Science.gov

Sample records for human transcription factors

  1. Circuitry and dynamics of human transcription factor regulatory networks

    PubMed Central

    Neph, Shane; Stergachis, Andrew B.; Reynolds, Alex; Sandstrom, Richard; Borenstein, Elhanan; Stamatoyannopoulos, John A.

    2012-01-01

    SUMMARY The combinatorial cross-regulation of hundreds of sequence-specific transcription factors defines a regulatory network that underlies cellular identity and function. Here we use genome-wide maps of in vivo DNaseI footprints to assemble an extensive core human regulatory network comprising connections among 475 sequence-specific transcription factors, and to analyze the dynamics of these connections across 41 diverse cell and tissue types. We find that human transcription factor networks are highly cell-selective and are driven by cohorts of factors that include regulators with previously unrecognized roles in control of cellular identity. Moreover, we identify many widely expressed factors that impact transcriptional regulatory networks in a cell-selective manner. Strikingly, in spite of their inherent diversity, all cell type regulatory networks independently converge on a common architecture that closely resembles the topology of living neuronal networks. Together, our results provide the first description of the circuitry, dynamics, and organizing principles of the human transcription factor regulatory network. PMID:22959076

  2. TFCat: the curated catalog of mouse and human transcription factors

    PubMed Central

    Fulton, Debra L; Sundararajan, Saravanan; Badis, Gwenael; Hughes, Timothy R; Wasserman, Wyeth W; Roach, Jared C; Sladek, Rob

    2009-01-01

    Unravelling regulatory programs governed by transcription factors (TFs) is fundamental to understanding biological systems. TFCat is a catalog of mouse and human TFs based on a reliable core collection of annotations obtained by expert review of the scientific literature. The collection, including proven and homology-based candidate TFs, is annotated within a function-based taxonomy and DNA-binding proteins are organized within a classification system. All data and user-feedback mechanisms are available at the TFCat portal . PMID:19284633

  3. Structural characterization of human general transcription factor TFIIF in solution

    PubMed Central

    Akashi, Satoko; Nagakura, Shinjiro; Yamamoto, Seiji; Okuda, Masahiko; Ohkuma, Yoshiaki; Nishimura, Yoshifumi

    2008-01-01

    Human general transcription factor IIF (TFIIF), a component of the transcription pre-initiation complex (PIC) associated with RNA polymerase II (Pol II), was characterized by size-exclusion chromatography (SEC), electrospray ionization mass spectrometry (ESI-MS), and chemical cross-linking. Recombinant TFIIF, composed of an equimolar ratio of α and β subunits, was bacterially expressed, purified to homogeneity, and found to have a transcription activity similar to a natural one in the human in vitro transcription system. SEC of purified TFIIF, as previously reported, suggested that this protein has a size >200 kDa. In contrast, ESI-MS of the purified sample gave a molecular size of 87 kDa, indicating that TFIIF is an αβ heterodimer, which was confirmed by matrix-assisted laser desorption/ionization (MALDI) MS of the cross-linked TFIIF components. Recent electron microscopy (EM) and photo-cross-linking studies showed that the yeast TFIIF homolog containing Tfg1 and Tfg2, corresponding to the human α and β subunits, exists as a heterodimer in the PIC, so the human TFIIF is also likely to exist as a heterodimer even in the PIC. In the yeast PIC, EM and photo-cross-linking studies showed different results for the mutual location of TFIIE and TFIIF along DNA. We have examined the direct interaction between human TFIIF and TFIIE by ESI-MS, SEC, and chemical cross-linking; however, no direct interaction was observed, at least in solution. This is consistent with the previous photo-cross-linking observation that TFIIF and TFIIE flank DNA separately on both sides of the Pol II central cleft in the yeast PIC. PMID:18218714

  4. DNA methylation presents distinct binding sites for human transcription factors

    PubMed Central

    Hu, Shaohui; Wan, Jun; Su, Yijing; Song, Qifeng; Zeng, Yaxue; Nguyen, Ha Nam; Shin, Jaehoon; Cox, Eric; Rho, Hee Sool; Woodard, Crystal; Xia, Shuli; Liu, Shuang; Lyu, Huibin; Ming, Guo-Li; Wade, Herschel; Song, Hongjun; Qian, Jiang; Zhu, Heng

    2013-01-01

    DNA methylation, especially CpG methylation at promoter regions, has been generally considered as a potent epigenetic modification that prohibits transcription factor (TF) recruitment, resulting in transcription suppression. Here, we used a protein microarray-based approach to systematically survey the entire human TF family and found numerous purified TFs with methylated CpG (mCpG)-dependent DNA-binding activities. Interestingly, some TFs exhibit specific binding activity to methylated and unmethylated DNA motifs of distinct sequences. To elucidate the underlying mechanism, we focused on Kruppel-like factor 4 (KLF4), and decoupled its mCpG- and CpG-binding activities via site-directed mutagenesis. Furthermore, KLF4 binds specific methylated or unmethylated motifs in human embryonic stem cells in vivo. Our study suggests that mCpG-dependent TF binding activity is a widespread phenomenon and provides a new framework to understand the role and mechanism of TFs in epigenetic regulation of gene transcription. DOI: http://dx.doi.org/10.7554/eLife.00726.001 PMID:24015356

  5. DNA methylation presents distinct binding sites for human transcription factors.

    PubMed

    Hu, Shaohui; Wan, Jun; Su, Yijing; Song, Qifeng; Zeng, Yaxue; Nguyen, Ha Nam; Shin, Jaehoon; Cox, Eric; Rho, Hee Sool; Woodard, Crystal; Xia, Shuli; Liu, Shuang; Lyu, Huibin; Ming, Guo-Li; Wade, Herschel; Song, Hongjun; Qian, Jiang; Zhu, Heng

    2013-01-01

    DNA methylation, especially CpG methylation at promoter regions, has been generally considered as a potent epigenetic modification that prohibits transcription factor (TF) recruitment, resulting in transcription suppression. Here, we used a protein microarray-based approach to systematically survey the entire human TF family and found numerous purified TFs with methylated CpG (mCpG)-dependent DNA-binding activities. Interestingly, some TFs exhibit specific binding activity to methylated and unmethylated DNA motifs of distinct sequences. To elucidate the underlying mechanism, we focused on Kruppel-like factor 4 (KLF4), and decoupled its mCpG- and CpG-binding activities via site-directed mutagenesis. Furthermore, KLF4 binds specific methylated or unmethylated motifs in human embryonic stem cells in vivo. Our study suggests that mCpG-dependent TF binding activity is a widespread phenomenon and provides a new framework to understand the role and mechanism of TFs in epigenetic regulation of gene transcription. DOI:http://dx.doi.org/10.7554/eLife.00726.001. PMID:24015356

  6. Transcription factor induction of human oligodendrocyte progenitor fate and differentiation.

    PubMed

    Wang, Jing; Pol, Suyog U; Haberman, Alexa K; Wang, Chunming; O'Bara, Melanie A; Sim, Fraser J

    2014-07-15

    Human oligodendrocyte progenitor cell (OPC) specification and differentiation occurs slowly and limits the potential for cell-based treatment of demyelinating disease. In this study, using FACS-based isolation and microarray analysis, we identified a set of transcription factors expressed by human primary CD140a(+)O4(+) OPCs relative to CD133(+)CD140a(-) neural stem/progenitor cells (NPCs). Among these, lentiviral overexpression of transcription factors ASCL1, SOX10, and NKX2.2 in NPCs was sufficient to induce Sox10 enhancer activity, OPC mRNA, and protein expression consistent with OPC fate; however, unlike ASCL1 and NKX2.2, only the transcriptome of SOX10-infected NPCs was induced to a human OPC gene expression signature. Furthermore, only SOX10 promoted oligodendrocyte commitment, and did so at quantitatively equivalent levels to native OPCs. In xenografts of shiverer/rag2 animals, SOX10 increased the rate of mature oligodendrocyte differentiation and axon ensheathment. Thus, SOX10 appears to be the principle and rate-limiting regulator of myelinogenic fate from human NPCs. PMID:24982138

  7. Transcription factor induction of human oligodendrocyte progenitor fate and differentiation

    PubMed Central

    Wang, Jing; Pol, Suyog U.; Haberman, Alexa K.; Wang, Chunming; O’Bara, Melanie A.; Sim, Fraser J.

    2014-01-01

    Human oligodendrocyte progenitor cell (OPC) specification and differentiation occurs slowly and limits the potential for cell-based treatment of demyelinating disease. In this study, using FACS-based isolation and microarray analysis, we identified a set of transcription factors expressed by human primary CD140a+O4+ OPCs relative to CD133+CD140a− neural stem/progenitor cells (NPCs). Among these, lentiviral overexpression of transcription factors ASCL1, SOX10, and NKX2.2 in NPCs was sufficient to induce Sox10 enhancer activity, OPC mRNA, and protein expression consistent with OPC fate; however, unlike ASCL1 and NKX2.2, only the transcriptome of SOX10-infected NPCs was induced to a human OPC gene expression signature. Furthermore, only SOX10 promoted oligodendrocyte commitment, and did so at quantitatively equivalent levels to native OPCs. In xenografts of shiverer/rag2 animals, SOX10 increased the rate of mature oligodendrocyte differentiation and axon ensheathment. Thus, SOX10 appears to be the principle and rate-limiting regulator of myelinogenic fate from human NPCs. PMID:24982138

  8. Transcription factor binding predicts histone modifications in human cell lines

    PubMed Central

    Benveniste, Dan; Sonntag, Hans-Joachim; Sanguinetti, Guido; Sproul, Duncan

    2014-01-01

    Gene expression in higher organisms is thought to be regulated by a complex network of transcription factor binding and chromatin modifications, yet the relative importance of these two factors remains a matter of debate. Here, we show that a computational approach allows surprisingly accurate prediction of histone modifications solely from knowledge of transcription factor binding both at promoters and at potential distal regulatory elements. This accuracy significantly and substantially exceeds what could be achieved by using DNA sequence as an input feature. Remarkably, we show that transcription factor binding enables strikingly accurate predictions across different cell lines. Analysis of the relative importance of specific transcription factors as predictors of specific histone marks recapitulated known interactions between transcription factors and histone modifiers. Our results demonstrate that reported associations between histone marks and gene expression may be indirect effects caused by interactions between transcription factors and histone-modifying complexes. PMID:25187560

  9. Human transcription factors contain a high fraction of intrinsically disordered regions essential for transcriptional regulation.

    PubMed

    Minezaki, Yoshiaki; Homma, Keiichi; Kinjo, Akira R; Nishikawa, Ken

    2006-06-16

    Human transcriptional regulation factors, such as activators, repressors, and enhancer-binding factors are quite different from their prokaryotic counterparts in two respects: the average sequence in human is more than twice as long as that in prokaryotes, while the fraction of sequence aligned to domains of known structure is 31% in human transcription factors (TFs), less than half of that in bacterial TFs (72%). Intrinsically disordered (ID) regions were identified by a disorder-prediction program, and were found to be in good agreement with available experimental data. Analysis of 401 human TFs with experimental evidence from the Swiss-Prot database showed that as high as 49% of the entire sequence of human TFs is occupied by ID regions. More than half of the human TFs consist of a small DNA binding domain (DBD) and long ID regions frequently sandwiching unassigned regions. The remaining TFs have structural domains in addition to DBDs and ID regions. Experimental studies, particularly those with NMR, revealed that the transactivation domains in unbound TFs are usually unstructured, but become structured upon binding to their partners. The sequences of human and mouse TF orthologues are 90.5% identical despite a high incidence of ID regions, probably reflecting important functional roles played by ID regions. In general ID regions occupy a high fraction in TFs of eukaryotes, but not in prokaryotes. Implications of this dichotomy are discussed in connection with their functional roles in transcriptional regulation and evolution. PMID:16697407

  10. The CREB Transcription Factor Controls Transcriptional Activity of the Human RIC8B Gene.

    PubMed

    Maureira, Alejandro; Sánchez, Rodolfo; Valenzuela, Nicole; Torrejón, Marcela; Hinrichs, María V; Olate, Juan; Gutiérrez, José L

    2016-08-01

    Proper regulation of gene expression is essential for normal development, cellular growth, and differentiation. Differential expression profiles of mRNA coding for vertebrate Ric-8B during embryo and adult stages have been observed. In addition, Ric-8B is expressed in few cerebral nuclei subareas. These facts point to a dynamic control of RIC8B gene expression. In order to understand the transcriptional regulation of this gene, we searched for cis-elements in the sequence of the human RIC8B promoter region, identifying binding sites for the basic/leucine zipper (bZip) CREB transcription factor family (CRE sites) and C/EBP transcription factor family (C/EBP sites). CRE sites were found clustered near the transcription start site, while the C/EBP sites were found clustered at around 300 bp upstream the CRE sites. Here, we demonstrate the ability of CREB1 and C/EBPβ to bind their respective elements identified in the RIC8B promoter. Comparative protein-DNA interaction analyses revealed only the proximal elements as high affinity sites for CREB1 and only the distal elements as high affinity sites for C/EBPβ. Chromatin immunoprecipitation analyses, carried out using a human neuroblastoma cell line, confirmed the preferential association of CREB to the proximal region of the RIC8B promoter. By performing luciferase reporter assays, we found the CRE sites as the most relevant elements for its transcriptional activity. Taken together, these data show the existence of functional CREB and C/EBP binding sites in the human RIC8B gene promoter, a particular distribution of these sites and demonstrate a relevant role of CREB in stimulating transcriptional activity of this gene. J. Cell. Biochem. 117: 1797-1805, 2016. © 2016 Wiley Periodicals, Inc. PMID:26729411

  11. Human Lineage-Specific Transcriptional Regulation through GA-Binding Protein Transcription Factor Alpha (GABPa).

    PubMed

    Perdomo-Sabogal, Alvaro; Nowick, Katja; Piccini, Ilaria; Sudbrak, Ralf; Lehrach, Hans; Yaspo, Marie-Laure; Warnatz, Hans-Jörg; Querfurth, Robert

    2016-05-01

    A substantial fraction of phenotypic differences between closely related species are likely caused by differences in gene regulation. While this has already been postulated over 30 years ago, only few examples of evolutionary changes in gene regulation have been verified. Here, we identified and investigated binding sites of the transcription factor GA-binding protein alpha (GABPa) aiming to discover cis-regulatory adaptations on the human lineage. By performing chromatin immunoprecipitation-sequencing experiments in a human cell line, we found 11,619 putative GABPa binding sites. Through sequence comparisons of the human GABPa binding regions with orthologous sequences from 34 mammals, we identified substitutions that have resulted in 224 putative human-specific GABPa binding sites. To experimentally assess the transcriptional impact of those substitutions, we selected four promoters for promoter-reporter gene assays using human and African green monkey cells. We compared the activities of wild-type promoters to mutated forms, where we have introduced one or more substitutions to mimic the ancestral state devoid of the GABPa consensus binding sequence. Similarly, we introduced the human-specific substitutions into chimpanzee and macaque promoter backgrounds. Our results demonstrate that the identified substitutions are functional, both in human and nonhuman promoters. In addition, we performed GABPa knock-down experiments and found 1,215 genes as strong candidates for primary targets. Further analyses of our data sets link GABPa to cognitive disorders, diabetes, KRAB zinc finger (KRAB-ZNF), and human-specific genes. Thus, we propose that differences in GABPa binding sites played important roles in the evolution of human-specific phenotypes. PMID:26814189

  12. Human Lineage-Specific Transcriptional Regulation through GA-Binding Protein Transcription Factor Alpha (GABPa)

    PubMed Central

    Perdomo-Sabogal, Alvaro; Nowick, Katja; Piccini, Ilaria; Sudbrak, Ralf; Lehrach, Hans; Yaspo, Marie-Laure; Warnatz, Hans-Jörg; Querfurth, Robert

    2016-01-01

    A substantial fraction of phenotypic differences between closely related species are likely caused by differences in gene regulation. While this has already been postulated over 30 years ago, only few examples of evolutionary changes in gene regulation have been verified. Here, we identified and investigated binding sites of the transcription factor GA-binding protein alpha (GABPa) aiming to discover cis-regulatory adaptations on the human lineage. By performing chromatin immunoprecipitation-sequencing experiments in a human cell line, we found 11,619 putative GABPa binding sites. Through sequence comparisons of the human GABPa binding regions with orthologous sequences from 34 mammals, we identified substitutions that have resulted in 224 putative human-specific GABPa binding sites. To experimentally assess the transcriptional impact of those substitutions, we selected four promoters for promoter-reporter gene assays using human and African green monkey cells. We compared the activities of wild-type promoters to mutated forms, where we have introduced one or more substitutions to mimic the ancestral state devoid of the GABPa consensus binding sequence. Similarly, we introduced the human-specific substitutions into chimpanzee and macaque promoter backgrounds. Our results demonstrate that the identified substitutions are functional, both in human and nonhuman promoters. In addition, we performed GABPa knock-down experiments and found 1,215 genes as strong candidates for primary targets. Further analyses of our data sets link GABPa to cognitive disorders, diabetes, KRAB zinc finger (KRAB-ZNF), and human-specific genes. Thus, we propose that differences in GABPa binding sites played important roles in the evolution of human-specific phenotypes. PMID:26814189

  13. Domain structure of a human general transcription initiation factor, TFIIF.

    PubMed Central

    Yonaha, M; Aso, T; Kobayashi, Y; Vasavada, H; Yasukochi, Y; Weissman, S M; Kitajima, S

    1993-01-01

    The structural and functional domains of a general transcription initiation factor, TFIIF (RAP30/74, FC), have been investigated using various deletion mutants of each subunit, both in vivo and in vitro. An in vivo assay showed that the N-terminal sequence containing residues of 1-110 of RAP30 that is located close to a sigma homology region interacts with a minimum sequence of residues 62-171 of RAP74 to form a heteromeric interaction. Reconstitution of in vitro transcription activity by deletion mutants of RAP74 clearly indicated that both N-terminal residues 73-205 and C-terminal residues 356-517 are essential for full activity, the former interacting with RAP30, thus complexing with RNA polymerase II. From these data, the functional significance of domain structure of TFIIF is discussed in terms of its sigma homology sequences and complex formation with RNA polymerase II in the initiation and elongation of transcription. Images PMID:8441635

  14. The mesenchymal transcription factor SNAI-1 instructs human liver specification.

    PubMed

    Goldman, Orit; Valdes, Victor Julian; Ezhkova, Elena; Gouon-Evans, Valerie

    2016-07-01

    Epithelial-mesenchymal transition (EMT) and the mesenchymal-epithelial transition (MET) are processes required for embryo organogenesis. Liver develops from the epithelial foregut endoderm from which the liver progenitors, hepatoblasts, are specified. The migrating hepatoblasts acquire a mesenchymal phenotype to form the liver bud. In mid-gestation, hepatoblasts mature into epithelial structures: the hepatocyte cords and biliary ducts. While EMT has been associated with liver bud formation, nothing is known about its contribution to hepatic specification. We previously established an efficient protocol from human embryonic stem cells (hESC) to generate hepatic cells (Hep cells) resembling the hepatoblasts expressing alpha-fetoprotein (AFP) and albumin (ALB). Here we show that Hep cells express both epithelial (EpCAM and E-cadherin) and mesenchymal (vimentin and SNAI-1) markers. Similar epithelial and mesenchymal hepatoblasts were identified in human and mouse fetal livers, suggesting a conserved interspecies phenotype. Knock-down experiments demonstrated the importance of SNAI-1 in Hep cell hepatic specification. Moreover, ChIP assays revealed direct binding of SNAI-1 in the promoters of AFP and ALB genes consistent with its transcriptional activator function in hepatic specification. Altogether, our hESC-derived Hep cell cultures reveal the dual mesenchymal and epithelial phenotype of hepatoblast-like cells and support the unexpected transcriptional activator role of SNAI-1 in hepatic specification. PMID:27240252

  15. Functional Analyses of Transcription Factor Binding Sites that Differ between Present-Day and Archaic Humans.

    PubMed

    Weyer, Sven; Pääbo, Svante

    2016-02-01

    We analyze 25 previously identified transcription factor binding sites that carry DNA sequence changes that are present in all or nearly all present-day humans, yet occur in the ancestral state in Neandertals and Denisovans, the closest evolutionary relatives of humans. When the ancestral and derived forms of the transcription factor binding sites are tested using reporter constructs in 3 neuronal cell lines, the activity of 12 of the derived versions of transcription factor binding sites differ from the respective ancestral variants. This suggests that the majority of this class of evolutionary differences between modern humans and Neandertals may affect gene expression in at least some tissue or cell type. PMID:26454764

  16. Functional Analyses of Transcription Factor Binding Sites that Differ between Present-Day and Archaic Humans

    PubMed Central

    Weyer, Sven; Pääbo, Svante

    2016-01-01

    We analyze 25 previously identified transcription factor binding sites that carry DNA sequence changes that are present in all or nearly all present-day humans, yet occur in the ancestral state in Neandertals and Denisovans, the closest evolutionary relatives of humans. When the ancestral and derived forms of the transcription factor binding sites are tested using reporter constructs in 3 neuronal cell lines, the activity of 12 of the derived versions of transcription factor binding sites differ from the respective ancestral variants. This suggests that the majority of this class of evolutionary differences between modern humans and Neandertals may affect gene expression in at least some tissue or cell type. PMID:26454764

  17. Technical Advance: Transcription factor, promoter, and enhancer utilization in human myeloid cells

    PubMed Central

    Joshi, Anagha; Pooley, Christopher; Freeman, Tom C.; Lennartsson, Andreas; Babina, Magda; Schmidl, Christian; Geijtenbeek, Teunis; Michoel, Tom; Severin, Jessica; Itoh, Masayoshi; Lassmann, Timo; Kawaji, Hideya; Hayashizaki, Yoshihide; Carninci, Piero; Forrest, Alistair R. R.; Rehli, Michael; Hume, David A.

    2015-01-01

    The generation of myeloid cells from their progenitors is regulated at the level of transcription by combinatorial control of key transcription factors influencing cell-fate choice. To unravel the global dynamics of this process at the transcript level, we generated transcription profiles for 91 human cell types of myeloid origin by use of CAGE profiling. The CAGE sequencing of these samples has allowed us to investigate diverse aspects of transcription control during myelopoiesis, such as identification of novel transcription factors, miRNAs, and noncoding RNAs specific to the myeloid lineage. We further reconstructed a transcription regulatory network by clustering coexpressed transcripts and associating them with enriched cis-regulatory motifs. With the use of the bidirectional expression as a proxy for enhancers, we predicted over 2000 novel enhancers, including an enhancer 38 kb downstream of IRF8 and an intronic enhancer in the KIT gene locus. Finally, we highlighted relevance of these data to dissect transcription dynamics during progressive maturation of granulocyte precursors. A multifaceted analysis of the myeloid transcriptome is made available (www.myeloidome.roslin.ed.ac.uk). This high-quality dataset provides a powerful resource to study transcriptional regulation during myelopoiesis and to infer the likely functions of unannotated genes in human innate immunity. PMID:25717144

  18. Partial Conservation between Mice and Humans in Olfactory Bulb Interneuron Transcription Factor Codes

    PubMed Central

    Fujiwara, Nana; Cave, John W.

    2016-01-01

    The mammalian main olfactory bulb (OB) has a large population of GABAergic inhibitory interneurons that contains several subtypes defined by the co-expression other neurotransmitters and calcium binding proteins. The three most commonly studied OB interneuron subtypes co-express either Calretinin, Calbindin, or Tyrosine hydroxylase (Th). Combinations of transcription factors used to specify the phenotype of progenitors are referred to as transcription factor codes, and the current understanding of transcription factor codes that specify OB inhibitory neuron phenotypes are largely based on studies in mice. The conservation of these transcription factor codes in the human OB, however, has not been investigated. The aim of this study was to establish whether transcription factor codes in OB interneurons are conserved between mice and humans. This study compared the co-expression of Foxp2, Meis2, Pax6, and Sp8 transcription factors with Calretinin, Calbindin, or Th in human and mouse OB interneurons. This analysis found strong conservation of Calretinin co-expression with Sp8 and Meis2 as well as Th co-expression with Pax6 and Meis2. This analysis also showed that selective Foxp2 co-expression with Calbindin was conserved between mice and humans, which suggests Foxp2 is a novel determinant of the OB Calbindin interneuron phenotype. Together, the findings in this study provide insight into the conservation of transcription codes for OB interneuron phenotypes between humans and mice, as well as reveal some important differences between the species. This advance in our understanding of transcription factor codes in OB interneurons provides an important complement to the codes that have been established for other regions within the mammalian central nervous system, such as the cortex and spinal cord. PMID:27489533

  19. Partial Conservation between Mice and Humans in Olfactory Bulb Interneuron Transcription Factor Codes.

    PubMed

    Fujiwara, Nana; Cave, John W

    2016-01-01

    The mammalian main olfactory bulb (OB) has a large population of GABAergic inhibitory interneurons that contains several subtypes defined by the co-expression other neurotransmitters and calcium binding proteins. The three most commonly studied OB interneuron subtypes co-express either Calretinin, Calbindin, or Tyrosine hydroxylase (Th). Combinations of transcription factors used to specify the phenotype of progenitors are referred to as transcription factor codes, and the current understanding of transcription factor codes that specify OB inhibitory neuron phenotypes are largely based on studies in mice. The conservation of these transcription factor codes in the human OB, however, has not been investigated. The aim of this study was to establish whether transcription factor codes in OB interneurons are conserved between mice and humans. This study compared the co-expression of Foxp2, Meis2, Pax6, and Sp8 transcription factors with Calretinin, Calbindin, or Th in human and mouse OB interneurons. This analysis found strong conservation of Calretinin co-expression with Sp8 and Meis2 as well as Th co-expression with Pax6 and Meis2. This analysis also showed that selective Foxp2 co-expression with Calbindin was conserved between mice and humans, which suggests Foxp2 is a novel determinant of the OB Calbindin interneuron phenotype. Together, the findings in this study provide insight into the conservation of transcription codes for OB interneuron phenotypes between humans and mice, as well as reveal some important differences between the species. This advance in our understanding of transcription factor codes in OB interneurons provides an important complement to the codes that have been established for other regions within the mammalian central nervous system, such as the cortex and spinal cord. PMID:27489533

  20. Regulation of transcription of the human presenilin-1 gene by ets transcription factors and the p53 protooncogene.

    PubMed

    Pastorcic, M; Das, H K

    2000-11-10

    The expression of the human presenilin-1 cellular gene is suppressed by the p53 protooncogene. The rapid kinetic of the down-regulation has suggested that it may result from a primary mechanism. We show here that p53 also suppresses the transcription of a presenilin-1 promoter-chloramphenicol acetyltransferase reporter synthetic gene in transient infection assays in neuroblastoma (SK-N-SH) and hepatoma (HepG2) cell lines. Only a minimum promoter including sequences from -35 to + 6 from the transcription initiation is sufficient to confer down-regulation. We have previously defined a crucial DNA element controlling 90% of the expression of the gene within the same short area, and the identification of the transcription factors involved should also provide insights into the regulation of PS1 by p53. This region contains an Ets transcription factor binding motif, and a 2-base pair alteration within the core sequence (GGAA to TTAA) of the Ets consensus also reduced transcription by more than 90%. We now show that Ets1 and Ets2 indeed transactivate a PS1 promoter-chloramphenicol acetyltransferase reporter including the (-35 to +6) fragment. Furthermore, in vitro translated Ets2 binds specifically to the -10 Ets motif in electrophoretic mobility shift assays. Therefore, Ets1/2 factors bind specifically to the -10 Ets element and activate PS1 transcription. We also show that the coactivator p300 enhances the activation by Ets1 and Ets2 as well as the repression by p53. p300 is known to interact with p53 as well as with Ets1 and Ets2. We show that p53 does not bind directly to the PS1 promoter. Hence the repression of PS1 transcription by p53 is likely to be mediated through protein-protein interactions. PMID:10942770

  1. Alterations in transcription factor binding in radioresistant human melanoma cells after ionizing radiation

    SciTech Connect

    Sahijdak, W.M.; Yang, Chin-Rang; Zuckerman, J.S.; Meyers, M.; Boothman, D.A.

    1994-04-01

    We analyzed alterations in transcription factor binding to specific, known promoter DNA consensus sequences between irradiated and unirradiated radioresistant human melanoma (U1-Mel) cells. The goal of this study was to begin to investigate which transcription factors and DNA-binding sites are responsible for the induction of specific transcripts and proteins after ionizing radiation. Transcription factor binding was observed using DNA band-shift assays and oligonucleotide competition analyses. Confluence-arrested U1-Mel cells were irradiated (4.5 Gy) and harvested at 4 h. Double-stranded oligonucleotides containing known DNA-binding consensus sites for specific transcription factors were used. Increased DNA binding activity after ionizing radiation was noted with oligonucleotides containing the CREB, NF-kB and Sp1 consensus sites. No changes in protein binding to AP-1, AP-2, AP-3, or CTF/NF1, GRE or Oct-1 consensus sequences were noted. X-ray activation of select transcription factors, which bind certain consensus sites in promoters, may cause specific induction or repression of gene transcription. 22 refs., 2 figs.

  2. The Transcription Factor Encyclopedia

    PubMed Central

    2012-01-01

    Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130 mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written and vetted by experts in the field. TFe is available at http://www.cisreg.ca/tfe. PMID:22458515

  3. The transcription factor encyclopedia.

    PubMed

    Yusuf, Dimas; Butland, Stefanie L; Swanson, Magdalena I; Bolotin, Eugene; Ticoll, Amy; Cheung, Warren A; Zhang, Xiao Yu Cindy; Dickman, Christopher T D; Fulton, Debra L; Lim, Jonathan S; Schnabl, Jake M; Ramos, Oscar H P; Vasseur-Cognet, Mireille; de Leeuw, Charles N; Simpson, Elizabeth M; Ryffel, Gerhart U; Lam, Eric W-F; Kist, Ralf; Wilson, Miranda S C; Marco-Ferreres, Raquel; Brosens, Jan J; Beccari, Leonardo L; Bovolenta, Paola; Benayoun, Bérénice A; Monteiro, Lara J; Schwenen, Helma D C; Grontved, Lars; Wederell, Elizabeth; Mandrup, Susanne; Veitia, Reiner A; Chakravarthy, Harini; Hoodless, Pamela A; Mancarelli, M Michela; Torbett, Bruce E; Banham, Alison H; Reddy, Sekhar P; Cullum, Rebecca L; Liedtke, Michaela; Tschan, Mario P; Vaz, Michelle; Rizzino, Angie; Zannini, Mariastella; Frietze, Seth; Farnham, Peggy J; Eijkelenboom, Astrid; Brown, Philip J; Laperrière, David; Leprince, Dominique; de Cristofaro, Tiziana; Prince, Kelly L; Putker, Marrit; del Peso, Luis; Camenisch, Gieri; Wenger, Roland H; Mikula, Michal; Rozendaal, Marieke; Mader, Sylvie; Ostrowski, Jerzy; Rhodes, Simon J; Van Rechem, Capucine; Boulay, Gaylor; Olechnowicz, Sam W Z; Breslin, Mary B; Lan, Michael S; Nanan, Kyster K; Wegner, Michael; Hou, Juan; Mullen, Rachel D; Colvin, Stephanie C; Noy, Peter John; Webb, Carol F; Witek, Matthew E; Ferrell, Scott; Daniel, Juliet M; Park, Jason; Waldman, Scott A; Peet, Daniel J; Taggart, Michael; Jayaraman, Padma-Sheela; Karrich, Julien J; Blom, Bianca; Vesuna, Farhad; O'Geen, Henriette; Sun, Yunfu; Gronostajski, Richard M; Woodcroft, Mark W; Hough, Margaret R; Chen, Edwin; Europe-Finner, G Nicholas; Karolczak-Bayatti, Magdalena; Bailey, Jarrod; Hankinson, Oliver; Raman, Venu; LeBrun, David P; Biswal, Shyam; Harvey, Christopher J; DeBruyne, Jason P; Hogenesch, John B; Hevner, Robert F; Héligon, Christophe; Luo, Xin M; Blank, Marissa Cathleen; Millen, Kathleen Joyce; Sharlin, David S; Forrest, Douglas; Dahlman-Wright, Karin; Zhao, Chunyan; Mishima, Yuriko; Sinha, Satrajit; Chakrabarti, Rumela; Portales-Casamar, Elodie; Sladek, Frances M; Bradley, Philip H; Wasserman, Wyeth W

    2012-01-01

    Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130 mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written and vetted by experts in the field. TFe is available at http://www.cisreg.ca/tfe. PMID:22458515

  4. Large-scale identification of sequence variants impacting human transcription factor occupancy in vivo

    PubMed Central

    Maurano, Matthew T.; Haugen, Eric; Sandstrom, Richard; Vierstra, Jeff; Shafer, Anthony; Kaul, Rajinder; Stamatoyannopoulos, John A.

    2015-01-01

    The function of human regulatory regions depends exquisitely on their local genomic environment and cellular context, complicating experimental analysis of the expanding pool of common disease- and trait-associated variants that localize within regulatory DNA. We leverage allelically resolved genomic DNaseI footprinting data encompassing 166 individuals and 114 cell types to identify >60,000 common variants that directly impact transcription factor occupancy and regulatory DNA accessibility in vivo. The unprecedented scale of these data enable systematic analysis of the impact of sequence variation on transcription factor occupancy in vivo. We leverage this analysis to develop accurate models of variation affecting the recognition sites for diverse transcription factors, and apply these models to discriminate nearly 500,000 common regulatory variants likely to affect transcription factor occupancy across the human genome. The approach and results provide a novel foundation for analysis and interpretation of noncoding variation in complete human genomes, and for systems-level investigation of disease-associated variants. PMID:26502339

  5. Toward a Functional Annotation of the Human Genome Using Artificial Transcription Factors

    PubMed Central

    Lee, Dong-ki; Park, Jin Woo; Kim, Youn-Jae; Kim, Jiwon; Lee, Yangsoon; Kim, Jeonglim; Kim, Jin-Soo

    2003-01-01

    We have developed a novel, high-throughput approach to collecting randomly perturbed gene-expression profiles from the human genome.A human 293 cell library that stably expresses randomly chosen zinc-finger transcription factors was constructed, and the expression profile of each cell line was obtained using cDNA microarray technology.Gene expression profiles from a total of 132 cell lines were collected and analyzed by (1) a simple clustering method based on expression-profile similarity, and (2) the shortest-path analysis method.These analyses identified a number of gene groups, and further investigation revealed that the genes that were grouped together had close biological relationships.The artificial transcription factor-based random genome perturbation method thus provides a novel functional genomic tool for annotation and classification of genes in the human genome and those of many other organisms. PMID:14656973

  6. Human Transcription Factor hTAFII150 (CIF150) Is Involved in Transcriptional Regulation of Cell Cycle Progression

    PubMed Central

    Martin, Jay; Halenbeck, Robert; Kaufmann, Jörg

    1999-01-01

    Here we present evidence that CIF150 (hTAFII150), the human homolog of Drosophila TAFII150, plays an important and selective role in establishing gene expression patterns necessary for progression through the cell cycle. Gel filtration experiments demonstrate that CIF150 (hTAFII150) seems to be less tightly associated with human transcription factor IID than hTAFII130 is associated with hTAFII250. The transient functional knockout of CIF150 (hTAFII150) protein led to cell cycle arrest at the G2/M transition in mammalian cell lines. PCR display analysis with the RNA derived from CIF150-depleted cells indicated that CIF150 (hTAFII150) is required for the transcription of only a subset of RNA polymerase II genes. CIF150 (hTAFII150) directly stimulated cyclin B1 and cyclin A transcription in cotransfection assays and in vitro assays, suggesting that the expression of these genes is dependent on CIF150 (hTAFII150) function. We defined a CIF150 (hTAFII150) consensus binding site and demonstrated that a CIF150-responsive cis element is present in the cyclin B1 core promoter. These results suggest that one function of CIF150 (hTAFII150) is to select specific RNA polymerase II core promoter elements involved in cell cycle progression. PMID:10409744

  7. Regulation of endogenous human gene expression by ligand-inducible TALE transcription factors.

    PubMed

    Mercer, Andrew C; Gaj, Thomas; Sirk, Shannon J; Lamb, Brian M; Barbas, Carlos F

    2014-10-17

    The construction of increasingly sophisticated synthetic biological circuits is dependent on the development of extensible tools capable of providing specific control of gene expression in eukaryotic cells. Here, we describe a new class of synthetic transcription factors that activate gene expression in response to extracellular chemical stimuli. These inducible activators consist of customizable transcription activator-like effector (TALE) proteins combined with steroid hormone receptor ligand-binding domains. We demonstrate that these ligand-responsive TALE transcription factors allow for tunable and conditional control of gene activation and can be used to regulate the expression of endogenous genes in human cells. Since TALEs can be designed to recognize any contiguous DNA sequence, the conditional gene regulatory system described herein will enable the design of advanced synthetic gene networks. PMID:24251925

  8. Stress-impaired transcription factor expression and insulin secretion in transplanted human islets

    PubMed Central

    Dai, Chunhua; Kayton, Nora S.; Shostak, Alena; Poffenberger, Greg; Cyphert, Holly A.; Aramandla, Radhika; Thompson, Courtney; Papagiannis, Ioannis G.; Shiota, Masakazu; Stafford, John M.; Greiner, Dale L.; Herrera, Pedro L.; Shultz, Leonard D.; Stein, Roland; Powers, Alvin C.

    2016-01-01

    Type 2 diabetes is characterized by insulin resistance, hyperglycemia, and progressive β cell dysfunction. Excess glucose and lipid impair β cell function in islet cell lines, cultured rodent and human islets, and in vivo rodent models. Here, we examined the mechanistic consequences of glucotoxic and lipotoxic conditions on human islets in vivo and developed and/or used 3 complementary models that allowed comparison of the effects of hyperglycemic and/or insulin-resistant metabolic stress conditions on human and mouse islets, which responded quite differently to these challenges. Hyperglycemia and/or insulin resistance impaired insulin secretion only from human islets in vivo. In human grafts, chronic insulin resistance decreased antioxidant enzyme expression and increased superoxide and amyloid formation. In human islet grafts, expression of transcription factors NKX6.1 and MAFB was decreased by chronic insulin resistance, but only MAFB decreased under chronic hyperglycemia. Knockdown of NKX6.1 or MAFB expression in a human β cell line recapitulated the insulin secretion defect seen in vivo. Contrary to rodent islet studies, neither insulin resistance nor hyperglycemia led to human β cell proliferation or apoptosis. These results demonstrate profound differences in how excess glucose or lipid influence mouse and human insulin secretion and β cell activity and show that reduced expression of key islet-enriched transcription factors is an important mediator of glucotoxicity and lipotoxicity. PMID:27064285

  9. Targeting the Central Pocket in Human Transcription Factor TEAD as a Potential Cancer Therapeutic Strategy.

    PubMed

    Pobbati, Ajaybabu V; Han, Xiao; Hung, Alvin W; Weiguang, Seetoh; Huda, Nur; Chen, Guo-Ying; Kang, CongBao; Chia, Cheng San Brian; Luo, Xuelian; Hong, Wanjin; Poulsen, Anders

    2015-11-01

    The human TEAD family of transcription factors (TEAD1-4) is required for YAP-mediated transcription in the Hippo pathway. Hyperactivation of TEAD's co-activator YAP contributes to tissue overgrowth and human cancers, suggesting that pharmacological interference of TEAD-YAP activity may be an effective strategy for anticancer therapy. Here we report the discovery of a central pocket in the YAP-binding domain (YBD) of TEAD that is targetable by small-molecule inhibitors. Our X-ray crystallography studies reveal that flufenamic acid, a non-steroidal anti-inflammatory drug (NSAID), binds to the central pocket of TEAD2 YBD. Our biochemical and functional analyses further demonstrate that binding of NSAIDs to TEAD inhibits TEAD-YAP-dependent transcription, cell migration, and proliferation, indicating that the central pocket is important for TEAD function. Therefore, our studies discover a novel way of targeting TEAD transcription factors and set the stage for therapeutic development of specific TEAD-YAP inhibitors against human cancers. PMID:26592798

  10. Transcriptional regulation of the human TR2 orphan receptor gene by nuclear factor 1-A

    SciTech Connect

    Lin, Y.-L.; Wang, Y.-H.; Lee, H.-J. . E-mail: hjlee@mail.ndhu.edu.tw

    2006-11-17

    The human testicular receptor 2 (TR2), a member of the nuclear hormone receptor superfamily, has no identified ligand yet. Previous evidence demonstrated that a 63 bp DNA fragment, named the promoter activating cis-element (PACE), has been identified as a positive regulatory region in the 5' promoter region of the human TR2 gene. In the present report, the human nuclear factor 1-A (NF1-A) was identified as a transcriptional activator to recognize the center of the PACE, called the PACE-C. NF1-A could bind to the 18 bp PACE-C region, and enhance about 13- to 17-fold of the luciferase reporter gene activity via the PACE-C in dose-dependent and orientation-independent manners. This transcriptional activation was further confirmed by real-time RT-PCR assay. In conclusion, our results indicated that NF1-A transcription factor plays an important role in the transcriptional activation of the TR2 gene expression via the PACE-C in the minimal promoter region.

