Science.gov

Sample records for human transcripts generates

  1. A Progenitor Cell Expressing Transcription Factor RORγt Generates All Human Innate Lymphoid Cell Subsets.

    PubMed

    Scoville, Steven D; Mundy-Bosse, Bethany L; Zhang, Michael H; Chen, Li; Zhang, Xiaoli; Keller, Karen A; Hughes, Tiffany; Chen, Luxi; Cheng, Stephanie; Bergin, Stephen M; Mao, Hsiaoyin C; McClory, Susan; Yu, Jianhua; Carson, William E; Caligiuri, Michael A; Freud, Aharon G

    2016-05-17

    The current model of murine innate lymphoid cell (ILC) development holds that mouse ILCs are derived downstream of the common lymphoid progenitor through lineage-restricted progenitors. However, corresponding lineage-restricted progenitors in humans have yet to be discovered. Here we identified a progenitor population in human secondary lymphoid tissues (SLTs) that expressed the transcription factor RORγt and was unique in its ability to generate all known ILC subsets, including natural killer (NK) cells, but not other leukocyte populations. In contrast to murine fate-mapping data, which indicate that only ILC3s express Rorγt, these human progenitor cells as well as human peripheral blood NK cells and all mature ILC populations expressed RORγt. Thus, all human ILCs can be generated through an RORγt(+) developmental pathway from a common progenitor in SLTs. These findings help establish the developmental signals and pathways involved in human ILC development. PMID:27178467

  2. Utility of next-generation RNA-sequencing in identifying chimeric transcription involving human endogenous retroviruses.

    PubMed

    Sokol, Martin; Jessen, Karen Margrethe; Pedersen, Finn Skou

    2016-01-01

    Several studies have shown that human endogenous retroviruses and endogenous retrovirus-like repeats (here collectively HERVs) impose direct regulation on human genes through enhancer and promoter motifs present in their long terminal repeats (LTRs). Although chimeric transcription in which novel gene isoforms containing retroviral and human sequence are transcribed from viral promoters are commonly associated with disease, regulation by HERVs is beneficial in other settings; for example, in human testis chimeric isoforms of TP63 induced by an ERV9 LTR protect the male germ line upon DNA damage by inducing apoptosis, whereas in the human globin locus the γ- and β-globin switch during normal hematopoiesis is mediated by complex interactions of an ERV9 LTR and surrounding human sequence. The advent of deep sequencing or next-generation sequencing (NGS) has revolutionized the way researchers solve important scientific questions and develop novel hypotheses in relation to human genome regulation. We recently applied next-generation paired-end RNA-sequencing (RNA-seq) together with chromatin immunoprecipitation with sequencing (ChIP-seq) to examine ERV9 chimeric transcription in human reference cell lines from Encyclopedia of DNA Elements (ENCODE). This led to the discovery of advanced regulation mechanisms by ERV9s and other HERVs across numerous human loci including transcription of large gene-unannotated genomic regions, as well as cooperative regulation by multiple HERVs and non-LTR repeats such as Alu elements. In this article, well-established examples of human gene regulation by HERVs are reviewed followed by a description of paired-end RNA-seq, and its application in identifying chimeric transcription genome-widely. Based on integrative analyses of RNA-seq and ChIP-seq, data we then present novel examples of regulation by ERV9s of tumor suppressor genes CADM2 and SEMA3A, as well as transcription of an unannotated region. Taken together, this article highlights

  3. Transcriptional Reactivation of OTX2, RX1 and SIX3 during Reprogramming Contributes to the Generation of RPE Cells from Human iPSCs

    PubMed Central

    Li, Peng; Sun, Xiaofeng; Ma, Zhizhong; Liu, Yinan; Jin, Ying; Ge, Ruimin; Hao, Limin; Ma, Yanling; Han, Shuo; Sun, Haojie; Zhang, Mingzhi; Li, Ruizhi; Li, Tao; Shen, Li

    2016-01-01

    Directed differentiation of human induced pluripotent stem cells (iPSCs) into retinal pigmented epithelium (RPE) holds great promise in cell replacement therapy for patients suffering from degenerative eye diseases, including age-related macular degeneration (AMD). In this study, we generated iPSCs from human dermal fibroblasts (HDFs) by electroporation with episomal plasmid vectors encoding OCT4, SOX2, KLF4, L-MYC together with p53 suppression. Intriguingly, cell reprogramming resulted in a metastable transcriptional activation and selective demethylation of neural and retinal specification-associated genes, such as OTX2, RX1 and SIX3. In contrast, RPE progenitor genes were transcriptionally silent in HDFs and descendant iPSCs. Overexpression of OCT4 and SOX2 directly stimulated the expression of OTX2, RX1 and SIX3 in HDFs and iPSCs. Luciferase and chromatin immunoprecipitation (ChIP) assays further identified an OCT4- and two SOX2-binding sites located in the proximal promoter of OTX2. Histone acetylation and methylation on the local promoter also participated in the reactivation of OTX2. The transcriptional conversion of RX1 and SIX3 genes partially attributed to DNA demethylation. Subsequently, iPSCs were induced into the RPE cells displaying the characteristics of polygonal shapes and pigments, and expressing typical RPE cell markers. Taken together, our results establish readily efficient and safe protocols to produce iPSCs and iPSC-derived RPE cells, and underline that the reactivation of anterior neural transcription factor OTX2, eye field transcription factor RX1 and SIX3 in iPSCs is a feature of pluripotency acquisition and predetermines the potential of RPE differentiation. PMID:27019633

  4. Transcriptional Reactivation of OTX2, RX1 and SIX3 during Reprogramming Contributes to the Generation of RPE Cells from Human iPSCs.

    PubMed

    Li, Peng; Sun, Xiaofeng; Ma, Zhizhong; Liu, Yinan; Jin, Ying; Ge, Ruimin; Hao, Limin; Ma, Yanling; Han, Shuo; Sun, Haojie; Zhang, Mingzhi; Li, Ruizhi; Li, Tao; Shen, Li

    2016-01-01

    Directed differentiation of human induced pluripotent stem cells (iPSCs) into retinal pigmented epithelium (RPE) holds great promise in cell replacement therapy for patients suffering from degenerative eye diseases, including age-related macular degeneration (AMD). In this study, we generated iPSCs from human dermal fibroblasts (HDFs) by electroporation with episomal plasmid vectors encoding OCT4, SOX2, KLF4, L-MYC together with p53 suppression. Intriguingly, cell reprogramming resulted in a metastable transcriptional activation and selective demethylation of neural and retinal specification-associated genes, such as OTX2, RX1 and SIX3. In contrast, RPE progenitor genes were transcriptionally silent in HDFs and descendant iPSCs. Overexpression of OCT4 and SOX2 directly stimulated the expression of OTX2, RX1 and SIX3 in HDFs and iPSCs. Luciferase and chromatin immunoprecipitation (ChIP) assays further identified an OCT4- and two SOX2-binding sites located in the proximal promoter of OTX2. Histone acetylation and methylation on the local promoter also participated in the reactivation of OTX2. The transcriptional conversion of RX1 and SIX3 genes partially attributed to DNA demethylation. Subsequently, iPSCs were induced into the RPE cells displaying the characteristics of polygonal shapes and pigments, and expressing typical RPE cell markers. Taken together, our results establish readily efficient and safe protocols to produce iPSCs and iPSC-derived RPE cells, and underline that the reactivation of anterior neural transcription factor OTX2, eye field transcription factor RX1 and SIX3 in iPSCs is a feature of pluripotency acquisition and predetermines the potential of RPE differentiation. PMID:27019633

  5. Identification of a non-coding KLF4 transcript generated from intron retention and downregulated in human hepatocellular carcinoma.

    PubMed

    Zhou, Junwei; Lai, Paul Bo-San; Tsui, Stephen Kwok-Wing

    2015-10-01

    The Krüppel-like factor 4 (KLF4) gene is related to various biological processes including stem cell reprogramming and tumorigenesis. In this study, we identified and characterized a non-coding transcript of KLF4, which was designated KLF4‑003, in human liver tissue samples. KLF4‑003 was identified in a number of cell lines by reverse transcription PCR and DNA sequencing. Its expression levels were determined in 54 pairs of human hepatocellular carcinoma (HCC) tissues and a number of HCC cell lines by real-time PCR (RT-PCR). Methylation status of KLF4‑003 CpG islands was determined by bisulfite sequencing. The regulatory effect of KLF4‑003 CpG islands hypermethylation in Hep3B cells was then validated by the 5-aza-dC demethylation treatment, followed by RT-PCR analysis. Receiver operating characteristic (ROC) curve was created to evaluate the diagnostic value for differentiating between HCC cancer and benign diseases. The association study between KLF4‑003 expression level and clinical traits of HCC patients was performed with SPSS. We found that KLF4‑003 was downregulated in 46 out of 54 HCC samples compared with their adjunct normal tissues. The reduced KLF4‑003 expression was significantly associated with HCC recurrence (P=0.045) in the follow-up of 31 HCC patients. Significant differences were detected between the methylation status of HCC specimens and their adjacent normal controls. Demethylation treatment significantly rescued the expression of KLF4‑003 in Hep3B cells. Such observation indicated that the CpG island hypermethylation was at least partially responsible for the downregulation of KLF4‑003 in HCC. The area under ROC curve for the prediction of HCC reached 0.803 (95% CI=0.719-0.886, P<0.001). Our results suggested that the expression of KLF4‑003 was epigenetically regulated by methylation status of a KLF4‑003 CpG island in HCC. The differential expression of KLF4‑003 might play an important role in HCC development and might

  6. Transcriptional gene silencing in humans.

    PubMed

    Weinberg, Marc S; Morris, Kevin V

    2016-08-19

    It has been over a decade since the first observation that small non-coding RNAs can functionally modulate epigenetic states in human cells to achieve functional transcriptional gene silencing (TGS). TGS is mechanistically distinct from the RNA interference (RNAi) gene-silencing pathway. TGS can result in long-term stable epigenetic modifications to gene expression that can be passed on to daughter cells during cell division, whereas RNAi does not. Early studies of TGS have been largely overlooked, overshadowed by subsequent discoveries of small RNA-directed post-TGS and RNAi. A reappraisal of early work has been brought about by recent findings in human cells where endogenous long non-coding RNAs function to regulate the epigenome. There are distinct and common overlaps between the proteins involved in small and long non-coding RNA transcriptional regulatory mechanisms, suggesting that the early studies using small non-coding RNAs to modulate transcription were making use of a previously unrecognized endogenous mechanism of RNA-directed gene regulation. Here we review how non-coding RNA plays a role in regulation of transcription and epigenetic gene silencing in human cells by revisiting these earlier studies and the mechanistic insights gained to date. We also provide a list of mammalian genes that have been shown to be transcriptionally regulated by non-coding RNAs. Lastly, we explore how TGS may serve as the basis for development of future therapeutic agents. PMID:27060137

  7. Generation of long read-through transcripts in vivo and in vitro by deletion of 3' termination and processing sequences in the human tRNAimet gene.

    PubMed Central

    Adeniyi-Jones, S; Romeo, P H; Zasloff, M

    1984-01-01

    The effects of 3' deletions of the coding and flanking regions of the human tRNAimet gene on its transcription and subsequent processing have been studied both in vitro and in vivo. We demonstrate that in the absence of the oligo T stop signal, polymerase III will read-through efficiently to the next available downstream stop signal. In mutations preserving the 3' terminal sequence of the coding region these read-through transcripts are efficiently processed, irrespective of their length and sequence by an endonucleolytic cleavage to yield both a mature tRNA and an intact trailer RNA. However, deletions involving the terminal regions up to +62 in the coding sequence produce an unprocessed co-transcript of tRNA and downstream sequences. Deletions further within the B promoter box abolish transcription. The use of these mutants as possible "portable" promoters is discussed. Images PMID:6320115

  8. Tunable protein synthesis by transcript isoforms in human cells

    PubMed Central

    Floor, Stephen N; Doudna, Jennifer A

    2016-01-01

    Eukaryotic genes generate multiple RNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5′ and 3′ untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5′ untranslated regions exert robust translational control between cell lines, while 3′ untranslated regions can confer cell type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. DOI: http://dx.doi.org/10.7554/eLife.10921.001 PMID:26735365

  9. Contributions of in vitro transcription to the understanding of human RNA polymerase III transcription

    PubMed Central

    Dumay-Odelot, Hélène; Durrieu-Gaillard, Stéphanie; El Ayoubi, Leyla; Parrot, Camila; Teichmann, Martin

    2014-01-01

    Human RNA polymerase III transcribes small untranslated RNAs that contribute to the regulation of essential cellular processes, including transcription, RNA processing and translation. Analysis of this transcription system by in vitro transcription techniques has largely contributed to the discovery of its transcription factors and to the understanding of the regulation of human RNA polymerase III transcription. Here we review some of the key steps that led to the identification of transcription factors and to the definition of minimal promoter sequences for human RNA polymerase III transcription. PMID:25764111

  10. Transcriptional correlates of human substance use

    PubMed Central

    Lehrmann, Elin; Freed, William J.

    2008-01-01

    Drugs-of-abuse produce both acute and chronic changes in brain function, each of which is reflected in altered gene expression patterns. A number of large-scale gene expression studies have employed microarray analysis of human postmortem brain to identify transcriptional correlates of ante-mortem substance use. These studies have identified changes in transcripts encoding proteins functionally involved in neuronal function and synaptic plasticity, oligodendrocyte function and myelination, lipid and energy metabolism, mitochondrial function, oxidative phoshorylation, and cytoskeleton-related signal transduction. Overall, different types of substance use appear to share some of these effects, but there are more differences than similarities in gene expression for different types of substance use. Moreover, data suggest that transcriptional subtypes within a diagnostic classification of substance use may occur. These transcriptional subtypes, or “endophenotypes”, may reflect complex patterns of substance use and comorbid neuropsychiatric disorders or other disease, which may interact with substance use to differentially impact gene expression. A broader understanding of the manner in which substance abuse causes long-term changes in brain function may be obtained from studies replicating and expanding the present gene expression data. In particular, cross-referencing comprehensive transcriptional data on regional and/or substance use-specific changes with genetic and proteomic data may further aid in identifying candidate biomarkers of altered brain function in substance use disorders. PMID:18991846

  11. Transcriptional analysis of human survivin gene expression.

    PubMed Central

    Li, F; Altieri, D C

    1999-01-01

    The preservation of tissue and organ homoeostasis depends on the regulated expression of genes controlling apoptosis (programmed cell death). In this study, we have investigated the basal transcriptional requirements of the survivin gene, an IAP (inhibitor of apoptosis) prominently up-regulated in cancer. Analysis of the 5' flanking region of the human survivin gene revealed the presence of a TATA-less promoter containing a canonical CpG island of approximately 250 nt, three cell cycle dependent elements, one cell cycle homology region and numerous Sp1 sites. PCR-based analysis of human genomic DNA, digested with methylation-sensitive and -insensitive restriction enzymes, indicated that the CpG island was unmethylated in both normal and neoplastic tissues. Primer extension and S1 nuclease mapping of the human survivin gene identified two main transcription start sites at position -72 and within -57/-61 from the initiating ATG. Transfection of cervical carcinoma HeLa cells with truncated or nested survivin promoter-luciferase constructs revealed the presence of both enhancer and repressor sequences and identified a minimal promoter region within the proximal -230 nt of the human survivin gene. Unbiased mutagenesis analysis of the human survivin promoter revealed that targeting the Sp1 sequences at position -171 and -151 abolished basal transcriptional activity by approximately 63-82%. Electrophoretic mobility-shift assay with DNA oligonucleotides confirmed formation of a DNA-protein complex between the survivin Sp1 sequences and HeLa cell extracts in a reaction abolished by mutagenesis of the survivin Sp1 sites. These findings identify the basal transcriptional requirements of survivin gene expression. PMID:10567210

  12. Transcriptional Landscape of the Prenatal Human Brain

    PubMed Central

    Miller, Jeremy A.; Ding, Song-Lin; Sunkin, Susan M.; Smith, Kimberly A; Ng, Lydia; Szafer, Aaron; Ebbert, Amanda; Riley, Zackery L.; Aiona, Kaylynn; Arnold, James M.; Bennet, Crissa; Bertagnolli, Darren; Brouner, Krissy; Butler, Stephanie; Caldejon, Shiella; Carey, Anita; Cuhaciyan, Christine; Dalley, Rachel A.; Dee, Nick; Dolbeare, Tim A.; Facer, Benjamin A. C.; Feng, David; Fliss, Tim P.; Gee, Garrett; Goldy, Jeff; Gourley, Lindsey; Gregor, Benjamin W.; Gu, Guangyu; Howard, Robert E.; Jochim, Jayson M.; Kuan, Chihchau L.; Lau, Christopher; Lee, Chang-Kyu; Lee, Felix; Lemon, Tracy A.; Lesnar, Phil; McMurray, Bergen; Mastan, Naveed; Mosqueda, Nerick F.; Naluai-Cecchini, Theresa; Ngo, Nhan-Kiet; Nyhus, Julie; Oldre, Aaron; Olson, Eric; Parente, Jody; Parker, Patrick D.; Parry, Sheana E.; Player, Allison Stevens; Pletikos, Mihovil; Reding, Melissa; Royall, Joshua J.; Roll, Kate; Sandman, David; Sarreal, Melaine; Shapouri, Sheila; Shapovalova, Nadiya V.; Shen, Elaine H.; Sjoquist, Nathan; Slaughterbeck, Clifford R.; Smith, Michael; Sodt, Andy J.; Williams, Derric; Zöllei, Lilla; Fischl, Bruce; Gerstein, Mark B.; Geschwind, Daniel H.; Glass, Ian A.; Hawrylycz, Michael J.; Hevner, Robert F.; Huang, Hao; Jones, Allan R.; Knowles, James A.; Levitt, Pat; Phillips, John W.; Sestan, Nenad; Wohnoutka, Paul; Dang, Chinh; Bernard, Amy; Hohmann, John G.; Lein, Ed S.

    2014-01-01

    Summary The anatomical and functional architecture of the human brain is largely determined by prenatal transcriptional processes. We describe an anatomically comprehensive atlas of mid-gestational human brain, including de novo reference atlases, in situ hybridization, ultra-high resolution magnetic resonance imaging (MRI) and microarray analysis on highly discrete laser microdissected brain regions. In developing cerebral cortex, transcriptional differences are found between different proliferative and postmitotic layers, wherein laminar signatures reflect cellular composition and developmental processes. Cytoarchitectural differences between human and mouse have molecular correlates, including species differences in gene expression in subplate, although surprisingly we find minimal differences between the inner and human-expanded outer subventricular zones. Both germinal and postmitotic cortical layers exhibit fronto-temporal gradients, with particular enrichment in frontal lobe. Finally, many neurodevelopmental disorder and human evolution-related genes show patterned expression, potentially underlying unique features of human cortical formation. These data provide a rich, freely-accessible resource for understanding human brain development. PMID:24695229

  13. Glucocorticoid regulation of human BMP-6 transcription.

    PubMed

    Liu, Yunshan; Titus, Louisa; Barghouthi, Mejd; Viggeswarapu, Manjula; Hair, Gregory; Boden, Scott D

    2004-09-01

    Addition of dexamethasone (Dex) to human mesenchymal stem cells (hMSCs) resulted in a 16-fold increase in human bone morphogenetic protein-6 (hBMP-6) mRNA levels 24 h after treatment. Evaluation of luciferase expression after transfection of HeLa cells with hBMP-6 promoter/luciferase reporter constructs indicated that the hBMP-6 promoter activity was contained in a 268-bp region (-1051 to -784 where +1 is the translation start site) over 600 bases 5' to that previously published. It further showed that the promoter activity is regulated by glucocorticoid treatment. Analysis of RNA from hMSCs and HeLa cells by primer extension, RNase protection, and 5' RACE further narrowed the location of the transcription start site to an 84-bp region (-940 to -857). To determine whether this start site was regulated in hMSCs, hBMP-6 mRNA levels in control and Dex-treated cells were quantitated by RT-PCR using one primer set in the translated region of the gene and one located just 3' of the 84-bp region. Both primer sets showed hBMP-6 mRNA levels approximately 16- to 22-fold higher in the Dex-treated cells, demonstrating that hBMP-6 transcription is being regulated by glucocorticoids in the pluripotent hMSCs at the upstream transcription start site. PMID:15336603

  14. Transcriptional regulation of the human biglycan gene.

    PubMed

    Ungefroren, H; Krull, N B

    1996-06-28

    The small leucine-rich proteoglycan biglycan is involved in several physiological and pathophysiological processes through the ability of its core protein to interact with other extracellular matrix molecules and transforming growth factor-beta (TGF-beta). To learn more about the regulation of biglycan core protein expression, we have cloned and sequenced 1218 base pairs from the 5'-flanking region of the human biglycan gene, demonstrated functional promoter activity, and investigated the molecular mechanisms through which various agents modulate its transcriptional activity. Sequencing revealed the presence of several cis-acting elements including multiple AP-2 sites and interleukin-6 response elements, a NF-kappaB site, a TGF-beta negative element, and an E-box. The TATA and CAAT box-lacking promoter possesses many features of a growth-related gene, e.g. a GC-rich immediate 5' region, many Sp1 sites, and the use of multiple transcriptional start sites. Transient transfections of the tumor cell lines MG-63, SK-UT-1, and T47D with various biglycan 5'-flanking region-luciferase reporter gene constructs showed that the proximal 78 base pairs are sufficient for full promoter activity. Several agents among them interleukin-6, and tumor necrosis factor-alpha. were capable of altering biglycan promoter activity. However, in MG-63 cells, TGF-beta1 failed to increase either activity of the biglycan promoter constructs or specific transcription from the endogenous biglycan gene. Since TGF-beta1 also did not alter the stability of cytoplasmic biglycan mRNA as determined from Northern analysis after inhibition of transcription with 5,6-dichloro-1beta-D-ribofuranosylbenzimidazole, an as yet unidentified nuclear post-transcriptional mechanism was considered responsible for the TGF-beta effect in this cell type. These results might help to elucidate the molecular pathways leading to pathological alterations of biglycan expression observed in atherosclerosis, glomerulonephritis

  15. THE TRANSCRIPTIONAL SIGNATURES OF CELLS FROM THE HUMAN PEYRONIE'S DISEASE PLAQUE AND THE ABILITY OF THESE CELLS TO GENERATE A PLAQUE IN A RAT MODEL SUGGEST POTENTIAL THERAPEUTIC TARGETS

    PubMed Central

    Gelfand, R; Vernet, D; Kovanecz, I; Rajfer, J; Gonzalez-Cadavid, NF

    2015-01-01

    Introduction The success of medical therapies for Peyronie's disease (PD) has not been optimal, possibly because many of them went directly to clinical application without sufficient preclinical scientific research. Previous studies revealed cellular and molecular pathways involved in the formation of the PD plaque, and in particular the role of the myofibroblast. Aims The current work aimed to determine under normal and fibrotic conditions what differentiates PD cells from tunica albuginea (TA) and corpora cavernosa (CC) cells, by defining their global transcriptional signatures and testing in vivo whether PD cells can generate a PD like plaque Main Outcomes Measures Fibroproliferative features of PD cells and identification of related key genes as novel targets to reduce plaque size Methods Human TA, PD, and CC cells were grown with TGFβ1 (TA+, PD+, CC+) or without it (TA−, PD−, CC−) and assayed by: a) immunofluorescence, western blot and RT/PCR for myofibroblast, smooth muscle cell and stem cell markers; b) collagen content; and c) DNA microarray analysis. The ability of PD+ cells to induce a PD like plaque in an immuno-suppressed rat model was assessed by Masson trichrome and Picrosirius Red. Results Upon TGFβ1stimulation, collagen levels were increased by myofibroblasts in the PD+ but not in the CC+ cells. The transcriptional signature of the PD− cells identified fibroproliferative, myogenic (myofibroblasts), inflammatory, and collagen turnover genes, that differentiate them from TA− or CC− cells, and respond to TGFβ1 with a PD+ fibrotic phenotype, by upregulation of IGF1, ACTG2, MYF5, ACTC1, PSTN, COL III, MMP3, and others. The PD+ cells injected into the TA of the rat induce a PD like plaque. Conclusions This suggests a novel combination therapy to eliminate a PD plaque, by targeting the identified genes to: a) improve collagenase action by stimulating endogenous MMPs specific to key collagen types, and b) counteract fibromatosis by inhibiting

  16. The transcriptional activity of human Chromosome 22

    PubMed Central

    Rinn, John L.; Euskirchen, Ghia; Bertone, Paul; Martone, Rebecca; Luscombe, Nicholas M.; Hartman, Stephen; Harrison, Paul M.; Nelson, F. Kenneth; Miller, Perry; Gerstein, Mark; Weissman, Sherman; Snyder, Michael

    2003-01-01

    A DNA microarray representing nearly all of the unique sequences of human Chromosome 22 was constructed and used to measure global-transcriptional activity in placental poly(A)+ RNA. We found that many of the known, related and predicted genes are expressed. More importantly, our study reveals twice as many transcribed bases as have been reported previously. Many of the newly discovered expressed fragments were verified by RNA blot analysis and a novel technique called differential hybridization mapping (DHM). Interestingly, a significant fraction of these novel fragments are expressed antisense to previously annotated introns. The coding potential of these novel expressed regions is supported by their sequence conservation in the mouse genome. This study has greatly increased our understanding of the biological information encoded on a human chromosome. To facilitate the dissemination of these results to the scientific community, we have developed a comprehensive Web resource to present the findings of this study and other features of human Chromosome 22 at http://array.mbb.yale.edu/chr22. PMID:12600945

  17. Transcription regulates telomere dynamics in human cancer cells

    PubMed Central

    Arora, Rajika; Brun, Catherine M.; Azzalin, Claus M.

    2012-01-01

    Telomeres are nucleoprotein structures capping the physical ends of linear eukaryotic chromosomes. Although largely heterochromatic, telomeres are transcribed into telomeric repeat-containing RNA (TERRA) molecules by RNA polymerase II. The functions associated with telomere transcription and TERRA remain ill defined. Here we show that the transcriptional activity of human telomeres directly regulates their movement during interphase. We find that chemical inhibition of global transcription dampens telomere motion, while global stimulation promotes it. Likewise, when DNA methyltransferase enzymes are deleted to augment telomere transcription, we observe increased telomere movement. Finally, using a cell line engineered with a unique transcriptionally inducible telomere, we show that transcription of one specific telomere stimulates only its own dynamics without overtly affecting its stability or its length. We reveal a new and unforeseen function for telomere transcription as a regulator of telomere motion, and speculate on the intriguing possibility that transcription-dependent telomere motion sustains the maintenance of functional and dysfunctional telomeres. PMID:22357912

  18. Technical Advance: Transcription factor, promoter, and enhancer utilization in human myeloid cells

    PubMed Central

    Joshi, Anagha; Pooley, Christopher; Freeman, Tom C.; Lennartsson, Andreas; Babina, Magda; Schmidl, Christian; Geijtenbeek, Teunis; Michoel, Tom; Severin, Jessica; Itoh, Masayoshi; Lassmann, Timo; Kawaji, Hideya; Hayashizaki, Yoshihide; Carninci, Piero; Forrest, Alistair R. R.; Rehli, Michael; Hume, David A.

    2015-01-01

    The generation of myeloid cells from their progenitors is regulated at the level of transcription by combinatorial control of key transcription factors influencing cell-fate choice. To unravel the global dynamics of this process at the transcript level, we generated transcription profiles for 91 human cell types of myeloid origin by use of CAGE profiling. The CAGE sequencing of these samples has allowed us to investigate diverse aspects of transcription control during myelopoiesis, such as identification of novel transcription factors, miRNAs, and noncoding RNAs specific to the myeloid lineage. We further reconstructed a transcription regulatory network by clustering coexpressed transcripts and associating them with enriched cis-regulatory motifs. With the use of the bidirectional expression as a proxy for enhancers, we predicted over 2000 novel enhancers, including an enhancer 38 kb downstream of IRF8 and an intronic enhancer in the KIT gene locus. Finally, we highlighted relevance of these data to dissect transcription dynamics during progressive maturation of granulocyte precursors. A multifaceted analysis of the myeloid transcriptome is made available (www.myeloidome.roslin.ed.ac.uk). This high-quality dataset provides a powerful resource to study transcriptional regulation during myelopoiesis and to infer the likely functions of unannotated genes in human innate immunity. PMID:25717144

  19. Landscape of transcription in human cells

    PubMed Central

    Djebali, Sarah; Davis, Carrie A.; Merkel, Angelika; Dobin, Alex; Lassmann, Timo; Mortazavi, Ali M.; Tanzer, Andrea; Lagarde, Julien; Lin, Wei; Schlesinger, Felix; Xue, Chenghai; Marinov, Georgi K.; Khatun, Jainab; Williams, Brian A.; Zaleski, Chris; Rozowsky, Joel; Röder, Maik; Kokocinski, Felix; Abdelhamid, Rehab F.; Alioto, Tyler; Antoshechkin, Igor; Baer, Michael T.; Bar, Nadav S.; Batut, Philippe; Bell, Kimberly; Bell, Ian; Chakrabortty, Sudipto; Chen, Xian; Chrast, Jacqueline; Curado, Joao; Derrien, Thomas; Drenkow, Jorg; Dumais, Erica; Dumais, Jacqueline; Duttagupta, Radha; Falconnet, Emilie; Fastuca, Meagan; Fejes-Toth, Kata; Ferreira, Pedro; Foissac, Sylvain; Fullwood, Melissa J.; Gao, Hui; Gonzalez, David; Gordon, Assaf; Gunawardena, Harsha; Howald, Cedric; Jha, Sonali; Johnson, Rory; Kapranov, Philipp; King, Brandon; Kingswood, Colin; Luo, Oscar J.; Park, Eddie; Persaud, Kimberly; Preall, Jonathan B.; Ribeca, Paolo; Risk, Brian; Robyr, Daniel; Sammeth, Michael; Schaffer, Lorian; See, Lei-Hoon; Shahab, Atif; Skancke, Jorgen; Suzuki, Ana Maria; Takahashi, Hazuki; Tilgner, Hagen; Trout, Diane; Walters, Nathalie; Wang, Huaien; Wrobel, John; Yu, Yanbao; Ruan, Xiaoan; Hayashizaki, Yoshihide; Harrow, Jennifer; Gerstein, Mark; Hubbard, Tim; Reymond, Alexandre; Antonarakis, Stylianos E.; Hannon, Gregory; Giddings, Morgan C.; Ruan, Yijun; Wold, Barbara; Carninci, Piero; Guigó, Roderic; Gingeras, Thomas R.

    2013-01-01

    Summary Eukaryotic cells make many types of primary and processed RNAs that are found either in specific sub-cellular compartments or throughout the cells. A complete catalogue of these RNAs is not yet available and their characteristic sub-cellular localizations are also poorly understood. Since RNA represents the direct output of the genetic information encoded by genomes and a significant proportion of a cell’s regulatory capabilities are focused on its synthesis, processing, transport, modifications and translation, the generation of such a catalogue is crucial for understanding genome function. Here we report evidence that three quarters of the human genome is capable of being transcribed, as well as observations about the range and levels of expression, localization, processing fates, regulatory regions and modifications of almost all currently annotated and thousands of previously unannotated RNAs. These observations taken together prompt to a redefinition of the concept of a gene. PMID:22955620

  20. The mesenchymal transcription factor SNAI-1 instructs human liver specification.

    PubMed

    Goldman, Orit; Valdes, Victor Julian; Ezhkova, Elena; Gouon-Evans, Valerie

    2016-07-01

    Epithelial-mesenchymal transition (EMT) and the mesenchymal-epithelial transition (MET) are processes required for embryo organogenesis. Liver develops from the epithelial foregut endoderm from which the liver progenitors, hepatoblasts, are specified. The migrating hepatoblasts acquire a mesenchymal phenotype to form the liver bud. In mid-gestation, hepatoblasts mature into epithelial structures: the hepatocyte cords and biliary ducts. While EMT has been associated with liver bud formation, nothing is known about its contribution to hepatic specification. We previously established an efficient protocol from human embryonic stem cells (hESC) to generate hepatic cells (Hep cells) resembling the hepatoblasts expressing alpha-fetoprotein (AFP) and albumin (ALB). Here we show that Hep cells express both epithelial (EpCAM and E-cadherin) and mesenchymal (vimentin and SNAI-1) markers. Similar epithelial and mesenchymal hepatoblasts were identified in human and mouse fetal livers, suggesting a conserved interspecies phenotype. Knock-down experiments demonstrated the importance of SNAI-1 in Hep cell hepatic specification. Moreover, ChIP assays revealed direct binding of SNAI-1 in the promoters of AFP and ALB genes consistent with its transcriptional activator function in hepatic specification. Altogether, our hESC-derived Hep cell cultures reveal the dual mesenchymal and epithelial phenotype of hepatoblast-like cells and support the unexpected transcriptional activator role of SNAI-1 in hepatic specification. PMID:27240252

  1. The generation of promoter-mediated transcriptional noise in bacteria.

    PubMed

    Mitarai, Namiko; Dodd, Ian B; Crooks, Michael T; Sneppen, Kim

    2008-01-01

    Noise in the expression of a gene produces fluctuations in the concentration of the gene product. These fluctuations can interfere with optimal function or can be exploited to generate beneficial diversity between cells; gene expression noise is therefore expected to be subject to evolutionary pressure. Shifts between modes of high and low rates of transcription initiation at a promoter appear to contribute to this noise both in eukaryotes and prokaryotes. However, models invoked for eukaryotic promoter noise such as stable activation scaffolds or persistent nucleosome alterations seem unlikely to apply to prokaryotic promoters. We consider the relative importance of the steps required for transcription initiation. The 3-step transcription initiation model of McClure is extended into a mathematical model that can be used to predict consequences of additional promoter properties. We show in principle that the transcriptional bursting observed at an E. coli promoter by Golding et al. (2005) can be explained by stimulation of initiation by the negative supercoiling behind a transcribing RNA polymerase (RNAP) or by the formation of moribund or dead-end RNAP-promoter complexes. Both mechanisms are tunable by the alteration of promoter kinetics and therefore allow the optimization of promoter mediated noise. PMID:18617999

  2. A Transcript Finishing Initiative for Closing Gaps in the Human Transcriptome

    PubMed Central

    Sogayar, Mari Cleide; Camargo, Anamaria A.

    2004-01-01

    We report the results of a transcript finishing initiative, undertaken for the purpose of identifying and characterizing novel human transcripts, in which RT-PCR was used to bridge gaps between paired EST clusters, mapped against the genomic sequence. Each pair of EST clusters selected for experimental validation was designated a transcript finishing unit (TFU). A total of 489 TFUs were selected for validation, and an overall efficiency of 43.1% was achieved. We generated a total of 59,975 bp of transcribed sequences organized into 432 exons, contributing to the definition of the structure of 211 human transcripts. The structure of several transcripts reported here was confirmed during the course of this project, through the generation of their corresponding full-length cDNA sequences. Nevertheless, for 21% of the validated TFUs, a full-length cDNA sequence is not yet available in public databases, and the structure of 69.2% of these TFUs was not correctly predicted by computer programs. The TF strategy provides a significant contribution to the definition of the complete catalog of human genes and transcripts, because it appears to be particularly useful for identification of low abundance transcripts expressed in a restricted set of tissues as well as for the delineation of gene boundaries and alternatively spliced isoforms. PMID:15197164

  3. Transcriptional comparison of human induced and primary midbrain dopaminergic neurons

    PubMed Central

    Xia, Ninuo; Zhang, Pengbo; Fang, Fang; Wang, Zhengyuan; Rothstein, Megan; Angulo, Benjamin; Chiang, Rosaria; Taylor, James; Reijo Pera, Renee A.

    2016-01-01

    Generation of induced dopaminergic (iDA) neurons may provide a significant step forward towards cell replacement therapy for Parkinson’s disease (PD). To study and compare transcriptional programs of induced cells versus primary DA neurons is a preliminary step towards characterizing human iDA neurons. We have optimized a protocol to efficiently generate iDA neurons from human pluripotent stem cells (hPSCs). We then sequenced the transcriptomes of iDA neurons derived from 6 different hPSC lines and compared them to that of primary midbrain (mDA) neurons. We identified a small subset of genes with altered expression in derived iDA neurons from patients with Parkinson’s Disease (PD). We also observed that iDA neurons differ significantly from primary mDA neurons in global gene expression, especially in genes related to neuron maturation level. Results suggest iDA neurons from patient iPSCs could be useful for basic and translational studies, including in vitro modeling of PD. However, further refinement of methods of induction and maturation of neurons may better recapitulate full development of mDA neurons from hPSCs. PMID:26842779

  4. The transcriptional terminator sequences downstream of the covR gene terminate covR/S operon transcription to generate covR monocistronic transcripts in Streptococcus pyogenes.

    PubMed

    Chiang-Ni, Chuan; Tsou, Chih-Cheng; Lin, Yee-Shin; Chuang, Woei-Jer; Lin, Ming-T; Liu, Ching-Chuan; Wu, Jiunn-Jong

    2008-12-31

    CovR/S is an important two component regulatory system, which regulates about 15% of the gene expression in Streptococcus pyogenes. The covR/S locus was identified as an operon generating an RNA transcript around 2.5-kb in size. In this study, we found the covR/S operon produced three RNA transcripts (around 2.5-, 1.0-, and 0.8-kb in size). Using RNA transcriptional terminator sequence prediction and transcriptional terminator analysis, we identified two atypical rho-independent terminator sequences downstream of the covR gene and showed these terminator sequences terminate RNA transcription efficiently. These results indicate that covR/S operon generates covR/S transcript and monocistronic covR transcripts. PMID:18824088

  5. Transcriptional neoteny in the human brain

    PubMed Central

    Somel, Mehmet; Franz, Henriette; Yan, Zheng; Lorenc, Anna; Guo, Song; Giger, Thomas; Kelso, Janet; Nickel, Birgit; Dannemann, Michael; Bahn, Sabine; Webster, Maree J.; Weickert, Cynthia S.; Lachmann, Michael; Pääbo, Svante; Khaitovich, Philipp

    2009-01-01

    In development, timing is of the utmost importance, and the timing of developmental processes often changes as organisms evolve. In human evolution, developmental retardation, or neoteny, has been proposed as a possible mechanism that contributed to the rise of many human-specific features, including an increase in brain size and the emergence of human-specific cognitive traits. We analyzed mRNA expression in the prefrontal cortex of humans, chimpanzees, and rhesus macaques to determine whether human-specific neotenic changes are present at the gene expression level. We show that the brain transcriptome is dramatically remodeled during postnatal development and that developmental changes in the human brain are indeed delayed relative to other primates. This delay is not uniform across the human transcriptome but affects a specific subset of genes that play a potential role in neural development. PMID:19307592

  6. Transcriptional and Post-Transcriptional Regulation of Nucleotide Excision Repair Genes in Human Cells

    PubMed Central

    Lefkofsky, Hailey B.; Veloso, Artur; Ljungman, Mats

    2014-01-01

    Nucleotide excision repair (NER) removes DNA helix-distorting lesions induced by UV light and various chemotherapeutic agents such as cisplatin. These lesions efficiently block the elongation of transcription and need to be rapidly removed by transcription-coupled NER (TC-NER) to avoid the induction of apoptosis. Twenty-nine genes have been classified to code for proteins participating in nucleotide excision repair (NER) in human cells. Here we explored the transcriptional and post-transcriptional regulation of these NER genes across 13 human cell lines using Bru-seq and BruChase-seq, respectively. Many NER genes are relatively large in size and therefore will be easily inactivated by UV-induced transcription-blocking lesions. Furthermore, many of these genes produce transcripts that are rather unstable. Thus, these genes are expected to rapidly lose expression leading to a diminished function of NER. One such gene is ERCC6 that codes for the CSB protein critical for TC-NER. Due to its large gene size and high RNA turnover rate, the ERCC6 gene may act as dosimeter of DNA damage so that at high levels of damage, ERCC6 RNA levels would be diminished leading to the loss of CSB expression, inhibition of TC-NER and the promotion of cell death. PMID:26255935

  7. Transcriptional and post-transcriptional regulation of nucleotide excision repair genes in human cells.

    PubMed

    Lefkofsky, Hailey B; Veloso, Artur; Ljungman, Mats

    2015-06-01

    Nucleotide excision repair (NER) removes DNA helix-distorting lesions induced by UV light and various chemotherapeutic agents such as cisplatin. These lesions efficiently block the elongation of transcription and need to be rapidly removed by transcription-coupled NER (TC-NER) to avoid the induction of apoptosis. Twenty-nine genes have been classified to code for proteins participating in nucleotide excision repair (NER) in human cells. Here we explored the transcriptional and post-transcriptional regulation of these NER genes across 13 human cell lines using Bru-seq and BruChase-seq, respectively. Many NER genes are relatively large in size and therefore will be easily inactivated by UV-induced transcription-blocking lesions. Furthermore, many of these genes produce transcripts that are rather unstable. Thus, these genes are expected to rapidly lose expression leading to a diminished function of NER. One such gene is ERCC6 that codes for the CSB protein critical for TC-NER. Due to its large gene size and high RNA turnover rate, the ERCC6 gene may act as dosimeter of DNA damage so that at high levels of damage, ERCC6 RNA levels would be diminished leading to the loss of CSB expression, inhibition of TC-NER and the promotion of cell death. PMID:26255935

  8. Human brain evolution: transcripts, metabolites and their regulators.

    PubMed

    Somel, Mehmet; Liu, Xiling; Khaitovich, Philipp

    2013-02-01

    What evolutionary events led to the emergence of human cognition? Although the genetic differences separating modern humans from both non-human primates (for example, chimpanzees) and archaic hominins (Neanderthals and Denisovans) are known, linking human-specific mutations to the cognitive phenotype remains a challenge. One strategy is to focus on human-specific changes at the level of intermediate phenotypes, such as gene expression and metabolism, in conjunction with evolutionary changes in gene regulation involving transcription factors, microRNA and proximal regulatory elements. In this Review we show how this strategy has yielded some of the first hints about the mechanisms of human cognition. PMID:23324662

  9. Human transcription factors contain a high fraction of intrinsically disordered regions essential for transcriptional regulation.

    PubMed

    Minezaki, Yoshiaki; Homma, Keiichi; Kinjo, Akira R; Nishikawa, Ken

    2006-06-16

    Human transcriptional regulation factors, such as activators, repressors, and enhancer-binding factors are quite different from their prokaryotic counterparts in two respects: the average sequence in human is more than twice as long as that in prokaryotes, while the fraction of sequence aligned to domains of known structure is 31% in human transcription factors (TFs), less than half of that in bacterial TFs (72%). Intrinsically disordered (ID) regions were identified by a disorder-prediction program, and were found to be in good agreement with available experimental data. Analysis of 401 human TFs with experimental evidence from the Swiss-Prot database showed that as high as 49% of the entire sequence of human TFs is occupied by ID regions. More than half of the human TFs consist of a small DNA binding domain (DBD) and long ID regions frequently sandwiching unassigned regions. The remaining TFs have structural domains in addition to DBDs and ID regions. Experimental studies, particularly those with NMR, revealed that the transactivation domains in unbound TFs are usually unstructured, but become structured upon binding to their partners. The sequences of human and mouse TF orthologues are 90.5% identical despite a high incidence of ID regions, probably reflecting important functional roles played by ID regions. In general ID regions occupy a high fraction in TFs of eukaryotes, but not in prokaryotes. Implications of this dichotomy are discussed in connection with their functional roles in transcriptional regulation and evolution. PMID:16697407

  10. The CREB Transcription Factor Controls Transcriptional Activity of the Human RIC8B Gene.

    PubMed

    Maureira, Alejandro; Sánchez, Rodolfo; Valenzuela, Nicole; Torrejón, Marcela; Hinrichs, María V; Olate, Juan; Gutiérrez, José L

    2016-08-01

    Proper regulation of gene expression is essential for normal development, cellular growth, and differentiation. Differential expression profiles of mRNA coding for vertebrate Ric-8B during embryo and adult stages have been observed. In addition, Ric-8B is expressed in few cerebral nuclei subareas. These facts point to a dynamic control of RIC8B gene expression. In order to understand the transcriptional regulation of this gene, we searched for cis-elements in the sequence of the human RIC8B promoter region, identifying binding sites for the basic/leucine zipper (bZip) CREB transcription factor family (CRE sites) and C/EBP transcription factor family (C/EBP sites). CRE sites were found clustered near the transcription start site, while the C/EBP sites were found clustered at around 300 bp upstream the CRE sites. Here, we demonstrate the ability of CREB1 and C/EBPβ to bind their respective elements identified in the RIC8B promoter. Comparative protein-DNA interaction analyses revealed only the proximal elements as high affinity sites for CREB1 and only the distal elements as high affinity sites for C/EBPβ. Chromatin immunoprecipitation analyses, carried out using a human neuroblastoma cell line, confirmed the preferential association of CREB to the proximal region of the RIC8B promoter. By performing luciferase reporter assays, we found the CRE sites as the most relevant elements for its transcriptional activity. Taken together, these data show the existence of functional CREB and C/EBP binding sites in the human RIC8B gene promoter, a particular distribution of these sites and demonstrate a relevant role of CREB in stimulating transcriptional activity of this gene. J. Cell. Biochem. 117: 1797-1805, 2016. © 2016 Wiley Periodicals, Inc. PMID:26729411

  11. CpG-island promoters drive transcription of human telomeres

    PubMed Central

    Nergadze, Solomon G.; Farnung, Benjamin O.; Wischnewski, Harry; Khoriauli, Lela; Vitelli, Valerio; Chawla, Raghav; Giulotto, Elena; Azzalin, Claus M.

    2009-01-01

    The longstanding dogma that telomeres, the heterochromatic extremities of linear eukaryotic chromosomes, are transcriptionally silent was overturned by the discovery that DNA-dependent RNA polymerase II (RNAPII) transcribes telomeric DNA into telomeric repeat-containing RNA (TERRA). Here, we show that CpG dinucleotide-rich DNA islands, shared among multiple human chromosome ends, promote transcription of TERRA molecules. TERRA promoters sustain cellular expression of reporter genes, are located immediately upstream of TERRA transcription start sites, and are bound by active RNAPII in vivo. Finally, the identified promoter CpG dinucleotides are methylated in vivo, and cytosine methylation negatively regulates TERRA abundance. The existence of subtelomeric promoters, driving TERRA transcription from independent chromosome ends, supports the idea that TERRA exerts fundamental functions in the context of telomere biology. PMID:19850908

  12. Circuitry and dynamics of human transcription factor regulatory networks

    PubMed Central

    Neph, Shane; Stergachis, Andrew B.; Reynolds, Alex; Sandstrom, Richard; Borenstein, Elhanan; Stamatoyannopoulos, John A.

    2012-01-01

    SUMMARY The combinatorial cross-regulation of hundreds of sequence-specific transcription factors defines a regulatory network that underlies cellular identity and function. Here we use genome-wide maps of in vivo DNaseI footprints to assemble an extensive core human regulatory network comprising connections among 475 sequence-specific transcription factors, and to analyze the dynamics of these connections across 41 diverse cell and tissue types. We find that human transcription factor networks are highly cell-selective and are driven by cohorts of factors that include regulators with previously unrecognized roles in control of cellular identity. Moreover, we identify many widely expressed factors that impact transcriptional regulatory networks in a cell-selective manner. Strikingly, in spite of their inherent diversity, all cell type regulatory networks independently converge on a common architecture that closely resembles the topology of living neuronal networks. Together, our results provide the first description of the circuitry, dynamics, and organizing principles of the human transcription factor regulatory network. PMID:22959076

  13. Transcriptional promiscuity of the human /alpha/-globin gene

    SciTech Connect

    Whitelaw, E.; Hogben, P.; Hanscombe, O.; Proudfoot, N.J.

    1989-01-01

    The human /alpha/-globin gene displays the unusual property of transcriptional promiscuity: that is, it functions in the absence of an enhancer when transfected into nonerythroid cell lines. It is also unusual in that its promoter region lies in a hypomethylated HpaII tiny fragment (HTF) island containing multiple copies of the consensus sequence for the SP1-binding site. The authors have investigated whether there is a relationship between these two observations. First, they investigated the mouse /alpha/-globin gene since it does not lie in an HTF island. They have demonstrated that it was not transcriptionally promiscuous. Second, they studied the transcriptional activity of the human /alpha/-globin gene in the absence of the GC-rich region containing putative SP1-binding sites and found a small (two- to threefold) but consistent positive effect of this region on transcriptional activity in both nonerythroid and erythroid cell lines. However, this effect did not account for the promiscuous nature of the human /alpha/-globin gene. They found that in a nonreplicating system, the human //a/-globin gene, like that of the mouse, required a simian virus 40 enhancer in order to be transcriptionally active in nonerythroid and erythroid cell lines. Since they only observed enhancer independence of the human /alpha/-globin gene in a high-copy-number replicating system, they suggest that competition for trans-acting factors could explain these results. Finally, the authors' experiments with the erythroid cell line Putko suggest that there are no tissue-specific enhancers within 1 kilobase 5' of the human /alpha/-globin cap site or within the gene itself.

  14. Transcription Activator-Like Effector Nuclease (TALEN)-Mediated CLYBL Targeting Enables Enhanced Transgene Expression and One-Step Generation of Dual Reporter Human Induced Pluripotent Stem Cell (iPSC) and Neural Stem Cell (NSC) Lines

    PubMed Central

    Cerbini, Trevor; Funahashi, Ray; Luo, Yongquan; Liu, Chengyu; Park, Kyeyoon; Rao, Mahendra; Malik, Nasir; Zou, Jizhong

    2015-01-01

    Targeted genome engineering to robustly express transgenes is an essential methodology for stem cell-based research and therapy. Although designer nucleases have been used to drastically enhance gene editing efficiency, targeted addition and stable expression of transgenes to date is limited at single gene/locus and mostly PPP1R12C/AAVS1 in human stem cells. Here we constructed transcription activator-like effector nucleases (TALENs) targeting the safe-harbor like gene CLYBL to mediate reporter gene integration at 38%–58% efficiency, and used both AAVS1-TALENs and CLYBL-TALENs to simultaneously knock-in multiple reporter genes at dual safe-harbor loci in human induced pluripotent stem cells (iPSCs) and neural stem cells (NSCs). The CLYBL-TALEN engineered cell lines maintained robust reporter expression during self-renewal and differentiation, and revealed that CLYBL targeting resulted in stronger transgene expression and less perturbation on local gene expression than PPP1R12C/AAVS1. TALEN-mediated CLYBL engineering provides improved transgene expression and options for multiple genetic modification in human stem cells. PMID:25587899

  15. KeyGenes, a Tool to Probe Tissue Differentiation Using a Human Fetal Transcriptional Atlas

    PubMed Central

    Roost, Matthias S.; van Iperen, Liesbeth; Ariyurek, Yavuz; Buermans, Henk P.; Arindrarto, Wibowo; Devalla, Harsha D.; Passier, Robert; Mummery, Christine L.; Carlotti, Françoise; de Koning, Eelco J.P.; van Zwet, Erik W.; Goeman, Jelle J.; Chuva de Sousa Lopes, Susana M.

    2015-01-01

    Summary Differentiated derivatives of human pluripotent stem cells in culture are generally phenotypically immature compared to their adult counterparts. Their identity is often difficult to determine with certainty because little is known about their human fetal equivalents in vivo. Cellular identity and signaling pathways directing differentiation are usually determined by extrapolating information from either human adult tissue or model organisms, assuming conservation with humans. To resolve this, we generated a collection of human fetal transcriptional profiles at different developmental stages. Moreover, we developed an algorithm, KeyGenes, which uses this dataset to quantify the extent to which next-generation sequencing or microarray data resemble specific cell or tissue types in the human fetus. Using KeyGenes combined with the human fetal atlas, we identified multiple cell and tissue samples unambiguously on a limited set of features. We thus provide a flexible and expandable platform to monitor and evaluate the efficiency of differentiation in vitro. PMID:26028532

  16. Transcriptional regulation of human small nuclear RNA genes

    PubMed Central

    Jawdekar, Gauri W.; Henry, R. William

    2009-01-01

    The products of human snRNA genes have been frequently described as performing housekeeping functions and their synthesis refractory to regulation. However, recent studies have emphasized that snRNA and other related non-coding RNA molecules control multiple facets of the central dogma, and their regulated expression is critical to cellular homeostasis during normal growth and in response to stress. Human snRNA genes contain compact and yet powerful promoters that are recognized by increasingly well-characterized transcription factors, thus providing a premier model system to study gene regulation. This review summarizes many recent advances deciphering the mechanism by which the transcription of human snRNA and related genes are regulated. PMID:18442490

  17. ASPicDB: a database of annotated transcript and protein variants generated by alternative splicing

    PubMed Central

    Martelli, Pier L.; D’Antonio, Mattia; Bonizzoni, Paola; Castrignanò, Tiziana; D’Erchia, Anna M.; D’Onorio De Meo, Paolo; Fariselli, Piero; Finelli, Michele; Licciulli, Flavio; Mangiulli, Marina; Mignone, Flavio; Pavesi, Giulio; Picardi, Ernesto; Rizzi, Raffaella; Rossi, Ivan; Valletti, Alessio; Zauli, Andrea; Zambelli, Federico; Casadio, Rita; Pesole, Graziano

    2011-01-01

    Alternative splicing is emerging as a major mechanism for the expansion of the transcriptome and proteome diversity, particularly in human and other vertebrates. However, the proportion of alternative transcripts and proteins actually endowed with functional activity is currently highly debated. We present here a new release of ASPicDB which now provides a unique annotation resource of human protein variants generated by alternative splicing. A total of 256 939 protein variants from 17 191 multi-exon genes have been extensively annotated through state of the art machine learning tools providing information of the protein type (globular and transmembrane), localization, presence of PFAM domains, signal peptides, GPI-anchor propeptides, transmembrane and coiled-coil segments. Furthermore, full-length variants can be now specifically selected based on the annotation of CAGE-tags and polyA signal and/or polyA sites, marking transcription initiation and termination sites, respectively. The retrieval can be carried out at gene, transcript, exon, protein or splice site level allowing the selection of data sets fulfilling one or more features settled by the user. The retrieval interface also enables the selection of protein variants showing specific differences in the annotated features. ASPicDB is available at http://www.caspur.it/ASPicDB/. PMID:21051348

  18. Transcriptional Network of p63 in Human Keratinocytes

    PubMed Central

    Pozzi, Silvia; Zambelli, Federico; Merico, Daniele; Pavesi, Giulio; Robert, Amélie; Maltère, Peggy; Gidrol, Xavier; Mantovani, Roberto; Vigano, M. Alessandra

    2009-01-01

    p63 is a transcription factor required for the development and maintenance of ectodermal tissues in general, and skin keratinocytes in particular. The identification of its target genes is fundamental for understanding the complex network of gene regulation governing the development of epithelia. We report a list of almost 1000 targets derived from ChIP on chip analysis on two platforms; all genes analyzed changed in expression during differentiation of human keratinocytes. Functional annotation highlighted unexpected GO terms enrichments and confirmed that genes involved in transcriptional regulation are the most significant. A detailed analysis of these transcriptional regulators in condition of perturbed p63 levels confirmed the role of p63 in the regulatory network. Rather than a rigid master-slave hierarchical model, our data indicate that p63 connects different hubs involved in the multiple specific functions of the skin. PMID:19390658

  19. What can digital transcript profiling reveal about human cancers?

    PubMed

    Cerutti, J M; Riggins, G J; de Souza, S J

    2003-08-01

    Important biological and clinical features of malignancy are reflected in its transcript pattern. Recent advances in gene expression technology and informatics have provided a powerful new means to obtain and interpret these expression patterns. A comprehensive approach to expression profiling is serial analysis of gene expression (SAGE), which provides digital information on transcript levels. SAGE works by counting transcripts and storing these digital values electronically, providing absolute gene expression levels that make historical comparisons possible. SAGE produces a comprehensive profile of gene expression and can be used to search for candidate tumor markers or antigens in a limited number of samples. The Cancer Genome Anatomy Project has created a SAGE database of human gene expression levels for many different tumors and normal reference tissues and provides online tools for viewing, comparing, and downloading expression profiles. Digital expression profiling using SAGE and informatics have been useful for identifying genes that have a role in tumor invasion and other aspects of tumor progression. PMID:12886451

  20. Human Lineage-Specific Transcriptional Regulation through GA-Binding Protein Transcription Factor Alpha (GABPa).

    PubMed

    Perdomo-Sabogal, Alvaro; Nowick, Katja; Piccini, Ilaria; Sudbrak, Ralf; Lehrach, Hans; Yaspo, Marie-Laure; Warnatz, Hans-Jörg; Querfurth, Robert

    2016-05-01

    A substantial fraction of phenotypic differences between closely related species are likely caused by differences in gene regulation. While this has already been postulated over 30 years ago, only few examples of evolutionary changes in gene regulation have been verified. Here, we identified and investigated binding sites of the transcription factor GA-binding protein alpha (GABPa) aiming to discover cis-regulatory adaptations on the human lineage. By performing chromatin immunoprecipitation-sequencing experiments in a human cell line, we found 11,619 putative GABPa binding sites. Through sequence comparisons of the human GABPa binding regions with orthologous sequences from 34 mammals, we identified substitutions that have resulted in 224 putative human-specific GABPa binding sites. To experimentally assess the transcriptional impact of those substitutions, we selected four promoters for promoter-reporter gene assays using human and African green monkey cells. We compared the activities of wild-type promoters to mutated forms, where we have introduced one or more substitutions to mimic the ancestral state devoid of the GABPa consensus binding sequence. Similarly, we introduced the human-specific substitutions into chimpanzee and macaque promoter backgrounds. Our results demonstrate that the identified substitutions are functional, both in human and nonhuman promoters. In addition, we performed GABPa knock-down experiments and found 1,215 genes as strong candidates for primary targets. Further analyses of our data sets link GABPa to cognitive disorders, diabetes, KRAB zinc finger (KRAB-ZNF), and human-specific genes. Thus, we propose that differences in GABPa binding sites played important roles in the evolution of human-specific phenotypes. PMID:26814189

  1. Human Lineage-Specific Transcriptional Regulation through GA-Binding Protein Transcription Factor Alpha (GABPa)

    PubMed Central

    Perdomo-Sabogal, Alvaro; Nowick, Katja; Piccini, Ilaria; Sudbrak, Ralf; Lehrach, Hans; Yaspo, Marie-Laure; Warnatz, Hans-Jörg; Querfurth, Robert

    2016-01-01

    A substantial fraction of phenotypic differences between closely related species are likely caused by differences in gene regulation. While this has already been postulated over 30 years ago, only few examples of evolutionary changes in gene regulation have been verified. Here, we identified and investigated binding sites of the transcription factor GA-binding protein alpha (GABPa) aiming to discover cis-regulatory adaptations on the human lineage. By performing chromatin immunoprecipitation-sequencing experiments in a human cell line, we found 11,619 putative GABPa binding sites. Through sequence comparisons of the human GABPa binding regions with orthologous sequences from 34 mammals, we identified substitutions that have resulted in 224 putative human-specific GABPa binding sites. To experimentally assess the transcriptional impact of those substitutions, we selected four promoters for promoter-reporter gene assays using human and African green monkey cells. We compared the activities of wild-type promoters to mutated forms, where we have introduced one or more substitutions to mimic the ancestral state devoid of the GABPa consensus binding sequence. Similarly, we introduced the human-specific substitutions into chimpanzee and macaque promoter backgrounds. Our results demonstrate that the identified substitutions are functional, both in human and nonhuman promoters. In addition, we performed GABPa knock-down experiments and found 1,215 genes as strong candidates for primary targets. Further analyses of our data sets link GABPa to cognitive disorders, diabetes, KRAB zinc finger (KRAB-ZNF), and human-specific genes. Thus, we propose that differences in GABPa binding sites played important roles in the evolution of human-specific phenotypes. PMID:26814189

  2. Generation of induced pluripotent stem cells from human blood.

    PubMed

    Loh, Yuin-Han; Agarwal, Suneet; Park, In-Hyun; Urbach, Achia; Huo, Hongguang; Heffner, Garrett C; Kim, Kitai; Miller, Justine D; Ng, Kitwa; Daley, George Q

    2009-05-28

    Human dermal fibroblasts obtained by skin biopsy can be reprogrammed directly to pluripotency by the ectopic expression of defined transcription factors. Here, we describe the derivation of induced pluripotent stem cells from CD34+ mobilized human peripheral blood cells using retroviral transduction of OCT4/SOX2/KLF4/MYC. Blood-derived human induced pluripotent stem cells are indistinguishable from human embryonic stem cells with respect to morphology, expression of surface antigens, and pluripotency-associated transcription factors, DNA methylation status at pluripotent cell-specific genes, and the capacity to differentiate in vitro and in teratomas. The ability to reprogram cells from human blood will allow the generation of patient-specific stem cells for diseases in which the disease-causing somatic mutations are restricted to cells of the hematopoietic lineage. PMID:19299331

  3. Oxytocin-Stimulated NFAT Transcriptional Activation in Human Myometrial Cells

    PubMed Central

    McArdle, Craig A.; López Bernal, Andrés

    2012-01-01

    Oxytocin (OXT) is a peptide hormone that binds the OXT receptor on myometrial cells, initiating an intracellular signaling cascade, resulting in accumulation of intracellular calcium and smooth muscle contraction. In other systems, an elevation of intracellular Ca2+ stimulates nuclear translocation of the transcription factor, nuclear factor of activated T cells (NFAT), which is transcriptionally active in arterial and ileal smooth muscle. Here we have investigated the role of NFAT in the mechanism of action of OXT. Human myometrial cells expressed all five NFAT isoforms (NFATC1–C4 and -5). Myometrial cells were transduced with a recombinant adenovirus expressing a NFATC1-EFP reporter, and a semi-automated imaging system was used to monitor effects of OXT on reporter localization in live cells. OXT induced a concentration-dependent nuclear translocation of NFATC1-EFP in a reversible manner, which was inhibited by OXT antagonists and calcineurin inhibitors. Pulsatile stimulation with OXT caused intermittent, pulse-frequency-dependent, nuclear translocation of NFATC1-EFP, which was more efficient than sustained stimulation. OXT induced nuclear translocation of endogenous NFAT that was transcriptionally active, because OXT stimulated activity of a NFAT-response element-luciferase reporter and induced calcineurin-NFAT dependent expression of RGS2, RCAN1, and PTGS2 (COX2) mRNA. Furthermore, OXT-dependent transcription was dependent on protein neosynthesis; cycloheximide abolished RGS2 transcription but augmented RCAN1 and COX2 transcriptional readouts. This study identifies a novel signaling mechanism within the myometrium, whereby calcineurin-NFAT signaling mediates OXT-induced transcriptional activity. Furthermore, we show NFATC1-EFP is responsive to pulses of OXT, a mechanism by which myometrial cells could decode OXT pulse frequency. PMID:22902539

  4. Post-transcriptional gene silencing, transcriptional gene silencing and human immunodeficiency virus

    PubMed Central

    Méndez, Catalina; Ahlenstiel, Chantelle L; Kelleher, Anthony D

    2015-01-01

    While human immunodeficiency virus 1 (HIV-1) infection is controlled through continuous, life-long use of a combination of drugs targeting different steps of the virus cycle, HIV-1 is never completely eradicated from the body. Despite decades of research there is still no effective vaccine to prevent HIV-1 infection. Therefore, the possibility of an RNA interference (RNAi)-based cure has become an increasingly explored approach. Endogenous gene expression is controlled at both, transcriptional and post-transcriptional levels by non-coding RNAs, which act through diverse molecular mechanisms including RNAi. RNAi has the potential to control the turning on/off of specific genes through transcriptional gene silencing (TGS), as well as fine-tuning their expression through post-transcriptional gene silencing (PTGS). In this review we will describe in detail the canonical RNAi pathways for PTGS and TGS, the relationship of TGS with other silencing mechanisms and will discuss a variety of approaches developed to suppress HIV-1 via manipulation of RNAi. We will briefly compare RNAi strategies against other approaches developed to target the virus, highlighting their potential to overcome the major obstacle to finding a cure, which is the specific targeting of the HIV-1 reservoir within latently infected cells. PMID:26279984

  5. Characterisation of CDKL5 Transcript Isoforms in Human and Mouse.

    PubMed

    Hector, Ralph D; Dando, Owen; Landsberger, Nicoletta; Kilstrup-Nielsen, Charlotte; Kind, Peter C; Bailey, Mark E S; Cobb, Stuart R

    2016-01-01

    Mutations in the X-linked Cyclin-Dependent Kinase-Like 5 gene (CDKL5) cause early onset infantile spasms and subsequent severe developmental delay in affected children. Deleterious mutations have been reported to occur throughout the CDKL5 coding region. Several studies point to a complex CDKL5 gene structure in terms of exon usage and transcript expression. Improvements in molecular diagnosis and more extensive research into the neurobiology of CDKL5 and pathophysiology of CDKL5 disorders necessitate an updated analysis of the gene. In this study, we have analysed human and mouse CDKL5 transcript patterns both bioinformatically and experimentally. We have characterised the predominant brain isoform of CDKL5, a 9.7 kb transcript comprised of 18 exons with a large 6.6 kb 3'-untranslated region (UTR), which we name hCDKL5_1. In addition we describe new exonic regions and a range of novel splice and UTR isoforms. This has enabled the description of an updated gene model in both species and a standardised nomenclature system for CDKL5 transcripts. Profiling revealed tissue- and brain development stage-specific differences in expression between transcript isoforms. These findings provide an essential backdrop for the diagnosis of CDKL5-related disorders, for investigations into the basic biology of this gene and its protein products, and for the rational design of gene-based and molecular therapies for these disorders. PMID:27315173

  6. Near-atomic resolution visualization of human transcription promoter opening.

    PubMed

    He, Yuan; Yan, Chunli; Fang, Jie; Inouye, Carla; Tjian, Robert; Ivanov, Ivaylo; Nogales, Eva

    2016-05-19

    In eukaryotic transcription initiation, a large multi-subunit pre-initiation complex (PIC) that assembles at the core promoter is required for the opening of the duplex DNA and identification of the start site for transcription by RNA polymerase II. Here we use cryo-electron microscropy (cryo-EM) to determine near-atomic resolution structures of the human PIC in a closed state (engaged with duplex DNA), an open state (engaged with a transcription bubble), and an initially transcribing complex (containing six base pairs of DNA-RNA hybrid). Our studies provide structures for previously uncharacterized components of the PIC, such as TFIIE and TFIIH, and segments of TFIIA, TFIIB and TFIIF. Comparison of the different structures reveals the sequential conformational changes that accompany the transition from each state to the next throughout the transcription initiation process. This analysis illustrates the key role of TFIIB in transcription bubble stabilization and provides strong structural support for a translocase activity of XPB. PMID:27193682

  7. Characterisation of CDKL5 Transcript Isoforms in Human and Mouse

    PubMed Central

    Dando, Owen; Landsberger, Nicoletta; Kilstrup-Nielsen, Charlotte; Kind, Peter C.; Bailey, Mark E. S.; Cobb, Stuart R.

    2016-01-01

    Mutations in the X-linked Cyclin-Dependent Kinase-Like 5 gene (CDKL5) cause early onset infantile spasms and subsequent severe developmental delay in affected children. Deleterious mutations have been reported to occur throughout the CDKL5 coding region. Several studies point to a complex CDKL5 gene structure in terms of exon usage and transcript expression. Improvements in molecular diagnosis and more extensive research into the neurobiology of CDKL5 and pathophysiology of CDKL5 disorders necessitate an updated analysis of the gene. In this study, we have analysed human and mouse CDKL5 transcript patterns both bioinformatically and experimentally. We have characterised the predominant brain isoform of CDKL5, a 9.7 kb transcript comprised of 18 exons with a large 6.6 kb 3’-untranslated region (UTR), which we name hCDKL5_1. In addition we describe new exonic regions and a range of novel splice and UTR isoforms. This has enabled the description of an updated gene model in both species and a standardised nomenclature system for CDKL5 transcripts. Profiling revealed tissue- and brain development stage-specific differences in expression between transcript isoforms. These findings provide an essential backdrop for the diagnosis of CDKL5-related disorders, for investigations into the basic biology of this gene and its protein products, and for the rational design of gene-based and molecular therapies for these disorders. PMID:27315173

  8. Structural characterization of human general transcription factor TFIIF in solution

    PubMed Central

    Akashi, Satoko; Nagakura, Shinjiro; Yamamoto, Seiji; Okuda, Masahiko; Ohkuma, Yoshiaki; Nishimura, Yoshifumi

    2008-01-01

    Human general transcription factor IIF (TFIIF), a component of the transcription pre-initiation complex (PIC) associated with RNA polymerase II (Pol II), was characterized by size-exclusion chromatography (SEC), electrospray ionization mass spectrometry (ESI-MS), and chemical cross-linking. Recombinant TFIIF, composed of an equimolar ratio of α and β subunits, was bacterially expressed, purified to homogeneity, and found to have a transcription activity similar to a natural one in the human in vitro transcription system. SEC of purified TFIIF, as previously reported, suggested that this protein has a size >200 kDa. In contrast, ESI-MS of the purified sample gave a molecular size of 87 kDa, indicating that TFIIF is an αβ heterodimer, which was confirmed by matrix-assisted laser desorption/ionization (MALDI) MS of the cross-linked TFIIF components. Recent electron microscopy (EM) and photo-cross-linking studies showed that the yeast TFIIF homolog containing Tfg1 and Tfg2, corresponding to the human α and β subunits, exists as a heterodimer in the PIC, so the human TFIIF is also likely to exist as a heterodimer even in the PIC. In the yeast PIC, EM and photo-cross-linking studies showed different results for the mutual location of TFIIE and TFIIF along DNA. We have examined the direct interaction between human TFIIF and TFIIE by ESI-MS, SEC, and chemical cross-linking; however, no direct interaction was observed, at least in solution. This is consistent with the previous photo-cross-linking observation that TFIIF and TFIIE flank DNA separately on both sides of the Pol II central cleft in the yeast PIC. PMID:18218714

  9. Organization of the human mitochondrial transcription initiation complex

    PubMed Central

    Yakubovskaya, Elena; Guja, Kip E.; Eng, Edward T.; Choi, Woo Suk; Mejia, Edison; Beglov, Dmitri; Lukin, Mark; Kozakov, Dima; Garcia-Diaz, Miguel

    2014-01-01

    Initiation of transcription in human mitochondria involves two factors, TFAM and TFB2M, in addition to the mitochondrial RNA polymerase, POLRMT. We have investigated the organization of the human mitochondrial transcription initiation complex on the light-strand promoter (LSP) through solution X-ray scattering, electron microscopy (EM) and biochemical studies. Our EM results demonstrate a compact organization of the initiation complex, suggesting that protein–protein interactions might help mediate initiation. We demonstrate that, in the absence of DNA, only POLRMT and TFAM form a stable interaction, albeit one with low affinity. This is consistent with the expected transient nature of the interactions necessary for initiation and implies that the promoter DNA acts as a scaffold that enables formation of the full initiation complex. Docking of known crystal structures into our EM maps results in a model for transcriptional initiation that strongly correlates with new and existing biochemical observations. Our results reveal the organization of TFAM, POLRMT and TFB2M around the LSP and represent the first structural characterization of the entire mitochondrial transcriptional initiation complex. PMID:24413562

  10. Transcriptional burst frequency and burst size are equally modulated across the human genome

    SciTech Connect

    Dar, Roy D.; Simpson, Michael L; Weinberger, Leor S.; Razooky, B; Cox, Chris D.; McCollum, James M.; Trimeloni, Tom; Singh, A

    2012-01-01

    Gene expression occurs either as an episodic process, characterized by pulsatile bursts or as a constitutive, Poisson-like accumulation of gene products. It is not clear which mode of gene expression (constitutive versus bursty) predominates across a genome or how transcriptional dynamics are influenced by genomic position and promoter sequence. Here, we use time-lapse fluorescence microscopy, building off of theoretical studies that exploit the time-resolved structure of stochastic fluctuations in gene expression, to develop a three-dimensional method for mapping underlying gene-regulatory mechanisms. Over 8,000 individual human genomic loci were analyzed, and at virtually all loci, episodic bursting as opposed to constitutive expression was found to be the predominant mode of expression. Quantitative analysis of the expression dynamics at these 8,000 loci indicates that both frequency and size of transcriptional bursts vary equally across the human genome independent of promoter sequence. Strikingly, weaker expression loci modulate burst frequency to increase activity, while stronger expression loci modulate burst size to increase activity. Transcriptional activators, such as TNF, generate similar patterns of change in burst frequency and burst size. In summary, transcriptional bursting dominates across the human genome, both burst frequency and burst size vary by chromosomal location, and transcriptional activators alter burst frequency and burst size, depending on the expression level of the locus.

