Science.gov

Sample records for human prostate tissue

  1. Monitoring changes in tissue optical properties following interstitial photothermal therapy of ex vivo human prostate tissue

    NASA Astrophysics Data System (ADS)

    Weersink, Robert A.; He, Jie; Veilleux, Israel; Trachtenberg, John; Wilson, Brian C.

    2013-03-01

    We are developing a method of monitoring treatment progression of interstitial photothermal therapy of focal prostate cancer using transrectal diffuse optical tomography (TRDOT) combined with transrectal 3D ultrasound (3D-TRUS). Measurements of prostate tissue optical properties were made on ex vivo human prostate samples prior to and post coagulation. Interstitial photothermal treatments were delivered to the ex vivo samples and monitored using an interstitial probe near the treatment fiber. After treatment, bulk optical properties were measured on native and coagulated zones of tissue. Changes in optical properties across the boundary between native and coagulated tissues were spatially mapped using a small diffuse reflectance probe. The optical property estimates and spatial information obtained using each method was compared.

  2. Beta-catenin is elevated in human benign prostatic hyperplasia specimens compared to histologically normal prostate tissue

    PubMed Central

    Bauman, Tyler M; Vezina, Chad M; Huang, Wei; Marker, Paul C; Peterson, Richard E; Ricke, William A

    2014-01-01

    Benign prostatic hyperplasia (BPH) is linked to lower urinary tract symptoms (LUTS) such as incomplete bladder emptying, urinary frequency and urgency. Mechanisms responsible for BPH are not fully known. Here, we tested whether beta-catenin (CTNNB1) immunostaining intensity and distribution differ in human glandular BPH tissue specimens compared to normal prostate tissue. Multiplex immunostaining of CTNNB1, its putative transcriptional target gene lymphoid enhancer binding factor 1 (LEF1), and the epithelial marker E-cadherin were examined in clinical human prostate specimens with or without histological BPH (pure epithelial or mixed stromal-epithelial nodules). BPH specimens were obtained from 24 men who experienced LUTS and underwent transurethral resection of the prostate surgery. Control specimens were tumor-adjacent histologically normal prostate tissue from 48 patients who underwent radical prostatectomy. The resulting multispectral images were unmixed and optical densities recorded to quantify staining abundance, cellular (membranous, cytoplasmic, and nuclear) and tissue localization (stromal versus epithelial), and determination of percentage of CTNNB1-positive cells. The following CTNNB1 indices were significantly higher in BPH compared to normal prostate tissue: overall staining intensity, staining intensity in prostate stromal cell membranes, cytoplasm and nuclei, and prostate epithelial cell nuclei. The following LEF1 indices were significantly lower in BPH compared to tumor-adjacent normal prostate tissue: stromal LEF1 staining intensity, percentage of LEF1-positive stromal cells, and intensity of LEF1 staining in stromal cell membranes, cytoplasm, and nuclei. The percentage of stromal cells with CTNNB1+/LEF1- nuclei was higher and percentage of stromal cells with CTNNB1-/LEF1+ nuclei was lower in BPH compared to tumor-adjacent normal prostate tissues. These results support the hypothesis that CTNNB1 expression increases in specific BPH tissue

  3. Obesity and prostate cancer: gene expression signature of human periprostatic adipose tissue

    PubMed Central

    2012-01-01

    Background Periprostatic (PP) adipose tissue surrounds the prostate, an organ with a high predisposition to become malignant. Frequently, growing prostatic tumor cells extend beyond the prostatic organ towards this fat depot. This study aimed to determine the genome-wide expression of genes in PP adipose tissue in obesity/overweight (OB/OW) and prostate cancer patients. Methods Differentially expressed genes in human PP adipose tissue were identified using microarrays. Analyses were conducted according to the donors' body mass index characteristics (OB/OW versus lean) and prostate disease (extra prostatic cancer versus organ confined prostate cancer versus benign prostatic hyperplasia). Selected genes with altered expression were validated by real-time PCR. Ingenuity Pathway Analysis (IPA) was used to investigate gene ontology, canonical pathways and functional networks. Results In the PP adipose tissue of OB/OW subjects, we found altered expression of genes encoding molecules involved in adipogenic/anti-lipolytic, proliferative/anti-apoptotic, and mild immunoinflammatory processes (for example, FADS1, down-regulated, and LEP and ANGPT1, both up-regulated). Conversely, in the PP adipose tissue of subjects with prostate cancer, altered genes were related to adipose tissue cellular activity (increased cell proliferation/differentiation, cell cycle activation and anti-apoptosis), whereas a downward impact on immunity and inflammation was also observed, mostly related to the complement (down-regulation of CFH). Interestingly, we found that the microRNA MIRLET7A2 was overexpressed in the PP adipose tissue of prostate cancer patients. Conclusions Obesity and excess adiposity modified the expression of PP adipose tissue genes to ultimately foster fat mass growth. In patients with prostate cancer the expression profile of PP adipose tissue accounted for hypercellularity and reduced immunosurveillance. Both findings may be liable to promote a favorable environment for

  4. Long term organ culture of human prostate tissue in a NASA-designed rotating wall bioreactor

    NASA Technical Reports Server (NTRS)

    Margolis, L.; Hatfill, S.; Chuaqui, R.; Vocke, C.; Emmert-Buck, M.; Linehan, W. M.; Duray, P. H.

    1999-01-01

    PURPOSE: To maintain ex vivo integral prostatic tissue including intact stromal and ductal elements using the NASA-designed Rotating Wall Vessel (RWV) which maintains colocalized cells in an environment that promotes both three-dimensional cellular interactions together with the uniform mass transfer of nutrients and metabolic wastes. MATERIALS AND METHODS: Samples of normal prostate were obtained as a byproduct of transurethral prostatectomy or needle biopsy. Prostatic tissue dissected into small 1 x 1 mm. blocks was cultured in the Rotating Wall Vessel (RWV) Bioreactor for various time periods and analyzed using histological, immunochemical, and total cell RNA assays. RESULTS: We report the long term maintenance of benign explanted human prostate tissue grown in simple culture medium, under the simulated microgravity conditions afforded by the RWV bioreactor. Mesenchymal stromal elements including blood vessels and architecturally preserved tubuloglandular acini were maintained for a minimum of 28 days. Cytokeratins, vimentin and TGF-beta2 receptor and ligand were preserved through the entire culture period as revealed by immunocytochemistry. Prostatic acid phosphatase (PAP) was continuously expressed during the culture period, although somewhat decreased. Prostatic specific antigen (PSA) and its transcript were down regulated over time of culture. Prostatic carcinoma cells from the TSU cell line were able to invade RWV-cultured benign prostate tissue explants. CONCLUSIONS: The RWV bioreactor represents an additional new technology for culturing prostate tissue for further investigations concerning the basic physiology and pathobiology of this clinically important tissue.

  5. Loss of estrogen receptor beta expression in malignant human prostate cells in primary cultures and in prostate cancer tissues.

    PubMed

    Pasquali, D; Rossi, V; Esposito, D; Abbondanza, C; Puca, G A; Bellastella, A; Sinisi, A A

    2001-05-01

    The aim of this study was to investigate the expression of estrogen receptor (ER) beta and alpha genes in normal (N) and malignant (C) primary cultures of human prostate epithelial cells (PEC) and fibroblasts (PFC) and in the prostate tissue donors. Both ERbeta and ERalpha messenger ribonucleic acids were found by RT-PCR analysis in six NPECs and normal prostate tissues and in only one of six CPECs and in the respective cancer tissue donor. The other five CPECs and related cancer tissue donors and all normal and cancer PFCs expressed ERalpha messenger ribonucleic acid alone. Immunoblot analysis, using a polyclonal anti-ERbeta (C-terminal) antibody, demonstrated ERbeta protein in all NPEC lysates and in one of the six CPECS: ERalpha protein was expressed in both NPECs and CPECs when a polyclonal antibody directed against the ERalpha N-terminal domain was used. In contrast, ERalpha protein was not detected in two of the six CPEC lysates when ERalpha C-terminal monoclonal antibodies were used. Using a set of primers designed to amplify the region from exons 6-8, RT-PCR analysis demonstrated the absence of the expected transcript in these cells. The present study shows that the ERbeta gene is expressed together with ERalpha in normal prostates and NPECs, whereas it is barely detectable in prostate cancer and CPECS: Moreover, in some CPECs, the ERalpha gene may be transcribed in a changed protein, resulting from the expression of a deletion variant. Together, these data suggest that prostate malignancy is associated with a potential disorder of ER-mediated pathways. PMID:11344205

  6. Expression and functional study of estrogen receptor-related receptors in human prostatic cells and tissues.

    PubMed

    Cheung, C P; Yu, Shan; Wong, K B; Chan, L W; Lai, Fernand M M; Wang, Xianghong; Suetsugi, Masatomo; Chen, Shiuan; Chan, Franky L

    2005-03-01

    Estrogen receptor-related receptors (ERRs; alpha, beta, gamma) are orphan nuclear receptors and constitutively active without binding to estrogen. Like estrogen receptors (ERs), ERRs bind to estrogen receptor elements and estrogen receptor element-related repeats. Growing evidence suggests that ERRs can cross-talk with ERs in different cell types via competition for DNA sites and coactivators. We hypothesize that ERRs might play regulatory roles in normal and neoplastic prostatic cells by sharing similar ER-mediated pathways or acting independently. In this study, we investigated mRNA and protein expression patterns of three ERR members in normal human prostate epithelial cells, established cell lines, cancer xenografts, and prostatic tissues. Additionally, effects of transient transfection of ERRs on prostatic cell proliferation and ER expression were also examined. RT-PCR showed that ERRalpha and ERRgamma transcripts were detected in most cell lines and xenografts, whereas ERRbeta was detected in normal epithelial cells and few immortalized cell lines but not in most cancer lines. Similar results were demonstrated in clinical prostatic specimens. Western blottings and immunohistochemistry confirmed similar expression patterns that ERR proteins were detected as nuclear proteins in epithelial cells, whereas their expressions became reduced or undetected in neoplastic prostatic cells. Transient transfection confirmed that ERRs were expressed in prostatic cells as nuclear proteins and transcriptionally active in the absence of estradiol. Transfection results showed that overexpression of ERRs inhibited cell proliferation and repressed ERalpha transcription in PC-3 cells. Our study shows that ERRs, which are coexpressed with ERs in prostatic cells, could regulate cell growth and modulate ER-mediated pathways via interference on ERalpha transcription in prostatic cells. PMID:15598686

  7. Multiphoton gradient index endoscopy for evaluation of diseased human prostatic tissue ex vivo

    NASA Astrophysics Data System (ADS)

    Huland, David M.; Jain, Manu; Ouzounov, Dimitre G.; Robinson, Brian D.; Harya, Diana S.; Shevchuk, Maria M.; Singhal, Paras; Xu, Chris; Tewari, Ashutosh K.

    2014-11-01

    Multiphoton microscopy can instantly visualize cellular details in unstained tissues. Multiphoton probes with clinical potential have been developed. This study evaluates the suitability of multiphoton gradient index (GRIN) endoscopy as a diagnostic tool for prostatic tissue. A portable and compact multiphoton endoscope based on a 1-mm diameter, 8-cm length GRIN lens system probe was used. Fresh ex vivo samples were obtained from 14 radical prostatectomy patients and benign and malignant areas were imaged and correlated with subsequent H&E sections. Multiphoton GRIN endoscopy images of unfixed and unprocessed prostate tissue at a subcellular resolution are presented. We note several differences and identifying features of benign versus low-grade versus high-grade tumors and are able to identify periprostatic tissues such as adipocytes, periprostatic nerves, and blood vessels. Multiphoton GRIN endoscopy can be used to identify both benign and malignant lesions in ex vivo human prostate tissue and may be a valuable diagnostic tool for real-time visualization of suspicious areas of the prostate.

  8. Penetration of piperacillin-tazobactam into human prostate tissue and dosing considerations for prostatitis based on site-specific pharmacokinetics and pharmacodynamics.

    PubMed

    Kobayashi, Ikuo; Ikawa, Kazuro; Nakamura, Kogenta; Nishikawa, Genya; Kajikawa, Keishi; Yoshizawa, Takahiko; Watanabe, Masahito; Kato, Yoshiharu; Zennami, Kenji; Kanao, Kent; Tobiume, Motoi; Yamada, Yoshiaki; Mitsui, Kenji; Narushima, Masahiro; Morikawa, Norifumi; Sumitomo, Makoto

    2015-08-01

    This study aimed to investigate the penetration of PIPC-TAZ into human prostate, and to assess effectiveness of PIPC-TAZ against prostatitis by evaluating site-specific PK-PD. Patients with prostatic hypertrophy (n = 47) prophylactically received a 0.5 h infusion of PIPC-TAZ (8:1.2-0.25 g or 4-0.5 g) before transurethral resection of the prostate. PIPC-TAZ concentrations in plasma (0.5-5 h) and prostate tissue (0.5-1.5 h) were analyzed with a three-compartment PK model. The estimated model parameters were, then used to estimate the drug exposure time above the minimum inhibitory concentration for bacteria (T > MIC, the PD indicator for antibacterial effects) in prostate tissue for six PIPC-TAZ regimens (2.25 or 4.5 g; once, twice, three times or four times daily; 0.5 h infusions). Prostate tissue/plasma ratio of PIPC was about 36% both for the maximum drug concentration (Cmax) and the area under the drug concentration-time curve (AUC). Against MIC distributions for isolates of Escherichia coli, Klebsiella species and Proteus species, regimens of 4.5 g twice daily and 2.25 g three times daily achieved a >90% probability of attaining the bacteriostatic target for PIPC (30% T > MIC) in prostate tissue; regimens of 4.5 g three times daily and 2.25 g four times daily achieved a >90% probability of attaining the bactericidal target for PIPC (50% T > MIC) in prostate tissue. However, against Pseudomonas aeruginosa isolates, none of the tested regimens achieved a >90% probability. PIPC-TAZ is appropriate for the treatment of prostatitis from the site-specific PK-PD perspective. PMID:26050020

  9. Optimization and comprehensive characterization of a faithful tissue culture model of the benign and malignant human prostate.

    PubMed

    Maund, Sophia Lisette; Nolley, Rosalie; Peehl, Donna Mae

    2014-02-01

    Few preclinical models accurately depict normal human prostate tissue or primary prostate cancer (PCa). In vitro systems typically lack complex cellular interactions among structured prostatic epithelia and a stromal microenvironment, and genetic and molecular fidelity are concerns in both in vitro and in vivo models. 'Tissue slice cultures' (TSCs) provide realistic preclinical models of diverse tissues and organs, but have not been fully developed or widely utilized for prostate studies. Problems encountered include degeneration of differentiated secretory cells, basal cell hyperplasia, and poor survival of PCa. Here, we optimized, characterized, and applied a TSC model of primary human PCa and benign prostate tissue that overcomes many deficiencies of current in vitro models. Tissue cores from fresh prostatectomy specimens were precision-cut at 300 μm and incubated in a rotary culture apparatus. The ability of varied culture conditions to faithfully maintain benign and cancer cell and tissue structure and function over time was evaluated by immunohistological and biochemical assays. After optimization of the culture system, molecular and cellular responses to androgen ablation and to piperlongumine (PL), purported to specifically reduce androgen signaling in PCa, were investigated. Optimized culture conditions successfully maintained the structural and functional fidelity of both benign and PCa TSCs for 5 days. TSCs exhibited androgen dependence, appropriately undergoing ductal degeneration, reduced proliferation, and decreased prostate-specific antigen expression upon androgen ablation. Further, TSCs revealed cancer-specific reduction of androgen receptor and increased apoptosis upon treatment with PL, validating data from cell lines. We demonstrate a TSC model that authentically recapitulates the structural, cellular, and genetic characteristics of the benign and malignant human prostate, androgen dependence of the native tissue, and cancer-specific response

  10. Oxidative phosphorylation and mitochondrial function differ between human prostate tissue and cultured cells.

    PubMed

    Schöpf, Bernd; Schäfer, Georg; Weber, Anja; Talasz, Heribert; Eder, Iris E; Klocker, Helmut; Gnaiger, Erich

    2016-06-01

    Altered mitochondrial metabolism plays a pivotal role in the development and progression of various diseases, including cancer. Cell lines are frequently used as models to study mitochondrial (dys)function, but little is known about their mitochondrial respiration and metabolic properties in comparison to the primary tissue of origin. We have developed a method for assessment of oxidative phosphorylation in prostate tissue samples of only 2 mg wet weight using high-resolution respirometry. Reliable protocols were established to investigate the respiratory activity of different segments of the mitochondrial electron transfer system (ETS) in mechanically permeabilized tissue biopsies. Additionally, the widely used immortalized prostate epithelial and fibroblast cell lines, RWPE1 and NAF, representing the major cell types in prostate tissue, were analyzed and compared to the tissue of origin. Our results show that mechanical treatment without chemical permeabilization agents or sample processing constitutes a reliable preparation method for OXPHOS analysis in small amounts of prostatic tissue typically obtained by prostate biopsy. The cell lines represented the bioenergetic properties of fresh tissue to a limited extent only. Particularly, tissue showed a higher oxidative capacity with succinate and glutamate, whereas pyruvate was a substrate supporting significantly higher respiratory activities in cell lines. Several fold higher zinc levels measured in tissue compared to cells confirmed the role of aconitase for prostate-specific metabolism in agreement with observed respiratory properties. In conclusion, combining the flexibility of cell culture models and tissue samples for respirometric analysis are powerful tools for investigation of mitochondrial function and tissue-specific metabolism. PMID:27060259

  11. Human periprostatic white adipose tissue is rich in stromal progenitor cells and a potential source of prostate tumor stroma.

    PubMed

    Ribeiro, Ricardo; Monteiro, Cátia; Silvestre, Ricardo; Castela, Angela; Coutinho, Helena; Fraga, Avelino; Príncipe, Paulo; Lobato, Carlos; Costa, Carla; Cordeiro-da-Silva, Anabela; Lopes, José Manuel; Lopes, Carlos; Medeiros, Rui

    2012-10-01

    A body of growing evidence now implicates white adipose tissue as a relevant source of stromal progenitor cells recruited to the tumor microenvironment to form supportive tumor stroma. While the role of periprostatic (PP) adipose tissue in prostate cancer progression has been barely appreciated, we sought to determine the progenitor cell population in PP adipose tissue and the association with prostate cancer. We isolated and characterized CD31(-)CD34(+)CD45(-)CD146(-) progenitor cells (adipose-derived stem cells [ASC]) in paired samples of PP and preperitoneal visceral adipose tissue from prostate tissue and peripheral blood mononuclear cells of prostate cancer and nodular prostatic hyperplasia patients. ASC were quantified by flow cytometry and confirmed through target gene expression. Here we show a significantly higher amount of ASC in PP than in visceral adipose tissue, independent of body mass index and prostatic disease. In the prostate, ASC are increased in cancer compared with prostatic nodular hyperplasia patients. Concordantly, adipsin gene (CFD) expression, which is known to be up-regulated in adipose stem cells, was overexpressed in PP adipose tissue, in the prostate of cancer patients and in prostate CD31(-)CD34(+)CD45(-)CD146(-) sorted cells. ASC were found at higher levels in the blood of prostate cancer patients simultaneously overweight/obese. Present findings indicate that PP adipose tissue is a reservoir of progenitor cells with the potential to migrate towards prostate tumors, although its clinical significance merits further evaluation. PMID:23038706

  12. Light propagation in paint and prostate human tissues using visible to mid-IR spectroscopy and imaging techniques

    NASA Astrophysics Data System (ADS)

    Ali, Jamal Hafiez

    The topic of the thesis is to understand the structural and molecular changes in scattering media for bio-medical applications such as animal, and human prostate tissues and non-biomedical applications such as corrosion and cracks beneath paint using steady and time-resolved light spectroscopy and imaging techniques in the visible to mid-IR spectral region. The thesis focuses also on understanding the randomization of coherence and polarization in thin scattering paint medium. Temporal polarization emission profiles of Fluorescein dye attached to different molecular weight ranging from 4 K to 500 K were measured. Images of an object containing varying molecular weight of Fluorescein dye embedded inside intralipid media were investigated. The non-invasive spectral polarization difference imaging and the fluorescence polarization difference imaging techniques using Cardio Green dye are introduced in the optical imaging studies to enhance the image quality. The measured transport length for prostate tissues using time-resolved pulse transmission is ℓtr = 0.86 mm. Four modeling samples of human rectum-membrane-prostate tissue were investigated using the near-infrared spectral polarization imaging technique to detect small foreign objects at different depths inside prostate tissues. The content of water in cancerous and normal human prostate tissues was shown to be different using near infrared spectroscopy and imaging techniques. The OH stretching vibrational overtone mode at 980 nm, 1195 nm, 1444 nm and other water overtone modes provide key spectroscopic fingerprints to detect non-invasively cancer in prostate tissue. The value of the transport length (ℓtr) for paint medium obtained from time-resolved pulse transmission, steady state, and degree of polarization measurements is 28mum, 34mu m, and 29mum, respectively. The correlation of time-resolved interference (coherence) and polarization in a scattering thin paint medium has been determined for the first time

  13. Isolation and genome-wide expression and methylation characterization of CD31+ cells from normal and malignant human prostate tissue

    PubMed Central

    Luo, Wei; Hu, Qiang; Wang, Dan; Deeb, Kristin K.; Ma, Yingyu; Morrison, Carl D.; Liu, Song; Johnson, Candace S.; Trump, Donald L.

    2013-01-01

    Endothelial cells (ECs) are an important component involved in the angiogenesis. Little is known about the global gene expression and epigenetic regulation in tumor endothelial cells. The identification of gene expression and epigenetic difference between human prostate tumor-derived endothelial cells (TdECs) and those in normal tissues may uncover unique biological features of TdEC and facilitate the discovery of new anti-angiogenic targets. We established a method for isolation of CD31+ endothelial cells from malignant and normal prostate tissues obtained at prostatectomy. TdECs and normal-derived ECs (NdECs) showed >90% enrichment in primary culture and demonstrated microvascular endothelial cell characteristics such as cobblestone morphology in monolayer culture, diI-acetyl-LDL uptake and capillary-tube like formation in Matrigel®. In vitro primary cultures of ECs maintained expression of endothelial markers such as CD31, von Willebrand factor, intercellular adhesion molecule, vascular endothelial growth factor receptor 1, and vascular endothelial growth factor receptor 2. We then conducted a pilot study of transcriptome and methylome analysis of TdECs and matched NdECs from patients with prostate cancer. We observed a wide spectrum of differences in gene expression and methylation patterns in endothelial cells, between malignant and normal prostate tissues. Array-based expression and methylation data were validated by qRT-PCR and bisulfite DNA pyrosequencing. Further analysis of transcriptome and methylome data revealed a number of differentially expressed genes with loci whose methylation change is accompanied by an inverse change in gene expression. Our study demonstrates the feasibility of isolation of ECs from histologically normal prostate and prostate cancer via CD31+ selection. The data, although preliminary, indicates that there exist widespread differences in methylation and transcription between TdECs and NdECs. Interestingly, only a small

  14. Proteomic Upregulation of Fatty Acid Synthase and Fatty Acid Binding Protein 5 and Identification of Cancer- and Race-Specific Pathway Associations in Human Prostate Cancer Tissues

    PubMed Central

    Myers, Jennifer S.; von Lersner, Ariana K.; Sang, Qing-Xiang Amy

    2016-01-01

    Protein profiling studies of prostate cancer have been widely used to characterize molecular differences between diseased and non-diseased tissues. When combined with pathway analysis, profiling approaches are able to identify molecular mechanisms of prostate cancer, group patients by cancer subtype, and predict prognosis. This strategy can also be implemented to study prostate cancer in very specific populations, such as African Americans who have higher rates of prostate cancer incidence and mortality than other racial groups in the United States. In this study, age-, stage-, and Gleason score-matched prostate tumor specimen from African American and Caucasian American men, along with non-malignant adjacent prostate tissue from these same patients, were compared. Protein expression changes and altered pathway associations were identified in prostate cancer generally and in African American prostate cancer specifically. In comparing tumor to non-malignant samples, 45 proteins were significantly cancer-associated and 3 proteins were significantly downregulated in tumor samples. Notably, fatty acid synthase (FASN) and epidermal fatty acid-binding protein (FABP5) were upregulated in human prostate cancer tissues, consistent with their known functions in prostate cancer progression. Aldehyde dehydrogenase family 1 member A3 (ALDH1A3) was also upregulated in tumor samples. The Metastasis Associated Protein 3 (MTA3) pathway was significantly enriched in tumor samples compared to non-malignant samples. While the current experiment was unable to detect statistically significant differences in protein expression between African American and Caucasian American samples, differences in overrepresentation and pathway enrichment were found. Structural components (Cytoskeletal Proteins and Extracellular Matrix Protein protein classes, and Biological Adhesion Gene Ontology (GO) annotation) were overrepresented in African American but not Caucasian American tumors. Additionally, 5

  15. Organoid culture systems for prostate epithelial tissue and prostate cancer tissue

    PubMed Central

    Drost, Jarno; Karthaus, Wouter R.; Gao, Dong; Driehuis, Else; Sawyers, Charles L.; Chen, Yu; Clevers, Hans

    2016-01-01

    Summary This protocol describes a recently developed strategy to generate 3D prostate organoid cultures from healthy mouse and human prostate (either bulk or FAC-sorted single luminal and basal cells), metastatic prostate cancer lesions and circulating tumour cells. Organoids derived from healthy material contain the differentiated luminal and basal cell types, whereas organoids derived from prostate cancer tissue mimic the histology of the tumour. The stepwise establishment of these cultures and the fully defined serum-free conditioned medium that is required to sustain organoid growth are outlined. Organoids established using this protocol can be used to study many different aspects of prostate biology, including homeostasis, tumorigenesis and drug discovery. PMID:26797458

  16. A Novel Model of Urinary Tract Differentiation, Tissue Regeneration, and Disease: Reprogramming Human Prostate and Bladder Cells into Induced Pluripotent Stem Cells

    PubMed Central

    Moad, Mohammad; Pal, Deepali; Hepburn, Anastasia C.; Williamson, Stuart C.; Wilson, Laura; Lako, Majlinda; Armstrong, Lyle; Hayward, Simon W.; Franco, Omar E.; Cates, Justin M.; Fordham, Sarah E.; Przyborski, Stefan; Carr-Wilkinson, Jane; Robson, Craig N.; Heer, Rakesh

    2013-01-01

    Background Primary culture and animal and cell-line models of prostate and bladder development have limitations in describing human biology, and novel strategies that describe the full spectrum of differentiation from foetal through to ageing tissue are required. Recent advances in biology demonstrate that direct reprogramming of somatic cells into pluripotent embryonic stem cell (ESC)-like cells is possible. These cells, termed induced pluripotent stem cells (iPSCs), could theoretically generate adult prostate and bladder tissue, providing an alternative strategy to study differentiation. Objective To generate human iPSCs derived from normal, ageing, human prostate (Pro-iPSC), and urinary tract (UT-iPSC) tissue and to assess their capacity for lineage-directed differentiation. Design, setting, and participants Prostate and urinary tract stroma were transduced with POU class 5 homeobox 1 (POU5F1; formerly OCT4), SRY (sex determining region Y)-box 2 (SOX2), Kruppel-like factor 4 (gut) (KLF4), and v-myc myelocytomatosis viral oncogene homolog (avian) (MYC, formerly C-MYC) genes to generate iPSCs. Outcome measurements and statistical analysis The potential for differentiation into prostate and bladder lineages was compared with classical skin-derived iPSCs. The student t test was used. Results and limitations Successful reprogramming of prostate tissue into Pro-iPSCs and bladder and ureter into UT-iPSCs was demonstrated by characteristic ESC morphology, marker expression, and functional pluripotency in generating all three germ-layer lineages. In contrast to conventional skin-derived iPSCs, Pro-iPSCs showed a vastly increased ability to generate prostate epithelial-specific differentiation, as characterised by androgen receptor and prostate-specific antigen induction. Similarly, UT-iPSCs were shown to be more efficient than skin-derived iPSCs in undergoing bladder differentiation as demonstrated by expression of urothelial-specific markers: uroplakins, claudins, and

  17. Ultra-high performance liquid chromatographic determination of levofloxacin in human plasma and prostate tissue with use of experimental design optimization procedures.

    PubMed

    Szerkus, O; Jacyna, J; Wiczling, P; Gibas, A; Sieczkowski, M; Siluk, D; Matuszewski, M; Kaliszan, R; Markuszewski, M J

    2016-09-01

    Fluoroquinolones are considered as gold standard for the prevention of bacterial infections after transrectal ultrasound guided prostate biopsy. However, recent studies reported that fluoroquinolone- resistant bacterial strains are responsible for gradually increasing number of infections after transrectal prostate biopsy. In daily clinical practice, antibacterial efficacy is evaluated only in vitro, by measuring the reaction of bacteria with an antimicrobial agent in culture media (i.e. calculation of minimal inhibitory concentration). Such approach, however, has no relation to the treated tissue characteristics and might be highly misleading. Thus, the objective of this study was to develop, with the use of Design of Experiments approach, a reliable, specific and sensitive ultra-high performance liquid chromatography- diode array detection method for the quantitative analysis of levofloxacin in plasma and prostate tissue samples obtained from patients undergoing prostate biopsy. Moreover, correlation study between concentrations observed in plasma samples vs prostatic tissue samples was performed, resulting in better understanding, evaluation and optimization of the fluoroquinolone-based antimicrobial prophylaxis during transrectal ultrasound guided prostate biopsy. Box-Behnken design was employed to optimize chromatographic conditions of the isocratic elution program in order to obtain desirable retention time, peak symmetry and resolution of levofloxacine and ciprofloxacine (internal standard) peaks. Fractional Factorial design 2(4-1) with four center points was used for screening of significant factors affecting levofloxacin extraction from the prostatic tissue. Due to the limited number of tissue samples the prostatic sample preparation procedure was further optimized using Central Composite design. Design of Experiments approach was also utilized for evaluation of parameter robustness. The method was found linear over the range of 0.030-10μg/mL for human

  18. A biospectroscopic analysis of human prostate tissue obtained from different time periods points to a trans-generational alteration in spectral phenotype.

    PubMed

    Theophilou, Georgios; Lima, Kássio M G; Briggs, Matthew; Martin-Hirsch, Pierre L; Stringfellow, Helen F; Martin, Francis L

    2015-01-01

    Prostate cancer is the most commonly-diagnosed malignancy in males worldwide; however, there is marked geographic variation in incidence that may be associated with a Westernised lifestyle. We set out to determine whether attenuated total reflection Fourier-transform infrared (ATR-FTIR) or Raman spectroscopy combined with principal component analysis-linear discriminant analysis or variable selection techniques employing genetic algorithm or successive projection algorithm could be utilised to explore differences between prostate tissues from differing years. In total, 156 prostate tissues from transurethral resection of the prostate procedures for benign prostatic hyperplasia from 1983 to 2013 were collected. These were distributed to form seven categories: 1983-1984 (n = 20), 1988-1989 (n = 25), 1993-1994 (n = 21), 1998-1999 (n = 21), 2003-2004 (n = 21), 2008-2009 (n = 20) and 2012-2013 (n = 21). Ten-μm-thick tissue sections were floated onto Low-E (IR-reflective) slides for ATR-FTIR or Raman spectroscopy. The prostate tissue spectral phenotype altered in a temporal fashion. Examination of the two categories that are at least one generation (30 years) apart indicated highly-significant segregation, especially in spectral regions containing DNA and RNA bands (≈1,000-1,490 cm(-1)). This may point towards alterations that have occurred through genotoxicity or through epigenetic modifications. Immunohistochemical studies for global DNA methylation supported this. This study points to a trans-generational phenotypic change in human prostate. PMID:26310632

  19. A biospectroscopic analysis of human prostate tissue obtained from different time periods points to a trans-generational alteration in spectral phenotype

    PubMed Central

    Theophilou, Georgios; Lima, Kássio M. G.; Briggs, Matthew; Martin-Hirsch, Pierre L.; Stringfellow, Helen F.; Martin, Francis L.

    2015-01-01

    Prostate cancer is the most commonly-diagnosed malignancy in males worldwide; however, there is marked geographic variation in incidence that may be associated with a Westernised lifestyle. We set out to determine whether attenuated total reflection Fourier-transform infrared (ATR-FTIR) or Raman spectroscopy combined with principal component analysis-linear discriminant analysis or variable selection techniques employing genetic algorithm or successive projection algorithm could be utilised to explore differences between prostate tissues from differing years. In total, 156 prostate tissues from transurethral resection of the prostate procedures for benign prostatic hyperplasia from 1983 to 2013 were collected. These were distributed to form seven categories: 1983–1984 (n = 20), 1988–1989 (n = 25), 1993–1994 (n = 21), 1998–1999 (n = 21), 2003–2004 (n = 21), 2008–2009 (n = 20) and 2012–2013 (n = 21). Ten-μm-thick tissue sections were floated onto Low-E (IR-reflective) slides for ATR-FTIR or Raman spectroscopy. The prostate tissue spectral phenotype altered in a temporal fashion. Examination of the two categories that are at least one generation (30 years) apart indicated highly-significant segregation, especially in spectral regions containing DNA and RNA bands (≈1,000–1,490 cm−1). This may point towards alterations that have occurred through genotoxicity or through epigenetic modifications. Immunohistochemical studies for global DNA methylation supported this. This study points to a trans-generational phenotypic change in human prostate. PMID:26310632

  20. Human prostatic carcinoma in tissue culture: correlations between histological diagnosis and in vitro parameters.

    PubMed

    Bologna, M; Vicentini, C; Festuccia, C; Muzi, P; Angeletti, P V; Miano, L

    1985-01-01

    Prostatic cell biology is still largely unknown so that even the natural history of prostatic carcinoma is unpredictable. In order to correlate new observations with the prognosis of patients with prostatic carcinoma of various grades, we followed up 24 in vitro samples from surgical specimens of prostatic carcinoma. Fragments from 7 grade-I, 10 grade-II, 6 grade-III; and 1 grade-IV tumors were cultivated in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, 10% horse serum and 50 ng/ml each of hydrocortisone and insulin. Epithelial cells grown from the explants continued to grow for a maximum of 120 days and their morphology varied from a fairly regular monolayer of polygonal cells to irregular patterns of overlapping growth with many giant multinucleated cells. Although our data need a longer clinical follow-up time and larger numbers to achieve any statistical significance, the present findings seem to indicate rather clearly that a short life span in culture, a regular growth and a positive secretion activity is typical of low-grade tumors and that a longer life span, an irregular growth and a negative secretion in vitro are characteristics of high-grade tumors. A longer clinical follow-up of these patients will be important in the future to indicate whether these findings can be of any real prognostic value. PMID:4076272

  1. Ectopic prostatic tissue in the uterine cervix.

    PubMed

    Larraza-Hernandez, O; Molberg, K H; Lindberg, G; Albores-Saavedra, J

    1997-07-01

    This is the first reported case of ectopic prostatic tissue in the uterine cervix, diagnosed in a 38-year-old woman. A cluster of benign prostatic glands with cribriform and papillary patterns and focal squamous metaplasia occupied the superficial endocervical stroma. The glands were immunoreactive for prostatic specific antigen and prostatic specific acid phosphatase. This lesion, which could be confused with microglandular hyperplasia, mesonephric rests, or adenocarcinoma in situ may represent an embryonic rest. PMID:9421098

  2. Evaluation of discoidin domain receptor-2 (DDR2) expression level in normal, benign, and malignant human prostate tissues

    PubMed Central

    Azemikhah, Mitra; Ashtiani, Hamidreza Ahmadi; Aghaei, Mahmoud; Rastegar, Hosein

    2015-01-01

    Discoidin domain receptor (DDR) is a new member of the receptor tyrosine kinase family. There are two isoforms of discoidin domain receptor (DDR), DDR1 and DDR2. These receptors play a major role in the adhesion, motility and cell proliferation. Due to the important role of DDR2 in the development of tumor extension, this receptor is pivotal in the field of carcinogenesis. The aim of this study was to investigate the mRNA and protein expression of DDR2, in the malignant, benign prostatic hyperplasia (BPH) and normal tissues of patients with prostate cancer. In this study the gene and protein expression of DDR2 in adjacent normal (n=40), BPH (n=40), and malignant (n=40) prostate tissue were measured using real-time PCR and Western blotting. Then, the correlation of DDR2 gene and protein expression with prognostic factors such as age, tumor grade, tumor stage, lymph node involvement, and serum prostate-specific antigen (PSA) concentration were evaluated. The relative mRNA and protein expression level of DDR2 in malignant and benign prostate tissue was significantly higher than those of adjacent normal tissues (P<0.01). This expression was found to increase approximately 3.5 and 2.1 fold for mRNA and protein levels, respectively. Spearman test indicated a significant correlation between DDR2 mRNA and protein expression with prognostic factors such as tumor grade, stage, lymph node involvement, and serum PSA concentration. However, significant correlation with age was not observed. These findings suggest that DDR2 is a cancer-related gene associated with the aggressive progression of prostate cancer patients. PMID:26600862

  3. Evaluation of discoidin domain receptor-2 (DDR2) expression level in normal, benign, and malignant human prostate tissues.

    PubMed

    Azemikhah, Mitra; Ashtiani, Hamidreza Ahmadi; Aghaei, Mahmoud; Rastegar, Hosein

    2015-01-01

    Discoidin domain receptor (DDR) is a new member of the receptor tyrosine kinase family. There are two isoforms of discoidin domain receptor (DDR), DDR1 and DDR2. These receptors play a major role in the adhesion, motility and cell proliferation. Due to the important role of DDR2 in the development of tumor extension, this receptor is pivotal in the field of carcinogenesis. The aim of this study was to investigate the mRNA and protein expression of DDR2, in the malignant, benign prostatic hyperplasia (BPH) and normal tissues of patients with prostate cancer. In this study the gene and protein expression of DDR2 in adjacent normal (n=40), BPH (n=40), and malignant (n=40) prostate tissue were measured using real-time PCR and Western blotting. Then, the correlation of DDR2 gene and protein expression with prognostic factors such as age, tumor grade, tumor stage, lymph node involvement, and serum prostate-specific antigen (PSA) concentration were evaluated. The relative mRNA and protein expression level of DDR2 in malignant and benign prostate tissue was significantly higher than those of adjacent normal tissues (P<0.01). This expression was found to increase approximately 3.5 and 2.1 fold for mRNA and protein levels, respectively. Spearman test indicated a significant correlation between DDR2 mRNA and protein expression with prognostic factors such as tumor grade, stage, lymph node involvement, and serum PSA concentration. However, significant correlation with age was not observed. These findings suggest that DDR2 is a cancer-related gene associated with the aggressive progression of prostate cancer patients. PMID:26600862

  4. Stokes polarimetry imaging of dog prostate tissue

    NASA Astrophysics Data System (ADS)

    Kim, Jihoon; Johnston, William K., III; Walsh, Joseph T., Jr.

    2010-02-01

    Prostate cancer is the second leading cause of death in the United States in 2009. Radical prostatectomy (complete removal of the prostate) is the most common treatment for prostate cancer, however, differentiating prostate tissue from adjacent bladder, nerves, and muscle is difficult. Improved visualization could improve oncologic outcomes and decrease damage to adjacent nerves and muscle important for preservation of potency and continence. A novel Stokes polarimetry imaging (SPI) system was developed and evaluated using a dog prostate specimen in order to examine the feasibility of the system to differentiate prostate from bladder. The degree of linear polarization (DOLP) image maps from linearly polarized light illumination at different visible wavelengths (475, 510, and 650 nm) were constructed. The SPI system used the polarization property of the prostate tissue. The DOLP images allowed advanced differentiation by distinguishing glandular tissue of prostate from the muscular-stromal tissue in the bladder. The DOLP image at 650 nm effectively differentiated prostate and bladder by strong DOLP in bladder. SPI system has the potential to improve surgical outcomes in open or robotic-assisted laparoscopic removal of the prostate. Further in vivo testing is warranted.

  5. Examination of CK2α and NF-κB p65 expression in human benign prostatic hyperplasia and prostate cancer tissues.

    PubMed

    Qaiser, Fatima; Trembley, Janeen H; Sadiq, Sarah; Muhammad, Iqbal; Younis, Rubina; Hashmi, Shoaib Naiyar; Murtaza, Badar; Rector, Thomas S; Naveed, Abdul Khaliq; Ahmed, Khalil

    2016-09-01

    Protein kinase CK2 plays a critical role in cell growth, proliferation, and suppression of cell death. CK2 is overexpressed, especially in the nuclear compartment, in the majority of cancers, including prostate cancer (PCa). CK2-mediated activation of transcription factor nuclear factor kappa B (NF-κB) p65 is a key step in cellular proliferation, resulting in translocation of NF-κB p65 from the cytoplasm to the nucleus. As CK2 expression and activity are also elevated in benign prostatic hyperplasia (BPH), we sought to increase the knowledge of CK2 function in benign and malignant prostate by examination of the relationships between nuclear CK2 and nuclear NF-κB p65 protein expression. The expression level and localization of CK2α and NF-κB p65 proteins in PCa and BPH tissue specimens was determined. Nuclear CK2α and NF-κB p65 protein levels are significantly higher in PCa compared with BPH, and these proteins are positively correlated with each other in both diseases. Nuclear NF-κB p65 levels correlated with Ki-67 or with cytoplasmic NF-κB p65 expression in BPH, but not in PCa. The findings provide information that combined analysis of CK2α and NF-κB p65 expression in prostate specimens relates to the disease status. Increased nuclear NF-κB p65 expression levels in PCa specifically related to nuclear CK2α levels, indicating a possible CK2-dependent relationship in malignancy. In contrast, nuclear NF-κB p65 protein levels related to both Ki-67 and cytoplasmic NF-κB p65 levels exclusively in BPH, suggesting a potential separate impact for NF-κB p65 function in proliferation for benign disease as opposed to malignant disease. PMID:27435858

  6. Lipids and FA analysis of canine prostate tissue.

    PubMed

    Attar-Bashi, Nadia M; Orzeszko, Karyn; Slocombe, Ronald F; Sinclair, Andrew J

    2003-06-01

    It is widely reported that an association exists between dietary fat intake and the incidence of prostate cancer in humans. To study this association, there is a need for an animal model where prostate carcinogenesis occurs spontaneously. The canine prostate is considered a suitable experimental model for prostate cancer in humans since it is morphologically similar to the human prostate and both humans and dogs have a predisposition to benign and malignant prostate disease. In this study, the FA and lipids profiles of the normal canine prostate tissue from nine dogs were examined. The total lipid content of the canine prostate tissue was 1.7 +/- 0.5% (wet weight). The lipid composition analysis using TLC-FID showed that the two major lipid classes were phospholipids and TAG. Total FA, phospholipid, and TAG FA analysis showed that the major FA were palmitic acid (16:0), stearic acid (18:0), oleic acid (18:1), linoleic acid (18:2n-6), and arachidonic acid (20:4n-6). The n-3 FA were present at <3% of total FA and included alpha-linolenic acid (18:3n-3) (in total and TAG tissue FA), EPA (20:5n-3) (not in TAG), and DHA (22:6n-3) (not in TAG). The n-3/n-6 ratio was 1:11, 1:13, and 1:8 in total, phospholipid, and TAG FA, respectively. This study shows the canine prostate has a low level of n-3 FA and a low n-3/n-6 ratio. This is perhaps due to low n-3 content of the diet of the dogs. FA analysis of dogfoods available in Australia showed that the n-3 content in both supermarket and premium brand dogfoods was <3% (wet weight), and the n-3/n-6 ratio was low. PMID:12934677

  7. Metabolomic Imaging for Human Prostate Cancer Detection

    PubMed Central

    Wu, Chin-Lee; Jordan, Kate W.; Ratai, Eva M.; Sheng, Jinhua; Adkins, Christen B.; DeFeo, Elita M; Jenkins, Bruce G.; Ying, Leslie; McDougal, W. Scott; Cheng, Leo L.

    2010-01-01

    As current radiological approaches cannot accurately localize prostate cancer in vivo, biopsies are conducted at random within prostates for at-risk patients, leading to high false-negative rates. Metabolomic imaging can map cancer-specific biomolecular profile values onto anatomical structures to direct biopsy. In this preliminary study, we evaluated five prostatectomy-removed whole prostates from biopsy-proven cancer patients on a 7 Tesla human, whole-body magnetic resonance scanner. Localized, multi-cross-sectional, multi-voxel magnetic resonance spectra were used to construct a malignancy index based on prostate cancer metabolomic profiles obtained from previous, intact tissue analyses by a 14 Tesla spectrometer. This calculated Malignancy Index shows linear correlation with lesion size (p<0.013) and demonstrates a 93–97% overall accuracy for detecting the presence of prostate cancer lesions. PMID:20371475

  8. Does diabetes affect the distribution and number of interstitial cells and neuronal tissue in the ureter, bladder, prostate, and urethra of humans?

    PubMed Central

    Dogan, Hayriye; Kandemir, Olcay; Atmaca, Ali Fuat; Akbulut, Ziya; Balbay, Mevlana Derya

    2014-01-01

    Introduction The aim of this study was to investigate and compare the distribution and number of interstitial cells (ICs) and neuronal tissue in the ureter, bladder, prostate, and urethra of human patients with and without diabetes. Material and methods Human tissue was obtained from patients who had undergone radical cystectomy for bladder cancer (10 diabetic and 11 non–diabetic males). Interstitial cells were stained immunohistochemically with anti–human CD117 (c–kit) rabbit polyclonal antibody, Vimentin, and Connexin–43. Neural tissue was stained with synaptophysin. The number of ICs and neurons was evaluated and compared between the groups (diabetic versus non–diabetic). Results The mean number of c–kit (+) ICs in bladder lamina propria was significantly decreased in diabetics (32.40 ±12.96 versus 57.18 ±25.37, p = 0.036). The mean number of ICs in the detrusor muscle was significantly decreased in diabetics (40.50 ±16.79 versus 64.55 ±22.08, p = 0.013). Between the groups, no significant differences were detected regarding the number of ICs at the level of the ureter, urethra, and prostate. No significant differences were detected regarding the number of nerves in the ureter, bladder, prostate, and urethra of both groups. Conclusions The number of ICs may be decreased in the lamina propria and detrusor muscle of the human bladder in diabetes. This can be an underlying cause of lower urinary tract (LUT) dysfunction in diabetics. Research into the development of drugs targeting or stimulating IC function in order to prevent diabetic LUT dysfunction is warranted. PMID:25667756

  9. HUMAN PROSTATE CANCER RISK FACTORS

    EPA Science Inventory

    Prostate cancer has the highest prevalence of any non-skin cancer in the human body, with similar likelihood of neoplastic foci found within the prostates of men around the world regardless of diet, occupation, lifestyle, or other factors. Essentially all men with circulating an...

  10. Human Prostate Cancer Hallmarks Map.

    PubMed

    Datta, Dipamoy; Aftabuddin, Md; Gupta, Dinesh Kumar; Raha, Sanghamitra; Sen, Prosenjit

    2016-01-01

    Human prostate cancer is a complex heterogeneous disease that mainly affects elder male population of the western world with a high rate of mortality. Acquisitions of diverse sets of hallmark capabilities along with an aberrant functioning of androgen receptor signaling are the central driving forces behind prostatic tumorigenesis and its transition into metastatic castration resistant disease. These hallmark capabilities arise due to an intense orchestration of several crucial factors, including deregulation of vital cell physiological processes, inactivation of tumor suppressive activity and disruption of prostate gland specific cellular homeostasis. The molecular complexity and redundancy of oncoproteins signaling in prostate cancer demands for concurrent inhibition of multiple hallmark associated pathways. By an extensive manual curation of the published biomedical literature, we have developed Human Prostate Cancer Hallmarks Map (HPCHM), an onco-functional atlas of human prostate cancer associated signaling and events. It explores molecular architecture of prostate cancer signaling at various levels, namely key protein components, molecular connectivity map, oncogenic signaling pathway map, pathway based functional connectivity map etc. Here, we briefly represent the systems level understanding of the molecular mechanisms associated with prostate tumorigenesis by considering each and individual molecular and cell biological events of this disease process. PMID:27476486

  11. Human Prostate Cancer Hallmarks Map

    PubMed Central

    Datta, Dipamoy; Aftabuddin, Md.; Gupta, Dinesh Kumar; Raha, Sanghamitra; Sen, Prosenjit

    2016-01-01

    Human prostate cancer is a complex heterogeneous disease that mainly affects elder male population of the western world with a high rate of mortality. Acquisitions of diverse sets of hallmark capabilities along with an aberrant functioning of androgen receptor signaling are the central driving forces behind prostatic tumorigenesis and its transition into metastatic castration resistant disease. These hallmark capabilities arise due to an intense orchestration of several crucial factors, including deregulation of vital cell physiological processes, inactivation of tumor suppressive activity and disruption of prostate gland specific cellular homeostasis. The molecular complexity and redundancy of oncoproteins signaling in prostate cancer demands for concurrent inhibition of multiple hallmark associated pathways. By an extensive manual curation of the published biomedical literature, we have developed Human Prostate Cancer Hallmarks Map (HPCHM), an onco-functional atlas of human prostate cancer associated signaling and events. It explores molecular architecture of prostate cancer signaling at various levels, namely key protein components, molecular connectivity map, oncogenic signaling pathway map, pathway based functional connectivity map etc. Here, we briefly represent the systems level understanding of the molecular mechanisms associated with prostate tumorigenesis by considering each and individual molecular and cell biological events of this disease process. PMID:27476486

  12. Androgen Regulated Genes in Human Prostate Xenografts in Mice: Relation to BPH and Prostate Cancer

    PubMed Central

    Love, Harold D.; Booton, S. Erin; Boone, Braden E.; Breyer, Joan P.; Koyama, Tatsuki; Revelo, Monica P.; Shappell, Scott B.; Smith, Jeffrey R.; Hayward, Simon W.