  11. A Network of Paralogous Stress Response Transcription Factors in the Human Pathogen Candida glabrata.

    PubMed

    Merhej, Jawad; Thiebaut, Antonin; Blugeon, Corinne; Pouch, Juliette; Ali Chaouche, Mohammed El Amine; Camadro, Jean-Michel; Le Crom, Stéphane; Lelandais, Gaëlle; Devaux, Frédéric

    2016-01-01

    The yeast Candida glabrata has become the second cause of systemic candidemia in humans. However, relatively few genome-wide studies have been conducted in this organism and our knowledge of its transcriptional regulatory network is quite limited. In the present work, we combined genome-wide chromatin immunoprecipitation (ChIP-seq), transcriptome analyses, and DNA binding motif predictions to describe the regulatory interactions of the seven Yap (Yeast AP1) transcription factors of C. glabrata. We described a transcriptional network containing 255 regulatory interactions and 309 potential target genes. We predicted with high confidence the preferred DNA binding sites for 5 of the 7 CgYaps and showed a strong conservation of the Yap DNA binding properties between S. cerevisiae and C. glabrata. We provided reliable functional annotation for 3 of the 7 Yaps and identified for Yap1 and Yap5 a core regulon which is conserved in S. cerevisiae, C. glabrata, and C. albicans. We uncovered new roles for CgYap7 in the regulation of iron-sulfur cluster biogenesis, for CgYap1 in the regulation of heme biosynthesis and for CgYap5 in the repression of GRX4 in response to iron starvation. These transcription factors define an interconnected transcriptional network at the cross-roads between redox homeostasis, oxygen consumption, and iron metabolism. PMID:27242683

  12. A Network of Paralogous Stress Response Transcription Factors in the Human Pathogen Candida glabrata

    PubMed Central

    Merhej, Jawad; Thiebaut, Antonin; Blugeon, Corinne; Pouch, Juliette; Ali Chaouche, Mohammed El Amine; Camadro, Jean-Michel; Le Crom, Stéphane; Lelandais, Gaëlle; Devaux, Frédéric

    2016-01-01

    The yeast Candida glabrata has become the second cause of systemic candidemia in humans. However, relatively few genome-wide studies have been conducted in this organism and our knowledge of its transcriptional regulatory network is quite limited. In the present work, we combined genome-wide chromatin immunoprecipitation (ChIP-seq), transcriptome analyses, and DNA binding motif predictions to describe the regulatory interactions of the seven Yap (Yeast AP1) transcription factors of C. glabrata. We described a transcriptional network containing 255 regulatory interactions and 309 potential target genes. We predicted with high confidence the preferred DNA binding sites for 5 of the 7 CgYaps and showed a strong conservation of the Yap DNA binding properties between S. cerevisiae and C. glabrata. We provided reliable functional annotation for 3 of the 7 Yaps and identified for Yap1 and Yap5 a core regulon which is conserved in S. cerevisiae, C. glabrata, and C. albicans. We uncovered new roles for CgYap7 in the regulation of iron-sulfur cluster biogenesis, for CgYap1 in the regulation of heme biosynthesis and for CgYap5 in the repression of GRX4 in response to iron starvation. These transcription factors define an interconnected transcriptional network at the cross-roads between redox homeostasis, oxygen consumption, and iron metabolism. PMID:27242683

  13. Human mitochondrial transcription factor A (mtTFA): gene structure and characterization of related pseudogenes.

    PubMed

    Reyes, Aurelio; Mezzina, Maria; Gadaleta, Gemma

    2002-05-29

    Mitochondrial transcription factor A (mtTFA or Tfam) is a 25 kDa protein encoded by a nuclear gene and imported to mitochondria, where it functions as a key regulator of mammalian mitochondrial (mt) DNA transcription and replication. The coding sequence of the human mtTFA gene is reported in the literature and the sizes of few introns are known. In this paper we present the genomic structure of the human mtTFA gene along with the complete sequence of its six intronic regions. Three of the introns (I, III, VI) have been found to be less than 600 bp, while the other three were greater than 1.8 kb. In the course of this work, we discovered that, in addition to the active copy, different homologous sequences identified as processed pseudogenes psi h-mtTFA have been isolated and sequenced. Using an 'in silico' mapping approach we determined their locations on chromosomes 7, 11 and X. psi h-mtTFA locations are different from that of the gene, previously reported on chromosome 10. Transcription analysis by means of reverse transcriptase-polymerase chain reaction has shown that other than the RNA corresponding to the full-length transcript, an isoform lacking 96 bp is also present. Among the three sequenced pseudogenes only one of them located on chromosome 11 has been found to be transcribed in Jurkat cells under these culture conditions, even though transcription initiation and binding sites for different transcription factors have also been found upstream from the other two pseudogenes. PMID:12095695

  14. A Progenitor Cell Expressing Transcription Factor RORγt Generates All Human Innate Lymphoid Cell Subsets.

    PubMed

    Scoville, Steven D; Mundy-Bosse, Bethany L; Zhang, Michael H; Chen, Li; Zhang, Xiaoli; Keller, Karen A; Hughes, Tiffany; Chen, Luxi; Cheng, Stephanie; Bergin, Stephen M; Mao, Hsiaoyin C; McClory, Susan; Yu, Jianhua; Carson, William E; Caligiuri, Michael A; Freud, Aharon G

    2016-05-17

    The current model of murine innate lymphoid cell (ILC) development holds that mouse ILCs are derived downstream of the common lymphoid progenitor through lineage-restricted progenitors. However, corresponding lineage-restricted progenitors in humans have yet to be discovered. Here we identified a progenitor population in human secondary lymphoid tissues (SLTs) that expressed the transcription factor RORγt and was unique in its ability to generate all known ILC subsets, including natural killer (NK) cells, but not other leukocyte populations. In contrast to murine fate-mapping data, which indicate that only ILC3s express Rorγt, these human progenitor cells as well as human peripheral blood NK cells and all mature ILC populations expressed RORγt. Thus, all human ILCs can be generated through an RORγt(+) developmental pathway from a common progenitor in SLTs. These findings help establish the developmental signals and pathways involved in human ILC development. PMID:27178467

  15. Human von Economo neurons express transcription factors associated with Layer V subcerebral projection neurons.

    PubMed

    Cobos, Inma; Seeley, William W

    2015-01-01

    The von Economo neurons (VENs) are large bipolar Layer V projection neurons found chiefly in the anterior cingulate and frontoinsular cortices. Although VENs have been linked to prevalent illnesses such as frontotemporal dementia, autism, and schizophrenia, little is known about VEN identity, including their major projection targets. Here, we undertook a developmental transcription factor expression study, focusing on markers associated with specific classes of Layer V projection neurons. Using mRNA in situ hybridization, we found that VENs prominently express FEZF2 and CTIP2, transcription factors that regulate the fate and differentiation of subcerebral projection neurons, in humans aged 3 months to 65 years. In contrast, few VENs expressed markers associated with callosal or corticothalamic projections. These findings suggest that VENs may represent a specialized Layer V projection neuron for linking cortical autonomic control sites to brainstem or spinal cord regions. PMID:23960210

  16. Transcription factor AP-2 regulates human immunodeficiency virus type 1 gene expression.

    PubMed Central

    Perkins, N D; Agranoff, A B; Duckett, C S; Nabel, G J

    1994-01-01

    Human immunodeficiency virus type 1 (HIV-1) gene expression is regulated by an enhancer region composed of multiple potential cis-acting regulatory sites. Here, we describe binding sites for the transcription factor AP-2 in the HIV-1 long terminal repeat which modulate HIV enhancer function. One site is embedded within the two previously described kappa B elements, and a second site is detected further downstream. DNase I footprinting and electrophoretic mobility shift assay experiments demonstrated that AP-2 binds to the site between the kappa B elements. Interestingly, AP-2 and NF-kappa B bind to this region in a mutually exclusive manner. Mutations which disrupt this AP-2-binding site lower basal levels of transcription but do not affect NF-kappa B-mediated induction by tumor necrosis factor alpha in Jurkat T leukemia cells. Images PMID:8084021

  17. Repression of the human papillomavirus type 18 enhancer by the cellular transcription factor Oct-1.

    PubMed Central

    Hoppe-Seyler, F; Butz, K; zur Hausen, H

    1991-01-01

    The role of cellular factors involved in the transcriptional regulation of the cancer-associated human papillomavirus type 18 (HPV18) is yet poorly understood. The presence of an Oct-1-binding site within the HPV18 upstream regulatory region led us to investigate the influence of Oct-1 on viral transcription. Cotransfection of Oct-1 expression plasmids together with luciferase reporter constructs containing HPV18 regulatory sequences indicated that Oct-1 can transcriptionally repress the HPV18 upstream regulatory region. In contrast, heterologous control regions were not affected by Oct-1. HPV18 cis elements that can be repressed by Oct-1 mapped to a 135-bp subregion of the viral constitutive enhancer. Analysis of an Oct-1 mutant defective in DNA binding suggested that HPV18 down-modulation does not require direct binding of Oct-1 to DNA. These results make Oct-1 a candidate factor involved in the intracellular surveillance of HPV18 transcription and support the notion of a host cell mechanism that can specifically repress HPV E6-E7 transforming gene expression. Images PMID:1654457

  18. Human Trefoil Factor 3 induces the transcription of its own promoter through STAT3

    PubMed Central

    Sun, Yong; Wang, Liangxi; Zhou, Yifang; Mao, Xuefei; Deng, Xiangdong

    2016-01-01

    Human trefoil factor 3 (hTFF3) is a small peptide of potential therapeutic value. The mechanisms underlying the transcriptional regulation of hTFF3 remain unclear. The purpose of this study was to identify the core functional elements for the self-induction action of hTFF3 and transcription factors. First, truncated promoters were constructed to identify the functional regions of the hTFF3 promoter. Next, point mutation, chromatin immunoprecipitation, RNA interference, and gene overexpression experiments were performed to analyze the transcriptional binding sites responsible for the self-induced transcription of hTFF3. Our results revealed the −1450 bp to −1400 bp fragment of the hTFF3 promoter was the functional region for the self-induction action of hTFF3. Bioinformatics analysis confirmed that a STAT3 binding site is present in the −1417 bp to −1409 bp region. Subsequently, site-directed mutagenesis analysis determined that this STAT3 binding site was critical for the self-induction effect of hTFF3. ChIP experiments confirmed that STAT3 binds to the hTFF3 promoter. STAT3 overexpression and knockdown experiments revealed that STAT3 enhanced the self-induction effect and the expression of hTFF3. This study confirmed that hTFF3 exhibits self-induction action, and that STAT3 is the key transcription factor to maintain the function of self-induction. PMID:27453253

  19. Recombinant human ciliary neurotrophic factor reduces weight partly by regulating nuclear respiratory factor 1 and mitochondrial transcription factor A.

    PubMed

    Liu, Qing-Shan; Wang, Qiu-Juan; Du, Guan-Hua; Zhu, Shen-Yin; Gao, Mei; Zhang, Li; Zhu, Jun-Ming; Cao, Jian-Feng

    2007-06-01

    Ciliary neurotrophic factor (CNTF) can lead to weight loss by up-regulating energy metabolism and the expression of UCP-1 in mitochondria. To investigate the up-stream regulators of the expression of UCP-1, recombinant human CNTF (rhCNTF) (0.1, 0.3, 0.9 mg/kg/day s.c.) administered to KK-Ay mice for 30 days resulting in reductions in body weight and perirenal fat mass. In brown adipose tissues, the gene expressions of nuclear respiratory factor (NRF)-1, mitochondrial transcription factor A (TFam) and uncoupling protein (UCP)-1 were found up-regulated by rhCNTF. To the best of our knowledge, these effects represent new insights on the mechanisms of action of weight loss by rhCNTF. In addition, we also found that rhCNTF increased the activity of mitochondrial complex IV. The stimulation of NRF-1, TFam, UCP-1 and the enhanced activity of mitochondrial complex IV may be associated with remedying obesity. The result indicates that rhCNTF can enhance the expressions of NRF-1 and TFam, both of which can up-regulate the expression of UCP-1. PMID:17397829

  20. Resetting transcription factor control circuitry toward ground-state pluripotency in human.

    PubMed

    Takashima, Yasuhiro; Guo, Ge; Loos, Remco; Nichols, Jennifer; Ficz, Gabriella; Krueger, Felix; Oxley, David; Santos, Fatima; Clarke, James; Mansfield, William; Reik, Wolf; Bertone, Paul; Smith, Austin

    2014-09-11

    Current human pluripotent stem cells lack the transcription factor circuitry that governs the ground state of mouse embryonic stem cells (ESC). Here, we report that short-term expression of two components, NANOG and KLF2, is sufficient to ignite other elements of the network and reset the human pluripotent state. Inhibition of ERK and protein kinase C sustains a transgene-independent rewired state. Reset cells self-renew continuously without ERK signaling, are phenotypically stable, and are karyotypically intact. They differentiate in vitro and form teratomas in vivo. Metabolism is reprogrammed with activation of mitochondrial respiration as in ESC. DNA methylation is dramatically reduced and transcriptome state is globally realigned across multiple cell lines. Depletion of ground-state transcription factors, TFCP2L1 or KLF4, has marginal impact on conventional human pluripotent stem cells but collapses the reset state. These findings demonstrate feasibility of installing and propagating functional control circuitry for ground-state pluripotency in human cells. PMID:25215486

  1. Cloning of the novel human myeloid-cell-specific C/EBP-epsilon transcription factor.

    PubMed Central

    Chumakov, A M; Grillier, I; Chumakova, E; Chih, D; Slater, J; Koeffler, H P

    1997-01-01

    Chicken NF-M transcription factor, in cooperation with either c-Myb or v-Myb, is active in the combinatorial activation of myeloid-cell-specific genes in heterologous cell types, such as embryonic fibroblasts. In humans, similar effects were observed with homologous members of the CCAAT/enhancer-binding protein (C/EBP) family of transcriptional regulators, especially the human homolog of chicken NF-M, C/EBP-beta (NF-IL6). However, the NF-IL6 gene is expressed in a variety of nonmyeloid cell types and is strongly inducible in response to inflammatory stimuli, making it an unlikely candidate to have an exclusive role as a combinatorial differentiation switch during myelopoiesis in human cells. By using a reverse transcription-PCR-based approach and a set of primers specific for the DNA-binding domains of highly homologous members of the C/EBP family of transcriptional regulators, we have cloned a novel human gene encoding a member of the C/EBP gene family, identified as the human homolog of CRP1, C/EBP-epsilon. A 1.2-kb cDNA encoding full-length human C/EBP-epsilon was cloned from a promyelocyte-late myeloblast-derived lambda gt11 library. Molecular analysis of the cDNA and genomic clones indicated the presence of two exons encoding a protein with an apparent molecular mass of 32 kDa and a pI of 9.5. Primer extension analysis of C/EBP-epsilon mRNA detected a single major transcription start site approximately 200 bp upstream of the start codon. The putative promoter area is similar to those of several other myeloid-cell-specific genes in that it contains no TATAAA box but has a number of purine-rich stretches with multiple sites for the factors of the Ets family of transcriptional regulators. Northern blot analyses indicated a highly restricted mRNA expression pattern, with the strongest expression occurring in promyelocyte and late-myeloblast-like cell lines. Western blot and immunoprecipitation studies using rabbit anti-C/EBP-epsilon antibodies raised against the N

  2. ETS transcription factor ETV2 directly converts human fibroblasts into functional endothelial cells.

    PubMed

    Morita, Rimpei; Suzuki, Mayu; Kasahara, Hidenori; Shimizu, Nana; Shichita, Takashi; Sekiya, Takashi; Kimura, Akihiro; Sasaki, Ken-ichiro; Yasukawa, Hideo; Yoshimura, Akihiko

    2015-01-01

    Transplantation of endothelial cells (ECs) is a promising therapeutic approach for ischemic disorders. In addition, the generation of ECs has become increasingly important for providing vascular plexus to regenerated organs, such as the liver. Although many attempts have been made to generate ECs from pluripotent stem cells and nonvascular cells, the minimum number of transcription factors that specialize in directly inducing vascular ECs remains undefined. Here, by screening 18 transcription factors that are important for both endothelial and hematopoietic development, we demonstrate that ets variant 2 (ETV2) alone directly converts primary human adult skin fibroblasts into functional vascular endothelial cells (ETVECs). In coordination with endogenous FOXC2 in fibroblasts, transduced ETV2 elicits expression of multiple key endothelial development factors, including FLI1, ERG, and TAL1, and induces expression of endothelial functional molecules, including EGFL7 and von Willebrand factor. Consequently, ETVECs exhibits EC characteristics in vitro and forms mature functional vasculature in Matrigel plugs transplanted in NOD SCID mice. Furthermore, ETVECs significantly improve blood flow recovery in a hind limb ischemic model using BALB/c-nu mice. Our study indicates that the creation of ETVECs provides further understanding of human EC development induced by ETV2. PMID:25540418

  3. Characterization of human mitochondrial ferritin promoter: identification of transcription factors and evidences of epigenetic control.

    PubMed

    Guaraldo, Michela; Santambrogio, Paolo; Rovelli, Elisabetta; Di Savino, Augusta; Saglio, Giuseppe; Cittaro, Davide; Roetto, Antonella; Levi, Sonia

    2016-01-01

    Mitochondrial ferritin (FtMt) is an iron storage protein belonging to the ferritin family but, unlike the cytosolic ferritin, it has an iron-unrelated restricted tissue expression. FtMt appears to be preferentially expressed in cell types characterized by high metabolic activity and oxygen consumption, suggesting a role in protecting mitochondria from iron-dependent oxidative damage. The human gene (FTMT) is intronless and its promoter region has not been described yet. To analyze the regulatory mechanisms controlling FTMT expression, we characterized the 5' flanking region upstream the transcriptional starting site of FTMT by in silico enquiry of sequences conservation, DNA deletion analysis, and ChIP assay. The data revealed a minimal promoter region and identified the presence of SP1, CREB and YY1 as positive regulators, and GATA2, FoxA1 and C/EBPβ as inhibitors of the transcriptional regulation. Furthermore, the FTMT transcription is increased by acetylating and de-methylating agent treatments in K562 and HeLa cells. These treatments up-regulate FtMt expression even in fibroblasts derived from a Friedreich ataxia patient, where it might exert a beneficial effect against mitochondrial oxidative damage. The expression of FTMT appears regulated by a complex mechanism involving epigenetic events and interplay between transcription factors. PMID:27625068

  4. Transcriptional Factor PU.1 Regulates Decidual C1q Expression in Early Pregnancy in Human.

    PubMed

    Madhukaran, Shanmuga Priyaa; Kishore, Uday; Jamil, Kaiser; Teo, Boon Heng Dennis; Choolani, Mahesh; Lu, Jinhua

    2015-01-01

    C1q is the first recognition subcomponent of the complement classical pathway, which in addition to being synthesized in the liver, is also expressed by macrophages and dendritic cells (DCs). Trophoblast invasion during early placentation results in accumulation of debris that triggers the complement system. Hence, both early and late components of the classical pathway are widely distributed in the placenta and decidua. In addition, C1q has recently been shown to significantly contribute to feto-maternal tolerance, trophoblast migration, and spiral artery remodeling, although the exact mechanism remains unknown. Pregnancy in mice, genetically deficient in C1q, mirrors symptoms similar to that of human preeclampsia. Thus, regulated complement activation has been proposed as an essential requirement for normal successful pregnancy. Little is known about the molecular pathways that regulate C1q expression in pregnancy. PU.1, an Ets-family transcription factor, is required for the development of hematopoietic myeloid lineage immune cells, and its expression is tissue-specific. Recently, PU.1 has been shown to regulate C1q gene expression in DCs and macrophages. Here, we have examined if PU.1 transcription factor regulates decidual C1q expression. We used immune-histochemical analysis, PCR, and immunostaining to localize and study the gene expression of PU.1 transcription factor in early human decidua. PU.1 was highly expressed at gene and protein level in early human decidual cells including trophoblast and stromal cells. Surprisingly, nuclear as well as cytoplasmic PU.1 expression was observed. Decidual cells with predominantly nuclear PU.1 expression had higher C1q expression. It is likely that nuclear and cytoplasmic PU.1 localization has a role to play in early pregnancy via regulating C1q expression in the decidua during implantation. PMID:25762996

  5. The Promyelocytic Leukemia Zinc Finger Transcription Factor Is Critical for Human Endometrial Stromal Cell Decidualization

    PubMed Central

    Kommagani, Ramakrishna; Szwarc, Maria M.; Vasquez, Yasmin M.; Peavey, Mary C.; Mazur, Erik C.; Gibbons, William E.; Lanz, Rainer B.; DeMayo, Francesco J.; Lydon, John P.

    2016-01-01

    Progesterone, via the progesterone receptor (PGR), is essential for endometrial stromal cell decidualization, a cellular transformation event in which stromal fibroblasts differentiate into decidual cells. Uterine decidualization supports embryo implantation and placentation as well as subsequent events, which together ensure a successful pregnancy. Accordingly, impaired decidualization results not only in implantation failure or early fetal miscarriage, but also may lead to potential adverse outcomes in all three pregnancy trimesters. Transcriptional reprogramming on a genome-wide scale underlies progesterone dependent decidualization of the human endometrial stromal cell (hESC). However, identification of the functionally essential signals encoded by these global transcriptional changes remains incomplete. Importantly, this knowledge-gap undercuts future efforts to improve diagnosis and treatment of implantation failure based on a dysfunctional endometrium. By integrating genome-wide datasets derived from decidualization of hESCs in culture, we reveal that the promyelocytic leukemia zinc finger (PLZF) transcription factor is rapidly induced by progesterone and that this induction is indispensable for progesterone-dependent decidualization. Chromatin immunoprecipitation followed by next generation sequencing (ChIP-Seq) identified at least ten progesterone response elements within the PLZF gene, indicating that PLZF may act as a direct target of PGR signaling. The spatiotemporal expression profile for PLZF in both the human and mouse endometrium offers further support for stromal PLZF as a mediator of the progesterone decidual signal. To identify functional targets of PLZF, integration of PLZF ChIP-Seq and RNA Pol II RNA-Seq datasets revealed that the early growth response 1 (EGR1) transcription factor is a PLZF target for which its level of expression must be reduced to enable progesterone dependent hESC decidualization. Apart from furnishing essential insights

  6. The Promyelocytic Leukemia Zinc Finger Transcription Factor Is Critical for Human Endometrial Stromal Cell Decidualization.

    PubMed

    Kommagani, Ramakrishna; Szwarc, Maria M; Vasquez, Yasmin M; Peavey, Mary C; Mazur, Erik C; Gibbons, William E; Lanz, Rainer B; DeMayo, Francesco J; Lydon, John P

    2016-04-01

    Progesterone, via the progesterone receptor (PGR), is essential for endometrial stromal cell decidualization, a cellular transformation event in which stromal fibroblasts differentiate into decidual cells. Uterine decidualization supports embryo implantation and placentation as well as subsequent events, which together ensure a successful pregnancy. Accordingly, impaired decidualization results not only in implantation failure or early fetal miscarriage, but also may lead to potential adverse outcomes in all three pregnancy trimesters. Transcriptional reprogramming on a genome-wide scale underlies progesterone dependent decidualization of the human endometrial stromal cell (hESC). However, identification of the functionally essential signals encoded by these global transcriptional changes remains incomplete. Importantly, this knowledge-gap undercuts future efforts to improve diagnosis and treatment of implantation failure based on a dysfunctional endometrium. By integrating genome-wide datasets derived from decidualization of hESCs in culture, we reveal that the promyelocytic leukemia zinc finger (PLZF) transcription factor is rapidly induced by progesterone and that this induction is indispensable for progesterone-dependent decidualization. Chromatin immunoprecipitation followed by next generation sequencing (ChIP-Seq) identified at least ten progesterone response elements within the PLZF gene, indicating that PLZF may act as a direct target of PGR signaling. The spatiotemporal expression profile for PLZF in both the human and mouse endometrium offers further support for stromal PLZF as a mediator of the progesterone decidual signal. To identify functional targets of PLZF, integration of PLZF ChIP-Seq and RNA Pol II RNA-Seq datasets revealed that the early growth response 1 (EGR1) transcription factor is a PLZF target for which its level of expression must be reduced to enable progesterone dependent hESC decidualization. Apart from furnishing essential insights

  7. Plant transcription factors.

    PubMed

    Meshi, T; Iwabuchi, M

    1995-12-01

    Transcriptional regulation of gene expression relies on the recognition of promoter elements by transcription factors. In the past several years, a considerable number of (putative) transcription factors have been identified in plants. Some genes coding for these factors were isolated by south-western screening with oligonucleotides as a probe or by homology-based screening, and others were initially isolated by genetic means and subsequently identified as the genes for transcription factors. These transcription factors often form families of structurally related proteins with similar DNA-binding specificities and in addition, they are sometimes involved in related phenomena. Some groups of factors homo- and/or heterodimerize to increase the length and variability of the target sequences. Transcriptional activators, in general, comprise a modular activation domain. The activities of the transcription factors are controlled by post-translational modification, like phosphorylation and glycosylation, as well as at the levels of nuclear transport, oligomerization, etc. In this review, we will summarize the current knowledge of plant transcription factors to help understand the mechanistic aspects of the transcriptional regulation of genes. PMID:8589926

  8. Transcription factors ETS2 and MESP1 transdifferentiate human dermal fibroblasts into cardiac progenitors.

    PubMed

    Islas, Jose Francisco; Liu, Yu; Weng, Kuo-Chan; Robertson, Matthew J; Zhang, Shuxing; Prejusa, Allan; Harger, John; Tikhomirova, Dariya; Chopra, Mani; Iyer, Dinakar; Mercola, Mark; Oshima, Robert G; Willerson, James T; Potaman, Vladimir N; Schwartz, Robert J

    2012-08-01

    Unique insights for the reprograming of cell lineages have come from embryonic development in the ascidian Ciona, which is dependent upon the transcription factors Ci-ets1/2 and Ci-mesp to generate cardiac progenitors. We tested the idea that mammalian v-ets erythroblastosis virus E26 oncogene homolog 2 (ETS2) and mesoderm posterior (MESP) homolog may be used to convert human dermal fibroblasts into cardiac progenitors. Here we show that murine ETS2 has a critical role in directing cardiac progenitors during cardiopoiesis in embryonic stem cells. We then use lentivirus-mediated forced expression of human ETS2 to convert normal human dermal fibroblasts into replicative cells expressing the cardiac mesoderm marker KDR(+). However, although neither ETS2 nor the purported cardiac master regulator MESP1 can by themselves generate cardiac progenitors de novo from fibroblasts, forced coexpression of ETS2 and MESP1 or cell treatment with purified proteins reprograms fibroblasts into cardiac progenitors, as shown by the de novo appearance of core cardiac transcription factors, Ca(2+) transients, and sarcomeres. Our data indicate that ETS2 and MESP1 play important roles in a genetic network that governs cardiopoiesis. PMID:22826236

  9. Genetic factors affecting gene transcription and catalytic activity of UDP-glucuronosyltransferases in human liver

    PubMed Central

    Liu, Wanqing; Ramírez, Jacqueline; Gamazon, Eric R.; Mirkov, Snezana; Chen, Peixian; Wu, Kehua; Sun, Chang; Cox, Nancy J.; Cook, Edwin; Das, Soma; Ratain, Mark J.

    2014-01-01

    The aim of this study was to discover cis- and trans-acting factors significantly affecting mRNA expression and catalytic activity of human hepatic UDP-glucuronosyltransferases (UGTs). Transcription levels of five major hepatic UGT1A (UGT1A1, UGT1A3, UGT1A4, UGT1A6 and UGT1A9) and five UGT2B (UGT2B4, UGT2B7, UGT2B10, UGT2B15 and UGT2B17) genes were quantified in human liver tissue samples (n = 125) using real-time PCR. Glucuronidation activities of 14 substrates were measured in 47 livers. We genotyped 167 tagSNPs (single-nucleotide polymorphisms) in UGT1A (n = 43) and UGT2B (n = 124), as well as the known functional UGT1A1*28 and UGT2B17 CNV (copy number variation) polymorphisms. Transcription levels of 15 transcription factors (TFs) known to regulate these UGTs were quantified. We found that UGT expression and activity were highly variable among the livers (median and range of coefficient of variations: 135%, 74–217% and 52%, 39–105%, respectively). CAR, PXR and ESR1 were found to be the most important trans-regulators of UGT transcription (median and range of correlation coefficients: 46%, 6–58%; 47%, 9–58%; and 52%, 24–75%, respectively). Hepatic UGT activities were mainly determined by UGT gene transcription levels. Twenty-one polymorphisms were significantly (FDR-adjusted P < 0.05) associated with mRNA expression and/or activities of UGT1A1, UGT1A3 and UGT2B17. We found novel SNPs in the UGT2B17 CNV region accounting for variability in UGT2B17 gene transcription and testosterone glucuronidation rate, in addition to that attributable to the UGT2B17 CNV. Our study discovered novel pharmacogenetic markers and provided detailed insight into the genetic network regulating hepatic UGTs. PMID:24879639

  10. Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle

    PubMed Central

    Hennenberg, Martin; Strittmatter, Frank; Beckmann, Christer; Rutz, Beata; Füllhase, Claudius; Waidelich, Raphaela; Montorsi, Francesco; Hedlund, Petter; Andersson, Karl-Erik; Stief, Christian G.; Gratzke, Christian

    2012-01-01

    Background The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. Objective To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Methods Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Results Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Conclusions Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors

  11. Expression of The Embryonic Stem Cell Transcription Factor SOX2 in Human Skin

    PubMed Central

    Laga, Alvaro C.; Lai, Chiou-Yan; Zhan, Qian; Huang, Susan J.; Velazquez, Elsa F.; Yang, Qinghong; Hsu, Mei-Yu; Murphy, George F.

    2010-01-01

    SOX2 is a gene located on chromosome 3q26.33 that encodes a transcription factor important to maintenance of embryonic neural crest stem cell pluripotency. We have identified rare SOX2-immunoreactive cells in normal human skin at or near the established stem cell niches. Three subsets of SOX2-positive cells were defined in these regions: those expressing only SOX2 and those that co-expressed SOX2 and either CK20 or microphthalmia-associated transcription factor, which are consistent with dichotomous differentiation of SOX2-expressing precursors along neuroendocrine (Merkel cell) or melanocytic lines, respectively. Examination of Merkel cell carcinomas confirmed nuclear SOX2 expression in this tumor type. In human patient melanoma, strong nuclear expression of SOX2 was noted in a subset of tumors, and the ability to detect SOX2 in lesional cells significantly correlated with primary tumor thickness in a survey cohort. To assess the potential role of SOX2 in melanoma growth, an in vivo tumorigenesis assay was used. Whereas SOX2 knockdown failed to influence proliferation of cultured melanoma cells in vitro, tumor xenografts generated with the SOX2-knockdown cell line showed significant decrease in mean tumor volume as compared with controls. In aggregate, these findings suggest that SOX2 is a novel biomarker for subpopulations of normal skin cells that reside in established stem cell niches and that might relate to Merkel cell and melanocyte ontogeny and tumorigenesis. PMID:20042675

  12. WRKY transcription factors

    PubMed Central

    Bakshi, Madhunita; Oelmüller, Ralf

    2014-01-01

    WRKY transcription factors are one of the largest families of transcriptional regulators found exclusively in plants. They have diverse biological functions in plant disease resistance, abiotic stress responses, nutrient deprivation, senescence, seed and trichome development, embryogenesis, as well as additional developmental and hormone-controlled processes. WRKYs can act as transcriptional activators or repressors, in various homo- and heterodimer combinations. Here we review recent progress on the function of WRKY transcription factors in Arabidopsis and other plant species such as rice, potato, and parsley, with a special focus on abiotic, developmental, and hormone-regulated processes. PMID:24492469

  13. Survey of variation in human transcription factors reveals prevalent DNA binding changes.

    PubMed

    Barrera, Luis A; Vedenko, Anastasia; Kurland, Jesse V; Rogers, Julia M; Gisselbrecht, Stephen S; Rossin, Elizabeth J; Woodard, Jaie; Mariani, Luca; Kock, Kian Hong; Inukai, Sachi; Siggers, Trevor; Shokri, Leila; Gordân, Raluca; Sahni, Nidhi; Cotsapas, Chris; Hao, Tong; Yi, Song; Kellis, Manolis; Daly, Mark J; Vidal, Marc; Hill, David E; Bulyk, Martha L

    2016-03-25

    Sequencing of exomes and genomes has revealed abundant genetic variation affecting the coding sequences of human transcription factors (TFs), but the consequences of such variation remain largely unexplored. We developed a computational, structure-based approach to evaluate TF variants for their impact on DNA binding activity and used universal protein-binding microarrays to assay sequence-specific DNA binding activity across 41 reference and 117 variant alleles found in individuals of diverse ancestries and families with Mendelian diseases. We found 77 variants in 28 genes that affect DNA binding affinity or specificity and identified thousands of rare alleles likely to alter the DNA binding activity of human sequence-specific TFs. Our results suggest that most individuals have unique repertoires of TF DNA binding activities, which may contribute to phenotypic variation. PMID:27013732

  14. Exploiting ancestral mammalian genomes for the prediction of human transcription factor binding sites

    PubMed Central

    2012-01-01

    Background The computational prediction of Transcription Factor Binding Sites (TFBS) remains a challenge due to their short length and low information content. Comparative genomics approaches that simultaneously consider several related species and favor sites that have been conserved throughout evolution improve the accuracy (specificity) of the predictions but are limited due to a phenomenon called binding site turnover, where sequence evolution causes one TFBS to replace another in the same region. In parallel to this development, an increasing number of mammalian genomes are now sequenced and it is becoming possible to infer, to a surprisingly high degree of accuracy, ancestral mammalian sequences. Results We propose a TFBS prediction approach that makes use of the availability of inferred ancestral mammalian genomes to improve its accuracy. This method aims to identify binding loci, which are regions of a few hundred base pairs that have preserved their potential to bind a given transcription factor over evolutionary time. After proposing a neutral evolutionary model of predicted TFBS counts in a DNA region of a given length, we use it to identify regions that have preserved the number of predicted TFBS they contain to an unexpected degree given their divergence. The approach is applied to human chromosome 1 and shows significant gains in accuracy as compared to both existing single-species and multi-species TFBS prediction approaches, in particular for transcription factors that are subject to high turnover rates. Availability The source code and predictions made by the program are available at http://www.cs.mcgill.ca/~blanchem/bindingLoci. PMID:23281809

  15. TFClass: a classification of human transcription factors and their rodent orthologs.

    PubMed

    Wingender, Edgar; Schoeps, Torsten; Haubrock, Martin; Dönitz, Jürgen

    2015-01-01

    TFClass aims at classifying eukaryotic transcription factors (TFs) according to their DNA-binding domains (DBDs). For this, a classification schema comprising four generic levels (superclass, class, family and subfamily) was defined that could accommodate all known DNA-binding human TFs. They were assigned to their (sub-)families as instances at two different levels, the corresponding TF genes and individual gene products (protein isoforms). In the present version, all mouse and rat orthologs have been linked to the human TFs, and the mouse orthologs have been arranged in an independent ontology. Many TFs were assigned with typical DNA-binding patterns and positional weight matrices derived from high-throughput in-vitro binding studies. Predicted TF binding sites from human gene upstream sequences are now also attached to each human TF whenever a PWM was available for this factor or one of his paralogs. TFClass is freely available at http://tfclass.bioinf.med.uni-goettingen.de/ through a web interface and for download in OBO format. PMID:25361979

  16. Identification of the imprinted KLF14 transcription factor undergoing human-specific accelerated evolution.

    PubMed

    Parker-Katiraee, Layla; Carson, Andrew R; Yamada, Takahiro; Arnaud, Philippe; Feil, Robert; Abu-Amero, Sayeda N; Moore, Gudrun E; Kaneda, Masahiro; Perry, George H; Stone, Anne C; Lee, Charles; Meguro-Horike, Makiko; Sasaki, Hiroyuki; Kobayashi, Keiko; Nakabayashi, Kazuhiko; Scherer, Stephen W

    2007-05-01

    Imprinted genes are expressed in a parent-of-origin manner and are located in clusters throughout the genome. Aberrations in the expression of imprinted genes on human Chromosome 7 have been suggested to play a role in the etiologies of Russell-Silver Syndrome and autism. We describe the imprinting of KLF14, an intronless member of the Krüppel-like family of transcription factors located at Chromosome 7q32. We show that it has monoallelic maternal expression in all embryonic and extra-embryonic tissues studied, in both human and mouse. We examine epigenetic modifications in the KLF14 CpG island in both species and find this region to be hypomethylated. In addition, we perform chromatin immunoprecipitation and find that the murine Klf14 CpG island lacks allele-specific histone modifications. Despite the absence of these defining features, our analysis of Klf14 in offspring from DNA methyltransferase 3a conditional knockout mice reveals that the gene's expression is dependent upon a maternally methylated region. Due to the intronless nature of Klf14 and its homology to Klf16, we suggest that the gene is an ancient retrotransposed copy of Klf16. By sequence analysis of numerous species, we place the timing of this event after the divergence of Marsupialia, yet prior to the divergence of the Xenarthra superclade. We identify a large number of sequence variants in KLF14 and, using several measures of diversity, we determine that there is greater variability in the human lineage with a significantly increased number of nonsynonymous changes, suggesting human-specific accelerated evolution. Thus, KLF14 may be the first example of an imprinted transcript undergoing accelerated evolution in the human lineage. PMID:17480121

  17. Molecular characterization of the ets-related human transcription factor ER81.

    PubMed

    Monté, D; Coutte, L; Baert, J L; Angeli, I; Stéhelin, D; de Launoit, Y

    1995-08-17

    The PEA3 group is a homogeneous group of the ets transcription factor family and is composed of three known members, PEA3, ERM and ER81, which, on the amino acid (AA) level, are more than 95% identical within the DNA-binding domain (the Ets domain), more than 85% within a 32 AA domain (the acidic domain) localized in the amino-terminus and almost 50% identical overall. By screening a human kidney cDNA library with a specific probe obtained from mouse ER81, we isolated two clones of 1.6 and 1.5 kb in length encoding a 458 AA open reading frame. When compared to mouse ER81, the present human ER81 lacks the last 13 AA of the acidic domain and the 5 AA contiguous to the carboxy-terminal part of the acidic domain. Of the 458 AA of the human ER81 protein, 97% are identical to mouse ER81. Gel shift analysis indicates that the full-length human ER81 protein is able to bind specifically to an oligonucleotide containing the binding sites recognized by most of the Ets proteins. By transient expression in RK13 mammalian cells, human ER81 protein transactivated a reporter plasmid containing Ets binding sites, indicating that this molecule is a bonafide transcriptional activator, while by expression in Cos-1 transfected cells, we detected the presence of human ER81 protein in the nucleus using immunocytochemistry. In human tissues, ER81 mRNA is very highly expressed in brain, highly expressed in testis, lung and heart, moderately in spleen, small intestine, pancreas and colon, weakly in liver, prostate and thymus, very weakly in skeletal muscle, kidney and ovary and not in placenta and peripheral blood leukocytes. Analysis of human solid or haematopoietic tumour cell lines showed that most of them did not express ER81 detectably. Database searches revealed that ETV1 mRNA is highly similar to human ER81 described here, although it contains the full-length acidic domain present in mouse ER81. By screening a genomic DNA library, we characterized the intron-exon junction within the

  18. Reprogramming of human fibroblasts to pluripotent stem cells using mRNA of four transcription factors

    SciTech Connect

    Yakubov, Eduard; Rechavi, Gidi; Rozenblatt, Shmuel; Givol, David

    2010-03-26

    Reprogramming of differentiated cells into induced pluripotent cells (iPS) was accomplished in 2006 by expressing four, or less, embryonic stem cell (ESC)-specific transcription factors. Due to the possible danger of DNA damage and the potential tumorigenicity associated with such DNA damage, attempts were made to minimize DNA integration by the vectors involved in this process without complete success. Here we present a method of using RNA transfection as a tool for reprogramming human fibroblasts to iPS. We used RNA synthesized in vitro from cDNA of the same reprogramming four transcription factors. After transfection of the RNA, we show intracellular expression and nuclear localization of the respective proteins in at least 70% of the cells. We used five consecutive transfections to support continuous protein expression resulting in the formation of iPS colonies that express alkaline phosphatase and several ESC markers and that can be expanded. This method completely avoids DNA integration and may be developed to replace the use of DNA vectors in the formation of iPS.

  19. Krüppel-like factor 9 is a circadian transcription factor in human epidermis that controls proliferation of keratinocytes

    PubMed Central

    Spörl, Florian; Korge, Sandra; Jürchott, Karsten; Wunderskirchner, Minetta; Schellenberg, Katja; Heins, Sven; Specht, Aljona; Stoll, Claudia; Klemz, Roman; Maier, Bert; Wenck, Horst; Schrader, Annika; Kunz, Dieter; Blatt, Thomas; Kramer, Achim

    2012-01-01

    Circadian clocks govern a wide range of cellular and physiological functions in various organisms. Recent evidence suggests distinct functions of local clocks in peripheral mammalian tissues such as immune responses and cell cycle control. However, studying circadian action in peripheral tissues has been limited so far to mouse models, leaving the implication for human systems widely elusive. In particular, circadian rhythms in human skin, which is naturally exposed to strong daytime-dependent changes in the environment, have not been investigated to date on a molecular level. Here, we present a comprehensive analysis of circadian gene expression in human epidermis. Whole-genome microarray analysis of suction-blister epidermis obtained throughout the day revealed a functional circadian clock in epidermal keratinocytes with hundreds of transcripts regulated in a daytime-dependent manner. Among those, we identified a circadian transcription factor, Krüppel-like factor 9 (Klf9), that is substantially up-regulated in a cortisol and differentiation-state-dependent manner. Gain- and loss-of-function experiments showed strong antiproliferative effects of Klf9. Putative Klf9 target genes include proliferation/differentiation markers that also show circadian expression in vivo, suggesting that Klf9 affects keratinocyte proliferation/differentiation by controlling the expression of target genes in a daytime-dependent manner. PMID:22711835

  20. The Inflammatory Transcription Factors NFκB, STAT1 and STAT3 Drive Age-Associated Transcriptional Changes in the Human Kidney

    PubMed Central

    O’Brown, Zach K.; Van Nostrand, Eric L.; Higgins, John P.; Kim, Stuart K.

    2015-01-01

    Human kidney function declines with age, accompanied by stereotyped changes in gene expression and histopathology, but the mechanisms underlying these changes are largely unknown. To identify potential regulators of kidney aging, we compared age-associated transcriptional changes in the human kidney with genome-wide maps of transcription factor occupancy from ChIP-seq datasets in human cells. The strongest candidates were the inflammation-associated transcription factors NFκB, STAT1 and STAT3, the activities of which increase with age in epithelial compartments of the renal cortex. Stimulation of renal tubular epithelial cells with the inflammatory cytokines IL-6 (a STAT3 activator), IFNγ (a STAT1 activator), or TNFα (an NFκB activator) recapitulated age-associated gene expression changes. We show that common DNA variants in RELA and NFKB1, the two genes encoding subunits of the NFκB transcription factor, associate with kidney function and chronic kidney disease in gene association studies, providing the first evidence that genetic variation in NFκB contributes to renal aging phenotypes. Our results suggest that NFκB, STAT1 and STAT3 underlie transcriptional changes and chronic inflammation in the aging human kidney. PMID:26678048

  1. Transcription Factors OVOL1 and OVOL2 Induce the Mesenchymal to Epithelial Transition in Human Cancer

    PubMed Central

    Roca, Hernan; Hernandez, James; Weidner, Savannah; McEachin, Richard C.; Fuller, David; Sud, Sudha; Schumann, Taibriana; Wilkinson, John E.; Zaslavsky, Alexander; Li, Hangwen; Maher, Christopher A.; Daignault-Newton, Stephanie; Healy, Patrick N.; Pienta, Kenneth J.

