmed by mass-spectrometry of ACEs tryptic digests. Conclusions Dramatic differences in the local conformations of seminal fluid and lung ACEs, as well as the effects of ACE-binding partners on mAbs binding to these ACEs, suggest different regulation of ACE functions and shedding from epithelial cells in epididymis and prostate and endothelial cells of lung capillaries. The differences in local conformation of ACE could be the base for the generation of mAbs distingushing tissue-specific ACEs. PMID:26600189

  16. Semi-parametric time-domain quantification of HR-MAS data from prostate tissue

    PubMed Central

    Ratiney, Helene; Albers, Mark J.; Rabeson, Herald; Kurhanewicz, John

    2011-01-01

    High Resolution – Magic Angle Spinning (HR-MAS) spectroscopy provides rich biochemical profiles that require accurate quantification to permit biomarker identification and to understand the underlying pathological mechanisms. Meanwhile, quantification of HR-MAS data from prostate tissue samples is challenging due to significant overlap between the resonant peaks, the presence of short T2∗ metabolites such as citrate or polyamines (T2 from 25 to 100 msec) and macromolecules, and variations in chemical shifts and T2∗s within a metabolite’s spin systems. Since existing methods do not address these challenges completely, a new quantification method was developed and optimized for HR-MAS data acquired with an ultra short TE and over 30,000 data points. The proposed method, named HR-QUEST (High Resolution – QUEST), iteratively employs the QUEST time-domain semi-parametric strategy with a new model function that incorporates prior knowledge from whole and subdivided metabolite signals. With these features, HR-QUEST is able to independently fit the chemical shifts and T2∗s of a metabolite’s spin systems, a necessity for HR-MAS data. By using the iterative fitting approach, it is able to account for significant contributions from macromolecules and to handle shorter T2 metabolites, such as citrate and polyamines. After subdividing the necessary metabolite basis signals, the root mean square (RMS) of the residual was reduced by 52% for measured HR-MAS data from prostate tissue. Monte Carlo studies on simulated spectra with varied macromolecular contributions showed that the iterative fitting approach (6 iterations) coupled with inclusion of long T2 macromolecule components in the basis set improve the quality of the fit, as assessed by the reduction of the RMS of the residual and of the RMS error of the metabolite signal estimate, by 27% and 71% respectively. With this optimized configuration, HR-QUEST was applied to measured HR-MAS prostate data and reliably

  17. Selenium and Vitamin E: Cell Type– and Intervention-Specific Tissue Effects in Prostate Cancer

    PubMed Central

    Tsavachidou, Dimitra; McDonnell, Timothy J.; Wen, Sijin; Wang, Xuemei; Vakar-Lopez, Funda; Pisters, Louis L.; Pettaway, Curtis A.; Wood, Christopher G.; Do, Kim-Anh; Thall, Peter F.; Stephens, Clifton; Efstathiou, Eleni; Taylor, Robert; Menter, David G.; Troncoso, Patricia; Lippman, Scott M.; Logothetis, Christopher J.

    2009-01-01

    Background Secondary analyses of two randomized, controlled phase III trials demonstrated that selenium and vitamin E could reduce prostate cancer incidence. To characterize pharmacodynamic and gene expression effects associated with use of selenium and vitamin E, we undertook a randomized, placebo-controlled phase IIA study of prostate cancer patients before prostatectomy and created a preoperative model for prostatectomy tissue interrogation. Methods Thirty-nine men with prostate cancer were randomly assigned to treatment with 200 μg of selenium, 400 IU of vitamin E, both, or placebo. Laser capture microdissection of prostatectomy biopsy specimens was used to isolate normal, stromal, and tumor cells. Gene expression in each cell type was studied with microarray analysis and validated with a real-time polymerase chain reaction (PCR) and immunohistochemistry. An analysis of variance model was fit to identify genes differentially expressed between treatments and cell types. A beta-uniform mixture model was used to analyze differential expression of genes and to assess the false discovery rate. All statistical tests were two-sided. Results The highest numbers of differentially expressed genes by treatment were 1329 (63%) of 2109 genes in normal epithelial cells after selenium treatment, 1354 (66%) of 2051 genes in stromal cells after vitamin E treatment, and 329 (56%) of 587 genes in tumor cells after combination treatment (false discovery rate = 2%). Validation of 21 representative genes across all treatments and all cell types yielded Spearman correlation coefficients between the microarray analysis and the PCR validation ranging from 0.64 (95% confidence interval [CI] = 0.31 to 0.79) for the vitamin E group to 0.87 (95% CI = 0.53 to 0.99) for the selenium group. The increase in the mean percentage of p53-positive tumor cells in the selenium-treated group (26.3%), compared with that in the placebo-treated group (5%), showed borderline statistical significance

  18. Three Dimension Filamentous Human Cardiac Tissue Model

    PubMed Central

    Ma, Zhen; Koo, Sangmo; Finnegan, Micaela A.; Loskill, Peter; Huebsch, Nathaniel; Marks, Natalie C.; Conklin, Bruce R.; Grigoropoulos, Costas P.; Healy, Kevin E.

    2013-01-01

    A human in vitro cardiac tissue model would be a significant advancement for understanding, studying, and developing new strategies for treating cardiac arrhythmias and related cardiovascular diseases. We developed an in vitro model of three-dimensional (3D) human cardiac tissue by populating synthetic filamentous matrices with cardiomyocytes derived from healthy wild-type volunteer (WT) and patient-specific long QT syndrome type 3 (LQT3) induced pluripotent stem cells (iPS-CMs) to mimic the condensed and aligned human ventricular myocardium. Using such a highly controllable cardiac model, we studied the contractility malfunctions associated with the electrophysiological consequences of LQT3 and their response to a panel of drugs. By varying the stiffness of filamentous matrices, LQT3 iPS-CMs exhibited different level of contractility abnormality and susceptibility to drug-induced cardiotoxicity. PMID:24268663

  19. Alpha 2 adrenergic receptors in hyperplastic human prostate: identification and characterization using (/sup 3/H) rauwolscine

    SciTech Connect

    Shapiro, E.; Lepor, H.

    1986-05-01

    (/sup 3/H)Rauwolscine ((/sup 3/H)Ra), a selective ligand for the alpha 2 adrenergic receptor, was used to identify and characterize alpha 2 adrenergic receptors in prostate glands of men with benign prostatic hyperplasia. Specific binding of (/sup 3/H)Ra to prostatic tissue homogenates was rapid and readily reversible by addition of excess unlabelled phentolamine. Scatchard analysis of saturation experiments demonstrates a single, saturable class of high affinity binding sites (Bmax = 0.31 +/- 0.04 fmol./microgram. DNA, Kd = 0.9 +/- 0.11 nM.). The relative potency of alpha adrenergic drugs (clonidine, alpha-methylnorepinephrine and prazosin) in competing for (/sup 3/H)Ra binding sites was consistent with the order predicted for an alpha 2 subtype. The role of alpha 2 adrenergic receptors in normal prostatic function and in men with bladder outlet obstruction secondary to BPH requires further investigation.

  20. Berberine-induced apoptosis in human prostate cancer cells is initiated by reactive oxygen species generation

    SciTech Connect

    Meeran, Syed M.; Katiyar, Suchitra; Katiyar, Santosh K.

    2008-05-15

    Phytochemicals show promise as potential chemopreventive or chemotherapeutic agents against various cancers. Here we report the chemotherapeutic effects of berberine, a phytochemical, on human prostate cancer cells. The treatment of human prostate cancer cells (PC-3) with berberine induced dose-dependent apoptosis but this effect of berberine was not seen in non-neoplastic human prostate epithelial cells (PWR-1E). Berberine-induced apoptosis was associated with the disruption of the mitochondrial membrane potential, release of apoptogenic molecules (cytochrome c and Smac/DIABLO) from mitochondria and cleavage of caspase-9,-3 and PARP proteins. This effect of berberine on prostate cancer cells was initiated by the generation of reactive oxygen species (ROS) irrespective of their androgen responsiveness, and the generation of ROS was through the increased induction of xanthine oxidase. Treatment of cells with allopurinol, an inhibitor of xanthine oxidase, inhibited berberine-induced oxidative stress in cancer cells. Berberine-induced apoptosis was blocked in the presence of antioxidant, N-acetylcysteine, through the prevention of disruption of mitochondrial membrane potential and subsequently release of cytochrome c and Smac/DIABLO. In conclusion, the present study reveals that the berberine-mediated cell death of human prostate cancer cells is regulated by reactive oxygen species, and therefore suggests that berberine may be considered for further studies as a promising therapeutic candidate for prostate cancer.

  1. Abrogation of prostaglandin E-EP4 signaling in osteoblasts prevents the bone destruction induced by human prostate cancer metastases.

    PubMed

    Watanabe, Kenta; Tominari, Tsukasa; Hirata, Michiko; Matsumoto, Chiho; Maruyama, Takayuki; Murphy, Gillian; Nagase, Hideaki; Miyaura, Chisato; Inada, Masaki

    2016-09-01

    The metastasis of tumors to bone is known to be promoted by prostaglandin E2 (PGE2) produced by the tumor host stromal tissue. Although bone metastases frequently occur in prostate cancer patients, the significance of PGE2 in stromal responses to the tumor is not known. In this study, we report that PGE2 and its receptor EP4 play a pivotal role in bone destruction and metastasis in an experimental metastasis model of prostate cancer in nude mice. Using human prostate cancer PC-3 cells that are stably transfected with luciferase, we showed that the development of bone metastasis was accompanied by increased osteoclastic bone resorption in the bone metastasis microenvironment, and could be abrogated by an EP4 receptor antagonist. The growth of PC-3 cells in vitro was not influenced by PGE2 or by the EP4 receptor. However, cell-cell interactions between fixed PC-3 cells and host osteoblasts induced PGE2 production and RANKL expression in the osteoblasts. Addition of an EP4 antagonist suppressed both PGE2 and RANKL expression induced by the PC3-osteoblast interaction, which would have consequent effects on osteoclast activation and osteolysis. These results indicate that the blockage of PGE2-EP4 signaling prevents the bone destruction required for prostate cancer metastases, and that this is, in part due to the abrogation of bone cell responses. The study provides further evidence that an EP4 antagonist is a candidate for the treatment of prostate cancer in the blockade of bone metastasis. PMID:27450806

  2. Frequency domain optical tomography in human tissue

    NASA Astrophysics Data System (ADS)

    Yao, Yuqi; Wang, Yao; Pei, Yaling; Zhu, Wenwu; Hu, Jenhun; Barbour, Randall L.

    1995-10-01

    In this paper, a reconstruction algorithm for frequency-domain optical tomography in human tissue is presented. A fast and efficient multigrid finite difference (MGFD) method is adopted as a forward solver to obtain the simulated detector responses and the required imaging operator. The solutions obtained form MGFD method for 3D problems with weakly discontinuous cocoefficients are compared with analyzed solutions to determine the accuracy of the numerical method. Simultaneous reconstruction of both absorption and scattering coefficients for tissue-like media is accomplished by solving a perturbation equation using the Born approximation. This solution is obtained by a conjugate gradient descent method with Tikhonov regularization. Two examples are given to show the quality of the reconstruction results. Both involve the examination of anatomically accurate optical models of tissue derived from segmented 3D magnetic resonance images to which have been assigned optical coefficients to the designated tissue types. One is a map of a female breast containing two small 'added pathologies', such as tumors. The other is a map of the brain containing a 'local bleeding' area, representing a hemorrhage. The reconstruction results show that the algorithm is computationally practical and can yield qualitatively correct geometry of the objects embedded in the simulated human tissue. Acceptable results are obtaiend even when 10% noise is present in the data.

  3. The diet as a cause of human prostate cancer.

    PubMed

    Nelson, William G; Demarzo, Angelo M; Yegnasubramanian, Srinivasan

    2014-01-01

    Asymptomatic prostate inflammation and prostate cancer have reached epidemic proportions among men in the developed world. Animal model studies implicate dietary carcinogens, such as the heterocyclic amines from over-cooked meats and sex steroid hormones, particularly estrogens, as candidate etiologies for prostate cancer. Each acts by causing epithelial cell damage, triggering an inflammatory response that can evolve into a chronic or recurrent condition. This milieu appears to spawn proliferative inflammatory atrophy (PIA) lesions, a type of focal atrophy that represents the earliest of prostate cancer precursor lesions. Rare PIA lesions contain cells which exhibit high c-Myc expression, shortened telomere segments, and epigenetic silencing of genes such as GSTP1, encoding the π-class glutathione S-transferase, all characteristic of prostatic intraepithelial neoplasia (PIN) and prostate cancer. Subsequent genetic changes, such as the gene translocations/deletions that generate fusion transcripts between androgen-regulated genes (such as TMPRSS2) and genes encoding ETS family transcription factors (such as ERG1), arise in PIN lesions and may promote invasiveness characteristic of prostatic adenocarcinoma cells. Lethal prostate cancers contain markedly corrupted genomes and epigenomes. Epigenetic silencing, which seems to arise in response to the inflamed microenvironment generated by dietary carcinogens and/or estrogens as part of an epigenetic "catastrophe" affecting hundreds of genes, persists to drive clonal evolution through metastatic dissemination. The cause of the initial epigenetic "catastrophe" has not been determined but likely involves defective chromatin structure maintenance by over-exuberant DNA methylation or histone modification. With dietary carcinogens and estrogens driving pro-carcinogenic inflammation in the developed world, it is tempting to speculate that dietary components associated with decreased prostate cancer risk, such as intake of

  4. Expression of interleukin-17RC protein in normal human tissues

    PubMed Central

    Ge, Dongxia; You, Zongbing

    2008-01-01

    Background Interleukin-17 (IL-17) cytokines and receptors play an important role in many autoimmune and inflammatory diseases. IL-17 receptors IL-17RA and IL-17RC have been found to form a heterodimer for mediating the signals of IL-17A and IL-17F cytokines. While the function and signaling pathway of IL-17RA has been revealed, IL-17RC has not been well characterized. The function and signaling pathway of IL-17RC remain largely unknown. The purpose of the present study was to systematically examine IL-17RC protein expression in 53 human tissues. Results IL-17RC expression in 51 normal human tissues and two benign tumors (i.e., lymphangioma and parathyroid adenoma) on the tissue microarrays was determined by immunohistochemical staining, using two polyclonal antibodies against IL-17RC. IL-17RC protein was expressed in many cell types including the myocardial cells, vascular and lymphatic endothelial cells, glandular cells (of the adrenal, parathyroid, pituitary, thyroid, pancreas, parotid salivary, and subepidermal glands), epithelial cells (of the esophagus, stomach, intestine, anus, renal tubule, breast, cervix, Fallopian tube, epididymis, seminal vesicle, prostate, gallbladder, bronchus, lung, and skin), oocytes in the ovary, Sertoli cells in the testis, motor neurons in the spinal cord, autonomic ganglia and nerves in the intestine, skeletal muscle cells, adipocytes, articular chondrocytes, and synovial cells. High levels of IL-17RC protein expression were observed in most vascular and lymphatic endothelium and squamous epithelium. The epithelium of the breast, cervix, Fallopian tube, kidney, bladder and bronchus also expressed high levels of IL-17RC, so did the glandular cells in the adrenal cortex, parotid salivary and subepidermal glands. In contrast, IL-17RC protein was not detectable in the smooth muscle cells, fibroblasts, antral mucosa of the stomach, mucosa of the colon, endometrium of the uterus, neurons of the brain, hepatocytes, or lymphocytes

  5. Iterative multiple reference tissue method for estimating pharmacokinetic parameters on prostate DCE MRI

    NASA Astrophysics Data System (ADS)

    Ginsburg, Shoshana B.; Bloch, B. Nicolas; Rofsky, Neil M.; Genega, Elizabeth M.; Lenkinski, Robert E.; Madabhushi, Anant

    2013-02-01

    Pharmacokinetic (PK) parameters are probes of tissue status that can be assessed by analysis of dynamic contrast-enhanced (DCE) MRI and are useful for prostate cancer (CaP) detection and grading. Traditionally, PK analysis requires knowledge of the time-resolved concentration of the contrast agent in the blood plasma, the arterial input function (AIF), which is typically estimated in an artery in the field-of-view (FOV). In cases when no suitable artery is present in the FOV, the multiple reference tissue method (MRTM) enables the estimation of PK parameters without the AIF by leveraging PK parameter values from the literature for a reference tissue in the FOV. Nevertheless, PK parameters estimated in the prostate vary significantly between patients. Consequently, population-based values obtained from the literature may introduce error into PK parameter estimation via MRTM. The objectives of this paper are two-fold. First we present a novel scheme, iterative MRTM (IMRTM), to estimate PK parameter values in the absence of the AIF without making assumptions about the PK constants associated with a reference tissue. Then, using IMRTM we investigate differences in PK constants between CaP in the peripheral zone (PZ) and CaP in the central gland (CG), as CG and PZ CaP have previously been shown to differ significantly in terms of both texture and prognosis. We apply IMRTM to 15 patients with CaP in either the CG or the PZ who were scheduled for a radical prostatectomy and a pre-operative MRI. Values for the PK parameters Ktrans and ve estimated via IMRTM average 0.29 and 0.60 for normal central gland (CG), 0.29 and 0.64 for normal peripheral zone (PZ), and 0.30 and 0.53 for CaP. It is noteworthy that PK constants estimated in PZ CaP are significantly higher than those estimated in CG CaP (p < 0:05). While both MRTM and IMRTM provide PK parameter values that are biologically feasible, IMRTM has the advantage that it invokes patient-specific information rather than

  6. Exogenous fatty acid binding protein 4 promotes human prostate cancer cell progression.

    PubMed

    Uehara, Hisanori; Takahashi, Tetsuyuki; Oha, Mina; Ogawa, Hirohisa; Izumi, Keisuke

    2014-12-01

    Epidemiologic studies have found that obesity is associated with malignant grade and mortality in prostate cancer. Several adipokines have been implicated as putative mediating factors between obesity and prostate cancer. Fatty acid binding protein 4 (FABP4), a member of the cytoplasmic fatty acid binding protein multigene family, was recently identified as a novel adipokine. Although FABP4 is released from adipocytes and mean circulating concentrations of FABP4 are linked with obesity, effects of exogenous FABP4 on prostate cancer progression are unclear. In this study, we examined the effects of exogenous FABP4 on human prostate cancer cell progression. FABP4 treatment promoted serum-induced prostate cancer cell invasion in vitro. Furthermore, oleic acid promoted prostate cancer cell invasion only if FABP4 was present in the medium. These promoting effects were reduced by FABP4 inhibitor, which inhibits FABP4 binding to fatty acids. Immunostaining for FABP4 showed that exogenous FABP4 was taken up into DU145 cells in three-dimensional culture. In mice, treatment with FABP4 inhibitor reduced the subcutaneous growth and lung metastasis of prostate cancer cells. Immunohistochemical analysis showed that the number of apoptotic cells, positive for cleaved caspase-3 and cleaved PARP, was increased in subcutaneous tumors of FABP4 inhibitor-treated mice, as compared with control mice. These results suggest that exogenous FABP4 might promote human prostate cancer cell progression by binding with fatty acids. Additionally, exogenous FABP4 activated the PI3K/Akt pathway, independently of binding to fatty acids. Thus, FABP4 might be a key molecule to understand the mechanisms underlying the obesity-prostate cancer progression link. PMID:24740818

  7. Co-Targeting Prostate Cancer Epithelium and Bone Stroma by Human Osteonectin-Promoter-Mediated Suicide Gene Therapy Effectively Inhibits Androgen-Independent Prostate Cancer Growth.

    PubMed

    Sung, Shian-Ying; Chang, Junn-Liang; Chen, Kuan-Chou; Yeh, Shauh-Der; Liu, Yun-Ru; Su, Yen-Hao; Hsueh, Chia-Yen; Chung, Leland W K; Hsieh, Chia-Ling

    2016-01-01

    Stromal-epithelial interaction has been shown to promote local tumor growth and distant metastasis. We sought to create a promising gene therapy approach that co-targets cancer and its supporting stromal cells for combating castration-resistant prostate tumors. Herein, we demonstrated that human osteonectin is overexpressed in the prostate cancer epithelium and tumor stroma in comparison with their normal counterpart. We designed a novel human osteonectin promoter (hON-522E) containing positive transcriptional regulatory elements identified in both the promoter and exon 1 region of the human osteonectin gene. In vitro reporter assays revealed that the hON-522E promoter is highly active in androgen receptor negative and metastatic prostate cancer and bone stromal cells compared to androgen receptor-positive prostate cancer cells. Moreover, in vivo prostate-tumor-promoting activity of the hON-522E promoter was confirmed by intravenous administration of an adenoviral vector containing the hON-522E promoter-driven luciferase gene (Ad-522E-Luc) into mice bearing orthotopic human prostate tumor xenografts. In addition, an adenoviral vector with the hON-522E-promoter-driven herpes simplex virus thymidine kinase gene (Ad-522E-TK) was highly effective against the growth of androgen-independent human prostate cancer PC3M and bone stromal cell line in vitro and in pre-established PC3M tumors in vivo upon addition of the prodrug ganciclovir. Because of the heterogeneity of human prostate tumors, hON-522E promoter-mediated gene therapy has the potential for the treatment of hormone refractory and bone metastatic prostate cancers. PMID:27054343

  8. Co-Targeting Prostate Cancer Epithelium and Bone Stroma by Human Osteonectin-Promoter–Mediated Suicide Gene Therapy Effectively Inhibits Androgen-Independent Prostate Cancer Growth

    PubMed Central

    Sung, Shian-Ying; Chang, Junn-Liang; Chen, Kuan-Chou; Yeh, Shauh-Der; Liu, Yun-Ru; Su, Yen-Hao; Hsueh, Chia-Yen; Chung, Leland W. K.; Hsieh, Chia-Ling

    2016-01-01

    Stromal-epithelial interaction has been shown to promote local tumor growth and distant metastasis. We sought to create a promising gene therapy approach that co-targets cancer and its supporting stromal cells for combating castration-resistant prostate tumors. Herein, we demonstrated that human osteonectin is overexpressed in the prostate cancer epithelium and tumor stroma in comparison with their normal counterpart. We designed a novel human osteonectin promoter (hON-522E) containing positive transcriptional regulatory elements identified in both the promoter and exon 1 region of the human osteonectin gene. In vitro reporter assays revealed that the hON-522E promoter is highly active in androgen receptor negative and metastatic prostate cancer and bone stromal cells compared to androgen receptor-positive prostate cancer cells. Moreover, in vivo prostate-tumor–promoting activity of the hON-522E promoter was confirmed by intravenous administration of an adenoviral vector containing the hON-522E promoter-driven luciferase gene (Ad-522E-Luc) into mice bearing orthotopic human prostate tumor xenografts. In addition, an adenoviral vector with the hON-522E-promoter–driven herpes simplex virus thymidine kinase gene (Ad-522E-TK) was highly effective against the growth of androgen-independent human prostate cancer PC3M and bone stromal cell line in vitro and in pre-established PC3M tumors in vivo upon addition of the prodrug ganciclovir. Because of the heterogeneity of human prostate tumors, hON-522E promoter-mediated gene therapy has the potential for the treatment of hormone refractory and bone metastatic prostate cancers. PMID:27054343

  9. Exophytic benign prostatic hyperplasia.

    PubMed

    Blaschko, Sarah D; Eisenberg, Michael L

    2011-08-01

    A 60-year-old man had incidental finding of a multilobular 8 × 7 × 7-cm mass identified posterior to the urinary bladder in continuity with the prostate. The man's prostate-specific antigen was 1.87, and he denied any lower urinary tract symptoms. A transrectal ultrasound-guided biopsy demonstrated benign prostatic tissue. A computed tomography-guided needle aspiration demonstrated a benign epithelium-lined cyst, likely prostatic in origin. Benign prostatic hyperplasia is a proliferation of prostatic epithelial and stromal cells. Although prostatic hyperplasia is usually restricted to the prostate gland, hyperplastic nodules occasionally protrude outside the prostate and rarely form exophytic pelvic masses. PMID:20869104

  10. Engineering tissue from human embryonic stem cells

    PubMed Central

    Metallo, CM; Azarin, SM; Ji, L; De Pablo, JJ; Palecek, SP

    2008-01-01

    Abstract Recent advances in human embryonic stem cell (hESC) biology now offer an alternative cell source for tissue engineers, as these cells are capable of proliferating indefinitely and differentiating to many clinically relevant cell types. Novel culture methods capable of exerting spatial and temporal control over the stem cell microenvironment allow for more efficient expansion of hESCs, and significant advances have been made toward improving our understanding of the biophysical and biochemical cues that direct stem cell fate choices. Effective production of lineage specific progenitors or terminally differentiated cells enables researchers to incorporate hESC derivatives into engineered tissue constructs. Here, we describe current efforts using hESCs as a cell source for tissue engineering applications, highlighting potential advantages of hESCs over current practices as well as challenges which must be overcome. PMID:18194458

  11. Screening and Characterization of a Novel RNA Aptamer That Specifically Binds to Human Prostatic Acid Phosphatase and Human Prostate Cancer Cells

    PubMed Central

    Kong, Hoon Young; Byun, Jonghoe

    2015-01-01

    Prostatic acid phosphatase (PAP) expression increases proportionally with prostate cancer progression, making it useful in prognosticating intermediate to high-risk prostate cancers. A novel ligand that can specifically bind to PAP would be very helpful for guiding prostate cancer therapy. RNA aptamers bind to target molecules with high specificity and have key advantages such as low immunogenicity and easy synthesis. Here, human PAP-specific aptamers were screened from a 2′-fluoropyrimidine (FY)-modified RNA library by SELEX. The candidate aptamer families were identified within six rounds followed by analysis of their sequences and PAP-specific binding. A gel shift assay was used to identify PAP binding aptamers and the 6N aptamer specifically bound to PAP with a Kd value of 118 nM. RT-PCR and fluorescence labeling analyses revealed that the 6N aptamer bound to PAP-positive mammalian cells, such as PC-3 and LNCaP. IMR-90 negative control cells did not bind the 6N aptamer. Systematic minimization analyses revealed that 50 nucleotide sequences and their two hairpin structures in the 6N 2′-FY RNA aptamer were equally important for PAP binding. Renewed interest in PAP combined with the versatility of RNA aptamers, including conjugation of anti-cancer drugs and nano-imaging probes, could open up a new route for early theragnosis of prostate cancer. PMID:25591398

  12. (3H)bunazosin, a novel selective radioligand of alpha 1 adrenoceptors in human prostates

    SciTech Connect

    Yamada, S.; Suzuki, M.; Matsuoka, Y.; Kato, Y.; Kimura, R.; Maruyama, M.; Kawabe, K. )

    1991-09-01

    The binding properties of a new radioligand, (3H)bunazosin, were studied in membranes of human prostates with benign prostatic hypertrophy (BPH). Specific binding of (3H)bunazosin was saturable, reversible, and of high affinity (Kd = 0.55 {plus minus} 0.04 nM). The density of (3H)bunazosin binding sites (Bmax) was 676 {plus minus} 33 fmol/mg. protein. (3H)Bunazosin rapidly associated with its binding sites in membranes of human prostates and reached steady state by 20 min. at 25C. The rate constants for association and dissociation of (3H)bunazosin binding were calculated to be 0.11 {plus minus} 0.01/nM/min. and 0.05 {plus minus} 0.02/min. (n = 4), respectively. Seven alpha 1 adrenoceptor antagonists competed with (3H)bunazosin for the binding sites in the rank order: R-(-)-YM-12617 greater than prazosin greater than SGB-1534 greater than bunazosin greater than terazosin greater than naftopidil greater than urapidil. In parallel studies with (3H)bunazosin, the Kd and Bmax values for (3H)prazosin binding in human prostates were slightly lower. There was a similarity in the potency and rank order of seven alpha 1, adrenoceptor antagonists for the inhibition of (3H) bunazosin and (3H)prazosin binding in human prostates. The new (3H)bunazosin binding assay in human prostates is remarkable for its low degree of nonspecific binding as compared to (3H)prazosin, especially at high ligand concentrations. Thus, (3H)bunazosin may become a useful radioligand for the further analysis of the alph 1 adrenoceptor binding sites in human prostates.

  13. Effect of urokinase on the proliferation of primary cultures of human prostatic cells

    SciTech Connect

    Kirchheimer, J.C.; Wojta, J.; Hienert, G.; Christ, G.; Heger, M.E.; Pflueger, H.B.; Binder, B.R.

    1987-11-01

    The effects of exogenously added urokinase type plasminogen activator, tissue type plasminogen activator, plasmin and thrombin on the proliferation of primary cultures of cells derived from prostatic hyperplasia or prostatic carcinomas were investigated by measuring the incorporation of /sup 3/H-thymidine into the cultures. Addition of urokinase type plasminogen activator (1.35 x 10(-9) M) or thrombin (10(-7) M) to the culture medium caused a two-fold increase of /sup 3/H-thymidine incorporation, regardless of the origin of the prostatic cells. Tissue type plasminogen activator did not alter the rate of /sup 3/H-thymidine incorporation, whereas plasmin caused a 25% decrease of /sup 3/H-thymidine incorporation in all cultures.

  14. Alpha-dispersion in human tissue

    NASA Astrophysics Data System (ADS)

    Grimnes, Sverre; Martinsen, Ørjan G.

    2010-04-01

    Beta dispersion is found in living tissue in the kilohertz - megahertz range and is caused by the cellular structure of biological materials with low frequency properties caused by cell membranes. Alpha dispersion is found in the hertz range and the causes are not so well known. Alpha dispersions are the first to disappear when tissue dies. Tissue data have often been based upon excised specimen from animals and are therefore not necessarily representative for human tissue alpha dispersions. Here we present data obtained with non-invasive skin surface electrodes for different segments of the living human body. We found alpha dispersions in all cases; the ankle-wrist results had the smallest. Large alpha dispersions were found where the distance between the electrodes and muscle masses was small, e.g. on the calf. Further studies on electrode technique and reciprocity, electrode positioning, statistical variations, gender, age and bodily constitutions are necessary in order to reveal more about the alpha dispersion, its appearance and disappearance.

  15. Information-based ranking of 10 compartment models of diffusion-weighted signal attenuation in fixed prostate tissue.

    PubMed

    Liang, Sisi; Panagiotaki, Eleftheria; Bongers, Andre; Shi, Peng; Sved, Paul; Watson, Geoffrey; Bourne, Roger

    2016-05-01

    This study compares the theoretical information content of single- and multi-compartment models of diffusion-weighted signal attenuation in prostate tissue. Diffusion-weighted imaging (DWI) was performed at 9.4 T with multiple diffusion times and an extended range of b values in four whole formalin-fixed prostates. Ten models, including different combinations of isotropic, anisotropic and restricted components, were tested. Models were ranked using the Akaike information criterion. In all four prostates, two-component models, comprising an anisotropic Gaussian component and an isotropic restricted component, ranked highest in the majority of voxels. Single-component models, whether isotropic (apparent diffusion coefficient, ADC) or anisotropic (diffusion tensor imaging, DTI), consistently ranked lower than multi-component models. Model ranking trends were independent of voxel size and maximum b value in the range tested (1.6-16 mm(3) and 3000-10 000 s/mm(2) ). This study characterizes the two major water components previously identified by biexponential models and shows that models incorporating both anisotropic and restricted components provide more information-rich descriptions of DWI signals in prostate tissue than single- or multi-component anisotropic models and models that do not account for restricted diffusion. Copyright © 2016 John Wiley & Sons, Ltd. PMID:26999065

  16. TOPICAL REVIEW: Human soft tissue analysis using x-ray or gamma-ray techniques

    NASA Astrophysics Data System (ADS)

    Theodorakou, C.; Farquharson, M. J.

    2008-06-01

    This topical review is intended to describe the x-ray techniques used for human soft tissue analysis. X-ray techniques have been applied to human soft tissue characterization and interesting results have been presented over the last few decades. The motivation behind such studies is to provide improved patient outcome by using the data obtained to better understand a disease process and improve diagnosis. An overview of theoretical background as well as a complete set of references is presented. For each study, a brief summary of the methodology and results is given. The x-ray techniques include x-ray diffraction, x-ray fluorescence, Compton scattering, Compton to coherent scattering ratio and attenuation measurements. The soft tissues that have been classified using x-rays or gamma rays include brain, breast, colon, fat, kidney, liver, lung, muscle, prostate, skin, thyroid and uterus.

  17. Immunohistochemical localization of the epidermal growth factor receptor in normal human tissues.

    PubMed

    Damjanov, I; Mildner, B; Knowles, B B

    1986-11-01

    A monoclonal antibody recognizing an epitope of the external domain of the human epidermal growth factor (EGF) receptor was used to localize this protein in selected normal human tissues. Two patterns of reactivity were recognized: strong linear or granular cell surface staining, and granular cytoplasmic staining. In one tissue, the endometrium, a change in the reaction pattern associated with changes in hormonal stimulation was observed. In some tissues such as epididymis and skin, the antibody showed surface reactivity with cells considered to represent part of the proliferating cell compartment, whereas in liver, pancreas, and prostate, all cells were reactive with the antibody, though the predominant reactivity was localized in the cytoplasm. The differential distribution of the epidermal growth factor receptor to specific cell types and cellular compartments may signify adaptations that permit growth factor responsiveness in a milieu of available ligand. PMID:3534450

  18. Towards optimizing prostate tissue retrieval following holmium laser enucleation of the prostate (HoLEP): Assessment of two morcellators and review of literature

    PubMed Central

    Elshal, Ahmed M.; Mekkawy, Ramy; Laymon, Mahmoud; El-Assmy, Ahmed; El-Nahas, Ahmed R.

    2015-01-01

    Introduction: We assess different approaches to retrieve the enucleated adenoma after transurethral enucleation of the prostate, particularly using the holmium laser. Methods: A retrospective review through our prospectively maintained database was performed looking for safety and efficacy of two morcellators. The enucleation phase of the holmium laser enucleation of the prostate (HoLEP) was classically performed followed by retrieval of the intravesical adenoma using either the Piranha (Wolf Inc., Knittlingen, Germany) or VersaCut (Lumenis) morcellator. A PubMed-MEDLINE search was conducted for all transurethral enucleation procedures and relevant data regarding methods of prostate tissue retrieval were extracted. Results: Strictly limiting the study to 3 reusable blades with each morcellator, we performed 67 and 55 consecutive procedures with Piranha and VersaCut, respectively. There was no significant difference between the two morcellators regarding perioperative complications, apart from 5 bladder mucosal injuries with the VersaCut (9%). Furthermore, there were similar retrieved tissue weight, mechanical problems-rate, catheter-time and hospital-stay in both morcellators. However, the Piranha morcellator needed significantly less morcellation-time, needed to use cold loop to remove non-morcellated pieces and to score the adenoma by laser for better bite of the adenoma, and had a higher median morcellation-rate 6.2 (rate: 2.8–12) g/min. Despite little reporting on morcellation, we had data on the tissue retrieval rate (2.6 to 6.5 g/min with Piranha and 1.9 to 11 g/min with VersaCut. Furthermore, bladder mucosal injury was reported in 1.4% and 0.7 to 5.7% with Piranha and VersaCut, respectively; bladder perforation with VersaCut was experienced in about 0.1 to 1.5% of patients. Our study is limited by its non-randomization. Conclusion: The Piranha morcellator was the most efficient and safe way to retrieve tissue after a transurethral enucleation of a prostate

  19. Radioimmunoscintigraphy of prostate cancer

    SciTech Connect

    Babaian, R.J.; Lamki, L.M. )

    1989-10-01

    The development of hybridoma technology has increased research efforts and clinical applications in the area of radioimmunodetection. Despite the many investigative antibodies directed against prostatic tissue or prostate cancer cell lines, only two have been tested in clinical trials. A 111In-labeled antibody directed against prostate-specific antigen, the best available serum tumor marker for prostate cancer, has shown poor sensitivity in limited clinical radioimmunoimaging trials. Monoclonal antibodies against prostatic acid phosphatase have shown better imaging results, particularly at higher antibody doses (greater than or equal to 40 mg). The limitations of this antibody include the poor results in detecting soft tissue lesions, including the primary lesion; the development of human antimouse antibodies in 50% of the patients at doses greater than or equal to 40 mg; the expense of the antibody; and the fact that better results are currently attainable by other less expensive imaging modalities. If and when a more suitable antibody or fragment is developed, the prospect of improved staging and new treatments using immunologic conjugates carrying therapeutic agents may become realities. Until such time, prostatic cancer will be staged with other currently available imaging modalities and conventional therapies with their limitations will remain state of the art. 56 references.