  11. TFCat: the curated catalog of mouse and human transcription factors

    PubMed Central

    Fulton, Debra L; Sundararajan, Saravanan; Badis, Gwenael; Hughes, Timothy R; Wasserman, Wyeth W; Roach, Jared C; Sladek, Rob

    2009-01-01

    Unravelling regulatory programs governed by transcription factors (TFs) is fundamental to understanding biological systems. TFCat is a catalog of mouse and human TFs based on a reliable core collection of annotations obtained by expert review of the scientific literature. The collection, including proven and homology-based candidate TFs, is annotated within a function-based taxonomy and DNA-binding proteins are organized within a classification system. All data and user-feedback mechanisms are available at the TFCat portal . PMID:19284633

  12. RNA polymerase II ternary transcription complexes generated in vitro.

    PubMed Central

    Ackerman, S; Bunick, D; Zandomeni, R; Weinmann, R

    1983-01-01

    Ternary transcription complexes have been formed with a HeLa cell extract, a specific DNA template, and nucleoside triphosphates. The assay depends on the formation of sarkosyl-resistant initiation complexes which contain RNA polymerase II, template DNA, and radioactive nucleoside triphosphates. Separation from the other elements in the in vitro reaction is achieved by electrophoresis in agarose - 0.25% sarkosyl gels. The mobility of the ternary complexes in this system cannot be distinguished from naked DNA. Formation of this complex is dependent on all parameters necessary for faithful in vitro transcription. Complexes are formed with both the plasmid vector and the specific adenovirus DNA insert containing a eucaryotic promoter. The formation of the complex on the eucaryotic DNA is sequence-dependent. An undecaribonucleotide predicted from the template DNA sequence remains associated with the DNA in the ternary complex and can be isolated if the chain terminator 3'-0-methyl GTP is used, or after T1 ribonuclease treatment of the RNA, or if exogenous GTP is omitted from the in vitro reaction. This oligonucleotide is not detected in association with the plasmid vector. Phosphocellulose fractionation of the extract indicates that at least one of the column fractions required for faithful runoff transcription is required for complex formation. A large molar excess of abortive initiation events was detected relative to the level of productive transcription events, indicating a 40-fold higher efficiency of transcription initiation vs. elongation. Images PMID:6193489

  13. Transcriptional divergence and conservation of human and mouse erythropoiesis

    PubMed Central

    Pishesha, Novalia; Thiru, Prathapan; Shi, Jiahai; Eng, Jennifer C.; Sankaran, Vijay G.; Lodish, Harvey F.

    2014-01-01

    Mouse models have been used extensively for decades and have been instrumental in improving our understanding of mammalian erythropoiesis. Nonetheless, there are several examples of variation between human and mouse erythropoiesis. We performed a comparative global gene expression study using data from morphologically identical stage-matched sorted populations of human and mouse erythroid precursors from early to late erythroblasts. Induction and repression of major transcriptional regulators of erythropoiesis, as well as major erythroid-important proteins, are largely conserved between the species. In contrast, at a global level we identified a significant extent of divergence between the species, both at comparable stages and in the transitions between stages, especially for the 500 most highly expressed genes during development. This suggests that the response of multiple developmentally regulated genes to key erythroid transcriptional regulators represents an important modification that has occurred in the course of erythroid evolution. In developing a systematic framework to understand and study conservation and divergence between human and mouse erythropoiesis, we show how mouse models can fail to mimic specific human diseases and provide predictions for translating findings from mouse models to potential therapies for human disease. PMID:24591581

  14. DNA methylation presents distinct binding sites for human transcription factors.

    PubMed

    Hu, Shaohui; Wan, Jun; Su, Yijing; Song, Qifeng; Zeng, Yaxue; Nguyen, Ha Nam; Shin, Jaehoon; Cox, Eric; Rho, Hee Sool; Woodard, Crystal; Xia, Shuli; Liu, Shuang; Lyu, Huibin; Ming, Guo-Li; Wade, Herschel; Song, Hongjun; Qian, Jiang; Zhu, Heng

    2013-01-01

    DNA methylation, especially CpG methylation at promoter regions, has been generally considered as a potent epigenetic modification that prohibits transcription factor (TF) recruitment, resulting in transcription suppression. Here, we used a protein microarray-based approach to systematically survey the entire human TF family and found numerous purified TFs with methylated CpG (mCpG)-dependent DNA-binding activities. Interestingly, some TFs exhibit specific binding activity to methylated and unmethylated DNA motifs of distinct sequences. To elucidate the underlying mechanism, we focused on Kruppel-like factor 4 (KLF4), and decoupled its mCpG- and CpG-binding activities via site-directed mutagenesis. Furthermore, KLF4 binds specific methylated or unmethylated motifs in human embryonic stem cells in vivo. Our study suggests that mCpG-dependent TF binding activity is a widespread phenomenon and provides a new framework to understand the role and mechanism of TFs in epigenetic regulation of gene transcription. DOI:http://dx.doi.org/10.7554/eLife.00726.001. PMID:24015356

  15. DNA methylation presents distinct binding sites for human transcription factors

    PubMed Central

    Hu, Shaohui; Wan, Jun; Su, Yijing; Song, Qifeng; Zeng, Yaxue; Nguyen, Ha Nam; Shin, Jaehoon; Cox, Eric; Rho, Hee Sool; Woodard, Crystal; Xia, Shuli; Liu, Shuang; Lyu, Huibin; Ming, Guo-Li; Wade, Herschel; Song, Hongjun; Qian, Jiang; Zhu, Heng

    2013-01-01

    DNA methylation, especially CpG methylation at promoter regions, has been generally considered as a potent epigenetic modification that prohibits transcription factor (TF) recruitment, resulting in transcription suppression. Here, we used a protein microarray-based approach to systematically survey the entire human TF family and found numerous purified TFs with methylated CpG (mCpG)-dependent DNA-binding activities. Interestingly, some TFs exhibit specific binding activity to methylated and unmethylated DNA motifs of distinct sequences. To elucidate the underlying mechanism, we focused on Kruppel-like factor 4 (KLF4), and decoupled its mCpG- and CpG-binding activities via site-directed mutagenesis. Furthermore, KLF4 binds specific methylated or unmethylated motifs in human embryonic stem cells in vivo. Our study suggests that mCpG-dependent TF binding activity is a widespread phenomenon and provides a new framework to understand the role and mechanism of TFs in epigenetic regulation of gene transcription. DOI: http://dx.doi.org/10.7554/eLife.00726.001 PMID:24015356

  16. A cancer-specific transcriptional signature in human neoplasia

    PubMed Central

    Nicassio, Francesco; Bianchi, Fabrizio; Capra, Maria; Vecchi, Manuela; Confalonieri, Stefano; Bianchi, Marco; Pajalunga, Deborah; Crescenzi, Marco; Bonapace, Ian Marc; Di Fiore, Pier Paolo

    2005-01-01

    The molecular anatomy of cancer cells is being explored through unbiased approaches aimed at the identification of cancer-specific transcriptional signatures. An alternative biased approach is exploitation of molecular tools capable of inducing cellular transformation. Transcriptional signatures thus identified can be readily validated in real cancers and more easily reverse-engineered into signaling pathways, given preexisting molecular knowledge. We exploited the ability of the adenovirus early region 1 A protein (E1A) oncogene to force the reentry into the cell cycle of terminally differentiated cells in order to identify and characterize genes whose expression is upregulated in this process. A subset of these genes was activated through a retinoblastoma protein/E2 viral promoter required factor–independent (pRb/E2F-independent) mechanism and was overexpressed in a fraction of human cancers. Furthermore, this overexpression correlated with tumor progression in colon cancer, and 2 of these genes predicted unfavorable prognosis in breast cancer. A proof of principle biological validation was performed on one of the genes of the signature, skeletal muscle cell reentry-induced (SKIN) gene, a previously undescribed gene. SKIN was found overexpressed in some primary tumors and tumor cell lines and was amplified in a fraction of colon adenocarcinomas. Furthermore, knockdown of SKIN caused selective growth suppression in overexpressing tumor cell lines but not in tumor lines expressing physiological levels of the transcript. Thus, SKIN is a candidate oncogene in human cancer. PMID:16224537

  17. Transcription factor induction of human oligodendrocyte progenitor fate and differentiation.

    PubMed

    Wang, Jing; Pol, Suyog U; Haberman, Alexa K; Wang, Chunming; O'Bara, Melanie A; Sim, Fraser J

    2014-07-15

    Human oligodendrocyte progenitor cell (OPC) specification and differentiation occurs slowly and limits the potential for cell-based treatment of demyelinating disease. In this study, using FACS-based isolation and microarray analysis, we identified a set of transcription factors expressed by human primary CD140a(+)O4(+) OPCs relative to CD133(+)CD140a(-) neural stem/progenitor cells (NPCs). Among these, lentiviral overexpression of transcription factors ASCL1, SOX10, and NKX2.2 in NPCs was sufficient to induce Sox10 enhancer activity, OPC mRNA, and protein expression consistent with OPC fate; however, unlike ASCL1 and NKX2.2, only the transcriptome of SOX10-infected NPCs was induced to a human OPC gene expression signature. Furthermore, only SOX10 promoted oligodendrocyte commitment, and did so at quantitatively equivalent levels to native OPCs. In xenografts of shiverer/rag2 animals, SOX10 increased the rate of mature oligodendrocyte differentiation and axon ensheathment. Thus, SOX10 appears to be the principle and rate-limiting regulator of myelinogenic fate from human NPCs. PMID:24982138

  18. Transcription factor induction of human oligodendrocyte progenitor fate and differentiation

    PubMed Central

    Wang, Jing; Pol, Suyog U.; Haberman, Alexa K.; Wang, Chunming; O’Bara, Melanie A.; Sim, Fraser J.

    2014-01-01

    Human oligodendrocyte progenitor cell (OPC) specification and differentiation occurs slowly and limits the potential for cell-based treatment of demyelinating disease. In this study, using FACS-based isolation and microarray analysis, we identified a set of transcription factors expressed by human primary CD140a+O4+ OPCs relative to CD133+CD140a− neural stem/progenitor cells (NPCs). Among these, lentiviral overexpression of transcription factors ASCL1, SOX10, and NKX2.2 in NPCs was sufficient to induce Sox10 enhancer activity, OPC mRNA, and protein expression consistent with OPC fate; however, unlike ASCL1 and NKX2.2, only the transcriptome of SOX10-infected NPCs was induced to a human OPC gene expression signature. Furthermore, only SOX10 promoted oligodendrocyte commitment, and did so at quantitatively equivalent levels to native OPCs. In xenografts of shiverer/rag2 animals, SOX10 increased the rate of mature oligodendrocyte differentiation and axon ensheathment. Thus, SOX10 appears to be the principle and rate-limiting regulator of myelinogenic fate from human NPCs. PMID:24982138

  19. Dynamic Transcriptional and Epigenetic Regulation of Human Epidermal Keratinocyte Differentiation

    PubMed Central

    Cavazza, Alessia; Miccio, Annarita; Romano, Oriana; Petiti, Luca; Malagoli Tagliazucchi, Guidantonio; Peano, Clelia; Severgnini, Marco; Rizzi, Ermanno; De Bellis, Gianluca; Bicciato, Silvio; Mavilio, Fulvio

    2016-01-01

    Summary Human skin is maintained by the differentiation and maturation of interfollicular stem and progenitors cells. We used DeepCAGE, genome-wide profiling of histone modifications and retroviral integration analysis, to map transcripts, promoters, enhancers, and super-enhancers (SEs) in prospectively isolated keratinocytes and transit-amplifying progenitors, and retrospectively defined keratinocyte stem cells. We show that >95% of the active promoters are in common and differentially regulated in progenitors and differentiated keratinocytes, while approximately half of the enhancers and SEs are stage specific and account for most of the epigenetic changes occurring during differentiation. Transcription factor (TF) motif identification and correlation with TF binding site maps allowed the identification of TF circuitries acting on enhancers and SEs during differentiation. Overall, our study provides a broad, genome-wide description of chromatin dynamics and differential enhancer and promoter usage during epithelial differentiation, and describes a novel approach to identify active regulatory elements in rare stem cell populations. PMID:27050947

  20. Dynamic Transcriptional and Epigenetic Regulation of Human Epidermal Keratinocyte Differentiation.

    PubMed

    Cavazza, Alessia; Miccio, Annarita; Romano, Oriana; Petiti, Luca; Malagoli Tagliazucchi, Guidantonio; Peano, Clelia; Severgnini, Marco; Rizzi, Ermanno; De Bellis, Gianluca; Bicciato, Silvio; Mavilio, Fulvio

    2016-04-12

    Human skin is maintained by the differentiation and maturation of interfollicular stem and progenitors cells. We used DeepCAGE, genome-wide profiling of histone modifications and retroviral integration analysis, to map transcripts, promoters, enhancers, and super-enhancers (SEs) in prospectively isolated keratinocytes and transit-amplifying progenitors, and retrospectively defined keratinocyte stem cells. We show that >95% of the active promoters are in common and differentially regulated in progenitors and differentiated keratinocytes, while approximately half of the enhancers and SEs are stage specific and account for most of the epigenetic changes occurring during differentiation. Transcription factor (TF) motif identification and correlation with TF binding site maps allowed the identification of TF circuitries acting on enhancers and SEs during differentiation. Overall, our study provides a broad, genome-wide description of chromatin dynamics and differential enhancer and promoter usage during epithelial differentiation, and describes a novel approach to identify active regulatory elements in rare stem cell populations. PMID:27050947

  1. Massive transcriptional start site analysis of human genes in hypoxia cells.

    PubMed

    Tsuchihara, Katsuya; Suzuki, Yutaka; Wakaguri, Hiroyuki; Irie, Takuma; Tanimoto, Kousuke; Hashimoto, Shin-ichi; Matsushima, Kouji; Mizushima-Sugano, Junko; Yamashita, Riu; Nakai, Kenta; Bentley, David; Esumi, Hiroyasu; Sugano, Sumio

    2009-04-01

    Combining our full-length cDNA method and the massively parallel sequencing technology, we developed a simple method to collect precise positional information of transcriptional start sites (TSSs) together with digital information of the gene-expression levels in a high throughput manner. We applied this method to observe gene-expression changes in a colon cancer cell line cultured in normoxic and hypoxic conditions. We generated more than 100 million 36-base TSS-tag sequences and revealed comprehensive features of hypoxia responsive alterations in the transcriptional landscape of the human genome. The features include presence of inducible 'hot regions' in 54 genomic regions, 220 novel hypoxia inducible promoters that may drive non-protein-coding transcripts, 191 hypoxia responsive alternative promoters and detailed views of 120 novel as well as known hypoxia responsive genes. We further analyzed hypoxic response of different cells using additional 60 million TSS-tags and found that the degree of the gene-expression changes were different among cell lines, possibly reflecting cellular robustness against hypoxia. The novel dynamic figure of the human gene transcriptome will deepen our understanding of the transcriptional program of the human genome as well as bringing new insights into the biology of cancer cells in hypoxia. PMID:19237398

  2. Telomere Transcripts Target Telomerase in Human Cancer Cells.

    PubMed

    Kreilmeier, Theresa; Mejri, Doris; Hauck, Marlene; Kleiter, Miriam; Holzmann, Klaus

    2016-01-01

    Long non-coding transcripts from telomeres, called telomeric repeat-containing RNA (TERRA), were identified as blocking telomerase activity (TA), a telomere maintenance mechanism (TMM), in tumors. We expressed recombinant TERRA transcripts in tumor cell lines with TA and with alternative lengthening of telomeres (ALT) to study effects on TMM and cell growth. Adeno- and lentivirus constructs (AV and LV) were established for transient and stable expression of approximately 130 units of telomere hexanucleotide repeats under control of cytomegalovirus (CMV) and human RNase P RNA H1 (hH1) promoters with and without polyadenylation, respectively. Six human tumor cell lines either using telomerase or ALT were infected and analyzed for TA levels. Pre-infection cells using telomerase had 1%-3% of the TERRA expression levels of ALT cells. AV and LV expression of recombinant TERRA in telomerase positive cells showed a 1.3-2.6 fold increase in TERRA levels, and a decrease in TA of 25%-58%. Dominant-negative or small hairpin RNA (shRNA) viral expression against human telomerase reverse transcriptase (hTERT) results in senescence, not induced by TERRA expression. Population doubling time, cell viability and TL (telomere length) were not impacted by ectopic TERRA expression. Clonal growth was reduced by TERRA expression in TA but not ALT cell lines. ALT cells were not affected by treatments applied. Established cell models and tools may be used to better understand the role of TERRA in the cell, especially for targeting telomerase. PMID:27537914

  3. Transcriptional control of human p53-regulated genes.

    PubMed

    Riley, Todd; Sontag, Eduardo; Chen, Patricia; Levine, Arnold

    2008-05-01

    The p53 protein regulates the transcription of many different genes in response to a wide variety of stress signals. Following DNA damage, p53 regulates key processes, including DNA repair, cell-cycle arrest, senescence and apoptosis, in order to suppress cancer. This Analysis article provides an overview of the current knowledge of p53-regulated genes in these pathways and others, and the mechanisms of their regulation. In addition, we present the most comprehensive list so far of human p53-regulated genes and their experimentally validated, functional binding sites that confer p53 regulation. PMID:18431400

  4. Identification of a novel transcript of human MD2 gene.

    PubMed

    Shen, Chen; Shen, A-Dong

    2016-09-15

    Myeloid differentiation protein 2 (MD2) regulates bacterial lipopolysaccharide (LPS) triggered anti-bacterial immune response as a broker between LPS and Toll-like receptor 4 (TLR4). In this study, we identified a novel naturally occurring spliceosome of human MD2, termed as MD2-T3. This transcript lacked two exons of MD2 gene. By protein structure analysis and literature review, we predicted that MD2-T3 isoform might execute regulatory biological effects such as limiting LPS-triggered TLR4 signaling. PMID:27317890

  5. Redundant cooperative interactions for assembly of a human U6 transcription initiation complex.

    PubMed

    Ma, Beicong; Hernandez, Nouria

    2002-11-01

    The core human U6 promoter consists of a proximal sequence element (PSE) located upstream of a TATA box. The PSE is recognized by the snRNA-activating protein complex (SNAP(c)), which consists of five types of subunits, SNAP190, SNAP50, SNAP45, SNAP43, and SNAP19. The TATA box is recognized by TATA box binding protein (TBP). In addition, basal U6 transcription requires the SANT domain protein Bdp1 and the transcription factor IIB-related factor Brf2. SNAP(c) and mini-SNAP(c), which consists of just SNAP43, SNAP50, and the N-terminal third of SNAP190, bind cooperatively with TBP to the core U6 promoter. By generating complexes smaller than mini-SNAP(c), we have identified a 50-amino-acid region within SNAP190 that is (i) required for cooperative binding with TBP in the context of mini-SNAP(c) and (ii) sufficient for cooperative binding with TBP when fused to a heterologous DNA binding domain. We show that derivatives of mini-SNAP(c) lacking this region are active for transcription and that with such complexes, TBP can still be recruited to the U6 promoter through cooperative interactions with Brf2. Our results identify complexes smaller than mini-SNAP(c) that are transcriptionally active and show that there are at least two redundant mechanisms to stably recruit TBP to the U6 transcription initiation complex. PMID:12391172

  6. Redundant Cooperative Interactions for Assembly of a Human U6 Transcription Initiation Complex

    PubMed Central

    Ma, Beicong; Hernandez, Nouria

    2002-01-01

    The core human U6 promoter consists of a proximal sequence element (PSE) located upstream of a TATA box. The PSE is recognized by the snRNA-activating protein complex (SNAPc), which consists of five types of subunits, SNAP190, SNAP50, SNAP45, SNAP43, and SNAP19. The TATA box is recognized by TATA box binding protein (TBP). In addition, basal U6 transcription requires the SANT domain protein Bdp1 and the transcription factor IIB-related factor Brf2. SNAPc and mini-SNAPc, which consists of just SNAP43, SNAP50, and the N-terminal third of SNAP190, bind cooperatively with TBP to the core U6 promoter. By generating complexes smaller than mini-SNAPc, we have identified a 50-amino-acid region within SNAP190 that is (i) required for cooperative binding with TBP in the context of mini-SNAPc and (ii) sufficient for cooperative binding with TBP when fused to a heterologous DNA binding domain. We show that derivatives of mini-SNAPc lacking this region are active for transcription and that with such complexes, TBP can still be recruited to the U6 promoter through cooperative interactions with Brf2. Our results identify complexes smaller than mini-SNAPc that are transcriptionally active and show that there are at least two redundant mechanisms to stably recruit TBP to the U6 transcription initiation complex. PMID:12391172

  7. Post-transcriptional gene silencing activity of human GIGYF2.

    PubMed

    Kryszke, Marie-Hélène; Adjeriou, Badia; Liang, Feifei; Chen, Hong; Dautry, François

    2016-07-01

    In mammalian post-transcriptional gene silencing, the Argonaute protein AGO2 indirectly recruits translation inhibitors, deadenylase complexes, and decapping factors to microRNA-targeted mRNAs, thereby repressing mRNA translation and accelerating mRNA decay. However, the exact composition and assembly pathway of the microRNA-induced silencing complex are not completely elucidated. As the GYF domain of human GIGYF2 was shown to bind AGO2 in pulldown experiments, we wondered whether GIGYF2 could be a novel protein component of the microRNA-induced silencing complex. Here we show that full-length GIGYF2 coimmunoprecipitates with AGO2 in human cells, and demonstrate that, upon tethering to a reporter mRNA, GIGYF2 exhibits strong, dose-dependent silencing activity, involving both mRNA destabilization and translational repression. PMID:27157137

  8. Genotype × age interaction in human transcriptional ageing

    PubMed Central

    Kent, Jack W.; Göring, Harald H. H.; Charlesworth, Jac C.; Drigalenko, Eugene; Diego, Vincent P.; Curran, Joanne E.; Johnson, Matthew P.; Dyer, Thomas D.; Cole, Shelley A.; Jowett, Jeremy B. M.; Mahaney, Michael C.; Comuzzie, Anthony G.; Almasy, Laura; Moses, Eric K.; Blangero, John; Williams-Blangero, Sarah

    2012-01-01

    Individual differences in biological ageing (i.e., the rate of physiological response to the passage of time) may be due in part to genotype-specific variation in gene action. However, the sources of heritable variation in human age-related gene expression profiles are largely unknown. We have profiled genome-wide expression in peripheral blood mononuclear cells from 1,240 individuals in large families and found 4,472 human autosomal transcripts, representing ~4,349 genes, significantly correlated with age. We identified 623 transcripts that show genotype by age interaction in addition to a main effect of age, defining a large set of novel candidates for characterization of the mechanisms of differential biological ageing. We applied a novel SNP genotype×age interaction test to one of these candidates, the ubiquilin-like gene UBQLNL, and found evidence of joint cis-association and genotype by age interaction as well as trans-genotype by age interaction for UBQLNL expression. Both UBQLNL expression levels at recruitment and cis genotype are associated with longitudinal cancer risk in our study cohort. PMID:22871458

  9. Comparison of the transcriptional landscapes between human and mouse tissues.

    PubMed

    Lin, Shin; Lin, Yiing; Nery, Joseph R; Urich, Mark A; Breschi, Alessandra; Davis, Carrie A; Dobin, Alexander; Zaleski, Christopher; Beer, Michael A; Chapman, William C; Gingeras, Thomas R; Ecker, Joseph R; Snyder, Michael P

    2014-12-01

    Although the similarities between humans and mice are typically highlighted, morphologically and genetically, there are many differences. To better understand these two species on a molecular level, we performed a comparison of the expression profiles of 15 tissues by deep RNA sequencing and examined the similarities and differences in the transcriptome for both protein-coding and -noncoding transcripts. Although commonalities are evident in the expression of tissue-specific genes between the two species, the expression for many sets of genes was found to be more similar in different tissues within the same species than between species. These findings were further corroborated by associated epigenetic histone mark analyses. We also find that many noncoding transcripts are expressed at a low level and are not detectable at appreciable levels across individuals. Moreover, the majority lack obvious sequence homologs between species, even when we restrict our attention to those which are most highly reproducible across biological replicates. Overall, our results indicate that there is considerable RNA expression diversity between humans and mice, well beyond what was described previously, likely reflecting the fundamental physiological differences between these two organisms. PMID:25413365

  10. Comparison of the transcriptional landscapes between human and mouse tissues

    PubMed Central

    Lin, Shin; Lin, Yiing; Nery, Joseph R.; Urich, Mark A.; Breschi, Alessandra; Davis, Carrie A.; Dobin, Alexander; Zaleski, Christopher; Beer, Michael A.; Chapman, William C.; Gingeras, Thomas R.; Ecker, Joseph R.; Snyder, Michael P.

    2014-01-01

    Although the similarities between humans and mice are typically highlighted, morphologically and genetically, there are many differences. To better understand these two species on a molecular level, we performed a comparison of the expression profiles of 15 tissues by deep RNA sequencing and examined the similarities and differences in the transcriptome for both protein-coding and -noncoding transcripts. Although commonalities are evident in the expression of tissue-specific genes between the two species, the expression for many sets of genes was found to be more similar in different tissues within the same species than between species. These findings were further corroborated by associated epigenetic histone mark analyses. We also find that many noncoding transcripts are expressed at a low level and are not detectable at appreciable levels across individuals. Moreover, the majority lack obvious sequence homologs between species, even when we restrict our attention to those which are most highly reproducible across biological replicates. Overall, our results indicate that there is considerable RNA expression diversity between humans and mice, well beyond what was described previously, likely reflecting the fundamental physiological differences between these two organisms. PMID:25413365

  11. Alternative splicing generates novel Fads3 transcript in mice.

    PubMed

    Zhang, Ji Yao; Qin, Xia; Park, Hui Gyu; Kim, Ellen; Liu, Guowen; Kothapalli, Kumar S D; Brenna, J Thomas

    2016-08-01

    Fads3 is the third member of the fatty acid desaturase gene cluster; with at least eight evolutionarily conserved alternative transcripts (AT), having no clearly established function as are known for FADS2 and FADS1. Here we present identification of a novel Fads3 transcript in mice (Fads3AT9), characterize Fads3AT9 expression in mouse tissues and evaluate correlations with metabolite profiles. Total RNA obtained from mouse tissues is reverse-transcribed into cDNA and used as template for PCR reactions. Tissue fatty acids were extracted and quantified by gas chromatography. Sequencing analysis revealed complete absence of exon 2 resulting in an open reading frame of 1239 bp, encoding a putative protein of 412 aa with loss of 37 aa compared to classical Fads3 (Fads3CS). FADS3AT9 retains all the conserved regions characteristic of front end desaturase (cytochrome b5 domain and three histidine repeats). Both Fads3CS and Fads3AT9 are ubiquitously expressed in 11 mouse tissues. Fads3AT9 abundance was greater than Fads3CS in pancreas, liver, spleen, brown adipose tissue and thymus. Fads3CS expression is low in pancreas while Fads3AT9 is over ten-fold greater abundance. The eicosanoid precursor fatty acid 20:4n - 6, the immediate desaturation product of the Fads1 coded Δ5-desaturase, was highest in pancreas where Fads3CS is low. Changes in expression patterns and fatty acid profiles suggest that Fads3AT9 may play a role in the regulation and/or biosynthesis of long chain polyunsaturated fatty acids from precursors. PMID:27216536

  12. Telomere Transcripts Target Telomerase in Human Cancer Cells

    PubMed Central

    Kreilmeier, Theresa; Mejri, Doris; Hauck, Marlene; Kleiter, Miriam; Holzmann, Klaus

    2016-01-01

    Long non-coding transcripts from telomeres, called telomeric repeat-containing RNA (TERRA), were identified as blocking telomerase activity (TA), a telomere maintenance mechanism (TMM), in tumors. We expressed recombinant TERRA transcripts in tumor cell lines with TA and with alternative lengthening of telomeres (ALT) to study effects on TMM and cell growth. Adeno- and lentivirus constructs (AV and LV) were established for transient and stable expression of approximately 130 units of telomere hexanucleotide repeats under control of cytomegalovirus (CMV) and human RNase P RNA H1 (hH1) promoters with and without polyadenylation, respectively. Six human tumor cell lines either using telomerase or ALT were infected and analyzed for TA levels. Pre-infection cells using telomerase had 1%–3% of the TERRA expression levels of ALT cells. AV and LV expression of recombinant TERRA in telomerase positive cells showed a 1.3–2.6 fold increase in TERRA levels, and a decrease in TA of 25%–58%. Dominant-negative or small hairpin RNA (shRNA) viral expression against human telomerase reverse transcriptase (hTERT) results in senescence, not induced by TERRA expression. Population doubling time, cell viability and TL (telomere length) were not impacted by ectopic TERRA expression. Clonal growth was reduced by TERRA expression in TA but not ALT cell lines. ALT cells were not affected by treatments applied. Established cell models and tools may be used to better understand the role of TERRA in the cell, especially for targeting telomerase. PMID:27537914

  13. The short transcript of Leishmania RNA virus is generated by RNA cleavage.

    PubMed Central

    MacBeth, K J; Patterson, J L

    1995-01-01

    Leishmania RNA virus 1 produces a short viral RNA transcript corresponding to the 5' end of positive-sense single-stranded RNAs both in virally infected cells and in in vitro polymerase assays. We hypothesized that this short transcript was generated via cleavage of full-length positive-sense single-stranded RNA. A putative cleavage site was mapped by primer extension analysis to nucleotide 320 of the viral genome. To address the hypothesis that the short transcript is generated via cleavage at this site, two substrate RNAs that possessed viral sequence encompassing the putative cleavage site were created. When incubated with sucrose-purified viral particles, these substrate RNAs were site-specifically cleaved. The cleavage site of the in vitro-processed RNAs also mapped to viral nucleotide 320. The short-transcript-generating activity could be specifically abolished by proteinase K treatment of sucrose-purified viral particles and high concentrations of EGTA [ethylene glycol-bis(beta-aminoethyl ether)-N,N,N',N'-tetraacetic acid], suggesting that the activity requires a proteinaceous factor and possibly intact viral particles. The cleavage activity is directly associated with short-transcript-generating activity, since only viral particle preparations which were capable of generating the short transcript in polymerase assays were also active in the cleavage assay. Furthermore, the short-transcript-generating activity is independent of the viral polymerase's transcriptase and replicase activities. We present a working model whereby cleavage of Leishmaniavirus RNA transcripts functions in the maintenance of a low-level persistent infection. PMID:7745692

  14. Characterization of proopiomelanocortin transcripts in human nonpituitary tissues

    SciTech Connect

    Lacaze-Masmonteil, T.; De Keyzer, Y.; Luton, J.P.; Kahn, A.; Bertagna, X.

    1987-10-01

    Proopiomelanocortin (POMC), the precursor to adrenocorticotropic hormone and other related peptides, was originally identified in the corticotropic cell. Recent evidence shows that POMC products are also normally present in a variety of nonpituitary tissues. To investigate this phenomenon in humans the authors looked for the presence and characteristics of POMC transcripts in various adult tissues. Blot hybridization analysis of normal adrenal, thymus, and testis RNAs revealed a small RNA species approximately 400 nucleotides shorter than the 1200-nucleotide pituitary species. Primer extension and S1 nuclease mapping studies showed that this small RNA lacked exon 1 and exon 2 of the gene, and it corresponded to a set of at least six molecules starting 41 to 162 nucleotides downstream from the 5' end of exon 3. These RNAs appear to result from heterogeneous transcription initiation sites presumably under the control of GC box promoter sequences located in the 3' end of intron 2. They cannot encode a complete POMC molecule, and the only truncated POMC molecules that could be translated would lack a signal peptide necessary for membrane translocation and precursor processing. The use of highly sensitive S1 nuclease mapping techniques with uniformly labeled single-stranded DNA probes allowed the detection of a small but definite amount of the normal, 1200-nucleotide, mRNA species. It is suggested that it is this POMC mRNA that is responsible for the local production of all the POMC peptides.

  15. A symbiotic SNARE protein generated by alternative termination of transcription.

    PubMed

    Pan, Huairong; Oztas, Onur; Zhang, Xiaowei; Wu, Xiaoyi; Stonoha, Christina; Wang, Ertao; Wang, Bin; Wang, Dong

    2016-01-01

    Many microbes interact with their hosts across a membrane interface, which is often distinct from existing membranes. Understanding how this interface acquires its identity has significant implications. In the symbiosis between legumes and rhizobia, the symbiosome encases the intracellular bacteria and receives host secretory proteins important for bacterial development. We show that the Medicago truncatula SYNTAXIN 132 (SYP132) gene undergoes alternative cleavage and polyadenylation during transcription, giving rise to two target-membrane soluble NSF attachment protein receptor (t-SNARE) isoforms. One of these isoforms, SYP132A, is induced during the symbiosis, is able to localize to the peribacteroid membrane, and is required for the maturation of symbiosomes into functional forms. The second isoform, SYP132C, has important functions unrelated to symbiosis. The SYP132A sequence is broadly found in flowering plants that form arbuscular mycorrhizal symbiosis, an ancestral mutualism between soil fungi and most land plants. SYP132A silencing severely inhibited arbuscule colonization, indicating that SYP132A is an ancient factor specifying plant-microbe interfaces. PMID:27249189

  16. Antioxidant-induced changes of the AP-1 transcription complex are paralleled by a selective suppression of human papillomavirus transcription.

    PubMed Central

    Rösl, F; Das, B C; Lengert, M; Geletneky, K; zur Hausen, H

    1997-01-01

    Considering the involvement of a redox-regulatory pathway in the expression of human papillomaviruses (HPVs), HPV type 16 (HPV-16)-immortalized human keratinocytes were treated with the antioxidant pyrrolidine-dithiocarbamate (PDTC). PDTC induces elevated binding of the transcription factor AP-1 to its cognate recognition site within the viral regulatory region. Despite of increased AP-1 binding, normally indispensable for efficient HPV-16 transcription, viral gene expression was selectively suppressed at the level of initiation of transcription. Electrophoretic mobility supershift assays showed that the composition of the AP-1 complex, predominantly consisting of Jun homodimers in untreated cells, was altered. Irrespective of enhanced c-fos expression, c-jun was phosphorylated and became primarily heterodimerized with fra-1, which was also induced after PDTC incubation. Additionally, there was also an increased complex formation between c-jun and junB. Because both fra-1 and junB overexpression negatively interferes with c-jun/c-fos trans-activation of AP-1-responsive genes, our results suggest that the observed block in viral transcription is mainly the consequence of an antioxidant-induced reconstitution of the AP-1 transcription complex. Since expression of the c-jun/c-fos gene family is tightly regulated during cellular differentiation, defined reorganization of a central viral transcription factor may represent a novel mechanism controlling the transcription of pathogenic HPVs during keratinocyte differentiation and in the progression to cervical cancer. PMID:8985358

  17. Human Cytomegalovirus Infection Upregulates the Mitochondrial Transcription and Translation Machineries

    PubMed Central

    Weekes, M. P.; Antrobus, R.; Rorbach, J.; van Haute, L.; Umrania, Y.; Smith, D. L.; Minczuk, M.; Lehner, P. J.; Sinclair, J. H.

    2016-01-01

    ABSTRACT Infection with human cytomegalovirus (HCMV) profoundly affects cellular metabolism. Like in tumor cells, HCMV infection increases glycolysis, and glucose carbon is shifted from the mitochondrial tricarboxylic acid cycle to the biosynthesis of fatty acids. However, unlike in many tumor cells, where aerobic glycolysis is accompanied by suppression of mitochondrial oxidative phosphorylation, HCMV induces mitochondrial biogenesis and respiration. Here, we affinity purified mitochondria and used quantitative mass spectrometry to determine how the mitochondrial proteome changes upon HCMV infection. We found that the mitochondrial transcription and translation systems are induced early during the viral replication cycle. Specifically, proteins involved in biogenesis of the mitochondrial ribosome were highly upregulated by HCMV infection. Inhibition of mitochondrial translation with chloramphenicol or knockdown of HCMV-induced ribosome biogenesis factor MRM3 abolished the HCMV-mediated increase in mitochondrially encoded proteins and significantly impaired viral growth under bioenergetically restricting conditions. Our findings demonstrate how HCMV manipulates mitochondrial biogenesis to support its replication. PMID:27025248

  18. Functional polypeptides can be synthesized from human mitochondrial transcripts lacking termination codons.

    PubMed Central

    Chrzanowska-Lightowlers, Zofia M A; Temperley, Richard J; Smith, Paul M; Seneca, Sara H; Lightowlers, Robert N

    2004-01-01

    The human mitochondrial genome (mtDNA) is a small, circular DNA duplex found in multi-copy in the mitochondrial matrix. It is almost fully transcribed from both strands to produce large polycistronic RNA units that are processed and matured. The 13 mtDNA-encoded polypeptides are translated from mt-mRNAs that have been matured by polyadenylation of their free 3'-termini. A patient with clinical features consistent with an mtDNA disorder was recently shown to carry a microdeletion, resulting in the loss of the termination codon for MTATP6 and in its juxtaposition with MTCO3. Cell lines from this patient exhibited low steady-state levels of RNA14, the bi-cistronic transcript encoding subunits 6 and 8 of the F(o)F(1)-ATP synthase, complex V, consistent with a decreased stability. Recent reports of 'non-stop' mRNA decay systems in the cytosol have failed to determine the fate of gene products derived from transcripts lacking termination codons, although enhanced decay clearly required the 'non-stop' transcripts to be translated. We wished to determine whether functional translation products could still be expressed from non-stop transcripts in the human mitochondrion. Although a minor defect in complex V assembly was noted in the patient-derived cell lines, the steady-state level of ATPase 6 was similar to controls, consistent with the pattern of de novo mitochondrial protein synthesis. Moreover, no significant difference in ATP synthase activity could be detected. We conclude that, in the absence of a functional termination codon, although mitochondrial transcripts are more rapidly degraded, they are also translated to generate stable polypeptides that are successfully integrated into functional enzyme complexes. PMID:14585098

  19. Wnt signaling induces transcription, spatial proximity, and translocation of fusion gene partners in human hematopoietic cells.

    PubMed

    Ugarte, Giorgia D; Vargas, Macarena F; Medina, Matías A; León, Pablo; Necuñir, David; Elorza, Alvaro A; Gutiérrez, Soraya E; Moon, Randall T; Loyola, Alejandra; De Ferrari, Giancarlo V

    2015-10-01

    Chromosomal translocations are frequently associated with a wide variety of cancers, particularly hematologic malignancies. A recurrent chromosomal abnormality in acute myeloid leukemia is the reciprocal translocation t(8;21) that fuses RUNX1 and ETO genes. We report here that Wnt/β-catenin signaling increases the expression of ETO and RUNX1 genes in human hematopoietic progenitors. We found that β-catenin is rapidly recruited into RNA polymerase II transcription factories (RNAPII-Ser5) and that ETO and RUNX1 genes are brought into close spatial proximity upon Wnt3a induction. Notably, long-term treatment of cells with Wnt3a induces the generation a frequent RUNX1-ETO translocation event. Thus, Wnt/β-catenin signaling induces transcription and translocation of RUNX1 and ETO fusion gene partners, opening a novel window to understand the onset/development of leukemia. PMID:26333776

  20. Transcription factors ETS2 and MESP1 transdifferentiate human dermal fibroblasts into cardiac progenitors.

    PubMed

    Islas, Jose Francisco; Liu, Yu; Weng, Kuo-Chan; Robertson, Matthew J; Zhang, Shuxing; Prejusa, Allan; Harger, John; Tikhomirova, Dariya; Chopra, Mani; Iyer, Dinakar; Mercola, Mark; Oshima, Robert G; Willerson, James T; Potaman, Vladimir N; Schwartz, Robert J

    2012-08-01

    Unique insights for the reprograming of cell lineages have come from embryonic development in the ascidian Ciona, which is dependent upon the transcription factors Ci-ets1/2 and Ci-mesp to generate cardiac progenitors. We tested the idea that mammalian v-ets erythroblastosis virus E26 oncogene homolog 2 (ETS2) and mesoderm posterior (MESP) homolog may be used to convert human dermal fibroblasts into cardiac progenitors. Here we show that murine ETS2 has a critical role in directing cardiac progenitors during cardiopoiesis in embryonic stem cells. We then use lentivirus-mediated forced expression of human ETS2 to convert normal human dermal fibroblasts into replicative cells expressing the cardiac mesoderm marker KDR(+). However, although neither ETS2 nor the purported cardiac master regulator MESP1 can by themselves generate cardiac progenitors de novo from fibroblasts, forced coexpression of ETS2 and MESP1 or cell treatment with purified proteins reprograms fibroblasts into cardiac progenitors, as shown by the de novo appearance of core cardiac transcription factors, Ca(2+) transients, and sarcomeres. Our data indicate that ETS2 and MESP1 play important roles in a genetic network that governs cardiopoiesis. PMID:22826236

  1. Genome-Wide Reprogramming of Transcript Architecture by Temperature Specifies the Developmental States of the Human Pathogen Histoplasma

    PubMed Central

    Gilmore, Sarah A.; Voorhies, Mark; Gebhart, Dana; Sil, Anita

    2015-01-01

    Eukaryotic cells integrate layers of gene regulation to coordinate complex cellular processes; however, mechanisms of post-transcriptional gene regulation remain poorly studied. The human fungal pathogen Histoplasma capsulatum (Hc) responds to environmental or host temperature by initiating unique transcriptional programs to specify multicellular (hyphae) or unicellular (yeast) developmental states that function in infectivity or pathogenesis, respectively. Here we used recent advances in next-generation sequencing to uncover a novel re-programming of transcript length between Hc developmental cell types. We found that ~2% percent of Hc transcripts exhibit 5’ leader sequences that differ markedly in length between morphogenetic states. Ribosome density and mRNA abundance measurements of differential leader transcripts revealed nuanced transcriptional and translational regulation. One such class of regulated longer leader transcripts exhibited tight transcriptional and translational repression. Further examination of these dually repressed genes revealed that some control Hc morphology and that their strict regulation is necessary for the pathogen to make appropriate developmental decisions in response to temperature. PMID:26177267

  2. RegNetwork: an integrated database of transcriptional and post-transcriptional regulatory networks in human and mouse

    PubMed Central

    Liu, Zhi-Ping; Wu, Canglin; Miao, Hongyu; Wu, Hulin

    2015-01-01

    Transcriptional and post-transcriptional regulation of gene expression is of fundamental importance to numerous biological processes. Nowadays, an increasing amount of gene regulatory relationships have been documented in various databases and literature. However, to more efficiently exploit such knowledge for biomedical research and applications, it is necessary to construct a genome-wide regulatory network database to integrate the information on gene regulatory relationships that are widely scattered in many different places. Therefore, in this work, we build a knowledge-based database, named ‘RegNetwork’, of gene regulatory networks for human and mouse by collecting and integrating the documented regulatory interactions among transcription factors (TFs), microRNAs (miRNAs) and target genes from 25 selected databases. Moreover, we also inferred and incorporated potential regulatory relationships based on transcription factor binding site (TFBS) motifs into RegNetwork. As a result, RegNetwork contains a comprehensive set of experimentally observed or predicted transcriptional and post-transcriptional regulatory relationships, and the database framework is flexibly designed for potential extensions to include gene regulatory networks for other organisms in the future. Based on RegNetwork, we characterized the statistical and topological properties of genome-wide regulatory networks for human and mouse, we also extracted and interpreted simple yet important network motifs that involve the interplays between TF-miRNA and their targets. In summary, RegNetwork provides an integrated resource on the prior information for gene regulatory relationships, and it enables us to further investigate context-specific transcriptional and post-transcriptional regulatory interactions based on domain-specific experimental data. Database URL: http://www.regnetworkweb.org PMID:26424082

  3. Extensive Transcriptional Regulation of Chromatin Modifiers during Human Neurodevelopment

    PubMed Central

    Weng, Matthias K.; Zimmer, Bastian; Pöltl, Dominik; Broeg, Marc P.; Ivanova, Violeta; Gaspar, John A.; Sachinidis, Agapios; Wüllner, Ullrich

    2012-01-01

    Epigenetic changes, including histone modifications or chromatin remodeling are regulated by a large number of human genes. We developed a strategy to study the coordinate regulation of such genes, and to compare different cell populations or tissues. A set of 150 genes, comprising different classes of epigenetic modifiers was compiled. This new tool was used initially to characterize changes during the differentiation of human embryonic stem cells (hESC) to central nervous system neuroectoderm progenitors (NEP). qPCR analysis showed that more than 60% of the examined transcripts were regulated, and >10% of them had a >5-fold increased expression. For comparison, we differentiated hESC to neural crest progenitors (NCP), a distinct peripheral nervous system progenitor population. Some epigenetic modifiers were regulated into the same direction in NEP and NCP, but also distinct differences were observed. For instance, the remodeling ATPase SMARCA2 was up-regulated >30-fold in NCP, while it remained unchanged in NEP; up-regulation of the ATP-dependent chromatin remodeler CHD7 was increased in NEP, while it was down-regulated in NCP. To compare the neural precursor profiles with those of mature neurons, we analyzed the epigenetic modifiers in human cortical tissue. This resulted in the identification of 30 regulations shared between all cell types, such as the histone methyltransferase SETD7. We also identified new markers for post-mitotic neurons, like the arginine methyl transferase PRMT8 and the methyl transferase EZH1. Our findings suggest a hitherto unexpected extent of regulation, and a cell type-dependent specificity of epigenetic modifiers in neurodifferentiation. PMID:22590590

  4. Temporal patterns of human immunodeficiency virus type 1 transcripts in human fetal astrocytes.

    PubMed Central

    Tornatore, C; Meyers, K; Atwood, W; Conant, K; Major, E

    1994-01-01

    Human immunodeficiency virus type 1 (HIV-1) infection of the developing central nervous system results in a dementing process in children, termed HIV-1-associated encephalopathy. Infection of astroglial elements of the pediatric nervous system has been demonstrated and suggests that direct infection of some astrocytes may contribute to the neurologic deficit. In this model, HIV-1 establishes a persistent state of infection in astrocytes, which can be reactivated by the cytokines tumor necrosis factor alpha (TNF-alpha) and interleukin 1 beta (IL-1 beta). To better understand the natural history of viral persistence in astroglial cells, we characterized infection at the transcriptional level. The most abundant viral transcript during the establishment of persistence was the subgenomic multiply spliced 2-kb message, similar to mononuclear cell models of HIV-1 latency. Following reactivation with TNF-alpha or IL-1 beta the multiply spliced 2-kb message remained the most abundant viral transcript, in contrast to infected mononuclear cells in which reactivation leads to the reemergence of the 9- and 4-kb transcripts. Further characterization of the persistent 2-kb transcript by PCR amplification of in vitro-synthesized viral cDNA showed that, in the absence of cytokine stimulation, the most abundant multiply spliced transcripts were the Nef- and Rev-specific messages. However, following cytokine stimulation, double- and triple-spliced Tat-, Rev-, and Nef-specific messages could be identified. Immunohistochemical staining demonstrated that, during viral persistence, astrocytes expressed Nef protein but few or no viral structural proteins. These results demonstrate that viral persistence in astrocytes at the transcriptional level is fundamentally different from that seen in mononuclear cells and could account for the virtual absence of astroglial expression of viral structural antigens in vivo. Images PMID:8254781

  5. Transcription factor binding predicts histone modifications in human cell lines

    PubMed Central

    Benveniste, Dan; Sonntag, Hans-Joachim; Sanguinetti, Guido; Sproul, Duncan

    2014-01-01

    Gene expression in higher organisms is thought to be regulated by a complex network of transcription factor binding and chromatin modifications, yet the relative importance of these two factors remains a matter of debate. Here, we show that a computational approach allows surprisingly accurate prediction of histone modifications solely from knowledge of transcription factor binding both at promoters and at potential distal regulatory elements. This accuracy significantly and substantially exceeds what could be achieved by using DNA sequence as an input feature. Remarkably, we show that transcription factor binding enables strikingly accurate predictions across different cell lines. Analysis of the relative importance of specific transcription factors as predictors of specific histone marks recapitulated known interactions between transcription factors and histone modifiers. Our results demonstrate that reported associations between histone marks and gene expression may be indirect effects caused by interactions between transcription factors and histone-modifying complexes. PMID:25187560

  6. ETS transcription factor ETV2 directly converts human fibroblasts into functional endothelial cells.

    PubMed

    Morita, Rimpei; Suzuki, Mayu; Kasahara, Hidenori; Shimizu, Nana; Shichita, Takashi; Sekiya, Takashi; Kimura, Akihiro; Sasaki, Ken-ichiro; Yasukawa, Hideo; Yoshimura, Akihiko

    2015-01-01

    Transplantation of endothelial cells (ECs) is a promising therapeutic approach for ischemic disorders. In addition, the generation of ECs has become increasingly important for providing vascular plexus to regenerated organs, such as the liver. Although many attempts have been made to generate ECs from pluripotent stem cells and nonvascular cells, the minimum number of transcription factors that specialize in directly inducing vascular ECs remains undefined. Here, by screening 18 transcription factors that are important for both endothelial and hematopoietic development, we demonstrate that ets variant 2 (ETV2) alone directly converts primary human adult skin fibroblasts into functional vascular endothelial cells (ETVECs). In coordination with endogenous FOXC2 in fibroblasts, transduced ETV2 elicits expression of multiple key endothelial development factors, including FLI1, ERG, and TAL1, and induces expression of endothelial functional molecules, including EGFL7 and von Willebrand factor. Consequently, ETVECs exhibits EC characteristics in vitro and forms mature functional vasculature in Matrigel plugs transplanted in NOD SCID mice. Furthermore, ETVECs significantly improve blood flow recovery in a hind limb ischemic model using BALB/c-nu mice. Our study indicates that the creation of ETVECs provides further understanding of human EC development induced by ETV2. PMID:25540418

  7. The Promyelocytic Leukemia Zinc Finger Transcription Factor Is Critical for Human Endometrial Stromal Cell Decidualization

    PubMed Central

    Kommagani, Ramakrishna; Szwarc, Maria M.; Vasquez, Yasmin M.; Peavey, Mary C.; Mazur, Erik C.; Gibbons, William E.; Lanz, Rainer B.; DeMayo, Francesco J.; Lydon, John P.

    2016-01-01

    Progesterone, via the progesterone receptor (PGR), is essential for endometrial stromal cell decidualization, a cellular transformation event in which stromal fibroblasts differentiate into decidual cells. Uterine decidualization supports embryo implantation and placentation as well as subsequent events, which together ensure a successful pregnancy. Accordingly, impaired decidualization results not only in implantation failure or early fetal miscarriage, but also may lead to potential adverse outcomes in all three pregnancy trimesters. Transcriptional reprogramming on a genome-wide scale underlies progesterone dependent decidualization of the human endometrial stromal cell (hESC). However, identification of the functionally essential signals encoded by these global transcriptional changes remains incomplete. Importantly, this knowledge-gap undercuts future efforts to improve diagnosis and treatment of implantation failure based on a dysfunctional endometrium. By integrating genome-wide datasets derived from decidualization of hESCs in culture, we reveal that the promyelocytic leukemia zinc finger (PLZF) transcription factor is rapidly induced by progesterone and that this induction is indispensable for progesterone-dependent decidualization. Chromatin immunoprecipitation followed by next generation sequencing (ChIP-Seq) identified at least ten progesterone response elements within the PLZF gene, indicating that PLZF may act as a direct target of PGR signaling. The spatiotemporal expression profile for PLZF in both the human and mouse endometrium offers further support for stromal PLZF as a mediator of the progesterone decidual signal. To identify functional targets of PLZF, integration of PLZF ChIP-Seq and RNA Pol II RNA-Seq datasets revealed that the early growth response 1 (EGR1) transcription factor is a PLZF target for which its level of expression must be reduced to enable progesterone dependent hESC decidualization. Apart from furnishing essential insights

  8. The Promyelocytic Leukemia Zinc Finger Transcription Factor Is Critical for Human Endometrial Stromal Cell Decidualization.

    PubMed

    Kommagani, Ramakrishna; Szwarc, Maria M; Vasquez, Yasmin M; Peavey, Mary C; Mazur, Erik C; Gibbons, William E; Lanz, Rainer B; DeMayo, Francesco J; Lydon, John P

    2016-04-01

    Progesterone, via the progesterone receptor (PGR), is essential for endometrial stromal cell decidualization, a cellular transformation event in which stromal fibroblasts differentiate into decidual cells. Uterine decidualization supports embryo implantation and placentation as well as subsequent events, which together ensure a successful pregnancy. Accordingly, impaired decidualization results not only in implantation failure or early fetal miscarriage, but also may lead to potential adverse outcomes in all three pregnancy trimesters. Transcriptional reprogramming on a genome-wide scale underlies progesterone dependent decidualization of the human endometrial stromal cell (hESC). However, identification of the functionally essential signals encoded by these global transcriptional changes remains incomplete. Importantly, this knowledge-gap undercuts future efforts to improve diagnosis and treatment of implantation failure based on a dysfunctional endometrium. By integrating genome-wide datasets derived from decidualization of hESCs in culture, we reveal that the promyelocytic leukemia zinc finger (PLZF) transcription factor is rapidly induced by progesterone and that this induction is indispensable for progesterone-dependent decidualization. Chromatin immunoprecipitation followed by next generation sequencing (ChIP-Seq) identified at least ten progesterone response elements within the PLZF gene, indicating that PLZF may act as a direct target of PGR signaling. The spatiotemporal expression profile for PLZF in both the human and mouse endometrium offers further support for stromal PLZF as a mediator of the progesterone decidual signal. To identify functional targets of PLZF, integration of PLZF ChIP-Seq and RNA Pol II RNA-Seq datasets revealed that the early growth response 1 (EGR1) transcription factor is a PLZF target for which its level of expression must be reduced to enable progesterone dependent hESC decidualization. Apart from furnishing essential insights

  9. Genome-scale transcriptional analyses of first-generation interspecific sunflower hybrids reveals broad regulatory compatibility

    PubMed Central

    2013-01-01

    Background Interspecific hybridization creates individuals harboring diverged genomes. The interaction of these genomes can generate successful evolutionary novelty or disadvantageous genomic conflict. Annual sunflowers Helianthus annuus and H. petiolaris have a rich history of hybridization in natural populations. Although first-generation hybrids generally have low fertility, hybrid swarms that include later generation and fully fertile backcross plants have been identified, as well as at least three independently-originated stable hybrid taxa. We examine patterns of transcript accumulation in the earliest stages of hybridization of these species via analyses of transcriptome sequences from laboratory-derived F1 offspring of an inbred H. annuus cultivar and a wild H. petiolaris accession. Results While nearly 14% of the reference transcriptome showed significant accumulation differences between parental accessions, total F1 transcript levels showed little evidence of dominance, as midparent transcript levels were highly predictive of transcript accumulation in F1 plants. Allelic bias in F1 transcript accumulation was detected in 20% of transcripts containing sufficient polymorphism to distinguish parental alleles; however the magnitude of these biases were generally smaller than differences among parental accessions. Conclusions While analyses of allelic bias suggest that cis regulatory differences between H. annuus and H. petiolaris are common, their effect on transcript levels may be more subtle than trans-acting regulatory differences. Overall, these analyses found little evidence of regulatory incompatibility or dominance interactions between parental genomes within F1 hybrid individuals, although it is unclear whether this is a legacy or an enabler of introgression between species. PMID:23701699

  10. Human Macrophages Support Persistent Transcription From Unintegrated HIV-1 DNA

    PubMed Central

    Kelly, Jeremy; Beddall, Margaret H.; Yu, Dongyang; Iyer, Subashini R.; Marsh, Jon W.; Wu, Yuntao

    2008-01-01

    Retroviruses require integration of their RNA genomes for both stability and productive viral replication. In HIV infection of non-dividing, resting CD4 T cells, where integration is greatly impeded, the reverse transcribed HIV DNA has limited biological activity and a short half-life. In metabolically active and proliferating T cells unintegrated DNA rapidly diminishes with cell division. HIV also infects the non-dividing, but metabolically active macrophage population. In an in vitro examination of HIV infection of macrophages, we find that unintegrated viral DNA not only has an unusual stability, but also maintains biological activity. The unintegrated linear DNA, 1-LTR, and 2-LTR circles are stable for at least 30 days. Additionally there is persistent viral gene transcription, which is selective and skewed towards viral early genes such as nef and tat with highly diminished rev and vif. One viral early gene product Nef was measurably synthesized. We also find that independent of integration, the HIV infection process in macrophages leads to generation of numerous chemokines. PMID:18054979

  11. Inhibition of human insulin gene transcription and MafA transcriptional activity by the dual leucine zipper kinase

    PubMed Central

    Stahnke, Marie-Jeannette; Dickel, Corinna; Schröder, Sabine; Kaiser, Diana; Blume, Roland; Stein, Roland; Pouponnot, Celio; Oetjen, Elke

    2016-01-01

    Insulin biosynthesis is an essential β-cell function and inappropriate insulin secretion and biosynthesis contribute to the pathogenesis of diabetes mellitus type 2. Previous studies showed that the dual leucine zipper kinase (DLK) induces β-cell apoptosis. Since β-cell dysfunction precedes β-cell loss, in the present study the effect of DLK on insulin gene transcription was investigated in the HIT-T15 β-cell line. Downregulation of endogenous DLK increased whereas overexpression of DLK decreased human insulin gene transcription. 5′- and 3′-deletion human insulin promoter analyses resulted in the identification of a DLK responsive element that mapped to the DNA binding-site for the β-cell specific transcription factor MafA. Overexpression of DLK wild-type but not its kinase-dead mutant inhibited MafA transcriptional activity conferred by its transactivation domain. Furthermore, in the non-β-cell line JEG DLK inhibited MafA overexpression-induced human insulin promoter activity. Overexpression of MafA and DLK or its kinase-dead mutant into JEG cells revealed that DLK but not its mutant reduced MafA protein content. Inhibition of the down-stream DLK kinase c-Jun N-terminal kinase (JNK) by SP600125 attenuated DLK-induced MafA loss. Furthermore, mutation of the serine 65 to alanine, shown to confer MafA protein stability, increased MafA-dependent insulin gene transcription and prevented DLK-induced MafA loss in JEG cells. These data suggest that DLK by activating JNK triggers the phosphorylation and degradation of MafA thereby attenuating insulin gene transcription. Given the importance of MafA for β-cell function, the inhibition of DLK might preserve β-cell function and ultimately retard the development of diabetes mellitus type 2. PMID:24726898

  12. Inhibition of human insulin gene transcription and MafA transcriptional activity by the dual leucine zipper kinase.

    PubMed

    Stahnke, Marie-Jeannette; Dickel, Corinna; Schröder, Sabine; Kaiser, Diana; Blume, Roland; Stein, Roland; Pouponnot, Celio; Oetjen, Elke

    2014-09-01

    Insulin biosynthesis is an essential β-cell function and inappropriate insulin secretion and biosynthesis contribute to the pathogenesis of diabetes mellitus type 2. Previous studies showed that the dual leucine zipper kinase (DLK) induces β-cell apoptosis. Since β-cell dysfunction precedes β-cell loss, in the present study the effect of DLK on insulin gene transcription was investigated in the HIT-T15 β-cell line. Downregulation of endogenous DLK increased whereas overexpression of DLK decreased human insulin gene transcription. 5'- and 3'-deletion human insulin promoter analyses resulted in the identification of a DLK responsive element that mapped to the DNA binding-site for the β-cell specific transcription factor MafA. Overexpression of DLK wild-type but not its kinase-dead mutant inhibited MafA transcriptional activity conferred by its transactivation domain. Furthermore, in the non-β-cell line JEG DLK inhibited MafA overexpression-induced human insulin promoter activity. Overexpression of MafA and DLK or its kinase-dead mutant into JEG cells revealed that DLK but not its mutant reduced MafA protein content. Inhibition of the down-stream DLK kinase c-Jun N-terminal kinase (JNK) by SP600125 attenuated DLK-induced MafA loss. Furthermore, mutation of the serine 65 to alanine, shown to confer MafA protein stability, increased MafA-dependent insulin gene transcription and prevented DLK-induced MafA loss in JEG cells. These data suggest that DLK by activating JNK triggers the phosphorylation and degradation of MafA thereby attenuating insulin gene transcription. Given the importance of MafA for β-cell function, the inhibition of DLK might preserve β-cell function and ultimately retard the development of diabetes mellitus type 2. PMID:24726898

  13. Large-scale gene discovery in human airway epithelia reveals novel transcripts.

    PubMed

    Scheetz, Todd E; Zabner, Joseph; Welsh, Michael J; Coco, Justin; Eyestone, Mari de Fatima; Bonaldo, Maria; Kucaba, Tamara; Casavant, Thomas L; Soares, M Bento; McCray, Paul B

    2004-03-12

    The airway epithelium represents an important barrier between the host and the environment. It is a first site of contact with pathogens, particulates, and other stimuli, and has evolved the means to dynamically respond to these challenges. In an effort to define the transcript profile of airway epithelia, we created and sequenced cDNA libraries from cystic fibrosis (CF) and non-CF epithelia and from human lung tissue. Sequencing of these libraries produced approximately 53,000 3'-expressed sequence tags (3'-ESTs). From these, a nonredundant UniGene set of more than 19,000 sequences was generated. Despite the relatively small contribution of airway epithelia to the total mass of the lung, focused gene discovery in this tissue yielded novel results. The ESTs included several thousand transcripts (6,416) not previously identified from cDNA sequences as expressed in the lung. Among the abundant transcripts were several genes involved in host defense. Most importantly, the set also included 879 3'-ESTs that appear to be novel sequences not previously represented in the National Center for Biotechnology Information UniGene collection. This UniGene set should be useful for studies of pulmonary diseases involving the airway epithelium including cystic fibrosis, respiratory infections and asthma. It also provides a reagent for large-scale expression profiling. PMID:14701920

  14. Factorbook.org: a Wiki-based database for transcription factor-binding data generated by the ENCODE consortium.

    PubMed

    Wang, Jie; Zhuang, Jiali; Iyer, Sowmya; Lin, Xin-Ying; Greven, Melissa C; Kim, Bong-Hyun; Moore, Jill; Pierce, Brian G; Dong, Xianjun; Virgil, Daniel; Birney, Ewan; Hung, Jui-Hung; Weng, Zhiping

    2013-01-01

    The Encyclopedia of DNA Elements (ENCODE) consortium aims to identify all functional elements in the human genome including transcripts, transcriptional regulatory regions, along with their chromatin states and DNA methylation patterns. The ENCODE project generates data utilizing a variety of techniques that can enrich for regulatory regions, such as chromatin immunoprecipitation (ChIP), micrococcal nuclease (MNase) digestion and DNase I digestion, followed by deeply sequencing the resulting DNA. As part of the ENCODE project, we have developed a Web-accessible repository accessible at http://factorbook.org. In Wiki format, factorbook is a transcription factor (TF)-centric repository of all ENCODE ChIP-seq datasets on TF-binding regions, as well as the rich analysis results of these data. In the first release, factorbook contains 457 ChIP-seq datasets on 119 TFs in a number of human cell lines, the average profiles of histone modifications and nucleosome positioning around the TF-binding regions, sequence motifs enriched in the regions and the distance and orientation preferences between motif sites. PMID:23203885

  15. White Light Generation in Human Saliva

    NASA Astrophysics Data System (ADS)

    Santhosh, C.; Dharmadhikari, A. K.; Dharmadhikari, J. A.; Alti, K.; Mathur, D.

    2011-07-01

    Interaction of intense, femto-second pulses of infrared light (800 nm) with water generates white light supercontinuum due to nonlinear optical effects. This supercontinuum was found to be suppressed by the addition of alpha amylase, a major protein in the human saliva. We have studied the suppression of supper continuum by human saliva, collected from healthy subjects with and without smoking habits. Suppression of the blue-sided components was observed significantly in non-smokers saliva than chain smokers.

  16. Regulation of transcription of the human presenilin-1 gene by ets transcription factors and the p53 protooncogene.

    PubMed

    Pastorcic, M; Das, H K

    2000-11-10

    The expression of the human presenilin-1 cellular gene is suppressed by the p53 protooncogene. The rapid kinetic of the down-regulation has suggested that it may result from a primary mechanism. We show here that p53 also suppresses the transcription of a presenilin-1 promoter-chloramphenicol acetyltransferase reporter synthetic gene in transient infection assays in neuroblastoma (SK-N-SH) and hepatoma (HepG2) cell lines. Only a minimum promoter including sequences from -35 to + 6 from the transcription initiation is sufficient to confer down-regulation. We have previously defined a crucial DNA element controlling 90% of the expression of the gene within the same short area, and the identification of the transcription factors involved should also provide insights into the regulation of PS1 by p53. This region contains an Ets transcription factor binding motif, and a 2-base pair alteration within the core sequence (GGAA to TTAA) of the Ets consensus also reduced transcription by more than 90%. We now show that Ets1 and Ets2 indeed transactivate a PS1 promoter-chloramphenicol acetyltransferase reporter including the (-35 to +6) fragment. Furthermore, in vitro translated Ets2 binds specifically to the -10 Ets motif in electrophoretic mobility shift assays. Therefore, Ets1/2 factors bind specifically to the -10 Ets element and activate PS1 transcription. We also show that the coactivator p300 enhances the activation by Ets1 and Ets2 as well as the repression by p53. p300 is known to interact with p53 as well as with Ets1 and Ets2. We show that p53 does not bind directly to the PS1 promoter. Hence the repression of PS1 transcription by p53 is likely to be mediated through protein-protein interactions. PMID:10942770

  17. Direct activation of human and mouse Oct4 genes using engineered TALE and Cas9 transcription factors.

    PubMed

    Hu, Jiabiao; Lei, Yong; Wong, Wing-Ki; Liu, Senquan; Lee, Kai-Chuen; He, Xiangjun; You, Wenxing; Zhou, Rui; Guo, Jun-Tao; Chen, Xiongfong; Peng, Xianlu; Sun, Hao; Huang, He; Zhao, Hui; Feng, Bo

    2014-04-01

    The newly developed transcription activator-like effector protein (TALE) and clustered regularly interspaced short palindromic repeats/Cas9 transcription factors (TF) offered a powerful and precise approach for modulating gene expression. In this article, we systematically investigated the potential of these new tools in activating the stringently silenced pluripotency gene Oct4 (Pou5f1) in mouse and human somatic cells. First, with a number of TALEs and sgRNAs targeting various regions in the mouse and human Oct4 promoters, we found that the most efficient TALE-VP64s bound around -120 to -80 bp, while highly effective sgRNAs targeted from -147 to -89-bp upstream of the transcription start sites to induce high activity of luciferase reporters. In addition, we observed significant transcriptional synergy when multiple TFs were applied simultaneously. Although individual TFs exhibited marginal activity to up-regulate endogenous gene expression, optimized combinations of TALE-VP64s could enhance endogenous Oct4 transcription up to 30-fold in mouse NIH3T3 cells and 20-fold in human HEK293T cells. More importantly, the enhancement of OCT4 transcription ultimately generated OCT4 proteins. Furthermore, examination of different epigenetic modifiers showed that histone acetyltransferase p300 could enhance both TALE-VP64 and sgRNA/dCas9-VP64 induced transcription of endogenous OCT4. Taken together, our study suggested that engineered TALE-TF and dCas9-TF are useful tools for modulating gene expression in mammalian cells. PMID:24500196

  18. Expression of The Embryonic Stem Cell Transcription Factor SOX2 in Human Skin

    PubMed Central

    Laga, Alvaro C.; Lai, Chiou-Yan; Zhan, Qian; Huang, Susan J.; Velazquez, Elsa F.; Yang, Qinghong; Hsu, Mei-Yu; Murphy, George F.

    2010-01-01

    SOX2 is a gene located on chromosome 3q26.33 that encodes a transcription factor important to maintenance of embryonic neural crest stem cell pluripotency. We have identified rare SOX2-immunoreactive cells in normal human skin at or near the established stem cell niches. Three subsets of SOX2-positive cells were defined in these regions: those expressing only SOX2 and those that co-expressed SOX2 and either CK20 or microphthalmia-associated transcription factor, which are consistent with dichotomous differentiation of SOX2-expressing precursors along neuroendocrine (Merkel cell) or melanocytic lines, respectively. Examination of Merkel cell carcinomas confirmed nuclear SOX2 expression in this tumor type. In human patient melanoma, strong nuclear expression of SOX2 was noted in a subset of tumors, and the ability to detect SOX2 in lesional cells significantly correlated with primary tumor thickness in a survey cohort. To assess the potential role of SOX2 in melanoma growth, an in vivo tumorigenesis assay was used. Whereas SOX2 knockdown failed to influence proliferation of cultured melanoma cells in vitro, tumor xenografts generated with the SOX2-knockdown cell line showed significant decrease in mean tumor volume as compared with controls. In aggregate, these findings suggest that SOX2 is a novel biomarker for subpopulations of normal skin cells that reside in established stem cell niches and that might relate to Merkel cell and melanocyte ontogeny and tumorigenesis. PMID:20042675

  19. Transcriptional regulation of human paraoxonase 1 by PXR and GR in human hepatoma cells.

    PubMed

    Ponce-Ruiz, N; Rojas-García, A E; Barrón-Vivanco, B S; Elizondo, G; Bernal-Hernández, Y Y; Mejía-García, A; Medina-Díaz, I M

    2015-12-25

    Human paraoxonase 1 (PON1) is A-esterase synthesized in the liver and secreted into the plasma, where it associates with HDL. PON1 acts as an antioxidant preventing lipid oxidation and detoxifies a wide range of substrates, including organophosphate compounds. The variability of PON1 (enzyme activity/serum levels) has been attributed to internal and external factors. However, the molecular mechanisms involved in the transcriptional regulation of PON1 have not been well-studied. The aim of this study was to evaluate and characterize the transcriptional activation of PON1 by nuclear receptors (NR) in human hepatoma cells. In silico analysis was performed on the promoter region of PON1 to determine the response elements of NR. Real-time PCR was used to evaluate the effect of specific NR ligands on the mRNA levels of genes regulated by NR and PON1. The results indicated that NR response elements had 95% homology to pregnenolone (PXR), glucocorticoids (GR), retinoic acid (RXR) and peroxisomes proliferator-activated receptor alpha (PPARα). Treatments with Dexamethasone (GR ligand), Rifampicin (PXR ligand) and TCDD (AhR ligand) increased the mRNA levels of PON1 at 24 and 48 h. We showed that the activation of GR by Dexamethasone results in PON1 gene induction accompanied by an increase in activity levels. In conclusion, these results demonstrate that GR regulates PON1 gene transcription through directly binding to NR response elements at -95 to -628 bp of the PON1 promoter. This study suggests new molecular mechanisms for the transcriptional regulation of PON1 through a process involving the activation of PXR. PMID:26434531

  20. Functional Analyses of Transcription Factor Binding Sites that Differ between Present-Day and Archaic Humans.

    PubMed

    Weyer, Sven; Pääbo, Svante

    2016-02-01

    We analyze 25 previously identified transcription factor binding sites that carry DNA sequence changes that are present in all or nearly all present-day humans, yet occur in the ancestral state in Neandertals and Denisovans, the closest evolutionary relatives of humans. When the ancestral and derived forms of the transcription factor binding sites are tested using reporter constructs in 3 neuronal cell lines, the activity of 12 of the derived versions of transcription factor binding sites differ from the respective ancestral variants. This suggests that the majority of this class of evolutionary differences between modern humans and Neandertals may affect gene expression in at least some tissue or cell type. PMID:26454764

  1. Functional Analyses of Transcription Factor Binding Sites that Differ between Present-Day and Archaic Humans

    PubMed Central

    Weyer, Sven; Pääbo, Svante

    2016-01-01

    We analyze 25 previously identified transcription factor binding sites that carry DNA sequence changes that are present in all or nearly all present-day humans, yet occur in the ancestral state in Neandertals and Denisovans, the closest evolutionary relatives of humans. When the ancestral and derived forms of the transcription factor binding sites are tested using reporter constructs in 3 neuronal cell lines, the activity of 12 of the derived versions of transcription factor binding sites differ from the respective ancestral variants. This suggests that the majority of this class of evolutionary differences between modern humans and Neandertals may affect gene expression in at least some tissue or cell type. PMID:26454764

  2. Generative models of the human connectome

    PubMed Central

    Betzel, Richard F.; Avena-Koenigsberger, Andrea; Goñi, Joaquín; He, Ye; de Reus, Marcel A.; Griffa, Alessandra; Vértes, Petra E.; Mišic, Bratislav; Thiran, Jean-Philippe; Hagmann, Patric; van den Heuvel, Martijn; Zuo, Xi-Nian; Bullmore, Edward T.; Sporns, Olaf

    2016-01-01

    The human connectome represents a network map of the brain's wiring diagram and the pattern into which its connections are organized is thought to play an important role in cognitive function. The generative rules that shape the topology of the human connectome remain incompletely understood. Earlier work in model organisms has suggested that wiring rules based on geometric relationships (distance) can account for many but likely not all topological features. Here we systematically explore a family of generative models of the human connectome that yield synthetic networks designed according to different wiring rules combining geometric and a broad range of topological factors. We find that a combination of geometric constraints with a homophilic attachment mechanism can create synthetic networks that closely match many topological characteristics of individual human connectomes, including features that were not included in the optimization of the generative model itself. We use these models to investigate a lifespan dataset and show that, with age, the model parameters undergo progressive changes, suggesting a rebalancing of the generative factors underlying the connectome across the lifespan. PMID:26427642

  3. Generative models of the human connectome.

    PubMed

    Betzel, Richard F; Avena-Koenigsberger, Andrea; Goñi, Joaquín; He, Ye; de Reus, Marcel A; Griffa, Alessandra; Vértes, Petra E; Mišic, Bratislav; Thiran, Jean-Philippe; Hagmann, Patric; van den Heuvel, Martijn; Zuo, Xi-Nian; Bullmore, Edward T; Sporns, Olaf

    2016-01-01

    The human connectome represents a network map of the brain's wiring diagram and the pattern into which its connections are organized is thought to play an important role in cognitive function. The generative rules that shape the topology of the human connectome remain incompletely understood. Earlier work in model organisms has suggested that wiring rules based on geometric relationships (distance) can account for many but likely not all topological features. Here we systematically explore a family of generative models of the human connectome that yield synthetic networks designed according to different wiring rules combining geometric and a broad range of topological factors. We find that a combination of geometric constraints with a homophilic attachment mechanism can create synthetic networks that closely match many topological characteristics of individual human connectomes, including features that were not included in the optimization of the generative model itself. We use these models to investigate a lifespan dataset and show that, with age, the model parameters undergo progressive changes, suggesting a rebalancing of the generative factors underlying the connectome across the lifespan. PMID:26427642

  4. Macaca specific exon creation event generates a novel ZKSCAN5 transcript.

    PubMed

    Kim, Young-Hyun; Choe, Se-Hee; Song, Bong-Seok; Park, Sang-Je; Kim, Myung-Jin; Park, Young-Ho; Yoon, Seung-Bin; Lee, Youngjeon; Jin, Yeung Bae; Sim, Bo-Woong; Kim, Ji-Su; Jeong, Kang-Jin; Kim, Sun-Uk; Lee, Sang-Rae; Park, Young-Il; Huh, Jae-Won; Chang, Kyu-Tae

    2016-02-15

    ZKSCAN5 (also known as ZFP95) is a zinc-finger protein belonging to the Krűppel family. ZKSCAN5 contains a SCAN box and a KRAB A domain and is proposed to play a distinct role during spermatogenesis. In humans, alternatively spliced ZKSCAN5 transcripts with different 5'-untranslated regions (UTRs) have been identified. However, investigation of our Macaca UniGene Database revealed novel alternative ZKSCAN5 transcripts that arose due to an exon creation event. Therefore, in this study, we identified the full-length sequences of ZKSCAN5 and its alternative transcripts in Macaca spp. Additionally, we investigated different nonhuman primate sequences to elucidate the molecular mechanism underlying the exon creation event. We analyzed the evolutionary features of the ZKSCAN5 transcripts by reverse transcription polymerase chain reaction (RT-PCR) and genomic PCR, and by sequencing various nonhuman primate DNA and RNA samples. The exon-created transcript was only detected in the Macaca lineage (crab-eating monkey and rhesus monkey). Full-length sequence analysis by rapid amplification of cDNA ends (RACE) identified ten full-length transcripts and four functional isoforms of ZKSCAN5. Protein sequence analyses revealed the presence of two groups of isoforms that arose because of differences in start-codon usage. Together, our results demonstrate that there has been specific selection for a discrete set of ZKSCAN5 variants in the Macaca lineage. Furthermore, study of this locus (and perhaps others) in Macaca spp. might facilitate our understanding of the evolutionary pressures that have shaped the mechanism of exon creation in primates. PMID:26657034

  5. Transcript analysis of a goat mesenteric lymph node by deep next-generation sequencing.

    PubMed

    E, G X; Zhao, Y J; Na, R S; Huang, Y F

    2016-01-01

    Deep RNA sequencing (RNA-seq) provides a practical and inexpensive alternative for exploring genomic data in non-model organisms. The functional annotation of non-model mammalian genomes, such as that of goats, is still poor compared to that of humans and mice. In the current study, we performed a whole transcriptome analysis of an intestinal mucous membrane lymph node to comprehensively characterize the transcript catalogue of this tissue in a goat. Using an Illumina HiSeq 4000 sequencing platform, 9.692 GB of raw reads were acquired. A total of 57,526 lymph transcripts were obtained, and the majority of these were mapped to known transcriptional units (42.67%). A comparison of the mRNA expression of the mesenteric lymph nodes during the juvenile and post-adolescent stages revealed 8949 transcripts that were differentially expressed, including 6174 known genes. In addition, we functionally classified these transcripts using Gene Ontology (GO) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) terms. A total of 6174 known genes were assigned to 64 GO terms, and 3782 genes were assigned to 303 KEGG pathways, including some related to immunity. Our results reveal the complex transcriptome profile of the lymph node and suggest that the immune system is immature in the mesenteric lymph nodes of juvenile goats. PMID:27173308

  6. To Your Health: NLM update transcript - Preventing disease spillover from animals to humans

    MedlinePlus

    ... update Transcript Preventing disease spillover from animals to humans : 07/11/2016 To use the sharing features ... accessible by entering the terms 'PREDICT (in all capital letters) - and UC Davis' in any search engine. ...