    2013-01-01

    Cell plasticity regulated by the balance between the mesenchymal to epithelial transition (MET) and the opposite program, EMT, is critical in the metastatic cascade. Several transcription factors (TFs) are known to regulate EMT, though the mechanisms of MET remain unclear. We demonstrate a novel function of two TFs, OVOL1 and OVOL2, as critical inducers of MET in human cancers. Our findings indicate that the OVOL-TFs control MET through a regulatory feedback loop with EMT-inducing TF ZEB1, and the regulation of mRNA splicing by inducing Epithelial Splicing Regulatory Protein 1 (ESRP1). Using mouse prostate tumor models we show that expression of OVOL-TFs in mesenchymal prostate cancer cells attenuates their metastatic potential. The role of OVOL-TFs as inducers of MET is further supported by expression analyses in 917 cancer cell lines, suggesting their role as crucial regulators of epithelial-mesenchymal cell plasticity in cancer. PMID:24124593

  2. ERK5 pathway regulates transcription factors important for monocytic differentiation of human myeloid leukemia cells.

    PubMed

    Wang, Xuening; Pesakhov, Stella; Harrison, Jonathan S; Danilenko, Michael; Studzinski, George P

    2014-07-01

    Mitogen-activated protein kinases (MAPKs) are important transducers of external signals for cell growth, survival, and other cellular responses including cell differentiation. Several MAPK cascades are known with the MEK1/2-ERK1/2, JNK, and p38MAPKs receiving most attention, but the role of MEK5-ERK5 in intracellular signaling deserves more scrutiny, as this pathway transmits signals that can complement ERK/2 signaling. We hypothesized that the ERK5 pathway plays a role in the control of monocytic differentiation, which is disturbed in myeloid leukemia. We therefore examined the cellular phenotype and key molecular events which occur when human myeloid leukemia cells, acute (AML) or chronic (CML), are forced to differentiate by vitamin D derivatives (VDDs). This study was performed using established cell lines HL60 and U937, and primary cultures of blasts from 10 patients with ML. We found that ERK5 and its direct downstream target transcription factor MEF2C are upregulated by 1,25D in parallel with monocytic differentiation. Further, inhibition of ERK5 activity by specific pharmacological agents BIX02189 and XMD8-92 alters the phenotype of these cells by reducing the abundance of the VDD-induced surface monocytic marker CD14, and concomitantly increasing surface expression of the general myeloid marker CD11b. Similar results were obtained when the expression of ERK5 was reduced by siRNA or short hairpin (sh) RNA. ERK5 inhibition resulted in an expected decrease in MEF2C activation. We also found that in AML cells the transcription factor C/EBPβ is positively regulated, while C/EBPα is negatively regulated by ERK5. These findings provide new understanding of dysregulated differentiation in human myeloid leukemia. PMID:24264602

  3. ERK5 Pathway Regulates Transcription Factors Important for Monocytic Differentiation of Human Myeloid Leukemia Cells†

    PubMed Central

    Wang, Xuening; Pesakhov, Stella; Harrison, Jonathan S; Danilenko, Michael; Studzinski, George P

    2014-01-01

    Mitogen-activated protein kinases (MAPKs) are important transducers of external signals for cell growth, survival and other cellular responses including cell differentiation. Several MAPK cascades are known with the MEK1/2-ERK1/2, JNK, and p38MAPKs receiving most attention, but the role of MEK5-ERK5 in intracellular signaling deserves more scrutiny, as this pathway transmits signals that can complement ERK/2 signaling. We hypothesized that the ERK5 pathway plays a role in the control of monocytic differentiation, which is disturbed in myeloid leukemia. We therefore examined the cellular phenotype and key molecular events which occur when human myeloid leukemia cells, acute (AML) or chronic (CML), are forced to differentiate by vitamin D derivatives (VDDs). This study was performed using established cell lines HL60 and U937, and primary cultures of blasts from 10 patients with ML. We found that ERK5 and its direct downstream target transcription factor MEF2C are upregulated by 1,25D in parallel with monocytic differentiation. Further, inhibition of ERK5 activity by specific pharmacological agents BIX02189 and XMD8-92 alters the phenotype of these cells by reducing the abundance of the VDD-induced surface monocytic marker CD14, and concomitantly increasing surface expression of the general myeloid marker CD11b. Similar results were obtained when the expression of ERK5 was reduced by siRNA or short hairpin (sh) RNA. ERK5 inhibition resulted in an expected decrease in MEF2C activation. We also found that in AML the transcription factor C/EBPβ is positively regulated, while C/EBPα is negatively regulated by ERK5. These findings provide new understanding of dysregulated differentiation in human myeloid leukemia. PMID:24264602

  4. Transcription factor 4 (TCF4) and schizophrenia: integrating the animal and the human perspective.

    PubMed

    Quednow, Boris B; Brzózka, Magdalena M; Rossner, Moritz J

    2014-08-01

    Schizophrenia is a genetically complex disease considered to have a neurodevelopmental pathogenesis and defined by a broad spectrum of positive and negative symptoms as well as cognitive deficits. Recently, large genome-wide association studies have identified common alleles slightly increasing the risk for schizophrenia. Among the few schizophrenia-risk genes that have been consistently replicated is the basic Helix-Loop-Helix (bHLH) transcription factor 4 (TCF4). Haploinsufficiency of the TCF4 (formatting follows IUPAC nomenclature: TCF4 protein/protein function, Tcf4 rodent gene cDNA mRNA, TCF4 human gene cDNA mRNA) gene causes the Pitt-Hopkins syndrome-a neurodevelopmental disease characterized by severe mental retardation. Accordingly, Tcf4 null-mutant mice display developmental brain defects. TCF4-associated risk alleles are located in putative coding and non-coding regions of the gene. Hence, subtle changes at the level of gene expression might be relevant for the etiopathology of schizophrenia. Behavioural phenotypes obtained with a mouse model of slightly increased gene dosage and electrophysiological investigations with human risk-allele carriers revealed an overlapping spectrum of schizophrenia-relevant endophenotypes. Most prominently, early information processing and higher cognitive functions appear to be associated with TCF4 risk genotypes. Moreover, a recent human study unravelled gene × environment interactions between TCF4 risk alleles and smoking behaviour that were specifically associated with disrupted early information processing. Taken together, TCF4 is considered as an integrator ('hub') of several bHLH networks controlling critical steps of various developmental, and, possibly, plasticity-related transcriptional programs in the CNS and changes of TCF4 expression also appear to affect brain networks important for information processing. Consequently, these findings support the neurodevelopmental hypothesis of schizophrenia and provide a

  5. Identification of Transcription Factor AML-1 Binding Site Upstream of Human Cytomegalovirus UL111A Gene

    PubMed Central

    Zheng, Xiaoqun; Gao, Yan; Zhang, Qi; Liu, Yanqing; Peng, Ying; Fu, Miao; Ji, Yanhong

    2015-01-01

    Human cytomegalovirus (HCMV) interleukin-10 (hcmvIL-10), encoded by HCMV UL111A gene, is a homolog of human IL-10. It exerts immunomodulatory effects that allow HCMV to evade host defense mechanisms. However, the exact mechanism underlying the regulation of hcmvIL-10 expression is not well understood. The transcription factor acute myeloid leukemia 1 (AML-1) plays an important role in the regulation of various genes involved in the differentiation of hematopoietic lineages. A putative AML-1 binding site is present within the upstream regulatory region (URR) of UL111A gene. To provide evidence that AML-1 is involved in regulating UL111A gene expression, we examined the interaction of AML-1 with the URR of UL111A in HCMV-infected human monocytic THP-1 cells using a chromatin immunoprecipitation assay. HcmvIL-10 transcription was detected in differentiated THP-1 cells, but not in undifferentiated ones. Furthermore, the URR of UL111A showed a higher intensity of AML-1 binding, a higher level of histone H3 acetyl-K9, but a lower level of histone H3 dimethyl-K9 in differentiated THP-1 cells than undifferentiated cells. Down-regulation of AML1 by RNA interference decreased the expression of the UL111A gene. Our results suggest that AML-1 may contribute to the epigenetic regulation of UL111A gene via histone modification in HCMV-infected differentiated THP-1 cells. This finding could be useful for the development of new anti-viral therapies. PMID:25658598

  6. Microphthalmia-associated transcription factor as the molecular target of cadmium toxicity in human melanocytes.

    PubMed

    Chantarawong, Wipa; Takeda, Kazuhisa; Sangartit, Weerapon; Yoshizawa, Miki; Pradermwong, Kantimanee; Shibahara, Shigeki

    2014-11-28

    Dietary intake of cadmium is inevitable, causing age-related increase in cadmium accumulation in many organs, including hair, choroid and retinal pigment epithelium (RPE). Cadmium has been implicated in the pathogenesis of hearing loss and macular degeneration. The functions of cochlea and retina are maintained by melanocytes and RPE, respectively, and the differentiation of these pigment cells is regulated by microphthalmia-associated transcription factor (MITF). In the present study, we explored the potential toxicity of cadmium in the cochlea and retina by using cultured human melanocytes and human RPE cell lines. MITF consists of multiple isoforms, including melanocyte-specific MITF-M and widely expressed MITF-H. Levels of MITF-M protein and its mRNA in human epidermal melanocytes and HMV-II melanoma cells were decreased significantly by cadmium. In parallel with the MITF reduction, mRNA levels of tyrosinase, the key enzyme of melanin biosynthesis that is regulated by MITF-M, were also decreased. In RPE cells, however, the levels of total MITF protein, constituting mainly MITF-H, were not decreased by cadmium. We thus identify MITF-M as the molecular target of cadmium toxicity in melanocytes, thereby accounting for the increased risk of disability from melanocyte malfunction, such as hearing and vision loss among people with elevated cadmium exposure. PMID:25449283

  7. Human mitochondrial transcription factor A is required for the segregation of mitochondrial DNA in cultured cells.

    PubMed

    Kasashima, Katsumi; Sumitani, Megumi; Endo, Hitoshi

    2011-01-15

    The segregation and transmission of the mitochondrial genome in humans are complicated processes but are particularly important for understanding the inheritance and clinical abnormalities of mitochondrial disorders. However, the molecular mechanism of the segregation of mitochondrial DNA (mtDNA) is largely unclear. In this study, we demonstrated that human mitochondrial transcription factor A (TFAM) is required for the segregation of mtDNA in cultured cells. RNAi-mediated knockdown of TFAM in HeLa cells resulted in the enlarged mtDNA, as indicated by the assembly of fluorescent signals stained with PicoGreen. Fluorescent in situ hybridization confirmed the enlarged mtDNA and further showed the existence of increased numbers of mitochondria lacking mtDNA signals in TFAM knockdown cells. By complementation analysis, the C-terminal tail of TFAM, which enhances its affinity with DNA, was found to be required for the appropriate distribution of mtDNA. Furthermore, we found that TFAM knockdown induced asymmetric segregation of mtDNA between dividing daughter cells. These results suggest an essential role for human TFAM in symmetric segregation of mtDNA. PMID:20955698

  8. Microphthalmia-associated transcription factor as the molecular target of cadmium toxicity in human melanocytes

    SciTech Connect

    Chantarawong, Wipa; Takeda, Kazuhisa; Sangartit, Weerapon; Yoshizawa, Miki; Pradermwong, Kantimanee; Shibahara, Shigeki

    2014-11-28

    Highlights: • In human melanocytes, cadmium decreases the expression of MITF-M and tyrosinase and their mRNAs. • In human melanoma cells, cadmium decreases the expression of MITF-M protein and tyrosinase mRNA. • Expression of MITF-H is less sensitive to cadmium toxicity in melanocyte-linage cells. • Cadmium does not decrease the expression of MITF-H in retinal pigment epithelial cells. • MITF-M is the molecular target of cadmium toxicity in melanocytes. - Abstract: Dietary intake of cadmium is inevitable, causing age-related increase in cadmium accumulation in many organs, including hair, choroid and retinal pigment epithelium (RPE). Cadmium has been implicated in the pathogenesis of hearing loss and macular degeneration. The functions of cochlea and retina are maintained by melanocytes and RPE, respectively, and the differentiation of these pigment cells is regulated by microphthalmia-associated transcription factor (MITF). In the present study, we explored the potential toxicity of cadmium in the cochlea and retina by using cultured human melanocytes and human RPE cell lines. MITF consists of multiple isoforms, including melanocyte-specific MITF-M and widely expressed MITF-H. Levels of MITF-M protein and its mRNA in human epidermal melanocytes and HMV-II melanoma cells were decreased significantly by cadmium. In parallel with the MITF reduction, mRNA levels of tyrosinase, the key enzyme of melanin biosynthesis that is regulated by MITF-M, were also decreased. In RPE cells, however, the levels of total MITF protein, constituting mainly MITF-H, were not decreased by cadmium. We thus identify MITF-M as the molecular target of cadmium toxicity in melanocytes, thereby accounting for the increased risk of disability from melanocyte malfunction, such as hearing and vision loss among people with elevated cadmium exposure.

  9. Phenotypic robustness and the assortativity signature of human transcription factor networks.

    PubMed

    Pechenick, Dov A; Payne, Joshua L; Moore, Jason H

    2014-08-01

    Many developmental, physiological, and behavioral processes depend on the precise expression of genes in space and time. Such spatiotemporal gene expression phenotypes arise from the binding of sequence-specific transcription factors (TFs) to DNA, and from the regulation of nearby genes that such binding causes. These nearby genes may themselves encode TFs, giving rise to a transcription factor network (TFN), wherein nodes represent TFs and directed edges denote regulatory interactions between TFs. Computational studies have linked several topological properties of TFNs - such as their degree distribution - with the robustness of a TFN's gene expression phenotype to genetic and environmental perturbation. Another important topological property is assortativity, which measures the tendency of nodes with similar numbers of edges to connect. In directed networks, assortativity comprises four distinct components that collectively form an assortativity signature. We know very little about how a TFN's assortativity signature affects the robustness of its gene expression phenotype to perturbation. While recent theoretical results suggest that increasing one specific component of a TFN's assortativity signature leads to increased phenotypic robustness, the biological context of this finding is currently limited because the assortativity signatures of real-world TFNs have not been characterized. It is therefore unclear whether these earlier theoretical findings are biologically relevant. Moreover, it is not known how the other three components of the assortativity signature contribute to the phenotypic robustness of TFNs. Here, we use publicly available DNaseI-seq data to measure the assortativity signatures of genome-wide TFNs in 41 distinct human cell and tissue types. We find that all TFNs share a common assortativity signature and that this signature confers phenotypic robustness to model TFNs. Lastly, we determine the extent to which each of the four components of the

  10. Profiling ethanol-targeted transcription factors in human carcinoma cell-derived embryoid bodies.

    PubMed

    Mandal, Chanchal; Halder, Debasish; Chai, Jin Choul; Lee, Young Seek; Jung, Kyoung Hwa; Chai, Young Gyu

    2016-01-15

    Fetal alcohol spectrum disorder is a collective term that represents fetal abnormalities associated with maternal alcohol consumption. Prenatal alcohol exposure and related anomalies are well characterized, but the molecular mechanism behind this phenomenon is not yet understood. Few insights have been gained from genetic and epigenetic studies of fetal alcohol spectrum disorder. Our aim was to profile the important molecular regulators of ethanol-related alterations of the genome. For this purpose, we have analyzed the gene expression pattern of human carcinoma cell-derived embryoid bodies in the absence or presence of ethanol. A cDNA microarray analysis was used to profile mRNA expression in embryoid bodies at day 7 with or without ethanol treatment. A total of 493 differentially expressed genes were identified in response to 50 mM ethanol exposure. Of these, 111 genes were up-regulated, and 382 were down-regulated. Gene ontology term enrichment analysis revealed that these genes are involved in important biological processes: neurological system processes, cognition, behavior, sensory perception of smell, taste and chemical stimuli and synaptic transmission. Similarly, the enrichment of disease-related genes included relevant categories such as neurological diseases, developmental disorders, skeletal and muscular disorders, and connective tissue disorders. Furthermore, we have identified a group of 26 genes that encode transcription factors. We validated the relative gene expression of several transcription factors using quantitative real time PCR. We hope that our study substantially contributes to the understanding of the molecular mechanisms underlying the pathology of alcohol-mediated anomalies and facilitates further research. PMID:26456191

  11. Involvement of microphthalmia-associated transcription factor (MITF) in expression of human melanocortin-1 receptor (MC1R).

    PubMed

    Aoki, Hirofumi; Moro, Osamu

    2002-09-20

    Analysis of the nucleotide sequence of human melanocortin-1 receptor (MC1R) promoter indicated that an E-box (CANNTG) is present immediately upstream of the transcriptional initiation site. The presence of the CATGTG motif suggests that MC1R gene expression may be regulated by a basic helix-loop-helix-leucine-zipper (bHLH-LZ) type transcription factor. The microphthalmia-associated transcription factor (MITF), which belongs to the family of bHLH-LZ type transcription factors, regulates the transcription of melanogenesis-related enzyme genes such as the tyrosinase and TRP-1 genes. We investigated whether MITF regulates human MC1R gene expression through the same transcriptional mechanism as tyrosinase and TRP-1 genes in melanocytes. For this purpose, the effect of co-expression of cDNA encoding MITF on MC1R promoter activity in NIH/3T3 cells was studied. MC1R promoter activity was induced to the extent of approximately 5-fold in the presence of MITF. In addition, electrophoretic mobility shift assay indicated that nuclear extracts of human SK-Mel-2 cells contain a protein that binds specifically to the MC1R promoter region containing the CATGTG motif. These results suggested that MITF regulates not only the expression of enzymes involved in melanin synthesis, but also the expression of a receptor which plays an essential role in melanocyte functions. PMID:12204775

  12. GATA Transcription Factors and Cancer

    PubMed Central

    Zheng, Rena; Blobel, Gerd A.

    2010-01-01

    It has been almost a quarter century since it was first appreciated that a class of oncogenes contained in rapidly transforming avian retroviruses encoded DNA-binding transcription factors. As with other oncogenes, genetic recombination with the viral genome led to their overexpression or functional alteration. In the years that followed, alterations of numerous transcription factors were shown to be causatively involved in various cancers in human patients and model organisms. Depending on their normal cellular functions, these factors were subsequently categorized as proto-oncogenes or tumor suppressor genes. This review focuses on the role of GATA transcription factors in carcinogenesis. GATA factors are zinc finger DNA binding proteins that control the development of diverse tissues by activating or repressing transcription. GATA factors thus coordinate cellular maturation with proliferation arrest and cell survival. Therefore, a role of this family of genes in human cancers is not surprising. Prominent examples include structural mutations in GATA1 that are found in almost all megakaryoblastic leukemias in patients with Down syndrome; loss of GATA3 expression in aggressive, dedifferentiated breast cancers; and silencing of GATA4 and GATA5 expression in colorectal and lung cancers. Here, we discuss possible mechanisms of carcinogenesis vis-à-vis the normal functions of GATA factors as they pertain to human patients and mouse models of cancer. PMID:21779441

  13. Selective activation of human heat shock gene transcription by nitrosourea antitumor drugs mediated by isocyanate-induced damage and activation of heat shock transcription factor

    SciTech Connect

    Kroes, R.A. Northwestern Univ., Evanston, IL ); Abravaya, K.; Morimoto, R.I. ); Seidenfeld, J. )

    1991-06-01

    Treatment of cultured human tumor cells with the chloroethylnitrosourea antitumor drug 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU) selectively induces transcription and protein synthesis of a subset of the human heat shock or stress-induced genes (HSP90 and HSP70) with little effect on other stress genes or on expression of the c-fos, c-myc, or {beta}-actin genes. The active component of BCNU and related compounds appears to be the isocyanate moiety that causes carbamoylation of proteins and nucleic acids. Transcriptional activation of the human HSP70 gene by BCNU is dependent on the heat shock element and correlates with the level of heat shock transcription factor and its binding to the heat shock element in vivo. Unlike activation by heat or heavy metals, BCNU-mediated activation is strongly dependent upon new protein synthesis. This suggests that BCNU-induced, isocyanate-mediated damage to newly synthesized protein(s) may be responsible for activation of the heat shock transcription factor and increased transcription of the HSP90 and HSP70 genes.

  14. Interaction of the human T-cell lymphotropic virus type 1 tax transactivator with transcription factor IIA.

    PubMed Central

    Clemens, K E; Piras, G; Radonovich, M F; Choi, K S; Duvall, J F; DeJong, J; Roeder, R; Brady, J N

    1996-01-01

    The Tax protein of human T-cell lymphotropic virus type 1 (HTLV-1) is a 40-kDa transcriptional activator which is critical for HTLV-1 gene regulation and virus-induced cellular transformation. Tax is localized to the DNA through its interaction with the site-specific activators cyclic AMP-responsive element-binding protein, NF-kappaB, and serum response factor. It has been suggested that the recruitment of Tax to the DNA positions Tax for interaction with the basal transcriptional machinery. On the basis of several independent assays, we now report a physical and functional interaction between Tax and the transcription factor, TFIIA. First, Tax was found to interact with the 35-kDa (alpha) subunit of TFIIA in the yeast two-hybrid interaction system. Importantly, two previously characterized mutants with point mutations in Tax, M32 (Y196A, K197S) and M41 (H287A, P288S), which were shown to be defective in Tax-activated transcription were unable to interact with TFIIA in this assay. Second, a glutathione-S-transferase (GST) affinity-binding assay showed that the interaction of holo-TFIIA with GST-Tax was 20-fold higher than that observed with either the GST-Tax M32 activation mutant or the GST control. Third, a coimmunoprecipitation assay showed that in HTLV-1-infected human T lymphocytes, Tax and TFIIA were associated. Finally, TFIIA facilitates Tax transactivation in vitro and in vivo. In vitro transcription studies showed reduced levels of Tax-activated transcription in cell extracts depleted of TFIIA. In addition, transfection of human T lymphocytes with TFIIA expression vectors enhanced Tax-activated transcription of an HTLV-1 long terminal repeat-chloramphenicol acetyltransferase reporter construct. Our study suggests that the interaction of Tax with the transcription factor TFIIA may play a role in Tax-mediated transcriptional activation. PMID:8756622

  15. Structure of human heat-shock transcription factor 1 in complex with DNA.

    PubMed

    Neudegger, Tobias; Verghese, Jacob; Hayer-Hartl, Manajit; Hartl, F Ulrich; Bracher, Andreas

    2016-02-01

    Heat-shock transcription factor 1 (HSF1) has a central role in mediating the protective response to protein conformational stresses in eukaryotes. HSF1 consists of an N-terminal DNA-binding domain (DBD), a coiled-coil oligomerization domain, a regulatory domain and a transactivation domain. Upon stress, HSF1 trimerizes via its coiled-coil domain and binds to the promoters of heat shock protein-encoding genes. Here, we present cocrystal structures of the human HSF1 DBD in complex with cognate DNA. A comparative analysis of the HSF1 paralog Skn7 from Chaetomium thermophilum showed that single amino acid changes in the DBD can switch DNA binding specificity, thus revealing the structural basis for the interaction of HSF1 with cognate DNA. We used a crystal structure of the coiled-coil domain of C. thermophilum Skn7 to develop a model of the active human HSF1 trimer in which HSF1 embraces the heat-shock-element DNA. PMID:26727489

  16. Human Gene-Centered Transcription Factor Networks for Enhancers and Disease Variants

    PubMed Central

    Bass, Juan I. Fuxman; Sahni, Nidhi; Shrestha, Shaleen; Garcia-Gonzalez, Aurian; Mori, Akihiro; Bhat, Numana; Yi, Song; Hill, David E.; Vidal, Marc; Walhout, Albertha J.M.

    2015-01-01

    SUMMARY Gene regulatory networks (GRNs) comprising interactions between transcription factors (TFs) and regulatory loci control development and physiology. Numerous disease-associated mutations have been identified, the vast majority residing in non-coding regions of the genome. As current GRN mapping methods test one TF at a time and require the use of cells harboring the mutation(s) of interest, they are not suitable to identify TFs that bind to wild type and mutant loci. Here, we use gene-centered yeast one-hybrid (eY1H) assays to interrogate binding of 1,086 human TFs to 246 enhancers, as well as to 109 non-coding disease mutations. We detect both loss and gain of TF interactions with mutant loci that are concordant with target gene expression changes. This work establishes eY1H assays as a powerful addition to the toolkit of mapping human GRNs and for the high-throughput characterization of genomic variants that are rapidly being identified by genome-wide association studies. PMID:25910213

  17. Murine and Human Spermatids Are Characterized by Numerous, Newly Synthesized and Differentially Expressed Transcription Factors and Bromodomain-Containing Proteins.

    PubMed

    Klaus, Elisabeth Sabine; Gonzalez, Nicola Helena; Bergmann, Martin; Bartkuhn, Marek; Weidner, Wolfgang; Kliesch, Sabine; Rathke, Christina

    2016-07-01

    Much of spermatid differentiation takes place in the absence of active transcription, but in the early phase, large amounts of mRNA are synthesized, translationally repressed, and stored. Most nucleosomal histones are then degraded, and chromatin is repackaged by protamines. For both transcription and the histone-to-protamine transition in differentiating spermatids, chromatin must be opened. This raises the question of whether two different processes exist. It is conceivable that for initiation of the histone-to-protamine transition, the already accessible, actively transcribed chromatin regions are utilized or vice versa. We analyzed the enrichment of different canonical TATA-box-binding, protein-associated factors and their variants in murine spermatids, diverse bromodomain-containing proteins, and components of the Polycomb repressive complexes PRC1 and PRC2 using quantitative PCR. We compared the enrichment of corresponding proteins in human and murine spermatids and analyzed the time frame of postmeiotic transcription and expression of histones, transition proteins, and protamines in human and murine spermatids using immunohistology. We correlated the expression of different transcription factors and bromodomain-containing proteins and the pattern of acetylated histones to active transcription and to the histone-to-protamine transition in both human and murine spermatids. Our findings suggest that differentiating spermatids use both common and specific features to open chromatin first for transcription and subsequently for histone-to-protamine transition. PMID:27170439

  18. Architectural transcription factor HMGI(Y) promotes tumor progression and mesenchymal transition of human epithelial cells.

    PubMed

    Reeves, R; Edberg, D D; Li, Y

    2001-01-01

    Numerous studies have demonstrated that overexpression or aberrant expression of the HMGI(Y) family of architectural transcription factors is frequently associated with both neoplastic transformation of cells and metastatic tumor progression. Little is known, however, about the molecular roles played by the HMGI(Y) proteins in these events. Here we report that human breast epithelial cells harboring tetracycline-regulated HMGI(Y) transgenes acquire the ability to form both primary and metastatic tumors in nude mice only when the transgenes are actively expressed. Unexpectedly, the HMG-Y, rather than the HMG-I, isoform of these proteins is the most effective elicitor of both neoplastic transformation and metastatic progression in vivo. Furthermore, expression of either antisense or dominant-negative HMGI(Y) constructs inhibits both the rate of proliferation of tumor cells and their ability to grow anchorage independently in soft agar. Array analysis of transcription profiles demonstrates that the HMG-I and HMG-Y isoform proteins each modulate the expression of distinctive constellations of genes known to be involved in signal transduction, cell proliferation, tumor initiation, invasion, migration, induction of angiogenesis, and colonization. Immunohistochemical analyses of tumors formed in nude mice indicate that many have undergone an epithelial-mesenchymal transition in vivo. Together, these findings demonstrate that overexpression of the HMGI(Y) proteins, more specifically, the HMG-Y isoform protein, is causally associated with both neoplastic transformation and metastatic progression and suggest that induction of integrins and their signaling pathways may play significant molecular roles in these biological events. PMID:11134344

  19. Architectural Transcription Factor HMGI(Y) Promotes Tumor Progression and Mesenchymal Transition of Human Epithelial Cells

    PubMed Central

    Reeves, Raymond; Edberg, Dale D.; Li, Ying

    2001-01-01

    Numerous studies have demonstrated that overexpression or aberrant expression of the HMGI(Y) family of architectural transcription factors is frequently associated with both neoplastic transformation of cells and metastatic tumor progression. Little is known, however, about the molecular roles played by the HMGI(Y) proteins in these events. Here we report that human breast epithelial cells harboring tetracycline-regulated HMGI(Y) transgenes acquire the ability to form both primary and metastatic tumors in nude mice only when the transgenes are actively expressed. Unexpectedly, the HMG-Y, rather than the HMG-I, isoform of these proteins is the most effective elicitor of both neoplastic transformation and metastatic progression in vivo. Furthermore, expression of either antisense or dominant-negative HMGI(Y) constructs inhibits both the rate of proliferation of tumor cells and their ability to grow anchorage independently in soft agar. Array analysis of transcription profiles demonstrates that the HMG-I and HMG-Y isoform proteins each modulate the expression of distinctive constellations of genes known to be involved in signal transduction, cell proliferation, tumor initiation, invasion, migration, induction of angiogenesis, and colonization. Immunohistochemical analyses of tumors formed in nude mice indicate that many have undergone an epithelial-mesenchymal transition in vivo. Together, these findings demonstrate that overexpression of the HMGI(Y) proteins, more specifically, the HMG-Y isoform protein, is causally associated with both neoplastic transformation and metastatic progression and suggest that induction of integrins and their signaling pathways may play significant molecular roles in these biological events. PMID:11134344

  20. Gene amplification of the transcription factor DP1 and CTNND1 in human lung cancer.

    PubMed

    Castillo, Sandra D; Angulo, Barbara; Suarez-Gauthier, Ana; Melchor, Lorenzo; Medina, Pedro P; Sanchez-Verde, Lydia; Torres-Lanzas, Juan; Pita, Guillermo; Benitez, Javier; Sanchez-Cespedes, Montse

    2010-09-01

    The search for novel oncogenes is important because they could be the target of future specific anticancer therapies. In the present paper we report the identification of novel amplified genes in lung cancer by means of global gene expression analysis. To screen for amplicons, we aligned the gene expression data according to the position of transcripts in the human genome and searched for clusters of over-expressed genes. We found several clusters with gene over-expression, suggesting an underlying genomic amplification. FISH and microarray analysis for DNA copy number in two clusters, at chromosomes 11q12 and 13q34, confirmed the presence of amplifications spanning about 0.4 and 1 Mb for 11q12 and 13q34, respectively. Amplification at these regions each occurred at a frequency of 3%. Moreover, quantitative RT-PCR of each individual transcript within the amplicons allowed us to verify the increased in gene expression of several genes. The p120ctn and DP1 proteins, encoded by two candidate oncogenes, CTNND1 and TFDP1, at 11q12 and 13q amplicons, respectively, showed very strong immunostaining in lung tumours with gene amplification. We then focused on the 13q34 amplicon and in the TFDP1 candidate oncogene. To further determine the oncogenic properties of DP1, we searched for lung cancer cell lines carrying TFDP1 amplification. Depletion of TFDP1 expression by small interference RNA in a lung cancer cell line (HCC33) with TFDP1 amplification and protein over-expression reduced cell viability by 50%. In conclusion, we report the identification of two novel amplicons, at 13q34 and 11q12, each occurring at a frequency of 3% of non-small cell lung cancers. TFDP1, which encodes the E2F-associated transcription factor DP1 is a candidate oncogene at 13q34. The data discussed in this publication have been deposited in NCBIs Gene Expression Omnibus (GEO; http://www.ncbi.nlm.nih.gov/geo/) and are accessible through GEO Series Accession No. GSE21168. PMID:20556744

  1. Expression of Human Frataxin Is Regulated by Transcription Factors SRF and TFAP2

    PubMed Central

    Li, Kuanyu; Singh, Anamika; Crooks, Daniel R.; Dai, Xiaoman; Cong, Zhuangzhuang; Pan, Liang; Ha, Dung; Rouault, Tracey A.

    2010-01-01

    Background Friedreich ataxia is an autosomal recessive neurodegenerative disease caused by reduced expression levels of the frataxin gene (FXN) due to expansion of triplet nucleotide GAA repeats in the first intron of FXN. Augmentation of frataxin expression levels in affected Friedreich ataxia patient tissues might substantially slow disease progression. Methodology/Principal Findings We utilized bioinformatic tools in conjunction with chromatin immunoprecipitation and electrophoretic mobility shift assays to identify transcription factors that influence transcription of the FXN gene. We found that the transcription factors SRF and TFAP2 bind directly to FXN promoter sequences. SRF and TFAP2 binding sequences in the FXN promoter enhanced transcription from luciferase constructs, while mutagenesis of the predicted SRF or TFAP2 binding sites significantly decreased FXN promoter activity. Further analysis demonstrated that robust SRF- and TFAP2-mediated transcriptional activity was dependent on a regulatory element, located immediately downstream of the first FXN exon. Finally, over-expression of either SRF or TFAP2 significantly increased frataxin mRNA and protein levels in HEK293 cells, and frataxin mRNA levels were also elevated in SH-SY5Y cells and in Friedreich ataxia patient lymphoblasts transfected with SRF or TFAP2. Conclusions/Significance We identified two transcription factors, SRF and TFAP2, as well as an intronic element encompassing EGR3-like sequence, that work together to regulate expression of the FXN gene. By providing new mechanistic insights into the molecular factors influencing frataxin expression, our results should aid in the discovery of new therapeutic targets for the treatment of Friedreich ataxia. PMID:20808827

  2. Frequent somatic mutations of the transcription factor ATBF1 in human prostate cancer.

    PubMed

    Sun, Xiaodong; Frierson, Henry F; Chen, Ceshi; Li, Changling; Ran, Qimei; Otto, Kristen B; Cantarel, Brandi L; Cantarel, Brandi M; Vessella, Robert L; Gao, Allen C; Petros, John; Miura, Yutaka; Simons, Jonathan W; Dong, Jin-Tang

    2005-04-01

    Cancer often results from the accumulation of multiple genetic alterations. Although most malignancies are sporadic, only a small number of genes have been shown to undergo frequent mutations in sporadic cancers. The long arm of chromosome 16 is frequently deleted in human cancers, but the target gene for this deletion has not been identified. Here we report that ATBF1, which encodes a transcription factor that negatively regulates AFP and MYB but transactivates CDKN1A, is a good candidate for the 16q22 tumor-suppressor gene. We narrowed the region of deletion at 16q22 to 861 kb containing ATBF1. ATBF1 mRNA was abundant in normal prostates but more scarce in approximately half of prostate cancers tested. In 24 of 66 (36%) cancers examined, we identified 22 unique somatic mutations, many of which impair ATBF1 function. Furthermore, ATBF1 inhibited cell proliferation. Hence, loss of ATBF1 is one mechanism that defines the absence of growth control in prostate cancer. PMID:15750593

  3. Specific interactions between transcription factors and the promoter-regulatory region of the human cytomegalovirus major immediate-early gene

    SciTech Connect

    Ghazal, P.; Lubon, H.; Hennighausen, L. )

    1988-03-01

    Repeat sequence motifs as well as unique sequences between nucleotides {minus}150 and {minus}22 of the human cytomegalovirus immediate-early 1 gene interact in vitro with nuclear proteins. The authors show that a transcriptional element between nucleotides {minus}91 and {minus}65 stimulated promoter activity in vivo and in vitro by binding specific cellular transcription factors. Finally, a common sequence motif, (T)TGG/AC, present in 15 of the determined binding sites suggests a particular class of nuclear factors associated with the immediate-early 1 gene.

  4. Classification of human genomic regions based on experimentally determined binding sites of more than 100 transcription-related factors

    PubMed Central

    2012-01-01

    Background Transcription factors function by binding different classes of regulatory elements. The Encyclopedia of DNA Elements (ENCODE) project has recently produced binding data for more than 100 transcription factors from about 500 ChIP-seq experiments in multiple cell types. While this large amount of data creates a valuable resource, it is nonetheless overwhelmingly complex and simultaneously incomplete since it covers only a small fraction of all human transcription factors. Results As part of the consortium effort in providing a concise abstraction of the data for facilitating various types of downstream analyses, we constructed statistical models that capture the genomic features of three paired types of regions by machine-learning methods: firstly, regions with active or inactive binding; secondly, those with extremely high or low degrees of co-binding, termed HOT and LOT regions; and finally, regulatory modules proximal or distal to genes. From the distal regulatory modules, we developed computational pipelines to identify potential enhancers, many of which were validated experimentally. We further associated the predicted enhancers with potential target transcripts and the transcription factors involved. For HOT regions, we found a significant fraction of transcription factor binding without clear sequence motifs and showed that this observation could be related to strong DNA accessibility of these regions. Conclusions Overall, the three pairs of regions exhibit intricate differences in chromosomal locations, chromatin features, factors that bind them, and cell-type specificity. Our machine learning approach enables us to identify features potentially general to all transcription factors, including those not included in the data. PMID:22950945

  5. Simulated binding of transcription factors to active and inactive regions folds human chromosomes into loops, rosettes and topological domains.

    PubMed

    Brackley, Chris A; Johnson, James; Kelly, Steven; Cook, Peter R; Marenduzzo, Davide

    2016-05-01

    Biophysicists are modeling conformations of interphase chromosomes, often basing the strengths of interactions between segments distant on the genetic map on contact frequencies determined experimentally. Here, instead, we develop a fitting-free, minimal model: bivalent or multivalent red and green 'transcription factors' bind to cognate sites in strings of beads ('chromatin') to form molecular bridges stabilizing loops. In the absence of additional explicit forces, molecular dynamic simulations reveal that bound factors spontaneously cluster-red with red, green with green, but rarely red with green-to give structures reminiscent of transcription factories. Binding of just two transcription factors (or proteins) to active and inactive regions of human chromosomes yields rosettes, topological domains and contact maps much like those seen experimentally. This emergent 'bridging-induced attraction' proves to be a robust, simple and generic force able to organize interphase chromosomes at all scales. PMID:27060145

  6. Human Prolyl-4-hydroxylase α(I) Transcription Is Mediated by Upstream Stimulatory Factors *

    PubMed Central

    Chen, Li; Shen, Ying H.; Wang, Xinwen; Wang, Jing; Gan, Yehua; Chen, Nanyue; Wang, Jian; LeMaire, Scott A.; Coselli, Joseph S.; Wang, Xing Li

    2010-01-01

    Prolyl-4-hydroxylase α(I) (P4Hα(I)) is the rate-limiting subunit forP4Henzyme activity, which is essential for procollagen hydroxylation and secretion. In the current study, we have characterized the human P4Hα(I) promoter for transcription factors and DNA elements regulating P4Hα(I) expression. Using a progressive deletion cloning approach, we have constructed pGL3-P4Hα(I) recombinant plasmids. We have identified a positive regulatory region at the positions of bp −184 to −97 responsible for ~80% of the P4Hα(I) promoter efficiency. Three E-boxes were located within this region, and the E-box at position bp −135 explains most of the regulatory capacity. Upstream stimulatory factors (USF1/USF2) were shown to bind on the E-box using chromatin immunoprecipitation assay. Suppression of USF1 and/or USF2 using specific short interference RNA resulted in a significant reduction in P4Hα(I) promoter activity, and overexpressed USF1 or USF2 increased P4Hα(I) promoter activity significantly. Although transforming growth factor β1 increased the USF1/USF2-E-box binding and P4Hα(I) promoter activity, this up-regulatory effect can be largely prevented by USF1/USF2-specific short interference RNA. On the other hand, cigarette smoking extracts, which have been shown to suppress P4Hα(I) expression, inhibited the binding between the USF1/USF2 and E-box, resulting in a reduced P4Hα(I) promoter activity. Furthermore, the E-box on the P4Hα(I) promoter appeared to indiscriminately bind with either USF1 or USF2, with a similar outcome on the promoter efficiency. In conclusion, our study shows that USF1/USF2 plays a critical role in basal P4Hα(I) expression, and both positive (transforming growth factor β1) and negative (cigarette smoking extract) regulators appear to influence the USF-E-box interaction and affect P4Hα(I) expression. PMID:16488890

  7. Steroid sulfotransferase 2A1 gene transcription is regulated by steroidogenic factor 1 and GATA-6 in the human adrenal.

    PubMed

    Saner, Karla J; Suzuki, Takashi; Sasano, Hironobu; Pizzey, John; Ho, Clement; Strauss, Jerome F; Carr, Bruce R; Rainey, William E

    2005-01-01

    Sulfonation is a phase II conjugation reaction responsible for the biotransformation of many compounds including steroids, bile acids, and drugs. Humans are presently known to express at least five cytosolic sulfotransferase (SULT) enzymes, of which only two are hydroxysteroid SULT, SULT2A1, commonly known as steroid sulfotransferase, and the cholesterol sulfotransferase SULT2B1. SULT2A1 is highly expressed in the adrenal where it is responsible for the sulfation of hydroxysteroids including conversion of dehydroepiandrosterone to dehydroepiandrosterone sulfate and in the liver where it is responsible for sulfation of bile acids and circulating hydroxysteroids. Little is known concerning the transcriptional regulation of human SULT2A1 in adrenal. Herein we demonstrate the role of two transcription factors, steroidogenic factor 1 (SF1) and GATA-6, in the regulation of SULT2A1 transcription. These transcription factors were quantified by real-time RT-PCR in normal human adrenal tissue. Transient transfection assays with deleted and mutated SULT2A1 promoter constructs allowed for the determination of specific SF1 and GATA binding cis-regulatory elements necessary for transactivation of SULT2A1 promoter, and binding was confirmed by EMSA analysis. Both SF1 and GATA-6 were positive regulators of SULT2A1 promoter constructs. These data support the hypothesis that adrenal SULT2A1 expression is regulated by SF1 and GATA-6. PMID:15388788

  8. Simulated binding of transcription factors to active and inactive regions folds human chromosomes into loops, rosettes and topological domains

    PubMed Central

    Brackley, Chris A.; Johnson, James; Kelly, Steven; Cook, Peter R.; Marenduzzo, Davide

    2016-01-01

    Biophysicists are modeling conformations of interphase chromosomes, often basing the strengths of interactions between segments distant on the genetic map on contact frequencies determined experimentally. Here, instead, we develop a fitting-free, minimal model: bivalent or multivalent red and green ‘transcription factors’ bind to cognate sites in strings of beads (‘chromatin’) to form molecular bridges stabilizing loops. In the absence of additional explicit forces, molecular dynamic simulations reveal that bound factors spontaneously cluster—red with red, green with green, but rarely red with green—to give structures reminiscent of transcription factories. Binding of just two transcription factors (or proteins) to active and inactive regions of human chromosomes yields rosettes, topological domains and contact maps much like those seen experimentally. This emergent ‘bridging-induced attraction’ proves to be a robust, simple and generic force able to organize interphase chromosomes at all scales. PMID:27060145

  9. The CCAAT-box binding transcription factor, Nuclear Factor-Y (NF-Y) regulates transcription of human aldo-keto reductase 1C1 (AKR1C1) gene

    PubMed Central

    Pallai, Rajash; Simpkins, Henry; Chen, Jianli; Parekh, Hemant K.

    2010-01-01

    Dihydrodiol dehydrogenases are a family of aldo-keto reductases (AKR1Cs) involved in the metabolism of steroid hormones and xenobiotics. Herein, we have cloned and characterized the proximal promoter region of the human AKR1C1 gene. The 5’ flanking proximal promoter region of the AKR1C1 gene consists of a TATA box and an inverted CCAAT binding site. Deletion analysis of the 5’-flanking, ~3.0 kb region of the human AKR1C1 gene identified the region between −128 to −88 as the minimal proximal promoter essential for basal transcription of AKR1C1 in human ovarian (2008 & 2008/C13*), lung (H23 & A549) and liver carcinoma (HepG2) cells. Site-directed mutagenesis studies indicated that the transcription factor binding sites for NF-Y/CEBP were involved in controlling the basal transcription of AKR1C1 in all the cancer cells studied. Electrophoretic mobility shift (EMSAs) and gel supershift assays demonstrated that the transcription factor NF-Y preferentially binds to the inverted CCAAT box at −109ATTGG−105 of the AKR1C1 gene. Chromatin immunoprecipitation (ChIP) analysis confirmed the in vivo association between NF-Y and human AKR1C1 gene promoter in human ovarian, lung and liver carcinoma cells. Ectopic expression of NF-Y’s increased the AKR1C1 gene transcription, whereas expression of a dominant-negative NF-YA or suppression of NF-YA decreased the AKR1C1 gene transcription. A 2-fold increase in AKR1C1 transcription was observed specifically in cisplatin-treated 2008 cells that was CCAAT box-dependent. These results indicate that the NF-Y regulates the basal transcription of AKR1C1 in human ovarian, lung and liver carcinoma cells and the cisplatin-induced transcription in human ovarian carcinoma cells. PMID:20338228

  10. Direct activation of human and mouse Oct4 genes using engineered TALE and Cas9 transcription factors.

    PubMed

    Hu, Jiabiao; Lei, Yong; Wong, Wing-Ki; Liu, Senquan; Lee, Kai-Chuen; He, Xiangjun; You, Wenxing; Zhou, Rui; Guo, Jun-Tao; Chen, Xiongfong; Peng, Xianlu; Sun, Hao; Huang, He; Zhao, Hui; Feng, Bo

    2014-04-01

    The newly developed transcription activator-like effector protein (TALE) and clustered regularly interspaced short palindromic repeats/Cas9 transcription factors (TF) offered a powerful and precise approach for modulating gene expression. In this article, we systematically investigated the potential of these new tools in activating the stringently silenced pluripotency gene Oct4 (Pou5f1) in mouse and human somatic cells. First, with a number of TALEs and sgRNAs targeting various regions in the mouse and human Oct4 promoters, we found that the most efficient TALE-VP64s bound around -120 to -80 bp, while highly effective sgRNAs targeted from -147 to -89-bp upstream of the transcription start sites to induce high activity of luciferase reporters. In addition, we observed significant transcriptional synergy when multiple TFs were applied simultaneously. Although individual TFs exhibited marginal activity to up-regulate endogenous gene expression, optimized combinations of TALE-VP64s could enhance endogenous Oct4 transcription up to 30-fold in mouse NIH3T3 cells and 20-fold in human HEK293T cells. More importantly, the enhancement of OCT4 transcription ultimately generated OCT4 proteins. Furthermore, examination of different epigenetic modifiers showed that histone acetyltransferase p300 could enhance both TALE-VP64 and sgRNA/dCas9-VP64 induced transcription of endogenous OCT4. Taken together, our study suggested that engineered TALE-TF and dCas9-TF are useful tools for modulating gene expression in mammalian cells. PMID:24500196

  11. Human general transcription factor TFIIA: characterization of a cDNA encoding the small subunit and requirement for basal and activated transcription.

    PubMed Central

    DeJong, J; Bernstein, R; Roeder, R G

    1995-01-01

    The human general transcription factor TFIIA is one of several factors involved in specific transcription by RNA polymerase II, possibly by regulating the activity of the TATA-binding subunit (TBP) of TFIID. TFIIA purified from HeLa extracts consists of 35-, 19-, and 12-kDa subunits. Here we describe the isolation of a cDNA clone (hTFIIA gamma) encoding the 12-kDa subunit. Using expression constructs derived from hTFIIA gamma and TFIIA alpha/beta (which encodes a 55-kDa precursor to the alpha and beta subunits of natural TFIIA), we have constructed a synthetic TFIIA with a polypeptide composition similar to that of natural TFIIA. The recombinant complex supports the formation of a DNA-TBP-TFIIA complex and mediates both basal and Gal4-VP16-activated transcription by RNA polymerase II in TFIIA-depleted nuclear extracts. In contrast, TFIIA has no effect on tRNA and 5S RNA transcription by RNA polymerase III in this system. We also present evidence that both the p55 and p12 recombinant subunits interact with TBP and that the basic region of TBP is critical for the TFIIA-dependent function of TBP in nuclear extracts. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:7724559

  12. Human teneurin-1 is a direct target of the homeobox transcription factor EMX2 at a novel alternate promoter

    PubMed Central

    2011-01-01

    Background Teneurin-1 is a member of a family of type II transmembrane proteins conserved from C.elegans to vertebrates. Teneurin expression in vertebrates is best studied in mouse and chicken, where the four members teneurin-1 to -4 are predominantly expressed in the developing nervous system in area specific patterns. Based on their distinct, complementary expression a possible function in the establishment of proper connectivity in the brain was postulated. However, the transcription factors contributing to these distinctive expression patterns are largely unknown. Emx2 is a homeobox transcription factor, known to be important for area specification in the developing cortex. A study of Emx2 knock-out mice suggested a role of Emx2 in regulating patterned teneurin expression. Results 5'RACE of human teneurin-1 revealed new alternative untranslated exons that are conserved in mouse and chicken. Closer analysis of the conserved region around the newly identified transcription start revealed promoter activity that was induced by EMX2. Mutation of a predicted homeobox binding site decreased the promoter activity in different reporter assays in vitro and in vivo in electroporated chick embryos. We show direct in vivo binding of EMX2 to the newly identified promoter element and finally confirm that the endogenous alternate transcript is specifically upregulated by EMX2. Conclusions We found that human teneurin-1 is directly regulated by EMX2 at a newly identified and conserved promoter region upstream of the published transcription start site, establishing teneurin-1 as the first human EMX2 target gene. We identify and characterize the EMX2 dependent promoter element of human teneurin-1. PMID:21651764

  13. Crystal structure of the C-terminal domain of the RAP74 subunit of human transcription factor IIF

    SciTech Connect

    Kamada, Katsuhiko; De Angelis, Jacqueline; Roeder, Robert G.; Burley, Stephen K.

    2012-12-13

    The x-ray structure of a C-terminal fragment of the RAP74 subunit of human transcription factor (TF) IIF has been determined at 1.02-{angstrom} resolution. The {alpha}/{beta} structure is strikingly similar to the globular domain of linker histone H5 and the DNA-binding domain of hepatocyte nuclear factor 3{gamma} (HNF-3{gamma}), making it a winged-helix protein. The surface electrostatic properties of this compact domain differ significantly from those of bona fide winged-helix transcription factors (HNF-3{gamma} and RFX1) and from the winged-helix domains found within the RAP30 subunit of TFIIF and the {beta} subunit of TFIIE. RAP74 has been shown to interact with the TFIIF-associated C-terminal domain phosphatase FCP1, and a putative phosphatase binding site has been identified within the RAP74 winged-helix domain.