  20. Preliminary report on the correlations among pineal concretions, prostatic calculi and age in human adult males.

    PubMed

    Mori, Ryoichi; Kodaka, Tetsuo; Sano, Tsuneyoshi

    2003-09-01

    By using quantitative image analysis of soft X-ray photographs on the bulk of extracted pineal glands and prostates, we made a preliminary investigation into the correlations among pineal concretions (% by mass), prostatic calculi (% by mass) and age (years) in 40 human adult males, ranging in age from 31 to 95 years (mean (+/-SD) 69.9 +/- 15.2 years), who died and underwent the routine dissection course. The mass concentrations of pineal concretions and prostatic calculi were 17.68 +/- 13.56% (range 0-51.34%) and 0.93 +/- 1.31% (range 0-5.82%), respectively. There was no correlation between the mass concentration of pineal concretions and aging (r = 0.03; P < 1.0). There was no correlation between mass concentration of prostatic calculi and aging (r = 0.28; P < 0.5). No pineal concretions and no prostatic calculi were observed in seven and 10 cases, respectively; in addition, in one case, neither-concretions nor calculi were seen. From such data and from the previously reported suggestion on the counteracting functions between the pineal gland and prostate, a negative correlation between the mass concentrations of pineal concretions and prostatic calculi was expected. This was certainly obtained, but the correlation was low (r = -0.39; P < 0.05). Such a low correlation and no correlations between the concentrations of pineal concretions and aging or between prostatic calculi and aging may have been caused by the examination of relatively older humans. Therefore, further investigations using a number of pair samples collected from males including younger age generations will be necessary. PMID:14527133

  1. Characterization of 17beta-hydroxysteroid dehydrogenase isoenzyme expression in benign and malignant human prostate.

    PubMed

    Elo, J P; Akinola, L A; Poutanen, M; Vihko, P; Kyllönen, A P; Lukkarinen, O; Vihko, R

    1996-03-28

    In the present study, expressions of 17beta-hydroxysteroid dehydrogenase (17HSD) types 1, 2, and 3, 5alpha-reductase type 2 and human androgen receptor mRNAs were determined in 12 benign prostatic hyperplasia and 17 prostatic carcinoma specimens. 17HSD type 2 was found to be the principle isoenzyme expressed in the prostate. Significantly higher expressions of 17HSD type 2 and 5alpha-reductase type 2 were detected in benign prostatic hyperplasia compared with the carcinoma specimens. Expression of the androgen receptor in the 2 groups was not significantly different. 17HSD type 3 mRNA was not detected in any of the specimens investigated. Only low constructive expression of the 2.3 kb mRNA of 17HSD type 1 was seen. Immunohistochemical analysis indicated that this did not lead to significant enzyme expression, only faint staining for the enzyme protein being detected, mainly in uroepithelial cells. No significant correlation was found between any of the mRNAs analysed, but the data on 5alpha-reductase type 2 mRNA support the presence of an increased proportion of 5alpha-dihydrotesterone in the hyperplastic prostate. In cultured PC-3 prostatic cancer cells and in the transiently transfected human embryonic kidney 293 cells, 17HSD type 2 was found exclusively to convert 5alpha-dihydrotestosterone and testosterone into the less potent 17-keto compounds 5alpha-androstanedione and 4-androstenedione, respectively. We suggest that the 17HSD type 2 isoenzyme plays a part in the metabolic pathway, resulting in the inactivation of testosterone and 5alpha-dihydrotestosterone locally in the prostate. The enzyme expressed in the prostate could, therefore, protect cells from excessive androgen action. PMID:8608963

  2. Prolactin-induced prostate tumorigenesis.

    PubMed

    Sackmann-Sala, Lucila; Goffin, Vincent

    2015-01-01

    The physiological role of prolactin (PRL) in the prostate gland is not clearly understood. Genetically-modified mouse models that have invalidated actors of the PRL signaling axis failed to identify an essential regulatory function on this tissue. However, a large body of evidence suggests an important role for PRL in prostate tumorigenesis. Mainly through the activation of its downstream target STAT5, PRL can induce growth and survival of prostate cancer cells and tissues in several experimental settings. In the clinic, PRL expression and STAT5 activation in human prostate tumors correlate with disease severity. Available data point to a role of local (autocrine/paracrine) rather than circulating (endocrine) PRL in the induction of disease progression. In mice, transgenic expression of PRL in the prostate leads to enhanced epithelial hyperplasia and dysplasia, with amplification of basal/stem cells which have been recently identified as prostate cancer-initiating cells. Thus, targeting PRL receptor (PRLR)/STAT5 signaling may provide an alternative therapy for the treatment of prostate cancer. Corresponding targeted therapies currently in preclinical development include antagonists or blocking antibodies for the PRLR and small molecule inhibitors directed against the tyrosine kinase JAK2 upstream of STAT5. Present efforts are aimed at validating these therapies for the treatment of prostate cancer, while understanding the mechanisms of disease progression induced by PRL/STAT5. PMID:25472541

  3. Sorption studies of human keratinized tissues

    NASA Astrophysics Data System (ADS)

    Johnsen, G. K.; Martinsen, Ø. G.; Grimnes, Sverre

    2010-04-01

    Water content is known to be the most important single parameter for keratinized tissue to remain its vital functions. In that sense, a general knowledge of the water binding properties is of great interest, and a reliable measurement setup must be found. Also, revealing the sorption properties of human keratinized tissues is vital towards a calibration of susceptance based skin hydration measurements that already is an important diagnostic tool in clinical dermatology, and we will see that any hysteresis will complicate such a calibration further. In this study we investigated the sorption properties of keratinized tissues such as human epidermal stratum corneum (SC), hair and nail. The study was performed under controlled environmental conditions with a dynamic vapor sorption (DVS) instrument, and the water uptake of the keratinized test samples was measured as the relative humidity in the ambient air was altered step-wisely. In this study, vital and characteristic water sorption properties such as the isotherm, relative water uptake, and hysteresis were investigated and will be discussed.

  4. Magnetic nanoparticle hyperthermia enhances radiation therapy: A study in mouse models of human prostate cancer

    PubMed Central

    Attaluri, Anilchandra; Kandala, Sri Kamal; Wabler, Michele; Zhou, Haoming; Cornejo, Christine; Armour, Michael; Hedayati, Mohammad; Zhang, Yonggang; DeWeese, Theodore L.; Herman, Cila; Ivkov, Robert

    2015-01-01

    Purpose We aimed to characterise magnetic nanoparticle hyperthermia (mNPH) with radiation therapy (RT) for prostate cancer. Methods Human prostate cancer subcutaneous tumours, PC3 and LAPC-4, were grown in nude male mice. When tumours measured 150 mm3 magnetic iron oxide nanoparticles (MIONPs) were injected into tumours to a target dose of 5.5 mg Fe/cm3 tumour, and treated 24 h later by exposure to alternating magnetic field (AMF). Mice were randomly assigned to one of four cohorts to characterise (1) intratumour MIONP distribution, (2) effects of variable thermal dose mNPH (fixed AMF peak amplitude 24 kA/m at 160±5 kHz) with/without RT (5 Gy), (3) effects of RT (RT5: 5 Gy; RT8: 8 Gy), and (4) fixed thermal dose mNPH (43 °C for 20min) with/without RT (5 Gy). MIONP concentration and distribution were assessed following sacrifice and tissue harvest using inductively coupled plasma mass spectrometry (ICP-MS) and Prussian blue staining, respectively. Tumour growth was monitored and compared among treated groups. Results LAPC-4 tumours retained higher MIONP concentration and more uniform distribution than did PC3 tumours. AMF power modulation provided similar thermal dose for mNPH and combination therapy groups (CEM43: LAPC-4: 33.6 ± 3.4 versus 25.9 ± 0.8, and PC3: 27.19 ± 0.7 versus 27.50 ± 0.6), thereby overcoming limitations of MIONP distribution and yielding statistically significant tumour growth delay. Conclusion PC3 and LAPC-4 tumours represent two biological models that demonstrate different patterns of nanoparticle retention and distribution, offering a model to make comparisons of these effects for mNPH. Modulating power for mNPH offers potential to overcome limitations of MIONP distribution to enhance mNPH. PMID:25811736

  5. Human prostatic acid phosphatase directly stimulates collagen synthesis and alkaline phosphatase content of isolated bone cells

    SciTech Connect

    Ishibe, M.; Rosier, R.N.; Puzas, J.E. )

    1991-10-01

    Human prostatic acid phosphatase (hPAP) directly enhances the differentiated characteristics of isolated bone cells in vitro. This enzyme, when added to cell cultures for 24 h in vitro stimulates collagen synthesis and the production of alkaline phosphatase. The effects are dose dependent, with statistically significant effects occurring from 0.1-100 nM hPAP. Concentrations higher than 100 nM do not evoke greater effects. The maximal effect of hPAP occurs between 12 and 24 h of exposure. The cells stimulated to the greatest degree are osteoprogenitor cells and osteoblasts. Fibroblasts isolated from the same tissue show a lesser sensitivity to hPAP. hPAP has no detectable effect on cell proliferation, as measured by radiolabeled thymidine incorporation or total DNA synthesis. None of the observations reported in this work can be attributed to contaminating proteins in the hPAP preparation. hPAP was radiolabeled with 125I and was used for affinity binding and cross-linking studies. Scatchard analysis of specific binding indicated the presence of 1.0 X 10(5) high affinity binding sites/cell, with a Kd of 6.5 nM. Cross-linking studies demonstrated the presence of one 320-kDa binding complex. The pH profile and kinetic determinations of Km and maximum velocity for hPAP were similar to those previously reported, except for the finding of positive cooperativity of the substrate with the enzyme under the conditions of our assay. We believe that the direct stimulation of bone-forming cells by hPAP may contribute to the sclerotic nature of skeletal bone around sites of neoplastic prostatic metastases and that the effect of the enzyme is probably mediated by a plasma membrane receptor.

  6. Suppression of human prostate cancer cell growth by alpha1-adrenoceptor antagonists doxazosin and terazosin via induction of apoptosis.

    PubMed

    Kyprianou, N; Benning, C M

    2000-08-15

    Recent evidence from our laboratory has demonstrated that alpha1-adrenoceptor antagonists doxazosin and terazosin induced apoptosis in prostate epithelial and smooth muscle cells in patients with benign prostatic hypertrophy (BPH; J. Urol., 159: 1810-1815, 1998; J. Urol., 161: 2002-2007, 1999). In this study, we investigated the biological action of three alpha1-adrenoceptor antagonists, doxazosin, terazosin, and tamsulosin, against prostate cancer cell growth. The antigrowth effect of the three alpha1-adrenoceptor antagonists was examined in two human prostate cancer cell lines, PC-3 and DU-145, and a prostate smooth muscle cell primary culture, SMC-1, on the basis of: (a) cell viability assay; (b) rate of DNA synthesis; and (c) induction of apoptosis. Our results indicate that treatment of prostate cancer cells with doxazosin or terazosin results in a significant loss of cell viability, via induction of apoptosis in a dose-dependent manner, whereas tamsulosin had no effect on prostate cell growth. Neither doxazosin nor terazosin exerted a significant effect on the rate of cell proliferation in prostate cancer cells. Exposure to phenoxybenzamine, an irreversible inhibitor of alpha1-adrenoceptors, does not abrogate the apoptotic effect of doxazosin or terazosin against human prostate cancer or smooth muscle cells. This suggests that the apoptotic activity of doxazosin and terazosin against prostate cells is independent of their capacity to antagonize alpha1-adrenoceptors. Furthermore, an in vivo efficacy trial demonstrated that doxazosin administration (at tolerated pharmacologically relevant doses) in SCID mice bearing PC-3 prostate cancer xenografts resulted in a significant inhibition of tumor growth. These findings demonstrate the ability of doxazosin and terazosin (but not tamsulosin) to suppress prostate cancer cell growth in vitro and in vivo by inducing apoptosis without affecting cell proliferation. This evidence provides the rationale for targeting both

  7. The molecular and cellular origin of human prostate cancer.

    PubMed

    Packer, John R; Maitland, Norman J

    2016-06-01

    Prostate cancer is the most commonly diagnosed male malignancy. Despite compelling epidemiology, there are no definitive aetiological clues linking development to frequency. Pre-malignancies such as proliferative inflammatory atrophy (PIA) and prostatic intraepithelial neoplasia (PIN) yield insights into the initiating events of prostate cancer, as they supply a background "field" for further transformation. An inflammatory aetiology, linked to recurrent prostatitis, and heterologous signalling from reactive stroma and infiltrating immune cells may result in cytokine addiction of cancer cells, including a tumour-initiating population also known as cancer stem cells (CSCs). In prostate tumours, the background mutational rate is rarely exceeded, but genetic change via profound sporadic chromosomal rearrangements results in copy number variations and aberrant gene expression. In cancer, dysfunctional differentiation is imposed upon the normal epithelial lineage, with disruption/disappearance of the basement membrane, loss of the contiguous basal cell layer and expansion of the luminal population. An initiating role for androgen receptor (AR) is attractive, due to the luminal phenotype of the tumours, but alternatively a pool of CSCs, which express little or no AR, has also been demonstrated. Indolent and aggressive tumours may also arise from different stem or progenitor cells. Castrate resistant prostate cancer (CRPC) remains the inevitable final stage of disease following treatment. Time-limited effectiveness of second-generation anti-androgens, and the appearance of an AR-neuroendocrine phenotype imply that metastatic disease is reliant upon the plasticity of the CSC population, and indeed CSC gene expression profiles are most closely related to those identified in CRPCs. PMID:26921821

  8. A high-fat diet containing lard accelerates prostate cancer progression and reduces survival rate in mice: possible contribution of adipose tissue-derived cytokines.

    PubMed

    Cho, Han Jin; Kwon, Gyoo Taik; Park, Heesook; Song, Hyerim; Lee, Ki Won; Kim, Jung-In; Park, Jung Han Yoon

    2015-04-01

    To examine the effects of high-fat diet (HFD) containing lard on prostate cancer development and progression and its underlying mechanisms, transgenic adenocarcinoma mouse prostate (TRAMP) and TRAMP-C2 allograft models, as well as in vitro culture models, were employed. In TRAMP mice, HFD feeding increased the incidence of poorly differentiated carcinoma and decreased that of prostatic intraepithelial neoplasia in the dorsolateral lobes of the prostate, which was accompanied by increased expression of proteins associated with proliferation and angiogenesis. HFD feeding also led to increased metastasis and decreased survival rate in TRAMP mice. In the allograft model, HFD increased solid tumor growth, the expression of proteins related to proliferation/angiogenesis, the number of lipid vacuoles in tumor tissues, and levels of several cytokines in serum and adipose tissue. In vitro results revealed that adipose tissue-conditioned media from HFD-fed mice stimulated the proliferation and migration of prostate cancer cells and angiogenesis compared to those from control-diet-fed mice. These results indicate that the increase of adipose tissue-derived soluble factors by HFD feeding plays a role in the growth and metastasis of prostate cancer via endocrine and paracrine mechanisms. These results provide evidence that a HFD containing lard increases prostate cancer development and progression, thereby reducing the survival rate. PMID:25912035

  9. Finite Element Modeling of Human Placental Tissue

    PubMed Central

    Yu, Mao; Manoogian, Sarah; Duma, Stefan M.; Stitzel, Joel D.

    2009-01-01

    Motor vehicle crashes account for a large portion of placental abruption and fetal losses. To better understand the material properties of the human placenta, a Finite Element (FE) model of human placenta tissue was created and verified using data from uniaxial tension tests. Sixty-four tensile tests at three different strain rates of 7% strain/s, 70% strain/s, and 700% strain/s from six whole human placentas were used for model development. Nominal stresses were calculated by dividing forces at the grips by the original cross-sectional area. Nominal strains were calculated by dividing cross-head displacement by the original gauge length. A detailed methodology for interpreting experimental data for application to material model development is presented. A model of the tension coupon was created in LS-DYNA and stretched in the same manner as the uniaxial tension tests. The behavior of the material was optimized to the uniaxial tension test using a multi-island genetic algorithm. The results demonstrate good correlation between experiments and the model, with an average difference of 2% between the optimized FE and experimental first principal stress at the termination state. The material parameters found in this study can be utilized in FE models of placental tissues for behavior under dynamic loading. PMID:20184849

  10. Epigenetic Regulation of Vitamin D 24-Hydroxylase/CYP24A1 in Human Prostate Cancer

    PubMed Central

    Luo, Wei; Karpf, Adam R.; Deeb, Kristin K.; Muindi, Josephia R.; Morrison, Carl D.; Johnson, Candace S.; Trump, Donald L.

    2010-01-01

    Calcitriol, a regulator of calcium homeostasis with antitumor properties, is degraded by the product of the CYP24A1 gene which is downregulated in human prostate cancer by unknown mechanisms. We found that CYP24A1 expression is inversely correlated with promoter DNA methylation in prostate cancer cell lines. Treatment with the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (DAC) activates CYP24A1 expression in prostate cancer cells. In vitro methylation of the CYP24A1 promoter represses its promoter activity. Furthermore, inhibition of histone deacetylases by trichostatin A (TSA) enhances the expression of CYP24A1 in prostate cancer cells. ChIP-qPCR reveals that specific histone modifications are associated with the CYP24A1 promoter region. Treatment with TSA increases H3K9ac and H3K4me2 and simultaneously decreases H3K9me2 at the CYP24A1 promoter. ChIP-qPCR assay reveals that treatment with DAC and TSA increases the recruitment of VDR to the CYP24A1 promoter. RT-PCR analysis of paired human prostate samples reveals that CYP24A1 expression is down-regulated in prostate malignant lesions compared to adjacent histologically benign lesions. Bisulfite pyrosequencing shows that CYP24A1 gene is hypermethylated in malignant lesions compared to matched benign lesions. Our findings indicate that repression of CYP24A1 gene expression in human prostate cancer cells is mediated in part by promoter DNA methylation and repressive histone modifications. PMID:20587525

  11. Neighborhood Socioeconomic Status Modifies the Association Between Individual Smoking Status and PAH-DNA Adduct Levels in Prostate Tissue

    PubMed Central

    Rundle, Andrew; Richards, Catherine; Neslund-Dudas, Christine; Tang, Deliang; Rybicki, Benjamin A.

    2013-01-01

    Interactions between smoking and neighborhood-level socioeconomic status (SES) as risk factors for higher polycyclic aromatic hydrocarbon (PAH) DNA adduct levels in prostate tissue were investigated. PAH-DNA adducts were measured by immunohistochemistry with staining intensity measured in optical density units by semiquantitative absorbance image analysis in tumor adjacent tissue from 400 prostatectomy specimens from the Henry Ford Health System in Detroit. For each subject, their U.S. Census tract of residence was classified as being of higher or lower SES using the median value of the distribution of the proportion of tract residents with a high-school education. Generalized estimating equation models were used to assess interactions between neighborhood-level SES and smoking status, adjusting for race, age, education level, tumor volume, primary Gleason grade and prostate specific antigen (PSA) at diagnosis. There was a statistical interaction (P = 0.004) between tract-level SES and smoking status. In lower SES tracts smoking status was not associated with adduct staining, but in higher SES tracts adduct staining intensity was 13% (P = 0.01) higher in ever-smokers as compared to never-smokers. Among never-smokers, living in a lower SES tract was associated with a 25% higher mean staining intensity (P < 0.001). Neighborhood SES modifies the association between individual smoking status and PAH-DNA adduct levels in prostate tissue. PMID:22467358

  12. Laser Illumination Modality of Photoacoustic Imaging Technique for Prostate Cancer

    NASA Astrophysics Data System (ADS)

    Peng, Dong-qing; Peng, Yuan-yuan; Guo, Jian; Li, Hui

    2016-02-01

    Photoacoustic imaging (PAI) has recently emerged as a promising imaging technique for prostate cancer. But there was still a lot of challenge in the PAI for prostate cancer detection, such as laser illumination modality. Knowledge of absorbed light distribution in prostate tissue was essential since the distribution characteristic of absorbed light energy would influence the imaging depth and range of PAI. In order to make a comparison of different laser illumination modality of photoacoustic imaging technique for prostate cancer, optical model of human prostate was established and combined with Monte Carlo simulation method to calculate the light absorption distribution in the prostate tissue. Characteristic of light absorption distribution of transurethral and trans-rectal illumination case, and of tumor at different location was compared with each other.The relevant conclusions would be significant for optimizing the light illumination in a PAI system for prostate cancer detection.

  13. Selective invocation of shape priors for deformable segmentation and morphologic classification of prostate cancer tissue microarrays.

    PubMed

    Ali, Sahirzeeshan; Veltri, Robert; Epstein, Jonathan I; Christudass, Christhunesa; Madabhushi, Anant

    2015-04-01

    Shape based active contours have emerged as a natural solution to overlap resolution. However, most of these shape-based methods are computationally expensive. There are instances in an image where no overlapping objects are present and applying these schemes results in significant computational overhead without any accompanying, additional benefit. In this paper we present a novel adaptive active contour scheme (AdACM) that combines boundary and region based energy terms with a shape prior in a multi level set formulation. To reduce the computational overhead, the shape prior term in the variational formulation is only invoked for those instances in the image where overlaps between objects are identified; these overlaps being identified via a contour concavity detection scheme. By not having to invoke all three terms (shape, boundary, region) for segmenting every object in the scene, the computational expense of the integrated active contour model is dramatically reduced, a particularly relevant consideration when multiple objects have to be segmented on very large histopathological images. The AdACM was employed for the task of segmenting nuclei on 80 prostate cancer tissue microarray images from 40 patient studies. Nuclear shape based, architectural and textural features extracted from these segmentations were extracted and found to able to discriminate different Gleason grade patterns with a classification accuracy of 86% via a quadratic discriminant analysis (QDA) classifier. On average the AdACM model provided 60% savings in computational times compared to a non-optimized hybrid active contour model involving a shape prior. PMID:25466771

  14. Integrin α7 Binds Tissue Inhibitor of Metalloproteinase 3 to Suppress Growth of Prostate Cancer Cells

    PubMed Central

    Tan, Lang-Zhu; Song, Yang; Nelson, Joel; Yu, Yan P.; Luo, Jian-Hua

    2014-01-01

    Integrin α7 (ITGA7) is a tumor-suppressor gene that is critical for suppressing the growth of malignant tumors; however, the mechanisms allowing ITGA7 to suppress the growth of cancer cells remain unclear. Herein, we show that ITGA7 binds to tissue inhibitor of metalloproteinase 3 (TIMP3) in prostate cancer cells. The ITGA7-TIMP3 binding led to a decreased protein level of tumor necrosis factor α, cytoplasmic translocation of NF-κB, and down-regulation of cyclin D1. These changes led to an accumulation of cells in G0/G1 and a dramatic suppression of cell growth. Knocking down TIMP3 or ITGA7/TIMP3 binding interference largely abrogated the signaling changes induced by ITGA7, whereas a mutant ITGA7 lacking TIMP3 binding activity had no tumor-suppressor activity. Interestingly, knocking down ITGA7 ligand laminin β1 enhanced ITGA7-TIMP3 signaling and the downstream tumor-suppressor activity, suggesting the existence of a counterbalancing role between extracellular matrix and integrin signaling. As a result, this report demonstrates a novel and critical signaling mechanism of ITGA7, through the TIMP3/NF-κB/cyclin D1 pathway. PMID:23830872

  15. Selective Invocation of Shape Priors for Deformable Segmentation and Morphologic Classification of Prostate Cancer Tissue Microarrays

    PubMed Central

    Ali, Sahirzeeshan; Veltri, Robert; Epstein, Jonathan A.; Christudass, Christhunesa; Madabhushi, Anant

    2015-01-01

    Shape based active contours have emerged as a natural solution to overlap resolution. However, most of these shape-based methods are computationally expensive. There are instances in an image where no overlapping objects are present and applying these schemes results in significant computational overhead without any accompanying, additional benefit. In this paper we present a novel adaptive active contour scheme (AdACM) that combines boundary and region based energy terms with a shape prior in a multi level set formulation. To reduce the computational overhead, the shape prior term in the variational formulation is only invoked for those instances in the image where overlaps between objects are identified; these overlaps being identified via a contour concavity detection scheme. By not having to invoke all 3 terms (shape, boundary, region) for segmenting every object in the scene, the computational expense of the integrated active contour model is dramatically reduced, a particularly relevant consideration when multiple objects have to be segmented on very large histopathological images. The AdACM was employed for the task of segmenting nuclei on 80 prostate cancer tissue microarray images from 40 patient studies. Nuclear shape based, architectural and textural features extracted from these segmentations were extracted and found to able to discriminate different Gleason grade patterns with a classification accuracy of 86% via a quadratic discriminant analysis (QDA) classifier. On average the AdACM model provided 60% savings in computational times compared to a non-optimized hybrid active contour model involving a shape prior. PMID:25466771

  16. A case-cohort study of human herpesvirus 8 seropositivity and incident prostate cancer in Tobago

    PubMed Central

    2011-01-01

    Background We previously reported a cross-sectional association between the presence of human herpesvirus 8 (HHV-8) serum antibodies and screen-detected prostate cancer in men living in Tobago. In the same study population, we examined the association between HHV-8 seropositivity and incident prostate cancer discovered at later screenings. Methods In 40-81 year-old men without prostate cancer discovered at initial digital rectal examination (DRE) and prostate-specific antigen (PSA) screening, a case-cohort design measured the association between baseline HHV-8 seropositivity (modified immunofluorescence assay for antibodies against HHV-8 lytic antigens) and incident prostate cancer detected at DRE and PSA screenings three or five years later. Results Analyses included 486 unique individuals, 96 incident prostate cancer cases, and 415 randomly selected subjects representing an at-risk cohort. By design, the random sub-cohort contained 25 incident prostate cancer cases. In the sub-cohort, the frequency of HHV-8 seropositivity increased across age groupings (40-49 years: 3.5%, 50-59 years: 13.6%, and ≥ 60 years: 22.9%). HHV-8 seropositivity was higher in men with elevated (≥ 4.0 ng/mL) than men with non-elevated PSA at initial screening (30.4% vs. 9.9% seropositive; crude odds ratio (OR) 3.96, 95% confidence interval (CI) 1.53-10.2; age-adjusted OR 2.42, 95% CI 0.91-6.47). HHV-8 seropositivity did not increase incident prostate cancer risk (age-adjusted hazard ratio (HR) 0.88, 95% CI 0.46-1.69). Conclusions Case-cohort analysis did not identify association between HHV-8 seropositivity and incident prostate cancer. However, analyses uncovered possible association between HHV-8 and PSA (a marker of prostate inflammation). Co-occurrence of HHV-8 seropositivity and PSA elevation may explain cross-sectional association between HHV-8 and PSA screen-detected prostate cancer. PMID:22151996

  17. Neuroanatomical Study of Periprostatic Nerve Distributions Using Human Cadaver Prostate

    PubMed Central

    Sung, Wooseuk; Lee, Sun; Park, Yong-Koo

    2010-01-01

    We investigated the distribution and navigation of periprostatic nerve fibers and constructed a 3-dimensional model of nerve distribution. A total of 5 cadaver specimens were serially sectioned in a transverse direction with 0.5 cm intervals. Hematoxylineosin staining and immunohistochemical staining were then performed on whole-mount sections. Three representative slides from the base, mid-part, and apex of each prostate were subsequently divided into 4 sectors: two lateral, one ventral, and one dorsal (rectal) part. The number of nerve fibers, the distance from nerve fiber to prostate capsule, and the nerve fiber diameters were analyzed on each sector from the representative slides by microscopy. Periprostatic nerve fibers revealed a relatively even distribution in both lateral and dorsal parts of the prostate. There was no difference in the distances from the prostate capsule to nerve fibers. Nerve fibers in the ventral area were also thinner as compared to other areas. In conclusion, periprostatic nerve fibers were observed to be distributed evenly in the periprostatic area, with the exception of the ventral area. As the number of nerve fibers on the ventral part is fewer in comparison, an excessive high up incision is insignificant during the nerve-sparing radical prostatectomy. PMID:20358006

  18. Multispectral texture characterization: application to computer aided diagnosis on prostatic tissue images

    NASA Astrophysics Data System (ADS)

    Khelifi, Riad; Adel, Mouloud; Bourennane, Salah

    2012-12-01

    Various approaches have been proposed in the literature for texture characterization of images. Some of them are based on statistical properties, others on fractal measures and some more on multi-resolution analysis. Basically, these approaches have been applied on mono-band images. However, most of them have been extended by including the additional information between spectral bands to deal with multi-band texture images. In this article, we investigate the problem of texture characterization for multi-band images. Therefore, we aim to add spectral information to classical texture analysis methods that only treat gray-level spatial variations. To achieve this goal, we propose a spatial and spectral gray level dependence method (SSGLDM) in order to extend the concept of gray level co-occurrence matrix (GLCM) by assuming the presence of texture joint information between spectral bands. Thus, we propose new multi-dimensional functions for estimating the second-order joint conditional probability density of spectral vectors. Theses functions can be represented in structure form which can help us to compute the occurrences while keeping the corresponding components of spectral vectors. In addition, new texture features measurements related to (SSGLDM) which define the multi-spectral image properties are proposed. Extensive experiments have been carried out on 624 textured multi-spectral images for use in prostate cancer diagnosis and quantitative results showed the efficiency of this method compared to the GLCM. The results indicate a significant improvement in terms of global accuracy rate. Thus, the proposed approach can provide clinically useful information for discriminating pathological tissue from healthy tissue.

  19. Role of hormonal and other factors in human prostate cancer.

    PubMed

    Wigle, Donald T; Turner, Michelle C; Gomes, James; Parent, Marie-Elise

    2008-03-01

    American men have a lifetime risk of about 18% for prostate cancer diagnosis. Large international variations in prostate cancer risks and increased risks among migrants from low- to high-risk countries indicate important roles for environmental factors. Major known risk factors include age, family history, and country/ethnicity. Type 2 diabetes appears to reduce risk, while high birth weight and adult height are linked to increased risk of aggressive prostate cancer. Limited evidence supports an association with a history of sexually transmitted infections. A previous meta-analysis of eight cohort studies indicated no associations with plasma androgen, estrogen, or sex hormone binding globulin (SHBG) levels. However, there were dose-response relationships with baseline plasma testosterone levels in two studies that adjusted for other serum hormones and obesity. Finasteride (a drug that blocks testosterone activation) reduced prostate cancer risk by 25%. Low-frequency genes linked to familial prostate cancer only explain a small fraction of all cases. Sporadic cases were linked to relatively common polymorphisms of genes involved in (1) androgen synthesis, activation, inactivation and excretion, (2) hormone and vitamin D receptors, (3) carcinogen metabolism, and (4) DNA repair. Epidemiologic evidence supports protective roles for dietary selenium, vitamin E, pulses, tomatoes/lycopene, and soy foods, and high plasma 1,25-dihydroxyvitamin D levels. There is inadequate evidence that vegetables, fruit, carotenoids, and vitamins A and C reduce risk and that animal fat, alpha-linoleic acid, meat, coffee, and tea increase risk. Two major cohort studies found dose-response relationships with dietary calcium intake. Total dietary energy intake may enhance risk. Limited evidence supports a protective role for physical activity and elevated risk for farmers and other men with occupational pesticide exposure, particularly to organochlorine compounds and phenoxy herbicides

  20. The Androgen Receptor Regulates PPARγ Expression and Activity in Human Prostate Cancer Cells.

    PubMed

    Olokpa, Emuejevoke; Bolden, Adrienne; Stewart, LaMonica V

    2016-12-01

    The peroxisome proliferator activated receptor gamma (PPARγ) is a ligand-activated transcription factor that regulates growth and differentiation within normal prostate and prostate cancers. However the factors that control PPARγ within the prostate cancers have not been characterized. The goal of this study was to examine whether the androgen receptor (AR) regulates PPARγ expression and function within human prostate cancer cells. qRT-PCR and Western blot analyses revealed nanomolar concentrations of the AR agonist dihydrotestosterone (DHT) decrease PPARγ mRNA and protein within the castration-resistant, AR-positive C4-2 and VCaP human prostate cancer cell lines. The AR antagonists bicalutamide and enzalutamide blocked the ability of DHT to reduce PPARγ levels. In addition, siRNA mediated knockdown of AR increased PPARγ protein levels and ligand-induced PPARγ transcriptional activity within the C4-2 cell line. Furthermore, proteasome inhibitors that interfere with AR function increased the level of basal PPARγ and prevented the DHT-mediated suppression of PPARγ. These data suggest that AR normally functions to suppress PPARγ expression within AR-positive prostate cancer cells. To determine whether increases in AR protein would influence PPARγ expression and activity, we used lipofectamine-based transfections to overexpress AR within the AR-null PC-3 cells. The addition of AR to PC-3 cells did not significantly alter PPARγ protein levels. However, the ability of the PPARγ ligand rosiglitazone to induce activation of a PPARγ-driven luciferase reporter and induce expression of FABP4 was suppressed in AR-positive PC-3 cells. Together, these data indicate AR serves as a key modulator of PPARγ expression and function within prostate tumors. J. Cell. Physiol. 231: 2664-2672, 2016. © 2016 Wiley Periodicals, Inc. PMID:26945682

  1. Hippocampus and epilepsy: findings from human tissues

    PubMed Central

    Huberfeld, Gilles; Blauwblomme, Thomas; Miles, Richard

    2015-01-01

    Surgical removal of the epileptogenic zone provides an effective therapy for several epileptic syndromes. This surgery offers the opportunity to study pathological activity in living human tissue for pharmacoresistant partial epilepsy syndromes including (1) temporal lobe epilepsies with hippocampal sclerosis, (2) cortical dysplasias, (3) epilepsies associated with tumors and (4) developmental malformations. Slices of tissue from patient with these syndromes retain functional neuronal networks and may generate epileptic activities. The properties of cells in this tissue may not be greatly changed, but excitatory synaptic transmission is often enhanced and GABAergic inhibition is preserved. Typically epileptic activity is not generated spontaneously by the neocortex, whether dysplastic or not, but can be induced by convulsants. The initiation of ictal discharges in neocortex depends on both GABAergic signaling and increased extracellular potassium. In contrast, a spontaneous interictal-like activity is generated by tissues from patients with temporal lobe epilepsies associated with hippocampal sclerosis. This activity is initiated, not in the hippocampus but in the subiculum an output region which projects to the entorhinal cortex. Interictal events seem to be triggered by GABAergic cells which paradoxically excite about 20% of subicular pyramidal cells while simultaneously inhibiting the majority. Interictal discharges thus depend on both GABAergic and glutamatergic signaling. The depolarizing effects of GABA depend on a pathological elevation in levels of chloride in some subicular cells, similar to those of developmentally immature cells. Such defect is caused by a perturbed expression of the cotransporters regulating intracellular chloride concentration, the importer NKCC1 and the extruder KCC2. Blockade of NKCC1 actions by the diuretic bumetanide, restores intracellular chloride and thus hyperpolarizing GABAergic actions so suppressing interictal activity. PMID

  2. Hippocampus and epilepsy: Findings from human tissues.

    PubMed

    Huberfeld, G; Blauwblomme, T; Miles, R

    2015-03-01

    Surgical removal of the epileptogenic zone provides an effective therapy for several focal epileptic syndromes. This surgery offers the opportunity to study pathological activity in living human tissue for pharmacoresistant partial epilepsy syndromes including temporal lobe epilepsies with hippocampal sclerosis, cortical dysplasias, epilepsies associated with tumors and developmental malformations. Slices of tissue from patients with these syndromes retain functional neuronal networks and may generate epileptic activities. The properties of cells in this tissue may not be greatly changed, but excitatory synaptic transmission is often enhanced and GABAergic inhibition is preserved. Typically epileptic activity is not generated spontaneously by the neocortex, whether dysplastic or not, but can be induced by convulsants. The initiation of ictal discharges in the neocortex depends on both GABAergic signaling and increased extracellular potassium. In contrast, a spontaneous interictal-like activity is generated by tissues from patients with temporal lobe epilepsies associated with hippocampal sclerosis. This activity is initiated, not in the hippocampus but in the subiculum, an output region, which projects to the entorhinal cortex. Interictal events seem to be triggered by GABAergic cells, which paradoxically excite about 20% of subicular pyramidal cells while simultaneously inhibiting the majority. Interictal discharges thus depend on both GABAergic and glutamatergic signaling. The depolarizing effects of GABA depend on a pathological elevation in levels of chloride in some subicular cells, similar to those of developmentally immature cells. Such defect is caused by a perturbed expression of the cotransporters regulating intracellular chloride concentration, the importer NKCC1 and the extruder KCC2. Blockade of NKCC1 actions by the diuretic bumetanide restores intracellular chloride and thus hyperpolarizing GABAergic actions and consequently suppressing interictal

  3. Prostate biopsy

    MedlinePlus

    Prostate gland biopsy; Transrectal prostate biopsy; Fine needle biopsy of the prostate; Core biopsy of the prostate; Targeted prostate biopsy; Prostate biopsy - transrectal ultrasound (TRUS); Stereotactic ...