  7. Transcription factor IIIB generates extended DNA interactions in RNA polymerase III transcription complexes on tRNA genes.

    PubMed Central

    Kassavetis, G A; Riggs, D L; Negri, R; Nguyen, L H; Geiduschek, E P

    1989-01-01

    Transcription complexes that assemble on tRNA genes in a crude Saccharomyces cerevisiae cell extract extend over the entire transcription unit and approximately 40 base pairs of contiguous 5'-flanking DNA. We show here that the interaction with 5'-flanking DNA is due to a protein that copurifies with transcription factor TFIIIB through several steps of purification and shares characteristic properties that are normally ascribed to TFIIIB: dependence on prior binding of TFIIIC and great stability once the TFIIIC-TFIIIB-DNA complex is formed. SUP4 gene (tRNATyr) DNA that was cut within the 5'-flanking sequence (either 31 or 28 base pairs upstream of the transcriptional start site) was no longer able to stably incorporate TFIIIB into a transcription complex. The TFIIIB-dependent 5'-flanking DNA protein interaction was predominantly not sequence specific. The extension of the transcription complex into this DNA segment does suggest two possible explanations for highly diverse effects of flanking-sequence substitutions on tRNA gene transcription: either (i) proteins that are capable of binding to these upstream DNA segments are also potentially capable of stimulating or interfering with the incorporation of TFIIIB into transcription complexes or (ii) 5'-flanking sequence influences the rate of assembly of TFIIIB into stable transcription complexes. Images PMID:2668737

  8. Inhibition of RNA Polymerase II Transcription in Human Cells by Synthetic DNA-Binding Ligands

    NASA Astrophysics Data System (ADS)

    Dickinson, Liliane A.; Gulizia, Richard J.; Trauger, John W.; Baird, Eldon E.; Mosier, Donald E.; Gottesfeld, Joel M.; Dervan, Peter B.

    1998-10-01

    Sequence-specific DNA-binding small molecules that can permeate human cells potentially could regulate transcription of specific genes. Multiple cellular DNA-binding transcription factors are required by HIV type 1 for RNA synthesis. Two pyrrole--imidazole polyamides were designed to bind DNA sequences immediately adjacent to binding sites for the transcription factors Ets-1, lymphoid-enhancer binding factor 1, and TATA-box binding protein. These synthetic ligands specifically inhibit DNA-binding of each transcription factor and HIV type 1 transcription in cell-free assays. When used in combination, the polyamides inhibit virus replication by >99% in isolated human peripheral blood lymphocytes, with no detectable cell toxicity. The ability of small molecules to target predetermined DNA sequences located with RNA polymerase II promoters suggests a general approach for regulation of gene expression, as well as a mechanism for the inhibition of viral replication.

  9. Human Transcription Factor hTAFII150 (CIF150) Is Involved in Transcriptional Regulation of Cell Cycle Progression

    PubMed Central

    Martin, Jay; Halenbeck, Robert; Kaufmann, Jörg

    1999-01-01

    Here we present evidence that CIF150 (hTAFII150), the human homolog of Drosophila TAFII150, plays an important and selective role in establishing gene expression patterns necessary for progression through the cell cycle. Gel filtration experiments demonstrate that CIF150 (hTAFII150) seems to be less tightly associated with human transcription factor IID than hTAFII130 is associated with hTAFII250. The transient functional knockout of CIF150 (hTAFII150) protein led to cell cycle arrest at the G2/M transition in mammalian cell lines. PCR display analysis with the RNA derived from CIF150-depleted cells indicated that CIF150 (hTAFII150) is required for the transcription of only a subset of RNA polymerase II genes. CIF150 (hTAFII150) directly stimulated cyclin B1 and cyclin A transcription in cotransfection assays and in vitro assays, suggesting that the expression of these genes is dependent on CIF150 (hTAFII150) function. We defined a CIF150 (hTAFII150) consensus binding site and demonstrated that a CIF150-responsive cis element is present in the cyclin B1 core promoter. These results suggest that one function of CIF150 (hTAFII150) is to select specific RNA polymerase II core promoter elements involved in cell cycle progression. PMID:10409744

  10. Telomere-surrounding regions are transcription-permissive 3D nuclear compartments in human cells

    SciTech Connect

    Quina, Ana Sofia; Parreira, Leonor . E-mail: lparreir@igc.gulbenkian.pt

    2005-07-01

    Positioning of genes relative to nuclear heterochromatic compartments is thought to help regulate their transcriptional activity. Given that human subtelomeric regions are rich in highly expressed genes, we asked whether human telomeres are related to transcription-permissive nuclear compartments. To address this question, we investigated in the nuclei of normal human lymphocytes the spatial relations of two constitutively expressed genes (ACTB and RARA) and three nuclear transcripts (ACTB, IL2RA and TCRB) to telomeres and centromeres, as a function of gene activity and transcription levels. We observed that genes and gene transcripts locate close to telomere clusters and away from chromocenters upon activation of transcription. These findings, together with the observation that SC35 domains, which are enriched in pre-mRNA processing factors, are in close proximity to telomeres, indicate that telomere-neighboring regions are permissive to gene expression in human cells. Therefore, the associations of telomeres observed in the interphase nucleus might contribute, as opposed to chromocenters, for the establishment of transcription-permissive 3D nuclear compartments.

  11. Identification of Multiple Forms of RNA Transcripts Associated with Human-Specific Retrotransposed Gene Copies

    PubMed Central

    Mori, Saori; Hayashi, Masaaki; Inagaki, Shun; Oshima, Takuji; Tateishi, Ken; Fujii, Hiroshi; Suzuki, Shunsuke

    2016-01-01

    The human genome contains thousands of retrocopies, mostly as processed pseudogenes, which were recently shown to be prevalently transcribed. In particular, those specifically acquired in the human lineage are able to modulate gene expression in a manner that contributed to the evolution of human-specific traits. Therefore, knowledge of the human-specific retrocopies that are transcribed or their full-length transcript structure contributes to better understand human genome evolution. In this study, we identified 16 human-specific retrocopies that harbor 5′ CpG islands by in silico analysis and showed that 12 were transcribed in normal tissues and cancer cell lines with a variety of expression patterns, including cancer-specific expression. Determination of the structure of the transcripts associated with the retrocopies revealed that none were transcribed from their 5′ CpG islands, but rather, from inside the 3′ UTR and the nearby 5′ flanking region of the retrocopies as well as the promoter of neighboring genes. The multiple forms of the transcripts, such as chimeric and individual transcripts in both the sense and antisense orientation, might have introduced novel post-transcriptional regulation into the genome during human evolution. These results shed light on the potential role of human-specific retrocopies in the evolution of gene regulation and genomic disorders. PMID:27389689

  12. Identification of Multiple Forms of RNA Transcripts Associated with Human-Specific Retrotransposed Gene Copies.

    PubMed

    Mori, Saori; Hayashi, Masaaki; Inagaki, Shun; Oshima, Takuji; Tateishi, Ken; Fujii, Hiroshi; Suzuki, Shunsuke

    2016-01-01

    The human genome contains thousands of retrocopies, mostly as processed pseudogenes, which were recently shown to be prevalently transcribed. In particular, those specifically acquired in the human lineage are able to modulate gene expression in a manner that contributed to the evolution of human-specific traits. Therefore, knowledge of the human-specific retrocopies that are transcribed or their full-length transcript structure contributes to better understand human genome evolution. In this study, we identified 16 human-specific retrocopies that harbor 5' CpG islands by in silico analysis and showed that 12 were transcribed in normal tissues and cancer cell lines with a variety of expression patterns, including cancer-specific expression. Determination of the structure of the transcripts associated with the retrocopies revealed that none were transcribed from their 5' CpG islands, but rather, from inside the 3' UTR and the nearby 5' flanking region of the retrocopies as well as the promoter of neighboring genes. The multiple forms of the transcripts, such as chimeric and individual transcripts in both the sense and antisense orientation, might have introduced novel post-transcriptional regulation into the genome during human evolution. These results shed light on the potential role of human-specific retrocopies in the evolution of gene regulation and genomic disorders. PMID:27389689

  13. Functional Domains of Autoimmune Regulator (AIRE) Modulate INS-VNTR Transcription in Human Thymic Epithelial Cells.

    PubMed

    Sparks, Avis E; Chen, Chiachen; Breslin, Mary B; Lan, Michael S

    2016-05-20

    INS-VNTR (insulin-variable number of tandem repeats) and AIRE (autoimmune regulator) have been associated with the modulation of insulin gene expression in thymus, which is essential to induce either insulin tolerance or the development of insulin autoimmunity and type 1 diabetes. We sought to analyze whether each functional domain of AIRE is critical for the activation of INS-VNTR in human thymic epithelial cells. Twelve missense or nonsense mutations in AIRE and two chimeric AIRE constructs were generated. A luciferase reporter assay and a pulldown assay using biotinylated INS-class I VNTR probe were performed to examine the transactivation and binding activities of WT, mutant, and chimeric AIREs on the INS-VNTR promoter. Confocal microscopy analysis was performed for WT or mutant AIRE cellular localization. We found that all of the AIRE mutations resulted in loss of transcriptional activation of INS-VNTR except mutant P252L. Using WT/mutant AIRE heterozygous forms to modulate the INS-VNTR target revealed five mutations (R257X, G228W, C311fsX376, L397fsX478, and R433fsX502) that functioned in a dominant negative fashion. The LXXLL-3 motif is identified for the first time to be essential for DNA binding to INS-VNTR, whereas the intact PHD1, PHD2, LXXLL-3, and LXXLL-4 motifs were important for successful transcriptional activation. AIRE nuclear localization in the human thymic epithelial cell line was disrupted by mutations in the homogenously staining region domain and the R257X mutation in the PHD1 domain. This study supports the notion that AIRE mutation could specifically affect human insulin gene expression in thymic epithelial cells through INS-VNTR and subsequently induce either insulin tolerance or autoimmunity. PMID:27048654

  14. Where does transcription start? 5′-RACE adapted to next-generation sequencing

    PubMed Central

    Leenen, Fleur A.D.; Vernocchi, Sara; Hunewald, Oliver E.; Schmitz, Stephanie; Molitor, Anne M.; Muller, Claude P.; Turner, Jonathan D.

    2016-01-01

    The variability and complexity of the transcription initiation process was examined by adapting RNA ligase-mediated rapid amplification of 5′ cDNA ends (5′-RACE) to Next-Generation Sequencing (NGS). We oligo-labelled 5′-m7G-capped mRNA from two genes, the simple mono-exonic Beta-2-Adrenoceptor (ADRB2R) and the complex multi-exonic Glucocorticoid Receptor (GR, NR3C1), and detected a variability in TSS location that has received little attention up to now. Transcription was not initiated at a fixed TSS, but from loci of 4 to 10 adjacent nucleotides. Individual TSSs had frequencies from <0.001% to 38.5% of the total gene-specific 5′ m7G-capped transcripts. ADRB2R used a single locus consisting of 4 adjacent TSSs. Unstimulated, the GR used a total of 358 TSSs distributed throughout 38 loci, that were principally in the 5′ UTRs and were spliced using established donor and acceptor sites. Complete demethylation of the epigenetically sensitive GR promoter with 5-azacytidine induced one new locus and 127 TSSs, 12 of which were unique. We induced GR transcription with dexamethasone and Interferon-γ, adding one new locus and 185 additional TSSs distributed throughout the promoter region. In-vitro the TSS microvariability regulated mRNA translation efficiency and the relative abundance of the different GR N-terminal protein isoform levels. PMID:26615195

  15. Transcriptional trans activators of human and simian foamy viruses contain a small, highly conserved activation domain.

    PubMed Central

    Garrett, E D; He, F; Bogerd, H P; Cullen, B R

    1993-01-01

    The Bel-1 protein of human foamy virus is a potent transcriptional trans activator of its homologous long terminal repeat promoter element. Here, we demonstrate that Bel-1 can also efficiently activate gene expression when targeted to a heterologous promoter by fusion to the DNA-binding motif of the yeast GAL4 protein. Analysis of a series of deletion mutants of Bel-1 generated in this hybrid protein context suggests the presence of a single transcription activation domain that is fully contained within a discrete, approximately 30-amino-acid segment located proximal to the Bel-1 carboxy terminus. Although this short motif can be shown to function effectively in eukaryotic cells of mammalian, avian, and fungal origin, it does not bear any evident sequence homology to the known classes of eukaryotic activation domain. However, this Bel-1 activation domain was found to be fully conserved, in terms of both biological activity and location, in the distantly related Taf trans activator of simian foamy virus type 1. Images PMID:8411385

  16. Transcriptional networks implicated in human nonalcoholic fatty liver disease.

    PubMed

    Ye, Hua; Liu, Wei

    2015-10-01

    The transcriptome of nonalcoholic fatty liver disease (NAFLD) was investigated in several studies. However, the implications of transcriptional networks in progressive NAFLD are not clear and mechanisms inducing transition from nonalcoholic simple fatty liver (NAFL) to nonalcoholic steatohepatitis (NASH) are still elusive. The aims of this study were to (1) construct networks for progressive NAFLD, (2) identify hub genes and functional modules in these networks and (3) infer potential linkages among hub genes, transcription factors and microRNAs (miRNA) for NAFLD progression. A systems biology approach by combining differential expression analysis and weighted gene co-expression network analysis (WGCNA) was utilized to dissect transcriptional profiles in 19 normal, 10 NAFL and 16 NASH patients. Based on this framework, 3 modules related to chromosome organization, proteasomal ubiquitin-dependent protein degradation and immune response were identified in NASH network. Furthermore, 9 modules of co-expressed genes associated with NAFL/NASH transition were found. Further characterization of these modules defined 13 highly connected hub genes in NAFLD progression network. Interestingly, 11 significantly changed miRNAs were predicted to target 10 of the 13 hub genes. Characterization of modules and hub genes that may be regulated by miRNAs could facilitate the identification of candidate genes and pathways responsible for NAFL/NASH transition and lead to a better understanding of NAFLD pathogenesis. The identified modules and hub genes may point to potential targets for therapeutic interventions. PMID:25851235

  17. Domain structure of a human general transcription initiation factor, TFIIF.

    PubMed Central

    Yonaha, M; Aso, T; Kobayashi, Y; Vasavada, H; Yasukochi, Y; Weissman, S M; Kitajima, S

    1993-01-01

    The structural and functional domains of a general transcription initiation factor, TFIIF (RAP30/74, FC), have been investigated using various deletion mutants of each subunit, both in vivo and in vitro. An in vivo assay showed that the N-terminal sequence containing residues of 1-110 of RAP30 that is located close to a sigma homology region interacts with a minimum sequence of residues 62-171 of RAP74 to form a heteromeric interaction. Reconstitution of in vitro transcription activity by deletion mutants of RAP74 clearly indicated that both N-terminal residues 73-205 and C-terminal residues 356-517 are essential for full activity, the former interacting with RAP30, thus complexing with RNA polymerase II. From these data, the functional significance of domain structure of TFIIF is discussed in terms of its sigma homology sequences and complex formation with RNA polymerase II in the initiation and elongation of transcription. Images PMID:8441635

  18. Generation of a transcription map at the HSD17B locus centromeric to BRCA1 at 17q21

    SciTech Connect

    Rommens, J.M.; McArthur, J.; Allen, T.

    1995-08-10

    A detailed transcription map of the 320-kb region containing the HSD17B locus on chromosome 17 was generated. Thirty unique cDNA fragments, retrieved following the hybridization of immobilized YACs to primary pools of cDNAs prepared from RNA of mammary gland, ovary, placenta, and the Caco-2 cell line, were aligned into 10 transcription units by physical mapping and hybridization to RNAs of a series of tissues. The cDNAs were then further characterized by sequencing and used to screen mammary gland DNA libraries. Fragments corresponding to the broadly expressed {gamma}-tubulin and Ki antigen genes were identified. A full-length cDNA clone encoding a 117-amino-acid protein homologous to the rat ribosomal protein L34 was isolated. Portions of genes with restricted patterns of expression were also obtained, including the previously characterized HSD17B1. One new gene, for which a full-length cDNA was isolated, was found to have an interesting tissue-specific pattern of expression with abundant mRNA in both the colon and the testis and in the mammary carcinoma cell line BT-474. This contrasted with the barely detectable level observed in several tissues including normal mammary gland. Of the five additional transcription units identified, one showed no similarity, two showed identity to human expressed sequences, and two displayed similarity to genes of animal species by amino acid alignment. These latter cDNA clones include potential homologues of a rat nuclear tyrosine phosphatase and of a factor of Drosophila that is known to be involved in the negative regulation of transcription of segment identity genes. 44 refs., 7 figs., 1 tab.

  19. Tissue-specific transcript annotation and expression profiling with complementary next-generation sequencing technologies

    PubMed Central

    Hestand, Matthew S.; Klingenhoff, Andreas; Scherf, Matthias; Ariyurek, Yavuz; Ramos, Yolande; van Workum, Wilbert; Suzuki, Makoto; Werner, Thomas; van Ommen, Gert-Jan B.; den Dunnen, Johan T.; Harbers, Matthias; 't Hoen, Peter A.C.

    2010-01-01

    Next-generation sequencing is excellently suited to evaluate the abundance of mRNAs to study gene expression. Here we compare two alternative technologies, cap analysis of gene expression (CAGE) and serial analysis of gene expression (SAGE), for the same RNA samples. Along with quantifying gene expression levels, CAGE can be used to identify tissue-specific transcription start sites, while SAGE monitors 3′-end usage. We used both methods to get more insight into the transcriptional control of myogenesis, studying differential gene expression in differentiated and proliferating C2C12 myoblast cells with statistical evaluation of reproducibility and differential gene expression. Both CAGE and SAGE provided highly reproducible data (Pearson's correlations >0.92 among biological triplicates). With both methods we found around 10 000 genes expressed at levels 2 transcripts per million (0.3 copies per cell), with an overlap of 86%. We identified 4304 and 3846 genes differentially expressed between proliferating and differentiated C2C12 cells by CAGE and SAGE, respectively, with an overlap of 2144. We identified 196 novel regulatory regions with preferential use in proliferating or differentiated cells. Next-generation sequencing of CAGE and SAGE libraries provides consistent expression levels and can enrich current genome annotations with tissue-specific promoters and alternative 3′-UTR usage. PMID:20615900

  20. Chromatin states reveal functional associations for globally defined transcription start sites in four human cell lines

    PubMed Central

    2014-01-01

    Background Deciphering the most common modes by which chromatin regulates transcription, and how this is related to cellular status and processes is an important task for improving our understanding of human cellular biology. The FANTOM5 and ENCODE projects represent two independent large scale efforts to map regulatory and transcriptional features to the human genome. Here we investigate chromatin features around a comprehensive set of transcription start sites in four cell lines by integrating data from these two projects. Results Transcription start sites can be distinguished by chromatin states defined by specific combinations of both chromatin mark enrichment and the profile shapes of these chromatin marks. The observed patterns can be associated with cellular functions and processes, and they also show association with expression level, location relative to nearby genes, and CpG content. In particular we find a substantial number of repressed inter- and intra-genic transcription start sites enriched for active chromatin marks and Pol II, and these sites are strongly associated with immediate-early response processes and cell signaling. Associations between start sites with similar chromatin patterns are validated by significant correlations in their global expression profiles. Conclusions The results confirm the link between chromatin state and cellular function for expressed transcripts, and also indicate that active chromatin states at repressed transcripts may poise transcripts for rapid activation during immune response. PMID:24669905

  1. Reduced DNA methylation patterning and transcriptional connectivity define human skin aging.

    PubMed

    Bormann, Felix; Rodríguez-Paredes, Manuel; Hagemann, Sabine; Manchanda, Himanshu; Kristof, Boris; Gutekunst, Julian; Raddatz, Günter; Haas, Rainer; Terstegen, Lara; Wenck, Horst; Kaderali, Lars; Winnefeld, Marc; Lyko, Frank

    2016-06-01

    Epigenetic changes represent an attractive mechanism for understanding the phenotypic changes associated with human aging. Age-related changes in DNA methylation at the genome scale have been termed 'epigenetic drift', but the defining features of this phenomenon remain to be established. Human epidermis represents an excellent model for understanding age-related epigenetic changes because of its substantial cell-type homogeneity and its well-known age-related phenotype. We have now generated and analyzed the currently largest set of human epidermis methylomes (N = 108) using array-based profiling of 450 000 methylation marks in various age groups. Data analysis confirmed that age-related methylation differences are locally restricted and characterized by relatively small effect sizes. Nevertheless, methylation data could be used to predict the chronological age of sample donors with high accuracy. We also identified discontinuous methylation changes as a novel feature of the aging methylome. Finally, our analysis uncovered an age-related erosion of DNA methylation patterns that is characterized by a reduced dynamic range and increased heterogeneity of global methylation patterns. These changes in methylation variability were accompanied by a reduced connectivity of transcriptional networks. Our findings thus define the loss of epigenetic regulatory fidelity as a key feature of the aging epigenome. PMID:27004597

  2. Partial Conservation between Mice and Humans in Olfactory Bulb Interneuron Transcription Factor Codes

    PubMed Central

    Fujiwara, Nana; Cave, John W.

    2016-01-01

    The mammalian main olfactory bulb (OB) has a large population of GABAergic inhibitory interneurons that contains several subtypes defined by the co-expression other neurotransmitters and calcium binding proteins. The three most commonly studied OB interneuron subtypes co-express either Calretinin, Calbindin, or Tyrosine hydroxylase (Th). Combinations of transcription factors used to specify the phenotype of progenitors are referred to as transcription factor codes, and the current understanding of transcription factor codes that specify OB inhibitory neuron phenotypes are largely based on studies in mice. The conservation of these transcription factor codes in the human OB, however, has not been investigated. The aim of this study was to establish whether transcription factor codes in OB interneurons are conserved between mice and humans. This study compared the co-expression of Foxp2, Meis2, Pax6, and Sp8 transcription factors with Calretinin, Calbindin, or Th in human and mouse OB interneurons. This analysis found strong conservation of Calretinin co-expression with Sp8 and Meis2 as well as Th co-expression with Pax6 and Meis2. This analysis also showed that selective Foxp2 co-expression with Calbindin was conserved between mice and humans, which suggests Foxp2 is a novel determinant of the OB Calbindin interneuron phenotype. Together, the findings in this study provide insight into the conservation of transcription codes for OB interneuron phenotypes between humans and mice, as well as reveal some important differences between the species. This advance in our understanding of transcription factor codes in OB interneurons provides an important complement to the codes that have been established for other regions within the mammalian central nervous system, such as the cortex and spinal cord. PMID:27489533

  3. Partial Conservation between Mice and Humans in Olfactory Bulb Interneuron Transcription Factor Codes.

    PubMed

    Fujiwara, Nana; Cave, John W

    2016-01-01

    The mammalian main olfactory bulb (OB) has a large population of GABAergic inhibitory interneurons that contains several subtypes defined by the co-expression other neurotransmitters and calcium binding proteins. The three most commonly studied OB interneuron subtypes co-express either Calretinin, Calbindin, or Tyrosine hydroxylase (Th). Combinations of transcription factors used to specify the phenotype of progenitors are referred to as transcription factor codes, and the current understanding of transcription factor codes that specify OB inhibitory neuron phenotypes are largely based on studies in mice. The conservation of these transcription factor codes in the human OB, however, has not been investigated. The aim of this study was to establish whether transcription factor codes in OB interneurons are conserved between mice and humans. This study compared the co-expression of Foxp2, Meis2, Pax6, and Sp8 transcription factors with Calretinin, Calbindin, or Th in human and mouse OB interneurons. This analysis found strong conservation of Calretinin co-expression with Sp8 and Meis2 as well as Th co-expression with Pax6 and Meis2. This analysis also showed that selective Foxp2 co-expression with Calbindin was conserved between mice and humans, which suggests Foxp2 is a novel determinant of the OB Calbindin interneuron phenotype. Together, the findings in this study provide insight into the conservation of transcription codes for OB interneuron phenotypes between humans and mice, as well as reveal some important differences between the species. This advance in our understanding of transcription factor codes in OB interneurons provides an important complement to the codes that have been established for other regions within the mammalian central nervous system, such as the cortex and spinal cord. PMID:27489533

  4. Regulation of the expression of human C[epsilon] germline transcript

    SciTech Connect

    Ichiki, T.; Takahashi, W.; Watanabe, T. )

    1993-06-15

    Transcriptional regulation for Ig H chain germline transcripts induced by cytokines is a topic of recent interest for the understanding of the mechanism of class switch recombination. Among human B cell lines examined, the authors have found that a human IgM-producing B cell line, DND39 (EBV negative) expressed germ-line transcripts of [epsilon] constant gene (C[epsilon]) when stimulated with lL-4. In this study, the regulatory element responsible for the expression of lL-4-induced human C[epsilon] germ-line transcript was determined using DND39 cells. To identify the lL-4 responsive promotor/enhancer element, deletion analysis of the upstream region of the germ-line exon (l[epsilon]) of the C[epsilon] germ-line transcript which is located 5' to the switch region, was performed by using a luciferase gene as a reporter. Deletion analysis showed that a DNA fragment which lies between [minus]215 and [minus]154 bp upstream from the most 3' transcriptional initiation site of human l[epsilon] gene is fully responsible for the induction of germ-line transcripts by IL-4. According to a mutational analysis, the DNA fragment between [minus]163 and [minus]152 bp was identified to be a novel IL-4 responsive element in a human C[epsilon] gene. Electrophoretic gel mobility shift assay showed the presence of IL-4-induced nuclear factor that specifically bound to this IL-4 responsive element. This novel IL-4 responsive element and an IL-4-induced DNA binding protein may play an important role for the induction of C[epsilon] germ-line transcript as well as class switching to IgE. 54 refs., 7 figs.

  5. Transcriptional profiling in an MPNST-derived cell line and normal human Schwann cells

    PubMed Central

    LEE, PHILIP R.; COHEN, JONATHAN E.; TENDI, ELISABETTA A.; FARRER, ROBERT; DE VRIES, GEORGE H.; BECKER, KEVIN G.; FIELDS, R. DOUGLAS

    2005-01-01

    cDNA microarrays were utilized to identify abnormally expressed genes in a malignant peripheral nerve sheath tumor (MPNST)-derived cell line, T265, by comparing the mRNA abundance profiles with that of normal human Schwann cells (nhSCs). The findings characterize the molecular phenotype of this important cell-line model of MPNSTs, and elucidate the contribution of Schwann cells in MPNSTs. In total, 4608 cDNA sequences were screened and hybridizations replicated on custom cDNA microarrays. In order to verify the microarray data, a large selection of differentially expressed mRNA transcripts were subjected to semi-quantitative reverse transcription PCR (LightCycler). Western blotting was performed to investigate a selection of genes and signal transduction pathways, as a further validation of the microarray data. The data generated from multiple microarray screens, semi-quantitative RT–PCR and Western blotting are in broad agreement. This study represents a comprehensive gene-expression analysis of an MPNST-derived cell line and the first comprehensive global mRNA profile of nhSCs in culture. This study has identified ~900 genes that are expressed abnormally in the T265 cell line and detected many genes not previously reported to be expressed in nhSCs. The results provide crucial information on the T265 cells that is essential for investigation using this cell line in experimental studies in neurofibromatosis type I (NF1), and important information on normal human Schwann cells that is applicable to a wide range of studies on Schwann cells in cell culture. PMID:16429615

  6. Regulation of PURA gene transcription by three promoters generating distinctly spliced 5-prime leaders: a novel means of fine control over tissue specificity and viral signals

    PubMed Central

    2010-01-01

    Background Purα is an evolutionarily conserved cellular protein participating in processes of DNA replication, transcription, and RNA transport; all involving binding to nucleic acids and altering conformation and physical positioning. The distinct but related roles of Purα suggest a need for expression regulated differently depending on intracellular and external signals. Results Here we report that human PURA (hPURA) transcription is regulated from three distinct and widely-separated transcription start sites (TSS). Each of these TSS is strongly homologous to a similar site in mouse chromosomal DNA. Transcripts from TSS I and II are characterized by the presence of large and overlapping 5'-UTR introns terminated at the same splice receptor site. Transfection of lung carcinoma cells with wild-type or mutated hPURA 5' upstream sequences identifies different regulatory elements. TSS III, located within 80 bp of the translational start codon, is upregulated by E2F1, CAAT and NF-Y binding elements. Transcription at TSS II is downregulated through the presence of adjacent consensus binding elements for interferon regulatory factors (IRFs). Chromatin immunoprecipitation reveals that IRF-3 protein binds hPURA promoter sequences at TSS II in vivo. By co-transfecting hPURA reporter plasmids with expression plasmids for IRF proteins we demonstrate that several IRFs, including IRF-3, down-regulate PURA transcription. Infection of NIH 3T3 cells with mouse cytomegalovirus results in a rapid decrease in levels of mPURA mRNA and Purα protein. The viral infection alters the degree of splicing of the 5'-UTR introns of TSS II transcripts. Conclusions Results provide evidence for a novel mechanism of transcriptional control by multiple promoters used differently in various tissues and cells. Viral infection alters not only the use of PURA promoters but also the generation of different non-coding RNAs from 5'-UTRs of the resulting transcripts. PMID:21062477

  7. Structure and transcription of the human c-mpl gene (MPL)

    SciTech Connect

    Mignotte, V.; Vigon, I.; De Crevecoeur, E.B.; Romeo, P.H.; Lemarchandel, V. ); Chretien, S. )

    1994-03-01

    The human c-mpl proto-oncogene encodes a member of the cytokine receptor superfamily, expressed mainly in CD 34-positive hematopoietic progenitors and in the megakaryocytic lineage. To investigate the elements required for this tissue-specific expression, the authors cloned the human c-mpl gene (MPL) as well as the 5[prime] end of the mouse gene. The human c-mpl gene contains 12 exons distributed over 17 kb of DNA. Each of the two [open quotes]cytokine receptor domains[close quotes] of Mpl is encoded by a set of four exons, the transmembrane domain by a single exon and the cytoplasmic domain by two exons. They also describe how three types of mRNA, encoding different proteins, are generated. The major species contains all 12 exons; mRNAs encoding a protein with a smaller cytoplasmic domain are produced by termination of the transcript within intron 10, and mrNAs encoding a putatitive soluble form of the c-Mpl protein lack exons 9 and 10. The promoter regions of the human and mouse genes were characterized. These promoters are GC-rich and contain putative binding sites for proteins of the Ets and GATA families. Finally, they show that a 700-bp fragment of the human c-mpl promoter is active in the HEL and K562 cell lines, which express erythroid and megakaryocytic markers, but is inactive in the nonhematopoietic HeLa cell line and the Jurkat T lymphoid cell line. 47 refs., 6 figs., 1 tab.

  8. Reshuffling transcriptional circuits: how microorganisms adapt to colonize the human body

    PubMed Central

    De, Sonakshi; Pérez, J Christian

    2014-01-01

    Several hundred taxa of microorganisms—including bacteria, archaea and eukaryotes—inhabit the human body. What did it take for these species to become stable residents of humans? Recent reports illustrate how evolutionary changes in transcriptional circuits played a pivotal role in the adaptation of single-celled eukaryotes to colonize mammals. PMID:25483603

  9. Structural and transcriptional analysis of human papillomavirus type 16 sequences in cervical carcinoma cell lines.

    PubMed Central

    Baker, C C; Phelps, W C; Lindgren, V; Braun, M J; Gonda, M A; Howley, P M

    1987-01-01

    We cloned and analyzed the integrated human papillomavirus type 16 (HPV-16) genomes that are present in the human cervical carcinoma cell lines SiHa and CaSki. The single HPV-16 genome in the SiHa line was cloned as a 10-kilobase (kb) HindIII fragment. Integration of the HPV-16 genome occurred at bases 3132 and 3384 with disruption of the E2 and E4 open reading frames (ORFs). An additional 52-base-pair deletion of HPV-16 sequences fused the E2 and E4 ORFs. the 5' portion of the disrupted E2 ORF terminated immediately in the contiguous human right-flanking sequences. Heteroduplex analysis of this cloned integrated viral genome with the prototype HPV-16 DNA revealed no other deletions, insertions, or rearrangements. DNA sequence analysis of the E1 ORF, however, revealed the presence of an additional guanine at nucleotide 1138, resulting in the fusion of the E1a and E1b ORFs into a single E1 ORF. Sequence analysis of the human flanking sequences revealed one-half of an Alu sequence at the left junction and a sequence highly homologous to the human O repeat in the right-flanking region. Analysis of the three most abundant BamHI clones from the CaSki line showed that these consisted of full-length, 7.9-kb HPV-16 DNA; a 6.5-kb genome resulting from a 1.4-kb deletion of the long control region; and a 10.5-kb clone generated by a 2.6-kb tandem repeat of the 3' early region. These HPV-16 genomes were arranged in the host chromosomes as head-to-tail, tandemly repeated arrays. Transcription analysis revealed expression of the HPV-16 genome in each of these two cervical carcinoma cell lines, albeit at significantly different levels. Preliminary mapping of the viral RNA with subgenomic strand-specific probes indicated that viral transcription appeared to be derived primarily from the E6 and E7 ORFs. Images PMID:3029430

  10. Human SWI-SNF Component BRG1 Represses Transcription of the c-fos Gene

    PubMed Central

    Murphy, Daniel J.; Hardy, Stephen; Engel, Daniel A.

    1999-01-01

    Yeast and mammalian SWI-SNF complexes regulate transcription through active modification of chromatin structure. Human SW-13 adenocarcinoma cells lack BRG1 protein, a component of SWI-SNF that has a DNA-dependent ATPase activity essential for SWI-SNF function. Expression of BRG1 in SW-13 cells potentiated transcriptional activation by the glucocorticoid receptor, which is known to require SWI-SNF function. BRG1 also specifically repressed transcription from a transfected c-fos promoter and correspondingly blocked transcriptional activation of the endogenous c-fos gene. Mutation of lysine residue 798 in the DNA-dependent ATPase domain of BRG1 significantly reduced its ability to repress c-fos transcription. Repression by BRG1 required the cyclic AMP response element of the c-fos promoter but not nearby binding sites for Sp1, YY1, or TFII-I. Using human C33A cervical carcinoma cells, which lack BRG1 and also express a nonfunctional Rb protein, transcriptional repression by BRG1 was weak unless wild-type Rb was also supplied. Interestingly, Rb-dependent repression by BRG1 was found to take place through a pathway that is independent of transcription factor E2F. PMID:10082538

  11. Transcriptional signatures of Ral GTPase are associated with aggressive clinicopathologic characteristics in human cancer

    PubMed Central

    Smith, Steven C.; Baras, Alexander S.; Owens, Charles R.; Dancik, Garrett; Theodorescu, Dan

    2013-01-01

    RalA and RalB are small GTPases which support malignant development and progression in experimental models of bladder, prostate and squamous cancer. However, demonstration of their clinical relevance in human tumors remains lacking. Here, we developed tools to evaluate Ral protein expression, activation and transcriptional output and evaluated their association with clinicopathologic parameters in common human tumor types. In order to evaluate the relevance of Ral activation and transcriptional output, we correlated RalA and RalB activation with the mutational status of key human bladder cancer genes. We also identified and evaluated a “transcriptional signature” of genes that correlates with depletion of RalA and RalB in vivo. The Ral transcriptional signature score, but not protein expression as evaluated by immunohistochemistry, predicted disease stage, progression to muscle invasion, and survival in human bladder cancers, and metastatic and stem cell phenotypes in bladder cancer models. In prostate cancer, the Ral transcriptional signature score was associated with seminal vesicle invasion, androgen-independent progression, and reduced survival. In squamous cell carcinoma, this score was decreased in cancer tissues compared with normal mucosa, validating the experimental findings that Ral acts as a tumor-suppressor in this tumor type. Together, our findings demonstrate the clinical relevance of Ral in human cancer and provide a rationale for the development of Ral-directed therapies. PMID:22586063

  12. The transcriptional regulator network of human inflammatory macrophages is defined by open chromatin

    PubMed Central

    Schmidt, Susanne V; Krebs, Wolfgang; Ulas, Thomas; Xue, Jia; Baßler, Kevin; Günther, Patrick; Hardt, Anna-Lena; Schultze, Hartmut; Sander, Jil; Klee, Kathrin; Theis, Heidi; Kraut, Michael; Beyer, Marc; Schultze, Joachim L

    2016-01-01

    Differentiation of inflammatory macrophages from monocytes is characterized by an orderly integration of epigenetic and transcriptional regulatory mechanisms guided by lineage-determining transcription factors such as PU.1. Further activation of macrophages leads to a stimulus- or microenvironment-specific signal integration with subsequent transcriptional control established by the action of tissue- or signal-associated transcription factors. Here, we assess four histone modifications during human macrophage activation and integrate this information with the gene expression data from 28 different macrophage activation conditions in combination with GM-CSF. Bioinformatically, for inflammatory macrophages we define a unique network of transcriptional and epigenetic regulators (TRs), which was characterized by accessible promoters independent of the activation signal. In contrast to the general accessibility of promoters of TRs, mRNA expression of central TRs belonging to the TR network displayed stimulus-specific expression patterns, indicating a second level of transcriptional regulation beyond epigenetic chromatin changes. In contrast, stringent integration of epigenetic and transcriptional regulation was observed in networks of TRs established from somatic tissues and tissue macrophages. In these networks, clusters of TRs with permissive histone marks were associated with high gene expression whereas clusters with repressive chromatin marks were associated with absent gene expression. Collectively, these results support that macrophage activation during inflammation in contrast to lineage determination is mainly regulated transcriptionally by a pre-defined TR network. PMID:26729620

  13. Human Mitochondrial Transcription Initiation Complexes Have Similar Topology on the Light and Heavy Strand Promoters.

    PubMed

    Morozov, Yaroslav I; Temiakov, Dmitry

    2016-06-24

    Transcription is a highly regulated process in all domains of life. In human mitochondria, transcription of the circular genome involves only two promoters, called light strand promoter (LSP) and heavy strand promoter (HSP), located in the opposite DNA strands. Initiation of transcription occurs upon sequential assembly of an initiation complex that includes mitochondrial RNA polymerase (mtRNAP) and the initiation factors mitochondrial transcription factor A (TFAM) and TFB2M. It has been recently suggested that the transcription initiation factor TFAM binds to HSP and LSP in opposite directions, implying that the mechanisms of transcription initiation are drastically dissimilar at these promoters. In contrast, we found that binding of TFAM to HSP and the subsequent recruitment of mtRNAP results in a pre-initiation complex that is remarkably similar in topology and properties to that formed at the LSP promoter. Our data suggest that assembly of the pre-initiation complexes on LSP and HSP brings these transcription units in close proximity, providing an opportunity for regulatory proteins to simultaneously control transcription initiation in both mtDNA strands. PMID:27226527

  14. Transcriptional regulation of human UDP-glucuronosyltransferase genes.

    PubMed

    Hu, Dong Gui; Meech, Robyn; McKinnon, Ross A; Mackenzie, Peter I

    2014-11-01

    Glucuronidation is an important metabolic pathway for many small endogenous and exogenous lipophilic compounds, including bilirubin, steroid hormones, bile acids, carcinogens and therapeutic drugs. Glucuronidation is primarily catalyzed by the UDP-glucuronosyltransferase (UGT) 1A and two subfamilies, including nine functional UGT1A enzymes (1A1, 1A3-1A10) and 10 functional UGT2 enzymes (2A1, 2A2, 2A3, 2B4, 2B7, 2B10, 2B11, 2B15, 2B17 and 2B28). Most UGTs are expressed in the liver and this expression relates to the major role of hepatic glucuronidation in systemic clearance of toxic lipophilic compounds. Hepatic glucuronidation activity protects the body from chemical insults and governs the therapeutic efficacy of drugs that are inactivated by UGTs. UGT mRNAs have also been detected in over 20 extrahepatic tissues with a unique complement of UGT mRNAs seen in almost every tissue. This extrahepatic glucuronidation activity helps to maintain homeostasis and hence regulates biological activity of endogenous molecules that are primarily inactivated by UGTs. Deciphering the molecular mechanisms underlying tissue-specific UGT expression has been the subject of a large number of studies over the last two decades. These studies have shown that the constitutive and inducible expression of UGTs is primarily regulated by tissue-specific and ligand-activated transcription factors (TFs) via their binding to cis-regulatory elements (CREs) in UGT promoters and enhancers. This review first briefly summarizes published UGT gene transcriptional studies and the experimental models and tools utilized in these studies, and then describes in detail the TFs and their respective CREs that have been identified in the promoters and/or enhancers of individual UGT genes. PMID:25336387

  15. GAD2 Alternative Transcripts in the Human Prefrontal Cortex, and in Schizophrenia and Affective Disorders

    PubMed Central

    Li, Chao; Gao, Yuan; Gondré-Lewis, Marjorie C.; Lipska, Barbara K.; Shin, Joo Heon; Xie, Bin; Ye, Tianzhang; Weinberger, Daniel R.; Kleinman, Joel E.; Hyde, Thomas M.

    2016-01-01

    Genetic variation and early adverse environmental events work together to increase risk for schizophrenia. γ-aminobutyric acid (GABA), the major inhibitory neurotransmitter in adult mammalian brain, plays a major role in normal brain development, and has been strongly implicated in the pathobiology of schizophrenia. GABA synthesis is controlled by two glutamic acid decarboxylase (GAD) genes, GAD1 and GAD2, both of which produce a number of alternative transcripts. Genetic variants in the GAD1 gene are associated with increased risk for schizophrenia, and reduced expression of its major transcript in the human dorsolateral prefrontal cortex (DLPFC). No consistent changes in GAD2 expression have been found in brains from patients with schizophrenia. In this work, with the use of RNA sequencing and PCR technologies, we confirmed and tracked the expression of an alternative truncated transcript of GAD2 (ENST00000428517) in human control DLPFC homogenates across lifespan besides the well-known full length transcript of GAD2. In addition, using quantitative RT-PCR, expression of GAD2 full length and truncated transcripts were measured in the DLPFC of patients with schizophrenia, bipolar disorder and major depression. The expression of GAD2 full length transcript is decreased in the DLPFC of schizophrenia and bipolar disorder patients, while GAD2 truncated transcript is increased in bipolar disorder patients but decreased in schizophrenia patients. Moreover, the patients with schizophrenia with completed suicide or positive nicotine exposure showed significantly higher expression of GAD2 full length transcript. Alternative transcripts of GAD2 may be important in the growth and development of GABA-synthesizing neurons as well as abnormal GABA signaling in the DLPFC of patients with schizophrenia and affective disorders. PMID:26848839

  16. Transcriptional specialization of human dendritic cell subsets in response to microbial vaccines

    PubMed Central

    Banchereau, Romain; Baldwin, Nicole; Cepika, Alma-Martina; Athale, Shruti; Xue, Yaming; Yu, Chun I; Metang, Patrick; Cheruku, Abhilasha; Berthier, Isabelle; Gayet, Ingrid; Wang, Yuanyuan; Ohouo, Marina; Snipes, LuAnn; Xu, Hui; Obermoser, Gerlinde; Blankenship, Derek; Oh, Sangkon; Ramilo, Octavio; Chaussabel, Damien; Banchereau, Jacques; Palucka, Karolina; Pascual, Virginia

    2014-01-01

    The mechanisms by which microbial vaccines interact with human APCs remain elusive. Herein, we describe the transcriptional programs induced in human DCs by pathogens, innate receptor ligands and vaccines. Exposure of DCs to influenza, Salmonella enterica and Staphylococcus aureus allows us to build a modular framework containing 204 transcript clusters. We use this framework to characterize the responses of human monocytes, monocyte-derived DCs and blood DC subsets to 13 vaccines. Different vaccines induce distinct transcriptional programs based on pathogen type, adjuvant formulation and APC targeted. Fluzone, Pneumovax and Gardasil, respectively, activate monocyte-derived DCs, monocytes and CD1c+ blood DCs, highlighting APC specialization in response to vaccines. Finally, the blood signatures from individuals vaccinated with Fluzone or infected with influenza reveal a signature of adaptive immunity activation following vaccination and symptomatic infections, but not asymptomatic infections. These data, offered with a web interface, may guide the development of improved vaccines. PMID:25335753

  17. Expression and purification of recombinant human c-Fos/c-Jun that is highly active in DNA binding and transcriptional activation in vitro

    PubMed Central

    Ferguson, Heather A.; Goodrich, James A.

    2001-01-01

    c-Fos and c-Jun are members of the AP-1 family of transcriptional activators that regulate the expression of genes during cell proliferation. To facilitate in vitro studies of mechanisms of transcriptional activation by c-Jun and c-Fos we developed a method for obtaining recombinant c-Fos/c-Jun that is highly active in DNA binding and transcriptional activation in vitro. Full-length human c-Fos and c-Jun were expressed in Escherichia coli. The expression of c-Fos was dependent on a helper plasmid that encodes rare ArgtRNAs. Both over-expressed c-Fos and c-Jun were recovered from inclusion bodies. A c-Fos/c-Jun complex was generated by co-renaturation and purified via a His-tag on the full-length human c-Fos. The resulting c-Fos/c-Jun bound DNA with high affinity and specificity, and activated transcription in a reconstituted human RNA polymerase II transcription system. The availability of active recombinant human c-Fos/c-Jun will allow future biochemical studies of these important transcriptional activators. PMID:11600717

  18. Transcriptional Regulation of the Human P450 Oxidoreductase Gene: Hormonal Regulation and Influence of Promoter Polymorphisms

    PubMed Central

    Tee, Meng Kian; Huang, Ningwu; Damm, Izabella

    2011-01-01

    P450 oxidoreductase (POR) is the flavoprotein that acts as the obligatory electron donor to all microsomal P450 enzymes, including those involved in hepatic drug metabolism as well as three steroidogenic P450 enzymes. The untranslated first exon of human POR was located recently, permitting analysis of human POR transcription. Expression of deletional mutants containing up to 3193 bp of the human POR promoter in human adrenal NCI-H295A and liver Hep-G2 cells located the proximal promoter at −325/−1 bp from the untranslated exon. Common human POR polymorphisms at −208 and −173 had little influence on transcription, but the polymorphism at −152 reduced transcription significantly in both cell lines. EMSA and supershift assays identified binding of Smad3/Smad4 between −249 and −261 and binding of thyroid hormone receptor-β (TRβ) at −240/−245. Chromatin immunoprecipitation showed that Smad3, Smad4, TRα, TRβ, and estrogen receptor-α were bound between −374 and −149. Cotransfection of vectors for these transcription factors and POR promoter-reporter constructs into both cell types followed by hormonal treatment showed that T3 exerts major tropic effects via TRβ, with TRα, estrogen receptor-α, Smad3, and Smad4 exerting lesser, modulatory effects. T3 also increased POR mRNA in both cell lines. Thyroid hormone also is essential for rat liver POR expression but acts via different transcription factor complexes. These are the first data on human POR gene transcription, establishing roles for TRβ and Smad3/4 in its expression and indicating that the common polymorphism at −152 may play a role in genetic variation in steroid biosynthesis and drug metabolism. PMID:21393444

  19. Transcriptional PROFILING OF MUCOCILIARY DIFFERENTIATION IN HUMAN AIRWAY EPITHELIAL CELLS

    EPA Science Inventory

    When cultured at an air-liquid interface (ALI) in the appropriate medium, primary human airway epithelial cells form a polarized, pseudostratified epithelium composed of ciliated and mucus-secreting cells. This culture system provides a useful tool for the in vitro study of...

  20. Fusion Transcript Discovery in Formalin-Fixed Paraffin-Embedded Human Breast Cancer Tissues Reveals a Link to Tumor Progression

    PubMed Central

    Ma, Yan; Ambannavar, Ranjana; Stephans, James; Jeong, Jennie; Dei Rossi, Andrew; Liu, Mei-Lan; Friedman, Adam J.; Londry, Jason J.; Abramson, Richard; Beasley, Ellen M.; Baker, Joffre; Levy, Samuel; Qu, Kunbin

    2014-01-01

    The identification of gene fusions promises to play an important role in personalized cancer treatment decisions. Many rare gene fusion events have been identified in fresh frozen solid tumors from common cancers employing next-generation sequencing technology. However the ability to detect transcripts from gene fusions in RNA isolated from formalin-fixed paraffin-embedded (FFPE) tumor tissues, which exist in very large sample repositories for which disease outcome is known, is still limited due to the low complexity of FFPE libraries and the lack of appropriate bioinformatics methods. We sought to develop a bioinformatics method, named gFuse, to detect fusion transcripts in FFPE tumor tissues. An integrated, cohort based strategy has been used in gFuse to examine single-end 50 base pair (bp) reads generated from FFPE RNA-Sequencing (RNA-Seq) datasets employing two breast cancer cohorts of 136 and 76 patients. In total, 118 fusion events were detected transcriptome-wide at base-pair resolution across the 212 samples. We selected 77 candidate fusions based on their biological relevance to cancer and supported 61% of these using TaqMan assays. Direct sequencing of 19 of the fusion sequences identified by TaqMan confirmed them. Three unique fused gene pairs were recurrent across the 212 patients with 6, 3, 2 individuals harboring these fusions respectively. We show here that a high frequency of fusion transcripts detected at the whole transcriptome level correlates with poor outcome (P<0.0005) in human breast cancer patients. This study demonstrates the ability to detect fusion transcripts as biomarkers from archival FFPE tissues, and the potential prognostic value of the fusion transcripts detected. PMID:24727804

  1. Molecular cloning of a putative novel human bZIP transcription factor on chromosome 17q22

    SciTech Connect

    Luna, L.; Johnsen, O.; Skartlien, A.H.

    1994-08-01

    We have cloned and characterized cDNA clones representing several mRNA isoforms generated by alternative splicing of a single gene localized to chromosome 17q22. Sequence analysis showed that the predicted translational product of the longest open reading frame (2316 nucleotides, 772 amino acids) is related to transcription factors of the basic elucine zipper (bZIP) class. The sequence contained several regions characteristic of transcriptional regulatory domains. A cluster of amino acids flanking the bZIP region on both sides was highly conserved between TCF11 and p45 NF-E2, a subunit of the human globin locus control region-binding protein, NF-E2. These same regions showed remarkable homology to two invertebrate proteins, CNC and skn-1, postulated to regulate embryonic development in Drosophila melanogaster and Caenorhabditis elegans, respectively. 46 refs., 7 figs., 1 tab.

  2. Nanoparticle-mediated transcriptional modification enhances neuronal differentiation of human neural stem cells following transplantation in rat brain.

    PubMed

    Li, Xiaowei; Tzeng, Stephany Y; Liu, Xiaoyan; Tammia, Markus; Cheng, Yu-Hao; Rolfe, Andrew; Sun, Dong; Zhang, Ning; Green, Jordan J; Wen, Xuejun; Mao, Hai-Quan

    2016-04-01

    Strategies to enhance survival and direct the differentiation of stem cells in vivo following transplantation in tissue repair site are critical to realizing the potential of stem cell-based therapies. Here we demonstrated an effective approach to promote neuronal differentiation and maturation of human fetal tissue-derived neural stem cells (hNSCs) in a brain lesion site of a rat traumatic brain injury model using biodegradable nanoparticle-mediated transfection method to deliver key transcriptional factor neurogenin-2 to hNSCs when transplanted with a tailored hyaluronic acid (HA) hydrogel, generating larger number of more mature neurons engrafted to the host brain tissue than non-transfected cells. The nanoparticle-mediated transcription activation method together with an HA hydrogel delivery matrix provides a translatable approach for stem cell-based regenerative therapy. PMID:26828681

  3. The Human Adult Skeletal Muscle Transcriptional Profile Reconstructed by a Novel Computational Approach

    PubMed Central

    Bortoluzzi, Stefania; d'Alessi, Fabio; Romualdi, Chiara; Danieli, Gian Antonio

    2000-01-01

    By applying a novel software tool, information on 4080 UniGene clusters was retrieved from three adult human skeletal muscle cDNA libraries, which were selected for being neither normalized nor subtracted. Reconstruction of a transcriptional profile of the corresponding tissue was attempted by a computational approach, classifying each transcript according to its level of expression. About 25% of the transcripts accounted for about 80% of the detected transcriptional activity, whereas most genes showed a low level of expression. This in silico transcriptional profile was then compared with data obtained by a SAGE study. A fairly good agreement between the two methods was observed. About 400 genes, highly expressed in skeletal muscle or putatively skeletal muscle-specific, may represent the minimal set of genes needed to determine the tissue specificity. These genes could be used as a convenient reference to monitor major changes in the transcriptional profile of adult human skeletal muscle in response to different physiological or pathological conditions, thus providing a framework for designing DNA microarrays and initiating biological studies. PMID:10720575

  4. TEFM (c17orf42) is necessary for transcription of human mtDNA

    PubMed Central

    Minczuk, Michal; He, Jiuya; Duch, Anna M.; Ettema, Thijs J.; Chlebowski, Aleksander; Dzionek, Karol; Nijtmans, Leo G. J.; Huynen, Martijn A.; Holt, Ian J.

    2011-01-01

    Here we show that c17orf42, hereafter TEFM (transcription elongation factor of mitochondria), makes a critical contribution to mitochondrial transcription. Inactivation of TEFM in cells by RNA interference results in respiratory incompetence owing to decreased levels of H- and L-strand promoter-distal mitochondrial transcripts. Affinity purification of TEFM from human mitochondria yielded a complex comprising mitochondrial transcripts, mitochondrial RNA polymerase (POLRMT), pentatricopeptide repeat domain 3 protein (PTCD3), and a putative DEAD-box RNA helicase, DHX30. After RNase treatment only POLRMT remained associated with TEFM, and in human cultured cells TEFM formed foci coincident with newly synthesized mitochondrial RNA. Based on deletion mutants, TEFM interacts with the catalytic region of POLRMT, and in vitro TEFM enhanced POLRMT processivity on ss- and dsDNA templates. TEFM contains two HhH motifs and a Ribonuclease H fold, similar to the nuclear transcription elongation regulator Spt6. These findings lead us to propose that TEFM is a mitochondrial transcription elongation factor. PMID:21278163

  5. Structural insights into Transcriptional Repression by non-coding RNAs that bind to Human Pol II

    PubMed Central

    Kassube, Susanne A.; Fang, Jie; Grob, Patricia; Yakovchuk, Petro; Goodrich, James A.; Nogales, Eva

    2012-01-01

    Gene transcription is regulated in response to environmental changes as well as developmental cues. In mammalian cells subjected to stress conditions such as heat shock, transcription of most protein-coding genes decreases, while the transcription of heat shock protein genes increases. Repression involves direct binding to RNA polymerase II (Pol II) of certain non-coding RNAs (ncRNAs) that are upregulated upon heat shock. Another class of ncRNAs is also upregulated and binds to Pol II, but does not inhibit transcription. Incorporation of repressive ncRNAs into pre-initiation complexes prevents transcription initiation, while non-repressive ncRNAs are displaced from Pol II by TFIIF. Here, we present cryo-EM reconstructions of human Pol II in complex with six different ncRNAs from mouse and human. Our structures show that both repressive and non-repressive ncRNAs bind to a conserved binding site within the cleft of Pol II. The site, also shared with a previously characterized yeast aptamer, is close to the active center and thus in an ideal position to regulate transcription. Importantly, additional RNA elements extend flexibly beyond the docking site. We propose that the differences concerning the repressive activity of the ncRNA analyzed must be due to the distinct character of these more unstructured, flexible segments of the RNA that emanate from the cleft. PMID:22954660

  6. Identification of Diversity-Generating Retroelements in Human Microbiomes

    PubMed Central

    Ye, Yuzhen

    2014-01-01

    Diversity-generating retroelements (DGRs) are a unique family of retroelements that confer selective advantages to their hosts by accelerating the evolution of target genes through a specialized, error-prone, reverse transcription process. First identified in a Bordetella phage (BPP-1), which mediates the phage tropism specificity by generating variability in an involved gene, DGRs were predicted to be present in a larger collection of viral and bacterial species. A minimal DGR system is comprised of a reverse transcriptase (RTase) gene, a template sequence (TR) and a variable region (VR) within a target gene. We developed a computational tool, DGRscan, to allow either de novo identification (based on the prediction of potential template-variable region pairs) or similarity-based searches of DGR systems using known template sequences as the reference. The application of DGRscan to the human microbiome project (HMP) datasets resulted in the identification of 271 non-redundant DGR systems, doubling the size of the collection of known DGR systems. We further identified a large number of putative target genes (651, which share no more than 90% sequence identity at the amino acid level) that are potentially under diversification by the DGR systems. Our study provides the first survey of the DGR systems in the human microbiome, showing that the DGR systems are frequently found in human-associated bacterial communities, although they are of low incidence in individual genomes. Our study also provides functional clues for a large number of genes (reverse transcriptases and target genes) that were previously annotated as proteins of unknown functions or nonspecific functions. PMID:25196521

  7. Identification of diversity-generating retroelements in human microbiomes.

    PubMed

    Ye, Yuzhen

    2014-01-01

    Diversity-generating retroelements (DGRs) are a unique family of retroelements that confer selective advantages to their hosts by accelerating the evolution of target genes through a specialized, error-prone, reverse transcription process. First identified in a Bordetella phage (BPP-1), which mediates the phage tropism specificity by generating variability in an involved gene, DGRs were predicted to be present in a larger collection of viral and bacterial species. A minimal DGR system is comprised of a reverse transcriptase (RTase) gene, a template sequence (TR) and a variable region (VR) within a target gene. We developed a computational tool, DGRscan, to allow either de novo identification (based on the prediction of potential template-variable region pairs) or similarity-based searches of DGR systems using known template sequences as the reference. The application of DGRscan to the human microbiome project (HMP) datasets resulted in the identification of 271 non-redundant DGR systems, doubling the size of the collection of known DGR systems. We further identified a large number of putative target genes (651, which share no more than 90% sequence identity at the amino acid level) that are potentially under diversification by the DGR systems. Our study provides the first survey of the DGR systems in the human microbiome, showing that the DGR systems are frequently found in human-associated bacterial communities, although they are of low incidence in individual genomes. Our study also provides functional clues for a large number of genes (reverse transcriptases and target genes) that were previously annotated as proteins of unknown functions or nonspecific functions. PMID:25196521

  8. Alterations in transcription factor binding in radioresistant human melanoma cells after ionizing radiation

    SciTech Connect

    Sahijdak, W.M.; Yang, Chin-Rang; Zuckerman, J.S.; Meyers, M.; Boothman, D.A.

    1994-04-01

    We analyzed alterations in transcription factor binding to specific, known promoter DNA consensus sequences between irradiated and unirradiated radioresistant human melanoma (U1-Mel) cells. The goal of this study was to begin to investigate which transcription factors and DNA-binding sites are responsible for the induction of specific transcripts and proteins after ionizing radiation. Transcription factor binding was observed using DNA band-shift assays and oligonucleotide competition analyses. Confluence-arrested U1-Mel cells were irradiated (4.5 Gy) and harvested at 4 h. Double-stranded oligonucleotides containing known DNA-binding consensus sites for specific transcription factors were used. Increased DNA binding activity after ionizing radiation was noted with oligonucleotides containing the CREB, NF-kB and Sp1 consensus sites. No changes in protein binding to AP-1, AP-2, AP-3, or CTF/NF1, GRE or Oct-1 consensus sequences were noted. X-ray activation of select transcription factors, which bind certain consensus sites in promoters, may cause specific induction or repression of gene transcription. 22 refs., 2 figs.

  9. Endometrial transcriptional profiling of a bovine fertility model by Next-Generation Sequencing

    PubMed Central

    Mesquita, F.S.; Ramos, R.S.; Pugliesi, G.; Andrade, S.C.S.; Van Hoeck, V.; Langbeen, A.; Oliveira, M.L.; Gonella-Diaza, A.M.; Gasparin, G.; Fukumasu, H.; Pulz, L.H.; Membrive, C.M.; Coutinho, L.L.; Binelli, M.

    2015-01-01

    Studying the multitude of molecular networks and pathways that are potentially involved in a complex trait such as fertility requires an equally complex and broad strategy. Here, we used Next-Generation Sequencing for the characterization of the transcriptional signature of the bovine endometrial tissue. Periovulatory endocrine environments were manipulated to generate two distinctly different fertility phenotypes. Cycling, non-lactating, multiparous Nelore cows were manipulated to ovulate larger (> 13 mm; LF group; high fertility phenotype) or smaller (< 12 mm; SF group) follicles. As a result, greater proestrus estrogen concentrations, corpora lutea and early diestrus progesterone concentrations were also observed in LF group in comparison to SF group. Endometrial cell proliferation was estimated by the protein marker MKI67 on tissues collected 4 (D4) and 7 (D7) days after induction of ovulation. Total RNA extracts from D7 were sequenced and compared according to the transcriptional profile of each experimental group (LF versus SF). Functional enrichment analysis revealed that LF and SF endometria were asynchronous in regards to their phenotype manifestation. Major findings indicated an LF endometrium that was switching phenotypes earlier than the SF one. More specifically, a proliferating SF endometrium was observed on D7, whereas the LF tissue, which expressed a proliferative phenotype earlier at D4, seemed to have already shifted towards a biosynthetically and metabolically active endometrium on D7. Data on MKI67 support the transcriptomic results. RNA-Seq-derived transcriptional profile of the endometrial tissue indicated a temporal effect of the periovulatory endocrine environment, suggesting that the moment of the endometrial exposure to the ovarian steroids, E2 and P4, regulates the timing of phenotype manifestation. Gene expression profiling revealed molecules that may be targeted to elucidate ovarian steroid-dependent mechanisms that regulate

  10. Helix Unwinding and Base Flipping Enable Human MTERF1 to Terminate Mitochondrial Transcription

    SciTech Connect

    Yakubovskaya, E.; Mejia, E; Byrnes, J; Hambardjieva, E; Garcia-Diaz, M

    2010-01-01

    Defects in mitochondrial gene expression are associated with aging and disease. Mterf proteins have been implicated in modulating transcription, replication and protein synthesis. We have solved the structure of a member of this family, the human mitochondrial transcriptional terminator MTERF1, bound to dsDNA containing the termination sequence. The structure indicates that upon sequence recognition MTERF1 unwinds the DNA molecule, promoting eversion of three nucleotides. Base flipping is critical for stable binding and transcriptional termination. Additional structural and biochemical results provide insight into the DNA binding mechanism and explain how MTERF1 recognizes its target sequence. Finally, we have demonstrated that the mitochondrial pathogenic G3249A and G3244A mutations interfere with key interactions for sequence recognition, eliminating termination. Our results provide insight into the role of mterf proteins and suggest a link between mitochondrial disease and the regulation of mitochondrial transcription.

  11. Controlling transcription in human pluripotent stem cells using CRISPR-effectors.

    PubMed

    Genga, Ryan M; Kearns, Nicola A; Maehr, René

    2016-05-15

    The ability to manipulate transcription in human pluripotent stem cells (hPSCs) is fundamental for the discovery of key genes and mechanisms governing cellular state and differentiation. Recently developed CRISPR-effector systems provide a systematic approach to rapidly test gene function in mammalian cells, including hPSCs. In this review, we discuss recent advances in CRISPR-effector technologies that have been employed to control transcription through gene activation, gene repression, and epigenome engineering. We describe an application of CRISPR-effector mediated transcriptional regulation in hPSCs by targeting a synthetic promoter driving a GFP transgene, demonstrating the ease and effectiveness of CRISPR-effector mediated transcriptional regulation in hPSCs. PMID:26525193

  12. The transcriptional architecture of early human hematopoiesis identifies multilevel control of lymphoid commitment

    PubMed Central

    Laurenti, Elisa; Doulatov, Sergei; Zandi, Sasan; Plumb, Ian; Chen, Jing; April, Craig; Fan, Jian-Bing; Dick, John E.