    2009-01-01

    Benign prostatic hyperplasia (BPH) and prostate carcinoma (CaP) are linked to aging and the presence of androgens, suggesting that androgen regulated genes play a major role in these common diseases. Androgen regulation of prostate growth and development depends on the presence of intact epithelial-stromal interactions. Further, the prostatic stroma is implicated in BPH. This suggests that epithelial cell lines are inadequate to identify androgen regulated genes that could contribute to BPH and CaP and which could serve as potential clinical biomarkers. In this study, we used a human prostate xenograft model to define a profile of genes regulated in vivo by androgens, with an emphasis on identifying candidate biomarkers. Benign transition zone (TZ) human prostate tissue from radical prostatectomies was grafted to the sub-renal capsule site of intact or castrated male immunodeficient mice, followed by the removal or addition of androgens, respectively. Microarray analysis of RNA from these tissues was used to identify genes that were; 1) highly expressed in prostate, 2) had significant expression changes in response to androgens, and, 3) encode extracellular proteins. A total of 95 genes meeting these criteria were selected for analysis and validation of expression in patient prostate tissues using quantitative real-time PCR. Expression levels of these genes were measured in pooled RNAs from human prostate tissues with varying severity of BPH pathologic changes and CaP of varying Gleason score. A number of androgen regulated genes were identified. Additionally, a subset of these genes were over-expressed in RNA from clinical BPH tissues, and the levels of many were found to correlate with disease status. Our results demonstrate the feasibility, and some of the problems, of using a mouse xenograft model to characterize the androgen regulated expression profiles of intact human prostate tissues. PMID:20027305

  13. Quantitative Analysis of BTF3, HINT1, NDRG1 and ODC1 Protein Over-Expression in Human Prostate Cancer Tissue

    PubMed Central

    Symes, Andrew J.; Eilertsen, Marte; Millar, Michael; Nariculam, Joseph; Freeman, Alex; Notara, Maria; Feneley, Mark R.; Patel, Hitenedra R. H.; Masters, John R. W.; Ahmed, Aamir

    2013-01-01

    Prostate carcinoma is the most common cancer in men with few, quantifiable, biomarkers. Prostate cancer biomarker discovery has been hampered due to subjective analysis of protein expression in tissue sections. An unbiased, quantitative immunohistochemical approach provided here, for the diagnosis and stratification of prostate cancer could overcome this problem. Antibodies against four proteins BTF3, HINT1, NDRG1 and ODC1 were used in a prostate tissue array (> 500 individual tissue cores from 82 patients, 41 case pairs matched with one patient in each pair had biochemical recurrence). Protein expression, quantified in an unbiased manner using an automated analysis protocol in ImageJ software, was increased in malignant vs non-malignant prostate (by 2-2.5 fold, p<0.0001). Operating characteristics indicate sensitivity in the range of 0.68 to 0.74; combination of markers in a logistic regression model demonstrates further improvement in diagnostic power. Triple-labeled immunofluorescence (BTF3, HINT1 and NDRG1) in tissue array showed a significant (p<0.02) change in co-localization coefficients for BTF3 and NDRG1 co-expression in biochemical relapse vs non-relapse cancer epithelium. BTF3, HINT1, NDRG1 and ODC1 could be developed as epithelial specific biomarkers for tissue based diagnosis and stratification of prostate cancer. PMID:24386364

  14. An unusual case of retrovesical ectopic prostate tissue accompanied by primary prostate cancer.

    PubMed

    Tan, Fu-Qing; Xu, Xin; Shen, Bo-Hua; Qin, Jie; Sun, Ke; You, Qihan; Shang, De-Sheng; Zheng, Xiang-Yi

    2012-01-01

    We report an unusual case of retrovesical ectopic prostate tissue in a 73-year-old man with primary prostate cancer. The man's prostate-specific antigen was 24.66 ng/ml.Transabdominal ultrasonography, pelvic computed tomography,and pelvic magnetic resonance imaging demonstrated a heterogeneous 8.5 × 8.0 × 7.0 cm mass in contact with the posterior wall of the urinary bladder. The patient underwent a retropubic radical prostatectomy and resection of tumor. Pathological examination of prostate revealed a prostatic adenocarcinoma, Gleason score of 4 + 5 = 9, and the retrovesical tumor was confirmed to be a benign prostate tissue. PMID:22966979

  15. Sex steroid receptor expression and localization in benign prostatic hyperplasia varies with tissue compartment.

    PubMed

    Nicholson, Tristan M; Sehgal, Priyanka D; Drew, Sally A; Huang, Wei; Ricke, William A

    2013-01-01

    Androgens and estrogens, acting via their respective receptors, are important in benign prostatic hyperplasia (BPH). The goals of this study were to quantitatively characterize the tissue distribution and staining intensity of androgen receptor (AR) and estrogen receptor-alpha (ERα), and assess cells expressing both AR and ERα, in human BPH compared to normal prostate. A tissue microarray composed of normal prostate and BPH tissue was used and multiplexed immunohistochemistry was performed to detect AR and ERα. We used a multispectral imaging platform for automated scanning, tissue and cell segmentation and marker quantification. BPH specimens had an increased number of epithelial and stromal cells and increased percentage of epithelium. In both stroma and epithelium, the mean nuclear area was decreased in BPH relative to normal prostate. AR expression and staining intensity in epithelial and stromal cells was significantly increased in BPH compared to normal prostate. ERα expression was increased in BPH epithelium. However, stromal ERα expression and staining intensity was decreased in BPH compared to normal prostate. Double positive (AR and ERα) epithelial cells were more prevalent in BPH, and fewer double negative (AR and ERα) stromal and epithelial negative cells were observed in BPH. These data underscore the importance of tissue layer localization and expression of steroid hormone receptors in the prostate. Understanding the tissue-specific hormone action of androgens and estrogens will lead to a better understanding of mechanisms of pathogenesis in the prostate and may lead to better treatment for BPH. PMID:23792768

  16. Sex steroid receptor expression and localization in benign prostatic hyperplasia varies with tissue compartment

    PubMed Central

    Nicholson, Tristan M.; Sehgal, Priyanka D.; Drew, Sally A.; Huang, Wei; Ricke, William A.

    2013-01-01

    Androgens and estrogens, acting via their respective receptors, are important in benign prostatic hyperplasia (BPH). The goal of this study was to quantitatively characterize the tissue distribution and staining intensity of androgen receptor (AR) and estrogen receptor-alpha (ERα), and assess cells expressing both AR and ERα, in human BPH compared to normal prostate. A tissue microarray composed of normal prostate and BPH tissue was used and multiplexed immunohistochemistry was performed to detect AR and ERα. We used a multispectral imaging platform for automated scanning, tissue and cell segmentation and marker quantification. BPH specimens had an increased number of epithelial and stromal cells and increased percentage of epithelium. In both stroma and epithelium, the mean nuclear area was decreased in BPH relative to normal prostate. AR expression and staining intensity in epithelial and stromal cells was significantly increased in BPH compared to normal prostate. ERα expression was increased in BPH epithelium. However, stromal ERα expression and staining intensity was decreased in BPH compared to normal prostate. Double positive (AR & ERα) epithelial cells were more prevalent in BPH, and fewer double negative (AR & ERα) stromal and epithelial negative cells were observed in BPH. These data underscore the importance of tissue layer localization and expression of steroid hormone receptors in the prostate. Understanding the tissue-specific hormone action of androgens and estrogens will lead to a better understanding of mechanisms of pathogenesis in the prostate and may lead to better treatment for BPH. PMID:23792768

  17. Segmentation of prostate cancer tissue microarray images

    NASA Astrophysics Data System (ADS)

    Cline, Harvey E.; Can, Ali; Padfield, Dirk

    2006-02-01

    Prostate cancer is diagnosed by histopathology interpretation of hematoxylin and eosin (H and E)-stained tissue sections. Gland and nuclei distributions vary with the disease grade. The morphological features vary with the advance of cancer where the epithelial regions grow into the stroma. An efficient pathology slide image analysis method involved using a tissue microarray with known disease stages. Digital 24-bit RGB images were acquired for each tissue element on the slide with both 10X and 40X objectives. Initial segmentation at low magnification was accomplished using prior spectral characteristics from a training tissue set composed of four tissue clusters; namely, glands, epithelia, stroma and nuclei. The segmentation method was automated by using the training RGB values as an initial guess and iterating the averaging process 10 times to find the four cluster centers. Labels were assigned to the nearest cluster center in red-blue spectral feature space. An automatic threshold algorithm separated the glands from the tissue. A visual pseudo color representation of 60 segmented tissue microarray image was generated where white, pink, red, blue colors represent glands, epithelia, stroma and nuclei, respectively. The higher magnification images provided refined nuclei morphology. The nuclei were detected with a RGB color space principle component analysis that resulted in a grey scale image. The shape metrics such as compactness, elongation, minimum and maximum diameters were calculated based on the eigenvalues of the best-fitting ellipses to the nuclei.

  18. Role of Plasma Discharge in Division of Prostatic Tissue

    NASA Astrophysics Data System (ADS)

    Ward, Arlen; Almgren, Carl; Yu, Zeng-Qi; Sartor, Joe; Collins, George

    2009-10-01

    During the treatment of benign prostatic hyperplasia electrical energy is used to separate prostatic tissue and remove it as a urinary obstruction. This surgical procedure is often performed in a saline environment, and current paths change as the tissue and fluid are heated. This study shows that a plasma discharge at the electrode is necessary to provide the current densities necessary to vaporize portions of the prostatic tissue in order to facilitate removal. This behavior is predicted in finite element simulations, and verified with color schlieren imaging and ex vivo bovine prostate tests.

  19. Inverse association between gluthathione peroxidase activity and both selenium-binding protein 1 levels and gleason score in human prostate tissue

    Technology Transfer Automated Retrieval System (TEKTRAN)

    BACKGROUND. Data from human epidemiological studies, cultured mammalian cells, and animal models have supported a potentially beneficial role of selenium (Se) in prostate cancer prevention. In addition, Se-containing proteins including members of the gutathione peroxidase (GPx) family and Selenium-B...

  20. Application of vibro-acoustography in prostate tissue imaging

    PubMed Central

    Alizad, Azra; Mehrmohammadi, Mohammad; Mitri, Farid G.; Davis, Brian J.; Sebo, Thomas J.; Mynderse, Lance A.; Kinnick, Randall R.; Greenleaf, James F.; Fatemi, Mostafa

    2013-01-01

    Purpose: To evaluate the potential of the imaging modality vibro-acoustography (VA) for imaging of the prostate. Methods: Excised cadaver prostate specimens were embedded in tissue mimicking gel to simulate the properties of surrounding soft tissues. The samples were imaged at various depths using a laboratory prototyped VA imaging system. The recorded signals were used for offline processing and image reconstruction. In a selected subgroup of tissue samples, conventional ultrasound (B-mode) and x-ray imaging were performed for further analysis, evaluation, and validation of the VA images. Results: The imaging results of prostate tissue samples indicate the capability of VA imaging to detect prostatic nodules and lesions. In the prostate sample with an adenocarcinoma, the lesion appears with a clear contrast with respect to its surrounding tissue. The VA images could also identify the presence of calcifications deep inside the prostate tissue. Further, quantifications of the imaging results demonstrate that VA imaging has higher sensitivity to detect the calcifications compared to conventional ultrasound imaging. VA is also capable of visualizing prostatic tissue structures and in some cases can identify the anatomical zones. More specifically, the observed higher texture level in peripheral zones demonstrates the ability of VA to differentiate between prostatic anatomical zones. Conclusions: Imaging results of ex vivo prostate tissues, reveals the potency of VA as a promising tool to detect abnormalities, delineate tissue structures and anatomical zones, and locate calcifications. The results of this pilot study suggest that in vivo VA imaging of the prostate may be of clinical utility. PMID:23387773

  1. Characterizing the stiffness of Human Prostates using Acoustic Radiation Force

    PubMed Central

    Zhai, Liang; Madden, John; Foo, Wen-Chi; Mouraviev, Vladimir; Polascik, Thomas J.; Palmeri, Mark L.; Nightingale, Kathryn R.

    2012-01-01

    Acoustic Radiation Force Impulse (ARFI) imaging has been previously reported to portray normal anatomic structures and pathologies in ex vivo human prostates with good contrast and resolution. These findings were based on comparison with histological slides and McNeal’s zonal anatomy. In ARFI images, the central zone (CZ) appears darker (smaller displacement) than other anatomic zones, and prostate cancer (PCa) is darker than normal tissue in the peripheral zone (PZ). Since displacement amplitudes in ARFI images are determined by both the underlying tissue stiffness and the amplitude of acoustic radiation force which varies with acoustic attenuation, one question that arises is: how are the relative displacements in prostate ARFI images related to the underlying prostatic tissue stiffness? In linear, isotropic elastic materials and in tissues that are relatively uniform in acoustic attenuation (e.g. liver), relative displacement in ARFI images has been shown to be correlated with underlying tissue stiffness. However, the prostate is known to be heterogeneous. Variations in acoustic attenuation of prostatic structures could confound the interpretation of ARFI images due to the associated variations in the applied acoustic radiation force. Therefore, in this study, co-registered three-dimensional (3D) ARFI datasets and quantitative shear wave elasticity imaging (SWEI) datasets were acquired in freshly excised human prostates to investigate the relationship between displacement amplitudes in ARFI prostate images and the matched reconstructed shear moduli. The lateral time-to-peak (LTTP) algorithm was applied to the SWEI data to compute the shear wave speed and reconstruct the shear moduli. Five types of prostatic tissue (PZ, CZ, transition zone (TZ) and benign prostatic hyperplasia (BPH), PCa, and atrophy) were identified, whose shear moduli were quantified to be 4.1±0.8 kPa, 9.9±0.9 kPa, 4.8±0.6 kPa, 10.0±1.0 kPa and 8.0 kPa, respectively. Linear regression was

  2. Immunochemiluminescent detection of galectin-3 in tumoral tissue from prostate

    PubMed Central

    Araújo-Filho, Jorge Luiz; Melo-Junior, Mário Ribeiro; Beltrão, Eduardo Isidoro Carneiro; de Lima, Luiza Rayanna Amorim; Antunes, Consuelo Barreto Lins; de Carvalho, Luiz Bezerra

    2013-01-01

    This work proposes a chemiluminescent quantitative method for galectin-3 (Gal3) detection in prostate tissues. Monoclonal antibody anti-Gal3 was conjugated to acridinium ester (AE) and the complex formed with Gal3 in the prostate tissue was chemiluminescently detected. The light emission (expressed in Relative Light Unit-RLU) showed mean values higher for benign prostatic hyperplasia than normal tissues and adenocarcinoma. These differences showed to be statistically significant (p < 0.001). There was a linear relationship between RLU and tissue area. Furthermore, these values were dramatically reduced when the tissue samples were previously incubated with non labeled anti-Gal3. Finally, the anti-Gal3-AE solution in buffer stored at 4°C and the treated samples showed to be stable during a year and at least 72 h, respectively. Gal3 content in prostate tissue was higher in benign prostatic hyperplasia than normal tissues and much lower in adenocarcinoma. This quantitative, specific and sensitive method based on labeling antibody to acridinium ester can be applied to detect antigen in tissue. PMID:24040451

  3. Comparison of microscopic vascularity in benign and malignant prostate tissue.

    PubMed

    Bigler, S A; Deering, R E; Brawer, M K

    1993-02-01

    A variety of malignant neoplasms have been shown to induce capillary neovascularization, and in some cases the degree of vascularization appears to correlate with aggressive behavior and risk of metastasis. We hypothesized that carcinoma of the prostate also induces the formation of new capillaries, and we developed a method to quantify the relative density of microscopic vessels in carcinoma of the prostate compared with benign prostatic glandular tissue. The number of microvessel profiles in tissue sections was quantified by marking the vascular endothelial cells with antibodies to factor VIII-related antigen using standard immunohistochemistry techniques and comparing fields of adenocarcinoma with benign glandular tissue in 15 radical prostatectomy specimens. The analysis was facilitated by using the Optimas computerized image analysis system (Bioscan, Seattle, WA) with software written for this investigation. Fourteen of the 15 cases demonstrated significantly higher vascular density in the areas of carcinoma than in the benign tissues. Overall, the ratio of vessels per unit area in sections of carcinoma versus benign tissue was approximately double (ratio = 2.02; P < .001). In benign tissues the capillaries are restricted for the most part to the periglandular stroma immediately adjacent to the epithelium, whereas the distribution in carcinoma appears to be more random. The data demonstrate the increased density of capillaries in prostatic carcinoma when compared with benign prostate tissue. PMID:8432518

  4. The androgen receptor cistrome is extensively reprogrammed in human prostate tumorigenesis

    PubMed Central

    Pomerantz, Mark M.; Li, Fugen; Takeda, David; Lenci, Romina; Chonkar, Apurva; Chabot, Matthew; Cejas, Paloma; Vazquez, Francisca; Cook, Jennifer; Shivdasani, Ramesh A.; Bowden, Michaela; Lis, Rosina; Hahn, William C.; Kantoff, Philip W.; Brown, Myles; Loda, Massimo; Long, Henry W.; Freedman, Matthew L.

    2015-01-01

    Master transcription factors interact with DNA to establish cell-type identity and to regulate gene expression in mammalian cells1,2. The genome-wide map of these transcription factor binding sites has been termed the cistrome3. Here we show that the androgen receptor (AR) cistrome undergoes extensive reprogramming during prostate epithelial transformation in man. Using human prostate tissue, we observed a core set of AR binding sites that are consistently reprogrammed in tumors. FOXA1 and HOXB13, co-localized with the reprogrammed AR sites in human tumor tissue. Introduction of FOXA1 and HOXB13 into an immortalized prostate cell line reprogrammed the AR cistrome to resemble that of a prostate tumor, functionally linking these specific factors to AR reprogramming. These findings offer mechanistic insights into a key set of events that drive normal prostate epithelium towards transformation and establish the centrality of epigenetic reprogramming in human prostate tumorigenesis. PMID:26457646

  5. Presence of calcitonin-like immunoreactivity (iCT) in human prostate gland: evidence for iCT secretion by cultured prostate cells.

    PubMed

    Shah, G V; Noble, M J; Austenfeld, M; Weigel, J; Deftos, L J; Mebust, W K

    1992-01-01

    Immunoreactive calcitonin (iCT) has been detected in human prostate tissue extracts as well as seminal plasma. The present studies were undertaken to examine whether iSCT (immunoreactive salmon CT-like human peptide) co-exists with iHCT (thyroid CT-like substance) in human prostate tissue extracts, and whether these substances are secreted by primary prostate cells in culture. Since the local secretion of these substances seems to increase in some neoplasms, a second objective of the study was to examine whether basal secretion of iCTs from primary prostate cells is increased in carcinoma. The present results have shown that both iHCT and iSCT were present in prostate tissue extracts. The mean iHCT levels in extracts of benign hyperplastic prostates (BPH) were 0.59 ng/g prostate, and these were significantly lower than iHCT concentrations in prostatic carcinoma (PC) (2.53 ng/g). No significant differences in their iSCT contents were observed. However, the results from culture of over 90 individual prostate tissue specimens from BPH or PC indicate that primary prostate cells secreted detectable quantities of iSCT and the basal release of this material from PC prostate cultures was almost four-fold higher than that from BPH prostate cultures. These results suggest that a CT-like immunoreactive material is secreted by primary prostate cells in culture, and the basal secretion of this material is significantly higher in PC cells as compared to BPH cells. Endogenous secretion of prostatic CT, and the elevation of its expression in PC suggest that it may serve as a regulatory factor in the pathophysiology of the prostate gland. PMID:1409122

  6. Which, when and why? Rational use of tissue-based molecular testing in localized prostate cancer.

    PubMed

    Ross, A E; D'Amico, A V; Freedland, S J

    2016-03-01

    An increased molecular understanding of localized prostate cancer and the improved ability for molecular testing of pathologic tissue has led to the development of multiple clinical assays. Here we review the relevant molecular biology of localized prostate cancer, currently available tissue-based tests and describe which is best supported for use in various clinical scenarios. Literature regarding testing of human prostate cancer tissue with Ki-67, PTEN (by immunohistochemistry (IHC) or fluroescence in situ hybridization (FISH)), ProMark, Prolaris, OncotypeDX Prostate and Decipher was reviewed to allow for generation of expert opinions. At diagnosis, evaluation of PTEN status, use of ProMark or OncotypeDX Prostate in men with Gleason 6 or 3+4=7 disease may help guide the use of active surveillance. For men with Gleason 7 or above disease considering watchful waiting, Ki-67 and Prolaris add independent prognostic information. For those men who have undergone prostatectomy and have adverse pathology, Decipher testing may aid in the decision to undergo adjuvant radiation. Newly available molecular tests bring opportunities to improve decision making for men with localized prostate cancer. A review of the currently available data suggests clinical scenarios for which each of these tests may have the greatest utility. PMID:26123120

  7. Influence of zinc deficiency on AKT-MDM2-P53 signaling axes in normal and malignant human prostate cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    With prostate being the highest zinc-accumulating tissue before the onset of cancer, the effects of physiologic levels of zinc on Akt-Mdm2-p53 and Akt-p21 signaling axes in human normal prostate epithelial cells (PrEC) and malignant prostate LNCaP cells were examined. Cells were cultured for 6 d in...

  8. Methylation profiling defines an extensive field defect in histologically normal prostate tissues associated with prostate cancer.

    PubMed

    Yang, Bing; Bhusari, Sachin; Kueck, Jessica; Weeratunga, Pushpa; Wagner, Jennifer; Leverson, Glen; Huang, Wei; Jarrard, David F

    2013-04-01

    Prostate cancer (PCa) is typically found as a multifocal disease suggesting the potential for molecular defects within the morphologically normal tissue. The frequency and spatial extent of DNA methylation changes encompassing a potential field defect are unknown. A comparison of non-tumor-associated (NTA) prostate to histologically indistinguishable tumor-associated (TA) prostate tissues detected a distinct profile of DNA methylation alterations (0.2%) using genome-wide DNA arrays based on the Encyclopedia of DNA Elements 18 sequence that tile both gene-rich and poor regions. Hypomethylation (87%) occurred more frequently than hypermethylation (13%). Several of the most significantly altered loci (CAV1, EVX1, MCF2L, and FGF1) were then used as probes to map the extent of these DNA methylation changes in normal tissues from prostates containing cancer. In TA tissues, the extent of methylation was similar both adjacent (2 mm) and at a distance (>1 cm) from tumor foci. These loci were also able to distinguish NTA from TA tissues in a validation set of patient samples. These mapping studies indicate that a spatially widespread epigenetic defect occurs in the peripheral prostate tissues of men who have PCa that may be useful in the detection of this disease. PMID:23555185

  9. Extracellular Vesicles from Metastatic Rat Prostate Tumors Prime the Normal Prostate Tissue to Facilitate Tumor Growth.

    PubMed

    Halin Bergström, Sofia; Hägglöf, Christina; Thysell, Elin; Bergh, Anders; Wikström, Pernilla; Lundholm, Marie

    2016-01-01

    Accumulating data indicates that tumor-derived extracellular vesicles (EVs) are responsible for tumor-promoting effects. However, if tumor EVs also prepare the tumor-bearing organ for subsequent tumor growth, and if this effect is different in low and high malignant tumors is not thoroughly explored. Here we used orthotopic rat Dunning R-3327 prostate tumors to compare the role of EVs from fast growing and metastatic MatLyLu (MLL) tumors with EVs from more indolent and non-metastatic Dunning G (G) tumors. Prostate tissue pre-conditioned with MLL-EVs in vivo facilitated G tumor establishment compared to G-EVs. MLL-EVs increased prostate epithelial proliferation and macrophage infiltration into the prostate compared to G-EVs. Both types of EVs increased macrophage endocytosis and the mRNA expression of genes associated with M2 polarization in vitro, with MLL-EVs giving the most pronounced effects. MLL-EVs also altered the mRNA expression of growth factors and cytokines in primary rat prostate fibroblasts compared to G-EVs, suggesting fibroblast activation. Our findings propose that EVs from metastatic tumors have the ability to prime the prostate tissue and enhance tumor growth to a higher extent than EVs from non-metastatic tumors. Identifying these differences could lead to novel therapeutic targets and potential prognostic markers for prostate cancer. PMID:27550147

  10. Extracellular Vesicles from Metastatic Rat Prostate Tumors Prime the Normal Prostate Tissue to Facilitate Tumor Growth

    PubMed Central

    Halin Bergström, Sofia; Hägglöf, Christina; Thysell, Elin; Bergh, Anders; Wikström, Pernilla; Lundholm, Marie

    2016-01-01

    Accumulating data indicates that tumor-derived extracellular vesicles (EVs) are responsible for tumor-promoting effects. However, if tumor EVs also prepare the tumor-bearing organ for subsequent tumor growth, and if this effect is different in low and high malignant tumors is not thoroughly explored. Here we used orthotopic rat Dunning R-3327 prostate tumors to compare the role of EVs from fast growing and metastatic MatLyLu (MLL) tumors with EVs from more indolent and non-metastatic Dunning G (G) tumors. Prostate tissue pre-conditioned with MLL-EVs in vivo facilitated G tumor establishment compared to G-EVs. MLL-EVs increased prostate epithelial proliferation and macrophage infiltration into the prostate compared to G-EVs. Both types of EVs increased macrophage endocytosis and the mRNA expression of genes associated with M2 polarization in vitro, with MLL-EVs giving the most pronounced effects. MLL-EVs also altered the mRNA expression of growth factors and cytokines in primary rat prostate fibroblasts compared to G-EVs, suggesting fibroblast activation. Our findings propose that EVs from metastatic tumors have the ability to prime the prostate tissue and enhance tumor growth to a higher extent than EVs from non-metastatic tumors. Identifying these differences could lead to novel therapeutic targets and potential prognostic markers for prostate cancer. PMID:27550147

  11. Radioimmunoassay of tissue steroids in adenocarcinoma of the prostate

    SciTech Connect

    Belis, J.A.; Tarry, W.F.

    1981-12-01

    Tissue steroid levels in 48 needle-biopsy samples of adenocarcinoma of the prostate were quantified by radioimmunoassay (RIA). Tissue levels of dihydrotestosterone (DHT), estradiol-17..beta.., and estrone were correlated with tumor stage, histologic grade, and patient response to endocrine therapy. All patients with well-differentiated carcinoma of the prostate had tissue DHT content greater than 2.0 ng/g while 35% of patients with moderately differentiated or poorly differentiated tumors had tissue DHT content less than 2.0 ng/g. DHT content appeared to be unrelated to tumor stage. Estradiol and estrone content correlated well with tumor grade but not with tumor stage. DHT levels were measured in 17 patients with symptomatic Stage D/sub 2/ carcinoma of the prostate. Thirteen patients with DHT content greater than 2.0 ng/g initially had an objective and/or subjective response to endocrine therapy. Four patients with tissue DHT levels below 2.0 ng/g had no response to hormonal therapy. Quantification of tissue DHT content by RIA is a promising method for predicting initial response to hormonal therapy in adenocarcinoma of the prostate.

  12. Dosimetric effect of tissue heterogeneity for 125I prostate implants

    PubMed Central

    Oliveira, Susana Maria; Teixeira, Nuno José; Fernandes, Lisete; Teles, Pedro; Vaz, Pedro

    2014-01-01

    Aim To use Monte Carlo (MC) together with voxel phantoms to analyze the tissue heterogeneity effect in the dose distributions and equivalent uniform dose (EUD) for 125I prostate implants. Background Dose distribution calculations in low dose-rate brachytherapy are based on the dose deposition around a single source in a water phantom. This formalism does not take into account tissue heterogeneities, interseed attenuation, or finite patient dimensions effects. Tissue composition is especially important due to the photoelectric effect. Materials and methods The computed tomographies (CT) of two patients with prostate cancer were used to create voxel phantoms for the MC simulations. An elemental composition and density were assigned to each structure. Densities of the prostate, vesicles, rectum and bladder were determined through the CT electronic densities of 100 patients. The same simulations were performed considering the same phantom as pure water. Results were compared via dose–volume histograms and EUD for the prostate and rectum. Results The mean absorbed doses presented deviations of 3.3–4.0% for the prostate and of 2.3–4.9% for the rectum, when comparing calculations in water with calculations in the heterogeneous phantom. In the calculations in water, the prostate D90 was overestimated by 2.8–3.9% and the rectum D0.1cc resulted in dose differences of 6–8%. The EUD resulted in an overestimation of 3.5–3.7% for the prostate and of 7.7–8.3% for the rectum. Conclusions The deposited dose was consistently overestimated for the simulation in water. In order to increase the accuracy in the determination of dose distributions, especially around the rectum, the introduction of the model-based algorithms is recommended. PMID:25337412

  13. ICRAC controls the rapid androgen response in human primary prostate epithelial cells and is altered in prostate cancer

    PubMed Central

    Holzmann, Christian; Kilch, Tatiana; Kappel, Sven; Armbrüster, Andrea; Jung, Volker; Stöckle, Michael; Bogeski, Ivan; Schwarz, Eva C.; Peinelt, Christine

    2013-01-01

    Labelled 5α-dihydrotestosterone (DHT) binding experiments have shown that expression levels of (yet unidentified) membrane androgen receptors (mAR) are elevated in prostate cancer and correlate with a negative prognosis. However, activation of these receptors which mediate a rapid androgen response can counteract several cancer hallmark functions such as unlimited proliferation, enhanced migration, adhesion and invasion and the inability to induce apoptosis. Here, we investigate the downstream signaling pathways of mAR and identify rapid DHT induced activation of store-operated Ca2+ entry (SOCE) in primary cultures of human prostate epithelial cells (hPEC) from non-tumorous tissue. Consequently, down-regulation of Orai1, the main molecular component of Ca2+ release-activated Ca2+ (CRAC) channels results in an almost complete loss of DHT induced SOCE. We demonstrate that this DHT induced Ca2+ influx via Orai1 is important for rapid androgen triggered prostate specific antigen (PSA) release. We furthermore identified alterations of the molecular components of CRAC channels in prostate cancer. Three lines of evidence indicate that prostate cancer cells down-regulate expression of the Orai1 homolog Orai3: First, Orai3 mRNA expression levels are significantly reduced in tumorous tissue when compared to non-tumorous tissue from prostate cancer patients. Second, mRNA expression levels of Orai3 are decreased in prostate cancer cell lines LNCaP and DU145 when compared to hPEC from healthy tissue. Third, the pharmacological profile of CRAC channels in prostate cancer cell lines and hPEC differ and siRNA based knock-down experiments indicate changed Orai3 levels are underlying the altered pharmacological profile. The cancer-specific composition and pharmacology of CRAC channels identifies CRAC channels as putative targets in prostate cancer therapy. PMID:24240085

  14. Prostate-specific membrane antigen protein expression in tumor tissue and risk of lethal prostate cancer

    PubMed Central

    Kasperzyk, Julie L.; Finn, Stephen P.; Flavin, Richard; Fiorentino, Michelangelo; Lis, Rosina; Hendrickson, Whitney K.; Clinton, Steven K.; Sesso, Howard D.; Giovannucci, Edward L.; Stampfer, Meir J.; Loda, Massimo; Mucci, Lorelei A.

    2013-01-01

    Background Over-expression of prostate-specific membrane antigen (PSMA) in tumor tissue and serum has been linked to increased risk of biochemical recurrence in surgically treated prostate cancer patients, but no studies have assessed its association with disease-specific mortality. Methods We examined whether high PSMA protein expression in prostate tumor tissue was associated with lethal disease, and with tumor biomarkers of progression, among participants of two US-based cohorts (n=902, diagnosed 1983–2004). We used Cox proportional hazards regression to calculate multivariable hazard ratios (HR) and 95% confidence intervals (CI) of lethal prostate cancer, defined as disease-specific death or development of distant metastases (n=95). Partial Spearman rank correlation coefficients were used to correlate PSMA with tumor biomarkers. Results During an average 13 years of follow-up, higher PSMA expression at prostatectomy was significantly associated with lethal prostate cancer (age-adjusted HRQuartile(Q)4vs.Q1=2.42; p-trend<0.01). This association was attenuated and non-significant (multivariable-adjusted HRQ4vs.Q1=1.01; p-trend=0.52) after further adjusting for Gleason score and PSA at diagnosis. High PSMA expression was significantly (p<0.05) correlated with higher Gleason score and PSA at diagnosis, increased tumor angiogenesis, lower vitamin D receptor and androgen receptor expression, and absence of ERG expression. Conclusions High tumor PSMA expression was not an independent predictor of lethal prostate cancer in the current study. PSMA expression likely captures, in part, malignant features of Gleason grade and tumor angiogenesis. Impact PSMA is not a strong candidate biomarker for predicting prostate cancer-specific mortality in surgically treated patients. PMID:24130224

  15. Prostate cancer outcome and tissue levels of metal ions

    USGS Publications Warehouse

    Sarafanov, A.G.; Todorov, T.I.; Centeno, J.A.; MacIas, V.; Gao, W.; Liang, W.-M.; Beam, C.; Gray, Michael A.; Kajdacsy-Balla, A.

    2011-01-01

    BACKGROUND There are several studies examining prostate cancer and exposure to cadmium, iron, selenium, and zinc. Less data are available on the possible influence of these metal ions on prostate cancer outcome. This study measured levels of these ions in prostatectomy samples in order to examine possible associations between metal concentrations and disease outcome. METHODS We obtained formalin fixed paraffin embedded tissue blocks of prostatectomy samples of 40 patients with PSA recurrence, matched 1:1 (for year of surgery, race, age, Gleason grading, and pathology TNM classification) with tissue blocks from 40 patients without recurrence (n = 80). Case-control pairs were compared for the levels of metals in areas adjacent to tumors. Inductively coupled plasma-mass spectrometry (ICP-MS) was used for quantification of Cd, Fe, Zn, and Se. RESULTS Patients with biochemical (PSA) recurrence of disease had 12% lower median iron (95 ??g/g vs. 111 ??g/g; P = 0.04) and 21% lower zinc (279 ??g/g vs. 346 ??g/g; P = 0.04) concentrations in the normal-appearing tissue immediately adjacent to cancer areas. Differences in cadmium (0.489 ??g/g vs. 0.439 ??g/g; 4% higher) and selenium (1.68 ??g/g vs. 1.58 ??g/g; 5% higher) levels were not statistically significant in recurrence cases, when compared to non-recurrences (P = 0.40 and 0.21, respectively). CONCLUSIONS There is an association between low zinc and low iron prostate tissue levels and biochemical recurrence in prostate cancer. Whether these novel findings are a cause or effect of more aggressive tumors, or whether low zinc and iron prostatic levels raise implications for therapy, remains to be investigated. Copyright ?? 2011 Wiley-Liss, Inc.

  16. Candidate Serum Biomarkers for Prostate Adenocarcinoma Identified by mRNA Differences in Prostate Tissue and Verified with Protein Measurements in Tissue and Blood

    PubMed Central

    Klee, Eric W.; Bondar, Olga P.; Goodmanson, Marcia K.; Dyer, Roy B.; Erdogan, Sibel; Bergstralh, Eric J.; Bergen, H. Robert; Sebo, Thomas J.; Klee, George G.

    2014-01-01

    BACKGROUND Improved tests are needed for detection and management of prostate cancer. We hypothesized that differential gene expression in prostate tissue could help identify candidate blood biomarkers for prostate cancer and that blood from men with advanced prostate disease could be used to verify their presence in circulation. METHODS Candidate markers were identified using mRNA expression patterns from laser-capture microdissected prostate tissue. Tissue expression was confirmed using immunohistochemistry (IHC) for the subset of candidates having commercial antisera. Tissue extracts were analyzed with tandem mass spectrometry (MS/MS). Blood concentrations were measured using immunoassays and MS/MS of trypsin-digested, immuno-extracted peptides. RESULTS Thirty-five novel candidate prostate adenocarcinoma biomarkers were selected. Tissue expression was confirmed for all of the 13 markers having commercial antisera for IHC and six of these markers showed statistical discrimination between normal and malignant tissue. Only 5 of these markers were detected in tissue extracts using MS/MS. Sixteen of the 35 candidate markers were successfully assayed in blood. Four of eight biomarkers measured with ELISA and 3 of 10 biomarkers measured by targeted MS showed statistically significant increases in blood concentrations of advanced prostate cancer cases, compared to controls. CONCLUSION Seven novel biomarkers identified by gene expression profiles in prostate tissue were shown to have statistically significant increased levels in blood from men with advanced prostate adenocarcinoma compared to controls: APOC1, ASPN, COMP, CXCL11, CXCL9, F5, and PCSK6. PMID:22247499

  17. Micro and bulk analysis of prostate tissues classified as hyperplasia

    NASA Astrophysics Data System (ADS)

    Kwiatek, W. M.; Banaś, A.; Banaś, K.; Cinque, G.; Dyduch, G.; Falkenberg, G.; Kisiel, A.; Marcelli, A.; Podgórczyk, M.

    2007-07-01

    BPH (Benign Prostatic Hyperplasia) is the most common benign neoplasm (non cancerous enlargement of the prostate gland), whose prevalence increases with age. The gland, when increased in size, exerts pressure on the urethra, causing obstruction to urine flow. The latter may result in severe urinary tract and kidney conditions. In this work prostate samples from patients diagnosed with BPH were analyzed using synchrotron radiation. Micro-analysis of the hyperplastic samples was carried out on the L-beam line at HASYLAB, DESY (Germany), while bulk analysis on selected samples was performed at the DRX2 beamline at LNF, Frascati (Italy). Microanalysis with a mono-energetic beam 15 μm in diameter confirmed that concentrations of certain elements, such as S, Mn, Cu, Fe and Zn, are good indicators of pathological disorders in prostate tissue that may be considered effective tracers of developing compliant. The concentrations of Mn, Cu, Fe and Zn are higher in hyperplastic tissues, as compared to normal ones, while for sulphur the opposite is observed. Additionally, Fe and S K-edge XANES (X-ray Absorption Near Edge Structure) spectroscopy experiments were carried out in order to determine the chemical speciation of these elements in our samples.

  18. Induced pluripotency of human prostatic epithelial cells.

    PubMed

    Zhao, Hongjuan; Sun, Ning; Young, Sarah R; Nolley, Rosalie; Santos, Jennifer; Wu, Joseph C; Peehl, Donna M

    2013-01-01

    Induced pluripotent stem (iPS) cells are a valuable resource for discovery of epigenetic changes critical to cell type-specific differentiation. Although iPS cells have been generated from other terminally differentiated cells, the reprogramming of normal adult human basal prostatic epithelial (E-PZ) cells to a pluripotent state has not been reported. Here, we attempted to reprogram E-PZ cells by forced expression of Oct4, Sox2, c-Myc, and Klf4 using lentiviral vectors and obtained embryonic stem cell (ESC)-like colonies at a frequency of 0.01%. These E-PZ-iPS-like cells with normal karyotype gained expression of pluripotent genes typical of iPS cells (Tra-1-81, SSEA-3, Nanog, Sox2, and Oct4) and lost gene expression characteristic of basal prostatic epithelial cells (CK5, CK14, and p63). E-PZ-iPS-like cells demonstrated pluripotency by differentiating into ectodermal, mesodermal, and endodermal cells in vitro, although lack of teratoma formation in vivo and incomplete demethylation of pluripotency genes suggested only partial reprogramming. Importantly, E-PZ-iPS-like cells re-expressed basal epithelial cell markers (CD44, p63, MAO-A) in response to prostate-specific medium in spheroid culture. Androgen induced expression of androgen receptor (AR), and co-culture with rat urogenital sinus further induced expression of prostate-specific antigen (PSA), a hallmark of secretory cells, suggesting that E-PZ-iPS-like cells have the capacity to differentiate into prostatic basal and secretory epithelial cells. Finally, when injected into mice, E-PZ-iPS-like cells expressed basal epithelial cell markers including CD44 and p63. When co-injected with rat urogenital mesenchyme, E-PZ-iPS-like cells expressed AR and expression of p63 and CD44 was repressed. DNA methylation profiling identified epigenetic changes in key pathways and genes involved in prostatic differentiation as E-PZ-iPS-like cells converted to differentiated AR- and PSA-expressing cells. Our results suggest that

  19. Epigenetic DNA methylation of antioxidative stress regulator NRF2 in human prostate cancer.

    PubMed

    Khor, Tin Oo; Fuentes, Francisco; Shu, Limin; Paredes-Gonzalez, Ximena; Yang, Anne Yuqing; Liu, Yue; Smiraglia, Dominic J; Yegnasubramanian, Srinivasan; Nelson, William G; Kong, Ah-Ng Tony

    2014-12-01

    Epigenetic control of NRF2, a master regulator of many critical antioxidative stress defense genes in human prostate cancer (CaP), is unknown. Our previous animal study found decreased Nrf2 expression through promoter CpG methylation/histone modifications during prostate cancer progression in TRAMP mice. In this study, we evaluated CpG methylation of human NRF2 promoter in 27 clinical prostate cancer samples and in LNCaP cells using MAQMA analysis and bisulfite genomic DNA sequencing. Prostate cancer tissue microarray (TMA) containing normal and prostate cancer tissues was studied by immunohistochemistry. Luciferase reporter assay using specific human NRF2 DNA promoter segments and chromatin immunoprecipitation (ChIP) assay against histone modifying proteins were performed in LNCaP cells. Three specific CpG sites in the NRF2 promoter were found to be hypermethylated in clinical prostate cancer samples (BPHhuman prostate cancer TMA showed a decreasing trend for both intensity and percentage of positive cells from normal tissues to advanced-stage prostate cancer (Gleason score from 3-9). Reporter assays in the LNCaP cells containing these three CpG sites showed methylation-inhibited transcriptional activity of the NRF2 promoter. LNCaP cells treated with 5-aza/TSA restored the expression of NRF2 and NRF2 downstream target genes, decreased expression levels of DNMT and HDAC proteins, and ChIP assays showed increased RNA Pol II and H3Ac with a concomitant decrease in H3K9me3, MBD2, and MeCP2 at CpG sites of human NRF2 promoter. Taken together, these findings suggest that epigenetic modification may contribute to the regulation of transcription activity of NRF2, which could be used as prevention and treatment target of human prostate cancer. PMID:25266896

  20. Maturation of the developing human fetal prostate in a rodent xenograft model

    PubMed Central

    Saffarini, Camelia M.; McDonnell, Elizabeth V.; Amin, Ali; Spade, Daniel J.; Huse, Susan M.; Kostadinov, Stefan; Hall, Susan J.; Boekelheide, Kim

    2015-01-01

    Background Prostate cancer is the most commonly diagnosed non-skin cancer in men. The etiology of prostate cancer is unknown, although both animal and epidemiologic data suggest that early life exposures to various toxicants, may impact DNA methylation status during development, playing an important role. Methods We have developed a xenograft model to characterize the growth and differentiation of human fetal prostate implants (gestational age 12-24 weeks) that can provide new data on the potential role of early life stressors on prostate cancer. The expression of key immunohistochemical markers responsible for prostate maturation was evaluated, including p63, cytokeratin 18, α-smooth muscle actin, vimentin, caldesmon, Ki-67, prostate specific antigen, estrogen receptor-α, and androgen receptor. Xenografts were separated into epithelial and stromal compartments using laser capture microdissection (LCM), and the DNA methylation status was assessed in >480,000 CpG sites throughout the genome. Results Xenografts demonstrated growth and maturation throughout the 200 days of post-implantation evaluation. DNA methylation profiles of laser capture micro-dissected tissue demonstrated tissue-specific markers clustered by their location in either the epithelium or stroma of human prostate tissue. Differential methylated promoter region CpG-associated gene analysis revealed significantly more stromal than epithelial DNA methylation in the 30 and 90-day xenografts. Functional classification analysis identified CpG-related gene clusters in methylated epithelial and stromal human xenografts. Conclusion This study of human fetal prostate tissue establishes a xenograft model that demonstrates dynamic growth and maturation, allowing for future mechanistic studies of the developmental origins of later life proliferative prostate disease. PMID:24038131

  1. Mutated human androgen receptor gene detected in a prostatic cancer patient is also activated by estradiol

    SciTech Connect

    Elo, J.P.; Kvist, L.; Leinonen, K.; Isomaa, V.

    1995-12-01

    Androgens are necessary for the development of prostatic cancer. The mechanisms by which the originally androgen-dependent prostatic cancer cells are relieved of the requirement to use androgen for their growth are largely unknown. The human prostatic cancer cell line LNCaP has been shown to contain a point mutation in the human androgen receptor gene (hAR), suggesting that changes in the hAR may contribute to the abnormal hormone response of prostatic cells. To search for point mutations in the hAR, we used single strand conformation polymorphism analysis and a polymerase chain reaction direct sequencing method to screen 23 prostatic cancer specimens from untreated patients, 6 prostatic cancer specimens from treated patients, and 11 benign prostatic hyperplasia specimens. One mutation was identified in DNA isolated from prostatic cancer tissue, and the mutation was also detected in the leukocyte DNA of the patient and his offspring. The mutation changed codon 726 in exon E from arginine to leucine and was a germ line mutation. The mutation we found in exon E of the hAR gene does not alter the ligand binding specificity of the AR, but the mutated receptor was activated by estradiol to a significantly greater extent than the wild-type receptor. The AR gene mutation described in this study might be one explanation for the altered biological activity of prostatic cancer. 36 refs., 4 figs.

  2. Genome-Wide Methylation Analysis of Prostate Tissues Reveals Global Methylation Patterns of Prostate Cancer

    PubMed Central

    Luo, Jian-Hua; Ding, Ying; Chen, Rui; Michalopoulos, George; Nelson, Joel; Tseng, George; Yu, Yan P.