  4. MYC and Prostate Cancer

    PubMed Central

    Koh, Cheryl M.; Bieberich, Charles J.; Dang, Chi V.; Nelson, William G.; Yegnasubramanian, Srinivasan; De Marzo, Angelo M.

    2010-01-01

    Prostate cancer, the majority of which is adenocarcinoma, is the most common epithelial cancer affecting a majority of elderly men in Western nations. Its manifestation, however, varies from clinically asymptomatic insidious neoplasms that progress slowly and do not threaten life to one that is highly aggressive with a propensity for metastatic spread and lethality if not treated in time. A number of somatic genetic and epigenetic alterations occur in prostate cancer cells. Some of these changes, such as loss of the tumor suppressors PTEN and p53, are linked to disease progression. Others, such as ETS gene fusions, appear to be linked more with early phases of the disease, such as invasion. Alterations in chromosome 8q24 in the region of MYC have also been linked to disease aggressiveness for many years. However, a number of recent studies in human tissues have indicated that MYC appears to be activated at the earliest phases of prostate cancer (e.g., in tumor-initiating cells) in prostatic intraepithelial neoplasia, a key precursor lesion to invasive prostatic adenocarcinoma. The initiation and early progression of prostate cancer can be recapitulated in genetically engineered mouse models, permitting a richer understanding of the cause and effects of loss of tumor suppressors and activation of MYC. The combination of studies using human tissues and mouse models paints an emerging molecular picture of prostate cancer development and early progression. This picture reveals that MYC contributes to disease initiation and progression by stimulating an embryonic stem cell–like signature characterized by an enrichment of genes involved in ribosome biogenesis and by repressing differentiation. These insights pave the way to potential novel therapeutic concepts based on MYC biology. PMID:21779461

  5. Real-Time Tissue Change Monitoring on the Sonablate® 500 during High Intensity Focused Ultrasound (HIFU) Treatment of Prostate Cancer

    NASA Astrophysics Data System (ADS)

    Chen, Wo-Hsing; Sanghvi, Narendra T.; Carlson, Roy; Uchida, Toyoaki

    2011-09-01

    Sonablate® 500 (SB-500) HIFU devices have been successfully used to treat prostate cancer non-invasively. In addition, Visually Directed HIFU with the SB-500 has demonstrated higher efficacy. Visually Directed HIFU works by displaying hyperechoic changes on the B-mode ultrasound images. However, small changes in the grey-scale images are not detectable by Visually Directed HIFU. To detect all tissue changes reliably, the SB-500 was enhanced with quantitative, real-time Tissue Change Monitoring (TCM) software. TCM uses pulse-echo ultrasound backscattered RF signals in 2D to estimate changes in the tissue properties caused by HIFU. The RF signal energy difference is calculated in selected frequency bands (pre and post HIFU) for each treatment site. The results are overlaid on the real-time ultrasound image in green, yellow and orange to represent low, medium and high degree of change in backscattered energy levels. The color mapping scheme was derived on measured temperature and backscattered RF signals from in vitro chicken tissue experiments. The TCM software was installed and tested in a clinical device to obtain human RF data. Post HIFU contrast enhanced MRI scans verified necrotic regions of the prostate. The color mapping success rate at higher HIFU power levels was 94% in the initial clinical test. Based on these results, TCM software has been released for wider usage. The clinical studies with TCM in Japan and The Bahamas have provided the following PSA (ng/ml) results. Japan (n = 97), PSA pre-treatment/post-treatment; minimum 0.7/0.0, maximum 76.0/4.73, median 6.89/0.07, standard deviation 11.19/0.62. The Bahamas (n = 59), minimum 0.4/0.0, maximum 13.0/1.4, median 4.7/0.1, standard deviation 2.8/0.3.

  6. Atlas of prostate cancer heritability in European and African-American men pinpoints tissue-specific regulation

    PubMed Central

    Gusev, Alexander; Shi, Huwenbo; Kichaev, Gleb; Pomerantz, Mark; Li, Fugen; Long, Henry W.; Ingles, Sue A.; Kittles, Rick A.; Strom, Sara S.; Rybicki, Benjamin A.; Nemesure, Barbara; Isaacs, William B.; Zheng, Wei; Pettaway, Curtis A.; Yeboah, Edward D.; Tettey, Yao; Biritwum, Richard B.; Adjei, Andrew A.; Tay, Evelyn; Truelove, Ann; Niwa, Shelley; Chokkalingam, Anand P.; John, Esther M.; Murphy, Adam B.; Signorello, Lisa B.; Carpten, John; Leske, M. Cristina; Wu, Suh-Yuh; Hennis, Anslem J. M.; Neslund-Dudas, Christine; Hsing, Ann W.; Chu, Lisa; Goodman, Phyllis J.; Klein, Eric A.; Witte, John S.; Casey, Graham; Kaggwa, Sam; Cook, Michael B.; Stram, Daniel O.; Blot, William J.; Eeles, Rosalind A.; Easton, Douglas; Kote-Jarai, ZSofia; Al Olama, Ali Amin; Benlloch, Sara; Muir, Kenneth; Giles, Graham G.; Southey, Melissa C.; Fitzgerald, Liesel M.; Gronberg, Henrik; Wiklund, Fredrik; Aly, Markus; Henderson, Brian E.; Schleutker, Johanna; Wahlfors, Tiina; Tammela, Teuvo L. J.; Nordestgaard, Børge G.; Key, Tim J.; Travis, Ruth C.; Neal, David E.; Donovan, Jenny L.; Hamdy, Freddie C.; Pharoah, Paul; Pashayan, Nora; Khaw, Kay-Tee; Stanford, Janet L.; Thibodeau, Stephen N.; McDonnell, Shannon K.; Schaid, Daniel J.; Maier, Christiane; Vogel, Walther; Luedeke, Manuel; Herkommer, Kathleen; Kibel, Adam S.; Cybulski, Cezary; Wokolorczyk, Dominika; Kluzniak, Wojciech; Cannon-Albright, Lisa; Teerlink, Craig; Brenner, Hermann; Dieffenbach, Aida K.; Arndt, Volker; Park, Jong Y.; Sellers, Thomas A.; Lin, Hui-Yi; Slavov, Chavdar; Kaneva, Radka; Mitev, Vanio; Batra, Jyotsna; Spurdle, Amanda; Clements, Judith A.; Teixeira, Manuel R.; Pandha, Hardev; Michael, Agnieszka; Paulo, Paula; Maia, Sofia; Kierzek, Andrzej; Cook, Margaret; Guy, Michelle; Govindasami, Koveela; Leongamornlert, Daniel; Sawyer, Emma J.; Wilkinson, Rosemary; Saunders, Edward J.; Tymrakiewicz, Malgorzata; Dadaev, Tokhir; Morgan, Angela; Fisher, Cyril; Hazel, Steve; Livni, Naomi; Lophatananon, Artitaya; Pedersen, John; Hopper, John L.; Adolfson, Jan; Stattin, Paer; Johansson, Jan-Erik; Cavalli-Bjoerkman, Carin; Karlsson, Ami; Broms, Michael; Auvinen, Anssi; Kujala, Paula; Maeaettaenen, Liisa; Murtola, Teemu; Taari, Kimmo; Weischer, Maren; Nielsen, Sune F.; Klarskov, Peter; Roder, Andreas; Iversen, Peter; Wallinder, Hans; Gustafsson, Sven; Cox, Angela; Brown, Paul; George, Anne; Marsden, Gemma; Lane, Athene; Davis, Michael; Zheng, Wei; Signorello, Lisa B.; Blot, William J.; Tillmans, Lori; Riska, Shaun; Wang, Liang; Rinckleb, Antje; Lubiski, Jan; Stegmaier, Christa; Pow-Sang, Julio; Park, Hyun; Radlein, Selina; Rincon, Maria; Haley, James; Zachariah, Babu; Kachakova, Darina; Popov, Elenko; Mitkova, Atanaska; Vlahova, Aleksandrina; Dikov, Tihomir; Christova, Svetlana; Heathcote, Peter; Wood, Glenn; Malone, Greg; Saunders, Pamela; Eckert, Allison; Yeadon, Trina; Kerr, Kris; Collins, Angus; Turner, Megan; Srinivasan, Srilakshmi; Kedda, Mary-Anne; Alexander, Kimberly; Omara, Tracy; Wu, Huihai; Henrique, Rui; Pinto, Pedro; Santos, Joana; Barros-Silva, Joao; Conti, David V.; Albanes, Demetrius; Berg, Christine; Berndt, Sonja I.; Campa, Daniele; Crawford, E. David; Diver, W. Ryan; Gapstur, Susan M.; Gaziano, J. Michael; Giovannucci, Edward; Hoover, Robert; Hunter, David J.; Johansson, Mattias; Kraft, Peter; Le Marchand, Loic; Lindström, Sara; Navarro, Carmen; Overvad, Kim; Riboli, Elio; Siddiq, Afshan; Stevens, Victoria L.; Trichopoulos, Dimitrios; Vineis, Paolo; Yeager, Meredith; Trynka, Gosia; Raychaudhuri, Soumya; Schumacher, Frederick R.; Price, Alkes L.; Freedman, Matthew L.; Haiman, Christopher A.; Pasaniuc, Bogdan

    2016-01-01

    Although genome-wide association studies have identified over 100 risk loci that explain ∼33% of familial risk for prostate cancer (PrCa), their functional effects on risk remain largely unknown. Here we use genotype data from 59,089 men of European and African American ancestries combined with cell-type-specific epigenetic data to build a genomic atlas of single-nucleotide polymorphism (SNP) heritability in PrCa. We find significant differences in heritability between variants in prostate-relevant epigenetic marks defined in normal versus tumour tissue as well as between tissue and cell lines. The majority of SNP heritability lies in regions marked by H3k27 acetylation in prostate adenoc7arcinoma cell line (LNCaP) or by DNaseI hypersensitive sites in cancer cell lines. We find a high degree of similarity between European and African American ancestries suggesting a similar genetic architecture from common variation underlying PrCa risk. Our findings showcase the power of integrating functional annotation with genetic data to understand the genetic basis of PrCa. PMID:27052111

  7. Atlas of prostate cancer heritability in European and African-American men pinpoints tissue-specific regulation.

    PubMed

    Gusev, Alexander; Shi, Huwenbo; Kichaev, Gleb; Pomerantz, Mark; Li, Fugen; Long, Henry W; Ingles, Sue A; Kittles, Rick A; Strom, Sara S; Rybicki, Benjamin A; Nemesure, Barbara; Isaacs, William B; Zheng, Wei; Pettaway, Curtis A; Yeboah, Edward D; Tettey, Yao; Biritwum, Richard B; Adjei, Andrew A; Tay, Evelyn; Truelove, Ann; Niwa, Shelley; Chokkalingam, Anand P; John, Esther M; Murphy, Adam B; Signorello, Lisa B; Carpten, John; Leske, M Cristina; Wu, Suh-Yuh; Hennis, Anslem J M; Neslund-Dudas, Christine; Hsing, Ann W; Chu, Lisa; Goodman, Phyllis J; Klein, Eric A; Witte, John S; Casey, Graham; Kaggwa, Sam; Cook, Michael B; Stram, Daniel O; Blot, William J; Eeles, Rosalind A; Easton, Douglas; Kote-Jarai, Zsofia; Al Olama, Ali Amin; Benlloch, Sara; Muir, Kenneth; Giles, Graham G; Southey, Melissa C; Fitzgerald, Liesel M; Gronberg, Henrik; Wiklund, Fredrik; Aly, Markus; Henderson, Brian E; Schleutker, Johanna; Wahlfors, Tiina; Tammela, Teuvo L J; Nordestgaard, Børge G; Key, Tim J; Travis, Ruth C; Neal, David E; Donovan, Jenny L; Hamdy, Freddie C; Pharoah, Paul; Pashayan, Nora; Khaw, Kay-Tee; Stanford, Janet L; Thibodeau, Stephen N; McDonnell, Shannon K; Schaid, Daniel J; Maier, Christiane; Vogel, Walther; Luedeke, Manuel; Herkommer, Kathleen; Kibel, Adam S; Cybulski, Cezary; Wokolorczyk, Dominika; Kluzniak, Wojciech; Cannon-Albright, Lisa; Teerlink, Craig; Brenner, Hermann; Dieffenbach, Aida K; Arndt, Volker; Park, Jong Y; Sellers, Thomas A; Lin, Hui-Yi; Slavov, Chavdar; Kaneva, Radka; Mitev, Vanio; Batra, Jyotsna; Spurdle, Amanda; Clements, Judith A; Teixeira, Manuel R; Pandha, Hardev; Michael, Agnieszka; Paulo, Paula; Maia, Sofia; Kierzek, Andrzej; Conti, David V; Albanes, Demetrius; Berg, Christine; Berndt, Sonja I; Campa, Daniele; Crawford, E David; Diver, W Ryan; Gapstur, Susan M; Gaziano, J Michael; Giovannucci, Edward; Hoover, Robert; Hunter, David J; Johansson, Mattias; Kraft, Peter; Le Marchand, Loic; Lindström, Sara; Navarro, Carmen; Overvad, Kim; Riboli, Elio; Siddiq, Afshan; Stevens, Victoria L; Trichopoulos, Dimitrios; Vineis, Paolo; Yeager, Meredith; Trynka, Gosia; Raychaudhuri, Soumya; Schumacher, Frederick R; Price, Alkes L; Freedman, Matthew L; Haiman, Christopher A; Pasaniuc, Bogdan

    2016-01-01

    Although genome-wide association studies have identified over 100 risk loci that explain ∼33% of familial risk for prostate cancer (PrCa), their functional effects on risk remain largely unknown. Here we use genotype data from 59,089 men of European and African American ancestries combined with cell-type-specific epigenetic data to build a genomic atlas of single-nucleotide polymorphism (SNP) heritability in PrCa. We find significant differences in heritability between variants in prostate-relevant epigenetic marks defined in normal versus tumour tissue as well as between tissue and cell lines. The majority of SNP heritability lies in regions marked by H3k27 acetylation in prostate adenoc7arcinoma cell line (LNCaP) or by DNaseI hypersensitive sites in cancer cell lines. We find a high degree of similarity between European and African American ancestries suggesting a similar genetic architecture from common variation underlying PrCa risk. Our findings showcase the power of integrating functional annotation with genetic data to understand the genetic basis of PrCa. PMID:27052111

  8. Tissue-type imaging (TTI) based on ultrasonic spectral and clinical parameters for detecting, evaluating, and managing prostate cancer

    NASA Astrophysics Data System (ADS)

    Feleppa, Ernest J.; Ketterling, Jeffrey A.; Dasgupta, Shreedevi; Kalisz, Andrew; Ramachandran, Sarayu; Porter, Christopher R.

    2005-04-01

    This study seeks to develop more-sensitive and -specific ultrasonic methods of imaging cancerous prostate tissue and thereby to improve means of guiding biopsies and planning, targeting, and monitoring treatment. Ultrasonic radio-frequency, echo-signal data, and clinical variables, e.g., PSA, voiding function, etc., during biopsy examinations were acquired. Spectra of the radio-frequency signals were computed in each biopsied region, and used to train neural networks; biopsy results served as the gold standard. A lookup table gave scores for cancer likelihood on a pixel-by-pixel basis from locally computed spectral-parameter and global clinical-parameter values. ROC curves used leave-one-patient- and leave-one-biopsy-out approaches to minimize classification bias. Resulting ROC-curve areas were 0.80+/-0.03 for neural-networks versus 0.66+/-0.03 for conventional classification. TTIs generated from data acquired pre-surgically showed tumors that were unrecognized in conventional images and during surgery. 3-D renderings of prostatectomy histology and TTIs showed encouraging correlations, which shows promise for improving the detection and management of prostate cancer, e.g., for biopsy guidance, planning dose-escalation and tissue-sparing options for radiation or cryotherapy, and assessing the effects of treatment. Combining MRS parameters with US spectral parameters appears capable of further improving prostate-cancer imaging. [Work supported by NIH.

  9. Decreased expression of SLC 39A14 is associated with tumor aggressiveness and biochemical recurrence of human prostate cancer

    PubMed Central

    Xu, Xiao-Ming; Wang, Cheng-Gong; Zhu, Yu-Di; Chen, Wei-Hua; Shao, Si-Liang; Jiang, Fu-Neng; Liao, Qian-De

    2016-01-01

    Objective Solute carrier family 39, member 14 (SLC39A14), has been identified as a potential biomarker for various cancers. However, its roles in prostate cancer (PCa) are still unclear. The aim of this study was to investigate the clinical significance of SLC39A14 in patients with PCa and its functions in malignant phenotypes of PCa cells. Patients and methods Subcellular localization and expression pattern of SLC39A14 protein were examined by immunohistochemistry. Then, the associations of SLC39A14 expression with various clinicopathological features and clinical outcome of patients with PCa were statistically evaluated. Subsequently, the effects of SLC39A14 overexpression and knockdown on PCa cell proliferation and motility were, respectively, examined by Cell Counting Kit-8, transwell, and wound-healing assays. Results The immunoreactive scores of SLC39A14 protein in human PCa tissues were significantly lower than those in normal prostate tissues. Based on the Taylor dataset, SLC39A14 downregulation occurred more frequently in patients with PCa with a higher Gleason score (P<0.001), advanced clinical stage (P=0.008), presence of metastasis (P=0.009), and prostate-specific antigen failure (P=0.006). More interestingly, the survival analysis identified SLC39A14 as an independent factor for predicting the biochemical recurrence-free survival of patients with PCa (P=0.017). Functionally, the enforced expression of SLC39A14 could suppress cell proliferation, invasion, and migration of PCa cell lines in vitro, which could be reversed by the knockdown of SLC39A14. Conclusion Decreased expression of SLC39A14 may lead to malignant phenotypes of PCa cells and aggressive tumor progression in patients with PCa. Importantly, SLC39A14 may function as a tumor suppressor and a biomarker for screening patients with biochemical recurrence following radical prostatectomy. PMID:27471394

  10. A New Murine Model of Osteoblastic/Osteolytic Lesions from Human Androgen-Resistant Prostate Cancer

    PubMed Central

    Depalle, Baptiste; Serre, Claire Marie; Farlay, Delphine; Turtoi, Andrei; Bellahcene, Akeila; Follet, Hélène; Castronovo, Vincent; Clézardin, Philippe; Bonnelye, Edith

    2013-01-01

    Background Up to 80% of patients dying from prostate carcinoma have developed bone metastases that are incurable. Castration is commonly used to treat prostate cancer. Although the disease initially responds to androgen blockade strategies, it often becomes castration-resistant (CRPC for Castration Resistant Prostate Cancer). Most of the murine models of mixed lesions derived from prostate cancer cells are androgen sensitive. Thus, we established a new model of CRPC (androgen receptor (AR) negative) that causes mixed lesions in bone. Methods PC3 and its derived new cell clone PC3c cells were directly injected into the tibiae of SCID male mice. Tumor growth was analyzed by radiography and histology. Direct effects of conditioned medium of both cell lines were tested on osteoclasts, osteoblasts and osteocytes. Results We found that PC3c cells induced mixed lesions 10 weeks after intratibial injection. In vitro, PC3c conditioned medium was able to stimulate tartrate resistant acid phosphatase (TRAP)-positive osteoclasts. Osteoprotegerin (OPG) and endothelin-1 (ET1) were highly expressed by PC3c while dikkopf-1 (DKK1) expression was decreased. Finally, PC3c highly expressed bone associated markers osteopontin (OPN), Runx2, alkaline phosphatase (ALP), bone sialoprotein (BSP) and produced mineralized matrix in vitro in osteogenic conditions. Conclusions We have established a new CRPC cell line as a useful system for modeling human metastatic prostate cancer which presents the mixed phenotype of bone metastases that is commonly observed in prostate cancer patients with advanced disease. This model will help to understand androgen-independent mechanisms involved in the progression of prostate cancer in bone and provides a preclinical model for testing the effects of new treatments for bone metastases. PMID:24069383

  11. Analysis of iron, zinc, selenium and cadmium in paraffin-embedded prostate tissue specimens using inductively coupled plasma mass-spectrometry

    USGS Publications Warehouse

    Sarafanov, A.G.; Todorov, T.I.; Kajdacsy-Balla, A.; Gray, Michael A.; MacIas, V.; Centeno, J.A.

    2008-01-01

    Formalin-fixed paraffin-embedded (FFPE) tissue specimens represent a valuable and abundant resource of pathologic material for various biomedical studies. In the present study, we report the application of high-resolution inductively coupled mass-spectrometry (ICP-MS) for quantification of Fe, Zn, Se and Cd in FFPE prostate tissue. These elements have a possible role in the development of prostate diseases: while Zn and Se are needed for a healthy prostate, Cd shows multiple toxic and carcinogenic effects. Excessive accumulation of Fe induces the production of highly reactive hydroxyl radical species, which may play a role in cancer etiopathogenesis. To assess whether the levels of these metals in the FFPE prostate tissue represent their original content, we compared their levels with those in the fresh tissue (on dry weight basis) in samples obtained from 15 patients. We found that in FFPE tissue, the recoveries of Se, Fe, Cd and Zn were progressively decreased, 97??11% (r=0.88), 82??22% (r=0.86), 59??23% (r=0.69) and 24??11% (r=0.38), respectively. Thus, the use of correction factors, determined as k=0.16 for Se, k=0.20 for Fe, k=0.27 for Cd and k=0.67 for Zn, is required to estimate the retrospective levels of these elements in the parental non-processed fresh (wet) prostate tissue. The technique used in this study enables the analysis of archival FFPE prostate tissue for the concentrations of Fe, Zn, Se and Cd to study association between the levels of these metals and prostate disease. ?? 2008.

  12. CpG Island Hypermethylation Frequently Silences FILIP1L Isoform 2 Expression in Prostate Cancer

    PubMed Central

    Desotelle, Joshua; Truong, Matthew; Ewald, Jonathan; Weeratunga, Pushpa; Yang, Bing; Huang, Wei; Jarrard, David

    2013-01-01

    Purpose Senescence related regulatory pathways serve as barriers to cancer immortalization and progression but they are currently not well defined. FILIP1L is a growth inhibitory gene with multiple isoforms whose expression is increased in senescent prostate and prostate cancer cells, and decreased in many cancers. We investigated whether DNA methylation regulates FILIP1L in senescence and in prostate cancer development. Materials and Methods FILIP1L mRNA expression was assessed in prostate cancer and associated normal prostate tissues using quantitative polymerase chain reaction. A tissue microarray was constructed using 95 prostate cancer specimens and 45 benign prostate specimens. Vectra™ imaging was used to quantitate nuclear and cytoplasmic FILIP1L protein expression. Bisulfite sequencing and Pyrosequencing® were used to assess methylation. Prostate cancer cell lines were treated with 2′-deoxy-5-azacytidine and mRNA expression was assessed. Results FILIP1L isoform 2 mRNA was increased in replicatively senescent human prostate epithelial cells and decreased in prostate cancer specimens. We verified a reduction in nuclear FILIP1L protein in prostate cancer using tissue microarrays (p = 0.006). A CpG island 5′ of the isoform 2 translational start site was identified that showed hypermethylation in prostate cancer cell lines and tumors compared to normal prostate cells and tissues. Pyrosequencing confirmed FILIP1L hypermethylation in all 14 tumors compared to paired normal tissues (p <0.0001). Isoform 2 expression was induced in prostate cancer cell lines using 2′-deoxy-5-azacytidine. Conclusions FILIP1L isoform 2 is one of the most commonly hypermethylated genes in prostate cancer. It may serve as an important marker of prostate cancer. Isoform 2 expression is associated with senescence and its down-regulation may represent an early important biological event in prostate cancer development. PMID:23174249

  13. Analysis of the codon 72 polymorphism of TP53 and human papillomavirus infection in Iranian patients with prostate cancer.

    PubMed

    Salehi, Zivar; Hadavi, Mahvash

    2012-09-01

    The TP53 gene is one of the most important tumor suppressor genes controlling DNA transcription and cell regulation. Common polymorphisms in p53 gene may play a role in some cancers. Some studies have reported an association between human papillomavirus (HPV) infections and prostate cancer. The aim of this study was to investigate whether the TP53 codon 72 polymorphism and HPV infection are responsible for susceptibility to prostate cancer in Iranian men. The prostate biopsies were taken during surgery from 68 Iranian prostatic cancer patients, and 85 patients with benign prostate hyperplasia. For genotyping of the p53 polymorphism at codon 72, PCRRFLP methods were used and the PCR products were digested with BstU1. An attempt was also made to detect HPV DNA in benign prostate hyperplasia and prostate cancer specimens. Among cancer cases, the distribution of Arg/Arg, Arg/Pro and Pro/Pro genotypes were 26.5%, 45.4%, and 19.1%, respectively. Among patients with benign prostate hyperplasia, the distribution of Arg/Arg, Arg/Pro, and Pro/Pro genotypes were 27%, 53%, and 20%, respectively. The allele frequencies did not differ significantly between prostate cancer and benign prostate hyperplasia samples. Human papillomavirus was detected only in three patients (4.4%; P = 0.71). The results from this study suggest that the TP53 codon 72 polymorphism and HPV infection do not confer susceptibility to prostate cancer in the Iranian population. Larger population-based studies are needed to clarify the relation between prostate carcinoma and p53 polymorphism and HPV infection. PMID:22825821

  14. Evaluating Prostate Cancer Using Fractional Tissue Composition of Radical Prostatectomy Specimens and Pre-Operative Diffusional Kurtosis Magnetic Resonance Imaging

    PubMed Central

    Lawrence, Edward M.; Warren, Anne Y.; Priest, Andrew N.; Barrett, Tristan; Goldman, Debra A.; Gill, Andrew B.

    2016-01-01

    Background Evaluating tissue heterogeneity using non-invasive imaging could potentially improve prostate cancer assessment and treatment. Methods 20 patients with intermediate/high-risk prostate cancer underwent diffusion kurtosis imaging, including calculation of apparent diffusion (Dapp) and kurtosis (Kapp), prior to radical prostatectomy. Whole-mount tissue composition was quantified into: cellularity, luminal space, and fibromuscular stroma. Peripheral zone tumors were subdivided according to Gleason score. Results Peripheral zone tumors had increased cellularity (p<0.0001), decreased fibromuscular stroma (p<0.05) and decreased luminal space (p<0.0001). Gleason score ≥4+3 tumors had significantly increased cellularity and decreased fibromuscular stroma compared to Gleason score ≤3+4 (p<0.05). In tumors, there was a significant positive correlation between median Kapp and cellularity (ρ = 0.50; p<0.05), and a negative correlation with fibromuscular stroma (ρ = -0.45; p<0.05). In normal tissue, median Dapp had a significant positive correlation with luminal space (ρ = 0.65; p<0.05) and a negative correlation with cellularity (ρ = -0.49; p<0.05). Median Kapp and Dapp varied significantly between tumor and normal tissue (p<0.0001), but only median Kapp was significantly different between Gleason score ≥4+3 and ≤3+4 (p<0.05). Conclusions Peripheral zone tumors have increased cellular heterogeneity which is reflected in mean Kapp, while normal prostate has a more homogeneous luminal space and cellularity better represented by Dapp. PMID:27467064

  15. Volume effects of late term normal tissue toxicity in prostate cancer radiotherapy

    NASA Astrophysics Data System (ADS)

    Bonta, Dacian Viorel

    Modeling of volume effects for treatment toxicity is paramount for optimization of radiation therapy. This thesis proposes a new model for calculating volume effects in gastro-intestinal and genito-urinary normal tissue complication probability (NTCP) following radiation therapy for prostate carcinoma. The radiobiological and the pathological basis for this model and its relationship to other models are detailed. A review of the radiobiological experiments and published clinical data identified salient features and specific properties a biologically adequate model has to conform to. The new model was fit to a set of actual clinical data. In order to verify the goodness of fit, two established NTCP models and a non-NTCP measure for complication risk were fitted to the same clinical data. The method of fit for the model parameters was maximum likelihood estimation. Within the framework of the maximum likelihood approach I estimated the parameter uncertainties for each complication prediction model. The quality-of-fit was determined using the Aikaike Information Criterion. Based on the model that provided the best fit, I identified the volume effects for both types of toxicities. Computer-based bootstrap resampling of the original dataset was used to estimate the bias and variance for the fitted parameter values. Computer simulation was also used to estimate the population size that generates a specific uncertainty level (3%) in the value of predicted complication probability. The same method was used to estimate the size of the patient population needed for accurate choice of the model underlying the NTCP. The results indicate that, depending on the number of parameters of a specific NTCP model, 100 (for two parameter models) and 500 patients (for three parameter models) are needed for accurate parameter fit. Correlation of complication occurrence in patients was also investigated. The results suggest that complication outcomes are correlated in a patient, although

  16. A single domain of human prostatic acid phosphatase shows antibody-mediated restoration of catalytic activity.

    PubMed Central

    Choe, B K; Dong, M K; Walz, D; Gleason, S; Rose, N R

    1982-01-01

    By limited proteolysis with mouse submaxillaris protease, human prostatic acid phosphatase (EC 3.1.3.2) was cleaved into three fragments, Sp1, Sp2, and Sp3, which individually had no enzymatic activity. One of the fragments, Sp3, regained enzymatic activity after interaction with rabbit antibody to prostatic acid phosphatase. The Sp3 fragment was purified and characterized as to its molecular weight, amino acid composition, and carbohydrate content. The Sp3 fragment behaved like the parent molecule in L(+)-tartrate affinity and in trapping of a phosphoryl intermediate. The same Sp3 fragment also bears the most prominent antigenic determinants. This evidence suggest that Sp3 is the enzymatically active domain of prostatic acid phosphatase. Images PMID:6193513

  17. NOTCH3 IS ACTIVATED BY CHRONIC HYPOXIA AND CONTRIBUTES TO THE PROGRESSION OF HUMAN PROSTATE CANCER

    PubMed Central

    Danza, Giovanna; Di Serio, Claudia; Ambrosio, Maria Raffaella; Sturli, Niccolò; Lonetto, Giuseppe; Rosati, Fabiana; Rocca, Bruno Jim; Ventimiglia, Giuseppina; del Vecchio, Maria Teresa; Prudovsky, Igor; Marchionni, Niccolò; Tarantini, Francesca

    2013-01-01

    Prostate cancer is still the second cause of cancer-related death among men. Although patients with metastatic presentation have an ominous outcome, the vast majority of PCs are diagnosed at an early stage. Nonetheless, even among patients with clinically localized disease the outcome may vary considerably. Other than androgen sensitivity, little is known about which other signaling pathways are deranged in aggressive, localized cancers. The elucidation of such pathways may help to develop innovative therapies aimed at specific molecular targets. We report that in a hormone-sensitive prostate cancer cell line, LNCaP, Notch3 was activated by hypoxia and sustained cell proliferation and colony formation in soft agar. Hypoxia also modulated cellular cholesterol content and the number and size of lipid rafts, causing a coalescence of small rafts into bigger clusters; under this experimental condition Notch3 migrated from the non-raft into the raft compartment where it co-localized with the γ-secretase complex. We also looked at human prostate cancer biopsies and found that expression of Notch3 positively correlated with Gleason score and with expression of carbonic anhydrase IX, a marker of hypoxia. In conclusion, hypoxia triggers the activation of Notch3 which, in turn, sustains proliferation of prostate cancer cells. Notch3 pathway represents a promising target for adjuvant therapy in patients with prostate cancer. PMID:23729168

  18. Widespread expression of serum amyloid A in histologically normal human tissues. Predominant localization to the epithelium.

    PubMed

    Urieli-Shoval, S; Cohen, P; Eisenberg, S; Matzner, Y

    1998-12-01

    Serum amyloid A (SAA) is an acute-phase reactant whose level in the blood is elevated to 1000-fold as part of the body's responses to various injuries, including trauma, infection, inflammation, and neoplasia. As an acute-phase reactant, the liver has been considered to be the primary site of expression. However, limited extrahepatic SAA expression was described in mouse tissues and in cells of human atherosclerotic lesions. Here we describe nonradioactive in situ hybridization experiments revealing that the SAA mRNA is widely expressed in many histologically normal human tissues. Expression was localized predominantly to the epithelial components of a variety of tissues, including breast, stomach, small and large intestine, prostate, lung, pancreas, kidney, tonsil, thyroid, pituitary, placenta, skin epidermis, and brain neurons. Expression was also observed in lymphocytes, plasma cells, and endothelial cells. RT-PCR analysis of selected tissues revealed expression of the SAA1, SAA2, and SAA4 genes but not of SAA3, consistent with expression of these genes in the liver. Immunohistochemical staining revealed SAA protein expression that co-localized with SAA mRNA expression. These data indicate local production of the SAA proteins in histologically normal human extrahepatic tissues. PMID:9815279

  19. Androgen-Sensitized Apoptosis of HPr-1AR Human Prostate Epithelial Cells

    PubMed Central

    Chen, Congcong; Dienhart, Jason A.; Bolton, Eric C.