  14. The Ability of Positive Transcription Elongation Factor b To Transactivate Human Immunodeficiency Virus Transcription Depends on a Functional Kinase Domain, Cyclin T1, and Tat

    PubMed Central

    Fujinaga, Koh; Cujec, Thomas P.; Peng, Junmin; Garriga, Judit; Price, David H.; Graña, Xavier; Peterlin, B. Matija

    1998-01-01

    By binding to the transactivation response element (TAR) RNA, the transcriptional transactivator (Tat) from the human immunodeficiency virus increases rates of elongation rather than initiation of viral transcription. Two cyclin-dependent serine/threonine kinases, CDK7 and CDK9, which phosphorylate the C-terminal domain of RNA polymerase II, have been implicated in Tat transactivation in vivo and in vitro. In this report, we demonstrate that CDK9, which is the kinase component of the positive transcription elongation factor b (P-TEFb) complex, can activate viral transcription when tethered to the heterologous Rev response element RNA via the regulator of expression of virion proteins (Rev). The kinase activity of CDK9 and cyclin T1 is essential for these effects. Moreover, P-TEFb binds to TAR only in the presence of Tat. We conclude that Tat–P-TEFb complexes bind to TAR, where CDK9 modifies RNA polymerase II for the efficient copying of the viral genome. PMID:9696809

  15. Human mitochondrial transcription factor A functions in both nuclei and mitochondria and regulates cancer cell growth

    SciTech Connect

    Han, Bin; Izumi, Hiroto; Yasuniwa, Yoshihiro; Akiyama, Masaki; Yamaguchi, Takahiro; Fujimoto, Naohiro; Matsumoto, Tetsuro; Wu, Bin; Tanimoto, Akihide; Sasaguri, Yasuyuki; Kohno, Kimitoshi

    2011-04-29

    Highlights: {yields} Mitochondrial transcription factor A (mtTFA) localizes in nuclei and binds tightly to the nuclear chromatin. {yields} mtTFA contains two putative nuclear localization signals (NLS) in the HMG-boxes. {yields} Overexpression of mtTFA enhances the growth of cancer cells, whereas downregulation of mtTFA inhibits their growth by regulating mtTFA target genes, such as baculoviral IAP repeat-containing 5 (BIRC5; also known as survivin). {yields} Knockdown of mtTFA expression induces p21-dependent G1 cell cycle arrest. -- Abstract: Mitochondrial transcription factor A (mtTFA) is one of the high mobility group protein family and is required for both transcription from and maintenance of mitochondrial genomes. However, the roles of mtTFA have not been extensively studied in cancer cells. Here, we firstly reported the nuclear localization of mtTFA. The proportion of nuclear-localized mtTFA varied among different cancer cells. Some mtTFA binds tightly to the nuclear chromatin. DNA microarray and chromatin immunoprecipitation assays showed that mtTFA can regulate the expression of nuclear genes. Overexpression of mtTFA enhanced the growth of cancer cell lines, whereas downregulation of mtTFA inhibited their growth by regulating mtTFA target genes, such as baculoviral IAP repeat-containing 5 (BIRC5; also known as survivin). Knockdown of mtTFA expression induced p21-dependent G1 cell cycle arrest. These results imply that mtTFA functions in both nuclei and mitochondria to promote cell growth.

  16. IFN-α Induces Transcription of Hypoxia-Inducible Factor-1α to Inhibit Proliferation of Human Endothelial Cells1

    PubMed Central

    Gerber, Scott A.; Pober, Jordan S.

    2009-01-01

    Expression of hypoxia-inducible factor (HIF)-1α, a transcription factor subunit increased by protein stabilization in response to hypoxia, is increased in human endothelial cells (ECs) by IFN-α under normoxic conditions. IFN-α increases HIF-1α transcript levels within 2 h by up to 50% and doubles HIF-1α protein expression. Based on pharmacological inhibition studies, the increase in HIF-1α mRNA involves new transcription, is independent of new protein synthesis, and requires JAK signaling. Protein knockdown by small interfering RNA confirms the involvement of JAK1 and TYK2, as well of IFN-stimulated gene factor 3 (ISGF3). IFN-γ does not significantly induce HIF-1α mRNA, but increases the magnitude and duration of the IFN-α effect. IFN-α-induced HIF-1α protein translocates to the nucleus and can bind to hypoxia response elements in DNA. However, IFN-α treatment fails to induce transcription of several prototypic HIF-responsive genes (VEGF-A, PPARγ, and prostacyclin synthase) due to an insufficient increase in HIF-1α protein levels. Although certain other HIF-responsive genes (PHD3 and VEGF-C) are induced following IFN-α and/or IFN-γ treatment, these responses are not inhibited by siRNA knockdown of HIF-1α. Additionally, IFN-α induction of ISGF3-dependent genes involved in innate immunity (viperin, OAS2, and CXCL10) are also unaffected by knockdown of HIF-1α. Interestingly, knockdown of HIF-1α significantly reduces the capacity of IFN-α to inhibit endothelial cell proliferation. We conclude that IFN-α induces the transcription of HIF-1α in human endothelial cells though a JAK-ISGF3 pathway under normoxic conditions, and that this response contributes to the antiproliferative activity of this cytokine. PMID:18606657

  17. Transcription factor 7-like 1 is involved in hypothalamo–pituitary axis development in mice and humans

    PubMed Central

    Gaston-Massuet, Carles; McCabe, Mark J.; Scagliotti, Valeria; Young, Rodrigo M.; Carreno, Gabriela; Gregory, Louise C.; Jayakody, Sujatha A.; Pozzi, Sara; Gualtieri, Angelica; Basu, Basudha; Koniordou, Markela; Wu, Chun-I; Bancalari, Rodrigo E.; Rahikkala, Elisa; Veijola, Riitta; Lopponen, Tuija; Graziola, Federica; Turton, James; Signore, Massimo; Mousavy Gharavy, Seyedeh Neda; Charolidi, Nicoletta; Sokol, Sergei Y.; Merrill, Bradley J.; Dattani, Mehul T.; Martinez-Barbera, Juan Pedro

    2016-01-01

    Aberrant embryonic development of the hypothalamus and/or pituitary gland in humans results in congenital hypopituitarism (CH). Transcription factor 7-like 1 (TCF7L1), an important regulator of the WNT/β-catenin signaling pathway, is expressed in the developing forebrain and pituitary gland, but its role during hypothalamo–pituitary (HP) axis formation or involvement in human CH remains elusive. Using a conditional genetic approach in the mouse, we first demonstrate that TCF7L1 is required in the prospective hypothalamus to maintain normal expression of the hypothalamic signals involved in the induction and subsequent expansion of Rathke’s pouch progenitors. Next, we reveal that the function of TCF7L1 during HP axis development depends exclusively on the repressing activity of TCF7L1 and does not require its interaction with β-catenin. Finally, we report the identification of two independent missense variants in human TCF7L1, p.R92P and p.R400Q, in a cohort of patients with forebrain and/or pituitary defects. We demonstrate that these variants exhibit reduced repressing activity in vitro and in vivo relative to wild-type TCF7L1. Together, our data provide support for a conserved molecular function of TCF7L1 as a transcriptional repressor during HP axis development in mammals and identify variants in this transcription factor that are likely to contribute to the etiology of CH. PMID:26764381

  18. Regulation of human hepatic hydroxysteroid sulfotransferase gene expression by the peroxisome proliferator-activated receptor alpha transcription factor.

    PubMed

    Fang, Hai-Lin; Strom, Stephen C; Cai, Hongbo; Falany, Charles N; Kocarek, Thomas A; Runge-Morris, Melissa

    2005-04-01

    Human hydroxysteroid sulfotransferase or (HUMAN)SULT2A1 catalyzes the sulfonation of procarcinogen xenobiotics, hydroxysteroids, and bile acids and plays a dynamic role in hepatic cholesterol homeostasis. The treatment of primary cultured human hepatocytes with a peroxisome proliferator-activated receptor alpha (PPARalpha)-activating concentration of ciprofibrate (10(-) (4) M) increased (HUMAN)SULT2A1 mRNA, immunoreactive protein, and enzymatic activity levels by approximately 2-fold. By contrast, expression of (RAT)SULT2A3, the rat counterpart to (HUMAN)SULT2A1, was induced by treatment of primary hepatocyte cultures with an activator of the pregnane X receptor, but not PPARalpha. In HepG2 cells, transient transfection analyses of luciferase reporter constructs containing upstream regions of the (HUMAN)SULT2A1 gene implicated a candidate peroxisome proliferator response element (PPRE) at nucleotides (nt) -5949 to -5929 relative to the transcription start site. Site-directed mutagenesis and electrophoretic mobility shift assay studies confirmed that this distal PPRE (dPPRE), a direct repeat nuclear receptor motif containing one intervening nt, represented a functional PPRE. Chromatin immunoprecipitation analysis indicated that the (HUMAN)SULT2A1 dPPRE was also a functional element in the context of the human genome. These data support a major role for the PPARalpha transcription factor in the regulation of hepatic (HUMAN)SULT2A1. Results also indicate that important species differences govern the transactivation of SULT2A gene transcription by nuclear receptors. PMID:15635043

  19. Regulation of human papillomavirus transcription by the differentiation-dependent epithelial factor Epoc-1/skn-1a.

    PubMed

    Yukawa, K; Butz, K; Yasui, T; Kikutani, H; Hoppe-Seyler, F

    1996-01-01

    Human papillomavirus (HPV) early gene expression is closely linked to the differentiation status of infected epithelial cells. Typically, HPV type 16 (HPV16) or HPV18 E6 and E7 transcripts are only barely detectable within the undifferentiated basal cell layer, but their levels increase concomitantly with higher degrees of epithelial cell differentiation in suprabasal cells. A similar differentiation-dependent distribution of expression has been reported for the recently cloned epithelial cell specific transcription factor Epoc-1/skn-1a. We therefore examined whether Epoc-1/skn-1a may be directly involved in the activation of HPV E6/E7 transcription. Transient transfection studies showed that Epoc-1/skn-1a specifically stimulated the HPV16 and HPV18 E6/E7 promoters. Moreover, ectopically expressed Epoc-1/skn-1a was sufficient to stimulate HPV transcription also in nonepithelial cells. By deletion analyses, the Epoc-1/skn-1a-responsive element was mapped to the promoter-proximal portion of the HPV18 transcriptional control region. Footprint analyses and gel retardation assays demonstrated direct binding of Epoc-1/skn-1a to a hitherto uncharacterized site within this region. Mutation of the Epoc-1/skn-1a recognition site within the context of the complete HPV18 upstream regulatory region inhibited Epoc-1/skn-1a-mediated transactivation. These results show that Epoc-1/skn-1a can directly activate the E6/E7 promoter by binding to the viral transcriptional control region. Thus, Epoc-1/skn-1a may be involved in the differentiation-dependent regulation of HPV transcription. PMID:8523512

  20. RNA Polymerase III Transcriptomes in Human Embryonic Stem Cells and Induced Pluripotent Stem Cells, and Relationships with Pluripotency Transcription Factors

    PubMed Central

    Alla, Ravi K.; Cairns, Bradley R.

    2014-01-01

    Recent genomic approaches have revealed that the repertoire of RNA Pol III-transcribed genes varies in different human cell types, and that this variation is likely determined by a combination of the chromatin landscape, cell-specific DNA-binding transcription factors, and collaboration with RNA Pol II. Although much is known about this regulation in differentiated human cells, there is presently little understanding of this aspect of the Pol III system in human ES cells. Here, we determine the occupancy profiles of Pol III components in human H1 ES cells, and also induced pluripotent cells, and compare to known profiles of chromatin, transcription factors, and RNA expression. We find a relatively large fraction of the Pol III repertoire occupied in human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs). In ES cells we find clear correlations between Pol III occupancy and active chromatin. Interestingly, we find a highly significant fraction of Pol III-occupied genes with adjacent binding events by pluripotency factors in ES cells, especially NANOG. Notably, in human ES cells we find H3K27me3 adjacent to but not overlapping many active Pol III loci. We observe in all such cases, a peak of H3K4me3 and/or RNA Pol II, between the H3K27me3 and Pol III binding peaks, suggesting that H3K4me3 and Pol II activity may “insulate” Pol III from neighboring repressive H3K27me3. Further, we find iPSCs have a larger Pol III repertoire than their precursors. Finally, the active Pol III genome in iPSCs is not completely reprogrammed to a hESC like state and partially retains the transcriptional repertoire of the precursor. Together, our correlative results are consistent with Pol III binding and activity in human ES cells being enabled by active/permissive chromatin that is shaped in part by the pluripotency network of transcription factors and RNA Pol II activity. PMID:24465633

  1. Transcriptional regulation of the human cystathionine beta-synthase -1b basal promoter: synergistic transactivation by transcription factors NF-Y and Sp1/Sp3.

    PubMed Central

    Ge, Y; Konrad, M A; Matherly, L H; Taub, J W

    2001-01-01

    Cystathionine beta-synthase (CBS) catalyses the condensation of serine and homocysteine to form cystathionine, an intermediate step in the synthesis of cysteine. Human CBS encodes five distinct 5' non-coding exons, the most frequent termed CBS -1a and CBS -1b, each transcribed from its own unique GC-rich TATA-less promoter. The minimal transcriptional region (-3792 to -3667) of the CBS -1b promoter was defined by 5'- and 3'-deletions, and transient transfections of reporter gene constructs in HepG2 cells, characterized by CBS transcription exclusively from the -1b promoter. Included in this 125 bp region are 3 GC-boxes (termed GC-a, GC-b and GC-c), an inverted CAAT-box and an E-box. By gel-shift and supershift assays, binding of specificity protein (Sp)1 and Sp3 to the GC-box elements, upstream stimulatory factor 1 (USF-1) to the E-box, and both nuclear factor (NF)-Y and an NF-1-like factor to the CAAT box could be demonstrated. By transient trans fections and reporter gene assays in HepG2 and Drosophila SL2 cells, a functional interplay was indicated between NF-Y binding to the CAAT-box, or between USF-1 binding to the E-box, and Sp1/Sp3 binding to the GC-box elements. In SL2 cells, NF-Y and Sp1/Sp3 were synergistic. Furthermore, both Sp1 and the long Sp3 isoform transactivated the CBS -1b minimal promoter; however, the short Sp3 isoforms were potent repressors. These results may explain the cell- or tissue-specific regulation of CBS transcription, and clarify the bases for alterations in CBS gene expression in human disease and Down's syndrome. PMID:11415440

  2. REACTIN: Regulatory activity inference of transcription factors underlying human diseases with application to breast cancer

    PubMed Central

    2013-01-01

    Background Genetic alterations of transcription factors (TFs) have been implicated in the tumorigenesis of cancers. In many cancers, alteration of TFs results in aberrant activity of them without changing their gene expression level. Gene expression data from microarray or RNA-seq experiments can capture the expression change of genes, however, it is still challenge to reveal the activity change of TFs. Results Here we propose a method, called REACTIN (REgulatory ACTivity INference), which integrates TF binding data with gene expression data to identify TFs with significantly differential activity between disease and normal samples. REACTIN successfully detect differential activity of estrogen receptor (ER) between ER+ and ER- samples in 10 breast cancer datasets. When applied to compare tumor and normal breast samples, it reveals TFs that are critical for carcinogenesis of breast cancer. Moreover, Reaction can be utilized to identify transcriptional programs that are predictive to patient survival time of breast cancer patients. Conclusions REACTIN provides a useful tool to investigate regulatory programs underlying a biological process providing the related case and control gene expression data. Considering the enormous amount of cancer gene expression data and the increasingly accumulating ChIP-seq data, we expect wide application of REACTIN for revealing the regulatory mechanisms of various diseases. PMID:23885756

  3. Molecular mechanism of thermosensory function of human heat shock transcription factor Hsf1.

    PubMed

    Hentze, Nikolai; Le Breton, Laura; Wiesner, Jan; Kempf, Georg; Mayer, Matthias P

    2016-01-01

    The heat shock response is a universal homeostatic cell autonomous reaction of organisms to cope with adverse environmental conditions. In mammalian cells, this response is mediated by the heat shock transcription factor Hsf1, which is monomeric in unstressed cells and upon activation trimerizes, and binds to promoters of heat shock genes. To understand the basic principle of Hsf1 activation we analyzed temperature-induced alterations in the conformational dynamics of Hsf1 by hydrogen exchange mass spectrometry. We found a temperature-dependent unfolding of Hsf1 in the regulatory region happening concomitant to tighter packing in the trimerization region. The transition to the active DNA binding-competent state occurred highly cooperative and was concentration dependent. Surprisingly, Hsp90, known to inhibit Hsf1 activation, lowered the midpoint temperature of trimerization and reduced cooperativity of the process thus widening the response window. Based on our data we propose a kinetic model of Hsf1 trimerization. PMID:26785146

  4. The interplay between the master transcription factor PU.1 and miR-424 regulates human monocyte/macrophage differentiation.

    PubMed

    Rosa, A; Ballarino, M; Sorrentino, A; Sthandier, O; De Angelis, F G; Marchioni, M; Masella, B; Guarini, A; Fatica, A; Peschle, C; Bozzoni, I

    2007-12-11

    We describe a pathway by which the master transcription factor PU.1 regulates human monocyte/macrophage differentiation. This includes miR-424 and the transcriptional factor NFI-A. We show that PU.1 and these two components are interlinked in a finely tuned temporal and regulatory circuitry: PU.1 activates the transcription of miR-424, and this up-regulation is involved in stimulating monocyte differentiation through miR-424-dependent translational repression of NFI-A. In turn, the decrease in NFI-A levels is important for the activation of differentiation-specific genes such as M-CSFr. In line with these data, both RNAi against NFI-A and ectopic expression of miR-424 in precursor cells enhance monocytic differentiation, whereas the ectopic expression of NFI-A has an opposite effect. The interplay among these three components was demonstrated in myeloid cell lines as well as in human CD34+ differentiation. These data point to the important role of miR-424 and NFI-A in controlling the monocyte/macrophage differentiation program. PMID:18056638

  5. The interplay between the master transcription factor PU.1 and miR-424 regulates human monocyte/macrophage differentiation

    PubMed Central

    Rosa, A.; Ballarino, M.; Sorrentino, A.; Sthandier, O.; De Angelis, F. G.; Marchioni, M.; Masella, B.; Guarini, A.; Fatica, A.; Peschle, C.; Bozzoni, I.

    2007-01-01

    We describe a pathway by which the master transcription factor PU.1 regulates human monocyte/macrophage differentiation. This includes miR-424 and the transcriptional factor NFI-A. We show that PU.1 and these two components are interlinked in a finely tuned temporal and regulatory circuitry: PU.1 activates the transcription of miR-424, and this up-regulation is involved in stimulating monocyte differentiation through miR-424-dependent translational repression of NFI-A. In turn, the decrease in NFI-A levels is important for the activation of differentiation-specific genes such as M-CSFr. In line with these data, both RNAi against NFI-A and ectopic expression of miR-424 in precursor cells enhance monocytic differentiation, whereas the ectopic expression of NFI-A has an opposite effect. The interplay among these three components was demonstrated in myeloid cell lines as well as in human CD34+ differentiation. These data point to the important role of miR-424 and NFI-A in controlling the monocyte/macrophage differentiation program. PMID:18056638

  6. The transcription of the human fructose-bisphosphate aldolase C gene is activated by nerve-growth-factor-induced B factor in human neuroblastoma cells.

    PubMed Central

    Buono, P; Conciliis, L D; Izzo, P; Salvatore, F

    1997-01-01

    A DNA region located at around -200 bp in the 5' flanking region (region D) of the human brain-type fructose-bisphosphate aldolase (aldolase C) gene has been analysed. We show by transient transfection assay and electrophoretic-mobility-shift assay (EMSA) that the binding of transcriptional activators to region D is much more efficient (80% versus 30%) in human neuroblastoma cells (SKNBE) than in the non-neuronal cell line A1251, which contains low levels of aldolase C mRNA. The sequence of region D, CAAGGTCA, is very similar to the AAAGGTCA motif present in the mouse steroid 21-hydroxylase gene; the latter motif binds nerve-growth-factor-induced B factor (NGFI-B), which is a member of the thyroid/steroid/retinoid nuclear receptor gene family. Competition experiments in EMSA and antibody-directed supershift experiments showed that NGFI-B is involved in the binding to region D of the human aldolase C gene. Furthermore, the regulation of the aldolase C gene (which is the second known target of NGFI-B) expression during development parallels that of NGFI-B. PMID:9173889

  7. In Vitro Anticancer Activity of Phlorofucofuroeckol A via Upregulation of Activating Transcription Factor 3 against Human Colorectal Cancer Cells

    PubMed Central

    Eo, Hyun Ji; Kwon, Tae-Hyung; Park, Gwang Hun; Song, Hun Min; Lee, Su-Jin; Park, Nyun-Ho; Jeong, Jin Boo

    2016-01-01

    Phlorofucofuroeckol A (PFF-A), one of the phlorotannins found in brown algae, has been reported to exert anti-cancer property. However, the molecular mechanism for the anti-cancer effect of PFF-A has not been known. Activating transcription factor 3 (ATF3) has been reported to be associated with apoptosis in colorectal cancer. The present study was performed to investigate the molecular mechanism by which PFF-A stimulates ATF3 expression and apoptosis in human colorectal cancer cells. PFF-A decreased cell viability through apoptosis of human colorectal cancer cells. PFF-A increased ATF3 expression through regulating transcriptional activity. The responsible cis-element for ATF3 transcriptional activation by PFF-A was cAMP response element binding protein (CREB), located between positions −147 and −85 of the ATF3 promoter. Inhibition of p38, c-Jun N-terminal kinases (JNK), glycogen synthase kinase (GSK) 3β, and IκB kinase (IKK)-α blocked PFF-A-mediated ATF3 expression. ATF3 knockdown by ATF3 siRNA attenuated the cleavage of poly (ADP-ribose) polymerase (PARP) by PFF-A, while ATF3 overexpression increased PFF-A-mediated cleaved PARP. These results suggest that PFF-A may exert anti-cancer property through inducing apoptosis via the ATF3-mediated pathway in human colorectal cancer cells. PMID:27043582

  8. Differences in human and chimpanzee gene expression patterns define an evolving network of transcription factors in brain

    PubMed Central

    Nowick, Katja; Gernat, Tim; Almaas, Eivind; Stubbs, Lisa

    2009-01-01

    Humans differ from other primates by marked differences in cognitive abilities and a significantly larger brain. These differences correlate with metabolic changes, as evidenced by the relative up-regulation of energy-related genes and metabolites in human brain. While the mechanisms underlying these evolutionary changes have not been elucidated, altered activities of key transcription factors (TFs) could play a pivotal role. To assess this possibility, we analyzed microarray data from five tissues from humans and chimpanzees. We identified 90 TF genes with significantly different expression levels in human and chimpanzee brain among which the rapidly evolving KRAB-zinc finger genes are markedly over-represented. The differentially expressed TFs cluster within a robust regulatory network consisting of two distinct but interlinked modules, one strongly associated with energy metabolism functions, and the other with transcription, vesicular transport, and ubiquitination. Our results suggest that concerted changes in a relatively small number of interacting TFs may coordinate major gene expression differences in human and chimpanzee brain. PMID:20007773

  9. Suppression of Homeobox Transcription Factor VentX Promotes Expansion of Human Hematopoietic Stem/Multipotent Progenitor Cells

    PubMed Central

    Gao, Hong; Wu, Xiaoming; Sun, Yan; Zhou, Shuanhu; Silberstein, Leslie E.; Zhu, Zhenglun

    2012-01-01

    Mechanisms that regulate proliferation and expansion of human hematopoietic stem/multipotent progenitor cells (HSC/MPPs) are targets of intensive investigations. Several cell intrinsic factors and signaling pathways have been implicated in the proliferation and differentiation of human HSC/MPPs. Nevertheless, expansion of human HSC/MPPs for clinical application remains a critical challenge. VentX is a human homeobox transcription factor that was recently identified as an anti-proliferation and pro-differentiation factor in human hematopoietic cells. Here, we report that VentX expression is up-regulated during ontogenesis of human hematopoietic cells. Strikingly, suppression of VentX expression led to significant expansion of HSC/MPPs ex vivo and a 20-fold increase in engraftment potential in the NOD/SCID/IL2Rγ2null mouse model. VentX suppression helped preserve the HSC/MPP pools and promote clonogenicity of hematopoietic progenitor cells. Mechanistically, we show that VentX regulates critical cell cycle regulators and Wnt downstream genes previously implicated in HSC/MPP proliferation and expansion. PMID:22791709

  10. Targeting Transcription Factors in Cancer

    PubMed Central

    Bhagwat, Anand S.; Vakoc, Christopher R.

    2015-01-01

    Transcription factors (TFs) are commonly deregulated in the pathogenesis of human cancer and are a major class of cancer cell dependencies. Consequently, targeting of TFs can be highly effective in treating particular malignancies, as highlighted by the clinical efficacy of agents that target nuclear hormone receptors. In this review we discuss recent advances in our understanding of TFs as drug targets in oncology, with an emphasis on the emerging chemical approaches to modulate TF function. The remarkable diversity and potency of TFs as drivers of cell transformation justifies a continued pursuit of TFs as therapeutic targets for drug discovery. PMID:26645049

  11. Molecular cloning of a putative novel human bZIP transcription factor on chromosome 17q22

    SciTech Connect

    Luna, L.; Johnsen, O.; Skartlien, A.H.

    1994-08-01

    We have cloned and characterized cDNA clones representing several mRNA isoforms generated by alternative splicing of a single gene localized to chromosome 17q22. Sequence analysis showed that the predicted translational product of the longest open reading frame (2316 nucleotides, 772 amino acids) is related to transcription factors of the basic elucine zipper (bZIP) class. The sequence contained several regions characteristic of transcriptional regulatory domains. A cluster of amino acids flanking the bZIP region on both sides was highly conserved between TCF11 and p45 NF-E2, a subunit of the human globin locus control region-binding protein, NF-E2. These same regions showed remarkable homology to two invertebrate proteins, CNC and skn-1, postulated to regulate embryonic development in Drosophila melanogaster and Caenorhabditis elegans, respectively. 46 refs., 7 figs., 1 tab.

  12. Transcription Factors and Medium Suitable for Initiating the Differentiation of Human-Induced Pluripotent Stem Cells to the Hepatocyte Lineage.

    PubMed

    Tomizawa, Minoru; Shinozaki, Fuminobu; Motoyoshi, Yasufumi; Sugiyama, Takao; Yamamoto, Shigenori; Ishige, Naoki

    2016-09-01

    Transcription factors and culture media were investigated to determine the condition to initiate the differentiation of human-induced pluripotent stem (iPS) cells most efficiently. The expression of genes in human adult liver was compared with that in 201B7 cells (iPS cells) using cDNA microarray analysis. Episomal plasmids expressing transcription factors were constructed. 201B7 cells were transfected with the episomal plasmids and cultured in ReproFF (feeder-free media maintaining pluripotency), Leibovitz-15 (L15), William's E (WE), or Dulbecco's modified Eagle medium/Nutrient F-12 Ham (DF12) for 7 days. RNA was isolated and subjected to real-time quantitative PCR to analyze the expression of alpha-feto protein (AFP) and albumin. cDNA microarray analysis revealed 16 transcription factors that were upregulated in human adult liver relative to that in 201B7 cells. Episomal plasmids expressing these 16 genes were transfected into 201B7 cells. CCAAT/enhancer-binding protein alpha (CEBPA), CCAAT/enhancer-binding protein beta (CEBPB), forkhead box A1 (FOXA1), and forkhead box A3 (FOXA3) up-regulated AFP and down-regulated Nanog. These four genes were further analyzed. The expression of AFP and albumin was the highest in 201B7 cells transfected with the combination of CEBPA, CEBPB, FOXA1, and FOXA3 and cultured in WE. The combination of CEBPA, CEBPB, FOXA1, and FOXA3 was suitable for 201B7 cells to initiate differentiation to the hepatocyte lineage and WE was the most suitable medium for culture after transfection. J. Cell. Biochem. 117: 2001-2009, 2016. © 2016 Wiley Periodicals, Inc. PMID:26773721

  13. Transcriptional Regulation of CYP2B6 Expression by Hepatocyte Nuclear Factor 3β in Human Liver Cells

    PubMed Central

    Li, Linhao; Li, Daochuan; Heyward, Scott; Wang, Hongbing

    2016-01-01

    CYP2B6 plays an increasingly important role in xenobiotic metabolism and detoxification. The constitutive androstane receptor (CAR) and the pregnane X receptor (PXR) have been established as predominant regulators for the inductive expression of CYP2B6 gene in human liver. However, there are dramatic interindividual variabilities in CYP2B6 expression that cannot be fully explained by the CAR/PXR-based modulation alone. Here, we show that expression level of CYP2B6 was correlated with that of hepatocyte nuclear factor 3β (HNF3β) in human primary hepatocytes prepared from 35 liver donors. Utilizing recombinant virus-mediated overexpression or knockdown of HNF3β in HepG2 cells, as well as constructs containing serial deletion and site-directed mutation of HNF3β binding motifs in CYP2B6 luciferase reporter assays, we demonstrated that the presence or lack of HNF3β expression markedly correlated with CYP2B6 gene expression and its promoter activity. Novel enhancer modules of HNF3β located upstream of the CYP2B6 gene transcription start site were identified and functionally validated as key elements governing HNF3β-mediated CYP2B6 expression. Chromatin immunoprecipitation assays in human primary hepatocytes and surface plasmon resonance binding affinity experiments confirmed the essential role of these enhancers in the recruitment of HNF3β to the promoter of CYP2B6 gene. Overall, these findings indicate that HNF3β represents a new liver enriched transcription factor that is involved in the transcription of CYP2B6 gene and contributes to the large interindividual variations of CYP2B6 expression in human population. PMID:26930610

  14. Transcription Factor SomA Is Required for Adhesion, Development and Virulence of the Human Pathogen Aspergillus fumigatus

    PubMed Central

    Lin, Chi-Jan; Sasse, Christoph; Gerke, Jennifer; Valerius, Oliver; Irmer, Henriette; Frauendorf, Holm; Heinekamp, Thorsten; Straßburger, Maria; Tran, Van Tuan; Herzog, Britta; Braus-Stromeyer, Susanna A.; Braus, Gerhard H.

    2015-01-01

    The transcription factor Flo8/Som1 controls filamentous growth in Saccharomyces cerevisiae and virulence in the plant pathogen Magnaporthe oryzae. Flo8/Som1 includes a characteristic N-terminal LUG/LUH-Flo8-single-stranded DNA binding (LUFS) domain and is activated by the cAMP dependent protein kinase A signaling pathway. Heterologous SomA from Aspergillus fumigatus rescued in yeast flo8 mutant strains several phenotypes including adhesion or flocculation in haploids and pseudohyphal growth in diploids, respectively. A. fumigatus SomA acts similarly to yeast Flo8 on the promoter of FLO11 fused with reporter gene (LacZ) in S. cerevisiae. FLO11 expression in yeast requires an activator complex including Flo8 and Mfg1. Furthermore, SomA physically interacts with PtaB, which is related to yeast Mfg1. Loss of the somA gene in A. fumigatus resulted in a slow growth phenotype and a block in asexual development. Only aerial hyphae without further differentiation could be formed. The deletion phenotype was verified by a conditional expression of somA using the inducible Tet-on system. A adherence assay with the conditional somA expression strain indicated that SomA is required for biofilm formation. A ptaB deletion strain showed a similar phenotype supporting that the SomA/PtaB complex controls A. fumigatus biofilm formation. Transcriptional analysis showed that SomA regulates expression of genes for several transcription factors which control conidiation or adhesion of A. fumigatus. Infection assays with fertilized chicken eggs as well as with mice revealed that SomA is required for pathogenicity. These data corroborate a complex control function of SomA acting as a central factor of the transcriptional network, which connects adhesion, spore formation and virulence in the opportunistic human pathogen A. fumigatus. PMID:26529322

  15. Structural insights into the autoregulation and cooperativity of the human transcription factor Ets-2.

    PubMed

    Newman, Joseph A; Cooper, Christopher D O; Aitkenhead, Hazel; Gileadi, Opher

    2015-03-27

    Ets-2, like its closely related homologue Ets-1, is a member of the Ets family of DNA binding transcription factors. Both proteins are subject to multiple levels of regulation of their DNA binding and transactivation properties. One such regulatory mechanism is the presence of an autoinhibitory module, which in Ets-1 allosterically inhibits the DNA binding activity. This inhibition can be relieved by interaction with protein partners or cooperative binding to closely separated Ets binding sites in a palindromic arrangement. In this study we describe the 2.5 Å resolution crystal structure of a DNA complex of the Ets-2 Ets domain. The Ets domain crystallized with two distinct species in the asymmetric unit, which closely resemble the autoinhibited and DNA bound forms of Ets-1. This discovery prompted us to re-evaluate the current model for the autoinhibitory mechanism and the structural basis for cooperative DNA binding. In contrast to Ets-1, in which the autoinhibition is caused by a combination of allosteric and steric mechanisms, we were unable to find clear evidence for the allosteric mechanism in Ets-2. We also demonstrated two possibly distinct types of cooperative binding to substrates with Ets binding motifs separated by four and six base pairs and suggest possible molecular mechanisms for this behavior. PMID:25670864

  16. Structural Insights into the Autoregulation and Cooperativity of the Human Transcription Factor Ets-2*

    PubMed Central

    Newman, Joseph A; Cooper, Christopher D. O.; Aitkenhead, Hazel; Gileadi, Opher

    2015-01-01

    Ets-2, like its closely related homologue Ets-1, is a member of the Ets family of DNA binding transcription factors. Both proteins are subject to multiple levels of regulation of their DNA binding and transactivation properties. One such regulatory mechanism is the presence of an autoinhibitory module, which in Ets-1 allosterically inhibits the DNA binding activity. This inhibition can be relieved by interaction with protein partners or cooperative binding to closely separated Ets binding sites in a palindromic arrangement. In this study we describe the 2.5 Å resolution crystal structure of a DNA complex of the Ets-2 Ets domain. The Ets domain crystallized with two distinct species in the asymmetric unit, which closely resemble the autoinhibited and DNA bound forms of Ets-1. This discovery prompted us to re-evaluate the current model for the autoinhibitory mechanism and the structural basis for cooperative DNA binding. In contrast to Ets-1, in which the autoinhibition is caused by a combination of allosteric and steric mechanisms, we were unable to find clear evidence for the allosteric mechanism in Ets-2. We also demonstrated two possibly distinct types of cooperative binding to substrates with Ets binding motifs separated by four and six base pairs and suggest possible molecular mechanisms for this behavior. PMID:25670864

  17. Molecular mechanism of thermosensory function of human heat shock transcription factor Hsf1

    PubMed Central

    Hentze, Nikolai; Le Breton, Laura; Wiesner, Jan; Kempf, Georg; Mayer, Matthias P

    2016-01-01

    The heat shock response is a universal homeostatic cell autonomous reaction of organisms to cope with adverse environmental conditions. In mammalian cells, this response is mediated by the heat shock transcription factor Hsf1, which is monomeric in unstressed cells and upon activation trimerizes, and binds to promoters of heat shock genes. To understand the basic principle of Hsf1 activation we analyzed temperature-induced alterations in the conformational dynamics of Hsf1 by hydrogen exchange mass spectrometry. We found a temperature-dependent unfolding of Hsf1 in the regulatory region happening concomitant to tighter packing in the trimerization region. The transition to the active DNA binding-competent state occurred highly cooperative and was concentration dependent. Surprisingly, Hsp90, known to inhibit Hsf1 activation, lowered the midpoint temperature of trimerization and reduced cooperativity of the process thus widening the response window. Based on our data we propose a kinetic model of Hsf1 trimerization. DOI: http://dx.doi.org/10.7554/eLife.11576.001 PMID:26785146

  18. Therapeutic transdifferentiation of human fibroblasts into endothelial cells using forced expression of lineage-specific transcription factors

    PubMed Central

    Wong, Wing Tak; Cooke, John P

    2016-01-01

    Transdifferentiation is the direct conversion from one somatic cell type into another desired somatic cell type. This reprogramming method offers an attractive approach for regenerative medicine. Here, we demonstrate that neonatal fibroblasts can be transdifferentiated into endothelial cells using only four endothelial transcription factors, namely, ETV2, FLI1, GATA2, and KLF4. We observed a significant up-regulation of endothelial genes including KDR, CD31, CD144, and vWF in human neonatal foreskin (BJ) fibroblasts infected with the lentiviral construct encoding the open reading frame of the four transcription factors. We observed morphological changes in BJ fibroblasts from the fibroblastic spindle shape into a more endothelial-like cobblestone structures. Fluorescence-activated cell sorting analysis revealed that ~16% of the infected cells with the lentiviral constructs encoding 4F expressed CD31. The sorted cells were allowed to expand for 2 weeks and these cells were immunostained and found to express endothelial markers CD31. The induced endothelial cells also incorporated fluorescence-labeled acetylated low-density lipoprotein and efficiently formed capillary-like networks when seeded on Matrigel. These results suggested that the induced endothelial cells were functional in vitro. Taken together, we successfully demonstrated the direct conversion of human neonatal fibroblasts into endothelial cells by transduction of lentiviral constructs encoding endothelial lineage-specific transcription factors ETV2, FLI1, GATA2, and KLF4. The directed differentiation of fibroblasts into endothelial cells may have significant utility in diseases characterized by fibrosis and loss of microvasculature. PMID:27081470

  19. Transcriptional control of spliced and unspliced human T-cell leukemia virus type 1 bZIP factor (HBZ) gene.

    PubMed

    Yoshida, Mika; Satou, Yorifumi; Yasunaga, Jun-Ichirou; Fujisawa, Jun-Ichi; Matsuoka, Masao

    2008-10-01

    The human T-cell leukemia virus type 1 (HTLV-1) basic leucine zipper factor (HBZ) gene is encoded by the minus strand of the HTLV-1 provirus and transcribed from the 3' long terminal repeat (LTR). HBZ gene expression not only inhibits the Tax-mediated activation of viral gene transcription through the 5' LTR but also promotes the proliferation of infected cells. However, the HBZ promoter region and the transcriptional regulation of the gene have not been studied. In this study, we characterize the promoters of the spliced version of the HBZ gene (sHBZ) and the unspliced version of the HBZ gene (usHBZ) by luciferase assay. Both promoters were TATA-less and contained initiators and downstream promoter elements. Detailed studies of the promoter for the sHBZ gene showed that Sp1 sites were critical for its activity. The activities of the sHBZ and usHBZ gene promoters were upregulated by Tax through Tax-responsible elements in the 3' LTR. We compared the functions of the proteins derived from the sHBZ and usHBZ transcripts. sHBZ showed a stronger suppression of Tax-mediated transcriptional activation through the 5' LTR than did usHBZ; the level of suppression correlated with the level of protein produced. The expression of sHBZ had a growth-promoting function in a T-cell line, while usHBZ expression did not. This study demonstrates that Sp1 is critical for sHBZ transcription, which accounts for the constitutive expression of the sHBZ gene. Functional differences between sHBZ and usHBZ suggest that the sHBZ gene plays a significant role in the proliferation of infected cells. PMID:18653454

  20. Mitotic bookmarking by transcription factors

    PubMed Central

    2013-01-01

    Mitosis is accompanied by dramatic changes in chromatin organization and nuclear architecture. Transcription halts globally and most sequence-specific transcription factors and co-factors are ejected from mitotic chromatin. How then does the cell maintain its transcriptional identity throughout the cell division cycle? It has become clear that not all traces of active transcription and gene repression are erased within mitotic chromatin. Many histone modifications are stable or only partially diminished throughout mitosis. In addition, some sequence-specific DNA binding factors have emerged that remain bound to select sites within mitotic chromatin, raising the possibility that they function to transmit regulatory information through the transcriptionally silent mitotic phase, a concept that has been termed “mitotic bookmarking.” Here we review recent approaches to studying potential bookmarking factors with regards to their mitotic partitioning, and summarize emerging ideas concerning the in vivo functions of mitotically bound nuclear factors. PMID:23547918

  1. Drug Repurposing Approach Identifies Inhibitors of the Prototypic Viral Transcription Factor IE2 that Block Human Cytomegalovirus Replication.

    PubMed

    Mercorelli, Beatrice; Luganini, Anna; Nannetti, Giulio; Tabarrini, Oriana; Palù, Giorgio; Gribaudo, Giorgio; Loregian, Arianna

    2016-03-17

    New targets for antiviral strategies are needed against human cytomegalovirus (HCMV), a major human pathogen. A cell-based screen aimed at finding inhibitors of the viral transcription factor Immediate-Early 2 (IE2) was performed in HCMV-infected cells expressing EGFP under the control of an IE2-inducible viral promoter. Screening of a library of bioactive small molecules led to the identification of several compounds able to inhibit EGFP expression and also HCMV replication with potency in the low-micromolar range. Follow-up studies with four selected hits indicated that they all block viral DNA synthesis as well as viral Early and Late gene expression. Furthermore, mechanistic studies confirmed that the compounds specifically act via inhibition of IE2 transactivating activity, thus blocking viral Early gene expression and the progression of virus replication. These results provide proof of concept for identifying small molecules that modulate the activity of a microbial transcription factor to control pathogen replication. PMID:26877023

  2. A Synthetic Interaction Screen Identifies Factors Selectively Required for Proliferation and TERT Transcription in p53-Deficient Human Cancer Cells

    PubMed Central

    Park, Sung Mi; Zhu, Lihua J.; Debily, Marie-anne; Kittler, Ellen L. W.; Zapp, Maria L.; Lapointe, David; Gobeil, Stephane; Virbasius, Ching-Man; Green, Michael R.

    2012-01-01

    Numerous genetic and epigenetic alterations render cancer cells selectively dependent on specific genes and regulatory pathways, and represent potential vulnerabilities that can be therapeutically exploited. Here we describe an RNA interference (RNAi)–based synthetic interaction screen to identify genes preferentially required for proliferation of p53-deficient (p53−) human cancer cells. We find that compared to p53-competent (p53+) human cancer cell lines, diverse p53− human cancer cell lines are preferentially sensitive to loss of the transcription factor ETV1 and the DNA damage kinase ATR. In p53− cells, RNAi–mediated knockdown of ETV1 or ATR results in decreased expression of the telomerase catalytic subunit TERT leading to growth arrest, which can be reversed by ectopic TERT expression. Chromatin immunoprecipitation analysis reveals that ETV1 binds to a region downstream of the TERT transcriptional start-site in p53− but not p53+ cells. We find that the role of ATR is to phosphorylate and thereby stabilize ETV1. Our collective results identify a regulatory pathway involving ETV1, ATR, and TERT that is preferentially important for proliferation of diverse p53− cancer cells. PMID:23284306

  3. Deregulated transcription factors in leukemia.

    PubMed

    Shima, Yutaka; Kitabayashi, Issay

    2011-08-01

    Specific chromosomal translocations and other mutations associated with acute myeloblastic leukemia (AML) often involve transcription factors and transcriptional coactivators. Such target genes include AML1, C/EBPα, RARα, MOZ, p300/CBP, and MLL, all of which are important in the regulation of hematopoiesis. The resultant fusion or mutant proteins deregulate the transcription of the affected genes and disrupt their essential role in hematopoiesis, causing differentiation block and abnormal proliferation and/or survival. This review focuses on such transcription factors and coactivators, and describes their roles in leukemogenesis and hematopoiesis. PMID:21823042

  4. Factor-binding element in the human c-myc promoter involved in transcriptional regulation by transforming growth factor. beta. 1 and by the retinoblastoma gene product

    SciTech Connect

    Pietenpol, J.A.; Stein, R.W.; Moses, H.L. ); Muenger, K.; Howley, P.M. )

    1991-11-15

    Previous studies have shown that transforming growth factor {beta}1 (TGF-{beta}1) inhibition of keratinocyte proliferation involves suppression of c-myc transcription, and indirect evidence has suggested that the retinoblastoma gene product (pRB) may be involved in this process. In this study, transient expression of pRB in skin keratinocytes was shown to repress transcription of the human c-myc promoter region was required for regulation by both TGF-{beta}1 and pRB. These sequences, termed the TGF-{beta} control element (TCE), lie between positions {minus}86 and {minus}63 relative to the P1 transcription start site. Oligonucleotides containing the TCE bound to several nuclear factors in mobility-shift assays using extracts from cells with or without normal pRB. Binding of some factors was inhibited by TGF-{beta}1 treatment of TGF-{beta}-sensitive but not TGF-{beta}-insensitive cells. These data indicate that pRB can suppress c-myc transcription and growth inhibition.

  5. Chromosomal mapping of the human and mouse homologues of two new members of the AP-2 family of transcription factors

    SciTech Connect

    Williamson, J.A.; Sheer, D.; Bosher, J.M.

    1996-07-01

    The AP-2 transcription factor has been shown to play an important role in the development of tissues of ectodermal origin and has also been implicated in mammary oncogenesis. It has recently been found that AP-2 is encoded by a family of related genes, AP-2{alpha}, AP-2{beta}, and AP-2{gamma}. As a further step in understanding the role of each of these genes has in development, we have used fluorescence in situ hybridization to map the chromosomal locations of the mouse and human homologues of the newly isolated AP-2{beta} and AP-2{gamma} genes. Tcfap2b and Tcfap2c map to mouse chromosomes 1A2-4 and 2H3-4, respectively, while TFAP2B and TFAP2C map to human chromosomes 6p12 and 20q13.2, the later being a region that is frequently amplified in breast carcinoma. 20 refs., 1 fig., 1 tab.

  6. Expression of the Human Endogenous Retrovirus HTDV/HERV-K Is Enhanced by Cellular Transcription Factor YY1

    PubMed Central

    Knössl, Michael; Löwer, Roswitha; Löwer, Johannes

    1999-01-01

    The human endogenous retrovirus HTDV/HERV-K, which resides in moderate copy numbers in the human genome, is expressed in a cell-type-specific manner, predominantly in teratocarcinoma cells. We have analyzed the regulatory potential of the 5′ enhancer of the HERV-K long terminal repeat. Protein extracts of HERV-K-expressing teratocarcinoma cell lines (GH and Tera2) and nonexpressing HeLa and HepG2 cells form different protein complexes on the enhancer sequence as detected by electrophoretic mobility shift assays (EMSA). Using competition EMSAs, DNase I footprinting, and supershift experiments, we localized the binding site of these complexes to a 20-bp sequence within the enhancer and showed that the transcription factor YY1 is one component of the HERV-K enhancer complex. Replacement of the YY1 binding site with unrelated sequences reduced expression of the luciferase gene as a reporter in transient-transfection assays. PMID:9882329

  7. HUMAN PAPILLOMAVIRUS E7 ENHANCES HYPOXIA-INDUCIBLE FACTOR 1 MEDIATED TRANSCRIPTION BY INHIBITING BINDING OF HISTONE DEACETYLASES

    PubMed Central

    Bodily, Jason M.; Mehta, Kavi P. M.; Laimins, Laimonis A.