    2014-01-01

    Altered genome methylation is a hallmark of human malignancies. In this study, high-throughput analyses of concordant gene methylation and expression events were performed for 91 human prostate specimens, including prostate tumor (T), matched normal adjacent to tumor (AT), and organ donor (OD). Methylated DNA in genomic DNA was immunoprecipitated with anti-methylcytidine antibodies and detected by Affymetrix human whole genome SNP 6.0 chips. Among the methylated CpG islands, 11,481 islands were found located in the promoter and exon 1 regions of 9295 genes. Genes (7641) were methylated frequently across OD, AT, and T samples, whereas 239 genes were differentially methylated in only T and 785 genes in both AT and T but not OD. Genes with promoter methylation and concordantly suppressed expression were identified. Pathway analysis suggested that many of the methylated genes in T and AT are involved in cell growth and mitogenesis. Classification analysis of the differentially methylated genes in T or OD produced a specificity of 89.4% and a sensitivity of 85.7%. The T and AT groups, however, were only slightly separated by the prediction analysis, indicating a strong field effect. A gene methylation prediction model was shown to predict prostate cancer relapse with sensitivity of 80.0% and specificity of 85.0%. These results suggest methylation patterns useful in predicting clinical outcomes of prostate cancer. PMID:23583283

  3. Orphan nuclear receptor nurr1 as a potential novel marker for progression in human prostate cancer.

    PubMed

    Wang, Jian; Yang, Jing; Zou, Ying; Huang, Guo-Liang; He, Zhi-Wei

    2013-01-01

    A number of studies have indicated that Nurr1, which belongs to a novel class of orphan nuclear receptors (the NR4A family), is important for carcinogenesis. Here we investigated expression of Nurr1 protein in benign and malignant human prostate tissues and association with clinicopathologic features using immunohistochemical techniques. Moreover, we also investigated the ability of Nurr1 to influence proliferation, migration, invasion and apoptosis of human prostate cancer cells using small interfering RNA silencing. Immunohistochemical analysis revealed that the expression of Nurr1 protein was higher in prostate cancer tissues than in benign prostate tissue (P < 0.001), levels being positively correlated with tumor T classification (P = 0.003), N classification (P = 0.017), M classification (P = 0.011) and the Gleason score (P = 0.020) of prostate cancer patients. In vitro, silencing of endogenous Nurr1 attenuated cell proliferation, migration and invasion, and induced apoptosis of prostate cancer cells. These results suggest that Nurr1 may be used as an indicator for prostate cancer progression and be useful for novel potential therapeutic strategies. PMID:23679312

  4. A Balanced Tissue Composition Reveals New Metabolic and Gene Expression Markers in Prostate Cancer

    PubMed Central

    Tessem, May-Britt; Bertilsson, Helena; Angelsen, Anders; Bathen, Tone F.; Drabløs, Finn; Rye, Morten Beck

    2016-01-01

    Molecular analysis of patient tissue samples is essential to characterize the in vivo variability in human cancers which are not accessible in cell-lines or animal models. This applies particularly to studies of tumor metabolism. The challenge is, however, the complex mixture of various tissue types within each sample, such as benign epithelium, stroma and cancer tissue, which can introduce systematic biases when cancers are compared to normal samples. In this study we apply a simple strategy to remove such biases using sample selections where the average content of stroma tissue is balanced between the sample groups. The strategy is applied to a prostate cancer patient cohort where data from MR spectroscopy and gene expression have been collected from and integrated on the exact same tissue samples. We reveal in vivo changes in cancer-relevant metabolic pathways which are otherwise hidden in the data due to tissue confounding. In particular, lowered levels of putrescine are connected to increased expression of SRM, reduced levels of citrate are attributed to upregulation of genes promoting fatty acid synthesis, and increased succinate levels coincide with reduced expression of SUCLA2 and SDHD. In addition, the strategy also highlights important metabolic differences between the stroma, epithelium and prostate cancer. These results show that important in vivo metabolic features of cancer can be revealed from patient data only if the heterogeneous tissue composition is properly accounted for in the analysis. PMID:27100877

  5. A Balanced Tissue Composition Reveals New Metabolic and Gene Expression Markers in Prostate Cancer.

    PubMed

    Tessem, May-Britt; Bertilsson, Helena; Angelsen, Anders; Bathen, Tone F; Drabløs, Finn; Rye, Morten Beck

    2016-01-01

    Molecular analysis of patient tissue samples is essential to characterize the in vivo variability in human cancers which are not accessible in cell-lines or animal models. This applies particularly to studies of tumor metabolism. The challenge is, however, the complex mixture of various tissue types within each sample, such as benign epithelium, stroma and cancer tissue, which can introduce systematic biases when cancers are compared to normal samples. In this study we apply a simple strategy to remove such biases using sample selections where the average content of stroma tissue is balanced between the sample groups. The strategy is applied to a prostate cancer patient cohort where data from MR spectroscopy and gene expression have been collected from and integrated on the exact same tissue samples. We reveal in vivo changes in cancer-relevant metabolic pathways which are otherwise hidden in the data due to tissue confounding. In particular, lowered levels of putrescine are connected to increased expression of SRM, reduced levels of citrate are attributed to upregulation of genes promoting fatty acid synthesis, and increased succinate levels coincide with reduced expression of SUCLA2 and SDHD. In addition, the strategy also highlights important metabolic differences between the stroma, epithelium and prostate cancer. These results show that important in vivo metabolic features of cancer can be revealed from patient data only if the heterogeneous tissue composition is properly accounted for in the analysis. PMID:27100877

  6. Developmental Exposure to Estrogen Alters Differentiation and Epigenetic Programming in a Human Fetal Prostate Xenograft Model

    PubMed Central

    Saffarini, Camelia M.; McDonnell-Clark, Elizabeth V.; Amin, Ali; Huse, Susan M.; Boekelheide, Kim

    2015-01-01

    Prostate cancer is the most frequent non-cutaneous malignancy in men. There is strong evidence in rodents that neonatal estrogen exposure plays a role in the development of this disease. However, there is little information regarding the effects of estrogen in human fetal prostate tissue. This study explored early life estrogen exposure, with and without a secondary estrogen and testosterone treatment in a human fetal prostate xenograft model. Histopathological lesions, proliferation, and serum hormone levels were evaluated at 7, 30, 90, and 200-day time-points after xenografting. The expression of 40 key genes involved in prostatic glandular and stromal growth, cell-cycle progression, apoptosis, hormone receptors and tumor suppressors was evaluated using a custom PCR array. Epigenome-wide analysis of DNA methylation was performed on whole tissue, and laser capture-microdissection (LCM) isolated epithelial and stromal compartments of 200-day prostate xenografts. Combined initial plus secondary estrogenic exposures had the most severe tissue changes as revealed by the presence of hyperplastic glands at day 200. Gene expression changes corresponded with the cellular events in the KEGG prostate cancer pathway, indicating that initial plus secondary exposure to estrogen altered the PI3K-Akt signaling pathway, ultimately resulting in apoptosis inhibition and an increase in cell cycle progression. DNA methylation revealed that differentially methylated CpG sites significantly predominate in the stromal compartment as a result of estrogen-treatment, thereby providing new targets for future investigation. By using human fetal prostate tissue and eliminating the need for species extrapolation, this study provides novel insights into the gene expression and epigenetic effects related to prostate carcinogenesis following early life estrogen exposure. PMID:25799167

  7. Detecting positive surgical margins of prostate tissues using elastic light single-scattering spectroscopy

    NASA Astrophysics Data System (ADS)

    Canpolat, Murat; Denkçeken, Tuba; Başsorgun, Ibrahim; Yücel, Selçuk; Çiftçioğlu, M. A.; Baykara, Mehment

    2011-09-01

    Elastic light single-scattering spectroscopy (ELSSS) system with a single optical fiber probe was employed to differentiate cancerous prostate tissue from non-cancerous prostate tissue ex-vivo just after radical prostatectomy. First, ELSSS spectra were acquired from cancerous prostate tissue to define its spectral features. Then, spectra were acquired from surgical margins of excised prostate tissue to detect positive surgical margins based on the spectral features of the spectra taken from cancerous prostate tissues. Of the total 128 tissue samples were evaluated from 18 patients by ELSSS system. Comparing of histopathology results and ELSSS measurements revealed that sign of the spectral slopes of cancerous prostate tissue is negative and non-cancerous tissue is positive in the wavelength range from 450 to 750 nm. Sign of the spectral slopes were used as a discrimination parameter between cancerous and non-cancerous prostate tissues. Based on the correlation between histopathology results and sign of the spectral slopes, ELSSS system differentiates cancerous prostate tissue from non-cancerous with a sensitivity of 0.97 and a specificity of 0.87.

  8. Detecting positive surgical margins of prostate tissues using elastic light single-scattering spectroscopy

    NASA Astrophysics Data System (ADS)

    Canpolat, Murat; Denkçeken, Tuba; Başsorgun, İbrahim; Yücel, Selçuk; Çiftçioğlu, M. A.; Baykara, Mehment

    2012-02-01

    Elastic light single-scattering spectroscopy (ELSSS) system with a single optical fiber probe was employed to differentiate cancerous prostate tissue from non-cancerous prostate tissue ex-vivo just after radical prostatectomy. First, ELSSS spectra were acquired from cancerous prostate tissue to define its spectral features. Then, spectra were acquired from surgical margins of excised prostate tissue to detect positive surgical margins based on the spectral features of the spectra taken from cancerous prostate tissues. Of the total 128 tissue samples were evaluated from 18 patients by ELSSS system. Comparing of histopathology results and ELSSS measurements revealed that sign of the spectral slopes of cancerous prostate tissue is negative and non-cancerous tissue is positive in the wavelength range from 450 to 750 nm. Sign of the spectral slopes were used as a discrimination parameter between cancerous and non-cancerous prostate tissues. Based on the correlation between histopathology results and sign of the spectral slopes, ELSSS system differentiates cancerous prostate tissue from non-cancerous with a sensitivity of 0.97 and a specificity of 0.87.

  9. Early Growth Response1and Fatty Acid Synthase Expression is Altered in Tumor Adjacent Prostate Tissue and Indicates Field Cancerization

    PubMed Central

    Jones, Anna C.; Trujillo, Kristina A.; Phillips, Genevieve K.; Fleet, Trisha M.; Murton, Jaclyn K.; Severns, Virginia; Shah, Satyan K.; Davis, Michael S.; Smith, Anthony Y.; Griffith, Jeffrey K.; Fischer, Edgar G.; Bisoffi, Marco

    2011-01-01

    BACKGROUND Field cancerization denotes the occurrence of molecular alterations in histologically normal tissues adjacent to tumors. In prostate cancer, identification of field cancerization has several potential clinical applications. However, prostate field cancerization remains ill defined. Our previous work has shown up-regulated mRNA of the transcription factor early growth response 1 (EGR-1) and the lipogenic enzyme fatty acid synthase (FAS) in tissues adjacent to prostate cancer. METHODS Immunofluorescence data were analyzed quantitatively by spectral imaging and linear unmixing to determine the protein expression levels of EGR-1 and FAS in human cancerous, histologically normal adjacent, and disease-free prostate tissues. RESULTS EGR-1 expression was elevated in both structurally intact tumor adjacent (1.6× on average) and in tumor (3.0× on average) tissues compared to disease-free tissues. In addition, the ratio of cytoplasmic versus nuclear EGR-1 expression was elevated in both tumor adjacent and tumor tissues. Similarly, FAS expression was elevated in both tumor adjacent (2.7× on average) and in tumor (2.5× on average) compared to disease-free tissues. CONCLUSIONS EGR-1 and FAS expression is similarly deregulated in tumor and structurally intact adjacent prostate tissues and defines field cancerization. In cases with high suspicion of prostate cancer but negative biopsy, identification of field cancerization could help clinicians target areas for repeat biopsy. Field cancerization at surgical margins on prostatectomy specimen should also be looked at as a predictor of cancer recurrence. EGR-1 and FAS could also serve as molecular targets for chemoprevention. PMID:22127986

  10. Frequency analysis of multispectral photoacoustic images for differentiating malignant region from normal region in excised human prostate

    NASA Astrophysics Data System (ADS)

    Sinha, Saugata; Rao, Navalgund A.; Valluru, Keerthi S.; Chinni, Bhargava K.; Dogra, Vikram S.; Helguera, Maria

    2014-03-01

    Frequency domain analysis of the photoacoustic (PA) radio frequency signals can potentially be used as a tool for characterizing microstructure of absorbers in tissue. This study investigates the feasibility of analyzing the spectrum of multiwavelength PA signals generated by excised human prostate tissue samples to differentiate between malignant and normal prostate regions. Photoacoustic imaging at five different wavelengths, corresponding to peak absorption coefficients of deoxyhemoglobin, whole blood, oxyhemoglobin, water and lipid in the near infrared (NIR) (700 nm - 1000 nm) region, was performed on freshly excised prostate specimens taken from patients undergoing prostatectomy for biopsy confirmed prostate cancer. The PA images were co-registered with the histopathology images of the prostate specimens to determine the region of interest (ROI) corresponding to malignant and normal tissue. The calibrated power spectrum of each PA signal from a selected ROI was fit to a linear model to extract the corresponding slope, midband fit and intercept parameters. The mean value of each parameter corresponding to malignant and adjacent normal prostate ROI was calculated for each of the five wavelengths. The results obtained for 9 different human prostate specimens, show that the mean values of midband fit and intercept are significantly different between malignant and normal regions. In addition, the average midband fit and intercept values show a decreasing trend with increasing wavelength. These preliminary results suggest that frequency analysis of multispectral PA signals can be used to differentiate malignant region from the adjacent normal region in human prostate tissue.

  11. Expression of leukemia/lymphoma related factor (LRF/Pokemon) in human benign prostate hyperplasia and prostate cancer.

    PubMed

    Aggarwal, Himanshu; Aggarwal, Anshu; Hunter, William J; Yohannes, Paulos; Khan, Ansar U; Agrawal, Devendra K

    2011-04-01

    Leukemia/lymphoma related factor (LRF), also known as Pokemon, is a protein that belongs to the POK family of transcriptional repressors. It has an oncogenic role in many different solid tumors. In this study, the expression of LRF was evaluated in benign prostate hyperplastic (BPH) and prostate cancer (PC) tissues. The functional expression of LRF was studied using multiple cellular and molecular methods including RT-PCR, western blotting, immunohistochemistry, and immunofluorescence. Paraffin-embedded human tissues of BPH and PC were used to examine LRF expression. Histological staining of the BPH and PC tissue sections revealed nuclear expression of LRF with minimal expression in the surrounding stroma. The semi-quantitative RT-PCR and western immunoblot analyses demonstrated significantly higher mRNA transcripts and protein expression in PC than BPH. High expression of LRF suggests that it may have a potential role in the pathogenesis of both BPH and prostate cancer. Further studies will help elucidate the mechanisms and signaling pathways that LRF may follow in the pathogenesis of prostate carcinoma. PMID:21251909

  12. AKT1 and MYC Induce Distinctive Metabolic Fingerprints in Human Prostate Cancer

    PubMed Central

    Priolo, Carmen; Pyne, Saumyadipta; Rose, Joshua; Regan, Erzsébet Ravasz; Zadra, Giorgia; Photopoulos, Cornelia; Cacciatore, Stefano; Schultz, Denise; Scaglia, Natalia; McDunn, Jonathan; De Marzo, Angelo M.; Loda, Massimo

    2014-01-01

    Cancer cells may overcome growth factor dependence by deregulating oncogenic and/or tumor suppressor pathways that affect their metabolism, or by activating metabolic pathways de novo with targeted mutations in critical metabolic enzymes. It is unknown whether human prostate tumors develop a similar metabolic response to different oncogenic drivers or a particular oncogenic event results in its own metabolic reprogramming. Akt and Myc are arguably the most prevalent driving oncogenes in prostate cancer. Mass spectrometry-based metabolite profiling was performed on immortalized human prostate epithelial cells transformed by AKT1 or MYC, transgenic mice driven by the same oncogenes under the control of a prostate-specific promoter, and human prostate specimens characterized for the expression and activation of these oncoproteins. Integrative analysis of these metabolomic datasets revealed that AKT1 activation was associated with accumulation of aerobic glycolysis metabolites, whereas MYC overexpression was associated with dysregulated lipid metabolism. Selected metabolites that differentially accumulated in the MYC-high vs. AKT1-high tumors, or in normal vs. tumor prostate tissue by untargeted metabolomics, were validated using absolute quantitation assays. Importantly, the AKT1/MYC status was independent of Gleason grade and pathologic staging. Our findings show how prostate tumors undergo a metabolic reprogramming which reflects their molecular phenotypes, with implications for the development of metabolic diagnostics and targeted therapeutics. PMID:25322691

  13. Optical characteristics of prostate tissues and the key chromophores and fluorophores within tissues related to carcinogenesis

    NASA Astrophysics Data System (ADS)

    Zhou, Kenneth J.; Chen, Jun

    2015-03-01

    Tissues are an impressive complex creation comprised of a vast of assortment of molecules, structures and functional units. Despite this overwhelming complexity, we may still discuss average optical properties as long as we realize the limitations involved. There are five independent macroscopic parameters that are believed to characterize light propagation in tissue: the index of refraction (n), the absorption coefficient (μa), the scattering coefficient (μs), the reduced scattering coefficient (μ's), and the scattering anisotropy (g). This paper summarizes the Optical characteristics of tissue of prostate tissues ex vivo and the key fluorophores related to carcinogenesis. The absorption coefficient (μa) describes the effectiveness of light absorbed by certain chromophore. The key spectra fingerprints of water were introduced to distinguish different water contents in normal and cancerous prostate tissues. Fluorescence occurs when a molecule, atom or nanostructure relaxes to its ground state after being electrically excited. There are three fluorescence parameters of interest we may concern in tissue optics: the fluorescence lifetime (τf), the fluorescence quantum yield (Φ) and the fluorescence emission peak (λmax). The key wavelengths which can be used for cancer detection were reviewed. Scattering of light occurs in media which contains fluctuations in the refractive index n. Tissue ultrastructure extends from membranes to membrane aggregates to collagen fibers to nuclei to cells, which may be an alternative way to detect cancer in tissues.

  14. Analysis of the Human Prostate-Specific Proteome Defined by Transcriptomics and Antibody-Based Profiling Identifies TMEM79 and ACOXL as Two Putative, Diagnostic Markers in Prostate Cancer

    PubMed Central

    O'Hurley, Gillian; Busch, Christer; Fagerberg, Linn; Hallström, Björn M.; Stadler, Charlotte; Tolf, Anna; Lundberg, Emma; Schwenk, Jochen M.; Jirström, Karin; Bjartell, Anders; Gallagher, William M.; Uhlén, Mathias; Pontén, Fredrik

    2015-01-01

    To better understand prostate function and disease, it is important to define and explore the molecular constituents that signify the prostate gland. The aim of this study was to define the prostate specific transcriptome and proteome, in comparison to 26 other human tissues. Deep sequencing of mRNA (RNA-seq) and immunohistochemistry-based protein profiling were combined to identify prostate specific gene expression patterns and to explore tissue biomarkers for potential clinical use in prostate cancer diagnostics. We identified 203 genes with elevated expression in the prostate, 22 of which showed more than five-fold higher expression levels compared to all other tissue types. In addition to previously well-known proteins we identified two poorly characterized proteins, TMEM79 and ACOXL, with potential to differentiate between benign and cancerous prostatic glands in tissue biopsies. In conclusion, we have applied a genome-wide analysis to identify the prostate specific proteome using transcriptomics and antibody-based protein profiling to identify genes with elevated expression in the prostate. Our data provides a starting point for further functional studies to explore the molecular repertoire of normal and diseased prostate including potential prostate cancer markers such as TMEM79 and ACOXL. PMID:26237329

  15. Feature-based analysis of mouse prostatic intraepithelial neoplasia in histological tissue sections.

    PubMed

    Ruusuvuori, Pekka; Valkonen, Mira; Nykter, Matti; Visakorpi, Tapio; Latonen, Leena

    2016-01-01

    This paper describes work presented at the Nordic Symposium on Digital Pathology 2015, in Linköping, Sweden. Prostatic intraepithelial neoplasia (PIN) represents premalignant tissue involving epithelial growth confined in the lumen of prostatic acini. In the attempts to understand oncogenesis in the human prostate, early neoplastic changes can be modeled in the mouse with genetic manipulation of certain tumor suppressor genes or oncogenes. As with many early pathological changes, the PIN lesions in the mouse prostate are macroscopically small, but microscopically spanning areas often larger than single high magnification focus fields in microscopy. This poses a challenge to utilize full potential of the data acquired in histological specimens. We use whole prostates fixed in molecular fixative PAXgene™, embedded in paraffin, sectioned through and stained with H&E. To visualize and analyze the microscopic information spanning whole mouse PIN (mPIN) lesions, we utilize automated whole slide scanning and stacked sections through the tissue. The region of interests is masked, and the masked areas are processed using a cascade of automated image analysis steps. The images are normalized in color space, after which exclusion of secretion areas and feature extraction is performed. Machine learning is utilized to build a model of early PIN lesions for determining the probability for histological changes based on the calculated features. We performed a feature-based analysis to mPIN lesions. First, a quantitative representation of over 100 features was built, including several features representing pathological changes in PIN, especially describing the spatial growth pattern of lesions in the prostate tissue. Furthermore, we built a classification model, which is able to align PIN lesions corresponding to grading by visual inspection to more advanced and mild lesions. The classifier allowed both determining the probability of early histological changes for uncategorized

  16. Feature-based analysis of mouse prostatic intraepithelial neoplasia in histological tissue sections

    PubMed Central

    Ruusuvuori, Pekka; Valkonen, Mira; Nykter, Matti; Visakorpi, Tapio; Latonen, Leena

    2016-01-01

    This paper describes work presented at the Nordic Symposium on Digital Pathology 2015, in Linköping, Sweden. Prostatic intraepithelial neoplasia (PIN) represents premalignant tissue involving epithelial growth confined in the lumen of prostatic acini. In the attempts to understand oncogenesis in the human prostate, early neoplastic changes can be modeled in the mouse with genetic manipulation of certain tumor suppressor genes or oncogenes. As with many early pathological changes, the PIN lesions in the mouse prostate are macroscopically small, but microscopically spanning areas often larger than single high magnification focus fields in microscopy. This poses a challenge to utilize full potential of the data acquired in histological specimens. We use whole prostates fixed in molecular fixative PAXgene™, embedded in paraffin, sectioned through and stained with H&E. To visualize and analyze the microscopic information spanning whole mouse PIN (mPIN) lesions, we utilize automated whole slide scanning and stacked sections through the tissue. The region of interests is masked, and the masked areas are processed using a cascade of automated image analysis steps. The images are normalized in color space, after which exclusion of secretion areas and feature extraction is performed. Machine learning is utilized to build a model of early PIN lesions for determining the probability for histological changes based on the calculated features. We performed a feature-based analysis to mPIN lesions. First, a quantitative representation of over 100 features was built, including several features representing pathological changes in PIN, especially describing the spatial growth pattern of lesions in the prostate tissue. Furthermore, we built a classification model, which is able to align PIN lesions corresponding to grading by visual inspection to more advanced and mild lesions. The classifier allowed both determining the probability of early histological changes for uncategorized

  17. Epidermal growth factor increases LRF/Pokemon expression in human prostate cancer cells.

    PubMed

    Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K

    2011-10-01

    Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. PMID:21640721

  18. Zinc in Specialized Secretory Tissues: Roles in the Pancreas, Prostate, and Mammary Gland12

    PubMed Central

    Kelleher, Shannon L.; McCormick, Nicholas H.; Velasquez, Vanessa; Lopez, Veronica

    2011-01-01

    Zinc (Zn) is an essential micronutrient required for over 300 different cellular processes, including DNA and protein synthesis, enzyme activity, and intracellular signaling. Cellular Zn homeostasis necessitates the compartmentalization of Zn into intracellular organelles, which is tightly regulated through the integration of Zn transporting mechanisms. The pancreas, prostate, and mammary gland are secretory tissues that have unusual Zn requirements and thus must tightly regulate Zn metabolism through integrating Zn import, sequestration, and export mechanisms. Recent findings indicate that these tissues utilize Zn for basic cellular processes but also require Zn for unique cellular needs. In addition, abundant Zn is transported into the secretory pathway and a large amount is subsequently secreted in a tightly regulated manner for unique biological processes. Expression of numerous members of the SLC30A (ZnT) and SLC39A (Zip) gene families has been documented in these tissues, yet there is limited understanding of their precise functional role in Zn metabolism or their regulation. Impairments in Zn secretion from the pancreas, prostate, and mammary gland are associated with disorders such as diabetes, infertility, and cancer, respectively. In this review, we will provide a brief summary of the specific role of Zn in each tissue and describe our current knowledge regarding how Zn metabolism is regulated. Finally, in each instance, we will reflect upon how this information shapes our current understanding of the role of Zn in these secretory tissues with respect to human health and disease. PMID:22332039

  19. Hormonal modulation of invitro biosynthesis of inhibin like peptide by human prostate.

    PubMed

    Vanage, G R; Phadke, M A; Bandivdekar, A H; Sheth, A R

    1990-01-01

    The hormonal regulation of inhibin biosynthesis by human benign hyperplastic prostate tissue was studied by determining the incorporation of 3H-leucine. 3H-inhibin, synthesized de novo, was immunoprecipitated from the culture media using specific antibodies to human prostatic inhibin. Testosterone and estradiol had no effect on inhibin biosynthesis whereas hFSH and PMSG had stimulatory effect. A decrease in inhibin biosynthesis was noticed on the addition of LHRH, TRH, hCG, hLH and human prolactin. PMID:2126421

  20. Methylation Profiling Defines an Extensive Field Defect in Histologically Normal Prostate Tissues Associated with Prostate Cancer12

    PubMed Central

    Yang, Bing; Bhusari, Sachin; Kueck, Jessica; Weeratunga, Pushpa; Wagner, Jennifer; Leverson, Glen; Huang, Wei; Jarrard, David F

    2013-01-01

    Prostate cancer (PCa) is typically found as a multifocal disease suggesting the potential for molecular defects within the morphologically normal tissue. The frequency and spatial extent of DNA methylation changes encompassing a potential field defect are unknown. A comparison of non-tumor-associated (NTA) prostate to histologically indistinguishable tumor-associated (TA) prostate tissues detected a distinct profile of DNA methylation alterations (0.2%) using genome-wide DNA arrays based on the Encyclopedia of DNA Elements 18 sequence that tile both gene-rich and poor regions. Hypomethylation (87%) occurred more frequently than hypermethylation (13%). Several of the most significantly altered loci (CAV1, EVX1, MCF2L, and FGF1) were then used as probes to map the extent of these DNA methylation changes in normal tissues from prostates containing cancer. In TA tissues, the extent of methylation was similar both adjacent (2 mm) and at a distance (>1 cm) from tumor foci. These loci were also able to distinguish NTA from TA tissues in a validation set of patient samples. These mapping studies indicate that a spatially widespread epigenetic defect occurs in the peripheral prostate tissues of men who have PCa that may be useful in the detection of this disease. PMID:23555185

  1. An informatics model for tissue banks – Lessons learned from the Cooperative Prostate Cancer Tissue Resource

    PubMed Central

    Patel, Ashokkumar A; Gilbertson, John R; Parwani, Anil V; Dhir, Rajiv; Datta, Milton W; Gupta, Rajnish; Berman, Jules J; Melamed, Jonathan; Kajdacsy-Balla, Andre; Orenstein, Jan; Becich, Michael J

    2006-01-01

    Background Advances in molecular biology and growing requirements from biomarker validation studies have generated a need for tissue banks to provide quality-controlled tissue samples with standardized clinical annotation. The NCI Cooperative Prostate Cancer Tissue Resource (CPCTR) is a distributed tissue bank that comprises four academic centers and provides thousands of clinically annotated prostate cancer specimens to researchers. Here we describe the CPCTR information management system architecture, common data element (CDE) development, query interfaces, data curation, and quality control. Methods Data managers review the medical records to collect and continuously update information for the 145 clinical, pathological and inventorial CDEs that the Resource maintains for each case. An Access-based data entry tool provides de-identification and a standard communication mechanism between each group and a central CPCTR database. Standardized automated quality control audits have been implemented. Centrally, an Oracle database has web interfaces allowing multiple user-types, including the general public, to mine de-identified information from all of the sites with three levels of specificity and granularity as well as to request tissues through a formal letter of intent. Results Since July 2003, CPCTR has offered over 6,000 cases (38,000 blocks) of highly characterized prostate cancer biospecimens, including several tissue microarrays (TMA). The Resource developed a website with interfaces for the general public as well as researchers and internal members. These user groups have utilized the web-tools for public query of summary data on the cases that were available, to prepare requests, and to receive tissues. As of December 2005, the Resource received over 130 tissue requests, of which 45 have been reviewed, approved and filled. Additionally, the Resource implemented the TMA Data Exchange Specification in its TMA program and created a computer program for

  2. N-Myc Drives Neuroendocrine Prostate Cancer Initiated from Human Prostate Epithelial Cells.

    PubMed

    Lee, John K; Phillips, John W; Smith, Bryan A; Park, Jung Wook; Stoyanova, Tanya; McCaffrey, Erin F; Baertsch, Robert; Sokolov, Artem; Meyerowitz, Justin G; Mathis, Colleen; Cheng, Donghui; Stuart, Joshua M; Shokat, Kevan M; Gustafson, W Clay; Huang, Jiaoti; Witte, Owen N

    2016-04-11

    MYCN amplification and overexpression are common in neuroendocrine prostate cancer (NEPC). However, the impact of aberrant N-Myc expression in prostate tumorigenesis and the cellular origin of NEPC have not been established. We define N-Myc and activated AKT1 as oncogenic components sufficient to transform human prostate epithelial cells to prostate adenocarcinoma and NEPC with phenotypic and molecular features of aggressive, late-stage human disease. We directly show that prostate adenocarcinoma and NEPC can arise from a common epithelial clone. Further, N-Myc is required for tumor maintenance, and destabilization of N-Myc through Aurora A kinase inhibition reduces tumor burden. Our findings establish N-Myc as a driver of NEPC and a target for therapeutic intervention. PMID:27050099

  3. Inhibition of smooth muscle force generation by focal adhesion kinase inhibitors in the hyperplastic human prostate.

    PubMed

    Kunit, Thomas; Gratzke, Christian; Schreiber, Andrea; Strittmatter, Frank; Waidelich, Raphaela; Rutz, Beata; Loidl, Wolfgang; Andersson, Karl-Erik; Stief, Christian G; Hennenberg, Martin

    2014-10-01

    Smooth muscle contraction may be critical for lower urinary tract symptoms (LUTS) in patients with benign prostate hyperplasia and requires stable anchorage of the cytoskeleton to the cell membrane. These connections are regulated by focal adhesion kinase (FAK). Here, we addressed the involvement of FAK in the regulation of smooth muscle contraction in hyperplastic human prostate tissues. Prostate tissues were obtained from radical prostatectomy. Expression of FAK and focal adhesion proteins was assessed by Western blot analysis and immunohistochemical stainings. Effects of the FAK inhibitors PF-573228 and Y-11 on contraction of prostate strips were examined in the organ bath. Expression of FAK and focal adhesion proteins (integrin-5α, paxilin, and c-Src) was detected by Western blot analysis in prostate samples. By double immunofluorescence staining with calponin and pan-cytokeratin, expression of FAK was observed in stromal and epithelial cells. Immunoreactivity for FAK colocalized with integrin-5α, paxilin, talin, and c-Src. Stimulation of prostate tissues with the α1-adrenergic agonist phenylephrine increased the phosphorylation state of FAK at Tyr³⁹⁷ and Tyr⁹²⁵ with different kinetics, which was blocked by the α1-adrenoceptor antagonist tamsulosin. Norepinephrine and phenylephrine induced concentration-dependent contractions of prostate strips. Both FAK inhibitors PF-573228 and Y-11 significantly inhibited norepinephrine- and phenylephrine-induced contractions. Finally, PF-573228 and Y-11 inhibited contractions induced by electric field stimulation, which was significant at the highest frequency. In conclusion, α1-adrenergic smooth muscle contraction or its regulation involves FAK in the human prostate. Consequently, FAK may be involved in the pathophysiology of LUTS and in current or future LUTS therapies. PMID:25056351

  4. Human Tissue Stimulator

    NASA Technical Reports Server (NTRS)

    1982-01-01

    Neurodyne Corporation Human Tissue Stimulator (HTS) is a totally implantable system used for treatment of chronic pain and involuntary motion disorders by electrical stimulation. It was developed by Pacesetter Systems, Inc. in cooperation with the Applied Physics Laboratory. HTS incorporates a nickel cadmium battery, telemetry and command systems technologies of the same type as those used in NASA's Small Astronomy Satellite-3 in microminiature proportions so that the implantable element is the size of a deck of cards. The stimulator includes a rechargeable battery, an antenna and electronics to receive and process commands and to report on its own condition via telemetry, a wireless process wherein instrument data is converted to electrical signals and sent to a receiver where signals are presented as usable information. The HTS is targeted to nerve centers or to particular areas of the brain to provide relief from intractable pain or arrest involuntary motion. The nickel cadmium battery can be recharged through the skin. The first two HTS units were implanted last year and have been successful. Extensive testing is required before HTS can be made available for general use.

  5. Impact of interseed attenuation and tissue composition for permanent prostate implants

    SciTech Connect

    Carrier, Jean-Francois; Beaulieu, Luc; Therriault-Proulx, Francois; Roy, Rene

    2006-03-15

    The purpose is to evaluate the impact of interseed attenuation and prostate composition for prostate treatment plans with {sup 125}I permanent seed implants using the Monte Carlo (MC) method. The effect of seed density (number of seeds per prostate unit volume) is specifically investigated. The study focuses on treatment plans that were generated for clinical cases. For each plan, four different dose calculation techniques are compared: TG-43 based calculation, superposition MC, full MC with water prostate, and full MC with realistic prostate tissue. The prostate tissue description is from the ICRP report 23 (W. S. Snyer, M. J. Cook, E. S. Nasset, L. R. Karkhausen, G. P. Howells, and I. H. Tipton, ''Report of the task group on reference man,'' Technical Report 23, International Commission on Radiological Protection, 1974). According to the comparisons, the seed density has an influence on interseed attenuation. A plan with a typical low seed density (42 0.6 mCi seeds in a 26 cm{sup 3} prostate) suffers a 1.2% drop in the CTV D{sub 90} value due to interseed attenuation. A drop of 3.0% is calculated for a higher seed density (75 0.3 mCi seeds, same prostate). The influence of the prostate composition is similar for all seed densities and prostate sizes. The difference between MC simulations in water and MC simulations in prostate tissue is between 4.4% and 4.8% for the D{sub 90} parameter. Overall, the effect on D{sub 90} is ranging from 5.8% to 12.8% when comparing clinically approved TG-43 and MC simulations in prostate tissue. The impact varies from one patient to the other and depends on the prostate size and the number of seeds. This effect can reach a significant level when reporting correlations between clinical effect and deposited dose.

  6. Human Prostate Side Population Cells Demonstrate Stem Cell Properties in Recombination with Urogenital Sinus Mesenchyme

    PubMed Central

    Foster, Barbara A.; Gangavarapu, Kalyan J.; Mathew, Grinu; Azabdaftari, Gissou; Morrison, Carl D.; Miller, Austin; Huss, Wendy J.

    2013-01-01

    Stem cell enrichment provides a tool to examine prostate stem cells obtained from benign and malignant tissue. Functional assays can enrich stem cells based on common stem cell phenotypes, such as high ATP binding cassette (ABC) transporter mediated efflux of Hoechst substrates (side population assay). This functional assay is based upon mechanisms that protect cells from environmental insult thus contributing to the survival and protection of the stem cell population. We have isolated and analyzed cells digested from twelve clinical prostate specimens based on the side population assay. Prostate stem cell properties of the isolated cells were tested by serial recombination with rat urogenital mesenchyme. Recombinants with side population cells demonstrate an increase in the frequency of human ductal growth and the number of glands per recombinant when compared to recombinants with non-side population cells. Isolated cells were capable of prostatic growth for up to three generations in the recombination assay with as little as 125 sorted prostate cells. The ability to reproducibly use cells isolated by fluorescence activated cell sorting from human prostate tissue is an essential step to a better understanding of human prostate stem cell biology. ABC transporter G2 (ABCG2) was expressed in recombinants from side population cells indicating the side population cells have self-renewal properties. Epithelial cell differentiation of recombinants was determined by immunohistochemical analysis for expression of the basal, luminal, and neuroendocrine markers, p63, androgen receptor, prostate specific antigen, and chromogranin A, respectively. Thus, the ABCG2 expressing side population demonstrates multipotency and self-renewal properties indicating stem cells are within this population. PMID:23383057

  7. Human prostate side population cells demonstrate stem cell properties in recombination with urogenital sinus mesenchyme.

    PubMed

    Foster, Barbara A; Gangavarapu, Kalyan J; Mathew, Grinu; Azabdaftari, Gissou; Morrison, Carl D; Miller, Austin; Huss, Wendy J

    2013-01-01

    Stem cell enrichment provides a tool to examine prostate stem cells obtained from benign and malignant tissue. Functional assays can enrich stem cells based on common stem cell phenotypes, such as high ATP binding cassette (ABC) transporter mediated efflux of Hoechst substrates (side population assay). This functional assay is based upon mechanisms that protect cells from environmental insult thus contributing to the survival and protection of the stem cell population. We have isolated and analyzed cells digested from twelve clinical prostate specimens based on the side population assay. Prostate stem cell properties of the isolated cells were tested by serial recombination with rat urogenital mesenchyme. Recombinants with side population cells demonstrate an increase in the frequency of human ductal growth and the number of glands per recombinant when compared to recombinants with non-side population cells. Isolated cells were capable of prostatic growth for up to three generations in the recombination assay with as little as 125 sorted prostate cells. The ability to reproducibly use cells isolated by fluorescence activated cell sorting from human prostate tissue is an essential step to a better understanding of human prostate stem cell biology. ABC transporter G2 (ABCG2) was expressed in recombinants from side population cells indicating the side population cells have self-renewal properties. Epithelial cell differentiation of recombinants was determined by immunohistochemical analysis for expression of the basal, luminal, and neuroendocrine markers, p63, androgen receptor, prostate specific antigen, and chromogranin A, respectively. Thus, the ABCG2 expressing side population demonstrates multipotency and self-renewal properties indicating stem cells are within this population. PMID:23383057

  8. Organ-wide Telomeric Status in Diseased and Disease-free Prostatic Tissues

    PubMed Central

    Heaphy, Christopher M.; Fleet, Trisha M.; Treat, Eric G.; Lee, Sang-Joon; Smith, Anthony Y.; Davis, Michael S.; Griffith, Jeffrey K.; Fischer, Edgar G.; Bisoffi, Marco

    2012-01-01

    BACKGROUND Telomere attrition occurs early in the development of prostatic adenocarcinoma. However, little is known about either telomere status in benign prostatic hyperplasia (BPH), or the spatial and organ-wide distribution of potential telomere aberrations throughout all areas of prostatic glands affected by cancer or BPH. METHODS Slot blot titration assay was used to determine telomere DNA content (TC), a proxy for telomere length, in macrodissected tissue consisting of 54 normal samples from 5 disease-free prostates, 128 BPH samples from 4 non-cancerous prostates, and 45 tumor, 73 BPH, and 4 prostatic intraepithelial neoplasia (PIN) samples from 5 cancerous prostates. RESULTS Compared to TC in normal prostate samples (n=54; TC mean=0.98), tumor samples displayed telomere attrition (n=45; TC mean=0.67). TC in PIN samples was similar to tumors. BPH samples from cancerous prostates were similar to TC in tumors and also displayed telomere shortening (n=73; TC mean=0.76), whereas BPH samples from non-cancerous prostates displayed longer telomeres (n=128; TC mean=1.06). In prostates affected by adenocarcinoma, areas of potential telomere attrition occurred in histologically normal tissues through the entire gland. However, three-dimensional zoning revealed a pattern of increasing TC as a function of distance from the primary (index) tumor. CONCLUSIONS Spatial distributions of TC in prostate specimens indicate a complex “field effect” with varying contributions from both cancer and BPH. The observation that telomere length variations occur in fields of histologically normal tissues surrounding the tumor is of clinical importance, as it may have implications for the diagnosis and focal therapy of prostate cancer. PMID:20687220

  9. Bauhinia purprea agglutinin-modified liposomes for human prostate cancer treatment.

    PubMed

    Ikemoto, Keisuke; Shimizu, Kosuke; Ohashi, Kento; Takeuchi, Yoshihito; Shimizu, Motohiro; Oku, Naoto

    2016-01-01

    Bauhinia purprea agglutinin (BPA) is a well-known lectin that recognizes galactosyl glycoproteins and glycolipids. In the present study, we firstly found that BPA bound to human prostate cancer specimens but not to normal prostate ones. Therefore, we sought to develop BPA-PEG-modified liposomes (BPA-PEG-LP) encapsulating anticancer drugs for the treatment of prostate cancer. We examined the tumor targetability of BPA-PEG-LP with human prostate cancer DU145 cells, and observed that fluorescently labeled BPA-PEG-LP dominantly associated with the cells via the interaction between liposome-surface BPA and cell-surface galactosyl molecules. We also observed that BPA-PEG-LP accumulated in the prostate cancer tissue after the i.v. injection to DU145 solid cancer-bearing mice, and strongly bound to the cancer cells. In a therapeutic study, DU145 solid cancer-bearing mice were i.v. injected thrice with BPA-PEG-LP encapsulating doxorubicin (BPA-PEG-LPDOX, 2 mg/kg/day as the DOX dosage) or PEG-modified liposomes encapsulating DOX (PEG-LPDOX). As a result, BPA-PEG-LPDOX significantly suppressed the growth of the DU145 cancer cells, whereas PEG-LPDOX at the same dosage as DOX showed little anti-cancer effect. The present study suggested that BPA-PEG-LP could be a useful drug carrier for the treatment of human prostate cancers. PMID:26495901

  10. Fluorescence spectra of benign and malignant prostate tissues

    NASA Astrophysics Data System (ADS)

    AlSalhi, M. S.; Masilamani, V.; Atif, M.; Farhat, K.; Rabah, D.; Turki, M. R. Al

    2012-09-01

    In this study, fluorescence emission spectrum (FES), Stokes' shift spectrum (SSS), and reflectance spectrum (RS) of benign (N = 12) and malignant prostate tissues (N = 8) were investigated to discriminate the two types of tissues. The FES was done with the excitation at 325 nm only; SSS with Δλ = 70 and Δλ = 0, the latter being equivalent to reflectance spectra. Of the three modes of spectra, SSS with Δλ = 70 nm showed the best discrimination. There were four important bands, one at 280 nm (due to tryptophan); 320 nm (due to elastin & tryptophan); 355 and 385 (due to NADH) and 440 nm (due to flavin). From the relative intensities of these bands, three ratios were evaluated. Similarly another two ratios were obtained from reflectance spectra and one more from FES. Thus, there are 6 ratio parameters which represent the relative concentration of tryptophan, elastin, nicotinamide adenine dinucleotide (NADH), and flavin. A statistical analysis showed that benign and malignant tissues could be classified with accuracy greater than 90%. This report is only for in vitro analysis; but employing optical fiber, this can be extended to in vivo analysis too, so that benign tumor could be distinguished without surgery.

  11. MOLECULAR EVENTS ASSOCIATED WITH ARSENIC-INDUCED MALIGNANT TRANSFORMATION OF HUMAN PROSTATIC EPITHELIAL CELLS: ABERRANT GENOMIC DNA METHYLATION AND K-RAS ONCOGENE ACTIVATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Numerous studies link arsenic exposure to human cancers in a variety of tissues, including the prostate. Our prior work showed that chronic arsenic exposure of the non-tumorigenic, human prostate epithelial cell line, RWPE-1, to low levels of (5 microM) sodium arsenite for 29 weeks resulted in malig...

  12. Lack of detection of human papillomavirus DNA in prostate carcinomas in patients from northeastern Brazil.

    PubMed

    Araujo-Neto, Ari P; Ferreira-Fernandes, Hygor; Amaral, Carolina M M; Santos, Lina G; Freitas, Antônio C; Silva-Neto, Jacinto C; Rey, Juan A; Burbano, Rommel R; Silva, Benedito B da; Yoshioka, France K N; Pinto, Giovanny R

    2016-03-01

    Prostate cancer is the second most common cancer among men in western populations, and despite its high mortality, its etiology remains unknown. Inflammatory processes are related to the etiology of various types of tumors, and prostate inflammation, in particular, has been associated with prostate cancer carcinogenesis and progression. Human papillomavirus (HPV) is associated with benign and malignant lesions in the anogenital tract of both females and males. The possible role of HPV in prostate carcinogenesis is a subject of great controversy. In this study, we aimed to examine the prevalence of HPV infections in prostate carcinomas of patients from northeastern Brazil. This study included 104 tissue samples from primary prostate carcinoma cases. HPV DNA was purified and then amplified using MY09/11 and GP5+/GP6+ degenerate primer sets that detect a wide range of HPV types, and with specific PCR primers sets for E6 and E7 HPV regions to detect HPV 16. None of the samples showed amplification products of HPV DNA for primer sets MY09/11 and GP5+/GP6+, or the specific primer set for the E6 and E7 HPV regions. HPV infection, thus, does not seem to be one of the causes of prostate cancer in the population studied. PMID:27007894

  13. Lack of detection of human papillomavirus DNA in prostate carcinomas in patients from northeastern Brazil

    PubMed Central

    Araujo-Neto, Ari P.; Ferreira-Fernandes, Hygor; Amaral, Carolina M.M.; Santos, Lina G.; Freitas, Antônio C.; Silva-Neto, Jacinto C.; Rey, Juan A.; Burbano, Rommel R.; da Silva, Benedito B.; Yoshioka, France K.N.; Pinto, Giovanny R.

    2016-01-01

    Abstract Prostate cancer is the second most common cancer among men in western populations, and despite its high mortality, its etiology remains unknown. Inflammatory processes are related to the etiology of various types of tumors, and prostate inflammation, in particular, has been associated with prostate cancer carcinogenesis and progression. Human papillomavirus (HPV) is associated with benign and malignant lesions in the anogenital tract of both females and males. The possible role of HPV in prostate carcinogenesis is a subject of great controversy. In this study, we aimed to examine the prevalence of HPV infections in prostate carcinomas of patients from northeastern Brazil. This study included 104 tissue samples from primary prostate carcinoma cases. HPV DNA was purified and then amplified using MY09/11 and GP5+/GP6+ degenerate primer sets that detect a wide range of HPV types, and with specific PCR primers sets for E6 and E7 HPV regions to detect HPV 16. None of the samples showed amplification products of HPV DNA for primer sets MY09/11 and GP5+/GP6+, or the specific primer set for the E6 and E7 HPV regions. HPV infection, thus, does not seem to be one of the causes of prostate cancer in the population studied. PMID:27007894

  14. Early Human Prostate Adenocarcinomas Harbor Androgen-Independent Cancer Cells

    PubMed Central

    Fiñones, Rita R.; Yeargin, Jo; Lee, Melissa; Kaur, Aman Preet; Cheng, Clari; Sun, Paulina; Wu, Christopher; Nguyen, Catherine; Wang-Rodriguez, Jessica; Meyer, April N.; Baird, Stephen M.; Donoghue, Daniel J.; Haas, Martin

    2013-01-01

    Although blockade of androgen receptor (AR) signaling represents the main treatment for advanced prostate cancer (PrCa), many patients progress to a lethal phenotype of “Castration-Resistant” prostate cancer (CR-PrCa). With the hypothesis that early PrCa may harbor a population of androgen-unresponsive cancer cells as precursors to CR-recurrent disease, we undertook the propagation of androgen-independent cells from PrCa-prostatectomy samples of early, localized (Stage-I) cases. A collection of 120 surgical specimens from prostatectomy cases was established, among which 54 were adenocarcinomas. Hormone-free cell culture conditions were developed allowing routine propagation of cells expressing prostate basal cell markers and stem/progenitor cell markers, and which proliferated as spheres/spheroids in suspension cultures. Colonies of androgen-independent epithelial cells grew out from 30/43 (70%) of the adenocarcinoma cases studied in detail. Fluorescence microscopy and flow cytometry showed that CR-PrCa cells were positive for CD44, CD133, CK5/14, c-kit, integrin α2β1, SSEA4, E-Cadherin and Aldehyde Dehydrogenase (ALDH). All 30 CR-PrCa cell cultures were also TERT-positive, but negative for TMPRSS2-ERG. Additionally, a subset of 22 of these CR-PrCa cell cultures was examined by orthotopic xenografting in intact and castrated SCID mice, generating histologically typical locally-invasive human PrCa or undifferentiated cancers, respectively, in 6–8 weeks. Cultured PrCa cells and orthotopically-induced in vivo cancers lacked PSA expression. We report here the propagation of Cancer Initiating Cells (CIC) directly from Stage I human PrCa tissue without selection or genetic manipulation. The propagation of stem/progenitor-like CR-PrCa cells derived from early human prostate carcinomas suggests the existence of a subpopulation of cells resistant to androgen-deprivation therapy and which may drive the subsequent emergence of disseminated CR-PrCa. PMID:24086346

  15. Trade in human tissue products.

    PubMed

    Tonti-Filippini, Nicholas; Zeps, Nikolajs

    2011-03-01

    Trade in human tissue in Australia is prohibited by state law, and in ethical guidelines by the National Health and Medical Research Council: National statement on ethical conduct in human research; Organ and tissue donation by living donors: guidelines for ethical practice for health professionals. However, trade in human tissue products is a common practice especially for: reconstructive orthopaedic or plastic surgery; novel human tissue products such as a replacement trachea created by using human mesenchymal stem cells; biomedical research using cell lines, DNA and protein provided through biobanks. Cost pressures on these have forced consideration of commercial models to sustain their operations. Both the existing and novel activities require a robust framework to enable commercial uses of human tissue products while maintaining community acceptability of such practices, but to date no such framework exists. In this article, we propose a model ethical framework for ethical governance which identifies specific ethical issues such as: privacy; unique value of a person's tissue; commodification of the body; equity and benefit to the community; perverse incentives; and "attenuation" as a potentially useful concept to help deal with the broad range of subjective views relevant to whether it is acceptable to commercialise certain human tissue products. PMID:21382003

  16. Quantitative Time-Resolved Fluorescence Imaging of Androgen Receptor and Prostate-Specific Antigen in Prostate Tissue Sections.