    2016-01-01

    Androgen receptor (AR) signaling is crucial to the development and homeostasis of the prostate gland, and its dysregulation mediates common prostate pathologies. The mechanisms whereby AR regulates growth suppression and differentiation of luminal epithelial cells in the prostate gland and proliferation of malignant versions of these cells have been investigated in human and rodent adult prostate. However, the cellular stress response of human prostate epithelial cells is not well understood, though it is central to prostate health and pathology. Here, we report that androgen sensitizes HPr-1AR and RWPE-AR human prostate epithelial cells to cell stress agents and apoptotic cell death. Although 5α-dihydrotestosterone (DHT) treatment alone did not induce cell death, co-treatment of HPr-1AR cells with DHT and an apoptosis inducer, such as staurosporine (STS), TNFt, or hydrogen peroxide, synergistically increased cell death in comparison to treatment with each apoptosis inducer by itself. We found that the synergy between DHT and apoptosis inducer led to activation of the intrinsic/mitochondrial apoptotic pathway, which is supported by robust cleavage activation of caspase-9 and caspase-3. Further, the dramatic depolarization of the mitochondrial membrane potential that we observed upon co-treatment with DHT and STS is consistent with increased mitochondrial outer membrane permeabilization (MOMP) in the pro-apoptotic mechanism. Interestingly, the synergy between DHT and apoptosis inducer was abolished by AR antagonists and inhibitors of transcription and protein synthesis, suggesting that AR mediates pro-apoptotic synergy through transcriptional regulation of MOMP genes. Expression analysis revealed that pro-apoptotic genes (BCL2L11/BIM and AIFM2) were DHT-induced, whereas pro-survival genes (BCL2L1/BCL-XL and MCL1) were DHT-repressed. Hence, we propose that the net effect of these AR-mediated expression changes shifts the balance of BCL2-family proteins, such that

  20. Phase Ib placebo-controlled, tissue biomarker trial of diindolylmethane (BR-DIMNG) in patients with prostate cancer who are undergoing prostatectomy.

    PubMed

    Gee, Jason R; Saltzstein, Daniel R; Messing, Edward; Kim, KyungMann; Kolesar, Jill; Huang, Wei; Havighurst, Thomas C; Harris, Linda; Wollmer, Barbara W; Jarrard, David; House, Margaret; Parnes, Howard; Bailey, Howard H

    2016-07-01

    Epidemiologic, preclinical, and early phase I studies of the cruciferous vegetable bioactive metabolite, 3,3'-diindolylmethane (DIM), support its potential prostate cancer chemopreventive ability. We performed a multicenter, double-blind, placebo-controlled trial of DIM in patients diagnosed with prostate cancer and scheduled for radical prostatectomy. A total of 45 patients with organ-confined prostate cancer were randomized to 21-28 days of an absorption-enhanced formulation of DIM (BR-DIM) at doses of 100 or 200 mg per os twice daily or to placebo twice daily. Prostate tissue levels of DIM were the primary endpoint, with selected secondary biomarker endpoints including blood levels of DIM, total prostate-specific antigen, testosterone, and the insulin-like growth factor-1: insulin-like growth factor binding protein-3 ratio and the urinary 2-hydroxyestrone/16-hydroxyestrone ratio, obtained at baseline, at day 15, and before surgery, as well as tissue expression of androgen receptor, prostate-specific antigen, Ki67, caspase 3 with cytochrome p450 mRNA expression and genotyping (polymorphisms). DIM was well tolerated with excellent study compliance and relatively rapid accrual of all 45 patients within 1 year. DIM levels were detected in only seven of 28 prostate tissue specimens. There was a statistically significant difference in the change in the urinary 2-hydroxyestrone/16-hydroxyestrone ratio from baseline until before surgery between the placebo and 400 mg DIM groups, with otherwise statistically nonsignificant changes in plasma biomarker expression. The administration of BR-DIM to prostate cancer patients before prostatectomy yields detectable plasma levels but without consistent or significant tissue accumulation or biomarker modulation. This study demonstrates the feasibility of biologic evaluation of relatively nontoxic preventive agents in the preprostatectomy setting with the potential for rapid accrual. PMID:26313229

  1. SYSTEMS MODELING OF PROSTATE REGULATION AND RESPONSE TO ANTIANDROGEN

    EPA Science Inventory

    The prostate is an androgen-dependent tissue that is an important site of disease in human males as well as an important indicator of androgen status in animals. The rat prostate is used for studying antiandrogenic drugs as well as for evaluation of endocrine disruption (e.g., He...

  2. Pyranocoumarin tissue distribution, and plasma metabolome and prostate transcriptome impacts of sub-chronic exposure to Korean Angelica supplement in mice

    PubMed Central

    ZHANG, Jinhui; LI, Li; TANG, Suni; ZHANG, Yong; MARKIEWSKI, Maciej; XING, Chengguo; JIANG, Cheng; LÜ, Junxuan

    2016-01-01

    Herbal products containing Korean Angelica gigas Nakai (AGN) root extract are marketed as dietary supplements for memory enhancement, pain killing, and female menopausal symptom relief. We have shown anti-cancer activity of AGN supplement in mouse models. To facilitate human anti-cancer translational research, we characterized the tissue distribution of AGN marker pyranocoumarin compounds decursin (D) and decursinol angelate (DA) (~50% in AGN) and their metabolite decursinol (DOH), assessed safety of sub-chronic AGN dietary exposure in mice, and explored the impacts on the plasma aqueous metabolites and prostate transcriptome. The data show that after a gavage dose, plasma contained readily detectable DOH, but little D and DA, mirroring patterns in the liver. Extra-hepatic tissues retained greater level of DA and D than liver. For sub-chronic exposures, male mice were provided ad libitum AIN93M-pellet diet with 0.5 and 1% AGN for 6 weeks. No adverse effect was observed on plasma biochemistry markers of liver and kidney integrity in spite of their enlargement. Histopathological examination of liver, kidney and other visceral organs did not reveal tissue abnormalities. Metabolomic assessment of plasma from the mice fed 1%-AGN diet suggested metabolic shifts of key amino acids especially methionine-cysteine cycle, purine cycle and glycolysis-citrate cycle. Prostate transcriptomic profiling identified gene signature changes of metabolisms of drugs, lipids and cellular energetics, neuro-muscular features, immunity and inflammation, and tumor suppressor/oncogene balance. The safety profile was corroborated with daily i.p. injection of AGN extract (200 mg/kg) for 4 weeks, which resulted in much greater systemic pyranocoumarin exposure than dietary route. PMID:27080944

  3. Proteomics. Tissue-based map of the human proteome.

    PubMed

    Uhlén, Mathias; Fagerberg, Linn; Hallström, Björn M; Lindskog, Cecilia; Oksvold, Per; Mardinoglu, Adil; Sivertsson, Åsa; Kampf, Caroline; Sjöstedt, Evelina; Asplund, Anna; Olsson, IngMarie; Edlund, Karolina; Lundberg, Emma; Navani, Sanjay; Szigyarto, Cristina Al-Khalili; Odeberg, Jacob; Djureinovic, Dijana; Takanen, Jenny Ottosson; Hober, Sophia; Alm, Tove; Edqvist, Per-Henrik; Berling, Holger; Tegel, Hanna; Mulder, Jan; Rockberg, Johan; Nilsson, Peter; Schwenk, Jochen M; Hamsten, Marica; von Feilitzen, Kalle; Forsberg, Mattias; Persson, Lukas; Johansson, Fredric; Zwahlen, Martin; von Heijne, Gunnar; Nielsen, Jens; Pontén, Fredrik

    2015-01-23

    Resolving the molecular details of proteome variation in the different tissues and organs of the human body will greatly increase our knowledge of human biology and disease. Here, we present a map of the human tissue proteome based on an integrated omics approach that involves quantitative transcriptomics at the tissue and organ level, combined with tissue microarray-based immunohistochemistry, to achieve spatial localization of proteins down to the single-cell level. Our tissue-based analysis detected more than 90% of the putative protein-coding genes. We used this approach to explore the human secretome, the membrane proteome, the druggable proteome, the cancer proteome, and the metabolic functions in 32 different tissues and organs. All the data are integrated in an interactive Web-based database that allows exploration of individual proteins, as well as navigation of global expression patterns, in all major tissues and organs in the human body. PMID:25613900

  4. 21 CFR 1270.42 - Human tissue offered for import.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Human tissue offered for import. 1270.42 Section 1270.42 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) REGULATIONS UNDER CERTAIN OTHER ACTS ADMINISTERED BY THE FOOD AND DRUG ADMINISTRATION HUMAN TISSUE...

  5. 21 CFR 1270.42 - Human tissue offered for import.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Human tissue offered for import. 1270.42 Section 1270.42 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) REGULATIONS UNDER CERTAIN OTHER ACTS ADMINISTERED BY THE FOOD AND DRUG ADMINISTRATION HUMAN TISSUE...

  6. 21 CFR 1270.42 - Human tissue offered for import.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Human tissue offered for import. 1270.42 Section 1270.42 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) REGULATIONS UNDER CERTAIN OTHER ACTS ADMINISTERED BY THE FOOD AND DRUG ADMINISTRATION HUMAN TISSUE...

  7. 21 CFR 1270.42 - Human tissue offered for import.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Human tissue offered for import. 1270.42 Section 1270.42 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) REGULATIONS UNDER CERTAIN OTHER ACTS ADMINISTERED BY THE FOOD AND DRUG ADMINISTRATION HUMAN TISSUE...

  8. 21 CFR 1270.42 - Human tissue offered for import.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Human tissue offered for import. 1270.42 Section 1270.42 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) REGULATIONS UNDER CERTAIN OTHER ACTS ADMINISTERED BY THE FOOD AND DRUG ADMINISTRATION HUMAN TISSUE...

  9. Tumour-initiating stem-like cells in human prostate cancer exhibit increased NF-κB signalling

    PubMed Central

    Rajasekhar, Vinagolu K.; Studer, Lorenz; Gerald, William; Socci, Nicholas D.; Scher, Howard I.

    2011-01-01

    Androgen depletion is a key strategy for treating human prostate cancer, but the presence of hormone-independent cells escaping treatment remains a major therapeutic challenge. Here, we identify a minor subset of stem-like human prostate tumour-initiating cells (TICs) that do not express prostate cancer markers, such as androgen receptor or prostate specific antigen. These TICs possess stem cell characteristics and multipotency as demonstrated by in vitro sphere-formation and in vivo tumour-initiation, respectively. The cells represent an undifferentiated subtype of basal cells and can be purified from prostate tumours based on coexpression of the human pluripotent stem cell marker TRA-1-60 with CD151 and CD166. Such triple-marker-positive TICs recapitulate the original parent tumour heterogeneity in serial xeno-transplantations indicating a tumour cell hierarchy in human prostate cancer development. These TICs exhibit increased nuclear factor-κB activity. These findings are important in understanding the molecular basis of human prostate cancer. PMID:21245843

  10. Uric acid: a modulator of prostate cells and activin sensitivity.

    PubMed

    Sangkop, Febbie; Singh, Geeta; Rodrigues, Ely; Gold, Elspeth; Bahn, Andrew

    2016-03-01

    Elevated serum uric acid (SUA) or urate is associated with inflammation and gout. Recent evidence has linked urate to cancers, but little is known about urate effects in prostate cancer. Activins are inflammatory cytokines and negative growth regulators in the prostate. A hallmark of prostate cancer progression is activin insensitivity; however, mechanisms underlying this are unclear. We propose that elevated SUA is associated with prostate cancer counteracting the growth inhibitory effects of activins. The expression of activins A and B, urate transporter GLUT9 and tissue urate levels were examined in human prostate disease. Intracellular and secreted urate and GLUT9 expression were assessed in human prostate cancer cell lines. Furthermore, the effects of urate and probenecid, a known urate transport inhibitor, were determined in combination with activin A. Activin A expression was increased in low-grade prostate cancer, whereas activin B expression was reduced in high-grade prostate cancer. Intracellular urate levels decreased in all prostate pathologies, while GLUT9 expression decreased in benign prostatic hyperplasia, prostatitis and high-grade prostate cancer. Activin responsive LNCaP cells had higher intracellular and lower secreted urate levels than activin-insensitive PC3 cells. GLUT9 expression in prostate cancer cells was progressively lower than in prostate epithelial cells. Elevated extracellular urate was growth promoting in vitro, which was abolished by the gout medication probenecid, and it antagonized the growth inhibitory effects of activins. This study shows for the first time that a change in plasma or intracellular urate levels, possibly involving GLUT9 and a urate efflux transporter, has an impact on prostate cancer cell growth, and that lowering SUA levels in prostate cancer is likely to be therapeutically beneficial. PMID:26910779

  11. The role of vascular endothelial growth factor in the tissue specific in vivo growth of prostate cancer cells.

    PubMed

    Krupski, T; Harding, M A; Herce, M E; Gulding, K M; Stoler, M H; Theodorescu, D

    2001-01-01

    Despite the fact that cancer cells can be found in many vascular beds, continued growth of the metastatic tumor focus exhibits a significant degree of 'organ tropism', with only certain organs exhibiting the ravages of metastatic disease. Since a limiting factor to the growth of metastases beyond 2 mm in diameter, may be a lack of angiogenesis, we sought to determine whether tumor overexpression of vascular endothelial growth factor (VEGF), a potent angiogenic factor related to prostate cancer metastasis, is causally related to organ specific tumor growth in a prostate cancer xenograft model. LnCaP-C4-2 is a subline of the human prostate cancer cell line LnCaP which unlike its parent, has a predilection for growth in bone, a common site for human prostate cancer metastasis. LnCaP-C4-2, is tumorigenic when injected intrafemorally in mice but requires co-injection of stromal components (Matrigel) to be tumorigenic in the subcutaneous site. Because of this site-specific tumorigenicity profile and relatively low VEGF mRNA and protein expression, this line was transfected with a full length cDNA encoding the 165 isoform of VEGF. Cells either overexpressing or not expressing the transfected gene were selected for study in vivo and in vitro. Overexpression of VEGF did not seem to affect in vitro cell growth. Such overexpression did affect tumorigenicity and in vivo tumor growth rates when cells were inoculated in the subcutaneus site. Interestingly, the dependency of subcutaneous tumorigenicity on Matrigel co-inoculation was still observed in cells overexpressing VEGF. In contrast to the impact that VEGF overexpression has on subcutaneous tumorigenicity, no such effect was observed when cells were inoculated in orthotopic/prostate (primary) or intrafemoral (metastatic) sites. In view of the importance of tumor-stromal interactions in growth of xenografts, we sought to determine if the host strain is important to the observed tumorigenicity effects of VEGF overexpression

  12. Curcumin analogues with high activity for inhibiting human prostate cancer cell growth and androgen receptor activation.

    PubMed

    Zhou, Dai-Ying; Ding, Ning; Du, Zhi-Yun; Cui, Xiao-Xing; Wang, Hong; Wei, Xing-Chuan; Conney, Allan H; Zhang, Kun; Zheng, Xi

    2014-09-01

    The androgen receptor (AR) has a critical role in prostate cancer development and progression. Several curcumin analogues (A10, B10, C10, E10 and F10) with different linker groups were investigated for their effects in human prostate cancer CWR‑22Rv1 and LNCaP cell lines. The ability of these compounds to inhibit testosterone (TT)‑ or dihydrotestosterone (DHT)‑induced AR activity was determined by an AR‑linked luciferase assay and by TT‑ or DHT‑induced expression of prostate specific antigen. Compounds F10 and E10 had stronger inhibitory effects on the growth of cultured CWR‑22Rv1 and LNCaP cell lines, and they also had enhanced stimulatory effects on apoptosis compared with curcumin and other curcumin analogues (A10, B10, C10) in CWR‑22Rv1 cells. E10 and F10 were more potent inhibitors of AR activity than curcumin, A10 and B10. The higher activities of E10 and F10 may be correlated with a heteroatom linker. The results indicate that one of the potential mechanisms for the anticancer effect of the curcumin analogues was inhibition of AR pathways in human prostate cancer cells. PMID:25060817

  13. Membrane type-1-matrix metalloproteinase expressed by prostate carcinoma cells cleaves human laminin-5 beta3 chain and induces cell migration.

    PubMed

    Udayakumar, Thirupandiyur S; Chen, Man Ling; Bair, Elisabeth L; Von Bredow, Dorothea C; Cress, Anne E; Nagle, Raymond B; Bowden, G Timothy

    2003-05-01

    Degradation of the extracellular matrix by proteolytic enzymes is a central aspect of physiological and pathologic tissue-remodeling processes such as trophoblastic implantation, wound healing, and tumor invasion. We have hypothesized that prostate adenocarcinoma cell invasion through the normal basal lamina is attributable in part to metalloproteinase-induced cleavage of laminin-5 (Ln-5) and enhanced motility of the cancer cells. We studied the role of membrane type-1-matrix metalloproteinase (MT1-MMP) expressed on the surface of prostate tumor cells in cleaving Ln-5 and enhancing the migration of prostate tumor cells. We also determined the nature of the MT1-MMP cleavage of human Ln-5 and how this altered Ln-5 changes the migration of prostate carcinoma cells. We found that human MT1-MMP cleaves purified human Ln-5 to an 80-kDa fragment. Mass spectrometry analyses of the 80-kDa cleaved product by trypsin and chymotrypsin gave 14 and 9 different peptide sequences, respectively, that were identical to the expected amino acid sequence of the Ln-5-beta3 chain. The recovered peptides represent 14.4% (trypsin) and 10.3% (chymotrypsin) of Ln-5-beta3 chain by amino acid count. Both trypsin and chymotrypsin digestion of MT1-MMP-cleaved product of Ln-5 did not show any other peptides that were identical to the other chains of Ln-5. Using a linear migration assay we found that the Ln-5 cleaved by MT1-MMP enhanced the migration of DU-145 prostate carcinoma cells by 2-fold compared with uncleaved Ln-5. The use of blocked antisense MT1-MMP oligonucleotides inhibited the migration of DU-145 cells on Ln-5. We also found that the prostate carcinoma cells expressing high levels of MT1-MMP, such as PC3N and PPC, demonstrated enhanced migration on human Ln-5-coated substrate, and this migration was inhibited using blocked antisense MT1-MMP oligonucleotides. In conclusion, this is a novel and important finding where we have shown that beta3-chain is cleaved by MT1-MMP, and this

  14. Subcellular concentrations of calcium, zinc, and magnesium in benign nodular hyperplasia of the human prostate: X-ray microanalysis of freeze-dried cryosections

    SciTech Connect

    Tvedt, K.E.; Kopstad, G.; Haugen, O.A.; Halgunset, J.

    1987-01-01

    Biopsies from human prostates were obtained from normal and hyperplastic glands. The intracellular concentrations of calcium, zinc, and magnesium were analyzed using X-ray microanalysis of freeze-dried cryosections. Two prostate biopsies were obtained from kidney donors, ages 19 and 50 years, without any sign of benign nodular hyperplasia. The normal tissues were frozen within 15 min after circulatory arrest. The central part of biopsies from eight elderly men suffering from benign nodular hyperplasia were frozen within 30 s after excision. Adjacent tissue was processed for light microscopy and histopathological diagnosis. All samples were fresh-frozen using liquid nitrogen cooled pliers, without the use of any freeze-protection, fixation, or staining. In both the normal and the hyperplastic prostates high concentrations (up to above 100 mmol/kg dry weight) of zinc were present in electron dense bodies in the cytoplasm of the epithelial cells. Together with zinc, about equal concentrations of magnesium were found. Calcium was detected in 4 to 8 times the concentration of zinc. Significant, positive correlation between calcium and zinc as well as between calcium and magnesium in the cytoplasm was a typical finding in both normal and hyperplastic glands. In six of eight patients, older than 60 years of age, high levels of calcium (17.0-38.8 mmol/kg dry weight) were observed in the nuclei of the epithelial cells, while very low values were found in the remaining two. In the two younger cases (19 and 50 years of age), the nuclear calcium level in prostatic epithelium was relatively low (about 10 mmol/kg dry weight). These observations suggest that an increase of intranuclear calcium with advancing age may be of pathogenetic significance to growth disturbances in the prostate.

  15. Imaging the Human Body: Micro- and Nanostructure of Human Tissues

    NASA Astrophysics Data System (ADS)

    Schulz, Georg; Deyhle, Hans; Müller, Bert

    Computed tomography based on X-rays is known to provide the best spatial resolution of all clinical three-dimensional imaging facilities and currently reaches a fraction of a millimeter. Better spatial and density resolution is obtained by means of micro computed tomography well established in the field of materials science. It is also very supportive imaging human tissues down to the level of individual cells (Lareida et al. J. Microsc. 234:95, 2009). The article demonstrates the power of micro computed tomography for imaging parts of the human body such as teeth, inner ear, cerebellum, tumors, and urethral tissue with conventional X-ray sources and synchrotron radiation facilities in absorption and phase contrast modes. The second part of the chapter relies on scanning X-ray scattering of tooth slices (Müller et al. Eur. J. Clin. Nanomed. 3:30, 2010) to uncover the presence of nanostructures including their anisotropy and orientation. This imaging technique gives unrivalled insights for medical experts, which will have a major influence on fields such as dental and incontinence treatments.

  16. Multispectral Photoacoustic Imaging of Prostate Cancer: Preliminary Ex-vivo Results

    PubMed Central

    Dogra, Vikram S.; Chinni, Bhargava K.; Valluru, Keerthi S.; Joseph, Jean V.; Ghazi, Ahmed; Yao, Jorge L.; Evans, Katie; Messing, Edward M.; Rao, Navalgund A.

    2013-01-01

    Objective: The objective of this study is to validate if ex-vivo multispectral photoacoustic (PA) imaging can differentiate between malignant prostate tissue, benign prostatic hyperplasia (BPH), and normal human prostate tissue. Materials and Methods: Institutional Review Board's approval was obtained for this study. A total of 30 patients undergoing prostatectomy for biopsy-confirmed prostate cancer were included in this study with informed consent. Multispectral PA imaging was performed on surgically excised prostate tissue and chromophore images that represent optical absorption of deoxyhemoglobin (dHb), oxyhemoglobin (HbO2), lipid, and water were reconstructed. After the imaging procedure is completed, malignant prostate, BPH and normal prostate regions were marked by the genitourinary pathologist on histopathology slides and digital images of marked histopathology slides were obtained. The histopathology images were co-registered with chromophore images. Region of interest (ROI) corresponding to malignant prostate, BPH and normal prostate were defined on the chromophore images. Pixel values within each ROI were then averaged to determine mean intensities of dHb, HbO2, lipid, and water. Results: Our preliminary results show that there is statistically significant difference in mean intensity of dHb (P < 0.0001) and lipid (P = 0.0251) between malignant prostate and normal prostate tissue. There was difference in mean intensity of dHb (P < 0.0001) between malignant prostate and BPH. Sensitivity, specificity, positive predictive value, and negative predictive value of our imaging system were found to be 81.3%, 96.2%, 92.9% and 89.3% respectively. Conclusion: Our preliminary results of ex-vivo human prostate study suggest that multispectral PA imaging can differentiate between malignant prostate, BPH and normal prostate tissue. PMID:24228210

  17. Three distinct commonly deleted regions of chromosome arm 16q in human primary and metastatic prostate cancers.

    PubMed

    Suzuki, H; Komiya, A; Emi, M; Kuramochi, H; Shiraishi, T; Yatani, R; Shimazaki, J

    1996-12-01

    Human prostate cancers frequently show loss of heterozygosity (LOH) at loci on the long arm of chromosome 16 (16q). In this study, we analyzed prostate cancer specimens from 48 patients (Stage B, 20 cases; Stage C, 10 cases; cancer death, 18 cases) for allelic loss on 16q, using either restriction fragment length polymorphism (RFLP)- or polymerase chain reaction (PCR)-based methods. Allelic losses were observed in 20 (42%) of 48 cases, all of which were informative with at least one locus. Detailed deletion mapping identified three distinct commonly deleted regions on this chromosome arm: q22.1-q22.3, q23.2-q24.1, and q24.3-qter. On the basis of a published sex-averaged framework map, the estimated sizes of the commonly deleted regions were 4.7 (16q22.1-q22.3), 17.2 (16q23.2-q24.1) and 8.4 cM (16q24.3-qter). Allelic losses on 16q were observed more frequently in the cancer-death cases (11 of 18; 61%) than in early-stage tumor cases (9 of 30; 30%; P < 0.05). In 7 of 11 patients from whom DNA was available from metastatic cancers as well as from normal tissues and primary tumors, the primary cancer foci had no detectable abnormality of 16q, but the metastatic tumors showed LOH. These results suggest that inactivation of tumor suppressor genes on 16q plays an important role in the progression of prostate cancer. We also analyzed exons 5-8 of the E-cadherin gene, located at 16q22.1, in tumor DNA by means of PCR-single strand conformation polymorphism and direct sequencing, but we detected no somatic mutations in this candidate gene. PMID:8946204

  18. Gene Electrotransfer in 3D Reconstructed Human Dermal Tissue.

    PubMed

    Madi, Moinecha; Rols, Marie-Pierre; Gibot, Laure

    2016-01-01

    Gene electrotransfer into the skin is of particular interest for the development of medical applications including DNA vaccination, cancer treatment, wound healing or treatment of local skin disorders. However, such clinical applications are currently limited due to poor understanding of the mechanisms governing DNA electrotransfer within human tissue. Nowadays, most studies are carried out in rodent models but rodent skin varies from human skin in terms of cell composition and architecture. We used a tissue-engineering approach to study gene electrotransfer mechanisms in a human tissue context. Primary human dermal fibroblasts were cultured according to the self-assembly method to produce 3D reconstructed human dermal tissue. In this study, we showed that cells of the reconstructed cutaneous tissue were efficiently electropermeabilized by applying millisecond electric pulses, without affecting their viability. A reporter gene was successfully electrotransferred into this human tissue and gene expression was detected for up to 48h. Interestingly, the transfected cells were solely located on the upper surface of the tissue, where they were in close contact with plasmid DNA solution. Furthermore, we report evidences that electrotransfection success depends on plasmid mobility within tissue- rich in collagens, but not on cell proliferation status. In conclusion, in addition to proposing a reliable alternative to animal experiments, tissue engineering produces valid biological tool for the in vitro study of gene electrotransfer mechanisms in human tissue. PMID:27029947

  19. Anti-CTLA-4 therapy results in higher CD4+ICOShi T cell frequency and IFN-γ levels in both nonmalignant and malignant prostate tissues

    PubMed Central

    Chen, Hong; Liakou, Chrysoula I.; Kamat, Ashish; Pettaway, Curtis; Ward, John F.; Tang, Derek Ng; Sun, Jingjing; Jungbluth, Achim A.; Troncoso, Patricia; Logothetis, Christopher; Sharma, Padmanee

    2009-01-01

    Cytotoxic lymphocyte antigen-4 (CTLA-4) blockade is an active immunotherapeutic strategy that is currently in clinical trials in cancer. There are several ongoing trials of anti-CTLA-4 in the metastatic setting of prostate cancer patients with reported clinical responses consisting of decreases in the prostate specific antigen (PSA) tumor marker for some patients. Immunologic markers that correlate with these clinical responses are necessary to guide further development of anti-CTLA-4 therapy in the treatment of cancer patients. We recently reported that CD4+ inducible co-stimulator (ICOS)hi T cells that produce interferon-γ (IFN-γ) are increased in the peripheral blood and tumor tissues of bladder cancer patients treated with anti-CTLA-4 antibody. Here we present data from the same clinical trial in bladder cancer patients demonstrating a higher frequency of CD4+ICOShi T cells and IFN-γ mRNA levels in nonmalignant prostate tissues and incidental prostate tumor tissues removed at the time of radical cystoprostatectomy. Our data suggest immunologic markers that can be used to monitor prostate cancer patients who receive anti-CTLA-4 therapy and indicate that the immunologic impact of anti-CTLA-4 antibody can occur in both tumor and nonmalignant tissues. These data should be taken into consideration for evaluation of efficacy as well as immune-related adverse events associated with anti-CTLA-4 therapy. PMID:19202079

  20. Blood flow responses to mild-intensity exercise in ectopic vs. orthotopic prostate tumors; dependence upon host tissue hemodynamics and vascular reactivity.

    PubMed

    Garcia, Emmanuel; Becker, Veronika G C; McCullough, Danielle J; Stabley, John N; Gittemeier, Elizabeth M; Opoku-Acheampong, Alexander B; Sieman, Dietmar W; Behnke, Bradley J

    2016-07-01

    Given the critical role of tumor O2 delivery in patient prognosis and the rise in preclinical exercise oncology studies, we investigated tumor and host tissue blood flow at rest and during exercise as well as vascular reactivity using a rat prostate cancer model grown in two transplantation sites. In male COP/CrCrl rats, blood flow (via radiolabeled microspheres) to prostate tumors [R3327-MatLyLu cells injected in the left flank (ectopic) or ventral prostate (orthotopic)] and host tissue was measured at rest and during a bout of mild-intensity exercise. α-Adrenergic vasoconstriction to norepinephrine (NE: 10(-9) to 10(-4) M) was determined in arterioles perforating the tumors and host tissue. To determine host tissue exercise hyperemia in healthy tissue, a sham-operated group was included. Blood flow was lower at rest and during exercise in ectopic tumors and host tissue (subcutaneous adipose) vs. the orthotopic tumor and host tissue (prostate). During exercise, blood flow to the ectopic tumor significantly decreased by 25 ± 5% (SE), whereas flow to the orthotopic tumor increased by 181 ± 30%. Maximal vasoconstriction to NE was not different between arterioles from either tumor location. However, there was a significantly higher peak vasoconstriction to NE in subcutaneous adipose arterioles (92 ± 7%) vs. prostate arterioles (55 ± 7%). Establishment of the tumor did not alter host tissue blood flow from either location at rest or during exercise. These data demonstrate that blood flow in tumors is dependent on host tissue hemodynamics and that the location of the tumor may critically affect how exercise impacts the tumor microenvironment and treatment outcomes. PMID:27125846

  1. Sensitivity of low energy brachytherapy Monte Carlo dose calculations to uncertainties in human tissue composition

    SciTech Connect

    Landry, Guillaume; Reniers, Brigitte; Murrer, Lars; Lutgens, Ludy; Bloemen-Van Gurp, Esther; Pignol, Jean-Philippe; Keller, Brian; Beaulieu, Luc; Verhaegen, Frank

    2010-10-15

    Purpose: The objective of this work is to assess the sensitivity of Monte Carlo (MC) dose calculations to uncertainties in human tissue composition for a range of low photon energy brachytherapy sources: {sup 125}I, {sup 103}Pd, {sup 131}Cs, and an electronic brachytherapy source (EBS). The low energy photons emitted by these sources make the dosimetry sensitive to variations in tissue atomic number due to the dominance of the photoelectric effect. This work reports dose to a small mass of water in medium D{sub w,m} as opposed to dose to a small mass of medium in medium D{sub m,m}. Methods: Mean adipose, mammary gland, and breast tissues (as uniform mixture of the aforementioned tissues) are investigated as well as compositions corresponding to one standard deviation from the mean. Prostate mean compositions from three different literature sources are also investigated. Three sets of MC simulations are performed with the GEANT4 code: (1) Dose calculations for idealized TG-43-like spherical geometries using point sources. Radial dose profiles obtained in different media are compared to assess the influence of compositional uncertainties. (2) Dose calculations for four clinical prostate LDR brachytherapy permanent seed implants using {sup 125}I seeds (Model 2301, Best Medical, Springfield, VA). The effect of varying the prostate composition in the planning target volume (PTV) is investigated by comparing PTV D{sub 90} values. (3) Dose calculations for four clinical breast LDR brachytherapy permanent seed implants using {sup 103}Pd seeds (Model 2335, Best Medical). The effects of varying the adipose/gland ratio in the PTV and of varying the elemental composition of adipose and gland within one standard deviation of the assumed mean composition are investigated by comparing PTV D{sub 90} values. For (2) and (3), the influence of using the mass density from CT scans instead of unit mass density is also assessed. Results: Results from simulation (1) show that variations

  2. Claudin-1, -3, -4 and -7 gene expression analyses in canine prostate carcinoma and mammary tissue derived cell lines.

    PubMed

    Hammer, S C; Nagel, S; Junginger, J; Hewicker-Trautwein, M; Wagner, S; Heisterkamp, A; Ngezahayo, A; Nolte, I; Murua Escobar, H

    2016-01-01

    Claudins (CLDNs) are transmembrane proteins localised in the cell membrane of epithelial cells composing a structural and functional component of the tight junction protein complexes. In canine tumors deregulations of the CLDN expression patterns were described immunohistochemically. Targeting of claudin proteins has further been evaluated to establish novel therapeutic approaches by directed claudin binding. Precondition for the development of claudin targeting approaches in canine cells is the possibility to characterise claudin expression specifically and the availability of claudin positive cell lines. Herein PCR/qPCR assays were established allowing a rapid qualitative and quantitative characterisation of CLDN-1, -3, -4 and -7 gene expression in canine cell lines and tissues. Further commercially available antibodies were used to verify CLDN gene expression on protein level by Western blots. The developed assays were used to analyse six canine cell lines derived from mammary and prostate tissue for their CLDN-1, -3, -4 and -7 expressions. The canine cell line DT08/40 (prostate transitional cell carcinoma) was used for the establishment of specific CLDNs -1, -3, -4 and -7PCR/qPCR. The designed assays were verified by amplicon cloning and sequencing. Gene expressions were verified on protein level by Western blot. Additionally further cell lines were analysed for their CLDN-1, -3, -4 and -7 expression on mRNA and protein level (mammary derived cell lines: MTH53A (non-neoplastic), ZMTH3 (adenoma), MTH52C (carcinoma); prostate derived cell lines: DT08/46 and CT1258 (both adenocarcinoma).The screened cell lines showed expression for the CLDNs as follows: DT08/46 and DT08/40: CLDN-1, -3, -4 and -7 positive; CT1258: CLDN-1, -3, -4 and -7 negative; ZMTH3 and MTH52C: CLDN-1 and -7 positive, CLDN-3 and -4 negative; MTH53A: CLDN-1, -3 and -4 negative, CLDN-7 positive. Western blot analyses reflect the detected CLDN-1, -3, -4 and -7 expressions in the analysed cell

  3. Metabolite Analysis and Histology on the Exact Same Tissue: Comprehensive Metabolomic Profiling and Metabolic Classification of Prostate Cancer.