    2010-01-01

    Infection by human papillomaviruses (HPVs) leads to the formation of benign lesions, warts, and in some cases, cervical cancer. The formation of these lesions is dependent upon increased expression of pro-angiogenic factors. Angiogenesis is linked to tissue hypoxia through the activity of the oxygen sensitive hypoxia inducible factor 1α (HIF-1α). Our studies indicate that the HPV E7 protein enhances HIF-1 transcriptional activity while E6 functions to counteract the repressive effects of p53. Both high and low risk HPV E7 proteins were found to bind to HIF-1α through a domain located in the the N terminus. Importantly, the ability of E7 to enhance HIF-1 activity mapped to the C terminus and correlated with the displacement of the histone deacetylases HDAC1, HDAC4, and HDAC7 from HIF-1α by E7. Our findings describe a novel role of the E7 oncoprotein in activating the function of a key transcription factor mediating hypoxic responses by blocking the binding of HDACs. PMID:21148070

  8. Human transcription factor IIIC contains a polypeptide of 55 kDa specifically binding to Pol III genes.

    PubMed Central

    Schneider, H R; Waldschmidt, R; Seifart, K H

    1990-01-01

    Human transcription factor IIIC contains a 55 kDa polypeptide which specifically interacts with the Adenovirus 2 VAI gene promoter and which mimics most of the DNA binding properties of the entire factor. The specificity and affinity of this protein:DNA interaction was demonstrated by: (i) Separation of purified fractions of hTFIIIC by SDS PAGE, electrotransfer to nitrocellulose, renaturation of proteins and their subsequent binding to the VAI gene, (ii) recovery and renaturation of proteins from SDS gels and identification of a fraction of hTFIIIC with a molecular mass less than 68 kDa, which specifically binds to VAI DNA, (iii) correlating the differential binding activity of the renatured 55 kDa component of hTFIIIC to mutated Pol III promoters with the ability of the entire factor to form functional transcription complexes thereon, and finally by (iv) specific crosslinking of the 55 kDa DNA binding component of hTFIIIC to the photoaffinity labeled B-box promoter sequence of the VAI gene. Images PMID:2395640

  9. High throughput assays for analyzing transcription factors.

    PubMed

    Li, Xianqiang; Jiang, Xin; Yaoi, Takuro

    2006-06-01

    Transcription factors are a group of proteins that modulate the expression of genes involved in many biological processes, such as cell growth and differentiation. Alterations in transcription factor function are associated with many human diseases, and therefore these proteins are attractive potential drug targets. A key issue in the development of such therapeutics is the generation of effective tools that can be used for high throughput discovery of the critical transcription factors involved in human diseases, and the measurement of their activities in a variety of disease or compound-treated samples. Here, a number of innovative arrays and 96-well format assays for profiling and measuring the activities of transcription factors will be discussed. PMID:16834538

  10. Characterization of the regulatory domains of the human skn-1a/Epoc-1/Oct-11 POU transcription factor.

    PubMed

    Hildesheim, J; Foster, R A; Chamberlin, M E; Vogel, J C

    1999-09-10

    The Skn-1a POU transcription factor is primarily expressed in keratinocytes of murine embryonic and adult epidermis. Although some POU factors expressed in a tissue-specific manner are important for normal differentiation, the biological function of Skn-1a remains unknown. Previous in vitro studies indicate that Skn-1a has the ability to transactivate markers of keratinocyte differentiation. In this study, we have characterized Skn-1a's transactivation domain(s) and engineered a dominant negative protein that lacked this transactivation domain. Deletional analysis of the human homologue of Skn-1a with three target promoters revealed the presence of two functional domains: a primary C-terminal transactivation domain and a combined N-terminal inhibitory domain and transactivation domain. Skn-1a lacking the C-terminal region completely lost transactivation ability, irrespective of the promoter tested, and was able to block transactivation by normal Skn-1a in competition assays. Compared with full-length, Skn-1a lacking the N-terminal region demonstrated either increased transactivation (bovine cytokeratin 6 promoter), comparable transactivation (human papillomavirus type 1a long control region), or loss of transactivation (human papillomavirus type 18 long control region). The identification of a primary C-terminal transactivation domain enabled us to generate a dominant negative Skn-1a factor, which will be useful in the quest for a better understanding of this keratinocyte-specific gene regulator. PMID:10473598

  11. Short-lived mammals (shrew, mouse) have a less robust metal-responsive transcription factor than humans and bats.

    PubMed

    Schmidt, Katharina; Steiner, Kurt; Petrov, Boyan; Georgiev, Oleg; Schaffner, Walter

    2016-06-01

    Non-essential "heavy" metals such as cadmium tend to accumulate in an organism and thus are a particular threat for long-lived animals. Here we show that two unrelated, short-lived groups of mammals (rodents and shrews, separated by 100 Mio years of evolution) each have independently acquired mutations in their metal-responsive transcription factor (MTF-1) in a domain relevant for robust transcriptional induction by zinc and cadmium. While key amino acids are mutated in rodents, in shrews an entire exon is skipped. Rodents and especially shrews are unique regarding the alterations of this region. To investigate the biological relevance of these alterations, MTF-1s from the common shrew (Sorex araneus), the mouse, humans and a bat (Myotis blythii), were tested by cotransfection with a reporter gene into cells lacking MTF-1. Whereas shrews only live for 1.5-2.5 years, bats, although living on a very similar insect diet, have a lifespan of several decades. We find that bat MTF-1 is similarly metal-responsive as its human counterpart, while shrew MTF-1 is less responsive, similar to mouse MTF-1. We propose that in comparison to most other mammals, the short-lived shrews and rodents can afford a "lower-quality" system for heavy metal homeostasis and detoxification. PMID:27067444

  12. Direct Induction of Hemogenic Endothelium and Blood by Overexpression of Transcription Factors in Human Pluripotent Stem Cells.

    PubMed

    Elcheva, Irina; Brok-Volchanskaya, Vera; Slukvin, Igor

    2015-01-01

    During development, hematopoietic cells arise from a specialized subset of endothelial cells, hemogenic endothelium (HE). Modeling HE development in vitro is essential for mechanistic studies of the endothelial-hematopoietic transition and hematopoietic specification. Here, we describe a method for the efficient induction of HE from human pluripotent stem cells (hPSCs) by way of overexpression of different sets of transcription factors. The combination of ETV2 and GATA1 or GATA2 TFs is used to induce HE with pan-myeloid potential, while a combination of GATA2 and TAL1 transcription factors allows for the production of HE with erythroid and megakaryocytic potential. The addition of LMO2 to GATA2 and TAL1 combination substantially accelerates differentiation and increases erythroid and megakaryocytic cells production. This method provides an efficient and rapid means of HE induction from hPSCs and allows for the observation of the endothelial-hematopoietic transition in a culture dish. The protocol includes hPSCs transduction procedures and post-transduction analysis of HE and blood progenitors. PMID:26710184

  13. Structure, organization, and transcription units of the human {alpha}-platelet-derived growth factor receptor gene, PDGFRA

    SciTech Connect

    Kawagishi, Jun; Yamamoto, Tokuo; Kumabe, Toshihiro; Yoshimoto, Takashi

    1995-11-20

    Isolation and characterization of genomic clones encoding human {alpha}-platelet derived growth factor receptor (HGAM-approved symbol PDGFRA) revealed that the gene spans approximately 65 kb and contains 23 exons. The 5{prime}-untranslated region of the mRNA is encoded by exon 1, and a large intron of 23 kb separates exon 2 encoding the translation initiator codon AUG and the signal sequence. The locations of exon/intron boundaries in the extracellular immunoglobulin-like domains, the transmembrane domain, the two cytoplasmic tyrosine kinase domains, and the kinase insertion domain are very similar to those in c-kit and macrophage colony stimulating factor-1 receptor genes. The transcription start site was mapped to a position 393 bp upstream of the AUG translation initiator codon by Si mapping and primer extension analysis. The 5{prime}-flanking region of the gene lacks a typical TATA box but contains a typical CCAAT box and GATA motifs. This region also contains potential sites for AP-1, AP-2, Oct-1, Oct-2, and Sp1. The 5{prime}-flanking region of the gene was fused to the luciferase reporter gene, and transcription units of the gene were determined. 49 refs., 6 figs., 1 tab.

  14. MicroRNAs control transcription factor NF-kB (p65) expression in human ovarian cells.

    PubMed

    Sirotkin, Alexander V; Alexa, Richard; Kišová, Gabriela; Harrath, Abdel Halim; Alwasel, Saleh; Ovcharenko, Dmitriy; Mlynček, Miloš

    2015-05-01

    MicroRNAs (miRNAs) are known to influence ovarian cell proliferation, apoptosis and hormone release, but it remains unknown whether miRNAs affect ovarian functions via transcription factors. We examined the effect of miRNAs on nuclear factor-κappaB (NF-kB) (p65) expression in human ovarian luteinized granulosa cells. We transfected cultured primary human ovarian luteinized granulosa cells with 80 different constructs encoding human pre-miRNAs and then evaluated NF-kB (p65) expression (percentage of cells containing p65) by immunocytochemistry. We found that 21 of the constructs stimulated NF-kB (p65) expression and 18 of the constructs inhibited NF-kB (p65) expression. This is the first direct demonstration that miRNAs affect NF-kB (p65) expression and the first genome-scale miRNA screen to identify upregulation and downregulation of NF-kB accumulation by miRNAs in the ovary. Novel miRNAs that affect the NF-kB signalling pathway could be useful for the control of NF-kB-dependent reproductive processes and the treatment of NF-kB-dependent reproductive disorders. PMID:25403593

  15. Conversion of Human Fibroblasts to Stably Self-Renewing Neural Stem Cells with a Single Zinc-Finger Transcription Factor

    PubMed Central

    Shahbazi, Ebrahim; Moradi, Sharif; Nemati, Shiva; Satarian, Leila; Basiri, Mohsen; Gourabi, Hamid; Zare Mehrjardi, Narges; Günther, Patrick; Lampert, Angelika; Händler, Kristian; Hatay, Firuze Fulya; Schmidt, Diana; Molcanyi, Marek; Hescheler, Jürgen; Schultze, Joachim L.; Saric, Tomo; Baharvand, Hossein

    2016-01-01

    Summary Direct conversion of somatic cells into neural stem cells (NSCs) by defined factors holds great promise for mechanistic studies, drug screening, and potential cell therapies for different neurodegenerative diseases. Here, we report that a single zinc-finger transcription factor, Zfp521, is sufficient for direct conversion of human fibroblasts into long-term self-renewable and multipotent NSCs. In vitro, Zfp521-induced NSCs maintained their characteristics in the absence of exogenous factor expression and exhibited morphological, molecular, developmental, and functional properties that were similar to control NSCs. In addition, the single-seeded induced NSCs were able to form NSC colonies with efficiency comparable with control NSCs and expressed NSC markers. The converted cells were capable of surviving, migrating, and attaining neural phenotypes after transplantation into neonatal mouse and adult rat brains, without forming tumors. Moreover, the Zfp521-induced NSCs predominantly expressed rostral genes. Our results suggest a facilitated approach for establishing human NSCs through Zfp521-driven conversion of fibroblasts. PMID:27052315

  16. Conversion of Human Fibroblasts to Stably Self-Renewing Neural Stem Cells with a Single Zinc-Finger Transcription Factor.

    PubMed

    Shahbazi, Ebrahim; Moradi, Sharif; Nemati, Shiva; Satarian, Leila; Basiri, Mohsen; Gourabi, Hamid; Zare Mehrjardi, Narges; Günther, Patrick; Lampert, Angelika; Händler, Kristian; Hatay, Firuze Fulya; Schmidt, Diana; Molcanyi, Marek; Hescheler, Jürgen; Schultze, Joachim L; Saric, Tomo; Baharvand, Hossein

    2016-04-12

    Direct conversion of somatic cells into neural stem cells (NSCs) by defined factors holds great promise for mechanistic studies, drug screening, and potential cell therapies for different neurodegenerative diseases. Here, we report that a single zinc-finger transcription factor, Zfp521, is sufficient for direct conversion of human fibroblasts into long-term self-renewable and multipotent NSCs. In vitro, Zfp521-induced NSCs maintained their characteristics in the absence of exogenous factor expression and exhibited morphological, molecular, developmental, and functional properties that were similar to control NSCs. In addition, the single-seeded induced NSCs were able to form NSC colonies with efficiency comparable with control NSCs and expressed NSC markers. The converted cells were capable of surviving, migrating, and attaining neural phenotypes after transplantation into neonatal mouse and adult rat brains, without forming tumors. Moreover, the Zfp521-induced NSCs predominantly expressed rostral genes. Our results suggest a facilitated approach for establishing human NSCs through Zfp521-driven conversion of fibroblasts. PMID:27052315

  17. Functional interaction between the human cytomegalovirus 86-kilodalton IE2 protein and the cellular transcription factor CREB.

    PubMed Central

    Lang, D; Gebert, S; Arlt, H; Stamminger, T

    1995-01-01

    The 86-kDa IE2 protein (IE86) of human cytomegalovirus (HCMV) has been described as a promiscuous transactivator of viral, as well as cellular, gene expression. Investigation of the mechanism used by IE86 to activate gene expression from the early UL112/113 promoter of HCMV revealed the existence of three binding sites for IE86 located between nucleotides -290 and -120 relative to the transcriptional start site (H. Arlt, D. Lang, S. Gebert, and T. Stamminger, J. Virol. 68:4117-4125, 1994). As shown previously, deletion of these target sites resulted in a reduction of IE86-mediated transactivation by approximately 70%. The remaining promoter, however, could still be stimulated about 40-fold, indicating the presence of an additional responsive element within these sequences. Here, we provide evidence that a binding site for the cellular transcription factor CREB can also act as a target for IE86 transactivation. By DNase I protection analysis, a binding sequence for CREB could be detected between nucleotides -78 and -56 within the respective promoter region. After in vitro mutagenesis of this CREB-binding site within the context of the entire UL112/113 promoter, a marked reduction in transactivation levels was evident. Moreover, when individual CREB-binding sites were positioned upstream of a minimal, TATA box-containing UL112/113 promoter, they were able to confer strong IE86 responsiveness, whereas a mutated sequence did not exert any effect. In far Western blot and pull-down experiments, a direct interaction of IE86 with the cellular transcription factor CREB could be observed. The in vivo relevance of this in vitro interaction was confirmed by using various GAL4 fusion proteins in the presence or absence of IE86 which revealed a strong activation only in the presence of both a GAL4-CREB fusion and IE86. This shows that at least one specific member of the ATF/CREB family of transcription factors is involved in mediating transactivation by the HCMV IE86 protein

  18. Chicken ovalbumin upstream promoter transcription factor II in human breast carcinoma: possible regulator of lymphangiogenesis via vascular endothelial growth factor-C expression.

    PubMed

    Nagasaki, Shuji; Suzuki, Takashi; Miki, Yasuhiro; Akahira, Jun-ichi; Shibata, Hirotaka; Ishida, Takanori; Ohuchi, Noriaki; Sasano, Hironobu

    2009-04-01

    Chicken ovalbumin upstream promoter transcription factors (COUP-TF) are orphan members of the nuclear receptor superfamily and consist of COUP-TFI and COUP-TFII. COUP-TFI was reported to be overexpressed in human breast cancer and to promote estrogen-independent transcriptional activity of estrogen receptor alpha. COUP-TFII, however, has not been examined in the breast. Therefore, we carried out immunohistochemical analysis of COUP-TFII in human breast cancer in order to clarify its biological and clinical significance. We immunolocalized COUP-TFII in 119 human breast cancers and correlated the findings with various clinicopathological parameters. Fifty-nine percent of the cases were immunohistochemically positive for COUP-TFII. COUP-TFII positivity was correlated with poor clinical outcome, and a statistically significant correlation was detected between COUP-TFII and the following clinicopathological parameters: clinical stage, lymph node status, histological grade, and estrogen receptor alpha status. In addition, short interfering RNA-mediated knockdown of COUP-TFII in the breast carcinoma cell line MCF-7 decreased the level of vascular endothelial growth factor-C mRNA expression, which is a known inducer of lymphangiogenesis and lymph node metastasis. These results suggest that COUP-TFII is involved in the development of advanced human breast cancer. PMID:19154418

  19. Network analysis of microRNAs, transcription factors, target genes and host genes in human anaplastic astrocytoma

    PubMed Central

    XUE, LUCHEN; XU, ZHIWEN; WANG, KUNHAO; WANG, NING; ZHANG, XIAOXU; WANG, SHANG

    2016-01-01

    Numerous studies have investigated the roles played by various genes and microRNAs (miRNAs) in neoplasms, including anaplastic astrocytoma (AA). However, the specific regulatory mechanisms involving these genes and miRNAs remain unclear. In the present study, associated biological factors (miRNAs, transcription factors, target genes and host genes) from existing studies of human AA were combined methodically through the interactions between genes and miRNAs, as opposed to studying one or several. Three regulatory networks, including abnormally expressed, related and global networks were constructed with the aim of identifying significant gene and miRNA pathways. Each network is composed of three associations between miRNAs targeted at genes, transcription factors (TFs) regulating miRNAs and miRNAs located on their host genes. Among these, the abnormally expressed network, which involves the pathways of previously identified abnormally expressed genes and miRNAs, partially indicated the regulatory mechanism underlying AA. The network contains numerous abnormal regulation associations when AA emerges. By modifying the abnormally expressed network factors to a normal expression pattern, the faulty regulation may be corrected and tumorigenesis of AA may be prevented. Certain specific pathways are highlighted in AA, for example PTEN which is targeted by miR-21 and miR-106b, regulates miR-25 which in turn targets TP53. PTEN and miR-21 have been observed to form feedback loops. Furthermore, by comparing and analyzing the pathway predecessors and successors of abnormally expressed genes and miRNAs in three networks, similarities and differences of regulatory pathways may be identified and proposed. In summary, the present study aids in elucidating the occurrence, mechanism, prevention and treatment of AA. These results may aid further investigation into therapeutic approaches for this disease. PMID:27347075

  20. The human protein kinase HIPK2 phosphorylates and downregulates the methyl-binding transcription factor ZBTB4.

    PubMed

    Yamada, D; Pérez-Torrado, R; Filion, G; Caly, M; Jammart, B; Devignot, V; Sasai, N; Ravassard, P; Mallet, J; Sastre-Garau, X; Schmitz, M L; Defossez, P-A

    2009-07-01

    HIPK2 is a eukaryotic Serine-Threonine kinase that controls cellular proliferation and survival in response to exogenous signals. Here, we show that the human transcription factor ZBTB4 is a new target of HIPK2. The two proteins interact in vitro, colocalize and associate in vivo, and HIPK2 phosphorylates several conserved residues of ZBTB4. Overexpressing HIPK2 causes the degradation of ZBTB4, whereas overexpressing a kinase-deficient mutant of HIPK2 has no effect. The chemical activation of HIPK2 also decreases the amount of ZBTB4 in cells. Conversely, the inhibition of HIPK2 by drugs or by RNA interference causes a large increase in ZBTB4 levels. This negative regulation of ZBTB4 by HIPK2 occurs under normal conditions of cell growth. In addition, the degradation is increased by DNA damage. These findings have two consequences. First, we have recently shown that ZBTB4 inhibits the transcription of p21. Therefore, the activation of p21 by HIPK2 is two-pronged: stimulation of the activator p53, and simultaneous repression of the inhibitor ZBTB4. Second, ZBTB4 is also known to bind methylated DNA and repress methylated sequences. Consequently, our findings raise the possibility that HIPK2 might influence the epigenetic regulation of gene expression at loci that remain to be identified. PMID:19448668

  1. Silencing of core transcription factors in human EC cells highlights the importance of autocrine FGF signaling for self-renewal

    PubMed Central

    Greber, Boris; Lehrach, Hans; Adjaye, James

    2007-01-01

    Background Despite their distinct origins, human embryonic stem (hES) and embryonic carcinoma (hEC) cells share a number of similarities such as surface antigen expression, growth characteristics, the ability to either self-renew or differentiate, and control of the undifferentiated state by the same core transcription factors. To obtain further insights into the regulation of self-renewal, we have silenced hES/hEC cell-specific genes in NCCIT hEC cells and analysed the downstream effects by means of microarrays. Results RNAi-mediated silencing of OCT4 and SOX2 induced differentiation with mesodermal characteristics. Markers of trophoblast induction were only transiently up-regulated in the OCT4 knock-down. Independent knock-downs of NANOG produced a proliferation rather than a differentiation phenotype, which may be due to high NANOG expression levels in the cell line used. Published ChIP-chip data from hES cells were used to identify putative direct targets. RNAi-mediated differentiation was accompanied by direct down-regulation of known hES/hEC cell markers. This included all three core transcription factors in the case of the OCT4 and SOX2 knock-downs, confirming previous findings of reciprocal activation in ES cells. Furthermore, large numbers of histone genes as well as epigenetic regulators were differentially expressed, pointing at chromatin remodeling as an additional regulatory level in the differentiation process. Moreover, loss of self-renewal was accompanied by the down-regulation of genes involved in FGF signaling. FGF receptor inhibition for short and prolonged periods of time revealed that the ERK/MAPK cascade is activated by endogenously expressed fibroblast growth factors and that FGF signaling is cruicial for maintaining the undifferentiated state of hEC cells, like in hES cells. Conclusion Control of self-renewal appears to be very similar in hEC and hES cells. This is supported by large numbers of common transcription factor targets and the

  2. Data in support of FSH induction of IRS-2 in human granulosa cells: Mapping the transcription factor binding sites in human IRS-2 promoter.

    PubMed

    Kaur, Surleen; Anjali, G; Bhardwaj, Priya; Taneja, Jyoti; Singh, Rita

    2016-03-01

    Insulin receptor substrate-2 (IRS-2) plays critical role in the regulation of various metabolic processes by insulin and IGF-1. The defects in its expression and/or function are linked to diseases like polycystic ovary syndrome (PCOS), insulin resistance and cancer. To predict the transcription factors (TFs) responsible for the regulation of human IRS-2 gene expression, the transcription factor binding sites (TFBS) and the corresponding TFs were investigated by analysis of IRS-2 promoter sequence using MatInspector Genomatix software (Cartharius et al., 2005 [1]). The ibid data is part of author׳s publication (Anjali et al., 2015 [2]) that explains Follicle stimulating hormone (FSH) mediated IRS-2 promoter activation in human granulosa cells and its importance in the pathophysiology of PCOS. Further analysis was carried out for binary interactions of TF regulatory genes in IRS-2 network using Cytoscape software tool and R-code. In this manuscript, we describe the methodology used for the identification of TFBSs in human IRS-2 promoter region and provide details on experimental procedures, analysis method, validation of data and also the raw files. The purpose of this article is to provide the data on all TFBSs in the promoter region of human IRS-2 gene as it has the potential for prediction of the regulation of IRS-2 gene in normal or diseased cells from patients with metabolic disorders and cancer. PMID:26858982

  3. Data in support of FSH induction of IRS-2 in human granulosa cells: Mapping the transcription factor binding sites in human IRS-2 promoter

    PubMed Central

    Kaur, Surleen; Anjali, G.; Bhardwaj, Priya; Taneja, Jyoti; Singh, Rita

    2015-01-01

    Insulin receptor substrate-2 (IRS-2) plays critical role in the regulation of various metabolic processes by insulin and IGF-1. The defects in its expression and/or function are linked to diseases like polycystic ovary syndrome (PCOS), insulin resistance and cancer. To predict the transcription factors (TFs) responsible for the regulation of human IRS-2 gene expression, the transcription factor binding sites (TFBS) and the corresponding TFs were investigated by analysis of IRS-2 promoter sequence using MatInspector Genomatix software (Cartharius et al., 2005 [1]). The ibid data is part of author׳s publication (Anjali et al., 2015 [2]) that explains Follicle stimulating hormone (FSH) mediated IRS-2 promoter activation in human granulosa cells and its importance in the pathophysiology of PCOS. Further analysis was carried out for binary interactions of TF regulatory genes in IRS-2 network using Cytoscape software tool and R-code. In this manuscript, we describe the methodology used for the identification of TFBSs in human IRS-2 promoter region and provide details on experimental procedures, analysis method, validation of data and also the raw files. The purpose of this article is to provide the data on all TFBSs in the promoter region of human IRS-2 gene as it has the potential for prediction of the regulation of IRS-2 gene in normal or diseased cells from patients with metabolic disorders and cancer. PMID:26858982

  4. Contributions of in vitro transcription to the understanding of human RNA polymerase III transcription

    PubMed Central

    Dumay-Odelot, Hélène; Durrieu-Gaillard, Stéphanie; El Ayoubi, Leyla; Parrot, Camila; Teichmann, Martin

    2014-01-01

    Human RNA polymerase III transcribes small untranslated RNAs that contribute to the regulation of essential cellular processes, including transcription, RNA processing and translation. Analysis of this transcription system by in vitro transcription techniques has largely contributed to the discovery of its transcription factors and to the understanding of the regulation of human RNA polymerase III transcription. Here we review some of the key steps that led to the identification of transcription factors and to the definition of minimal promoter sequences for human RNA polymerase III transcription. PMID:25764111

  5. Cloning and characterization of a novel human hepatocyte transcription factor, hB1F, which binds and activates enhancer II of hepatitis B virus.

    PubMed

    Li, M; Xie, Y H; Kong, Y Y; Wu, X; Zhu, L; Wang, Y

    1998-10-30

    Enhancer II (ENII) of hepatitis B virus (HBV) is one of the essential cis-elements for the transcriptional regulation of HBV gene expression. Its function is highly liver-specific, suggesting that liver-enriched transcriptional factors play critical roles in regulating the activity of ENII. In this report, a novel hepatocyte transcription factor, which binds specifically to the B1 region (AACGACCGACCTTGAG) within the major functional unit (B unit) of ENII, has been cloned from a human liver cDNA library by yeast one-hybrid screening, and demonstrated to trans-activate ENII via the B1 region. We named this factor hB1F, for human B1-binding factor. Amino acid analysis revealed this factor structurally belongs to nuclear receptor superfamily. Based on the sequence similarities, hB1F is characterized to be a novel human homolog of the orphan receptor fushi tarazu factor I (FTZ-F1). Using reverse transcription-polymerase chain reaction, a splicing isoform of hB1F (hB1F-2) was identified, which has an extra 46 amino acid residues in the A/B region. Examination of the tissue distribution has revealed an abundant 5.2-kilobase transcript of hB1F is present specifically in human pancreas and liver. Interestingly, an additional transcript of 3.8 kilobases was found to be present in hepatoma cells HepG2. Fluorescent in situ hybridization has mapped the gene locus of hB1F to the region q31-32.1 of human chromosome 1. Altogether, this study provides the first report that a novel human homolog of FTZ-F1 binds and regulates ENII of HBV. The potential roles of this FTZ-F1 homolog in tissue-specific gene regulation, in embryonic development, as well as in liver carcinogenesis are discussed. PMID:9786908

  6. Minimal promoter systems reveal the importance of conserved residues in the B-finger of human transcription factor IIB.

    PubMed

    Thompson, Nancy E; Glaser, Bryan T; Foley, Katherine M; Burton, Zachary F; Burgess, Richard R

    2009-09-11

    The "B-finger" of transcription factor IIB (TFIIB) is highly conserved and believed to play a role in the initiation process. We performed alanine substitutions across the B-finger of human TFIIB, made change-of-charge mutations in selected residues, and substituted the B-finger sequence from other organisms. Mutant proteins were examined in two minimal promoter systems (containing only RNA polymerase II, TATA-binding protein, and TFIIB) and in a complex system, using TFIIB-immunodepleted HeLa cell nuclear extract (NE). Mutations in conserved residues located on the sides of the B-finger had the greatest effect on activity in both minimal promoter systems, with mutations in residues Glu-51 and Arg-66 eliminating activity. The double change-of-charge mutant (E51R:R66E) did not show activity in either minimal promoter system. Mutations in the nonconserved residues at the tip of the B-finger did not significantly affect activity. However, all of the mutations in the B-finger showed at least 25% activity in the HeLa cell NE. Chimeric proteins, containing B-finger sequences from species with conserved residues on the side of the B-finger, showed wild-type activity in a minimal promoter system and in the HeLa cell NE. However, chimeric proteins whose sequence showed divergence on the sides of the B-finger had reduced activity. Transcription factor IIF (TFIIF) partially restored activity of the inactive mutants in the minimal promoter system, suggesting that TFIIF in HeLa cell NE helps to rescue the inactive mutations by interacting with either the B-finger or another component of the initiation complex that is influenced by the B-finger. PMID:19590095

  7. DIESEL EXHAUST ACTIVATES REDOX-SENSITIVE TRANSCRIPTION FACTORS AND KINASES IN HUMAN AIRWAYS

    EPA Science Inventory

    Diesel exhaust (DE) is a major component of airborne particulate matter. In previous studies we have described the acute inflammatory response of the human airway to inhaled DE. This was characterized by neutrophil, mast cell, and lymphocyte infiltration into the bronchial mucosa...

  8. Dnmt1/Transcription Factor Interactions

    PubMed Central

    Hervouet, Eric; Vallette, François M.; Cartron, Pierre-François

    2010-01-01

    DNA methylation inheritance is the process of copying, via the DNA methyltransferase 1 (Dnmt1), the pre-existing methylation patterns onto the new DNA strand during DNA replication. Experiments of chromatin immunoprecipitation, measurement of maintenance methyltransferase activity, proximity ligation in situ assays (P-LISA, Duolink/Olink), and transcription factor arrays demonstrate that Dnmt1 interacts with transcription factors to promote site-specific DNA methylation inheritance, while the Dnmt1-PCNA-UHRF1 complex promotes the DNA methylation inheritance without site preference. We also show that the Dnmt1-PCNA-UHRF1 and Dnmt1/transcription factor complexes methylate DNA by acting as a single player or in cooperation. Thus, our data establish that the copying of the pre-existing methylation pattern is governed by the orchestration of the untargeted and the targeted mechanisms of DNA methylation inheritance, which are themselves dictated by the partners of Dnmt1. PMID:21779454

  9. RNA polymerase III dependence of the human L1 promoter and possible participation of the RNA polymerase II factor YY1 in the RNA polymerase III transcription system.

    PubMed Central

    Kurose, K; Hata, K; Hattori, M; Sakaki, Y

    1995-01-01

    From the general views of the eukaryotic transcription systems, L1 (or L1-like) retrotransposons that encode some proteins are unusual. L1, unlike other protein-coding elements, is transcribed through an internal promoter. And the L1 internal promoter, unlike other internal promoters, is thought to be RNA polymerase II (pol II) dependent, because the L1 transcript has a large size (approximately 6 kb), protein coding capacity and a 3' terminal polyadenylation signal followed by a poly(A) tail, and also because transcription from the promoter of Drosophila L1-like element jockey was highly sensitive to alpha-amanitin. However, our in vitro transcription study reveals that transcription from the human L1 promoter is highly sensitive to tagetitoxin, a selective inhibitor of RNA polymerase III (pol III), but insensitive to 1 micrograms/ml of alpha-amanitin, indicating that the human L1 promoter is pol III-dependent. The pol III dependence is further supported by our observation that L1 and pol III-dependent tRNA gene promoters share a common nuclear factor YY1. There is evidence that YY1 is also a pol II transcription factor. We thus propose that YY1 is a possible member of the pol III transcription system. Images PMID:7479000

  10. Runx transcription factors repress human and murine c-Myc expression in a DNA-binding and C-terminally dependent manner.

    PubMed

    Jacobs, Paejonette T; Cao, Li; Samon, Jeremy B; Kane, Christyne A; Hedblom, Emmett E; Bowcock, Anne; Telfer, Janice C

    2013-01-01

    The transcription factors Runx1 and c-Myc have individually been shown to regulate important gene targets as well as to collaborate in oncogenesis. However, it is unknown whether there is a regulatory relationship between the two genes. In this study, we investigated the transcriptional regulation of endogenous c-Myc by Runx1 in the human T cell line Jurkat and murine primary hematopoietic cells. Endogenous Runx1 binds to multiple sites in the c-Myc locus upstream of the c-Myc transcriptional start site. Cells transduced with a C-terminally truncated Runx1 (Runx1.d190), which lacks important cofactor interaction sites and can block C-terminal-dependent functions of all Runx transcription factors, showed increased transcription of c-Myc. In order to monitor c-Myc expression in response to early and transiently-acting Runx1.d190, we generated a cell membrane-permeable TAT-Runx1.d190 fusion protein. Murine splenocytes treated with TAT-Runx1.d190 showed an increase in the transcription of c-Myc within 2 hours, peaking at 4 hours post-treatment and declining thereafter. This effect is dependent on the ability of Runx1.d190 to bind to DNA. The increase in c-Myc transcripts is correlated with increased c-Myc protein levels. Collectively, these data show that Runx1 directly regulates c-Myc transcription in a C-terminal- and DNA-binding-dependent manner. PMID:23874874

  11. Runx Transcription Factors Repress Human and Murine c-Myc Expression in a DNA-Binding and C-Terminally Dependent Manner

    PubMed Central

    Jacobs, Paejonette T.; Cao, Li; Samon, Jeremy B.; Kane, Christyne A.; Hedblom, Emmett E.; Bowcock, Anne; Telfer, Janice C.

    2013-01-01

    The transcription factors Runx1 and c-Myc have individually been shown to regulate important gene targets as well as to collaborate in oncogenesis. However, it is unknown whether there is a regulatory relationship between the two genes. In this study, we investigated the transcriptional regulation of endogenous c-Myc by Runx1 in the human T cell line Jurkat and murine primary hematopoietic cells. Endogenous Runx1 binds to multiple sites in the c-Myc locus upstream of the c-Myc transcriptional start site. Cells transduced with a C-terminally truncated Runx1 (Runx1.d190), which lacks important cofactor interaction sites and can block C-terminal-dependent functions of all Runx transcription factors, showed increased transcription of c-Myc. In order to monitor c-Myc expression in response to early and transiently-acting Runx1.d190, we generated a cell membrane-permeable TAT-Runx1.d190 fusion protein. Murine splenocytes treated with TAT-Runx1.d190 showed an increase in the transcription of c-Myc within 2 hours, peaking at 4 hours post-treatment and declining thereafter. This effect is dependent on the ability of Runx1.d190 to bind to DNA. The increase in c-Myc transcripts is correlated with increased c-Myc protein levels. Collectively, these data show that Runx1 directly regulates c-Myc transcription in a C-terminal- and DNA-binding-dependent manner. PMID:23874874

  12. A compendium of Caenhorabditis elegans regulatory transcription factors: a resource for mapping transcription regulatory networks

    PubMed Central

    Reece-Hoyes, John S; Deplancke, Bart; Shingles, Jane; Grove, Christian A; Hope, Ian A; Walhout, Albertha JM

    2005-01-01

    Background Transcription regulatory networks are composed of interactions between transcription factors and their target genes. Whereas unicellular networks have been studied extensively, metazoan transcription regulatory networks remain largely unexplored. Caenorhabditis elegans provides a powerful model to study such metazoan networks because its genome is completely sequenced and many functional genomic tools are available. While C. elegans gene predictions have undergone continuous refinement, this is not true for the annotation of functional transcription factors. The comprehensive identification of transcription factors is essential for the systematic mapping of transcription regulatory networks because it enables the creation of physical transcription factor resources that can be used in assays to map interactions between transcription factors and their target genes. Results By computational searches and extensive manual curation, we have identified a compendium of 934 transcription factor genes (referred to as wTF2.0). We find that manual curation drastically reduces the number of both false positive and false negative transcription factor predictions. We discuss how transcription factor splice variants and dimer formation may affect the total number of functional transcription factors. In contrast to mouse transcription factor genes, we find that C. elegans transcription factor genes do not undergo significantly more splicing than other genes. This difference may contribute to differences in organism complexity. We identify candidate redundant worm transcription factor genes and orthologous worm and human transcription factor pairs. Finally, we discuss how wTF2.0 can be used together with physical transcription factor clone resources to facilitate the systematic mapping of C. elegans transcription regulatory networks. Conclusion wTF2.0 provides a starting point to decipher the transcription regulatory networks that control metazoan development and function

  13. Total Binding Affinity Profiles of Regulatory Regions Predict Transcription Factor Binding and Gene Expression in Human Cells

    PubMed Central

    Molineris, Ivan; Provero, Paolo

    2015-01-01

    Transcription factors regulate gene expression by binding regulatory DNA. Understanding the rules governing such binding is an essential step in describing the network of regulatory interactions, and its pathological alterations. We show that describing regulatory regions in terms of their profile of total binding affinities for transcription factors leads to increased predictive power compared to methods based on the identification of discrete binding sites. This applies both to the prediction of transcription factor binding as revealed by ChIP-seq experiments and to the prediction of gene expression through RNA-seq. Further significant improvements in predictive power are obtained when regulatory regions are defined based on chromatin states inferred from histone modification data. PMID:26599758

  14. The Cancer-Related Transcription Factor Runx2 Modulates Cell Proliferation in Human Osteosarcoma Cell Lines

    PubMed Central

    Lucero, Claudia M.J.; Vega, Oscar A.; Osorio, Mariana M.; Tapia, Julio C.; Antonelli, Marcelo; Stein, Gary S.; Van Wijnen, Andre J.; Galindo, Mario A.

    2013-01-01

    Runx2 regulates osteogenic differentiation and bone formation, but also suppresses pre-osteoblast proliferation by affecting cell cycle progression in the G1 phase. The growth suppressive potential of Runx2 is normally inactivated in part by protein destabilization, which permits cell cycle progression beyond the G1/S phase transition, and Runx2 is again up-regulated after mitosis. Runx2 expression also correlates with metastasis and poor chemotherapy response in osteosarcoma. Here we show that six human osteosarcoma cell lines (SaOS, MG63, U2OS, HOS, G292, and 143B) have different growth rates, which is consistent with differences in the lengths of the cell cycle. Runx2 protein levels are cell cycle-regulated with respect to the G1/S phase transition in U2OS, HOS, G292, and 143B cells. In contrast, Runx2 protein levels are constitutively expressed during the cell cycle in SaOS and MG63 cells. Forced expression of Runx2 suppresses growth in all cell lines indicating that accumulation of Runx2 in excess of its pre-established levels in a given cell type triggers one or more anti-proliferative pathways in osteosarcoma cells. Thus, regulatory mechanisms controlling Runx2 expression in osteosarcoma cells must balance Runx2 protein levels to promote its putative oncogenic functions, while avoiding suppression of bone tumor growth. PMID:22949168

  15. Human Immunodeficiency Virus Type 1 Nef Inhibits Autophagy through Transcription Factor EB Sequestration.

    PubMed

    Campbell, Grant R; Rawat, Pratima; Bruckman, Rachel S; Spector, Stephen A

    2015-06-01

    HIV Nef acts as an anti-autophagic maturation factor through interaction with beclin-1 (BECN1). We report that exposure of macrophages to infectious or non-infectious purified HIV induces toll-like receptor 8 (TLR8) and BECN1 dependent dephosphorylation and nuclear translocation of TFEB and that this correlates with an increase in autophagy markers. RNA interference for ATG13, TFEB, TLR8, or BECN1 inhibits this HIV-induced autophagy. However, once HIV establishes a productive infection, TFEB phosphorylation and cytoplasmic sequestration are increased resulting in decreased autophagy markers. Moreover, by 7 d post-infection, autophagy levels are similar to mock infected controls. Conversely, although Nef deleted HIV similarly induces TFEB dephosphorylation and nuclear localization, and increases autophagy, these levels remain elevated during continued productive infection. Thus, the interaction between HIV and TLR8 serves as a signal for autophagy induction that is dependent upon the dephosphorylation and nuclear translocation of TFEB. During permissive infection, Nef binds BECN1 resulting in mammalian target of rapamycin (MTOR) activation, TFEB phosphorylation and cytosolic sequestration, and the inhibition of autophagy. To our knowledge, this is the first report of a virus modulating TFEB localization and helps to explain how HIV modulates autophagy to promote its own replication and cell survival. PMID:26115100

  16. Human Immunodeficiency Virus Type 1 Nef Inhibits Autophagy through Transcription Factor EB Sequestration

    PubMed Central

    Campbell, Grant R.; Rawat, Pratima; Bruckman, Rachel S.; Spector, Stephen A.

    2015-01-01

    HIV Nef acts as an anti-autophagic maturation factor through interaction with beclin-1 (BECN1). We report that exposure of macrophages to infectious or non-infectious purified HIV induces toll-like receptor 8 (TLR8) and BECN1 dependent dephosphorylation and nuclear translocation of TFEB and that this correlates with an increase in autophagy markers. RNA interference for ATG13, TFEB, TLR8, or BECN1 inhibits this HIV-induced autophagy. However, once HIV establishes a productive infection, TFEB phosphorylation and cytoplasmic sequestration are increased resulting in decreased autophagy markers. Moreover, by 7 d post-infection, autophagy levels are similar to mock infected controls. Conversely, although Nef deleted HIV similarly induces TFEB dephosphorylation and nuclear localization, and increases autophagy, these levels remain elevated during continued productive infection. Thus, the interaction between HIV and TLR8 serves as a signal for autophagy induction that is dependent upon the dephosphorylation and nuclear translocation of TFEB. During permissive infection, Nef binds BECN1 resulting in mammalian target of rapamycin (MTOR) activation, TFEB phosphorylation and cytosolic sequestration, and the inhibition of autophagy. To our knowledge, this is the first report of a virus modulating TFEB localization and helps to explain how HIV modulates autophagy to promote its own replication and cell survival. PMID:26115100

  17. DIFFERENTIAL TRANSCRIPTION FACTOR ACTIVATION AD GENE EXPRESSION PROFILES IN HUMAN VASCULAR ENDOTHELIAL CELLS ON EXPOSURE TO RESIDUAL OIL FLY ASH (ROFA) AND VANADIUM

    EPA Science Inventory


    Differential transcription factor activation and gene expression profiles in human vascular endothelial cells on exposure to residual oil fly ash (ROFA) and vanadium.
    Srikanth S. Nadadur and Daniel L. Costa, US EPA, ORD, NHEERL (ETD, Pulmonary Toxicology Branch), Research ...

  18. Transcription factor-based biosensor

    SciTech Connect

    Dietrich, Jeffrey A; Keasling, Jay D

    2013-10-08

    The present invention provides for a system comprising a BmoR transcription factor, a .sigma..sup.54-RNA polymerase, and a pBMO promoter operatively linked to a reporter gene, wherein the pBMO promoter is capable of expression of the reporter gene with an activated form of the BmoR and the .sigma..sup.54-RNA polymerase.

  19. An epitope tag derived from human transcription factor IIB that reacts with a polyol-responsive monoclonal antibody.

    PubMed

    Duellman, Sarah J; Thompson, Nancy E; Burgess, Richard R

    2004-05-01

    Polyol-responsive monoclonal antibodies (PR-mAbs) provide a strategy to purify active, nondenatured proteins by a single-step immunoaffinity chromatography procedure. The high affinity interaction between these antibodies and the antigen can be dissociated in the presence of a nonchaotropic salt and a low molecular weight polyhydroxylated compound (polyol). The epitope for PR-mAb IIB8 is located near the N-terminus of the human transcription factor IIB (TFIIB). The epitope is an eight amino acid sequence, TKDPSRVG, that can be fused to a desired protein for use as a purification tag. This epitope tag (termed hIIB) was fused to the C-terminus of green fluorescent protein (GFP). An additional GFP fusion protein utilized another version of hIIB containing a point mutation at position two. These fusion proteins, expressed in Escherichia coli, allowed successful separation of the desired protein in a single chromatographic step. This strategy extends PR-mAb gentle-release purification to numerous expressed proteins. PMID:15039078

  20. Functional delineation and differentiation dynamics of human CD4+ T cells expressing the FoxP3 transcription factor.

    PubMed

    Miyara, Makoto; Yoshioka, Yumiko; Kitoh, Akihiko; Shima, Tomoko; Wing, Kajsa; Niwa, Akira; Parizot, Christophe; Taflin, Cécile; Heike, Toshio; Valeyre, Dominique; Mathian, Alexis; Nakahata, Tatsutoshi; Yamaguchi, Tomoyuki; Nomura, Takashi; Ono, Masahiro; Amoura, Zahir; Gorochov, Guy; Sakaguchi, Shimon

    2009-06-19

    FoxP3 is a key transcription factor for the development and function of natural CD4(+) regulatory T cells (Treg cells). Here we show that human FoxP3(+)CD4(+) T cells were composed of three phenotypically and functionally distinct subpopulations: CD45RA(+)FoxP3(lo) resting Treg cells (rTreg cells) and CD45RA(-)FoxP3(hi) activated Treg cells (aTreg cells), both of which were suppressive in vitro, and cytokine-secreting CD45RA(-)FoxP3(lo) nonsuppressive T cells. The proportion of the three subpopulations differed between cord blood, aged individuals, and patients with immunological diseases. Terminally differentiated aTreg cells rapidly died whereas rTreg cells proliferated and converted into aTreg cells in vitro and in vivo. This was shown by the transfer of rTreg cells into NOD-scid-common gamma-chain-deficient mice and by TCR sequence-based T cell clonotype tracing in peripheral blood in a normal individual. Taken together, the dissection of FoxP3(+) cells into subsets enables one to analyze Treg cell differentiation dynamics and interactions in normal and disease states, and to control immune responses through manipulating particular FoxP3(+) subpopulations. PMID:19464196

  1. Probing Zn2+-binding effects on the zinc-ribbon domain of human general transcription factor TFIIB.

    PubMed Central

    Ghosh, Mahua; Elsby, Laura M; Mal, Tapas K; Gooding, Jane M; Roberts, Stefan G E; Ikura, Mitsuhiko

    2004-01-01

    The general transcription factor, TFIIB, plays an important role in the assembly of the pre-initiation complex. The N-terminal domain (NTD) of TFIIB contains a zinc-ribbon motif, which is responsible for the recruitment of RNA polymerase II and TFIIF to the core promoter region. Although zinc-ribbon motif structures of eukaryotic and archaeal TFIIBs have been reported previously, the structural role of Zn2 binding to TFIIB remains to be determined. In the present paper, we report NMR and biochemical studies of human TFIIB NTD, which characterize the structure and dynamics of the TFIIB Zn2-binding domain in both Zn2-bound and -free states. The NMR data show that, whereas the backbone fold of NTD is pre-formed in the apo state, Zn2 binding reduces backbone mobility in the b-turn (Arg28-Gly30), induces enhanced structural rigidity of the charged-cluster domain in the central linker region of TFIIB and appends a positive surface charge within the Zn2-binding site. V8 protease-sensitivity assays of full-length TFIIB support the Zn2-dependent structural changes. These structural effects of Zn2 binding on TFIIB may have a critical role in interactions with its binding partners, such as the Rpb1 subunit of RNA polymerase II. PMID:14641108

  2. A Murine Uterine Transcriptome, Responsive to Steroid Receptor Coactivator-2, Reveals Transcription Factor 23 as Essential for Decidualization of Human Endometrial Stromal Cells1

    PubMed Central

    Kommagani, Ramakrishna; Szwarc, Maria M.; Kovanci, Ertug; Creighton, Chad J.; O'Malley, Bert W.; DeMayo, Francesco J.; Lydon, John P.