    PubMed

    Krzyzanowska, Agnieszka; Lippolis, Giuseppe; Helczynski, Leszek; Anand, Aseem; Peltola, Mari; Pettersson, Kim; Lilja, Hans; Bjartell, Anders

    2016-05-01

    Androgen receptor (AR) and prostate-specific antigen (PSA) are expressed in the prostate and are involved in prostate cancer (PCa). The aim of this study was to develop reliable protocols for reproducible quantification of AR and PSA in benign and malignant prostate tissue using time-resolved fluorescence (TRF) imaging techniques. AR and PSA were detected with TRF in tissue microarrays from 91 PCa patients. p63/ alpha-methylacyl-CoA racemase (AMACR) staining on consecutive sections was used to categorize tissue areas as benign or cancerous. Automated image analysis was used to quantify staining intensity. AR intensity was significantly higher in AMACR+ and lower in AMACR- cancer areas as compared with benign epithelium. The PSA intensity was significantly lower in cancer areas, particularly in AMACR- glands. The AR/PSA ratio varied significantly in the AMACR+ tumor cells as compared with benign glands. There was a trend of more rapid disease progression in patients with higher AR/PSA ratios in the AMACR- areas. This study demonstrates the feasibility of developing reproducible protocols for TRF imaging and automated image analysis to study the expression of AR and PSA in benign and malignant prostate. It also highlighted the differences in AR and PSA protein expression within AMACR- and AMACR+ cancer regions. PMID:27026295

  17. Regulation of mRNA and Protein Levels of β1 Integrin Variants in Human Prostate Carcinoma

    PubMed Central

    Perlino, Elda; Lovecchio, Mariarosaria; Vacca, Rosa A.; Fornaro, Mara; Moro, Loredana; Ditonno, Pasquale; Battaglia, Michele; Selvaggi, Francesco P.; Mastropasqua, Mauro G.; Bufo, Pantaleo; Languino, Lucia R.

    2000-01-01

    Alterations of integrin expression levels in cancer cells correlate with changes in invasiveness, tumor progression, and metastatic potential. The β1C integrin, an alternatively spliced form of the human β1 integrin, has been shown to inhibit prostate cell proliferation. Furthermore, β1C protein levels were found to be abundant in normal prostate glandular epithelium and down-regulated in prostatic adenocarcinoma. To gain further insights into the molecular mechanisms underlying abnormal cancer cell proliferation, we have studied β1C and β1 integrin expression at both mRNA and protein levels by Northern and immunoblotting analysis using freshly isolated neoplastic and normal human prostate tissue specimens. Steady-state mRNA levels were evaluated in 38 specimens: 33 prostatic adenocarcinomas exhibiting different Gleason’s grade and five normal tissue specimens that did not show any histological manifestation of benign prostatic hypertrophy. Our results demonstrate that β1C mRNA is expressed in normal prostate and is significantly down-regulated in neoplastic prostate specimens. In addition, using a probe that hybridizes with all β1 variants, mRNA levels of β1 are found reduced in neoplastic versus normal prostate tissues. We demonstrate that β1C mRNA down-regulation does not correlate with either tumor grade or differentiation according to Gleason’s grade and TNM system evaluation, and that β1C mRNA levels are not affected by hormonal therapy. In parallel, β1C protein levels were analyzed. As expected, β1C is found to be expressed in normal prostate and dramatically reduced in neoplastic prostate tissues; in contrast, using an antibody to β1 that recognizes all β1 variants, the levels of β1 are comparable in normal and neoplastic prostate, thus indicating a selective down-regulation of the β1C protein in prostate carcinoma. These results demonstrate for the first time that β1C and β1 mRNA expression is down-regulated in prostate carcinoma

  18. Prostate-specific extracellular vesicles as a novel biomarker in human prostate cancer

    PubMed Central

    Park, Yong Hyun; Shin, Hyun Woo; Jung, Ae Ryang; Kwon, Oh Sung; Choi, Yeong-Jin; Park, Jaesung; Lee, Ji Youl

    2016-01-01

    Extracellular vesicles (EVs) may play an important role in cancer development and progression. We aimed to investigate the prognostic potential of prostate-specific EVs in prostate cancer (PCa) patients. Plasma and prostate tissue were collected from patients who underwent surgery for PCa (n = 82) or benign prostatic hyperplasia (BPH, n = 28). To analyze the quantity of EVs in prostate, we performed transmission electron microscopy (TEM), immuno-TEM with CD63 and prostate-specific membrane antigen (PSMA), and immunofluorescence staining. After EV isolation from plasma, CD63 and PSMA concentration was measured using ELISA kits. PSMA-positive areas in prostate differed in patients with BPH, and low-, intermediate-, and high-risk PCa (2.4, 8.2, 17.5, 26.5%, p < 0.001). Plasma PSMA-positive EV concentration differed in patients with BPH, and low-, intermediate-, and high-risk PCa (21.9, 43.4, 49.2, 59.9 ng/mL, p < 0.001), and ROC curve analysis indicated that plasma PSMA-positive EV concentration differentiated PCa from BPH (AUC 0.943). Patients with lower plasma PSMA-positive EV concentration had greater prostate volume (50.2 vs. 33.4 cc, p < 0.001) and lower pathologic Gleason score (p = 0.025). During the median follow-up of 18 months, patients with lower plasma PSMA-positive EV concentration tended to have a lower risk of biochemical failure than those with higher levels of prostate-specific EVs (p = 0.085). PMID:27503267

  19. Prostate-specific extracellular vesicles as a novel biomarker in human prostate cancer.

    PubMed

    Park, Yong Hyun; Shin, Hyun Woo; Jung, Ae Ryang; Kwon, Oh Sung; Choi, Yeong-Jin; Park, Jaesung; Lee, Ji Youl

    2016-01-01

    Extracellular vesicles (EVs) may play an important role in cancer development and progression. We aimed to investigate the prognostic potential of prostate-specific EVs in prostate cancer (PCa) patients. Plasma and prostate tissue were collected from patients who underwent surgery for PCa (n = 82) or benign prostatic hyperplasia (BPH, n = 28). To analyze the quantity of EVs in prostate, we performed transmission electron microscopy (TEM), immuno-TEM with CD63 and prostate-specific membrane antigen (PSMA), and immunofluorescence staining. After EV isolation from plasma, CD63 and PSMA concentration was measured using ELISA kits. PSMA-positive areas in prostate differed in patients with BPH, and low-, intermediate-, and high-risk PCa (2.4, 8.2, 17.5, 26.5%, p < 0.001). Plasma PSMA-positive EV concentration differed in patients with BPH, and low-, intermediate-, and high-risk PCa (21.9, 43.4, 49.2, 59.9 ng/mL, p < 0.001), and ROC curve analysis indicated that plasma PSMA-positive EV concentration differentiated PCa from BPH (AUC 0.943). Patients with lower plasma PSMA-positive EV concentration had greater prostate volume (50.2 vs. 33.4 cc, p < 0.001) and lower pathologic Gleason score (p = 0.025). During the median follow-up of 18 months, patients with lower plasma PSMA-positive EV concentration tended to have a lower risk of biochemical failure than those with higher levels of prostate-specific EVs (p = 0.085). PMID:27503267

  20. SCRIB expression is deregulated in human prostate cancer, and its deficiency in mice promotes prostate neoplasia

    PubMed Central

    Pearson, Helen B.; Perez-Mancera, Pedro A.; Dow, Lukas E.; Ryan, Andrew; Tennstedt, Pierre; Bogani, Debora; Elsum, Imogen; Greenfield, Andy; Tuveson, David A.; Simon, Ronald; Humbert, Patrick O.

    2011-01-01

    Loss of cellular polarity is a hallmark of epithelial cancers, raising the possibility that regulators of polarity have a role in suppressing tumorigenesis. The Scribble complex is one of at least three interacting protein complexes that have a critical role in establishing and maintaining epithelial polarity. In human colorectal, breast, and endometrial cancers, expression of the Scribble complex member SCRIB is often mislocalized and deregulated. Here, we report that Scrib is indispensable for prostate homeostasis in mice. Scrib heterozygosity initiated prostate hyperplasia, while targeted biallelic Scrib loss predisposed mice to prostate intraepithelial neoplasia. Mechanistically, Scrib was shown to negatively regulate the MAPK cascade to suppress tumorigenesis. Further analysis revealed that prostate-specific loss of Scrib in mice combined with expression of an oncogenic Kras mutation promoted the progression of prostate cancer that recapitulated the human disease. The clinical significance of the work in mice was highlighted by our observation that SCRIB deregulation strongly correlated with poor survival in human prostate cancer. These data suggest that the polarity network could provide a new avenue for therapeutic intervention. PMID:21965329

  1. Magnetic resonance microscopy of prostate tissue: How basic science can inform clinical imaging development

    SciTech Connect

    Bourne, Roger

    2013-03-15

    This commentary outlines how magnetic resonance imaging (MRI) microscopy studies of prostate tissue samples and whole organs have shed light on a number of clinical imaging mysteries and may enable more effective development of new clinical imaging methods.

  2. Agonist and antagonist switch DNA motifs recognized by human androgen receptor in prostate cancer

    PubMed Central

    Chen, Zhong; Lan, Xun; Thomas-Ahner, Jennifer M; Wu, Dayong; Liu, Xiangtao; Ye, Zhenqing; Wang, Liguo; Sunkel, Benjamin; Grenade, Cassandra; Chen, Junsheng; Zynger, Debra L; Yan, Pearlly S; Huang, Jiaoti; Nephew, Kenneth P; Huang, Tim H-M; Lin, Shili; Clinton, Steven K; Li, Wei; Jin, Victor X; Wang, Qianben

    2015-01-01

    Human transcription factors recognize specific DNA sequence motifs to regulate transcription. It is unknown whether a single transcription factor is able to bind to distinctly different motifs on chromatin, and if so, what determines the usage of specific motifs. By using a motif-resolution chromatin immunoprecipitation-exonuclease (ChIP-exo) approach, we find that agonist-liganded human androgen receptor (AR) and antagonist-liganded AR bind to two distinctly different motifs, leading to distinct transcriptional outcomes in prostate cancer cells. Further analysis on clinical prostate tissues reveals that the binding of AR to these two distinct motifs is involved in prostate carcinogenesis. Together, these results suggest that unique ligands may switch DNA motifs recognized by ligand-dependent transcription factors in vivo. Our findings also provide a broad mechanistic foundation for understanding ligand-specific induction of gene expression profiles. PMID:25535248

  3. Agonist and antagonist switch DNA motifs recognized by human androgen receptor in prostate cancer.

    PubMed

    Chen, Zhong; Lan, Xun; Thomas-Ahner, Jennifer M; Wu, Dayong; Liu, Xiangtao; Ye, Zhenqing; Wang, Liguo; Sunkel, Benjamin; Grenade, Cassandra; Chen, Junsheng; Zynger, Debra L; Yan, Pearlly S; Huang, Jiaoti; Nephew, Kenneth P; Huang, Tim H-M; Lin, Shili; Clinton, Steven K; Li, Wei; Jin, Victor X; Wang, Qianben

    2015-02-12

    Human transcription factors recognize specific DNA sequence motifs to regulate transcription. It is unknown whether a single transcription factor is able to bind to distinctly different motifs on chromatin, and if so, what determines the usage of specific motifs. By using a motif-resolution chromatin immunoprecipitation-exonuclease (ChIP-exo) approach, we find that agonist-liganded human androgen receptor (AR) and antagonist-liganded AR bind to two distinctly different motifs, leading to distinct transcriptional outcomes in prostate cancer cells. Further analysis on clinical prostate tissues reveals that the binding of AR to these two distinct motifs is involved in prostate carcinogenesis. Together, these results suggest that unique ligands may switch DNA motifs recognized by ligand-dependent transcription factors in vivo. Our findings also provide a broad mechanistic foundation for understanding ligand-specific induction of gene expression profiles. PMID:25535248

  4. A simple analysis of extinction spectra of cancerous and normal prostate tissues in near infrared range using a size discrete particle distribution and Mie scattering model

    NASA Astrophysics Data System (ADS)

    Zhou, Kenneth J.; Chen, Jun

    2015-03-01

    The extinction spectra and optical coefficients of human cancerous and normal prostate tissues were investigated in the spectral range of 750 nm - 860 nm. The scattering coefficient (μs) was determined from the extinction measurements on thin prostate tissue and Beer's law. The absorption coefficient (μa) and the reduced scattering coefficient (μs') were extracted from integrate sphere intensity measurements on prostate tissue of which the thickness is in the multiple scattering range. The anisotropy factor (g) was calculated using the extracted values of μs and μs'. A micro-optical model of soft biological tissue was introduced to simulate the numerical computation of the absolute magnitudes of its scattering coefficients from the refractive index and a particle distribution function based on the Mie theory. A key assumption of the model is that the refractive index variations caused by microscopic tissue elements can be treated as particles with sizes distributed according to a skewed log-normal distribution function. The particle distribution and mean particle size of the two types of tissues were then calculated. Results show that the mean diameter of the particle size of cancerous tissue is larger than that of the cancerous tissue, which is responsible for larger reduced scattering coefficient of normal tissue in comparison with cancerous tissue. The results can be explained the change of tissue during prostate cancer evolution defined by Gleason Grade. The difference of the particles distribution and optical coefficients of cancerous and normal prostate tissues may present a potential criterion for prostate cancer detection.

  5. Phenotypic characterization of telomerase-immortalized primary non-malignant and malignant tumor-derived human prostate epithelial cell lines

    SciTech Connect

    Gu Yongpeng; Li Hongzhen; Miki, Jun; Kim, Kee-Hong; Furusato, Bungo; Sesterhenn, Isabell A.; Chu, Wei-Sing; McLeod, David G.; Srivastava, Shiv; Ewing, Charles M.; Isaacs, William B.; Rhim, Johng S. . E-mail: jrhim@cpdr.org

    2006-04-01

    In vitro human prostate cell culture models are critical for clarifying the mechanism of prostate cancer progression and for testing preventive and therapeutic agents. Cell lines ideal for the study of human primary prostate tumors would be those derived from spontaneously immortalized tumor cells; unfortunately, explanted primary prostate cells survive only short-term in culture, and rarely immortalize spontaneously. Therefore, we recently have generated five immortal human prostate epithelial cell cultures derived from both the benign and malignant tissues of prostate cancer patients with telomerase, a gene that prevents cellular senescence. Examination of these cell lines for their morphologies and proliferative capacities, their abilities to grow in low serum, to respond to androgen stimulation, to grow above the agar layer, to form tumors in SCID mice, suggests that they may serve as valid, useful tools for the elucidation of early events in prostate tumorigenesis. Furthermore, the chromosome alterations observed in these immortalized cell lines expressing aspects of the malignant phenotypes imply that these cell lines accurately recapitulate the genetic composition of primary tumors. These novel in vitro models may offer unique models for the study of prostate carcinogenesis and also provide the means for testing both chemopreventive and chemotherapeutic agents.

  6. P21-Activated Kinase Inhibitors FRAX486 and IPA3: Inhibition of Prostate Stromal Cell Growth and Effects on Smooth Muscle Contraction in the Human Prostate

    PubMed Central

    Wang, Yiming; Gratzke, Christian; Tamalunas, Alexander; Wiemer, Nicolas; Ciotkowska, Anna; Rutz, Beata; Waidelich, Raphaela; Strittmatter, Frank; Liu, Chunxiao; Stief, Christian G.; Hennenberg, Martin

    2016-01-01

    Prostate smooth muscle tone and hyperplastic growth are involved in the pathophysiology and treatment of male lower urinary tract symptoms (LUTS). Available drugs are characterized by limited efficacy. Patients’ adherence is particularly low to combination therapies of 5α-reductase inhibitors and α1-adrenoceptor antagonists, which are supposed to target contraction and growth simultaneously. Consequently, molecular etiology of benign prostatic hyperplasia (BPH) and new compounds interfering with smooth muscle contraction or growth in the prostate are of high interest. Here, we studied effects of p21-activated kinase (PAK) inhibitors (FRAX486, IPA3) in hyperplastic human prostate tissues, and in stromal cells (WPMY-1). In hyperplastic prostate tissues, PAK1, -2, -4, and -6 may be constitutively expressed in catecholaminergic neurons, while PAK1 was detected in smooth muscle and WPMY-1 cells. Neurogenic contractions of prostate strips by electric field stimulation were significantly inhibited by high concentrations of FRAX486 (30 μM) or IPA3 (300 μM), while noradrenaline- and phenylephrine-induced contractions were not affected. FRAX486 (30 μM) inhibited endothelin-1- and -2-induced contractions. In WPMY-1 cells, FRAX486 or IPA3 (24 h) induced concentration-dependent (1–10 μM) degeneration of actin filaments. This was paralleled by attenuation of proliferation rate, being observed from 1 to 10 μM FRAX486 or IPA3. Cytotoxicity of FRAX486 and IPA3 in WPMY-1 cells was time- and concentration-dependent. Stimulation of WPMY-1 cells with endothelin-1 or dihydrotestosterone, but not noradrenaline induced PAK phosphorylation, indicating PAK activation by endothelin-1. Thus, PAK inhibitors may inhibit neurogenic and endothelin-induced smooth muscle contractions in the hyperplastic human prostate, and growth of stromal cells. Targeting prostate smooth muscle contraction and stromal growth at once by a single compound is principally possible, at least under

  7. A human fetal prostate xenograft model of developmental estrogenization.

    PubMed

    Saffarini, Camelia M; McDonnell-Clark, Elizabeth V; Amin, Ali; Boekelheide, Kim

    2015-01-01

    Prostate cancer is a common disease in older men. Rodent models have demonstrated that an early and later-life exposure to estrogen can lead to cancerous lesions and implicated hormonal dysregulation as an avenue for developing future prostate neoplasia. This study utilizes a human fetal prostate xenograft model to study the role of estrogen in the progression of human disease. Histopathological lesions were assessed in 7-, 30-, 90-, 200-, and 400-day human prostate xenografts. Gene expression for cell cycle, tumor suppressors, and apoptosis-related genes (ie, CDKN1A, CASP9, ESR2, PTEN, and TP53) was performed for 200-day estrogen-treated xenografts. Glandular hyperplasia was observed in xenografts given both an initial and secondary exposure to estradiol in both 200- and 400-day xenografts. Persistent estrogenic effects were verified using immunohistochemical markers for cytokeratin 10, p63, and estrogen receptor α. This model provides data on the histopathological state of the human prostate following estrogenic treatment, which can be utilized in understanding the complicated pathology associated with prostatic disease and early and later-life estrogenic exposures. PMID:25633637

  8. Interleukin-6: a multifunctional targetable cytokine in human prostate cancer.

    PubMed

    Culig, Zoran; Puhr, Martin

    2012-09-01

    Several cytokines are involved in regulation of cellular events in prostate cancer. Interleukin-6 (IL-6) was frequently investigated in prostate cancer models because of its increased expression in cancer tissue at early stages of the disease. In patients with metastatic prostate cancer, it is well-known that IL-6 levels increase in serum. High levels of IL-6 were measured in the supernatants of cells which do not respond to androgenic stimulation. IL-6 expression in prostate cancer increases due to enhanced expression of transforming growth factor-beta, and members of the activating protein-1 complex, and loss of the retinoblastoma tumour suppressor. IL-6 activation of androgen receptor (AR) may contribute to progression of a subgroup of prostate cancers. Results obtained with two prostate cancer cell lines, LNCaP and MDA PCa 2b, indicate that IL-6 activation of AR may cause either stimulatory or inhibitory responses on proliferation. Interestingly, prolonged treatment with IL-6 led to establishment of an IL-6 autocrine loop, suppressed signal transducer and activator of transcription (STAT)3 activation, and increased mitogen-activated protein kinase phosphorylation. In several cell lines IL-6 acts as a survival molecule through activation of the signalling pathway of phosphotidylinositol 3-kinase. Expression of suppressors of cytokine signalling (SOCS) has been studied in prostate cancer. SOCS-3 prevents phosphorylation of STAT3 and is an important anti-apoptotic factor in AR-negative prostate cancer cells. Experimental therapy against IL-6 in prostate cancer is based on the use of the monoclonal antibody siltuximab which may be used for personalised therapy coming in the future. PMID:21664423

  9. Trimodal spectra for high discrimination of benign and malignant prostate tissue

    NASA Astrophysics Data System (ADS)

    Al Salhi, Mohamad; Masilamani, Vadivel; Trinka, Vijmasi; Rabah, Danny; Al Turki, Mohammed R.

    2011-02-01

    High false positives and over diagnosis is a major problem with management of prostate cancer. A non-invasive or a minimally invasive technique to accurately distinguish malignant prostate cancers from benign tumors will be extremely helpful to overcome this problem. In this paper, we had used three different fluorescence spectroscopy techniques viz., Fluorescence Emission Spectrum (FES), Stokes' Shift Spectrum (SSS) and Reflectance Spectrum (RS) to discriminate benign prostate tumor tissues (N=12) and malignant prostate cancer tissues (N=8). These fluorescence techniques were used to determine the relative concentration of naturally occurring biomolecules such as tryptophan, elastin, NADH and flavin which are found to be out of proportion in cancer tissues. Our studies show that combining all three techniques, benign and malignant prostate tissues could be classified with accuracy greater than 90%. This preliminary report is based on in vitro spectroscopy analysis. However, by employing fluorescence endoscopy techniques, this can be extended to in vivo analysis as well. This technique has the potential to identify malignant prostate tissues without surgery.

  10. Hydrogen sulfide mediates the anti-survival effect of sulforaphane on human prostate cancer cells

    SciTech Connect

    Pei, Yanxi; Wu, Bo; Cao, Qiuhui; Wu, Lingyun; Yang, Guangdong

    2011-12-15

    Hydrogen sulfide (H{sub 2}S) is a novel gasotransmitter that regulates cell proliferation and other cellular functions. Sulforaphane (SFN) is a sulfur-containing compound that exhibits anticancer properties, and young sprouts of broccoli are particularly rich in SFN. There is consistent epidemiological evidence that the consumption of sulfur-containing vegetables, such as garlic and cruciferous vegetables, may help reduce the occurrence of prostate cancer. Here we found that a large amount of H{sub 2}S is released when SFN is added into cell culture medium or mixed with mouse liver homogenates, respectively. Both SFN and NaHS (a H{sub 2}S donor) decreased the viability of PC-3 cells (a human prostate cancer cell line) in a dose-dependent manner, and supplement of methemoglobin or oxidized glutathione (two H{sub 2}S scavengers) reversed SFN-reduced cell viability. We further found both cystathionine gamma-lyase (CSE) and cystathionine beta-synthase are expressed in PC-3 cells and mouse prostate tissues. H{sub 2}S production in prostate tissues from CSE knockout mice was only 20% of that from wild-type mice, suggesting CSE is a major H{sub 2}S-producing enzyme in prostate. CSE overexpression enhanced H{sub 2}S production and inhibited cell viability in PC-3 cells. In addition, both SFN and NaHS activated p38 mitogen-activated protein kinases (MAPK) and c-Jun N-terminal kinase (JNK). Pre-treatment of PC-3 cells with methemoglobin decreased SFN-stimulated MAPK activities. Suppression of both p38 MAPK and JNK reversed H{sub 2}S- or SFN-reduced viability of PC-3 cells. Our results demonstrated that H{sub 2}S mediates the inhibitory effect of SFN on the proliferation of PC-3 cells, which suggests that H{sub 2}S-releasing diet or drug might be beneficial in the treatment of prostate cancer. Highlights: Black-Right-Pointing-Pointer A large amount of H{sub 2}S is released from sulforaphane. Black-Right-Pointing-Pointer H{sub 2}S mediates the anti-survival effect of

  11. Xenotransplantation Models to Study the Effects of Toxicants on Human Fetal Tissues1

    PubMed Central

    Spade, Daniel J.; McDonnell, Elizabeth V.; Heger, Nicholas E.; Sanders, Jennifer A.; Saffarini, Camelia M.; Gruppuso, Philip A.; De Paepe, Monique E.; Boekelheide, Kim

    2015-01-01

    Many diseases that manifest throughout the lifetime are influenced by factors affecting fetal development. Fetal exposure to xenobiotics, in particular, may influence the development of adult diseases. Established animal models provide systems for characterizing both developmental biology and developmental toxicology. However, animal model systems do not allow researchers to assess the mechanistic effects of toxicants on developing human tissue. Human fetal tissue xenotransplantation models have recently been implemented to provide human-relevant mechanistic data on the many tissue-level functions that may be affected by fetal exposure to toxicants. This review describes the development of human fetal tissue xenotransplant models for testis, prostate, lung, liver, and adipose tissue, aimed at studying the effects of xenobiotics on tissue development, including implications for testicular dysgenesis, prostate disease, lung disease, and metabolic syndrome. The mechanistic data obtained from these models can complement data from epidemiology, traditional animal models, and in vitro studies to quantify the risks of toxicant exposures during human development. PMID:25477288

  12. Differentially Expressed Genes and Signature Pathways of Human Prostate Cancer

    PubMed Central

    Myers, Jennifer S.; von Lersner, Ariana K.; Robbins, Charles J.; Sang, Qing-Xiang Amy

    2015-01-01

    Genomic technologies including microarrays and next-generation sequencing have enabled the generation of molecular signatures of prostate cancer. Lists of differentially expressed genes between malignant and non-malignant states are thought to be fertile sources of putative prostate cancer biomarkers. However such lists of differentially expressed genes can be highly variable for multiple reasons. As such, looking at differential expression in the context of gene sets and pathways has been more robust. Using next-generation genome sequencing data from The Cancer Genome Atlas, differential gene expression between age- and stage- matched human prostate tumors and non-malignant samples was assessed and used to craft a pathway signature of prostate cancer. Up- and down-regulated genes were assigned to pathways composed of curated groups of related genes from multiple databases. The significance of these pathways was then evaluated according to the number of differentially expressed genes found in the pathway and their position within the pathway using Gene Set Enrichment Analysis and Signaling Pathway Impact Analysis. The “transforming growth factor-beta signaling” and “Ran regulation of mitotic spindle formation” pathways were strongly associated with prostate cancer. Several other significant pathways confirm reported findings from microarray data that suggest actin cytoskeleton regulation, cell cycle, mitogen-activated protein kinase signaling, and calcium signaling are also altered in prostate cancer. Thus we have demonstrated feasibility of pathway analysis and identified an underexplored area (Ran) for investigation in prostate cancer pathogenesis. PMID:26683658

  13. Coagulation of human prostate volumes with MRI-controlled transurethral ultrasound therapy: Results in gel phantoms

    PubMed Central

    N’Djin, William Apoutou; Burtnyk, Mathieu; Kobelevskiy, Ilya; Hadjis, Stefan; Bronskill, Michael; Chopra, Rajiv

    2012-01-01

    Purpose: The feasibility and safety of magnetic resonance imaging (MRI)-controlled transurethral ultrasound therapy were demonstrated recently in a preliminary human study in which a small subvolume of prostate tissue was treated prior to radical prostatectomy. Translation of this technology to full clinical use, however, requires the capability to generate thermal coagulation in a volume up to that of the prostate gland itself. The aim of this study was to investigate the parameters required to treat a full 3D human prostate accurately with a multi-element transurethral applicator and multiplanar MR temperature control. Methods: The approach was a combination of simulations (to select appropriate parameters) followed by experimental confirmation in tissue-mimicking phantoms. A ten-channel, MRI-compatible transurethral ultrasound therapy system was evaluated using six human prostate models (average volume: 36 cm3) obtained from the preliminary human feasibility study. Real-time multiplanar MR thermometry at 3 T was used to control the spatial heating pattern in up to nine planes simultaneously. Treatment strategies incorporated both single (4.6 or 8.1 MHz) and dual (4.6 and 14.4 MHz) frequencies, as well as maximum acoustic surface powers of 10 or 20 W cm−2. Results: Treatments at 4.6 MHz were capable of coagulating a volume equivalent to 97% of the prostate. Increasing power from 10 to 20 W cm−2 reduced treatment times by approximately 50% with full treatments taking 26 ± 3 min at a coagulation rate of 1.8 ± 0.4 cm3 min−1. A dual-frequency 4.6/14.4 MHz treatment strategy was shown to be the most effective configuration for achieving full human prostate treatment while maintaining good treatment accuracy for small treatment radii. The dual-frequency approach reduced overtreatment close to the prostate base and apex, confirming the simulations. Conclusions: This study reinforces the capability of MRI-controlled transurethral ultrasound therapy to treat

  14. Myeloid sarcoma of the periprostatic tissue and prostate: Case report and review of literature

    PubMed Central

    Koppisetty, Shalini; Edelman, Brain L.; Rajpurkar, Atul

    2016-01-01

    Myeloid sarcoma (MS) is a rare extramedullary tumor composed of immature cells of myeloid lineage that destroy the original tissue architecture in which it is found. It is most commonly identified in patients with acute myelogenous leukemia, and less often in myelodysplastic syndromes (MDSs) and other myeloproliferative disorders. It is most commonly reported in the periosteum, bone, skin, and lymph nodes but has been reported in many other sites of the body. Herein, we describe a case of MS involving the periprostatic tissue and review of literature of MS of the prostate. Our patient was initially diagnosed with MDS and was in remission following successful treatment. Six months later, the patient was diagnosed with prostate adenocarcinoma, and MS of the periprostatic tissue was incidentally discovered in the postprostatectomy pathology specimen. An extensive review of literature from 1997 to 2014 revealed a total of eight cases of MS involving the prostate. Of the eight cases of MS of the prostate, four were primary MS (absence of a history of leukemia) and four were secondary MS. Three received local radiation to the prostate with relief of obstructive symptoms, and one of them had a repeat prostate biopsy negative for leukemic cells. Despite being a rare entity, MS should be considered as a differential diagnosis of soft tissue masses, especially in patients with a history of hematological malignancies. PMID:27453659

  15. Histotripsy Fractionation of Prostate Tissue: Local Effects and Systemic Response in a Canine Model

    PubMed Central

    Hempel, Christopher R.; Hall, Timothy L; Cain, Charles A.; Fowlkes, J. Brian; Xu, Zhen; Roberts, William W.

    2010-01-01

    Purpose Histotripsy is an extracorporeal ultrasound (US) technology that utilizes cavitational mechanisms to produce non-thermal tissue destruction. Previously, we demonstrated the feasibility of histotripsy for fractionation and immediate debulking of prostate tissue. The purpose of this study is to characterize the local effects and systemic response after histotripsy treatment of prostate tissue in an in-vivo canine model. Materials and Methods Histotripsy was applied transabdominally to the prostate in eighteen intact male canine subjects under general anesthesia. Acoustic bursts (4 microseconds) were delivered at 300 Hz pulse repetition rate from a highly focused 750 kHz piezoelectric US transducer (15 cm aperture, 3×3×8 mm focal volume). The prostate and surrounding structures were harvested at prescribed time points (0, 7, 28, or 56 days) following histotripsy. Blood and urine parameters were assessed periodically while clinical evaluation incorporating a validated veterinary pain scale was performed daily. Results Conventional transrectal US imaging facilitated targeting of the focal volume and provided real-time assessment of cavitation activity. Fractionation of the targeted volume and clearance of the resultant debris with urination produced a treatment cavity within each prostate. No acoustic collateral damage was seen and urothelialization of the treatment cavity occurred within 28 days of treatment. Only transient lab abnormalities and minimal hematuria were noted after treatment. Pain scores revealed only mild post treatment discomfort. Conclusions Histotripsy produced consistent tissue fractionation and prostate debulking without collateral acoustic injury or clinical side effects and was well tolerated in the canine model. PMID:21334667

  16. The development of common data elements for a multi-institute prostate cancer tissue bank: The Cooperative Prostate Cancer Tissue Resource (CPCTR) experience

    PubMed Central

    Patel, Ashokkumar A; Kajdacsy-Balla, André; Berman, Jules J; Bosland, Maarten; Datta, Milton W; Dhir, Rajiv; Gilbertson, John; Melamed, Jonathan; Orenstein, Jan; Tai, Kuei-Fang; Becich, Michael J

    2005-01-01

    Background The Cooperative Prostate Cancer Tissue Resource (CPCTR) is a consortium of four geographically dispersed institutions that are funded by the U.S. National Cancer Institute (NCI) to provide clinically annotated prostate cancer tissue samples to researchers. To facilitate this effort, it was critical to arrive at agreed upon common data elements (CDEs) that could be used to collect demographic, pathologic, treatment and clinical outcome data. Methods The CPCTR investigators convened a CDE curation subcommittee to develop and implement CDEs for the annotation of collected prostate tissues. The draft CDEs were refined and progressively annotated to make them ISO 11179 compliant. The CDEs were implemented in the CPCTR database and tested using software query tools developed by the investigators. Results By collaborative consensus the CPCTR CDE subcommittee developed 145 data elements to annotate the tissue samples collected. These included for each case: 1) demographic data, 2) clinical history, 3) pathology specimen level elements to describe the staging, grading and other characteristics of individual surgical pathology cases, 4) tissue block level annotation critical to managing a virtual inventory of cases and facilitating case selection, and 5) clinical outcome data including treatment, recurrence and vital status. These elements have been used successfully to respond to over 60 requests by end-users for tissue, including paraffin blocks from cases with 5 to 10 years of follow up, tissue microarrays (TMAs), as well as frozen tissue collected prospectively for genomic profiling and genetic studies. The CPCTR CDEs have been fully implemented in two major tissue banks and have been shared with dozens of other tissue banking efforts. Conclusion The freely available CDEs developed by the CPCTR are robust, based on "best practices" for tissue resources, and are ISO 11179 compliant. The process for CDE development described in this manuscript provides a

  17. Comparison of Prostatic Tissue Processed by Microwave and Conventional Technique Using Morphometry

    PubMed Central

    Jain, Promil; Kumar, Sanjay; Arora, B; Singh, Sneh; Chabbra, Sonia; Sen, Rajeev

    2015-01-01

    Background and Objectives: Rapid processing of histopathological specimens and decreased turnaround time is important to fulfill the needs of clinicians treating sick patients, so the present study was conducted to compare the time taken and quality of sections in processing of prostatic tissue by rapid microwave and conventional techniques using morphometry. Methods: Four to five mm thick paired prostate tissue pieces of fifty cases of prostatectomy specimens were taken. One tissue piece of the pair was processed routinely overnight by conventional tissue processing and the other by microwave processing. Time taken for processing by both conventional technique and microwave technique was noted and compared. Then, both were stained with conventional method of hematoxylin and eosin staining and examined for histological typing and grading. Morphometric study was done on slides of prostatic tissue processed by both conventional and microwave technique. Result: The prostatectomy specimens included both benign (86%) and malignant (14%) prostatic lesions in the age range of 46-85 years. The time taken for steps of dehydration, clearing and impregnation in microwave technique was significantly less as compared to histoprocessing done by conventional technique. Morphology, staining patterns of prostatic tissue processed within minutes by microwave technique, whether benign or malignant, were comparable to those sections which were processed in days using standard technique. Conclusion: Domestic microwave oven can be used for histoprocessing to accelerate the processing with preservation of morphology and is cheaper than commercially available microwave ovens and processing time was considerably reduced from days to minutes. PMID:26516319

  18. Nonylphenol effects on human prostate non tumorigenic cells.

    PubMed

    Forte, Maurizio; Di Lorenzo, Mariana; Carrizzo, Albino; Valiante, Salvatore; Vecchione, Carmine; Laforgia, Vincenza; De Falco, Maria

    2016-05-16

    Nonylphenol (NP) is an industrial chemical with estrogenic activity both in vivo and in vitro; estrogens play a critical role in the development of prostate and may be the cause of some pathological states, including cancer. In this study we examined the effects of NP on human prostate non tumorigenic epithelial cells (PNT1A) investigating on cell proliferation, interaction with estrogen receptors (ERs) and gene expression of genes involved in prostate diseases. We found that NP affects cell proliferation at 10(-6)M, promoting a cytoplasm-nucleus translocation of ERα and not ERβ, like the natural estrogen 17β-estradiol (E2). Moreover, we showed that NP enhances gene expression of key regulators of cell cycle. Estrogen selective antagonist ICI182780 in part reverted the observed effects of NP. These results confirm the estrogenic activity of NP and suggest that other transduction pathways may be involved in NP action on prostate. PMID:27260121

  19. [Brown fat tissue in humans].

    PubMed

    Medvedev, L N; Elsukova, E I

    2002-01-01

    Brown adipose tissue (BAT) is universally present in mammals. Thermal production in such tissue is physiologically important for maintaining temperature homeostasis and regulation of body mass in small-size homoiotherms. At present it is clearly established that unlike other large mammals, brown adipose in man and primates is retained throughout the whole postnatal othogenesis. Therefore, BAT appears as a possible effector of pharmacogenetic protection from human excessive adiposis. Systematic reserach of various functioning aspects of this unique organ of mammals were started abroad as early as 1960-es, and are actively developing at present. Domestic research of energy circulation physiology and of thermoregulation developed mostly outside the brown adipose tissue. Therefore, the principal objective of this publication is to draw attention of experimental and clinical researches to an intriguing aspect of the issue of energy circulation in humans--the issue of brown adipose functioning. PMID:12004574

  20. Multiplexed quantum dot labeling of activated c-Met signaling in castration-resistant human prostate cancer.

    PubMed

    Hu, Peizhen; Chu, Gina C-Y; Zhu, Guodong; Yang, Hua; Luthringer, Daniel; Prins, Gail; Habib, Fouad; Wang, Yuzhuo; Wang, Ruoxiang; Chung, Leland W K; Zhau, Haiyen E

    2011-01-01

    The potential application of multiplexed quantum dot labeling (MQDL) for cancer detection and prognosis and monitoring therapeutic responses has attracted the interests of bioengineers, pathologists and cancer biologists. Many published studies claim that MQDL is effective for cancer biomarker detection and useful in cancer diagnosis and prognosis, these studies have not been standardized against quantitative biochemical and molecular determinations. In the present study, we used a molecularly characterized human prostate cancer cell model exhibiting activated c-Met signaling with epithelial to mesenchymal transition (EMT) and lethal metastatic progression to bone and soft tissues as the gold standard, and compared the c-Met cell signaling network in this model, in clinical human prostate cancer tissue specimens and in a castration-resistant human prostate cancer xenograft model. We observed c-Met signaling network activation, manifested by increased phosphorylated c-Met in all three. The downstream survival signaling network was mediated by NF-κB and Mcl-1 and EMT was driven by receptor activator of NF-κB ligand (RANKL), at the single cell level in clinical prostate cancer specimens and the xenograft model. Results were confirmed by real-time RT-PCR and western blots in a human prostate cancer cell model. MQDL is a powerful tool for assessing biomarker expression and it offers molecular insights into cancer progression at both the cell and tissue level with high degree of sensitivity. PMID:22205960

  1. Tubulosquamous polyps in the vagina. Immunohistochemical comparison with ectopic prostatic tissue and Skene glands.

    PubMed

    Roma, Andres A

    2016-06-01

    Two tubulosquamous polyps arising in the vagina are reported. Both were diffusely positive for GATA3 in the squamous component and focally positive for NKX3.1 in the glandular component, prostate acid phosphatase was focally positive in only 1 case in the glandular component. Both cases were negative for PAX2, PAX8, SALL4, and prostate-specific antigen. In addition, we included 3 cases of cervical squamous-lined cysts most likely representing ectopic prostatic tissue in the cervix and 1 case of paraurethral Skene-type glands to compare the immunophenotype. We analyze this immunoprofile, not previously reported. We also suggest unifying the nomenclature because vaginal Brenner tumors are most likely synonymous with tubulosquamous polyp (TSP) of the vagina. Our findings add support to the postulated origin of TSPs and cervical ectopic prostatic tissue from eutopic or misplaced Skene glands, equivalent of the prostate in the female. NKX3.1 seems a better marker to study and diagnose ectopic prostatic tissue in the cervix as well as TSPs. PMID:27180063

  2. The regulation of adiponectin receptors in human prostate cancer cell lines

    SciTech Connect

    Mistry, T.; Digby, J.E.; Chen, J.; Desai, K.M.; Randeva, H.S. . E-mail: H.Randeva@warwick.ac.uk

    2006-09-29

    Obesity is a risk factor for prostate cancer, and plasma levels of the adipokine, adiponectin, are low in the former but high in the latter. Adiponectin has been shown to modulate cell proliferation and apoptosis, suggesting that adiponectin and its receptors (Adipo-R1, Adipo-R2) may provide a molecular association between obesity and prostate carcinogenesis. We show for First time, the protein distribution of Adipo-R1 and Adipo-R2 in LNCaP and PC3 cells, and in human prostate tissue. Using real-time RT-PCR we provide novel data demonstrating the differential regulation of Adipo-R1 and Adipo-R2 mRNA expression by testosterone, 5-{alpha} dihydrotestosterone, {beta}-estradiol, tumour necrosis factor-{alpha}, leptin, and adiponectin in LNCaP and PC3 cells. Our findings suggest that adiponectin and its receptors may contribute to the molecular association between obesity and prostate cancer through a complex interaction with other hormones and cytokines that also play important roles in the pathophysiology of obesity and prostate cancer.

  3. Inter- and Intra-Observer Variability in Prostate Definition With Tissue Harmonic and Brightness Mode Imaging

    SciTech Connect

    Sandhu, Gurpreet Kaur; Dunscombe, Peter; Meyer, Tyler; Pavamani, Simon; Khan, Rao

    2012-01-01

    Purpose: The objective of this study was to compare the relative utility of tissue harmonic (H) and brightness (B) transrectal ultrasound (TRUS) images of the prostate by studying interobserver and intraobserver variation in prostate delineation. Methods and Materials: Ten patients with early-stage disease were randomly selected. TRUS images of prostates were acquired using B and H modes. The prostates on all images were contoured by an experienced radiation oncologist (RO) and five equally trained observers. The observers were blinded to information regarding patient and imaging mode. The volumes of prostate glands and areas of midgland slices were calculated. Volumes contoured were compared among the observers and between observer group and RO. Contours on one patient were repeated five times by four observers to evaluate the intraobserver variability. Results: A one-sample Student t-test showed the volumes outlined by five observers are in agreement (p > 0.05) with the RO. Paired Student t-test showed prostate volumes (p = 0.008) and midgland areas (p = 0.006) with H mode were significantly smaller than that with B mode. Two-factor analysis of variances showed significant interobserver variability (p < 0.001) in prostate volumes and areas. Inter- and intraobserver consistency was quantified as the standard deviation of mean volumes and areas, and concordance indices. It was found that for small glands ({<=}35 cc) H mode provided greater interobserver consistency; however, for large glands ({>=}35 cc), B mode provided more consistent estimates. Conclusions: H mode provided superior inter- and intraobserver agreement in prostate volume definition for small to medium prostates. In large glands, H mode does not exhibit any additional advantage. Although harmonic imaging has not proven advantageous for all cases, its utilization seems to be judicious for small prostates.

  4. Growth inhibition of human prostate cells in vitro by novel inhibitors of androgen synthesis.

    PubMed

    Klus, G T; Nakamura, J; Li, J S; Ling, Y Z; Son, C; Kemppainen, J A; Wilson, E M; Brodie, A M

    1996-11-01

    The long-standing strategy for the treatment of metastatic prostate cancer has been to reduce androgenic stimulation of tumor growth by removal of the testes, the primary site of testosterone synthesis. However, a low level of androgenic stimulation may continue, even after castration, by the conversion of adrenal androgens to 5alpha-dihydrotestosterone (DHT) in the prostate tumor cells. Two important enzymes of the androgen biosynthetic pathway are 17alpha-hydroxylase/C17,20-lyase, which regulates an early step in the synthesis of testosterone and other androgens in both the testes and adrenal glands, and 5alpha-reductase, which converts testosterone to the more potent androgen, DHT, in the prostate. We have identified new inhibitors of these enzymes that may be of use in achieving a more complete ablation of androgens in the treatment of metastatic prostate cancer. Three derivatives of androstene were shown to inhibit 17alpha-hydroxylase/C17,20-lyase with potencies 2-20-fold greater than that of ketoconazole, a previously established inhibitor of this enzyme. Derivatives of pregnane and pregnene displayed activities against 5alpha-reductase that were comparable to that of N-(1,1-dimethyl-ethyl)-3-oxo-4-aza-5alpha-androst-1-ene-17beta-car boxamide. All of the 5alpha-reductase inhibitors were able to at least partially inhibit the mitogenic effect of testosterone in either histocultures of human benign prostatic hypertrophic tissue or in cultures of the LNCaP human prostatic tumor cell line. For these compounds, it appears that this inhibition can be attributed to a reduction of DHT synthesis in these cultures, because no inhibitory effect was observed in DHT-treated cultures, and none of the compounds had a cytotoxic effect. Surprisingly, one of the inhibitors of 17alpha-hydroxylase/C17,20-lyase, 17beta-(4-imidazolyl)-5-pregnen-3beta-ol, was also able to inhibit the mitogenic effect of testosterone in both the histoculture and cell culture assays and had an effect

  5. Hydrogen sulfide mediates the anti-survival effect of sulforaphane on human prostate cancer cells.

    PubMed

    Pei, Yanxi; Wu, Bo; Cao, Qiuhui; Wu, Lingyun; Yang, Guangdong

    2011-12-15

    Hydrogen sulfide (H(2)S) is a novel gasotransmitter that regulates cell proliferation and other cellular functions. Sulforaphane (SFN) is a sulfur-containing compound that exhibits anticancer properties, and young sprouts of broccoli are particularly rich in SFN. There is consistent epidemiological evidence that the consumption of sulfur-containing vegetables, such as garlic and cruciferous vegetables, may help reduce the occurrence of prostate cancer. Here we found that a large amount of H(2)S is released when SFN is added into cell culture medium or mixed with mouse liver homogenates, respectively. Both SFN and NaHS (a H(2)S donor) decreased the viability of PC-3 cells (a human prostate cancer cell line) in a dose-dependent manner, and supplement of methemoglobin or oxidized glutathione (two H(2)S scavengers) reversed SFN-reduced cell viability. We further found both cystathionine gamma-lyase (CSE) and cystathionine beta-synthase are expressed in PC-3 cells and mouse prostate tissues. H(2)S production in prostate tissues from CSE knockout mice was only 20% of that from wild-type mice, suggesting CSE is a major H(2)S-producing enzyme in prostate. CSE overexpression enhanced H(2)S production and inhibited cell viability in PC-3 cells. In addition, both SFN and NaHS activated p38 mitogen-activated protein kinases (MAPK) and c-Jun N-terminal kinase (JNK). Pre-treatment of PC-3 cells with methemoglobin decreased SFN-stimulated MAPK activities. Suppression of both p38 MAPK and JNK reversed H(2)S- or SFN-reduced viability of PC-3 cells. Our results demonstrated that H(2)S mediates the inhibitory effect of SFN on the proliferation of PC-3 cells, which suggests that H(2)S-releasing diet or drug might be beneficial in the treatment of prostate cancer. PMID:22005276

  6. Thioredoxin 1 in Prostate Tissue Is Associated with Gleason Score, Erythrocyte Antioxidant Enzyme Activity, and Dietary Antioxidants

    PubMed Central

    Vance, Terrence M.; Azabdaftari, Gissou; Pop, Elena A.; Lee, Sang Gil; Su, L. Joseph; Fontham, Elizabeth T. H.; Bensen, Jeannette T.; Steck, Susan E.; Arab, Lenore; Mohler, James L.; Chen, Ming-Hui; Koo, Sung I.; Chun, Ock K.

    2015-01-01

    Background. Prostate cancer is the most common noncutaneous cancer and second leading cause of cancer-related mortality in men in the US. Growing evidence suggests that oxidative stress is involved in prostate cancer. Methods. In this study, thioredoxin 1 (Trx 1), an enzyme and subcellular indicator of redox status, was measured in prostate biopsy tissue from 55 men from the North Carolina-Louisiana Prostate Cancer Project. A pathologist blindly scored levels of Trx 1. The association between Trx 1 and the Gleason score, erythrocyte antioxidant enzyme activity, and dietary antioxidant intake was determined using Fisher's exact test. Results. Trx 1 levels in benign prostate tissue in men with incident prostate cancer were positively associated with the Gleason score (P = 0.01) and inversely associated with dietary antioxidant intake (P = 0.03). In prostate cancer tissue, Trx 1 levels were associated with erythrocyte glutathione peroxidase activity (P = 0.01). No association was found for other erythrocyte enzymes. Greater Gleason score of malignant tissue corresponds to a greater difference in Trx 1 levels between malignant and benign tissue (P = 0.04). Conclusion. These results suggest that the redox status of prostate tissue is associated with prostate cancer grade and both endogenous and exogenous antioxidants. PMID:26357575

  7. Thioredoxin 1 in Prostate Tissue Is Associated with Gleason Score, Erythrocyte Antioxidant Enzyme Activity, and Dietary Antioxidants.