    PubMed

    Huan, Tao; Troyer, Dean A; Li, Liang

    2016-01-01

    We report a method of metabolomic profiling of intact tissue based on molecular preservation by extraction and fixation (mPREF) and high-performance chemical isotope labeling (CIL) liquid chromatography mass spectrometry (LC-MS). mPREF extracts metabolites by aqueous methanol from tissue biopsies without altering tissue architecture and thus conventional histology can be performed on the same tissue. In a proof-of-principle study, we applied dansylation LC-MS to profile the amine/phenol submetabolome of prostate needle biopsies from 25 patient samples derived from 16 subjects. 2900 metabolites were consistently detected in more than 50% of the samples. This unprecedented coverage allowed us to identify significant metabolites for differentiating tumor and normal tissues. The panel of significant metabolites was refined using 36 additional samples from 18 subjects. Receiver Operating Characteristic (ROC) analysis showed area-under-the-curve (AUC) of 0.896 with sensitivity of 84.6% and specificity of 83.3% using 7 metabolites. A blind study of 24 additional validation samples gave a specificity of 90.9% at the same sensitivity of 84.6%. The mPREF extraction can be readily implemented into the existing clinical workflow. Our method of combining mPREF with CIL LC-MS offers a powerful and convenient means of performing histopathology and discovering or detecting metabolite biomarkers in the same tissue biopsy. PMID:27578275

  4. Metabolite Analysis and Histology on the Exact Same Tissue: Comprehensive Metabolomic Profiling and Metabolic Classification of Prostate Cancer

    PubMed Central

    Huan, Tao; Troyer, Dean A.; Li, Liang

    2016-01-01

    We report a method of metabolomic profiling of intact tissue based on molecular preservation by extraction and fixation (mPREF) and high-performance chemical isotope labeling (CIL) liquid chromatography mass spectrometry (LC-MS). mPREF extracts metabolites by aqueous methanol from tissue biopsies without altering tissue architecture and thus conventional histology can be performed on the same tissue. In a proof-of-principle study, we applied dansylation LC-MS to profile the amine/phenol submetabolome of prostate needle biopsies from 25 patient samples derived from 16 subjects. 2900 metabolites were consistently detected in more than 50% of the samples. This unprecedented coverage allowed us to identify significant metabolites for differentiating tumor and normal tissues. The panel of significant metabolites was refined using 36 additional samples from 18 subjects. Receiver Operating Characteristic (ROC) analysis showed area-under-the-curve (AUC) of 0.896 with sensitivity of 84.6% and specificity of 83.3% using 7 metabolites. A blind study of 24 additional validation samples gave a specificity of 90.9% at the same sensitivity of 84.6%. The mPREF extraction can be readily implemented into the existing clinical workflow. Our method of combining mPREF with CIL LC-MS offers a powerful and convenient means of performing histopathology and discovering or detecting metabolite biomarkers in the same tissue biopsy. PMID:27578275

  5. External beam radiotherapy and abiraterone in men with localized prostate cancer: safety and effect on tissue androgens

    PubMed Central

    Cho, Eunpi; Mostaghel, Elahe A.; Russell, Kenneth J.; Liao, Jay J.; Konodi, Mark A.; Kurland, Brenda F.; Marck, Brett T.; Matsumoto, Alvin M.; Dalkin, Bruce L.; Montgomery, R. Bruce

    2015-01-01

    Purpose/Objectives Optimizing androgen suppression may provide better control of localized prostate cancer (PCa). Numerous trials have supported the benefit of combining androgen deprivation with definitive radiotherapy in men with locally advanced or high-grade disease. Addition of abiraterone to LHRH agonist (LHRHa) with radiation has not been reported. We examined the safety of this combination as well as its impact on androgen suppression. Materials/Methods A prospective, phase II study was conducted in men with localized PCa treated with 6 months of neoadjuvant and concurrent abiraterone with LHRHa and radiation. Duration of adjuvant LHRHa was at discretion of treating clinician. Prostate biopsies were obtained prior to start of therapy and prior to radiation. Serum and tissue androgen levels were measured by liquid chromatography-tandem mass spectrometry. Results 22 men with intermediate (3) and high-risk PCa (19) received study therapy. 16 men completed the intended course of abiraterone, and 19 men completed planned radiation to 77.4–81 Gy. Radiation to pelvic nodes was administered in 20 men. The following grade 3 toxicities were reported: lymphopenia (14),, fatigue (1), transaminitis (2), hypertension (2), and hypokalemia (1). There were no grade 4 toxicities. All 21 men who complied with at least 3 months of abiraterone had pre-radiation PSA nadir of <0.3. Median levels of tissue androgens downstream of CYP17A were significantly suppressed after treatment with abiraterone, and upstream steroids were increased. At median follow-up of 21 months (range 3–37), only one patient (who had discontinued abiraterone at 3 months) had biochemical relapse. Conclusions Addition of abiraterone to LHRHa with radiation is safe and achieves effective prostatic androgen suppression. Preliminary analysis of the clinical data is also promising with excellent PSA nadir and no relapse to date in this high-risk population. PMID:25772183

  6. Targeted chemotherapy with cytotoxic bombesin analogue AN-215 inhibits growth of experimental human prostate cancers.

    PubMed

    Stangelberger, Anton; Schally, Andrew V; Letsch, Markus; Szepeshazi, Karoly; Nagy, Attila; Halmos, Gabor; Kanashiro, Celia A; Corey, Eva; Vessella, Robert

    2006-01-01

    We developed a powerful cytotoxic analogue of bombesin AN-215, in which the bombesin (BN)-like carrier peptide is conjugated to 2-pyrrolino doxorubicin (AN-201). Human prostate cancers express high levels of receptors for BN/gastrin releasing peptide (GRP) that can be used for targeted chemotherapy. The effects of targeted chemotherapy with cytotoxic BN analogue AN-215 were evaluated in nude mice bearing subcutaneous xenografts of DU-145, LuCaP-35, MDA-PCa-2b and intraosseous implants of C4-2 human prostate cancers. Intraosseous growth of C4-2 tumors was monitored by serum PSA. BN/GRP receptors were evaluated by 125I-[Tyr4]BN binding assays and RT-PCR. The effects of AN-215 on apoptosis and cell proliferation were followed by histology, and the expression of Bcl-2 and Bax protein was determined by Western blot analysis. Targeted analog AN-215 significantly inhibited growth of subcutaneously implanted DU-145, LuCaP-35 and MDA-PCa-2b prostate cancers by 81% to 91% compared to controls, while cytotoxic radical AN-201 was less effective and more toxic. Serum PSA levels of mice bearing intraosseous C4-2 prostate tumors were significantly reduced. In LuCaP-35 tumors administration of BN antagonist RC-3095 prior to AN-215 blocked the receptors for BN/GRP and inhibited the effects of AN-215. High affinity receptors for BN/GRP and their m-RNA were detected on membranes of all 4 tumor models. Therapy with AN-215, but not with AN-201, decreased the ratio of Bcl-2/Bax in DU-145 and the expression of antiapoptotic Bcl-2 in LuCaP-35 tumors. The presence of BN/GRP receptors on primary and metastatic prostate cancers makes possible targeted chemotherapy with AN-215 for the treatment of this malignancy. PMID:16003723

  7. Tetrandrine suppresses proliferation, induces apoptosis, and inhibits migration and invasion in human prostate cancer cells

    PubMed Central

    Liu, Wei; Kou, Bo; Ma, Zhen-Kun; Tang, Xiao-Shuang; Lv, Chuan; Ye, Min; Chen, Jia-Qi; Li, Lei; Wang, Xin-Yang; He, Da-Lin

    2015-01-01

    Tetrandrine (TET), a traditional Chinese medicine, exerts remarkable anticancer activity on various cancer cells. However, little is known about the effect of TET on human prostate cancer cells, and the mechanism of function of TET on prostate cancer has not yet been elucidated. To investigate the effects of TET on the suppression of proliferation, induction of apoptosis, and inhibition of migration and invasion in human prostate cancer cell lines, DU145 and PC-3. Inhibition of growth was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and clone formation assay, and flow cytometry analysis was performed to detect the induction of apoptosis. Activation of poly (ADP-ribose) polymerase, caspase-3, Akt, phospho-Akt, Bcl-2, and Bax was analyzed by Western blotting. Wound healing assay and transwell migration assay were used to evaluate the effect of TET on migration and invasion of cancer cells. TET inhibited the growth of DU145 and PC–3 cells in a dose- and time-dependent manner. Cell cloning was inhibited in the presence of TET in DU145 and PC-3 cells. TET suppressed the migration of DU145 and PC-3 cells. Transwell invasion assay showed that TET significantly weakened invasion capacity of DU145 and PC-3 cells. TET exhibited strong inhibitory effect on proliferation, migration, and invasion of prostate cancer cells. In addition, TET induced apoptosis in a dose-dependent manner by activating the caspase cascade and inhibiting phosphoinositide 3-kinase-Akt signal pathway. The accumulating evidence suggests that TET could be a potential therapeutic candidate against prostate cancer in a clinical setting. PMID:25677131

  8. Tetrandrine suppresses proliferation, induces apoptosis, and inhibits migration and invasion in human prostate cancer cells.

    PubMed

    Liu, Wei; Kou, Bo; Ma, Zhen-Kun; Tang, Xiao-Shuang; Lv, Chuan; Ye, Min; Chen, Jia-Qi; Li, Lei; Wang, Xin-Yang; He, Da-Lin

    2015-01-01

    Tetrandrine (TET), a traditional Chinese medicine, exerts remarkable anticancer activity on various cancer cells. However, little is known about the effect of TET on human prostate cancer cells, and the mechanism of function of TET on prostate cancer has not yet been elucidated. To investigate the effects of TET on the suppression of proliferation, induction of apoptosis, and inhibition of migration and invasion in human prostate cancer cell lines, DU145 and PC-3. Inhibition of growth was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and clone formation assay, and flow cytometry analysis was performed to detect the induction of apoptosis. Activation of poly (ADP-ribose) polymerase, caspase-3, Akt, phospho-Akt, Bcl-2, and Bax was analyzed by Western blotting. Wound healing assay and transwell migration assay were used to evaluate the effect of TET on migration and invasion of cancer cells. TET inhibited the growth of DU145 and PC-3 cells in a dose- and time-dependent manner. Cell cloning was inhibited in the presence of TET in DU145 and PC-3 cells. TET suppressed the migration of DU145 and PC-3 cells. Transwell invasion assay showed that TET significantly weakened invasion capacity of DU145 and PC-3 cells. TET exhibited strong inhibitory effect on proliferation, migration, and invasion of prostate cancer cells. In addition, TET induced apoptosis in a dose-dependent manner by activating the caspase cascade and inhibiting phosphoinositide 3-kinase-Akt signal pathway. The accumulating evidence suggests that TET could be a potential therapeutic candidate against prostate cancer in a clinical setting. PMID:25677131

  9. Expression of melanocortin receptors in human prostate cancer cell lines: MC2R activation by ACTH increases prostate cancer cell proliferation.

    PubMed

    Hafiz, Saly; Dennis, John C; Schwartz, Dean; Judd, Robert; Tao, Ya-Xiong; Khazal, Kamel; Akingbemi, Benson; Mo, Xiu-Lei; Abdel-Mageed, Asim B; Morrison, Edward; Mansour, Mahmoud

    2012-10-01

    The melanocortin receptors (MCRs 1-5) are G protein coupled-receptors (GPCRs) that regulate food intake, inflammation, skin pigmentation, sexual function and steroidogenesis. Their peptide ligands, the melanocortins, are α-, β- and γ-melanocyte-stimulating hormone and adrenocorticotropic hormone (ACTH) all of which are secreted from the anterior pituitary gland under hypothalamic control. MC2R binds ACTH but has no affinity for the other melanocortins and is, thereby, pharmacologically different from MCRs that bind those ligands. Evidence suggests that elevated GPCRs transactivate the androgen receptor (AR), the critical mediator of prostate cell growth, and consequently promote prostate cancer cell proliferation. It may be that reduced central melanocortin signaling is coincidental with reversal of prostate cancer cachexia, but no data are available on the expression of, or the role for, MCRs in prostate cancer. Here, we show that MCR (1-5) mRNAs are expressed in androgen-dependent LNCaP and androgen-independent PC3 and DU-145 human prostate cancer cell lines. Further, MC2R, the specific target of ACTH, is expressed in LNCaP, PC3 and DU-145 cells. Among the several synthetic MCR peptide ligands that we used, only ACTH promoted concentration-dependent cell proliferation in the three cell lines as shown by MTT cell proliferation assay. In LNCaP cells, the effect was additive with testosterone stimulation and was partially blunted with SHU9119, a non-selective MCR antagonist. In the same cells, ACTH induced cAMP production and increased AR nuclear labeling in immunocytochemical assays. Our observations suggest that MC2R is involved in prostate carcinogenesis and that targeting MC2R signaling may provide a novel avenue in prostate carcinoma treatment. PMID:22842514

  10. Vaccination against prostate cancer using a live tissue factor deficient cell line in Lobund-Wistar rats.

    PubMed

    Heinrich, Julie E; Pollard, Morris; Wolter, William A; Liang, Zhong; Song, Hui; Rosen, Elliot D; Suckow, Mark A

    2007-05-01

    Reducing expression of the tissue factor gene in prostate adenocarcinoma cells (PAIII) results in a cell line that, in vivo, mimics the growth of wildtype (wt) PAIII. However, instead of continuing to grow and metastasize as wt PAIII tumors do, tissue factor deficient PAIII (TFD PAIII) masses spontaneously regress after several weeks. Although whole cell vaccines are typically inactivated prior to administration to prevent proliferation within the host, numerous studies have suggested that exposure to live, attenuated, whole tumor cells, and the extracellular microenvironment they recruit, increases immunotherapeutic potential. Here, we provide support for this notion, and a strategy through which to implement it, by demonstrating that subcutaneous vaccinations with the TFD PAIII protect the Lobund-Wistar rat against subsequent wt PAIII cell challenge. TFD PAIII immunized rats suffered significantly less metastasis of wt PAIII challenge tumors compared to unvaccinated naïve controls rats. These results offer the intriguing possibility that the TFD PAIII vaccine is an effective system for the prevention and, possibly, the treatment of prostate cancer. PMID:16953436

  11. Transplantation of a tissue-engineered human vascularized cardiac muscle.

    PubMed

    Lesman, Ayelet; Habib, Manhal; Caspi, Oren; Gepstein, Amira; Arbel, Gil; Levenberg, Shulamit; Gepstein, Lior

    2010-01-01

    Myocardial regeneration strategies have been hampered by the lack of sources for human cardiomyocytes (CMs) and by the significant donor cell loss following transplantation. We assessed the ability of a three-dimensional tissue-engineered human vascularized cardiac muscle to engraft in the in vivo rat heart and to promote functional vascularization. Human embryonic stem cell-derived CMs alone or with human endothelial cells (human umbilical vein endothelial cells) and embryonic fibroblasts (triculture constructs) were seeded onto biodegradable porous scaffolds. The resulting tissue constructs were transplanted to the in vivo rat heart and formed cardiac tissue grafts. Immunostaining studies for human-specific CD31 and alpha-smooth muscle actin demonstrated the formation of both donor (human) and host (rat)-derived vasculature within the engrafted triculture tissue constructs. Intraventricular injection of fluorescent microspheres or lectin resulted in their incorporation by human-derived vessels, confirming their functional integration with host coronary vasculature. Finally, the number of blood vessels was significantly greater in the triculture tissue constructs (60.3 +/- 8/mm(3), p < 0.05) when compared with scaffolds containing only CMs (39.0 +/- 14.4/mm(3)). In conclusion, a tissue-engineered human vascularized cardiac muscle can be established ex vivo and transplanted in vivo to form stable grafts. By utilizing a multicellular preparation we were able to increase biograft vascularization and to show that the preexisting human vessels can become functional and contribute to tissue perfusion. PMID:19642856

  12. Effect of resveratrol and zinc on intracellular zinc status in normal human prostate epithelial cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To evaluate the influence of resveratrol on cellular zinc status, normal human prostate epithelial (NHPrE) cells were treated with 6 levels of resveratrol (0, 0.5, 1, 2.5, 5 and 10 microM) and 4 levels of zinc [0, 4, 16, and 32 microM for zinc-deficient (ZD), zinc-normal (ZN), zinc-adequate (ZA), an...

  13. Fluorescence Lifetimes of Normal and Carcinomatous Human Nasopharyngeal Tissues

    NASA Astrophysics Data System (ADS)

    Chen, M.; Li, H.; Li, B.; Chen, R.; Zheng, G.; Song, C.

    2016-03-01

    Time-resolved fluorescence spectra of normal and carcinomatous in vitro human nasopharyngeal tissues are compared. By fitting the time-resolved emission with exponential decays, mean lifetimes were obtained. There were marked differences between the lifetimes of the carcinomatous and the normal tissues. Thus, early diagnosis of nasopharyngeal carcinoma is possible. In general, comprehensive information from human tissue autofluorescence can be acquired via both time-resolved and steady-state fluorescence spectra.

  14. The human transcriptome across tissues and individuals

    PubMed Central

    Melé, Marta; Ferreira, Pedro G.; Reverter, Ferran; DeLuca, David S.; Monlong, Jean; Sammeth, Michael; Young, Taylor R.; Goldmann, Jakob M; Pervouchine, Dmitri D.; Sullivan, Timothy J.; Johnson, Rory; Segrè, Ayellet V.; Djebali, Sarah; Niarchou, Anastasia; Wright, Fred A.; Lappalainen, Tuuli; Calvo, Miquel; Getz, Gad; Dermitzakis, Emmanouil T.; Ardlie, Kristin G.; Guigó, Roderic

    2015-01-01

    Transcriptional regulation and posttranscriptional processing underlie many cellular and organismal phenotypes. We used RNA sequence data generated by Genotype-Tissue Expression (GTEx) project to investigate the patterns of transcriptome variation across individuals and tissues. Tissues exhibit characteristic transcriptional signatures that show stability in postmortem samples. These signatures are dominated by a relatively small number of genes—which is most clearly seen in blood—though few are exclusive to a particular tissue and vary more across tissues than individuals. Genes exhibiting high interindividual expression variation include disease candidates associated with sex, ethnicity, and age. Primary transcription is the major driver of cellular specificity, with splicing playing mostly a complementary role; except for the brain, which exhibits a more divergent splicing program. Variation in splicing, despite its stochasticity, may play in contrast a comparatively greater role in defining individual phenotypes. PMID:25954002

  15. External Beam Radiation Therapy and Abiraterone in Men With Localized Prostate Cancer: Safety and Effect on Tissue Androgens

    SciTech Connect

    Cho, Eunpi; Mostaghel, Elahe A.; Russell, Kenneth J.; Liao, Jay J.; Konodi, Mark A.; Kurland, Brenda F.; Marck, Brett T.; Matsumoto, Alvin M.; Dalkin, Bruce L.; Montgomery, R. Bruce

    2015-06-01

    Purpose: Optimizing androgen suppression may provide better control of localized prostate cancer (PCa). Numerous trials have supported the benefit of combining androgen deprivation therapy with definitive radiation therapy in men with locally advanced or high-grade disease. Addition of abiraterone to luteinizing hormone-releasing hormone agonist (LHRHa) with radiation has not been reported. We examined the safety of this combination as well as its impact on androgen suppression. Methods and Materials: A prospective, phase 2 study was conducted in men with localized PCa treated with 6 months of neoadjuvant and concurrent abiraterone with LHRHa and radiation. Duration of adjuvant LHRHa was at the discretion of the treating clinician. Prostate biopsy assays were obtained prior to the start of therapy and prior to radiation. Sera and tissue androgen levels were measured by liquid chromatography-tandem mass spectrometry. Results: A total of 22 men with intermediate- (n=3) and high-risk PCa (n=19) received study therapy. Sixteen men completed the intended course of abiraterone, and 19 men completed planned radiation to 77.4 to 81 Gy. Radiation to pelvic nodes was administered in 20 men. The following grade 3 toxicities were reported: lymphopenia (14 patients), fatigue (1 patient), transaminitis (2 patients), hypertension (2 patients), and hypokalemia (1 patient). There were no grade 4 toxicities. All 21 men who complied with at least 3 months of abiraterone therapy had a preradiation prostate-specific antigen (PSA) concentration nadir of <0.3 ng/mL. Median levels of tissue androgen downstream of CYP17A were significantly suppressed after treatment with abiraterone, and upstream steroids were increased. At median follow-up of 21 months (range: 3-37 months), only 1 patient (who had discontinued abiraterone at 3 months) had biochemical relapse. Conclusions: Addition of abiraterone to LHRHa with radiation is safe and achieves effective prostatic androgen suppression

  16. Predicting DNA methylation level across human tissues

    PubMed Central

    Ma, Baoshan; Wilker, Elissa H.; Willis-Owen, Saffron A. G.; Byun, Hyang-Min; Wong, Kenny C. C.; Motta, Valeria; Baccarelli, Andrea A.; Schwartz, Joel; Cookson, William O. C. M.; Khabbaz, Kamal; Mittleman, Murray A.; Moffatt, Miriam F.; Liang, Liming

    2014-01-01

    Differences in methylation across tissues are critical to cell differentiation and are key to understanding the role of epigenetics in complex diseases. In this investigation, we found that locus-specific methylation differences between tissues are highly consistent across individuals. We developed a novel statistical model to predict locus-specific methylation in target tissue based on methylation in surrogate tissue. The method was evaluated in publicly available data and in two studies using the latest IlluminaBeadChips: a childhood asthma study with methylation measured in both peripheral blood leukocytes (PBL) and lymphoblastoid cell lines; and a study of postoperative atrial fibrillation with methylation in PBL, atrium and artery. We found that our method can greatly improve accuracy of cross-tissue prediction at CpG sites that are variable in the target tissue [R2 increases from 0.38 (original R2 between tissues) to 0.89 for PBL-to-artery prediction; from 0.39 to 0.95 for PBL-to-atrium; and from 0.81 to 0.98 for lymphoblastoid cell line-to-PBL based on cross-validation, and confirmed using cross-study prediction]. An extended model with multiple CpGs further improved performance. Our results suggest that large-scale epidemiology studies using easy-to-access surrogate tissues (e.g. blood) could be recalibrated to improve understanding of epigenetics in hard-to-access tissues (e.g. atrium) and might enable non-invasive disease screening using epigenetic profiles. PMID:24445802

  17. Predicting DNA methylation level across human tissues.

    PubMed

    Ma, Baoshan; Wilker, Elissa H; Willis-Owen, Saffron A G; Byun, Hyang-Min; Wong, Kenny C C; Motta, Valeria; Baccarelli, Andrea A; Schwartz, Joel; Cookson, William O C M; Khabbaz, Kamal; Mittleman, Murray A; Moffatt, Miriam F; Liang, Liming

    2014-04-01

    Differences in methylation across tissues are critical to cell differentiation and are key to understanding the role of epigenetics in complex diseases. In this investigation, we found that locus-specific methylation differences between tissues are highly consistent across individuals. We developed a novel statistical model to predict locus-specific methylation in target tissue based on methylation in surrogate tissue. The method was evaluated in publicly available data and in two studies using the latest IlluminaBeadChips: a childhood asthma study with methylation measured in both peripheral blood leukocytes (PBL) and lymphoblastoid cell lines; and a study of postoperative atrial fibrillation with methylation in PBL, atrium and artery. We found that our method can greatly improve accuracy of cross-tissue prediction at CpG sites that are variable in the target tissue [R(2) increases from 0.38 (original R(2) between tissues) to 0.89 for PBL-to-artery prediction; from 0.39 to 0.95 for PBL-to-atrium; and from 0.81 to 0.98 for lymphoblastoid cell line-to-PBL based on cross-validation, and confirmed using cross-study prediction]. An extended model with multiple CpGs further improved performance. Our results suggest that large-scale epidemiology studies using easy-to-access surrogate tissues (e.g. blood) could be recalibrated to improve understanding of epigenetics in hard-to-access tissues (e.g. atrium) and might enable non-invasive disease screening using epigenetic profiles. PMID:24445802

  18. Influence of lycopene on cell viability, cell cycle, and apoptosis of human prostate cancer and benign hyperplastic cells.

    PubMed

    Soares, Nathalia da Costa Pereira; Teodoro, Anderson Junger; Oliveira, Felipe Leite; Santos, Carlos Antonio do Nascimento; Takiya, Christina Maeda; Junior, Oswaldo Saback; Bianco, Mario; Junior, Antonio Palumbo; Nasciutti, Luiz Eurico; Ferreira, Luciana Bueno; Gimba, Etel Rodrigues Pereira; Borojevic, Radovan

    2013-01-01

    Prostate cancer is the most common malignancy in men and the second leading cause of cancer-related mortality in men of the Western world. Lycopene has received attention because of its expcted potential to prevent cancer. In the present study, we evaluated the influence of lycopene on cell viability, cell cycle, and apoptosis of human prostate cancer cells and benign prostate hyperplastic cells. Using MTT assay, we observed a decrease of cell viability in all cancer cell lines after treatment with lycopene, which decreased the percentage of cells in G0/G1 phase and increased in S and G2/M phases after 96 h of treatment in metastatic prostate cancer cell lineages. Flow citometry analysis of cell cycle revealed lycopene promoted cell cycle arrest in G0/G1 phase after 48 and 96 h of treatment in a primary cancer cell line. Using real time PCR assay, lycopene also induced apoptosis in prostate cancer cells with altered gene expression of Bax and Bcl-2. No effect was observed in benign prostate hyperplasia cells. These results suggest an effect of lycopene on activity of human prostate cancer cells. PMID:24053141

  19. Lectin-Like Oxidized LDL Receptor-1 Is an Enhancer of Tumor Angiogenesis in Human Prostate Cancer Cells

    PubMed Central

    González-Chavarría, Iván; Cerro, Rita P.; Parra, Natalie P.; Sandoval, Felipe A.; Zuñiga, Felipe A.; Omazábal, Valeska A.; Lamperti, Liliana I.; Jiménez, Silvana P.; Fernandez, Edelmira A.; Gutiérrez, Nicolas A.; Rodriguez, Federico S.; Onate, Sergio A.; Sánchez, Oliberto; Vera, Juan C.; Toledo, Jorge R.

    2014-01-01

    Altered expression and function of lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1) has been associated with several diseases such as endothelial dysfunction, atherosclerosis and obesity. In these pathologies, oxLDL/LOX-1 activates signaling pathways that promote cell proliferation, cell motility and angiogenesis. Recent studies have indicated that olr1 mRNA is over-expressed in stage III and IV of human prostatic adenocarcinomas. However, the function of LOX-1 in prostate cancer angiogenesis remains to be determined. Our aim was to analyze the contribution of oxLDL and LOX-1 to tumor angiogenesis using C4-2 prostate cancer cells. We analyzed the expression of pro-angiogenic molecules and angiogenesis on prostate cancer tumor xenografts, using prostate cancer cell models with overexpression or knockdown of LOX-1 receptor. Our results demonstrate that the activation of LOX-1 using oxLDL increases cell proliferation, and the expression of the pro-angiogenic molecules VEGF, MMP-2, and MMP-9 in a dose-dependent manner. Noticeably, these effects were prevented in the C4-2 prostate cancer model when LOX-1 expression was knocked down. The angiogenic effect of LOX-1 activated with oxLDL was further demonstrated using the aortic ring assay and the xenograft model of tumor growth on chorioallantoic membrane of chicken embryos. Consequently, we propose that LOX-1 activation by oxLDL is an important event that enhances tumor angiogenesis in human prostate cancer cells. PMID:25170920

  20. Single luminal epithelial progenitors can generate prostate organoids in culture

    PubMed Central

    Chua, Chee Wai; Shibata, Maho; Lei, Ming; Toivanen, Roxanne; Barlow, LaMont J.; Bergren, Sarah K.; Badani, Ketan K.; McKiernan, James M.; Benson, Mitchell C.; Hibshoosh, Hanina; Shen, Michael M.

    2014-01-01

    The intrinsic ability to display self-organizing morphogenetic properties in ex vivo culture may represent a general property of tissue stem cells. Here we show that single luminal stem/progenitor cells can generate prostate organoids in a three-dimensional culture system in the absence of stroma. Organoids generated from CARNs (castration-resistant Nkx3.1-expressing cells) or normal prostate epithelium exhibit tissue architecture containing luminal and basal cells, undergo long-term expansion in culture, and display functional androgen receptor signaling. Lineage-tracing demonstrates that luminal cells are favored for organoid formation, and generate basal cells in culture. Furthermore, tumor organoids can initiate from CARNs after oncogenic transformation, and from mouse models of prostate cancer, and can facilitate analyses of drug response. Finally, we provide evidence supporting the feasibility of organoid studies of human prostate tissue. Our studies underscore the progenitor properties of luminal cells, and identify in vitro approaches for studying prostate biology. PMID:25241035

  1. The evaluation of tissue mass loss in the incision line of prostate with benign hyperplasia performed using holmium laser and cutting electrode

    PubMed Central

    Szewczyk, Mariusz; Jesionek–Kupnicka, Dorota; Lipinski, Piotr; Różański, Waldemar

    2014-01-01

    Introduction The aim of this study is to compare the changes in the incision line of prostatic adenoma using a monopolar cutting electrode and holmium laser, as well as the assessment of associated tissue mass and volume loss of benign prostatic hyperplasia (BPH). Material and methods The material used in this study consisted of 74 preparations of prostatic adenoma obtained via open retropubic adenomectomy, with an average volume of 120.7 ml. The material obtained cut in vitro before fixation in formaldehyde. One lobe was cut using holmium laser, the other using a monopolar cutting electrode. After the incision was made, tissue mass and volume loss were evaluated. Thermocoagulation changes in the incision line were examinedunder light microscope. Results In the case of the holmium laser incision, the average tissue mass loss was 1.73 g, tissue volume loss 3.57 ml and the depth of thermocoagulation was 1.17 mm. When the monopolar cutting electrode was used average tissue mass loss was 0.807 g, tissue volume loss 2.48 ml and the depth of thermocoagulation was 0.19 mm. Conclusions Where holmium laser was used, it was observed that the layer of tissue with thermocoagulation changes was deeper than in the case of the monopolar cutting electrode. Moreover, it was noticed that holmium laser caused bigger tissue mass and volume loss than the cutting electrode. PMID:25247088

  2. Cadmium Induces p53-Dependent Apoptosis in Human Prostate Epithelial Cells

    PubMed Central

    Aimola, Pierpaolo; Carmignani, Marco; Volpe, Anna Rita; Di Benedetto, Altomare; Claudio, Luigi; Waalkes, Michael P.; van Bokhoven, Adrie; Tokar, Erik J.; Claudio, Pier Paolo

    2012-01-01

    Cadmium, a widespread toxic pollutant of occupational and environmental concern, is a known human carcinogen. The prostate is a potential target for cadmium carcinogenesis, although the underlying mechanisms are still unclear. Furthermore, cadmium may induce cell death by apoptosis in various cell types, and it has been hypothesized that a key factor in cadmium-induced malignant transformation is acquisition of apoptotic resistance. We investigated the in vitro effects produced by cadmium exposure in normal or tumor cells derived from human prostate epithelium, including RWPE-1 and its cadmium-transformed derivative CTPE, the primary adenocarcinoma 22Rv1 and CWR-R1 cells and LNCaP, PC-3 and DU145 metastatic cancer cell lines. Cells were treated for 24 hours with different concentrations of CdCl2 and apoptosis, cell cycle distribution and expression of tumor suppressor proteins were analyzed. Subsequently, cellular response to cadmium was evaluated after siRNA-mediated p53 silencing in wild type p53-expressing RWPE-1 and LNCaP cells, and after adenoviral p53 overexpression in p53-deficient DU145 and PC-3 cell lines. The cell lines exhibited different sensitivity to cadmium, and 24-hour exposure to different CdCl2 concentrations induced dose- and cell type-dependent apoptotic response and inhibition of cell proliferation that correlated with accumulation of functional p53 and overexpression of p21 in wild type p53-expressing cell lines. On the other hand, p53 silencing was able to suppress cadmium-induced apoptosis. Our results demonstrate that cadmium can induce p53-dependent apoptosis in human prostate epithelial cells and suggest p53 mutation as a possible contributing factor for the acquisition of apoptotic resistance in cadmium prostatic carcinogenesis. PMID:22448262

  3. Vaccine Therapy and Pembrolizumab in Treating Patients With Hormone-Resistant, Metastatic Prostate Cancer

    ClinicalTrials.gov

    2016-06-22

    Hormone-Resistant Prostate Cancer; Metastatic Malignant Neoplasm in the Bone; Metastatic Malignant Neoplasm in the Soft Tissues; Metastatic Prostate Carcinoma; Prostate Adenocarcinoma; Recurrent Prostate Carcinoma; Stage IV Prostate Cancer

  4. Alpha-Methylacyl-CoA Racemase Spliced Variants and their Expression in Normal and Malignant Prostate Tissues

    PubMed Central

    Ouyang, Bin; Leung, Yuet-Kin; Wang, Vinson; Chung, Ethan; Levin, Linda; Bracken, Bruce; Cheng, Liang; Ho, Shuk-Mei

    2010-01-01

    OBJECTIVES Alpha-methylacyl-CoA racemase (AMACR) has been used as a diagnostic biomarker for prostate cancer (CaP) and is now a standard biomarker for needle biopsy specimens with ambiguous lesions. In this study, we evaluate the possibility of using AMACR variants to improve the specificity of CaP detection. METHODS We used in silico analysis and molecular cloning to discover new AMACR variants and quantitative RT-PCR to measure the transcript levels of AMACR and its variants in four prostate cell lines and 23 pairs of CaP and adjacent normal tissue. RESULTS We found four novel variants, IAs, IBL, IBLd, and IBLi. Transcript levels of the majority of AMACR variants were significantly upregulated in CaP as compared with its adjacent normal counterparts. A variants, the functional variants based on bioinformatic analysis, showed levels of transcript expression in CaP in this order: IA≫IAd=IIA≫IIAs>IAs. In contrast, the expression of the B variants, which appear to be nonfunctional due to the absence of exon 3, was lower than that of the A variants. IB was the most abundant form of B variant; and expression of IIB was negligible. More important, the difference between levels of variant IA, IAd, IIA, IIAs, IB, and IBLi in CaP and normal tissue was significantly higher than the difference in levels of total AMACR. CONCLUSIONS Our data suggest that AMACR variants have better power than total AMACR in discriminating between CaP and adjacent normal tissue. These findings may be useful for the development of future diagnostic assays. PMID:21195844

  5. Characterization of a Gene Expression Signature in Normal Rat Prostate Tissue Induced by the Presence of a Tumor Elsewhere in the Organ

    PubMed Central

    Adamo, Hanibal Hani; Halin Bergström, Sofia; Bergh, Anders

    2015-01-01

    Implantation of rat prostate cancer cells into the normal rat prostate results in tumor-stimulating changes in the tumor-bearing organ, for example growth of the vasculature, an altered extracellular matrix, and influx of inflammatory cells. To investigate this response further, we compared prostate morphology and the gene expression profile of tumor-bearing normal rat prostate tissue (termed tumor-instructed/indicating normal tissue (TINT)) with that of prostate tissue from controls. Dunning rat AT-1 prostate cancer cells were injected into rat prostate and tumors were established after 10 days. As controls we used intact animals, animals injected with heat-killed AT-1 cells or cell culture medium. None of the controls showed morphological TINT-changes. A rat Illumina whole-genome expression array was used to analyze gene expression in AT-1 tumors, TINT, and in medium injected prostate tissue. We identified 423 upregulated genes and 38 downregulated genes (p<0.05, ≥2-fold change) in TINT relative to controls. Quantitative RT-PCR analysis verified key TINT-changes, and they were not detected in controls. Expression of some genes was changed in a manner similar to that in the tumor, whereas other changes were exclusive to TINT. Ontological analysis using GeneGo software showed that the TINT gene expression profile was coupled to processes such as inflammation, immune response, and wounding. Many of the genes whose expression is altered in TINT have well-established roles in tumor biology, and the present findings indicate that they may also function by adapting the surrounding tumor-bearing organ to the needs of the tumor. Even though a minor tumor cell contamination in TINT samples cannot be ruled out, our data suggest that there are tumor-induced changes in gene expression in the normal tumor-bearing organ which can probably not be explained by tumor cell contamination. It is important to validate these changes further, as they could hypothetically serve as

  6. Bifunctional Phage-Based Pretargeted Imaging of Human Prostate Carcinoma Bifunctional Phage Based Pretargeted Imaging

    PubMed Central

    Newton-Northup, Jessica R.; Figueroa, Said D.; Quinn, Thomas P.; Deutscher, Susan L.