    2016-01-01

    Understanding how differentiation programs originate from within the gene expression landscape of hematopoietic stem cells (HSC) is crucial to develop new clinical therapies. We mapped the transcriptional dynamics underlying the first steps of commitment by tracking transcriptome changes in human HSC and eight early progenitor populations. Transcriptional programs are extensively shared, extend across lineage-potential boundaries, and are not strictly lineage-affiliated. Elements of stem, lymphoid and myeloid programs are retained in multi-lymphoid progenitors (MLP), reflecting a hybrid transcriptional state. Based on functional single cell analysis, BCL11A, SOX4 and TEAD1 governed transcriptional networks within MLPs, leading to B cell specification. Overall, we show that integrated transcriptome approaches can identify novel regulators of multipotency and uncover additional complexity in lymphoid commitment. PMID:23708252

  13. Distinct DNA-based epigenetic switches trigger transcriptional activation of silent genes in human dermal fibroblasts

    PubMed Central

    Pandian, Ganesh N.; Taniguchi, Junichi; Junetha, Syed; Sato, Shinsuke; Han, Le; Saha, Abhijit; AnandhaKumar, Chandran; Bando, Toshikazu; Nagase, Hiroki; Vaijayanthi, Thangavel; Taylor, Rhys D.; Sugiyama, Hiroshi

    2014-01-01

    The influential role of the epigenome in orchestrating genome-wide transcriptional activation instigates the demand for the artificial genetic switches with distinct DNA sequence recognition. Recently, we developed a novel class of epigenetically active small molecules called SAHA-PIPs by conjugating selective DNA binding pyrrole-imidazole polyamides (PIPs) with the histone deacetylase inhibitor SAHA. Screening studies revealed that certain SAHA-PIPs trigger targeted transcriptional activation of pluripotency and germ cell genes in mouse and human fibroblasts, respectively. Through microarray studies and functional analysis, here we demonstrate for the first time the remarkable ability of thirty-two different SAHA-PIPs to trigger the transcriptional activation of exclusive clusters of genes and noncoding RNAs. QRT-PCR validated the microarray data, and some SAHA-PIPs activated therapeutically significant genes like KSR2. Based on the aforementioned results, we propose the potential use of SAHA-PIPs as reagents capable of targeted transcriptional activation. PMID:24457603

  14. Maf1, a New Player in the Regulation of Human RNA Polymerase III Transcription

    PubMed Central

    Hernandez, Nouria

    2006-01-01

    Background Human RNA polymerase III (pol III) transcription is regulated by several factors, including the tumor suppressors P53 and Rb, and the proto-oncogene c-Myc. In yeast, which lacks these proteins, a central regulator of pol III transcription, called Maf1, has been described. Maf1 is required for repression of pol III transcription in response to several signal transduction pathways and is broadly conserved in eukaryotes. Methodology/Principal Findings We show that human endogenous Maf1 can be co-immunoprecipitated with pol III and associates in vitro with two pol III subunits, the largest subunit RPC1 and the α-like subunit RPAC2. Maf1 represses pol III transcription in vitro and in vivo and is required for maximal pol III repression after exposure to MMS or rapamycin, treatments that both lead to Maf1 dephosphorylation. Conclusions/Significance These data suggest that Maf1 is a major regulator of pol III transcription in human cells. PMID:17205138

  15. Next generation prophylactic human papillomavirus vaccines.

    PubMed

    Schiller, John T; Müller, Martin

    2015-05-01

    The two licensed bivalent and quadrivalent human papillomavirus (HPV) L1 (the major papillomavirus virion protein) virus-like particle (VLP) vaccines are regarded as safe, effective, and well established prophylactic vaccines. However, they have some inherent limitations, including a fairly high production and delivery cost, virus-type restricted protection, and no reported therapeutic activity, which might be addressed with the development of alternative dosing schedules and vaccine products. A change from a three-dose to a two-dose protocol for the licensed HPV vaccines, especially in younger adolescents (aged 9-13 years), is underway in several countries and is likely to become the future norm. Preliminary evidence suggests that recipients of HPV vaccines might derive prophylactic benefits from one dose of the bivalent vaccine. Substantial interest exists in both the academic and industrial sectors in the development of second-generation L1 VLP vaccines in terms of cost reduction-eg, by production in Escherichia coli or alternative types of yeast. However, Merck's nonavalent vaccine, produced via the Saccharomyces cerevisiae production system that is also used for their quadrivalent vaccine, is the first second-generation HPV VLP vaccine to be available on the market. By contrast, other pharmaceutical companies are developing microbial vectors that deliver L1 genes. These two approaches would add an HPV component to existing live attenuated vaccines for measles and typhoid fever. Prophylactic vaccines that are based on induction of broadly cross-neutralising antibodies to L2, the minor HPV capsid protein, are also being developed both as simple monomeric fusion proteins and as virus-like display vaccines. The strong interest in developing the next generation of vaccines, particularly by manufacturers in middle-to-high income countries, increases the likelihood that vaccine production will become decentralised with the hope that effective HPV vaccines will be

  16. Transcriptional Dynamics of Immortalized Human Mesenchymal Stem Cells during Transformation.

    PubMed

    Takeuchi, Masao; Higashino, Atsunori; Takeuchi, Kikuko; Hori, Yutaro; Koshiba-Takeuchi, Kazuko; Makino, Hatsune; Monobe, Yoko; Kishida, Marina; Adachi, Jun; Takeuchi, Jun; Tomonaga, Takeshi; Umezawa, Akihiro; Kameoka, Yosuke; Akagi, Ken-Ichi

    2015-01-01

    Comprehensive analysis of alterations in gene expression along with neoplastic transformation in human cells provides valuable information about the molecular mechanisms underlying transformation. To further address these questions, we performed whole transcriptome analysis to the human mesenchymal stem cell line, UE6E7T-3, which was immortalized with hTERT and human papillomavirus type 16 E6/E7 genes, in association with progress of transformation in these cells. At early stages of culture, UE6E7T-3 cells preferentially lost one copy of chromosome 13, as previously described; in addition, tumor suppressor genes, DNA repair genes, and apoptosis-activating genes were overexpressed. After the loss of chromosome 13, additional aneuploidy and genetic alterations that drove progressive transformation, were observed. At this stage, the cell line expressed oncogenes as well as genes related to anti-apoptotic functions, cell-cycle progression, and chromosome instability (CIN); these pro-tumorigenic changes were concomitant with a decrease in tumor suppressor gene expression. At later stages after prolong culture, the cells exhibited chromosome translocations, acquired anchorage-independent growth and tumorigenicity in nude mice, (sarcoma) and exhibited increased expression of genes encoding growth factor and DNA repair genes, and decreased expression of adhesion genes. In particular, glypican-5 (GPC5), which encodes a cell-surface proteoglycan that might be a biomarker for sarcoma, was expressed at high levels in association with transformation. Patched (Ptc1), the cell surface receptor for hedgehog (Hh) signaling, was also significantly overexpressed and co-localized with GPC5. Knockdown of GPC5 expression decreased cell proliferation, suggesting that it plays a key role in growth in U3-DT cells (transformants derived from UE6E7T-3 cells) through the Hh signaling pathway. Thus, the UE6E7T-3 cell culture model is a useful tool for assessing the functional contribution of

  17. Transcriptional Dynamics of Immortalized Human Mesenchymal Stem Cells during Transformation

    PubMed Central

    Hori, Yutaro; Koshiba-Takeuchi, Kazuko; Makino, Hatsune; Monobe, Yoko; Kishida, Marina; Adachi, Jun; Takeuchi, Jun; Tomonaga, Takeshi; Umezawa, Akihiro; Kameoka, Yosuke; Akagi, Ken-ichi

    2015-01-01

    Comprehensive analysis of alterations in gene expression along with neoplastic transformation in human cells provides valuable information about the molecular mechanisms underlying transformation. To further address these questions, we performed whole transcriptome analysis to the human mesenchymal stem cell line, UE6E7T-3, which was immortalized with hTERT and human papillomavirus type 16 E6/E7 genes, in association with progress of transformation in these cells. At early stages of culture, UE6E7T-3 cells preferentially lost one copy of chromosome 13, as previously described; in addition, tumor suppressor genes, DNA repair genes, and apoptosis-activating genes were overexpressed. After the loss of chromosome 13, additional aneuploidy and genetic alterations that drove progressive transformation, were observed. At this stage, the cell line expressed oncogenes as well as genes related to anti-apoptotic functions, cell-cycle progression, and chromosome instability (CIN); these pro-tumorigenic changes were concomitant with a decrease in tumor suppressor gene expression. At later stages after prolong culture, the cells exhibited chromosome translocations, acquired anchorage-independent growth and tumorigenicity in nude mice, (sarcoma) and exhibited increased expression of genes encoding growth factor and DNA repair genes, and decreased expression of adhesion genes. In particular, glypican-5 (GPC5), which encodes a cell-surface proteoglycan that might be a biomarker for sarcoma, was expressed at high levels in association with transformation. Patched (Ptc1), the cell surface receptor for hedgehog (Hh) signaling, was also significantly overexpressed and co-localized with GPC5. Knockdown of GPC5 expression decreased cell proliferation, suggesting that it plays a key role in growth in U3-DT cells (transformants derived from UE6E7T-3 cells) through the Hh signaling pathway. Thus, the UE6E7T-3 cell culture model is a useful tool for assessing the functional contribution of

  18. Runx transcription factors repress human and murine c-Myc expression in a DNA-binding and C-terminally dependent manner.

    PubMed

    Jacobs, Paejonette T; Cao, Li; Samon, Jeremy B; Kane, Christyne A; Hedblom, Emmett E; Bowcock, Anne; Telfer, Janice C

    2013-01-01

    The transcription factors Runx1 and c-Myc have individually been shown to regulate important gene targets as well as to collaborate in oncogenesis. However, it is unknown whether there is a regulatory relationship between the two genes. In this study, we investigated the transcriptional regulation of endogenous c-Myc by Runx1 in the human T cell line Jurkat and murine primary hematopoietic cells. Endogenous Runx1 binds to multiple sites in the c-Myc locus upstream of the c-Myc transcriptional start site. Cells transduced with a C-terminally truncated Runx1 (Runx1.d190), which lacks important cofactor interaction sites and can block C-terminal-dependent functions of all Runx transcription factors, showed increased transcription of c-Myc. In order to monitor c-Myc expression in response to early and transiently-acting Runx1.d190, we generated a cell membrane-permeable TAT-Runx1.d190 fusion protein. Murine splenocytes treated with TAT-Runx1.d190 showed an increase in the transcription of c-Myc within 2 hours, peaking at 4 hours post-treatment and declining thereafter. This effect is dependent on the ability of Runx1.d190 to bind to DNA. The increase in c-Myc transcripts is correlated with increased c-Myc protein levels. Collectively, these data show that Runx1 directly regulates c-Myc transcription in a C-terminal- and DNA-binding-dependent manner. PMID:23874874

  19. Runx Transcription Factors Repress Human and Murine c-Myc Expression in a DNA-Binding and C-Terminally Dependent Manner

    PubMed Central

    Jacobs, Paejonette T.; Cao, Li; Samon, Jeremy B.; Kane, Christyne A.; Hedblom, Emmett E.; Bowcock, Anne; Telfer, Janice C.

    2013-01-01

    The transcription factors Runx1 and c-Myc have individually been shown to regulate important gene targets as well as to collaborate in oncogenesis. However, it is unknown whether there is a regulatory relationship between the two genes. In this study, we investigated the transcriptional regulation of endogenous c-Myc by Runx1 in the human T cell line Jurkat and murine primary hematopoietic cells. Endogenous Runx1 binds to multiple sites in the c-Myc locus upstream of the c-Myc transcriptional start site. Cells transduced with a C-terminally truncated Runx1 (Runx1.d190), which lacks important cofactor interaction sites and can block C-terminal-dependent functions of all Runx transcription factors, showed increased transcription of c-Myc. In order to monitor c-Myc expression in response to early and transiently-acting Runx1.d190, we generated a cell membrane-permeable TAT-Runx1.d190 fusion protein. Murine splenocytes treated with TAT-Runx1.d190 showed an increase in the transcription of c-Myc within 2 hours, peaking at 4 hours post-treatment and declining thereafter. This effect is dependent on the ability of Runx1.d190 to bind to DNA. The increase in c-Myc transcripts is correlated with increased c-Myc protein levels. Collectively, these data show that Runx1 directly regulates c-Myc transcription in a C-terminal- and DNA-binding-dependent manner. PMID:23874874

  20. TGF-β stimulation in human and murine cells reveals commonly affected biological processes and pathways at transcription level

    PubMed Central

    2014-01-01

    Background The TGF-β signaling pathway is a fundamental pathway in the living cell, which plays a key role in many central cellular processes. The complex and sometimes contradicting mechanisms by which TGF-β yields phenotypic effects are not yet completely understood. In this study we investigated and compared the transcriptional response profile of TGF-β1 stimulation in different cell types. For this purpose, extensive experiments are performed and time-course microarray data are generated in human and mouse parenchymal liver cells, human mesenchymal stromal cells and mouse hematopoietic progenitor cells at different time points. We applied a panel of bioinformatics methods on our data to uncover common patterns in the dynamic gene expression response in respective cells. Results Our analysis revealed a quite variable and multifaceted transcriptional response profile of TGF-β1 stimulation, which goes far beyond the well-characterized classical TGF-β1 signaling pathway. Nonetheless, we could identify several commonly affected processes and signaling pathways across cell types and species. In addition our analysis suggested an important role of the transcription factor EGR1, which appeared to have a conserved influence across cell-types and species. Validation via an independent dataset on A549 lung adenocarcinoma cells largely confirmed our findings. Network analysis suggested explanations, how TGF-β1 stimulation could lead to the observed effects. Conclusions The analysis of dynamical transcriptional response to TGF-β treatment experiments in different human and murine cell systems revealed commonly affected biological processes and pathways, which could be linked to TGF-β1 via network analysis. This helps to gain insights about TGF-β pathway activities in these cell systems and its conserved interactions between the species and tissue types. PMID:24886091

  1. Identifying and retargeting transcriptional hot spots in the human genome.

    PubMed

    Cheng, Joseph K; Lewis, Amanda M; Kim, Do Soon; Dyess, Timothy; Alper, Hal S

    2016-08-01

    Mammalian cell line development requires streamlined methodologies that will reduce both the cost and time to identify candidate cell lines. Improvements in site-specific genomic editing techniques can result in flexible, predictable, and robust cell line engineering. However, an outstanding question in the field is the specific site of integration. Here, we seek to identify productive loci within the human genome that will result in stable, high expression of heterologous DNA. Using an unbiased, random integration approach and a green fluorescent reporter construct, we identify ten single-integrant, recombinant human cell lines that exhibit stable, high-level expression. From these cell lines, eight unique corresponding integration loci were identified. These loci are concentrated in non-protein coding regions or intronic regions of protein coding genes. Expression mapping of the surrounding genes reveals minimal disruption of endogenous gene expression. Finally, we demonstrate that targeted de novo integration at one of the identified loci, the 12(th) exon-intron region of the GRIK1 gene on chromosome 21, results in superior expression and stability compared to the standard, illegitimate integration approach at levels approaching 4-fold. The information identified here along with recent advances in site-specific genomic editing techniques can lead to expedited cell line development. PMID:27311394

  2. Specific requirement for ATP at an early step of in vitro transcription of human mitochondrial DNA

    SciTech Connect

    Narasimhan, N.; Attardi, G.

    1987-06-01

    The ATP concentrations allowing transcription of heavy- and light-strand of human mtDNA in a HeLa cell mitochrondrial lysate were found to cover a broad range, with a maximum around 2.5 mM, and with reproducible differences in the ATP response curves for the two transcription events. Direct measurements showed that nonspecific ATP degradation during the assay did not account for the high ATP requirement. 5'-Adenylyl imidodiphosphate (p(NH)ppA), an ATP analog with a nonhydrolyzable ..beta..-..gamma.. bond, was unable to substitute for ATP in supporting mtDNA transcription but greatly stimulated this transcription in the presence of a low concentration of exogenous APT, measured with (/sup 32/P)-labeled nucleotides. Evidence was obtained indicating that p(NH)ppA did not support an early event in mtDNA transcription (formation of preinitiation complex or initiation), whereas this analog could substitute effectively for ATP in the subsequent elongation steps. These results pointed to a specific requirement for ATP at an early step of the transcription process.

  3. Oncogene transcription in normal human IMR-90 fibroblasts: induction by serum and tetradecanoyl phorbol acetate

    SciTech Connect

    Bower, E.A.; Kaji, H.

    1988-01-01

    The authors report studies of oncogene transcription induced by the addition of serum to quiescent cultures of human IMR-90 fibroblasts. Oncogene messenger RNAs for c-myc, c-erbB and c-ras were increased in a specific temporal sequence after the addition of serum. Compounds that are proposed to exert their actions by the stimulation of cell growth were tested for their effect on oncogene transcription in IMR-90 fibroblasts. The tumor promoter tetradecanoyl phorbol acetate (TPA) was found to selectively induce the transcription of c-myc without observable effect on the transcription of the other oncogenes studied, and without inducing cell division. The inactive analog, phorbol didecanoate (PDD), and two complete carcinogens dimethylbenzanthracene (DMBA) and 4-nitro quinoline-1-oxide (4NQO) were without effect on the transcription of the genes studied. These results suggest that the complete ordered sequence of gene transcription is necessary to achieve the physiologic response of cell division, and that classical promoters and complete carcinogens achieve their effects through different pathways.

  4. A novel intermediate in transcription initiation by human mitochondrial RNA polymerase

    PubMed Central

    Morozov, Yaroslav I.; Agaronyan, Karen; Cheung, Alan C. M.; Anikin, Michael; Cramer, Patrick; Temiakov, Dmitry

    2014-01-01

    The mitochondrial genome is transcribed by a single-subunit T7 phage-like RNA polymerase (mtRNAP), structurally unrelated to cellular RNAPs. In higher eukaryotes, mtRNAP requires two transcription factors for efficient initiation—TFAM, a major nucleoid protein, and TFB2M, a transient component of mtRNAP catalytic site. The mechanisms behind assembly of the mitochondrial transcription machinery and its regulation are poorly understood. We isolated and identified a previously unknown human mitochondrial transcription intermediate—a pre-initiation complex that includes mtRNAP, TFAM and promoter DNA. Using protein–protein cross-linking, we demonstrate that human TFAM binds to the N-terminal domain of mtRNAP, which results in bending of the promoter DNA around mtRNAP. The subsequent recruitment of TFB2M induces promoter melting and formation of an open initiation complex. Our data indicate that the pre-initiation complex is likely to be an important target for transcription regulation and provide basis for further structural, biochemical and biophysical studies of mitochondrial transcription. PMID:24393772

  5. Insight into GATA1 transcriptional activity through interrogation of cis elements disrupted in human erythroid disorders

    PubMed Central

    Wakabayashi, Aoi; Ulirsch, Jacob C.; Ludwig, Leif S.; Fiorini, Claudia; Yasuda, Makiko; Choudhuri, Avik; McDonel, Patrick; Zon, Leonard I.; Sankaran, Vijay G.

    2016-01-01

    Whole-exome sequencing has been incredibly successful in identifying causal genetic variants and has revealed a number of novel genes associated with blood and other diseases. One limitation of this approach is that it overlooks mutations in noncoding regulatory elements. Furthermore, the mechanisms by which mutations in transcriptional cis-regulatory elements result in disease remain poorly understood. Here we used CRISPR/Cas9 genome editing to interrogate three such elements harboring mutations in human erythroid disorders, which in all cases are predicted to disrupt a canonical binding motif for the hematopoietic transcription factor GATA1. Deletions of as few as two to four nucleotides resulted in a substantial decrease (>80%) in target gene expression. Isolated deletions of the canonical GATA1 binding motif completely abrogated binding of the cofactor TAL1, which binds to a separate motif. Having verified the functionality of these three GATA1 motifs, we demonstrate strong evolutionary conservation of GATA1 motifs in regulatory elements proximal to other genes implicated in erythroid disorders, and show that targeted disruption of such elements results in altered gene expression. By modeling transcription factor binding patterns, we show that multiple transcription factors are associated with erythroid gene expression, and have created predictive maps modeling putative disruptions of their binding sites at key regulatory elements. Our study provides insight into GATA1 transcriptional activity and may prove a useful resource for investigating the pathogenicity of noncoding variants in human erythroid disorders. PMID:27044088

  6. Selective suppression of human papillomavirus transcription in non-tumorigenic cells by 5-azacytidine.

    PubMed Central

    Rösl, F; Dürst, M; zur Hausen, H

    1988-01-01

    The transcription of human papillomavirus type 18 (HPV 18) is selectively suppressed in non-tumorigenic HeLa x fibroblast or HeLa x keratinocyte cell hybrids by 5-azacytidine. In contrast, viral gene expression is not influenced by 5-azacytidine in both tumorigenic hybrid segregants and in the parental HeLa cells. The suppression mechanism seems to operate at the level of initiation of transcription since nuclear run-on experiments show the absence of elongated nascent viral RNA, whereas the transcription of cellular reference genes remains unaffected. Down-regulation of HPV 18 mRNA correlates directly with cessation of cellular growth and can be abolished using the protein synthesis inhibitor cycloheximide. Furthermore human keratinocytes immortalized by HPV 16 but still retaining the non-tumorigenic phenotype reveal the same inhibitory effect on viral transcription after treatment with 5-azacytidine. These results support a model of a postulated intracellular control mechanism, directed against papillomavirus transcription, which can be induced by 5-azacytidine and appears to correlate with the presence of specific chromosomes in non-tumorigenic cells. Images PMID:2457495

  7. Transcriptional regulation of human RANK ligand gene expression by E2F1

    SciTech Connect

    Hu Yan; Sun Meng; Nadiminty, Nagalakshmi; Lou Wei; Pinder, Elaine; Gao, Allen C.

    2008-06-06

    Receptor activator of nuclear factor kappa B ligand (RANKL) is a critical osteoclastogenic factor involved in the regulation of bone resorption, immune function, the development of mammary gland and cardiovascular system. To understand the transcriptional regulation of RANKL, we amplified and characterized a 1890 bp 5'-flanking sequence of human RANKL gene (-1782 bp to +108 bp relative to the transcription start site). Using a series of deletion mutations of the 1890 bp RANKL promoter, we identified a 72 bp region (-172 to -100 bp) mediating RANKL basal transcriptional activity. Sequence analysis revealed a putative E2F binding site within this 72 bp region in the human RANKL promoter. Overexpression of E2F1 increased RANKL promoter activity, while down-regulation of E2F1 expression by small interfering RNA decreased RANKL promoter activity. RT-PCR and enzyme linked immunosorbent assays (ELISA) further demonstrated that E2F1 induced the expression of RANKL. Electrophoretic gel mobility shift assays (EMSA) and antibody competition assays confirmed that E2F1 proteins bind to the consensus E2F binding site in the RANKL promoter. Mutation of the E2F consensus binding site in the RANKL promoter profoundly reduced the basal promoter activity and abolished the transcriptional modulation of RANKL by E2F1. These results suggest that E2F1 plays an important role in regulating RANKL transcription through binding to the E2F consensus binding site.

  8. Transcript catalogs of human chromosome 21 and orthologous chimpanzee and mouse regions.

    PubMed

    Sturgeon, Xiaolu; Gardiner, Katheleen J

    2011-06-01

    A comprehensive representation of the gene content of the long arm of human chromosome 21 (Hsa21q) remains of interest for the study of Down syndrome, its associated phenotypic features, and mouse models. Here we compare transcript catalogs for Hsa21q, chimpanzee chromosome 21 (Ptr21q), and orthologous regions of mouse chromosomes 16, 17, and 10 for open reading frame (ORF) characteristics and conservation. The Hsa21q and mouse catalogs contain 552 and 444 gene models, respectively, of which only 162 are highly conserved. Hsa21q transcripts were used to identify orthologous exons in Ptr21q and assemble 533 putative transcripts. Transcript catalogs for all three organisms are searchable for nucleotide and amino acid sequence features of ORF length, repeat content, experimental support, gene structure, and conservation. For human and mouse comparisons, three additional summaries are provided: (1) the chromosomal distribution of novel ORF transcripts versus potential functional RNAs, (2) the distribution of species-specific transcripts within Hsa21q and mouse models of Down syndrome, and (3) the organization of sense-antisense and putative sense-antisense structures defining potential regulatory mechanisms. Catalogs, summaries, and nucleotide and amino acid sequences of all composite transcripts are available and searchable at http://gfuncpathdb.ucdenver.edu/iddrc/chr21/home.php. These data sets provide comprehensive information useful for evaluation of candidate genes and mouse models of Down syndrome and for identification of potential functional RNA genes and novel regulatory mechanisms involving Hsa21q genes. These catalogs and search tools complement and extend information available from other gene annotation projects. PMID:21400203

  9. A human mitochondrial poly(A) polymerase mutation reveals the complexities of post-transcriptional mitochondrial gene expression.

    PubMed

    Wilson, William C; Hornig-Do, Hue-Tran; Bruni, Francesco; Chang, Jeong Ho; Jourdain, Alexis A; Martinou, Jean-Claude; Falkenberg, Maria; Spåhr, Henrik; Larsson, Nils-Göran; Lewis, Richard J; Hewitt, Lorraine; Baslé, Arnaud; Cross, Harold E; Tong, Liang; Lebel, Robert R; Crosby, Andrew H; Chrzanowska-Lightowlers, Zofia M A; Lightowlers, Robert N

    2014-12-01

    The p.N478D missense mutation in human mitochondrial poly(A) polymerase (mtPAP) has previously been implicated in a form of spastic ataxia with optic atrophy. In this study, we have investigated fibroblast cell lines established from family members. The homozygous mutation resulted in the loss of polyadenylation of all mitochondrial transcripts assessed; however, oligoadenylation was retained. Interestingly, this had differential effects on transcript stability that were dependent on the particular species of transcript. These changes were accompanied by a severe loss of oxidative phosphorylation complexes I and IV, and perturbation of de novo mitochondrial protein synthesis. Decreases in transcript polyadenylation and in respiratory chain complexes were effectively rescued by overexpression of wild-type mtPAP. Both mutated and wild-type mtPAP localized to the mitochondrial RNA-processing granules thereby eliminating mislocalization as a cause of defective polyadenylation. In vitro polyadenylation assays revealed severely compromised activity by the mutated protein, which generated only short oligo(A) extensions on RNA substrates, irrespective of RNA secondary structure. The addition of LRPPRC/SLIRP, a mitochondrial RNA-binding complex, enhanced activity of the wild-type mtPAP resulting in increased overall tail length. The LRPPRC/SLIRP effect although present was less marked with mutated mtPAP, independent of RNA secondary structure. We conclude that (i) the polymerase activity of mtPAP can be modulated by the presence of LRPPRC/SLIRP, (ii) N478D mtPAP mutation decreases polymerase activity and (iii) the alteration in poly(A) length is sufficient to cause dysregulation of post-transcriptional expression and the pathogenic lack of respiratory chain complexes. PMID:25008111

  10. Stress-impaired transcription factor expression and insulin secretion in transplanted human islets

    PubMed Central

    Dai, Chunhua; Kayton, Nora S.; Shostak, Alena; Poffenberger, Greg; Cyphert, Holly A.; Aramandla, Radhika; Thompson, Courtney; Papagiannis, Ioannis G.; Shiota, Masakazu; Stafford, John M.; Greiner, Dale L.; Herrera, Pedro L.; Shultz, Leonard D.; Stein, Roland; Powers, Alvin C.

    2016-01-01

    Type 2 diabetes is characterized by insulin resistance, hyperglycemia, and progressive β cell dysfunction. Excess glucose and lipid impair β cell function in islet cell lines, cultured rodent and human islets, and in vivo rodent models. Here, we examined the mechanistic consequences of glucotoxic and lipotoxic conditions on human islets in vivo and developed and/or used 3 complementary models that allowed comparison of the effects of hyperglycemic and/or insulin-resistant metabolic stress conditions on human and mouse islets, which responded quite differently to these challenges. Hyperglycemia and/or insulin resistance impaired insulin secretion only from human islets in vivo. In human grafts, chronic insulin resistance decreased antioxidant enzyme expression and increased superoxide and amyloid formation. In human islet grafts, expression of transcription factors NKX6.1 and MAFB was decreased by chronic insulin resistance, but only MAFB decreased under chronic hyperglycemia. Knockdown of NKX6.1 or MAFB expression in a human β cell line recapitulated the insulin secretion defect seen in vivo. Contrary to rodent islet studies, neither insulin resistance nor hyperglycemia led to human β cell proliferation or apoptosis. These results demonstrate profound differences in how excess glucose or lipid influence mouse and human insulin secretion and β cell activity and show that reduced expression of key islet-enriched transcription factors is an important mediator of glucotoxicity and lipotoxicity. PMID:27064285

  11. Transcription in vivo of an Alu family member upstream from the human epsilon-globin gene.

    PubMed Central

    Allan, M; Paul, J

    1984-01-01

    The more distal Alu repeat flanking the epsilon-globin gene is transcribed in K562 cells to generate transcripts 350-400 nucleotides in length. Initiation occurs at the start of the repeat, upstream of a putative PolIII control signal. These transcripts originate from the strand which does not code epsilon-globin and are oriented in the opposite direction from the gene. They are non-polyadenylated, nucleus-confined and are only detectable in association with expression of the epsilon-globin gene. Images PMID:6320117

  12. Transcriptional regulation of the human TR2 orphan receptor gene by nuclear factor 1-A

    SciTech Connect

    Lin, Y.-L.; Wang, Y.-H.; Lee, H.-J. . E-mail: hjlee@mail.ndhu.edu.tw

    2006-11-17

    The human testicular receptor 2 (TR2), a member of the nuclear hormone receptor superfamily, has no identified ligand yet. Previous evidence demonstrated that a 63 bp DNA fragment, named the promoter activating cis-element (PACE), has been identified as a positive regulatory region in the 5' promoter region of the human TR2 gene. In the present report, the human nuclear factor 1-A (NF1-A) was identified as a transcriptional activator to recognize the center of the PACE, called the PACE-C. NF1-A could bind to the 18 bp PACE-C region, and enhance about 13- to 17-fold of the luciferase reporter gene activity via the PACE-C in dose-dependent and orientation-independent manners. This transcriptional activation was further confirmed by real-time RT-PCR assay. In conclusion, our results indicated that NF1-A transcription factor plays an important role in the transcriptional activation of the TR2 gene expression via the PACE-C in the minimal promoter region.

  13. Targeting the Central Pocket in Human Transcription Factor TEAD as a Potential Cancer Therapeutic Strategy.

    PubMed

    Pobbati, Ajaybabu V; Han, Xiao; Hung, Alvin W; Weiguang, Seetoh; Huda, Nur; Chen, Guo-Ying; Kang, CongBao; Chia, Cheng San Brian; Luo, Xuelian; Hong, Wanjin; Poulsen, Anders

    2015-11-01

    The human TEAD family of transcription factors (TEAD1-4) is required for YAP-mediated transcription in the Hippo pathway. Hyperactivation of TEAD's co-activator YAP contributes to tissue overgrowth and human cancers, suggesting that pharmacological interference of TEAD-YAP activity may be an effective strategy for anticancer therapy. Here we report the discovery of a central pocket in the YAP-binding domain (YBD) of TEAD that is targetable by small-molecule inhibitors. Our X-ray crystallography studies reveal that flufenamic acid, a non-steroidal anti-inflammatory drug (NSAID), binds to the central pocket of TEAD2 YBD. Our biochemical and functional analyses further demonstrate that binding of NSAIDs to TEAD inhibits TEAD-YAP-dependent transcription, cell migration, and proliferation, indicating that the central pocket is important for TEAD function. Therefore, our studies discover a novel way of targeting TEAD transcription factors and set the stage for therapeutic development of specific TEAD-YAP inhibitors against human cancers. PMID:26592798

  14. Human Disease Modeling Reveals Integrated Transcriptional and Epigenetic Mechanisms of NOTCH1 Haploinsufficiency

    PubMed Central

    Theodoris, Christina V.; Li, Molong; White, Mark P.; Liu, Lei; He, Daniel; Pollard, Katherine S.; Bruneau, Benoit G.; Srivastava, Deepak

    2015-01-01

    SUMMARY The mechanisms by which transcription factor haploinsufficiency alters the epigenetic and transcriptional landscape in human cells to cause disease are unknown. Here, we utilized human induced pluripotent stem cell (iPSC)-derived endothelial cells (ECs) to show that heterozygous nonsense mutations in NOTCH1 that cause aortic valve calcification disrupt the epigenetic architecture resulting in derepression of latent pro-osteogenic and -inflammatory gene networks. Hemodynamic shear stress, which protects valves from calcification in vivo, activated anti-osteogenic and anti-inflammatory networks in NOTCH1+/+, but not NOTCH1+/−, iPSC-derived ECs. NOTCH1 haploinsufficiency altered H3K27ac at NOTCH1-bound enhancers, dysregulating downstream transcription of over 1000 genes involved in osteogenesis, inflammation, and oxidative stress. Computational predictions of the disrupted NOTCH1-dependent gene network revealed regulatory nodes that when modulated restored the network toward the wild-type state. Our results highlight how alterations in transcription factor dosage affect gene networks leading to human disease and reveal nodes for potential therapeutic intervention. PMID:25768904

  15. Large-scale identification of sequence variants impacting human transcription factor occupancy in vivo

    PubMed Central

    Maurano, Matthew T.; Haugen, Eric; Sandstrom, Richard; Vierstra, Jeff; Shafer, Anthony; Kaul, Rajinder; Stamatoyannopoulos, John A.

    2015-01-01

    The function of human regulatory regions depends exquisitely on their local genomic environment and cellular context, complicating experimental analysis of the expanding pool of common disease- and trait-associated variants that localize within regulatory DNA. We leverage allelically resolved genomic DNaseI footprinting data encompassing 166 individuals and 114 cell types to identify >60,000 common variants that directly impact transcription factor occupancy and regulatory DNA accessibility in vivo. The unprecedented scale of these data enable systematic analysis of the impact of sequence variation on transcription factor occupancy in vivo. We leverage this analysis to develop accurate models of variation affecting the recognition sites for diverse transcription factors, and apply these models to discriminate nearly 500,000 common regulatory variants likely to affect transcription factor occupancy across the human genome. The approach and results provide a novel foundation for analysis and interpretation of noncoding variation in complete human genomes, and for systems-level investigation of disease-associated variants. PMID:26502339

  16. Differentially methylated CpG island within human XIST mediates alternative P2 transcription and YY1 binding

    PubMed Central

    2014-01-01

    Background X-chromosome inactivation silences one X chromosome in females to achieve dosage compensation with the single X chromosome in males. While most genes are silenced on the inactive X chromosome, the gene for the long non-coding RNA XIST is silenced on the active X chromosome and expressed from the inactive X chromosome with which the XIST RNA associates, triggering silencing of the chromosome. In mouse, an alternative Xist promoter, P2 is also the site of YY1 binding, which has been shown to serve as a tether between the Xist RNA and the DNA of the chromosome. In humans there are many differences from the initial events of mouse Xist activation, including absence of a functional antisense regulator Tsix, and absence of strictly paternal inactivation in extraembryonic tissues, prompting us to examine regulatory regions for the human XIST gene. Results We demonstrate that the female-specific DNase hypersensitivity site within XIST is specific to the inactive X chromosome and correlates with transcription from an internal P2 promoter. P2 is located within a CpG island that is differentially methylated between males and females and overlaps conserved YY1 binding sites that are only bound on the inactive X chromosome where the sites are unmethylated. However, YY1 binding is insufficient to drive P2 expression or establish the DHS, which may require a development-specific factor. Furthermore, reduction of YY1 reduces XIST transcription in addition to causing delocalization of XIST. Conclusions The differentially methylated DNase hypersensitive site within XIST marks the location of an alternative promoter, P2, that generates a transcript of unknown function as it lacks the A repeats that are critical for silencing. In addition, this region binds YY1 on the unmethylated inactive X chromosome, and depletion of YY1 untethers the XIST RNA as well as decreasing transcription of XIST. PMID:25200388

  17. Toward a Functional Annotation of the Human Genome Using Artificial Transcription Factors

    PubMed Central

    Lee, Dong-ki; Park, Jin Woo; Kim, Youn-Jae; Kim, Jiwon; Lee, Yangsoon; Kim, Jeonglim; Kim, Jin-Soo

    2003-01-01

    We have developed a novel, high-throughput approach to collecting randomly perturbed gene-expression profiles from the human genome.A human 293 cell library that stably expresses randomly chosen zinc-finger transcription factors was constructed, and the expression profile of each cell line was obtained using cDNA microarray technology.Gene expression profiles from a total of 132 cell lines were collected and analyzed by (1) a simple clustering method based on expression-profile similarity, and (2) the shortest-path analysis method.These analyses identified a number of gene groups, and further investigation revealed that the genes that were grouped together had close biological relationships.The artificial transcription factor-based random genome perturbation method thus provides a novel functional genomic tool for annotation and classification of genes in the human genome and those of many other organisms. PMID:14656973

  18. Generation and gene expression profiling of 48 transcription-factor-inducible mouse embryonic stem cell lines

    PubMed Central

    Yamamizu, Kohei; Sharov, Alexei A.; Piao, Yulan; Amano, Misa; Yu, Hong; Nishiyama, Akira; Dudekula, Dawood B.; Schlessinger, David; Ko, Minoru S. H.

    2016-01-01

    Mouse embryonic stem cells (ESCs) can differentiate into a wide range – and possibly all cell types in vitro, and thus provide an ideal platform to study systematically the action of transcription factors (TFs) in cell differentiation. Previously, we have generated and analyzed 137 TF-inducible mouse ESC lines. As an extension of this “NIA Mouse ESC Bank,” we generated and characterized 48 additional mouse ESC lines, in which single TFs in each line could be induced in a doxycycline-controllable manner. Together, with the previous ESC lines, the bank now comprises 185 TF-manipulable ESC lines (>10% of all mouse TFs). Global gene expression (transcriptome) profiling revealed that the induction of individual TFs in mouse ESCs for 48 hours shifts their transcriptomes toward specific differentiation fates (e.g., neural lineages by Myt1 Isl1, and St18; mesodermal lineages by Pitx1, Pitx2, Barhl2, and Lmx1a; white blood cells by Myb, Etv2, and Tbx6, and ovary by Pitx1, Pitx2, and Dmrtc2). These data also provide and lists of inferred target genes of each TF and possible functions of these TFs. The results demonstrate the utility of mouse ESC lines and their transcriptome data for understanding the mechanism of cell differentiation and the function of TFs. PMID:27150017

  19. Fenton Reaction-Generated Advanced Oxidation Protein Products Induces Inflammation in Human Embryonic Kidney Cells.

    PubMed

    Bochi, Guilherme Vargas; Torbitz, Vanessa Dorneles; Santos, Roberto Christ Vianna; Cubillos-Rojas, Monica; López, José Luis Rosa; Siebel, Anna Maria; Gomes, Patrícia; de Oliveira, Jarbas Rodrigues; Moresco, Rafael Noal

    2016-08-01

    Fenton reaction is a new mechanism able to generate advanced oxidation protein products (AOPPs) by exposing the human serum albumin to the Fenton system. Here, we characterized the effects of Fenton reaction-generated advanced oxidation protein products (AOPP-FR) on the gene transcription of the nuclear factor-κB (NF-κB), cyclooxygenase-2 (COX-2), and interleukin-6 (IL-6) in human embryonic kidney cells (HEK 293). To investigate the effects of AOPP-FR and AOPP-HOCl on transcription of inflammatory genes, the NF-κB, COX-2, and IL-6 luciferase promoter activities were analyzed. AOPP-FR and AOPP-HOCl were able to induce the activation of the gene transcription of NF-κB, COX-2, and IL-6 in HEK 293 cells. However, the effects of AOPP-FR were significantly higher than the effects of AOPP-HOCl in relation to COX-2 and IL-6. AOPP-FR induces the activation of the gene transcription of NF-κB, COX-2, and IL-6 and may represent a novel pathogenic mediator of inflammation in kidney. PMID:27145783

  20. Regulation of endogenous human gene expression by ligand-inducible TALE transcription factors.

    PubMed

    Mercer, Andrew C; Gaj, Thomas; Sirk, Shannon J; Lamb, Brian M; Barbas, Carlos F

    2014-10-17

    The construction of increasingly sophisticated synthetic biological circuits is dependent on the development of extensible tools capable of providing specific control of gene expression in eukaryotic cells. Here, we describe a new class of synthetic transcription factors that activate gene expression in response to extracellular chemical stimuli. These inducible activators consist of customizable transcription activator-like effector (TALE) proteins combined with steroid hormone receptor ligand-binding domains. We demonstrate that these ligand-responsive TALE transcription factors allow for tunable and conditional control of gene activation and can be used to regulate the expression of endogenous genes in human cells. Since TALEs can be designed to recognize any contiguous DNA sequence, the conditional gene regulatory system described herein will enable the design of advanced synthetic gene networks. PMID:24251925

  1. Human mitochondrial transcription factor A (mtTFA): gene structure and characterization of related pseudogenes.

    PubMed

    Reyes, Aurelio; Mezzina, Maria; Gadaleta, Gemma

    2002-05-29

    Mitochondrial transcription factor A (mtTFA or Tfam) is a 25 kDa protein encoded by a nuclear gene and imported to mitochondria, where it functions as a key regulator of mammalian mitochondrial (mt) DNA transcription and replication. The coding sequence of the human mtTFA gene is reported in the literature and the sizes of few introns are known. In this paper we present the genomic structure of the human mtTFA gene along with the complete sequence of its six intronic regions. Three of the introns (I, III, VI) have been found to be less than 600 bp, while the other three were greater than 1.8 kb. In the course of this work, we discovered that, in addition to the active copy, different homologous sequences identified as processed pseudogenes psi h-mtTFA have been isolated and sequenced. Using an 'in silico' mapping approach we determined their locations on chromosomes 7, 11 and X. psi h-mtTFA locations are different from that of the gene, previously reported on chromosome 10. Transcription analysis by means of reverse transcriptase-polymerase chain reaction has shown that other than the RNA corresponding to the full-length transcript, an isoform lacking 96 bp is also present. Among the three sequenced pseudogenes only one of them located on chromosome 11 has been found to be transcribed in Jurkat cells under these culture conditions, even though transcription initiation and binding sites for different transcription factors have also been found upstream from the other two pseudogenes. PMID:12095695

  2. Human transcriptional interactome of chromatin contribute to gene co-expression

    PubMed Central

    2010-01-01

    Background Transcriptional interactome of chromatin is one of the important mechanisms in gene transcription regulation. By chromatin conformation capture and 3D FISH experiments, several chromatin interactions cases among sequence-distant genes or even inter-chromatin genes were reported. However, on genomics level, there is still little evidence to support these mechanisms. Recently based on Hi-C experiment, a genome-wide picture of chromatin interactions in human cells was presented. It provides a useful material for analysing whether the mechanism of transcriptional interactome is common. Results The main work here is to demonstrate whether the effects of transcriptional interactome on gene co-expression exist on genomic level. While controlling the effects of transcription factors control similarities (TCS), we tested the correlation between Hi-C interaction and the mutual ranks of gene co-expression rates (provided by COXPRESdb) of intra-chromatin gene pairs. We used 6,084 genes with both TF annotation and co-expression information, and matched them into 273,458 pairs with similar Hi-C interaction ranks in different cell types. The results illustrate that co-expression is strongly associated with chromatin interaction. Further analysis using GO annotation reveals potential correlation between gene function similarity, Hi-C interaction and their co-expression. Conclusions According to the results in this research, the intra-chromatin interactome may have relation to gene function and associate with co-expression. This study provides evidence for illustrating the effect of transcriptional interactome on transcription regulation. PMID:21156067

  3. Determinants of Plasma Apolipoprotein A-V and APOA5 Gene Transcripts in Humans

    PubMed Central

    Hahne, P.; Krempler, F.; Schaap, F.G.; Soyal, S.M.; Höffinger, H.; Miller, K.; Oberkofler, H.; Strobl, W.; Patsch, W.

    2012-01-01

    Objective Apolipoprotein A-V (apoAV) contributes to the regulation of triglyceride metabolism, which plays a role in the pathogenesis of atherosclerotic diseases. We therefore ascertained determinants of hepatic APOA5 transcript and apoAV plasma levels in humans. Design We determined influences of anthropometric variables, biochemical factors related to lipid and glucose metabolism, hepatic mRNA levels transcribed from the APOA1/C3/A4/A5 cluster and transcription factor genes implicated in the regulation of APOA5 as well as common SNPs at the APOA5 locus on APOA5 expression in 89 obese patients and 22 non-obese controls. Results Mean, age and sex adjusted, hepatic APOA5 mRNA or apoAV plasma levels did not differ by obesity status, HOMA-IR or inflammatory markers. In multivariate regression models, the c56C>G SNP, plasma apoCIII, plasma non-esterified fatty acids, hepatic APOA5 transcripts, sex and a weak association with obesity status explained 61% of the variance in apoAV plasma levels. Hepatic transcript levels of CPT1A1 and PPARA, plasma non-esterified fatty acids and the c56C>G SNP explained 48% of the variance in hepatic APOA5 transcript levels. Conclusion ApoAV plasma levels are independently associated with plasma free fatty acid and hepatic APOA5 mRNA levels. Associations of APOA5 transcripts with PPARA and CPT1A1 transcripts suggest that APOA5 expression is intimately linked to hepatic lipid metabolism. PMID:18537870

  4. Immunoglobulin analysis tool: a novel tool for the analysis of human and mouse heavy and light chain transcripts.

    PubMed

    Rogosch, Tobias; Kerzel, Sebastian; Hoi, Kam Hon; Zhang, Zhixin; Maier, Rolf F; Ippolito, Gregory C; Zemlin, Michael

    2012-01-01

    Sequence analysis of immunoglobulin (Ig) heavy and light chain transcripts can refine categorization of B cell subpopulations and can shed light on the selective forces that act during immune responses or immune dysregulation, such as autoimmunity, allergy, and B cell malignancy. High-throughput sequencing yields Ig transcript collections of unprecedented size. The authoritative web-based IMGT/HighV-QUEST program is capable of analyzing large collections of transcripts and provides annotated output files to describe many key properties of Ig transcripts. However, additional processing of these flat files is required to create figures, or to facilitate analysis of additional features and comparisons between sequence sets. We present an easy-to-use Microsoft(®) Excel(®) based software, named Immunoglobulin Analysis Tool (IgAT), for the summary, interrogation, and further processing of IMGT/HighV-QUEST output files. IgAT generates descriptive statistics and high-quality figures for collections of murine or human Ig heavy or light chain transcripts ranging from 1 to 150,000 sequences. In addition to traditionally studied properties of Ig transcripts - such as the usage of germline gene segments, or the length and composition of the CDR-3 region - IgAT also uses published algorithms to calculate the probability of antigen selection based on somatic mutational patterns, the average hydrophobicity of the antigen-binding sites, and predictable structural properties of the CDR-H3 loop according to Shirai's H3-rules. These refined analyses provide in-depth information about the selective forces acting upon Ig repertoires and allow the statistical and graphical comparison of two or more sequence sets. IgAT is easy to use on any computer running Excel(®) 2003 or higher. Thus, IgAT is a useful tool to gain insights into the selective forces and functional properties of small to extremely large collections of Ig transcripts, thereby assisting a researcher to mine a data set

  5. Functional Impact and Evolution of a Novel Human Polymorphic Inversion That Disrupts a Gene and Creates a Fusion Transcript

    PubMed Central

    Puig, Marta; Castellano, David; Pantano, Lorena; Giner-Delgado, Carla; Izquierdo, David; Gayà-Vidal, Magdalena; Lucas-Lledó, José Ignacio; Esko, Tõnu; Terao, Chikashi; Matsuda, Fumihiko; Cáceres, Mario

    2015-01-01

    Despite many years of study into inversions, very little is known about their functional consequences, especially in humans. A common hypothesis is that the selective value of inversions stems in part from their effects on nearby genes, although evidence of this in natural populations is almost nonexistent. Here we present a global analysis of a new 415-kb polymorphic inversion that is among the longest ones found in humans and is the first with clear position effects. This inversion is located in chromosome 19 and has been generated by non-homologous end joining between blocks of transposable elements with low identity. PCR genotyping in 541 individuals from eight different human populations allowed the detection of tag SNPs and inversion genotyping in multiple populations worldwide, showing that the inverted allele is mainly found in East Asia with an average frequency of 4.7%. Interestingly, one of the breakpoints disrupts the transcription factor gene ZNF257, causing a significant reduction in the total expression level of this gene in lymphoblastoid cell lines. RNA-Seq analysis of the effects of this expression change in standard homozygotes and inversion heterozygotes revealed distinct expression patterns that were validated by quantitative RT-PCR. Moreover, we have found a new fusion transcript that is generated exclusively from inverted chromosomes around one of the breakpoints. Finally, by the analysis of the associated nucleotide variation, we have estimated that the inversion was generated ~40,000–50,000 years ago and, while a neutral evolution cannot be ruled out, its current frequencies are more consistent with those expected for a deleterious variant, although no significant association with phenotypic traits has been found so far. PMID:26427027

  6. A Network of Paralogous Stress Response Transcription Factors in the Human Pathogen Candida glabrata

    PubMed Central

    Merhej, Jawad; Thiebaut, Antonin; Blugeon, Corinne; Pouch, Juliette; Ali Chaouche, Mohammed El Amine; Camadro, Jean-Michel; Le Crom, Stéphane; Lelandais, Gaëlle; Devaux, Frédéric

    2016-01-01

    The yeast Candida glabrata has become the second cause of systemic candidemia in humans. However, relatively few genome-wide studies have been conducted in this organism and our knowledge of its transcriptional regulatory network is quite limited. In the present work, we combined genome-wide chromatin immunoprecipitation (ChIP-seq), transcriptome analyses, and DNA binding motif predictions to describe the regulatory interactions of the seven Yap (Yeast AP1) transcription factors of C. glabrata. We described a transcriptional network containing 255 regulatory interactions and 309 potential target genes. We predicted with high confidence the preferred DNA binding sites for 5 of the 7 CgYaps and showed a strong conservation of the Yap DNA binding properties between S. cerevisiae and C. glabrata. We provided reliable functional annotation for 3 of the 7 Yaps and identified for Yap1 and Yap5 a core regulon which is conserved in S. cerevisiae, C. glabrata, and C. albicans. We uncovered new roles for CgYap7 in the regulation of iron-sulfur cluster biogenesis, for CgYap1 in the regulation of heme biosynthesis and for CgYap5 in the repression of GRX4 in response to iron starvation. These transcription factors define an interconnected transcriptional network at the cross-roads between redox homeostasis, oxygen consumption, and iron metabolism. PMID:27242683

  7. A Network of Paralogous Stress Response Transcription Factors in the Human Pathogen Candida glabrata.

    PubMed

    Merhej, Jawad; Thiebaut, Antonin; Blugeon, Corinne; Pouch, Juliette; Ali Chaouche, Mohammed El Amine; Camadro, Jean-Michel; Le Crom, Stéphane; Lelandais, Gaëlle; Devaux, Frédéric

    2016-01-01

    The yeast Candida glabrata has become the second cause of systemic candidemia in humans. However, relatively few genome-wide studies have been conducted in this organism and our knowledge of its transcriptional regulatory network is quite limited. In the present work, we combined genome-wide chromatin immunoprecipitation (ChIP-seq), transcriptome analyses, and DNA binding motif predictions to describe the regulatory interactions of the seven Yap (Yeast AP1) transcription factors of C. glabrata. We described a transcriptional network containing 255 regulatory interactions and 309 potential target genes. We predicted with high confidence the preferred DNA binding sites for 5 of the 7 CgYaps and showed a strong conservation of the Yap DNA binding properties between S. cerevisiae and C. glabrata. We provided reliable functional annotation for 3 of the 7 Yaps and identified for Yap1 and Yap5 a core regulon which is conserved in S. cerevisiae, C. glabrata, and C. albicans. We uncovered new roles for CgYap7 in the regulation of iron-sulfur cluster biogenesis, for CgYap1 in the regulation of heme biosynthesis and for CgYap5 in the repression of GRX4 in response to iron starvation. These transcription factors define an interconnected transcriptional network at the cross-roads between redox homeostasis, oxygen consumption, and iron metabolism. PMID:27242683

  8. Transcriptional interactions suggest niche segregation among microorganisms in the human gut.

    PubMed

    Plichta, Damian Rafal; Juncker, Agnieszka Sierakowska; Bertalan, Marcelo; Rettedal, Elizabeth; Gautier, Laurent; Varela, Encarna; Manichanh, Chaysavanh; Fouqueray, Charlène; Levenez, Florence; Nielsen, Trine; Doré, Joël; Machado, Ana Manuel Dantas; de Evgrafov, Mari Cristina Rodriguez; Hansen, Torben; Jørgensen, Torben; Bork, Peer; Guarner, Francisco; Pedersen, Oluf; Sommer, Morten O A; Ehrlich, S Dusko; Sicheritz-Pontén, Thomas; Brunak, Søren; Nielsen, H Bjørn

    2016-01-01

    The human gastrointestinal (GI) tract is the habitat for hundreds of microbial species, of which many cannot be cultivated readily, presumably because of the dependencies between species(1). Studies of microbial co-occurrence in the gut have indicated community substructures that may reflect functional and metabolic interactions between cohabiting species(2,3). To move beyond species co-occurrence networks, we systematically identified transcriptional interactions between pairs of coexisting gut microbes using metagenomics and microarray-based metatranscriptomics data from 233 stool samples from Europeans. In 102 significantly interacting species pairs, the transcriptional changes led to a reduced expression of orthologous functions between the coexisting species. Specific species-species transcriptional interactions were enriched for functions important for H2 and CO2 homeostasis, butyrate biosynthesis, ATP-binding cassette (ABC) transporters, flagella assembly and bacterial chemotaxis, as well as for the metabolism of carbohydrates, amino acids and cofactors. The analysis gives the first insight into the microbial community-wide transcriptional interactions, and suggests that the regulation of gene expression plays an important role in species adaptation to coexistence and that niche segregation takes place at the transcriptional level. PMID:27564131

  9. The Inflammatory Transcription Factors NFκB, STAT1 and STAT3 Drive Age-Associated Transcriptional Changes in the Human Kidney

    PubMed Central

    O’Brown, Zach K.; Van Nostrand, Eric L.; Higgins, John P.; Kim, Stuart K.

    2015-01-01

    Human kidney function declines with age, accompanied by stereotyped changes in gene expression and histopathology, but the mechanisms underlying these changes are largely unknown. To identify potential regulators of kidney aging, we compared age-associated transcriptional changes in the human kidney with genome-wide maps of transcription factor occupancy from ChIP-seq datasets in human cells. The strongest candidates were the inflammation-associated transcription factors NFκB, STAT1 and STAT3, the activities of which increase with age in epithelial compartments of the renal cortex. Stimulation of renal tubular epithelial cells with the inflammatory cytokines IL-6 (a STAT3 activator), IFNγ (a STAT1 activator), or TNFα (an NFκB activator) recapitulated age-associated gene expression changes. We show that common DNA variants in RELA and NFKB1, the two genes encoding subunits of the NFκB transcription factor, associate with kidney function and chronic kidney disease in gene association studies, providing the first evidence that genetic variation in NFκB contributes to renal aging phenotypes. Our results suggest that NFκB, STAT1 and STAT3 underlie transcriptional changes and chronic inflammation in the aging human kidney. PMID:26678048

  10. Limitations in the process of transcription and translation inhibit recombinant human chorionic gonadotropin expression in CHO cells.

    PubMed

    Liu, Yang; Yi, Xiaoping; Zhuang, Yingping; Zhang, Siliang

    2015-06-20

    Human chorionic gonadotropin (hCG) is a glycoprotein hormone that exists as a heterodimer with a α subunit and β subunit assembled together with disulfide bridges. This hormone plays an important role in the detection of ovulation induction and in the treatment of certain diseases that cause female infertility. The effects of transcription, subunit expression, assembling and secretion on recombinant hCG expression in CHO cells were studied using stable high-producing and low-producing cell lines generated by the FLP-In™ system. The results indicated that the mRNA and polypeptide levels of the β subunit were always higher than those of the α subunit. Further study confirmed that the differences were caused by the transcription rate rather than by mRNA stability. In the high-producing cell lines, there was obvious transcription level limitation of the α subunit in contrast to the β subunit. In addition, there was obvious limitation of the synthetic steps from mRNA to polypeptide for both the α subunit and the β subunit, especially the β subunit. Significant limitations of the assembly and secretion levels were not observed in this research. This study presents a research methodology for double subunit protein expression and provides valuable evidence for the enhancement of recombinant hCG productivity. PMID:25529346

  11. Sp1 and CREB regulate basal transcription of the human SNF2L gene

    SciTech Connect

    Xia Yu; Jiang Baichun; Zou Yongxin; Gao Guimin; Shang Linshan; Chen Bingxi; Liu Qiji; Gong Yaoqin

    2008-04-04

    Imitation Switch (ISWI) is a member of the SWI2/SNF2 superfamily of ATP-dependent chromatin remodelers, which are involved in multiple nuclear functions, including transcriptional regulation, replication, and chromatin assembly. Mammalian genomes encode two ISWI orthologs, SNF2H and SNF2L. In order to clarify the molecular mechanisms governing the expression of human SNF2L gene, we functionally examined the transcriptional regulation of human SNF2L promoter. Reporter gene assays demonstrated that the minimal SNF2L promoter was located between positions -152 to -86 relative to the transcription start site. In this region we have identified a cAMP-response element (CRE) located at -99 to -92 and a Sp1-binding site at -145 to -135 that play a critical role in regulating basal activity of human SNF2L gene, which were proven by deletion and mutation of specific binding sites, EMSA, and down-regulating Sp1 and CREB via RNAi. This study provides the first insight into the mechanisms that control basal expression of human SNF2L gene.

  12. Human Aldehyde Dehydrogenase Genes: Alternatively-Spliced Transcriptional Variants and Their Suggested Nomenclature

    PubMed Central

    Black, William J.; Stagos, Dimitrios; Marchitti, Satori A.; Nebert, Daniel W.; Tipton, Keith F.; Bairoch, Amos; Vasiliou, Vasilis

    2011-01-01

    OBJECTIVE The human aldehyde dehydrogenase (ALDH) gene superfamily consists of 19 genes encoding enzymes critical for NAD(P)+-dependent oxidation of endogenous and exogenous aldehydes, including drugs and environmental toxicants. Mutations in ALDH genes are the molecular basis of several disease states (e.g. Sjögren-Larsson syndrome, pyridoxine-dependent seizures, and type II hyperprolinemia) and may contribute to the etiology of complex diseases such as cancer and Alzheimer’s disease. The aim of this nomenclature update was to identify splice transcriptional variants principally for the human ALDH genes. METHODS Data-mining methods were used to retrieve all human ALDH sequences. Alternatively-spliced transcriptional variants were determined based upon: a) criteria for sequence integrity and genomic alignment; b) evidence of multiple independent cDNA sequences corresponding to a variant sequence; and c) if available, empirical evidence of variants from the literature. RESULTS AND CONCLUSION Alternatively-spliced transcriptional variants and their encoded proteins exist for most of the human ALDH genes; however, their function and significance remain to be established. When compared with the human genome, rat and mouse include an additional gene, Aldh1a7, in the ALDH1A subfamily. In order to avoid confusion when identifying splice variants in various genomes, nomenclature guidelines for the naming of such alternative transcriptional variants and proteins are recommended herein. In addition, a web database (www.aldh.org) has been developed to provide up-to-date information and nomenclature guidelines for the ALDH superfamily. PMID:19823103

  13. Insight into GATA1 transcriptional activity through interrogation of cis elements disrupted in human erythroid disorders.

    PubMed

    Wakabayashi, Aoi; Ulirsch, Jacob C; Ludwig, Leif S; Fiorini, Claudia; Yasuda, Makiko; Choudhuri, Avik; McDonel, Patrick; Zon, Leonard I; Sankaran, Vijay G

    2016-04-19

    Whole-exome sequencing has been incredibly successful in identifying causal genetic variants and has revealed a number of novel genes associated with blood and other diseases. One limitation of this approach is that it overlooks mutations in noncoding regulatory elements. Furthermore, the mechanisms by which mutations in transcriptionalcis-regulatory elements result in disease remain poorly understood. Here we used CRISPR/Cas9 genome editing to interrogate three such elements harboring mutations in human erythroid disorders, which in all cases are predicted to disrupt a canonical binding motif for the hematopoietic transcription factor GATA1. Deletions of as few as two to four nucleotides resulted in a substantial decrease (>80%) in target gene expression. Isolated deletions of the canonical GATA1 binding motif completely abrogated binding of the cofactor TAL1, which binds to a separate motif. Having verified the functionality of these three GATA1 motifs, we demonstrate strong evolutionary conservation of GATA1 motifs in regulatory elements proximal to other genes implicated in erythroid disorders, and show that targeted disruption of such elements results in altered gene expression. By modeling transcription factor binding patterns, we show that multiple transcription factors are associated with erythroid gene expression, and have created predictive maps modeling putative disruptions of their binding sites at key regulatory elements. Our study provides insight into GATA1 transcriptional activity and may prove a useful resource for investigating the pathogenicity of noncoding variants in human erythroid disorders. PMID:27044088

  14. Transcriptional properties of human NANOG1 and NANOG2 in acute leukemic cells

    PubMed Central

    Eberle, Irina; Pless, Birgit; Braun, Miriam; Dingermann, Theo; Marschalek, Rolf

    2010-01-01

    Transcripts of NANOG and OCT4 have been recently identified in human t(4;11) leukemia and in a model system expressing both t(4;11) fusion proteins. Moreover, downstream target genes of NANOG/OCT4/SOX2 were shown to be transcriptionally activated. However, the NANOG1 gene belongs to a gene family, including a gene tandem duplication (named NANOG2 or NANOGP1) and several pseudogenes (NANOGP2-P11). Thus, it was unclear which of the NANOG family members were transcribed in t(4;11) leukemia cells. 5′-RACE experiments revealed novel 5′-exons of NANOG1 and NANOG2, which could give rise to the expression of two different NANOG1 and three different NANOG2 protein variants. Moreover, a novel PCR-based method was established that allows distinguishing between transcripts deriving from NANOG1, NANOG2 and all other NANOG pseudogenes (P2–P11). By applying this method, we were able to demonstrate that human hematopoietic stem cells and different leukemic cells transcribe NANOG2. Furthermore, we functionally tested NANOG1 and NANOG2 protein variants by recombinant expression in 293 cells. These studies revealed that NANOG1 and NANOG2 protein variants are functionally equivalent and activate a regulatory circuit that activates specific stem cell genes. Therefore, we pose the hypothesis that the transcriptional activation of NANOG2 represents a ‘gain-of-stem cell function’ in acute leukemia. PMID:20427424

  15. Evidence for Transcript Networks Composed of Chimeric RNAs in Human Cells

    PubMed Central

    Borel, Christelle; Mudge, Jonathan M.; Howald, Cédric; Foissac, Sylvain; Ucla, Catherine; Chrast, Jacqueline; Ribeca, Paolo; Martin, David; Murray, Ryan R.; Yang, Xinping; Ghamsari, Lila; Lin, Chenwei; Bell, Ian; Dumais, Erica; Drenkow, Jorg; Tress, Michael L.; Gelpí, Josep Lluís; Orozco, Modesto; Valencia, Alfonso; van Berkum, Nynke L.; Lajoie, Bryan R.; Vidal, Marc; Stamatoyannopoulos, John; Batut, Philippe; Dobin, Alex; Harrow, Jennifer; Hubbard, Tim; Dekker, Job; Frankish, Adam; Salehi-Ashtiani, Kourosh; Reymond, Alexandre; Antonarakis, Stylianos E.; Guigó, Roderic; Gingeras, Thomas R.

    2012-01-01

    The classic organization of a gene structure has followed the Jacob and Monod bacterial gene model proposed more than 50 years ago. Since then, empirical determinations of the complexity of the transcriptomes found in yeast to human has blurred the definition and physical boundaries of genes. Using multiple analysis approaches we have characterized individual gene boundaries mapping on human chromosomes 21 and 22. Analyses of the locations of the 5′ and 3′ transcriptional termini of 492 protein coding genes revealed that for 85% of these genes the boundaries extend beyond the current annotated termini, most often connecting with exons of transcripts from other well annotated genes. The biological and evolutionary importance of these chimeric transcripts is underscored by (1) the non-random interconnections of genes involved, (2) the greater phylogenetic depth of the genes involved in many chimeric interactions, (3) the coordination of the expression of connected genes and (4) the close in vivo and three dimensional proximity of the genomic regions being transcribed and contributing to parts of the chimeric RNAs. The non-random nature of the connection of the genes involved suggest that chimeric transcripts should not be studied in isolation, but together, as an RNA network. PMID:22238572

  16. Thalassaemia mutations within the 5'UTR of the human beta-globin gene disrupt transcription.

    PubMed

    Sgourou, Argyro; Routledge, Samantha; Antoniou, Michael; Papachatzopoulou, Adamantia; Psiouri, Lambrini; Athanassiadou, Aglaia

    2004-03-01

    The mechanisms by which mutations within the 5' untranslated region (UTR) of the human beta-globin gene (HBB) cause thalassaemia are currently not well understood. We present here the first comprehensive comparative functional analysis of four 'silent' mutations in the human beta-globin 5'UTR, namely: +10(-T), +22(G --> A), +33(C --> G) and +(40-43)(-AAAC), which are present in patients with beta-thalassaemia intermedia. Expression of these genes under the control of the beta-globin locus control region in stable transfected murine erythroleukaemia cells showed that all four mutations decreased steady state levels of mRNA to 61.6%, 68%, 85.2% and 70.6%, respectively, compared with the wildtype gene. These mutations did not interfere with either mRNA transport from the nucleus to the cytoplasm, 3' end processing or mRNA stability. Nuclear run-on experiments demonstrated that mutations +10(-T) and +33(C --> G) reduced the rate of transcription to a degree that fully accounted for the observed lower level of mRNA accumulation, suggesting a disruption of downstream promoter sequences. Interestingly, mutation +22(G --> A) decreased the rate of transcription to a low degree, indicating the existence of a mechanism that acts post-transcriptionally. Generally, our data demonstrated the significance of functionally analysing mutants of this type in the presence of a full complement of transcriptional regulatory elements within a stably integrated chromatin context in an erythroid cell environment. PMID:15009072

  17. Pervasive Transcription of the Human Genome Produces Thousands of Previously Unidentified Long Intergenic Noncoding RNAs

    PubMed Central

    McManus, Michael T.

    2013-01-01

    Known protein coding gene exons compose less than 3% of the human genome. The remaining 97% is largely uncharted territory, with only a small fraction characterized. The recent observation of transcription in this intergenic territory has stimulated debate about the extent of intergenic transcription and whether these intergenic RNAs are functional. Here we directly observed with a large set of RNA-seq data covering a wide array of human tissue types that the majority of the genome is indeed transcribed, corroborating recent observations by the ENCODE project. Furthermore, using de novo transcriptome assembly of this RNA-seq data, we found that intergenic regions encode far more long intergenic noncoding RNAs (lincRNAs) than previously described, helping to resolve the discrepancy between the vast amount of observed intergenic transcription and the limited number of previously known lincRNAs. In total, we identified tens of thousands of putative lincRNAs expressed at a minimum of one copy per cell, significantly expanding upon prior lincRNA annotation sets. These lincRNAs are specifically regulated and conserved rather than being the product of transcriptional noise. In addition, lincRNAs are strongly enriched for trait-associated SNPs suggesting a new mechanism by which intergenic trait-associated regions may function. These findings will enable the discovery and interrogation of novel intergenic functional elements. PMID:23818866

  18. Evidence for transcript networks composed of chimeric RNAs in human cells.

    PubMed

    Djebali, Sarah; Lagarde, Julien; Kapranov, Philipp; Lacroix, Vincent; Borel, Christelle; Mudge, Jonathan M; Howald, Cédric; Foissac, Sylvain; Ucla, Catherine; Chrast, Jacqueline; Ribeca, Paolo; Martin, David; Murray, Ryan R; Yang, Xinping; Ghamsari, Lila; Lin, Chenwei; Bell, Ian; Dumais, Erica; Drenkow, Jorg; Tress, Michael L; Gelpí, Josep Lluís; Orozco, Modesto; Valencia, Alfonso; van Berkum, Nynke L; Lajoie, Bryan R; Vidal, Marc; Stamatoyannopoulos, John; Batut, Philippe; Dobin, Alex; Harrow, Jennifer; Hubbard, Tim; Dekker, Job; Frankish, Adam; Salehi-Ashtiani, Kourosh; Reymond, Alexandre; Antonarakis, Stylianos E; Guigó, Roderic; Gingeras, Thomas R

    2012-01-01

    The classic organization of a gene structure has followed the Jacob and Monod bacterial gene model proposed more than 50 years ago. Since then, empirical determinations of the complexity of the transcriptomes found in yeast to human has blurred the definition and physical boundaries of genes. Using multiple analysis approaches we have characterized individual gene boundaries mapping on human chromosomes 21 and 22. Analyses of the locations of the 5' and 3' transcriptional termini of 492 protein coding genes revealed that for 85% of these genes the boundaries extend beyond the current annotated termini, most often connecting with exons of transcripts from other well annotated genes. The biological and evolutionary importance of these chimeric transcripts is underscored by (1) the non-random interconnections of genes involved, (2) the greater phylogenetic depth of the genes involved in many chimeric interactions, (3) the coordination of the expression of connected genes and (4) the close in vivo and three dimensional proximity of the genomic regions being transcribed and contributing to parts of the chimeric RNAs. The non-random nature of the connection of the genes involved suggest that chimeric transcripts should not be studied in isolation, but together, as an RNA network. PMID:22238572

  19. Incomplete DNA methylation underlies a transcriptional memory of the somatic cell in human iPS cells

    PubMed Central

    Ohi, Yuki; Qin, Han; Hong, Chibo; Blouin, Laure; Polo, Jose M.; Guo, Tingxia; Qi, Zhongxia; Downey, Sara L.; Manos, Philip D.; Rossi, Derrick J.; Yu, Jingwei; Hebrok, Matthias; Hochedlinger, Konrad; Costello, Joseph F.; Song, Jun S.; Ramalho-Santos, Miguel

    2013-01-01

    Human induced pluripotent stem (iPS) cells are remarkably similar to embryonic stem (ES) cells, but recent reports suggest that there may be important differences between them. We performed a systematic comparison of human iPS cells generated from hepatocytes (representative of endoderm), skin fibroblasts (mesoderm) and melanocytes (ectoderm). All low passage iPS cells analyzed retain a transcriptional memory of the original cells. The persistent expression of somatic genes can be partially explained by incomplete promoter DNA methylation. This epigenetic mechanism underlies a robust form of memory that can be found in iPS cells generated by multiple laboratories using different methods, including RNA transfection. Incompletely silenced genes tend to be isolated from other genes that are repressed during reprogramming, indicating that recruitment of the silencing machinery may be inefficient at isolated genes. Knockdown of the incompletely reprogrammed gene C9orf64 reduces the efficiency of human iPS cell generation, suggesting that somatic memory genes may be functionally relevant during reprogramming. PMID:21499256

  20. Genome-wide analysis of human global and transcription-coupled excision repair of UV damage at single-nucleotide resolution

    PubMed Central

    Hu, Jinchuan; Adar, Sheera; Selby, Christopher P.

    2015-01-01

    We developed a method for genome-wide mapping of DNA excision repair named XR-seq (excision repair sequencing). Human nucleotide excision repair generates two incisions surrounding the site of damage, creating an ∼30-mer. In XR-seq, this fragment is isolated and subjected to high-throughput sequencing. We used XR-seq to produce stranded, nucleotide-resolution maps of repair of two UV-induced DNA damages in human cells: cyclobutane pyrimidine dimers (CPDs) and (6-4) pyrimidine–pyrimidone photoproducts [(6-4)PPs]. In wild-type cells, CPD repair was highly associated with transcription, specifically with the template strand. Experiments in cells defective in either transcription-coupled excision repair or general excision repair isolated the contribution of each pathway to the overall repair pattern and showed that transcription-coupled repair of both photoproducts occurs exclusively on the template strand. XR-seq maps capture transcription-coupled repair at sites of divergent gene promoters and bidirectional enhancer RNA (eRNA) production at enhancers. XR-seq data also uncovered the repair characteristics and novel sequence preferences of CPDs and (6-4)PPs. XR-seq and the resulting repair maps will facilitate studies of the effects of genomic location, chromatin context, transcription, and replication on DNA repair in human cells. PMID:25934506

  1. The emerging role of RNA in the regulation of gene transcription in human cells

    PubMed Central

    Morris, Kevin V.

    2011-01-01

    Recent evidence suggests that particular species of non-coding RNAs can modulate gene transcription in human cells. While such observations were in the past relegated to imprinted genes, it is now becoming apparent that several different genes in differentiated cells may be under some form of RNA based regulatory control. Studies carried out to date have begun to discern the mechanism of action whereby non-coding RNAs modulate gene transcription by the targeted recruitment of epigenetic silencing complexes to homology containing loci in the genome. The results of these studies will be considered in detail as well as the implications that a vast array of non-coding RNA based regulatory networks may be operative in human cells. PMID:21333746

  2. Selective activation of human heat shock gene transcription by nitrosourea antitumor drugs mediated by isocyanate-induced damage and activation of heat shock transcription factor

    SciTech Connect

    Kroes, R.A. Northwestern Univ., Evanston, IL ); Abravaya, K.; Morimoto, R.I. ); Seidenfeld, J. )

    1991-06-01

    Treatment of cultured human tumor cells with the chloroethylnitrosourea antitumor drug 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU) selectively induces transcription and protein synthesis of a subset of the human heat shock or stress-induced genes (HSP90 and HSP70) with little effect on other stress genes or on expression of the c-fos, c-myc, or {beta}-actin genes. The active component of BCNU and related compounds appears to be the isocyanate moiety that causes carbamoylation of proteins and nucleic acids. Transcriptional activation of the human HSP70 gene by BCNU is dependent on the heat shock element and correlates with the level of heat shock transcription factor and its binding to the heat shock element in vivo. Unlike activation by heat or heavy metals, BCNU-mediated activation is strongly dependent upon new protein synthesis. This suggests that BCNU-induced, isocyanate-mediated damage to newly synthesized protein(s) may be responsible for activation of the heat shock transcription factor and increased transcription of the HSP90 and HSP70 genes.

  3. Activation of transcription factor AP-2 mediates UVA radiation- and singlet oxygen-induced expression of the human intercellular adhesion molecule 1 gene

    SciTech Connect

    Grether-Beck, S.; Olaizola-Horn, S.; Schmitt, H.; Grewe, M.

    1996-12-10

    UVA radiation is the major component of the UV solar spectrum that reaches the earth, and the therapeutic application of UVA radiation is increasing in medicine. Analysis of the cellular effects of UVA radiation has revealed that exposure of human cells to UVA radiation at physiological doses leads to increased gene expression and that this UVA response is primarily mediated through the generation of singlet oxygen. In this study, the mechanisms by which UVA radiation induces transcriptional activation of the human intercellular adhesion molecule 1 (ICAM-1) were examined. UVA radiation was capable of inducing activation of the human ICAM-1 promoter and increasing OCAM-1 mRNA and protein expression. These UVA radiation effects were inhibited by singlet oxygen quenchers, augmented by enhancement of singlet oxygen life-time, and mimicked in unirradiated cells by a singlet oxygen-generating system. UVA radiation as well as singlet oxygen-induced ICAM-1 promoter activation required activation of the transcription factor AP-2. Accordingly, both stimuli activated AP-2, and deletion of the putative AP-2-binding site abrogated ICAM-1 promoter activation in this system. This study identified the AP-2 site as the UVA radiation- and singlet oxygen-responsive element of the human ICAM-1 gene. The capacity of UVA radiation and/or singlet oxygen to induce human gene expression through activation of AP-2 indicates a previously unrecognized role of this transcription factor in the mammalian stress response. 38 refs., 3 figs., 3 tabs.

  4. Generation of a Conditional Allele of the Transcription Factor Atonal Homolog 8 (Atoh8)

    PubMed Central

    Ejarque, Miriam; Mir-Coll, Joan; Gomis, Ramon; German, Michael S.; Lynn, Francis C.; Gasa, Rosa

    2016-01-01

    Atonal Homolog 8 (Atoh8) is a basic helix-loop-helix (bHLH) transcription factor that is highly conserved across species and expressed in multiple tissues during embryogenesis. In the developing pancreas, Atoh8 is expressed in endocrine progenitors but declines in hormone-positive cells, suggesting a role during early stages of the endocrine differentiation program. We previously generated a whole-body Atoh8 knockout but early lethality of null embryos precluded assessment of Atoh8 functions during organ development. Here we report the generation of a conditional Atoh8 knockout mouse strain by insertion of two loxP sites flanking exon 1 of the Atoh8 gene. Pancreas-specific Atoh8 knockout (Atoh8 Δpanc) mice were obtained by mating this strain with a Pdx1-Cre transgenic line. Atoh8 Δpanc mice were born at the expected mendelian ratio and showed normal appearance and fertility. Pancreas weight and gross pancreatic morphology were normal. All pancreatic cell lineages were present, although endocrine δ (somatostatin) cells were modestly augmented in Atoh8 Δpanc as compared to control neonates. This increase did not affect whole-body glucose tolerance in adult knockout animals. Gene expression analysis in embryonic pancreases at the time of the major endocrine differentiation wave revealed modest alterations in several early endocrine differentiation markers. Together, these data argue that Atoh8 modulates activation of the endocrine program but it is not essential for pancreas formation or endocrine differentiation in the mouse. Given the ubiquitous expression pattern of Atoh8, the availability of a mouse strain carrying a conditional allele for this gene warrants further studies using temporally regulated Cre transgenic lines to elucidate time or cell-autonomous functions of Atoh8 during development and in the adult. PMID:26752640

  5. RBFOX1 regulates both splicing and transcriptional networks in human neuronal development

    PubMed Central

    Fogel, Brent L.; Wexler, Eric; Wahnich, Amanda; Friedrich, Tara; Vijayendran, Chandran; Gao, Fuying; Parikshak, Neelroop; Konopka, Genevieve; Geschwind, Daniel H.