    2014-01-01

    ABSTRACT Recent data from human and mouse studies strongly support an indispensable role for steroid receptor coactivator-2 (SRC-2)—a member of the p160/SRC family of coregulators—in progesterone-dependent endometrial stromal cell decidualization, an essential cellular transformation process that regulates invasion of the developing embryo into the maternal compartment. To identify the key progesterone-induced transcriptional changes that are dependent on SRC-2 and required for endometrial decidualization, we performed comparative genome-wide transcriptional profiling of endometrial tissue RNA from ovariectomized SRC-2flox/flox (SRC-2f/f [control]) and PRcre/+/SRC-2flox/flox (SRC-2d/d [SRC-2-depleted]) mice, acutely treated with vehicle or progesterone. Although data mining revealed that only a small subset of the total progesterone-dependent transcriptional changes is dependent on SRC-2 (∼13%), key genes previously reported to mediate progesterone-driven endometrial stromal cell decidualization are present within this subset. Along with providing a more detailed molecular portrait of the decidual transcriptional program governed by SRC-2, the degree of functional diversity of these progesterone mediators underscores the pleiotropic regulatory role of SRC-2 in this tissue. To showcase the utility of this powerful informational resource to uncover novel signaling paradigms, we stratified the total SRC-2-dependent subset of progesterone-induced transcriptional changes in terms of novel gene expression and identified transcription factor 23 (Tcf23), a basic-helix-loop-helix transcription factor, as a new progesterone-induced target gene that requires SRC-2 for full induction. Importantly, using primary human endometrial stromal cells in culture, we demonstrate that TCF23 function is essential for progesterone-dependent decidualization, providing crucial translational support for this transcription factor as a new decidual mediator of progesterone action. PMID

  3. CREB, ATF, and AP-1 transcription factors regulate IFN-gamma secretion by human T cells in response to mycobacterial antigen.

    PubMed

    Samten, Buka; Townsend, James C; Weis, Steven E; Bhoumik, Anindita; Klucar, Peter; Shams, Homayoun; Barnes, Peter F

    2008-08-01

    IFN-gamma production by T cells is pivotal for defense against many pathogens, and the proximal promoter of IFN-gamma, -73 to -48 bp upstream of the transcription start site, is essential for its expression. However, transcriptional regulation mechanisms through this promoter in primary human cells remain unclear. We studied the effects of cAMP response element binding protein/activating transcription factor (CREB/ATF) and AP-1 transcription factors on the proximal promoter of IFN-gamma in human T cells stimulated with Mycobacterium tuberculosis. Using EMSA, supershift assays, and promoter pulldown assays, we demonstrated that CREB, ATF-2, and c-Jun, but not cyclic AMP response element modulator, ATF-1, or c-Fos, bind to the proximal promoter of IFN-gamma upon stimulation, and coimmunoprecipitation indicated the possibility of interaction among these transcription factors. Chromatin immunoprecipitation confirmed the recruitment of these transcription factors to the IFN-gamma proximal promoter in live Ag-activated T cells. Inhibition of ATF-2 activity in T cells with a dominant-negative ATF-2 peptide or with small interfering RNA markedly reduced the expression of IFN-gamma and decreased the expression of CREB and c-Jun. These findings suggest that CREB, ATF-2, and c-Jun are recruited to the IFN-gamma proximal promoter and that they up-regulate IFN-gamma transcription in response to microbial Ag. Additionally, ATF-2 controls expression of CREB and c-Jun during T cell activation. PMID:18641343

  4. TATA-binding protein and transcription factor IIB induce transcript slipping during early transcription by RNA polymerase II.

    PubMed

    Gilman, Benjamin; Drullinger, Linda F; Kugel, Jennifer F; Goodrich, James A

    2009-04-01

    To better understand the mechanism of steps in early transcription by RNA polymerase II (pol II), we investigated the molecular determinants of transcript slipping within complexes assembled on promoters containing a pre-melted transcription bubble from -9 to +3. Transcript slippage occurs when an RNA transcript contains a repetitive sequence that allows the transcript to slip back and pair with the template strand of the DNA at a new register before transcription continues. We established the contributions of individual transcription factors, DNA elements, and RNA length to slipping on a heteroduplex template using a highly purified human pol II transcription system. We found that transcripts slip at a very defined point in the transcription reaction, after pol II completes phosphodiester bond synthesis at register +5. This point is set by the position of the polymerase active site on the DNA template, as opposed to the length of the transcript, as well as by a repetitive CUCU sequence that must occur from +2 to +5. Interestingly, slipping at this juncture is induced by TATA-binding protein and transcription factor IIB and requires a TATA box but not a transcription factor IIB recognition sequence. We propose a model in which transcribing complexes, upon completing phosphodiester bond synthesis at register +5, enter one of two branches in which they either complete productive synthesis of the transcript or undergo multiple rounds of transcript slipping. PMID:19193635

  5. Glucocorticoids facilitate the transcription from the human cytomegalovirus major immediate early promoter in glucocorticoid receptor- and nuclear factor-I-like protein-dependent manner

    SciTech Connect

    Inoue-Toyoda, Maki; Kato, Kohsuke; Nagata, Kyosuke; Yoshikawa, Hiroyuki

    2015-02-27

    Human cytomegalovirus (HCMV) is a common and usually asymptomatic virus agent in healthy individuals. Initiation of HCMV productive infection depends on expression of the major immediate early (MIE) genes. The transcription of HCMV MIE genes is regulated by a diverse set of transcription factors. It was previously reported that productive HCMV infection is triggered probably by elevation of the plasma hydroxycorticoid level. However, it is poorly understood whether the transcription of MIE genes is directly regulated by glucocorticoid. Here, we found that the dexamethasone (DEX), a synthetic glucocorticoid, facilitates the transcription of HCMV MIE genes through the MIE promoter and enhancer in a glucocorticoid receptor (GR)-dependent manner. By competitive EMSA and reporter assays, we revealed that an NF-I like protein is involved in DEX-mediated transcriptional activation of the MIE promoter. Thus, this study supports a notion that the increased level of hydroxycorticoid in the third trimester of pregnancy reactivates HCMV virus production from the latent state. - Highlights: • DEX facilitates the transcription from the HCMV MIE promoter. • GR is involved in DEX-dependent transcription from the HCMV MIE promoter. • A 17 bp repeat is responsible for the HCMV MIE promoter activation by DEX. • An NF-I-like protein is involved in the HCMV MIE promoter activation by DEX.

  6. Identification of cis-acting sequences responsible for phorbol ester induction of human serum amyloid A gene expression via a nuclear factor kB-like transcription factor

    SciTech Connect

    Edbrooke, M.R.; Cheshire, J.K.; Woo, P.; Burt, B.W.

    1989-05-01

    The authors have analyzed the 5'-flanking region of one of the genes coding for the human acute-phase protein, serum amyloid A (SAA). They found that SAA mRNA could be increased fivefold in transfected cells by treatment with phorbol 12-myristate 13-acetate (PMA). To analyze this observation further, they placed a 265-base-pair 5' SAA fragment upstream of the reporter chloramphenicol acetyltransferase (CAT) gene and transfected this construct into HeLa cells. PMA treatment of these transient transfectants resulted in increased CAT expression. Nuclear proteins from PMA-treated HeLa cells bound to this DNA fragment, and methylation interference analysis showed that the binding was specific to the sequence GGGACTTTCC (between -82 and -91), a sequence previously described by others as the binding site for the nuclear factor NF/kappa/B. In a cotransfection competition experiment, they could abolish PMA-induced CAT activity by using cloned human immunodeficiency virus long-terminal-repeat DNA containing the NF/kappa/B-binding sequence. The same long-terminal-repeat DNA containing mutant NF/kappa/B-binding sequences did not affect CAT expression, which suggested that binding by an NF/kappa/B-like factor is required for increased SAA transcription.

  7. RbAp48, a novel inhibitory factor that regulates the transcription of human immunodeficiency virus type 1.

    PubMed

    Wang, Juan; Yang, Jin; Yang, Zongxing; Lu, Xiangyun; Jin, Changzhong; Cheng, Linfang; Wu, Nanping

    2016-07-01

    Retinoblastoma binding protein 4 (RbAp48) is a histone chaperone which has been suggested to play a role in gene silencing. However, the role of RbAp48 in human immunodeficiency virus type 1 (HIV-1) infection and gene replication has not been determined to date, to the best of our knowledge. For this purpose, we demonstrated in the present study that RbAp48 expression was upregulated by HIV-1 infection, whereas the knockdown of RbAp48 promoted HIV infection and the production of virus particles. The ectopic expression of RbAp48 inhibited HIV-1 expression, and this inhibition correlated with a marked decrease in the expression of HIV-1 genomic RNA and various RNA transcripts. Further experiments to determine the mechanism responsible for the inhibitory effects of RbAp48 revealed that the ectopic expression of RbAp48 repressed HIV-1 long terminal repeat (LTR)-mediated basal transcription as well as TNF-α- and phorbol 12-myristate 13-acetate (PMA)‑activated transcription. Furthermore, the results of the electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) analysis revealed that RbAp48 binds to the HIV-1 LTR in vitro. Taken together, these findings demonstrate that, as a transcriptional cofactor, RbAp48 is likely to act as a potent antiretroviral defense. PMID:27222146

  8. Polyphenol Compound as a Transcription Factor Inhibitor.

    PubMed

    Park, Seyeon

    2015-11-01

    A target-based approach has been used to develop novel drugs in many therapeutic fields. In the final stage of intracellular signaling, transcription factor-DNA interactions are central to most biological processes and therefore represent a large and important class of targets for human therapeutics. Thus, we focused on the idea that the disruption of protein dimers and cognate DNA complexes could impair the transcriptional activation and cell transformation regulated by these proteins. Historically, natural products have been regarded as providing the primary leading compounds capable of modulating protein-protein or protein-DNA interactions. Although their mechanism of action is not fully defined, polyphenols including flavonoids were found to act mostly as site-directed small molecule inhibitors on signaling. There are many reports in the literature of screening initiatives suggesting improved drugs that can modulate the transcription factor interactions responsible for disease. In this review, we focus on polyphenol compound inhibitors against dimeric forms of transcription factor components of intracellular signaling pathways (for instance, c-jun/c-fos (Activator Protein-1; AP-1), c-myc/max, Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and β-catenin/T cell factor (Tcf)). PMID:26529010

  9. Human Genes Encoding Transcription Factors and Chromatin-Modifying Proteins Have Low Levels of Promoter Polymorphism: A Study of 1000 Genomes Project Data

    PubMed Central

    Ignatieva, Elena V.; Levitsky, Victor G.; Kolchanov, Nikolay A.

    2015-01-01

    The expression level of each gene is controlled by its regulatory regions, which determine the precise regulation in a tissue-specific manner, according to the developmental stage of the body and the necessity of a response to external stimuli. Nucleotide substitutions in regulatory gene regions may modify the affinity of transcription factors to their specific DNA binding sites, affecting the transcription rates of genes. In our previous research, we found that genes controlling the sensory perception of smell and genes involved in antigen processing and presentation were overrepresented significantly among genes with high SNP contents in their promoter regions. The goal of our study was to reveal functional features of human genes containing extremely small numbers of SNPs in promoter regions. Two functional groups were found to be overrepresented among genes whose promoters did not contain SNPs: (1) genes involved in gene-specific transcription and (2) genes controlling chromatin organization. We revealed that the 5′-regulatory regions of genes encoding transcription factors and chromatin-modifying proteins were characterized by reduced genetic variability. One important exception from this rule refers to genes encoding transcription factors with zinc-coordinating DNA-binding domains (DBDs), which underwent extensive expansion in vertebrates, particularly, in primate evolution. Hence, we obtained new evidence for evolutionary forces shaping variability in 5′-regulatory regions of genes. PMID:26417590

  10. Estrogen induced concentration dependent differential gene expression in human breast cancer (MCF7) cells: Role of transcription factors

    SciTech Connect

    Chandrasekharan, Sabarinath; Kandasamy, Krishna Kumar; Dayalan, Pavithra; Ramamurthy, Viraragavan

    2013-08-02

    Highlights: •Estradiol (E2) at low dose induced cell proliferation in breast cancer cells. •E2 at high concentration induced cell stress in breast cancer cells. •Estrogen receptor physically interacts only with a few transcription factors. •Differential expression of genes with Oct-1 binding sites increased under stress. •Transcription factor binding sites showed distinct spatial distribution on genes. -- Abstract: Background: Breast cancer cells respond to estrogen in a concentration dependent fashion, resulting in proliferation or apoptosis. The mechanism of this concentration dependent differential outcome is not well understood yet. Methodology: Meta-analysis of the expression data of MCF7 cells treated with low (1 nM) or high (100 nM) dose of estradiol (E2) was performed. We identified genes differentially expressed at the low or the high dose, and examined the nature of regulatory elements in the vicinity of these genes. Specifically, we looked for the difference in the presence, abundance and spatial distribution of binding sites for estrogen receptor (ER) and selected transcription factors (TFs) in the genomic region up to 25 kb upstream and downstream from the transcription start site (TSS) of these genes. Results: It was observed that at high dose E2 induced the expression of stress responsive genes, while at low dose, genes involved in cell cycle were induced. We found that the occurrence of transcription factor binding regions (TFBRs) for certain factors such as Sp1 and SREBP1 were higher on regulatory regions of genes expressed at low dose. At high concentration of E2, genes with a higher frequency of Oct-1 binding regions were predominantly involved. In addition, there were differences in the spatial distribution pattern of the TFBRs in the genomic regions among the two sets of genes. Discussion: E2 induced predominantly proliferative/metabolic response at low concentrations; but at high concentration, stress–rescue responses were induced

  11. Transcriptional gene silencing in humans.

    PubMed

    Weinberg, Marc S; Morris, Kevin V

    2016-08-19

    It has been over a decade since the first observation that small non-coding RNAs can functionally modulate epigenetic states in human cells to achieve functional transcriptional gene silencing (TGS). TGS is mechanistically distinct from the RNA interference (RNAi) gene-silencing pathway. TGS can result in long-term stable epigenetic modifications to gene expression that can be passed on to daughter cells during cell division, whereas RNAi does not. Early studies of TGS have been largely overlooked, overshadowed by subsequent discoveries of small RNA-directed post-TGS and RNAi. A reappraisal of early work has been brought about by recent findings in human cells where endogenous long non-coding RNAs function to regulate the epigenome. There are distinct and common overlaps between the proteins involved in small and long non-coding RNA transcriptional regulatory mechanisms, suggesting that the early studies using small non-coding RNAs to modulate transcription were making use of a previously unrecognized endogenous mechanism of RNA-directed gene regulation. Here we review how non-coding RNA plays a role in regulation of transcription and epigenetic gene silencing in human cells by revisiting these earlier studies and the mechanistic insights gained to date. We also provide a list of mammalian genes that have been shown to be transcriptionally regulated by non-coding RNAs. Lastly, we explore how TGS may serve as the basis for development of future therapeutic agents. PMID:27060137

  12. Activation of transcription factor AP-2 mediates UVA radiation- and singlet oxygen-induced expression of the human intercellular adhesion molecule 1 gene

    SciTech Connect

    Grether-Beck, S.; Olaizola-Horn, S.; Schmitt, H.; Grewe, M.

    1996-12-10

    UVA radiation is the major component of the UV solar spectrum that reaches the earth, and the therapeutic application of UVA radiation is increasing in medicine. Analysis of the cellular effects of UVA radiation has revealed that exposure of human cells to UVA radiation at physiological doses leads to increased gene expression and that this UVA response is primarily mediated through the generation of singlet oxygen. In this study, the mechanisms by which UVA radiation induces transcriptional activation of the human intercellular adhesion molecule 1 (ICAM-1) were examined. UVA radiation was capable of inducing activation of the human ICAM-1 promoter and increasing OCAM-1 mRNA and protein expression. These UVA radiation effects were inhibited by singlet oxygen quenchers, augmented by enhancement of singlet oxygen life-time, and mimicked in unirradiated cells by a singlet oxygen-generating system. UVA radiation as well as singlet oxygen-induced ICAM-1 promoter activation required activation of the transcription factor AP-2. Accordingly, both stimuli activated AP-2, and deletion of the putative AP-2-binding site abrogated ICAM-1 promoter activation in this system. This study identified the AP-2 site as the UVA radiation- and singlet oxygen-responsive element of the human ICAM-1 gene. The capacity of UVA radiation and/or singlet oxygen to induce human gene expression through activation of AP-2 indicates a previously unrecognized role of this transcription factor in the mammalian stress response. 38 refs., 3 figs., 3 tabs.

  13. Polyphenol Compound as a Transcription Factor Inhibitor

    PubMed Central

    Park, Seyeon

    2015-01-01

    A target-based approach has been used to develop novel drugs in many therapeutic fields. In the final stage of intracellular signaling, transcription factor–DNA interactions are central to most biological processes and therefore represent a large and important class of targets for human therapeutics. Thus, we focused on the idea that the disruption of protein dimers and cognate DNA complexes could impair the transcriptional activation and cell transformation regulated by these proteins. Historically, natural products have been regarded as providing the primary leading compounds capable of modulating protein–protein or protein-DNA interactions. Although their mechanism of action is not fully defined, polyphenols including flavonoids were found to act mostly as site-directed small molecule inhibitors on signaling. There are many reports in the literature of screening initiatives suggesting improved drugs that can modulate the transcription factor interactions responsible for disease. In this review, we focus on polyphenol compound inhibitors against dimeric forms of transcription factor components of intracellular signaling pathways (for instance, c-jun/c-fos (Activator Protein-1; AP-1), c-myc/max, Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and β-catenin/T cell factor (Tcf)). PMID:26529010

  14. β-Catenin-Independent Activation of TCF1/LEF1 in Human Hematopoietic Tumor Cells through Interaction with ATF2 Transcription Factors

    PubMed Central

    Grumolato, Luca; Liu, Guizhong; Haremaki, Tomomi; Mungamuri, Sathish Kumar; Mong, Phyllus; Akiri, Gal; Lopez-Bergami, Pablo; Arita, Adriana; Anouar, Youssef; Mlodzik, Marek; Ronai, Ze'ev A.; Brody, Joshua; Weinstein, Daniel C.; Aaronson, Stuart A.

    2013-01-01

    The role of Wnt signaling in embryonic development and stem cell maintenance is well established and aberrations leading to the constitutive up-regulation of this pathway are frequent in several types of human cancers. Upon ligand-mediated activation, Wnt receptors promote the stabilization of β-catenin, which translocates to the nucleus and binds to the T-cell factor/lymphoid enhancer factor (TCF/LEF) family of transcription factors to regulate the expression of Wnt target genes. When not bound to β-catenin, the TCF/LEF proteins are believed to act as transcriptional repressors. Using a specific lentiviral reporter, we identified hematopoietic tumor cells displaying constitutive TCF/LEF transcriptional activation in the absence of β-catenin stabilization. Suppression of TCF/LEF activity in these cells mediated by an inducible dominant-negative TCF4 (DN-TCF4) inhibited both cell growth and the expression of Wnt target genes. Further, expression of TCF1 and LEF1, but not TCF4, stimulated TCF/LEF reporter activity in certain human cell lines independently of β-catenin. By a complementary approach in vivo, TCF1 mutants, which lacked the ability to bind to β-catenin, induced Xenopus embryo axis duplication, a hallmark of Wnt activation, and the expression of the Wnt target gene Xnr3. Through generation of different TCF1-TCF4 fusion proteins, we identified three distinct TCF1 domains that participate in the β-catenin-independent activity of this transcription factor. TCF1 and LEF1 physically interacted and functionally synergized with members of the activating transcription factor 2 (ATF2) family of transcription factors. Moreover, knockdown of ATF2 expression in lymphoma cells phenocopied the inhibitory effects of DN-TCF4 on the expression of target genes associated with the Wnt pathway and on cell growth. Together, our findings indicate that, through interaction with ATF2 factors, TCF1/LEF1 promote the growth of hematopoietic malignancies in the absence of

  15. Identification of cis-regulatory modules in promoters of human genes exploiting mutual positioning of transcription factors

    PubMed Central

    Nandi, Soumyadeep; Blais, Alexandre; Ioshikhes, Ilya

    2013-01-01

    In higher organisms, gene regulation is controlled by the interplay of non-random combinations of multiple transcription factors (TFs). Although numerous attempts have been made to identify these combinations, important details, such as mutual positioning of the factors that have an important role in the TF interplay, are still missing. The goal of the present work is in silico mapping of some of such associating factors based on their mutual positioning, using computational screening. We have selected the process of myogenesis as a study case, and we focused on TF combinations involving master myogenic TF Myogenic differentiation (MyoD) with other factors situated at specific distances from it. The results of our work show that some muscle-specific factors occur together with MyoD within the range of ±100 bp in a large number of promoters. We confirm co-occurrence of the MyoD with muscle-specific factors as described in earlier studies. However, we have also found novel relationships of MyoD with other factors not specific for muscle. Additionally, we have observed that MyoD tends to associate with different factors in proximal and distal promoter areas. The major outcome of our study is establishing the genome-wide connection between biological interactions of TFs and close co-occurrence of their binding sites. PMID:23913413

  16. Nuclear respiratory factor 2 induces the expression of many but not all human proteins acting in mitochondrial DNA transcription and replication.

    PubMed

    Bruni, Francesco; Polosa, Paola Loguercio; Gadaleta, Maria Nicola; Cantatore, Palmiro; Roberti, Marina

    2010-02-01

    In mammals, NRF-2 (nuclear respiratory factor 2), also named GA-binding protein, is an Ets family transcription factor that controls many genes involved in cell cycle progression and protein synthesis as well as in mitochondrial biogenesis. In this paper, we analyzed the role of NRF-2 in the regulation of human genes involved in mitochondrial DNA transcription and replication. By a combination of bioinformatic and biochemical approaches, we found that the factor binds in vitro and in vivo to the proximal promoter region of the genes coding for the transcription termination factor mTERF, the RNA polymerase POLRMT, the B subunit of the DNA polymerase-gamma, the DNA helicase TWINKLE, and the single-stranded DNA-binding protein mtSSB. The role of NRF-2 in modulating the expression of those genes was further established by RNA interference and overexpression strategies. On the contrary, we found that NRF-2 does not control the genes for the subunit A of DNA polymerase-gamma and for the transcription repressor MTERF3; we suggest that these genes are under regulatory mechanisms that do not involve NRF proteins. Since NRFs are known to positively control the expression of transcription-activating proteins, the novelty emerging from our data is that proteins playing antithetical roles in mitochondrial DNA transcription, namely activators and repressors, are under different regulatory pathways. Finally, we developed a more stringent consensus with respect to the general consensus of NRF-2/GA-binding protein when searching for NRF-2 binding sites in the promoter of mitochondrial proteins. PMID:19951946

  17. Transcription factors of Lotus: regulation of isoflavonoid biosynthesis requires coordinated changes in transcription factor activity.

    PubMed

    Shelton, Dale; Stranne, Maria; Mikkelsen, Lisbeth; Pakseresht, Nima; Welham, Tracey; Hiraka, Hideki; Tabata, Satoshi; Sato, Shusei; Paquette, Suzanne; Wang, Trevor L; Martin, Cathie; Bailey, Paul

    2012-06-01

    Isoflavonoids are a class of phenylpropanoids made by legumes, and consumption of dietary isoflavonoids confers benefits to human health. Our aim is to understand the regulation of isoflavonoid biosynthesis. Many studies have shown the importance of transcription factors in regulating the transcription of one or more genes encoding enzymes in phenylpropanoid metabolism. In this study, we coupled bioinformatics and coexpression analysis to identify candidate genes encoding transcription factors involved in regulating isoflavonoid biosynthesis in Lotus (Lotus japonicus). Genes encoding proteins belonging to 39 of the main transcription factor families were examined by microarray analysis of RNA from leaf tissue that had been elicited with glutathione. Phylogenetic analyses of each transcription factor family were used to identify subgroups of proteins that were specific to L. japonicus or closely related to known regulators of the phenylpropanoid pathway in other species. R2R3MYB subgroup 2 genes showed increased expression after treatment with glutathione. One member of this subgroup, LjMYB14, was constitutively overexpressed in L. japonicus and induced the expression of at least 12 genes that encoded enzymes in the general phenylpropanoid and isoflavonoid pathways. A distinct set of six R2R3MYB subgroup 2-like genes was identified. We suggest that these subgroup 2 sister group proteins and those belonging to the main subgroup 2 have roles in inducing isoflavonoid biosynthesis. The induction of isoflavonoid production in L. japonicus also involves the coordinated down-regulation of competing biosynthetic pathways by changing the expression of other transcription factors. PMID:22529285

  18. N-Myc regulates a widespread euchromatic program in the human genome partially independent of its role as a classical transcription factor

    PubMed Central

    Cotterman, Rebecca; Jin, Victor X.; Krig, Sheryl R.; Lemen, Jessica M.; Wey, Alice; Farnham, Peggy J.; Knoepfler, Paul S.

    2009-01-01

    Myc proteins have long been modeled to operate strictly as classical gene specific transcription factors, however we find that N-Myc has a robust role in the human genome in regulating global cellular euchromatin including that of intergenic regions. Strikingly, 90–95% of the total genomic euchromatic marks histone H3 acetylated at lysine 9 and methylated at lysine 4 is N-Myc dependent. However, Myc regulation of transcription, even of genes it directly binds and at which it is required for maintenance of active chromatin, is generally weak. Thus, Myc has a much more potent ability to regulate large domains of euchromatin than to influence transcription of individual genes. Overall, Myc regulation of chromatin in the human genome includes both specific genes, but also expansive genomic domains that invoke functions independent of a classical transcription factor. These findings support a new dual model for Myc chromatin function with important implications for the role of Myc in cancer and stem cell biology, including that of induced pluripotent stem (iPS) cells. PMID:19047142

  19. c-ETS transcription factors play an essential role in the licensing of human MCM4 origin of replication.

    PubMed

    Sidhu, Kaveri; Kumar, Vijay

    2015-11-01

    In metazoans, DNA replication is a highly regulated and ordered process that occurs during the S phase of cell cycle. It begins with the licensing of origins of replication usually found in close proximity of actively transcribing genes owing perhaps to a profound influence of transcription factors on the epigenetic signatures and architecture of chromatin. Here we show that ETS transcription factors are novel regulators of MCM4 origin, whose binding sites are localized between two divergently transcribing MCM4 and PRKDC genes. c-ETS1 and c-ETS2 were recruited to the MCM4 origin respectively during the S and G1 phases of cell cycle. c-ETS2 binding was facilitated by an active chromatin distinguished by acetylated histone H3 orchestrated by histone acetyl transferase GCN5 and followed by HBO1 mediated histone H4 acetylation. Interestingly, c-ETS2 overexpression led to increased BrdU incorporation in the S phase cells while its down-regulation by RNA interference compromised the loading of pre-replicative complex at the origin. Conversely, the recruitment of c-ETS1 at the origin coincided with histone H3 methylation signature characteristic of closed chromatin conformation. As expected, enforced expression of c-ETS1 severely compromised DNA replication whereas its down-regulation enhanced DNA replication as evident from increased BrdU incorporation. Thus, c-ETS transcription factors appear to be key regulators of MCM4 origin where c-ETS2 seems to promote DNA replication whereas c-ETS1 functions as a negative regulator. PMID:26365772

  20. A Role for the Transcription Factor Nk2 Homeobox 1 in Schizophrenia: Convergent Evidence from Animal and Human Studies.

    PubMed

    Malt, Eva A; Juhasz, Katalin; Malt, Ulrik F; Naumann, Thomas

    2016-01-01

    Schizophrenia is a highly heritable disorder with diverse mental and somatic symptoms. The molecular mechanisms leading from genes to disease pathology in schizophrenia remain largely unknown. Genome-wide association studies (GWASs) have shown that common single-nucleotide polymorphisms associated with specific diseases are enriched in the recognition sequences of transcription factors that regulate physiological processes relevant to the disease. We have used a "bottom-up" approach and tracked a developmental trajectory from embryology to physiological processes and behavior and recognized that the transcription factor NK2 homeobox 1 (NKX2-1) possesses properties of particular interest for schizophrenia. NKX2-1 is selectively expressed from prenatal development to adulthood in the brain, thyroid gland, parathyroid gland, lungs, skin, and enteric ganglia, and has key functions at the interface of the brain, the endocrine-, and the immune system. In the developing brain, NKX2-1-expressing progenitor cells differentiate into distinct subclasses of forebrain GABAergic and cholinergic neurons, astrocytes, and oligodendrocytes. The transcription factor is highly expressed in mature limbic circuits related to context-dependent goal-directed patterns of behavior, social interaction and reproduction, fear responses, responses to light, and other homeostatic processes. It is essential for development and mature function of the thyroid gland and the respiratory system, and is involved in calcium metabolism and immune responses. NKX2-1 interacts with a number of genes identified as susceptibility genes for schizophrenia. We suggest that NKX2-1 may lie at the core of several dose dependent pathways that are dysregulated in schizophrenia. We correlate the symptoms seen in schizophrenia with the temporal and spatial activities of NKX2-1 in order to highlight promising future research areas. PMID:27064909

  1. A Role for the Transcription Factor Nk2 Homeobox 1 in Schizophrenia: Convergent Evidence from Animal and Human Studies

    PubMed Central

    Malt, Eva A.; Juhasz, Katalin; Malt, Ulrik F.; Naumann, Thomas

    2016-01-01

    Schizophrenia is a highly heritable disorder with diverse mental and somatic symptoms. The molecular mechanisms leading from genes to disease pathology in schizophrenia remain largely unknown. Genome-wide association studies (GWASs) have shown that common single-nucleotide polymorphisms associated with specific diseases are enriched in the recognition sequences of transcription factors that regulate physiological processes relevant to the disease. We have used a “bottom-up” approach and tracked a developmental trajectory from embryology to physiological processes and behavior and recognized that the transcription factor NK2 homeobox 1 (NKX2-1) possesses properties of particular interest for schizophrenia. NKX2-1 is selectively expressed from prenatal development to adulthood in the brain, thyroid gland, parathyroid gland, lungs, skin, and enteric ganglia, and has key functions at the interface of the brain, the endocrine-, and the immune system. In the developing brain, NKX2-1-expressing progenitor cells differentiate into distinct subclasses of forebrain GABAergic and cholinergic neurons, astrocytes, and oligodendrocytes. The transcription factor is highly expressed in mature limbic circuits related to context-dependent goal-directed patterns of behavior, social interaction and reproduction, fear responses, responses to light, and other homeostatic processes. It is essential for development and mature function of the thyroid gland and the respiratory system, and is involved in calcium metabolism and immune responses. NKX2-1 interacts with a number of genes identified as susceptibility genes for schizophrenia. We suggest that NKX2-1 may lie at the core of several dose dependent pathways that are dysregulated in schizophrenia. We correlate the symptoms seen in schizophrenia with the temporal and spatial activities of NKX2-1 in order to highlight promising future research areas. PMID:27064909

  2. Nuclear-encoded factors involved in post-transcriptional processing and modification of mitochondrial tRNAs in human disease

    PubMed Central

    Powell, Christopher A.; Nicholls, Thomas J.; Minczuk, Michal

    2015-01-01

    The human mitochondrial genome (mtDNA) encodes 22 tRNAs (mt-tRNAs) that are necessary for the intraorganellar translation of the 13 mtDNA-encoded subunits of the mitochondrial respiratory chain complexes. Maturation of mt-tRNAs involves 5′ and 3′ nucleolytic excision from precursor RNAs, as well as extensive post-transcriptional modifications. Recent data suggest that over 7% of all mt-tRNA residues in mammals undergo post-transcriptional modification, with over 30 different modified mt-tRNA positions so far described. These processing and modification steps are necessary for proper mt-tRNA function, and are performed by dedicated, nuclear-encoded enzymes. Recent growing evidence suggests that mutations in these nuclear genes (nDNA), leading to incorrect maturation of mt-tRNAs, are a cause of human mitochondrial disease. Furthermore, mtDNA mutations in mt-tRNA genes, which may also affect mt-tRNA function, processing, and modification, are also frequently associated with human disease. In theory, all pathogenic mt-tRNA variants should be expected to affect only a single process, which is mitochondrial translation, albeit to various extents. However, the clinical manifestations of mitochondrial disorders linked to mutations in mt-tRNAs are extremely heterogeneous, ranging from defects of a single tissue to complex multisystem disorders. This review focuses on the current knowledge of nDNA coding for proteins involved in mt-tRNA maturation that have been linked to human mitochondrial pathologies. We further discuss the possibility that tissue specific regulation of mt-tRNA modifying enzymes could play an important role in the clinical heterogeneity observed for mitochondrial diseases caused by mutations in mt-tRNA genes. PMID:25806043

  3. Zinc-finger transcription factors are associated with guanine quadruplex motifs in human, chimpanzee, mouse and rat promoters genome-wide

    PubMed Central

    Kumar, Pankaj; Yadav, Vinod Kumar; Baral, Aradhita; Kumar, Parveen; Saha, Dhurjhoti; Chowdhury, Shantanu

    2011-01-01

    Function of non-B DNA structures are poorly understood though several bioinformatics studies predict role of the G-quadruplex DNA structure in transcription. Earlier, using transcriptome profiling we found evidence of widespread G-quadruplex-mediated gene regulation. Herein, we asked whether potential G-quadruplex (PG4) motifs associate with transcription factors (TF). This was analyzed using 220 position weight matrices [designated as transcription factor binding sites (TFBS)], representing 187 unique TF, in >75 000 genes in human, chimpanzee, mouse and rat. Results show binding sites of nine TFs, including that of AP-2, SP1, MAZ and VDR, occurred significantly within 100 bases of the PG4 motif (P < 1.24E-10). PG4–TFBS combinations were conserved in ‘orthologously’ related promoters across all four organisms and were associated with >850 genes in each genome. Remarkably, seven of the nine TFs were zinc-finger binding proteins indicating a novel characteristic of PG4 motifs. To test these findings, transcriptome profiles from human cell lines treated with G-quadruplex-specific molecules were used; 66 genes were significantly differentially expressed across both cell-types, which also harbored conserved PG4 motifs along with one/more of the nine TFBS. In addition, genes regulated by PG4–TFBS combinations were found to be co-regulated in human tissues, further emphasizing the regulatory significance of the associations. PMID:21729868

  4. Triplex targeting of human PDGF-B (c-sis, proto-oncogene) promoter specifically inhibits factors binding and PDGF-B transcription

    PubMed Central

    Liu, Jing; Xu, Ren-Huan; Jin, You-Xin; Wang, De-Bao

    2001-01-01

    Human c-sis/PDGF-B proto-oncogene has been shown to be overexpressed in a large percentage of human tumor cells establishing a growth-promoting, autocrine growth circuit. Triplex forming oligonucleotides (TFOs) can recognize and bind sequences in duplex DNA, and have received considerable attention because of their potential for targeting specific genomic sites. The c-sis/PDGF-B promoter contains a unique homopurine/homopyrimidine sequence (SIS proximal element, SPE), which is crucial for binding nuclear factors that provoke transcription. In order to develop specific transcriptional inhibitors of the human c-sis/PDGF-B proto-oncogene, 20 potential TFOs targeting part or all of the SPE were screened by gel mobility analysis. DNase I footprinting shows that the TFOs we designed can form a sequence-specific triplex with the target. Protein binding assays demonstrate that triplex formation inhibits nuclear factors binding the c-sis/PDGF-B promoter. Both transient and stable transfection experiments demonstrate that the transcriptional activity of the promoter is considerably inhibited by the TFOs. We propose that TFOs represent a therapeutic potential to specifically diminish the expression of c-sis/PDGF-B proto-oncogene in various pathologic settings where constitutive expression of this gene has been observed. PMID:11160902

  5. Evolution of vertebrate E protein transcription factors: comparative analysis of the E protein gene family in Takifugu rubripes and humans.

    PubMed

    Hikima, Jun-ichi; Lennard, Mara L; Wilson, Melanie R; Miller, Norman W; Clem, L William; Warr, Gregory W

    2005-04-14

    E proteins are essential for B lymphocyte development and function, including immunoglobulin (Ig) gene rearrangement and expression. Previous studies of B cells in the channel catfish (Ictalurus punctatus) identified E protein homologs that are capable of binding the muE5 motif and driving a strong transcriptional response. There are three E protein genes in mammals, HEB (TCF12), E2A (TCF3), and E2-2 (TCF4). The major expressed E proteins found in catfish B cells are homologs of HEB and of E2A. Here we sought to define the complete family of E protein genes in a teleost fish, Takifugu rubripes, taking advantage of the completed genome sequence. The catfish CFEB (HEB homolog) sequence identified homologous E-protein-encoding sequences in five scaffolds in the Takifugu genome database. Detailed comparative analysis with the human genome revealed the presence of five E protein homologs in Takifugu. Single genes orthologous to HEB and to E2-2 were identified. In contrast, two members of the E2A gene family were identified in Takifugu; one of these shows the alternative processing of transcripts that identifies it as the ortholog of the E12/E47-encoding mammalian E2A gene, whereas the second Takifugu E2A gene has no predicted alternative splice products. A novel fifth E protein gene (EX) was identified in Takifugu. Phylogenetic analysis revealed four E protein branches among vertebrates: EX, E2A, HEB, and E2-2. PMID:15713784

  6. The Basic Helix-Loop-Helix Transcription Factor E47 Reprograms Human Pancreatic Cancer Cells to a Quiescent Acinar State With Reduced Tumorigenic Potential

    PubMed Central

    Kim, SangWun; Lahmy, Reyhaneh; Riha, Chelsea; Yang, Challeng; Jakubison, Brad L.; van Niekerk, Jaco; Staub, Claudio; Wu, Yifan; Gates, Keith; Dong, Duc Si; Konieczny, Stephen F.; Itkin-Ansari, Pamela

    2015-01-01

    Objectives Pancreatic ductal adenocarcinoma (PDA) initiates from quiescent acinar cells that attain a Kras mutation, lose signaling from basic helix-loop-helix (bHLH) transcription factors, undergo acinar-ductal metaplasia, and rapidly acquire increased growth potential. We queried whether PDA cells can be reprogrammed to revert to their original quiescent acinar cell state by shifting key transcription programs. Methods Human PDA cell lines were engineered to express an inducible form of the bHLH protein E47. Gene expression, growth, and functional studies were investigated using microarray, quantitative polymerase chain reaction, immunoblots, immunohistochemistry, small interfering RNA, chromatin immunoprecipitation analyses, and cell transplantation into mice. Results In human PDA cells, E47 activity triggers stable G0/G1 arrest, which requires the cyclin-dependent kinase inhibitor p21 and the stress response protein TP53INP1. Concurrently, E47 induces high level expression of acinar digestive enzymes and feed forward activation of the acinar maturation network regulated by the bHLH factor MIST1. Moreover, induction of E47 in human PDA cells in vitro is sufficient to inhibit tumorigenesis. Conclusions Human PDA cells retain a high degree of plasticity, which can be exploited to induce a quiescent acinar cell state with reduced tumorigenic potential. Moreover, bHLH activity is a critical node coordinately regulating human PDA cell growth versus cell fate. PMID:25894862

  7. Wnt/β-Catenin Signaling Pathway Is a Direct Enhancer of Thyroid Transcription Factor-1 in Human Papillary Thyroid Carcinoma Cells

    PubMed Central

    Gilbert-Sirieix, Marie; Makoukji, Joelle; Kimura, Shioko; Talbot, Monique; Caillou, Bernard; Massaad, Charbel; Massaad-Massade, Liliane

    2011-01-01

    The Wnt/β-catenin signaling pathway is involved in the normal development of thyroid gland, but its disregulation provokes the appearance of several types of cancers, including papillary thyroid carcinomas (PTC) which are the most common thyroid tumours. The follow-up of PTC patients is based on the monitoring of serum thyroglobulin levels which is regulated by the thyroid transcription factor 1 (TTF-1): a tissue-specific transcription factor essential for the differentiation of the thyroid. We investigated whether the Wnt/β-catenin pathway might regulate TTF-1 expression in a human PTC model and examined the molecular mechanisms underlying this regulation. Immunofluorescence analysis, real time RT-PCR and Western blot studies revealed that TTF-1 as well as the major Wnt pathway components are co-expressed in TPC-1 cells and human PTC tumours. Knocking-down the Wnt/β-catenin components by siRNAs inhibited both TTF-1 transcript and protein expression, while mimicking the activation of Wnt signaling by lithium chloride induced TTF-1 gene and protein expression. Functional promoter studies and ChIP analysis showed that the Wnt/β-catenin pathway exerts its effect by means of the binding of β-catenin to TCF/LEF transcription factors on the level of an active TCF/LEF response element at [−798, −792 bp] in TTF-1 promoter. In conclusion, we demonstrated that the Wnt/β-catenin pathway is a direct and forward driver of the TTF-1 expression. The localization of TCF-4 and TTF-1 in the same area of PTC tissues might be of clinical relevance, and justifies further examination of these factors in the papillary thyroid cancers follow-up. PMID:21814573

  8. Transcription factor (TF)-like nuclear regulator, the 250-kDa form of Homo sapiens TFIIIB", is an essential component of human TFIIIC1 activity.

    PubMed

    Weser, Stephan; Gruber, Christin; Hafner, Heike M; Teichmann, Martin; Roeder, Robert G; Seifart, Klaus H; Meissner, Wolfgang

    2004-06-25

    The general human RNA polymerase III transcription factor (TF) IIIC1 has hitherto been ill defined with respect to the polypeptides required for reconstitution of its activity. Here we identify Homo sapiens TFIIIB" (HsBdp1) as an essential component of hTFIIIC1 and hTFIIIC1-like activities. Several forms of HsBdp1 are described. The 250-kDa form of HsBdp1, also designated the "transcription factor-like nuclear regulator," strictly co-eluted with TFIIIC1 activity over multiple chromatographic purification steps as revealed by Western blot with anti-HsBdp1 antibodies and by MALDI-TOF analysis. In addition, TFIIIC1 activity could be depleted from partially purified fractions with anti-HsBdp1 antibodies but not with control antibodies. Moreover, highly purified recombinant HsBdp1 could replace TFIIIC1 activity in reconstituted transcription of the VAI gene in vitro. Furthermore, smaller proteins of approximately 90-150 kDa that were recognized by anti-HsBdp1 antibodies co-eluted with TFIIIC1-like activity. Finally, cytoplasmic extracts from differentiated mouse F9 fibroblast cells that lacked TFIIIC1 activity could be made competent for transcription of the VA1 gene by the addition of TFIIIC1, TFIIIC1-like, or recombinant HsBdp1. These results suggest that HsBdp1 proteins represent essential components of TFIIIC1 and TFIIIC1-like activities. PMID:15096501

  9. Human variants in the neuronal basic helix-loop-helix/Per-Arnt-Sim (bHLH/PAS) transcription factor complex NPAS4/ARNT2 disrupt function.