    2009-01-01

    Introduction Two-step and three-step pretargeting systems utilizing biotinylated prostate tumor-homing bacteriophage (phage) and 111In-radiolabeled- streptavidin or biotin were developed for use in cancer radioimaging. The in vivo selected prostate carcinoma-specific phage (G1) displaying up to five copies of the peptide IAGLATPGWSHWLAL, was the focus of the present study. Methods The ability of G1 phage to extravasate and target prostate tumor cells was investigated using immunohistochemistry. G1 phage were biotinylated, streptavidin was conjugated to diethylenetriaminepentaacetic acid (DTPA), and biotin was conjugated to 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA). Biodistribution studies and single photon emission computed tomography (SPECT)/CT imaging of xenografted PC-3 tumors via two-step pretargeted 111In-labeled streptavidin and three-step pretargeted 111In-labeled biotin were performed in SCID mice to determine the optimal pretargeting method. Results The ability of G1 phage to extravasate the vasculature and bind directly to human PC-3 prostate carcinoma tumor cells in vivo was demonstrated via immunocytochemical analysis. Comparative biodistribution studies of the two-step and three-step pretargeting strategies indicated increased PC-3 human prostate carcinoma tumor uptake in SCID mice of 4.34 ±0.26 %ID/g at 0.5 hours post-injection of 111In radiolabeled biotin (utilized in a three-step protocol) compared to that of 0.67 ±0.06 %ID/g at twenty four hour postinjection of 111In radiolabeled streptavidin (employed in a two-step protocol). In vivo SPECT/CT imaging of xenografted PC-3 tumors in SCID mice with the three-step pretargeting method was superior to that of the two-step pretargeting method, and, importantly, blocking studies demonstrated specificity of tumor uptake of 111In-labeled biotin in the three-step pretargeting scheme. Conclusion This study demonstrates the use of multivalent bifunctional phage in a three

  7. Extracts of various species of Epilobium inhibit proliferation of human prostate cells.

    PubMed

    Vitalone, Annabella; Guizzetti, Marina; Costa, Lucio G; Tita, Beatrice

    2003-05-01

    This study examined whether various species of Epilobium, a phytotherapeutic agent used in folk medicine as a treatment for benign prostatic hyperplasia, may have an antiproliferative effect in PZ-HPV-7 human prostatic epithelial cells in-vitro. The MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl-tetrazolium bromide) test, [methyl-(3)H]thymidine incorporation into DNA and flow cytometry analysis were used to evaluate cell proliferation. Ethanolic extracts of E. spicatum, E. rosmarinifolium and E. tetragonum inhibited DNA synthesis in PZ-HPV-7 cells. While at high concentrations all extracts were cytotoxic, DNA synthesis was also decreased at levels that caused no or little cytotoxicity. Treatment of cells with Epilobium extracts did not result in a formation of DNA fragments (evaluated by the TUNEL assay) or chromatin condensation (assessed by Hoechst staining). Flow cytometry analysis indicated that Epilobium extracts inhibit the progression of the cell cycle from the G(0)/G(1) phase. These results suggest that extracts of Epilobium inhibit proliferation of human PZ-HPV-7 cells in-vitro by affecting progression of the cell cycle. This study provides some initial biological plausibility for the use of Epilobium extracts in benign prostatic hyperplasia. PMID:12831512

  8. Decreased sensitivity to aspirin is associated with altered polyamine metabolism in human prostate cancer cells.

    PubMed

    Li, Jun; Cameron, Gary A; Wallace, Heather M

    2016-04-01

    Aspirin is a well-known analgesic, anti-inflammatory and antipyretic drug and is recognised as a chemopreventative agent in cardiovascular disease and, more recently, in colorectal cancer. Although several studies indicate that aspirin is capable of reducing the risk of developing cancers, there is a lack of convincing evidence that aspirin can prevent prostate cancer in man. In this study, aspirin was shown to be an effective inhibitor of the growth of human prostate cancer cells. In order to investigate the link between polyamine catabolism and the effects of aspirin we used a "Tet off" system that induced the activity of spermidine/spermine N (1)-acetyltransferase (SSAT) in human prostate cancer cells (LNCap). Treatment with aspirin was found to decrease induced SSAT activity in these cells. A negative correlation was observed between increased polyamine catabolism via increased SSAT activity and the sensitivity to aspirin. In the presence of increased SSAT activity high amounts of N (1)-acetylspermidine and putrescine were observed. These cells were also found to grow more slowly than the non-induced cells. The results indicate that SSAT and its related polyamine metabolism may play a key role in sensitivity of cancer cells to aspirin and possibly other NSAIDs and this may have implications for the development of novel chemopreventative agents. PMID:26704566

  9. Quantify Prostate Cancer by Automated Histomorphometry

    NASA Astrophysics Data System (ADS)

    Braumann, Ulf-Dietrich; Kuska, Jens-Peer; Löffler, Markus; Wernert, Nicolas

    A new method is presented to quantify malignant changes in histological sections of prostate tissue immunohistochemically stained for prostate-specific antigen (PSA) by means of image processing. The morphological analysis of the prostate tissue uses the solidity of PSA-positive prostate tissue segments to compute a quantitative measure that turns out highly correlated with scores obtained from routine diagnosis (Gleason, Dhom).

  10. The essential role of methylthioadenosine phosphorylase in prostate cancer

    PubMed Central

    Foster, Barbara A.; Karasik, Ellen; Gillard, Bryan; Morrison, Carl; Mohler, James; Phillips, James G.; Smiraglia, Dominic J.

    2016-01-01

    Prostatic epithelial cells secrete high levels of acetylated polyamines into the prostatic lumen. This distinctive characteristic places added strain on the connected pathways, which are forced to increase metabolite production to maintain pools. The methionine salvage pathway recycles the one-carbon unit lost to polyamine biosynthesis back to the methionine cycle, allowing for replenishment of SAM pools providing a mechanism to help mitigate metabolic stress associated with high flux through these pathways. The rate-limiting enzyme involved in this process is methylthioadenosine phosphorylase (MTAP), which, although commonly deleted in many cancers, is protected in prostate cancer. We report near universal retention of MTAP expression in a panel of human prostate cancer cell lines as well as patient samples. Upon metabolic perturbation, prostate cancer cell lines upregulate MTAP and this correlates with recovery of SAM levels. Furthermore, in a mouse model of prostate cancer we find that both normal prostate and diseased prostate maintain higher SAM levels than other tissues, even under increased metabolic stress. Finally, we show that knockdown of MTAP, both genetically and pharmacologically, blocks androgen sensitive prostate cancer growth in vivo. Our findings strongly suggest that the methionine salvage pathway is a major player in homeostatic regulation of metabolite pools in prostate cancer due to their high level of flux through the polyamine biosynthetic pathway. Therefore, this pathway, and specifically the MTAP enzyme, is an attractive therapeutic target for prostate cancer. PMID:26910893

  11. Completely Humanizing Prolactin Rescues Infertility in Prolactin Knockout Mice and Leads to Human Prolactin Expression in Extrapituitary Mouse Tissues

    PubMed Central

    Christensen, Heather R.; Murawsky, Michael K.; Horseman, Nelson D.; Willson, Tara A.

    2013-01-01

    A variety of fundamental differences have evolved in the physiology of the human and rodent prolactin (PRL) systems. The PRL gene in humans and other primates contains an alternative promoter, 5.8 kbp upstream of the pituitary transcription start site, which drives expression of PRL in “extrapituitary” tissues, where PRL is believed to exert local, or paracrine, actions. Several of these extrapituitary PRL tissues serve a reproductive function (eg, mammary gland, decidua, prostate, etc), consistent with the hypothesis that local PRL production may be involved in, and required for, normal reproductive physiology in primates. Rodent research models have generated significant findings regarding the role of PRL in reproduction. Specifically, disruption (knockout) of either the PRL gene or its receptor causes profound female reproductive defects at several levels (ovaries, preimplantation endometrium, mammary glands). However, the rodent PRL gene differs significantly from the human, most notably lacking the alternative promoter. Understanding of the physiological regulation and function of extrapituitary PRL has been limited by the absence of a readily accessible experimental model, because the rodent PRL gene does not contain the alternative promoter. To overcome these limitations, we have generated mice that have been “humanized” with regard to the structural gene and tissue expression of PRL. Here, we present the characterization of these animals, demonstrating that the human PRL transgene is responsive to known physiological regulators both in vitro and in vivo. More importantly, the expression of the human PRL transgene is able to rescue the reproductive defects observed in mouse PRL knockout (mPRL−) females, validating their usefulness in studying the function or regulation of this hormone in a manner that is relevant to human physiology. PMID:24029242

  12. Tissue temperature control using a water-cooled applicator: implications for transurethral laser-induced thermotherapy of benign prostatic hyperplasia.

    PubMed

    Sturesson, C; Andersson-Engels, S

    1997-03-01

    A prototype to a water-cooled applicator to be used in transurethral laser-induced thermotherapy of benign prostatic hyperplasia was developed. The flexible applicator was made of Teflon tubes except for the distal outer part which was made of glass, providing a transparent medium for laser radiation and enabling efficient cooling of the surrounding tissue. For heating, laser light from a Nd:YAG laser emitting at 1064 nm, which was coupled into an optical fiber with an institutionally made diffusing tip, was used. Cooling was performed by flushing water through the applicator. By using a mathematical model it was possible to connect the temperature rise of the water in the applicator to the maximum tissue temperature. Tissue light absorption was calculated using Monte Carlo simulations and the heat conduction equation was solved numerically using a finite-difference technique. Experiments on porcine liver in vitro showed that the maximum tissue temperature could be estimated with an average accuracy of 0.4 degree C by measuring the difference in outlet and inlet applicator water temperature and using the thermal model. The results presented suggest that the described method for temperature control can be used during laser prostatectomy to maximize the lesion size while preventing carbonization. PMID:9089598

  13. Biomarker Discovery in Human Prostate Cancer: an Update in Metabolomics Studies.

    PubMed

    Lima, Ana Rita; Bastos, Maria de Lourdes; Carvalho, Márcia; Guedes de Pinho, Paula

    2016-08-01

    Prostate cancer (PCa) is the most frequently diagnosed cancer and the second leading cause of cancer death among men in Western countries. Current screening techniques are based on the measurement of serum prostate specific antigen (PSA) levels and digital rectal examination. A decisive diagnosis of PCa is based on prostate biopsies; however, this approach can lead to false-positive and false-negative results. Therefore, it is important to discover new biomarkers for the diagnosis of PCa, preferably noninvasive ones. Metabolomics is an approach that allows the analysis of the entire metabolic profile of a biological system. As neoplastic cells have a unique metabolic phenotype related to cancer development and progression, the identification of dysfunctional metabolic pathways using metabolomics can be used to discover cancer biomarkers and therapeutic targets. In this study, we review several metabolomics studies performed in prostatic fluid, blood plasma/serum, urine, tissues and immortalized cultured cell lines with the objective of discovering alterations in the metabolic phenotype of PCa and thus discovering new biomarkers for the diagnosis of PCa. Encouraging results using metabolomics have been reported for PCa, with sarcosine being one of the most promising biomarkers identified to date. However, the use of sarcosine as a PCa biomarker in the clinic remains a controversial issue within the scientific community. Beyond sarcosine, other metabolites are considered to be biomarkers for PCa, but they still need clinical validation. Despite the lack of metabolomics biomarkers reaching clinical practice, metabolomics proved to be a powerful tool in the discovery of new biomarkers for PCa detection. PMID:27567960

  14. First approach to studies of sulphur electron DOS in prostate cancer cell lines and tissues studied by XANES

    NASA Astrophysics Data System (ADS)

    Kwiatek, Wojciech M.; Czapla, Joanna; Podgórczyk, Magdalena; Kisiel, Andrzej; Konior, Jerzy; Balerna, Antonella

    2011-10-01

    Urological cancers comprise approximately one-third of all cancers diagnosed in men worldwide and out of these, prostate cancer is the most common one ( WHO World Cancer Report, 2008). Several risk factors such as age, hormone levels, environmental conditions and family history are suspected to play a role in the onset of this disease of otherwise obscure aetiology. It is therefore the medical need that drives multidisciplinary research in this field, carried out by means of various experimental and theoretical techniques. Out of many relevant factors, it is believed that sulphur can take an important part in cancer transformations. We have investigated the prostate cancer cell lines and tissues, along with selected organic and inorganic compounds used as references, by the X-ray absorption fine structure spectroscopy near the sulphur edge energy region. Particularly, the comparison of the experimental results collected during XANES measurements and theoretical calculations of electron density of states with use of the FEFF8 code and LAPW (linearised augmented plane-wave) method has been performed and in this work the first results of our studies are presented.

  15. Clinical validation of candidate genes associated with prostate cancer progression in the CWR22 model system using tissue microarrays.

    PubMed

    Mousses, Spyro; Bubendorf, Lukas; Wagner, Urs; Hostetter, Galen; Kononen, Juha; Cornelison, Robert; Goldberger, Natalie; Elkahloun, Abdel G; Willi, Niels; Koivisto, Pasi; Ferhle, William; Raffeld, Mark; Sauter, Guito; Kallioniemi, Olli-P

    2002-03-01

    To explore molecular mechanisms of prostate cancer progression, we applied tissue microarrays (TMAs) to analyze expression of candidate gene targets discovered by cDNA microarray analysis of the CWR22 xenograft model system. A TMA with 544 clinical specimens from different stages of disease progression was probed by mRNA in situ hybridization and protein immunohistochemistry. There was an excellent correlation (r = 0.96; n = 16) between the expression levels of the genes in the xenografts by cDNA microarray and mRNA in situ hybridization on a TMA. One of the most highly overexpressed genes in hormone-refractory CWR22R xenografts was the S100P gene. This gene, coding for a calcium signaling molecule implicated in the loss of senescence, was also significantly associated with progression in clinical tumors by TMA analysis (P < 0.001), suggesting dysregulation of this pathway in hormone-refractory and metastatic prostate cancers. Conversely, two genes that were down-regulated during tumor progression in the CWR22 model system were validated in vivo: crystallin mu (CRYM) and a LIM-domain protein LMO4 both showed significantly lower mRNA levels in hormone-refractory tumors as compared with primary tumors (P < 0.001). These results illustrate a strategy for rapid clinical validation at the mRNA and protein level of gene targets found to be differentially expressed in cDNA microarray experiments of model systems of cancer. PMID:11888886

  16. Depth-resolved fluorescence of human ectocervical tissue

    NASA Astrophysics Data System (ADS)

    Wu, Yicong; Xi, Peng; Cheung, Tak-Hong; Yim, So Fan; Yu, Mei-Yung; Qu, Jianan Y.

    2005-04-01

    The depth-resolved autofluorescence of normal and dysplastic human ectocervical tissue within 120um depth were investigated utilizing a portable confocal fluorescence spectroscopy with the excitations at 355nm and 457nm. From the topmost keratinizing layer of all ectocervical tissue samples, strong keratin fluorescence with the spectral characteristics similar to collagen was observed, which created serious interference in seeking the correlation between tissue fluorescence and tissue pathology. While from the underlying non-keratinizing epithelial layer, the measured NADH fluorescence induced by 355nm excitation and FAD fluorescence induced by 457nm excitation were strongly correlated to the tissue pathology. The ratios between NADH over FAD fluorescence increased statistically in the CIN epithelial relative to the normal and HPV epithelia, which indicated increased metabolic activity in precancerous tissue. This study demonstrates that the depth-resolved fluorescence spectroscopy can reveal fine structural information on epithelial tissue and potentially provide more accurate diagnostic information for determining tissue pathology.

  17. Analysis of human breast tissues with Raman microspectroscopy

    NASA Astrophysics Data System (ADS)

    Liu, Gang; Zhang, Lin; Liu, Jianhong; Yu, Fan; Sun, Shizhong

    2006-01-01

    Raman microspectroscopy was used to study normal, benign and malignant human breast tissues. The Raman spectrum of normal breast tissue recorded with 514.5 nm line of Ar + laser excitation contains features attributed to carotenoids and lipids. The CH II bending mode near 1447 cm -1 in normal tissue shifts up to 1454 cm -1 in diseased tissues (benign and malignant). The band near 1660 cm -1 in normal tissue is narrow and sharp; whereas the band is broaden in the diseased tissues. In the region of C-H stretching mode, the 2902-/2860-cm -1 intensity ratio shows differences among normal, benign and malignant breast tissues. The ratio is the smallest in carcinoma tissue. The observed spectra differences may be used to probe breast lesion. The results show that Raman spectroscopic technique may have clinical applications.

  18. Fatty acid regulates gene expression and growth of human prostate cancer PC-3 cells

    NASA Technical Reports Server (NTRS)

    Hughes-Fulford, M.; Chen, Y.; Tjandrawinata, R. R.

    2001-01-01

    It has been proposed that the omega-6 fatty acids increase the rate of tumor growth. Here we test that hypothesis in the PC-3 human prostate tumor. We found that the essential fatty acids, linoleic acid (LA) and arachidonic acid (AA), and the AA metabolite PGE(2) stimulate tumor growth while oleic acid (OA) and the omega-3 fatty acid, eicosapentaenoic acid (EPA) inhibited growth. In examining the role of AA in growth response, we extended our studies to analyze changes in early gene expression induced by AA. We demonstrate that c-fos expression is increased within minutes of addition in a dose-dependent manner. Moreover, the immediate early gene cox-2 is also increased in the presence of AA in a dose-dependent manner, while the constitutive cox-1 message was not increased. Three hours after exposure to AA, the synthesis of PGE(2) via COX-2 was also increased. Previous studies have demonstrated that AA was primarily delivered by low density lipoprotein (LDL) via its receptor (LDLr). Since it is known that hepatomas, acute myelogenous leukemia and colorectal tumors lack normal cholesterol feedback, we examined the role of the LDLr in growth regulation of the PC-3 prostate cancer cells. Analysis of ldlr mRNA expression and LDLr function demonstrated that human PC-3 prostate cancer cells lack normal feedback regulation. While exogenous LDL caused a significant stimulation of cell growth and PGE(2) synthesis, no change was seen in regulation of the LDLr by LDL. Taken together, these data show that normal cholesterol feedback of ldlr message and protein is lost in prostate cancer. These data suggest that unregulated over-expression of LDLr in tumor cells would permit increased availability of AA, which induces immediate early genes c-fos and cox-2 within minutes of uptake.

  19. Identification of progesterone receptor in human subcutaneous adipose tissue.

    PubMed

    O'Brien, S N; Welter, B H; Mantzke, K A; Price, T M

    1998-02-01

    Sex steroids are postulated to play a role in adipose tissue regulation and distribution, because the amount and location of adipose tissue changes during puberty and menopause. Because of the nature of adipose tissue, receptors for the female sex steroids have been difficult to demonstrate. To date, estrogen receptor messenger RNA and protein have been identified in human subcutaneous adipose tissue, but the presence of progesterone receptor (PR) has not been reported. In this study, we demonstrate PR message by Northern blot analysis in RNA isolated from the abdominal subcutaneous adipose tissue of premenopausal women. These preliminary studies revealed that PR messenger RNA levels are higher in the stromal-vascular fraction as opposed to the adipocyte fraction. Western blot analysis demonstrates both PR protein isoforms (human PR-A and human PR-B) in human subcutaneous adipose tissue. Using an enzyme-linked immunosorbent assay, total PR could be quantitated. These studies substantiate that sex steroid receptors are present in human adipose tissue, thereby providing a direct route for regulation of adipose tissue by female sex steroids. PMID:9467566

  20. Intraprostatic injection of botulinum toxin type- A relieves bladder outlet obstruction in human and induces prostate apoptosis in dogs

    PubMed Central

    Chuang, Yao-Chi; Tu, Chieh-Hsien; Huang, Chao-Cheng; Lin, Hsin-Ju; Chiang, Po-Hui; Yoshimura, Naoki; Chancellor, Michael B

    2006-01-01

    Background With the increasing interest with botulinum toxin – A (BTX-A) application in the lower urinary tract, we investigated the BTX-A effects on the canine prostate and also in men with bladder outlet obstruction (BOO) due to benign prostatic hyperplasia (BPH). Methods Transperineal injection into the prostate using transrectal ultrasound (TRUS) was performed throughout the study. Saline with or without 100 U of BTX-A was injected into mongrel dogs prostate. One or 3 months later, the prostate was harvested for morphologic and apoptotic study. In addition, eight BPH patients refractory to α-blockers were treated with ultrasound guided intraprostatic injection of 200 U of BTX-A. Results In the BTX-A treated dogs, atrophy and diffuse apoptosis was observed with H&E stain and TUNEL stain at 1 and 3 months. Clinically, the mean prostate volume, symptom score, and quality of life index were significantly reduced by 18.8%, 73.1%, and 61.5% respectively. Maximal flow rate significantly increased by 72.0%. Conclusion Intraprostatic BTX-A injection induces prostate apotosis in dogs and relieves BOO in humans. It is therefore a promising alternative treatment for refractory BOO due to BPH. PMID:16620393

  1. Three-Dimensionally Engineered Normal Human Lung Tissue-Like Assemblies: Target Tissues for Human Respiratory Viral Infections

    NASA Technical Reports Server (NTRS)

    Goodwin, Thomas J.; McCarthy, M.; Lin, Y-H.; Deatly, A. M.

    2008-01-01

    In vitro three-dimensional (3D) human lung epithelio-mesenchymal tissue-like assemblies (3D hLEM TLAs) from this point forward referred to as TLAs were engineered in Rotating Wall Vessel (RWV) technology to mimic the characteristics of in vivo tissues thus providing a tool to study human respiratory viruses and host cell interactions. The TLAs were bioengineered onto collagen-coated cyclodextran microcarriers using primary human mesenchymal bronchial-tracheal cells (HBTC) as the foundation matrix and an adult human bronchial epithelial immortalized cell line (BEAS-2B) as the overlying component. The resulting TLAs share significant characteristics with in vivo human respiratory epithelium including polarization, tight junctions, desmosomes, and microvilli. The presence of tissue-like differentiation markers including villin, keratins, and specific lung epithelium markers, as well as the production of tissue mucin, further confirm these TLAs differentiated into tissues functionally similar to in vivo tissues. Increasing virus titers for human respiratory syncytial virus (wtRSVA2) and the detection of membrane bound glycoproteins over time confirm productive infection with the virus. Therefore, we assert TLAs mimic aspects of the human respiratory epithelium and provide a unique capability to study the interactions of respiratory viruses and their primary target tissue independent of the host s immune system.

  2. Three-Dimensionally Engineered Normal Human Broncho-epithelial Tissue-Like Assemblies: Target Tissues for Human Respiratory Viral Infections

    NASA Technical Reports Server (NTRS)

    Goodwin, T. J.; McCarthy, M.; Lin, Y-H

    2006-01-01

    In vitro three-dimensional (3D) human broncho-epithelial (HBE) tissue-like assemblies (3D HBE TLAs) from this point forward referred to as TLAs were engineered in Rotating Wall Vessel (RWV) technology to mimic the characteristics of in vivo tissues thus providing a tool to study human respiratory viruses and host cell interactions. The TLAs were bioengineered onto collagen-coated cyclodextran microcarriers using primary human mesenchymal bronchial-tracheal cells (HBTC) as the foundation matrix and an adult human bronchial epithelial immortalized cell line (BEAS-2B) as the overlying component. The resulting TLAs share significant characteristics with in vivo human respiratory epithelium including polarization, tight junctions, desmosomes, and microvilli. The presence of tissue-like differentiation markers including villin, keratins, and specific lung epithelium markers, as well as the production of tissue mucin, further confirm these TLAs differentiated into tissues functionally similar to in vivo tissues. Increasing virus titers for human respiratory syncytial virus (wtRSVA2) and parainfluenza virus type 3 (wtPIV3 JS) and the detection of membrane bound glycoproteins over time confirm productive infections with both viruses. Therefore, TLAs mimic aspects of the human respiratory epithelium and provide a unique capability to study the interactions of respiratory viruses and their primary target tissue independent of the host's immune system.

  3. National Human Adipose Tissue Survey (Nhats)

    EPA Science Inventory

    Background:

    The U.S. Environmental Protection Agency (EPA)'s National Human Monitoring Program (NHMP), established by the U.S. Public Health Service in 1967, used an exposure-based approach to assess human exposure to toxic substances. Its primary component was the Natio...

  4. Circulating testosterone and prostate-specific antigen in nipple aspirate fluid and tissue are associated with breast cancer.

    PubMed Central

    Sauter, Edward R; Tichansky, David S; Chervoneva, Inna; Diamandis, Eleftherios P

    2002-01-01

    Preliminary evidence has associated testosterone and prostate-specific antigen (PSA) with breast cancer. Our objective was to determine whether a) testosterone levels in nipple aspirate fluid (NAF), serum, or breast tissue are associated with breast cancer; b) testosterone levels in serum are associated with levels in NAF; c) PSA in NAF, serum, or breast tissue is associated with breast cancer; and d) serum PSA is associated with NAF PSA levels. We obtained 342 NAF specimens from 171 women by means of a modified breast pump. Additionally, we collected 201 blood samples from 99 women and 51 tissue samples from 41 subjects who underwent surgical resection for suspected disease. Women currently using birth control pills or hormone replacement therapy were excluded from the study. Controlling for age and menopausal status, serum testosterone was significantly increased in women with breast cancer (p = 0.002). NAF and serum testosterone levels were not associated. Neither NAF nor tissue testosterone was associated with breast cancer. Controlling for menopausal status and age, NAF PSA was significantly decreased in women with breast cancer (p < 0.001). We did not find serum PSA to be associated with breast cancer, although we found an indication that, in postmenopausal women, its levels were lower in women with cancer. Serum PSA was associated with NAF PSA in postmenopausal women (p < 0.001). PSA levels in cancerous tissue were significantly lower than in benign breast specimens from subjects without cancer (p = 0.011), whereas levels of PSA in histologically benign specimens from subjects with cancer were intermediate. Our results suggest that serum testosterone is increased and NAF PSA is decreased in women with breast cancer, with PSA expression being higher in normal than in cancerous breast tissues. NAF and serum PSA levels in postmenopausal women are correlated, suggesting that as laboratory assessment of PSA becomes more sensitive, serum PSA may become useful in

  5. Banking of fresh-frozen prostate tissue using the alternate mirror image protocol: methods, validation, and impact on the pathological prognostic parameters in radical prostatectomy.

    PubMed

    Brimo, Fadi; Sircar, Kanishka; Chevalier, Simone; Saad, Fred; Lacombe, Louis; Têtu, Bernard; Scarlata, Eleanora; Aprikian, Armen

    2012-12-01

    We evaluated the value of the 'alternative slices mirror image method' used in prostate tissue banking in terms of predicting the sampling of cancerous tissue while preserving the pathological prognostic information. The concordance of diagnosis between banked sections and their mirror image paraffin- sections was studied using 50 cases corresponding to 400 H&E sections taken from 400 banked frozen blocks (two presumed benign and two presumed cancer for each case). The mean number of paraffin blocks in each case was 21. On average 29% of the prostate gland was banked and banked tissue contained cancer in 47 cases (94%). There was no difference between the concordant and discordant groups in terms of the final Gleason score, pathological stage, prostate size, number of banked blocks and the percentage of the prostate submitted for banking. However, concordant cases had larger foci of cancer in the mirror image paraffin block (P = 0.0088). In addition, the surgical margins sections which are not banked using this method provided important information about the pathological stage, surgical margins status and the final Gleason score in 2.6, 2.6, and 1.3% of cases, respectively. The 'alternative slices mirror image method' is a straightforward method that is highly efficient in banking prostatic cancerous tissue. Overall, tumor volume and especially size of tumor foci in the image paraffin block are the most important factors in dictating the success rate of banking frozen cancerous tissue. Including 'surgical margins' sections for histology provides additional important prognostic information in a minority of cases. PMID:22200970

  6. Bovine Leukemia Virus DNA in Human Breast Tissue

    PubMed Central

    Shen, Hua Min; Jensen, Hanne M.; Choi, K. Yeon; Sun, Dejun; Nuovo, Gerard

    2014-01-01

    Bovine leukemia virus (BLV), a deltaretrovirus, causes B-cell leukemia/lymphoma in cattle and is prevalent in herds globally. A previous finding of antibodies against BLV in humans led us to examine the possibility of human infection with BLV. We focused on breast tissue because, in cattle, BLV DNA and protein have been found to be more abundant in mammary epithelium than in lymphocytes. In human breast tissue specimens, we identified BLV DNA by using nested liquid-phase PCR and DNA sequencing. Variations from the bovine reference sequence were infrequent and limited to base substitutions. In situ PCR and immunohistochemical testing localized BLV to the secretory epithelium of the breast. Our finding of BLV in human tissues indicates a risk for the acquisition and proliferation of this virus in humans. Further research is needed to determine whether BLV may play a direct role in human disease. PMID:24750974

  7. Crystal structures of human tissue kallikrein 4: activity modulation by a specific zinc binding site.

    PubMed

    Debela, Mekdes; Magdolen, Viktor; Grimminger, Valerie; Sommerhoff, Christian; Messerschmidt, Albrecht; Huber, Robert; Friedrich, Rainer; Bode, Wolfram; Goettig, Peter

    2006-10-01

    Human tissue kallikrein 4 (hK4) belongs to a 15-member family of closely related serine proteinases. hK4 is predominantly expressed in prostate, activates hK3/PSA, and is up-regulated in prostate and ovarian cancer. We have identified active monomers of recombinant hK4 besides inactive oligomers in solution. hK4 crystallised in the presence of zinc, nickel, and cobalt ions in three crystal forms containing cyclic tetramers and octamers. These structures display a novel metal site between His25 and Glu77 that links the 70-80 loop with the N-terminal segment. Micromolar zinc as present in prostatic fluid inhibits the enzymatic activity of hK4 against fluorogenic substrates. In our measurements, wild-type hK4 exhibited a zinc inhibition constant (IC50) of 16 microM including a permanent residual activity, in contrast to the zinc-independent mutants H25A and E77A. Since the Ile16 N terminus of wild-type hK4 becomes more accessible for acetylating agents in the presence of zinc, we propose that zinc affects the hK4 active site via the salt-bridge formed between the N terminus and Asp194 required for a functional active site. hK4 possesses an unusual 99-loop that creates a groove-like acidic S2 subsite. These findings explain the observed specificity of hK4 for the P1 to P4 substrate residues. Moreover, hK4 shows a negatively charged surface patch, which may represent an exosite for prime-side substrate recognition. PMID:16950394

  8. Deletion of antigens of the Lewis a/b blood group family in human prostatic carcinoma.

    PubMed Central

    Young, W. W.; Mills, S. E.; Lippert, M. C.; Ahmed, P.; Lau, S. K.

    1988-01-01

    The expression of antigens of the blood group Lewis a/b family were studied in a series of 42 prostatectomy specimens from patients with adenocarcinoma clinically confined to the prostate; 19 of these were later reclassified as pathologic Stage C. Staining of normal or hyperplastic versus neoplastic epithelium was assessed in routinely processed, paraffin-embedded tissue using murine monoclonal antibodies and an avidin-biotin immunoperoxidase technique. Antigens screened and the antibodies used to recognize them were Lewis a (CF4C4), Lewis b and Type 1 H (NS10), monosialosyl Lewis a I (19.9), and disialosyl Lewis a and monosialosyl Lewis a II (FH7). FH7 strongly stained the benign epithelium of all 39 Lewis positive cases, suggesting that the sialyltransferase responsible for synthesis of FH7-reactive determinants is highly active in benign prostatic tissue. When compared to the reactivity of benign epithelium in Lewis positive cases, the staining of the carcinomas was markedly reduced in 18 cases (46%) and absent in 16 cases (41%). This reduction or loss of staining of the malignant epithelium was observed for all antibodies that stained the corresponding benign epithelium of each case. In only five of the cases (13%) was the intensity of staining in the carcinoma equal to that of the surrounding benign epithelium. No cases in this latter group had recurrence of disease, whereas in the other staining groups 25-33% of the cases had recurrences; median follow-up for the entire group was 78 months. No correlation was apparent between Gleason score and the staining pattern with these antigens. In summary, antigens of the Lewis a/b family are deleted in a high percentage of cases of prostatic adenocarcinoma. Images Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:2454582

  9. Defined conditions for the isolation and expansion of basal prostate progenitor cells of mouse and human origin.

    PubMed

    Höfner, Thomas; Eisen, Christian; Klein, Corinna; Rigo-Watermeier, Teresa; Goeppinger, Stephan M; Jauch, Anna; Schoell, Brigitte; Vogel, Vanessa; Noll, Elisa; Weichert, Wilko; Baccelli, Irène; Schillert, Anja; Wagner, Steve; Pahernik, Sascha; Sprick, Martin R; Trumpp, Andreas

    2015-03-10

    Methods to isolate and culture primary prostate epithelial stem/progenitor cells (PESCs) have proven difficult and ineffective. Here, we present a method to grow and expand both murine and human basal PESCs long term in serum- and feeder-free conditions. The method enriches for adherent mouse basal PESCs with a Lin(-)SCA-1(+)CD49f(+)TROP2(high) phenotype. Progesterone and sodium selenite are additionally required for the growth of human Lin(-)CD49f(+)TROP2(high) PESCs. The gene-expression profiles of expanded basal PESCs show similarities to ESCs, and NF-kB function is critical for epithelial differentiation of sphere-cultured PESCs. When transplanted in combination with urogenital sinus mesenchyme, expanded mouse and human PESCs generate ectopic prostatic tubules, demonstrating their stem cell activity in vivo. This novel method will facilitate the molecular, genomic, and functional characterization of normal and pathologic prostate glands of mouse and human origin. PMID:25702639

  10. Targeting Btk/Etk of prostate cancer cells by a novel dual inhibitor.

    PubMed

    Guo, W; Liu, R; Bhardwaj, G; Yang, J C; Changou, C; Ma, A-H; Mazloom, A; Chintapalli, S; Xiao, K; Xiao, W; Kumaresan, P; Sanchez, E; Yeh, C-T; Evans, C P; Patterson, R; Lam, K S; Kung, H-J

    2014-01-01

    Btk and Etk/BMX are Tec-family non-receptor tyrosine kinases. Btk has previously been reported to be expressed primarily in B cells and has an important role in immune responses and B-cell malignancies. Etk has been shown previously to provide a strong survival and metastasis signal in human prostate cancer cells, and to confer androgen independence and drug resistance. While the role of Etk in prostate carcinogenesis is well established, the functions of Btk in prostate cancer have never been investigated, likely due to the perception that Btk is a hematopoietic, but not epithelial, kinase. Herein, we found that Btk is overexpressed in prostate cancer tissues and prostate cancer cells. The level of Btk in prostate cancer tissues correlates with cancer grades. Knockdown of Btk expression selectively inhibits the growth of prostate cancer cells, but not that of the normal prostate epithelial cells, which express very little Btk. Dual inhibition of Btk and Etk has an additive inhibitory effect on prostate cancer cell growth. To explore Btk and Etk as targets for prostate cancer, we developed a small molecule dual inhibitor of Btk and Etk, CTN06. Treatment of PC3 and other prostate cancer cells, but not immortalized prostate epithelial cells with CTN06 resulted in effective cell killing, accompanied by the attenuation of Btk/Etk signals. The killing effect of CTN06 is more potent than that of commonly used inhibitors against Src, Raf/VEGFR and EGFR. CTN06 induces apoptosis as well as autophagy in human prostate cancer cells, and is a chemo-sensitizer for docetaxel (DTX), a standard of care for metastatic prostate cancer patients. CTN06 also impeded the migration of human prostate cancer cells based on a 'wound healing' assay. The anti-cancer effect of CTN06 was further validated in vivo in a PC3 xenograft mouse model. PMID:25188519

  11. Altered autophagy in human adipose tissues in obesity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Context: Autophagy is a housekeeping mechanism, involved in metabolic regulation and stress response, shown recently to regulate lipid droplets biogenesis/breakdown and adipose tissue phenotype. Objective: We hypothesized that in human obesity autophagy may be altered in adipose tissue in a fat d...