    2012-01-01

    RNA splicing plays a critical role in the programming of neuronal differentiation and, consequently, normal human neurodevelopment, and its disruption may underlie neurodevelopmental and neuropsychiatric disorders. The RNA-binding protein, fox-1 homolog (RBFOX1; also termed A2BP1 or FOX1), is a neuron-specific splicing factor predicted to regulate neuronal splicing networks clinically implicated in neurodevelopmental disease, including autism spectrum disorder (ASD), but only a few targets have been experimentally identified. We used RNA sequencing to identify the RBFOX1 splicing network at a genome-wide level in primary human neural stem cells during differentiation. We observe that RBFOX1 regulates a wide range of alternative splicing events implicated in neuronal development and maturation, including transcription factors, other splicing factors and synaptic proteins. Downstream alterations in gene expression define an additional transcriptional network regulated by RBFOX1 involved in neurodevelopmental pathways remarkably parallel to those affected by splicing. Several of these differentially expressed genes are further implicated in ASD and related neurodevelopmental diseases. Weighted gene co-expression network analysis demonstrates a high degree of connectivity among these disease-related genes, highlighting RBFOX1 as a key factor coordinating the regulation of both neurodevelopmentally important alternative splicing events and clinically relevant neuronal transcriptional programs in the development of human neurons. PMID:22730494

  6. Transcriptional promoter of the human alpha 1(V) collagen gene (COL5A1).

    PubMed Central

    Lee, S; Greenspan, D S

    1995-01-01

    We have characterized the 5' region of the human alpha 1(V) collagen gene (COL5A1). The transcriptional promoter is shown to have a number of features characteristic of the promoters of 'housekeeping' and growth-control-related genes. It lacks obvious TATA and CAAT boxes, has multiple transcription start sites, has a high GC content, lies within a well-defined CpG island and has a number of consensus sites for the potential binding of transcription factor Sp1. This type of promoter structure, while unusual for a collagen gene, is consistent with the broad distribution of expression of COL5A1 and is reminiscent of the promoter structures of the genes encoding type VI collagen, which has a similarly broad distribution of expression. Stepwise deletion of COL5A1 5' sequences, placed upstream of a heterologous reporter gene, yielded a gradual decrease in promoter activity, indicating that the COL5A1 promoter is composed of an array of cis-acting elements. A minimal promoter region contained within the 212 bp immediately upstream of the major transcription start site contained no consensus sequences for the binding of known transcription factors, but gel mobility shift assays showed this region to bind nuclear factors, including Sp1, at a number of sites. The major transcription start site is flanked by an upstream 34-bp oligopurine/oligopyrimidine stretch, or 'GAGA' box, and a downstream 56-bp GAGA box which contains a 10-bp mirror repeat and is sensitive to cleavage with S1 nuclease. Images Figure 1 Figure 3 Figure 4 Figure 6 PMID:7646438

  7. Saci-1, -2, and -3 and Perere, Four Novel Retrotransposons with High Transcriptional Activities from the Human Parasite Schistosoma mansoni

    PubMed Central

    DeMarco, Ricardo; Kowaltowski, Andre T.; Machado, Abimael A.; Soares, M. Bento; Gargioni, Cybele; Kawano, Toshie; Rodrigues, Vanderlei; Madeira, Alda M. B. N.; Wilson, R. Alan; Menck, Carlos F. M.; Setubal, João C.; Dias-Neto, Emmanuel; Leite, Luciana C. C.; Verjovski-Almeida, Sergio

    2004-01-01

    Using the data set of 180,000 expressed sequence tags (ESTs) of the blood fluke Schistosoma mansoni generated recently by our group, we identified three novel long-terminal-repeat (LTR)- and one novel non-LTR-expressed retrotransposon, named Saci-1, -2, and -3 and Perere, respectively. Full-length sequences were reconstructed from ESTs and have deduced open reading frames (ORFs) with several uncorrupted features, characterizing them as possible active retrotransposons of different known transposon families. Alignment of reconstructed sequences to available preliminary genome sequence data confirmed the overall structure of the transposons. The frequency of sequenced transposon transcripts in cercariae was 14% of all transcripts from that stage, twofold higher than that in schistosomula and three- to fourfold higher than that in adults, eggs, miracidia, and germ balls. We show by Southern blot analysis, by EST annotation and tallying, and by counting transposon tags from a Social Analysis of Gene Expression library, that the four novel retrotransposons exhibit a 10- to 30-fold lower copy number in the genome and a 4- to 200-fold-higher transcriptional rate per copy than the four previously described S. mansoni retrotransposons. Such differences lead us to hypothesize that there are two different populations of retrotransposons in S. mansoni genome, occupying different niches in its ecology. Examples of retrotransposon fragment inserts were found into the 5′ and 3′ untranslated regions of four different S. mansoni target gene transcripts. The data presented here suggest a role for these elements in the dynamics of this complex human parasite genome. PMID:14990715

  8. Transcriptional activation of JC virus by human T-lymphotropic virus type I Tax protein in human neuronal cell lines.

    PubMed

    Okada, Y; Sawa, H; Tanaka, S; Takada, A; Suzuki, S; Hasegawa, H; Umemura, T; Fujisawa, J; Tanaka, Y; Hall, W W; Nagashima, K

    2000-06-01

    Polyomavirus JC (JCV) causes the human demyelinating disease, progressive multifocal leukoencephalopathy (PML). The recent demonstration of cases of PML in association with human T-lymphotropic virus type I (HTLV-I) infection prompted us to examine whether the HTLV-I-encoded regulatory protein Tax activates JCV transcription. By employing a dual luciferase assay, we initially found that the expression of Tax activated the transcriptional potential of both early and late promoters of JCV in human neuronal but not in non-neuronal cells. We subsequently analyzed the mechanism of Tax-induced activation of the JCV promoter in neuronal cells with the following results: 1) the JCV promoter that lacks the NF-kappaB-binding motif could not be activated by Tax; 2) the overexpression of IkappaBalpha abolished Tax-induced transcriptional activation of the JCV promoter; 3) a Tax mutant (M22) lacking the potential for activation via the NF-kappaB pathway did not activate the JCV promoter. Furthermore, Tax enhances the gene expression of JCV T antigen and VP1. We examined mechanisms of the cell-specific activation of the JCV promoter by Tax. Electrophoretic mobility shift assay demonstrated the presence of Tax-bound protein(s) that were specifically present in non-neuronal cells. This study is the first demonstration of the activation of JCV promoter by HTLV-I Tax in an NF-kappaB-dependent manner. PMID:10828075

  9. Commensal Streptococcus salivarius Modulates PPARγ Transcriptional Activity in Human Intestinal Epithelial Cells

    PubMed Central

    Couvigny, Benoît; de Wouters, Tomas; Kaci, Ghalia; Jacouton, Elsa; Delorme, Christine; Doré, Joël; Renault, Pierre; Blottière, Hervé M.

    2015-01-01

    The impact of commensal bacteria in eukaryotic transcriptional regulation has increasingly been demonstrated over the last decades. A multitude of studies have shown direct effects of commensal bacteria from local transcriptional activity to systemic impact. The commensal bacterium Streptococcus salivarius is one of the early bacteria colonizing the oral and gut mucosal surfaces. It has been shown to down-regulate nuclear transcription factor (NF-кB) in human intestinal cells, a central regulator of the host mucosal immune system response to the microbiota. In order to evaluate its impact on a further important transcription factor shown to link metabolism and inflammation in the intestine, namely PPARγ (peroxisome proliferator-activated receptor), we used human intestinal epithelial cell-lines engineered to monitor PPARγ transcriptional activity in response to a wide range of S. salivarius strains. We demonstrated that different strains from this bacterial group share the property to inhibit PPARγ activation independently of the ligand used. First attempts to identify the nature of the active compounds showed that it is a low-molecular-weight, DNase-, proteases- and heat-resistant metabolite secreted by S. salivarius strains. Among PPARγ-targeted metabolic genes, I-FABP and Angptl4 expression levels were dramatically reduced in intestinal epithelial cells exposed to S. salivarius supernatant. Both gene products modulate lipid accumulation in cells and down-regulating their expression might consequently affect host health. Our study shows that species belonging to the salivarius group of streptococci impact both host inflammatory and metabolic regulation suggesting a possible role in the host homeostasis and health. PMID:25946041

  10. Commensal Streptococcus salivarius Modulates PPARγ Transcriptional Activity in Human Intestinal Epithelial Cells.

    PubMed

    Couvigny, Benoît; de Wouters, Tomas; Kaci, Ghalia; Jacouton, Elsa; Delorme, Christine; Doré, Joël; Renault, Pierre; Blottière, Hervé M; Guédon, Eric; Lapaque, Nicolas

    2015-01-01

    The impact of commensal bacteria in eukaryotic transcriptional regulation has increasingly been demonstrated over the last decades. A multitude of studies have shown direct effects of commensal bacteria from local transcriptional activity to systemic impact. The commensal bacterium Streptococcus salivarius is one of the early bacteria colonizing the oral and gut mucosal surfaces. It has been shown to down-regulate nuclear transcription factor (NF-кB) in human intestinal cells, a central regulator of the host mucosal immune system response to the microbiota. In order to evaluate its impact on a further important transcription factor shown to link metabolism and inflammation in the intestine, namely PPARγ (peroxisome proliferator-activated receptor), we used human intestinal epithelial cell-lines engineered to monitor PPARγ transcriptional activity in response to a wide range of S. salivarius strains. We demonstrated that different strains from this bacterial group share the property to inhibit PPARγ activation independently of the ligand used. First attempts to identify the nature of the active compounds showed that it is a low-molecular-weight, DNase-, proteases- and heat-resistant metabolite secreted by S. salivarius strains. Among PPARγ-targeted metabolic genes, I-FABP and Angptl4 expression levels were dramatically reduced in intestinal epithelial cells exposed to S. salivarius supernatant. Both gene products modulate lipid accumulation in cells and down-regulating their expression might consequently affect host health. Our study shows that species belonging to the salivarius group of streptococci impact both host inflammatory and metabolic regulation suggesting a possible role in the host homeostasis and health. PMID:25946041

  11. Cloning of the novel human myeloid-cell-specific C/EBP-epsilon transcription factor.

    PubMed Central

    Chumakov, A M; Grillier, I; Chumakova, E; Chih, D; Slater, J; Koeffler, H P

    1997-01-01

    Chicken NF-M transcription factor, in cooperation with either c-Myb or v-Myb, is active in the combinatorial activation of myeloid-cell-specific genes in heterologous cell types, such as embryonic fibroblasts. In humans, similar effects were observed with homologous members of the CCAAT/enhancer-binding protein (C/EBP) family of transcriptional regulators, especially the human homolog of chicken NF-M, C/EBP-beta (NF-IL6). However, the NF-IL6 gene is expressed in a variety of nonmyeloid cell types and is strongly inducible in response to inflammatory stimuli, making it an unlikely candidate to have an exclusive role as a combinatorial differentiation switch during myelopoiesis in human cells. By using a reverse transcription-PCR-based approach and a set of primers specific for the DNA-binding domains of highly homologous members of the C/EBP family of transcriptional regulators, we have cloned a novel human gene encoding a member of the C/EBP gene family, identified as the human homolog of CRP1, C/EBP-epsilon. A 1.2-kb cDNA encoding full-length human C/EBP-epsilon was cloned from a promyelocyte-late myeloblast-derived lambda gt11 library. Molecular analysis of the cDNA and genomic clones indicated the presence of two exons encoding a protein with an apparent molecular mass of 32 kDa and a pI of 9.5. Primer extension analysis of C/EBP-epsilon mRNA detected a single major transcription start site approximately 200 bp upstream of the start codon. The putative promoter area is similar to those of several other myeloid-cell-specific genes in that it contains no TATAAA box but has a number of purine-rich stretches with multiple sites for the factors of the Ets family of transcriptional regulators. Northern blot analyses indicated a highly restricted mRNA expression pattern, with the strongest expression occurring in promyelocyte and late-myeloblast-like cell lines. Western blot and immunoprecipitation studies using rabbit anti-C/EBP-epsilon antibodies raised against the N

  12. Generation of improved humanized mouse models for human infectious diseases

    PubMed Central

    Brehm, Michael A.; Wiles, Michael V.; Greiner, Dale L.; Shultz, Leonard D.

    2014-01-01

    The study of human-specific infectious agents has been hindered by the lack of optimal small animal models. More recently development of novel strains of immunodeficient mice has begun to provide the opportunity to utilize small animal models for the study of many human-specific infectious agents. The introduction of a targeted mutation in the IL2 receptor common gamma chain gene (IL2rgnull) in mice already deficient in T and B cells led to a breakthrough in the ability to engraft hematopoietic stem cells, as well as functional human lymphoid cells and tissues, effectively creating human immune systems in immunodeficient mice. These humanized mice are becoming increasingly important as pre-clinical models for the study of human immunodeficiency virus-1 (HIV-1) and other human-specific infectious agents. However, there remain a number of opportunities to further improve humanized mouse models for the study of human-specific infectious agents. This is being done by the implementation of innovative technologies, which collectively will accelerate the development of new models of genetically modified mice, including; i) modifications of the host to reduce innate immunity, which impedes human cell engraftment; ii) genetic modification to provide human-specific growth factors and cytokines required for optimal human cell growth and function; iii) and new cell and tissue engraftment protocols. The development of “next generation” humanized mouse models continues to provide exciting opportunities for the establishment of robust small animal models to study the pathogenesis of human-specific infectious agents, as well as for testing the efficacy of therapeutic agents and experimental vaccines. PMID:24607601

  13. Comprehensive analysis of the transcriptional profile of the Mediator complex across human cancer types.

    PubMed

    Syring, Isabella; Klümper, Niklas; Offermann, Anne; Braun, Martin; Deng, Mario; Boehm, Diana; Queisser, Angela; von Mässenhausen, Anne; Brägelmann, Johannes; Vogel, Wenzel; Schmidt, Doris; Majores, Michael; Schindler, Anne; Kristiansen, Glen; Müller, Stefan C; Ellinger, Jörg; Shaikhibrahim, Zaki; Perner, Sven

    2016-04-26

    The Mediator complex is a key regulator of gene transcription and several studies demonstrated altered expressions of particular subunits in diverse human diseases, especially cancer. However a systematic study deciphering the transcriptional expression of the Mediator across different cancer entities is still lacking.We therefore performed a comprehensive in silico cancer vs. benign analysis of the Mediator complex subunits (MEDs) for 20 tumor entities using Oncomine datasets. The transcriptional expression profiles across almost all cancer entities showed differentially expressed MEDs as compared to benign tissue. Differential expression of MED8 in renal cell carcinoma (RCC) and MED12 in lung cancer (LCa) were validated and further investigated by immunohistochemical staining on tissue microarrays containing large numbers of specimen. MED8 in clear cell RCC (ccRCC) associated with shorter survival and advanced TNM stage and showed higher expression in metastatic than primary tumors. In vitro, siRNA mediated MED8 knockdown significantly impaired proliferation and motility in ccRCC cell lines, hinting at a role for MED8 to serve as a novel therapeutic target in ccRCC. Taken together, our Mediator complex transcriptome proved to be a valid tool for identifying cancer-related shifts in Mediator complex composition, revealing that MEDs do exhibit cancer specific transcriptional expression profiles. PMID:27050271

  14. Characterization of human mitochondrial ferritin promoter: identification of transcription factors and evidences of epigenetic control.

    PubMed

    Guaraldo, Michela; Santambrogio, Paolo; Rovelli, Elisabetta; Di Savino, Augusta; Saglio, Giuseppe; Cittaro, Davide; Roetto, Antonella; Levi, Sonia

    2016-01-01

    Mitochondrial ferritin (FtMt) is an iron storage protein belonging to the ferritin family but, unlike the cytosolic ferritin, it has an iron-unrelated restricted tissue expression. FtMt appears to be preferentially expressed in cell types characterized by high metabolic activity and oxygen consumption, suggesting a role in protecting mitochondria from iron-dependent oxidative damage. The human gene (FTMT) is intronless and its promoter region has not been described yet. To analyze the regulatory mechanisms controlling FTMT expression, we characterized the 5' flanking region upstream the transcriptional starting site of FTMT by in silico enquiry of sequences conservation, DNA deletion analysis, and ChIP assay. The data revealed a minimal promoter region and identified the presence of SP1, CREB and YY1 as positive regulators, and GATA2, FoxA1 and C/EBPβ as inhibitors of the transcriptional regulation. Furthermore, the FTMT transcription is increased by acetylating and de-methylating agent treatments in K562 and HeLa cells. These treatments up-regulate FtMt expression even in fibroblasts derived from a Friedreich ataxia patient, where it might exert a beneficial effect against mitochondrial oxidative damage. The expression of FTMT appears regulated by a complex mechanism involving epigenetic events and interplay between transcription factors. PMID:27625068

  15. Differential Transcriptional Responses to Interferon-α and Interferon-γ in Primary Human Hepatocytes

    PubMed Central

    Nanda, Santosh; Ji, Xuhuai; Calderon-Rodriguez, Gloria M.; Greenberg, Harry B.; Liang, T. Jake

    2010-01-01

    Interferon (IFN) plays a central role in the innate and adaptive antiviral immune responses. While IFN-α is currently approved for treating chronic hepatitis B and hepatitis C, in limited studies, IFN-γ has not been shown to be effective for chronic hepatitis B or C. To identify the potential mechanism underlying the differential antiviral effects of IFN-α and IFN-γ, we used cDNA microarray to profile the global transcriptional response to IFN-α and IFN-γ in primary human hepatocytes, the target cell population of hepatitis viruses. Our results reveal distinct patterns of gene expression induced by these 2 cytokines. Overall, IFN-α induces more genes than IFN-γ at the transcriptional level. Distinct sets of genes were induced by IFN-α and IFN-γ with limited overlaps. IFN-α induces gene transcription at an early time point (6 h) but not at a later time point (18 h), while the effects of IFN-γ are more prominent at 18 h than at 6 h, suggesting a delayed transcriptional response to IFN-γ in the hepatocytes. These findings indicate differential actions of IFN-α and IFN-γ in the context of therapeutic intervention for chronic viral infections in the liver. PMID:20038212

  16. Repression of the human papillomavirus type 18 enhancer by the cellular transcription factor Oct-1.

    PubMed Central

    Hoppe-Seyler, F; Butz, K; zur Hausen, H

    1991-01-01

    The role of cellular factors involved in the transcriptional regulation of the cancer-associated human papillomavirus type 18 (HPV18) is yet poorly understood. The presence of an Oct-1-binding site within the HPV18 upstream regulatory region led us to investigate the influence of Oct-1 on viral transcription. Cotransfection of Oct-1 expression plasmids together with luciferase reporter constructs containing HPV18 regulatory sequences indicated that Oct-1 can transcriptionally repress the HPV18 upstream regulatory region. In contrast, heterologous control regions were not affected by Oct-1. HPV18 cis elements that can be repressed by Oct-1 mapped to a 135-bp subregion of the viral constitutive enhancer. Analysis of an Oct-1 mutant defective in DNA binding suggested that HPV18 down-modulation does not require direct binding of Oct-1 to DNA. These results make Oct-1 a candidate factor involved in the intracellular surveillance of HPV18 transcription and support the notion of a host cell mechanism that can specifically repress HPV E6-E7 transforming gene expression. Images PMID:1654457

  17. METTL23, a transcriptional partner of GABPA, is essential for human cognition.

    PubMed

    Reiff, Rachel E; Ali, Bassam R; Baron, Byron; Yu, Timothy W; Ben-Salem, Salma; Coulter, Michael E; Schubert, Christian R; Hill, R Sean; Akawi, Nadia A; Al-Younes, Banan; Kaya, Namik; Evrony, Gilad D; Al-Saffar, Muna; Felie, Jillian M; Partlow, Jennifer N; Sunu, Christine M; Schembri-Wismayer, Pierre; Alkuraya, Fowzan S; Meyer, Brian F; Walsh, Christopher A; Al-Gazali, Lihadh; Mochida, Ganeshwaran H

    2014-07-01

    Whereas many genes associated with intellectual disability (ID) encode synaptic proteins, transcriptional defects leading to ID are less well understood. We studied a large, consanguineous pedigree of Arab origin with seven members affected with ID and mild dysmorphic features. Homozygosity mapping and linkage analysis identified a candidate region on chromosome 17 with a maximum multipoint logarithm of odds score of 6.01. Targeted high-throughput sequencing of the exons in the candidate region identified a homozygous 4-bp deletion (c.169_172delCACT) in the METTL23 (methyltransferase like 23) gene, which is predicted to result in a frameshift and premature truncation (p.His57Valfs*11). Overexpressed METTL23 protein localized to both nucleus and cytoplasm, and physically interacted with GABPA (GA-binding protein transcription factor, alpha subunit). GABP, of which GABPA is a component, is known to regulate the expression of genes such as THPO (thrombopoietin) and ATP5B (ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide) and is implicated in a wide variety of important cellular functions. Overexpression of METTL23 resulted in increased transcriptional activity at the THPO promoter, whereas knockdown of METTL23 with siRNA resulted in decreased expression of ATP5B, thus revealing the importance of METTL23 as a regulator of GABPA function. The METTL23 mutation highlights a new transcriptional pathway underlying human intellectual function. PMID:24501276

  18. Blood transcriptional signature of recombinant human erythropoietin administration and implications for antidoping strategies.

    PubMed

    Durussel, Jérôme; Haile, Diresibachew W; Mooses, Kerli; Daskalaki, Evangelia; Beattie, Wendy; Mooses, Martin; Mekonen, Wondyefraw; Ongaro, Neford; Anjila, Edwin; Patel, Rajan K; Padmanabhan, Neal; McBride, Martin W; McClure, John D; Pitsiladis, Yannis P

    2016-03-01

    Recombinant human erythropoietin (rHuEPO) is frequently abused by athletes as a performance-enhancing drug, despite being prohibited by the World Anti-Doping Agency. Although the methods to detect blood doping, including rHuEPO injections, have improved in recent years, they remain imperfect. In a proof-of-principle study, we identified, replicated, and validated the whole blood transcriptional signature of rHuEPO in endurance-trained Caucasian males at sea level (n = 18) and Kenyan endurance runners at moderate altitude (n = 20), all of whom received rHuEPO injections for 4 wk. Transcriptional profiling shows that hundreds of transcripts were altered by rHuEPO in both cohorts. The main regulated expression pattern, observed in all participants, was characterized by a "rebound" effect with a profound upregulation during rHuEPO and a subsequent downregulation up to 4 wk postadministration. The functions of the identified genes were mainly related to the functional and structural properties of the red blood cell. Of the genes identified to be differentially expressed during and post-rHuEPO, we further confirmed a whole blood 34-transcript signature that can distinguish between samples collected pre-, during, and post-rHuEPO administration. By providing biomarkers that can reveal rHuEPO use, our findings represent an advance in the development of new methods for the detection of blood doping. PMID:26757800

  19. Transcriptional Adaptation of Drug-tolerant Mycobacterium tuberculosis During Treatment of Human Tuberculosis

    PubMed Central

    Walter, Nicholas D.; Dolganov, Gregory M.; Garcia, Benjamin J.; Worodria, William; Andama, Alfred; Musisi, Emmanuel; Ayakaka, Irene; Van, Tran T.; Voskuil, Martin I.; de Jong, Bouke C.; Davidson, Rebecca M.; Fingerlin, Tasha E.; Kechris, Katerina; Palmer, Claire; Nahid, Payam; Daley, Charles L.; Geraci, Mark; Huang, Laurence; Cattamanchi, Adithya; Strong, Michael; Schoolnik, Gary K.; Davis, John Lucian

    2015-01-01

    Background. Treatment initiation rapidly kills most drug-susceptible Mycobacterium tuberculosis, but a bacterial subpopulation tolerates prolonged drug exposure. We evaluated drug-tolerant bacilli in human sputum by comparing messenger RNA (mRNA) expression of drug-tolerant bacilli that survive the early bactericidal phase with treatment-naive bacilli. Methods. M. tuberculosis gene expression was quantified via reverse-transcription polymerase chain reaction in serial sputa from 17 Ugandans treated for drug-susceptible pulmonary tuberculosis. Results. Within 4 days, bacterial mRNA abundance declined >98%, indicating rapid killing. Thereafter, the rate of decline slowed >94%, indicating drug tolerance. After 14 days, 16S ribosomal RNA transcripts/genome declined 96%, indicating slow growth. Drug-tolerant bacilli displayed marked downregulation of genes associated with growth, metabolism, and lipid synthesis and upregulation in stress responses and key regulatory categories—including stress-associated sigma factors, transcription factors, and toxin-antitoxin genes. Drug efflux pumps were upregulated. The isoniazid stress signature was induced by initial drug exposure, then disappeared after 4 days. Conclusions. Transcriptional patterns suggest that drug-tolerant bacilli in sputum are in a slow-growing, metabolically and synthetically downregulated state. Absence of the isoniazid stress signature in drug-tolerant bacilli indicates that physiological state influences drug responsiveness in vivo. These results identify novel drug targets that should aid in development of novel shorter tuberculosis treatment regimens. PMID:25762787

  20. Targeting Tat Inhibitors in the Assembly of Human Immunodeficiency Virus Type 1 Transcription Complexes▿ †

    PubMed Central

    D'Orso, Iván; Grunwell, Jocelyn R.; Nakamura, Robert L.; Das, Chandreyee; Frankel, Alan D.

    2008-01-01

    Human immunodeficiency virus type 1 (HIV-1) transcription is regulated by the viral Tat protein, which relieves a block to elongation by recruiting an elongation factor, P-TEFb, to the viral promoter. Here, we report the discovery of potent Tat inhibitors that utilize a localization signal to target a dominant negative protein to its site of action. Fusing the Tat activation domain to some splicing factors, particularly to the Arg-Ser (RS) domain of U2AF65, creates Tat inhibitors that localize to subnuclear speckles, sites where pre-mRNA processing factors are stored for assembly into transcription complexes. A U2AF65 fusion named T-RS interacts with the nonphosphorylated C-terminal domain of RNA polymerase II (RNAP II) via its RS domain and is loaded into RNAP II holoenzyme complexes. T-RS is recruited efficiently to the HIV-1 promoter in a TAR-independent manner before RNAP II hyperphosphorylation but not to cellular promoters. The “preloading” of T-RS into HIV-1 preinitiation complexes prevents the entry of active Tat molecules, leaving the complexes in an elongation-incompetent state and effectively suppressing HIV-1 replication. The ability to deliver inhibitors to transcription complexes through the use of targeting/localization signals may provide new avenues for designing viral and transcription inhibitors. PMID:18667497

  1. Transcription-Associated R-Loop Formation across the Human FMR1 CGG-Repeat Region

    PubMed Central

    Loomis, Erick W.; Sanz, Lionel A.; Chédin, Frédéric; Hagerman, Paul J.

    2014-01-01

    Expansion of a trinucleotide (CGG) repeat element within the 5′ untranslated region (5′UTR) of the human FMR1 gene is responsible for a number of heritable disorders operating through distinct pathogenic mechanisms: gene silencing for fragile X syndrome (>200 CGG) and RNA toxic gain-of-function for FXTAS (∼55–200 CGG). Existing models have focused almost exclusively on post-transcriptional mechanisms, but co-transcriptional processes could also contribute to the molecular dysfunction of FMR1. We have observed that transcription through the GC-rich FMR1 5′UTR region favors R-loop formation, with the nascent (G-rich) RNA forming a stable RNA:DNA hybrid with the template DNA strand, thereby displacing the non-template DNA strand. Using DNA:RNA (hybrid) immunoprecipitation (DRIP) of genomic DNA from cultured human dermal fibroblasts with both normal (∼30 CGG repeats) and premutation (55human genomic DNA. Using a doxycycline (DOX)-inducible episomal system in which both the CGG-repeat and transcription frequency can be varied, we further show that R-loop formation increases with higher expression levels. Finally, non-denaturing bisulfite mapping of the displaced single-stranded DNA confirmed R-loop formation at the endogenous FMR1 locus and further indicated that R-loops formed over CGG repeats may be prone to structural complexities, including hairpin formation, not commonly associated with other R-loops. These observations introduce a new molecular feature of the FMR1 gene that is directly affected by CGG-repeat expansion and is likely to be involved in the associated cellular dysfunction. PMID:24743386

  2. Differential transcription of the human spermidine/spermine N1-acetyltransferase (SSAT) gene in human lung carcinoma cells.

    PubMed Central

    Xiao, L; Casero, R A

    1996-01-01

    The expression of spermidine/spermine N1-acetyltransferase (SSAT), the rate-limiting enzyme in the catabolism of polyamines, is highly regulated by a number of factors including the natural polyamines and their analogues. The phenotype-specific cytotoxicity that occurs in response to a class of polyamine analogues, the diethylpolyamines, is associated with a phenotype-specific superinduction of SSAT in human non-small-cell lung carcinomas, whereas in non-responding cell types, including the small-cell lung carcinomas, the superinduction of SSAT does not occur. In this study, we have investigated the molecular basis of this phenotype-specific SSAT induction in human lung carcinoma cells in response to N1,N12-diethylspermine (BESpm). To facilitate the study of transcriptional regulation, we have cloned and characterized 11 kb of the human SSAT locus, including 3500 bp of the 5' promoter region. Nuclear run-on transcription studies suggest that the initial induction of SSAT results from an increase in the rate of gene transcription. Results from Northern blot analysis and ribonuclease protection assays indicate a differential expression of SSAT mRNA between the analogue-responsive H157 and non-responsive H82 cells. There is no detectable SSAT mRNA in H82 cells, even after a 24-h analogue treatment, whereas SSAT mRNA in H157 cells was detectable by Northern blot analysis and increased more than 100-fold following drug exposure. Furthermore, nuclear run-on transcription assays do not detect any active transcription of SSAT gene in either treated or untreated H82 cells. These results indicate that at least one component of the phenotype-specific induction of SSAT appears to be due to differences in transcriptional regulation of the gene. In addition, mapping of DNase I-hypersensitive sites of the SSAT gene suggest that the cell type-specific promoter/enhancer utilization may control the expression of the SSAT gene in differentially sensitive cell types in vivo. PMID

  3. Distinct Regulatory Mechanisms of the Human Ferritin Gene by Hypoxia and Hypoxia Mimetic Cobalt Chloride at the Transcriptional and Post-transcriptional Levels

    PubMed Central

    Huang, Bo-Wen; Miyazawa, Masaki; Tsuji, Yoshiaki

    2014-01-01

    Cobalt chloride has been used as a hypoxia mimetic because it stabilizes hypoxia inducible factor-1α (HIF1-α) and activates gene transcription through a hypoxia responsive element (HRE). However, differences between hypoxia and hypoxia mimetic cobalt chloride in gene regulation remain elusive. Expression of ferritin, the major iron storage protein, is regulated at the transcriptional and posttranscriptional levels through DNA and RNA regulatory elements. Here we demonstrate that hypoxia and cobalt chloride regulate ferritin heavy chain (ferritin H) expression by two distinct mechanisms. Both hypoxia and cobalt chloride increased HIF1-α but a putative HRE in the human ferritin H gene was not activated. Instead, cobalt chloride but not hypoxia activated ferritin H transcription through an antioxidant responsive element (ARE), to which Nrf2 was recruited. Intriguingly, cobalt chloride downregulated ferritin H protein expression while upregulated other ARE-regulated antioxidant genes in K562 cells. Further characterization demonstrated that cobalt chloride increased interaction between iron regulatory proteins (IRP1 and IRP2) and iron responsive element (IRE) in the 5′UTR of ferritin H mRNA, resulting in translational block of the accumulated ferritin H mRNA. In contrast, hypoxia had marginal effect on ferritin H transcription but increased its translation through decreased IRP1-IRE interaction. These results suggest that hypoxia and hypoxia mimetic cobalt chloride employ distinct regulatory mechanisms through the interplay between DNA and mRNA elements at the transcriptional and post-transcriptional levels. PMID:25172425

  4. Transcriptional profiles of supragranular-enriched genes associate with corticocortical network architecture in the human brain

    PubMed Central

    Krienen, Fenna M.; Yeo, B. T. Thomas; Ge, Tian; Buckner, Randy L.; Sherwood, Chet C.

    2016-01-01

    The human brain is patterned with disproportionately large, distributed cerebral networks that connect multiple association zones in the frontal, temporal, and parietal lobes. The expansion of the cortical surface, along with the emergence of long-range connectivity networks, may be reflected in changes to the underlying molecular architecture. Using the Allen Institute’s human brain transcriptional atlas, we demonstrate that genes particularly enriched in supragranular layers of the human cerebral cortex relative to mouse distinguish major cortical classes. The topography of transcriptional expression reflects large-scale brain network organization consistent with estimates from functional connectivity MRI and anatomical tracing in nonhuman primates. Microarray expression data for genes preferentially expressed in human upper layers (II/III), but enriched only in lower layers (V/VI) of mouse, were cross-correlated to identify molecular profiles across the cerebral cortex of postmortem human brains (n = 6). Unimodal sensory and motor zones have similar molecular profiles, despite being distributed across the cortical mantle. Sensory/motor profiles were anticorrelated with paralimbic and certain distributed association network profiles. Tests of alternative gene sets did not consistently distinguish sensory and motor regions from paralimbic and association regions: (i) genes enriched in supragranular layers in both humans and mice, (ii) genes cortically enriched in humans relative to nonhuman primates, (iii) genes related to connectivity in rodents, (iv) genes associated with human and mouse connectivity, and (v) 1,454 gene sets curated from known gene ontologies. Molecular innovations of upper cortical layers may be an important component in the evolution of long-range corticocortical projections. PMID:26739559

  5. Transposable elements, polydactyl proteins and the genesis of human-specific transcription networks

    PubMed Central

    Trono, Didier

    2016-01-01

    Transposable elements (TEs) may account for up to two-thirds of the human genome, and as genomic threats they are subjected to epigenetic control mechanisms engaged from the earliest stages of embryonic development. We previously determined that an important component of this process is the sequence-specific recognition of TEs by KRAB-containing zinc finger proteins (KRAB-ZFPs), a large family of tetrapod-restricted transcription factors that act by recruiting inducers of heterochromatin formation and DNA methylation. We further demonstrated that KRAB-ZFPs and their cofactor KAP1 exert a marked influence on the transcription dynamics of embryonic stem cells via their docking of repressor complexes at TE-contained regulatory sequences. It is generally held that, beyond this early embryonic period, TEs become permanently silenced, and that the evolutionary selection of KRAB-ZFPs and other TE controllers is the result of a simple evolutionary arms race between the host and these genetics invaders. Here, I discuss recent evidence that invalidates this dual assumption, and instead suggests that KRAB-ZFPs are the instruments of a massive enterprise of TE domestication, whereby transposon-based regulatory sequences and their cellular ligands establish species-specific transcription regulation networks that influence multiple aspects of human development and physiology. PMID:26763983

  6. Genomic organization and transcriptional analysis of the human l-glutaminase gene.

    PubMed Central

    Pérez-Gómez, Cristina; Matés, José M; Gómez-Fabre, Pedro M; del Castillo-Olivares, Antonio; Alonso, Francisco J; Márquez, Javier

    2003-01-01

    In mammals, glutaminase (GA) is expressed in most tissues, but the regulation of organ-specific expression is largely unknown. Therefore, as an essential step towards studying the regulation of GA expression, the human liver-type GA (hLGA) gene has been characterized. LGA genomic sequences were isolated using the genome walking technique. Analysis and comparison of these sequences with two LGA cDNA clones and the Human Genome Project database, allowed the determination of the genomic organization of the LGA gene. The gene has 18 exons and is approx. 18 kb long. All exon/intron junction sequences conform to the GT/AG rule. Progressive deletion analysis of LGA promoter-luciferase constructs indicated that the core promoter is located between nt -141 and +410, with several potential regulatory elements: CAAT, GC, TATA-like, Ras-responsive element binding protein and specificity protein 1 (Sp1) sites. The minimal promoter was mapped within +107 and +410, where only an Sp1 binding site is present. Mutation experiments suggested that two CAAT recognition elements near the transcription-initiation site (-138 and -87), play a crucial role for optimal promoter activity. Electrophoretic mobility-shift assays confirmed the importance of CAAT- and TATA-like boxes to enhance basal transcription, and demonstrated that HNF-1 motif is a significant distal element for transcriptional regulation of the hLGA gene. PMID:12444921

  7. Genome editing in nonhuman primates: approach to generating human disease models.

    PubMed

    Chen, Y; Niu, Y; Ji, W

    2016-09-01

    Nonhuman primates (NHPs) are superior than rodents to be animal models for the study of human diseases, due to their similarities in terms of genetics, physiology, developmental biology, social behaviour and cognition. Transgenic animals have become a key tool in functional genomics to generate models for human diseases and validate new drugs. However, until now, progress in the field of transgenic NHPs has been slow because of technological limitations. Many human diseases, including neurodegenerative disorders, are caused by mutations in endogenous genes. Fortunately, recent developments in precision gene editing have led to the generation of NHP models for human diseases. Since 2014, there have been several reports of the generation of monkey models using transcription activator-like endonucleases (TALENs) or clustered regularly interspaced short palindromic repeats (CRISPR/Cas9); some of these NHP models showed symptoms that were much closer to those of human diseases than have been seen previously in mouse models. No off-targeting was observed in the NHP models, and multiple gene knockout and biallelic mutants were feasible with low efficiency. These findings suggest that there are many possibilities to establish NHP models for human diseases that can mimic human diseases more faithfully than rodent models. PMID:27114283

  8. Resetting transcription factor control circuitry toward ground-state pluripotency in human.

    PubMed

    Takashima, Yasuhiro; Guo, Ge; Loos, Remco; Nichols, Jennifer; Ficz, Gabriella; Krueger, Felix; Oxley, David; Santos, Fatima; Clarke, James; Mansfield, William; Reik, Wolf; Bertone, Paul; Smith, Austin

    2014-09-11

    Current human pluripotent stem cells lack the transcription factor circuitry that governs the ground state of mouse embryonic stem cells (ESC). Here, we report that short-term expression of two components, NANOG and KLF2, is sufficient to ignite other elements of the network and reset the human pluripotent state. Inhibition of ERK and protein kinase C sustains a transgene-independent rewired state. Reset cells self-renew continuously without ERK signaling, are phenotypically stable, and are karyotypically intact. They differentiate in vitro and form teratomas in vivo. Metabolism is reprogrammed with activation of mitochondrial respiration as in ESC. DNA methylation is dramatically reduced and transcriptome state is globally realigned across multiple cell lines. Depletion of ground-state transcription factors, TFCP2L1 or KLF4, has marginal impact on conventional human pluripotent stem cells but collapses the reset state. These findings demonstrate feasibility of installing and propagating functional control circuitry for ground-state pluripotency in human cells. PMID:25215486

  9. Transcriptional Profiles of Imprinted Genes in Human Embryonic Stem Cells During In vitro Differentiation

    PubMed Central

    Park, Sang-Wook; Do, Hyo-Sang; Kim, Dongkyu; Ko, Ji-Yun; Lee, Sang-Hun; Han, Yong-Mahn

    2014-01-01

    Background and Objectives: Genomic imprinting is an inheritance phenomenon by which a subset of genes are expressed from one allele of two homologous chromosomes in a parent of origin-specific manner. Even though fine-tuned regulation of genomic imprinting process is essential for normal development, no other means are available to study genomic imprinting in human during embryonic development. In relation with this bottleneck, differentiation of human embryonic stem cells (hESCs) into specialized lineages may be considered as an alternative to mimic human development. Methods and Results: In this study, hESCs were differentiated into three lineage cell types to analyze temporal and spatial expression of imprinted genes. Of 19 imprinted genes examined, 15 imprinted genes showed similar transcriptional level among two hESC lines and two human induced pluripotent stem cell (hiPSC) lines. Expressional patterns of most imprinted genes were varied in progenitors and fully differentiated cells which were derived from hESCs. Also, no consistence was observed in the expression pattern of imprinted genes within an imprinting domain during in vitro differentiation of hESCs into three lineage cell types. Conclusions: Transcriptional expression of imprinted genes is regulated in a cell type- specific manner in hESCs during in vitro differentiation. PMID:25473448

  10. Human Trefoil Factor 3 induces the transcription of its own promoter through STAT3

    PubMed Central

    Sun, Yong; Wang, Liangxi; Zhou, Yifang; Mao, Xuefei; Deng, Xiangdong

    2016-01-01

    Human trefoil factor 3 (hTFF3) is a small peptide of potential therapeutic value. The mechanisms underlying the transcriptional regulation of hTFF3 remain unclear. The purpose of this study was to identify the core functional elements for the self-induction action of hTFF3 and transcription factors. First, truncated promoters were constructed to identify the functional regions of the hTFF3 promoter. Next, point mutation, chromatin immunoprecipitation, RNA interference, and gene overexpression experiments were performed to analyze the transcriptional binding sites responsible for the self-induced transcription of hTFF3. Our results revealed the −1450 bp to −1400 bp fragment of the hTFF3 promoter was the functional region for the self-induction action of hTFF3. Bioinformatics analysis confirmed that a STAT3 binding site is present in the −1417 bp to −1409 bp region. Subsequently, site-directed mutagenesis analysis determined that this STAT3 binding site was critical for the self-induction effect of hTFF3. ChIP experiments confirmed that STAT3 binds to the hTFF3 promoter. STAT3 overexpression and knockdown experiments revealed that STAT3 enhanced the self-induction effect and the expression of hTFF3. This study confirmed that hTFF3 exhibits self-induction action, and that STAT3 is the key transcription factor to maintain the function of self-induction. PMID:27453253

  11. Inhibition of p53 transcriptional activity by human cytomegalovirus UL44.

    PubMed

    Kwon, Yejin; Kim, Mi-Na; Young Choi, Eun; Heon Kim, Jung; Hwang, Eung-Soo; Cha, Chang-Yong

    2012-05-01

    Human cytomegalovirus (HCMV) stimulates cellular synthesis of DNA and proteins and induces transition of the cell cycle from G(1) to S and G(2) /M phase, in spite of increased amounts of p53 in the infected cells. The immediate early protein IE2-86  kDa (IE86) tethers a transcriptional repression domain to p53; however, its repression of p53 function is not enough to abrogate the G(1) checkpoint function of p53. Other HCMV proteins that suppress the activity of p53 were investigated in this study. Of the HCMV proteins that bind to p53 when assessed by immunoprecipitation and immunoblot analysis, HCMV UL44 was chosen as a candidate protein. It was found that reporter gene containing p53 consensus sequence was activated by transfection with wild type p53, but when plasmids of p53 with IE86 or UL44 were co-transfected, p53 transcriptional activity was decreased to 3-7% of the p53 control in a dose-dependent manner. When the deletion mutant of UL44 was co-transected with p53, the carboxyl one-third portion of UL44 had little effect on inhibition of p53 transcriptional activity. The amount of mRNA p21 was measured in H1299 by real time PCR after transfection of the combination of p53 and UL44 vectors and it was found that p21 transcription by p53 was inhibited dose-dependently by UL44. Increased G0/G1 and decreased S phases in p53 wild type-transfected H1299 cells were recovered to the level of p53 mutant type-transfected ones by the additional transfection of UL44 in a dose-dependent manner. In conclusion, the transcriptional activity of p53 is suppressed by UL44 as well as by IE86. PMID:22376288

  12. Site-Specific Oligonucleotide Binding Represses Transcription of the Human c-myc Gene in vitro

    NASA Astrophysics Data System (ADS)

    Cooney, Michael; Czernuszewicz, Graznya; Postel, Edith H.; Flint, S. Jane; Hogan, Michael E.

    1988-07-01

    A 27-base-long DNA oligonucleotide was designed that binds to duplex DNA at a single site within the 5' end of the human c-myc gene, 115 base pairs upstream from the transcription origin P1. On the basis of the physical properties of its bound complex, it was concluded that the oligonucleotide forms a colinear triplex with the duplex binding site. By means of an in vitro assay system, it was possible to show a correlation between triplex formation at -115 base pairs and repression of c-myc transcription. The possibility is discussed that triplex formation (site-specific RNA binding to a DNA duplex) could serve as the basis for an alternative program of gene control in vivo.

  13. Plastic downregulation of the transcriptional repressor BCL6 during maturation of human dendritic cells

    SciTech Connect

    Pantano, Serafino . E-mail: serafino.pantano@unil.ch; Jarrossay, David; Saccani, Simona; Bosisio, Daniela; Natoli, Gioacchino

    2006-05-01

    Dendritic cell (DC) maturation links peripheral events initiated by the encounter with pathogens to the activation and expansion of antigen-specific T lymphocytes in secondary lymphoid organs. Here, we describe an as yet unrecognized modulator of human DC maturation, the transcriptional repressor BCL6. We found that both myeloid and plasmacytoid DCs constitutively express BCL6, which is rapidly downregulated following maturation triggered by selected stimuli. Both in unstimulated and maturing DCs, control of BCL6 protein levels reflects the convergence of several mechanisms regulating BCL6 stability, mRNA transcription and nuclear export. By regulating the induction of several genes implicated in the immune response, including inflammatory cytokines, chemokines and survival genes, BCL6 may represent a pivotal modulator of the afferent branch of the immune response.

  14. Transcriptionally Driven DNA Replication Program of the Human Parasite Leishmania major.

    PubMed

    Lombraña, Rodrigo; Álvarez, Alba; Fernández-Justel, José Miguel; Almeida, Ricardo; Poza-Carrión, César; Gomes, Fábia; Calzada, Arturo; Requena, José María; Gómez, María

    2016-08-01

    Faithful inheritance of eukaryotic genomes requires the orchestrated activation of multiple DNA replication origins (ORIs). Although origin firing is mechanistically conserved, how origins are specified and selected for activation varies across different model systems. Here, we provide a complete analysis of the nucleosomal landscape and replication program of the human parasite Leishmania major, building on a better evolutionary understanding of replication organization in Eukarya. We found that active transcription is a driving force for the nucleosomal organization of the L. major genome and that both the spatial and the temporal program of DNA replication can be explained as associated to RNA polymerase kinetics. This simple scenario likely provides flexibility and robustness to deal with the environmental changes that impose alterations in the genetic programs during parasitic life cycle stages. Our findings also suggest that coupling replication initiation to transcription elongation could be an ancient solution used by eukaryotic cells for origin maintenance. PMID:27477279

  15. Transcriptional activity of human endogenous retrovirus in Albanian children with autism spectrum disorders.

    PubMed

    Balestrieri, Emanuela; Cipriani, Chiara; Matteucci, Claudia; Capodicasa, Natale; Pilika, Anita; Korca, Ina; Sorrentino, Roberta; Argaw-Denboba, Ayele; Bucci, Ilaria; Miele, Martino Tony; Coniglio, Antonella; Alessandrelli, Riccardo; Sinibaldi Vallebona, Paola

    2016-09-01

    Recent studies suggest that autism spectrum disorders (ASD) result from interactions between genetic and environmental factors, whose possible links could be represented by epigenetic mechanisms. Here, we investigated the transcriptional activity of three human endogenous retrovirus (HERV) families, in peripheral blood mononuclear cells (PBMCs) from Albanian ASD children, by quantitative real-time PCR. We aimed to confirm the different expression profile already found in Italian ASD children, and to highlight any social and family health condition emerging from information gathered through a questionnaire, to be included among environmental risk factors. The presence of increased HERV-H transcriptional activity in all autistic patients could be understood as a constant epigenetic imprinting of the disease, potentially useful for early diagnosis and for the development of effective novel therapeutic strategies. PMID:27602423

  16. Atomic force microscope observation of branching in single transcript molecules derived from human cardiac muscle

    NASA Astrophysics Data System (ADS)

    Reed, Jason; Hsueh, Carlin; Mishra, Bud; Gimzewski, James K.

    2008-09-01

    We have used an atomic force microscope to examine a clinically derived sample of single-molecule gene transcripts, in the form of double-stranded cDNA, (c: complementary) obtained from human cardiac muscle without the use of polymerase chain reaction (PCR) amplification. We observed a log-normal distribution of transcript sizes, with most molecules being in the range of 0.4-7.0 kilobase pairs (kb) or 130-2300 nm in contour length, in accordance with the expected distribution of mRNA (m: messenger) sizes in mammalian cells. We observed novel branching structures not previously known to exist in cDNA, and which could have profound negative effects on traditional analysis of cDNA samples through cloning, PCR and DNA sequencing.

  17. Human von Economo neurons express transcription factors associated with Layer V subcerebral projection neurons.

    PubMed

    Cobos, Inma; Seeley, William W

    2015-01-01

    The von Economo neurons (VENs) are large bipolar Layer V projection neurons found chiefly in the anterior cingulate and frontoinsular cortices. Although VENs have been linked to prevalent illnesses such as frontotemporal dementia, autism, and schizophrenia, little is known about VEN identity, including their major projection targets. Here, we undertook a developmental transcription factor expression study, focusing on markers associated with specific classes of Layer V projection neurons. Using mRNA in situ hybridization, we found that VENs prominently express FEZF2 and CTIP2, transcription factors that regulate the fate and differentiation of subcerebral projection neurons, in humans aged 3 months to 65 years. In contrast, few VENs expressed markers associated with callosal or corticothalamic projections. These findings suggest that VENs may represent a specialized Layer V projection neuron for linking cortical autonomic control sites to brainstem or spinal cord regions. PMID:23960210

  18. Transcription factor AP-2 regulates human immunodeficiency virus type 1 gene expression.

    PubMed Central

    Perkins, N D; Agranoff, A B; Duckett, C S; Nabel, G J

    1994-01-01

    Human immunodeficiency virus type 1 (HIV-1) gene expression is regulated by an enhancer region composed of multiple potential cis-acting regulatory sites. Here, we describe binding sites for the transcription factor AP-2 in the HIV-1 long terminal repeat which modulate HIV enhancer function. One site is embedded within the two previously described kappa B elements, and a second site is detected further downstream. DNase I footprinting and electrophoretic mobility shift assay experiments demonstrated that AP-2 binds to the site between the kappa B elements. Interestingly, AP-2 and NF-kappa B bind to this region in a mutually exclusive manner. Mutations which disrupt this AP-2-binding site lower basal levels of transcription but do not affect NF-kappa B-mediated induction by tumor necrosis factor alpha in Jurkat T leukemia cells. Images PMID:8084021

  19. Identification of the transcriptional response of human intestinal mucosa to Lactobacillus plantarum WCFS1 in vivo

    PubMed Central

    Troost, Freddy J; van Baarlen, Peter; Lindsey, Patrick; Kodde, Andrea; de Vos, Willem M; Kleerebezem, Michiel; Brummer, Robert-Jan M

    2008-01-01

    Background There is limited knowledge on the extent and dynamics of the mucosal response to commensal and probiotic species in the human intestinal lumen. This study aimed to identify the acute, time-dependent responses of intestinal mucosa to commensal Lactobacillus plantarum WCFS1 in vivo in two placebo-controlled human intervention studies in healthy volunteers. Transcriptional changes in duodenal mucosa upon continuous intraduodenal infusion of L. plantarum WCFS1 for one- and six h, respectively, were studied using oro- and nasogastric intubations with dedicated orogastric catheters and tissue sampling by standard flexible gastroduodenoscopy. Results One- and six-h exposure of small intestinal mucosa to L. plantarum WCFS1 induced differential expression of 669 and 424 gene reporters, respectively. While short-term exposure to L. plantarum WCFS1 inhibited fatty acid metabolism and cell cycle progression, cells switched to a more proliferative phase after prolonged exposure with an overall expression profile characterized by upregulation of genes involved in lipid metabolism, cellular growth and development. Cell death and immune responses were triggered, but cell death-executing genes or inflammatory signals were not expressed. Proteome analysis showed differential expression of several proteins. Only the microsomal protein 'microsomal triglyceride transfer protein' was regulated on both the transcriptional and the protein level in all subjects. Conclusion Overall, this study showed that intestinal exposure to L. plantarum WCFS1 induced consistent, time-dependent transcriptional responses in healthy intestinal mucosa. This extensive exploration of the human response to L. plantarum WCFS1 could eventually provide molecular support for specific or probiotic activity of this strain or species, and exemplifies the strength of the applied technology to identify the potential bio-activity of microbes in the human intestine. PMID:18681965

  20. Defining cell-type specificity at the transcriptional level in human disease

    PubMed Central

    Ju, Wenjun; Greene, Casey S.; Eichinger, Felix; Nair, Viji; Hodgin, Jeffrey B.; Bitzer, Markus; Lee, Young-suk; Zhu, Qian; Kehata, Masami; Li, Min; Jiang, Song; Rastaldi, Maria Pia; Cohen, Clemens D.; Troyanskaya, Olga G.; Kretzler, Matthias

    2013-01-01

    Cell-lineage–specific transcripts are essential for differentiated tissue function, implicated in hereditary organ failure, and mediate acquired chronic diseases. However, experimental identification of cell-lineage–specific genes in a genome-scale manner is infeasible for most solid human tissues. We developed the first genome-scale method to identify genes with cell-lineage–specific expression, even in lineages not separable by experimental microdissection. Our machine-learning–based approach leverages high-throughput data from tissue homogenates in a novel iterative statistical framework. We applied this method to chronic kidney disease and identified transcripts specific to podocytes, key cells in the glomerular filter responsible for hereditary and most acquired glomerular kidney disease. In a systematic evaluation of our predictions by immunohistochemistry, our in silico approach was significantly more accurate (65% accuracy in human) than predictions based on direct measurement of in vivo fluorescence-tagged murine podocytes (23%). Our method identified genes implicated as causal in hereditary glomerular disease and involved in molecular pathways of acquired and chronic renal diseases. Furthermore, based on expression analysis of human kidney disease biopsies, we demonstrated that expression of the podocyte genes identified by our approach is significantly related to the degree of renal impairment in patients. Our approach is broadly applicable to define lineage specificity in both cell physiology and human disease contexts. We provide a user-friendly website that enables researchers to apply this method to any cell-lineage or tissue of interest. Identified cell-lineage–specific transcripts are expected to play essential tissue-specific roles in organogenesis and disease and can provide starting points for the development of organ-specific diagnostics and therapies. PMID:23950145

  1. Genetic factors affecting gene transcription and catalytic activity of UDP-glucuronosyltransferases in human liver

    PubMed Central

    Liu, Wanqing; Ramírez, Jacqueline; Gamazon, Eric R.; Mirkov, Snezana; Chen, Peixian; Wu, Kehua; Sun, Chang; Cox, Nancy J.; Cook, Edwin; Das, Soma; Ratain, Mark J.

    2014-01-01

    The aim of this study was to discover cis- and trans-acting factors significantly affecting mRNA expression and catalytic activity of human hepatic UDP-glucuronosyltransferases (UGTs). Transcription levels of five major hepatic UGT1A (UGT1A1, UGT1A3, UGT1A4, UGT1A6 and UGT1A9) and five UGT2B (UGT2B4, UGT2B7, UGT2B10, UGT2B15 and UGT2B17) genes were quantified in human liver tissue samples (n = 125) using real-time PCR. Glucuronidation activities of 14 substrates were measured in 47 livers. We genotyped 167 tagSNPs (single-nucleotide polymorphisms) in UGT1A (n = 43) and UGT2B (n = 124), as well as the known functional UGT1A1*28 and UGT2B17 CNV (copy number variation) polymorphisms. Transcription levels of 15 transcription factors (TFs) known to regulate these UGTs were quantified. We found that UGT expression and activity were highly variable among the livers (median and range of coefficient of variations: 135%, 74–217% and 52%, 39–105%, respectively). CAR, PXR and ESR1 were found to be the most important trans-regulators of UGT transcription (median and range of correlation coefficients: 46%, 6–58%; 47%, 9–58%; and 52%, 24–75%, respectively). Hepatic UGT activities were mainly determined by UGT gene transcription levels. Twenty-one polymorphisms were significantly (FDR-adjusted P < 0.05) associated with mRNA expression and/or activities of UGT1A1, UGT1A3 and UGT2B17. We found novel SNPs in the UGT2B17 CNV region accounting for variability in UGT2B17 gene transcription and testosterone glucuronidation rate, in addition to that attributable to the UGT2B17 CNV. Our study discovered novel pharmacogenetic markers and provided detailed insight into the genetic network regulating hepatic UGTs. PMID:24879639

  2. Generation of rodent and human osteoblasts

    PubMed Central

    Taylor, Sarah E B; Shah, Mittal; Orriss, Isabel R

    2014-01-01

    This paper describes the isolation, culture and staining of primary osteoblasts from neonatal rodents and human samples. The calvaria and long-bone assays allow direct measurement of bone matrix deposition and mineralisation, as well as producing osteoblasts at defined stages of differentiation for molecular and histological analysis. Culture of human osteoblasts enables cell function to be investigated in targeted patient groups. The described methods will provide a step-by-step guide of what to expect at each stage of the culture and highlight the varied tissue culture conditions required to successfully grow osteoblasts from different sources. A special focus of this paper is the methods used for analysis of bone mineralisation and how to ensure that nonspecific mineral deposition or staining is not quantified. PMID:25396049

  3. Enhanced Generation of Myeloid Lineages in Hematopoietic Differentiation from Embryonic Stem Cells by Silencing Transcriptional Repressor Twist-2

    PubMed Central

    Sharabi, Andrew B.; Lee, Sung-Hyung; Goodell, Margaret A.; Huang, Xue F.

    2009-01-01

    Abstract The self-renewal and multilineage differentiation of embryonic stem cells (ESC) is largely governed by transcription factors or repressors. Extensive efforts have focused on elucidating critical factors that control the differentiation of specific cell lineages, for instance, myeloid lineages in hematopoietic development. In this study, we found that Twist-2, a basic helix-loop-helix (bHLH) transcription factor, plays a critical role in inhibiting the differentiation of ESC. Murine ES cells, in which Twist-2 expression is silenced by lentivirally delivered shRNA, exhibit an enhanced formation of primary embryoid bodies (EB) and enhanced differentiation into mesodermally derived hematopoietic colonies. Furthermore, Twist-2 silenced (LV-siTwist-2) ESC display significantly increased generation of myeloid lineages (Gr-1+ and F4/80+ cells) during in vitro hematopoietic differentiation. Treatment with the Toll-like receptor (TLR) 4 ligand synergistically stimulates the generation of primary EB formation as well as of hematopoietic progenitors differentiated from LV-siTwist-2 ES cells. Thus, this study reveals the critical role of the transcriptional repressor Twist-2 in regulating the development of myeloid lineage in hematopoietic differentiation from ESC. This study also suggests a potential strategy for directional differentiation of ESC by inhibiting a transcriptional repressor. PMID:20025523

  4. Repression in vitro, by human adenovirus E1A protein domains, of basal or Tat-activated transcription of the human immunodeficiency virus type 1 long terminal repeat.

    PubMed Central

    Song, C Z; Loewenstein, P M; Green, M

    1995-01-01

    Human adenovirus E1A proteins can repress the expression of several viral and cellular genes. By using a cell-free transcription system, we demonstrated that the gene product of the E1A 12S mRNA, the 243-residue protein E1A243R, inhibits basal transcription from the human immunodeficiency virus type 1 (HIV-1) long terminal repeat (LTR). The HIV-1 transactivator protein Tat greatly stimulates transcription from the viral promoter in vitro. However, E1A243R can repress Tat-activated transcription in vitro. Strong repression of both basal and Tat-activated transcriptions requires only E1A N-terminal amino acid residues 1 to 80. Deletion analysis showed that E1A N-terminal amino acids 4 to 25 are essential for repression, whereas amino acid residues 30 to 49 and 70 to 80 are dispensable. Transcriptional repression by E1A in the cell-free transcription system is promoter specific, since under identical conditions, transcription of the adenovirus major late promoter and the Rous sarcoma virus LTR promoter was unaffected. The repression of transcription by small E1A peptides in vitro provides an assay for investigation of molecular mechanisms governing E1A-mediated repression of both basal and Tat-activated transcriptions of the HIV-1 LTR promoter. PMID:7707515

  5. The Mission Transcript Collection: U.S. Human Spaceflight Missions from Mercury Redstone 3 to Apollo 17

    NASA Technical Reports Server (NTRS)

    2000-01-01

    Aboard every U.S. piloted spacecraft, from Mercury through Apollo, NASA installed tape recorders that captured nearly every word spoken by the astronauts during their history-making flights into space. For the first time ever, NASA has digitally scanned all of the transcripts made from both the onboard tapes and those tape recordings made on the ground from the air-to-ground transmissions and placed them on this two CD-ROM set. Gathered in this special collection are 80 transcripts totaling nearly 45,000 pages of text that cover every US human spaceflight from the first human Mercury mission through the last lunar landing flight of Apollo 17. Users of this CD will note that the quantity and type of transcripts made for each mission vary. For example, the Mercury flights each had one transcript whereas the Gemini missions produced several. Starting with the Gemini flights, NASA produced a Public Affairs Office (PAO) commentary version, as well as at least one "technical" air-to-ground transcript version, per mission. Most of the Apollo missions produced four transcripts per flight. These included the onboard voice data recorder transcripts made from the Data Storage Equipment (DSE) on the Command Module (CM), and the Data Storage Electronics Assembly (DSEA) onboard the Lunar Module (LM), in addition to the PAO commentary and air-to-ground technical transcripts. The CD set includes an index listing each transcript file by name. Some of the transcripts include a detailed explanation of their contents and how they were made. Also included in this collection is a listing of all the original air-to-ground audiotapes housed in NASA's archives from which many of these transcripts were made. We hope you find this collection of transcripts interesting and useful.

  6. LncRNA profiling of human lymphoid progenitors reveals transcriptional divergence of B and T lineages

    PubMed Central

    Casero, David; Sandoval, Salemiz; Seet, Christopher S.; Scholes, Jessica; Zhu, Yuhua; Ha, Vi Luan; Luong, Annie; Parekh, Chintan; Crooks, Gay M.

    2015-01-01

    To elucidate the transcriptional landscape that regulates human lymphoid commitment during postnatal life, we used RNA sequencing to assemble the long non-coding transcriptome across human bone marrow and thymic progenitors spanning the earliest stages of B and T lymphoid specification. Over 3000 novel long non-coding RNA genes (lncRNAs) were revealed through the analysis of these rare populations. Lymphoid commitment was characterized by lncRNA expression patterns that were highly stage-specific and more lineage-specific than protein coding patterns. Protein-coding genes co-expressed with neighboring lncRNA genes were enriched for ontologies related to lymphoid differentiation. The exquisite cell-type specificity of global lncRNA expression patterns independently revealed new developmental relationships between the earliest progenitors in the human bone marrow and thymus. PMID:26502406

  7. Transcriptional activity of the human pseudogene psi alpha globin compared with alpha globin, its functional gene counterpart.

    PubMed Central

    Whitelaw, E; Proudfoot, N J

    1983-01-01

    Transcriptional analysis of the human pseudogene psi alpha globin has revealed the following features: (1) The promoter with a 23 bp deletion between the CCAAT and ATA boxes is functional both in vitro and in vivo, 3 fold and 10 fold less efficient, respectively, than alpha. (2) Both the psi alpha and alpha globin gene promoters are active in the absence of transcriptional enhancers, either a gene-encoded or viral enhancer. (3) The mutated poly(A) addition signal in psi alpha (AATGAA) appears to be completely nonfunctional. This result provides an explanation for the absence of psi alpha transcripts in human erythroid cells. Images PMID:6316269

  8. Isolation of All CD44 Transcripts in Human Epidermis and Regulation of Their Expression by Various Agents

    PubMed Central

    Teye, Kwesi; Numata, Sanae; Ishii, Norito; Krol, Rafal P.; Tsuchisaka, Atsunari; Hamada, Takahiro; Koga, Hiroshi; Karashima, Tadashi; Ohata, Chika; Tsuruta, Daisuke; Saya, Hideyuki; Haftek, Marek; Hashimoto, Takashi

    2016-01-01

    CD44, a cell surface proteoglycan, is involved in many biological events. CD44 transcripts undergo complex alternative splicing, resulting in many functionally distinct isoforms. To date, however, the nature of these isoforms in human epidermis has not been adequately determined. In this study, we isolated all CD44 transcripts from normal human epidermis, and studied how their expressions are regulated. By RT-PCR, we found that a number of different CD44 transcripts were expressed in human epidermis, and we obtained all these transcripts from DNA bands in agarose and acrylamide gels by cloning. Detailed sequence analysis revealed 18 CD44 transcripts, 3 of which were novel. Next, we examined effects of 10 different agents on the expression of CD44 transcripts in cultured human keratinocytes, and found that several agents, particularly epidermal growth factor, hydrogen peroxide, phorbol 12-myristate 13-acetate, retinoic acid, calcium and fetal calf serum differently regulated their expressions in various patterns. Furthermore, normal and malignant keratinocytes were found to produce different CD44 transcripts upon serum stimulation and subsequent starvation, suggesting that specific CD44 isoforms are involved in tumorigenesis via different CD44-mediated biological pathways. PMID:27505250

  9. Nucleotide sequences of cDNAs for human papillomavirus type 18 transcripts in HeLa cells

    SciTech Connect

    Inagaki, Yutaka; Tsunokawa, Youko; Takebe, Naoko; Terada, Masaaki; Sugimura, Takashi ); Nawa, Hiroyuki; Nakanishi, Shigetada )

    1988-05-01

    HeLa cells expressed 3.4- and 1.6-kilobase (kb) transcripts of the integrated human papillomavirus (HPV) type 18 genome. Two types of cDNA clones representing each size of HPV type 18 transcript were isolated. Sequence analysis of these two types of cDNA clones revealed that the 3.4-kb transcript contained E6, E7, the 5{prime} portion of E1, and human sequence and that the 1.6-kb transcript contained spliced and frameshifted E6 (E6{sup *}), E7, and human sequence. There was a common human sequence containing a poly(A) addition signal in the 3{prime} end portions of both transcripts, indicating that they were transcribed from the HPV genome at the same integration site with different splicing. Furthermore, the 1.6-kb transcript contained both of the two viral TATA boxes upstream of E6, strongly indicating that a cellular promoter was used for its transcription.

  10. Bacillus anthracis’ lethal toxin induces broad transcriptional responses in human peripheral monocytes

    PubMed Central

    2012-01-01

    Background Anthrax lethal toxin (LT), produced by the Gram-positive bacterium Bacillus anthracis, is a highly effective zinc dependent metalloprotease that cleaves the N-terminus of mitogen-activated protein kinase kinases (MAPKK or MEKs) and is known to play a role in impairing the host immune system during an inhalation anthrax infection. Here, we present the transcriptional responses of LT treated human monocytes in order to further elucidate the mechanisms of LT inhibition on the host immune system. Results Western Blot analysis demonstrated cleavage of endogenous MEK1 and MEK3 when human monocytes were treated with 500 ng/mL LT for four hours, proving their susceptibility to anthrax lethal toxin. Furthermore, staining with annexin V and propidium iodide revealed that LT treatment did not induce human peripheral monocyte apoptosis or necrosis. Using Affymetrix Human Genome U133 Plus 2.0 Arrays, we identified over 820 probe sets differentially regulated after LT treatment at the p <0.001 significance level, interrupting the normal transduction of over 60 known pathways. As expected, the MAPKK signaling pathway was most drastically affected by LT, but numerous genes outside the well-recognized pathways were also influenced by LT including the IL-18 signaling pathway, Toll-like receptor pathway and the IFN alpha signaling pathway. Multiple genes involved in actin regulation, signal transduction, transcriptional regulation and cytokine signaling were identified after treatment with anthrax LT. Conclusion We conclude LT directly targets human peripheral monocytes and causes multiple aberrant gene responses that would be expected to be associated with defects in human monocyte’s normal signaling transduction pathways and function. This study provides further insights into the mechanisms associated with the host immune system collapse during an anthrax infection, and suggests that anthrax LT may have additional downstream targets outside the well-known MAPK

  11. Osterix and RUNX2 are Transcriptional Regulators of Sclerostin in Human Bone.

    PubMed

    Pérez-Campo, Flor M; Santurtún, Ana; García-Ibarbia, Carmen; Pascual, María A; Valero, Carmen; Garcés, Carlos; Sañudo, Carolina; Zarrabeitia, María T; Riancho, José A

    2016-09-01

    Sclerostin, encoded by the SOST gene, works as an inhibitor of the Wnt pathway and therefore is an important regulator of bone homeostasis. Due to its potent action as an inhibitor of bone formation, blocking sclerostin activity is the purpose of recently developed anti-osteoporotic treatments. Two bone-specific transcription factors, RUNX2 and OSX, have been shown to interact and co-ordinately regulate the expression of bone-specific genes. Although it has been recently shown that sclerostin is targeted by OSX in mice, there is currently no information of whether this is also the case in human cells. We have identified SP-protein family and AML1 consensus binding sequences at the human SOST promoter and have shown that OSX, together with RUNX2, binds to a specific region close to the transcription start site. Furthermore, we show that OSX and RUNX2 activate SOST expression in a co-ordinated manner in vitro and that SOST expression levels show a significant positive correlation with OSX/RUNX2 expression levels in human bone. We also confirmed previous results showing an association of several SOST/RUNX2 polymorphisms with bone mineral density. PMID:27154028

  12. A novel transcriptional regulator of L-arabinose utilization in human gut bacteria

    PubMed Central

    Chang, Changsoo; Tesar, Christine; Li, Xiaoqing; Kim, Youngchang; Rodionov, Dmitry A.; Joachimiak, Andrzej

    2015-01-01

    Carbohydrate metabolism plays a crucial role in the ecophysiology of human gut microbiota. Mechanisms of transcriptional regulation of sugar catabolism in commensal and prevalent human gut bacteria such as Bacteroides thetaiotaomicron remain mostly unknown. By a combination of bioinformatics and experimental approaches, we have identified an NrtR family transcription factor (BT0354 in B. thetaiotaomicron, BtAraR) as a novel regulator controlling the arabinose utilization genes. L-arabinose was confirmed to be a negative effector of BtAraR. We have solved the crystal structures of the apo and L-arabinose-bound BtAraR proteins, as well as the complex of apo-protein with a specific DNA operator. BtAraR forms a homodimer with each subunit comprised of the ligand-binding Nudix hydrolase-like domain and the DNA-binding winged-helix-turn-helix (wHTH) domain. We have identified the residues involved in binding of L-arabinose and recognition of DNA. The majority of these residues are well conserved in the AraR orthologs in Bacteroidetes. In the structure of the BtAraR–DNA complex, we found the unique interaction of arginine intercalating its guanidinum moiety into the base pair stacking of B-DNA. L-arabinose binding induces movement of wHTH domains, resulting in a conformation unsuitable for DNA binding. Our analysis facilitates reconstruction of the metabolic and regulatory networks involved in carbohydrate utilization in human gut Bacteroides. PMID:26438537

  13. Genomic mapping and cellular expression of human CPG2 transcripts in the SYNE1 gene.

    PubMed

    Loebrich, Sven; Rathje, Mette; Hager, Emily; Ataman, Bulent; Harmin, David A; Greenberg, Michael E; Nedivi, Elly

    2016-03-01

    Bipolar disorder (BD) is a prevalent and severe mood disorder characterized by recurrent episodes of mania and depression. Both genetic and environmental factors have been implicated in BD etiology, but the biological underpinnings remain elusive. Recent genome-wide association studies (GWAS) for identifying genes conferring risk for schizophrenia, BD, and major depression, identified an association between single-nucleotide polymorphisms (SNPs) in the SYNE1 gene and increased risk of BD. SYNE1 has also been identified as a risk locus for multiple other neurological or neuromuscular genetic disorders. The BD associated SNPs map within the gene region homologous to part of rat Syne1 encompassing the brain specific transcripts encoding CPG2, a postsynaptic neuronal protein localized to excitatory synapses and an important regulator of glutamate receptor internalization. Here, we use RNA-seq, ChIP-seq and RACE to map the human SYNE1 transcriptome, focusing on the CPG2 locus. We validate several CPG2 transcripts, including ones not previously annotated in public databases, and identify and clone a full-length CPG2 cDNA expressed in human neocortex, hippocampus and striatum. Using lenti-viral gene knock down/replacement and surface receptor internalization assays, we demonstrate that human CPG2 protein localizes to dendritic spines in rat hippocampal neurons and is functionally equivalent to rat CPG2 in regulating glutamate receptor internalization. This study provides a valuable gene-mapping framework for relating multiple genetic disease loci in SYNE1 with their transcripts, and for evaluating the effects of missense SNPs identified by patient genome sequencing on neuronal function. PMID:26704904

  14. Transcriptional Factor PU.1 Regulates Decidual C1q Expression in Early Pregnancy in Human.

    PubMed

    Madhukaran, Shanmuga Priyaa; Kishore, Uday; Jamil, Kaiser; Teo, Boon Heng Dennis; Choolani, Mahesh; Lu, Jinhua

    2015-01-01

    C1q is the first recognition subcomponent of the complement classical pathway, which in addition to being synthesized in the liver, is also expressed by macrophages and dendritic cells (DCs). Trophoblast invasion during early placentation results in accumulation of debris that triggers the complement system. Hence, both early and late components of the classical pathway are widely distributed in the placenta and decidua. In addition, C1q has recently been shown to significantly contribute to feto-maternal tolerance, trophoblast migration, and spiral artery remodeling, although the exact mechanism remains unknown. Pregnancy in mice, genetically deficient in C1q, mirrors symptoms similar to that of human preeclampsia. Thus, regulated complement activation has been proposed as an essential requirement for normal successful pregnancy. Little is known about the molecular pathways that regulate C1q expression in pregnancy. PU.1, an Ets-family transcription factor, is required for the development of hematopoietic myeloid lineage immune cells, and its expression is tissue-specific. Recently, PU.1 has been shown to regulate C1q gene expression in DCs and macrophages. Here, we have examined if PU.1 transcription factor regulates decidual C1q expression. We used immune-histochemical analysis, PCR, and immunostaining to localize and study the gene expression of PU.1 transcription factor in early human decidua. PU.1 was highly expressed at gene and protein level in early human decidual cells including trophoblast and stromal cells. Surprisingly, nuclear as well as cytoplasmic PU.1 expression was observed. Decidual cells with predominantly nuclear PU.1 expression had higher C1q expression. It is likely that nuclear and cytoplasmic PU.1 localization has a role to play in early pregnancy via regulating C1q expression in the decidua during implantation. PMID:25762996

  15. Transcriptional regulation of human ferredoxin reductase through an intronic enhancer in steroidogenic cells.

    PubMed

    Imamichi, Yoshitaka; Mizutani, Tetsuya; Ju, Yunfeng; Matsumura, Takehiro; Kawabe, Shinya; Kanno, Masafumi; Yazawa, Takashi; Miyamoto, Kaoru

    2014-01-01

    Ferredoxin reductase (FDXR, also known as adrenodoxin reductase) is a mitochondrial flavoprotein that transfers electrons from NADPH to mitochondrial cytochrome P450 enzymes, mediating the function of an iron-sulfur cluster protein, ferredoxin. FDXR functions in various metabolic processes including steroidogenesis. It is well known that multiple steroidogenic enzymes are regulated by a transcription factor steroidogenic factor-1 (SF-1, also known as Ad4BP). Previously, we have shown that SF-1 transduction causes human mesenchymal stem cell differentiation into steroidogenic cells. Genome-wide analysis of differentiated cells, using a combination of DNA microarray and promoter tiling array analyses, showed that FDXR is a novel SF-1 target gene. In this study, the transcriptional regulatory mechanism of FDXR was examined in steroidogenic cells. A chromatin immunoprecipitation assay revealed that a novel SF-1 binding region was located within intron 2 of the human FDXR gene. Luciferase reporter assays showed that FDXR transcription was activated through the novel SF-1 binding site within intron 2. Endogenous SF-1 knockdown in human adrenocortical H295R and KGN cells decreased FDXR expression. In H295R cells, strong binding of two histone markers of active enhancers, histones H3K27ac and H3K4me2, were detected near the SF-1 binding site within intron 2. Furthermore, the binding of these histone markers was decreased concurrent with SF-1 knockdown in H295R cells. These results indicated that abundant FDXR expression in these steroidogenic cells was maintained through SF-1 binding to the intronic enhancer of the FDXR gene. PMID:24321386

  16. The Transcription and Translation Landscapes during Human Cytomegalovirus Infection Reveal Novel Host-Pathogen Interactions.