    PubMed

    Bersten, David C; Bruning, John B; Peet, Daniel J; Whitelaw, Murray L

    2014-01-01

    Neuronal Per-Arnt-Sim homology (PAS) Factor 4 (NPAS4) is a neuronal activity-dependent transcription factor which heterodimerises with ARNT2 to regulate genes involved in inhibitory synapse formation. NPAS4 functions to maintain excitatory/inhibitory balance in neurons, while mouse models have shown it to play roles in memory formation, social interaction and neurodegeneration. NPAS4 has therefore been implicated in a number of neuropsychiatric or neurodegenerative diseases which are underpinned by defects in excitatory/inhibitory balance. Here we have explored a broad set of non-synonymous human variants in NPAS4 and ARNT2 for disruption of NPAS4 function. We found two variants in NPAS4 (F147S and E257K) and two variants in ARNT2 (R46W and R107H) which significantly reduced transcriptional activity of the heterodimer on a luciferase reporter gene. Furthermore, we found that NPAS4.F147S was unable to activate expression of the NPAS4 target gene BDNF due to reduced dimerisation with ARNT2. Homology modelling predicts F147 in NPAS4 to lie at the dimer interface, where it appears to directly contribute to protein/protein interaction. We also found that reduced transcriptional activation by ARNT2 R46W was due to disruption of nuclear localisation. These results provide insight into the mechanisms of NPAS4/ARNT dimerisation and transcriptional activation and have potential implications for cognitive phenotypic variation and diseases such as autism, schizophrenia and dementia. PMID:24465693

  10. Human Variants in the Neuronal Basic Helix-Loop-Helix/Per-Arnt-Sim (bHLH/PAS) Transcription Factor Complex NPAS4/ARNT2 Disrupt Function

    PubMed Central

    Bersten, David C.; Bruning, John B.; Peet, Daniel J.; Whitelaw, Murray L.

    2014-01-01

    Neuronal Per-Arnt-Sim homology (PAS) Factor 4 (NPAS4) is a neuronal activity-dependent transcription factor which heterodimerises with ARNT2 to regulate genes involved in inhibitory synapse formation. NPAS4 functions to maintain excitatory/inhibitory balance in neurons, while mouse models have shown it to play roles in memory formation, social interaction and neurodegeneration. NPAS4 has therefore been implicated in a number of neuropsychiatric or neurodegenerative diseases which are underpinned by defects in excitatory/inhibitory balance. Here we have explored a broad set of non-synonymous human variants in NPAS4 and ARNT2 for disruption of NPAS4 function. We found two variants in NPAS4 (F147S and E257K) and two variants in ARNT2 (R46W and R107H) which significantly reduced transcriptional activity of the heterodimer on a luciferase reporter gene. Furthermore, we found that NPAS4.F147S was unable to activate expression of the NPAS4 target gene BDNF due to reduced dimerisation with ARNT2. Homology modelling predicts F147 in NPAS4 to lie at the dimer interface, where it appears to directly contribute to protein/protein interaction. We also found that reduced transcriptional activation by ARNT2 R46W was due to disruption of nuclear localisation. These results provide insight into the mechanisms of NPAS4/ARNT dimerisation and transcriptional activation and have potential implications for cognitive phenotypic variation and diseases such as autism, schizophrenia and dementia. PMID:24465693

  11. Regulatory network analysis of transcription factors, microRNAs, target genes and host genes in human multiple myeloma.

    PubMed

    Huang, Zhuoyan; Xu, Zhiwen; Kunhao Wang, Kunhao Wang; Wang, Ning; Wang, Shang

    2015-11-01

    In recent years, molecular biologists have achieved great advance in micro RNA (miRNA) and gene investigation about the pathogenesis of multiple myeloma (MM). Existing research data of the transcription factors (TFs) and miRNAs is disperse and unorganized, which prevents researchers from investigating the mechanism and analyze regulatory pathways of MM systematically. In our research, regulatory interactions among miRNAs, TFs, host genes and target genes were imported to construct regulatory networks at three levels, including the abnormally expressed network and the related network as well as the global network. The abnormally expressed network was primary investigated cause it was an experimentally validated topological network, and it systematically explained the regulatory mechanism of MM. Its outstanding significance lies in that if we correct each abnormally expressed gene and miRNA to normal expression level by transcriptional control adjustment, thus the whole genetic expression network will return to normal state, and MM may not relapse. Additionally, analyses and comparisons to upstream as well as downstream of abnormally expressed miRNAs and genes in three networks highlighted some important regulators and key signaling pathways. For example, STAT3 and hsa-miR-125b, PIAS3 and hsa-miR-21 respectively formed self adaptation feedback regulations. The current research proposed a novel perspective to systematically explained the regulatory mechanism of MM and may contribute to further research and therapy of carcinomas. PMID:26687742

  12. The mtfA Transcription Factor Gene Controls Morphogenesis, Gliotoxin Production, and Virulence in the Opportunistic Human Pathogen Aspergillus fumigatus

    PubMed Central

    Smith, Timothy D.

    2014-01-01

    Aspergillus fumigatus is the leading causative agent of invasive aspergillosis (IA). The number of cases is on the rise, with mortality rates as high as 90% among immunocompromised patients. Molecular genetic studies in A. fumigatus could provide novel targets to potentially set the basis for antifungal therapies. In the current study, we investigated the role of the transcription factor gene mtfA in A. fumigatus. Our results revealed that mtfA plays a role in the growth and development of the fungus. Deletion or overexpression of mtfA leads to a slight reduction in colony growth, as well as a reduction in conidiation levels, in the overexpression strain compared to the wild-type strain. Furthermore, production of the secondary metabolite gliotoxin increased when mtfA was overexpressed, coinciding with an increase in the transcription levels of the gliotoxin genes gliZ and gliP with respect to the wild type. In addition, our study showed that mtfA is also necessary for normal protease activity in A. fumigatus; deletion of mtfA resulted in a reduction of protease activity compared to wild-type levels. Importantly, the absence of mtfA caused a decrease in virulence in the Galleria mellonella infection model, indicating that mtfA is necessary for A. fumigatus wild-type pathogenesis. PMID:24728192

  13. Molecular and Electrophysiological Characterization of GABAergic Interneurons Expressing the Transcription Factor COUP-TFII in the Adult Human Temporal Cortex

    PubMed Central

    Varga, Csaba; Tamas, Gabor; Barzo, Pal; Olah, Szabolcs; Somogyi, Peter

    2015-01-01

    Transcription factors contribute to the differentiation of cortical neurons, orchestrate specific interneuronal circuits, and define synaptic relationships. We have investigated neurons expressing chicken ovalbumin upstream promoter transcription factor II (COUP-TFII), which plays a role in the migration of GABAergic neurons. Whole-cell, patch-clamp recording in vitro combined with colocalization of molecular cell markers in the adult cortex differentiates distinct interneurons. The majority of strongly COUP-TFII-expressing neurons were in layers I–III. Most calretinin (CR) and/or cholecystokinin- (CCK) and/or reelin-positive interneurons were also COUP-TFII-positive. CR-, CCK-, or reelin-positive neurons formed 80%, 20%, or 17% of COUP-TFII-positive interneurons, respectively. About half of COUP-TFII-/CCK-positive interneurons were CR-positive, a quarter of them reelin-positive, but none expressed both. Interneurons positive for COUP-TFII fired irregular, accommodating and adapting trains of action potentials (APs) and innervated mostly small dendritic shafts and rarely spines or somata. Paired recording showed that a calretinin-/COUP-TFII-positive interneuron elicited inhibitory postsynaptic potentials (IPSPs) in a reciprocally connected pyramidal cell. Calbindin, somatostatin, or parvalbumin-immunoreactive interneurons and most pyramidal cells express no immunohistochemically detectable COUP-TFII. In layers V and VI, some pyramidal cells expressed a low level of COUP-TFII in the nucleus. In conclusion, COUP-TFII is expressed in a diverse subset of GABAergic interneurons predominantly innervating small dendritic shafts originating from both interneurons and pyramidal cells. PMID:25787832

  14. Structure-function analysis of the human TFIIB-related factor II protein reveals an essential role for the C-terminal domain in RNA polymerase III transcription.

    PubMed

    Saxena, Ashish; Ma, Beicong; Schramm, Laura; Hernandez, Nouria

    2005-11-01

    The transcription factors TFIIB, Brf1, and Brf2 share related N-terminal zinc ribbon and core domains. TFIIB bridges RNA polymerase II (Pol II) with the promoter-bound preinitiation complex, whereas Brf1 and Brf2 are involved, as part of activities also containing TBP and Bdp1 and referred to here as Brf1-TFIIIB and Brf2-TFIIIB, in the recruitment of Pol III. Brf1-TFIIIB recruits Pol III to type 1 and 2 promoters and Brf2-TFIIIB to type 3 promoters such as the human U6 promoter. Brf1 and Brf2 both have a C-terminal extension absent in TFIIB, but their C-terminal extensions are unrelated. In yeast Brf1, the C-terminal extension interacts with the TBP/TATA box complex and contributes to the recruitment of Bdp1. Here we have tested truncated Brf2, as well as Brf2/TFIIB chimeric proteins for U6 transcription and for assembly of U6 preinitiation complexes. Our results characterize functions of various human Brf2 domains and reveal that the C-terminal domain is required for efficient association of the protein with U6 promoter-bound TBP and SNAP(c), a type 3 promoter-specific transcription factor, and for efficient recruitment of Bdp1. This in turn suggests that the C-terminal extensions in Brf1 and Brf2 are crucial to specific recruitment of Pol III over Pol II. PMID:16227591

  15. Structure-Function Analysis of the Human TFIIB-Related Factor II Protein Reveals an Essential Role for the C-Terminal Domain in RNA Polymerase III Transcription

    PubMed Central

    Saxena, Ashish; Ma, Beicong; Schramm, Laura; Hernandez, Nouria

    2005-01-01

    The transcription factors TFIIB, Brf1, and Brf2 share related N-terminal zinc ribbon and core domains. TFIIB bridges RNA polymerase II (Pol II) with the promoter-bound preinitiation complex, whereas Brf1 and Brf2 are involved, as part of activities also containing TBP and Bdp1 and referred to here as Brf1-TFIIIB and Brf2-TFIIIB, in the recruitment of Pol III. Brf1-TFIIIB recruits Pol III to type 1 and 2 promoters and Brf2-TFIIIB to type 3 promoters such as the human U6 promoter. Brf1 and Brf2 both have a C-terminal extension absent in TFIIB, but their C-terminal extensions are unrelated. In yeast Brf1, the C-terminal extension interacts with the TBP/TATA box complex and contributes to the recruitment of Bdp1. Here we have tested truncated Brf2, as well as Brf2/TFIIB chimeric proteins for U6 transcription and for assembly of U6 preinitiation complexes. Our results characterize functions of various human Brf2 domains and reveal that the C-terminal domain is required for efficient association of the protein with U6 promoter-bound TBP and SNAPc, a type 3 promoter-specific transcription factor, and for efficient recruitment of Bdp1. This in turn suggests that the C-terminal extensions in Brf1 and Brf2 are crucial to specific recruitment of Pol III over Pol II. PMID:16227591

  16. Transcription factor RUNX2 up-regulates chemokine receptor CXCR4 to promote invasive and metastatic potentials of human gastric cancer

    PubMed Central

    Guo, Zheng-Jun; Yang, Lang; Qian, Feng; Wang, Yan-Xia; Yu, Xi; Ji, Cheng-Dong; Cui, Wei; Xiang, Dong-Fang; Zhang, Xia; Zhang, Peng; Wang, Ji Ming; Cui, You-Hong; Bian, Xiu-Wu

    2016-01-01

    Runt-related transcription factor 2 (RUNX2) is a regulator of embryogenesis and development, but has also been implicated in the progression of certain human cancer. This study aimed to elucidate the role of RUNX2 in the invasive and metastatic potentials of human gastric cancer (GC) and the underlying mechanisms. We found that the levels of RUNX2 expression in gastric cancer tissues were correlated with the differentiation degrees, invasion depth and lymph node metastasis. COX regression analysis indicated that RUNX2 was an independent prognostic indicator for GC patients. RUNX2 significantly increased the migration and invasion ability of GC cells in vitro and enhanced the invasion and metastatic potential of GC cells in an orthotopic GC model of nude mice. Mechanistically, RUNX2 directly bound to the promoter region of the gene coding for the chemokine receptor CXCR4 to enhance its transcription. CXCR4 knockdown or treatment with AMD3100, a CXCR4 inhibitor, attenuated RUNX2-promoted invasion and metastasis. These results demonstrate that RUNX2 promotes the invasion and metastasis of human GC by transcriptionally up-regulating the chemokine receptor CXCR4. Therefore, the RUNX2-CXCR4 axis is a potential therapeutic target for GC. PMID:27007162

  17. Upstream stimulatory factors, USF1 and USF2, bind to the human haem oxygenase-1 proximal promoter in vivo and regulate its transcription

    PubMed Central

    2004-01-01

    The human HO-1 (haem oxygenase-1) gene encodes a microsomal enzyme responsible for the breakdown of haem, and is also cytoprotective in response to various cellular insults. HO-1 transcription is induced by a vast array of compounds including, but certainly not limited to, haem and heavy metals such as cadmium. In the present study, we show that upstream stimulatory factors, USF1 and USF2, ubiquitous proteins belonging to the basic helix–loop–helix-leucine zipper family of transcription factors, constitutively bind to the class B E-box located in the proximal promoter of the human HO-1 gene and are responsible for the enhancement of HO-1 gene transcription in human renal proximal tubular epithelial cells. Dimethylsulphate in vivo footprinting studies have identified three protected guanine residues in the E-box of the HO-1 proximal promoter. One of these guanine contact points is essential for USF binding, and when mutated mimics a deletion mutation of the entire E-box palindrome sequence encompassing all three guanine contact points. Binding of USF1 and USF2 to the HO-1 E-box was confirmed by chromatin immunoprecipitation and gel-shift assays. Furthermore, we show that overexpression of USF1 or USF2 enhances the basal expression of HO-1 and that expression of a USF dominant negative form reduces its expression. These results demonstrate for the first time that USF proteins bind to the human HO-1 promoter in vivo and are required for high-level expression of HO-1 by haem and cadmium in human renal epithelial cells. PMID:15242350

  18. Early B-cell factor 1 (EBF1) is critical for transcriptional control of SLAMF1 gene in human B cells.

    PubMed

    Schwartz, Anton M; Putlyaeva, Lidia V; Covich, Milica; Klepikova, Anna V; Akulich, Kseniya A; Vorontsov, Ilya E; Korneev, Kirill V; Dmitriev, Sergey E; Polanovsky, Oleg L; Sidorenko, Svetlana P; Kulakovskiy, Ivan V; Kuprash, Dmitry V

    2016-10-01

    Signaling lymphocytic activation molecule family member 1 (SLAMF1)/CD150 is a co-stimulatory receptor expressed on a variety of hematopoietic cells, in particular on mature lymphocytes activated by specific antigen, costimulation and cytokines. Changes in CD150 expression level have been reported in association with autoimmunity and with B-cell chronic lymphocytic leukemia. We characterized the core promoter for SLAMF1 gene in human B-cell lines and explored binding sites for a number of transcription factors involved in B cell differentiation and activation. Mutations of SP1, STAT6, IRF4, NF-kB, ELF1, TCF3, and SPI1/PU.1 sites resulted in significantly decreased promoter activity of varying magnitude, depending on the cell line tested. The most profound effect on the promoter strength was observed upon mutation of the binding site for Early B-cell factor 1 (EBF1). This mutation produced a 10-20 fold drop in promoter activity and pinpointed EBF1 as the master regulator of human SLAMF1 gene in B cells. We also identified three potent transcriptional enhancers in human SLAMF1 locus, each containing functional EBF1 binding sites. Thus, EBF1 interacts with specific binding sites located both in the promoter and in the enhancer regions of the SLAMF1 gene and is critical for its expression in human B cells. PMID:27424222

  19. Methamphetamine activates nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and induces human immunodeficiency virus (HIV) transcription in human microglial cells

    PubMed Central

    Wires, Emily S.; Alvarez, David; Dobrowolski, Curtis; Wang, Yun; Morales, Marisela; Karn, Jonathan; Harvey, Brandon K.

    2012-01-01

    Human immunodeficiency virus (HIV) primarily infects glial cells in the central nervous system (CNS). Recent evidence suggests that HIV-infected individuals who abuse drugs such as methamphetamine (METH) have higher viral loads and experience more severe neurological complications than HIV-infected individuals who do not abuse drugs. The aim of this study was to determine the effect of METH on HIV expression from the HIV long terminal repeats (LTR) promoter and on an HIV integrated provirus in microglial cells, the primary host cells for HIV in the CNS. Primary human microglial cells immortalized with SV40 T-antigen (CHME-5 cells) were co-transfected with an HIV LTR reporter and the HIV Tat gene, a key regulator of viral replication and gene expression, and exposed to METH. Our results demonstrate that METH treatment induced LTR activation, an effect potentiated in the presence of Tat. We also found that METH increased the nuclear translocation of the nuclear factor kappa B (NF-κB), a key cellular transcriptional regulator of the LTR promoter, and the activity of an NF-κB-specific reporter plasmid in CHME-5 cells. The presence of a dominant-negative regulator of NF-κB blocked METH-related activation of the HIV LTR. Furthermore, treatment of HIV-latently infected CHME-5 (CHME-5/HIV) cells with METH induced HIV expression in a dose-dependent manner, and nuclear translocation of the p65 subunit of NF-κB. These results suggest that METH can stimulate HIV gene expression in microglia cells through activation of the NF-κB signaling pathway. This mechanism may outline the initial biochemical events leading to the observed increased neurodegeneration in HIV-positive individuals who use METH. PMID:22618514

  20. Modulation of Cytokine Production and Transcription Factors Activities in Human Jurkat T Cells by Thymol and Carvacrol

    PubMed Central

    Gholijani, Nasser; Gharagozloo, Marjan; Kalantar, Fathollah; Ramezani, Amin; Amirghofran, Zahra

    2015-01-01

    Purpose: Thymol and carvacrol, two main components of thyme, have shown anti-inflammatory effects. The aim of this study was to assess the effects of these components on Jurkat leukemia cells as an in vitro T cell model and their molecular mechanisms of activity. Methods: Cells were cultured in the presence of components and subsequently stimulated with phorbol-12-myristate-13-acetate (PMA)/calcium ionophore for evaluating interleukin (IL)-2 and interferon (IFN)-γ production. The activation of T cell transcription factors that included nuclear factors of activated T cells (NFATs), activator protein-1 (AP-1; c-Jun/c-Fos), and nuclear factor (NF)-κB were examined by Western blot analysis. Results: Thymol and carvacrol at 25 µg/ml significantly reduced IL-2 levels from 119.4 ± 8pg/ml in control cells treated only with PMA/Calcium ionophore and the solvent to 66.9 ± 6.4pg/ml (thymol) and 32.3 ± 3.6pg/ml (carvacrol) and IFN-γ from 423.7 ± 19.7pg/ml in control cells to 311.9 ± 11.6pg/ml (thymol) and 293.5 ± 16.7pg/ml (carvacrol). Western blot analyses of nuclear extracts showed that the same concentrations of components significantly reduced NFAT-2 to 44.2 ± 2.7% (thymol) and 91.4 ± 2.3% (carvacrol) of the control (p<0.05), and c-Fos to 31.2 ± 6.2% (thymol) and 27.6 ± 3.1% (carvacrol) of the control (p<0.01). No effects on NFAT-1, c-Jun and phospho-NF-κBp65 levels were observed. Conclusion: Thymol and carvacrol could contribute to modulation of T cell activity by reducing IL-2 and IFN-γ production possibly through down regulation of AP-1 and NFAT-2 transcription factors suggesting their potential usefulness for reduction of T cell overactivity in immune-mediated diseases. PMID:26793612

  1. Transcriptional factors, Mafs and their biological roles

    PubMed Central

    Tsuchiya, Mariko; Misaka, Ryoichi; Nitta, Kosaku; Tsuchiya, Ken

    2015-01-01

    The Maf family of transcription factors is characterized by a typical bZip structure; these transcription factors act as important regulators of the development and differentiation of many organs and tissues, including the kidney. The Maf family consists of two subgroups that are characterized according to their structure: large Maf transcription factors and small Maf transcription factors. The large Maf subgroup consists of four proteins, designated as MAFA, MAFB, c-MAF and neural retina-specific leucine zipper. In particular, MAFA is a distinct molecule that has been attracting the attention of researchers because it acts as a strong transactivator of insulin, suggesting that Maf transcription factors are likely to be involved in systemic energy homeostasis. In this review, we focused on the regulation of glucose/energy balance by Maf transcription factors in various organs. PMID:25685288

  2. ZCF32, a fungus specific Zn(II)2 Cys6 transcription factor, is a repressor of the biofilm development in the human pathogen Candida albicans

    PubMed Central

    Kakade, Pallavi; Sadhale, Parag; Sanyal, Kaustuv; Nagaraja, Valakunja

    2016-01-01

    As a human fungal pathogen, Candida albicans can cause a wide variety of disease conditions ranging from superficial to systemic infections. Many of these infections are caused by an inherent ability of the pathogen to form biofilms on medical devices resulting in high mortality. Biofilms formed by C. albicans are a complex consortium of yeast and hyphal cells embedded in an extracellular matrix and are regulated by a network of transcription factors. Here, we report the role of a novel Zn(II)2-Cys6 binuclear cluster transcription factor, ZCF32, in the regulation of biofilm formation. Global transcriptome analysis reveals that biofilm development is the most altered pathway in the zcf32 null mutant. To delineate the functional correlation between ZCF32 and biofilm development, we determined the set of genes directly regulated by Zcf32. Our data suggests that Zcf32 regulates biofilm formation by repressing the expression of adhesins, chitinases and a significant number of other GPI-anchored proteins. We establish that there is the lesser recruitment of Zcf32 on the promoters of biofilm genes in biofilm condition compared to the planktonic mode of growth. Taking together, we propose that the transcription factor ZCF32 negatively regulates biofilm development in C. albicans. PMID:27498700

  3. ZCF32, a fungus specific Zn(II)2 Cys6 transcription factor, is a repressor of the biofilm development in the human pathogen Candida albicans.

    PubMed

    Kakade, Pallavi; Sadhale, Parag; Sanyal, Kaustuv; Nagaraja, Valakunja

    2016-01-01

    As a human fungal pathogen, Candida albicans can cause a wide variety of disease conditions ranging from superficial to systemic infections. Many of these infections are caused by an inherent ability of the pathogen to form biofilms on medical devices resulting in high mortality. Biofilms formed by C. albicans are a complex consortium of yeast and hyphal cells embedded in an extracellular matrix and are regulated by a network of transcription factors. Here, we report the role of a novel Zn(II)2-Cys6 binuclear cluster transcription factor, ZCF32, in the regulation of biofilm formation. Global transcriptome analysis reveals that biofilm development is the most altered pathway in the zcf32 null mutant. To delineate the functional correlation between ZCF32 and biofilm development, we determined the set of genes directly regulated by Zcf32. Our data suggests that Zcf32 regulates biofilm formation by repressing the expression of adhesins, chitinases and a significant number of other GPI-anchored proteins. We establish that there is the lesser recruitment of Zcf32 on the promoters of biofilm genes in biofilm condition compared to the planktonic mode of growth. Taking together, we propose that the transcription factor ZCF32 negatively regulates biofilm development in C. albicans. PMID:27498700

  4. Transcriptional regulation of the human H ferritin-encoding gene (FERH) in G418-treated cells: role of the B-box-binding factor.

    PubMed

    Bevilacqua, M A; Faniello, M C; Russo, T; Cimino, F; Costanzo, F

    1994-04-20

    We have analysed the molecular basis underlying the increase in ferritin heavy-chain mRNA (FERH) levels in cells exposed to the antibiotic Geneticin (G418). Transient transfection experiments demonstrate that this increase is paralleled by an enhanced transcription driven by the promoter (pFERH) for the human FERH gene, in which the most proximal promoter element (B-box) appears to play a key role. This region is conserved in human and rat, and binds an unknown factor. The DNA-protein complex composed of B-box-binding factor and its cis-element becomes more abundant in the G418-treated cells, as compared with the untreated ones. PMID:8163204

  5. Human RNA polymerase II associated factor 1 complex promotes tumorigenesis by activating c-MYC transcription in non-small cell lung cancer.

    PubMed

    Zhi, Xiuyi; Giroux-Leprieur, Etienne; Wislez, Marie; Hu, Mu; Zhang, Yi; Shi, Huaiyin; Du, Kaiqi; Wang, Lei

    2015-10-01

    Human RNA polymerase II (RNAPII)-associated factor 1 complex (hPAF1C) plays a crucial role in protein-coding gene transcription. Overexpression of hPAF1C has been implicated in the initiation and progression of various human cancers. However, the molecular pathways involved in tumorigenesis through hPAF1C remain to be elucidated. The current study suggested hPAF1C expression as a prognostic biomarker for early stage non-small cell lung cancer (NSCLC) and patients with low hPAF1C expression levels had significantly better overall survival. Furthermore, the expression of hPAF1C was found to be positively correlated with c-MYC expression in patient tumor samples and in cancer cell lines. Mechanistic studies indicated that hPAF1C could promote lung cancer cell proliferation through regulating c-MYC transcription. These results demonstrated the prognostic value of hPAF1C in early-stage NSCLC and the role of hPAF1C in the transcriptional regulation of c-MYC oncogene during NSCLC tumorigenesis. PMID:26282204

  6. Expression of Nuclear Transcription Factor Kappa B in Locally Advanced Human Cervical Cancer Treated With Definitive Chemoradiation

    SciTech Connect

    Garg, Amit K.; Jhingran, Anuja; Klopp, Ann H.; Aggarwal, Bharat B.; Kunnumakkara, Ajai B.; Broadus, Russell R.; Eifel, Patricia J.; Buchholz, Thomas A.

    2010-12-01

    Purpose: Nuclear factor kappa B (NF-{kappa}B), a transcriptional factor that has been shown to be constitutively active in cervical cancer, is part of an important pathway leading to treatment resistance in many tumor types. The purpose of our study was to determine whether expression of NF-{kappa}B in pretreatment specimens and specimens taken shortly after treatment initiation correlated with outcome in cervical cancer patients treated with definitive chemoradiation. Methods and Materials: Eighteen patients with locally advanced cervical cancer were enrolled in a study in which cervical biopsy specimens were obtained before radiation therapy and 48 h after treatment initiation. Matched biopsy specimens from 16 of these patients were available and evaluated for the nuclear expression of NF-{kappa}B protein by immunohistochemical staining. Results: After a median follow-up of 43 months, there were 9 total treatment failures. Nuclear staining for NF-{kappa}B was positive in 3 of 16 pretreatment biopsy specimens (19%) and 5 of 16 postradiation biopsy specimens (31%). Pretreatment expression of NF-{kappa}B nuclear staining correlated with increased rates of local-regional failure (100% vs. 23%, p = 0.01), distant failure (100% vs. 38%, p = 0.055), disease-specific mortality (100% vs. 31%, p = 0.03), and overall mortality (100% vs. 38%, p = 0.055). Conclusions: Our data suggest that pretreatment nuclear expression of NF-{kappa}B may be associated with a poor outcome for cervical cancer patients treated with chemoradiation. Although these data require validation in a larger group of patients, the results support the continued study of the relationship between NF-{kappa}B and outcome in patients treated for carcinoma of the cervix.

  7. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. PMID:24845645

  8. Prunus transcription factors: breeding perspectives.

    PubMed

    Bianchi, Valmor J; Rubio, Manuel; Trainotti, Livio; Verde, Ignazio; Bonghi, Claudio; Martínez-Gómez, Pedro

    2015-01-01

    Many plant processes depend on differential gene expression, which is generally controlled by complex proteins called transcription factors (TFs). In peach, 1533 TFs have been identified, accounting for about 5.5% of the 27,852 protein-coding genes. These TFs are the reference for the rest of the Prunus species. TF studies in Prunus have been performed on the gene expression analysis of different agronomic traits, including control of the flowering process, fruit quality, and biotic and abiotic stress resistance. These studies, using quantitative RT-PCR, have mainly been performed in peach, and to a lesser extent in other species, including almond, apricot, black cherry, Fuji cherry, Japanese apricot, plum, and sour and sweet cherry. Other tools have also been used in TF studies, including cDNA-AFLP, LC-ESI-MS, RNA, and DNA blotting or mapping. More recently, new tools assayed include microarray and high-throughput DNA sequencing (DNA-Seq) and RNA sequencing (RNA-Seq). New functional genomics opportunities include genome resequencing and the well-known synteny among Prunus genomes and transcriptomes. These new functional studies should be applied in breeding programs in the development of molecular markers. With the genome sequences available, some strategies that have been used in model systems (such as SNP genotyping assays and genotyping-by-sequencing) may be applicable in the functional analysis of Prunus TFs as well. In addition, the knowledge of the gene functions and position in the peach reference genome of the TFs represents an additional advantage. These facts could greatly facilitate the isolation of genes via QTL (quantitative trait loci) map-based cloning in the different Prunus species, following the association of these TFs with the identified QTLs using the peach reference genome. PMID:26124770

  9. Prunus transcription factors: breeding perspectives

    PubMed Central

    Bianchi, Valmor J.; Rubio, Manuel; Trainotti, Livio; Verde, Ignazio; Bonghi, Claudio; Martínez-Gómez, Pedro

    2015-01-01

    Many plant processes depend on differential gene expression, which is generally controlled by complex proteins called transcription factors (TFs). In peach, 1533 TFs have been identified, accounting for about 5.5% of the 27,852 protein-coding genes. These TFs are the reference for the rest of the Prunus species. TF studies in Prunus have been performed on the gene expression analysis of different agronomic traits, including control of the flowering process, fruit quality, and biotic and abiotic stress resistance. These studies, using quantitative RT-PCR, have mainly been performed in peach, and to a lesser extent in other species, including almond, apricot, black cherry, Fuji cherry, Japanese apricot, plum, and sour and sweet cherry. Other tools have also been used in TF studies, including cDNA-AFLP, LC-ESI-MS, RNA, and DNA blotting or mapping. More recently, new tools assayed include microarray and high-throughput DNA sequencing (DNA-Seq) and RNA sequencing (RNA-Seq). New functional genomics opportunities include genome resequencing and the well-known synteny among Prunus genomes and transcriptomes. These new functional studies should be applied in breeding programs in the development of molecular markers. With the genome sequences available, some strategies that have been used in model systems (such as SNP genotyping assays and genotyping-by-sequencing) may be applicable in the functional analysis of Prunus TFs as well. In addition, the knowledge of the gene functions and position in the peach reference genome of the TFs represents an additional advantage. These facts could greatly facilitate the isolation of genes via QTL (quantitative trait loci) map-based cloning in the different Prunus species, following the association of these TFs with the identified QTLs using the peach reference genome. PMID:26124770

  10. The SCL/TAL1 Transcription Factor Represses the Stress Protein DDiT4/REDD1 in Human Hematopoietic Stem/Progenitor Cells.

    PubMed

    Benyoucef, Aissa; Calvo, Julien; Renou, Laurent; Arcangeli, Marie-Laure; van den Heuvel, Anita; Amsellem, Sophie; Mehrpour, Maryam; Larghero, Jerome; Soler, Eric; Naguibneva, Irina; Pflumio, Francoise

    2015-07-01

    Hematopoietic stem/progenitor cells (HSPCs) are regulated through numerous molecular mechanisms that have not been interconnected. The transcription factor stem cell leukemia/T-cell acute leukemia 1 (TAL1) controls human HSPC but its mechanism of action is not clarified. In this study, we show that knockdown (KD) or short-term conditional over-expression (OE) of TAL1 in human HSPC ex vivo, respectively, blocks and maintains hematopoietic potentials, affecting proliferation of human HSPC. Comparative gene expression analyses of TAL1/KD and TAL1/OE human HSPC revealed modifications of cell cycle regulators as well as previously described TAL1 target genes. Interestingly an inverse correlation between TAL1 and DNA damage-induced transcript 4 (DDiT4/REDD1), an inhibitor of the mammalian target of rapamycin (mTOR) pathway, is uncovered. Low phosphorylation levels of mTOR target proteins in TAL1/KD HSPC confirmed an interplay between mTOR pathway and TAL1 in correlation with TAL1-mediated effects of HSPC proliferation. Finally chromatin immunoprecipitation experiments performed in human HSPC showed that DDiT4 is a direct TAL1 target gene. Functional analyses showed that TAL1 represses DDiT4 expression in HSPCs. These results pinpoint DDiT4/REDD1 as a novel target gene regulated by TAL1 in human HSPC and establish for the first time a link between TAL1 and the mTOR pathway in human early hematopoietic cells. Stem Cells 2015;33:2268-2279. PMID:25858676

  11. PAX transcription factors in neural crest development.

    PubMed

    Monsoro-Burq, Anne H

    2015-08-01

    The nine vertebrate PAX transcription factors (PAX1-PAX9) play essential roles during early development and organogenesis. Pax genes were identified in vertebrates using their homology with the Drosophila melanogaster paired gene DNA-binding domain. PAX1-9 functions are largely conserved throughout vertebrate evolution, in particular during central nervous system and neural crest development. The neural crest is a vertebrate invention, which gives rise to numerous derivatives during organogenesis, including neurons and glia of the peripheral nervous system, craniofacial skeleton and mesenchyme, the heart outflow tract, endocrine and pigment cells. Human and mouse spontaneous mutations as well as experimental analyses have evidenced the critical and diverse functions of PAX factors during neural crest development. Recent studies have highlighted the role of PAX3 and PAX7 in neural crest induction. Additionally, several PAX proteins - PAX1, 3, 7, 9 - regulate cell proliferation, migration and determination in multiple neural crest-derived lineages, such as cardiac, sensory, and enteric neural crest, pigment cells, glia, craniofacial skeleton and teeth, or in organs developing in close relationship with the neural crest such as the thymus and parathyroids. The diverse PAX molecular functions during neural crest formation rely on fine-tuned modulations of their transcriptional transactivation properties. These modulations are generated by multiple means, such as different roles for the various isoforms (formed by alternative splicing), or posttranslational modifications which alter protein-DNA binding, or carefully orchestrated protein-protein interactions with various co-factors which control PAX proteins activity. Understanding these regulations is the key to decipher the versatile roles of PAX transcription factors in neural crest development, differentiation and disease. PMID:26410165

  12. Cell Fate Determination by Transcription Factors.

    PubMed

    Gurdon, John B

    2016-01-01

    Transcription factors fulfill a key role in the formation and maintenance of different cell-types during development. It is known that transcription factors largely dissociate from chromosomes during mitosis. We found, previously, that mitosis is also a time when somatic nuclei can be far more easily reprogrammed after nuclear transfer than the nuclei of interphase cells. We refer to this as a mitotic advantage. Here, the rate of exchange of a transcription factor on its designated DNA-binding site is discussed. It is proposed that the Xenopus oocyte could serve as an experimental system in which the duration of binding site occupancy could be usefully analyzed. In particular, the Xenopus oocyte has several characteristics which make it possible to determine accurately the concentration and duration of transcription factor binding. It is proposed that the concentration and time are the key variables which govern the action of transcription factors when they activate genes needed for cell lineage determination. PMID:26970633

  13. An autocrine loop between TGF-β1 and the transcription factor Brachyury controls the transition of human carcinoma cells into a mesenchymal phenotype

    PubMed Central

    Larocca, Cecilia; Cohen, Joseph R.; Fernando, Romaine I.; Huang, Bruce; Hamilton, Duane H.; Palena, Claudia

    2013-01-01

    The epithelial-mesenchymal transition (EMT) is a process associated with the metastasis of solid tumors as well as with the acquisition of resistance to standard anti-cancer modalities. A major initiator of EMT in carcinoma cells is TGF-β, which has been shown to induce the expression of several transcription factors ultimately responsible for initiating and maintaining the EMT program. We have previously identified Brachyury, a T-box transcription factor, as an inducer of mesenchymal features in human carcinoma cells. In this study, a potential link between Brachyury and TGF-β signaling has been investigated. The results demonstrate for the first time that Brachyury expression is enhanced during TGF-β1-induced EMT in various human cancer cell lines, and that a positive feedback loop is established between Brachyury and TGF-β1 in mesenchymal-like tumor cells. In this context, Brachyury overexpression is shown to promote upregulation of TGF-β1 at the mRNA and protein levels, an effect mediated by activation of the TGF-β1 promoter in the presence of high levels of Brachyury. Furthermore, inhibition of TGF-β1 signaling by a small molecule inhibitor of TGF-β receptor type I decreases Brachyury expression, induces a mesenchymal-to-epithelial transition, and renders cancer cells more susceptible to chemotherapy. This study thus has implications for the future development of clinical trials using TGF-β inhibitors in combination with other anti-cancer agents. PMID:23783250

  14. Transcription factor AP-1 in esophageal squamous cell carcinoma: Alterations in activity and expression during Human Papillomavirus infection

    PubMed Central

    2009-01-01

    Background Esophageal squamous cell carcinoma (ESCC) is a leading cause of cancer-related deaths in Jammu and Kashmir (J&K) region of India. A substantial proportion of esophageal carcinoma is associated with infection of high-risk HPV type 16 and HPV18, the oncogenic expression of which is controlled by host cell transcription factor Activator Protein-1 (AP-1). We, therefore, have investigated the role of DNA binding and expression pattern of AP-1 in esophageal cancer with or without HPV infection. Methods Seventy five histopathologically-confirmed esophageal cancer and an equal number of corresponding adjacent normal tissue biopsies from Kashmir were analyzed for HPV infection, DNA binding activity and expression of AP-1 family of proteins by PCR, gel shift assay and immunoblotting respectively. Results A high DNA binding activity and elevated expression of AP-1 proteins were observed in esophageal cancer, which differed between HPV positive (19%) and HPV negative (81%) carcinomas. While JunB, c-Fos and Fra-1 were the major contributors to AP-1 binding activity in HPV negative cases, Fra-1 was completely absent in HPV16 positive cancers. Comparison of AP-1 family proteins demonstrated high expression of JunD and c-Fos in HPV positive tumors, but interestingly, Fra-1 expression was extremely low or nil in these tumor tissues. Conclusion Differential AP-1 binding activity and expression of its specific proteins between HPV - positive and HPV - negative cases indicate that AP-1 may play an important role during HPV-induced esophageal carcinogenesis. PMID:19758438

  15. Regulation of endochondral ossification by transcription factors.

    PubMed

    Nishimura, Riko; Hata, Kenji; Ono, Koichiro; Amano, Katsuhiko; Takigawa, Yoko; Wakabayashi, Makoto; Takashima, Rikako; Yoneda, Toshiyuki

    2012-01-01

    Endochondral ossification is very unique and complex biological event which is associated with skeletal development and tissue partnering. Genetic studies and gene-targeting approaches identified several transcription factors that play important roles in endochondral ossification. These transcription factors sequentially and harmoniously regulate each step of endochondral ossification, and consequently maintain the spatio-temporal control of the program. Importantly, these transcription factors form large protein complex to control chromatin remodeling, histone modification, transcription and splicing steps during endochondral ossification. It is also important to understand how these transcription factors regulate expression of their target genes. Biochemical and molecular cloning techniques largely contributed to identification of the components of the transcriptional complex and the target genes. Most recently, importance of endoplasmic reticulum (ER) stress in endochondral ossification has been reported. A transcription factor, BBF2H7, functions as an ER stress sensor in chondrocytes through regulation of appropriate secretion of chondrogenic matrices. We would like to discuss how the transcription factors regulate endochondral ossification. PMID:22652803

  16. Regulation of hematopoietic development by ZBTB transcription factors.

    PubMed

    Maeda, Takahiro

    2016-09-01

    Hematopoietic development is governed by the coordinated expression of lineage- and differentiation stage-specific genes. Transcription factors play major roles in this process and their perturbation may underlie hematologic and immunologic disorders. Nearly 1900 transcription factors are encoded in the human genome: of these, 49 BTB (for broad-complex, tram-track and bric à brac)-zinc finger transcription factors referred to as ZBTB or POK proteins have been identified. ZBTB proteins, including BCL6, PLZF, ThPOK and LRF, exhibit a broad spectrum of functions in normal and malignant hematopoiesis. This review summarizes developmental and molecular functions of ZBTB proteins relevant to hematology. PMID:27250345

  17. Comparative Immunohistochemistry of Placental Corticotropin-Releasing Hormone and the Transcription Factor RelB–NFκB2 Between Humans and Nonhuman Primates

    PubMed Central

    Rosen, Todd; Schulkin, Jay; Power, Michael; Tadesse, Serkalem; Norwitz, Errol R; Wen, Zhaoqin; Wang, Bingbing

    2015-01-01

    The transcription factor RelB–NFκB2, activated by the noncanonical NFκB pathway, positively regulates corticotropin-releasing hormone (CRH) and prostaglandin production in the term human placenta and may play an important role in the timing of human parturition. Here we explored whether RelB–NFκB2 signaling plays a role in parturition in nonhuman anthropoid primates. We performed immunohistochemical staining to assess the correlation between CRH and nuclear activity of RelB–NFκB2 heterodimers in term placentas from humans, 3 catarrhine primate species, and a single platyrrhine primate species. Consistent with our previous studies, the human placenta showed cytoplasmic staining for CRH and nuclear staining for RelB–NFκB2. Similar staining patterns were noted in the 3 catarrhine primates (chimpanzee, baboon, and rhesus macaque). The platyrrhine (marmoset) placentas stained positively for CRH and RelB but not for NFκB2. Catarrhine (but not platyrrhine) nonhuman primate term placentas demonstrate the same CRH staining and nuclear localization patterns of RelB and NFκB2 as does human placenta. These results suggest that catarrhine primates, particularly rhesus macaques, may serve as useful animal models to study the biologic significance of the noncanonical NFκB pathway in human pregnancy. PMID:25926400

  18. Comparative Immunohistochemistry of Placental Corticotropin-Releasing Hormone and the Transcription Factor RelB-NFκB2 Between Humans and Nonhuman Primates.

    PubMed

    Rosen, Todd; Schulkin, Jay; Power, Michael; Tadesse, Serkalem; Norwitz, Errol R; Wen, Zhaoqin; Wang, Bingbing

    2015-04-01

    The transcription factor RelB-NFκB2, activated by the noncanonical NFκB pathway, positively regulates corticotropin-releasing hormone (CRH) and prostaglandin production in the term human placenta and may play an important role in the timing of human parturition. Here we explored whether RelB-NFκB2 signaling plays a role in parturition in nonhuman anthropoid primates. We performed immunohistochemical staining to assess the correlation between CRH and nuclear activity of RelB-NFκB2 heterodimers in term placentas from humans, 3 catarrhine primate species, and a single platyrrhine primate species. Consistent with our previous studies, the human placenta showed cytoplasmic staining for CRH and nuclear staining for RelB-NFκB2. Similar staining patterns were noted in the 3 catarrhine primates (chimpanzee, baboon, and rhesus macaque). The platyrrhine (marmoset) placentas stained positively for CRH and RelB but not for NFκB2. Catarrhine (but not platyrrhine) nonhuman primate term placentas demonstrate the same CRH staining and nuclear localization patterns of RelB and NFκB2 as does human placenta. These results suggest that catarrhine primates, particularly rhesus macaques, may serve as useful animal models to study the biologic significance of the noncanonical NFκB pathway in human pregnancy. PMID:25926400

  19. The human NFKB3 gene encoding the p65 subunit of transcription factor NF-[sub K]B is located on chromosome 11q12

    SciTech Connect

    Deloukas, P.; Loon, A.P.G.M. van ); Dauwerse, J.G.; Ommen, G.J.B. van )

    1994-02-01

    A YAC clone that contains the human gene NFKB3, encoding the p65 subunit of transcription factor nuclear factor [sub K]B (NF-[sub K]B), was isolated. The YAC contains the entire NFKB3 gene, which is smaller than 15 kb and present in a single copy in the genome. Fluorescence in situ hybridization with metaphase chromosomes showed two different chromosomal locations (11q12 and Xp11.4) for sequences present in the YAC. The NFKB3 gene was assigned to chromosome 11q12 by PCR analysis of a panel of relevant hybrid cell lines. Thus, no linkage exists between NFKB3 and genes encoding other known members of the NF-[sub K]B family. 20 refs., 2 figs.

  20. Placental endoplasmic reticulum stress negatively regulates transcription of placental growth factor via ATF4 and ATF6β: implications for the pathophysiology of human pregnancy complications

    PubMed Central

    Mizuuchi, Masahito; Cindrova‐Davies, Tereza; Olovsson, Matts; Charnock‐Jones, D Stephen; Burton, Graham J

    2016-01-01

    Abstract Low maternal circulating concentrations of placental growth factor (PlGF) are one of the hallmarks of human pregnancy complications, including fetal growth restriction (FGR) and early‐onset pre‐eclampsia (PE). Currently, PlGF is used clinically with other biomarkers to screen for high‐risk cases, although the mechanisms underlying its regulation are largely unknown. Placental endoplasmic reticulum (ER) stress has recently been found to be elevated in cases of FGR, and to an even greater extent in early‐onset PE complicated with FGR. ER stress activates the unfolded protein response (UPR); attenuation of protein translation and a reduction in cell growth and proliferation play crucial roles in the pathophysiology of these complications of pregnancy. In this study, we further identified that ER stress regulates release of PlGF. We first observed that down‐regulation of PlGF protein was associated with nuclear localization of ATF4, ATF6α and ATF6β in the syncytiotrophoblast of placentae from PE patients. Transcript analysis showed a decrease of PlGF mRNA, and an increase from genes encoding those UPR transcription factors in placentae from cases of early‐onset PE, but not of late‐onset (>34 weeks) PE, compared to term controls. Further investigations indicated a strong correlation between ATF4 and PlGF mRNA levels only (r = − 0.73, p < 0.05). These results could be recapitulated in trophoblast‐like cells exposed to chemical inducers of ER stress or hypoxia–reoxygenation. The stability of PlGF transcripts was unchanged. The use of small interfering RNA specific for transcription factors in the UPR pathways revealed that ATF4 and ATF6β, but not ATF6α, modulate PlGF transcription. To conclude, ATF4 and ATF6β act synergistically in the negative regulation of PlGF mRNA expression, resulting in reduced PlGF secretion by the trophoblast in response to stress. Therefore, these results further support the targeting of placental ER stress as a

  1. The human papillomavirus type 16 E7 gene product interacts with and trans-activates the AP1 family of transcription factors.