    PubMed

    Vance, Terrence M; Azabdaftari, Gissou; Pop, Elena A; Lee, Sang Gil; Su, L Joseph; Fontham, Elizabeth T H; Bensen, Jeannette T; Steck, Susan E; Arab, Lenore; Mohler, James L; Chen, Ming-Hui; Koo, Sung I; Chun, Ock K

    2015-01-01

    Background. Prostate cancer is the most common noncutaneous cancer and second leading cause of cancer-related mortality in men in the US. Growing evidence suggests that oxidative stress is involved in prostate cancer. Methods. In this study, thioredoxin 1 (Trx 1), an enzyme and subcellular indicator of redox status, was measured in prostate biopsy tissue from 55 men from the North Carolina-Louisiana Prostate Cancer Project. A pathologist blindly scored levels of Trx 1. The association between Trx 1 and the Gleason score, erythrocyte antioxidant enzyme activity, and dietary antioxidant intake was determined using Fisher's exact test. Results. Trx 1 levels in benign prostate tissue in men with incident prostate cancer were positively associated with the Gleason score (P = 0.01) and inversely associated with dietary antioxidant intake (P = 0.03). In prostate cancer tissue, Trx 1 levels were associated with erythrocyte glutathione peroxidase activity (P = 0.01). No association was found for other erythrocyte enzymes. Greater Gleason score of malignant tissue corresponds to a greater difference in Trx 1 levels between malignant and benign tissue (P = 0.04). Conclusion. These results suggest that the redox status of prostate tissue is associated with prostate cancer grade and both endogenous and exogenous antioxidants. PMID:26357575

  8. Capillary Force Seeding of Sphere-Templated Hydrogels for Tissue-Engineered Prostate Cancer Xenografts

    PubMed Central

    Long, Thomas J.; Takeno, Marc; Sprenger, Cynthia C.; Plymate, Stephen R.

    2013-01-01

    Biomaterial-based tissue-engineered tumor models are now widely used in cancer biology studies. However, specific methods for efficient and reliable cell seeding into these and tissue-engineering constructs used for regenerative medicine often remain poorly defined. Here, we describe a capillary force-based method for seeding the human prostate cancer cell lines M12 and LNCaP C4-2 into sphere-templated poly(2-hydroxyethyl methacrylate) hydrogels. The capillary force seeding method improved the cell number and distribution within the porous scaffolds compared to well-established protocols such as static and centrifugation seeding. Seeding efficiency was found to be strongly dependent on the rounded cell diameter relative to the pore diameter and pore interconnect size, parameters that can be controllably modulated during scaffold fabrication. Cell seeding efficiency was evaluated quantitatively using a PicoGreen DNA assay, which demonstrated some variation in cell retention using the capillary force method. When cultured within the porous hydrogels, both cell lines attached and proliferated within the network, but histology showed the formation of a necrotic zone by 7 days likely due to oxygen and nutrient diffusional limitations. The necrotic zone thickness was decreased by dynamically culturing cells in an orbital shaker. Proliferation analysis showed that despite a variable seeding efficiency, by 7 days in culture, scaffolds contained a roughly consistent number of cells as they proliferated to fill the pores of the scaffold. These studies demonstrate that sphere-templated polymeric scaffolds have the potential to serve as an adaptable cell culture substrate for engineering a three-dimensional prostate cancer model. PMID:23373788

  9. Human and murine prostate basal/stem cells are not direct targets of prolactin.

    PubMed

    Sackmann-Sala, Lucila; Angelergues, Antoine; Boutillon, Florence; d'Acremont, Bruno; Maidenberg, Marc; Oudard, Stéphane; Goffin, Vincent

    2015-09-01

    Local overexpression of prolactin (PRL) in the prostate of Pb-PRL transgenic mice induces benign prostate tumors exhibiting marked amplification of the epithelial basal/stem cell compartment. However, PRL-activated intracellular signaling seems to be restricted to luminal cells, suggesting that basal/stem cells may not be direct targets of PRL. Given their described role as prostate cancer-initiating cells, it is important to understand the mechanisms that regulate basal/stem cells. In this study, we evaluated whether PRL can act directly on these cells, by growing them as prostaspheres. For this, primary 3D prostasphere cultures were prepared from unfractionated cells isolated from freshly harvested human and mouse benign prostate tissues and subjected to PRL stimulation in vitro. None of the various concentrations of PRL tested showed any effects on the sizes or numbers of the prostaspheres generated. In addition, neither activation of canonical PRL-induced signaling pathways (Stat5, Stat3 or Erk1/2) nor increased expression of the proliferation marker Ki-67 were detected by immunostaining in PRL-stimulated prostaspheres. Consistent with the absence of response, PRL receptor mRNA levels were generally undetectable in mouse sphere cells. We conclude that human and mouse prostate basal/stem cells are not direct targets of PRL action. The observed amplification of basal/stem cells in Pb-PRL prostates might be due to paracrine mechanisms originating from PRL action on other cell compartments. Our current efforts are aimed at unraveling these mechanisms. PMID:25888939

  10. Distribution of miRNA expression across human tissues

    PubMed Central

    Ludwig, Nicole; Leidinger, Petra; Becker, Kurt; Backes, Christina; Fehlmann, Tobias; Pallasch, Christian; Rheinheimer, Steffi; Meder, Benjamin; Stähler, Cord; Meese, Eckart; Keller, Andreas

    2016-01-01

    We present a human miRNA tissue atlas by determining the abundance of 1997 miRNAs in 61 tissue biopsies of different organs from two individuals collected post-mortem. One thousand three hundred sixty-four miRNAs were discovered in at least one tissue, 143 were present in each tissue. To define the distribution of miRNAs, we utilized a tissue specificity index (TSI). The majority of miRNAs (82.9%) fell in a middle TSI range i.e. were neither specific for single tissues (TSI > 0.85) nor housekeeping miRNAs (TSI < 0.5). Nonetheless, we observed many different miRNAs and miRNA families that were predominantly expressed in certain tissues. Clustering of miRNA abundances revealed that tissues like several areas of the brain clustered together. Considering -3p and -5p mature forms we observed miR-150 with different tissue specificity. Analysis of additional lung and prostate biopsies indicated that inter-organism variability was significantly lower than inter-organ variability. Tissue-specific differences between the miRNA patterns appeared not to be significantly altered by storage as shown for heart and lung tissue. MiRNAs TSI values of human tissues were significantly (P = 10−8) correlated with those of rats; miRNAs that were highly abundant in certain human tissues were likewise abundant in according rat tissues. We implemented a web-based repository enabling scientists to access and browse the data (https://ccb-web.cs.uni-saarland.de/tissueatlas). PMID:26921406

  11. Distribution of miRNA expression across human tissues.

    PubMed

    Ludwig, Nicole; Leidinger, Petra; Becker, Kurt; Backes, Christina; Fehlmann, Tobias; Pallasch, Christian; Rheinheimer, Steffi; Meder, Benjamin; Stähler, Cord; Meese, Eckart; Keller, Andreas

    2016-05-01

    We present a human miRNA tissue atlas by determining the abundance of 1997 miRNAs in 61 tissue biopsies of different organs from two individuals collected post-mortem. One thousand three hundred sixty-four miRNAs were discovered in at least one tissue, 143 were present in each tissue. To define the distribution of miRNAs, we utilized a tissue specificity index (TSI). The majority of miRNAs (82.9%) fell in a middle TSI range i.e. were neither specific for single tissues (TSI > 0.85) nor housekeeping miRNAs (TSI < 0.5). Nonetheless, we observed many different miRNAs and miRNA families that were predominantly expressed in certain tissues. Clustering of miRNA abundances revealed that tissues like several areas of the brain clustered together. Considering -3p and -5p mature forms we observed miR-150 with different tissue specificity. Analysis of additional lung and prostate biopsies indicated that inter-organism variability was significantly lower than inter-organ variability. Tissue-specific differences between the miRNA patterns appeared not to be significantly altered by storage as shown for heart and lung tissue. MiRNAs TSI values of human tissues were significantly (P = 10(-8)) correlated with those of rats; miRNAs that were highly abundant in certain human tissues were likewise abundant in according rat tissues. We implemented a web-based repository enabling scientists to access and browse the data (https://ccb-web.cs.uni-saarland.de/tissueatlas). PMID:26921406

  12. Localization and physical mapping of the prostate-specific membrane antigen (PSM) gene to human chromosome 11

    SciTech Connect

    Rinker-Schaeffer, C.W.; Hawkins, A.L.; Griffin, C.A.; Isaacs, J.T.

    1995-11-01

    The prostate-specific membrane antigen (PSM) was identified by the monoclonal antibody 7E11-C5.3, which was raised against the human prostatic carcinoma cell line LNCaP. The PSM antigen is expressed by normal, neoplastic, and metastatic prostatic tissues. The 2.65-kb cDNA encoding the 100-kDa PSM glycoprotein was cloned from LNCaP cells. Studies have shown that the expression of PSM is tissue-specific. In the present study monochromosomal somatic cell hybrids were used to localize the PSM gene to human chromosome 11. Using this information, initial mapping studies identified two potential PSM gene loci at 11p11.1-p13 and 11q14. Further high-stringency analysis using cosmid probes identified the 11q14 region as the location of the PSM gene. 10 refs., 2 figs.

  13. Vitamin D Receptor Protein Expression in Tumor Tissue and Prostate Cancer Progression

    PubMed Central

    Hendrickson, Whitney K.; Flavin, Richard; Kasperzyk, Julie L.; Fiorentino, Michelangelo; Fang, Fang; Lis, Rosina; Fiore, Christopher; Penney, Kathryn L.; Ma, Jing; Kantoff, Philip W.; Stampfer, Meir J.; Loda, Massimo; Mucci, Lorelei A.; Giovannucci, Edward

    2011-01-01

    Purpose Data suggest that circulating 25-hydroxyvitamin D [25(OH)D] interacts with the vitamin D receptor (VDR) to decrease proliferation and increase apoptosis for some malignancies, although evidence for prostate cancer is less clear. How VDR expression in tumor tissue may influence prostate cancer progression has not been evaluated in large studies. Patients and Methods We examined protein expression of VDR in tumor tissue among 841 patients with prostate cancer in relation to risk of lethal prostate cancer within two prospective cohorts, the Physicians' Health Study and Health Professionals Follow-Up Study. We also examined the association of VDR expression with prediagnostic circulating 25(OH)D and 1,25-dihydroxyvitamin D levels and with two VDR single nucleotide polymorphisms, FokI and BsmI. Results Men whose tumors had high VDR expression had significantly lower prostate-specific antigen (PSA) at diagnosis (P for trend < .001), lower Gleason score (P for trend < .001), and less advanced tumor stage (P for trend < .001) and were more likely to have tumors harboring the TMPRSS2:ERG fusion (P for trend = .009). Compared with the lowest quartile, men whose tumors had the highest VDR expression had significantly reduced risk of lethal prostate cancer (hazard ratio [HR], 0.17; 95% CI, 0.07 to 0.41). This association was only slightly attenuated after adjustment for Gleason score and PSA at diagnosis (HR, 0.33; 95% CI, 0.13 to 0.83) or, additionally, for tumor stage (HR, 0.37; 95% CI, 0.14 to 0.94). Neither prediagnostic plasma vitamin D levels nor VDR polymorphisms were associated with VDR expression. Conclusion High VDR expression in prostate tumors is associated with a reduced risk of lethal cancer, suggesting a role of the vitamin D pathway in prostate cancer progression. PMID:21537045

  14. Production and Characterization of Monoclonal Antibodies against Human Prostate Specific Antigen

    PubMed Central

    Bayat, Ali Ahmad; Ghods, Roya; Shabani, Mahdi; Mahmoudi, Ahmad Reza; Yeganeh, Omid; Hassannia, Hadi; Sadeghitabar, Ali; Balay-Goli, Leila; Noutash-Haghighat, Farzaneh; Sarrafzadeh, Ali reza; Jeddi-Tehrani, Mahmood

    2015-01-01

    Background Prostate Specific Antigen (PSA) is an important laboratory marker for diagnosis of prostatic cancer. Thus, development of diagnostic tools specific for PSA plays an important role in screening, monitoring and early diagnosis of prostate cancer. In this paper, the production and characterization of a panel of murine monoclonal antibodies (mAbs) against PSA have been presented. Methods Balb/c mice were immunized with PSA, which was purified from seminal plasma. Splenocytes of hyperimmunized mice were extracted and fused with Sp2/0 cells. By adding selective HAT medium, hybridoma cells were established and positive clones were selected by ELISA after four times of cloning. The isotypes of produced mAbs were determined by ELISA and then purified from ascitic fluids using Hi-Trap protein G column. The reactivities of the mAbs were examined with the purified PSA and seminal plasma by ELISA and western blot techniques. Furthermore, the reactivities of the mAbs were assessed in Prostate Cancer (PCa), Benign Prostatic Hyperplasia (BPH) and brain cancer tissues by Immunohistochemistry (IHC). Results Five anti-PSA mAbs (clones: 2G2-B2, 2F9-F4, 2D6-E8, IgG1/К) and clones (2C8-E9, 2G3-E2, IgG2a/К) were produced and characterized. All mAbs, except 2F9-F4 detected the expression of PSA in PCa and BPH tissues and none of them reacted with PSA in brain cancer tissue in IHC. Besides, all mAbs could detect a protein band around 33 kDa in human seminal plasma in western blot. Conclusion These mAbs can specifically recognize PSA and may serve as a component of PSA diagnostic kit in various biological fluids. PMID:25926946

  15. A Double Blind, Randomized, Neoadjuvant Study of the Tissue effects of POMx Pills in Men with Prostate Cancer Prior to Radical Prostatectomy

    PubMed Central

    Freedland, Stephen J.; Carducci, Michael; Kroeger, Nils; Partin, Alan; Rao, Jian-yu; Jin, Yusheng; Kerkoutian, Susan; Wu, Hong; Li, Yunfeng; Creel, Patricia; Mundy, Kelly; Gurganus, Robin; Fedor, Helen; King, Serina A.; Zhang, Yanjun; Heber, David; Pantuck, Allan J.

    2013-01-01

    Pomegranates slow prostate cancer xenograft growth and prolong PSA doubling times in single-arm human studies. Pomegranates’ effects on human prostate tissue are understudied. We hypothesized orally administered pomegranate extract (POMx; PomWonderful, Los Angeles, CA) would lower tissue 8-hydroxy-2-deoxyguanosine (8-OHdG), an oxidative stress biomarker. 70 men were randomized to 2 tablets POMx or placebo daily up to 4 weeks prior to radical prostatectomy. Tissue was analyzed for intra-prostatic Urolithin A, a pomegranate metabolite, benign and malignant 8-OHdG, and cancer pS6 kinase, NFκB, and Ki67. Primary end-point was differences in 8-OHdG powered to detect 30% reduction. POMx was associated with 16% lower benign tissue 8-OHdG (p=0.095), which was not statistically significant. POMx was well-tolerated with no treatment-related withdrawals. There were no differences in baseline clinicopathological features between arms. Urolithin A was detected in 21/33 patient in the POMx group vs. 12/35 in the placebo group (p=0.031). Cancer pS6 kinase, NFκB, Ki67, and serum PSA changes were similar between arms. POMx prior to surgery results in pomegranate metabolite accumulation in prostate tissues. Our primary end-point in this modest-sized short-term trial was negative. Future larger longer studies are needed to more definitely test whether POMx reduces prostate oxidative stress as well as further animal testing to better understand the multiple mechanisms through which POMx may alter prostate cancer biology. PMID:23985577

  16. Online Image-based Monitoring of Soft-tissue Displacements for Radiation Therapy of the Prostate

    SciTech Connect

    Schlosser, Jeffrey; Salisbury, Kenneth; Hristov, Dimitre

    2012-08-01

    Purpose: Emerging prolonged, hypofractionated radiotherapy regimens rely on high-dose conformality to minimize toxicity and thus can benefit from image guidance systems that continuously monitor target position during beam delivery. To address this need we previously developed, as a potential add-on device for existing linear accelerators, a novel telerobotic ultrasound system capable of real-time, soft-tissue imaging. Expanding on this capability, the aim of this work was to develop and characterize an image-based technique for real-time detection of prostate displacements. Methods and Materials: Image processing techniques were implemented on spatially localized ultrasound images to generate two parameters representing prostate displacements in real time. In a phantom and five volunteers, soft-tissue targets were continuously imaged with a customized robotic manipulator while recording the two tissue displacement parameters (TDPs). Variations of the TDPs in the absence of tissue displacements were evaluated, as was the sensitivity of the TDPs to prostate translations and rotations. Robustness of the approach to probe force was also investigated. Results: With 95% confidence, the proposed method detected in vivo prostate displacements before they exceeded 2.3, 2.5, and 2.8 mm in anteroposterior, superoinferior, and mediolateral directions. Prostate pitch was detected before exceeding 4.7 Degree-Sign at 95% confidence. Total system time lag averaged 173 ms, mostly limited by ultrasound acquisition rate. False positives (FPs) (FP) in the absence of displacements did not exceed 1.5 FP events per 10 min of continuous in vivo imaging time. Conclusions: The feasibility of using telerobotic ultrasound for real-time, soft-tissue-based monitoring of target displacements was confirmed in vivo. Such monitoring has the potential to detect small clinically relevant intrafractional variations of the prostate position during beam delivery.

  17. SEM and X-ray microanalysis of human prostatic calculi

    SciTech Connect

    Vilches, J.; Lopez, A.; De Palacio, L.; Munoz, C.; Gomez, J.

    1982-02-01

    Calculi removed from human prostates affected with nodular hyperplasia were analyzed with scanning electron microscopy and EDAX system. The general spectrum was made up of Na, Al, Mg, S, P, Ca and Zn. Two types of stone were identified morphostructurally and microanalytically: calculi type I of nodular surface with high peaks of S, and calculi type II polyfaceted with high peaks of P and Ca. Their formation from corpora amylacea and/or exogenous constituents is discussed. The superficial deposit of Zn suggests its incorporation from the prostatic liquid and does not seem to play an important role in the genesis.

  18. Effect of anthralin on cell viability in human prostate adenocarcinoma.

    PubMed

    Raevskaya, A A; Gorbunova, S L; Savvateeva, M V; Severin, S E; Kirpichnikov, M P

    2012-07-01

    The study revealed the key role of serine protease hepsin activity in transition of in situ prostate adenocarcinoma into the metastasizing form. Inhibition of hepsin activity suppresses the invasive growth of the tumor. Hepsin is an convenient target for pharmacological agents, so the study of its inhibitory mechanisms is a promising avenue in drug development. Assay of proteolytic activity in various tumor cell lines in vitro showed that this activity in prostate adenocarcinoma cells significantly surpasses proteolytic activity in other examined tumor cell lines. Selective cytotoxic action of anthralin, an inhibitor of hepsin activity, on human adenocarcinoma cells was demonstrated in comparison with other tumor cell lines. PMID:22866312

  19. Diffusion optical spectroscopy of cancerous and normal prostate tissues in time-resolved and frequency domain

    NASA Astrophysics Data System (ADS)

    Zhou, Kenneth J.; Pu, Yang; Chen, Jun

    2014-03-01

    It is well-known that light transport can be well described using Maxwell's electromagnetic theory. In biological tissue, the scattering particles cause the interaction of scattered waves from neighboring particles. Since such interaction cannot be ignored, multiple scattering occurs. The theoretical solution of multiple scattering is complicated. A suitable description is that the wavelike behavior of light is ignored and the transport of an individual photon is considered to be absorbed or scattered. This is known as the Radiative Transfer Equation (RTE) theory. Analytical solutions to the RTE that explicitly describes photon migration can be obtained by introducing some proper approximations. One of the most popular models used in the field of tissue optics is the Diffusion Approximation (DA). In this study, we report on the results of our initial study of optical properties of ex vivo normal and cancerous prostate tissues and how tissue parameters affect the near infrared light transporting in the two types of tissues. The time-resolved transport of light is simulated as an impulse isotropic point source of energy within a homogeneous unbounded medium with different absorption and scattering properties of cancerous and normal prostate tissues. Light source is also modulated sinusoidally to yield a varied fluence rate in frequency domain at a distant observation point within the cancerous and normal prostate tissues. Due to difference of the absorption and scattering coefficients between cancerous and normal tissues, the expansion of light pulse, intensity, phase are found to be different.

  20. Elevated expression of HIF-lα in actively growing prostate tissues is associated with clinical features of benign prostatic hyperplasia

    PubMed Central

    Li, Xin; Wang, Hui; Liu, Shuai; Wu, Haihu; Bi, Dongbin; Ding, Kejia; Lu, Jiaju

    2016-01-01

    Background Benign prostatic hyperplasia (BPH) is one of the most common diseases in middle-age or older men. Increasing evidence has shown that BPH is associated with hypoxia microenvironment. Methods We retrospectively collected patient data and tissue samples from fetal prostates(FP), normal prostates(NP), intra-acinar of BPH, peri-acinar of BPH, prostate cancers and sarcomas of prostate. The expression of HIF-1α, as well as VEGF was visualized by immunohistochemistry and statistically analyzed with clinical parameters. Results Expression of HIF-lα was observed in intra-acinar of BPH (69.5%), prostate cancer (85.7%) and all FPs, while NP and peri-acinar of BPH tissues were all stained negative. HIF-lα levels in FPs and the malignant tumors were higher than BPH tissues(p < 0.05), and the expression of HIF-lα in intra-acinar of BPH was higher than NP and peri-acinar of BPH (p < 0.05). The expression of HIF-lα was correlated with the weight of intra-acinar of prostate (p < 0.05). And patients with prostate weight larger that 72.45g were prone to have HIF-lα moderate-positive expression, according to the ROC curve (AUC = 0.734, 95%CI = 0.630-0.838). Moreover, the risk of acute urine retention (AUR) for HIF-lα moderate-positive patients increased significantly (OR=5.517, 95%CI = 2.434-12.504). Conclusions HIF-lα expression is increased in highly proliferative prostate tissues and correlated with the weight of intra-acinar prostate. Moreover, HIF-lα is also an independent risk factor for AUR occurrence in BPH patients. PMID:26919249

  1. Interaction between high power 532nm laser and prostatic tissue: in vivo evaluation for laser prostatectomy

    NASA Astrophysics Data System (ADS)

    Malek, Reza; Kang, Hyun Wook; Peng, Steven Yihlih; Stinson, Douglas; Beck, Michael; Koullick, Ed

    2011-03-01

    A previous in vitro study demonstrated that 180W was the optimal power to reduce photoselective vaporization of the prostate (PVP) time for larger prostate glands. In this study, we investigated anatomic and histologic outcomes and ablation parameters of 180W laser performed with a new 750-μm side-firing fiber in a survival study of living canines. Eight male canines underwent anterograde PVP with the 180W 532-nm laser. Four each animals were euthanized 3 hours or 8 weeks postoperatively. Prostates were measured and histologically analyzed after hematoxylin and eosin (H&E), triphenyltetrazolium chloride (TTC), or Gomori trichrome (GT) staining. Compared to the previous 120W laser, PVP with the 180W laser bloodlessly created a 76% larger cavity (mean 11.8 vs. 6.7 cm3; p=0.014) and ablated tissue at a 77% higher rate (mean 2.3 vs. 1.3 cm3/min; p=0.03) while H&E- and TTC-staining demonstrated its 33% thicker mean coagulation zone (2.0+/-0.4 vs. 1.5+/-0.3 mm). H&E-stained cross-sectional prostatic tissue specimens from the 3-hour (acute) group showed histologic evolution of concentric non-viable coagulation zone, partially viable hyperemic transition zone of repair, and viable non-treated zone. H&E- and GT-stained specimens from the 8-week (chronic) group revealed healed circumferentially epithelialized, non-edematous, prostatic urethral channels with no increase in collagen in the subjacent prostatic tissue vis-á-vis the normal control. Our canine study demonstrates that 180W 532-nm laser PVP with its new fiber has a significantly higher ablation rate with a more hemostatic coagulation zone, but equally favorable tissue interaction and healing, compared with our previous 120W canine study.

  2. Expression of tmp21 in normal adult human tissues

    PubMed Central

    Xie, Jian; Yang, Yuan; Li, Jianbo; Hou, Jing; Xia, Kun; Song, Weihong; Liu, Shengchun

    2014-01-01

    TMP21, known as p23 protein, is one important member of the p24 protein families. The degradation of TMP21 is mediated by the ubiquitin-proteasome pathway, as with the other presenilin-associated γ-secretase complex members. NFAT plays a very important role in regulation of human TMP21 gene expression. Compared with the function of TMP21, the studies about the distribution of this protein in human tissues are limited. We collected 19 normal adult human tissues from a healthy adult man died in a traffic accident and did examination of all the tissues collected for ICH, western blot and RT-PCR. It was shown that the expression of TMP21 is at high levels in heart, liver, lung, kidney and adrenal gland; moderate levels in brain, pancreas, prostate gland, testicle, small intestine, colon, stomach, gall bladder, thyroid gland and trachea; low levels in skeletal muscle, skin and lymphonodus. TMP21 is widely existed in normal adult human tissues. The current study provided for the first time a comprehensive expression of TMP21 in normal adult human tissues. It will benefit on helping in the design and interpretation of future studies focused on expounding the function of TMP21. PMID:25356171

  3. Tissue mimicking materials for the detection of prostate cancer using shear wave elastography: A validation study

    PubMed Central

    Cao, Rui; Huang, Zhihong; Varghese, Tomy; Nabi, Ghulam

    2013-01-01

    Purpose: Quantification of stiffness changes may provide important diagnostic information and aid in the early detection of cancers. Shear wave elastography is an imaging technique that assesses tissue stiffness using acoustic radiation force as an alternate to manual palpation reported previously with quasistatic elastography. In this study, the elastic properties of tissue mimicking materials, including agar, polyacrylamide (PAA), and silicone, are evaluated with an objective to determine material characteristics which resemble normal and cancerous prostate tissue. Methods: Acoustic properties and stiffness of tissue mimicking phantoms were measured using compressional mechanical testing and shear wave elastography using supersonic shear imaging. The latter is based on the principles of shear waves generated using acoustic radiation force. The evaluation included tissue mimicking materials (TMMs) within the prostate at different positions and sizes that could mimic cancerous and normal prostate tissue. Patient data on normal and prostate cancer tissues quantified using biopsy histopathology were used to validate the findings. Pathologist reports on histopathology were blinded to mechanical testing and elastographic findings. Results: Young's modulus values of 86.2 ± 4.5 and 271.5 ± 25.7 kPa were obtained for PAA mixed with 2% Al2O3 particles and silicone, respectively. Young's modulus of TMMs from mechanical compression testing showed a clear trend of increasing stiffness with an increasing percentage of agar. The silicone material had higher stiffness values when compared with PAA with Al2O3. The mean Young's modulus value in cancerous tissue was 90.5 ± 4.5 kPa as compared to 93.8 ± 4.4 and 86.2 ± 4.5 kPa obtained with PAA with 2% Al2O3 phantom at a depth of 52.4 and 36.6 mm, respectively. Conclusions: PAA mixed with Al2O3 provides the most suitable tissue mimicking material for prostate cancer tumor material, while agar could form the surrounding

  4. Tissue composition and density impact on the clinical parameters for (125)I prostate implants dosimetry.

    PubMed

    Oliveira, Susana Maria; Teixeira, Nuno José; Fernandes, Lisete; Teles, Pedro; Vieira, Guy; Vaz, Pedro

    2014-11-01

    The MCNPX code was used to calculate the TG-43U1 recommended parameters in water and prostate tissue in order to quantify the dosimetric impact in 30 patients treated with (125)I prostate implants when replacing the TG-43U1 formalism parameters calculated in water by a prostate-like medium in the planning system (PS) and to evaluate the uncertainties associated with Monte Carlo (MC) calculations. The prostate density was obtained from the CT of 100 patients with prostate cancer. The deviations between our results for water and the TG-43U1 consensus dataset values were -2.6% for prostate V100, -13.0% for V150, and -5.8% for D90; -2.0% for rectum V100, and -5.1% for D0.1; -5.0% for urethra D10, and -5.1% for D30. The same differences between our water and prostate results were all under 0.3%. Uncertainties estimations were up to 2.9% for the gL(r) function, 13.4% for the F(r,θ) function and 7.0% for Λ, mainly due to seed geometry uncertainties. Uncertainties in extracting the TG-43U1 parameters in the MC simulations as well as in the literature comparison are of the same order of magnitude as the differences between dose distributions computed for water and prostate-like medium. The selection of the parameters for the PS should be done carefully, as it may considerably affect the dose distributions. The seeds internal geometry uncertainties are a major limiting factor in the MC parameters deduction. PMID:25239870

  5. Deep RNA sequencing analysis of readthrough gene fusions in human prostate adenocarcinoma and reference samples

    PubMed Central

    2011-01-01

    Background Readthrough fusions across adjacent genes in the genome, or transcription-induced chimeras (TICs), have been estimated using expressed sequence tag (EST) libraries to involve 4-6% of all genes. Deep transcriptional sequencing (RNA-Seq) now makes it possible to study the occurrence and expression levels of TICs in individual samples across the genome. Methods We performed single-end RNA-Seq on three human prostate adenocarcinoma samples and their corresponding normal tissues, as well as brain and universal reference samples. We developed two bioinformatics methods to specifically identify TIC events: a targeted alignment method using artificial exon-exon junctions within 200,000 bp from adjacent genes, and genomic alignment allowing splicing within individual reads. We performed further experimental verification and characterization of selected TIC and fusion events using quantitative RT-PCR and comparative genomic hybridization microarrays. Results Targeted alignment against artificial exon-exon junctions yielded 339 distinct TIC events, including 32 gene pairs with multiple isoforms. The false discovery rate was estimated to be 1.5%. Spliced alignment to the genome was less sensitive, finding only 18% of those found by targeted alignment in 33-nt reads and 59% of those in 50-nt reads. However, spliced alignment revealed 30 cases of TICs with intervening exons, in addition to distant inversions, scrambled genes, and translocations. Our findings increase the catalog of observed TIC gene pairs by 66%. We verified 6 of 6 predicted TICs in all prostate samples, and 2 of 5 predicted novel distant gene fusions, both private events among 54 prostate tumor samples tested. Expression of TICs correlates with that of the upstream gene, which can explain the prostate-specific pattern of some TIC events and the restriction of the SLC45A3-ELK4 e4-e2 TIC to ERG-negative prostate samples, as confirmed in 20 matched prostate tumor and normal samples and 9 lung cancer

  6. Tookad-mediated photodynamic effects on the prostate and its adjacent tissues: in vivo study in canine models

    NASA Astrophysics Data System (ADS)

    Huang, Zheng; Chen, Qun; Luck, David; Beckers, Jill; Blanc, Dominique; Hetzel, Fred W.

    2005-04-01

    Photodynamic therapy (PDT) mediated with a vascular acting photosensitizer Tookad (pd-bacteriopheophorbide), was investigated as an alternative treatment modality for prostate cancer. Tookad photodynamic effects on the prostate and its adjacent tissues were evaluated in canine models. Interstitial prostate PDT was performed by irradiating individual lobes with a diode laser (763 nm) and 1-cm cylindrical diffuser fibers at various light doses to activate the IV administered photosensitizer Tookad (1 - 2 mg/kg). The sensitivity of the adjacent tissues to Tookad-PDT was determined by superficially irradiating the surfaces of the bladder, colon, abdominal muscle and pelvic plexus with a microlens fiber at various drug/light doses. PDT effect on the prostatic urethra was evaluated by transurethral irradiation. The prostate and adjacent tissues were harvested one-week after the treatment and subjected to histopathologic examination. At one-week post interstitial prostate PDT, the animals recovered well with little or no urethral complications. PDT induced prostate lesions were characterized by marked hemorrhagic necrosis. The bladder, colon, abdominal muscle and pelvic plexus, appeared to also be sensitive to Tookad-PDT at light dose levels greater than 40 Jcm2. Urethral mucosa appeared less sensitive to Tookad-PDT. In conclusion, Tookad-mediated PDT demonstrates very strong vascular effects and can provide an effective alternative for the treatment of localized prostate cancer. Protection of the adjacent tissues should be taken into consideration in the total prostate ablation process due to their sensitivity to the Tookad-mediated PDT.

  7. Glucocorticoid receptor antagonism reverts docetaxel resistance in human prostate cancer

    PubMed Central

    Kroon, Jan; Puhr, Martin; Buijs, Jeroen T; van der Horst, Geertje; Hemmer, Daniëlle M; Marijt, Koen A; Hwang, Ming S; Masood, Motasim; Grimm, Stefan; Storm, Gert; Metselaar, Josbert M; Meijer, Onno C; Culig, Zoran; van der Pluijm, Gabri

    2016-01-01

    Resistance to docetaxel is a major clinical problem in advanced prostate cancer (PCa). Although glucocorticoids (GCs) are frequently used in combination with docetaxel, it is unclear to what extent GCs and their receptor, the glucocorticoid receptor (GR), contribute to the chemotherapy resistance. In this study, we aim to elucidate the role of the GR in docetaxel-resistant PCa in order to improve the current PCa therapies. GR expression was analyzed in a tissue microarray of primary PCa specimens from chemonaive and docetaxel-treated patients, and in cultured PCa cell lines with an acquired docetaxel resistance (PC3-DR, DU145-DR, and 22Rv1-DR). We found a robust overexpression of the GR in primary PCa from docetaxel-treated patients and enhanced GR levels in cultured docetaxel-resistant human PCa cells, indicating a key role of the GR in docetaxel resistance. The capability of the GR antagonists (RU-486 and cyproterone acetate) to revert docetaxel resistance was investigated and revealed significant resensitization of docetaxel-resistant PCa cells for docetaxel treatment in a dose- and time-dependent manner, in which a complete restoration of docetaxel sensitivity was achieved in both androgen receptor (AR)-negative and AR-positive cell lines. Mechanistically, we demonstrated down-regulation of Bcl-xL and Bcl-2 upon GR antagonism, thereby defining potential treatment targets. In conclusion, we describe the involvement of the GR in the acquisition of docetaxel resistance in human PCa. Therapeutic targeting of the GR effectively resensitizes docetaxel-resistant PCa cells. These findings warrant further investigation of the clinical utility of the GR antagonists in the management of patients with advanced and docetaxel-resistant PCa. PMID:26483423

  8. Identification of candidate genes for prostate cancer-risk SNPs utilizing a normal prostate tissue eQTL data set

    PubMed Central

    Thibodeau, S. N.; French, A. J.; McDonnell, S. K.; Cheville, J.; Middha, S.; Tillmans, L.; Riska, S.; Baheti, S.; Larson, M. C.; Fogarty, Z.; Zhang, Y.; Larson, N.; Nair, A.; O'Brien, D.; Wang, L.; Schaid, D J.

    2015-01-01

    Multiple studies have identified loci associated with the risk of developing prostate cancer but the associated genes are not well studied. Here we create a normal prostate tissue-specific eQTL data set and apply this data set to previously identified prostate cancer (PrCa)-risk SNPs in an effort to identify candidate target genes. The eQTL data set is constructed by the genotyping and RNA sequencing of 471 samples. We focus on 146 PrCa-risk SNPs, including all SNPs in linkage disequilibrium with each risk SNP, resulting in 100 unique risk intervals. We analyse cis-acting associations where the transcript is located within 2 Mb (±1 Mb) of the risk SNP interval. Of all SNP–gene combinations tested, 41.7% of SNPs demonstrate a significant eQTL signal after adjustment for sample histology and 14 expression principal component covariates. Of the 100 PrCa-risk intervals, 51 have a significant eQTL signal and these are associated with 88 genes. This study provides a rich resource to study biological mechanisms underlying genetic risk to PrCa. PMID:26611117

  9. Radiation Effect on Human Tissue

    NASA Technical Reports Server (NTRS)

    Richmond, Robert C.; Cruz, Angela; Bors, Karen; Curreri, Peter A. (Technical Monitor)

    2002-01-01

    Predicting the occurrence of human cancer following exposure of an epidemiologic population to any agent causing genetic damage is a difficult task. To an approximation, this is because the uncertainty of uniform exposure to the damaging agent, and the uncertainty of uniform processing of that damage within a complex set of biological variables, degrade the confidence of predicting the delayed expression of cancer as a relatively rare event within clinically normal individuals. This situation begs the need for alternate controlled experimental models that are predictive for the development of human cancer following exposures to agents causing genetic damage. Such models historically have not been of substantial proven value. It is more recently encouraging, however, that developments in molecular and cell biology have led to an expanded knowledge of human carcinogenesis, and of molecular markers associated with that process. It is therefore appropriate to consider new laboratory models developed to accomodate that expanded knowledge in order to assess the cancer risks associated with exposures to genotoxic agents. When ionizing radiation of space is the genotoxic agent, then a series of additional considerations for human cancer risk assessment must also be applied. These include the dose of radiation absorbed by tissue at different locations in the body, the quality of the absorbed radiation, the rate at which absorbed dose accumulates in tissue, the way in which absorbed dose is measured and calculated, and the alterations in incident radiation caused by shielding materials. It is clear that human cancer risk assessment for damage caused by ionizing radiation is a multidisciplinary responsibility, and that within this responsibility no single discipline can hold disproportionate sway if a risk assessment model of radiation-induced human cancer is to be developed that has proven value. Biomolecular and cellular markers from the work reported here are considered

  10. Telomerase-immortalized non-malignant human prostate epithelial cells retain the properties of multipotent stem cells

    SciTech Connect

    Li Hongzhen; Zhou Jianjun; Miki, Jun; Furusato, Bungo; Gu Yongpeng; Srivastava, Shiv; McLeod, David G.; Vogel, Jonathan C.; Rhim, Johng S.

    2008-01-01

    Understanding prostate stem cells may provide insight into the origin of prostate cancer. Primary cells have been cultured from human prostate tissue but they usually survive only 15-20 population doublings before undergoing senescence. We report here that RC-170N/h/clone 7 cells, a clonal cell line from hTERT-immortalized primary non-malignant tissue-derived human prostate epithelial cell line (RC170N/h), retain multipotent stem cell properties. The RC-170N/h/clone 7 cells expressed a human embryonic stem cell marker, Oct-4, and potential prostate epithelial stem cell markers, CD133, integrin {alpha}2{beta}1{sup hi} and CD44. The RC-170N/h/clone 7 cells proliferated in KGM and Dulbecco's Modified Eagle Medium with 10% fetal bovine serum and 5 {mu}g/ml insulin (DMEM + 10% FBS + Ins.) medium, and differentiated into epithelial stem cells that expressed epithelial cell markers, including CK5/14, CD44, p63 and cytokeratin 18 (CK18); as well as the mesenchymal cell markers, vimentin, desmin; the neuron and neuroendocrine cell marker, chromogranin A. Furthermore the RC170 N/h/clone 7 cells differentiated into multi tissues when transplanted into the sub-renal capsule and subcutaneously of NOD-SCID mice. The results indicate that RC170N/h/clone 7 cells retain the properties of multipotent stem cells and will be useful as a novel cell model for studying the mechanisms of human prostate stem cell differentiation and transformation.

  11. Impact of pre-treatment prostate tissue androgen content on the prediction of castration-resistant prostate cancer development in patients treated with primary androgen deprivation therapy.

    PubMed

    Shibata, Y; Suzuki, K; Arai, S; Miyoshi, Y; Umemoto, S; Masumori, N; Kamiya, N; Ichikawa, T; Kitagawa, Y; Mizokami, A; Sugimura, Y; Nonomura, N; Sakai, H; Honma, S; Kubota, Y

    2013-05-01

    Great advances in tissue androgen analysis using liquid chromatography-tandem mass spectrometry (LC-MS/MS) have made it possible to evaluate the tissue androgen content from a single needle prostate biopsy specimen. In this study, we investigated if pre-treatment androgen content in prostate biopsy specimens could predict their response to primary androgen deprivation therapy (ADT) and future castration-resistant prostate cancer (CRPC). One-hundred and sixty-five prostate cancer patients who received primary ADT were enrolled. They had received multiple core prostate needle biopsy at diagnosis, and an additional one needle biopsy specimen was obtained for tissue androgen determination using LC-MS/MS. The patients' prostate specific antigen (PSA) values were periodically followed during the treatment and patients were determined to have CRPC when their PSA value increased continuously to 25% above the nadir and a 2.0 ng/mL increase. A significant correlation was found between PSA value decline velocity (PSA half-time) after ADT and pre-ADT tissue androgen content. Twenty-three patients were determined to have CRPC. These CRPC patients had a significantly high concentration of tissue T (p < 0.01) and low concentration of tissue 5α-dihydrotestosterone (DHT) (p < 0.01), resulting in a higher tissue T/DHT ratio (p < 0.001). A multivariate Cox proportional hazard model revealed the pre-ADT tissue T/DHT ratio and Gleason score as independent predictors for CRPC development. By using the two statistically significant variables, the relative risk of CRPC development could be calculated. The results of this study suggest that the evaluation of prostate androgen content in a single needle biopsy specimen may be useful to predict future CRPC development after primary ADT. Further studies are required for the clinical application of T/DHT ratio evaluation. PMID:23444052

  12. Prostate tissue decomposition via DECT using the model based iterative image reconstruction algorithm DIRA

    NASA Astrophysics Data System (ADS)

    Malusek, Alexandr; Magnusson, Maria; Sandborg, Michael; Westin, Robin; Alm Carlsson, Gudrun

    2014-03-01

    Better knowledge of elemental composition of patient tissues may improve the accuracy of absorbed dose delivery in brachytherapy. Deficiencies of water-based protocols have been recognized and work is ongoing to implement patient-specific radiation treatment protocols. A model based iterative image reconstruction algorithm DIRA has been developed by the authors to automatically decompose patient tissues to two or three base components via dual-energy computed tomography. Performance of an updated version of DIRA was evaluated for the determination of prostate calcification. A computer simulation using an anthropomorphic phantom showed that the mass fraction of calcium in the prostate tissue was determined with accuracy better than 9%. The calculated mass fraction was little affected by the choice of the material triplet for the surrounding soft tissue. Relative differences between true and approximated values of linear attenuation coefficient and mass energy absorption coefficient for the prostate tissue were less than 6% for photon energies from 1 keV to 2 MeV. The results indicate that DIRA has the potential to improve the accuracy of dose delivery in brachytherapy despite the fact that base material triplets only approximate surrounding soft tissues.

  13. Simulation and experiment of soft-tissue deformation in prostate brachytherapy.

    PubMed

    Liang, Dong; Jiang, Shan; Yang, Zhiyong; Wang, Xingji

    2016-06-01

    Soft-tissue deformation is one of the major reasons for the inaccurate positioning of percutaneous needle insertion process. In this article, simulations and experiments of the needle insertion soft-tissue process are both applied to study soft-tissue deformation. A needle deflection model based on the mechanics is used to calculate the needle deflection during the interaction process. The obtained needle deflection data are applied into finite element analysis process as the system input. The uniaxial tensile strength tests, compression tests, and static indentation experiments are used to obtain the soft-tissue parameters and choose the best strain-energy function to model in the simulation. Magnetic resonance imaging is used to reconstruct the prostate, establishing both prostate three-dimensional finite element model and artificial prostate model. The needle-soft tissue interaction simulation results are compared with those of the needle insertion experiment. The displacement data of the mark point in the experiment are comparable to the simulation results. It is concluded that, using this simulation method, the surgeon can predict the deformation of the tissue and the displacement of the target in advance. PMID:27129384

  14. Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle

    PubMed Central

    Hennenberg, Martin; Strittmatter, Frank; Beckmann, Christer; Rutz, Beata; Füllhase, Claudius; Waidelich, Raphaela; Montorsi, Francesco; Hedlund, Petter; Andersson, Karl-Erik; Stief, Christian G.; Gratzke, Christian

    2012-01-01

    Background The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. Objective To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Methods Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Results Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Conclusions Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors

  15. [Transurethral prostate resection prior to kidney transplantation leading to urethral cicatricial tissue].

    PubMed

    Schou-Jensen, Katrine; Mohammad, Wael

    2015-01-26

    In Denmark, kidney transplantations in patients above 50 years have increased during the last decade. Consequently, the number of patients with lower urinary tract symptoms due to prostate hypertrophy increases accordingly. We describe two patients, who both had a resection of the prostate while having anuria and waiting for a kidney transplantation from a deceased donor. In both cases it was impossible to place a urethral catheter during the following transplantation due to total urethral occlusion, so a suprapubic catheter was inserted until the scar tissue was dilated or resected by a later transurethral intervention. PMID:25612989

  16. Phenomenological model of laser-tissue interaction with application to Benign Prostatic Hyperplasia (BPH) simulation.

    PubMed

    Zhou, Xiangmin; Zhang, Nan; Shen, Yunhe; Burke, Dan; Konchada, Vamsi; Sweet, Robert

    2011-01-01

    Laser-tissue interaction is a multi-physics phenomenon not yet mathematically describable and computationally predictable. It is a challenge to model the laser-tissue interaction for real time laser Benign Prostatic Hyperplasia (BPH) simulation which requires the laser-tissue interaction model to be computationally efficient and accurate. Under the consideration and enforcement of the thermodynamic first law and treating the laser-tissue interaction as a gray-box, utilizing the sensitivity analysis of some key parameters that will affect the laser intensity on the tissue surface with respect to the tissue vaporization rate, a phenomenological model of laser-tissue interaction is developed. The developed laser-tissue interaction model has been implemented for a laser BPH simulator and achieves real time performance (more than 30 frames per second). The model agrees well with the available experimental data. PMID:21335893

  17. Interaction between high power 532nm laser and prostatic tissue: in vitro evaluation for laser prostatectomy

    NASA Astrophysics Data System (ADS)

    Kang, Hyun Wook; Peng, Yihlih Steven; Stinson, Douglas

    2011-03-01

    Photoselective vaporization of the prostate (PVP) has been developed for effective treatment of obstructive benign prostatic hyperplasia. To maximize tissue ablation for large prostate gland, identifying the optimal power level for PVP is still necessary. We investigated the effect of various power levels on in vitro bovine prostate ablation with a 532-nm laser system. A custom-made 532-nm laser was employed to provide various power levels, delivered through a newly designed 750-μm side-firing fiber. Tissue ablation efficiency was evaluated in terms of power (P; 120~200W), treatment speed of fiber (TS; 2~8 mm/s), and working distance between fiber and tissue surface (WD; 1~5 mm). Coagulation depth was also estimated macroscopically and histologically (H&E) at various Ps. Both 180 and 200W yielded comparable ablated volume (104.3+/-24.7 vs. 104.1+/-23.9 mm3 at TS=4 mm/s and WD=2 mm; p=0.99); thus, 180W was identified as the optimal power to maximize tissue ablation, by removing tissue up to 80% faster than 120W (41.7+/-9.9 vs. 23.2+/-3.4 mm3/s at TS=4 mm/s and WD=2 mm; p<0.005). Tissue ablation was maximized at TS=4 mm/s and ablated equally efficiently at up to 3 mm WD (104.5+/-16.7 mm3 for WD=1 mm vs. 93.4+/-7.4 mm3 for WD=3 mm at 180W; p=0.33). The mean thickness of coagulation zone for 180W was 20% thicker than that for 120W (1.31+/-0.17 vs. 1.09+/-0.16 mm; p<0.005). The current in vitro study demonstrated that 180W was the optimal power to maximize tissue ablation efficiency with enhanced coagulation characteristics.

  18. The efficacy of Stokes Shift Spectroscopy for detecting prostate and breast cancer tissues

    NASA Astrophysics Data System (ADS)

    Pu, Yang; Wang, W. B.; Yang, Yuanlong; Alfano, Robert R.

    2013-03-01

    Stokes Shift Spectroscopy (S3) offers a novel way to rapidly measure spectral fingerprints of complex molecular mixtures in tissue. The changes of key fluorophores from normal state to the malignant state can be reflected by alteration of Stokes Shift Spectra (S3 spectra). S3 measurements can be used to acquire enough information of different key fluorophores from one spectrum to speed up spectral acquisition time. In this study, we demonstrate the usefulness of the S3 technique to distinguish the malignant tissue from the normal prostate and breast tissues. The optimal wavelength shift constant (Δλc) of S3 spectra measurements for prostate/breast cancer detection were determined to be 40 nm. The underlying physical and biological basis for S3 is discussed. For the first time, our work explicitly discloses how and why S3 is supreme in comparison with other conventional spectroscopic techniques.

  19. Collecting and Studying Blood and Tissue Samples From Patients With Locally Recurrent or Metastatic Prostate or Bladder/Urothelial Cancer

    ClinicalTrials.gov

    2016-06-06

    Healthy Control; Localized Urothelial Carcinoma of the Renal Pelvis and Ureter; Metastatic Malignant Neoplasm in the Bone; Metastatic Malignant Neoplasm in the Soft Tissues; Metastatic Urothelial Carcinoma of the Renal Pelvis and Ureter; Recurrent Bladder Carcinoma; Recurrent Prostate Carcinoma; Recurrent Urothelial Carcinoma of the Renal Pelvis and Ureter; Stage IV Bladder Cancer; Stage IV Bladder Urothelial Carcinoma; Stage IV Prostate Cancer

  20. Nd:YAG surgical laser effects in canine prostate tissue: temperature and damage distribution

    NASA Astrophysics Data System (ADS)

    van Nimwegen, S. A.; L'Eplattenier, H. F.; Rem, A. I.; van der Lugt, J. J.; Kirpensteijn, J.