    PubMed

    Tirosh, Osnat; Cohen, Yifat; Shitrit, Alina; Shani, Odem; Le-Trilling, Vu Thuy Khanh; Trilling, Mirko; Friedlander, Gilgi; Tanenbaum, Marvin; Stern-Ginossar, Noam

    2015-01-01

    Viruses are by definition fully dependent on the cellular translation machinery, and develop diverse mechanisms to co-opt this machinery for their own benefit. Unlike many viruses, human cytomegalovirus (HCMV) does suppress the host translation machinery, and the extent to which translation machinery contributes to the overall pattern of viral replication and pathogenesis remains elusive. Here, we combine RNA sequencing and ribosomal profiling analyses to systematically address this question. By simultaneously examining the changes in transcription and translation along HCMV infection, we uncover extensive transcriptional control that dominates the response to infection, but also diverse and dynamic translational regulation for subsets of host genes. We were also able to show that, at late time points in infection, translation of viral mRNAs is higher than that of cellular mRNAs. Lastly, integration of our translation measurements with recent measurements of protein abundance enabled comprehensive identification of dozens of host proteins that are targeted for degradation during HCMV infection. Since targeted degradation indicates a strong biological importance, this approach should be applicable for discovering central host functions during viral infection. Our work provides a framework for studying the contribution of transcription, translation and degradation during infection with any virus. PMID:26599541

  17. Genomic localization, sequence analysis, and transcription of the putative human cytomegalovirus DNA polymerase gene.

    PubMed Central

    Heilbronn, R; Jahn, G; Bürkle, A; Freese, U K; Fleckenstein, B; zur Hausen, H

    1987-01-01

    The human cytomegalovirus (HCMV)-induced DNA polymerase has been well characterized biochemically and functionally, but its genomic location has not yet been assigned. To identify the coding sequence, cross-hybridization with the herpes simplex virus type 1 (HSV-1) polymerase gene was used, as suggested by the close similarity of the herpes group virus-induced DNA polymerases to the HCMV DNA polymerase. A cosmid and plasmid library of the entire HCMV genome was screened with the BamHI Q fragment of HSV-1 at different stringency conditions. One PstI-HincII restriction fragment of 850 base pairs mapping within the EcoRI M fragment of HCMV cross-hybridized at Tm - 25 degrees C. Sequence analysis revealed one open reading frame spanning the entire sequence. The amino acid sequence showed a highly conserved domain of 133 amino acids shared with the HSV and putative Epstein-Barr virus polymerase sequences. This domain maps within the C-terminal part of the HSV polymerase gene, which has been suggested to contain part of the catalytic center of the enzyme. Transcription analysis revealed one 5.4-kilobase early transcript in the sense orientation with respect to the open reading frame identified. This transcript appears to code for the 140-kilodalton HCMV polymerase protein. Images PMID:3023689

  18. YY1 represses human papillomavirus type 16 transcription by quenching AP-1 activity.

    PubMed Central

    O'Connor, M J; Tan, S H; Tan, C H; Bernard, H U

    1996-01-01

    YY1 is a multifunctional transcription factor that has been shown to regulate the expression of a number of cellular and viral genes, including the human papillomavirus (HPV) oncogenes E6 and E7. In this study, we have analyzed the YY1-mediated repression of the HPV type 16 (HPV-16) E6-E7 promoter. A systematic analysis to identify YY1 sites present in the HPV-16 long control region showed that of 30 potential YY1 binding motifs, 24 bound purified recombinant YY1 protein, but only 10 of these were able to bind YY1 when nuclear extracts of HeLa cells were used. Of these, only a cluster of five sites, located in the vicinity of an AP-1 motif, were found to be responsible for repressing the HPV-16 P97 promoter. All five sites were required for repression, the mutation of any one site giving rise to a four- to sixfold increase in transcriptional activity. The target for YY1-mediated repression was identified as being a highly conserved AP-1 site, and we propose that AP-1 may represent a common target for YY1 repression. We also provide data demonstrating that YY1 can bind the transcriptional coactivator CREB-binding protein and propose a potentially novel mechanism by which YY1 represses AP-1 activity as a result of this YY1-CREB-binding protein interaction. PMID:8794287

  19. The Transcription and Translation Landscapes during Human Cytomegalovirus Infection Reveal Novel Host-Pathogen Interactions

    PubMed Central

    Shitrit, Alina; Shani, Odem; Le-Trilling, Vu Thuy Khanh; Trilling, Mirko; Friedlander, Gilgi; Tanenbaum, Marvin; Stern-Ginossar, Noam

    2015-01-01

    Viruses are by definition fully dependent on the cellular translation machinery, and develop diverse mechanisms to co-opt this machinery for their own benefit. Unlike many viruses, human cytomegalovirus (HCMV) does suppress the host translation machinery, and the extent to which translation machinery contributes to the overall pattern of viral replication and pathogenesis remains elusive. Here, we combine RNA sequencing and ribosomal profiling analyses to systematically address this question. By simultaneously examining the changes in transcription and translation along HCMV infection, we uncover extensive transcriptional control that dominates the response to infection, but also diverse and dynamic translational regulation for subsets of host genes. We were also able to show that, at late time points in infection, translation of viral mRNAs is higher than that of cellular mRNAs. Lastly, integration of our translation measurements with recent measurements of protein abundance enabled comprehensive identification of dozens of host proteins that are targeted for degradation during HCMV infection. Since targeted degradation indicates a strong biological importance, this approach should be applicable for discovering central host functions during viral infection. Our work provides a framework for studying the contribution of transcription, translation and degradation during infection with any virus. PMID:26599541

  20. Transcription Regulation of the Human Telomerase Reverse Transcriptase (hTERT) Gene

    PubMed Central

    Ramlee, Muhammad Khairul; Wang, Jing; Toh, Wei Xun; Li, Shang

    2016-01-01

    Embryonic stem cells and induced pluripotent stem cells have the ability to maintain their telomere length via expression of an enzymatic complex called telomerase. Similarly, more than 85%–90% of cancer cells are found to upregulate the expression of telomerase, conferring them with the potential to proliferate indefinitely. Telomerase Reverse Transcriptase (TERT), the catalytic subunit of telomerase holoenzyme, is the rate-limiting factor in reconstituting telomerase activity in vivo. To date, the expression and function of the human Telomerase Reverse Transcriptase (hTERT) gene are known to be regulated at various molecular levels (including genetic, mRNA, protein and subcellular localization) by a number of diverse factors. Among these means of regulation, transcription modulation is the most important, as evident in its tight regulation in cancer cell survival as well as pluripotent stem cell maintenance and differentiation. Here, we discuss how hTERT gene transcription is regulated, mainly focusing on the contribution of trans-acting factors such as transcription factors and epigenetic modifiers, as well as genetic alterations in hTERT proximal promoter. PMID:27548225

  1. Direct induction of haematoendothelial programs in human pluripotent stem cells by transcriptional regulators.

    PubMed

    Elcheva, Irina; Brok-Volchanskaya, Vera; Kumar, Akhilesh; Liu, Patricia; Lee, Jeong-Hee; Tong, Lilian; Vodyanik, Maxim; Swanson, Scott; Stewart, Ron; Kyba, Michael; Yakubov, Eduard; Cooke, John; Thomson, James A; Slukvin, Igor

    2014-01-01

    Advancing pluripotent stem cell technologies for modelling haematopoietic stem cell development and blood therapies requires identifying key regulators of haematopoietic commitment from human pluripotent stem cells (hPSCs). Here, by screening the effect of 27 candidate factors, we reveal two groups of transcriptional regulators capable of inducing distinct haematopoietic programs from hPSCs: pan-myeloid (ETV2 and GATA2) and erythro-megakaryocytic (GATA2 and TAL1). In both cases, these transcription factors directly convert hPSCs to endothelium, which subsequently transform into blood cells with pan-myeloid or erythro-megakaryocytic potential. These data demonstrate that two distinct genetic programs regulate the haematopoietic development from hPSCs and that both of these programs specify hPSCs directly to haemogenic endothelial cells. In addition, this study provides a novel method for the efficient induction of blood and endothelial cells from hPSCs via the overexpression of modified mRNA for the selected transcription factors. PMID:25019369

  2. Transcription Regulation of the Human Telomerase Reverse Transcriptase (hTERT) Gene.

    PubMed

    Ramlee, Muhammad Khairul; Wang, Jing; Toh, Wei Xun; Li, Shang

    2016-01-01

    Embryonic stem cells and induced pluripotent stem cells have the ability to maintain their telomere length via expression of an enzymatic complex called telomerase. Similarly, more than 85%-90% of cancer cells are found to upregulate the expression of telomerase, conferring them with the potential to proliferate indefinitely. Telomerase Reverse Transcriptase (TERT), the catalytic subunit of telomerase holoenzyme, is the rate-limiting factor in reconstituting telomerase activity in vivo. To date, the expression and function of the human Telomerase Reverse Transcriptase (hTERT) gene are known to be regulated at various molecular levels (including genetic, mRNA, protein and subcellular localization) by a number of diverse factors. Among these means of regulation, transcription modulation is the most important, as evident in its tight regulation in cancer cell survival as well as pluripotent stem cell maintenance and differentiation. Here, we discuss how hTERT gene transcription is regulated, mainly focusing on the contribution of trans-acting factors such as transcription factors and epigenetic modifiers, as well as genetic alterations in hTERT proximal promoter. PMID:27548225

  3. Genomic localization, sequence analysis, and transcription of the putative human cytomegalovirus DNA polymerase gene

    SciTech Connect

    Heilbronn, T.; Jahn, G.; Buerkle, A.; Freese, U.K.; Fleckenstein, B.; Zur Hausen, H.

    1987-01-01

    The human cytomegalovirus (HCMV)-induced DNA polymerase has been well characterized biochemically and functionally, but its genomic location has not yet been assigned. To identify the coding sequence, cross-hybridization with the herpes simplex virus type 1 (HSV-1) polymerase gene was used, as suggested by the close similarity of the herpes group virus-induced DNA polymerases to the HCMV DNA polymerase. A cosmid and plasmid library of the entire HCMV genome was screened with the BamHI Q fragment of HSF-1 at different stringency conditions. One PstI-HincII restriction fragment of 850 base pairs mapping within the EcoRI M fragment of HCMV cross-hybridized at T/sub m/ - 25/degrees/C. Sequence analysis revealed one open reading frame spanning the entire sequence. The amino acid sequence showed a highly conserved domain of 133 amino acids shared with the HSV and putative Esptein-Barr virus polymerase sequences. This domain maps within the C-terminal part of the HSV polymerase gene, which has been suggested to contain part of the catalytic center of the enzyme. Transcription analysis revealed one 5.4-kilobase early transcript in the sense orientation with respect to the open reading frame identified. This transcript appears to code for the 140-kilodalton HCMV polymerase protein.

  4. Transcriptional Repression of E-Cadherin by Human Papillomavirus Type 16 E6

    PubMed Central

    D'Costa, Zarina J.; Jolly, Carol; Androphy, Elliot J.; Mercer, Andrew; Matthews, Charles M.; Hibma, Merilyn H.

    2012-01-01

    There is increasing evidence supporting DNA virus regulation of the cell adhesion and tumour suppressor protein, E-cadherin. We previously reported that loss of E-cadherin in human papillomavirus (HPV) type 16-infected epidermis is contributed to by the major viral proto-oncogene E6 and is associated with reduced Langerhans cells density, potentially regulating the immune response. The focus of this study is determining how the HPV16 E6 protein mediates E-cadherin repression. We found that the E-cadherin promoter is repressed in cells expressing E6, resulting in fewer E-cadherin transcripts. On exploring the mechanism for this, repression by increased histone deacetylase activity or by increased binding of trans-repressors to the E-cadherin promoter Epal element was discounted. In contrast, DNA methyltransferase (DNMT) activity was increased in E6 expressing cells. Upon inhibiting DNMT activity using 5-Aza-2′-deoxycytidine, E-cadherin transcription was restored in the presence of HPV16 E6. The E-cadherin promoter was not directly methylated, however a mutational analysis showed general promoter repression and reduced binding of the transactivators Sp1 and AML1 and the repressor Slug. Expression of E7 with E6 resulted in a further reduction in surface E-cadherin levels. This is the first report of HPV16 E6-mediated transcriptional repression of this adhesion molecule and tumour suppressor protein. PMID:23189137

  5. Molecular characterization of the ets-related human transcription factor ER81.

    PubMed

    Monté, D; Coutte, L; Baert, J L; Angeli, I; Stéhelin, D; de Launoit, Y

    1995-08-17

    The PEA3 group is a homogeneous group of the ets transcription factor family and is composed of three known members, PEA3, ERM and ER81, which, on the amino acid (AA) level, are more than 95% identical within the DNA-binding domain (the Ets domain), more than 85% within a 32 AA domain (the acidic domain) localized in the amino-terminus and almost 50% identical overall. By screening a human kidney cDNA library with a specific probe obtained from mouse ER81, we isolated two clones of 1.6 and 1.5 kb in length encoding a 458 AA open reading frame. When compared to mouse ER81, the present human ER81 lacks the last 13 AA of the acidic domain and the 5 AA contiguous to the carboxy-terminal part of the acidic domain. Of the 458 AA of the human ER81 protein, 97% are identical to mouse ER81. Gel shift analysis indicates that the full-length human ER81 protein is able to bind specifically to an oligonucleotide containing the binding sites recognized by most of the Ets proteins. By transient expression in RK13 mammalian cells, human ER81 protein transactivated a reporter plasmid containing Ets binding sites, indicating that this molecule is a bonafide transcriptional activator, while by expression in Cos-1 transfected cells, we detected the presence of human ER81 protein in the nucleus using immunocytochemistry. In human tissues, ER81 mRNA is very highly expressed in brain, highly expressed in testis, lung and heart, moderately in spleen, small intestine, pancreas and colon, weakly in liver, prostate and thymus, very weakly in skeletal muscle, kidney and ovary and not in placenta and peripheral blood leukocytes. Analysis of human solid or haematopoietic tumour cell lines showed that most of them did not express ER81 detectably. Database searches revealed that ETV1 mRNA is highly similar to human ER81 described here, although it contains the full-length acidic domain present in mouse ER81. By screening a genomic DNA library, we characterized the intron-exon junction within the

  6. Variability of Gene Expression Identifies Transcriptional Regulators of Early Human Embryonic Development

    PubMed Central

    Hasegawa, Yu; Taylor, Deanne; Ovchinnikov, Dmitry A.; Wolvetang, Ernst J.; de Torrenté, Laurence; Mar, Jessica C.

    2015-01-01

    An analysis of gene expression variability can provide an insightful window into how regulatory control is distributed across the transcriptome. In a single cell analysis, the inter-cellular variability of gene expression measures the consistency of transcript copy numbers observed between cells in the same population. Application of these ideas to the study of early human embryonic development may reveal important insights into the transcriptional programs controlling this process, based on which components are most tightly regulated. Using a published single cell RNA-seq data set of human embryos collected at four-cell, eight-cell, morula and blastocyst stages, we identified genes with the most stable, invariant expression across all four developmental stages. Stably-expressed genes were found to be enriched for those sharing indispensable features, including essentiality, haploinsufficiency, and ubiquitous expression. The stable genes were less likely to be associated with loss-of-function variant genes or human recessive disease genes affected by a DNA copy number variant deletion, suggesting that stable genes have a functional impact on the regulation of some of the basic cellular processes. Genes with low expression variability at early stages of development are involved in regulation of DNA methylation, responses to hypoxia and telomerase activity, whereas by the blastocyst stage, low-variability genes are enriched for metabolic processes as well as telomerase signaling. Based on changes in expression variability, we identified a putative set of gene expression markers of morulae and blastocyst stages. Experimental validation of a blastocyst-expressed variability marker demonstrated that HDDC2 plays a role in the maintenance of pluripotency in human ES and iPS cells. Collectively our analyses identified new regulators involved in human embryonic development that would have otherwise been missed using methods that focus on assessment of the average expression

  7. Identification of the imprinted KLF14 transcription factor undergoing human-specific accelerated evolution.

    PubMed

    Parker-Katiraee, Layla; Carson, Andrew R; Yamada, Takahiro; Arnaud, Philippe; Feil, Robert; Abu-Amero, Sayeda N; Moore, Gudrun E; Kaneda, Masahiro; Perry, George H; Stone, Anne C; Lee, Charles; Meguro-Horike, Makiko; Sasaki, Hiroyuki; Kobayashi, Keiko; Nakabayashi, Kazuhiko; Scherer, Stephen W

    2007-05-01

    Imprinted genes are expressed in a parent-of-origin manner and are located in clusters throughout the genome. Aberrations in the expression of imprinted genes on human Chromosome 7 have been suggested to play a role in the etiologies of Russell-Silver Syndrome and autism. We describe the imprinting of KLF14, an intronless member of the Krüppel-like family of transcription factors located at Chromosome 7q32. We show that it has monoallelic maternal expression in all embryonic and extra-embryonic tissues studied, in both human and mouse. We examine epigenetic modifications in the KLF14 CpG island in both species and find this region to be hypomethylated. In addition, we perform chromatin immunoprecipitation and find that the murine Klf14 CpG island lacks allele-specific histone modifications. Despite the absence of these defining features, our analysis of Klf14 in offspring from DNA methyltransferase 3a conditional knockout mice reveals that the gene's expression is dependent upon a maternally methylated region. Due to the intronless nature of Klf14 and its homology to Klf16, we suggest that the gene is an ancient retrotransposed copy of Klf16. By sequence analysis of numerous species, we place the timing of this event after the divergence of Marsupialia, yet prior to the divergence of the Xenarthra superclade. We identify a large number of sequence variants in KLF14 and, using several measures of diversity, we determine that there is greater variability in the human lineage with a significantly increased number of nonsynonymous changes, suggesting human-specific accelerated evolution. Thus, KLF14 may be the first example of an imprinted transcript undergoing accelerated evolution in the human lineage. PMID:17480121

  8. Regulation of aryl hydrocarbon receptor-mediated transcription in human retinal pigmented epithelial cells.

    PubMed

    Jin, Hong Lan; Jeong, Kwang Won

    2016-04-01

    The aryl hydrocarbon receptor (AHR) is a ligand-activated transcription factor with pleiotropic effects in normal physiology or vascular development, xenobiotic metabolism, and cancer. A previous study has reported that BRG1, a component of the SWI/SNF complex, is a coactivator for AHR and is recruited to the promoter region of the CYP1A1 gene in mouse hepatocytes. Recent data suggest that AHR is also expressed in human retinal pigment epithelial cells (ARPE-19), which play a crucial role in retinal physiology and the visual cycle. Multiple studies have shown that the AHR plays an important role in the pathogenesis of retinal diseases including age-related macular degeneration. However, the mechanism of AHR transcriptional activation in retinal pigment cells has not been reported. Here, we demonstrate that the AHR signaling pathway is active in ARPE-19 cells, as in hepatocytes, but with different target gene specificity. We also found that chromatin remodeling by the BRG1-containing SWI/SNF complex is required for the AHR-mediated expression of target genes in ARPE-19 cells. We identified a novel enhancer region (-12 kb) of the CYP1A1 gene in ARPE-19 cells, to which both AHR and BRG1 are recruited in a ligand-dependent manner. BRG1 is associated with the AHR in ARPE-19 cells, and the C-terminal activation domain of the AHR directly interacts with BRG1. Furthermore, depletion of BRG1 caused a reduction in chromatin accessibility at the CYP1A1 enhancer. These results suggest that ARPE-19 cells possess an AHR-mediated transcription pathway with different target gene specificity, and that BRG1 is required for AHR-mediated transcription in ARPE-19 cells. PMID:26966070

  9. Inhibition of Human Methionine Adenosyltransferase 1A Transcription by Coding Region Methylation

    PubMed Central

    Tomasi, Maria Lauda; Li, Tony W. H.; Li, Mei; Mato, José M.; Lu, Shelly C.

    2011-01-01

    Two genes (MAT1A and MAT2A) encode for the essential enzyme methionine adenosyltransferase (MAT). MAT1A is silenced in hepatocellular carcinoma (HCC), and absence of MAT1A leads to spontaneous development of HCC in mice. Previous report correlated promoter methylation to silencing of MAT1A but definitive proof was lacking. Here we investigated the role of methylation in regulating MAT1A expression. There are three MspI/HpaII sites from −1913 to +160 of the human MAT1A gene (numbered relative to the translational start site) at position −977, +10, and +88. Bisulfite treatment and DNA sequencing, and Southern blot analysis showed that methylation at +10 and +88, but not −977, correlated with lack of MAT1A expression. MAT1A promoter construct methylated at −977, +10 or +88 position has 0.7-fold, 3-fold, and 1.6-fold lower promoter activity, respectively. Methylation at −977 and +10 did not inhibit the promoter more than methylation at +10 alone; while methylation at +10 and +88 reduced promoter activity by 60%. Mutation of +10 and +88 sites also resulted in 40% reduction of promoter activity. Reactivation of MAT1A correlated with demethylation of +10 and +88. In vitro transcription assay showed that methylation or mutation of +10 and +88 sites reduced transcription. In conclusion, our data support the novel finding that methylation of the MAT1A coding region can inhibit gene transcription. This represents a key mechanism for decreased MAT1A expression in HCC and a target for therapy. To our knowledge, this is the first example of coding region methylation inhibiting transcription of a mammalian gene. PMID:21678410

  10. Up-Regulation of Human Inducible Nitric Oxide Synthase by p300 Transcriptional Complex.

    PubMed

    Guo, Zhong; Zheng, Liang; Liao, Xinghua; Geller, David

    2016-01-01

    p300, a ubiquitous transcription coactivator, plays an important role in gene activation. Our previous work demonstrated that human inducible nitric oxide synthase (hiNOS) expression can be highly induced with the cytokine mixture (CM) of TNF-α + IL-1β + IFN-γ. In this study, we investigated the functional role of p300 in the regulation of hiNOS gene expression. Our initial data showed that overexpression of p300 significantly increased the basal and cytokine-induced hiNOS promoter activities in A549 cells. Interestingly, p300 activated cytokine-induced hiNOS transcriptional activity was completely abrogated by deleting the upstream hiNOS enhancer at -5 kb to -6 kb in the promoter. Furthermore, p300 over-expression increased cytokine-induced transcriptional activity on a heterologous minimal TK promoter with the same hiNOS enhancer. Site-directed mutagenesis of the hiNOS AP-1 motifs revealed that an intact upstream (-5.3 kb) AP-1 binding site was critical for p300 mediated cytokine-induced hiNOS transcription. Furthermore, our ChIP analysis demonstrated that p300 was binding to Jun D and Fra-2 proteins at -5.3 kb AP-1 binding site in vivo. Lastly, our 3C assay was able to detect a long DNA loop between the hiNOS enhancer and core promoter site, and ChIP loop assay confirmed that p300 binds to AP-1 and RNA pol II proteins. Overall, our results suggest that coactivator p300 mediates cytokine-induced hiNOS transactivation by forming a distant DNA loop between its enhancer and core promoter region. PMID:26751080

  11. Accurate Gene Expression-Based Biodosimetry Using a Minimal Set of Human Gene Transcripts

    SciTech Connect

    Tucker, James D.; Joiner, Michael C.; Thomas, Robert A.; Grever, William E.; Bakhmutsky, Marina V.; Chinkhota, Chantelle N.; Smolinski, Joseph M.; Divine, George W.; Auner, Gregory W.

    2014-03-15

    Purpose: Rapid and reliable methods for conducting biological dosimetry are a necessity in the event of a large-scale nuclear event. Conventional biodosimetry methods lack the speed, portability, ease of use, and low cost required for triaging numerous victims. Here we address this need by showing that polymerase chain reaction (PCR) on a small number of gene transcripts can provide accurate and rapid dosimetry. The low cost and relative ease of PCR compared with existing dosimetry methods suggest that this approach may be useful in mass-casualty triage situations. Methods and Materials: Human peripheral blood from 60 adult donors was acutely exposed to cobalt-60 gamma rays at doses of 0 (control) to 10 Gy. mRNA expression levels of 121 selected genes were obtained 0.5, 1, and 2 days after exposure by reverse-transcriptase real-time PCR. Optimal dosimetry at each time point was obtained by stepwise regression of dose received against individual gene transcript expression levels. Results: Only 3 to 4 different gene transcripts, ASTN2, CDKN1A, GDF15, and ATM, are needed to explain ≥0.87 of the variance (R{sup 2}). Receiver-operator characteristics, a measure of sensitivity and specificity, of 0.98 for these statistical models were achieved at each time point. Conclusions: The actual and predicted radiation doses agree very closely up to 6 Gy. Dosimetry at 8 and 10 Gy shows some effect of saturation, thereby slightly diminishing the ability to quantify higher exposures. Analyses of these gene transcripts may be advantageous for use in a field-portable device designed to assess exposures in mass casualty situations or in clinical radiation emergencies.

  12. Transcriptional recapitulation and subversion of embryonic colon development by mouse colon tumor models and human colon cancer

    PubMed Central

    Kaiser, Sergio; Park, Young-Kyu; Franklin, Jeffrey L; Halberg, Richard B; Yu, Ming; Jessen, Walter J; Freudenberg, Johannes; Chen, Xiaodi; Haigis, Kevin; Jegga, Anil G; Kong, Sue; Sakthivel, Bhuvaneswari; Xu, Huan; Reichling, Timothy; Azhar, Mohammad; Boivin, Gregory P; Roberts, Reade B; Bissahoyo, Anika C; Gonzales, Fausto; Bloom, Greg C; Eschrich, Steven; Carter, Scott L; Aronow, Jeremy E; Kleimeyer, John; Kleimeyer, Michael; Ramaswamy, Vivek; Settle, Stephen H; Boone, Braden; Levy, Shawn; Graff, Jonathan M; Doetschman, Thomas; Groden, Joanna; Dove, William F; Threadgill, David W; Yeatman, Timothy J; Coffey, Robert J; Aronow, Bruce J

    2007-01-01

    Background The expression of carcino-embryonic antigen by colorectal cancer is an example of oncogenic activation of embryonic gene expression. Hypothesizing that oncogenesis-recapitulating-ontogenesis may represent a broad programmatic commitment, we compared gene expression patterns of human colorectal cancers (CRCs) and mouse colon tumor models to those of mouse colon development embryonic days 13.5-18.5. Results We report here that 39 colon tumors from four independent mouse models and 100 human CRCs encompassing all clinical stages shared a striking recapitulation of embryonic colon gene expression. Compared to normal adult colon, all mouse and human tumors over-expressed a large cluster of genes highly enriched for functional association to the control of cell cycle progression, proliferation, and migration, including those encoding MYC, AKT2, PLK1 and SPARC. Mouse tumors positive for nuclear β-catenin shifted the shared embryonic pattern to that of early development. Human and mouse tumors differed from normal embryonic colon by their loss of expression modules enriched for tumor suppressors (EDNRB, HSPE, KIT and LSP1). Human CRC adenocarcinomas lost an additional suppressor module (IGFBP4, MAP4K1, PDGFRA, STAB1 and WNT4). Many human tumor samples also gained expression of a coordinately regulated module associated with advanced malignancy (ABCC1, FOXO3A, LIF, PIK3R1, PRNP, TNC, TIMP3 and VEGF). Conclusion Cross-species, developmental, and multi-model gene expression patterning comparisons provide an integrated and versatile framework for definition of transcriptional programs associated with oncogenesis. This approach also provides a general method for identifying pattern-specific biomarkers and therapeutic targets. This delineation and categorization of developmental and non-developmental activator and suppressor gene modules can thus facilitate the formulation of sophisticated hypotheses to evaluate potential synergistic effects of targeting within- and

  13. Towards Human Centred Manufacturing Systems in the Next Generation

    NASA Astrophysics Data System (ADS)

    Anezaki, Takashi; Hata, Seiji

    Nowadays agile market is in common, and the fundamental technology supporting next-generation production system requires further development of machine and information technologies to establish “human friendly technology" and a bridging of these technologies together. IMS-HUTOP project proposes a new product life cycle that respects the human nature of individuals, and establishes the elemental technologies necessary for acquiring, modelling and evaluating various human factors in an effort to achieve the HUTOP cycle. In this paper we propose a human centred and human friendly manufacturing system, which has been proposed in the IMS-HUTOP project.

  14. Characterization of the regulatory domains of the human skn-1a/Epoc-1/Oct-11 POU transcription factor.

    PubMed

    Hildesheim, J; Foster, R A; Chamberlin, M E; Vogel, J C

    1999-09-10

    The Skn-1a POU transcription factor is primarily expressed in keratinocytes of murine embryonic and adult epidermis. Although some POU factors expressed in a tissue-specific manner are important for normal differentiation, the biological function of Skn-1a remains unknown. Previous in vitro studies indicate that Skn-1a has the ability to transactivate markers of keratinocyte differentiation. In this study, we have characterized Skn-1a's transactivation domain(s) and engineered a dominant negative protein that lacked this transactivation domain. Deletional analysis of the human homologue of Skn-1a with three target promoters revealed the presence of two functional domains: a primary C-terminal transactivation domain and a combined N-terminal inhibitory domain and transactivation domain. Skn-1a lacking the C-terminal region completely lost transactivation ability, irrespective of the promoter tested, and was able to block transactivation by normal Skn-1a in competition assays. Compared with full-length, Skn-1a lacking the N-terminal region demonstrated either increased transactivation (bovine cytokeratin 6 promoter), comparable transactivation (human papillomavirus type 1a long control region), or loss of transactivation (human papillomavirus type 18 long control region). The identification of a primary C-terminal transactivation domain enabled us to generate a dominant negative Skn-1a factor, which will be useful in the quest for a better understanding of this keratinocyte-specific gene regulator. PMID:10473598

  15. Next-generation sequencing of genomic DNA fragments bound to a transcription factor in vitro reveals its regulatory potential.

    PubMed

    Kurihara, Yukio; Makita, Yuko; Kawashima, Mika; Hamasaki, Hidefumi; Yamamoto, Yoshiharu Y; Matsui, Minami

    2014-01-01

    Several transcription factors (TFs) coordinate to regulate expression of specific genes at the transcriptional level. In Arabidopsis thaliana it is estimated that approximately 10% of all genes encode TFs or TF-like proteins. It is important to identify target genes that are directly regulated by TFs in order to understand the complete picture of a plant's transcriptome profile. Here, we investigate the role of the LONG HYPOCOTYL5 (HY5) transcription factor that acts as a regulator of photomorphogenesis. We used an in vitro genomic DNA binding assay coupled with immunoprecipitation and next-generation sequencing (gDB-seq) instead of the in vivo chromatin immunoprecipitation (ChIP)-based methods. The results demonstrate that the HY5-binding motif predicted here was similar to the motif reported previously and that in vitro HY5-binding loci largely overlapped with the HY5-targeted candidate genes identified in previous ChIP-chip analysis. By combining these results with microarray analysis, we identified hundreds of HY5-binding genes that were differentially expressed in hy5. We also observed delayed induction of some transcripts of HY5-binding genes in hy5 mutants in response to blue-light exposure after dark treatment. Thus, an in vitro gDNA-binding assay coupled with sequencing is a convenient and powerful method to bridge the gap between identifying TF binding potential and establishing function. PMID:25534860

  16. Mapping of Betapapillomavirus Human Papillomavirus 5 Transcription and Characterization of Viral-Genome Replication Function

    PubMed Central

    Sankovski, Eve; Männik, Andres; Geimanen, Jelizaveta; Ustav, Ene

    2014-01-01

    Betapapillomavirus replication and transcription have not been studied in detail because of a lack of suitable cellular systems supporting human papillomavirus (HPV) genome replication. We have recently shown that the human osteosarcoma cell line U2OS provides a useful environment for the genome replication of many different HPVs, including the betapapillomaviruses HPV5 and HPV8. Using mutational analysis and complementation assay, we demonstrated herein that the viral early proteins E1 and E2 are viral transfactors that are necessary and sufficient for HPV5 genome replication. We also identified four HPV5 early promoter regions with transcription start sites (TSSs) at nucleotides (nt) 184/191, 460, 840, and 1254, respectively, and the HPV late promoter with a TSS at nt 7640. In addition, we mapped the HPV5 early polyadenylation cleavage sites via 3′ rapid amplification of cDNA ends (3′RACE) to nt 4457 and 4475. In total, 14 different viral mRNA species, originating from the HPV5 genome, were mapped in U2OS cells during transient and stable replication. The main splicing donor and acceptor sites identified herein are consistent with the data previously obtained in HPV5-positive skin lesions. In addition, we identified novel E8 open reading frame (ORF)-containing transcripts (E8^E1C and E8^E2C) expressed from the HPV5 genome. Similar to several other papillomaviruses, the product of the E8^E2C mRNA acts as a repressor of viral genome replication. PMID:24198410

  17. Inherited human sex reversal due to impaired nucleocytoplasmic trafficking of SRY defines a male transcriptional threshold

    PubMed Central

    Chen, Yen-Shan; Racca, Joseph D.; Phillips, Nelson B.; Weiss, Michael A.

    2013-01-01

    Human testis determination is initiated by SRY (sex determining region on Y chromosome). Mutations in SRY cause gonadal dysgenesis with female somatic phenotype. Two subtle variants (V60L and I90M in the high-mobility group box) define inherited alleles shared by an XY sterile daughter and fertile father. Whereas specific DNA binding and bending are unaffected in a rat embryonic pre-Sertoli cell line, the variants exhibited selective defects in nucleocytoplasmic shuttling due to impaired nuclear import (V60L; mediated by Exportin-4) or export (I90M; mediated by chromosome region maintenance 1). Decreased shuttling limits nuclear accumulation of phosphorylated (activated) SRY, in turn reducing occupancy of DNA sites regulating Sertoli-cell differentiation [the testis-specific SRY-box 9 (Sox9) enhancer]. Despite distinct patterns of biochemical and cell-biological perturbations, V60L and I90M each attenuated Sox9 expression in transient transfection assays by twofold. Such attenuation was also observed in studies of V60A, a clinical variant associated with ovotestes and hence ambiguity between divergent cell fates. This shared twofold threshold is reminiscent of autosomal syndromes of transcription-factor haploinsufficiency, including XY sex reversal associated with mutations in SOX9. Our results demonstrate that nucleocytoplasmic shuttling of SRY is necessary for robust initiation of testicular development. Although also characteristic of ungulate orthologs, such shuttling is not conserved among rodents wherein impaired nuclear export of the high-mobility group box and import-dependent phosphorylation are compensated by a microsatellite-associated transcriptional activation domain. Human sex reversal due to subtle defects in the nucleocytoplasmic shuttling of SRY suggests that its transcriptional activity lies near the edge of developmental ambiguity. PMID:24003159

  18. Primary and secondary transcriptional effects in the developing human Down syndrome brain and heart

    PubMed Central

    Mao, Rong; Wang, Xiaowen; Spitznagel, Edward L; Frelin, Laurence P; Ting, Jason C; Ding, Huashi; Kim, Jung-whan; Ruczinski, Ingo; Downey, Thomas J; Pevsner, Jonathan

    2005-01-01

    Background Down syndrome, caused by trisomic chromosome 21, is the leading genetic cause of mental retardation. Recent studies demonstrated that dosage-dependent increases in chromosome 21 gene expression occur in trisomy 21. However, it is unclear whether the entire transcriptome is disrupted, or whether there is a more restricted increase in the expression of those genes assigned to chromosome 21. Also, the statistical significance of differentially expressed genes in human Down syndrome tissues has not been reported. Results We measured levels of transcripts in human fetal cerebellum and heart tissues using DNA microarrays and demonstrated a dosage-dependent increase in transcription across different tissue/cell types as a result of trisomy 21. Moreover, by having a larger sample size, combining the data from four different tissue and cell types, and using an ANOVA approach, we identified individual genes with significantly altered expression in trisomy 21, some of which showed this dysregulation in a tissue-specific manner. We validated our microarray data by over 5,600 quantitative real-time PCRs on 28 genes assigned to chromosome 21 and other chromosomes. Gene expression values from chromosome 21, but not from other chromosomes, accurately classified trisomy 21 from euploid samples. Our data also indicated functional groups that might be perturbed in trisomy 21. Conclusions In Down syndrome, there is a primary transcriptional effect of disruption of chromosome 21 gene expression, without a pervasive secondary effect on the remaining transcriptome. The identification of dysregulated genes and pathways suggests molecular changes that may underlie the Down syndrome phenotypes. PMID:16420667

  19. Transcriptional modulator ZBED6 affects cell cycle and growth of human colorectal cancer cells

    PubMed Central

    Akhtar Ali, Muhammad; Younis, Shady; Wallerman, Ola; Gupta, Rajesh; Andersson, Leif; Sjöblom, Tobias

    2015-01-01

    The transcription factor ZBED6 (zinc finger, BED-type containing 6) is a repressor of IGF2 whose action impacts development, cell proliferation, and growth in placental mammals. In human colorectal cancers, IGF2 overexpression is mutually exclusive with somatic mutations in PI3K signaling components, providing genetic evidence for a role in the PI3K pathway. To understand the role of ZBED6 in tumorigenesis, we engineered and validated somatic cell ZBED6 knock-outs in the human colorectal cancer cell lines RKO and HCT116. Ablation of ZBED6 affected the cell cycle and led to increased growth rate in RKO cells but reduced growth in HCT116 cells. This striking difference was reflected in the transcriptome analyses, which revealed enrichment of cell-cycle–related processes among differentially expressed genes in both cell lines, but the direction of change often differed between the cell lines. ChIP sequencing analyses displayed enrichment of ZBED6 binding at genes up-regulated in ZBED6-knockout clones, consistent with the view that ZBED6 modulates gene expression primarily by repressing transcription. Ten differentially expressed genes were identified as putative direct gene targets, and their down-regulation by ZBED6 was validated experimentally. Eight of these genes were linked to the Wnt, Hippo, TGF-β, EGF receptor, or PI3K pathways, all involved in colorectal cancer development. The results of this study show that the effect of ZBED6 on tumor development depends on the genetic background and the transcriptional state of its target genes. PMID:26056301

  20. LNCipedia: a database for annotated human lncRNA transcript sequences and structures.

    PubMed

    Volders, Pieter-Jan; Helsens, Kenny; Wang, Xiaowei; Menten, Björn; Martens, Lennart; Gevaert, Kris; Vandesompele, Jo; Mestdagh, Pieter

    2013-01-01

    Here, we present LNCipedia (http://www.lncipedia.org), a novel database for human long non-coding RNA (lncRNA) transcripts and genes. LncRNAs constitute a large and diverse class of non-coding RNA genes. Although several lncRNAs have been functionally annotated, the majority remains to be characterized. Different high-throughput methods to identify new lncRNAs (including RNA sequencing and annotation of chromatin-state maps) have been applied in various studies resulting in multiple unrelated lncRNA data sets. LNCipedia offers 21 488 annotated human lncRNA transcripts obtained from different sources. In addition to basic transcript information and gene structure, several statistics are determined for each entry in the database, such as secondary structure information, protein coding potential and microRNA binding sites. Our analyses suggest that, much like microRNAs, many lncRNAs have a significant secondary structure, in-line with their presumed association with proteins or protein complexes. Available literature on specific lncRNAs is linked, and users or authors can submit articles through a web interface. Protein coding potential is assessed by two different prediction algorithms: Coding Potential Calculator and HMMER. In addition, a novel strategy has been integrated for detecting potentially coding lncRNAs by automatically re-analysing the large body of publicly available mass spectrometry data in the PRIDE database. LNCipedia is publicly available and allows users to query and download lncRNA sequences and structures based on different search criteria. The database may serve as a resource to initiate small- and large-scale lncRNA studies. As an example, the LNCipedia content was used to develop a custom microarray for expression profiling of all available lncRNAs. PMID:23042674

  1. TNF-Alpha Represses Transcription of Human Bone Morphogenetic Protein-4 in Lung Epithelial Cells

    PubMed Central

    Zhu, Nian-Ling; Li, Changgong; Huang, Hao Hao; Sebald, Matthew; Londhe, Vedang A.; Heisterkamp, Nora; Warburton, David; Bellusci, Saverio; Minoo, Parviz

    2007-01-01

    Bone Morphogenetic Proteins are key signaling molecules in vertebrate development. Little is known about Bmp gene regulation in any organ. In Drosophila, the Bmp gene, dpp is regulated by Dorsal, the invertebrate homologue of Rel-NFkB. In this study we examined whether TNF-alpha, which activates NF-kB, can regulate Bmp4 gene expression. TNF-alpha reduced Bmp4 mRNA in lung adenocarcinoma A549 cells and repressed transcriptional activity of the human Bmp4 promoter in a dose-dependent manner. Similar repression was observed when the Bmp4 promoter was co-transfected with a p65 (RelA) expression vector in the absence of TNF-alpha treatment, suggesting that RelA mediates the effect of TNF-alpha. In support of this finding, the repressor effect of TNF-alpha on Bmp4 was abrogated by a co-transfected dominant negative mutant of IkB (S32A/S36A). The human Bmp4 promoter contains 3 putative consensus binding sites for NF-kB. Surprisingly, only one of the latter binding sites was capable of binding NFkB. Repressor effect of NFkB was not dependent on any of the three binding sites, but localized to a 122 bp fragment which bound both RelA and SP1. SP1stimulated transcription, whereas increasing doses of RelA opposed this effect. In vivo, TNF-alpha inhibited branching morphogenesis and LacZ gene expression in Bmp4-lacz transgenic lungs. These data support a model in which TNF-alpha-induced RelA interacts with SP1 to bring about transcriptional repression of Bmp4 gene. These findings provide a mechanistic paradigm for interactions between mediators of inflammation and morphogenesis with relevant implications for normal lung development and pathogenesis of disease. PMID:17350185

  2. Real-Time Reverse Transcription-PCR Assay for Comprehensive Detection of Human Rhinoviruses▿

    PubMed Central

    Lu, Xiaoyan; Holloway, Brian; Dare, Ryan K.; Kuypers, Jane; Yagi, Shigeo; Williams, John V.; Hall, Caroline B.; Erdman, Dean D.

    2008-01-01

    Human rhinoviruses (HRVs) are important contributors to respiratory disease, but their healthcare burden remains unclear, primarily because of the lack of sensitive, accurate, and convenient means of determining their causal role. To address this, we developed and clinically validated the sensitivity and specificity of a real-time reverse transcription-PCR (RT-PCR) assay targeting the viral 5′ noncoding region defined by sequences obtained from all 100 currently recognized HRV prototype strains and 85 recently circulating field isolates. The assay successfully amplified all HRVs tested and could reproducibly detect 50 HRV RNA transcript copies, with a dynamic range of over 7 logs. In contrast, a quantified RNA transcript of human enterovirus 68 (HEV68) that showed the greatest sequence homology to the HRV primers and probe set was not detected below a concentration of 5 × 105 copies per reaction. Nucleic acid extracts of 111 coded respiratory specimens that were culture positive for HRV or HEV were tested with the HRV real-time RT-PCR assay and by two independent laboratories that used different in-house HRV/HEV RT-PCR assays. Eighty-seven HRV-culture-positive specimens were correctly identified by the real-time RT-PCR assay, and 4 of the 24 HEV-positive samples were positive for HRV. HRV-specific sequences subsequently were identified in these four specimens, suggesting HRV/HEV coinfection in these patients. The assay was successfully applied in an investigation of a coincidental outbreak of HRV respiratory illness among laboratory staff. PMID:18057136

  3. Transcriptional profiling of vaccine‐induced immune responses in humans and non‐human primates

    PubMed Central

    Wang, I‐Ming; Bett, Andrew J.; Cristescu, Razvan; Loboda, Andrey; ter Meulen, Jan

    2012-01-01

    Summary There is an urgent need for pre‐clinical and clinical biomarkers predictive of vaccine immunogenicity, efficacy and safety to reduce the risks and costs associated with vaccine development. Results emerging from immunoprofiling studies in non‐human primates and humans demonstrate clearly that (i) type and duration of immune memory are largely determined by the magnitude and complexity of the innate immune signals and (ii) genetic signatures highly predictive of B‐cell and T‐cell responses can be identified for specific vaccines. For vaccines with similar composition, e.g. live attenuated viral vaccines, these signatures share common patterns. Signatures predictive of vaccine efficacy have been identified in a few experimental challenge studies. This review aims to give an overview of the current literature on immunoprofiling studies in humans and also presents some of our own data on profiling of licensed and experimental vaccines in non‐human primates. PMID:22103427

  4. Rapid generation of endogenously driven transcriptional reporters in cells through CRISPR/Cas9

    PubMed Central

    Rojas-Fernandez, Alejandro; Herhaus, Lina; Macartney, Thomas; Lachaud, Christophe; Hay, Ronald T.; Sapkota, Gopal P.

    2015-01-01

    CRISPR/Cas9 technologies have been employed for genome editing to achieve gene knockouts and knock-ins in somatic cells. Similarly, certain endogenous genes have been tagged with fluorescent proteins. Often, the detection of tagged proteins requires high expression and sophisticated tools such as confocal microscopy and flow cytometry. Therefore, a simple, sensitive and robust transcriptional reporter system driven by endogenous promoter for studies into transcriptional regulation is desirable. We report a CRISPR/Cas9-based methodology for rapidly integrating a firefly luciferase gene in somatic cells under the control of endogenous promoter, using the TGFβ-responsive gene PAI-1. Our strategy employed a polycistronic cassette containing a non-fused GFP protein to ensure the detection of transgene delivery and rapid isolation of positive clones. We demonstrate that firefly luciferase cDNA can be efficiently delivered downstream of the promoter of the TGFβ-responsive gene PAI-1. Using chemical and genetic regulators of TGFβ signalling, we show that it mimics the transcriptional regulation of endogenous PAI-1 expression. Our unique approach has the potential to expedite studies on transcription of any gene in the context of its native chromatin landscape in somatic cells, allowing for robust high-throughput chemical and genetic screens. PMID:25922883

  5. Survey of variation in human transcription factors reveals prevalent DNA binding changes.

    PubMed

    Barrera, Luis A; Vedenko, Anastasia; Kurland, Jesse V; Rogers, Julia M; Gisselbrecht, Stephen S; Rossin, Elizabeth J; Woodard, Jaie; Mariani, Luca; Kock, Kian Hong; Inukai, Sachi; Siggers, Trevor; Shokri, Leila; Gordân, Raluca; Sahni, Nidhi; Cotsapas, Chris; Hao, Tong; Yi, Song; Kellis, Manolis; Daly, Mark J; Vidal, Marc; Hill, David E; Bulyk, Martha L

    2016-03-25

    Sequencing of exomes and genomes has revealed abundant genetic variation affecting the coding sequences of human transcription factors (TFs), but the consequences of such variation remain largely unexplored. We developed a computational, structure-based approach to evaluate TF variants for their impact on DNA binding activity and used universal protein-binding microarrays to assay sequence-specific DNA binding activity across 41 reference and 117 variant alleles found in individuals of diverse ancestries and families with Mendelian diseases. We found 77 variants in 28 genes that affect DNA binding affinity or specificity and identified thousands of rare alleles likely to alter the DNA binding activity of human sequence-specific TFs. Our results suggest that most individuals have unique repertoires of TF DNA binding activities, which may contribute to phenotypic variation. PMID:27013732

  6. CD161 defines a transcriptional and functional phenotype across distinct human T cell lineages

    PubMed Central

    Fergusson, Joannah R.; Smith, Kira E.; Fleming, Vicki M.; Rajoriya, Neil; Newell, Evan W.; Simmons, Ruth; Marchi, Emanuele; Björkander, Sophia; Kang, Yu-Hoi; Swadling, Leo; Kurioka, Ayako; Sahgal, Natasha; Lockstone, Helen; Baban, Dilair; Freeman, Gordon J.; Sverremark-Ekström, Eva; Davis, Mark M.; Davenport, Miles P.; Venturi, Vanessa; Ussher, James E.; Willberg, Christian B.; Klenerman, Paul

    2014-01-01

    The C-type lectin CD161 is expressed by a large proportion of human T lymphocytes of all lineages, including a novel population known as Mucosal Associated Invariant T (MAIT) cells. To understand whether different T cell subsets expressing CD161 have similar properties, we examined these populations in parallel using mass cytometry and mRNA microarray approaches. The analysis identified a conserved CD161++/MAIT cell transcriptional signature enriched in CD161+CD8+ T cells, that can be extended to CD161+ CD4+ and CD161+TCRγδ+ T cells. Further, this led to the identification of a shared innate-like, TCR-independent response to interleukin (IL)-12 plus IL-18 by different CD161 expressing T cell populations. This response was independent of regulation by CD161, which acted as a costimulatory molecule in the context of T cell receptor stimulation. Expression of CD161 hence identifies a transcriptional and functional phenotype, shared across human T lymphocytes and independent of both TCR expression and cell lineage. PMID:25437561

  7. Predicting novel histopathological microlesions in human epileptic brain through transcriptional clustering

    PubMed Central

    Dachet, Fabien; Bagla, Shruti; Keren-Aviram, Gal; Morton, Andrew; Balan, Karina; Saadat, Laleh; Valyi-Nagy, Tibor; Kupsky, William; Song, Fei; Dratz, Edward; Loeb, Jeffrey A.

    2015-01-01

    Although epilepsy is associated with a variety of abnormalities, exactly why some brain regions produce seizures and others do not is not known. We developed a method to identify cellular changes in human epileptic neocortex using transcriptional clustering. A paired analysis of high and low spiking tissues recorded in vivo from 15 patients predicted 11 cell-specific changes together with their ‘cellular interactome’. These predictions were validated histologically revealing millimetre-sized ‘microlesions’ together with a global increase in vascularity and microglia. Microlesions were easily identified in deeper cortical layers using the neuronal marker NeuN, showed a marked reduction in neuronal processes, and were associated with nearby activation of MAPK/CREB signalling, a marker of epileptic activity, in superficial layers. Microlesions constitute a common, undiscovered layer-specific abnormality of neuronal connectivity in human neocortex that may be responsible for many ‘non-lesional’ forms of epilepsy. The transcriptional clustering approach used here could be applied more broadly to predict cellular differences in other brain and complex tissue disorders. PMID:25516101

  8. A Comprehensive, High-Resolution Genomic Transcript Map of Human Skeletal Muscle

    PubMed Central

    Bortoluzzi, Stefania; Rampoldi, Luca; Simionati, Barbara; Zimbello, Rosanna; Barbon, Alessandro; d’Alessi, Fabio; Tiso, Natascia; Pallavicini, Alberto; Toppo, Stefano; Cannata, Nicola; Valle, Giorgio; Lanfranchi, Gerolamo; Danieli, Gian Antonio

    1998-01-01

    We present the Human Muscle Gene Map (HMGM), the first comprehensive and updated high-resolution expression map of human skeletal muscle. The 1078 entries of the map were obtained by merging data retrieved from UniGene with the RH mapping information on 46 novel muscle transcripts, which showed no similarity to any known sequence. In the map, distances are expressed in megabase pairs. About one-quarter of the map entries represents putative novel genes. Genes known to be specifically expressed in muscle account for <4% of the total. The genomic distribution of the map entries confirmed the previous finding that muscle genes are selectively concentrated in chromosomes 17, 19, and X. Five chromosomal regions are suspected to have a significant excess of muscle genes. Present data support the hypothesis that the biochemical and functional properties of differentiated muscle cells may result from the transcription of a very limited number of muscle-specific genes along with the activity of a large number of genes, shared with other tissues, but showing different levels of expression in muscle. [The sequence data described in this paper have been submitted to the EMBL data library under accession nos. F23198–F23242.] PMID:9724327

  9. Capsaicin represses transcriptional activity of β-catenin in human colorectal cancer cells.

    PubMed

    Lee, Seong-Ho; Richardson, Raphael L; Dashwood, Roderick H; Baek, Seung Joon

    2012-06-01

    Capsaicin is a pungent ingredient in chili red peppers and has been linked to suppression of growth in various cancer cells. However, the underlying mechanism(s) by which capsaicin induces growth arrest and apoptosis of cancer cells is not completely understood. In the present study, we investigated whether capsaicin alters β-catenin-dependent signaling in human colorectal cancer cells in vitro. Exposure of SW480, LoVo and HCT-116 cells to capsaicin suppressed cell proliferation. Transient transfection with a β-catenin/T-cell factor (TCF)-responsive reporter indicated that capsaicin suppressed the transcriptional activity of β-catenin/TCF. Capsaicin treatment resulted in a decrease of intracellular β-catenin levels and a reduction of transcripts from the β-catenin gene (CTNNB1). These results were confirmed by a reduced luciferase reporter activity driven by promoter-reporter construct containing the promoter region of the Catnb gene. In addition, capsaicin destabilized β-catenin through enhancement of proteosomal-dependent degradation. Western blot and immunoprecipitation studies indicated that capsaicin treatment suppressed TCF-4 expression and disrupted the interaction of TCF-4 and β-catenin. This study identifies a role for the β-catenin/TCF-dependent pathway that potentially contributes to the anticancer activity of capsaicin in human colorectal cancer cells. PMID:21764279

  10. CTCF-Mediated Human 3D Genome Architecture Reveals Chromatin Topology for Transcription.

    PubMed

    Tang, Zhonghui; Luo, Oscar Junhong; Li, Xingwang; Zheng, Meizhen; Zhu, Jacqueline Jufen; Szalaj, Przemyslaw; Trzaskoma, Pawel; Magalska, Adriana; Wlodarczyk, Jakub; Ruszczycki, Blazej; Michalski, Paul; Piecuch, Emaly; Wang, Ping; Wang, Danjuan; Tian, Simon Zhongyuan; Penrad-Mobayed, May; Sachs, Laurent M; Ruan, Xiaoan; Wei, Chia-Lin; Liu, Edison T; Wilczynski, Grzegorz M; Plewczynski, Dariusz; Li, Guoliang; Ruan, Yijun

    2015-12-17

    Spatial genome organization and its effect on transcription remains a fundamental question. We applied an advanced chromatin interaction analysis by paired-end tag sequencing (ChIA-PET) strategy to comprehensively map higher-order chromosome folding and specific chromatin interactions mediated by CCCTC-binding factor (CTCF) and RNA polymerase II (RNAPII) with haplotype specificity and nucleotide resolution in different human cell lineages. We find that CTCF/cohesin-mediated interaction anchors serve as structural foci for spatial organization of constitutive genes concordant with CTCF-motif orientation, whereas RNAPII interacts within these structures by selectively drawing cell-type-specific genes toward CTCF foci for coordinated transcription. Furthermore, we show that haplotype variants and allelic interactions have differential effects on chromosome configuration, influencing gene expression, and may provide mechanistic insights into functions associated with disease susceptibility. 3D genome simulation suggests a model of chromatin folding around chromosomal axes, where CTCF is involved in defining the interface between condensed and open compartments for structural regulation. Our 3D genome strategy thus provides unique insights in the topological mechanism of human variations and diseases. PMID:26686651

  11. Chemically induced oxidative stress increases polyamine levels by activating the transcription of ornithine decarboxylase and spermidine/spermine-N1-acetyltransferase in human hepatoma HUH7 cells.

    PubMed

    Smirnova, Olga A; Isaguliants, Maria G; Hyvonen, Mervi T; Keinanen, Tuomo A; Tunitskaya, Vera L; Vepsalainen, Jouko; Alhonen, Leena; Kochetkov, Sergey N; Ivanov, Alexander V

    2012-09-01

    Biogenic polyamines spermine and spermidine participate in numerous cellular processes including transcription, RNA processing and translation. Specifically, they counteract oxidative stress, an alteration of cell redox balance involved in generation and progression of various pathological states including cancer. Here, we investigated how chemically induced oxidative stress affects polyamine metabolism, specifically the expression and activities of enzymes catalyzing polyamine synthesis (ornithine decarboxylase; ODC) and degradation (spermidine/spermine-N(1)-acetyltransferase; SSAT), in human hepatoma cells. Oxidative stress induced the up-regulation of ODC and SSAT gene transcription mediated by Nrf2, and in case of SSAT, also by NF-κB transcription factors. Activation of transcription led to the elevated intracellular activities of both enzymes. The balance in antagonistic activities of ODC and SSAT in the stressed hepatoma cells was shifted towards polyamine biosynthesis, which resulted in increased intracellular levels of putrescine, spermidine, and spermine. Accumulation of putrescine is indicating for accelerated degradation of polyamines by SSAT - acetylpolyamine oxidase (APAO) pathway generating toxic products that promote carcinogenesis, whereas accelerated polyamine synthesis via activation of ODC is favorable for proliferation of cells including those sub-lethally damaged by oxidative stress. PMID:22579641

  12. Lysophosphatidic acid (LPA) 18:1 transcriptional regulation of primary human gingival fibroblasts

    PubMed Central

    Cerutis, D. Roselyn; Weston, Michael D.; Ogunleye, Afolabi O.; McVaney, Timothy P.; Miyamoto, Takanari

    2014-01-01

    The pleiotropic, bioactive lipid lysophosphatidic acid [(LPA), 1-acyl-sn-glycerol-3-phosphate] exerts critical regulatory actions in physiology and pathophysiology in many systems. It is present in normal bodily fluids, and is elevated in pathology (1). In vivo, “LPA” exists as distinct molecular species, each having a single fatty acid of varying chain length and degree of unsaturation covalently attached to the glycerol backbone via an acyl, alkyl, or alkenyl link. These species differ in affinities for the individual LPA receptors [(LPARs), LPA1-6] and coupling to G proteins (2). However, LPA 18:1 has been and continues to be the most commonly utilized species in reported studies. The actions of “LPA” remain poorly defined in oral biology and pathophysiology. Our laboratory has addressed this knowledge gap by studying in vitro the actions of the major human salivary LPA species [18:1, 18:0, and 16:0 (3)] in human oral cells [4], [5], [6], [7]. This includes gingival fibroblasts (GF), which our flow cytometry data from multiple donors found that they express LPA1-5 (6). We have also reported that these species are ten-fold elevated to pharmacologic levels in the saliva and gingival crevicular fluid obtained from patients with moderate–severe periodontitis (8). As the potential of LPA to regulate transcriptional activity had not been examined in the oral system, this study used whole human genome microarray analysis to test the hypothesis that LPA 18:1-treated human GF would show significant changes in gene transcripts relevant to their biology, wound-healing, and inflammatory responses. LPA 18:1 was found to significantly regulate a large, complex set of genes critical to GF biology in these categories and to periodontal disease. The raw data has been deposited at NCBI's GEO database as record GSE57496. PMID:26484133

  13. Human Parainfluenza Virus Type 2 Vector Induces Dendritic Cell Maturation Without Viral RNA Replication/Transcription

    PubMed Central

    Hara, Kenichiro; Fukumura, Masayuki; Ohtsuka, Junpei; Kawano, Mitsuo

    2013-01-01

    Abstract The dendritic cell (DC), a most potent antigen-presenting cell, plays a key role in vaccine therapy against infectious diseases and malignant tumors. Although advantages of viral vectors for vaccine therapy have been reported, potential risks for adverse effects prevent them from being licensed for clinical use. Human parainfluenza virus type 2 (hPIV2), one of the members of the Paramyxoviridae family, is a nonsegmented and negative-stranded RNA virus. We have developed a reverse genetics system for the production of infectious hPIV2 lacking the F gene (hPIV2ΔF), wherein various advantages for vaccine therapy exist, such as cytoplasmic replication/transcription, nontransmissible infectivity, and extremely high transduction efficacy in various types of target cells. Here we demonstrate that hPIV2ΔF shows high transduction efficiency in human DCs, while not so high in mouse DCs. In addition, hPIV2ΔF sufficiently induces maturation of both human and murine DCs, and the maturation state of both human and murine DCs is almost equivalent to that induced by lipopolysaccharide. Moreover, alkylating agent β-propiolactone-inactivated hPIV2ΔF (BPL-hPIV2ΔF) elicits DC maturation without viral replication/transcription. These results suggest that hPIV2ΔF may be a useful tool for vaccine therapy as a novel type of paramyxoviral vector, which is single-round infectious vector and has potential adjuvant activity. PMID:23790317

  14. A comprehensive catalogue of the coding and non-coding transcripts of the human inner ear.

    PubMed

    Schrauwen, Isabelle; Hasin-Brumshtein, Yehudit; Corneveaux, Jason J; Ohmen, Jeffrey; White, Cory; Allen, April N; Lusis, Aldons J; Van Camp, Guy; Huentelman, Matthew J; Friedman, Rick A

    2016-03-01

    The mammalian inner ear consists of the cochlea and the vestibular labyrinth (utricle, saccule, and semicircular canals), which participate in both hearing and balance. Proper development and life-long function of these structures involves a highly complex coordinated system of spatial and temporal gene expression. The characterization of the inner ear transcriptome is likely important for the functional study of auditory and vestibular components, yet, primarily due to tissue unavailability, detailed expression catalogues of the human inner ear remain largely incomplete. We report here, for the first time, comprehensive transcriptome characterization of the adult human cochlea, ampulla, saccule and utricle of the vestibule obtained from patients without hearing abnormalities. Using RNA-Seq, we measured the expression of >50,000 predicted genes corresponding to approximately 200,000 transcripts, in the adult inner ear and compared it to 32 other human tissues. First, we identified genes preferentially expressed in the inner ear, and unique either to the vestibule or cochlea. Next, we examined expression levels of specific groups of potentially interesting RNAs, such as genes implicated in hearing loss, long non-coding RNAs, pseudogenes and transcripts subject to nonsense mediated decay (NMD). We uncover the spatial specificity of expression of these RNAs in the hearing/balance system, and reveal evidence of tissue specific NMD. Lastly, we investigated the non-syndromic deafness loci to which no gene has been mapped, and narrow the list of potential candidates for each locus. These data represent the first high-resolution transcriptome catalogue of the adult human inner ear. A comprehensive identification of coding and non-coding RNAs in the inner ear will enable pathways of auditory and vestibular function to be further defined in the study of hearing and balance. Expression data are freely accessible at https://www.tgen.org/home/research

  15. Developmental changes in the transcriptome of human cerebral cortex tissue: long noncoding RNA transcripts.

    PubMed

    Lipovich, Leonard; Tarca, Adi L; Cai, Juan; Jia, Hui; Chugani, Harry T; Sterner, Kirstin N; Grossman, Lawrence I; Uddin, Monica; Hof, Patrick R; Sherwood, Chet C; Kuzawa, Christopher W; Goodman, Morris; Wildman, Derek E

    2014-06-01

    The human neocortex is characterized by protracted developmental intervals of synaptogenesis and myelination, which allow for an extended period of learning. The molecular basis of these and other postnatal developmental changes in the human cerebral cortex remain incompletely understood. Recently, a new large class of mammalian genes, encoding nonmessenger, long nonprotein-coding ribonucleic acid (lncRNA) molecules has been discovered. Although their function remains uncertain, numerous lncRNAs have primate-specific sequences and/or show evidence of rapid, lineage-specific evolution, making them potentially relevant to the evolution of unique human neural properties. To examine the hypothesis that lncRNA expression varies with age, potentially paralleling known developmental trends in synaptogenesis, myelination, and energetics, we quantified levels of nearly 6000 lncRNAs in 36 surgically resected human neocortical samples (primarily derived from temporal cortex) spanning infancy to adulthood. Our analysis identified 8 lncRNA genes with distinct developmental expression patterns. These lncRNA genes contained anthropoid-specific exons, as well as splice sites and polyadenylation signals that resided in primate-specific sequences. To our knowledge, our study is the first to describe developmental expression profiles of lncRNA in surgically resected in vivo human brain tissue. Future analysis of the functional relevance of these transcripts to neural development and energy metabolism is warranted. PMID:23377288

  16. Differential regulation of mouse and human nephron progenitors by the Six family of transcriptional regulators.

    PubMed

    O'Brien, Lori L; Guo, Qiuyu; Lee, YoungJin; Tran, Tracy; Benazet, Jean-Denis; Whitney, Peter H; Valouev, Anton; McMahon, Andrew P

    2016-02-15

    Nephron endowment is determined by the self-renewal and induction of a nephron progenitor pool established at the onset of kidney development. In the mouse, the related transcriptional regulators Six1 and Six2 play non-overlapping roles in nephron progenitors. Transient Six1 activity prefigures, and is essential for, active nephrogenesis. By contrast, Six2 maintains later progenitor self-renewal from the onset of nephrogenesis. We compared the regulatory actions of Six2 in mouse and human nephron progenitors by chromatin immunoprecipitation followed by DNA sequencing (ChIP-seq). Surprisingly, SIX1 was identified as a SIX2 target unique to the human nephron progenitors. Furthermore, RNA-seq and immunostaining revealed overlapping SIX1 and SIX2 activity in 16 week human fetal nephron progenitors. Comparative bioinformatic analysis of human SIX1 and SIX2 ChIP-seq showed each factor targeted a similar set of cis-regulatory modules binding an identical target recognition motif. In contrast to the mouse where Six2 binds its own enhancers but does not interact with DNA around Six1, both human SIX1 and SIX2 bind homologous SIX2 enhancers and putative enhancers positioned around SIX1. Transgenic analysis of a putative human SIX1 enhancer in the mouse revealed a transient, mouse-like, pre-nephrogenic, Six1 regulatory pattern. Together, these data demonstrate a divergence in SIX-factor regulation between mouse and human nephron progenitors. In the human, an auto/cross-regulatory loop drives continued SIX1 and SIX2 expression during active nephrogenesis. By contrast, the mouse establishes only an auto-regulatory Six2 loop. These data suggest differential SIX-factor regulation might have contributed to species differences in nephron progenitor programs such as the duration of nephrogenesis and the final nephron count. PMID:26884396

  17. Influence of promoter/enhancer region haplotypes on MGMT transcriptional regulation: a potential biomarker for human sensitivity to alkylating agents

    PubMed Central

    Abdel-Rahman, Sherif Z.

    2014-01-01

    The O 6-methylguanine-DNA methyltransferase gene (MGMT) encodes the direct reversal DNA repair protein that removes alkyl adducts from the O 6 position of guanine. Several single-nucleotide polymorphisms (SNPs) exist in the MGMT promoter/enhancer (P/E) region. However, the haplotype structure encompassing these SNPs and their functional/biological significance are currently unknown. We hypothesized that MGMT P/E haplotypes, rather than individual SNPs, alter MGMT transcription and can thus alter human sensitivity to alkylating agents. To identify the haplotype structure encompassing the MGMT P/E region SNPs, we sequenced 104 DNA samples from healthy individuals and inferred the haplotypes using the data generated. We identified eight SNPs in this region, namely T7C (rs180989103), T135G (rs1711646), G290A (rs61859810), C485A (rs1625649), C575A (rs113813075), G666A (rs34180180), C777A (rs34138162) and C1099T (rs16906252). Phylogenetics and Sequence Evolution analysis predicted 21 potential haplotypes that encompass these SNPs ranging in frequencies from 0.000048 to 0.39. Of these, 10 were identified in our study population as 20 paired haplotype combinations. To determine the functional significance of these haplotypes, luciferase reporter constructs representing these haplotypes were transfected into glioblastoma cells and their effect on MGMT promoter activity was determined. Compared with the most common (reference) haplotype 1, seven haplotypes significantly upregulated MGMT promoter activity (18–119% increase; P < 0.05), six significantly downregulated MGMT promoter activity (29–97% decrease; P < 0.05) and one haplotype had no effect. Mechanistic studies conducted support the conclusion that MGMT P/E haplotypes, rather than individual SNPs, differentially regulate MGMT transcription and could thus play a significant role in human sensitivity to environmental and therapeutic alkylating agents. PMID:24163400

  18. Human Galectin-9 Is a Potent Mediator of HIV Transcription and Reactivation

    PubMed Central

    Abdel-Mohsen, Mohamed; Chavez, Leonard; Tandon, Ravi; Chew, Glen M.; Deng, Xutao; Danesh, Ali; Keating, Sheila; Lanteri, Marion; Samuels, Michael L.; Hoh, Rebecca; Sacha, Jonah B.; Norris, Philip J.; Niki, Toshiro; Shikuma, Cecilia M.; Hirashima, Mitsuomi; Deeks, Steven G.; Ndhlovu, Lishomwa C.; Pillai, Satish K.