    PubMed Central

    Antinore, M J; Birrer, M J; Patel, D; Nader, L; McCance, D J

    1996-01-01

    The E7 gene product of human papillomavirus type 16 (HPV16) binds to the retinoblastoma gene product (pRb) and dissociates pRb-E2F complexes. However, the observation that the ability of E7 to bind pRb is not required for the HPV16-induced immortalization of primary keratinocytes prompted a search for other cellular factors bound by E7. Using a glutathione-S-transferase (GST) fusion protein system, we show that E7 complexes with AP1 transcription factors including c-Jun, JunB, JunD and c-Fos. The ability of E7 to complex with c-Jun in vivo is demonstrated by co-immunoprecipitation and the yeast two-hybrid system. An analysis of E7 point mutants in the GST system indicates that the E7 zinc-finger motif, but not the pRb binding domain, is involved in these interactions. Using c-Jun deletion mutants, E7 binding maps between amino acids 224 and 286 of c-Jun. E7 trans-activates c-Jun-induced transcription from a Jun responsive promoter, and this activity correlates with the ability of E7 mutants to bind Jun proteins. Finally, a transcriptionally inactive c-Jun deletion, which can bind E7, interferes with the E7-induced transformation of rat embryo fibroblasts in cooperation with an activated ras, indicating that the Jun-E7 interaction is physiologically relevant and that Jun factors may be targeted in the E7 transformation pathway. Images PMID:8617242

  2. Network and pathway analysis of microRNAs, transcription factors, target genes and host genes in human glioma

    PubMed Central

    ZHANG, YING; ZHAO, SHISHUN; XU, ZHIWEN

    2016-01-01

    To date, there has been rapid development with regard to gene and microRNA (miR/miRNA) research in gliomas. However, the regulatory mechanisms of the associated genes and miRNAs remain unclear. In the present study, the genes, miRNAs and transcription factors (TFs) were considered as elements in the regulatory network, and focus was placed on the associations between TFs and miRNAs, miRNAs and target genes, and miRNAs and host genes. In order to show the regulatory correlation clearly, all the elements were investigated and three regulatory networks, namely the differentially-expressed, related and global networks, were constructed. Certain important pathways were highlighted, with analysis of the similarities and differences among the networks. Next, the upstream and downstream elements of differentially-expressed genes, miRNAs and predicted TFs were listed. The most notable aspect of the present study was the three levels of network, particularly the differentially-expressed network, since the differentially-expressed associations that these networks provide appear at the initial stages of cancers such as glioma. If the states of the differentially-expressed associations can be adjusted to the normal state via alterations in regulatory associations, which were also recorded in the study networks and tables, it is likely that cancer can be regulated or even avoided. In the present study, the differentially-expressed network illuminated the pathogenesis of glioma; for example, a TF can regulate one or more miRNAs, and a target gene can be targeted by one or more miRNAs. Therefore, the host genes and target genes, the host genes and TFs, and the target genes and TFs indirectly affect each other through miRNAs. The association also exists between TFs and TFs, target genes and target genes, and host genes and host genes. The present study also demonstrated self-adaption associations and circle-regulations. The related network further described the regulatory mechanism

  3. Potential Role of Activating Transcription Factor 5 during Osteogenesis.

    PubMed

    Vicari, Luisa; Calabrese, Giovanna; Forte, Stefano; Giuffrida, Raffaella; Colarossi, Cristina; Parrinello, Nunziatina Laura; Memeo, Lorenzo

    2016-01-01

    Human adipose-derived stem cells are an abundant population of stem cells readily isolated from human adipose tissue that can differentiate into connective tissue lineages including bone, cartilage, fat, and muscle. Activating transcription factor 5 is a transcription factor of the ATF/cAMP response element-binding protein (CREB) family. It is transcribed in two types of mRNAs (activating transcription factor 5 isoform 1 and activating transcription factor 5 isoform 2), encoding the same single 30-kDa protein. Although it is well demonstrated that it regulates the proliferation, differentiation, and apoptosis, little is known about its potential role in osteogenic differentiation. The aim of this study was to evaluate the expression levels of the two isoforms and protein during osteogenic differentiation of human adipose-derived stem cells. Our data indicate that activating transcription factor 5 is differentially expressed reaching a peak of expression at the stage of bone mineralization. These findings suggest that activating transcription factor 5 could play an interesting regulatory role during osteogenesis, which would provide a powerful tool to study bone physiology. PMID:26770207

  4. Transcriptional regulation of the human biglycan gene.

    PubMed

    Ungefroren, H; Krull, N B

    1996-06-28

    The small leucine-rich proteoglycan biglycan is involved in several physiological and pathophysiological processes through the ability of its core protein to interact with other extracellular matrix molecules and transforming growth factor-beta (TGF-beta). To learn more about the regulation of biglycan core protein expression, we have cloned and sequenced 1218 base pairs from the 5'-flanking region of the human biglycan gene, demonstrated functional promoter activity, and investigated the molecular mechanisms through which various agents modulate its transcriptional activity. Sequencing revealed the presence of several cis-acting elements including multiple AP-2 sites and interleukin-6 response elements, a NF-kappaB site, a TGF-beta negative element, and an E-box. The TATA and CAAT box-lacking promoter possesses many features of a growth-related gene, e.g. a GC-rich immediate 5' region, many Sp1 sites, and the use of multiple transcriptional start sites. Transient transfections of the tumor cell lines MG-63, SK-UT-1, and T47D with various biglycan 5'-flanking region-luciferase reporter gene constructs showed that the proximal 78 base pairs are sufficient for full promoter activity. Several agents among them interleukin-6, and tumor necrosis factor-alpha. were capable of altering biglycan promoter activity. However, in MG-63 cells, TGF-beta1 failed to increase either activity of the biglycan promoter constructs or specific transcription from the endogenous biglycan gene. Since TGF-beta1 also did not alter the stability of cytoplasmic biglycan mRNA as determined from Northern analysis after inhibition of transcription with 5,6-dichloro-1beta-D-ribofuranosylbenzimidazole, an as yet unidentified nuclear post-transcriptional mechanism was considered responsible for the TGF-beta effect in this cell type. These results might help to elucidate the molecular pathways leading to pathological alterations of biglycan expression observed in atherosclerosis, glomerulonephritis

  5. Chemical and genetic blockade of HDACs enhances osteogenic differentiation of human adipose tissue-derived stem cells by oppositely affecting osteogenic and adipogenic transcription factors.

    PubMed

    Maroni, Paola; Brini, Anna Teresa; Arrigoni, Elena; de Girolamo, Laura; Niada, Stefania; Matteucci, Emanuela; Bendinelli, Paola; Desiderio, Maria Alfonsina

    2012-11-16

    The human adipose-tissue derived stem/stromal cells (hASCs) are an interesting source for bone-tissue engineering applications. Our aim was to clarify in hASCs the role of acetylation in the control of Runt-related transcription factor 2 (Runx2) and Peroxisome proliferator activated receptor (PPAR) γ. These key osteogenic and adipogenic transcription factors are oppositely involved in osteo-differentiation. The hASCs, committed or not towards bone lineage with osteoinductive medium, were exposed to HDACs chemical blockade with Trichostatin A (TSA) or were genetically silenced for HDACs. Alkaline phosphatase (ALP) and collagen/calcium deposition, considered as early and late osteogenic markers, were evaluated concomitantly as index of osteo-differentiation. TSA pretreatment, useful experimental protocol to analyse pan-HDAC-chemical inhibition, and switch to osteogenic medium induced early-osteoblast maturation gene Runx2, while transiently decreased PPARγ and scarcely affected late-differentiation markers. Time-dependent effects were observed after knocking-down of HDAC1 and 3: Runx2 and ALP underwent early activation, followed by late-osteogenic markers increase and by PPARγ/ALP activity diminutions mostly after HDAC3 silencing. HDAC1 and 3 genetic blockade increased and decreased Runx2 and PPARγ target genes, respectively. Noteworthy, HDACs knocking-down favoured the commitment effect of osteogenic medium. Our results reveal a role for HDACs in orchestrating osteo-differentiation of hASCs at transcriptional level, and might provide new insights into the modulation of hASCs-based regenerative therapy. PMID:23085045

  6. Phylogenetic and Transcription Analysis of Chrysanthemum WRKY Transcription Factors

    PubMed Central

    Song, Aiping; Li, Peiling; Jiang, Jiafu; Chen, Sumei; Li, Huiyun; Zeng, Jun; Shao, Yafeng; Zhu, Lu; Zhang, Zhaohe; Chen, Fadi

    2014-01-01

    WRKY transcription factors are known to function in a number of plant processes. Here we have characterized 15 WRKY family genes of the important ornamental species chrysanthemum (Chrysanthemum morifolium). A total of 15 distinct sequences were isolated; initially internal fragments were amplified based on transcriptomic sequence, and then the full length cDNAs were obtained using RACE (rapid amplification of cDNA ends) PCR. The transcription of these 15 genes in response to a variety of phytohormone treatments and both biotic and abiotic stresses was characterized. Some of the genes behaved as would be predicted based on their homology with Arabidopsis thaliana WRKY genes, but others showed divergent behavior. PMID:25196345

  7. Targeting human respiratory syncytial virus transcription anti-termination factor M2-1 to inhibit in vivo viral replication

    PubMed Central

    Bailly, B.; Richard, C.-A.; Sharma, G.; Wang, L.; Johansen, L.; Cao, J.; Pendharkar, V.; Sharma, D.-C.; Galloux, M.; Wang, Y.; Cui, R.; Zou, G.; Guillon, P.; von Itzstein, M.; Eléouët, J.-F.; Altmeyer, R.

    2016-01-01

    Human respiratory syncytial virus (hRSV) is a leading cause of acute lower respiratory tract infection in infants, elderly and immunocompromised individuals. To date, no specific antiviral drug is available to treat or prevent this disease. Here, we report that the Smoothened receptor (Smo) antagonist cyclopamine acts as a potent and selective inhibitor of in vitro and in vivo hRSV replication. Cyclopamine inhibits hRSV through a novel, Smo-independent mechanism. It specifically impairs the function of the hRSV RNA-dependent RNA polymerase complex notably by reducing expression levels of the viral anti-termination factor M2-1. The relevance of these findings is corroborated by the demonstration that a single R151K mutation in M2-1 is sufficient to confer virus resistance to cyclopamine in vitro and that cyclopamine is able to reduce virus titers in a mouse model of hRSV infection. The results of our study open a novel avenue for the development of future therapies against hRSV infection. PMID:27194388

  8. Sphingosine-1-phosphate induces human endothelial VEGF and MMP-2 production via transcription factor ZNF580: Novel insights into angiogenesis

    SciTech Connect

    Sun, Hui-Yan; Wei, Shu-Ping; Xu, Rui-Cheng; Xu, Peng-Xiao; Zhang, Wen-Cheng

    2010-05-07

    Sphingosine-1-phosphate (S1P)-induced migration and proliferation of endothelial cells are critical for angiogenesis. C2H2-zinc finger (ZNF) proteins usually play an essential role in altering gene expression and regulating the angiogenesis. The aim of this study is to investigate whether a novel human C2H2-zinc finger gene ZNF580 (Gene ID: 51157) is involved in the migration and proliferation of endothelial cells stimulated by S1P. Our study shows that EAhy926 endothelial cells express S1P1, S1P3 and S1P5 receptors. Furthermore, S1P upregulates both ZNF580 mRNA and protein levels in a concentration- and time-dependent manner. SB203580, the specific inhibitor of the p38 mitogen-activated protein kinase (p38 MAPK) pathway, blocks the S1P-induced upregulation of ZNF580. Moreover, overexpression/downexpression of ZNF580 in EAhy926 cells leads to the enhancement/decrease of matrix metalloproteinase-2 (MMP-2) and vascular endothelial growth factor (VEGF) expression as well as the migration and proliferation of EAhy926 endothelial cells. These results elucidate the important role that ZNF580 plays in the process of migration and proliferation of endothelial cells, which provides a foundation for a novel approach to regulate angiogenesis.

  9. Beyond microarrays: Finding key transcription factors controlling signal transduction pathways

    PubMed Central

    Kel, Alexdander; Voss, Nico; Jauregui, Ruy; Kel-Margoulis, Olga; Wingender, Edgar

    2006-01-01

    Background Massive gene expression changes in different cellular states measured by microarrays, in fact, reflect just an "echo" of real molecular processes in the cells. Transcription factors constitute a class of the regulatory molecules that typically require posttranscriptional modifications or ligand binding in order to exert their function. Therefore, such important functional changes of transcription factors are not directly visible in the microarray experiments. Results We developed a novel approach to find key transcription factors that may explain concerted expression changes of specific components of the signal transduction network. The approach aims at revealing evidence of positive feedback loops in the signal transduction circuits through activation of pathway-specific transcription factors. We demonstrate that promoters of genes encoding components of many known signal transduction pathways are enriched by binding sites of those transcription factors that are endpoints of the considered pathways. Application of the approach to the microarray gene expression data on TNF-alpha stimulated primary human endothelial cells helped to reveal novel key transcription factors potentially involved in the regulation of the signal transduction pathways of the cells. Conclusion We developed a novel computational approach for revealing key transcription factors by knowledge-based analysis of gene expression data with the help of databases on gene regulatory networks (TRANSFAC® and TRANSPATH®). The corresponding software and databases are available at . PMID:17118134

  10. A nuclear factor induced by hypoxia via de novo protein synthesis binds to the human erythropoietin gene enhancer at a site required for transcriptional activation.

    PubMed Central

    Semenza, G L; Wang, G L

    1992-01-01

    We have identified a 50-nucleotide enhancer from the human erythropoietin gene 3'-flanking sequence which can mediate a sevenfold transcriptional induction in response to hypoxia when cloned 3' to a simian virus 40 promoter-chloramphenicol acetyltransferase reporter gene and transiently expressed in Hep3B cells. Nucleotides (nt) 1 to 33 of this sequence mediate sevenfold induction of reporter gene expression when present in two tandem copies compared with threefold induction when present in a single copy, suggesting that nt 34 to 50 bind a factor which amplifies the induction signal. DNase I footprinting demonstrated binding of a constitutive nuclear factor to nt 26 to 48. Mutagenesis studies revealed that nt 4 to 12 and 19 to 23 are essential for induction, as substitutions at either site eliminated hypoxia-induced expression. Electrophoretic mobility shift assays identified a nuclear factor which bound to a probe spanning nt 1 to 18 but not to a probe containing a mutation which eliminated enhancer function. Factor binding was induced by hypoxia, and its induction was sensitive to cycloheximide treatment. We have thus defined a functionally tripartite, 50-nt hypoxia-inducible enhancer which binds several nuclear factors, one of which is induced by hypoxia via de novo protein synthesis. Images PMID:1448077

  11. Involvement of doublesex and mab-3-related transcription factors in human female germ cell development demonstrated by xenograft and interference RNA strategies.

    PubMed

    Poulain, Marine; Frydman, Nelly; Tourpin, Sophie; Muczynski, Vincent; Mucsynski, Vincent; Souquet, Benoit; Benachi, Alexandra; Habert, René; Rouiller-Fabre, Virginie; Livera, Gabriel

    2014-10-01

    We identified three doublesex and mab-3-related transcription factors (DMRT) that were sexually differentially expressed in human fetal gonads and present in the ovaries at the time of meiotic initiation. These were also identified in murine embryonic female germ cells. Among these, we focused on DMRTA2 (DMRT5), whose function is unknown in the developing gonads, and clarified its role in human female fetal germ cells, using an original xenograft model. Early human fetal ovaries (8-11 weeks post-fertilization) were grafted into nude mice. Grafted ovaries developed normally, with no apparent overt changes, when compared with ungrafted ovaries at equivalent developmental stages. Appropriate germ cell density, mitotic/meiotic transition, markers of meiotic progression and follicle formation were evident. Four weeks after grafting, mice were treated with siRNA, specifically targeting human DMRTA2 mRNA. DMRTA2 inhibition triggered an increase in undifferentiated FUT4-positive germ cells and a decrease in the percentage of meiotic γH2AX-positive germ cells, when compared with mice that were injected with control siRNA. Interestingly, the expression of markers associated with pre-meiotic germ cell differentiation was also impaired, as was the expression of DMRTB1 (DMRT6) and DMRTC2 (DMRT7). This study reveals, for the first time, the requirement of DMRTA2 for normal human female embryonic germ cell development. DMRTA2 appears to be necessary for proper differentiation of oogonia, prior to entry into meiosis, in the human species. Additionally, we developed a new model of organ xenografting, coupled with RNA interference, which provides a useful tool for genetic investigations of human germline development. PMID:25082981

  12. Expression patterns of transcription factor PPARγ and C/EBP family members during in vitro adipogenesis of human bone marrow mesenchymal stem cells.

    PubMed

    Zhao, Xiao-Yi; Chen, Xiao-Yong; Zhang, Zi-Ji; Kang, Yan; Liao, Wei-Ming; Yu, Wei-Hua; Xiang, Andy Peng

    2015-04-01

    In the past decades increasing lines of evidence have demonstrated that adipose tissue, as an endocrine organ plays a central role in metabolic homeostasis and its related maladies. CCAAT/enhancer-binding protein (C/EBP) family members and the nuclear receptor peroxisome proliferator-activated receptor gamma (PPARγ) were known to be the vital transcription factors in the regulation of adipogenesis. However, the exact mechanism for increased marrow fat in patients with bone metabolic diseases, such as osteoporosis, is still poorly understood. Herein, we studied the expression pattern of PPARγ and C/EBPs in human bone marrow mesenchymal stem cell (hBMSC) adipogenesis and evaluated the effects of individual components of an adipogenic cocktail on the differentiation and transcription factor expression. We furthermore examined whether the ERK signaling pathway was involved in mediating these effects. These findings showed that C/EBPβ and C/EBPδ were detected in undifferentiated hBMSC and maintained during the whole process of adipogenesis, and could initiate the expression of PPARγ1 under the treatment of dexamethasone and IBMX. Subsequently, the activation of PPARγ1 by indomethacin, its exogenous ligand, activated C/EBPα, which, together with IBMX, up-regulated PPARγ2 expression and therefore the fullest adipogenesis. Insulin and its downstream signal pathway extracellular signal-regulated kinases (ERK), however, were found not necessary for hBMSC adipogenesis. Our results revealed some unique characteristics of human adipocyte formation, which may help to understand the molecular mechanisms of bone marrow adipogenesis and give insights into the treatment of osteoporosis. PMID:25523390

  13. Experimental determination of the evolvability of a transcription factor.

    PubMed

    Maerkl, Sebastian J; Quake, Stephen R

    2009-11-01

    Sequence-specific binding of a transcription factor to DNA is the central event in any transcriptional regulatory network. However, relatively little is known about the evolutionary plasticity of transcription factors. For example, the exact functional consequence of an amino acid substitution on the DNA-binding specificity of most transcription factors is currently not predictable. Furthermore, although the major structural families of transcription factors have been identified, the detailed DNA-binding repertoires within most families have not been characterized. We studied the sequence recognition code and evolvability of the basic helix-loop-helix transcription factor family by creating all possible 95 single-point mutations of five DNA-contacting residues of Max, a human helix-loop-helix transcription factor and measured the detailed DNA-binding repertoire of each mutant. Our results show that the sequence-specific repertoire of Max accessible through single-point mutations is extremely limited, and we are able to predict 92% of the naturally occurring diversity at these positions. All naturally occurring basic regions were also found to be accessible through functional intermediates. Finally, we observed a set of amino acids that are functional in vitro but are not found to be used naturally, indicating that functionality alone is not sufficient for selection. PMID:19841254

  14. Transcriptional activation in yeast cells lacking transcription factor IIA.

    PubMed Central

    Chou, S; Chatterjee, S; Lee, M; Struhl, K

    1999-01-01

    The general transcription factor IIA (TFIIA) forms a complex with TFIID at the TATA promoter element, and it inhibits the function of several negative regulators of the TATA-binding protein (TBP) subunit of TFIID. Biochemical experiments suggest that TFIIA is important in the response to transcriptional activators because activation domains can interact with TFIIA, increase recruitment of TFIID and TFIIA to the promoter, and promote isomerization of the TFIID-TFIIA-TATA complex. Here, we describe a double-shut-off approach to deplete yeast cells of Toa1, the large subunit of TFIIA, to <1% of the wild-type level. Interestingly, such TFIIA-depleted cells are essentially unaffected for activation by heat shock factor, Ace1, and Gal4-VP16. However, depletion of TFIIA causes a general two- to threefold decrease of transcription from most yeast promoters and a specific cell-cycle arrest at the G2-M boundary. These results indicate that transcriptional activation in vivo can occur in the absence of TFIIA. PMID:10581267

  15. Physcion inhibits the metastatic potential of human colorectal cancer SW620 cells in vitro by suppressing the transcription factor SOX2

    PubMed Central

    Han, Yan-tao; Chen, Xue-hong; Gao, Hui; Ye, Jun-li; Wang, Chun-bo

    2016-01-01

    Aim: Physcion, an anthraquinone derivative, exhibits hepatoprotective, anti-inflammatory, anti-microbial and anti-cancer activities. In this study we examined whether and how physcion inhibited metastatic potential of human colorectal cancer cells in vitro. Methods: Human colorectal cancer cell line SW620 was tested. Cell migration and invasion were assessed using a wound healing and Transwell assay, respectively. The expression levels of transcription factor SOX2 in the cells were modulated with shRNA targeting SOX2 and SOX2 overexpressing plasmid. The expression of target molecules involved in epithelial-mesenchymal transition (EMT) process and the signaling pathways was determined with Western blots or qRT-PCR. ROS levels were measured using DCF-DA. Results: Physcion (2.5, 5 mol/L) did not affect the cell viability, but dose-dependently inhibited the cell adhesion, migration and invasion. Physcion also inhibited the EMT process in the cells, as evidenced by the increased epithelial marker E-cadherin expression, and by decreased expression of mesenchymal markers N-cadherin, vimentin, fibronectin and α-SMA, as well as transcriptional repressors Snail, Slug and Twist. Physcion suppressed the expression of SOX2, whereas overexpression of SOX2 abrogated the inhibition of physcion on metastatic behaviors. Physcion markedly increased ROS production and phosphorylation of AMPK and GSK3β in the cells, whereas the AMPK inhibitor compound C or the ROS inhibitor NAC abolished the inhibition of physcion on metastatic behaviors. Conclusion: Physcion inhibits the metastatic potential of human colorectal cancer cells in vitro via activating ROS/AMPK/GSK3β signaling pathways and suppressing SOX2. PMID:26707141

  16. Up-Regulation of CREG Expression by the Transcription Factor GATA1 Inhibits High Glucose- and High Palmitate-Induced Apoptosis in Human Umbilical Vein Endothelial Cells

    PubMed Central

    Li, Yang; Liu, Dan; Liu, Meili; Zhang, Xiaolin; Zhang, Quanyu; Yan, Chenghui; Han, Yaling

    2016-01-01

    Background Endothelial cell (EC) apoptosis plays a vital role in the pathogenesis of atherosclerosis in patients with diabetes mellitus (DM), but the underlying mechanism remains unclear. Cellular repressor of E1A-stimulated genes (CREG) is a novel gene reported to be involved in maintaining the homeostasis of ECs. Therefore, in the present study, we investigated the role of CREG in high glucose/high palmitate-induced EC apoptosis and to decipher the upstream regulatory mechanism underlying the transcriptional regulation of CREG. Methods The expression of CREG and the rate of apoptosis were assessed in lower-limb atherosclerotic lesions from patients with type 2 DM (T2DM). Primary human umbilical vein endothelial cells (HUVECs) were isolated and cultured in a high glucose/high palmitate medium (25 mmol/L D-glucose, 0.4 mmol/L palmitate), and the over-expression and knock-down of CREG were performed in HUVECs to determine the role of CREG in EC apoptosis. The upstream regulatory mechanism of CREG was identified using a promoter-binding transcription-factor profiling array, chromatin immunoprecipitation (ChIP) assay and a mutation analysis. Results Compared with normal arteries from non-diabetic patients, reduced CREG expression and increased apoptosis were found in the endothelium of atherosclerotic lesions from patients with T2DM. In vitro treatment of HUVECs with a high glucose/high palmitate medium also resulted in decreased CREG expression and increased apoptosis. Moreover, high glucose/high palmitate induced-HUVEC apoptosis was increased by the knock-down of CREG and rescued by the over-expression of CREG. We also demonstrated that GATA1 was able to bind to the promoter of the human CREG gene. A deletion mutation at -297/-292 in the CREG promoter disrupted GATA1 binding and reduced the activation of CREG transcription by approximately 83.3%. Finally, the overexpression of GATA1 abrogated the high glucose/high palmitate-induced apoptosis in HUVECs. Conclusions

  17. Optogenetic Inhibitor of the Transcription Factor CREB.

    PubMed

    Ali, Ahmed M; Reis, Jakeb M; Xia, Yan; Rashid, Asim J; Mercaldo, Valentina; Walters, Brandon J; Brechun, Katherine E; Borisenko, Vitali; Josselyn, Sheena A; Karanicolas, John; Woolley, G Andrew

    2015-11-19

    Current approaches for optogenetic control of transcription do not mimic the activity of endogenous transcription factors, which act at numerous sites in the genome in a complex interplay with other factors. Optogenetic control of dominant negative versions of endogenous transcription factors provides a mechanism for mimicking the natural regulation of gene expression. Here we describe opto-DN-CREB, a blue-light-controlled inhibitor of the transcription factor CREB created by fusing the dominant negative inhibitor A-CREB to photoactive yellow protein (PYP). A light-driven conformational change in PYP prevents coiled-coil formation between A-CREB and CREB, thereby activating CREB. Optogenetic control of CREB function was characterized in vitro, in HEK293T cells, and in neurons where blue light enabled control of expression of the CREB targets NR4A2 and c-Fos. Dominant negative inhibitors exist for numerous transcription factors; linking these to optogenetic domains offers a general approach for spatiotemporal control of native transcriptional events. PMID:26590638

  18. Epigenetic role of CCAAT box-binding transcription factor NF-Y on ID gene family in human embryonic carcinoma cells.

    PubMed

    Moeinvaziri, Farideh; Shahhoseini, Maryam

    2015-11-01

    Nuclear factor Y (NF-Y) is a histone substitute protein that specifically binds to the CCAAT box of the target genes and thereby promotes their regulation. NF-Y transcription factor, with defined CCAAT element-binding activities, target a gene family that encodes a group of basic helix-loop-helix ID factors (ID1-ID4), with or without CCAAT box at their promoter region. In this study, the expressions of NF-Y in mRNA and protein level were evaluated in a human embryonic carcinoma cell line, named NTera2, before and after 7 days induction of differentiation. We also looked into expression levels of ID genes in NTera2 cells during differentiation because of their critical role in development. By using chromatin immunoprecipitation coupled with real-time polymerase chain reaction, NF-Y incorporation and acetylation/dimethylation of histone H3 at lysine 9 (H3K9ac/me2) was quantitatively evaluated on the regulatory regions of considered genes to monitor the changes in epigenetic markers at ID gene promoters throughout differentiation. The results demonstrated a marked down-regulation of ID1, ID2, and ID3 genes, parallel to a loss of NF-Y binding to the promoters of these genes. The data show that although the genes encoding NF-Y complex remained expressed at mRNA level, NF-YC is lost at the protein level onset of differentiation. Additionally, the epigenetic marks of H3K9ac and H3K9me2 at the target gene promoters decreased and increased, respectively, after 1 day of differentiation. It is suggested that, in the absence of NF-Y binding, the corresponding regions adopt a heterochromatic nature, whereas when NF-Y comes back after 7 days of differentiation, the ID1-3 promoters become again converted into active chromatin. The ID4 gene, lacking a CCAAT box, behaves differently and does not show any incorporation. This experiment implies for the first time that the presence of NF-Y transcription factor plays a pivotal role in transcriptional regulation of ID genes in

  19. Competitive binding of viral E2 protein and mammalian core-binding factor to transcriptional control sequences of human papillomavirus type 8 and bovine papillomavirus type 1.

    PubMed Central

    Schmidt, H M; Steger, G; Pfister, H

    1997-01-01

    The promoter P7535 of human papillomavirus type 8 and the promoter P7185 of bovine papillomavirus type 1 are negatively regulated by viral E2 proteins via the promoter proximal binding sites P2 and BS1, respectively. Mutations of these E2 binding sites can reduce basal promoter activity. This suggests binding of a transcription-stimulating factor and may indicate that repression by E2 is due to competitive binding of viral and cellular proteins. A computer search revealed putative binding sites for core-binding factor (CBF; also referred to as PEA2, PEBP2, or AML), overlapping with P2 and BS1. Binding of recombinant CBF proteins to these sites was confirmed by band shift analysis. Competition of CBF and E2 protein for DNA binding was shown for both human papillomavirus type 8 and bovine papillomavirus type 1. The importance of CBF-E2 competition in E2-mediated repression could be demonstrated by comparing the E2 effect on P7185 activity in two cell lines containing different amounts of endogenous CBF. In cells with large amounts of CBF, E2 repressed P7185 wild-type constructs to the basal promoter activity of a mutant (50%) that could not bind this protein any more. In contrast, in a cell line containing small amounts of CBF, the promoter activities of constructs with wild-type and mutated CBF binding sites hardly differed and specific repression by E2 was not detectable. PMID:9311900

  20. DNA bending is induced by a transcription factor that interacts with the human c-FOS and alpha-actin promoters.

    PubMed Central

    Gustafson, T A; Taylor, A; Kedes, L

    1989-01-01

    Conserved sequence elements in the human cardiac and skeletal alpha-actin promoters that contain the CC(A + T-rich)6GG motif have been shown to regulate transcription of these genes. A similar sequence is found in the serum response element of the human c-FOS gene. In this study, we demonstrate that indistinguishable proteins bind to each of five CC(A + T-rich)6GG elements examined in the human cardiac and skeletal alpha-actin promoters and the c-FOS serum response element. Using electrophoretic techniques, we show that these factors induce a stable bend in the DNA upon binding, and the bend center is shown to coincide with the CC(A + T-rich)6GG element. In addition, the ability to bend DNA is retained by a small proteolytic fragment of the protein, suggesting that the DNA-binding domain of the protein is resistant to proteases and is sufficient to bend DNA. Images PMID:2494661

  1. Regulation of cytochrome b5 gene transcription by Sp3, GATA-6, and steroidogenic factor 1 in human adrenal NCI-H295A cells.

    PubMed

    Huang, Ningwu; Dardis, Andrea; Miller, Walter L

    2005-08-01

    Sex steroid synthesis requires the 17,20 lyase activity of P450c17, which is enhanced by cytochrome b5, acting as an allosteric factor to promote association of P450c17 with its electron donor, P450 oxidoreductase. Cytochrome b5 is preferentially expressed in the fetal adrenal and postadrenarchal adrenal zona reticularis; the basis of this tissue-specific, developmentally regulated transcription of the b5 gene is unknown. We found b5 expression in all cell lines tested, including human adrenal NCI-H295A cells, where its mRNA is reduced by cAMP and phorbol ester. Multiple sites, between -83 and -122 bp upstream from the first ATG, initiate transcription. Deletional mutagenesis localized all detectable promoter activity within -327/+15, and deoxyribonuclease I footprinting identified protein binding at -72/-107 and -157/-197. DNA segments -65/-40, -114/-70 and -270/-245 fused to TK32/Luc yielded significant activity, and mutations in their Sp sites abolished that activity; electrophoretic mobility shift assay (EMSA) showed that Sp3, but not Sp1, binds to these Sp sites. Nuclear factor 1 (NF-1) and GATA-6, but not GATA-4 bind to the NF-1 and GATA sites in -157/-197. In Drosophila S2 cells, Sp3 increased -327/Luc activity 58-fold, but Sp1 and NF-1 isoforms were inactive. Mutating the three Sp sites ablated activity without or with cotransfection of Sp1/Sp3. In NCI-H295A cells, mutating the three Sp sites reduced activity to 39%; mutating the Sp, GATA, and NF-1 sites abolished activity. In JEG-3 cells, GATA-4 was inactive, GATA-6 augmented -327/Luc activity to 231% over the control, and steroidogenic factor 1 augmented activity to 655% over the control; these activities required the Sp and NF-1 sites. Transcription of cytochrome b5 shares many features with the regulation of P450c17, whose activity it enhances. PMID:15831526

  2. Expression of active iron regulatory factor from a full-length human cDNA by in vitro transcription/translation.

    PubMed Central

    Hirling, H; Emery-Goodman, A; Thompson, N; Neupert, B; Seiser, C; Kühn, L C

    1992-01-01

    Iron regulatory factor (IRF), also called iron responsive element-binding protein (IRE-BP), is a cytoplasmic RNA-binding protein which regulates post-transcriptionally transferrin receptor mRNA stability and ferritin mRNA translation. By using the polymerase chain reaction (PCR) and the sequence published by Rouault et al. (1990) a probe was derived which permitted the isolation of three human IRF cDNA clones. Hybridization to genomic DNA and mRNA, as well as sequencing data indicated a single copy gene of about 40 kb specifying a 4.0 kb mRNA that translates into a protein of 98,400 dalton. By in vitro transcription of a assembled IRF cDNA coupled to in vitro translation in a wheat germ extract, we obtained full sized IRF that bound specifically to a human ferritin IRE. In vitro translated IRF retained sensitivity to sulfhydryl oxidation by diamide and could be reactivated by beta-mercaptoethanol in the same way as native placental IRF. An IRF deletion mutant shortened by 132 amino acids at the COOH-terminus was no longer able to bind to an IRE, indicating that this region of the protein plays a role in RNA recognition. Placental IRF has previously been shown to migrate as a doublet on SDS-polyacrylamide gels. After V8 protease digestion the heterogeneity was located in a 65/70 kDa NH2-terminal doublet. The liberated 31 kDa COOH-terminal polypeptide was found to be homogeneous by amino acid sequencing supporting the conclusion of a single IRF gene. Images PMID:1738601

  3. Functional Analysis of Transcription Factors in Arabidopsis

    PubMed Central

    Mitsuda, Nobutaka; Ohme-Takagi, Masaru

    2009-01-01

    Transcription factors (TFs) regulate the expression of genes at the transcriptional level. Modification of TF activity dynamically alters the transcriptome, which leads to metabolic and phenotypic changes. Thus, functional analysis of TFs using ‘omics-based’ methodologies is one of the most important areas of the post-genome era. In this mini-review, we present an overview of Arabidopsis TFs and introduce strategies for the functional analysis of plant TFs, which include both traditional and recently developed technologies. These strategies can be assigned to five categories: bioinformatic analysis; analysis of molecular function; expression analysis; phenotype analysis; and network analysis for the description of entire transcriptional regulatory networks. PMID:19478073

  4. Transcription Factors in Xylem Development. Final report

    SciTech Connect

    Sederoff, Ronald; Whetten, Ross; O'Malley, David; Campbell, Malcolm

    1999-07-01

    Answers to the following questions are answered in this report. do the two pine Byb proteins previously identified as candidate transcription factors bind to DNA and activate transcription? In what cell types are tehse Myb proteins expressed? Are these proteins localized to the nucleus? Do other proteins in pine xylem interact with these Myb proteins? Does altered expression of these genes have an impact on xylogenesis, specifically the expression of monolignol biosynthetic genes?

  5. Human herpesvirus 6 (HHV-6) alters E2F1/Rb pathways and utilizes the E2F1 transcription factor to express viral genes

    PubMed Central

    Sharon, Eyal; Volchek, Ludmila; Frenkel, Niza

    2014-01-01

    E2F transcription factors play pivotal roles in controlling the expression of genes involved in cell-cycle progression. Different viruses affect E2F1/retinoblastoma (Rb) interactions by diverse mechanisms releasing E2F1 from its suppressor Rb, enabling viral replication. We show that in T cells infected with human herpesvirus 6A (HHV-6A), the E2F1 protein and its cofactor DP1 increased, whereas the Rb protein underwent massive degradation without hyperphosphorylation at three sites known to control E2F/Rb association. Although E2F1 and DP1 increased without Rb suppression, the E2F1 target genes—including cyclin A, cyclin E, and dihydrofolate reductase—were not up-regulated. To test whether the E2F1/DP1 complexes were used for viral transcription, we scanned the viral genome for genes containing the E2F binding site in their promoters. In the present work, we concentrated on the U27 and U79 genes known to act in viral DNA synthesis. We constructed amplicon-6 vectors containing a GFP reporter gene driven by WT viral promoter or by promoter mutated in the E2F binding site. We found that the expression of the fusion U27 promoter was dependent on the presence of the E2F binding site. Test of the WT U79 promoter yielded >10-fold higher expression of the GFP reporter gene than the mutant U79 promoter with abrogated E2F binding site. Moreover, by using siRNA to E2F1, we found that E2F1 was essential for the activity of the U79 promoter. These findings revealed a unique pathway in HHV-6 replication: The virus causes Rb degradation and uses the increased E2F1 and DP1 factors to transcribe viral genes. PMID:24335704

  6. Functional analysis of the promoter of the mitochondrial phosphate carrier human gene: identification of activator and repressor elements and their transcription factors

    PubMed Central

    2005-01-01

    The phosphate carrier (PiC) catalyses the import of phosphate into mitochondria where it is needed for ATP synthesis. We have analysed the 5′-flanking region of the human PiC gene and found that it has a single transcriptional initiation site and lacks a TATA box. Through deletion analysis of the −1213/−25 nt region, we identified an activation domain (−223/−25) and an inhibition domain (−1017/−814). The most effective promoter activity in transfected HeLa cells corresponded to the region containing putative binding sites for Sp1 (−163/−142; where Sp1 stands for stimulating protein-1) and CREB (−138/−116; where CREB stands for cAMP-response-element-binding protein). These DNA sequences were active in gel-shift assays in the presence of HeLa cell nuclear extracts or recombinant Sp1 and CREB respectively. Forskolin increased PiC promoter activity via the CREB site. Both footprinting and transfection of deletion constructs of the inhibition region (−1017/−814) showed that PiC silencer activity extends over 25 nt (−943/−919), which specifically binds two proteins present in HeLa cell nuclear extracts. These transcription factors were purified by DNA affinity, analysed by MS and identified as p54nrb/NonO (nuclear RNA binding protein) and PSF (protein-associated splicing factor). The PiC silencer region cloned in front of the ferritin promoter conferred a strong inhibition to the heterologous promoter. These findings may provide insight into control of PiC gene expression in different cell types and under different growth conditions. To our knowledge, this is the first study to analyse the regulation of the PiC gene expression in any cell. PMID:15984930

  7. SERCA2a controls the mode of agonist-induced intracellular Ca2+ signal, transcription factor NFAT and proliferation in human vascular smooth muscle cells.

    PubMed

    Bobe, Regis; Hadri, Lahouaria; Lopez, Jose J; Sassi, Yassine; Atassi, Fabrice; Karakikes, Ioannis; Liang, Lifan; Limon, Isabelle; Lompré, Anne-Marie; Hatem, Stephane N; Hajjar, Roger J; Lipskaia, Larissa

    2011-04-01

    In blood vessels, tone is maintained by agonist-induced cytosolic Ca(2+) oscillations of quiescent/contractile vascular smooth muscle cells (VSMCs). However, in synthetic/proliferative VSMCs, Gq/phosphoinositide receptor-coupled agonists trigger a steady-state increase in cytosolic Ca(2+) followed by a Store Operated Calcium Entry (SOCE) which translates into activation of the proliferation-associated transcription factor NFAT. Here, we report that in human coronary artery smooth muscle cells (hCASMCs), the sarco/endoplasmic reticulum calcium ATPase type 2a (SERCA2a) expressed in the contractile form of the hCASMCs, controls the nature of the agonist-induced Ca(2+) transient and the resulting down-stream signaling pathway. Indeed, restoring SERCA2a expression by gene transfer in synthetic hCASMCs 1) increased Ca(2+) storage capacity; 2) modified agonist-induced IP(3)R Ca(2+) release from steady-state to oscillatory mode (the frequency of agonist-induced IP(3)R Ca(2+) signal was 11.66 ± 1.40/100 s in SERCA2a-expressing cells (n=39) vs 1.37 ± 0.20/100 s in control cells (n=45), p<0.01); 3) suppressed SOCE by preventing interactions between SR calcium sensor STIM1 and pore forming unit ORAI1; 4) inhibited calcium regulated transcription factor NFAT and its down-stream physiological function such as proliferation and migration. This study provides evidence for the first time that oscillatory and steady-state patterns of Ca(2+) transients have different effects on calcium-dependent physiological functions in smooth muscle cells. PMID:21195084

  8. Cell fate control by pioneer transcription factors.

    PubMed

    Iwafuchi-Doi, Makiko; Zaret, Kenneth S

    2016-06-01

    Distinct combinations of transcription factors are necessary to elicit cell fate changes in embryonic development. Yet within each group of fate-changing transcription factors, a subset called 'pioneer factors' are dominant in their ability to engage silent, unmarked chromatin and initiate the recruitment of other factors, thereby imparting new function to regulatory DNA sequences. Recent studies have shown that pioneer factors are also crucial for cellular reprogramming and that they are implicated in the marked changes in gene regulatory networks that occur in various cancers. Here, we provide an overview of the contexts in which pioneer factors function, how they can target silent genes, and their limitations at regions of heterochromatin. Understanding how pioneer factors regulate gene expression greatly enhances our understanding of how specific developmental lineages are established as well as how cell fates can be manipulated. PMID:27246709

  9. Identification of EhTIF-IA: The putative E. histolytica orthologue of the human ribosomal RNA transcription initiation factor-IA.

    PubMed

    Srivastava, Ankita; Bhattacharya, Alok; Bhattacharya, Sudha; Jhingan, Gagan Deep

    2016-03-01

    Initiation of rDNA transcription requires the assembly of a specific multi-protein complex at the rDNA promoter containing the RNA Pol I with auxiliary factors. One of these factors is known as Rrn3P in yeast and Transcription Initiation Factor IA (TIF-IA) in mammals. Rrn3p/TIF-IA serves as a bridge between RNA Pol I and the pre-initiation complex at the promoter. It is phosphorylated at multiple sites and is involved in regulation of rDNA transcription in a growth-dependent manner. In the early branching parasitic protist Entamoeba histolytica, the rRNA genes are present exclusively on circular extra chromosomal plasmids. The protein factors involved in regulation of rDNA transcription in E. histolytica are not known. We have identified the E. histolytica equivalent of TIF-1A (EhTIF-IA) by homology search within the database and was further cloned and expressed. Immuno-localization studies showed that EhTIF-IA co-localized partially with fibrillarin in the peripherally localized nucleolus. EhTIF-IA was shown to interact with the RNA Pol I-specific subunit RPA12 both in vivo and in vitro. Mass spectroscopy data identified RNA Pol I-specific subunits and other nucleolar proteins to be the interacting partners of EhTIF-IA. Our study demonstrates for the first time a conserved putative RNA Pol I transcription factor TIF-IA in E. histolytica. PMID:26949087

  10. Chemical and genetic blockade of HDACs enhances osteogenic differentiation of human adipose tissue-derived stem cells by oppositely affecting osteogenic and adipogenic transcription factors

    SciTech Connect

    Maroni, Paola; Brini, Anna Teresa; Arrigoni, Elena; Girolamo, Laura de; Niada, Stefania; Matteucci, Emanuela; Bendinelli, Paola; Desiderio, Maria Alfonsina

    2012-11-16

    Highlights: Black-Right-Pointing-Pointer Acetylation affected hASCs osteodifferentiation through Runx2-PPAR{gamma}. Black-Right-Pointing-Pointer HDACs knocking-down favoured the commitment effect of osteogenic medium. Black-Right-Pointing-Pointer HDACs silencing early activated Runx2 and ALP. Black-Right-Pointing-Pointer PPAR{gamma} reduction and calcium/collagen deposition occurred later. Black-Right-Pointing-Pointer Runx2/PPAR{gamma} target genes were modulated in line with HDACs role in osteo-commitment. -- Abstract: The human adipose-tissue derived stem/stromal cells (hASCs) are an interesting source for bone-tissue engineering applications. Our aim was to clarify in hASCs the role of acetylation in the control of Runt-related transcription factor 2 (Runx2) and Peroxisome proliferator activated receptor (PPAR) {gamma}. These key osteogenic and adipogenic transcription factors are oppositely involved in osteo-differentiation. The hASCs, committed or not towards bone lineage with osteoinductive medium, were exposed to HDACs chemical blockade with Trichostatin A (TSA) or were genetically silenced for HDACs. Alkaline phosphatase (ALP) and collagen/calcium deposition, considered as early and late osteogenic markers, were evaluated concomitantly as index of osteo-differentiation. TSA pretreatment, useful experimental protocol to analyse pan-HDAC-chemical inhibition, and switch to osteogenic medium induced early-osteoblast maturation gene Runx2, while transiently decreased PPAR{gamma} and scarcely affected late-differentiation markers. Time-dependent effects were observed after knocking-down of HDAC1 and 3: Runx2 and ALP underwent early activation, followed by late-osteogenic markers increase and by PPAR{gamma}/ALP activity diminutions mostly after HDAC3 silencing. HDAC1 and 3 genetic blockade increased and decreased Runx2 and PPAR{gamma} target genes, respectively. Noteworthy, HDACs knocking-down favoured the commitment effect of osteogenic medium. Our results reveal