    2009-01-01

    An in vitro model was used to predict short-term, laser-induced, thermal damage in canine prostate tissue. Canine prostate tissue samples were equipped with thermocouple probes to measure tissue temperature at 3, 6, 9 and 12 mm depths. The tissue surface was irradiated with a Nd:YAG laser in contact or non-contact mode for up to 20 s, using powers from 5 to 20 W. Prediction of thermal damage using Arrhenius theory was discussed and compared to the in vitro damage threshold, determined by histological evaluation. The threshold temperature for acute thermal tissue damage was 69 ± 6 °C (means ± SD), irrespective of exposure time. Contact mode laser application caused vaporization of tissue, leaving a crater underneath the fiber tip. The mean extent of tissue damage underneath the vaporization crater floor was 0.9 ± 0.6 mm after 5, 10 or 20 s of contact mode laser irradiation at 10 W, whereas 20 W non-contact exposure up to 20 s causes up to 4.7 ± 0.2 mm coagulation necrosis. It was concluded that short-term acute thermal tissue damage can be comprehensively described by a single threshold temperature.

  1. The bioavailability of different zinc compounds used as human dietary supplements in rat prostate: a comparative study.

    PubMed

    Sapota, Andrzej; Daragó, Adam; Skrzypińska-Gawrysiak, Małgorzata; Nasiadek, Marzenna; Klimczak, Michał; Kilanowicz, Anna

    2014-06-01

    The normal human prostate accumulates the highest levels of zinc (Zn) of any soft tissue in the body. The pool of zinc available to the body is known to significantly decrease with age. It is suggested that dietary Zn supplementation protects against oxidative damage and reduces the risk of cancer. Zinc sulfate and zinc gluconate were the most frequently mentioned in per os administration in studies on Zn supplementation. The major aim of the study was to compare the bioavailability of different Zn compounds (sulfate, gluconate and citrate) in the prostate after their daily administration to male rats at three different doses (3.0; 15.0; and 50.0 mg Zn/kg b.w.) for 30 days. The results show that bioavailability in the prostate differs significantly between individual zinc preparations. A significantly elevated Zn concentration in the dorso-lateral lobe of the prostate, compared to controls, was found in the rats supplemented with two compounds only: zinc gluconate and zinc citrate. However, after administration of zinc gluconate, this effect occurred even at the lowest dose. The lowest zinc bioavailability in the prostate was found in the rats administered zinc sulfate: no significant Zn increase was seen in particular zones of the prostate. To sum up, the use of zinc gluconate is worth considering as a possible means of zinc supplementation in men. PMID:24619814

  2. First Evidence that Sika Deer (Cervus nippon) Velvet Antler Extract Suppresses Migration of Human Prostate Cancer Cells.

    PubMed

    Tang, YuJiao; Jeon, Byong-Tae; Wang, Yanmei; Choi, Eun-Ju; Kim, Yon-Suk; Hwang, Jin-Woo; Park, Pyo-Jam; Moon, Sang Ho; Kim, Eun-Kyung

    2015-01-01

    Deer velvet antler (DVA) is one of the most popular medicines in China. Numerous studies have demonstrated that velvet antler possess biological effects. However, data regarding its anti-migration activity on prostate cancer is scarce. In this study, we investigated the inhibitory effect of top DVA (T-DVA) on the expression of prostate-specific antigen (PSA) and migration-related genes in the human prostate cancer cell, LNCaP. The T-DVA down-regulated the expression of PSA. In addition, the Radius(TM) assay revealed that T-DVA inhibited the migration behavior of prostate cancer cells. Furthermore, the expression of matrix metalloproteinase (MMP)-9 and vascular endothelial growth factor (VEGF) was also decreased with T-DVA. On the contrary, T-DVA increased the tissue inhibition of metalloproteinase (TIMP)-1 and (TIMP)-2. Taken together, our findings indicate that the T-DVA possesses anti-migration activity on prostate cancer cells. This is the first study of DVA to report the anti-migration activity on prostate cancer. PMID:26761873

  3. First Evidence that Sika Deer (Cervus nippon) Velvet Antler Extract Suppresses Migration of Human Prostate Cancer Cells

    PubMed Central

    Tang, YuJiao; Jeon, Byong-Tae; Wang, Yanmei; Choi, Eun-Ju; Kim, Yon-Suk; Hwang, Jin-Woo; Park, Pyo-Jam; Moon, Sang Ho; Kim, Eun-Kyung

    2015-01-01

    Deer velvet antler (DVA) is one of the most popular medicines in China. Numerous studies have demonstrated that velvet antler possess biological effects. However, data regarding its anti-migration activity on prostate cancer is scarce. In this study, we investigated the inhibitory effect of top DVA (T-DVA) on the expression of prostate-specific antigen (PSA) and migration-related genes in the human prostate cancer cell, LNCaP. The T-DVA down-regulated the expression of PSA. In addition, the RadiusTM assay revealed that T-DVA inhibited the migration behavior of prostate cancer cells. Furthermore, the expression of matrix metalloproteinase (MMP)-9 and vascular endothelial growth factor (VEGF) was also decreased with T-DVA. On the contrary, T-DVA increased the tissue inhibition of metalloproteinase (TIMP)-1 and (TIMP)-2. Taken together, our findings indicate that the T-DVA possesses anti-migration activity on prostate cancer cells. This is the first study of DVA to report the anti-migration activity on prostate cancer. PMID:26761873

  4. Noninvasive surgery of prostate tissue by high-intensity focused ultrasound: an updated report

    NASA Astrophysics Data System (ADS)

    Sanghvi, Narendra T.; Syrus, J.; Foster, Richard S.; Bihrle, Richard; Casey, Richard W.; Uchida, Toyoak

    2000-05-01

    High Intensity Focused Ultrasound (HIFU) has been clinically used for the treatment of benign prostatic hyperplasia (BPH) and it is experimentally applied for the treatment of localized prostate caner (PC). Recent advances in the transducer material and technology have permitted to combine the ultrasound visualization capability and HIFU on the same ceramic crystal. Also, the transducer efficiency has increased to a level that a smaller size intracavity probe can be made to produce sufficient acoustic power required for the focused ultrasound surgery of the prostate. Using this technology, 4 MHz mechanically scanning transrectal ultrasound probes has been designed. The transrectal probes are used with Sonablate (SB-200, manufactured by Focus Surgery, Inc., Indianapolis, IN) device. The SB-200 produces both transverse and longitudinal images of the prostate. The transverse and longitudinal images are used for selection of tissue volume, treatment planning and monitoring of tissue during the HIFU treatment cycle. The paper reviews the present operation of the device and recent clinical protocol that has improved efficiency, efficacy and safety of the device. The two years follow-up clinical results from the multi-site US Pilot Study (USPS) and The Male Health Centre are compared with the Kitasato-study (Kitasato School of Medicine, Sagamihara, Japan).

  5. Expression profiling of prostate cancer tissue delineates genes associated with recurrence after prostatectomy

    PubMed Central

    Mortensen, Martin Mørck; Høyer, Søren; Lynnerup, Anne-Sophie; Ørntoft, Torben Falck; Sørensen, Karina Dalsgaard; Borre, Michael; Dyrskjøt, Lars

    2015-01-01

    Prostate cancer is a leading cause of cancer death amongst males. The main clinical dilemma in treating prostate cancer is the high number of indolent cases that confer a significant risk of overtreatment. In this study, we have performed gene expression profiling of tumor tissue specimens from 36 patients with prostate cancer to identify transcripts that delineate aggressive and indolent cancer. Key genes were validated using previously published data and by tissue microarray analysis. Two molecular subgroups were identified with a significant overrepresentation of tumors from patients with biochemical recurrence in one of the groups. We successfully validated key transcripts association with recurrence using two publically available datasets totaling 669 patients. Twelve genes were found to be independent predictors of recurrence in multivariate logistical regression analysis. SFRP4 gene expression was consistently up regulated in patients with recurrence in all three datasets. Using an independent cohort of 536 prostate cancer patients we showed SFRP4 expression to be an independent predictor of recurrence after prostatectomy (HR = 1.35; p = 0.009). We identified SFRP4 to be associated with disease recurrence. Prospective studies are needed in order to assess the clinical usefulness of the identified key markers in this study. PMID:26522007

  6. Targeting Prostate Cancer Cells In Vivo Using a Rapidly Internalizing Novel Human Single-Chain Antibody Fragment

    PubMed Central

    He, Jiang; Wang, Yong; Feng, Jinjin; Zhu, Xiaodong; Lan, Xiaoli; Iyer, Arun K.; Zhang, Niu; Seo, Youngho; VanBrocklin, Henry F.; Liu, Bin

    2010-01-01

    Human antibodies targeting prostate cancer cell surface epitopes may be useful for imaging and therapy. The objective of this study was to evaluate the tumor targeting of an internalizing human antibody fragment, a small-size platform, to provide high contrast in a mouse model of human prostate carcinoma. Methods A prostate tumor-targeting single-chain antibody fragment (scFv), UA20, along with a nonbinding control scFv, N3M2, were labeled with 99mTc and evaluated for binding and rapid internalization into human prostate tumor cells in vitro and tumor homing in vivo using xenograft models. For the in vitro studies, the labeled UA20 scFv was incubated at 37°C for 1 h with metastatic prostate cancer cells (DU145) to assess the total cellular uptake versus intracellular uptake. For the animal studies, labeled UA20 and N3M2 scFvs were administered to athymic mice implanted subcutaneously with DU145 cells. Mice were imaged with small-animal SPECT/CT with concomitant biodistribution at 1 and 3 h after injection. Results The UA20 scFv was labeled in 55%–65% yield and remained stable in phosphate buffer within 24 h. The labeled UA20 scFv was taken up specifically by prostate tumor cells. Internalization was rapid, because incubation at 37°C for less than 1 h resulted in 93% internalization of total cell-associated scFvs. In animal studies, SPECT/CT showed significant tumor uptake as early as 1 h after injection. At 3 h after injection, tumor uptake was 4.4 percentage injected dose per gram (%ID/g), significantly greater than all organs or tissues studied (liver, 2.7 %ID/g; other organs or tissues, <1 %ID/g), except the kidneys (81.4 %ID/g), giving tumor-to-blood and tumor-to-muscle ratios of 12:1 and 70:1, respectively. In contrast, the control antibody exhibited a tumor uptake of only 0.26 %ID/g, similar to that of muscle and fat. Tumor-specific targeting was evidenced by reduced tumor uptake of nearly 70% on administration of a 10-fold excess of unlabeled UA20 sc

  7. Serially heterotransplanted human prostate tumours as an experimental model

    PubMed Central

    Lopez-Barcons, Lluis-A

    2010-01-01

    Abstract Preclinical research on prostate cancer (PC) therapies uses several models to represent the human disease accurately. A common model uses patient prostate tumour biopsies to develop a cell line by serially passaging and subsequent implantation, in immunodeficient mice. An alternative model is direct implantation of patient prostate tumour biopsies into immunodeficient mice, followed by serial passage in vivo. The purpose of this review is to compile data from the more than 30 years of human PC serial heterotransplantation research. Serially heterotransplanted tumours are characterized by evaluating the histopathology of the resulting heterotransplants, including cellular differentiation, karyotype, marker expression, hormone sensitivity, cellular proliferation, metastatic potential and stromal and vascular components. These data are compared with the initial patient tumour specimen and, depending on available information, the patient’s clinical outcome was compared with the heterotransplanted tumour. The heterotansplant model is a more accurate preclinical model than older generation serially passaged or genetic models to investigate current and newly developed androgen-deprivation agents, antitumour compounds, anti-angiogenic drugs and positron emission tomography radiotracers, as well as new therapeutic regimens for the treatment of PC. PMID:19874422

  8. Quantifying Gleason scores with photoacoustic spectral analysis: feasibility study with human tissues

    PubMed Central

    Xu, Guan; Davis, Mandy C.; Siddiqui, Javed; Tomlins, Scott A.; Huang, Shengsong; Kunju, Lakshmi P.; Wei, John T.; Wang, Xueding

    2015-01-01

    Gleason score is a highly prognostic factor for prostate cancer describing the microscopic architecture of the tumor tissue. The standard procedure for evaluating Gleason scores, namely biopsy, is to remove prostate tissue for observation under microscope. Currently, biopsies are guided by transrectal ultrasound (TRUS). Due to the low sensitivity of TRUS to prostate cancer (PCa), non-guided and saturated biopsies are frequently employed, unavoidably causing pain, damage to the normal prostate tissues and other complications. More importantly, due to the limited number of biopsy cores, current procedure could either miss early stage small tumors or undersample aggressive cancers. Photoacoustic (PA) measurement has the unique capability of evaluating tissue microscopic architecture information at ultrasonic resolution. By frequency domain analysis of the broadband PA signal, namely PA spectral analysis (PASA), the microscopic architecture within the assessed tissue can be quantified. This study investigates the feasibility of evaluating Gleason scores by PASA. Simulations with the classic Gleason patterns and experiment measurements from human PCa tissues have demonstrated strong correlation between the PASA parameters and the Gleason scores. PMID:26713193

  9. Influence of trace elements in human tissue in low-energy photon brachytherapy dosimetry

    NASA Astrophysics Data System (ADS)

    White, Shane A.; Landry, Guillaume; van Gils, Francis; Verhaegen, Frank; Reniers, Brigitte

    2012-06-01

    The aim of this paper is to determine the dosimetric impact of trace elements in human tissues for low-energy photon sources used in brachytherapy. Monte Carlo dose calculations were used to investigate the dosimetric effect of trace elements present in normal or cancerous human tissues. The effect of individual traces (atomic number Z = 11-30) was studied in soft tissue irradiated by low-energy brachytherapy sources. Three other tissue types (prostate, adipose and mammary gland) were also simulated with varying trace concentrations to quantify the contribution of each trace to the dose distribution. The dose differences between cancerous and healthy prostate tissues were calculated in single- and multi-source geometries. The presence of traces in a tissue produces a difference in the dose distribution that is dependent on Z and the concentration of the trace. Low-Z traces (Na) have a negligible effect (<0.3%) in all tissues, while higher Z (K) had a larger effect (>3%). There is a potentially significant difference in the dose distribution between cancerous and healthy prostate tissues (4%) and even larger if compared to the trace-free composition (15%) in both single- and multi-sourced geometries. Trace elements have a non-negligible (up to 8% in prostate D90) effect on the dose in tissues irradiated with low-energy photon sources. This study underlines the need for further investigation into accurate determination of the trace composition of tissues associated with low-energy brachytherapy. Alternatively, trace elements could be incorporated as a source of uncertainty in dose calculations. This work was part of an invited presentation at the ‘International Workshop on Recent Advances in Monte Carlo Techniques for Radiation Therapy’, held in Montreal, June 8-10, 2011.

  10. The prostatic acid phosphatase (ACPP) gene is localized to human chromosome 3q21-q23

    SciTech Connect

    Li, S.S.L.; Sharief, F.S. )

    1993-09-01

    Human prostatic acid phosphatase (ACPP) has been used as a diagnostic marker for prostate cancer. It is synthesized under androgen regulation and secreted by the epithelial cells of the prostate gland. The authors have confirmed the previous assignment of the ACPP gene to chromosome 3 by probing a panel of 25 human-Chinese hamster somatic cell hybrids, and they have further localized the ACPP gene to chromosome 3q21-q23 by fluorescence in situ hybridization. 10 refs., 1 fig.

  11. Comprehensively Evaluating cis-Regulatory Variation in the Human Prostate Transcriptome by Using Gene-Level Allele-Specific Expression

    PubMed Central

    Larson, Nicholas B.; McDonnell, Shannon; French, Amy J.; Fogarty, Zach; Cheville, John; Middha, Sumit; Riska, Shaun; Baheti, Saurabh; Nair, Asha A.; Wang, Liang; Schaid, Daniel J.; Thibodeau, Stephen N.

    2015-01-01

    The identification of cis-acting regulatory variation in primary tissues has the potential to elucidate the genetic basis of complex traits and further our understanding of transcriptomic diversity across cell types. Expression quantitative trait locus (eQTL) association analysis using RNA sequencing (RNA-seq) data can improve upon the detection of cis-acting regulatory variation by leveraging allele-specific expression (ASE) patterns in association analysis. Here, we present a comprehensive evaluation of cis-acting eQTLs by analyzing RNA-seq gene-expression data and genome-wide high-density genotypes from 471 samples of normal primary prostate tissue. Using statistical models that integrate ASE information, we identified extensive cis-eQTLs across the prostate transcriptome and found that approximately 70% of expressed genes corresponded to a significant eQTL at a gene-level false-discovery rate of 0.05. Overall, cis-eQTLs were heavily concentrated near the transcription start and stop sites of affected genes, and effects were negatively correlated with distance. We identified multiple instances of cis-acting co-regulation by using phased genotype data and discovered 233 SNPs as the most strongly associated eQTLs for more than one gene. We also noted significant enrichment (25/50, p = 2E−5) of previously reported prostate cancer risk SNPs in prostate eQTLs. Our results illustrate the benefit of assessing ASE data in cis-eQTL analyses by showing better reproducibility of prior eQTL findings than of eQTL mapping based on total expression alone. Altogether, our analysis provides extensive functional context of thousands of SNPs in prostate tissue, and these results will be of critical value in guiding studies examining disease of the human prostate. PMID:25983244

  12. Tissue metabolite profiling identifies differentiating and prognostic biomarkers for prostate carcinoma.

    PubMed

    Jung, Klaus; Reszka, Regina; Kamlage, Beate; Bethan, Bianca; Stephan, Carsten; Lein, Michael; Kristiansen, Glen

    2013-12-15

    Metabolomic research offers a deeper insight into biochemical changes in cancer metabolism and is a promising tool for identifying novel biomarkers. We aimed to evaluate the diagnostic and prognostic potential of metabolites in prostate cancer (PCa) tissue after radical prostatectomy. In matched malignant and nonmalignant prostatectomy samples from 95 PCa patients, aminoadipic acid, cerebronic acid, gluconic acid, glycerophosphoethanolamine, 2-hydroxybehenic acid, isopentenyl pyrophosphate, maltotriose, 7-methylguanine and tricosanoic acid were determined within a global metabolite profiling study using gas chromatography/liquid chromatography-mass spectrometry. The data were related to clinicopathological variables like prostate volume, tumor stage, Gleason score, preoperative prostate-specific antigen and disease recurrence in the follow-up. All nine metabolites showed higher concentrations in malignant than in nonmalignant samples except for gluconic acid and maltotriose, which had lower levels in tumors. Receiver -operating characteristics analysis demonstrated a significant discrimination for all metabolites between malignant and nonmalignant tissue with a maximal area under the curve of 0.86 for tricosanoic acid, whereas no correlation was observed between the metabolite levels and the Gleason score or tumor stage except for gluconic acid. Univariate Cox regression and Kaplan-Meier analyses showed that levels of aminoadipic acid, gluconic acid and maltotriose were associated with the biochemical tumor recurrence (prostate-specific antigen > 0.2 ng/mL). In multivariate Cox regression analyses, aminoadipic acid together with tumor stage and Gleason score remained in a model as independent marker for prediction of biochemical recurrence. This study proved that metabolites in PCa tissue can be used, in combination with traditional clinicopathological factors, as promising diagnostic and prognostic tools. PMID:23737455

  13. Personalized Medicine Approaches in Prostate Cancer Employing Patient Derived 3D Organoids and Humanized Mice

    PubMed Central

    Bartucci, Monica; Ferrari, Anna C.; Kim, Isaac Yi; Ploss, Alexander; Yarmush, Martin; Sabaawy, Hatem E.

    2016-01-01

    Prostate cancer (PCa) is the most common malignancy and the second most common cause of cancer death in Western men. Despite its prevalence, PCa has proven very difficult to propagate in vitro. PCa represents a complex organ-like multicellular structure maintained by the dynamic interaction of tumoral cells with parenchymal stroma, endothelial and immune cells, and components of the extracellular matrix (ECM). The lack of PCa models that recapitulate this intricate system has hampered progress toward understanding disease progression and lackluster therapeutic responses. Tissue slices, monolayer cultures and genetically engineered mouse models (GEMM) fail to mimic the complexities of the PCa microenvironment or reproduce the diverse mechanisms of therapy resistance. Moreover, patient derived xenografts (PDXs) are expensive, time consuming, difficult to establish for prostate cancer, lack immune cell-tumor regulation, and often tumors undergo selective engraftments. Here, we describe an interdisciplinary approach using primary PCa and tumor initiating cells (TICs), three-dimensional (3D) tissue engineering, genetic and morphometric profiling, and humanized mice to generate patient-derived organoids for examining personalized therapeutic responses in vitro and in mice co-engrafted with a human immune system (HIS), employing adaptive T-cell- and chimeric antigen receptor- (CAR) immunotherapy. The development of patient specific therapies targeting the vulnerabilities of cancer, when combined with antiproliferative and immunotherapy approaches could help to achieve the full transformative power of cancer precision medicine. PMID:27446916

  14. Personalized Medicine Approaches in Prostate Cancer Employing Patient Derived 3D Organoids and Humanized Mice.

    PubMed

    Bartucci, Monica; Ferrari, Anna C; Kim, Isaac Yi; Ploss, Alexander; Yarmush, Martin; Sabaawy, Hatem E

    2016-01-01

    Prostate cancer (PCa) is the most common malignancy and the second most common cause of cancer death in Western men. Despite its prevalence, PCa has proven very difficult to propagate in vitro. PCa represents a complex organ-like multicellular structure maintained by the dynamic interaction of tumoral cells with parenchymal stroma, endothelial and immune cells, and components of the extracellular matrix (ECM). The lack of PCa models that recapitulate this intricate system has hampered progress toward understanding disease progression and lackluster therapeutic responses. Tissue slices, monolayer cultures and genetically engineered mouse models (GEMM) fail to mimic the complexities of the PCa microenvironment or reproduce the diverse mechanisms of therapy resistance. Moreover, patient derived xenografts (PDXs) are expensive, time consuming, difficult to establish for prostate cancer, lack immune cell-tumor regulation, and often tumors undergo selective engraftments. Here, we describe an interdisciplinary approach using primary PCa and tumor initiating cells (TICs), three-dimensional (3D) tissue engineering, genetic and morphometric profiling, and humanized mice to generate patient-derived organoids for examining personalized therapeutic responses in vitro and in mice co-engrafted with a human immune system (HIS), employing adaptive T-cell- and chimeric antigen receptor- (CAR) immunotherapy. The development of patient specific therapies targeting the vulnerabilities of cancer, when combined with antiproliferative and immunotherapy approaches could help to achieve the full transformative power of cancer precision medicine. PMID:27446916

  15. Semiconductor diode lasers in the canine prostate: laser-tissue interaction

    NASA Astrophysics Data System (ADS)

    Perlmutter, Aaron P.; Muschter, Rolf; Anson, K.; Vargas Stuve, Juan C.; Razvi, Hassan A.

    1995-05-01

    We have studied 810 nm (Diomed, Cambridge England), 950 nm (Diolase, Endocare, Irvine CA), 980 nm (Dornier, Munich Germany), and 1000 nm (Cynosure, Bedford MA) using free beam right angle firing fibers in the canine prostate. Because some lasers only accept specific fibers, and each wavelength has its own divergence properties, standardization of fiber and power density was not possible. Power was studied in increments to the maximum output for each laser. Laser-tissue interaction was studied by video endoscopy during lasing, pathology, and real time interstitial thermometry at 3, 7, and 11 mm deep from the prostatic urethra. We found that using the Dornier Sidefocus fiber at 25 W, 810 nm created a small vaporized cavity surrounded by a zone of necrosis, whereas 980 nm at 25 W caused more necrosis but little vaporization. Irradiation with 950 nm and the Prolase II fiber created deeper lesions at 40 W than 25 W. At 1000 nm with the angle delivery device produced by Cynosure, popcorn with the formation of carbonized cavities occurred at both 25 and 40 W. The lesions were only slightly deeper at the higher wattage. We conclude that the high power diode lasers are capable of producing volume lesions in the prostate. The different wavelengths, fibers and power densities lead to different laser-tissue interaction, and thus each wavelength needs to be considered separately.

  16. Automatic classification of prostate stromal tissue in histological images using Haralick descriptors and Local Binary Patterns

    NASA Astrophysics Data System (ADS)

    Oliveira, D. L. L.; Nascimento, M. Z.; Neves, L. A.; Batista, V. R.; Godoy, M. F.; Jacomini, R. S.; Duarte, Y. A. S.; Arruda, P. F. F.; Neto, D. S.

    2014-03-01

    In this paper we presente a classification system that uses a combination of texture features from stromal regions: Haralick features and Local Binary Patterns (LBP) in wavelet domain. The system has five steps for classification of the tissues. First, the stromal regions were detected and extracted using segmentation techniques based on thresholding and RGB colour space. Second, the Wavelet decomposition was applied in the extracted regions to obtain the Wavelet coefficients. Third, the Haralick and LBP features were extracted from the coefficients. Fourth, relevant features were selected using the ANOVA statistical method. The classication (fifth step) was performed with Radial Basis Function (RBF) networks. The system was tested in 105 prostate images, which were divided into three groups of 35 images: normal, hyperplastic and cancerous. The system performance was evaluated using the area under the ROC curve and resulted in 0.98 for normal versus cancer, 0.95 for hyperplasia versus cancer and 0.96 for normal versus hyperplasia. Our results suggest that texture features can be used as discriminators for stromal tissues prostate images. Furthermore, the system was effective to classify prostate images, specially the hyperplastic class which is the most difficult type in diagnosis and prognosis.

  17. Worldwide Prevalence of Human Papillomavirus and Relative Risk of Prostate Cancer: A Meta-analysis

    PubMed Central

    Yang, Lin; Xie, Shuanghua; Feng, Xiaoshuang; Chen, Yuheng; Zheng, Tongzhang; Dai, Min; Ke Zhou, Cindy; Hu, Zhibin; Li, Ni; Hang, Dong

    2015-01-01

    Despite the increasing number of studies conducted recently to evaluate the association between HPV infections and the risk of prostate cancer, the results remain inconclusive. Furthermore, the prevalence and distribution of overall and individual HPV types worldwide in prostate cancer has not been reported until now. Therefore, we estimated the prevalence of HPV in prostate cancer by pooling data of 46 studies with 4919 prostate cancer cases, taking into account the heterogeneity of major related parameters, including study region, specimen type, HPV DNA source, detection method, publication calendar period and Gleason score. Moreover, we tested the association of HPV infections with prostate cancer risks by a meta-analysis of 26 tissue-based case-control studies. We found that the prevalence of HPV infection was 18.93% (95% CI = 17.84–20.05%) in prostate cancer cases, and most of which were high-risk HPV types (17.73%, 95% CI = 16.52–18.99%). The prevalence varied by region, PCR primers used, publication calendar period and Gleason score. Our study also showed a significantly increased risk of prostate cancer with the positivity of overall HPV detected in prostate tissues (OR = 1.79, 95% CI = 1.29–2.49) and revealed the geographic variation of association strength (P < 0.001). In conclusion, HPV infections may contribute to the risk of prostate cancer. PMID:26441160

  18. Daytime Blue Light Enhances the Nighttime Circadian Melatonin Inhibition of Human Prostate Cancer Growth

    PubMed Central

    Dauchy, Robert T; Hoffman, Aaron E; Wren-Dail, Melissa A; Hanifin, John P; Warfield, Benjamin; Brainard, George C; Xiang, Shulin; Yuan, Lin; Hill, Steven M; Belancio, Victoria P; Dauchy, Erin M; Smith, Kara; Blask, David E

    2015-01-01

    Light controls pineal melatonin production and temporally coordinates circadian rhythms of metabolism and physiology in normal and neoplastic tissues. We previously showed that peak circulating nocturnal melatonin levels were 7-fold higher after daytime spectral transmittance of white light through blue-tinted (compared with clear) rodent cages. Here, we tested the hypothesis that daytime blue-light amplification of nocturnal melatonin enhances the inhibition of metabolism, signaling activity, and growth of prostate cancer xenografts. Compared with male nude rats housed in clear cages under a 12:12-h light:dark cycle, rats in blue-tinted cages (with increased transmittance of 462–484 nm and decreased red light greater than 640 nm) evinced over 6-fold higher peak plasma melatonin levels at middark phase (time, 2400), whereas midlight-phase levels (1200) were low (less than 3 pg/mL) in both groups. Circadian rhythms of arterial plasma levels of linoleic acid, glucose, lactic acid, pO2, pCO2, insulin, leptin, and corticosterone were disrupted in rats in blue cages as compared with the corresponding entrained rhythms in clear-caged rats. After implantation with tissue-isolated PC3 human prostate cancer xenografts, tumor latency-to-onset of growth and growth rates were markedly delayed, and tumor cAMP levels, uptake–metabolism of linoleic acid, aerobic glycolysis (Warburg effect), and growth signaling activities were reduced in rats in blue compared with clear cages. These data show that the amplification of nighttime melatonin levels by exposing nude rats to blue light during the daytime significantly reduces human prostate cancer metabolic, signaling, and proliferative activities. PMID:26678364

  19. 1H HRMAS NMR Derived Bio-markers Related to Tumor Grade, Tumor Cell Fraction, and Cell Proliferation in Prostate Tissue Samples

    PubMed Central

    Stenman, Katarina; Stattin, Pär; Stenlund, Hans; Riklund, Katrine; Gröbner, Gerhard; Bergh, Anders

    2011-01-01

    A high-resolution magic angle spinning NMR spectroscopic approach is presented for evaluating the occurrence, amount and aggressiveness of cancer in human prostate tissue samples. Using this technique, key metabolites in malignant and non-malignant samples (n = 149) were identified, and patterns of their relative abundance were analyzed by multivariate statistical methods. Ratios of various metabolites – including (glycerophophorylcholine + phosphorylcholine)/creatine, myo-inositol/scyllo-inositol, scyllo-inositol/creatine, choline/creatine, and citrate/creatine – correlated with: i) for non-malignant tissue samples, the distance to the nearest tumor and its Gleason score and; ii) the fraction of tumor cells present in the sample; and iii) tumor cell proliferation (Ki67 labelling index). This NMR-based approach allows the extraction of information that could be useful for developing novel diagnostic methods for prostate cancer. PMID:21499438

  20. Expression and Localization of Aquaporins in Benign Prostate Hyperplasia and Prostate Cancer

    PubMed Central

    Hwang, Insang; Hwang, Eu-Chang; Song, Seung Hee; Lee, Hyun-Suk; Kim, Sun-Ouck; Kang, Taek-Won; Kwon, Dongdeuk; Park, Kwangsung

    2012-01-01

    The aquaporin (AQP) families of water channels are intrinsic membrane proteins that facilitate selective water and small solute movement across the plasma membrane. The purposes of this study were to determine the expression and localization of AQPs in benign prostatic hyperplasia and prostate cancer. Prostatic tissue was collected from patients with benign prostatic hyperplasia or prostate cancer by transurethral resection of the prostate. The expression and cellular localization of the AQPs were determined in the human prostate by Western blot and immunohistochemistry. AQP1, 3, and 9 were expressed in the human prostate. Western blot analysis revealed bands at 28-36 kDa for the AQP1, 3, and 9 proteins. Of these proteins, AQP3 and 9 were expressed in the epithelium. Immunolabeling showed that AQP1 was mainly expressed in the capillaries and venules of the prostate, AQP9 was expressed in the cytoplasm of the epithelium, and AQP3 was mainly associated with the plasma membrane of the prostatic epithelium. Only AQP3 expression was localized in the cell membrane, and expressed AQP3 was translocated to the cytoplasm in prostate cancer. The epithelium in the human prostate expresses AQP3 and 9 proteins, and the capillaries and venules of the prostate express AQP1. Characterizing or modifying the expression of AQP3 may lead to an understanding of the role of the AQPs in human prostatic disease. PMID:23323224

  1. Prostate cancer diagnosis by optical coherence tomography: First results from a needle based optical platform for tissue sampling.

    PubMed

    Muller, Berrend G; de Bruin, Daniel M; Brandt, Martin J; van den Bos, Willemien; van Huystee, Suzanne; Faber, D J; Savci, Dilaria; Zondervan, Patricia J; de Reijke, Theo M; Laguna-Pes, M Pilar; van Leeuwen, Ton G; de la Rosette, Jean J M C H

    2016-05-01

    The diagnostic accuracy of Optical Coherence Tomography (OCT) based optical attenuation coefficient analysis is assessed for the detection of prostate cancer. Needle-based OCT-measurements were performed on the prostate specimens. Attenuation coefficients were determined by an earlier described in-house developed software package. The mean attenuation coefficients (benign OCT data; malignant OCT data; p-value Mann-Whitney U test) were: (3.56 mm(-1) ; 3.85 mm(-1) ; p < 0.0001) for all patients combined. The area under the ROC curve was 0.64. In order to circumvent the effect of histopathology mismatching, we performed a sub-analysis on only OCT data in which tumor was visible in two subsequent histopathological prostate slices. This analysis could be performed in 3 patients. The mean attenuation coefficients (benign OCT data; malignant OCT data; p-value Mann-Whitney U test) were: (3.23 mm(-1) ; 4.11 mm(-1) ; p < 0.0001) for all patients grouped together. The area under the ROC curve was 0.89. Functional OCT of the prostate has shown to differentiate between cancer and healthy prostate tissue. The optical attenuation coefficient in malignant tissue was significantly higher in malignant tissue compared to benign prostate tissue. Further studies are required to validate these initial results in a larger group of patients with a more tailored histopathology matching protocol. PMID:26856796

  2. α-Klotho Expression in Human Tissues

    PubMed Central

    Lim, Kenneth; Groen, Arnoud; Molostvov, Guerman; Lu, Tzongshi; Lilley, Kathryn S.; Snead, David; James, Sean; Wilkinson, Ian B.; Ting, Stephen

    2015-01-01

    Context: α-Klotho has emerged as a powerful regulator of the aging process. To date, the expression profile of α-Klotho in human tissues is unknown, and its existence in some human tissue types is subject to much controversy. Objective: This is the first study to characterize systemwide tissue expression of transmembrane α-Klotho in humans. We have employed next-generation targeted proteomic analysis using parallel reaction monitoring in parallel with conventional antibody-based methods to determine the expression and spatial distribution of human α-Klotho expression in health. Results: The distribution of α-Klotho in human tissues from various organ systems, including arterial, epithelial, endocrine, reproductive, and neuronal tissues, was first identified by immunohistochemistry. Kidney tissues showed strong α-Klotho expression, whereas liver did not reveal a detectable signal. These results were next confirmed by Western blotting of both whole tissues and primary cells. To validate our antibody-based results, α-Klotho-expressing tissues were subjected to parallel reaction monitoring mass spectrometry (data deposited at ProteomeXchange, PXD002775) identifying peptides specific for the full-length, transmembrane α-Klotho isoform. Conclusions: The data presented confirm α-Klotho expression in the kidney tubule and in the artery and provide evidence of α-Klotho expression across organ systems and cell types that has not previously been described in humans. PMID:26280509

  3. Alteration of proliferation and apoptotic markers in normal and premalignant tissue associated with prostate cancer

    PubMed Central

    Ananthanarayanan, Vijayalakshmi; Deaton, Ryan J; Yang, Ximing J; Pins, Michael R; Gann, Peter H

    2006-01-01

    Background Molecular markers identifying alterations in proliferation and apoptotic pathways could be particularly important in characterizing high-risk normal or pre-neoplastic tissue. We evaluated the following markers: Ki67, Minichromosome Maintenance Protein-2 (Mcm-2), activated caspase-3 (a-casp3) and Bcl-2 to determine if they showed differential expression across progressive degrees of intraepithelial neoplasia and cancer in the prostate. To identify field effects, we also evaluated whether high-risk expression patterns in normal tissue were more common in prostates containing cancer compared to those without cancer (supernormal), and in histologically normal glands adjacent to a cancer focus as opposed to equivalent glands that were more distant. Methods The aforementioned markers were studied in 13 radical prostatectomy (RP) and 6 cystoprostatectomy (CP) specimens. Tissue compartments representing normal, low grade prostatic intraepithelial neoplasia (LGPIN), high grade prostatic intraepithelial neoplasia (HGPIN), as well as different grades of cancer were mapped on H&E slides and adjacent sections were analyzed using immunohistochemistry. Normal glands within 1 mm distance of a tumor focus and glands beyond 5 mm were considered "near" and "far", respectively. Randomly selected nuclei and 40 × fields were scored by a single observer; basal and luminal epithelial layers were scored separately. Results Both Ki-67 and Mcm-2 showed an upward trend from normal tissue through HGPIN and cancer with a shift in proliferation from basal to luminal compartment. Activated caspase-3 showed a significant decrease in HGPIN and cancer compartments. Supernormal glands had significantly lower proliferation indices and higher a-casp3 expression compared to normal glands. "Near" normal glands had higher Mcm-2 indices compared to "far" glands; however, they also had higher a-casp3 expression. Bcl-2, which varied minimally in normal tissue, did not show any trend across

  4. In vivo cryoablation of prostate tissue with temperature monitoring by optoacoustic imaging

    NASA Astrophysics Data System (ADS)

    Petrova, Elena V.; Motamedi, Massoud; Oraevsky, Alexander A.; Ermilov, Sergey A.

    2016-03-01

    Cryoablation of prostate cancer is an FDA approved clinical procedure, which involves repetitive rapid cooling of a lesion to lethal temperatures of -40°C and below. The major drawback of the technique is the insufficient control over the fast thermal processes that may result in severe complications (impotence, incontinence, perforation of the rectal wall) and morbidity. The developed optoacoustic imaging technique provides non-invasive real-time temperature mapping of tissue adjacent to prostate and enables more efficient control over the procedure, which is necessary to reduce side effects and accelerate the physician's learning curve. In these studies we successfully demonstrated real-time transrectal optoacoustic imaging during prostate cryoablation in live canine model focused on optoacoustic thermography of the rectal wall within the depth of 1cm. Our method utilized previously discovered universal thermal dependence of the normalized optoacoustic response of blood. Nanosecond-pulse radiation of Ti-Sapphire laser tuned to the isosbestic point of hemoglobin (802+/-3 nm) was delivered via fiberoptic illuminators assembled on both sides of the linear array of the 128-channel transrectal ultrasound probe. Temperature readouts at discrete locations inside and nearby prostate were also performed using standard transperineal needle sensors. The effect of homeostasis on optoacoustic imaging in live tissue was examined during cooling and shown to be significant only within the range of +/-1.5°C in respect to the body temperature. Accuracy of in vivo optoacoustic temperature measurements was determined as +/-2°C for the range of temperature from +35 to -15°C, which is more than sufficient for tracking the essential isotherms in the course of clinical procedures.

  5. Quantification of phase I / II metabolizing enzyme gene expression and polycyclic aromatic hydrocarbon-DNA adduct levels in human prostate

    PubMed Central

    John, Kaarthik; Ragavan, Narasimhan; Pratt, M. Margaret; Singh, Paras B.; Al-Buheissi, Salah; Matanhelia, Shyam S.; Phillips, David H.; Poirier, Miriam C.; Martin, Francis L.

    2008-01-01

    BACKGROUND Studies of migrant populations suggest that dietary and/or environmental factors play a crucial role in the aetiology of prostatic adenocarcinoma (CaP). The human prostate consists of the peripheral zone (PZ), transition zone (TZ) and central zone (CZ); CaP occurs most often in the PZ. METHODS To investigate the notion that an underlying differential expression of phase I/II genes, and/or the presence of polycyclic aromatic hydrocarbon (PAH)-DNA adducts might explain the elevated PZ susceptibility, we examined prostate tissues (matched tissue sets consisting of PZ and TZ) from men undergoing radical retropubic prostatectomy for CaP (n=26) or cystoprostatectomy (n=1). Quantitative gene expression analysis was employed for cytochrome P450 (CYP) isoforms CYP1A1, CYP1B1 and CYP1A2, as well as N-acetyltransferase 1 and 2 (NAT1 and NAT2) and catechol-O-methyl transferase (COMT). RESULTS CYP1B1, NAT1 and COMT were expressed in all tissue sets; levels of CYP1B1 and NAT1 were consistently higher in the PZ compared to TZ. Immunohistochemistry confirmed the presence of CYP1B1 (nuclear-associated and primarily in basal epithelial cells) and NAT1. Tissue sections from 23 of these aforementioned 27 matched tissue sets were analyzed for PAH-DNA adduct levels using antiserum elicited against DNA modified with r7, t8-dihydroxy-t-9,10-oxy-7,8,9,10-tetrahydro-benzo[a]pyrene (BPDE). PAH-DNA adduct levels were highest in glandular epithelial cells, but a comparison of PZ and TZ showed no significant differences. CONCLUSION Although expression of activating and/or detoxifying enzymes may be higher in the PZ, PAH-DNA adduct levels appear to be similar in both zones. Therefore, factors other than PAH-DNA adducts may be responsible for promotion of tumour formation in the human prostate. PMID:19143007

  6. Dosimetric Coverage of the Prostate, Normal Tissue Sparing, and Acute Toxicity with High-Dose-Rate Brachytherapy for Large Prostate Volumes

    PubMed Central

    Yang, George; Strom, Tobin J.; Wilder, Richard B.; Shrinath, Kushagra; Mellon, Eric A.; Fernandez, Daniel C.; Biagioli, Matthew C.

    2015-01-01

    ABSTRACT Purpose To evaluate dosimetric coverage of the prostate, normal tissue sparing, and acute toxicity with HDR brachytherapy for large prostate volumes. Materials and Methods One hundred and two prostate cancer patients with prostate volumes >50 mL (range: 5-29 mL) were treated with high-dose-rate (HDR) brachytherapy ± intensity modulated radiation therapy (IMRT) to 4,500 cGy in 25 daily fractions between 2009 and 2013. HDR brachytherapy monotherapy doses consisted of two 1,350-1,400 cGy fractions separated by 2-3 weeks, and HDR brachytherapy boost doses consisted of two 950-1,150 cGy fractions separated by 4 weeks. Twelve of 32 (38%) unfavorable intermediate risk, high risk, and very high risk patients received androgen deprivation therapy. Acute toxicity was graded according to the Common Terminology Criteria for Adverse Events (CTCAE) version 4. Results Median follow-up was 14 months. Dosimetric goals were achieved in over 90% of cases. Three of 102 (3%) patients developed Grade 2 acute proctitis. No variables were significantly associated with Grade 2 acute proctitis. Seventeen of 102 (17%) patients developed Grade 2 acute urinary retention. American Urological Association (AUA) symptom score was the only variable significantly associated with Grade 2 acute urinary retention (p=0.04). There was no ≥ Grade 3 acute toxicity. Conclusions Dosimetric coverage of the prostate and normal tissue sparing were adequate in patients with prostate volumes >50 mL. Higher pre-treatment AUA symptom scores increased the relative risk of Grade 2 acute urinary retention. However, the overall incidence of acute toxicity was acceptable in patients with large prostate volumes. PMID:26200536

  7. In vivo determination of the absorption and scattering spectra of the human prostate during photodynamic therapy

    PubMed Central

    Finlay, Jarod C.; Zhu, Timothy C; Dimofte, Andreea; Stripp, Diana; Malkowicz, S. Bruce; Whittington, Richard; Miles, Jeremy; Glatstein, Eli; Hahn, Stephen M.

    2015-01-01

    A continuing challenge in photodynamic therapy is the accurate in vivo determination of the optical properties of the tissue being treated. We have developed a method for characterizing the absorption and scattering spectra of prostate tissue undergoing PDT treatment. Our current prostate treatment protocol involves interstitial illumination of the organ via cylindrical diffusing optical fibers (CDFs) inserted into the prostate through clear catheters. We employ one of these catheters to insert an isotropic white light point source into the prostate. An isotropic detection fiber connected to a spectrograph is inserted into a second catheter a known distance away. The detector is moved along the catheter by a computer-controlled step motor, acquiring diffuse light spectra at 2 mm intervals along its path. We model the fluence rate as a function of wavelength and distance along the detector’s path using an infinite medium diffusion theory model whose free parameters are the absorption coefficient µa at each wavelength and two variables A and b which characterize the reduced scattering spectrum of the form µ’s = Aλ−b. We analyze our spectroscopic data using a nonlinear fitting algorithm to determine A, b, and µa at each wavelength independently; no prior knowledge of the absorption spectrum or of the sample’s constituent absorbers is required. We have tested this method in tissue simulating phantoms composed of intralipid and the photosensitizer motexafin lutetium (MLu). The MLu absorption spectrum recovered from the phantoms agrees with that measured in clear solution, and µa at the MLu absorption peak varies linearly with concentration. The µ’s spectrum reported by the fit is in agreement with the known scattering coefficient of intralipid. We have applied this algorithm to spectroscopic data from human patients sensitized with MLu (2 mg kg−1) acquired before and after PDT. Before PDT, the absorption spectra we measure include the characteristic

  8. Analysis of the Genetic Phylogeny of Multifocal Prostate Cancer Identifies Multiple Independent Clonal Expansions in Neoplastic and Morphologically Normal Prostate Tissue

    PubMed Central

    Gundem, Gunes; Alexandrov, Ludmil B; Kremeyer, Barbara; Butler, Adam; Lynch, Andrew G; Camacho, Niedzica; Massie, Charlie E; Kay, Jonathan; Luxton, Hayley J; Edwards, Sandra; Kote-Jarai, ZSofia; Dennis, Nening; Merson, Sue; Leongamornlert, Daniel; Zamora, Jorge; Corbishley, Cathy; Thomas, Sarah; Nik-Zainal, Serena; O’Meara, Sarah; Matthews, Lucy; Clark, Jeremy; Hurst, Rachel; Mithen, Richard; Bristow, Robert G; Boutros, Paul C; Fraser, Michael; Cooke, Susanna; Raine, Keiran; Jones, David; Menzies, Andrew; Stebbings, Lucy; Hinton, Jon; Teague, Jon; McLaren, Stuart; Mudie, Laura; Hardy, Claire; Anderson, Elizabeth; Joseph, Olivia; Goody, Victoria; Robinson, Ben; Maddison, Mark; Gamble, Stephen; Greenman, Christopher; Berney, Dan; Hazell, Steven; Livni, Naomi; Fisher, Cyril; Ogden, Christopher; Kumar, Pardeep; Thompson, Alan; Woodhouse, Christopher; Nicol, David; Mayer, Erik; Dudderidge, Tim; Shah, Nimish C; Gnanapragasam, Vincent; Voet, Thierry; Campbell, Peter; Futreal, Andrew; Easton, Douglas; Stratton, Michael R

    2015-01-01

    Whole genome DNA sequencing was used to decrypt the phylogeny of multiple samples from distinct areas of cancer and morphologically normal tissue taken from the prostates of three men. Mutations were present at high levels in morphologically normal tissue distant from the cancer reflecting clonal expansions, and the underlying mutational processes at work in morphologically normal tissue were also at work in cancer. Our observations demonstrate the existence of on-going abnormal mutational processes, consistent with field-effects, underlying carcinogenesis. This mechanism gives rise to extensive branching evolution and cancer clone mixing as exemplified by the coexistence of multiple cancer lineages harboring distinct ERG fusions within a single cancer nodule. Subsets of mutations were shared either by morphologically normal and malignant tissue or between different ERG-lineages, indicating earlier or separate clonal cell expansions. Our observations inform on the origin of multifocal disease and have implications for prostate cancer therapy in individual cases. PMID:25730763

  9. Prostate cancer detection using combined auto-fluorescence and light reflectance spectroscopy: ex vivo study of human prostates

    PubMed Central

    Sharma, Vikrant; Olweny, Ephrem O.; Kapur, Payal; Cadeddu, Jeffrey A.; Roehrborn, Claus G.; Liu, Hanli

    2014-01-01

    This study was conducted to evaluate the capability of detecting prostate cancer (PCa) using auto-fluorescence lifetime spectroscopy (AFLS) and light reflectance spectroscopy (LRS). AFLS used excitation at 447 nm with four emission wavelengths (532, 562, 632, and 684 nm), where their lifetimes and weights were analyzed using a double exponent model. LRS was measured between 500 and 840 nm and analyzed by a quantitative model to determine hemoglobin concentrations and light scattering. Both AFLS and LRS were taken on n = 724 distinct locations from both prostate capsular (nc = 185) and parenchymal (np = 539) tissues, including PCa tissue, benign peripheral zone tissue and benign prostatic hyperplasia (BPH), of fresh ex vivo radical prostatectomy specimens from 37 patients with high volume, intermediate-to-high-grade PCa (Gleason score, GS ≥7). AFLS and LRS parameters from parenchymal tissues were analyzed for statistical testing and classification. A feature selection algorithm based on multinomial logistic regression was implemented to identify critical parameters in order to classify high-grade PCa tissue. The regression model was in turn used to classify PCa tissue at the individual aggressive level of GS = 7,8,9. Receiver operating characteristic curves were generated and used to determine classification accuracy for each tissue type. We show that our dual-modal technique resulted in accuracies of 87.9%, 90.1%, and 85.1% for PCa classification at GS = 7, 8, 9 within parenchymal tissues, and up to 91.1%, 91.9%, and 94.3% if capsular tissues were included for detection. Possible biochemical and physiological mechanisms causing signal differences in AFLS and LRS between PCa and benign tissues were also discussed. PMID:24877012

  10. Preliminary results on diode-laser assisted vaporization of prostate tissue

    NASA Astrophysics Data System (ADS)

    Sroka, Ronald; Seitz, Michael; Reich, Oliver; Bachmann, Alexander; Steinbrecher, Verena; Ackermann, Alexander; Stief, Christian

    2007-07-01

    Introduction and objectives: The aim was to identify the capability and the laser parameter of under water tissue vaporisation by means of a diode laser (1470 nm). Afterwards the feasibility and postoperative clinical outcome of vaporization of the prostate was investigated. Method: After acquiring suitable laser parameters in in-vitro experiments using a perfused tissue model patients (n=10) suffering from bladder outlet obstruction due to benign prostatic hyperplasia (BPH) were treated by diode laser. Their clinical outcome, in terms of acceptance and post-operatively voiding were evaluated. The diode laser emitted light of the wavelength of 1470 nm at 50 W (Biolitec GmbH) and delivered to the tissue by means of a side-fire fibre introduced through a 24F continuous-flow cystoscope. Normal saline was used for irrigation with an additive of 1% ethanol. The prostatic lobes (volume range 35-80ml) were vaporized within the prostatic capsular using sweeping and push and pull technique. The mean time of laser application was 2400 sec (1220-4000 sec) resulting in applied energies of 121 kJ in the mean (range: 61-200kJ). Results: During laser treatment none of the 10 patients showed any significant blood loss or any fluid absorption (no ethanol uptake). Foley catheters were removed between 18 and 168 hours postoperatively (mean: 49.8h+/-46h). After removal of the catheter the mean peak urine flow rate increased from 8.9ml/s +/- 2.9ml/s pre-operatively in comparison to 15.7ml/s +/- 5 ml/s (p=0.049) post-operatively. 8/10 patients were satisfied with their voiding outcome. None of the patients showed appearance of urgency, dysuria, hematuria, or incontinence but two patients required re-catheterization. After a follow-up of 1month, 8/10 patients showed evidence of good results and are satisfied with the outcome. Two patients required consecutive TUR-P. After a follow-up of 6-month the 8 patients are still satisfied. Conclusions: This very early and limited experience using

  11. Differential vitamin D 24-hydroxylase/CYP24A1 gene promoter methylation in endothelium from benign and malignant human prostate

    PubMed Central

    Karpf, Adam R; Omilian, Angela R; Bshara, Wiam; Tian, Lili; Tangrea, Michael A; Morrison, Carl D; Johnson, Candace S

    2011-01-01

    Epigenetic alterations occur in tumor-associated vessels in the tumor microenvironment. Methylation of the CYP24A1 gene promoter differs in endothelial cells isolated from tumors and non-tumor microenvironments in mice. The epigenetic makeup of endothelial cells of human tumor-associated vasculature is unknown due to difficulty of isolating endothelial cells populations from a heterogeneous tissue microenvironment. To ascertain CYP24A1 promoter methylation in tumor-associated endothelium, we utilized laser microdissection guided by CD31 immunohistochemistry to procure endothelial cells from human prostate tumor specimens. Prostate tissues were obtained following robotic radical prostatectomy from men with clinically localized prostate cancer. Adjacent histologically benign prostate tissues were used to compare endothelium from benign versus tumor microenvironments. Sodium bisulfite sequencing of CYP24A1 promoter region showed that the average CYP24A1 promoter methylation in the endothelium was 20% from the tumor microenvironment compared with 8.2% in the benign microenvironment (p < 0.05). A 2-fold to 17-fold increase in CYP24A1 promoter methylation was observed in the prostate tumor endothelium compared with the matched benign prostate endothelium in four patient samples, while CYP24A1 promoter methylation remained unchanged in two patient samples. In addition, there is no correlation of the level of CYP24A1 promoter methylation in prostate tumor-associated endothelium with that of epithelium/stroma. This study demonstrates that the CYP24A1 promoter is methylated in tumor-associated endothelium, indicating that epigenetic alterations in CYP24A1 may play a role in determining the phenotype of tumor-associated vasculature in the prostate tumor microenvironment. PMID:21725204

  12. Reference-tissue correction of T2-weighted signal intensity for prostate cancer detection

    NASA Astrophysics Data System (ADS)

    Peng, Yahui; Jiang, Yulei; Oto, Aytekin

    2014-03-01

    The purpose of this study was to investigate whether correction with respect to reference tissue of T2-weighted MRimage signal intensity (SI) improves its effectiveness for classification of regions of interest (ROIs) as prostate cancer (PCa) or normal prostatic tissue. Two image datasets collected retrospectively were used in this study: 71 cases acquired with GE scanners (dataset A), and 59 cases acquired with Philips scanners (dataset B). Through a consensus histology- MR correlation review, 175 PCa and 108 normal-tissue ROIs were identified and drawn manually. Reference-tissue ROIs were selected in each case from the levator ani muscle, urinary bladder, and pubic bone. T2-weighted image SI was corrected as the ratio of the average T2-weighted image SI within an ROI to that of a reference-tissue ROI. Area under the receiver operating characteristic curve (AUC) was used to evaluate the effectiveness of T2-weighted image SIs for differentiation of PCa from normal-tissue ROIs. AUC (+/- standard error) for uncorrected T2-weighted image SIs was 0.78+/-0.04 (datasets A) and 0.65+/-0.05 (datasets B). AUC for corrected T2-weighted image SIs with respect to muscle, bladder, and bone reference was 0.77+/-0.04 (p=1.0), 0.77+/-0.04 (p=1.0), and 0.75+/-0.04 (p=0.8), respectively, for dataset A; and 0.81+/-0.04 (p=0.002), 0.78+/-0.04 (p<0.001), and 0.79+/-0.04 (p<0.001), respectively, for dataset B. Correction in reference to the levator ani muscle yielded the most consistent results between GE and Phillips images. Correction of T2-weighted image SI in reference to three types of extra-prostatic tissue can improve its effectiveness for differentiation of PCa from normal-tissue ROIs, and correction in reference to the levator ani muscle produces consistent T2-weighted image SIs between GE and Phillips MR images.