    2016-01-01

    Identifying host immune determinants governing HIV transcription, latency and infectivity in vivo is critical to developing an HIV cure. Based on our recent finding that the host factor p21 regulates HIV transcription during antiretroviral therapy (ART), and published data demonstrating that the human carbohydrate-binding immunomodulatory protein galectin-9 regulates p21, we hypothesized that galectin-9 modulates HIV transcription. We report that the administration of a recombinant, stable form of galectin-9 (rGal-9) potently reverses HIV latency in vitro in the J-Lat HIV latency model. Furthermore, rGal-9 reverses HIV latency ex vivo in primary CD4+ T cells from HIV-infected, ART-suppressed individuals (p = 0.002), more potently than vorinostat (p = 0.02). rGal-9 co-administration with the latency reversal agent "JQ1", a bromodomain inhibitor, exhibits synergistic activity (p<0.05). rGal-9 signals through N-linked oligosaccharides and O-linked hexasaccharides on the T cell surface, modulating the gene expression levels of key transcription initiation, promoter proximal-pausing, and chromatin remodeling factors that regulate HIV latency. Beyond latent viral reactivation, rGal-9 induces robust expression of the host antiviral deaminase APOBEC3G in vitro and ex vivo (FDR<0.006) and significantly reduces infectivity of progeny virus, decreasing the probability that the HIV reservoir will be replenished when latency is reversed therapeutically. Lastly, endogenous levels of soluble galectin-9 in the plasma of 72 HIV-infected ART-suppressed individuals were associated with levels of HIV RNA in CD4+ T cells (p<0.02) and with the quantity and binding avidity of circulating anti-HIV antibodies (p<0.009), suggesting a role of galectin-9 in regulating HIV transcription and viral production in vivo during therapy. Our data suggest that galectin-9 and the host glycosylation machinery should be explored as foundations for novel HIV cure strategies. PMID:27253379

  19. Human Galectin-9 Is a Potent Mediator of HIV Transcription and Reactivation.

    PubMed

    Abdel-Mohsen, Mohamed; Chavez, Leonard; Tandon, Ravi; Chew, Glen M; Deng, Xutao; Danesh, Ali; Keating, Sheila; Lanteri, Marion; Samuels, Michael L; Hoh, Rebecca; Sacha, Jonah B; Norris, Philip J; Niki, Toshiro; Shikuma, Cecilia M; Hirashima, Mitsuomi; Deeks, Steven G; Ndhlovu, Lishomwa C; Pillai, Satish K

    2016-06-01

    Identifying host immune determinants governing HIV transcription, latency and infectivity in vivo is critical to developing an HIV cure. Based on our recent finding that the host factor p21 regulates HIV transcription during antiretroviral therapy (ART), and published data demonstrating that the human carbohydrate-binding immunomodulatory protein galectin-9 regulates p21, we hypothesized that galectin-9 modulates HIV transcription. We report that the administration of a recombinant, stable form of galectin-9 (rGal-9) potently reverses HIV latency in vitro in the J-Lat HIV latency model. Furthermore, rGal-9 reverses HIV latency ex vivo in primary CD4+ T cells from HIV-infected, ART-suppressed individuals (p = 0.002), more potently than vorinostat (p = 0.02). rGal-9 co-administration with the latency reversal agent "JQ1", a bromodomain inhibitor, exhibits synergistic activity (p<0.05). rGal-9 signals through N-linked oligosaccharides and O-linked hexasaccharides on the T cell surface, modulating the gene expression levels of key transcription initiation, promoter proximal-pausing, and chromatin remodeling factors that regulate HIV latency. Beyond latent viral reactivation, rGal-9 induces robust expression of the host antiviral deaminase APOBEC3G in vitro and ex vivo (FDR<0.006) and significantly reduces infectivity of progeny virus, decreasing the probability that the HIV reservoir will be replenished when latency is reversed therapeutically. Lastly, endogenous levels of soluble galectin-9 in the plasma of 72 HIV-infected ART-suppressed individuals were associated with levels of HIV RNA in CD4+ T cells (p<0.02) and with the quantity and binding avidity of circulating anti-HIV antibodies (p<0.009), suggesting a role of galectin-9 in regulating HIV transcription and viral production in vivo during therapy. Our data suggest that galectin-9 and the host glycosylation machinery should be explored as foundations for novel HIV cure strategies. PMID:27253379

  20. Generation of functional hepatocytes from human spermatogonial stem cells

    PubMed Central

    Chen, Zheng; Sun, Min; Yuan, Qingqing; Niu, Minghui; Yao, Chencheng; Hou, Jingmei; Wang, Hong; Wen, Liping; Liu, Yun; Li, Zheng; He, Zuping

    2016-01-01

    To generate functional human hepatocytes from stem cells and/or extra-hepatic tissues could provide an important source of cells for treating liver diseases. Spermatogonial stem cells (SSCs) have an unlimited plasticity since they can dedifferentiate and transdifferentiate to other cell lineages. However, generation of mature and functional hepatocytes from human SSCs has not yet been achieved. Here we have for the first time reported direct transdifferentiation of human SSCs to mature and functional hepatocytes by three-step induction using the defined condition medium. Human SSCs were first transdifferentiated to hepatic stem cells, as evidenced by their morphology and biopotential nature of co-expressing hepatocyte and cholangiocyte markers but not hallmarks for embryonic stem cells. Hepatic stem cells were further induced to differentiate into mature hepatocytes identified by their morphological traits and strong expression of CK8, CK18, ALB, AAT, TF, TAT, and cytochrome enzymes rather than CK7 or CK19. Significantly, mature hepatocytes derived from human SSCs assumed functional attributes of human hepatocytes, because they could produce albumin, remove ammonia, and uptake and release indocyanine green. Moreover, expression of β-CATENIN, HNF4A, FOXA1 and GATA4 was upregulated during the transdifferentiation of human SSCs to mature hepatocytes. Collectively, human SSCs could directly transdifferentiate to mature and functional hepatocytes. This study could offer an invaluable source of human hepatocytes for curing liver disorders and drug toxicology screening and provide novel insights into mechanisms underlying human liver regeneration. PMID:26840458

  1. Generation of functional hepatocytes from human spermatogonial stem cells.

    PubMed

    Chen, Zheng; Sun, Min; Yuan, Qingqing; Niu, Minghui; Yao, Chencheng; Hou, Jingmei; Wang, Hong; Wen, Liping; Liu, Yun; Li, Zheng; He, Zuping

    2016-02-23

    To generate functional human hepatocytes from stem cells and/or extra-hepatic tissues could provide an important source of cells for treating liver diseases. Spermatogonial stem cells (SSCs) have an unlimited plasticity since they can dedifferentiate and transdifferentiate to other cell lineages. However, generation of mature and functional hepatocytes from human SSCs has not yet been achieved. Here we have for the first time reported direct transdifferentiation of human SSCs to mature and functional hepatocytes by three-step induction using the defined condition medium. Human SSCs were first transdifferentiated to hepatic stem cells, as evidenced by their morphology and biopotential nature of co-expressing hepatocyte and cholangiocyte markers but not hallmarks for embryonic stem cells. Hepatic stem cells were further induced to differentiate into mature hepatocytes identified by their morphological traits and strong expression of CK8, CK18, ALB, AAT, TF, TAT, and cytochrome enzymes rather than CK7 or CK19. Significantly, mature hepatocytes derived from human SSCs assumed functional attributes of human hepatocytes, because they could produce albumin, remove ammonia, and uptake and release indocyanine green. Moreover, expression of β-CATENIN, HNF4A, FOXA1 and GATA4 was upregulated during the transdifferentiation of human SSCs to mature hepatocytes. Collectively, human SSCs could directly transdifferentiate to mature and functional hepatocytes. This study could offer an invaluable source of human hepatocytes for curing liver disorders and drug toxicology screening and provide novel insights into mechanisms underlying human liver regeneration. PMID:26840458

  2. An empirical assessment of generational differences in basic human values.

    PubMed

    Lyons, Sean T; Duxbury, Linda; Higgins, Christopher

    2007-10-01

    This study assessed generational differences in human values as measured by the Schwartz Value Survey. It was proposed that the two most recent generations, Millennials and Generation Xers, would value Self-enhancement and Openness to Change more than the two older generations, Baby Boomers and Matures, while the two older generations would value Self-transcendence and Conservation more. The hypotheses were tested with a combined sample of Canadian knowledge workers and undergraduate business students (N = 1,194). Two hypotheses were largely supported, although an unexpectedly large difference was observed between Millennials and Generation Xers with respect to Openness to Change and Self-enhancement. The findings suggest that generation is a useful variable in examining differences in social values. PMID:18175471

  3. Understanding Generational Diversity: Strategic Human Resource Management and Development across the Generational "Divide"

    ERIC Educational Resources Information Center

    Amayah, Angela Titi; Gedro, Julie

    2014-01-01

    There are more generations in today's workforce than ever before, which has the possibility to create challenges for Human Resource professionals. The purpose of this article is to interrogate existing stereotypes and generalities about the characteristics of different generations with respect to the workplace, and to offer suggestions for…

  4. Interaction of the human T-cell lymphotropic virus type 1 tax transactivator with transcription factor IIA.

    PubMed Central

    Clemens, K E; Piras, G; Radonovich, M F; Choi, K S; Duvall, J F; DeJong, J; Roeder, R; Brady, J N

    1996-01-01

    The Tax protein of human T-cell lymphotropic virus type 1 (HTLV-1) is a 40-kDa transcriptional activator which is critical for HTLV-1 gene regulation and virus-induced cellular transformation. Tax is localized to the DNA through its interaction with the site-specific activators cyclic AMP-responsive element-binding protein, NF-kappaB, and serum response factor. It has been suggested that the recruitment of Tax to the DNA positions Tax for interaction with the basal transcriptional machinery. On the basis of several independent assays, we now report a physical and functional interaction between Tax and the transcription factor, TFIIA. First, Tax was found to interact with the 35-kDa (alpha) subunit of TFIIA in the yeast two-hybrid interaction system. Importantly, two previously characterized mutants with point mutations in Tax, M32 (Y196A, K197S) and M41 (H287A, P288S), which were shown to be defective in Tax-activated transcription were unable to interact with TFIIA in this assay. Second, a glutathione-S-transferase (GST) affinity-binding assay showed that the interaction of holo-TFIIA with GST-Tax was 20-fold higher than that observed with either the GST-Tax M32 activation mutant or the GST control. Third, a coimmunoprecipitation assay showed that in HTLV-1-infected human T lymphocytes, Tax and TFIIA were associated. Finally, TFIIA facilitates Tax transactivation in vitro and in vivo. In vitro transcription studies showed reduced levels of Tax-activated transcription in cell extracts depleted of TFIIA. In addition, transfection of human T lymphocytes with TFIIA expression vectors enhanced Tax-activated transcription of an HTLV-1 long terminal repeat-chloramphenicol acetyltransferase reporter construct. Our study suggests that the interaction of Tax with the transcription factor TFIIA may play a role in Tax-mediated transcriptional activation. PMID:8756622

  5. Cysteine-Generated Sulfide in the Cytosol Negatively Regulates Autophagy and Modulates the Transcriptional Profile in Arabidopsis[W

    PubMed Central

    Álvarez, Consolación; García, Irene; Moreno, Inmaculada; Pérez-Pérez, María Esther; Crespo, José L.; Romero, Luis C.; Gotor, Cecilia

    2012-01-01

    In Arabidopsis thaliana, DES1 is the only identified l-Cysteine desulfhydrase located in the cytosol, and it is involved in the degradation of cysteine and the concomitant production of H2S in this cell compartment. Detailed characterization of the T-DNA insertion mutants des1-1 and des1-2 has provided insight into the role of sulfide metabolically generated in the cytosol as a signaling molecule. Mutations of L-CYS DESULFHYDRASE 1 (DES1) impede H2S generation in the Arabidopsis cytosol and strongly affect plant metabolism. Senescence-associated vacuoles are detected in mesophyll protoplasts of des1 mutants. Additionally, DES1 deficiency promotes the accumulation and lipidation of the ATG8 protein, which is associated with the process of autophagy. The transcriptional profile of the des1-1 mutant corresponds to its premature senescence and autophagy-induction phenotypes, and restoring H2S generation has been shown to eliminate the phenotypic defects of des1 mutants. Moreover, sulfide is able to reverse ATG8 accumulation and lipidation, even in wild-type plants when autophagy is induced by carbon starvation, suggesting a general effect of sulfide on autophagy regulation that is unrelated to sulfur or nitrogen limitation stress. Our results suggest that cysteine-generated sulfide in the cytosol negatively regulates autophagy and modulates the transcriptional profile of Arabidopsis. PMID:23144183

  6. Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle

    PubMed Central

    Hennenberg, Martin; Strittmatter, Frank; Beckmann, Christer; Rutz, Beata; Füllhase, Claudius; Waidelich, Raphaela; Montorsi, Francesco; Hedlund, Petter; Andersson, Karl-Erik; Stief, Christian G.; Gratzke, Christian

    2012-01-01

    Background The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. Objective To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Methods Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Results Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Conclusions Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors

  7. Generation of serrated and wavy petals by inhibition of the activity of TCP transcription factors in Arabidopsis thaliana

    PubMed Central

    Ohme-Takagi, Masaru; Sato, Fumihiko

    2011-01-01

    The final shape of shoot lateral organs, namely, leaves and flowers, is determined by coordinated growth after the initiation of primordia from shoot meristems in seed plants. This coordination is achieved by the complex action of many transcription factors, which include the TEOSINTE BRANCHED1, CYCLOIDEA and PCF (TCP) family. We have recently reported that CINCINNATA-like (CIN-like) TCP genes act dose-dependently to regulate the flat and smooth morphology of leaves in Arabidopsis thaliana. In contrast, the roles of CIN-like TCP genes in flower development are poorly understood. In this report, using multiple tcp mutants and transgenic plants in which the activity of CIN-like TCP transcription factors is dominantly inhibited, we found that these TCPs regulate the smooth and flat morphology of petals. Based on these findings, we discuss a possible strategy to generate a fringed morphology in floricultural plants. PMID:21455021

  8. Human general transcription factor TFIIA: characterization of a cDNA encoding the small subunit and requirement for basal and activated transcription.

    PubMed Central

    DeJong, J; Bernstein, R; Roeder, R G

    1995-01-01

    The human general transcription factor TFIIA is one of several factors involved in specific transcription by RNA polymerase II, possibly by regulating the activity of the TATA-binding subunit (TBP) of TFIID. TFIIA purified from HeLa extracts consists of 35-, 19-, and 12-kDa subunits. Here we describe the isolation of a cDNA clone (hTFIIA gamma) encoding the 12-kDa subunit. Using expression constructs derived from hTFIIA gamma and TFIIA alpha/beta (which encodes a 55-kDa precursor to the alpha and beta subunits of natural TFIIA), we have constructed a synthetic TFIIA with a polypeptide composition similar to that of natural TFIIA. The recombinant complex supports the formation of a DNA-TBP-TFIIA complex and mediates both basal and Gal4-VP16-activated transcription by RNA polymerase II in TFIIA-depleted nuclear extracts. In contrast, TFIIA has no effect on tRNA and 5S RNA transcription by RNA polymerase III in this system. We also present evidence that both the p55 and p12 recombinant subunits interact with TBP and that the basic region of TBP is critical for the TFIIA-dependent function of TBP in nuclear extracts. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:7724559

  9. The Ability of Positive Transcription Elongation Factor b To Transactivate Human Immunodeficiency Virus Transcription Depends on a Functional Kinase Domain, Cyclin T1, and Tat

    PubMed Central

    Fujinaga, Koh; Cujec, Thomas P.; Peng, Junmin; Garriga, Judit; Price, David H.; Graña, Xavier; Peterlin, B. Matija

    1998-01-01

    By binding to the transactivation response element (TAR) RNA, the transcriptional transactivator (Tat) from the human immunodeficiency virus increases rates of elongation rather than initiation of viral transcription. Two cyclin-dependent serine/threonine kinases, CDK7 and CDK9, which phosphorylate the C-terminal domain of RNA polymerase II, have been implicated in Tat transactivation in vivo and in vitro. In this report, we demonstrate that CDK9, which is the kinase component of the positive transcription elongation factor b (P-TEFb) complex, can activate viral transcription when tethered to the heterologous Rev response element RNA via the regulator of expression of virion proteins (Rev). The kinase activity of CDK9 and cyclin T1 is essential for these effects. Moreover, P-TEFb binds to TAR only in the presence of Tat. We conclude that Tat–P-TEFb complexes bind to TAR, where CDK9 modifies RNA polymerase II for the efficient copying of the viral genome. PMID:9696809

  10. Responses of human cells to ZnO nanoparticles: a gene transcription study†

    PubMed Central

    Moos, Philip J.; Olszewski, Kyle; Honeggar, Matthew; Cassidy, Pamela; Leachman, Sancy; Woessner, David; Cutler, N. Shane; Veranth, John M.

    2013-01-01

    The gene transcript profile responses to metal oxide nanoparticles was studied using human cell lines derived from the colon and skin tumors. Much of the research on nanoparticle toxicology has focused on models of inhalation and intact skin exposure, and effects of ingestion exposure and application to diseased skin are relatively unknown. Powders of nominally nanosized SiO2, TiO2, ZnO and Fe2O3 were chosen because these substances are widely used in consumer products. The four oxides were evaluated using colon-derived cell lines, RKO and CaCo-2, and ZnO and TiO2 were evaluated further using skin-derived cell lines HaCaT and SK Mel-28. ZnO induced the most notable gene transcription changes, even though this material was applied at the lowest concentration. Nano-sized and conventional ZnO induced similar responses suggesting common mechanisms of action. The results showed neither a non-specific response pattern common to all substances nor synergy of the particles with TNF-α cotreatment. The response to ZnO was not consistent with a pronounced proinflammatory signature, but involved changes in metal metabolism, chaperonin proteins, and protein folding genes. This response was observed in all cell lines when ZnO was in contact with the human cells. When the cells were exposed to soluble Zn, the genes involved in metal metabolism were induced but the genes involved in protein refoldling were unaffected. This provides some of the first data on the effects of commercial metal oxide nanoparticles on human colon-derived and skin-derived cells. PMID:21769377

  11. Ultraviolet radiation inhibits 15-hydroxyprostaglandin dehydrogenase levels in human skin: evidence of transcriptional suppression

    PubMed Central

    Judson, Benjamin L.; Miyaki, Akira; Kekatpure, Vikram D.; Du, Baoheng; Gilleaudeau, Patricia; Sullivan-Whalen, Mary; Mohebati, Arash; Nair, Sudhir; Boyle, Jay O.; Granstein, Richard D.; Subbaramaiah, Kotha; Krueger, James G.; Dannenberg, Andrew J.

    2010-01-01

    Elevated levels of prostaglandins (PGs) have been detected in skin following ultraviolet radiation (UVR). Prostaglandins play an important role in mediating both the acute and chronic consequences of UVR exposure. UVR-mediated induction of cyclooxygenase-2 (COX-2) contributes to increased PG synthesis. In theory, reduced catabolism might also contribute to increased PG levels. 15-hydroxyprostaglandin deyhdrogenase (15-PGDH), a tumor suppressor gene, plays a major role in PG catabolism. In this study, we investigated whether UVR exposure suppressed 15-PGDH while inducing COX-2 in keratinocytes and in human skin. UVR exposure caused dose-dependent induction of COX-2, suppression of 15-PGDH and increased PGE2 production in HaCaT cells. Exposure to UVR suppressed the transcription of 15-PGDH resulting in reduced amounts of 15-PGDH mRNA, protein and enzyme activity. UVR exposure induced Slug, a repressive transcription factor that bound to the 15-PGDH promoter. Silencing Slug blocked UVR-mediated down-regulation of 15-PGDH. The effects of UVR were also evaluated in the EpiDerm™ skin model, a 3-dimensional model of human epidermis. Here too, COX-2 levels were induced and 15-PGDH levels suppressed following UVR exposure. Next the effects of UVR were evaluated in human subjects. UVR treatment induced COX-2 while suppressing 15-PGDH mRNA in the skin of 9 of 10 subjects. Collectively, these data suggest that reduced expression of 15-PGDH contributes to the elevated levels of PGs found in skin following UVR exposure. Possibly, agents that prevent UVR-mediated down regulation of 15-PGDH will affect the acute or long-term consequences of UVR exposure including nonmelanoma skin cancer. PMID:20643784

  12. A novel transcriptional regulator of L-arabinose utilization in human gut bacteria

    DOE PAGESBeta

    Chang, Changsoo; Tesar, Christine; Li, Xiaoqing; Kim, Youngchang; Rodionov, Dmitry A.; Joachimiak, Andrzej

    2015-10-04

    We report that carbohydrate metabolism plays a crucial role in the ecophysiology of human gut microbiota. Mechanisms of transcriptional regulation of sugar catabolism in commensal and prevalent human gut bacteria such as Bacteroides thetaiotaomicron remain mostly unknown. By a combination of bioinformatics and experimental approaches, we have identified an NrtR family transcription factor (BT0354 in B. thetaiotaomicron, BtAraR) as a novel regulator controlling the arabinose utilization genes. L-arabinose was confirmed to be a negative effector of BtAraR. We have solved the crystal structures of the apo and L-arabinose-bound BtAraR proteins, as well as the complex of apo-protein with a specificmore » DNA operator. BtAraR forms a homodimer with each subunit comprised of the ligand-binding Nudix hydrolase-like domain and the DNA-binding winged-helix-turn-helix (wHTH) domain. We have identified the residues involved in binding of L-arabinose and recognition of DNA. The majority of these residues are well conserved in the AraR orthologs in Bacteroidetes. In the structure of the BtAraR–DNA complex, we found the unique interaction of arginine intercalating its guanidinum moiety into the base pair stacking of B-DNA. L-arabinose binding induces movement of wHTH domains, resulting in a conformation unsuitable for DNA binding. Furthermore, our analysis facilitates reconstruction of the metabolic and regulatory networks involved in carbohydrate utilization in human gut Bacteroides.« less

  13. A novel transcriptional regulator of L-arabinose utilization in human gut bacteria

    SciTech Connect

    Chang, Changsoo; Tesar, Christine; Li, Xiaoqing; Kim, Youngchang; Rodionov, Dmitry A.; Joachimiak, Andrzej

    2015-10-04

    We report that carbohydrate metabolism plays a crucial role in the ecophysiology of human gut microbiota. Mechanisms of transcriptional regulation of sugar catabolism in commensal and prevalent human gut bacteria such as Bacteroides thetaiotaomicron remain mostly unknown. By a combination of bioinformatics and experimental approaches, we have identified an NrtR family transcription factor (BT0354 in B. thetaiotaomicron, BtAraR) as a novel regulator controlling the arabinose utilization genes. L-arabinose was confirmed to be a negative effector of BtAraR. We have solved the crystal structures of the apo and L-arabinose-bound BtAraR proteins, as well as the complex of apo-protein with a specific DNA operator. BtAraR forms a homodimer with each subunit comprised of the ligand-binding Nudix hydrolase-like domain and the DNA-binding winged-helix-turn-helix (wHTH) domain. We have identified the residues involved in binding of L-arabinose and recognition of DNA. The majority of these residues are well conserved in the AraR orthologs in Bacteroidetes. In the structure of the BtAraR–DNA complex, we found the unique interaction of arginine intercalating its guanidinum moiety into the base pair stacking of B-DNA. L-arabinose binding induces movement of wHTH domains, resulting in a conformation unsuitable for DNA binding. Furthermore, our analysis facilitates reconstruction of the metabolic and regulatory networks involved in carbohydrate utilization in human gut Bacteroides.

  14. Reverse transcription-polymerase chain reaction detection of transcribed sequences on human chromosome 21

    SciTech Connect

    Cheng, J.F.; Zhu, Y. )

    1994-03-15

    Seventy-four pairs of oligonucleotides derived from sequence-tagged sites (STSs) on the long arm of human chromosome 21, specifically from bands 21q22.1 to 21q22.3, were used in reverse transcription-polymerase chain reactions (RT-PCR) to detect the presence of expressed sequences in a fetal brain. These STSs included 69 that had not been related to transcribed sequences and 5 that had detected two known genes and three previously isolated cDNA clones. Of the 69 STSs analyzed in RT-PCR, 25 allowed amplification of specific cDNA fragments. The sizes of amplified cDNA fragments match those amplified from either human genomic DNA or somatic hybrid cells containing human chromosome 21. Of the 11 cDNA analyzed in Northern blot hybridizations, 6 hybridized to specific RNA species. The rapid screening for cDNA using previously mapped STSs has provided insight into the distribution of expressed sequences in this region of chromosome 21. Northern blot analysis of the amplified cDNA fragments has revealed interesting candidate genes in two disease loci. The marker D21S267 was previously mapped in the Down syndrome region of chromosome 21, and the marker D21S113 is closely linked to progressive myoclonus epilepsy. The cDNA fragments amplified using the primer sequences derived from D21S267 and D21S113 hybridized to 7- and 6.5-kb transcripts, respectively, which seems to express predominantly in brain. 37 refs., 3 figs., 1 tab.

  15. Transcriptional expression profile of cultured human embryonic stem cells in vitro and in vivo.

    PubMed

    Keil, Marlen; Siegert, Antje; Eckert, Klaus; Gerlach, Jörg; Haider, Wolfram; Fichtner, Iduna

    2012-03-01

    The aims of this study were to analyze the spontaneous differentiation of human embryonic stem cells in vitro and in vivo and to investigate the influence of in vitro partial differentiation on in vivo teratoma formation in immunodeficient mice. Standardized methods are needed for long-term cultivation of undifferentiated stem cells and the multilineage cells that spontaneously differentiate from them. Accordingly, SA002 human embryonic stem cells were cultured on irradiated mouse embryonic fibroblasts cells, on irradiated human foreskin fibroblasts, or were cultured feeder-free using matrigel. Expression of marker protein transcripts was analyzed in undifferentiated and differentiated stem cells using real-time PCR, and both types of stem cells were transplanted subcutaneously into immunodeficient NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ mice to test for teratoma formation. Teratoma histology and expression profiles were subsequently characterized. Cells cultured using different conditions and morphologically undifferentiated cells had comparable marker expression profiles, showing high expression levels of markers for pluripotency and low-to-moderate expression levels of germ layer markers. Cells showing spontaneous differentiation that were cultured in feeder-free conditions in the absence of basic fibroblast growth factor demonstrated slight upregulation of sex determining region Y-box 17, connexin 32, and albumin expression at early time points, as well as expression of octamer-binding transcription factor 4, proteoglycan epitopes on podocalyxin (Trafalgar), and alkaline phosphatase. At later time points, expression of hepatocyte nuclear factor-3-beta, and hepatocyte nuclear factor-4-alpha and alpha fetoprotein was upregulated, whereas beta-3-tubulin, chemokine receptor, nestin, sex-determining region Y-box 17, and connexin 32 were downregulated. Expression of pluripotency markers remained high, and hematopoetic markers were not expressed. SA002 cells that showed

  16. Transcription factor 4 (TCF4) and schizophrenia: integrating the animal and the human perspective.

    PubMed

    Quednow, Boris B; Brzózka, Magdalena M; Rossner, Moritz J

    2014-08-01

    Schizophrenia is a genetically complex disease considered to have a neurodevelopmental pathogenesis and defined by a broad spectrum of positive and negative symptoms as well as cognitive deficits. Recently, large genome-wide association studies have identified common alleles slightly increasing the risk for schizophrenia. Among the few schizophrenia-risk genes that have been consistently replicated is the basic Helix-Loop-Helix (bHLH) transcription factor 4 (TCF4). Haploinsufficiency of the TCF4 (formatting follows IUPAC nomenclature: TCF4 protein/protein function, Tcf4 rodent gene cDNA mRNA, TCF4 human gene cDNA mRNA) gene causes the Pitt-Hopkins syndrome-a neurodevelopmental disease characterized by severe mental retardation. Accordingly, Tcf4 null-mutant mice display developmental brain defects. TCF4-associated risk alleles are located in putative coding and non-coding regions of the gene. Hence, subtle changes at the level of gene expression might be relevant for the etiopathology of schizophrenia. Behavioural phenotypes obtained with a mouse model of slightly increased gene dosage and electrophysiological investigations with human risk-allele carriers revealed an overlapping spectrum of schizophrenia-relevant endophenotypes. Most prominently, early information processing and higher cognitive functions appear to be associated with TCF4 risk genotypes. Moreover, a recent human study unravelled gene × environment interactions between TCF4 risk alleles and smoking behaviour that were specifically associated with disrupted early information processing. Taken together, TCF4 is considered as an integrator ('hub') of several bHLH networks controlling critical steps of various developmental, and, possibly, plasticity-related transcriptional programs in the CNS and changes of TCF4 expression also appear to affect brain networks important for information processing. Consequently, these findings support the neurodevelopmental hypothesis of schizophrenia and provide a

  17. Identification of Transcription Factor AML-1 Binding Site Upstream of Human Cytomegalovirus UL111A Gene

    PubMed Central

    Zheng, Xiaoqun; Gao, Yan; Zhang, Qi; Liu, Yanqing; Peng, Ying; Fu, Miao; Ji, Yanhong

    2015-01-01

    Human cytomegalovirus (HCMV) interleukin-10 (hcmvIL-10), encoded by HCMV UL111A gene, is a homolog of human IL-10. It exerts immunomodulatory effects that allow HCMV to evade host defense mechanisms. However, the exact mechanism underlying the regulation of hcmvIL-10 expression is not well understood. The transcription factor acute myeloid leukemia 1 (AML-1) plays an important role in the regulation of various genes involved in the differentiation of hematopoietic lineages. A putative AML-1 binding site is present within the upstream regulatory region (URR) of UL111A gene. To provide evidence that AML-1 is involved in regulating UL111A gene expression, we examined the interaction of AML-1 with the URR of UL111A in HCMV-infected human monocytic THP-1 cells using a chromatin immunoprecipitation assay. HcmvIL-10 transcription was detected in differentiated THP-1 cells, but not in undifferentiated ones. Furthermore, the URR of UL111A showed a higher intensity of AML-1 binding, a higher level of histone H3 acetyl-K9, but a lower level of histone H3 dimethyl-K9 in differentiated THP-1 cells than undifferentiated cells. Down-regulation of AML1 by RNA interference decreased the expression of the UL111A gene. Our results suggest that AML-1 may contribute to the epigenetic regulation of UL111A gene via histone modification in HCMV-infected differentiated THP-1 cells. This finding could be useful for the development of new anti-viral therapies. PMID:25658598

  18. TFClass: a classification of human transcription factors and their rodent orthologs.

    PubMed

    Wingender, Edgar; Schoeps, Torsten; Haubrock, Martin; Dönitz, Jürgen

    2015-01-01

    TFClass aims at classifying eukaryotic transcription factors (TFs) according to their DNA-binding domains (DBDs). For this, a classification schema comprising four generic levels (superclass, class, family and subfamily) was defined that could accommodate all known DNA-binding human TFs. They were assigned to their (sub-)families as instances at two different levels, the corresponding TF genes and individual gene products (protein isoforms). In the present version, all mouse and rat orthologs have been linked to the human TFs, and the mouse orthologs have been arranged in an independent ontology. Many TFs were assigned with typical DNA-binding patterns and positional weight matrices derived from high-throughput in-vitro binding studies. Predicted TF binding sites from human gene upstream sequences are now also attached to each human TF whenever a PWM was available for this factor or one of his paralogs. TFClass is freely available at http://tfclass.bioinf.med.uni-goettingen.de/ through a web interface and for download in OBO format. PMID:25361979

  19. Enhancer Turnover Is Associated with a Divergent Transcriptional Response to Glucocorticoid in Mouse and Human Macrophages.

    PubMed

    Jubb, Alasdair W; Young, Robert S; Hume, David A; Bickmore, Wendy A

    2016-01-15

    Phenotypic differences between individuals and species are controlled in part through differences in expression of a relatively conserved set of genes. Genes expressed in the immune system are subject to especially powerful selection. We have investigated the evolution of both gene expression and candidate enhancers in human and mouse macrophages exposed to glucocorticoid (GC), a regulator of innate immunity and an important therapeutic agent. Our analyses revealed a very limited overlap in the repertoire of genes responsive to GC in human and mouse macrophages. Peaks of inducible binding of the GC receptor (GR) detected by chromatin immunoprecipitation-Seq correlated with induction, but not repression, of target genes in both species, occurred at distal regulatory sites not promoters, and were strongly enriched for the consensus GR-binding motif. Turnover of GR binding between mice and humans was associated with gain and loss of the motif. There was no detectable signal of positive selection at species-specific GR binding sites, but clear evidence of purifying selection at the small number of conserved sites. We conclude that enhancer divergence underlies the difference in transcriptional activation after GC treatment between mouse and human macrophages. Only the shared inducible loci show evidence of selection, and therefore these loci may be important for the subset of responses to GC that is shared between species. PMID:26663721

  20. Involvement of microphthalmia-associated transcription factor (MITF) in expression of human melanocortin-1 receptor (MC1R).

    PubMed

    Aoki, Hirofumi; Moro, Osamu

    2002-09-20

    Analysis of the nucleotide sequence of human melanocortin-1 receptor (MC1R) promoter indicated that an E-box (CANNTG) is present immediately upstream of the transcriptional initiation site. The presence of the CATGTG motif suggests that MC1R gene expression may be regulated by a basic helix-loop-helix-leucine-zipper (bHLH-LZ) type transcription factor. The microphthalmia-associated transcription factor (MITF), which belongs to the family of bHLH-LZ type transcription factors, regulates the transcription of melanogenesis-related enzyme genes such as the tyrosinase and TRP-1 genes. We investigated whether MITF regulates human MC1R gene expression through the same transcriptional mechanism as tyrosinase and TRP-1 genes in melanocytes. For this purpose, the effect of co-expression of cDNA encoding MITF on MC1R promoter activity in NIH/3T3 cells was studied. MC1R promoter activity was induced to the extent of approximately 5-fold in the presence of MITF. In addition, electrophoretic mobility shift assay indicated that nuclear extracts of human SK-Mel-2 cells contain a protein that binds specifically to the MC1R promoter region containing the CATGTG motif. These results suggested that MITF regulates not only the expression of enzymes involved in melanin synthesis, but also the expression of a receptor which plays an essential role in melanocyte functions. PMID:12204775

  1. Murine and Human Spermatids Are Characterized by Numerous, Newly Synthesized and Differentially Expressed Transcription Factors and Bromodomain-Containing Proteins.

    PubMed

    Klaus, Elisabeth Sabine; Gonzalez, Nicola Helena; Bergmann, Martin; Bartkuhn, Marek; Weidner, Wolfgang; Kliesch, Sabine; Rathke, Christina

    2016-07-01

    Much of spermatid differentiation takes place in the absence of active transcription, but in the early phase, large amounts of mRNA are synthesized, translationally repressed, and stored. Most nucleosomal histones are then degraded, and chromatin is repackaged by protamines. For both transcription and the histone-to-protamine transition in differentiating spermatids, chromatin must be opened. This raises the question of whether two different processes exist. It is conceivable that for initiation of the histone-to-protamine transition, the already accessible, actively transcribed chromatin regions are utilized or vice versa. We analyzed the enrichment of different canonical TATA-box-binding, protein-associated factors and their variants in murine spermatids, diverse bromodomain-containing proteins, and components of the Polycomb repressive complexes PRC1 and PRC2 using quantitative PCR. We compared the enrichment of corresponding proteins in human and murine spermatids and analyzed the time frame of postmeiotic transcription and expression of histones, transition proteins, and protamines in human and murine spermatids using immunohistology. We correlated the expression of different transcription factors and bromodomain-containing proteins and the pattern of acetylated histones to active transcription and to the histone-to-protamine transition in both human and murine spermatids. Our findings suggest that differentiating spermatids use both common and specific features to open chromatin first for transcription and subsequently for histone-to-protamine transition. PMID:27170439

  2. Identification of Tissue-Specific Protein-Coding and Noncoding Transcripts across 14 Human Tissues Using RNA-seq

    PubMed Central

    Zhu, Jinhang; Chen, Geng; Zhu, Sibo; Li, Suqing; Wen, Zhuo; Bin Li; Zheng, Yuanting; Shi, Leming

    2016-01-01

    Many diseases and adverse drug reactions exhibit tissue specificity. To better understand the tissue-specific expression characteristics of transcripts in different human tissues, we deeply sequenced RNA samples from 14 different human tissues. After filtering many lowly expressed transcripts, 24,729 protein-coding transcripts and 1,653 noncoding transcripts were identified. By analyzing highly expressed tissue-specific protein-coding transcripts (TSCTs) and noncoding transcripts (TSNTs), we found that testis expressed the highest numbers of TSCTs and TSNTs. Brain, monocytes, ovary, and heart expressed more TSCTs than the rest tissues, whereas brain, placenta, heart, and monocytes expressed more TSNTs than other tissues. Co-expression network constructed based on the TSCTs and TSNTs showed that each hub TSNT was co-expressed with several TSCTs, allowing functional annotation of TSNTs. Important biological processes and KEGG pathways highly related to the specific functions or diseases of each tissue were enriched with the corresponding TSCTs. These TSCTs and TSNTs may participate in the tissue-specific physiological or pathological processes. Our study provided a unique data set and systematic analysis of expression characteristics and functions of both TSCTs and TSNTs based on 14 distinct human tissues, and could facilitate future investigation of the mechanisms behind tissue-specific diseases and adverse drug reactions. PMID:27329541

  3. Identification of Tissue-Specific Protein-Coding and Noncoding Transcripts across 14 Human Tissues Using RNA-seq.

    PubMed

    Zhu, Jinhang; Chen, Geng; Zhu, Sibo; Li, Suqing; Wen, Zhuo; Bin Li; Zheng, Yuanting; Shi, Leming

    2016-01-01

    Many diseases and adverse drug reactions exhibit tissue specificity. To better understand the tissue-specific expression characteristics of transcripts in different human tissues, we deeply sequenced RNA samples from 14 different human tissues. After filtering many lowly expressed transcripts, 24,729 protein-coding transcripts and 1,653 noncoding transcripts were identified. By analyzing highly expressed tissue-specific protein-coding transcripts (TSCTs) and noncoding transcripts (TSNTs), we found that testis expressed the highest numbers of TSCTs and TSNTs. Brain, monocytes, ovary, and heart expressed more TSCTs than the rest tissues, whereas brain, placenta, heart, and monocytes expressed more TSNTs than other tissues. Co-expression network constructed based on the TSCTs and TSNTs showed that each hub TSNT was co-expressed with several TSCTs, allowing functional annotation of TSNTs. Important biological processes and KEGG pathways highly related to the specific functions or diseases of each tissue were enriched with the corresponding TSCTs. These TSCTs and TSNTs may participate in the tissue-specific physiological or pathological processes. Our study provided a unique data set and systematic analysis of expression characteristics and functions of both TSCTs and TSNTs based on 14 distinct human tissues, and could facilitate future investigation of the mechanisms behind tissue-specific diseases and adverse drug reactions. PMID:27329541

  4. System-wide analysis of the transcriptional network of human myelomonocytic leukemia cells predicts attractor structure and phorbol-ester-induced differentiation and dedifferentiation transitions

    NASA Astrophysics Data System (ADS)

    Sakata, Katsumi; Ohyanagi, Hajime; Sato, Shinji; Nobori, Hiroya; Hayashi, Akiko; Ishii, Hideshi; Daub, Carsten O.; Kawai, Jun; Suzuki, Harukazu; Saito, Toshiyuki

    2015-02-01

    We present a system-wide transcriptional network structure that controls cell types in the context of expression pattern transitions that correspond to cell type transitions. Co-expression based analyses uncovered a system-wide, ladder-like transcription factor cluster structure composed of nearly 1,600 transcription factors in a human transcriptional network. Computer simulations based on a transcriptional regulatory model deduced from the system-wide, ladder-like transcription factor cluster structure reproduced expression pattern transitions when human THP-1 myelomonocytic leukaemia cells cease proliferation and differentiate under phorbol myristate acetate stimulation. The behaviour of MYC, a reprogramming Yamanaka factor that was suggested to be essential for induced pluripotent stem cells during dedifferentiation, could be interpreted based on the transcriptional regulation predicted by the system-wide, ladder-like transcription factor cluster structure. This study introduces a novel system-wide structure to transcriptional networks that provides new insights into network topology.

  5. Transcription analysis, physical mapping, and molecular characterization of a nonclassical human leukocyte antigen class I gene.

    PubMed Central

    Chorney, M J; Sawada, I; Gillespie, G A; Srivastava, R; Pan, J; Weissman, S M

    1990-01-01

    The human major histocompatibility complex contains approximately 20 class I genes, pseudogenes, and gene fragments. These include the genes for the three major transplantation antigens, HLA-A, HLA-B, and HLA-C, as well as a number of other genes or pseudogenes of unknown biological significance. Most of the latter have C + G-rich sequences in their 5' ends that are unmethylated in the B-lymphoblastoid cell line 3.1.0. We investigated one of these genes, HLA-H, in more detail. The gene is, overall, strongly homologous in sequence to HLA-A but differs in several potentially significant ways, including changes in conserved promoter sequences, a single-base deletion producing a translation termination codon in exon 4, and a region of sequence divergence downstream of the transcribed portion of the gene. Nevertheless, mouse L cells transfected with the gene accumulated small amounts of apparently full-length polyadenylated RNA. A portion of this RNA begins at the transcription site predicted by analogy to certain class I cDNA clones, while another portion appears to begin shortly upstream. L cells transfected with a hybrid gene containing the first three exons of HLA-H and the last five exons of HLA-B27 accumulated full-length HLA transcripts at the same level as cells transfected with an HLA-B27 gene; both levels are at least 15- to 20-fold higher than that directed by HLA-H alone. In addition, we isolated a cDNA clone for HLA-H that contains a portion of intron 3 attached to a normally spliced sequence comprising exons 4 through 8. These results suggest that low levels of translatable mRNA for the truncated class I heavy chain encoded by HLA-H are produced under physiologic circumstances and that sequences 3' of intron 3 decrease the levels of stable transcripts. Images PMID:2294403

  6. Mutations in Human Immunodeficiency Virus Type 1 Nucleocapsid Protein Zinc Fingers Cause Premature Reverse Transcription

    PubMed Central

    Thomas, James A.; Bosche, William J.; Shatzer, Teresa L.; Johnson, Donald G.; Gorelick, Robert J.

    2008-01-01

    Human immunodeficiency virus type 1 (HIV-1) requires that its genome be reverse transcribed into double-stranded DNA for productive infection of cells. This process requires not only reverse transcriptase but also the nucleocapsid protein (NC), which functions as a nucleic acid chaperone. Reverse transcription generally begins once the core of the virion enters the cytoplasm of a newly infected cell. However, some groups have reported the presence of low levels of viral DNA (vDNA) within particles prior to infection, the significance and function of which is controversial. We report here that several HIV-1 NC mutants, which we previously identified as being replication defective, contain abnormally high levels of intravirion DNA. These findings were further reinforced by the inability of these NC mutants to perform endogenous reverse transcription (ERT), in contrast to the readily measurable ERT activity in wild-type HIV-1. When either of the NC mutations is combined with a mutation that inactivates the viral protease, we observed a significant reduction in the amount of intravirion DNA. Interestingly, we also observed high levels of intravirion DNA in the context of wild-type NC when we delayed budding by means of a PTAP(−) (Pro-Thr-Ala-Pro) mutation. Premature reverse transcription is most probably occurring before these mutant virions bud from producer cells, but we fail to see any evidence that the NC mutations alter the timing of Pr55Gag processing. Critically, our results also suggest that the presence of intravirion vDNA could serve as a diagnostic for identifying replication-defective HIV-1. PMID:18667500

  7. Exploiting ancestral mammalian genomes for the prediction of human transcription factor binding sites

    PubMed Central

    2012-01-01

    Background The computational prediction of Transcription Factor Binding Sites (TFBS) remains a challenge due to their short length and low information content. Comparative genomics approaches that simultaneously consider several related species and favor sites that have been conserved throughout evolution improve the accuracy (specificity) of the predictions but are limited due to a phenomenon called binding site turnover, where sequence evolution causes one TFBS to replace another in the same region. In parallel to this development, an increasing number of mammalian genomes are now sequenced and it is becoming possible to infer, to a surprisingly high degree of accuracy, ancestral mammalian sequences. Results We propose a TFBS prediction approach that makes use of the availability of inferred ancestral mammalian genomes to improve its accuracy. This method aims to identify binding loci, which are regions of a few hundred base pairs that have preserved their potential to bind a given transcription factor over evolutionary time. After proposing a neutral evolutionary model of predicted TFBS counts in a DNA region of a given length, we use it to identify regions that have preserved the number of predicted TFBS they contain to an unexpected degree given their divergence. The approach is applied to human chromosome 1 and shows significant gains in accuracy as compared to both existing single-species and multi-species TFBS prediction approaches, in particular for transcription factors that are subject to high turnover rates. Availability The source code and predictions made by the program are available at http://www.cs.mcgill.ca/~blanchem/bindingLoci. PMID:23281809

  8. EXPRESSION OF AS3MT ALTERS TRANSCRIPTIONAL PROFILES IN HUMAN UROTHELIAL CELLS EXPOSED TO ARSENITE

    EPA Science Inventory

    Inorganic arsenic (iAs) is an environmental toxin and human carcinogen. The enzymatic methylation of iAs that is catalyzed by arsenic (+3 oxidation state)-methyltransferase (AS3MT) generates reactive methylated intermediates that contribute to the toxic and carcinogenic effects ...

  9. EXPRESSON OF AS3MT ALTERS TRANSCRIPTIONAL PROFILES IN HUMAN UROTHELIAL CELLS EXPOSED TO ARSENITE

    EPA Science Inventory

    Inorganic arsenic (iAs) is an environmental toxin and human carcinogen. The enzymatic methylation of iAs that is catalyzed by As (3+ oxidation state)-methyltransferase (AS3MT) generates reactive methyl-As intermediates that may contribute to the toxic or carcinogenic effects of i...

  10. Regulation of the transcriptional program by DNA methylation during human αβ T-cell development

    PubMed Central

    Rodriguez, Ramon M.; Suarez-Alvarez, Beatriz; Mosén-Ansorena, David; García-Peydró, Marina; Fuentes, Patricia; García-León, María J.; Gonzalez-Lahera, Aintzane; Macias-Camara, Nuria; Toribio, María L.; Aransay, Ana M.; Lopez-Larrea, Carlos

    2015-01-01

    Thymocyte differentiation is a complex process involving well-defined sequential developmental stages that ultimately result in the generation of mature T-cells. In this study, we analyzed DNA methylation and gene expression profiles at successive human thymus developmental stages. Gain and loss of methylation occurred during thymocyte differentiation, but DNA demethylation was much more frequent than de novo methylation and more strongly correlated with gene expression. These changes took place in CpG-poor regions and were closely associated with T-cell differentiation and TCR function. Up to 88 genes that encode transcriptional regulators, some of whose functions in T-cell development are as yet unknown, were differentially methylated during differentiation. Interestingly, no reversion of accumulated DNA methylation changes was observed as differentiation progressed, except in a very small subset of key genes (RAG1, RAG2, CD8A, PTCRA, etc.), indicating that methylation changes are mostly unique and irreversible events. Our study explores the contribution of DNA methylation to T-cell lymphopoiesis and provides a fine-scale map of differentially methylated regions associated with gene expression changes. These can lay the molecular foundations for a better interpretation of the regulatory networks driving human thymopoiesis. PMID:25539926

  11. Human-specific histone methylation signatures at transcription start sites in prefrontal neurons.

    PubMed

    Shulha, Hennady P; Crisci, Jessica L; Reshetov, Denis; Tushir, Jogender S; Cheung, Iris; Bharadwaj, Rahul; Chou, Hsin-Jung; Houston, Isaac B; Peter, Cyril J; Mitchell, Amanda C; Yao, Wei-Dong; Myers, Richard H; Chen, Jiang-Fan; Preuss, Todd M; Rogaev, Evgeny I; Jensen, Jeffrey D; Weng, Zhiping; Akbarian, Schahram

    2012-01-01

    Cognitive abilities and disorders unique to humans are thought to result from adaptively driven changes in brain transcriptomes, but little is known about the role of cis-regulatory changes affecting transcription start sites (TSS). Here, we mapped in human, chimpanzee, and macaque prefrontal cortex the genome-wide distribution of histone H3 trimethylated at lysine 4 (H3K4me3), an epigenetic mark sharply regulated at TSS, and identified 471 sequences with human-specific enrichment or depletion. Among these were 33 loci selectively methylated in neuronal but not non-neuronal chromatin from children and adults, including TSS at DPP10 (2q14.1), CNTN4 and CHL1 (3p26.3), and other neuropsychiatric susceptibility genes. Regulatory sequences at DPP10 and additional loci carried a strong footprint of hominid adaptation, including elevated nucleotide substitution rates and regulatory motifs absent in other primates (including archaic hominins), with evidence for selective pressures during more recent evolution and adaptive fixations in modern populations. Chromosome conformation capture at two neurodevelopmental disease loci, 2q14.1 and 16p11.2, revealed higher order chromatin structures resulting in physical contact of multiple human-specific H3K4me3 peaks spaced 0.5-1 Mb apart, in conjunction with a novel cis-bound antisense RNA linked to Polycomb repressor proteins and downregulated DPP10 expression. Therefore, coordinated epigenetic regulation via newly derived TSS chromatin could play an important role in the emergence of human-specific gene expression networks in brain that contribute to cognitive functions and neurological disease susceptibility in modern day humans. PMID:23185133

  12. High-quality RNA preparation for transcript profiling of osteocytes from native human bone microdissections.

    PubMed

    Eisenberger, Sabine; Hoppe, Godehard; Pyerin, Walter; Ackermann, Karin

    2004-12-15

    Osteocytes, the most abundant bone cell type with important roles in tissue maintenance and pathological aberrations such as observed in bone metastases, are enclosed within a highly compact, calcified extracellular matrix. This location complicates analysis in native bone, with the consequence that despite their importance their in vivo molecular physiology is only poorly understood. We have examined the possibility of isolating osteocyte RNA for transcript profiling from native, frozen bone instead of employing the formalin-fixed, paraffin-embedded, decalcified version routinely used in histology, providing chemically modified and highly disintegrated RNAs. Bone tissue was tape-assisted cryosectioned and fixed to glass slides by support of UV-flash-triggered adhesive polymerization followed by quick hematoxylin-eosin staining to generate a guidance image for microdissection. Using an UVa-nitrogen laser, matrix-enclosed osteocytes were either excised and catapulted into RNA preparation vials or freed of accompanying nonosteocyte cellular material. The influences of bone sectioning, staining, and osteocyte capturing procedures on the prepared osteocyte RNAs were analyzed and the method was optimized accordingly. The obtained osteocyte RNAs showed the expected expression pattern of marker genes (reverse transcriptase-polymerase chain reaction), and, following conversion into fluorescent-labeled cDNAs, led to transcript profiles (cDNAchips; 2600 genes) with scatter-graph geometries indicating suitability for high-confidence evaluation. With the approach described here we introduce a methodological way for the characterization of the in vivo molecular physiology of osteocytes by functional genomics. PMID:15556565

  13. Isoform-specific inhibition of ROR alpha-mediated transcriptional activation by human FOXP3.

    PubMed

    Du, Jianguang; Huang, Chunjian; Zhou, Baohua; Ziegler, Steven F

    2008-04-01

    FOXP3 is a forkhead family transcriptional repressor important for the development and function of CD4(+)CD25(+) regulatory T cells. In humans, FOXP3 is expressed as two isoforms, a full-length form and a smaller form lacking exon 2. These two isoforms are expressed in approximately equal amounts in circulating regulatory T cells, and are induced equally in freshly activated CD4(+)CD25(-) T cells. Herein, we show that FOXP3 interacts with retinoic acid receptor-related orphan receptor (ROR)alpha, and that this interaction inhibits transcriptional activation mediated by RORalpha. Full-length FOXP3, but not the isoform lacking exon 2, interacts with RORalpha, and the region of FOXP3 involved in the interaction is encoded by exon 2. Mutation of the LxxLL motif in FOXP3, located in exon 2, abolished interaction and repression by FOXP3. Additionally, the inhibition of RORalpha by FOXP3 does not require an intact forkhead domain, demonstrating a mode of FOXP3 function that is independent of DNA binding. Interestingly, expression of RORalpha in T cells leads to the expression of genes that define Th17 cells, and the expression of each of these gene was inhibited by coexpression of full-length, but not DeltaEx2, FOXP3. These data expand the possible targets of FOXP3-mediated repression and demonstrate functional differences between FOXP3 isoforms. PMID:18354202

  14. Two closely linked but separable promoters for human neuronal nitric oxide synthase gene transcription.

    PubMed Central

    Xie, J; Roddy, P; Rife, T K; Murad, F; Young, A P

    1995-01-01

    In this report we demonstrate that the human cerebellum contains neuronal nitric oxide synthase (nNOS) mRNAs with two distinct 5'-untranslated regions that are encoded through use of closely linked but separate promoters. nNOS cDNA clones were shown to contain different 5' terminal exons spliced to a common exon 2. Genomic cloning and sequence analysis demonstrate that the unique exons are positioned within 300 bp of each other but separated from exon 2 by an intron that is at least 20 kb in length. A CpG island engulfs the downstream 5'-terminal exon. In contrast, most of the upstream exon resides outside of this CpG island. Interestingly, the upstream exon includes a GT dinucleotide repeat. A fusion gene with a 414-bp nNOS genomic fragment that includes a portion of the upstream 5'-terminal exon and its immediate 5'-flanking DNA is expressed in transfected HeLa cells. Also expressed is a fusion gene that contains the luciferase reporter under transcriptional control by a 308-bp genomic fragment that includes the region separating both 5'-terminal exons. These results indicate that expression of these exons is subject to transcriptional control by separate promoters. However, the proximity of these promoters raise the possibility that complex interactions may be involved in regulating nNOS gene expression at these sites. Images Fig. 1 Fig. 4 PMID:7532307

  15. Reprogramming of human fibroblasts to pluripotent stem cells using mRNA of four transcription factors

    SciTech Connect

    Yakubov, Eduard; Rechavi, Gidi; Rozenblatt, Shmuel; Givol, David

    2010-03-26

    Reprogramming of differentiated cells into induced pluripotent cells (iPS) was accomplished in 2006 by expressing four, or less, embryonic stem cell (ESC)-specific transcription factors. Due to the possible danger of DNA damage and the potential tumorigenicity associated with such DNA damage, attempts were made to minimize DNA integration by the vectors involved in this process without complete success. Here we present a method of using RNA transfection as a tool for reprogramming human fibroblasts to iPS. We used RNA synthesized in vitro from cDNA of the same reprogramming four transcription factors. After transfection of the RNA, we show intracellular expression and nuclear localization of the respective proteins in at least 70% of the cells. We used five consecutive transfections to support continuous protein expression resulting in the formation of iPS colonies that express alkaline phosphatase and several ESC markers and that can be expanded. This method completely avoids DNA integration and may be developed to replace the use of DNA vectors in the formation of iPS.

  16. The Regulation of rRNA Gene Transcription during Directed Differentiation of Human Embryonic Stem Cells

    PubMed Central

    Liu, Zhong; Zhao, Rui; Giles, Keith E.

    2016-01-01

    It has become increasingly clear that proper cellular control of pluripotency and differentiation is related to the regulation of rRNA synthesis. To further our understanding of the role that the regulation of rRNA synthesis has in pluripotency we monitored rRNA synthesis during the directed differentiation of human embryonic stem cells (hESCs). We discovered that the rRNA synthesis rate is reduced ~50% within 6 hours of ACTIVIN A treatment. This precedes reductions in expression of specific stem cell markers and increases in expression of specific germ layer markers. The reduction in rRNA synthesis is concomitant with dissociation of the Pol I transcription factor, UBTF, from the rRNA gene promoter and precedes any increase to heterochromatin throughout the rRNA gene. To directly investigate the role of rRNA synthesis in pluripotency, hESCs were treated with the Pol I inhibitor, CX-5461. The direct reduction of rRNA synthesis by CX-5461 induces the expression of markers for all three germ layers, reduces the expression of pluripotency markers, and is overall similar to the ACTIVIN A induced changes. This work indicates that the dissociation of UBTF from the rRNA gene, and corresponding reduction in transcription, represent early regulatory events during the directed differentiation of pluripotent stem cells. PMID:27299313

  17. Circulating Human Eosinophils Share a Similar Transcriptional Profile in Asthma and Other Hypereosinophilic Disorders

    PubMed Central

    Barnig, Cindy; Dembélé, Doulaye; Paul, Nicodème; Poirot, Anh; Uring-Lambert, Béatrice; Georgel, Philippe; de Blay, Fréderic; Bahram, Seiamak

    2015-01-01

    Eosinophils are leukocytes that are released into the peripheral blood in a phenotypically mature state and are capable of being recruited into tissues in response to appropriate stimuli. Eosinophils, traditionally considered cytotoxic effector cells, are leukocytes recruited into the airways of asthma patients where they are believed to contribute to the development of many features of the disease. This perception, however, has been challenged by recent findings suggesting that eosinophils have also immunomodulatory functions and may be involved in tissue homeostasis and wound healing. Here we describe a transcriptome-based approach–in a limited number of patients and controls—to investigate the activation state of circulating human eosinophils isolated by flow cytometry. We provide an overview of the global expression pattern in eosinophils in various relevant conditions, e.g., eosinophilic asthma, hypereosinophilic dermatological diseases, parasitosis and pulmonary aspergillosis. Compared to healthy subjects, circulating eosinophils isolated from asthma patients differed in their gene expression profile which is marked by downregulation of transcripts involved in antigen presentation, pathogen recognition and mucosal innate immunity, whereas up-regulated genes were involved in response to non-specific stimulation, wounding and maintenance of homeostasis. Eosinophils from other hypereosinophilic disorders displayed a very similar transcriptional profile. Taken together, these observations seem to indicate that eosinophils exhibit non-specific immunomodulatory functions important for tissue repair and homeostasis and suggest new roles for these cells in asthma immunobiology. PMID:26524763

  18. Potent and selective inhibition of human immunodeficiency virus type 1 transcription by piperazinyloxoquinoline derivatives.

    PubMed Central

    Baba, M; Okamoto, M; Makino, M; Kimura, Y; Ikeuchi, T; Sakaguchi, T; Okamoto, T

    1997-01-01

    We have found novel piperazinyloxoquinoline derivatives to be potent and selective inhibitors of human immunodeficiency virus type 1 (HIV-1) replication in both acutely and chronically infected cells. 8-Difluoromethoxy-1-ethyl-6-fluoro-1,4-didehydro-7-[4-(2-met hoxyphenyl)-1-piperazinyl]-4-oxoquinoline-3-carboxylic acid (K-12), the most potent congener of the series, completely inhibited HIV-1 replication in acutely infected MOLT-4 cells at a concentration of 0.16 to 0.8 microM without showing any cytotoxicity. The compound completely suppressed tumor necrosis factor alpha (TNF-alpha)-induced HIV-1 expression in latently infected cells (OM-10.1) and constitutive viral production in chronically infected cells (MOLT-4/III(B)) at a concentration of 0.8 microM. K-12 could also inhibit HIV-1 antigen expression in OM-10.1 and MOLT-4/III(B) cells at this concentration. Northern blot analysis revealed that K-12 selectively prevented the accumulation of HIV-1 mRNA in MOLT-4/III(B) and TNF-alpha-treated OM-10.1 cells in a dose-dependent fashion. It was not inhibitory to HIV-1 Tat or the cellular transcription factors NF-kappaB and Sp1, suggesting that the piperazinyloxoquinoline derivatives are a group of HIV-1 transcription inhibitors with a unique mechanism of action. PMID:9174179

  19. Characterization of tissue-specific transcription by the human synapsin I gene promoter

    SciTech Connect

    Thiel, G. Univ. of Texas, Dallas ); Greengard, P. ); Suedhof, T.C. )

    1991-04-15

    Synapsin Ia and synapsin Ib are abundant synaptic vesicle proteins that are derived by differential splicing from a single gene. To identify control elements directing the neuronal expression of synapsins Ia/b, the authors functionally analyzed the promoter region of the human synapsin I gene. A hybrid gene was constructed containing 2 kilobases of 5{prime} flanking sequence from the synapsin I gene fused to the bacterial gene chloramphenicol acetyltransferase and transfected into 12 different neuronal and nonneuronal cell lines. In general, expression of the chimeric reporter gene showed excellent correlation with endogenous expression of synapsin I in different neuronal cell lines, whereas transcription was low in all nonneuronal cell lines examined. The addition of the simian virus 40 enhancer promoted non-tissue-specific expression. Deletion mutagenesis of the synapsin I promoter revealed the presence of positive and negative sequence elements. A basal (constitutive) promoter that directs reporter gene expression in neuronal and nonneuronal cell lines was mapped to the region {minus}115 to +47. The promoter region from {minus}422 to {minus}22 contains positive elements that upon fusion with the herpes simplex virus thymidine kinase promoter potentiate its transcription in PC12 and neuroblastoma cells but not in Chinese hamster ovary cells.

  20. HSF1 drives a transcriptional program distinct from heat shock to support highly malignant human cancers

    PubMed Central

    Mendillo, Marc L.; Santagata, Sandro; Koeva, Martina; Bell, George W.; Hu, Rong; Tamimi, Rulla M.; Fraenkel, Ernest; Ince, Tan A.; Whitesell, Luke; Lindquist, Susan

    2012-01-01

    SUMMARY Heat-Shock Factor 1 (HSF1), master regulator of the heat-shock response, facilitates malignant transformation, cancer cell survival and proliferation in model systems. The common assumption is that these effects are mediated through regulation of heat-shock protein (HSP) expression. However, the transcriptional network that HSF1 coordinates directly in malignancy and its relationship to the heat-shock response have never been defined. By comparing cells with high and low malignant potential alongside their non-transformed counterparts, we identify an HSF1-regulated transcriptional program specific to highly malignant cells and distinct from heat shock. Cancer-specific genes in this program support oncogenic processes: cell-cycle regulation, signaling, metabolism, adhesion and translation. HSP genes are integral to this program, however, many are uniquely regulated in malignancy. This HSF1 cancer program is active in breast, colon and lung tumors isolated directly from human patients and is strongly associated with metastasis and death. Thus, HSF1 rewires the transcriptome in tumorigenesis, with prognostic and therapeutic implications. PMID:22863008

  1. Transcriptional regulatory elements in the noncoding region of human papillomavirus type 6

    SciTech Connect

    Wu, Tzyy-Choou.

    1989-01-01

    The structure and function of the transcriptional regulatory region of human papillomavirus type 6 (HPV-6) has been investigated. To investigate tissue specific gene expression, a sensitive method to detect and localize HPV-6 viral DNA, mRNA and protein in plastic-embedded tissue sections of genital and respiratory tract papillomata by using in situ hybridization and immunoperoxidase assays has been developed. This method, using ultrathin sections and strand-specific {sup 3}H labeled riboprobes, offers the advantages of superior morphological preservation and detection of viral genomes at low copy number with good resolution, and the modified immunocytochemistry provides better sensitivity. The results suggest that genital tract epithelium is more permissive for HPV-6 replication than respiratory tract epithelium. To study the tissue tropism of HPV-6 at the level of regulation of viral gene expression, the polymerase chain reaction was used to isolate the noncoding region (NCR) of HPV-6 in independent isolates. Nucleotide sequence analysis of molecularly cloned DNA identified base substitutions, deletions/insertions and tandem duplications. Transcriptional regulatory elements in the NCR were assayed in recombinant plasmids containing the bacterial gene for chloramphenicol acetyl transferase.

  2. COUP-TF interacting protein 2 represses the initial phase of HIV-1 gene transcription in human microglial cells

    PubMed Central

    Marban, Céline; Redel, Laetitia; Suzanne, Stella; Van Lint, Carine; Lecestre, Dominique; Chasserot-Golaz, Sylvette; Leid, Mark; Aunis, Dominique; Schaeffer, Evelyne; Rohr, Olivier

    2005-01-01

    Human immunodeficiency virus type 1 (HIV-1) gene transcription is characterized by two temporally distinct phases. While the initial phase relies solely on cellular transcription factors, the subsequent phase is activated by the viral Tat transactivator. We have previously reported that the subsequent phase of viral gene transcription can be repressed by the chicken ovalbumin upstream promoter transcription factor (COUP-TF)-interacting protein 2 (CTIP2) in human microglial cells [O. Rohr, D. Lecestre, S. Chasserot-Golaz, C. Marban, D. Avram, D. Aunis, M. Leid and E. Schaeffer (2003), J. Virol., 77, 5415–5427]. Here, we demonstrate that CTIP proteins also repress the initial phase of HIV-1 gene transcription, mainly supported by the cellular transcription factors Sp1 and COUP-TF in microglial cells. We report that CTIP2 represses Sp1- and COUP-TF-mediated activation of HIV-1 gene transcription and viral replication as a result of physical interactions with COUP-TF and Sp1 in microglial nuclei. Using laser confocal microscopy CTIP2 was found to colocalize with Sp1, COUP-TF and the heterochromatin-associated protein Hp1α, which is mainly detected in transcriptionally repressed heterochromatic region. Moreover, we describe that CTIP2 can be recruited to the HIV-1 promoter via its association with Sp1 bound to the GC-box sequences of the long terminal repeat (LTR). Since our findings demonstrate that CTIP2 interacts with the HIV-1 proximal promoter, it is likely that CTIP2 promotes HIV-1 gene silencing by forcing transcriptionally repressed heterochromatic environment to the viral LTR region. PMID:15849318

  3. TALEN-based generation of a cynomolgus monkey disease model for human microcephaly.

    PubMed

    Ke, Qiong; Li, Weiqiang; Lai, Xingqiang; Chen, Hong; Huang, Lihua; Kang, Zhuang; Li, Kai; Ren, Jie; Lin, Xiaofeng; Zheng, Haiqing; Huang, Weijun; Ma, Yunhan; Xu, Dongdong; Chen, Zheng; Song, Xinming; Lin, Xinyi; Zhuang, Min; Wang, Tao; Zhuang, Fengfeng; Xi, Jianzhong; Mao, Frank Fuxiang; Xia, Huimin; Lahn, Bruce T; Zhou, Qi; Yang, Shihua; Xiang, Andy Peng

    2016-09-01

    Gene editing in non-human primates may lead to valuable models for exploring the etiologies and therapeutic strategies of genetically based neurological disorders in humans. However, a monkey model of neurological disorders that closely mimics pathological and behavioral deficits in humans has not yet been successfully generated. Microcephalin 1 (MCPH1) is implicated in the evolution of the human brain, and MCPH1 mutation causes microcephaly accompanied by mental retardation. Here we generated a cynomolgus monkey (Macaca fascicularis) carrying biallelic MCPH1 mutations using transcription activator-like effector nucleases. The monkey recapitulated most of the important clinical features observed in patients, including marked reductions in head circumference, premature chromosome condensation (PCC), hypoplasia of the corpus callosum and upper limb spasticity. Moreover, overexpression of MCPH1 in mutated dermal fibroblasts rescued the PCC syndrome. This monkey model may help us elucidate the role of MCPH1 in the pathogenesis of human microcephaly and better understand the function of this protein in the evolution of primate brain size. PMID:27502025

  4. Reproductive conflict and the separation of reproductive generations in humans

    PubMed Central

    Cant, Michael A.; Johnstone, Rufus A.

    2008-01-01

    An enduring puzzle of human life history is why women cease reproduction midway through life. Selection can favor postreproductive survival because older females can help their offspring to reproduce. But the kin-selected fitness gains of helping appear insufficient to outweigh the potential benefits of continued reproduction. Why then do women cease reproduction in the first place? Here, we suggest that early reproductive cessation in humans is the outcome of reproductive competition between generations, and we present a simple candidate model of how this competition will be resolved. We show that among primates exhibiting a postreproductive life span, humans exhibit an extraordinarily low degree of reproductive overlap between generations. The rapid senescence of the human female reproductive system coincides with the age at which, in natural fertility populations, women are expected to encounter reproductive competition from breeding females of the next generation. Several lines of evidence suggest that in ancestral hominids, this younger generation typically comprised immigrant females. In these circumstances, relatedness asymmetries within families are predicted to give younger females a decisive advantage in reproductive conflict with older females. A model incorporating both the costs of reproductive competition and the benefits of grandmothering can account for the timing of reproductive cessation in humans and so offers an improved understanding of the evolution of menopause. PMID:18378891

  5. EnsemPro: an ensemble approach to predicting transcription start sites in human genomic DNA sequences.

    PubMed

    Won, Hong-Hee; Kim, Min-Ji; Kim, Seonwoo; Kim, Jong-Won

    2008-03-01

    Although several computational methods have been developed to identify transcription start sites (TSSs)/promoters, the computational prediction still needs improvement. Due to low performance, the promoter prediction programs can provide misleading results in functional genomic studies. To improve the prediction accuracy, we propose the use of an ensemble approach, EnsemPro (Ensemble Promoter), which combines the prediction results of the existing promoter predictors. We schematically compared the prediction performance of the currently available promoter prediction programs in an identical evaluating environment, and the results served as a guide for choosing the combined predictors. We applied three representative ensemble schemes-the majority voting, the weighted voting, and the Bayesian approach-for the TSS prediction of hundreds of human genomic sequences. EnsemPro identified the TSSs more precisely than other combining methods as well as the currently available individual predictor programs. The source code of EnsemPro is available on request from the authors. PMID:18164178

  6. UVSSA and USP7: new players regulating transcription-coupled nucleotide excision repair in human cells

    PubMed Central

    2012-01-01

    Transcription-coupled nucleotide excision repair (TC-NER) specifically removes DNA damage located in actively transcribed genes. Defects in TC-NER are associated with several human disorders, including Cockayne syndrome (CS) and ultraviolet (UV)-sensitive syndrome (UVSS). Using exome sequencing, and genetic and proteomic approaches, three recent studies have identified mutations in the UVSSA gene as being responsible for UVSS-A. These findings suggest a new mechanistic model involving UV-stimulated scaffold protein A (UVSSA) and the ubiquitin-specific protease 7 (USP7) in the fate of stalled RNA polymerase II during TC-NER, and provide insights into the diverse clinical features of CS and UVSS. PMID:22621766

  7. UVSSA and USP7: new players regulating transcription-coupled nucleotide excision repair in human cells.

    PubMed

    Sarasin, Alain

    2012-01-01

    Transcription-coupled nucleotide excision repair (TC-NER) specifically removes DNA damage located in actively transcribed genes. Defects in TC-NER are associated with several human disorders, including Cockayne syndrome (CS) and ultraviolet (UV)-sensitive syndrome (UVSS). Using exome sequencing, and genetic and proteomic approaches, three recent studies have identified mutations in the UVSSA gene as being responsible for UVSS-A. These findings suggest a new mechanistic model involving UV-stimulated scaffold protein A (UVSSA) and the ubiquitin-specific protease 7 (USP7) in the fate of stalled RNA polymerase II during TC-NER, and provide insights into the diverse clinical features of CS and UVSS. PMID:22621766

  8. Transcription Factors OVOL1 and OVOL2 Induce the Mesenchymal to Epithelial Transition in Human Cancer

    PubMed Central

    Roca, Hernan; Hernandez, James; Weidner, Savannah; McEachin, Richard C.; Fuller, David; Sud, Sudha; Schumann, Taibriana; Wilkinson, John E.; Zaslavsky, Alexander; Li, Hangwen; Maher, Christopher A.; Daignault-Newton, Stephanie; Healy, Patrick N.; Pienta, Kenneth J.