  12. Tissue-based imaging model of human trabecular meshwork.

    PubMed

    Chu, Edward R; Gonzalez, Jose M; Tan, James C H

    2014-01-01

    We have developed a tissue-based model of the human trabecular meshwork (TM) using viable postmortem corneoscleral donor tissue. Two-photon microscopy is used to optically section and image deep in the tissue to analyze cells and extracellular matrix (ECM) within the original three-dimensional (3D) environment of the TM. Multimodal techniques, including autofluorescence (AF), second harmonic generation (SHG), intravital dye fluorescence, and epifluorescence, are combined to provide unique views of the tissue at the cellular and subcellular level. SHG and AF imaging are non-invasive tissue imaging techniques with potential for clinical application, which can be modeled in the system. We describe the following in the tissue-based model: analysis of live cellularity to determine tissue viability; characteristics of live cells based on intravital labeling; features and composition of the TM's structural ECM; localization of specific ECM proteins to regions such as basement membrane; in situ induction and expression of tissue markers characteristic of cultured TM cells relevant to glaucoma; analysis of TM actin and pharmacological effects; in situ visualization of TM, inner wall endothelium, and Schlemm's canal; and application of 3D reconstruction, modeling, and quantitative analysis to the TM. The human model represents a cost-effective use of valuable and scarce yet available human tissue that allows unique cell biology, pharmacology, and translational studies of the TM. PMID:24517246

  13. The effects of SB 216469, an antagonist which discriminates between the alpha 1A-adrenoceptor and the human prostatic alpha 1-adrenoceptor.

    PubMed Central

    Chess-Williams, R.; Chapple, C. R.; Verfurth, F.; Noble, A. J.; Couldwell, C. J.; Michel, M. C.

    1996-01-01

    1. The affinity of the alpha 1-adrenoceptor antagonist SB 216469 (also known as REC 15/2739) has been determined at native and cloned alpha 1-adrenoceptor subtypes by radioligand binding and at functional alpha 1-adrenoceptor subtypes in isolated tissues. 2. In radioligand binding studies with [3H]-prazosin, SB 216469 had a high affinity at the alpha 1A-adrenoceptors of the rat cerebral cortex and kidney (9.5-9.8) but a lower affinity at the alpha 1B-adrenoceptors of the rat spleen and liver (7.7-8.2). 3. At cloned rat alpha 1-adrenoceptor subtypes transiently expressed in COS-1 cells and also at cloned human alpha 1-adrenoceptor subtypes stably transfected in Rat-1 cells, SB 216469 exhibited a high affinity at the alpha 1a-adrenoceptors (9.6-10.4) with a significantly lower affinity at the alpha 1b-adrenoceptor (8.0-8.4) and an intermediate affinity at the alpha 1d-adrenoceptor (8.7-9.2). 4. At functional alpha 1-adrenoceptors, SB 216469 had a similar pharmacological profile, with a high affinity at the alpha 1A-adrenoceptors of the rat vas deferens and anococcygeus muscle (pA2 = 9.5-10.0), a low affinity at the alpha 1B-adrenoceptors of the rat spleen (6.7) and guinea-pig aorta (8.0), and an intermediate affinity at the alpha 1D-adrenoceptors of the rat aorta (8.8). 5. Several recent studies have concluded that the alpha 1-adrenoceptor present in the human prostate has the pharmacological characteristics of the alpha 1A-adrenoceptor subtype. However, the affinity of SB 216469 at human prostatic alpha 1-adrenoceptors (pA2 = 8.1) determined in isolated tissue strips, was significantly lower than the values obtained at either the cloned alpha 1a-adrenoceptors (human, rat, bovine) or the native alpha 1A-adrenoceptors in radioligand binding and functional studies in the rat. 6. Our results with SB 216469, therefore, suggest that the alpha 1-adrenoceptor mediating contractile responses of the human prostate has properties which distinguish it from the cloned alpha 1a

  14. Proapoptotic effects of new pentabromobenzylisothiouronium salts in a human prostate adenocarcinoma cell line.

    PubMed

    Koronkiewicz, Mirosława; Kazimierczuk, Zygmunt; Szarpak, Kinga; Chilmonczyk, Zdzisław

    2012-01-01

    Prostate cancer is the second most common cancer in elderly men worldwide and its incidence rate is rising continuously. Agents capable of inducing apoptosis in prostate cancer cells seem a promising approach to treat this malignancy. In this study we describe the synthesis of a number of novel N- and N,N'-substituted S-2,3,4,5,6-pentabromobenzylisothiouronium bromides and their activity against the human prostate adenocarcinoma PC3 cell line. All the compounds produced changes in mitochondrial transmembrane potential and cell cycle progression, showed a cytostatic effect and induced apoptosis in the tested cancer line in a concentration- and time-dependent manner. The most effective compounds ZKK-3, ZKK-9 and ZKK-13 produced, at 20 microM concentration, apoptosis in 42, 46, and 66% of the cells, respectively, after 48 h incubation. Two selected S-2,3,4,5,6-pentabromobenzylisothiouronium bromides (ZKK-3, ZKK-9) showed also a synergic proapoptotic effect with the new casein kinase II inhibitor 2-(4-methylpiperazin-1-yl)-4,5,6,7-tetrabromo-1H-benzimidazole (TBIPIP) in the PC3 cell line. PMID:23285698

  15. Frequent somatic mutations of the transcription factor ATBF1 in human prostate cancer.

    PubMed

    Sun, Xiaodong; Frierson, Henry F; Chen, Ceshi; Li, Changling; Ran, Qimei; Otto, Kristen B; Cantarel, Brandi L; Cantarel, Brandi M; Vessella, Robert L; Gao, Allen C; Petros, John; Miura, Yutaka; Simons, Jonathan W; Dong, Jin-Tang

    2005-04-01

    Cancer often results from the accumulation of multiple genetic alterations. Although most malignancies are sporadic, only a small number of genes have been shown to undergo frequent mutations in sporadic cancers. The long arm of chromosome 16 is frequently deleted in human cancers, but the target gene for this deletion has not been identified. Here we report that ATBF1, which encodes a transcription factor that negatively regulates AFP and MYB but transactivates CDKN1A, is a good candidate for the 16q22 tumor-suppressor gene. We narrowed the region of deletion at 16q22 to 861 kb containing ATBF1. ATBF1 mRNA was abundant in normal prostates but more scarce in approximately half of prostate cancers tested. In 24 of 66 (36%) cancers examined, we identified 22 unique somatic mutations, many of which impair ATBF1 function. Furthermore, ATBF1 inhibited cell proliferation. Hence, loss of ATBF1 is one mechanism that defines the absence of growth control in prostate cancer. PMID:15750593

  16. Suppression of β-catenin Signaling Pathway in Human Prostate Cancer PC3 Cells by Delphinidin

    PubMed Central

    Lee, Wooje; Yun, Jung-Mi

    2016-01-01

    Delphinidin possesses strong anti-oxidant, anti-inflammatory, and anti-cancer properties. Suppression of the Wnt/β-catenin signaling pathway is a potential strategy for chemoprevention and therapy. As aberrant activation of the β-catenin signaling pathway contributes to prostate cancer progression, we evaluated the effect of delphinidin on this pathway in human PC3 prostate cancer cells. An MTT assay showed that treatment with delphinidin (15–180 μM, 72 hours) resulted in a dose-dependent growth inhibition of cells. Treatment with delphinidin increased the phosphorylation of serine or threonine residues on β-catenin and decreased the levels of cytoplasmic β-catenin. Moreover, treatment with delphinidin inhibited the nuclear translocation of β-catenin and the expression of β-catenin target genes such as cyclin D1, c-myc, Axin-2, and T cell factor-1. Delphinidin also induced the phosphorylation of glycogen synthase kinase 3β and the expression of adenomatous polyposis coli and Axin proteins. Our results indicate that inhibition of cell growth by delphinidin is mediated, at least in part, through modulation of the β-catenin signaling pathway. We suggest that delphinidin is a potent inhibitor of Wnt/β-catenin signaling in prostate cancer cells. PMID:27390740

  17. Transceive surface coil array for MRI of the human prostate at 4T.

    PubMed

    Pinkerton, Robert G; Near, James P; Barberi, Enzo A; Menon, Ravi S; Bartha, Robert

    2007-02-01

    A novel torso transceive surface coil array for prostate magnetic resonance imaging (MRI) and spectroscopy (MRS) at 4T is presented. It is shown that with the use of a conformal transceive surface coil array with 50 Omega transmitter amplifiers and receiver preamplifiers, one can perform whole-volume torso imaging while maintaining the high signal-to-noise ratio (SNR) inherent to surface coil designs. Recent theoretical considerations have shown that by focusing the infringing radiofrequency (RF) electromagnetic field, one can achieve increased penetration and signal homogeneity compared to a conventional circularly polarized driving scheme. A variation of this driving scheme particular to the proposed coil design resulted in a twofold increase in SNR in the prostate compared to that achieved with a conventional circularly polarized driving scheme. The novel transceive surface coil array presented is capable of full-volume imaging of the human torso at 4T while maintaining signal penetration in the deep region of the prostate gland. PMID:17260367

  18. Tocopherols and saponins derived from Argania spinosa exert, an antiproliferative effect on human prostate cancer.

    PubMed

    Drissi, A; Bennani, H; Giton, F; Charrouf, Z; Fiet, J; Adlouni, A

    2006-10-01

    The aim of our study is to evaluate the antiproliferative effect of tocopherols obtained from alimentary virgin argan oil extracted from the endemic argan tree of Morocco and of saponins extracted from argan press cake on three human prostatic cell lines (DU145, LNCaP, and PC3). The results were compared to 2-methoxyestradiol as antiproliferative drug candidates. Cytotoxicity and antiproliferative effects were investigated after cells' treatment with tocopherols and saponins compared to 2-Methoxyoestradiol as the positive control. Tocopherols and saponins extracted from argan tree and 2-methoxyestradiol exhibit a dose-response cytotoxic effect and an antiproliferative action on the tested cell lines. The best antiproliferative effect of tocopherols is obtained with DU145 and LNCaP cell lines (28 microg/ml and 32 microg/ml, respectively, as GI50). The saponins fraction displayed the best antiproliferative effect on the PC3 cell line with 18 microg/ml as GI50. Our results confirm the antiproliferative effect of 2-methoxyestradiol and show for the first time the antiproliferative effect of tocopherols and saponins extracted from the argan tree on hormone-dependent and hormone-independent prostate cancer cell lines. These data suggest that argan oil is of potential interest in developing new strategies for prostate cancer prevention. PMID:16982463

  19. First evidence of sphingosine 1-phosphate lyase protein expression and activity downregulation in human neoplasm: implication for resistance to therapeutics in prostate cancer.

    PubMed

    Brizuela, Leyre; Ader, Isabelle; Mazerolles, Catherine; Bocquet, Magalie; Malavaud, Bernard; Cuvillier, Olivier

    2012-09-01

    This is the first report of sphingosine 1-phosphate lyase (SPL) protein expression and enzymatic activity in human neoplasm. This enzyme drives irreversible degradation of sphingosine 1-phosphate (S1P), a bioactive lipid associated with resistance to therapeutics in various cancers, including prostate adenocarcinoma. In fresh human prostatectomy specimens, a remarkable decrease in SPL enzymatic activity was found in tumor samples, as compared with normal adjacent tissues. A significant relationship between loss of SPL expression and higher Gleason score was confirmed in tissue microarray (TMA) analysis. Moreover, SPL protein expression and activity were inversely correlated with those of sphingosine kinase-1 (SphK1), the enzyme producing S1P. SPL and SphK1 expressions were independently predictive of aggressive cancer on TMA, supporting the relevance of S1P in prostate cancer. In human C4-2B and PC-3 cell lines, silencing SPL enhanced survival after irradiation or chemotherapy by decreasing expression of proteins involved in sensing and repairing DNA damage or apoptosis, respectively. In contrast, enforced expression of SPL sensitized cancer cells to irradiation or docetaxel by tilting the ceramide/S1P balance toward cell death. Interestingly, the S1P degradation products failed to sensitize to chemo- and radiotherapy, supporting the crucial role of ceramide/S1P balance in cancer. Of note, the combination of SPL enforced expression with a SphK1 silencing strategy by further decreasing S1P content made prostate cancer cells even more sensitive to anticancer therapies, suggesting that a dual strategy aimed at stimulating SPL, and inhibiting SphK1 could represent a future approach to sensitize cancer cells to cancer treatments. PMID:22784711

  20. Irradiation of Human Prostate Cancer Cells Increases Uptake of Antisense Oligodeoxynucleotide

    SciTech Connect

    Anai, Satoshi; Brown, Bob D.; Nakamura, Kogenta; Goodison, Steve; Hirao, Yoshihiko; Rosser, Charles J. . E-mail: charles.rosser@urology.ufl.edu

    2007-07-15

    Purpose: To investigate whether irradiation before antisense Bcl-2 oligodeoxynucleotide (ODN) administration enhances tissue uptake, and whether periodic dosing enhances cellular uptake of fluorescently labeled ODN relative to constant dosing. Methods and Materials: PC-3-Bcl-2 cells (prostate cancer cell line engineered to overexpress Bcl-2) were subjected to increasing doses of irradiation (0-10 Gy) with or without increasing concentrations of fluorescently labeled antisense Bcl-2 ODN (G4243). The fluorescent signal intensity was quantified as the total grain area with commercial software. In addition, PC-3-Bcl-2 subcutaneous xenograft tumors were treated with or without irradiation in combination with various dosing schemas of G4243. The uptake of fluorescent G4243 in tumors was quantitated. Results: The uptake of G4243 was increased in prostate cancer cells exposed to low doses of irradiation both in vitro and in vivo. Irradiation before G4243 treatment resulted in increased fluorescent signal intensity in xenograft tumors compared with those irradiated after G4243 treatment. A single weekly dose of G4243 produced higher G4243 uptake in xenograft tumors than daily dosing, even when the total dose administered per week was held constant. Conclusions: These findings suggest that ionizing radiation increases the uptake of therapeutic ODN in target tissues and, thus, has potential to increase the efficacy of ODN in clinical applications.

  1. Microwave non-contact imaging of subcutaneous human body tissues.

    PubMed

    Kletsov, Andrey; Chernokalov, Alexander; Khripkov, Alexander; Cho, Jaegeol; Druchinin, Sergey

    2015-10-01

    A small-size microwave sensor is developed for non-contact imaging of a human body structure in 2D, enabling fitness and health monitoring using mobile devices. A method for human body tissue structure imaging is developed and experimentally validated. Subcutaneous fat tissue reconstruction depth of up to 70 mm and maximum fat thickness measurement error below 2 mm are demonstrated by measurements with a human body phantom and human subjects. Electrically small antennas are developed for integration of the microwave sensor into a mobile device. Usability of the developed microwave sensor for fitness applications, healthcare, and body weight management is demonstrated. PMID:26609415

  2. Microwave non-contact imaging of subcutaneous human body tissues

    PubMed Central

    Chernokalov, Alexander; Khripkov, Alexander; Cho, Jaegeol; Druchinin, Sergey

    2015-01-01

    A small-size microwave sensor is developed for non-contact imaging of a human body structure in 2D, enabling fitness and health monitoring using mobile devices. A method for human body tissue structure imaging is developed and experimentally validated. Subcutaneous fat tissue reconstruction depth of up to 70 mm and maximum fat thickness measurement error below 2 mm are demonstrated by measurements with a human body phantom and human subjects. Electrically small antennas are developed for integration of the microwave sensor into a mobile device. Usability of the developed microwave sensor for fitness applications, healthcare, and body weight management is demonstrated. PMID:26609415

  3. Genetic deletion of osteopontin in TRAMP mice skews prostate carcinogenesis from adenocarcinoma to aggressive human-like neuroendocrine cancers

    PubMed Central

    Mauri, Giorgio; Jachetti, Elena; Comuzzi, Barbara; Dugo, Matteo; Arioli, Ivano; Miotti, Silvia; Sangaletti, Sabina; Di Carlo, Emma; Tripodo, Claudio; Colombo, Mario P.

    2016-01-01

    Osteopontin (OPN) is a secreted glycoprotein, that belongs to the non-structural extracellular matrix (ECM), and its over expression in human prostate cancer has been associated with disease progression, androgen independence and metastatic ability. Nevertheless, the pathophysiology of OPN in prostate tumorigenesis has never been studied. We crossed TRansgenic Adenocarcinoma of the Mouse Prostate (TRAMP) mice with OPN deficient (OPN−/−) mice and followed tumor onset and progression in these double mutants. Ultrasound examination detected the early onset of a rapidly growing, homogeneous and spherical tumor in about 60% of OPN−/− TRAMP mice. Such neoplasms seldom occurred in parental TRAMP mice otherwise prone to adenocarcinomas and were characterized for being androgen receptor negative, highly proliferative and endowed with neuroendocrine (NE) features. Gene expression profiling showed up-regulation of genes involved in tumor progression, cell cycle and neuronal differentiation in OPN-deficient versus wild type TRAMP tumors. Down-regulated genes included key genes of TGFa pathway, including SMAD3 and Filamin, which were confirmed at the protein level. Furthermore, NE genes and particularly those characterizing early prostatic lesions of OPN-deficient mice were found to correlate with those of human prostate NE tumours. These data underscore a novel role of OPN in the early stages of prostate cancer growth, protecting against the development of aggressive NE tumors. PMID:26700622

  4. Genetic deletion of osteopontin in TRAMP mice skews prostate carcinogenesis from adenocarcinoma to aggressive human-like neuroendocrine cancers.

    PubMed

    Mauri, Giorgio; Jachetti, Elena; Comuzzi, Barbara; Dugo, Matteo; Arioli, Ivano; Miotti, Silvia; Sangaletti, Sabina; Di Carlo, Emma; Tripodo, Claudio; Colombo, Mario P

    2016-01-26

    Osteopontin (OPN) is a secreted glycoprotein, that belongs to the non-structural extracellular matrix (ECM), and its over expression in human prostate cancer has been associated with disease progression, androgen independence and metastatic ability. Nevertheless, the pathophysiology of OPN in prostate tumorigenesis has never been studied. We crossed TRansgenic Adenocarcinoma of the Mouse Prostate (TRAMP) mice with OPN deficient (OPN-/-) mice and followed tumor onset and progression in these double mutants. Ultrasound examination detected the early onset of a rapidly growing, homogeneous and spherical tumor in about 60% of OPN-/- TRAMP mice. Such neoplasms seldom occurred in parental TRAMP mice otherwise prone to adenocarcinomas and were characterized for being androgen receptor negative, highly proliferative and endowed with neuroendocrine (NE) features. Gene expression profiling showed up-regulation of genes involved in tumor progression, cell cycle and neuronal differentiation in OPN-deficient versus wild type TRAMP tumors. Down-regulated genes included key genes of TGFa pathway, including SMAD3 and Filamin, which were confirmed at the protein level. Furthermore, NE genes and particularly those characterizing early prostatic lesions of OPN-deficient mice were found to correlate with those of human prostate NE tumours. These data underscore a novel role of OPN in the early stages of prostate cancer growth, protecting against the development of aggressive NE tumors. PMID:26700622

  5. Widespread telomere instability in prostatic lesions.

    PubMed

    Tu, LiRen; Huda, Nazmul; Grimes, Brenda R; Slee, Roger B; Bates, Alison M; Cheng, Liang; Gilley, David

    2016-05-01

    A critical function of the telomere is to disguise chromosome ends from cellular recognition as double strand breaks, thereby preventing aberrant chromosome fusion events. Such chromosome end-to-end fusions are known to initiate genomic instability via breakage-fusion-bridge cycles. Telomere dysfunction and other forms of genomic assault likely result in misregulation of genes involved in growth control, cell death, and senescence pathways, lowering the threshold to malignancy and likely drive disease progression. Shortened telomeres and anaphase bridges have been reported in a wide variety of early precursor and malignant cancer lesions including those of the prostate. These findings are being extended using methods for the analysis of telomere fusions (decisive genetic markers for telomere dysfunction) specifically within human tissue DNA. Here we report that benign prostatic hyperplasia (BPH), high-grade prostatic intraepithelial neoplasia (PIN), and prostate cancer (PCa) prostate lesions all contain similarly high frequencies of telomere fusions and anaphase bridges. Tumor-adjacent, histologically normal prostate tissue generally did not contain telomere fusions or anaphase bridges as compared to matched PCa tissues. However, we found relatively high levels of telomerase activity in this histologically normal tumor-adjacent tissue that was reduced but closely correlated with telomerase levels in corresponding PCa samples. Thus, we present evidence of high levels of telomere dysfunction in BPH, an established early precursor (PIN) and prostate cancer lesions but not generally in tumor adjacent normal tissue. Our results suggest that telomere dysfunction may be a common gateway event leading to genomic instability in prostate tumorigenesis. . PMID:25917938

  6. Prostate Cryotherapy Monitoring Using Vibroacoustography: Preliminary Results of an Ex Vivo Study and Technical Feasibility

    PubMed Central

    Davis, Brian J.; Alizad, Azra; Greenleaf, James F.; Wilson, Torrence M.; Mynderse, Lance A.; Fatemi, Mostafa

    2009-01-01

    The objective of this research is to prospectively evaluate the feasibility of vibroacoustography (VA) imaging in monitoring prostate cryotherapy in an ex vivo model. Baseline scanning of an excised human prostate is accomplished by a VA system apparatus in a tank of degassed water. Alcohol and dry ice mixture are used to freeze two prostate tissue samples. The frozen prostates are subsequently placed within the water tank at 27°C and rescanned. VA images were acquired at prescribed time intervals to characterize the acoustic properties of the partially frozen tissue. The frozen prostate tissue appears in the images as hypoemitting signal. Once the tissue thaws, previously frozen regions show coarser texture than prior to freezing. The margin of the frozen tissue is delineated with a well-defined rim. The thawed cryolesions show a different contrast compared with normal unfrozen prostate. In conclusion, this pilot study shows that VA produces clear images of a frozen prostate at different temperature stages. The frozen tissue appears as a uniform region with well-defined borders that are readily identified. These characteristic images should allow safer and more efficient application of prostatic cryosurgery. These results provide substantial motivation to further investigate VA as a potential modality to monitor prostate cryotherapy intraoperatively. PMID:18990628

  7. Activated α2-Macroglobulin Binding to Human Prostate Cancer Cells Triggers Insulin-like Responses

    PubMed Central

    Misra, Uma Kant; Pizzo, Salvatore Vincent

    2015-01-01

    Ligation of cell surface GRP78 by activated α2-macroglobulin (α2M*) promotes cell proliferation and suppresses apoptosis. α2M*-treated human prostate cancer cells exhibit a 2–3-fold increase in glucose uptake and lactate secretion, an effect similar to insulin treatment. In both α2M* and insulin-treated cells, the mRNA levels of SREBP1-c, SREBP2, fatty-acid synthase, acetyl-CoA carboxylase, ATP citrate lyase, and Glut-1 were significantly increased together with their protein levels, except for SREBP2. Pretreatment of cells with α2M* antagonist antibody directed against the carboxyl-terminal domain of GRP78 blocks these α2M*-mediated effects, and silencing GRP78 expression by RNAi inhibits up-regulation of ATP citrate lyase and fatty-acid synthase. α2M* induces a 2–3-fold increase in lipogenesis as determined by 6-[14C]glucose or 1-[14C]acetate incorporation into free cholesterol, cholesterol esters, triglycerides, free fatty acids, and phosphatidylcholine, which is blocked by inhibitors of fatty-acid synthase, PI 3-kinase, mTORC, or an antibody against the carboxyl-terminal domain of GRP78. We also assessed the incorporation of [14CH3]choline into phosphatidylcholine and observed similar effects. Lipogenesis is significantly affected by pretreatment of prostate cancer cells with fatostatin A, which blocks sterol regulatory element-binding protein proteolytic cleavage and activation. This study demonstrates that α2M* functions as a growth factor, leading to proliferation of prostate cancer cells by promoting insulin-like responses. An antibody against the carboxyl-terminal domain of GRP78 may have important applications in prostate cancer therapy. PMID:25720493

  8. Activated α2-macroglobulin binding to human prostate cancer cells triggers insulin-like responses.

    PubMed

    Misra, Uma Kant; Pizzo, Salvatore Vincent

    2015-04-10

    Ligation of cell surface GRP78 by activated α2-macroglobulin (α2M*) promotes cell proliferation and suppresses apoptosis. α2M*-treated human prostate cancer cells exhibit a 2-3-fold increase in glucose uptake and lactate secretion, an effect similar to insulin treatment. In both α2M* and insulin-treated cells, the mRNA levels of SREBP1-c, SREBP2, fatty-acid synthase, acetyl-CoA carboxylase, ATP citrate lyase, and Glut-1 were significantly increased together with their protein levels, except for SREBP2. Pretreatment of cells with α2M* antagonist antibody directed against the carboxyl-terminal domain of GRP78 blocks these α2M*-mediated effects, and silencing GRP78 expression by RNAi inhibits up-regulation of ATP citrate lyase and fatty-acid synthase. α2M* induces a 2-3-fold increase in lipogenesis as determined by 6-[(14)C]glucose or 1-[(14)C]acetate incorporation into free cholesterol, cholesterol esters, triglycerides, free fatty acids, and phosphatidylcholine, which is blocked by inhibitors of fatty-acid synthase, PI 3-kinase, mTORC, or an antibody against the carboxyl-terminal domain of GRP78. We also assessed the incorporation of [(14)CH3]choline into phosphatidylcholine and observed similar effects. Lipogenesis is significantly affected by pretreatment of prostate cancer cells with fatostatin A, which blocks sterol regulatory element-binding protein proteolytic cleavage and activation. This study demonstrates that α2M* functions as a growth factor, leading to proliferation of prostate cancer cells by promoting insulin-like responses. An antibody against the carboxyl-terminal domain of GRP78 may have important applications in prostate cancer therapy. PMID:25720493

  9. Total DDT and dieldrin content of human adipose tissue

    SciTech Connect

    Ahmad, N.; Harsas, W.; Marolt, R.S.; Morton, M.; Pollack, J.K.

    1988-12-01

    As far as the authors could ascertain only 4 well-documented analytical studies have been carried out in Australia determining the total DDT and dieldrin content of human adipose tissue. The latest of these studies was published over 16 years ago. Therefore it is timely and important to re-examine the total DDT and dieldrin concentration within the adipose tissue of the Australian population. The present investigation has analyzed 290 samples of human adipose tissue obtained from Westmead Hospital situated in an outer suburb of Sydney, New South Wales for their content of total DDT and dieldrin.

  10. Tissue ablation after 120W greenlight laser vaporization and bipolar plasma vaporization of the prostate: a comparison using transrectal three-dimensional ultrasound volumetry

    NASA Astrophysics Data System (ADS)

    Kranzbühler, Benedikt; Gross, Oliver; Fankhauser, Christian D.; Hefermehl, Lukas J.; Poyet, Cédric; Largo, Remo; Müntener, Michael; Seifert, Hans-Helge; Zimmermann, Matthias; Sulser, Tullio; Müller, Alexander; Hermanns, Thomas

    2012-02-01

    Introduction and objectives: Greenlight laser vaporization (LV) of the prostate is characterized by simultaneous vaporization and coagulation of prostatic tissue resulting in tissue ablation together with excellent hemostasis during the procedure. It has been reported that bipolar plasma vaporization (BPV) of the prostate might be an alternative for LV. So far, it has not been shown that BPV is as effective as LV in terms of tissue ablation or hemostasis. We performed transrectal three-dimensional ultrasound investigations to compare the efficiency of tissue ablation between LV and BPV. Methods: Between 11.2009 and 5.2011, 50 patients underwent pure BPV in our institution. These patients were matched with regard to the pre-operative prostate volume to 50 LV patients from our existing 3D-volumetry-database. Transrectal 3D ultrasound and planimetric volumetry of the prostate were performed pre-operatively, after catheter removal, 6 weeks and 6 months. Results: Median pre-operative prostate volume was not significantly different between the two groups (45.3ml vs. 45.4ml; p=1.0). After catheter removal, median absolute volume reduction (BPV 12.4ml, LV 6.55ml) as well as relative volume reduction (27.8% vs. 16.4%) were significantly higher in the BPV group (p<0.001). After six weeks (42.9% vs. 33.3%) and six months (47.2% vs. 39.7%), relative volume reduction remained significantly higher in the BPV group (p<0.001). Absolute volume reduction was non-significantly higher in the BPV group after six weeks (18.4ml, 13.8ml; p=0.051) and six months (20.8ml, 18ml; p=0.3). Clinical outcome parameters improved significantly in both groups without relevant differences between the groups. Conclusions: Both vaporization techniques result in efficient tissue ablation with initial prostatic swelling. BPV seems to be superior due to a higher relative volume reduction. This difference had no clinical impact after a follow-up of 6M.

  11. Human Kidney Injury Molecule-1 Is a Tissue and Urinary Tumor Marker of Renal Cell Carcinoma

    PubMed Central

    Han, Won K.; Alinani, Anwar; Wu, Chin-Lee; Michaelson, Dror; Loda, Massimo; McGovern, Francis J.; Thadhani, Ravi; Bonventre, Joseph V.

    2005-01-01

    Human kidney injury molecule-1 (hKIM-1) is a type 1 transmembrane protein that is not detectable in normal kidney tissue but is expressed at high levels in human and rodent kidneys with dedifferentiated proximal tubule epithelial cells after ischemic or toxic injury. Therefore, it was hypothesized that renal tumors express hKIM-1 and release this protein into the urine. Forty renal cell carcinoma (RCC) and 484 nonrenal tumors were analyzed by immunohistochemistry for expression of hKIM-1 (group 1). Urine samples before nephrectomy and nephrectomy tissue samples were collected from an additional 42 patients with renal tumors, from 30 normal control subjects, and also from 10 patients with prostate carcinoma (group 2). In five additional patients with RCC, urine was collected before and after nephrectomy (group 3). Tissue was examined for expression of hKIM-1, and cell-free urine supernatants were analyzed for hKIM-1 by ELISA. Urinary hKIM-1 was normalized to the urinary creatinine concentration (UCr). Expression of hKIM-1 was present in 32 tissue sections (91%) of 35 clear cell RCC (group 1). In group 2, the normalized urinary hKIM-1 levels were significantly higher in patients with clear cell RCC (0.39 ± 0.08 ng/mg UCr; n = 21), compared with levels in patients with prostate carcinoma (0.12 ± 0.03 ng/mg UCr; P < 0.02; n = 10), or normal control subjects (0.05 ± 0.01 ng/mg UCr; P < 0.005; n = 30). Tissue sections from 28 (82%) of 34 primary RCC stained positively for the expression of hKIM-1. In all patients with a detectable prenephrectomy urinary hKIM-1 level, there was either complete disappearance or marked reduction after nephrectomy (group 3). In conclusion, the cleaved ectodomain of hKIM-1 can be detected in the urine of patients with RCC and may serve as a new biomarker for early detection of RCC. PMID:15744000

  12. Efficient In Vitro Electropermeabilization of Reconstructed Human Dermal Tissue.

    PubMed

    Madi, Moinecha; Rols, Marie-Pierre; Gibot, Laure

    2015-10-01

    DNA electrotransfer is a successful technic for gene delivery. However, its use in clinical applications is limited since little is known about the mechanisms governing DNA electrotransfer in the complex environment occurring in a tissue. The objectives of this work were to investigate the role of the extracellular matrix (ECM) in that process. Tumor ECM composition was shown to modulate in vivo gene electrotransfer efficiency. In order to assess the effects of ECM composition and organization, as well as intercellular junctions and communication, in normal tissue response to electric pulses, we developed an innovative three-dimensional (3D) reconstructed human connective tissue model. 3D human dermal tissue was reconstructed in vitro by a tissue engineering approach and was representative of in vivo cell organization since cell-cell contacts were present as well as complex ECM. This human cell model presented multiple layers of primary dermal fibroblasts embedded in a native, collagen-rich ECM. This dermal tissue could become a useful tool to study skin DNA electrotransfer mechanisms. As proof of the concept, we show here that the cells within this standardized 3D tissue can be efficiently electropermeabilized by milliseconds electric pulses. We believe that a better comprehension of gene electrotransfer in such a model tissue would help improve electrogene therapy approaches such as the systemic delivery of therapeutic proteins and DNA vaccination. PMID:25788148

  13. Selenite Treatment Inhibits LAPC-4 Tumor Growth and Prostate-Specific Antigen Secretion in a Xenograft Model of Human Prostate Cancer

    SciTech Connect

    Bhattacharyya, Rumi S.; Husbeck, Bryan; Feldman, David; Knox, Susan J.

    2008-11-01

    Purpose: Selenium compounds have known chemopreventive effects on prostate cancer. However selenite, an inorganic form of selenium, has not been extensively studied as a treatment option for prostate cancer. Our previous studies have demonstrated the inhibition of androgen receptor expression and androgen stimulated prostate-specific antigen (PSA) expression by selenite in human prostate cancer cell lines. In this study, we investigated the in vivo effects of selenite as a therapy to treat mice with established LAPC-4 tumors. Methods and Materials: Male mice harboring androgen-dependent LAPC-4 xenograft tumors were treated with selenite (2 mg/kg intraperitoneally three times per week) or vehicle for 42 days. In addition, androgen-independent LAPC-4 xenograft tumors were generated in female mice over 4 to 6 months. Once established, androgen-independent LAPC-4 tumor fragments were passaged into female mice and were treated with selenite or vehicle for 42 days. Changes in tumor volume and serum PSA levels were assessed. Results: Selenite significantly decreased androgen-dependent LAPC-4 tumor growth in male mice over 42 days (p < 0.001). Relative tumor volume was decreased by 41% in selenite-treated animals compared with vehicle-treated animals. The inhibition of LAPC-4 tumor growth corresponded to a marked decrease in serum PSA levels (p < 0.01). In the androgen-independent LAPC-4 tumors in female mice, selenite treatment decreased tumor volume by 58% after 42 days of treatment (p < 0.001). Conclusions: These results suggest that selenite may have potential as a novel therapeutic agent to treat both androgen-dependent and androgen-independent prostate cancer.