  13. Use of human tissue explants to study human infectious agents

    PubMed Central

    Grivel, Jean-Charles; Margolis, Leonid

    2012-01-01

    The study of human cell–cell and cell–pathogen interactions that occur in the context of complex tissue cytoarchitecture is critical for deciphering the mechanisms of many normal and pathogenic processes. This protocol describes methods for culturing and infecting explants of human tissues to study the pathogenesis of human infectious agents and their local interactions. The protocol relies on the use of fresh human tissues dissected into small blocks or biopsies that are cultured at the liquid–air interface on collagen rafts. These tissue blocks retain their cytoarchitecture and support productive infection of various pathogens without exogenous stimulation. Experimental details for setting up cultures of human tonsils, lymph nodes and cervicovaginal and rectosigmoid tissues, including protocols for their infection with HIV-1 and other pathogens, are described here. Using this protocol, culture and infections can be set up in 3–6 h and be maintained for 2–3 weeks, depending on the tissue used. PMID:19197269

  14. Pyranocoumarin Tissue Distribution, Plasma Metabolome and Prostate Transcriptome Impacts of Sub-Chronic Exposure to Korean Angelica Supplement in Mice.

    PubMed

    Zhang, Jinhui; Li, Li; Tang, Suni; Zhang, Yong; Markiewski, Maciej; Xing, Chengguo; Jiang, Cheng; Lü, Junxuan

    2016-01-01

    Herbal products containing Korean Angelica gigas Nakai (AGN) root extract are marketed as dietary supplements for memory enhancement, pain killing, and female menopausal symptom relief. We have shown the anticancer activities of AGN supplements in mouse models. To facilitate human anticancer translational research, we characterized the tissue distribution of AGN marker pyranocoumarin compounds decursin (D) and decursinol angelate (DA) ([Formula: see text]% in AGN) and their metabolite decursinol (DOH), assessed the safety of sub-chronic AGN dietary exposure in mice, and explored its impact on plasma aqueous metabolites and the prostate transcriptome. The data show that after a gavage dose, plasma contained readily detectable DOH, but little D and DA, mirroring patterns in the liver. Extra-hepatic tissues retained greater levels of DA and D than the liver did. For sub-chronic exposures, male mice were provided ad libitum AIN93M-pellet diets with 0.5 and 1% AGN for six weeks. No adverse effects were observed on the plasma biochemistry markers of liver and kidney integrity in spite of their enlargement. Histopathological examinations of the liver, kidney and other visceral organs did not reveal tissue abnormalities. Metabolomic assessment of plasma from mice fed the 1%-AGN diet suggested metabolic shifts of key amino acids especially in the methionine-cysteine cycle, purine cycle, and glycolysis-citrate cycle. Prostate transcriptomic profiling identified gene signature changes in the metabolisms of drugs, lipids and cellular energetics, neuro-muscular features, immunity and inflammation, and tumor suppressor/oncogene balance. The safety profile was corroborated with a daily [Formula: see text] injection of AGN extract (100-300[Formula: see text]mg/kg) for four weeks, which resulted in much greater systemic pyranocoumarin exposure than the dietary route did. PMID:27080944

  15. Grating-based tomography of human tissues

    NASA Astrophysics Data System (ADS)

    Müller, Bert; Schulz, Georg; Mehlin, Andrea; Herzen, Julia; Lang, Sabrina; Holme, Margaret; Zanette, Irene; Hieber, Simone; Deyhle, Hans; Beckmann, Felix; Pfeiffer, Franz; Weitkamp, Timm

    2012-07-01

    The development of therapies to improve our health requires a detailed knowledge on the anatomy of soft tissues from the human body down to the cellular level. Grating-based phase contrast micro computed tomography using synchrotron radiation provides a sensitivity, which allows visualizing micrometer size anatomical features in soft tissue without applying any contrast agent. We show phase contrast tomography data of human brain, tumor vessels and constricted arteries from the beamline ID 19 (ESRF) and urethral tissue from the beamline W2 (HASYLAB/DESY) with micrometer resolution. Here, we demonstrate that anatomical features can be identified within brain tissue as well known from histology. Using human urethral tissue, the application of two photon energies is compared. Tumor vessels thicker than 20 μm can be perfectly segmented. The morphology of coronary arteries can be better extracted in formalin than after paraffin embedding.

  16. NCI’s Cooperative Human Tissue Network

    Cancer.gov

    Quality biospecimens are a foundational resource for cancer research. One of NCI’s longest running biospecimen programs is the Cooperative Human Tissue Network, a resource mainly for basic discovery and early translational research.

  17. Detection of cancer cells in prostate tissue with time-resolved fluorescence spectroscopy

    NASA Astrophysics Data System (ADS)

    Gerich, C. E.; Opitz, J.; Toma, M.; Sergon, M.; Füssel, S.; Nanke, R.; Fehre, J.; Wirth, M.; Baretton, G.; Schreiber, J.

    2011-03-01

    Goals: Improving cancer diagnosis is one of the important challenges at this time. The precise differentiation between benign and malignant tissue is in the oncology and oncologic surgery of the utmost significance. A new diagnostic system, that facilitates the decision which tissue has to be removed, would be appreciated. In previous studies many attempts were made to use tissue fluorescence for cancer recognition. However, no clear correlation was found between tissue type and fluorescence parameters like time and wavelength dependent fluorescence intensity I(t, λ). The present study is focused on cooperative behaviour of cells in benign or malignant prostates tissue reflecting differences in their metabolism. Material and Methods: 50 prostate specimens were obtained directly after radical prostatectomy and from each specimen 6 punch biopsies were taken. Time-resolved fluorescence spectra were recorded for 4 different measurement points for each biopsy. The pathologist evaluated each measurement point separately. An algorithm was developed to determine a relevant parameter of the time dependent fluorescence data (fractal dimension DF ). The results of the finding and the DF -value were correlated for each point and then analysed with statistical methods. Results: A total of 1200 measurements points were analysed. The optimal algorithm and conditions for discrimination between malignant and non-malignant tissue areas were found. The correct classification could be stated in 93.4% of analysed points. The ROC-curve (AUC = 0.94) confirms the chosen statistical method as well as it informs about the specificity (0.94) and sensitivity (0.90). Conclusion: The new method seems to offer a very helpful diagnostic tool for pathologists as well as for surgery.

  18. Performance assessment of automated tissue characterization for prostate H and E stained histopathology

    NASA Astrophysics Data System (ADS)

    DiFranco, Matthew D.; Reynolds, Hayley M.; Mitchell, Catherine; Williams, Scott; Allan, Prue; Haworth, Annette

    2015-03-01

    Reliable automated prostate tumor detection and characterization in whole-mount histology images is sought in many applications, including post-resection tumor staging and as ground-truth data for multi-parametric MRI interpretation. In this study, an ensemble-based supervised classification algorithm for high-resolution histology images was trained on tile-based image features including histogram and gray-level co-occurrence statistics. The algorithm was assessed using different combinations of H and E prostate slides from two separate medical centers and at two different magnifications (400x and 200x), with the aim of applying tumor classification models to new data. Slides from both datasets were annotated by expert pathologists in order to identify homogeneous cancerous and non-cancerous tissue regions of interest, which were then categorized as (1) low-grade tumor (LG-PCa), including Gleason 3 and high-grade prostatic intraepithelial neoplasia (HG-PIN), (2) high-grade tumor (HG-PCa), including various Gleason 4 and 5 patterns, or (3) non-cancerous, including benign stroma and benign prostatic hyperplasia (BPH). Classification models for both LG-PCa and HG-PCa were separately trained using a support vector machine (SVM) approach, and per-tile tumor prediction maps were generated from the resulting ensembles. Results showed high sensitivity for predicting HG-PCa with an AUC up to 0.822 using training data from both medical centres, while LG-PCa showed a lower sensitivity of 0.763 with the same training data. Visual inspection of cancer probability heatmaps from 9 patients showed that 17/19 tumors were detected, and HG-PCa generally reported less false positives than LG-PCa.

  19. Prostate cancer specific integrin αvβ3 modulates bone metastatic growth and tissue remodeling

    PubMed Central

    McCabe, NP; De, S; Vasanji, A; Brainard, J; Byzova, TV

    2009-01-01

    The management of pain and morbidity owing to the spreading and growth of cancer within bone remains to be a paramount problem in clinical care. Cancer cells actively transform bone, however, the molecular requirements and mechanisms of this process remain unclear. This study shows that functional modulation of the αvβ3 integrin receptor in prostate cancer cells is required for progression within bone and determines tumor-induced bone tissue transformation. Using histology and quantitative microCT analysis, we show that αvβ3 integrin is required not only for tumor growth within the bone but for tumor-induced bone gain, a response resembling bone lesions in prostate cancer patients. Expression of normal, fully functional αvβ3 enabled tumor growth in bone (incidence: 4/4), whereas αvβ3 (—), inactive or constitutively active mutants of αvβ3 did not (incidence: 0/4, 0/6 and 1/7, respectively) within a 35-day-period. This response appeared to be bone-specific in comparison to the subcutis where tumor incidence was greater than 60% for all groups. Interestingly, bone residing prostate cancer cells expressing normal or dis-regulated αvβ3 (either inactive of constitutively active), but not those lacking β3 promoted bone gain or afforded protection from bone loss in the presence or absence of histologically detectable tumor 35 days following implantation. As bone is replete with ligands for β3 integrin, we next demonstrated that αvβ3 integrin activation on tumor cells is essential for the recognition of key bone-specific matrix proteins. As a result, prostate cancer cells expressing fully functional but not dis-regulated αvβ3 integrin are able to control their own adherence and migration to bone matrix, functions that facilitate tumor growth and control bone lesion development. PMID:17369840

  20. Does Inflammation Mediate the Obesity and BPH Relationship? An Epidemiologic Analysis of Body Composition and Inflammatory Markers in Blood, Urine, and Prostate Tissue, and the Relationship with Prostate Enlargement and Lower Urinary Tract Symptoms

    PubMed Central

    Fowke, Jay H.; Koyama, Tatsuki; Fadare, Oluwole; Clark, Peter E.

    2016-01-01

    Background BPH is a common disease associated with age and obesity. However, the biological pathways between obesity and BPH are unknown. Our objective was to investigate biomarkers of systemic and prostate tissue inflammation as potential mediators of the obesity and BPH association. Methods Participants included 191 men without prostate cancer at prostate biopsy. Trained staff measured weight, height, waist and hip circumferences, and body composition by bioelectric impedance analysis. Systemic inflammation was estimated by serum IL-6, IL-1β, IL-8, and TNF-α; and by urinary prostaglandin E2 metabolite (PGE-M), F2-isoprostane (F2iP), and F2-isoprostane metabolite (F2iP-M) levels. Prostate tissue was scored for grade, aggressiveness, extent, and location of inflammatory regions, and also stained for CD3 and CD20 positive lymphocytes. Analyses investigated the association between multiple body composition scales, systemic inflammation, and prostate tissue inflammation against BPH outcomes, including prostate size at ultrasound and LUTS severity by the AUA-symptom index (AUA-SI). Results Prostate size was significantly associated with all obesity measures. For example, prostate volume was 5.5 to 9.0 mls larger comparing men in the 25th vs. 75th percentile of % body fat, fat mass (kg) or lean mass (kg). However, prostate size was not associated with proinflammatory cytokines, PGE-M, F2iP, F2iP-M, prostate tissue inflammation scores or immune cell infiltration. In contrast, the severity of prostate tissue inflammation was significantly associated with LUTS, such that there was a 7 point difference in AUA-SI between men with mild vs. severe inflammation (p = 0.004). Additionally, men with a greater waist-hip ratio (WHR) were significantly more likely to have severe prostate tissue inflammation (p = 0.02), and a high WHR was significantly associated with moderate/severe LUTS (OR = 2.56, p = 0.03) among those participants with prostate tissue inflammation. Conclusion

  1. Molecular effects of soy phytoalexin glyceollins in human prostate cancer cells LNCaP

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Glyceollins are soy–derived phytoalexins that have been proposed to be candidate cancer preventive compounds. The effect of the glyceollins on prostate cancer is unknown. The present study examined the molecular effects of soy phytoalexins, glyceollins, on the human prostate cancer cell line LNCaP t...

  2. Human Prostatic Acid Phosphatase: Structure, Function and Regulation

    PubMed Central

    Muniyan, Sakthivel; Chaturvedi, Nagendra K.; Dwyer, Jennifer G.; LaGrange, Chad A.; Chaney, William G.; Lin, Ming-Fong

    2013-01-01

    Human prostatic acid phosphatase (PAcP) is a 100 kDa glycoprotein composed of two subunits. Recent advances demonstrate that cellular PAcP (cPAcP) functions as a protein tyrosine phosphatase by dephosphorylating ErbB-2/Neu/HER-2 at the phosphotyrosine residues in prostate cancer (PCa) cells, which results in reduced tumorigenicity. Further, the interaction of cPAcP and ErbB-2 regulates androgen sensitivity of PCa cells. Knockdown of cPAcP expression allows androgen-sensitive PCa cells to develop the castration-resistant phenotype, where cells proliferate under an androgen-reduced condition. Thus, cPAcP has a significant influence on PCa cell growth. Interestingly, promoter analysis suggests that PAcP expression can be regulated by NF-κB, via a novel binding sequence in an androgen-independent manner. Further understanding of PAcP function and regulation of expression will have a significant impact on understanding PCa progression and therapy. PMID:23698773

  3. Variation in alternative splicing across human tissues

    PubMed Central

    Yeo, Gene; Holste, Dirk; Kreiman, Gabriel; Burge, Christopher B

    2004-01-01

    Background Alternative pre-mRNA splicing (AS) is widely used by higher eukaryotes to generate different protein isoforms in specific cell or tissue types. To compare AS events across human tissues, we analyzed the splicing patterns of genomically aligned expressed sequence tags (ESTs) derived from libraries of cDNAs from different tissues. Results Controlling for differences in EST coverage among tissues, we found that the brain and testis had the highest levels of exon skipping. The most pronounced differences between tissues were seen for the frequencies of alternative 3' splice site and alternative 5' splice site usage, which were about 50 to 100% higher in the liver than in any other human tissue studied. Quantifying differences in splice junction usage, the brain, pancreas, liver and the peripheral nervous system had the most distinctive patterns of AS. Analysis of available microarray expression data showed that the liver had the most divergent pattern of expression of serine-arginine protein and heterogeneous ribonucleoprotein genes compared to the other human tissues studied, possibly contributing to the unusually high frequency of alternative splice site usage seen in liver. Sequence motifs enriched in alternative exons in genes expressed in the brain, testis and liver suggest specific splicing factors that may be important in AS regulation in these tissues. Conclusions This study distinguishes the human brain, testis and liver as having unusually high levels of AS, highlights differences in the types of AS occurring commonly in different tissues, and identifies candidate cis-regulatory elements and trans-acting factors likely to have important roles in tissue-specific AS in human cells. PMID:15461793

  4. Melanin content of hamster tissues, human tissues, and various melanomas

    SciTech Connect

    Watts, K.P.; Fairchild, R.G.; Slatkin, D.N.; Greenberg, D.; Packer, S.; Atkins, H.L.; Hannon, S.J.

    1981-02-01

    Melanin content (percentage by weight) was determined in both pigmented and nonpigmented tissues of Syrian golden hamsters bearing Greene melanoma. Melanin content was also measured in various other melanoma models (B-16 in C57 mice, Harding-Passey in BALB/c mice, and KHDD in C3H mice) and in nine human melanomas, as well as in selected normal tissues. The purpose was to evaluate the possible efficacy of chlorpromazine, which is known to bind to melanin, as a vehicle for boron transport in neutron capture therapy. Successful therapy would depend upon selective uptake and absolute concentration of borated compounds in tumors; these parameters will in turn depend upon melanin concentration in melanomas and nonpigmented ''background'' tissues. Hamster whole eyes, hamster melanomas, and other well-pigmented animal melanomas were found to contain 0.3 to 0.8% melanin by weight, whereas human melanomas varied from 0.1 to 0.9% (average, 0.35%). Other tissues, with the exception of skin, were lower in content by a factor of greater than or equal to30. Melanin pigment was extracted from tissues, and the melanin content was determined spectrophotometrically. Measurements were found to be sensitive to the presence of other proteins. Previous procedures for isolating and quantifying melanin often neglected the importance of removing proteins and other interfering nonmelanic substances.

  5. Effects of a human plasma membrane-associated sialidase siRNA on prostate cancer invasion

    SciTech Connect

    Li, Xiaojie; Zhang, Ling; Shao, Yueting; Liang, Zuowen; Shao, Chen; Wang, Bo; Guo, Baofeng; Li, Na; Zhao, Xuejian; Li, Yang; Xu, Deqi

    2011-12-16

    Highlights: Black-Right-Pointing-Pointer Neu3 is as one of the sialidases and regulates cell surface functions. Black-Right-Pointing-Pointer A Neu3-specific siRNA inhibited prostrate cancer cell invasion and migration. Black-Right-Pointing-Pointer The Neu3-specific siRNA inhibited prostate cancer metastasis in mice. Black-Right-Pointing-Pointer Targeting Neu3 may have utility for gene-based therapy of human cancer metastasis. -- Abstract: Human plasma membrane-associated sialidase (Neu3) is one of several sialidases that hydrolyze sialic acids in the terminal position of the carbohydrate groups of glycolipids and glycoproteins. Neu3 is mainly localized in plasma membranes and plays crucial roles in the regulation of cell surface functions. In this study, we investigated the effects and molecular mechanisms of Neu3 on cell invasion and migration in vivo and in vitro. Initially, we found that the levels of Neu3 expression were higher in prostate cancer tissues and cell lines than in normal prostate tissues based on RT-PCR and Western blotting analyses. We then applied a Neu3 siRNA approach to block Neu3 signaling using PC-3M cells as model cells. Transwell invasion assays and wound assays showed significantly decreased invasion and migration potential in the Neu3 siRNA-transfected cells. RT-PCR and Western blotting analyses revealed that Neu3 knockdown decreased the expressions of the matrix metalloproteinases MMP-2 and MMP-9. In vivo, mice injected with PC-3M cell tumors were evaluated by SPECT/CT to determine the presence of bone metastases. Mice treated with attenuated Salmonella carrying the Neu3 siRNA developed fewer bone metastases than mice treated with attenuated Salmonella carrying a control Scramble siRNA, attenuated Salmonella alone or PBS. The results for bone metastasis detection by pathology were consistent with the data obtained by SPECT/CT. Tumor blocks were evaluated by histochemical, RT-PCR and Western blotting analyses. The results revealed

  6. Prediction of alpha1-adrenoceptor occupancy in the human prostate from plasma concentrations of silodosin, tamsulosin and terazosin to treat urinary obstruction in benign prostatic hyperplasia.

    PubMed

    Yamada, Shizuo; Kato, Yasuhiro; Okura, Takashi; Kagawa, Yoshiyuki; Kawabe, Kazuki

    2007-07-01

    Alpha1-adrenoceptor antagonists are clinically useful for the improvement of urinary obstruction due to benign prostatic hyperplasia (BPH), and their therapeutic effects are mediated through the blockade of prostatic alpha(1)-adrenoceptors. The present study was undertaken to predict the magnitude and duration of alpha(1)-adrenoceptor occupancy in the human prostate after oral alpha(1)-adrenoceptor antagonists. Prostatic alpha(1)-adrenoceptor-binding parameters of silodosin were estimated by measuring specific [(3)H]prazosin binding in rat prostate after oral administration of this drug. The plasma concentration of silodosin after oral administration in rats and healthy volunteers was measured using a high-performance liquid chromatographic method. The alpha(1)-adrenoceptor-binding affinities (K(i)) of silodosin, tamsulosin, and terazosin in the human prostate and plasma concentrations of tamsulosin and terazosin were obtained from the literature. Using the alpha(1)-adrenoceptor binding parameters of silodosin in rat prostate, alpha(1)-adrenoceptor occupancy in the human prostate was estimated to be around 60-70% at 1-6 h after oral administration of silodosin at doses of 3.0, 8.1, and 16.1 micromol. Thereafter, the receptor occupancy was periodically decreased, to 24% (8.1 micromol) and 54% (16.1 micromol) 24 h later. A similar magnitude and time course of alpha(1)-adrenoceptor occupancy by silodosin in the human prostate were estimated using alpha(1)-adrenoceptor-binding affinities (K(i)) in the human prostate. Despite about two orders of differences in the plasma unbound concentrations after clinically effective oral dosages of silodosin, tamsulosin, and terazosin, there was a comparable magnitude of prostatic alpha(1)-adrenoceptor occupancy by these drugs. In conclusion, the prediction of alpha(1)-adrenoceptor occupancy in the human prostate by alpha(1)-adrenoceptor antagonists may provide the rationale for the optimum dosage regimen of these drugs in the

  7. The effect of Tookad-mediated photodynamic ablation of the prostate gland on adjacent tissues - in vivo study in a canine model

    PubMed Central

    Huang, Zheng; Chen, Qun; Dole, Kenneth C.; Barqawi, Al B.; Chen, Yang K.; Blanc, Dominique; Wilson, Brian C.; Hetzel, Fred W.

    2008-01-01

    Summary Photodynamic therapy (PDT) mediated with vascular acting photosensitizer Tookad (pd-bacteriopheophorbide) was investigated as an alternative modality for treating prostate cancer. Photodynamic effects on the prostate gland and its adjacent tissues were evaluated in a canine model. Interstitial prostate PDT was performed by irradiating individual lobes with a cylindrical diffuser fiber at various drug/light doses. The sensitivity of the adjacent tissues to Tookad PDT was determined by directly irradiating the surface of the bladder, colon, abdominal muscle and pelvic plexus with a microlens fiber at various drug/light doses. The prostate and adjacent tissues were harvested one-week after the treatment and subjected to histopathological examination. PDT-induced prostate lesions were characterized by marked hemorrhagic necrosis. The bladder, colon, abdominal muscle and pelvic plexus appeared to be sensitive to PDT although the Tookad PDT-induced responses in these tissues were minimal compared to that of the prostate gland at the same dose levels. Nevertheless, the protection of the adjacent tissues should be taken into consideration during the total prostate ablation process due to their sensitivity to PDT. The sensitivity of the prostatic urethra is worth further investigation. Direct intraurethral irradiation might provide an ideal means to determine the sensitivity of the prostatic urethra and might lead to transurethral PDT protocols for the management of benign prostatic hyperplasia. PMID:18046488

  8. The proportion of prostate biopsy tissue with Gleason pattern 4 or 5 predicts for biochemical and clinical outcome after radiotherapy for prostate cancer

    SciTech Connect

    D'Ambrosio, David J.; Hanlon, Alexandra L.; Al-Saleem, Tahseen; Feigenberg, Steven J.; Horwitz, Eric M.; Uzzo, Robert G.; Pollack, Alan; Buyyounouski, Mark K. . E-mail: mark.buyyounouski@fccc.edu

    2007-03-15

    Purpose: To investigate the prognostic utility of the proportion of prostate biopsy tissue containing Gleason pattern 4 or 5 (GP4/5) after definitive radiotherapy (RT) for prostate cancer. Methods and Materials: A total of 568 patients with T1c-3 Nx/0 prostate cancer who received three-dimensional conformal RT alone between May 1989 and August 2001 were studied. There were 161 men with Gleason score 7-10 disease. The GP4/5 was defined as the percentage of biopsy tissue containing Gleason pattern 4 or 5. A Cox proportional hazards model was used for univariate and multivariate analyses (MVA) for biochemical failure (BF) (American Society of Therapeutic Radiology and Oncology definition) and distant metastasis (DM). A recursive partitioning analysis was done using the results of the MVA to identify a cutpoint for GP4/5. Results: The median follow-up was 46 (range, 13-114) months and median RT dose was 76 (range, 65-82) Gy. On MVA, increasing initial prostate-specific antigen (p = 0.0248) decreasing RT dose (continuous, p = 0.0022), T stage (T1/2 vs. T3) (p = 0.0136) and GP4/5 (continuous, p < 0.0001) were significant predictors of BF in a model also containing GS. GP4/5 was the only significant predictor of DM in the same model (p < 0.0001). Conclusion: The GP4/5 in prostate biopsy specimens is a predictor of BF and DM after RT independent of Gleason score. This parameter should be reported by the pathologist when reviewing prostatic biopsy specimens.

  9. Antiinflammatory effect of androgen receptor activation in human benign prostatic hyperplasia cells.

    PubMed

    Vignozzi, Linda; Cellai, Ilaria; Santi, Raffaella; Lombardelli, Letizia; Morelli, Annamaria; Comeglio, Paolo; Filippi, Sandra; Logiodice, Federica; Carini, Marco; Nesi, Gabriella; Gacci, Mauro; Piccinni, Marie-Pierre; Adorini, Luciano; Maggi, Mario

    2012-07-01

    Progression of benign prostatic hyperplasia (BPH) involves chronic inflammation and immune dysregulation. Preclinical studies have demonstrated that prostate inflammation and tissue remodeling are exacerbated by hypogonadism and prevented by testosterone supplementation. We now investigated whether, in humans, hypogonadism was associated with more severe BPH inflammation and the in vitro effect of the selective androgen receptor agonist dihydrotestosterone (DHT) on cultures of stromal cells derived from BPH patients (hBPH). Histological analysis of inflammatory infiltrates in prostatectomy specimens from a cohort of BPH patients and correlation with serum testosterone level was performed. Even after adjusting for confounding factors, hypogonadism was associated with a fivefold increased risk of intraprostatic inflammation, which was also more severe than that observed in eugonadal BPH patients. Triggering hBPH cells by inflammatory stimuli (tumor necrosis factor α, lipopolysaccharide, or CD4(+)T cells) induced abundant secretion of inflammatory/growth factors (interleukin 6 (IL6), IL8, and basic fibroblast growth factor (bFGF)). Co-culture of CD4(+)T cells with hBPH cells induced secretion of Th1 inducer (IL12), Th1-recruiting chemokine (interferon γ inducible protein 10, IP10), and Th2 (IL9)- and Th17 (IL17)-specific cytokines. Pretreatment with DHT inhibited NF-κB activation and suppressed secretion of several inflammatory/growth factors, with the most pronounced effects on IL8, IL6, and bFGF. Reduced inflammatory cytokine production by T-cells, an increase in IL10, and a significant reduction of T cells proliferation suggested that DHT exerted a broad anti inflammatory effect on testosterone cells [corrected]. In conclusion, our data demonstrate that DHT exerts an immune regulatory role on human prostatic stromal cells, inhibiting their potential to actively induce and/or sustain autoimmune and inflammatory responses. PMID:22562653

  10. Automated high-throughput assessment of prostate biopsy tissue using infrared spectroscopic chemical imaging

    NASA Astrophysics Data System (ADS)

    Bassan, Paul; Sachdeva, Ashwin; Shanks, Jonathan H.; Brown, Mick D.; Clarke, Noel W.; Gardner, Peter

    2014-03-01

    Fourier transform infrared (FT-IR) chemical imaging has been demonstrated as a promising technique to complement histopathological assessment of biomedical tissue samples. Current histopathology practice involves preparing thin tissue sections and staining them using hematoxylin and eosin (H&E) after which a histopathologist manually assess the tissue architecture under a visible microscope. Studies have shown that there is disagreement between operators viewing the same tissue suggesting that a complementary technique for verification could improve the robustness of the evaluation, and improve patient care. FT-IR chemical imaging allows the spatial distribution of chemistry to be rapidly imaged at a high (diffraction-limited) spatial resolution where each pixel represents an area of 5.5 × 5.5 μm2 and contains a full infrared spectrum providing a chemical fingerprint which studies have shown contains the diagnostic potential to discriminate between different cell-types, and even the benign or malignant state of prostatic epithelial cells. We report a label-free (i.e. no chemical de-waxing, or staining) method of imaging large pieces of prostate tissue (typically 1 cm × 2 cm) in tens of minutes (at a rate of 0.704 × 0.704 mm2 every 14.5 s) yielding images containing millions of spectra. Due to refractive index matching between sample and surrounding paraffin, minimal signal processing is required to recover spectra with their natural profile as opposed to harsh baseline correction methods, paving the way for future quantitative analysis of biochemical signatures. The quality of the spectral information is demonstrated by building and testing an automated cell-type classifier based upon spectral features.

  11. Prostate Field Cancerization: Deregulated Expression of Macrophage Inhibitory Cytokine 1 (MIC-1) and Platelet Derived Growth Factor A (PDGF-A) in Tumor Adjacent Tissue

    PubMed Central

    Jones, Anna C.; Shoshan, Dor S.; Fischer, Edgar G.; Trujillo, Kristina A.; Bisoffi, Marco

    2015-01-01

    Prostate field cancerization denotes molecular alterations in histologically normal tissues adjacent to tumors. Such alterations include deregulated protein expression, as we have previously shown for the key transcription factor early growth response 1 (EGR-1) and the lipogenic enzyme fatty acid synthase (FAS). Here we add the two secreted factors macrophage inhibitory cytokine 1 (MIC-1) and platelet derived growth factor A (PDGF-A) to the growing list of protein markers of prostate field cancerization. Expression of MIC-1 and PDGF-A was measured quantitatively by immunofluorescence and comprehensively analyzed using two methods of signal capture and several groupings of data generated in human cancerous (n = 25), histologically normal adjacent (n = 22), and disease-free (n = 6) prostate tissues. A total of 208 digitized images were analyzed. MIC-1 and PDGF-A expression in tumor tissues were elevated 7.1x to 23.4x and 1.7x to 3.7x compared to disease-free tissues, respectively (p<0.0001 to p = 0.08 and p<0.01 to p = 0.23, respectively). In support of field cancerization, MIC-1 and PDGF-A expression in adjacent tissues were elevated 7.4x to 38.4x and 1.4x to 2.7x, respectively (p<0.0001 to p<0.05 and p<0.05 to p = 0.51, respectively). Also, MIC-1 and PDGF-A expression were similar in tumor and adjacent tissues (0.3x to 1.0x; p<0.001 to p = 0.98 for MIC-1; 0.9x to 2.6x; p<0.01 to p = 1.00 for PDGF-A). All analyses indicated a high level of inter- and intra-tissue heterogeneity across all types of tissues (mean coefficient of variation of 86.0%). Our data shows that MIC-1 and PDGF-A expression is elevated in both prostate tumors and structurally intact adjacent tissues when compared to disease-free specimens, defining field cancerization. These secreted factors could promote tumorigenesis in histologically normal tissues and lead to tumor multifocality. Among several clinical applications, they could also be exploited as indicators of disease in false negative

  12. Long non-coding RNA ATB promotes growth and epithelial-mesenchymal transition and predicts poor prognosis in human prostate carcinoma.

    PubMed

    Xu, Song; Yi, Xiao-Ming; Tang, Chao-Peng; Ge, Jing-Ping; Zhang, Zheng-Yu; Zhou, Wen-Quan

    2016-07-01

    Long non-coding RNAs (lncRNAs) have been identified to be critical mediators in various tumors associated with cancer progression. Long non-coding RNA activated by TGF-β (lncRNA-ATB) is a stimulator of epithelial-mesenchymal transition (EMT) and serves as a novel prognostic biomarker for hepatocellular carcinoma. However, the biological role and clinical significance of lncRNA-ATB in human prostate cancer have yet to be fully elucidated. The present study was designed to explore the expression of lncRNA-ATB in human prostate cancer patients and the role of lncRNA-ATB in prostate cancer cells. We showed that lncRNA-ATB expression was significantly upregulated in tumor tissues in patients with prostate cancer in comparison with adjacent non-tumor tissues. Further analysis indicted that high lncRNA-ATB expression may be an independent prognostic factor for biochemical recurrence (BCR)-free survival in prostate cancer patients. Overexpression of lncRNA-ATB promoted, and knockdown of lncRNA-ATB inhibited the growth of prostate cancer cells via regulations of cell cycle regulatory protein expression levels. In addition, lncRNA-ATB stimulated epithelial-mesenchymal transition (EMT) associated with ZEB1 and ZNF217 expression levels via ERK and PI3K/AKT signaling pathways. These results indicated that lncRNA-ATB may be considered as a new predictor in the clinical prognosis of patients with prostate cancer. Overexpression of lncRNA-ATB exerts mitogenic and EMT effects of prostate cancer via activation of ERK and PI3K/AKT signaling pathways. PMID:27176634

  13. Long non-coding RNA ATB promotes growth and epithelial-mesenchymal transition and predicts poor prognosis in human prostate carcinoma

    PubMed Central

    XU, SONG; YI, XIAO-MING; TANG, CHAO-PENG; GE, JING-PING; ZHANG, ZHENG-YU; ZHOU, WEN-QUAN

    2016-01-01

    Long non-coding RNAs (lncRNAs) have been identified to be critical mediators in various tumors associated with cancer progression. Long non-coding RNA activated by TGF-β (lncRNA-ATB) is a stimulator of epithelial-mesenchymal transition (EMT) and serves as a novel prognostic biomarker for hepatocellular carcinoma. However, the biological role and clinical significance of lncRNA-ATB in human prostate cancer have yet to be fully elucidated. The present study was designed to explore the expression of lncRNA-ATB in human prostate cancer patients and the role of lncRNA-ATB in prostate cancer cells. We showed that lncRNA-ATB expression was significantly upregulated in tumor tissues in patients with prostate cancer in comparison with adjacent non-tumor tissues. Further analysis indicted that high lncRNA-ATB expression may be an independent prognostic factor for biochemical recurrence (BCR)-free survival in prostate cancer patients. Overexpression of lncRNA-ATB promoted, and knockdown of lncRNA-ATB inhibited the growth of prostate cancer cells via regulations of cell cycle regulatory protein expression levels. In addition, lncRNA-ATB stimulated epithelial-mesenchymal transition (EMT) associated with ZEB1 and ZNF217 expression levels via ERK and PI3K/AKT signaling pathways. These results indicated that lncRNA-ATB may be considered as a new predictor in the clinical prognosis of patients with prostate cancer. Overexpression of lncRNA-ATB exerts mitogenic and EMT effects of prostate cancer via activation of ERK and PI3K/AKT signaling pathways. PMID:27176634

  14. Protective effects of different antioxidants against cadmium induced oxidative damage in rat testis and prostate tissues.

    PubMed

    Jahan, Sarwat; Zahra, Asia; Irum, Umaira; Iftikhar, Natasha; Ullah, Hizb

    2014-08-01

    The present study was performed to determine the effects of different antioxidants on testicular histopathology and oxidative damage induced by cadmium (Cd) in rat testis and prostate. Twenty five rats were equally divided into five groups (n = 5/group). The control group was injected subcutaneously with saline while the Cd alone treated group received a subcutaneous injection of 0.2 mg/kg CdCl(2). Other groups were treated with sulphoraphane (25 µg/rat), vitamin E (75 mg/kg), and Ficus Religiosa plant extract (100 mg/kg) orally along with subcutaneous injections of 0.2 mg/kg CdCl(2) for fifteen days. Oxidative damage in the testicular and prostate tissues were assessed by the estimation of catalase (CAT), peroxidase (POD), superoxide dismutase (SOD), and glutathione reductase (GSR) activity. Lipid peroxidation (TBARS), protein estimation, and histomorphology were also assessed. Cadmium exposure caused a significant decrease in antioxidant enzymes like CAT, POD, SOD, GSR, protein concentrations, and a marked increase in TBARS activity in rat testis and prostate. Histological examination of adult male rat testes showed a disruption in the arrangement of seminiferous tubules along with a reduction in the number of germ cells, Leydig cells, tunica albuginea thickness, diameter of seminiferous tubules, and height of germinal epithelium. Co-treatment with vitamin E, sulphoraphane, and Ficus religiosa were found to be effective in reversing Cd induced toxicity, representing potential therapeutic options to protect the reproductive tissues from the detrimental effects of Cd toxicity. PMID:24758558

  15. Complex degree of mutual anisotropy of linear birefringence and optical activity of biological tissues in diagnostics of prostate cancer

    NASA Astrophysics Data System (ADS)

    Ushenko, V. A.; Gorsky, M. P.

    2013-08-01

    We present theoretical fundamentals of polarization and correlation analysis of the optical anisotropy of biological tissues. Results of measurements of coordinate distributions of the complex degree of mutual anisotropy (CDMA) that are formed by birefringent structures of the prostate tissue with benign and malignant changes are compared. Magnitudes and ranges of variation of statistical (the firstto fourth-order distribution moments) and correlation (excess of autocorrelation functions) parameters of the coordinate CDMA distributions of histological sections of the prostate postoperative bioptic material are studied. Objective criteria of the diagnostics of the appearance of pathology and of the differentiation of the degree of its severity are determined.

  16. Role of androgen and vitamin D receptors in endothelial cells from benign and malignant human prostate

    PubMed Central

    Chung, Ivy; Montecinos, Viviana P.; Buttyan, Ralph; Johnson, Candace S.; Smith, Gary J.

    2013-01-01

    Forty years ago, Judah Folkman (Folkman. N Engl J Med 285: 1182–1186, 1971) proposed that tumor growth might be controlled by limiting formation of new blood vessels (angiogenesis) needed to supply a growing tumor with oxygen and nutrients. To this end, numerous “antiangiogenic” agents have been developed and tested for therapeutic efficacy in cancer patients, including prostate cancer (CaP) patients, with limited success. Despite the lack of clinical efficacy of lead anti-angiogenic therapeutics in CaP patients, recent published evidence continues to support the idea that prostate tumor vasculature provides a reasonable target for development of new therapeutics. Particularly relevant to antiangiogenic therapies targeted to the prostate is the observation that specific hormones can affect the survival and vascular function of prostate endothelial cells within normal and malignant prostate tissues. Here, we review the evidence demonstrating that both androgen(s) and vitamin D significantly impact the growth and survival of endothelial cells residing within prostate cancer and that systemic changes in circulating androgen or vitamin D drastically affect blood flow and vascularity of prostate tissue. Furthermore, recent evidence will be discussed about the expression of the receptors for both androgen and vitamin D in prostate endothelial cells that argues for direct effects of these hormone-activated receptors on the biology of endothelial cells. Based on this literature, we propose that prostate tumor vasculature represents an unexplored target for modulation of tumor growth. A better understanding of androgen and vitamin D effects on prostate endothelial cells will support development of more effective angiogenesis-targeting therapeutics for CaP patients. PMID:23548616

  17. Carbogen breathing increases prostate cancer oxygenation: a translational MRI study in murine xenografts and humans

    PubMed Central

    Alonzi, R; Padhani, A R; Maxwell, R J; Taylor, N J; Stirling, J J; Wilson, J I; d′Arcy, J A; Collins, D J; Saunders, M I; Hoskin, P J

    2009-01-01

    Hypoxia has been associated with poor local tumour control and relapse in many cancer sites, including carcinoma of the prostate. This translational study tests whether breathing carbogen gas improves the oxygenation of human prostate carcinoma xenografts in mice and in human patients with prostate cancer. A total of 23 DU145 tumour-bearing mice, 17 PC3 tumour-bearing mice and 17 human patients with prostate cancer were investigated. Intrinsic susceptibility-weighted MRI was performed before and during a period of carbogen gas breathing. Quantitative R2* pixel maps were produced for each tumour and at each time point and changes in R2* induced by carbogen were determined. There was a mean reduction in R2* of 6.4% (P=0.003) for DU145 xenografts and 5.8% (P=0.007) for PC3 xenografts. In all, 14 human subjects were evaluable; 64% had reductions in tumour R2* during carbogen inhalation with a mean reduction of 21.6% (P=0.0005). Decreases in prostate tumour R2* in both animal models and human patients as a result of carbogen inhalation suggests the presence of significant hypoxia. The finding that carbogen gas breathing improves prostate tumour oxygenation provides a rationale for testing the radiosensitising effects of combining carbogen gas breathing with radiotherapy in prostate cancer patients. PMID:19190629

  18. Antitumor effects of methotrexate-monoclonal anti-prostatic acid phosphatase antibody conjugate on human prostate tumor

    SciTech Connect

    Deguchi, T.; Chu, T.M.; Leong, S.S.; Horoszewicz, J.S.; Lee, C.L.

    1986-03-01

    Methotrexate (MTX) was conjugated to an IgG/sub 1/ monoclonal antibody (MCA) specific for human prostatic acid phosphatase (PAP) by an active ester method, resulting in a molar ratio of MTX to IgG/sub 1/ of 14. MTX-MCA conjugate retained 94% of free antibody activity and preserved 90% of dihydrofolate reductase inhibitory activity of free MTX. MTX-MCA conjugate was shown to be accumulated in vitro by prostate tumor cells (LNCaP) 1.3 times higher than that of MTX conjugate to normal mouse IgG (NIgG) and 6.2 times higher than that of free MTX. Antitumor activity in vitro exhibited that MTX-MCA conjugate is more effective on inhibition (52%) of /sup 3/H-deoxyuridine incorporation into LNCaP cells than that of MTX-NIgG (39%), but both were less effective than free MTX (70%). The in vivo distribution of /sup 3/H-MTX-MCA conjugate in human prostate tumor xenograft (tumor: blood ratio 5.1) was higher than those of /sup 3/H-MTX-NIgG conjugate (1.1) and of free /sup 3/H-MTX (1.5). Anti-tumor activity in vivo demonstrated that MTX-MCA conjugate retarded the growth of xenografted human prostate tumor greatly and persistently, as compared with the control groups. These results suggested that MTX-monoclonal anti-PAP antibody conjugate represents a potential reagent for immunochemotherapy of human prostate tumor (NIH CA-34536, CA-15437 and ACS CH-269.

  19. Aminomethylphosphonic acid inhibits growth and metastasis of human prostate cancer in an orthotopic xenograft mouse model.