  14. Tumor suppressor microRNAs, miR-100 and -125b, are regulated by 1,25-dihydroxyvitamin D in primary prostate cells and in patient tissue

    PubMed Central

    Giangreco, Angeline A; Vaishnav, Avani; Wagner, Dennis; Finelli, Antonio; Fleshner, Neil; Van der Kwast, Theodorus; Vieth, Reinhold; Nonn, Larisa

    2013-01-01

    MiR-100 and miR-125b are lost in many cancers and have potential function as tumor suppressors. Using both primary prostatic epithelial cultures and laser-capture-microdissected prostate epithelium from 45 patients enrolled in a vitamin D3 randomized trial, we identified miR-100 and -125b as targets of 1,25-dihydroxyvitamin D3 (1,25D). In patients, miR-100 and -125b levels were significantly lower in tumor tissue than in benign prostate. Similarly, miR-100 and -125b were lower in primary PCa cells than in cells derived from benign prostate. Prostatic concentrations of 1,25D positively correlated with these miRNA levels in both PCa and benign epithelium, demonstrating that PCa patients may still benefit from vitamin D3. In cell assays, upregulation of these miRNAs by 1,25D was vitamin D receptor-dependent. Transfection of pre-miR-100 and pre-miR-125b in the presence or absence of 1,25D decreased invasiveness of cancer cell, RWPE-2. Pre-miR-100 and pre-miR-125b decreased proliferation in primary cells and cancer cells respectively. Pre-miR-125b transfection suppressed migration and clonal growth of PCa cells while knockdown of miR-125b in normal cells increased migration indicates a tumor suppressor function. 1,25D suppressed expression of previously bona fide mRNA targets of these miRNAs, E2F3 and Plk1, in a miRNA-dependent manner. Together, these findings demonstrate that vitamin D3 supplementation augments tumor suppressive miRNAs in patient prostate tissue, providing evidence that miRNAs could be key physiologic mediators of vitamin D3 activity in prevention and early treatment of PCa. PMID:23503652

  15. Steroid hormone receptors in prostatic hyperplasia and prostatic carcinoma.

    PubMed

    Khalid, B A; Nurshireen, A; Rashidah, M; Zainal, B Y; Roslan, B A; Mahamooth, Z

    1990-06-01

    One hundred and six prostatic tissue samples obtained from transurethral resection were analysed for androgen and estrogen receptors. In 62 of these, progesterone and glucocorticoid receptors were also assayed. Steroid receptors were assayed using single saturation dose 3H-labelled ligand assays. Ninety percent of the 97 prostatic hyperplasia tissues and six of the nine prostatic carcinoma tissues were positive for androgen receptors. Estrogen receptors were only present in 19% and 33% respectively. Progesterone receptors were present in 70% of the tissues, but glucocorticoid receptors were present in only 16% of prostatic hyperplasia and none in prostatic carcinoma. PMID:1725553

  16. CCR5 receptor antagonists block metastasis to bone of v-Src-oncogene-transformed metastatic prostate cancer cell lines

    PubMed Central

    Sicoli, Daniela; Jiao, Xuanmao; Ju, Xiaoming; Velasco-Velazquez, Marco; Ertel, Adam; Addya, Sankar; Li, Zhiping; Ando, Sebastiano; Fatatis, Alessandro; Paudyal, Bishnuhari; Cristofanilli, Massimo; Thakur, Mathew L.; Lisanti, Michael P; Pestell, Richard G.

    2014-01-01

    Src family kinases (SFKs) integrate signal transduction for multiple receptors, regulating cellular proliferation invasion and metastasis in human cancer. Although Src is rarely mutated in human prostate cancer, SFK activity is increased in the majority of human prostate cancers. In order to determine the molecular mechanisms governing prostate cancer bone metastasis, FVB murine prostate epithelium was transduced with oncogenic v-Src. The prostate cancer cell lines metastasized in FVB mice to brain and bone. Gene expression profiling of the tumors identified activation of a CCR5 signaling module when the prostate epithelial cells (PEC) lines were grown in vivo vs. tissue cultures. The whole body, bone and brain metastatic prostate cancer burden was reduced by oral CCR5 antagonist. Clinical trials of CCR5 inhibitors may warrant consideration in patients with CCR5 activation in their tumors. PMID:25452256

  17. Contouring variability of human- and deformable-generated contours in radiotherapy for prostate cancer

    NASA Astrophysics Data System (ADS)

    Gardner, Stephen J.; Wen, Ning; Kim, Jinkoo; Liu, Chang; Pradhan, Deepak; Aref, Ibrahim; Cattaneo, Richard, II; Vance, Sean; Movsas, Benjamin; Chetty, Indrin J.; Elshaikh, Mohamed A.

    2015-06-01

    This study was designed to evaluate contouring variability of human-and deformable-generated contours on planning CT (PCT) and CBCT for ten patients with low-or intermediate-risk prostate cancer. For each patient in this study, five radiation oncologists contoured the prostate, bladder, and rectum, on one PCT dataset and five CBCT datasets. Consensus contours were generated using the STAPLE method in the CERR software package. Observer contours were compared to consensus contour, and contour metrics (Dice coefficient, Hausdorff distance, Contour Distance, Center-of-Mass [COM] Deviation) were calculated. In addition, the first day CBCT was registered to subsequent CBCT fractions (CBCTn: CBCT2-CBCT5) via B-spline Deformable Image Registration (DIR). Contours were transferred from CBCT1 to CBCTn via the deformation field, and contour metrics were calculated through comparison with consensus contours generated from human contour set. The average contour metrics for prostate contours on PCT and CBCT were as follows: Dice coefficient—0.892 (PCT), 0.872 (CBCT-Human), 0.824 (CBCT-Deformed); Hausdorff distance—4.75 mm (PCT), 5.22 mm (CBCT-Human), 5.94 mm (CBCT-Deformed); Contour Distance (overall contour)—1.41 mm (PCT), 1.66 mm (CBCT-Human), 2.30 mm (CBCT-Deformed); COM Deviation—2.01 mm (PCT), 2.78 mm (CBCT-Human), 3.45 mm (CBCT-Deformed). For human contours on PCT and CBCT, the difference in average Dice coefficient between PCT and CBCT (approx. 2%) and Hausdorff distance (approx. 0.5 mm) was small compared to the variation between observers for each patient (standard deviation in Dice coefficient of 5% and Hausdorff distance of 2.0 mm). However, additional contouring variation was found for the deformable-generated contours (approximately 5.0% decrease in Dice coefficient and 0.7 mm increase in Hausdorff distance relative to human-generated contours on CBCT). Though deformable contours provide a reasonable starting point for contouring on

  18. 21 CFR 876.5885 - Tissue culture media for human ex vivo tissue and cell culture processing applications.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... cell culture processing applications. 876.5885 Section 876.5885 Food and Drugs FOOD AND DRUG... DEVICES Therapeutic Devices § 876.5885 Tissue culture media for human ex vivo tissue and cell culture processing applications. (a) Identification. Tissue culture media for human ex vivo tissue and cell...

  19. 21 CFR 876.5885 - Tissue culture media for human ex vivo tissue and cell culture processing applications.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... cell culture processing applications. 876.5885 Section 876.5885 Food and Drugs FOOD AND DRUG... DEVICES Therapeutic Devices § 876.5885 Tissue culture media for human ex vivo tissue and cell culture processing applications. (a) Identification. Tissue culture media for human ex vivo tissue and cell...

  20. 21 CFR 876.5885 - Tissue culture media for human ex vivo tissue and cell culture processing applications.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... cell culture processing applications. 876.5885 Section 876.5885 Food and Drugs FOOD AND DRUG... DEVICES Therapeutic Devices § 876.5885 Tissue culture media for human ex vivo tissue and cell culture processing applications. (a) Identification. Tissue culture media for human ex vivo tissue and cell...

  1. 21 CFR 876.5885 - Tissue culture media for human ex vivo tissue and cell culture processing applications.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... cell culture processing applications. 876.5885 Section 876.5885 Food and Drugs FOOD AND DRUG... DEVICES Therapeutic Devices § 876.5885 Tissue culture media for human ex vivo tissue and cell culture processing applications. (a) Identification. Tissue culture media for human ex vivo tissue and cell...

  2. 21 CFR 876.5885 - Tissue culture media for human ex vivo tissue and cell culture processing applications.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... cell culture processing applications. 876.5885 Section 876.5885 Food and Drugs FOOD AND DRUG... DEVICES Therapeutic Devices § 876.5885 Tissue culture media for human ex vivo tissue and cell culture processing applications. (a) Identification. Tissue culture media for human ex vivo tissue and cell...

  3. Transcription Factor Stat3 Stimulates Metastatic Behavior of Human Prostate Cancer Cells in Vivo, whereas Stat5b Has a Preferential Role in the Promotion of Prostate Cancer Cell Viability and Tumor Growth

    PubMed Central

    Gu, Lei; Dagvadorj, Ayush; Lutz, Jacqueline; Leiby, Benjamin; Bonuccelli, Gloria; Lisanti, Michael P.; Addya, Sankar; Fortina, Paolo; Dasgupta, Abhijit; Hyslop, Terry; Bubendorf, Lukas; Nevalainen, Marja T.

    2010-01-01

    Identification of the molecular changes that promote viability and metastatic behavior of prostate cancer is critical for the development of improved therapeutic interventions. Stat5a/b and Stat3 are both constitutively active in locally-confined and advanced prostate cancer, and both transcription factors have been reported to be critical for the viability of prostate cancer cells. We recently showed that Stat3 promotes metastatic behavior of human prostate cancer cells not only in vitro but also in an in vivo experimental metastases model. In this work, we compare side-by-side Stat5a/b versus Stat3 in the promotion of prostate cancer cell viability, tumor growth, and induction of metastatic colonization in vivo. Inhibition of Stat5a/b induced massive death of prostate cancer cells in culture and reduced both subcutaneous and orthotopic prostate tumor growth, whereas Stat3 had a predominant role over Stat5a/b in promoting metastases formation of prostate cancer cells in vivo in nude mice. The molecular mechanisms underlying the differential biological effects induced by these two transcription factors involve largely different sets of genes regulated by Stat5a/b versus Stat3 in human prostate cancer model systems. Of the two Stat5 homologs, Stat5b was more important for supporting growth of prostate cancer cells than Stat5a. This work provides the first mechanistic comparison of the biological effects induced by transcription factors Stat5a/b versus Stat3 in prostate cancer. PMID:20167868

  4. A comparison of isolated circulating tumor cells and tissue biopsies using whole-genome sequencing in prostate cancer

    PubMed Central

    Chen, Jie-Fu; Lin, Millicent; Li, Fuqiang; Wu, Kui; Wu, Hanjie; Lichterman, Jake; Wan, Haolei; Lu, Chia-Lun; OuYang, William; Ni, Ming; Wang, Linlin; Li, Guibo; Lee, Tom; Zhang, Xiuqing; Yang, Jonathan; Rettig, Matthew; Chung, Leland W.K.; Yang, Huanming; Li, Ker-Chau; Hou, Yong; Tseng, Hsian-Rong; Hou, Shuang; Xu, Xun; Wang, Jun; Posadas, Edwin M.

    2015-01-01

    Previous studies have demonstrated focal but limited molecular similarities between circulating tumor cells (CTCs) and biopsies using isolated genetic assays. We hypothesized that molecular similarity between CTCs and tissue exists at the single cell level when characterized by whole genome sequencing (WGS). By combining the NanoVelcro CTC Chip with laser capture microdissection (LCM), we developed a platform for single-CTC WGS. We performed this procedure on CTCs and tissue samples from a patient with advanced prostate cancer who had serial biopsies over the course of his clinical history. We achieved 30X depth and ≥ 95% coverage. Twenty-nine percent of the somatic single nucleotide variations (SSNVs) identified were founder mutations that were also identified in CTCs. In addition, 86% of the clonal mutations identified in CTCs could be traced back to either the primary or metastatic tumors. In this patient, we identified structural variations (SVs) including an intrachromosomal rearrangement in chr3 and an interchromosomal rearrangement between chr13 and chr15. These rearrangements were shared between tumor tissues and CTCs. At the same time, highly heterogeneous short structural variants were discovered in PTEN, RB1, and BRCA2 in all tumor and CTC samples. Using high-quality WGS on single-CTCs, we identified the shared genomic alterations between CTCs and tumor tissues. This approach yielded insight into the heterogeneity of the mutational landscape of SSNVs and SVs. It may be possible to use this approach to study heterogeneity and characterize the biological evolution of a cancer during the course of its natural history. PMID:26575023

  5. A comparison of isolated circulating tumor cells and tissue biopsies using whole-genome sequencing in prostate cancer.

    PubMed

    Jiang, Runze; Lu, Yi-Tsung; Ho, Hao; Li, Bo; Chen, Jie-Fu; Lin, Millicent; Li, Fuqiang; Wu, Kui; Wu, Hanjie; Lichterman, Jake; Wan, Haolei; Lu, Chia-Lun; OuYang, William; Ni, Ming; Wang, Linlin; Li, Guibo; Lee, Tom; Zhang, Xiuqing; Yang, Jonathan; Rettig, Matthew; Chung, Leland W K; Yang, Huanming; Li, Ker-Chau; Hou, Yong; Tseng, Hsian-Rong; Hou, Shuang; Xu, Xun; Wang, Jun; Posadas, Edwin M

    2015-12-29

    Previous studies have demonstrated focal but limited molecular similarities between circulating tumor cells (CTCs) and biopsies using isolated genetic assays. We hypothesized that molecular similarity between CTCs and tissue exists at the single cell level when characterized by whole genome sequencing (WGS). By combining the NanoVelcro CTC Chip with laser capture microdissection (LCM), we developed a platform for single-CTC WGS. We performed this procedure on CTCs and tissue samples from a patient with advanced prostate cancer who had serial biopsies over the course of his clinical history. We achieved 30X depth and ≥ 95% coverage. Twenty-nine percent of the somatic single nucleotide variations (SSNVs) identified were founder mutations that were also identified in CTCs. In addition, 86% of the clonal mutations identified in CTCs could be traced back to either the primary or metastatic tumors. In this patient, we identified structural variations (SVs) including an intrachromosomal rearrangement in chr3 and an interchromosomal rearrangement between chr13 and chr15. These rearrangements were shared between tumor tissues and CTCs. At the same time, highly heterogeneous short structural variants were discovered in PTEN, RB1, and BRCA2 in all tumor and CTC samples. Using high-quality WGS on single-CTCs, we identified the shared genomic alterations between CTCs and tumor tissues. This approach yielded insight into the heterogeneity of the mutational landscape of SSNVs and SVs. It may be possible to use this approach to study heterogeneity and characterize the biological evolution of a cancer during the course of its natural history. PMID:26575023

  6. Clinical Evaluation of Positioning Verification Using Digital Tomosynthesis and Bony Anatomy and Soft Tissues for Prostate Image-Guided Radiotherapy

    SciTech Connect

    Yoo, Sua Wu, Q. Jackie; Godfrey, Devon; Yan Hui; Ren Lei; Das, Shiva; Lee, William R.; Yin Fangfang

    2009-01-01

    Purpose: To evaluate on-board digital tomosynthesis (DTS) for patient positioning vs. two-dimensional (2D) radiography and three-dimensional cone beam (CBCT). Methods and Materials: A total of 92 image sessions from 9 prostate cancer patients were analyzed. An on-board image set was registered to a corresponding reference image set. Four pairs of image sets were used: digitally reconstructed radiographs vs. on-board orthogonal paired radiographs for the 2D method, coronal-reference DTS vs. on-board coronal DTS for the coronal-DTS method, sagittal-reference DTS vs. on-board sagittal DTS for the sagittal-DTS method, and planning CT vs. CBCT for the CBCT method. The registration results were compared. Results: The systematic errors in all methods were <1 mm/1{sup o}. When registering the bony anatomy, the mean vector difference was 0.21 {+-} 0.11 cm between 2D and CBCT, 0.11 {+-} 0.08 cm between CBCT and coronal DTS, and 0.14 {+-} 0.07 cm between CBCT and sagittal DTS. The correlation between CBCT to DTS was stronger (coefficient = 0.92-0.95) than the correlation between 2D and CBCT or DTS (coefficient = 0.81-0.83). When registering the soft tissue, the mean vector difference was 0.18 {+-} 0.11 cm between CBCT and coronal DTS and 0.29 {+-} 0.17 cm between CBCT and sagittal DTS. The correlation coefficient of CBCT to sagittal DTS and to coronal DTS was 0.84 and 0.92, respectively. Conclusion: DTS could provide equivalent results to CBCT when the bony anatomy is used as landmarks for prostate image-guided radiotherapy. For soft tissue-based positioning verification, coronal DTS produced equivalent results to CBCT, but sagittal DTS alone was insufficient. DTS could allow for comparable soft tissue-based target localization with faster scanning time and a lower imaging dose compared with CBCT.

  7. Mineralized human primary osteoblast matrices as a model system to analyse interactions of prostate cancer cells with the bone microenvironment.

    PubMed

    Reichert, Johannes C; Quent, Verena M C; Burke, Leslie J; Stansfield, Scott H; Clements, Judith A; Hutmacher, Dietmar W

    2010-11-01

    Prostate cancer metastasis is reliant on the reciprocal interactions between cancer cells and the bone niche/micro-environment. The production of suitable matrices to study metastasis, carcinogenesis and in particular prostate cancer/bone micro-environment interaction has been limited to specific protein matrices or matrix secreted by immortalised cell lines that may have undergone transformation processes altering signaling pathways and modifying gene or receptor expression. We hypothesize that matrices produced by primary human osteoblasts are a suitable means to develop an in vitro model system for bone metastasis research mimicking in vivo conditions. We have used a decellularized matrix secreted from primary human osteoblasts as a model for prostate cancer function in the bone micro-environment. We show that this collagen I rich matrix is of fibrillar appearance, highly mineralized, and contains proteins, such as osteocalcin, osteonectin and osteopontin, and growth factors characteristic of bone extracellular matrix (ECM). LNCaP and PC3 cells grown on this matrix, adhere strongly, proliferate, and express markers consistent with a loss of epithelial phenotype. Moreover, growth of these cells on the matrix is accompanied by the induction of genes associated with attachment, migration, increased invasive potential, Ca(2+) signaling and osteolysis. In summary, we show that growth of prostate cancer cells on matrices produced by primary human osteoblasts mimics key features of prostate cancer bone metastases and thus is a suitable model system to study the tumor/bone micro-environment interaction in this disease. PMID:20688384

  8. Reduced Activity of Double-Strand Break Repair Genes in Prostate Cancer Patients With Late Normal Tissue Radiation Toxicity

    SciTech Connect

    Oorschot, Bregje van; Hovingh, Suzanne E.; Moerland, Perry D.; Medema, Jan Paul; Stalpers, Lukas J.A.; Vrieling, Harry; Franken, Nicolaas A.P.

    2014-03-01

    Purpose: To investigate clinical parameters and DNA damage response as possible risk factors for radiation toxicity in the setting of prostate cancer. Methods and Materials: Clinical parameters of 61 prostate cancer patients, 34 with (overresponding, OR) and 27 without (non-responding, NR) severe late radiation toxicity were assembled. In addition, for a matched subset the DNA damage repair kinetics (γ-H2AX assay) and expression profiles of DNA repair genes were determined in ex vivo irradiated lymphocytes. Results: Examination of clinical data indicated none of the considered clinical parameters to be correlated with the susceptibility of patients to develop late radiation toxicity. Although frequencies of γ-H2AX foci induced immediately after irradiation were similar (P=.32), significantly higher numbers of γ-H2AX foci were found 24 hours after irradiation in OR compared with NR patients (P=.03). Patient-specific γ-H2AX foci decay ratios were significantly higher in NR patients than in OR patients (P<.0001). Consequently, NR patients seem to repair DNA double-strand breaks (DSBs) more efficiently than OR patients. Moreover, gene expression analysis indicated several genes of the homologous recombination pathway to be stronger induced in NR compared with OR patients (P<.05). A similar trend was observed in genes of the nonhomologous end-joining repair pathway (P=.09). This is congruent with more proficient repair of DNA DSBs in patients without late radiation toxicity. Conclusions: Both gene expression profiling and DNA DSB repair kinetics data imply that less-efficient repair of radiation-induced DSBs may contribute to the development of late normal tissue damage. Induction levels of DSB repair genes (eg, RAD51) may potentially be used to assess the risk for late radiation toxicity.

  9. mRNA distribution analysis of human TRPC family in CNS and peripheral tissues.

    PubMed

    Riccio, Antonio; Medhurst, Andrew D; Mattei, Cesar; Kelsell, Rosemary E; Calver, Andrew R; Randall, Andrew D; Benham, Christopher D; Pangalos, Menelas N

    2002-12-30

    The mammalian homologues of the Drosophila transient receptor potential (TRP) channel are plasma membrane proteins involved in the regulation of cellular Ca(2+) influx. These ion channels can be activated subsequent to either depletion of Ca(2+) from internal stores or through receptor-mediated processes. The mRNA expression patterns of several individual mammalian short transient receptor potential channels (TRPCs) have been described. Cross-comparisons between these data, however, are at best difficult predominantly due to the non-quantitative methods used. Furthermore there is limited data on the expression of TRPC family members in human tissues. In the present study we used a single technique, namely TaqMan real-time quantitative RT-PCR, to investigate the mRNA distribution of human TRPC1, TRPC3, TRPC4, TRPC5, TRPC6 and TRPC7 (hTRPCs) in discrete human brain areas, peripheral tissues as well as a panel of cell-lines. All hTRPCs studied were widely expressed within CNS and significant peripheral expression was often observed. Despite this, each channel exhibited a distinctive hallmark distribution profile. hTRPC1 was widely expressed in CNS and peripheral tissues, whereas hTRPC3 and hTRPC5 were predominantly expressed in tissues of CNS. hTRPC4 mRNA was detected in CNS and certain peripheral tissues such as bone, heart and prostate. hTRPC6 was homogeneously expressed throughout the CNS and peripheral tissues with the highest levels in placenta and lung. hTRPC7 mRNA was also broadly expressed in CNS as well as some peripheral tissues. The pattern of expression of the TRPCs was quite different in the various cell lines examined. TRPC3 and TRPC6 were selectively present in HEK-293 cells whilst TRPC1 was broadly distributed in the cell lines analyzed. In contrast TRPC4 and TRPC5 mRNAs were predominantly expressed in HK-2 and HEK-293 cell lines respectively. TRPC7 was selectively expressed in COS-1, COS-7 and HK-2 cell lines. These results show tissue- and cell

  10. 78 FR 44134 - Submission for OMB Review; 30-day Comment Request: Financial Sustainability of Human Tissue...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-23

    ...: Financial Sustainability of Human Tissue Biobanking (NCI) SUMMARY: Under the provisions of Section 3507(a)(1... Collection: Financial Sustainability of Human Tissue Biobanking, 0925-NEW, National Cancer Institute...

  11. Predicting tissue-specific enhancers in the human genome

    PubMed Central

    Pennacchio, Len A.; Loots, Gabriela G.; Nobrega, Marcelo A.; Ovcharenko, Ivan

    2007-01-01

    Determining how transcriptional regulatory signals are encoded in vertebrate genomes is essential for understanding the origins of multicellular complexity; yet the genetic code of vertebrate gene regulation remains poorly understood. In an attempt to elucidate this code, we synergistically combined genome-wide gene-expression profiling, vertebrate genome comparisons, and transcription factor binding-site analysis to define sequence signatures characteristic of candidate tissue-specific enhancers in the human genome. We applied this strategy to microarray-based gene expression profiles from 79 human tissues and identified 7187 candidate enhancers that defined their flanking gene expression, the majority of which were located outside of known promoters. We cross-validated this method for its ability to de novo predict tissue-specific gene expression and confirmed its reliability in 57 of the 79 available human tissues, with an average precision in enhancer recognition ranging from 32% to 63% and a sensitivity of 47%. We used the sequence signatures identified by this approach to successfully assign tissue-specific predictions to ∼328,000 human–mouse conserved noncoding elements in the human genome. By overlapping these genome-wide predictions with a data set of enhancers validated in vivo, in transgenic mice, we were able to confirm our results with a 28% sensitivity and 50% precision. These results indicate the power of combining complementary genomic data sets as an initial computational foray into a global view of tissue-specific gene regulation in vertebrates. PMID:17210927

  12. Testosterone metabolism of fibroblasts grown from prostatic carcinoma, benign prostatic hyperplasia and skin fibroblasts

    SciTech Connect

    Schweikert, H.U.; Hein, H.J.; Romijn, J.C.; Schroeder, F.H.

    1982-02-01

    The metabolism of (1,2,6,7-3H)testosterone was assessed in fibroblast monolayers derived from tissue of 5 prostates with benign hyperplasia (BPH), 4 prostates with carcinoma (PC), and 3 biopsy samples of skin, 2 nongenital skin (NG) and 1 genital skin. The following metabolites could be identified: androstanedione androstenedione, dihydrotestosterone, androsterone, epiandrosterone, androstane-3 alpha, 17 beta-diol and androstane-3 beta, 17 beta-diol. Testosterone was metabolized much more rapidly in fibroblasts originating from prostatic tissue than in fibroblasts derived from NG. A significantly higher formation of 5 alpha-androstanes and 3 alpha-hydroxysteroids could be observed in fibroblasts from BPH as compared to PC. 17-ketosteroid formation exceeded 5 alpha-androstane formation in BPH, whereas 5 alpha-reduction was the predominant pathway in fibroblasts grown from PC and NG. Since testosterone metabolism in fibroblasts of prostatic origin therefore resembles in many aspects that in whole prostatic tissue, fibroblasts grown from prostatic tissues might be a valuable tool for further investigation of the pathogenesis of human BPH and PC.

  13. Comparison of normal tissue pharmacokinetics with {sup 111}In/{sup 9}Y monoclonal antibody m170 for breast and prostate cancer

    SciTech Connect

    Lehmann, Joerg; O'Donnell, Robert T.; Richman, Carol M. . E-mail: sjdenardo@ucdavis.edu

    2006-11-15

    Purpose: Radioactivity deposition in normal tissues limits the dose deliverable by radiopharmaceuticals (RP) in radioimmunotherapy (RIT). This study investigated the absorbed radiation dose in normal tissues for prostate cancer patients in comparison to breast cancer patients for 2 RPs using the monoclonal antibody (MAb) m170. Methods and Materials: {sup 111}In-DOTA-glycylglycylglycyl-L-p-isothiocyanatophenylalanine amide (GGGF)-m170 and {sup 111}In-1,4,7,10-tetraazacyclododecane-N,N',N'',N'''-tetraacetic acid (DOTA) 2-iminothiolane (2IT)-m170, representing the same MAb and chelate with and without a cleavable linkage, were studied in 13 breast cancer and 26 prostate cancer patients. Dosimetry for {sup 9}Y was calculated using {sup 111}In MAb pharmacokinetics from the initial imaging study for each patient, using reference man- and patient-specific masses. Results: The reference man-specific radiation doses (cGy/MBq) were not significantly different for the breast and the prostate cancer patients for both RPs in all but one tissue-RP combination (liver, DOTA-2IT). The patient-specific doses had differences between the groups most of which can be related to weight differences. Conclusions: Similar normal tissue doses were calculated for two groups of patients having different cancers and genders. This similarity combined with continued careful analysis of the imaging data might allow the use of higher starting doses in early phase RIT studies.

  14. Predicting Tissue-Specific Enhancers in the Human Genome

    SciTech Connect

    Pennacchio, Len A.; Loots, Gabriela G.; Nobrega, Marcelo A.; Ovcharenko, Ivan

    2006-07-01

    Determining how transcriptional regulatory signals areencoded in vertebrate genomes is essential for understanding the originsof multi-cellular complexity; yet the genetic code of vertebrate generegulation remains poorly understood. In an attempt to elucidate thiscode, we synergistically combined genome-wide gene expression profiling,vertebrate genome comparisons, and transcription factor binding siteanalysis to define sequence signatures characteristic of candidatetissue-specific enhancers in the human genome. We applied this strategyto microarray-based gene expression profiles from 79 human tissues andidentified 7,187 candidate enhancers that defined their flanking geneexpression, the majority of which were located outside of knownpromoters. We cross-validated this method for its ability to de novopredict tissue-specific gene expression and confirmed its reliability in57 of the 79 available human tissues, with an average precision inenhancer recognition ranging from 32 percent to 63 percent, and asensitivity of 47 percent. We used the sequence signatures identified bythis approach to assign tissue-specific predictions to ~;328,000human-mouse conserved noncoding elements in the human genome. Byoverlapping these genome-wide predictions with a large in vivo dataset ofenhancers validated in transgenic mice, we confirmed our results with a28 percent sensitivity and 50 percent precision. These results indicatethe power of combining complementary genomic datasets as an initialcomputational foray into the global view of tissue-specific generegulation in vertebrates.

  15. Optical coherence elastography (OCE) as a method for identifying benign and malignant prostate biopsies

    NASA Astrophysics Data System (ADS)

    Li, Chunhui; Guan, Guangying; Ling, Yuting; Lang, Stephen; Wang, Ruikang K.; Huang, Zhihong; Nabi, Ghulam

    2015-03-01

    Objectives. Prostate cancer is the most frequently diagnosed malignancy in men. Digital rectal examination (DRE) - a known clinical tool based on alteration in the mechanical properties of tissues due to cancer has traditionally been used for screening prostate cancer. Essentially, DRE estimates relative stiffness of cancerous and normal prostate tissue. Optical coherence elastography (OCE) are new optical imaging techniques capable of providing cross-sectional imaging of tissue microstructure as well as elastogram in vivo and in real time. In this preliminary study, OCE was used in the setting of the human prostate biopsies ex vivo, and the images acquired were compared with those obtained using standard histopathologic methods. Methods. 120 prostate biopsies were obtained by TRUS guided needle biopsy procedures from 9 patients with clinically suspected cancer of the prostate. The biopsies were approximately 0.8mm in diameter and 12mm in length, and prepared in Formalin solution. Quantitative assessment of biopsy samples using OCE was obtained in kilopascals (kPa) before histopathologic evaluation. The results obtained from OCE and standard histopathologic evaluation were compared provided the cross-validation. Sensitivity, specificity, and positive and negative predictive values were calculated for OCE (histopathology was a reference standard). Results. OCE could provide quantitative elasticity properties of prostate biopsies within benign prostate tissue, prostatic intraepithelial neoplasia, atypical hyperplasia and malignant prostate cancer. Data analysed showed that the sensitivity and specificity of OCE for PCa detection were 1 and 0.91, respectively. PCa had significantly higher stiffness values compared to benign tissues, with a trend of increasing in stiffness with increasing of malignancy. Conclusions. Using OCE, microscopic resolution elastogram is promising in diagnosis of human prostatic diseases. Further studies using this technique to improve the

  16. The use of matrix coating assisted by an electric field (MCAEF) to enhance mass spectrometric imaging of human prostate cancer biomarkers.

    PubMed

    Wang, Xiaodong; Han, Jun; Hardie, Darryl B; Yang, Juncong; Borchers, Christoph H

    2016-01-01

    In this work, we combined a newly developed matrix coating technique - matrix coating assisted by an electric field (MCAEF) and matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) to enhance the imaging of peptides and proteins in tissue specimens of human prostate cancer. MCAEF increased the signal-to-noise ratios of the detected proteins by a factor of 2 to 5, and 232 signals were detected within the m/z 3500-37500 mass range on a time-of-flight mass spectrometer and with the sinapinic acid MALDI matrix. Among these species, three proteins (S100-A9, S100-A10, and S100-A12) were only observed in the cancerous cell region and 14 proteins, including a fragment of mitogen-activated protein kinase/extracellular signal-regulated kinase kinase kinase 2, a fragment of cAMP-regulated phosphoprotein 19, 3 apolipoproteins (C-I, A-I, and A-II), 2 S100 proteins (A6 and A8), β-microseminoprotein, tumor protein D52, α-1-acid glycoprotein 1, heat shock protein β-1, prostate-specific antigen, and 2 unidentified large peptides at m/z 5002.2 and 6704.2, showed significantly differential distributions at the p < 0.05 (t-test) level between the cancerous and the noncancerous regions of the tissue. Among these 17 species, the distributions of apolipoprotein C-I, S100-A6, and S100-A8 were verified by immunohistological staining. In summary, this study resulted in the imaging of the largest group of proteins in prostate cancer tissues by MALDI-MS reported thus far, and is the first to show a correlation between S100 proteins and prostate cancer in a MS imaging study. The successful imaging of the three proteins only found in the cancerous tissues, as well as those showing differential expressions demonstrated the potential of MCAEF-MALDI/MS for the in situ detection of potential cancer biomarkers. Copyright © 2015 John Wiley & Sons, Ltd. PMID:26757076

  17. The retinoblastoma tumor suppressor controls androgen signaling and human prostate cancer progression.

    PubMed

    Sharma, Ankur; Yeow, Wen-Shuz; Ertel, Adam; Coleman, Ilsa; Clegg, Nigel; Thangavel, Chellappagounder; Morrissey, Colm; Zhang, Xiaotun; Comstock, Clay E S; Witkiewicz, Agnieszka K; Gomella, Leonard; Knudsen, Erik S; Nelson, Peter S; Knudsen, Karen E

    2010-12-01

    Retinoblastoma (RB; encoded by RB1) is a tumor suppressor that is frequently disrupted in tumorigenesis and acts in multiple cell types to suppress cell cycle progression. The role of RB in tumor progression, however, is poorly defined. Here, we have identified a critical role for RB in protecting against tumor progression through regulation of targets distinct from cell cycle control. In analyses of human prostate cancer samples, RB loss was infrequently observed in primary disease and was predominantly associated with transition to the incurable, castration-resistant state. Further analyses revealed that loss of the RB1 locus may be a major mechanism of RB disruption and that loss of RB function was associated with poor clinical outcome. Modeling of RB dysfunction in vitro and in vivo revealed that RB controlled nuclear receptor networks critical for tumor progression and that it did so via E2F transcription factor 1-mediated regulation of androgen receptor (AR) expression and output. Through this pathway, RB depletion induced unchecked AR activity that underpinned therapeutic bypass and tumor progression. In agreement with these findings, disruption of the RB/E2F/nuclear receptor axis was frequently observed in the transition to therapy resistance in human disease. Together, these data reveal what we believe to be a new paradigm for RB function in controlling prostate tumor progression and lethal tumor phenotypes. PMID:21099110

  18. A Prospective Randomized Trial of Two Different Prostate Biopsy Schemes

    ClinicalTrials.gov

    2016-07-03

    Prostate Cancer; Local Anesthesia; Prostate-Specific Antigen/Blood; Biopsy/Methods; Image-guided Biopsy/Methods; Prostatic Neoplasms/Diagnosis; Prostate/Pathology; Prospective Studies; Humans; Male; Ultrasonography, Interventional/Methods

  19. Engineered human broncho-epithelial tissue-like assemblies

    NASA Technical Reports Server (NTRS)

    Goodwin, Thomas J. (Inventor)

    2012-01-01

    Three-dimensional human broncho-epithelial tissue-like assemblies (TLAs) are produced in a rotating wall vessel (RWV) with microcarriers by coculturing mesenchymal bronchial-tracheal cells (BTC) and bronchial epithelium cells (BEC). These TLAs display structural characteristics and express markers of in vivo respiratory epithelia. TLAs are useful for screening compounds active in lung tissues such as antiviral compounds, cystic fibrosis treatments, allergens, and cytotoxic compounds.