    PubMed

    Parajuli, Keshab Raj; Zhang, Qiuyang; Liu, Sen; You, Zongbing

    2016-03-01

    Aminomethylphosphonic acid (AMPA) has been shown to inhibit prostate cancer cell growth in vitro. The purpose of the present study was to determine if AMPA could inhibit growth and metastasis of prostate cancer in vivo. Human prostate cancer PC-3-LacZ-luciferase cells were implanted into the ventral lateral lobes of the prostate in 39 athymic Nu/Nu nude male mice. Seven days later, mice were randomized into the control group (n = 14, treated intraperitoneally with phosphate buffered saline), low dose group (n = 10, treated intraperitoneally with AMPA at 400 mg/kg body weight/day), and high dose group (n = 15, treated intraperitoneally with AMPA at 800 mg/kg body weight/day). Tumor growth and metastasis were examined every 4-7 days by bioluminescence imaging of live mice. We found that AMPA treatment significantly inhibited growth and metastasis of orthotopic xenograft prostate tumors and prolonged the survival time of the mice. AMPA treatment decreased expression of BIRC2 and activated caspase 3, leading to increased apoptosis in the prostate tumors. AMPA treatment decreased expression of cyclin D1. AMPA treatment also reduced angiogenesis in the prostate tumors. Taken together, these results demonstrate that AMPA can inhibit prostate cancer growth and metastasis, suggesting that AMPA may be developed into a therapeutic agent for the treatment of prostate cancer. PMID:26840261

  20. Aminomethylphosphonic acid inhibits growth and metastasis of human prostate cancer in an orthotopic xenograft mouse model

    PubMed Central

    Parajuli, Keshab Raj; Zhang, Qiuyang; Liu, Sen; You, Zongbing

    2016-01-01

    Aminomethylphosphonic acid (AMPA) has been shown to inhibit prostate cancer cell growth in vitro. The purpose of the present study was to determine if AMPA could inhibit growth and metastasis of prostate cancer in vivo. Human prostate cancer PC-3-LacZ-luciferase cells were implanted into the ventral lateral lobes of the prostate in 39 athymic Nu/Nu nude male mice. Seven days later, mice were randomized into the control group (n = 14, treated intraperitoneally with phosphate buffered saline), low dose group (n = 10, treated intraperitoneally with AMPA at 400 mg/kg body weight/day), and high dose group (n = 15, treated intraperitoneally with AMPA at 800 mg/kg body weight/day). Tumor growth and metastasis were examined every 4-7 days by bioluminescence imaging of live mice. We found that AMPA treatment significantly inhibited growth and metastasis of orthotopic xenograft prostate tumors and prolonged the survival time of the mice. AMPA treatment decreased expression of BIRC2 and activated caspase 3, leading to increased apoptosis in the prostate tumors. AMPA treatment decreased expression of cyclin D1. AMPA treatment also reduced angiogenesis in the prostate tumors. Taken together, these results demonstrate that AMPA can inhibit prostate cancer growth and metastasis, suggesting that AMPA may be developed into a therapeutic agent for the treatment of prostate cancer. PMID:26840261

  1. Human histocultures (tissue explants) in retrovirology

    PubMed Central

    Arakelyan, Anush; Fitzgerald, Wendy; Grivel, Jean-Charles; Vanpouille, Christophe; Margolis, Leonid

    2014-01-01

    Summary Viral pathogenesis is studied predominantly in cultures of primary isolated cells or cell lines. Many retroviruses efficiently replicate only in activated cells. Therefore, in order to become efficient viral producers cells should be artificially activated, a procedure which significantly changes cell physiology. However, for many viral diseases, like HIV-1 and other retroviruses’ diseases, critical pathogenic events occur in tissues and cell isolation from their native microenvironment prevents single cell cultures from faithfully reflecting important aspects of cell-cell and cell-pathogen interactions that occur in the context of complex tissue cytoarchitecture. Tissue explants (histocultures) that retain tissue cytoarchitecture and many aspects of cell-cell interactions more faithfully represent in vivo tissue features. Human histocultures constitute an adequate model for studying viral pathogenesis under controlled laboratory conditions. Protocols for various human histocultures as applied to study retroviral pathogenesis, in particular of HIV-1, have been refined by our laboratory and are described in the present publication. Human histocultures of human tonsils and lymph nodes, as well as of recto-sigmoid and cervico-vaginal tissues can be used to study viral transmission, pathogenesis and as a pre-clinical platform for antivirals evaluation. PMID:24158827

  2. Increased Expression of Herpes Virus-Encoded hsv1-miR-H18 and hsv2-miR-H9-5p in Cancer-Containing Prostate Tissue Compared to That in Benign Prostate Hyperplasia Tissue

    PubMed Central

    Shinn, Helen Ki; Yan, Chunri; Kim, Tae-Hwan; Kim, Sang Tae; Kim, Won Tae; Lee, Ok-Jun; Moon, Sung-Kwon; Kim, Nam-Hyung; Kim, Jayoung; Cha, Eun-Jong

    2016-01-01

    Purpose: Previously, we reported the presence of virus-encoded microRNAs (miRNAs) in the urine of prostate cancer (CaP) patients. In this study, we investigated the expression of two herpes virus-encoded miRNAs in prostate tissue. Methods: A total of 175 tissue samples from noncancerous benign prostatic hyperplasia (BPH), 248 tissue samples from patients with CaP and BPH, and 50 samples from noncancerous surrounding tissues from these same patients were analyzed for the expression of two herpes virus-encoded miRNAs by real-time polymerase chain reaction (PCR) and immunocytochemistry using nanoparticles as molecular beacons. Results: Real-time reverse transcription-PCR results revealed significantly higher expression of hsv1-miR-H18 and hsv2-miRH9- 5p in surrounding noncancerous and CaP tissues than that in BPH tissue (each comparison, P<0.001). Of note, these miRNA were expressed equivalently in the CaP tissues and surrounding noncancerous tissues. Moreover, immunocytochemistry clearly demonstrated a significant enrichment of both hsv1-miR-H18 and hsv2-miR-H9 beacon-labeled cells in CaP and surrounding noncancerous tissue compared to that in BPH tissue (each comparison, P<0.05 for hsv1-miR-H18 and hsv2- miR-H9). Conclusions: These results suggest that increased expression of hsv1-miR-H18 and hsv2-miR-H95p might be associated with tumorigenesis in the prostate. Further studies will be required to elucidate the role of these miRNAs with respect to CaP and herpes viral infections. PMID:27377944

  3. How does performance of ultrasound tissue typing affect design of prostate IMRT dose-painting protocols?

    SciTech Connect

    Zhang Pengpeng . E-mail: pz2010@columbia.edu; Osterman, K. Sunshine; Liu Tian; Li Xiang; Kessel, Jack; Wu, Leester; Schiff, Peter; Kutcher, Gerald J.

    2007-02-01

    Purpose: To investigate how the performance characteristics of ultrasound tissue typing (UTT) affect the design of a population-based prostate dose-painting protocol. Methods and Materials: The performance of UTT is evaluated using the receiver operating characteristic curve. As the imager's sensitivity increases, more tumors are detected, but the specificity worsens, causing more false-positive results. The UTT tumor map, obtained with a specific sensitivity and specificity setup, was used with the patient's CT image to guide intensity-modulated radiotherapy (IMRT) planning. The optimal escalation dose to the UTT positive region, as well as the safe dose to the negative background, was obtained by maximizing the uncomplicated control (i.e., a combination of tumor control probability and weighted normal tissue complication probability). For high- and low-risk tumors, IMRT plans guided by conventional ultrasound or UTT with a one-dimensional or two-dimensional spectrum analysis technique were compared with an IMRT plan in which the whole prostate was dose escalated. Results: For all imaging modalities, the specificity of 0.9 was chosen to reduce complications resulting from high false-positive results. If the primary tumors were low risk, the IMRT plans guided by all imaging modalities achieved high tumor control probability and reduced the normal tissue complication probability significantly compared with the plan with whole gland dose escalation. However, if the primary tumors were high risk, the accuracy of the imaging modality was critical to maintain the tumor control probability and normal tissue complication probability at acceptable levels. Conclusion: The performance characteristics of an imager have important implications in dose painting and should be considered in the design of dose-painting protocols.

  4. Automated segmentation of reference tissue for prostate cancer localization in dynamic contrast enhanced MRI

    NASA Astrophysics Data System (ADS)

    Vos, Pieter C.; Hambrock, Thomas; Barentsz, Jelle O.; Huisman, Henkjan J.

    2010-03-01

    For pharmacokinetic (PK) analysis of Dynamic Contrast Enhanced (DCE) MRI the arterial input function needs to be estimated. Previously, we demonstrated that PK parameters have a significant better discriminative performance when per patient reference tissue was used, but required manual annotation of reference tissue. In this study we propose a fully automated reference tissue segmentation method that tackles this limitation. The method was tested with our Computer Aided Diagnosis (CADx) system to study the effect on the discriminating performance for differentiating prostate cancer from benign areas in the peripheral zone (PZ). The proposed method automatically segments normal PZ tissue from DCE derived data. First, the bladder is segmented in the start-to-enhance map using the Otsu histogram threshold selection method. Second, the prostate is detected by applying a multi-scale Hessian filter to the relative enhancement map. Third, normal PZ tissue was segmented by threshold and morphological operators. The resulting segmentation was used as reference tissue to estimate the PK parameters. In 39 consecutive patients carcinoma, benign and normal tissue were annotated on MR images by a radiologist and a researcher using whole mount step-section histopathology as reference. PK parameters were computed for each ROI. Features were extracted from the set of ROIs using percentiles to train a support vector machine that was used as classifier. Prospective performance was estimated by means of leave-one-patient-out cross validation. A bootstrap resampling approach with 10,000 iterations was used for estimating the bootstrap mean AUCs and 95% confidence intervals. In total 42 malignant, 29 benign and 37 normal regions were annotated. For all patients, normal PZ was successfully segmented. The diagnostic accuracy obtained for differentiating malignant from benign lesions using a conventional general patient plasma profile showed an accuracy of 0.64 (0.53-0.74). Using the

  5. Role of IAPs in prostate cancer progression: immunohistochemical study in normal and pathological (benign hyperplastic, prostatic intraepithelial neoplasia and cancer) human prostate

    PubMed Central

    2010-01-01

    Background In this study was investigate IAPs in normal human prostate (NP), benign prostatic hyperplasia (BPH), prostatic intraepithelial neoplasia (PIN) and prostatic carcinoma (PC), and their involvement in apoptosis/proliferation via NF-kB (TNF-α, IL-1) stimulation. Methods Immunohistochemical and Western blot analyses were performed in 10 samples of normal prostates, 35 samples of BPH, 27 samples diagnosis of PIN (with low-grade PIN or high-grade PIN) and 95 samples of PC (with low, medium or high Gleason grades). Results In NP, cytoplasm of epithelial cells were positive to c-IAP1/2 (80% of samples), c-IAP-2 (60%), ILP (20%), XIAP (20%); negative to NAIP and survivin. In BPH, epithelial cells were immunostained to c-IAP1/2 (57.57%), c-IAP-2 (57.57%), ILP (66.6%), NAIP (60.6%), XIAP (27.27%), survivin (9.1%). Whereas low-grade PIN showed intermediate results between NP and BPH; results in high-grade PIN were similar to those found in PC. In PC, epithelial cells were immunostained to c-IAP1/2, c-IAP-2, ILP, NAIP, XIAP (no Gleason variation) and survivin (increasing with Gleason). Conclusions IAPs could be involved in prostate disorder (BPH, PIN and PC) development since might be provoke inhibition of apoptosis and subsequently cell proliferation. At the same time, different transduction pathway such as IL-1/NIK/NF-kB or TNF/NF-kB (NIK or p38) also promotes proliferation. Inhibitions of IAPs, IL-1α and TNFα might be a possible target for PC treatment since IAPs are the proteins that inhibited apoptosis (favour proliferation) and IL-1α and TNFα would affect all the transduction pathway involucrate in the activation of transcription factors related to survival or proliferation (NF-kB, Elk-1 or ATF-2). PMID:20078866

  6. Prostate PDT dosimetry

    PubMed Central

    Zhu, Timothy C.; Finlay, Jarod C.

    2015-01-01

    Summary We provide a review of the current state of dosimetry in prostate photodynamic therapy (PDT). PDT of the human prostate has been performed with a number of different photosensitizers and with a variety of dosimetry schemes. The simplest clinical light dose prescription is to quantify the total light energy emitted per length (J/cm) of cylindrical diffusing fibers (CDF) for patients treated with a defined photosensitizer injection per body weight. However, this approach does not take into account the light scattering by tissue and usually underestimates the local light fluence rate, and consequently the fluence. Techniques have been developed to characterize tissue optical properties and light fluence rates in vivo using interstitial measurements during prostate PDT. Optical methods have been developed to characterize tissue absorption and scattering spectra, which in turn provide information about tissue oxygenation and drug concentration. Fluorescence techniques can be used to quantify drug concentrations and photobleaching rates of photosensitizers. PMID:25046988

  7. The cancer-promoting gene fatty acid-binding protein 5 (FABP5) is epigenetically regulated during human prostate carcinogenesis.

    PubMed

    Kawaguchi, Koichiro; Kinameri, Ayumi; Suzuki, Shunsuke; Senga, Shogo; Ke, Youqiang; Fujii, Hiroshi

    2016-02-15

    FABPs (fatty-acid-binding proteins) are a family of low-molecular-mass intracellular lipid-binding proteins consisting of ten isoforms. FABPs are involved in binding and storing hydrophobic ligands such as long-chain fatty acids, as well as transporting these ligands to the appropriate compartments in the cell. FABP5 is overexpressed in multiple types of tumours. Furthermore, up-regulation of FABP5 is strongly associated with poor survival in triple-negative breast cancer. However, the mechanisms underlying the specific up-regulation of the FABP5 gene in these cancers remain poorly characterized. In the present study, we determined that FABP5 has a typical CpG island around its promoter region. The DNA methylation status of the CpG island in the FABP5 promoter of benign prostate cells (PNT2), prostate cancer cells (PC-3, DU-145, 22Rv1 and LNCaP) and human normal or tumour tissue was assessed by bisulfite sequencing analysis, and then confirmed by COBRA (combined bisulfite restriction analysis) and qAMP (quantitative analysis of DNA methylation using real-time PCR). These results demonstrated that overexpression of FABP5 in prostate cancer cells can be attributed to hypomethylation of the CpG island in its promoter region, along with up-regulation of the direct trans-acting factors Sp1 (specificity protein 1) and c-Myc. Together, these mechanisms result in the transcriptional activation of FABP5 expression during human prostate carcinogenesis. Importantly, silencing of Sp1, c-Myc or FABP5 expression led to a significant decrease in cell proliferation, indicating that up-regulation of FABP5 expression by Sp1 and c-Myc is critical for the proliferation of prostate cancer cells. PMID:26614767

  8. Towards 3D ultrasound image based soft tissue tracking: a transrectal ultrasound prostate image alignment system.

    PubMed

    Baumann, Michael; Mozer, Pierre; Daanen, Vincent; Troccaz, Jocelyne

    2007-01-01

    The emergence of real-time 3D ultrasound (US) makes it possible to consider image-based tracking of subcutaneous soft tissue targets for computer guided diagnosis and therapy. We propose a 3D transrectal US based tracking system for precise prostate biopsy sample localisation. The aim is to improve sample distribution, to enable targeting of unsampled regions for repeated biopsies, and to make post-interventional quality controls possible. Since the patient is not immobilized, since the prostate is mobile and due to the fact that probe movements are only constrained by the rectum during biopsy acquisition, the tracking system must be able to estimate rigid transformations that are beyond the capture range of common image similarity measures. We propose a fast and robust multi-resolution attribute-vector registration approach that combines global and local optimization methods to solve this problem. Global optimization is performed on a probe movement model that reduces the dimensionality of the search space and thus renders optimization efficient. The method was tested on 237 prostate volumes acquired from 14 different patients for 3D to 3D and 3D to orthogonal 2D slices registration. The 3D-3D version of the algorithm converged correctly in 96.7% of all cases in 6.5s with an accuracy of 1.41mm (r.m.s.) and 3.84mm (max). The 3D to slices method yielded a success rate of 88.9% in 2.3s with an accuracy of 1.37mm (r.m.s.) and 4.3mm (max). PMID:18044549

  9. Cadmium Levels in Tissue and Plasma as a Risk Factor for Prostate Carcinoma: a Meta-Analysis.

    PubMed

    Zhang, Liang; Zhu, Yi; Hao, Rui; Shao, Mengmeng; Luo, Yunbo

    2016-07-01

    Cadmium is a heavy metal that has been suggested to be a carcinogen by evidence. A number of published studies have investigated the association between cadmium levels and prostate cancer, but the results were inconsistent. Thus, we conducted a meta-analysis to get a precise estimate of this subject. After a careful searching and screening, a total of 11 publications containing 14 separated studies were included. Based on a random-effect model, the pooled data showed that cadmium levels of prostate tissues (standard mean difference (SMD) = 3.17, 95 % confidence interval (CI) = 0.60-5.74, P < 0.05) and plasma (SMD = 4.07, 95 % CI = 2.01-6.13, P < 0.05) were significantly higher in prostate cancer patients than those in the healthy controls. No difference of hair and nail cadmium levels between the prostate cancer cases and the controls was found. The data suggested that cadmium exposure might exert an influence on the tumorigenesis of prostate tissues. Future investigations with large sample sizes are needed to verify the results. PMID:26631052

  10. Time-resolved fluorescence imaging (TRFI) for direct immunofluorescence of PSA and alpha-1-antichymotrypsin in prostatic tissue sections.

    PubMed

    Bjartell, A; Siivola, P; Hulkko, S; Pettersson, K; Rundt, K; Lilja, H; Lövgren, T

    1999-05-01

    We have developed a direct immunofluorescence technique utilising chelates of the lanthanide ions europium and terbium conjugated to monoclonal IgGs (Mabs) against prostate-specific antigen (PSA) and alpha-1-antichymotrypsin (ACT) for the detection and quantification on the same tissue section. Strong signals without disturbance from tissue autofluorescence were demonstrated in paraffin sections of ten benign and six malignant prostate tissue specimens. The signal intensity increased linearly with the amount of labelled Mab until epitope saturation began. The highest concentrations of bound IgG in tissue sections were 27.3 fmol/pixel for ACT and 7.2 for PSA. Time-resolved fluorescence imaging (TRFI) offers an attractive method for histochemical studies based on specific and quantitative detection of fluorescent lanthanide chelates. PMID:12496823

  11. Distribution of somatostatin receptors in normal and neoplastic human tissues: recent advances and potential relevance.

    PubMed Central

    Reubi, J. C.; Schaer, J. C.; Markwalder, R.; Waser, B.; Horisberger, U.; Laissue, J.

    1997-01-01

    This short review describes the localization of somatostatin receptors with in vitro receptor autoradiography techniques in several non-classical, normal human somatostatin target tissues as well as in selected human tumors. In addition to brain, gut and neuroendocrine localizations, somatostatin receptors are expressed in most lymphatic tissues, including gut-associated lymphatic tissue, spleen and thymus; in the cortical and medullary area of the kidney; in the stroma of the prostate and in the epithelial cells of the thyroid. Among human tumors, the extremely high density of somatostatin receptors in medulloblastomas should be stressed as well as the favorable prognostic role of the presence of somatostatin receptors in neuroblastomas. Moreover, several types of mesenchymal tumors have somatostatin receptors as well. The receptor subtypes expressed by distinct tumors may vary: Whereas medulloblastomas and neuroblastomas predominantly express sst2, prostate cancers express sst1 rather than sst2. A further emerging somatostatin target is represented by the peritumoral veins, also known to express sst2 receptors. The multiple somatostatin targets in normal and pathological human tissues represents the basis for potential diagnostic and clinical applications of somatostatin analogs. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:9825475

  12. Glycoproteomic Analysis of Prostate Cancer Tissues by SWATH Mass Spectrometry Discovers N-acylethanolamine Acid Amidase and Protein Tyrosine Kinase 7 as Signatures for Tumor Aggressiveness*

    PubMed Central

    Liu, Yansheng; Chen, Jing; Sethi, Atul; Li, Qing K.; Chen, Lijun; Collins, Ben; Gillet, Ludovic C. J.; Wollscheid, Bernd; Zhang, Hui; Aebersold, Ruedi

    2014-01-01

    The identification of biomarkers indicating the level of aggressiveness of prostate cancer (PCa) will address the urgent clinical need to minimize the general overtreatment of patients with non-aggressive PCa, who account for the majority of PCa cases. Here, we isolated formerly N-linked glycopeptides from normal prostate (n = 10) and from non-aggressive (n = 24), aggressive (n = 16), and metastatic (n = 25) PCa tumor tissues and analyzed the samples using SWATH mass spectrometry, an emerging data-independent acquisition method that generates a single file containing fragment ion spectra of all ionized species of a sample. The resulting datasets were searched using a targeted data analysis strategy in which an a priori spectral reference library representing known N-glycosites of the human proteome was used to identify groups of signals in the SWATH mass spectrometry data. On average we identified 1430 N-glycosites from each sample. Out of those, 220 glycoproteins showed significant quantitative changes associated with diverse biological processes involved in PCa aggressiveness and metastasis and indicated functional relationships. Two glycoproteins, N-acylethanolamine acid amidase and protein tyrosine kinase 7, that were significantly associated with aggressive PCa in the initial sample cohort were further validated in an independent set of patient tissues using tissue microarray analysis. The results suggest that N-acylethanolamine acid amidase and protein tyrosine kinase 7 may be used as potential tissue biomarkers to avoid overtreatment of non-aggressive PCa. PMID:24741114

  13. Synchrotron FTIR Imaging For The Identification Of Cell Types Within Human Tissues

    SciTech Connect

    Walsh, Michael J.; Pounder, F. Nell; Nasse, Michael J.; Macias, Virgilia; Kajdacsy-Balla, Andre; Hirschmugl, Carol; Bhargava, Rohit

    2010-02-03

    The use of synchrotron Fourier Transform Infrared spectroscopy (S-FTIR) has been shown to be a very promising tool for biomedical research. S-FTIR spectroscopy allows for the fast acquisition of infrared (IR) spectra at a spatial resolution approaching the IR diffraction limit. The development of the Infrared Environmental Imaging (IRENI) beamline at the Synchrotron Radiation Center (SRC) at the University of Wisconsin-Madison has allowed for diffraction limited imaging measurements of cells in human prostate and breast tissues. This has allowed for the identification of cell types within tissues that would otherwise not have been resolvable using conventional FTIR sources.

  14. SPOCK1 promotes tumor growth and metastasis in human prostate cancer

    PubMed Central

    Chen, Qi; Yao, Yuan-ting; Xu, Huan; Chen, Yan-bo; Gu, Meng; Cai, Zhi-kang; Wang, Zhong

    2016-01-01

    Prostate cancer is the most diagnosed noncutaneous cancer and ranks as the second leading cause of cancer-related deaths in American males. Metastasis is the primary cause of prostate cancer mortality. Survival rate is only 28% for metastatic patients, but is nearly 100% for patients with localized prostate cancers. Molecular mechanisms that underlie this malignancy remain obscure, and this study investigated the role of SPARC/osteonectin, cwcv, and kazal-like domain proteoglycan 1 (SPOCK1) in prostate cancer progression. Initially, we found that SPOCK1 expression was significantly higher in prostate cancer tissues relative to noncancerous tissues. In particular, SPOCK1 expression was also markedly high in metastatic tissues compared with nonmetastatic cancerous tissues. SPOCK1 expression knockdown by specific short hairpin RNA in PC3 cells was significantly inhibited, whereas SPOCK1 overexpression in RWPE-1 cells promoted cell viability, colony formation in vitro, and tumor growth in vivo. Moreover, the SPOCK1 knockdown in PC3 cells was associated with cell cycle arrest in G0/G1 phase, while the SPOCK1 overexpression in RWPE-1 cells induced cell cycle arrest in S phase. The SPOCK1 knockdown in PC3 cells even increased cell apoptosis. SPOCK1 modulation was also observed to affect cancerous cell proliferation and apoptotic processes in the mouse model of prostate cancer. Additionally, the SPOCK1 knockdown decreased, whereas the SPOCK1 overexpression increased cell migration and invasion abilities in vitro. Injection of SPOCK1-depleted PC3 cells significantly decreased metastatic nodules in mouse lungs. These findings suggest that SPOCK1 is a critical mediator of tumor growth and metastasis in prostate cancer. PMID:27486308

  15. Tissue Specificity of Human Angiotensin I-Converting Enzyme

    PubMed Central

    Kryukova, Olga V.; Tikhomirova, Victoria E.; Golukhova, Elena Z.; Evdokimov, Valery V.; Kalantarov, Gavreel F.; Trakht, Ilya N.; Schwartz, David E.; Dull, Randal O.; Gusakov, Alexander V.; Uporov, Igor V.; Kost, Olga A.; Danilov, Sergei M.

    2015-01-01

    Background Angiotensin-converting enzyme (ACE), which metabolizes many peptides and plays a key role in blood pressure regulation and vascular remodeling, as well as in reproductive functions, is expressed as a type-1 membrane glycoprotein on the surface of endothelial and epithelial cells. ACE also presents as a soluble form in biological fluids, among which seminal fluid being the richest in ACE content - 50-fold more than that in blood. Methods/Principal Findings We performed conformational fingerprinting of lung and seminal fluid ACEs using a set of monoclonal antibodies (mAbs) to 17 epitopes of human ACE and determined the effects of potential ACE-binding partners on mAbs binding to these two different ACEs. Patterns of mAbs binding to ACEs from lung and from seminal fluid dramatically differed, which reflects difference in the local conformations of these ACEs, likely due to different patterns of ACE glycosylation in the lung endothelial cells and epithelial cells of epididymis/prostate (source of seminal fluid ACE), confirmed by mass-spectrometry of ACEs tryptic digests. Conclusions Dramatic differences in the local conformations of seminal fluid and lung ACEs, as well as the effects of ACE-binding partners on mAbs binding to these ACEs, suggest different regulation of ACE functions and shedding from epithelial cells in epididymis and prostate and endothelial cells of lung capillaries. The differences in local conformation of ACE could be the base for the generation of mAbs distingushing tissue-specific ACEs. PMID:26600189

  16. Three Dimension Filamentous Human Cardiac Tissue Model

    PubMed Central

    Ma, Zhen; Koo, Sangmo; Finnegan, Micaela A.; Loskill, Peter; Huebsch, Nathaniel; Marks, Natalie C.; Conklin, Bruce R.; Grigoropoulos, Costas P.; Healy, Kevin E.

    2013-01-01

    A human in vitro cardiac tissue model would be a significant advancement for understanding, studying, and developing new strategies for treating cardiac arrhythmias and related cardiovascular diseases. We developed an in vitro model of three-dimensional (3D) human cardiac tissue by populating synthetic filamentous matrices with cardiomyocytes derived from healthy wild-type volunteer (WT) and patient-specific long QT syndrome type 3 (LQT3) induced pluripotent stem cells (iPS-CMs) to mimic the condensed and aligned human ventricular myocardium. Using such a highly controllable cardiac model, we studied the contractility malfunctions associated with the electrophysiological consequences of LQT3 and their response to a panel of drugs. By varying the stiffness of filamentous matrices, LQT3 iPS-CMs exhibited different level of contractility abnormality and susceptibility to drug-induced cardiotoxicity. PMID:24268663

  17. Semi-parametric time-domain quantification of HR-MAS data from prostate tissue

    PubMed Central

    Ratiney, Helene; Albers, Mark J.; Rabeson, Herald; Kurhanewicz, John

    2011-01-01

    High Resolution – Magic Angle Spinning (HR-MAS) spectroscopy provides rich biochemical profiles that require accurate quantification to permit biomarker identification and to understand the underlying pathological mechanisms. Meanwhile, quantification of HR-MAS data from prostate tissue samples is challenging due to significant overlap between the resonant peaks, the presence of short T2∗ metabolites such as citrate or polyamines (T2 from 25 to 100 msec) and macromolecules, and variations in chemical shifts and T2∗s within a metabolite’s spin systems. Since existing methods do not address these challenges completely, a new quantification method was developed and optimized for HR-MAS data acquired with an ultra short TE and over 30,000 data points. The proposed method, named HR-QUEST (High Resolution – QUEST), iteratively employs the QUEST time-domain semi-parametric strategy with a new model function that incorporates prior knowledge from whole and subdivided metabolite signals. With these features, HR-QUEST is able to independently fit the chemical shifts and T2∗s of a metabolite’s spin systems, a necessity for HR-MAS data. By using the iterative fitting approach, it is able to account for significant contributions from macromolecules and to handle shorter T2 metabolites, such as citrate and polyamines. After subdividing the necessary metabolite basis signals, the root mean square (RMS) of the residual was reduced by 52% for measured HR-MAS data from prostate tissue. Monte Carlo studies on simulated spectra with varied macromolecular contributions showed that the iterative fitting approach (6 iterations) coupled with inclusion of long T2 macromolecule components in the basis set improve the quality of the fit, as assessed by the reduction of the RMS of the residual and of the RMS error of the metabolite signal estimate, by 27% and 71% respectively. With this optimized configuration, HR-QUEST was applied to measured HR-MAS prostate data and reliably

  18. Selenium and Vitamin E: Cell Type– and Intervention-Specific Tissue Effects in Prostate Cancer

    PubMed Central

    Tsavachidou, Dimitra; McDonnell, Timothy J.; Wen, Sijin; Wang, Xuemei; Vakar-Lopez, Funda; Pisters, Louis L.; Pettaway, Curtis A.; Wood, Christopher G.; Do, Kim-Anh; Thall, Peter F.; Stephens, Clifton; Efstathiou, Eleni; Taylor, Robert; Menter, David G.; Troncoso, Patricia; Lippman, Scott M.; Logothetis, Christopher J.

    2009-01-01

    Background Secondary analyses of two randomized, controlled phase III trials demonstrated that selenium and vitamin E could reduce prostate cancer incidence. To characterize pharmacodynamic and gene expression effects associated with use of selenium and vitamin E, we undertook a randomized, placebo-controlled phase IIA study of prostate cancer patients before prostatectomy and created a preoperative model for prostatectomy tissue interrogation. Methods Thirty-nine men with prostate cancer were randomly assigned to treatment with 200 μg of selenium, 400 IU of vitamin E, both, or placebo. Laser capture microdissection of prostatectomy biopsy specimens was used to isolate normal, stromal, and tumor cells. Gene expression in each cell type was studied with microarray analysis and validated with a real-time polymerase chain reaction (PCR) and immunohistochemistry. An analysis of variance model was fit to identify genes differentially expressed between treatments and cell types. A beta-uniform mixture model was used to analyze differential expression of genes and to assess the false discovery rate. All statistical tests were two-sided. Results The highest numbers of differentially expressed genes by treatment were 1329 (63%) of 2109 genes in normal epithelial cells after selenium treatment, 1354 (66%) of 2051 genes in stromal cells after vitamin E treatment, and 329 (56%) of 587 genes in tumor cells after combination treatment (false discovery rate = 2%). Validation of 21 representative genes across all treatments and all cell types yielded Spearman correlation coefficients between the microarray analysis and the PCR validation ranging from 0.64 (95% confidence interval [CI] = 0.31 to 0.79) for the vitamin E group to 0.87 (95% CI = 0.53 to 0.99) for the selenium group. The increase in the mean percentage of p53-positive tumor cells in the selenium-treated group (26.3%), compared with that in the placebo-treated group (5%), showed borderline statistical significance

  19. Alpha 2 adrenergic receptors in hyperplastic human prostate: identification and characterization using (/sup 3/H) rauwolscine

    SciTech Connect

    Shapiro, E.; Lepor, H.

    1986-05-01

    (/sup 3/H)Rauwolscine ((/sup 3/H)Ra), a selective ligand for the alpha 2 adrenergic receptor, was used to identify and characterize alpha 2 adrenergic receptors in prostate glands of men with benign prostatic hyperplasia. Specific binding of (/sup 3/H)Ra to prostatic tissue homogenates was rapid and readily reversible by addition of excess unlabelled phentolamine. Scatchard analysis of saturation experiments demonstrates a single, saturable class of high affinity binding sites (Bmax = 0.31 +/- 0.04 fmol./microgram. DNA, Kd = 0.9 +/- 0.11 nM.). The relative potency of alpha adrenergic drugs (clonidine, alpha-methylnorepinephrine and prazosin) in competing for (/sup 3/H)Ra binding sites was consistent with the order predicted for an alpha 2 subtype. The role of alpha 2 adrenergic receptors in normal prostatic function and in men with bladder outlet obstruction secondary to BPH requires further investigation.

  20. Berberine-induced apoptosis in human prostate cancer cells is initiated by reactive oxygen species generation

    SciTech Connect

    Meeran, Syed M.; Katiyar, Suchitra; Katiyar, Santosh K.

    2008-05-15

    Phytochemicals show promise as potential chemopreventive or chemotherapeutic agents against various cancers. Here we report the chemotherapeutic effects of berberine, a phytochemical, on human prostate cancer cells. The treatment of human prostate cancer cells (PC-3) with berberine induced dose-dependent apoptosis but this effect of berberine was not seen in non-neoplastic human prostate epithelial cells (PWR-1E). Berberine-induced apoptosis was associated with the disruption of the mitochondrial membrane potential, release of apoptogenic molecules (cytochrome c and Smac/DIABLO) from mitochondria and cleavage of caspase-9,-3 and PARP proteins. This effect of berberine on prostate cancer cells was initiated by the generation of reactive oxygen species (ROS) irrespective of their androgen responsiveness, and the generation of ROS was through the increased induction of xanthine oxidase. Treatment of cells with allopurinol, an inhibitor of xanthine oxidase, inhibited berberine-induced oxidative stress in cancer cells. Berberine-induced apoptosis was blocked in the presence of antioxidant, N-acetylcysteine, through the prevention of disruption of mitochondrial membrane potential and subsequently release of cytochrome c and Smac/DIABLO. In conclusion, the present study reveals that the berberine-mediated cell death of human prostate cancer cells is regulated by reactive oxygen species, and therefore suggests that berberine may be considered for further studies as a promising therapeutic candidate for prostate cancer.

  1. Abrogation of prostaglandin E-EP4 signaling in osteoblasts prevents the bone destruction induced by human prostate cancer metastases.

    PubMed

    Watanabe, Kenta; Tominari, Tsukasa; Hirata, Michiko; Matsumoto, Chiho; Maruyama, Takayuki; Murphy, Gillian; Nagase, Hideaki; Miyaura, Chisato; Inada, Masaki

    2016-09-01

    The metastasis of tumors to bone is known to be promoted by prostaglandin E2 (PGE2) produced by the tumor host stromal tissue. Although bone metastases frequently occur in prostate cancer patients, the significance of PGE2 in stromal responses to the tumor is not known. In this study, we report that PGE2 and its receptor EP4 play a pivotal role in bone destruction and metastasis in an experimental metastasis model of prostate cancer in nude mice. Using human prostate cancer PC-3 cells that are stably transfected with luciferase, we showed that the development of bone metastasis was accompanied by increased osteoclastic bone resorption in the bone metastasis microenvironment, and could be abrogated by an EP4 receptor antagonist. The growth of PC-3 cells in vitro was not influenced by PGE2 or by the EP4 receptor. However, cell-cell interactions between fixed PC-3 cells and host osteoblasts induced PGE2 production and RANKL expression in the osteoblasts. Addition of an EP4 antagonist suppressed both PGE2 and RANKL expression induced by the PC3-osteoblast interaction, which would have consequent effects on osteoclast activation and osteolysis. These results indicate that the blockage of PGE2-EP4 signaling prevents the bone destruction required for prostate cancer metastases, and that this is, in part due to the abrogation of bone cell responses. The study provides further evidence that an EP4 antagonist is a candidate for the treatment of prostate cancer in the blockade of bone metastasis. PMID:27450806

  2. Frequency domain optical tomography in human tissue

    NASA Astrophysics Data System (ADS)

    Yao, Yuqi; Wang, Yao; Pei, Yaling; Zhu, Wenwu; Hu, Jenhun; Barbour, Randall L.

    1995-10-01

    In this paper, a reconstruction algorithm for frequency-domain optical tomography in human tissue is presented. A fast and efficient multigrid finite difference (MGFD) method is adopted as a forward solver to obtain the simulated detector responses and the required imaging operator. The solutions obtained form MGFD method for 3D problems with weakly discontinuous cocoefficients are compared with analyzed solutions to determine the accuracy of the numerical method. Simultaneous reconstruction of both absorption and scattering coefficients for tissue-like media is accomplished by solving a perturbation equation using the Born approximation. This solution is obtained by a conjugate gradient descent method with Tikhonov regularization. Two examples are given to show the quality of the reconstruction results. Both involve the examination of anatomically accurate optical models of tissue derived from segmented 3D magnetic resonance images to which have been assigned optical coefficients to the designated tissue types. One is a map of a female breast containing two small 'added pathologies', such as tumors. The other is a map of the brain containing a 'local bleeding' area, representing a hemorrhage. The reconstruction results show that the algorithm is computationally practical and can yield qualitatively correct geometry of the objects embedded in the simulated human tissue. Acceptable results are obtaiend even when 10% noise is present in the data.

  3. The diet as a cause of human prostate cancer.

    PubMed

    Nelson, William G; Demarzo, Angelo M; Yegnasubramanian, Srinivasan

    2014-01-01

    Asymptomatic prostate inflammation and prostate cancer have reached epidemic proportions among men in the developed world. Animal model studies implicate dietary carcinogens, such as the heterocyclic amines from over-cooked meats and sex steroid hormones, particularly estrogens, as candidate etiologies for prostate cancer. Each acts by causing epithelial cell damage, triggering an inflammatory response that can evolve into a chronic or recurrent condition. This milieu appears to spawn proliferative inflammatory atrophy (PIA) lesions, a type of focal atrophy that represents the earliest of prostate cancer precursor lesions. Rare PIA lesions contain cells which exhibit high c-Myc expression, shortened telomere segments, and epigenetic silencing of genes such as GSTP1, encoding the π-class glutathione S-transferase, all characteristic of prostatic intraepithelial neoplasia (PIN) and prostate cancer. Subsequent genetic changes, such as the gene translocations/deletions that generate fusion transcripts between androgen-regulated genes (such as TMPRSS2) and genes encoding ETS family transcription factors (such as ERG1), arise in PIN lesions and may promote invasiveness characteristic of prostatic adenocarcinoma cells. Lethal prostate cancers contain markedly corrupted genomes and epigenomes. Epigenetic silencing, which seems to arise in response to the inflamed microenvironment generated by dietary carcinogens and/or estrogens as part of an epigenetic "catastrophe" affecting hundreds of genes, persists to drive clonal evolution through metastatic dissemination. The cause of the initial epigenetic "catastrophe" has not been determined but likely involves defective chromatin structure maintenance by over-exuberant DNA methylation or histone modification. With dietary carcinogens and estrogens driving pro-carcinogenic inflammation in the developed world, it is tempting to speculate that dietary components associated with decreased prostate cancer risk, such as intake of

  4. Expression of interleukin-17RC protein in normal human tissues

    PubMed Central

    Ge, Dongxia; You, Zongbing

    2008-01-01

    Background Interleukin-17 (IL-17) cytokines and receptors play an important role in many autoimmune and inflammatory diseases. IL-17 receptors IL-17RA and IL-17RC have been found to form a heterodimer for mediating the signals of IL-17A and IL-17F cytokines. While the function and signaling pathway of IL-17RA has been revealed, IL-17RC has not been well characterized. The function and signaling pathway of IL-17RC remain largely unknown. The purpose of the present study was to systematically examine IL-17RC protein expression in 53 human tissues. Results IL-17RC expression in 51 normal human tissues and two benign tumors (i.e., lymphangioma and parathyroid adenoma) on the tissue microarrays was determined by immunohistochemical staining, using two polyclonal antibodies against IL-17RC. IL-17RC protein was expressed in many cell types including the myocardial cells, vascular and lymphatic endothelial cells, glandular cells (of the adrenal, parathyroid, pituitary, thyroid, pancreas, parotid salivary, and subepidermal glands), epithelial cells (of the esophagus, stomach, intestine, anus, renal tubule, breast, cervix, Fallopian tube, epididymis, seminal vesicle, prostate, gallbladder, bronchus, lung, and skin), oocytes in the ovary, Sertoli cells in the testis, motor neurons in the spinal cord, autonomic ganglia and nerves in the intestine, skeletal muscle cells, adipocytes, articular chondrocytes, and synovial cells. High levels of IL-17RC protein expression were observed in most vascular and lymphatic endothelium and squamous epithelium. The epithelium of the breast, cervix, Fallopian tube, kidney, bladder and bronchus also expressed high levels of IL-17RC, so did the glandular cells in the adrenal cortex, parotid salivary and subepidermal glands. In contrast, IL-17RC protein was not detectable in the smooth muscle cells, fibroblasts, antral mucosa of the stomach, mucosa of the colon, endometrium of the uterus, neurons of the brain, hepatocytes, or lymphocytes

  5. Iterative multiple reference tissue method for estimating pharmacokinetic parameters on prostate DCE MRI

    NASA Astrophysics Data System (ADS)

    Ginsburg, Shoshana B.; Bloch, B. Nicolas; Rofsky, Neil M.; Genega, Elizabeth M.; Lenkinski, Robert E.; Madabhushi, Anant

    2013-02-01

    Pharmacokinetic (PK) parameters are probes of tissue status that can be assessed by analysis of dynamic contrast-enhanced (DCE) MRI and are useful for prostate cancer (CaP) detection and grading. Traditionally, PK analysis requires knowledge of the time-resolved concentration of the contrast agent in the blood plasma, the arterial input function (AIF), which is typically estimated in an artery in the field-of-view (FOV). In cases when no suitable artery is present in the FOV, the multiple reference tissue method (MRTM) enables the estimation of PK parameters without the AIF by leveraging PK parameter values from the literature for a reference tissue in the FOV. Nevertheless, PK parameters estimated in the prostate vary significantly between patients. Consequently, population-based values obtained from the literature may introduce error into PK parameter estimation via MRTM. The objectives of this paper are two-fold. First we present a novel scheme, iterative MRTM (IMRTM), to estimate PK parameter values in the absence of the AIF without making assumptions about the PK constants associated with a reference tissue. Then, using IMRTM we investigate differences in PK constants between CaP in the peripheral zone (PZ) and CaP in the central gland (CG), as CG and PZ CaP have previously been shown to differ significantly in terms of both texture and prognosis. We apply IMRTM to 15 patients with CaP in either the CG or the PZ who were scheduled for a radical prostatectomy and a pre-operative MRI. Values for the PK parameters Ktrans and ve estimated via IMRTM average 0.29 and 0.60 for normal central gland (CG), 0.29 and 0.64 for normal peripheral zone (PZ), and 0.30 and 0.53 for CaP. It is noteworthy that PK constants estimated in PZ CaP are significantly higher than those estimated in CG CaP (p < 0:05). While both MRTM and IMRTM provide PK parameter values that are biologically feasible, IMRTM has the advantage that it invokes patient-specific information rather than

  6. Exogenous fatty acid binding protein 4 promotes human prostate cancer cell progression.

    PubMed

    Uehara, Hisanori; Takahashi, Tetsuyuki; Oha, Mina; Ogawa, Hirohisa; Izumi, Keisuke

    2014-12-01

    Epidemiologic studies have found that obesity is associated with malignant grade and mortality in prostate cancer. Several adipokines have been implicated as putative mediating factors between obesity and prostate cancer. Fatty acid binding protein 4 (FABP4), a member of the cytoplasmic fatty acid binding protein multigene family, was recently identified as a novel adipokine. Although FABP4 is released from adipocytes and mean circulating concentrations of FABP4 are linked with obesity, effects of exogenous FABP4 on prostate cancer progression are unclear. In this study, we examined the effects of exogenous FABP4 on human prostate cancer cell progression. FABP4 treatment promoted serum-induced prostate cancer cell invasion in vitro. Furthermore, oleic acid promoted prostate cancer cell invasion only if FABP4 was present in the medium. These promoting effects were reduced by FABP4 inhibitor, which inhibits FABP4 binding to fatty acids. Immunostaining for FABP4 showed that exogenous FABP4 was taken up into DU145 cells in three-dimensional culture. In mice, treatment with FABP4 inhibitor reduced the subcutaneous growth and lung metastasis of prostate cancer cells. Immunohistochemical analysis showed that the number of apoptotic cells, positive for cleaved caspase-3 and cleaved PARP, was increased in subcutaneous tumors of FABP4 inhibitor-treated mice, as compared with control mice. These results suggest that exogenous FABP4 might promote human prostate cancer cell progression by binding with fatty acids. Additionally, exogenous FABP4 activated the PI3K/Akt pathway, independently of binding to fatty acids. Thus, FABP4 might be a key molecule to understand the mechanisms underlying the obesity-prostate cancer progression link. PMID:24740818

  7. Co-Targeting Prostate Cancer Epithelium and Bone Stroma by Human Osteonectin-Promoter–Mediated Suicide Gene Therapy Effectively Inhibits Androgen-Independent Prostate Cancer Growth

    PubMed Central

    Sung, Shian-Ying; Chang, Junn-Liang; Chen, Kuan-Chou; Yeh, Shauh-Der; Liu, Yun-Ru; Su, Yen-Hao; Hsueh, Chia-Yen; Chung, Leland W. K.; Hsieh, Chia-Ling

    2016-01-01

    Stromal-epithelial interaction has been shown to promote local tumor growth and distant metastasis. We sought to create a promising gene therapy approach that co-targets cancer and its supporting stromal cells for combating castration-resistant prostate tumors. Herein, we demonstrated that human osteonectin is overexpressed in the prostate cancer epithelium and tumor stroma in comparison with their normal counterpart. We designed a novel human osteonectin promoter (hON-522E) containing positive transcriptional regulatory elements identified in both the promoter and exon 1 region of the human osteonectin gene. In vitro reporter assays revealed that the hON-522E promoter is highly active in androgen receptor negative and metastatic prostate cancer and bone stromal cells compared to androgen receptor-positive prostate cancer cells. Moreover, in vivo prostate-tumor–promoting activity of the hON-522E promoter was confirmed by intravenous administration of an adenoviral vector containing the hON-522E promoter-driven luciferase gene (Ad-522E-Luc) into mice bearing orthotopic human prostate tumor xenografts. In addition, an adenoviral vector with the hON-522E-promoter–driven herpes simplex virus thymidine kinase gene (Ad-522E-TK) was highly effective against the growth of androgen-independent human prostate cancer PC3M and bone stromal cell line in vitro and in pre-established PC3M tumors in vivo upon addition of the prodrug ganciclovir. Because of the heterogeneity of human prostate tumors, hON-522E promoter-mediated gene therapy has the potential for the treatment of hormone refractory and bone metastatic prostate cancers. PMID:27054343

  8. Co-Targeting Prostate Cancer Epithelium and Bone Stroma by Human Osteonectin-Promoter-Mediated Suicide Gene Therapy Effectively Inhibits Androgen-Independent Prostate Cancer Growth.

    PubMed

    Sung, Shian-Ying; Chang, Junn-Liang; Chen, Kuan-Chou; Yeh, Shauh-Der; Liu, Yun-Ru; Su, Yen-Hao; Hsueh, Chia-Yen; Chung, Leland W K; Hsieh, Chia-Ling

    2016-01-01

    Stromal-epithelial interaction has been shown to promote local tumor growth and distant metastasis. We sought to create a promising gene therapy approach that co-targets cancer and its supporting stromal cells for combating castration-resistant prostate tumors. Herein, we demonstrated that human osteonectin is overexpressed in the prostate cancer epithelium and tumor stroma in comparison with their normal counterpart. We designed a novel human osteonectin promoter (hON-522E) containing positive transcriptional regulatory elements identified in both the promoter and exon 1 region of the human osteonectin gene. In vitro reporter assays revealed that the hON-522E promoter is highly active in androgen receptor negative and metastatic prostate cancer and bone stromal cells compared to androgen receptor-positive prostate cancer cells. Moreover, in vivo prostate-tumor-promoting activity of the hON-522E promoter was confirmed by intravenous administration of an adenoviral vector containing the hON-522E promoter-driven luciferase gene (Ad-522E-Luc) into mice bearing orthotopic human prostate tumor xenografts. In addition, an adenoviral vector with the hON-522E-promoter-driven herpes simplex virus thymidine kinase gene (Ad-522E-TK) was highly effective against the growth of androgen-independent human prostate cancer PC3M and bone stromal cell line in vitro and in pre-established PC3M tumors in vivo upon addition of the prodrug ganciclovir. Because of the heterogeneity of human prostate tumors, hON-522E promoter-mediated gene therapy has the potential for the treatment of hormone refractory and bone metastatic prostate cancers. PMID:27054343

  9. Exophytic benign prostatic hyperplasia.

    PubMed

    Blaschko, Sarah D; Eisenberg, Michael L

    2011-08-01

    A 60-year-old man had incidental finding of a multilobular 8 × 7 × 7-cm mass identified posterior to the urinary bladder in continuity with the prostate. The man's prostate-specific antigen was 1.87, and he denied any lower urinary tract symptoms. A transrectal ultrasound-guided biopsy demonstrated benign prostatic tissue. A computed tomography-guided needle aspiration demonstrated a benign epithelium-lined cyst, likely prostatic in origin. Benign prostatic hyperplasia is a proliferation of prostatic epithelial and stromal cells. Although prostatic hyperplasia is usually restricted to the prostate gland, hyperplastic nodules occasionally protrude outside the prostate and rarely form exophytic pelvic masses. PMID:20869104

  10. Engineering tissue from human embryonic stem cells

    PubMed Central

    Metallo, CM; Azarin, SM; Ji, L; De Pablo, JJ; Palecek, SP

    2008-01-01

    Abstract Recent advances in human embryonic stem cell (hESC) biology now offer an alternative cell source for tissue engineers, as these cells are capable of proliferating indefinitely and differentiating to many clinically relevant cell types. Novel culture methods capable of exerting spatial and temporal control over the stem cell microenvironment allow for more efficient expansion of hESCs, and significant advances have been made toward improving our understanding of the biophysical and biochemical cues that direct stem cell fate choices. Effective production of lineage specific progenitors or terminally differentiated cells enables researchers to incorporate hESC derivatives into engineered tissue constructs. Here, we describe current efforts using hESCs as a cell source for tissue engineering applications, highlighting potential advantages of hESCs over current practices as well as challenges which must be overcome. PMID:18194458