    2013-01-01

    Cell plasticity regulated by the balance between the mesenchymal to epithelial transition (MET) and the opposite program, EMT, is critical in the metastatic cascade. Several transcription factors (TFs) are known to regulate EMT, though the mechanisms of MET remain unclear. We demonstrate a novel function of two TFs, OVOL1 and OVOL2, as critical inducers of MET in human cancers. Our findings indicate that the OVOL-TFs control MET through a regulatory feedback loop with EMT-inducing TF ZEB1, and the regulation of mRNA splicing by inducing Epithelial Splicing Regulatory Protein 1 (ESRP1). Using mouse prostate tumor models we show that expression of OVOL-TFs in mesenchymal prostate cancer cells attenuates their metastatic potential. The role of OVOL-TFs as inducers of MET is further supported by expression analyses in 917 cancer cell lines, suggesting their role as crucial regulators of epithelial-mesenchymal cell plasticity in cancer. PMID:24124593

  9. A DNA Fragment of Herpes Simplex 2 and Its Transcription in Human Cervical Cancer Tissue

    PubMed Central

    Frenkel, Niza; Roizman, Bernard; Cassai, Enzo; Nahmias, Andre

    1972-01-01

    A human cervical tumor, free of detectable infectious herpes simplex 2 virus, contained a fragment comprising 39% of herpes viral DNA. Renaturation kinetics indicate that an average of 1 to 3.5 DNA fragments of herpes simplex virus are present per cell, depending on the ploidy of the cells in this particular tumor. Virus-specific sequences were found linked to highly repetitive sequences of host DNA, which reassociated under conditions designed to preclude reassociation of viral sequences. The tumor also contained RNA transcripts complementary to 5% of the viral DNA. The fraction of viral DNA template transcribed in the cervical tumor is considerably less than that transcribed in productively infected cells (50%). PMID:4345508

  10. Late-onset spastic paraplegia: Aberrant SPG11 transcripts generated by a novel splice site donor mutation.

    PubMed

    Kawarai, Toshitaka; Miyamoto, Ryosuke; Mori, Atsuko; Oki, Ryosuke; Tsukamoto-Miyashiro, Ai; Matsui, Naoko; Miyazaki, Yoshimichi; Orlacchio, Antonio; Izumi, Yuishin; Nishida, Yoshihiko; Kaji, Ryuji

    2015-12-15

    We identified a novel homozygous mutation in the splice site donor (SSD) of intron 30 (c.5866+1G>A) in consanguineous Japanese SPG11 siblings showing late-onset spastic paraplegia using the whole-exome sequencing. Phenotypic variability was observed, including age-at-onset, dysarthria and pes cavus. Coding DNA sequencing revealed that the mutation affected the recognition of the constitutive SSD of intron 30, splicing upstream onto a nearby cryptic SSD in exon 30. The use of constitutive splice sites of intron 29 was confirmed by sequencing. The mutant transcripts are mostly subject to degradation by the nonsense-mediated mRNA decay system. SPG11 transcripts, escaping from the nonsense-mediated mRNA decay pathway, would generate a truncated protein (p.Tyr1900Phefs5X) containing the first 1899 amino acids and followed by 4 aberrant amino acids. This study showed a successful clinical application of whole-exome sequencing in spastic paraplegia and demonstrated a further evidence of allelic heterogeneity in SPG11. The confirmation of aberrant transcript by splice site mutation is a prerequisite for a more precise molecular diagnosis. PMID:26671123

  11. Generation of Human Melanocytes from Induced Pluripotent Stem Cells

    PubMed Central

    Okada, Yohei; Akamatsu, Wado; Kuwahara, Reiko; Ohyama, Manabu; Amagai, Masayuki; Matsuzaki, Yumi; Yamanaka, Shinya; Okano, Hideyuki; Kawakami, Yutaka

    2011-01-01

    Epidermal melanocytes play an important role in protecting the skin from UV rays, and their functional impairment results in pigment disorders. Additionally, melanomas are considered to arise from mutations that accumulate in melanocyte stem cells. The mechanisms underlying melanocyte differentiation and the defining characteristics of melanocyte stem cells in humans are, however, largely unknown. In the present study, we set out to generate melanocytes from human iPS cells in vitro, leading to a preliminary investigation of the mechanisms of human melanocyte differentiation. We generated iPS cell lines from human dermal fibroblasts using the Yamanaka factors (SOX2, OCT3/4, and KLF4, with or without c-MYC). These iPS cell lines were subsequently used to form embryoid bodies (EBs) and then differentiated into melanocytes via culture supplementation with Wnt3a, SCF, and ET-3. Seven weeks after inducing differentiation, pigmented cells expressing melanocyte markers such as MITF, tyrosinase, SILV, and TYRP1, were detected. Melanosomes were identified in these pigmented cells by electron microscopy, and global gene expression profiling of the pigmented cells showed a high similarity to that of human primary foreskin-derived melanocytes, suggesting the successful generation of melanocytes from iPS cells. This in vitro differentiation system should prove useful for understanding human melanocyte biology and revealing the mechanism of various pigment cell disorders, including melanoma. PMID:21249204

  12. Microphthalmia-associated transcription factor as the molecular target of cadmium toxicity in human melanocytes.

    PubMed

    Chantarawong, Wipa; Takeda, Kazuhisa; Sangartit, Weerapon; Yoshizawa, Miki; Pradermwong, Kantimanee; Shibahara, Shigeki

    2014-11-28

    Dietary intake of cadmium is inevitable, causing age-related increase in cadmium accumulation in many organs, including hair, choroid and retinal pigment epithelium (RPE). Cadmium has been implicated in the pathogenesis of hearing loss and macular degeneration. The functions of cochlea and retina are maintained by melanocytes and RPE, respectively, and the differentiation of these pigment cells is regulated by microphthalmia-associated transcription factor (MITF). In the present study, we explored the potential toxicity of cadmium in the cochlea and retina by using cultured human melanocytes and human RPE cell lines. MITF consists of multiple isoforms, including melanocyte-specific MITF-M and widely expressed MITF-H. Levels of MITF-M protein and its mRNA in human epidermal melanocytes and HMV-II melanoma cells were decreased significantly by cadmium. In parallel with the MITF reduction, mRNA levels of tyrosinase, the key enzyme of melanin biosynthesis that is regulated by MITF-M, were also decreased. In RPE cells, however, the levels of total MITF protein, constituting mainly MITF-H, were not decreased by cadmium. We thus identify MITF-M as the molecular target of cadmium toxicity in melanocytes, thereby accounting for the increased risk of disability from melanocyte malfunction, such as hearing and vision loss among people with elevated cadmium exposure. PMID:25449283

  13. Portrait of transcriptional responses to ultraviolet and ionizing radiation in human cells

    PubMed Central

    Rieger, Kerri E.; Chu, Gilbert

    2004-01-01

    To understand the human response to DNA damage, we used microarrays to measure transcriptional responses of 10 000 genes to ionizing radiation (IR) and ultraviolet radiation (UV). To identify bona fide responses, we used cell lines from 15 individuals and a rigorous statistical method, Significance Analysis of Microarrays (SAM). By exploring how sample number affects SAM, we rendered a portrait of the human damage response with a degree of accuracy unmatched by previous studies. By showing how SAM can be used to estimate the total number of responsive genes, we discovered that 24% of all genes respond to IR and 32% respond to UV, although most responses were less than 2-fold. Many genes were involved in known damage-response pathways for cell cycling and proliferation, apoptosis, DNA repair or the stress response. However, the majority of genes were involved in unexpected pathways, with functions in signal transduction, RNA binding and editing, protein synthesis and degradation, energy metabolism, metabolism of macromolecular precursors, cell structure and adhesion, vesicle transport, or lysosomal metabolism. Although these functions were not previously associated with the damage response in mammals, many were conserved in yeast. These insights reveal new directions for studying the human response to DNA damage. PMID:15356296

  14. Human mitochondrial transcription factor A is required for the segregation of mitochondrial DNA in cultured cells.

    PubMed

    Kasashima, Katsumi; Sumitani, Megumi; Endo, Hitoshi

    2011-01-15

    The segregation and transmission of the mitochondrial genome in humans are complicated processes but are particularly important for understanding the inheritance and clinical abnormalities of mitochondrial disorders. However, the molecular mechanism of the segregation of mitochondrial DNA (mtDNA) is largely unclear. In this study, we demonstrated that human mitochondrial transcription factor A (TFAM) is required for the segregation of mtDNA in cultured cells. RNAi-mediated knockdown of TFAM in HeLa cells resulted in the enlarged mtDNA, as indicated by the assembly of fluorescent signals stained with PicoGreen. Fluorescent in situ hybridization confirmed the enlarged mtDNA and further showed the existence of increased numbers of mitochondria lacking mtDNA signals in TFAM knockdown cells. By complementation analysis, the C-terminal tail of TFAM, which enhances its affinity with DNA, was found to be required for the appropriate distribution of mtDNA. Furthermore, we found that TFAM knockdown induced asymmetric segregation of mtDNA between dividing daughter cells. These results suggest an essential role for human TFAM in symmetric segregation of mtDNA. PMID:20955698

  15. [Visual Detection of Human Coronavirus NL63 by Reverse Transcription Loop-Mediated Isothermal Amplification].

    PubMed

    Geng, Heyuan; Wang, Shengqiang; Xie, Xiaoqian; Xiao, Yu; Zhang, Ting; Tan, Wenjie; Su, Chuan

    2016-01-01

    A simple and sensitive assay for rapid detection of human coronavirus NL63 (HCoV-NL63) was developed by colorimetic reverse transcription loop-mediated isothermal amplification (RT-LAMP). The method employed six specially designed primers that recognized eight distinct regions of the HCoV-NL63 nucleocapsid protein gene for amplification of target sequences under isothermal conditions at 63 degrees C for 1 h Amplification of RT-LAMP was monitored by addition of calcein before amplification. A positive reaction was confirmed by change from light-brown to yellow-green under visual detection. Specificity of the RT-LAMP assay was validated by cross-reaction with different human coronaviruses, norovirus, influenza A virus, and influenza B virus. Sensitivity was evaluated by serial dilution of HCoV-NL63 RNA from 1.6 x 10(9) to 1.6 x 10(1) per reaction. The RT-LAMP assay could achieve 1,600 RNA copies per reaction with high specificity. Hence, our colorimetric RT-LAMP assay could be used for rapid detection of human coronavirus NL63. PMID:27295884

  16. Ceramide Induces Human Hepcidin Gene Transcription through JAK/STAT3 Pathway

    PubMed Central

    Lu, Sizhao; Natarajan, Sathish Kumar; Mott, Justin L.; Kharbanda, Kusum K.; Harrison-Findik, Duygu Dee

    2016-01-01

    Changes in lipid metabolism and iron content are observed in the livers of patients with fatty liver disease. The expression of hepcidin, an iron-regulatory and acute phase protein synthesized by the liver, is also modulated. The potential interaction of lipid and iron metabolism is largely unknown. We investigated the role of lipid intermediate, ceramide in the regulation of human hepcidin gene, HAMP. Human hepatoma HepG2 cells were treated with cell-permeable ceramide analogs. Ceramide induced significant up-regulation of HAMP mRNA expression in HepG2 cells. The effect of ceramide on HAMP expression was mediated through transcriptional mechanisms because it was completely blocked with actinomycin D treatment. Reporter assays also confirmed the activation of 0.6 kb HAMP promoter by ceramide. HepG2 cells treated with ceramide displayed increased phosphorylation of STAT3, JNK, and NF-κB proteins. However, ceramide induced the binding of STAT3, but not NF-κB or c-Jun, to HAMP promoter, as shown by the chromatin immunoprecipitation assays. The mutation of STAT3 response element within 0.6 kb HAMP promoter region significantly inhibited the stimulatory effect of ceramide on HAMP promoter activity. Similarly, the inhibition of STAT3 with a pan-JAK kinase inhibitor and STAT3 siRNA pool also diminished the induction of both HAMP promoter activity and mRNA expression by ceramide. In conclusion, we have shown a direct role for ceramide in the activation of hepatic HAMP transcription via STAT3. Our findings suggest a crosstalk between lipid and iron metabolism in the liver, which may contribute to the pathogenesis of obesity-related fatty liver disease. PMID:26807955

  17. ERK5 Pathway Regulates Transcription Factors Important for Monocytic Differentiation of Human Myeloid Leukemia Cells†

    PubMed Central

    Wang, Xuening; Pesakhov, Stella; Harrison, Jonathan S; Danilenko, Michael; Studzinski, George P

    2014-01-01

    Mitogen-activated protein kinases (MAPKs) are important transducers of external signals for cell growth, survival and other cellular responses including cell differentiation. Several MAPK cascades are known with the MEK1/2-ERK1/2, JNK, and p38MAPKs receiving most attention, but the role of MEK5-ERK5 in intracellular signaling deserves more scrutiny, as this pathway transmits signals that can complement ERK/2 signaling. We hypothesized that the ERK5 pathway plays a role in the control of monocytic differentiation, which is disturbed in myeloid leukemia. We therefore examined the cellular phenotype and key molecular events which occur when human myeloid leukemia cells, acute (AML) or chronic (CML), are forced to differentiate by vitamin D derivatives (VDDs). This study was performed using established cell lines HL60 and U937, and primary cultures of blasts from 10 patients with ML. We found that ERK5 and its direct downstream target transcription factor MEF2C are upregulated by 1,25D in parallel with monocytic differentiation. Further, inhibition of ERK5 activity by specific pharmacological agents BIX02189 and XMD8-92 alters the phenotype of these cells by reducing the abundance of the VDD-induced surface monocytic marker CD14, and concomitantly increasing surface expression of the general myeloid marker CD11b. Similar results were obtained when the expression of ERK5 was reduced by siRNA or short hairpin (sh) RNA. ERK5 inhibition resulted in an expected decrease in MEF2C activation. We also found that in AML the transcription factor C/EBPβ is positively regulated, while C/EBPα is negatively regulated by ERK5. These findings provide new understanding of dysregulated differentiation in human myeloid leukemia. PMID:24264602

  18. ERK5 pathway regulates transcription factors important for monocytic differentiation of human myeloid leukemia cells.

    PubMed

    Wang, Xuening; Pesakhov, Stella; Harrison, Jonathan S; Danilenko, Michael; Studzinski, George P

    2014-07-01

    Mitogen-activated protein kinases (MAPKs) are important transducers of external signals for cell growth, survival, and other cellular responses including cell differentiation. Several MAPK cascades are known with the MEK1/2-ERK1/2, JNK, and p38MAPKs receiving most attention, but the role of MEK5-ERK5 in intracellular signaling deserves more scrutiny, as this pathway transmits signals that can complement ERK/2 signaling. We hypothesized that the ERK5 pathway plays a role in the control of monocytic differentiation, which is disturbed in myeloid leukemia. We therefore examined the cellular phenotype and key molecular events which occur when human myeloid leukemia cells, acute (AML) or chronic (CML), are forced to differentiate by vitamin D derivatives (VDDs). This study was performed using established cell lines HL60 and U937, and primary cultures of blasts from 10 patients with ML. We found that ERK5 and its direct downstream target transcription factor MEF2C are upregulated by 1,25D in parallel with monocytic differentiation. Further, inhibition of ERK5 activity by specific pharmacological agents BIX02189 and XMD8-92 alters the phenotype of these cells by reducing the abundance of the VDD-induced surface monocytic marker CD14, and concomitantly increasing surface expression of the general myeloid marker CD11b. Similar results were obtained when the expression of ERK5 was reduced by siRNA or short hairpin (sh) RNA. ERK5 inhibition resulted in an expected decrease in MEF2C activation. We also found that in AML cells the transcription factor C/EBPβ is positively regulated, while C/EBPα is negatively regulated by ERK5. These findings provide new understanding of dysregulated differentiation in human myeloid leukemia. PMID:24264602

  19. Ceramide Induces Human Hepcidin Gene Transcription through JAK/STAT3 Pathway.

    PubMed

    Lu, Sizhao; Natarajan, Sathish Kumar; Mott, Justin L; Kharbanda, Kusum K; Harrison-Findik, Duygu Dee

    2016-01-01

    Changes in lipid metabolism and iron content are observed in the livers of patients with fatty liver disease. The expression of hepcidin, an iron-regulatory and acute phase protein synthesized by the liver, is also modulated. The potential interaction of lipid and iron metabolism is largely unknown. We investigated the role of lipid intermediate, ceramide in the regulation of human hepcidin gene, HAMP. Human hepatoma HepG2 cells were treated with cell-permeable ceramide analogs. Ceramide induced significant up-regulation of HAMP mRNA expression in HepG2 cells. The effect of ceramide on HAMP expression was mediated through transcriptional mechanisms because it was completely blocked with actinomycin D treatment. Reporter assays also confirmed the activation of 0.6 kb HAMP promoter by ceramide. HepG2 cells treated with ceramide displayed increased phosphorylation of STAT3, JNK, and NF-κB proteins. However, ceramide induced the binding of STAT3, but not NF-κB or c-Jun, to HAMP promoter, as shown by the chromatin immunoprecipitation assays. The mutation of STAT3 response element within 0.6 kb HAMP promoter region significantly inhibited the stimulatory effect of ceramide on HAMP promoter activity. Similarly, the inhibition of STAT3 with a pan-JAK kinase inhibitor and STAT3 siRNA pool also diminished the induction of both HAMP promoter activity and mRNA expression by ceramide. In conclusion, we have shown a direct role for ceramide in the activation of hepatic HAMP transcription via STAT3. Our findings suggest a crosstalk between lipid and iron metabolism in the liver, which may contribute to the pathogenesis of obesity-related fatty liver disease. PMID:26807955

  20. A Hox Transcription Factor Collective Binds a Highly Conserved Distal-less cis-Regulatory Module to Generate Robust Transcriptional Outcomes

    PubMed Central

    Uhl, Juli D.; Zandvakili, Arya; Gebelein, Brian

    2016-01-01

    cis-regulatory modules (CRMs) generate precise expression patterns by integrating numerous transcription factors (TFs). Surprisingly, CRMs that control essential gene patterns can differ greatly in conservation, suggesting distinct constraints on TF binding sites. Here, we show that a highly conserved Distal-less regulatory element (DCRE) that controls gene expression in leg precursor cells recruits multiple Hox, Extradenticle (Exd) and Homothorax (Hth) complexes to mediate dual outputs: thoracic activation and abdominal repression. Using reporter assays, we found that abdominal repression is particularly robust, as neither individual binding site mutations nor a DNA binding deficient Hth protein abolished cooperative DNA binding and in vivo repression. Moreover, a re-engineered DCRE containing a distinct configuration of Hox, Exd, and Hth sites also mediated abdominal Hox repression. However, the re-engineered DCRE failed to perform additional segment-specific functions such as thoracic activation. These findings are consistent with two emerging concepts in gene regulation: First, the abdominal Hox/Exd/Hth factors utilize protein-protein and protein-DNA interactions to form repression complexes on flexible combinations of sites, consistent with the TF collective model of CRM organization. Second, the conserved DCRE mediates multiple cell-type specific outputs, consistent with recent findings that pleiotropic CRMs are associated with conserved TF binding and added evolutionary constraints. PMID:27058369

  1. A Hox Transcription Factor Collective Binds a Highly Conserved Distal-less cis-Regulatory Module to Generate Robust Transcriptional Outcomes.

    PubMed

    Uhl, Juli D; Zandvakili, Arya; Gebelein, Brian

    2016-04-01

    cis-regulatory modules (CRMs) generate precise expression patterns by integrating numerous transcription factors (TFs). Surprisingly, CRMs that control essential gene patterns can differ greatly in conservation, suggesting distinct constraints on TF binding sites. Here, we show that a highly conserved Distal-less regulatory element (DCRE) that controls gene expression in leg precursor cells recruits multiple Hox, Extradenticle (Exd) and Homothorax (Hth) complexes to mediate dual outputs: thoracic activation and abdominal repression. Using reporter assays, we found that abdominal repression is particularly robust, as neither individual binding site mutations nor a DNA binding deficient Hth protein abolished cooperative DNA binding and in vivo repression. Moreover, a re-engineered DCRE containing a distinct configuration of Hox, Exd, and Hth sites also mediated abdominal Hox repression. However, the re-engineered DCRE failed to perform additional segment-specific functions such as thoracic activation. These findings are consistent with two emerging concepts in gene regulation: First, the abdominal Hox/Exd/Hth factors utilize protein-protein and protein-DNA interactions to form repression complexes on flexible combinations of sites, consistent with the TF collective model of CRM organization. Second, the conserved DCRE mediates multiple cell-type specific outputs, consistent with recent findings that pleiotropic CRMs are associated with conserved TF binding and added evolutionary constraints. PMID:27058369

  2. Microphthalmia-associated transcription factor as the molecular target of cadmium toxicity in human melanocytes

    SciTech Connect

    Chantarawong, Wipa; Takeda, Kazuhisa; Sangartit, Weerapon; Yoshizawa, Miki; Pradermwong, Kantimanee; Shibahara, Shigeki

    2014-11-28

    Highlights: • In human melanocytes, cadmium decreases the expression of MITF-M and tyrosinase and their mRNAs. • In human melanoma cells, cadmium decreases the expression of MITF-M protein and tyrosinase mRNA. • Expression of MITF-H is less sensitive to cadmium toxicity in melanocyte-linage cells. • Cadmium does not decrease the expression of MITF-H in retinal pigment epithelial cells. • MITF-M is the molecular target of cadmium toxicity in melanocytes. - Abstract: Dietary intake of cadmium is inevitable, causing age-related increase in cadmium accumulation in many organs, including hair, choroid and retinal pigment epithelium (RPE). Cadmium has been implicated in the pathogenesis of hearing loss and macular degeneration. The functions of cochlea and retina are maintained by melanocytes and RPE, respectively, and the differentiation of these pigment cells is regulated by microphthalmia-associated transcription factor (MITF). In the present study, we explored the potential toxicity of cadmium in the cochlea and retina by using cultured human melanocytes and human RPE cell lines. MITF consists of multiple isoforms, including melanocyte-specific MITF-M and widely expressed MITF-H. Levels of MITF-M protein and its mRNA in human epidermal melanocytes and HMV-II melanoma cells were decreased significantly by cadmium. In parallel with the MITF reduction, mRNA levels of tyrosinase, the key enzyme of melanin biosynthesis that is regulated by MITF-M, were also decreased. In RPE cells, however, the levels of total MITF protein, constituting mainly MITF-H, were not decreased by cadmium. We thus identify MITF-M as the molecular target of cadmium toxicity in melanocytes, thereby accounting for the increased risk of disability from melanocyte malfunction, such as hearing and vision loss among people with elevated cadmium exposure.

  3. New role for Kruppel-like factor 14 as a transcriptional activator involved in the generation of signaling lipids.

    PubMed

    de Assuncao, Thiago M; Lomberk, Gwen; Cao, Sheng; Yaqoob, Usman; Mathison, Angela; Simonetto, Douglas A; Huebert, Robert C; Urrutia, Raul A; Shah, Vijay H

    2014-05-30

    Sphingosine kinase 1 (SK1) is an FGF-inducible gene responsible for generation of sphingosine-1-phosphate, a critical lipid signaling molecule implicated in diverse endothelial cell functions. In this study, we identified SK1 as a target of the canonical FGF2/FGF receptor 1 activation pathway in endothelial cells and sought to identify novel transcriptional pathways that mediate lipid signaling. Studies using the 1.9-kb SK1 promoter and deletion mutants revealed that basal and FGF2-stimulated promoter activity occurred through two GC-rich regions located within 633 bp of the transcription start site. Screening for GC-rich binding transcription factors that could activate this site demonstrated that KLF14, a gene implicated in obesity and the metabolic syndrome, binds to this region. Congruently, overexpression of KLF14 increased basal and FGF2-stimulated SK1 promoter activity by 3-fold, and this effect was abrogated after mutation of the GC-rich sites. In addition, KLF14 siRNA transfection decreased SK1 mRNA and protein levels by 3-fold. Congruently, SK1 mRNA and protein levels were decreased in livers from KLF14 knock-out mice. Combined, luciferase, gel shift, and chromatin immunoprecipitation assays showed that KLF14 couples to p300 to increase the levels of histone marks associated with transcriptional activation (H4K8ac and H3K14ac), while decreasing repressive marks (H3K9me3 and H3K27me3). Collectively, the results demonstrate a novel mechanism whereby SK1 lipid signaling is regulated by epigenetic modifications conferred by KLF14 and p300. Thus, this is the first description of the activity and mechanisms underlying the function of KLF14 as an activator protein and novel regulator of lipid signaling. PMID:24759103

  4. New Role for Kruppel-like Factor 14 as a Transcriptional Activator Involved in the Generation of Signaling Lipids*

    PubMed Central

    de Assuncao, Thiago M.; Lomberk, Gwen; Cao, Sheng; Yaqoob, Usman; Mathison, Angela; Simonetto, Douglas A.; Huebert, Robert C.; Urrutia, Raul A.; Shah, Vijay H.

    2014-01-01

    Sphingosine kinase 1 (SK1) is an FGF-inducible gene responsible for generation of sphingosine-1-phosphate, a critical lipid signaling molecule implicated in diverse endothelial cell functions. In this study, we identified SK1 as a target of the canonical FGF2/FGF receptor 1 activation pathway in endothelial cells and sought to identify novel transcriptional pathways that mediate lipid signaling. Studies using the 1.9-kb SK1 promoter and deletion mutants revealed that basal and FGF2-stimulated promoter activity occurred through two GC-rich regions located within 633 bp of the transcription start site. Screening for GC-rich binding transcription factors that could activate this site demonstrated that KLF14, a gene implicated in obesity and the metabolic syndrome, binds to this region. Congruently, overexpression of KLF14 increased basal and FGF2-stimulated SK1 promoter activity by 3-fold, and this effect was abrogated after mutation of the GC-rich sites. In addition, KLF14 siRNA transfection decreased SK1 mRNA and protein levels by 3-fold. Congruently, SK1 mRNA and protein levels were decreased in livers from KLF14 knock-out mice. Combined, luciferase, gel shift, and chromatin immunoprecipitation assays showed that KLF14 couples to p300 to increase the levels of histone marks associated with transcriptional activation (H4K8ac and H3K14ac), while decreasing repressive marks (H3K9me3 and H3K27me3). Collectively, the results demonstrate a novel mechanism whereby SK1 lipid signaling is regulated by epigenetic modifications conferred by KLF14 and p300. Thus, this is the first description of the activity and mechanisms underlying the function of KLF14 as an activator protein and novel regulator of lipid signaling. PMID:24759103

  5. VarySysDB: a human genetic polymorphism database based on all H-InvDB transcripts.

    PubMed

    Shimada, Makoto K; Matsumoto, Ryuzou; Hayakawa, Yosuke; Sanbonmatsu, Ryoko; Gough, Craig; Yamaguchi-Kabata, Yumi; Yamasaki, Chisato; Imanishi, Tadashi; Gojobori, Takashi

    2009-01-01

    Creation of a vast variety of proteins is accomplished by genetic variation and a variety of alternative splicing transcripts. Currently, however, the abundant available data on genetic variation and the transcriptome are stored independently and in a dispersed fashion. In order to provide a research resource regarding the effects of human genetic polymorphism on various transcripts, we developed VarySysDB, a genetic polymorphism database based on 187,156 extensively annotated matured mRNA transcripts from 36,073 loci provided by H-InvDB. VarySysDB offers information encompassing published human genetic polymorphisms for each of these transcripts separately. This allows comparisons of effects derived from a polymorphism on different transcripts. The published information we analyzed includes single nucleotide polymorphisms and deletion-insertion polymorphisms from dbSNP, copy number variations from Database of Genomic Variants, short tandem repeats and single amino acid repeats from H-InvDB and linkage disequilibrium regions from D-HaploDB. The information can be searched and retrieved by features, functions and effects of polymorphisms, as well as by keywords. VarySysDB combines two kinds of viewers, GBrowse and Sequence View, to facilitate understanding of the positional relationship among polymorphisms, genome, transcripts, loci and functional domains. We expect that VarySysDB will yield useful information on polymorphisms affecting gene expression and phenotypes. VarySysDB is available at http://h-invitational.jp/varygene/. PMID:18953038

  6. A minimal RNA polymerase III transcription system from human cells reveals positive and negative regulatory roles for CK2.

    PubMed

    Hu, Ping; Wu, Si; Hernandez, Nouria

    2003-09-01

    In higher eukaryotes, RNA polymerase (pol) III is known to use different transcription factors to recognize three basic types of promoters, but in no case have these transcription factors been completely defined. We show that a highly purified pol III complex combined with the recombinant transcription factors SNAP(c), TBP, Brf2, and Bdp1 directs multiple rounds of transcription initiation and termination from the human U6 promoter. The pol III complex contains traces of CK2, and CK2 associates with the U6 promoter region in vivo. Transcription requires CK2 phosphorylation of the pol III complex. In contrast, CK2 phosphorylation of TBP, Brf2, and Bdp1 combined is inhibitory. The results define a minimum core machinery, the ultimate target of regulatory mechanisms, capable of directing all steps of the transcription process-initiation, elongation, and termination-by a metazoan RNA polymerase, and suggest positive and negative regulatory roles for CK2 in transcription by pol III. PMID:14527415

  7. Generation of L-cells in mouse and human small intestine organoids

    PubMed Central

    Petersen, Natalia; Reimann, Frank; Bartfeld, Sina; Farin, Henner F.; Ringnalda, Femke C.; Vries, Robert G. J.; van den Brink, Stieneke; Clevers, Hans; Gribble, Fiona M.; de Koning, Eelco J. P.

    2015-01-01

    Upon a nutrient challenge, L-cells produce glucagon-like peptide 1 (GLP-1), a powerful stimulant of insulin release. Strategies to augment endogenous GLP-1 production include promoting L-cell differentiation and increasing L-cell number. Here we present a novel in vitro platform to generate functional L-cells from 3D cultures of mouse and human intestinal crypts. We show that short-chain fatty acids (SCFAs) selectively increase the number of L-cells resulting in an elevation of GLP-1 release. This is accompanied by up-regulation of transcription factors, associated with the endocrine lineage of intestinal stem cell development. Thus, our platform allows us to study and modulate the development of L-cells in mouse and human crypts as a potential basis for novel therapeutic strategies in type 2 diabetes. PMID:24130334

  8. Neural Differentiation in the Third Dimension: Generating a Human Midbrain.

    PubMed

    Marton, Rebecca M; Paşca, Sergiu P

    2016-08-01

    In recent years, technological improvements in three-dimensional (3D) culture systems have enabled the generation of organoids or spheroids representing a variety of tissues, including the brain. In this issue of Cell Stem Cell, Jo et al. (2016) describe a 3D culture model of the human midbrain containing dopaminergic neurons and neuromelanin. PMID:27494668

  9. Generating trunk neural crest from human pluripotent stem cells

    PubMed Central

    Huang, Miller; Miller, Matthew L.; McHenry, Lauren K.; Zheng, Tina; Zhen, Qiqi; Ilkhanizadeh, Shirin; Conklin, Bruce R.; Bronner, Marianne E.; Weiss, William A.

    2016-01-01

    Neural crest cells (NCC) are stem cells that generate different lineages, including neuroendocrine, melanocytic, cartilage, and bone. The differentiation potential of NCC varies according to the level from which cells emerge along the neural tube. For example, only anterior “cranial” NCC form craniofacial bone, whereas solely posterior “trunk” NCC contribute to sympathoadrenal cells. Importantly, the isolation of human fetal NCC carries ethical and scientific challenges, as NCC induction typically occur before pregnancy is detectable. As a result, current knowledge of NCC biology derives primarily from non-human organisms. Important differences between human and non-human NCC, such as expression of HNK1 in human but not mouse NCC, suggest a need to study human NCC directly. Here, we demonstrate that current protocols to differentiate human pluripotent stem cells (PSC) to NCC are biased toward cranial NCC. Addition of retinoic acid drove trunk-related markers and HOX genes characteristic of a posterior identity. Subsequent treatment with bone morphogenetic proteins (BMPs) enhanced differentiation to sympathoadrenal cells. Our approach provides methodology for detailed studies of human NCC, and clarifies roles for retinoids and BMPs in the differentiation of human PSC to trunk NCC and to sympathoadrenal lineages. PMID:26812940

  10. Direct generation of induced pluripotent stem cells from human nonmobilized blood.

    PubMed

    Kunisato, Atsushi; Wakatsuki, Mariko; Shinba, Haruna; Ota, Toshio; Ishida, Isao; Nagao, Kenji

    2011-01-01

    The use of induced pluripotent stem cells (iPSCs) is an exciting frontier in the study and treatment of human diseases through the generation of specific cell types. Here we show the derivation of iPSCs from human nonmobilized peripheral blood (PB) and bone marrow (BM) mononuclear cells (MNCs) by retroviral transduction of OCT3/4, SOX2, KLF4, and c-MYC. The PB- and BM-derived iPSCs were quite similar to human embryonic stem cells with regard to morphology, expression of surface antigens and pluripotency-associated transcription factors, global gene expression profiles, and differentiation potential in vitro and in vivo. Infected PB and BM MNCs gave rise to iPSCs in the presence of several cytokines, although transduction efficiencies were not high. We found that 5 × 10(5) PB MNCs, which corresponds to less than 1 mL of PB, was enough for the generation of several iPSC colonies. Generation of iPSCs from MNCs of nonmobilized PB, with its relative efficiency and ease of harvesting, could enable the therapeutic use of patient-specific pluripotent stem cells. PMID:20497033

  11. Multiple mRNA isoforms of the transcription activator protein CREB: generation by alternative splicing and specific expression in primary spermatocytes.

    PubMed Central

    Ruppert, S; Cole, T J; Boshart, M; Schmid, E; Schütz, G

    1992-01-01

    We have characterized cDNA clones representing mouse CREB (cyclic AMP responsive element binding protein) mRNA isoforms. These include CREB delta and CREB alpha, of which the rat and human homologues have been previously identified. Both encode proteins with CRE-binding activity and identical transactivation potential. The additional CREB mRNA isoforms potentially encode CREB related proteins. From the structural organization of the mouse CREB gene we conclude that the multiple transcripts are generated by alternative splicing. Furthermore we show that specific CREB mRNA isoforms are expressed at a high level in the adult testis. Expression of these isoforms is induced after commencement of spermatogenesis. In situ hybridization suggests that this expression occurs predominantly in the primary spermatocytes. Comparison of the CREB gene with the recently isolated CREM (cAMP responsive element modulator) cDNAs illustrates that the two genes have arisen by gene duplication and have diverged to encode transcriptional activators and repressors of the cAMP signal transduction pathway. Images PMID:1532935

  12. TRANSCRIPTION FACTOR Bmsage PLAYS A CRUCIAL ROLE IN SILK GLAND GENERATION IN SILKWORM, Bombyx mori.

    PubMed

    Xin, Hu-hu; Zhang, Deng-pan; Chen, Rui-ting; Cai, Zi-zheng; Lu, Yan; Liang, Shuang; Miao, Yun-gen

    2015-10-01

    Salivary gland secretion is altered in Drosophila embryos with loss of function of the sage gene. Saliva has a reduced volume and an increased electron density according to transmission electron microscopy, resulting in regions of tube dilation and constriction with intermittent tube closure. However, the precise functions of Bmsage in silkworm (Bombyx mori) are unknown, although its sequence had been deposited in SilkDB. From this, Bmsage is inferred to be a transcription factor that regulates the synthesis of silk fibroin and interacts with another silk gland-specific transcription factor, namely, silk gland factor-1. In this study, we introduced a germline mutation of Bmsage using the Cas9/sgRNA system, a genome-editing technology, resulting in deletion of Bmsage from the genome of B. mori. Of the 15 tested samples, seven displayed alterations at the target site. The mutagenesis efficiency was about 46.7% and there were no obvious off-target effects. In the screened homozygous mutants, silk glands developed poorly and the middle and posterior silk glands (MSG and PSG) were absent, which was significantly different from the wild type. The offspring of G0 mosaic silkworms had indel mutations causing 2- or 9-bp deletions at the target site, but exhibited the same abnormal silk gland structure. Mutant larvae containing different open-reading frames of Bmsage had the same silk gland phenotype. This illustrated that the mutant phenotype was due to Bmsage knockout. We conclude that Bmsage participates in embryonic development of the silk gland. PMID:25917878

  13. Dynamics of Cell Generation and Turnover in the Human Heart.

    PubMed

    Bergmann, Olaf; Zdunek, Sofia; Felker, Anastasia; Salehpour, Mehran; Alkass, Kanar; Bernard, Samuel; Sjostrom, Staffan L; Szewczykowska, Mirosława; Jackowska, Teresa; Dos Remedios, Cris; Malm, Torsten; Andrä, Michaela; Jashari, Ramadan; Nyengaard, Jens R; Possnert, Göran; Jovinge, Stefan; Druid, Henrik; Frisén, Jonas

    2015-06-18

    The contribution of cell generation to physiological heart growth and maintenance in humans has been difficult to establish and has remained controversial. We report that the full complement of cardiomyocytes is established perinataly and remains stable over the human lifespan, whereas the numbers of both endothelial and mesenchymal cells increase substantially from birth to early adulthood. Analysis of the integration of nuclear bomb test-derived (14)C revealed a high turnover rate of endothelial cells throughout life (>15% per year) and more limited renewal of mesenchymal cells (<4% per year in adulthood). Cardiomyocyte exchange is highest in early childhood and decreases gradually throughout life to <1% per year in adulthood, with similar turnover rates in the major subdivisions of the myocardium. We provide an integrated model of cell generation and turnover in the human heart. PMID:26073943

  14. Generation of Megakaryocytes and Platelets from Human Pluripotent Stem Cells.

    PubMed

    Pick, Marjorie

    2016-01-01

    Human pluripotent stem cells (hPSC) have the potential to produce any tissue type in the body and thus represent a source of cells for regenerative medicine. Here we have shown that human platelets can be produced from embryonic or induced pluripotent stem cells in a defined culture system. We describe a serum- and feeder-free culture system that enabled the generation of megakaryocyte (Mk) progenitors and functional platelets from hPSCs. After 13 days the differentiated population included precursor cells that formed colonies containing differentiated Mks, and after 20 days these Mks were able to fragment into platelet-like particles that were functional. This protocol represents an important step towards the generation of human platelets for therapeutic use. PMID:24297316

  15. The Transcription Factor Encyclopedia

    PubMed Central

    2012-01-01

    Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130 mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written and vetted by experts in the field. TFe is available at http://www.cisreg.ca/tfe. PMID:22458515

  16. The transcription factor encyclopedia.

    PubMed

    Yusuf, Dimas; Butland, Stefanie L; Swanson, Magdalena I; Bolotin, Eugene; Ticoll, Amy; Cheung, Warren A; Zhang, Xiao Yu Cindy; Dickman, Christopher T D; Fulton, Debra L; Lim, Jonathan S; Schnabl, Jake M; Ramos, Oscar H P; Vasseur-Cognet, Mireille; de Leeuw, Charles N; Simpson, Elizabeth M; Ryffel, Gerhart U; Lam, Eric W-F; Kist, Ralf; Wilson, Miranda S C; Marco-Ferreres, Raquel; Brosens, Jan J; Beccari, Leonardo L; Bovolenta, Paola; Benayoun, Bérénice A; Monteiro, Lara J; Schwenen, Helma D C; Grontved, Lars; Wederell, Elizabeth; Mandrup, Susanne; Veitia, Reiner A; Chakravarthy, Harini; Hoodless, Pamela A; Mancarelli, M Michela; Torbett, Bruce E; Banham, Alison H; Reddy, Sekhar P; Cullum, Rebecca L; Liedtke, Michaela; Tschan, Mario P; Vaz, Michelle; Rizzino, Angie; Zannini, Mariastella; Frietze, Seth; Farnham, Peggy J; Eijkelenboom, Astrid; Brown, Philip J; Laperrière, David; Leprince, Dominique; de Cristofaro, Tiziana; Prince, Kelly L; Putker, Marrit; del Peso, Luis; Camenisch, Gieri; Wenger, Roland H; Mikula, Michal; Rozendaal, Marieke; Mader, Sylvie; Ostrowski, Jerzy; Rhodes, Simon J; Van Rechem, Capucine; Boulay, Gaylor; Olechnowicz, Sam W Z; Breslin, Mary B; Lan, Michael S; Nanan, Kyster K; Wegner, Michael; Hou, Juan; Mullen, Rachel D; Colvin, Stephanie C; Noy, Peter John; Webb, Carol F; Witek, Matthew E; Ferrell, Scott; Daniel, Juliet M; Park, Jason; Waldman, Scott A; Peet, Daniel J; Taggart, Michael; Jayaraman, Padma-Sheela; Karrich, Julien J; Blom, Bianca; Vesuna, Farhad; O'Geen, Henriette; Sun, Yunfu; Gronostajski, Richard M; Woodcroft, Mark W; Hough, Margaret R; Chen, Edwin; Europe-Finner, G Nicholas; Karolczak-Bayatti, Magdalena; Bailey, Jarrod; Hankinson, Oliver; Raman, Venu; LeBrun, David P; Biswal, Shyam; Harvey, Christopher J; DeBruyne, Jason P; Hogenesch, John B; Hevner, Robert F; Héligon, Christophe; Luo, Xin M; Blank, Marissa Cathleen; Millen, Kathleen Joyce; Sharlin, David S; Forrest, Douglas; Dahlman-Wright, Karin; Zhao, Chunyan; Mishima, Yuriko; Sinha, Satrajit; Chakrabarti, Rumela; Portales-Casamar, Elodie; Sladek, Frances M; Bradley, Philip H; Wasserman, Wyeth W

    2012-01-01

    Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130 mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written and vetted by experts in the field. TFe is available at http://www.cisreg.ca/tfe. PMID:22458515

  17. Efficient Generation of Human Embryonic Stem Cell-Derived Corneal Endothelial Cells by Directed Differentiation

    PubMed Central

    McCabe, Kathryn L.; Kunzevitzky, Noelia J.; Chiswell, Brian P.; Xia, Xin; Goldberg, Jeffrey L.; Lanza, Robert

    2015-01-01

    Aim To generate human embryonic stem cell derived corneal endothelial cells (hESC-CECs) for transplantation in patients with corneal endothelial dystrophies. Materials and Methods Feeder-free hESC-CECs were generated by a directed differentiation protocol. hESC-CECs were characterized by morphology, expression of corneal endothelial markers, and microarray analysis of gene expression. Results hESC-CECs were nearly identical morphologically to primary human corneal endothelial cells, expressed Zona Occludens 1 (ZO-1) and Na+/K+ATPaseα1 (ATPA1) on the apical surface in monolayer culture, and produced the key proteins of Descemet’s membrane, Collagen VIIIα1 and VIIIα2 (COL8A1 and 8A2). Quantitative PCR analysis revealed expression of all corneal endothelial pump transcripts. hESC-CECs were 96% similar to primary human adult CECs by microarray analysis. Conclusion hESC-CECs are morphologically similar, express corneal endothelial cell markers and express a nearly identical complement of genes compared to human adult corneal endothelial cells. hESC-CECs may be a suitable alternative to donor-derived corneal endothelium. PMID:26689688

  18. Generation and use of human 3D-CAD models

    NASA Astrophysics Data System (ADS)

    Grotepass, Juergen; Speyer, Hartmut; Kaiser, Ralf

    2002-05-01

    Individualized Products are one of the ten mega trends of the 21st Century with human modeling as the key issue for tomorrow's design and product development. The use of human modeling software for computer based ergonomic simulations within the production process increases quality while reducing costs by 30- 50 percent and shortening production time. This presentation focuses on the use of human 3D-CAD models for both, the ergonomic design of working environments and made to measure garment production. Today, the entire production chain can be designed, individualized models generated and analyzed in 3D computer environments. Anthropometric design for ergonomics is matched to human needs, thus preserving health. Ergonomic simulation includes topics as human vision, reachability, kinematics, force and comfort analysis and international design capabilities. In German more than 17 billions of Mark are moved to other industries, because clothes do not fit. Individual clothing tailored to the customer's preference means surplus value, pleasure and perfect fit. The body scanning technology is the key to generation and use of human 3D-CAD models for both, the ergonomic design of working environments and made to measure garment production.

  19. Novel Mutations in the Transcriptional Activator Domain of the Human TBX20 in Patients with Atrial Septal Defect

    PubMed Central

    Monroy-Muñoz, Irma Eloisa; Rodríguez-Pérez, José Manuel; Muñoz-Medina, José Esteban; Angeles-Martínez, Javier; García-Trejo, José J.; Morales-Ríos, Edgar; Massó, Felipe; Sandoval-Jones, Juan Pablo; Cervantes-Salazar, Jorge; García-Montes, José Antonio; Calderón-Colmenero, Juan; Vargas-Alarcón, Gilberto

    2015-01-01

    Background. The relevance of TBX20 gene in heart development has been demonstrated in many animal models, but there are few works that try to elucidate the effect of TBX20 mutations in human congenital heart diseases. In these studies, all missense mutations associated with atrial septal defect (ASD) were found in the DNA-binding T-box domain, none in the transcriptional activator domain. Methods. We search for TBX20 mutations in a group of patients with ASD or ventricular septal defect (VSD) using the High Resolution Melting (HRM) method and DNA sequencing. Results. We report three missense mutations (Y309D, T370O, and M395R) within the transcriptional activator domain of human TBX20 that were associated with ASD. Conclusions. This is the first association of TBX20 transcriptional activator domain missense mutations with ASD. These findings could have implications for diagnosis, genetic screening, and patient follow-up. PMID:25834824

  20. Structure of human heat-shock transcription factor 1 in complex with DNA.

    PubMed

    Neudegger, Tobias; Verghese, Jacob; Hayer-Hartl, Manajit; Hartl, F Ulrich; Bracher, Andreas

    2016-02-01

    Heat-shock transcription factor 1 (HSF1) has a central role in mediating the protective response to protein conformational stresses in eukaryotes. HSF1 consists of an N-terminal DNA-binding domain (DBD), a coiled-coil oligomerization domain, a regulatory domain and a transactivation domain. Upon stress, HSF1 trimerizes via its coiled-coil domain and binds to the promoters of heat shock protein-encoding genes. Here, we present cocrystal structures of the human HSF1 DBD in complex with cognate DNA. A comparative analysis of the HSF1 paralog Skn7 from Chaetomium thermophilum showed that single amino acid changes in the DBD can switch DNA binding specificity, thus revealing the structural basis for the interaction of HSF1 with cognate DNA. We used a crystal structure of the coiled-coil domain of C. thermophilum Skn7 to develop a model of the active human HSF1 trimer in which HSF1 embraces the heat-shock-element DNA. PMID:26727489

  1. (Some) Cellular Mechanisms Influencing the Transcription of Human Endogenous Retrovirus, HERV-Fc1

    PubMed Central

    Laska, Magdalena Janina; Nissen, Kari Konstantin; Nexø, Bjørn Andersen

    2013-01-01

    DNA methylation and histone acetylation are epigenetic modifications that act as regulators of gene expression. DNA methylation is considered an important mechanism for silencing of retroelements in the mammalian genome. However, the methylation of human endogenous retroviruses (HERVs) is not well investigated. The aim of this study was to investigate the transcriptional potential of HERV-Fc1 proviral 5′LTR in more detail, and examined the specific influence of CpG methylation on this LTR in number of cell lines. Specifically, the role of demethylating chemicals e.g. 5-aza-2′ deoxycytidine and Trichostatin-A, in inducing or reactivating expression of HERV-Fc1 specific sequences and the mechanisms were investigated. In our present study, 5-aza-dC is shown to be a powerful inducer of HERV-Fc1, and at the same time it strongly inhibits methylation of DNA. Treatment with this demethylating agent 5-aza-dC, results in significantly increased levels of HERV-Fc1 expression in cells previously not expressing HERV-Fc1, or with a very low expression level. The extent of expression of HERV-Fc1 RNAs precisely correlates with the apparent extent of demethylation of the related DNA sequences. In conclusion, the results suggest that inhibition of DNA methylation/histone deacetylase can interfere with gene silencing mechanisms affecting HERV-Fc1 expression in human cells. PMID:23382858

  2. Transcriptional up-regulation of the human androgen receptor by androgen in bone cells.

    PubMed

    Wiren, K M; Zhang, X; Chang, C; Keenan, E; Orwoll, E S

    1997-06-01

    Androgen regulation of androgen receptor (AR) expression has been observed in a variety of tissues, generally as inhibition, and is thought to attenuate cellular responses to androgen. AR is expressed in osteoblasts, the bone-forming cell, suggesting direct actions of androgens on bone. Here we characterized the effect of androgen exposure on AR gene expression in human osteoblastic SaOS-2 and U-2 OS cells. Treatment of osteoblastic cells with the nonaromatizable androgen 5alpha-dihydrotestosterone increased AR steady state messenger RNA levels in a time- and dose-dependent fashion. Reporter assays with 2.3 kilobases of the proximal 5'-flanking region of the human AR promoter linked to the chloramphenicol acetyltransferase gene in transfected cultures showed that up-regulation of AR promoter activity by androgen was time and dose dependent. Treatment with other steroid hormones, including progesterone, 17beta-estradiol, and dexamethasone, was without effect. The antiandrogen hydroxyflutamide completely antagonized androgen up-regulation. Thus, in contrast to many other androgen target tissues, androgen exposure increases steady state AR messenger RNA levels in osteoblasts. This regulation occurs at least partially at the level of transcription, is mediated by the 5'-promoter region of the AR gene, and is dependent on functional AR. These results suggest that physiological concentrations of androgens have significant effects on AR expression in skeletal tissue. PMID:9165014

  3. Human Gene-Centered Transcription Factor Networks for Enhancers and Disease Variants

    PubMed Central

    Bass, Juan I. Fuxman; Sahni, Nidhi; Shrestha, Shaleen; Garcia-Gonzalez, Aurian; Mori, Akihiro; Bhat, Numana; Yi, Song; Hill, David E.; Vidal, Marc; Walhout, Albertha J.M.

    2015-01-01

    SUMMARY Gene regulatory networks (GRNs) comprising interactions between transcription factors (TFs) and regulatory loci control development and physiology. Numerous disease-associated mutations have been identified, the vast majority residing in non-coding regions of the genome. As current GRN mapping methods test one TF at a time and require the use of cells harboring the mutation(s) of interest, they are not suitable to identify TFs that bind to wild type and mutant loci. Here, we use gene-centered yeast one-hybrid (eY1H) assays to interrogate binding of 1,086 human TFs to 246 enhancers, as well as to 109 non-coding disease mutations. We detect both loss and gain of TF interactions with mutant loci that are concordant with target gene expression changes. This work establishes eY1H assays as a powerful addition to the toolkit of mapping human GRNs and for the high-throughput characterization of genomic variants that are rapidly being identified by genome-wide association studies. PMID:25910213

  4. Transcriptional insulation of the human keratin 18 gene in transgenic mice.

    PubMed Central

    Neznanov, N; Thorey, I S; Ceceña, G; Oshima, R G

    1993-01-01

    Expression of the 10-kb human keratin 18 (K18) gene in transgenic mice results in efficient and appropriate tissue-specific expression in a variety of internal epithelial organs, including liver, lung, intestine, kidney, and the ependymal epithelium of brain, but not in spleen, heart, or skeletal muscle. Expression at the RNA level is directly proportional to the number of integrated K18 transgenes. These results indicate that the K18 gene is able to insulate itself both from the commonly observed cis-acting effects of the sites of integration and from the potential complications of duplicated copies of the gene arranged in head-to-tail fashion. To begin to identify the K18 gene sequences responsible for this property of transcriptional insulation, additional transgenic mouse lines containing deletions of either the 5' or 3' distal end of the K18 gene have been characterized. Deletion of 1.5 kb of the distal 5' flanking sequence has no effect upon either the tissue specificity or the copy number-dependent behavior of the transgene. In contrast, deletion of the 3.5-kb 3' flanking sequence of the gene results in the loss of the copy number-dependent behavior of the gene in liver and intestine. However, expression in kidney, lung, and brain remains efficient and copy number dependent in these transgenic mice. Furthermore, herpes simplex virus thymidine kinase gene expression is copy number dependent in transgenic mice when the gene is located between the distal 5'- and 3'-flanking sequences of the K18 gene. Each adult transgenic male expressed the thymidine kinase gene in testes and brain and proportionally to the number of integrated transgenes. We conclude that the characteristic of copy number-dependent expression of the K18 gene is tissue specific because the sequence requirements for transcriptional insulation in adult liver and intestine are different from those for lung and kidney. In addition, the behavior of the transgenic thymidine kinase gene in testes and

  5. Gene amplification of the transcription factor DP1 and CTNND1 in human lung cancer.

    PubMed

    Castillo, Sandra D; Angulo, Barbara; Suarez-Gauthier, Ana; Melchor, Lorenzo; Medina, Pedro P; Sanchez-Verde, Lydia; Torres-Lanzas, Juan; Pita, Guillermo; Benitez, Javier; Sanchez-Cespedes, Montse

    2010-09-01

    The search for novel oncogenes is important because they could be the target of future specific anticancer therapies. In the present paper we report the identification of novel amplified genes in lung cancer by means of global gene expression analysis. To screen for amplicons, we aligned the gene expression data according to the position of transcripts in the human genome and searched for clusters of over-expressed genes. We found several clusters with gene over-expression, suggesting an underlying genomic amplification. FISH and microarray analysis for DNA copy number in two clusters, at chromosomes 11q12 and 13q34, confirmed the presence of amplifications spanning about 0.4 and 1 Mb for 11q12 and 13q34, respectively. Amplification at these regions each occurred at a frequency of 3%. Moreover, quantitative RT-PCR of each individual transcript within the amplicons allowed us to verify the increased in gene expression of several genes. The p120ctn and DP1 proteins, encoded by two candidate oncogenes, CTNND1 and TFDP1, at 11q12 and 13q amplicons, respectively, showed very strong immunostaining in lung tumours with gene amplification. We then focused on the 13q34 amplicon and in the TFDP1 candidate oncogene. To further determine the oncogenic properties of DP1, we searched for lung cancer cell lines carrying TFDP1 amplification. Depletion of TFDP1 expression by small interference RNA in a lung cancer cell line (HCC33) with TFDP1 amplification and protein over-expression reduced cell viability by 50%. In conclusion, we report the identification of two novel amplicons, at 13q34 and 11q12, each occurring at a frequency of 3% of non-small cell lung cancers. TFDP1, which encodes the E2F-associated transcription factor DP1 is a candidate oncogene at 13q34. The data discussed in this publication have been deposited in NCBIs Gene Expression Omnibus (GEO; http://www.ncbi.nlm.nih.gov/geo/) and are accessible through GEO Series Accession No. GSE21168. PMID:20556744

  6. A transcriptional switch underlies commitment to sexual development in human malaria parasites

    PubMed Central

    Kafsack, Björn F.C.; Rovira-Graells, Núria; Clark, Taane G.; Bancells, Cristina; Crowley, Valerie M.; Campino, Susana G.; Williams, April E.; Drought, Laura G.; Kwiatkowski, Dominic P.; Baker, David A.; Cortés, Alfred; Llinás, Manuel

    2014-01-01

    The life cycles of many parasites involve transitions between disparate host species, requiring these parasites to go through multiple developmental stages adapted to each of these specialized niches. Transmission of malaria parasites (Plasmodium spp.) from humans to the mosquito vector requires differentiation from asexual stages replicating within red blood cells into non-dividing male and female gametocytes. Although gametocytes were first described in 1880, our understanding of the molecular mechanisms involved in commitment to gametocyte formation is extremely limited and disrupting this critical developmental transition remains a long-standing goal1. We show here that expression levels of the DNA-binding protein PfAP2-G correlate strongly with levels of gametocyte formation. Using independent forward and reverse genetics approaches, we demonstrate that PfAP2-G function is essential for parasite sexual differentiation. By combining genome-wide PfAP2-G cognate motif occurrence with global transcriptional changes resulting from PfAP2-G ablation, we identify early gametocyte genes as likely targets of PfAP2-G and show that their regulation by PfAP2-G is critical for their wild-type level expression. In the asexual blood-stage parasites pfap2-g appears to be among a set of epigenetically silenced loci2,3 prone to spontaneous activation4. Stochastic activation presents a simple mechanism for a low baseline of gametocyte production. Overall, these findings identify PfAP2-G as a master regulator of sexual-stage development in malaria parasites and mark the first identification of a transcriptional switch controlling a differentiation decision in protozoan parasites. PMID:24572369

  7. Transcriptional and metabolic adaptation of human neurons to the mitochondrial toxicant MPP(+).

    PubMed

    Krug, A K; Gutbier, S; Zhao, L; Pöltl, D; Kullmann, C; Ivanova, V; Förster, S; Jagtap, S; Meiser, J; Leparc, G; Schildknecht, S; Adam, M; Hiller, K; Farhan, H; Brunner, T; Hartung, T; Sachinidis, A; Leist, M

    2014-01-01

    Assessment of the network of toxicity pathways by Omics technologies and bioinformatic data processing paves the road toward a new toxicology for the twenty-first century. Especially, the upstream network of responses, taking place in toxicant-treated cells before a point of no return is reached, is still little explored. We studied the effects of the model neurotoxicant 1-methyl-4-phenylpyridinium (MPP(+)) by a combined metabolomics (mass spectrometry) and transcriptomics (microarrays and deep sequencing) approach to provide unbiased data on earliest cellular adaptations to stress. Neural precursor cells (LUHMES) were differentiated to homogeneous cultures of fully postmitotic human dopaminergic neurons, and then exposed to the mitochondrial respiratory chain inhibitor MPP(+) (5 μM). At 18-24 h after treatment, intracellular ATP and mitochondrial integrity were still close to control levels, but pronounced transcriptome and metabolome changes were seen. Data on altered glucose flux, depletion of phosphocreatine and oxidative stress (e.g., methionine sulfoxide formation) confirmed the validity of the approach. New findings were related to nuclear paraspeckle depletion, as well as an early activation of branches of the transsulfuration pathway to increase glutathione. Bioinformatic analysis of our data identified the transcription factor ATF-4 as an upstream regulator of early responses. Findings on this signaling pathway and on adaptive increases of glutathione production were confirmed biochemically. Metabolic and transcriptional profiling contributed complementary information on multiple primary and secondary changes that contribute to the cellular response to MPP(+). Thus, combined 'Omics' analysis is a new unbiased approach to unravel earliest metabolic changes, whose balance decides on the final cell fate. PMID:24810058

  8. Efficient transcription of the human angiotensin II type 2 receptor gene requires intronic sequence elements.

    PubMed Central

    Warnecke, C; Willich, T; Holzmeister, J; Bottari, S P; Fleck, E; Regitz-Zagrosek, V

    1999-01-01

    To investigate mechanisms of human angiotensin II type 2 receptor (hAT2) gene regulation we functionally characterized the promoter and downstream regions of the gene. 5'-Terminal deletion mutants from -1417/+100 to -46/+100 elicited significant but low functional activity in luciferase reporter gene assays with PC12W cells. Inclusion into the promoter constructs of intron 1 and the transcribed region of the hAT2 gene up to the translation start enhanced luciferase activity 6.7+/-1.6-fold and 11.6+/-1.7-fold (means+/-S.E.M.) respectively, whereas fusion of the promoter to the spliced 5' untranslated region of hAT2 cDNA did not, which indicated an enhancement caused by intronic sequence elements. Reverse transcriptase-mediated PCR confirmed that the chimaeric hAT2-luciferase mRNA was regularly spliced in PC12W cells. A Northern blot analysis of transfected cells showed levels of luciferase mRNA expression consistent with the respective enzyme activities. Mapping of intron 1 revealed that a 12 bp sequence in the centre of the intron was required for the increase in promoter activity, whereas the 5' adjacent intronic region mediated a decrease in luciferase activity. Mutation of the 12 bp region led to altered protein binding and markedly decreased luciferase activity. Cloned into a promoterless luciferase vector, a 123 bp intron 1 fragment was able to direct reporter gene expression to the same activity as occurred in conjunction with the 5' flanking region. These results indicate that sequence elements in intron 1 are necessary for efficient transcription of hAT2. In reporter gene assays, intron 1 might by itself function as a promoter and initiate transcription from an alternative start point. PMID:10229654

  9. Reversion of a transcriptionally defective MHC class II-negative human B-cell mutant.

    PubMed Central

    Ombra, M N; Perfetto, C; Autiero, M; Anzisi, A M; Pasquinelli, R; Maffei, A; Del Pozzo, G; Guardiola, J

    1993-01-01

    RJ2.2.5, a mutant derived from the human B-lymphoma cell, Raji, is unable to express the MHC class II genes because of a recessive transcriptional defect attributed to the lack of an activator function. We report the isolation of a RJ2.2.5 revertant, namely AR, in which the expression of the mRNAs encoded by these genes is restored. Comparison of the binding of nuclear extracts or of partially purified nuclear preparations from the wild-type, the mutant and the revertant cells to a conserved MHC class II promoter element, the X-box, showed no alteration in the mobility of the complexes thus formed. However, in extracts from RJ2.2.5, and other MHC class II negative cell lines, such as HeLa, the amount of complex observed was significantly higher than in wild-type Raji cells. Furthermore, the binding activity exhibited by the AR revertant was lower than that of the RJ2.2.5 and higher than that of Raji. The use of specific monoclonal antibodies indicated that in all cases c-Jun and c-Fos or antigenically related proteins were required for binding. An inverse correlation between the level of DNA-protein complex formed and the level of MHC class II gene mRNA expressed in the three cell lines was apparent, suggesting that overexpression of a DNA binding factor forming complexes with class II promoter elements may cause repression of MHC class II transcription. A model which reconciles the previously ascertained recessivity of the phenotype of the mutation carried by RJ2.2.5 with the findings reported here is discussed. Images PMID:8441650

  10. Phenotypic robustness and the assortativity signature of human transcription factor networks.

    PubMed

    Pechenick, Dov A; Payne, Joshua L; Moore, Jason H

    2014-08-01

    Many developmental, physiological, and behavioral processes depend on the precise expression of genes in space and time. Such spatiotemporal gene expression phenotypes arise from the binding of sequence-specific transcription factors (TFs) to DNA, and from the regulation of nearby genes that such binding causes. These nearby genes may themselves encode TFs, giving rise to a transcription factor network (TFN), wherein nodes represent TFs and directed edges denote regulatory interactions between TFs. Computational studies have linked several topological properties of TFNs - such as their degree distribution - with the robustness of a TFN's gene expression phenotype to genetic and environmental perturbation. Another important topological property is assortativity, which measures the tendency of nodes with similar numbers of edges to connect. In directed networks, assortativity comprises four distinct components that collectively form an assortativity signature. We know very little about how a TFN's assortativity signature affects the robustness of its gene expression phenotype to perturbation. While recent theoretical results suggest that increasing one specific component of a TFN's assortativity signature leads to increased phenotypic robustness, the biological context of this finding is currently limited because the assortativity signatures of real-world TFNs have not been characterized. It is therefore unclear whether these earlier theoretical findings are biologically relevant. Moreover, it is not known how the other three components of the assortativity signature contribute to the phenotypic robustness of TFNs. Here, we use publicly available DNaseI-seq data to measure the assortativity signatures of genome-wide TFNs in 41 distinct human cell and tissue types. We find that all TFNs share a common assortativity signature and that this signature confers phenotypic robustness to model TFNs. Lastly, we determine the extent to which each of the four components of the

  11. Profiling ethanol-targeted transcription factors in human carcinoma cell-derived embryoid bodies.

    PubMed

    Mandal, Chanchal; Halder, Debasish; Chai, Jin Choul; Lee, Young Seek; Jung, Kyoung Hwa; Chai, Young Gyu

    2016-01-15

    Fetal alcohol spectrum disorder is a collective term that represents fetal abnormalities associated with maternal alcohol consumption. Prenatal alcohol exposure and related anomalies are well characterized, but the molecular mechanism behind this phenomenon is not yet understood. Few insights have been gained from genetic and epigenetic studies of fetal alcohol spectrum disorder. Our aim was to profile the important molecular regulators of ethanol-related alterations of the genome. For this purpose, we have analyzed the gene expression pattern of human carcinoma cell-derived embryoid bodies in the absence or presence of ethanol. A cDNA microarray analysis was used to profile mRNA expression in embryoid bodies at day 7 with or without ethanol treatment. A total of 493 differentially expressed genes were identified in response to 50 mM ethanol exposure. Of these, 111 genes were up-regulated, and 382 were down-regulated. Gene ontology term enrichment analysis revealed that these genes are involved in important biological processes: neurological system processes, cognition, behavior, sensory perception of smell, taste and chemical stimuli and synaptic transmission. Similarly, the enrichment of disease-related genes included relevant categories such as neurological diseases, developmental disorders, skeletal and muscular disorders, and connective tissue disorders. Furthermore, we have identified a group of 26 genes that encode transcription factors. We validated the relative gene expression of several transcription factors using quantitative real time PCR. We hope that our study substantially contributes to the understanding of the molecular mechanisms underlying the pathology of alcohol-mediated anomalies and facilitates further research. PMID:26456191

  12. Architectural Transcription Factor HMGI(Y) Promotes Tumor Progression and Mesenchymal Transition of Human Epithelial Cells

    PubMed Central

    Reeves, Raymond; Edberg, Dale D.; Li, Ying

    2001-01-01

    Numerous studies have demonstrated that overexpression or aberrant expression of the HMGI(Y) family of architectural transcription factors is frequently associated with both neoplastic transformation of cells and metastatic tumor progression. Little is known, however, about the molecular roles played by the HMGI(Y) proteins in these events. Here we report that human breast epithelial cells harboring tetracycline-regulated HMGI(Y) transgenes acquire the ability to form both primary and metastatic tumors in nude mice only when the transgenes are actively expressed. Unexpectedly, the HMG-Y, rather than the HMG-I, isoform of these proteins is the most effective elicitor of both neoplastic transformation and metastatic progression in vivo. Furthermore, expression of either antisense or dominant-negative HMGI(Y) constructs inhibits both the rate of proliferation of tumor cells and their ability to grow anchorage independently in soft agar. Array analysis of transcription profiles demonstrates that the HMG-I and HMG-Y isoform proteins each modulate the expression of distinctive constellations of genes known to be involved in signal transduction, cell proliferation, tumor initiation, invasion, migration, induction of angiogenesis, and colonization. Immunohistochemical analyses of tumors formed in nude mice indicate that many have undergone an epithelial-mesenchymal transition in vivo. Together, these findings demonstrate that overexpression of the HMGI(Y) proteins, more specifically, the HMG-Y isoform protein, is causally associated with both neoplastic transformation and metastatic progression and suggest that induction of integrins and their signaling pathways may play significant molecular roles in these biological events. PMID:11134344

  13. Transcriptional and metabolic adaptation of human neurons to the mitochondrial toxicant MPP+

    PubMed Central

    Krug, A K; Gutbier, S; Zhao, L; Pöltl, D; Kullmann, C; Ivanova, V; Förster, S; Jagtap, S; Meiser, J; Leparc, G; Schildknecht, S; Adam, M; Hiller, K; Farhan, H; Brunner, T; Hartung, T; Sachinidis, A; Leist, M

    2014-01-01

    Assessment of the network of toxicity pathways by Omics technologies and bioinformatic data processing paves the road toward a new toxicology for the twenty-first century. Especially, the upstream network of responses, taking place in toxicant-treated cells before a point of no return is reached, is still little explored. We studied the effects of the model neurotoxicant 1-methyl-4-phenylpyridinium (MPP+) by a combined metabolomics (mass spectrometry) and transcriptomics (microarrays and deep sequencing) approach to provide unbiased data on earliest cellular adaptations to stress. Neural precursor cells (LUHMES) were differentiated to homogeneous cultures of fully postmitotic human dopaminergic neurons, and then exposed to the mitochondrial respiratory chain inhibitor MPP+ (5 μM). At 18–24 h after treatment, intracellular ATP and mitochondrial integrity were still close to control levels, but pronounced transcriptome and metabolome changes were seen. Data on altered glucose flux, depletion of phosphocreatine and oxidative stress (e.g., methionine sulfoxide formation) confirmed the validity of the approach. New findings were related to nuclear paraspeckle depletion, as well as an early activation of branches of the transsulfuration pathway to increase glutathione. Bioinformatic analysis of our data identified the transcription factor ATF-4 as an upstream regulator of early responses. Findings on this signaling pathway and on adaptive increases of glutathione production were confirmed biochemically. Metabolic and transcriptional profiling contributed complementary information on multiple primary and secondary changes that contribute to the cellular response to MPP+. Thus, combined ‘Omics' analysis is a new unbiased approach to unravel earliest metabolic changes, whose balance decides on the final cell fate. PMID:24810058

  14. Architectural transcription factor HMGI(Y) promotes tumor progression and mesenchymal transition of human epithelial cells.

    PubMed

    Reeves, R; Edberg, D D; Li, Y

    2001-01-01

    Numerous studies have demonstrated that overexpression or aberrant expression of the HMGI(Y) family of architectural transcription factors is frequently associated with both neoplastic transformation of cells and metastatic tumor progression. Little is known, however, about the molecular roles played by the HMGI(Y) proteins in these events. Here we report that human breast epithelial cells harboring tetracycline-regulated HMGI(Y) transgenes acquire the ability to form both primary and metastatic tumors in nude mice only when the transgenes are actively expressed. Unexpectedly, the HMG-Y, rather than the HMG-I, isoform of these proteins is the most effective elicitor of both neoplastic transformation and metastatic progression in vivo. Furthermore, expression of either antisense or dominant-negative HMGI(Y) constructs inhibits both the rate of proliferation of tumor cells and their ability to grow anchorage independently in soft agar. Array analysis of transcription profiles demonstrates that the HMG-I and HMG-Y isoform proteins each modulate the expression of distinctive constellations of genes known to be involved in signal transduction, cell proliferation, tumor initiation, invasion, migration, induction of angiogenesis, and colonization. Immunohistochemical analyses of tumors formed in nude mice indicate that many have undergone an epithelial-mesenchymal transition in vivo. Together, these findings demonstrate that overexpression of the HMGI(Y) proteins, more specifically, the HMG-Y isoform protein, is causally associated with both neoplastic transformation and metastatic progression and suggest that induction of integrins and their signaling pathways may play significant molecular roles in these biological events. PMID:11134344

  15. Calorie restriction in humans inhibits the PI3K/AKT pathway and induces a younger transcription profile

    PubMed Central

    Mercken, Evi M.; Crosby, Seth D.; Lamming, Dudley W.; JeBailey, Lellean; Krzysik-Walker, Susan; Villareal, Dennis; Capri, Miriam; Franceschi, Claudio; Zhang, Yongqing; Becker, Kevin; Sabatini, David M.; de Cabo, Rafael; Fontana, Luigi

    2013-01-01

    Summary Caloric restriction (CR) and down-regulation of the insulin/IGF pathway are the most robust interventions known to increase longevity in lower organisms. However, little is known about the molecular adaptations induced by CR in humans. Here we report that long-term CR in humans inhibits the IGF-1/insulin pathway in skeletal muscle, a key metabolic tissue. We also demonstrate that CR-induced dramatic changes of the skeletal muscle transcriptional profile that resemble those of younger individuals. Finally, in both rats and humans CR evoked similar responses in the transcriptional profiles of skeletal muscle. This common signature consisted of three key pathways typically associated with longevity: IGF-1/insulin signaling, mitochondrial biogenesis and inflammation. Furthermore, our data identifies promising pathways for therapeutic targets to combat age-related diseases and promote health in humans. PMID:23601134

  16. University Commission on Human Relations: Focusing on Racism & Other Forms of Discrimination. Final Report. Volume II: Transcripts of Public Hearings.

    ERIC Educational Resources Information Center

    James, Olive C. R., Ed.; Matson, Hollis N., Ed.

    This volume contains transcripts of six public hearings held by the San Francisco State University Commission on Human Relations between September and December 1989. The first hearing focused on Asian Pacific Americans and received testimony on higher education admissions policies, treatment in equity programs, student services, health issues,…

  17. Generation of neuropeptidergic hypothalamic neurons from human pluripotent stem cells

    PubMed Central

    Merkle, Florian T.; Maroof, Asif; Wataya, Takafumi; Sasai, Yoshiki; Studer, Lorenz; Eggan, Kevin; Schier, Alexander F.

    2015-01-01

    Hypothalamic neurons orchestrate many essential physiological and behavioral processes via secreted neuropeptides, and are relevant to human diseases such as obesity, narcolepsy and infertility. We report the differentiation of human pluripotent stem cells into many of the major types of neuropeptidergic hypothalamic neurons, including those producing pro-opiolemelanocortin, agouti-related peptide, hypocretin/orexin, melanin-concentrating hormone, oxytocin, arginine vasopressin, corticotropin-releasing hormone (CRH) or thyrotropin-releasing hormone. Hypothalamic neurons can be generated using a ‘self-patterning’ strategy that yields a broad array of cell types, or via a more reproducible directed differentiation approach. Stem cell-derived human hypothalamic neurons share characteristic morphological properties and gene expression patterns with their counterparts in vivo, and are able to integrate into the mouse brain. These neurons could form the basis of cellular models, chemical screens or cellular therapies to study and treat common human diseases. PMID:25670790

  18. Transcriptional regulation of the human cystathionine beta-synthase -1b basal promoter: synergistic transactivation by transcription factors NF-Y and Sp1/Sp3.

    PubMed Central

    Ge, Y; Konrad, M A; Matherly, L H; Taub, J W

    2001-01-01

    Cystathionine beta-synthase (CBS) catalyses the condensation of serine and homocysteine to form cystathionine, an intermediate step in the synthesis of cysteine. Human CBS encodes five distinct 5' non-coding exons, the most frequent termed CBS -1a and CBS -1b, each transcribed from its own unique GC-rich TATA-less promoter. The minimal transcriptional region (-3792 to -3667) of the CBS -1b promoter was defined by 5'- and 3'-deletions, and transient transfections of reporter gene constructs in HepG2 cells, characterized by CBS transcription exclusively from the -1b promoter. Included in this 125 bp region are 3 GC-boxes (termed GC-a, GC-b and GC-c), an inverted CAAT-box and an E-box. By gel-shift and supershift assays, binding of specificity protein (Sp)1 and Sp3 to the GC-box elements, upstream stimulatory factor 1 (USF-1) to the E-box, and both nuclear factor (NF)-Y and an NF-1-like factor to the CAAT box could be demonstrated. By transient trans fections and reporter gene assays in HepG2 and Drosophila SL2 cells, a functional interplay was indicated between NF-Y binding to the CAAT-box, or between USF-1 binding to the E-box, and Sp1/Sp3 binding to the GC-box elements. In SL2 cells, NF-Y and Sp1/Sp3 were synergistic. Furthermore, both Sp1 and the long Sp3 isoform transactivated the CBS -1b minimal promoter; however, the short Sp3 isoforms were potent repressors. These results may explain the cell- or tissue-specific regulation of CBS transcription, and clarify the bases for alterations in CBS gene expression in human disease and Down's syndrome. PMID:11415440

  19. β-Catenin-Independent Activation of TCF1/LEF1 in Human Hematopoietic Tumor Cells through Interaction with ATF2 Transcription Factors

    PubMed Central

    Grumolato, Luca; Liu, Guizhong; Haremaki, Tomomi; Mungamuri, Sathish Kumar; Mong, Phyllus; Akiri, Gal; Lopez-Bergami, Pablo; Arita, Adriana; Anouar, Youssef; Mlodzik, Marek; Ronai, Ze'ev A.; Brody, Joshua; Weinstein, Daniel C.; Aaronson, Stuart A.

    2013-01-01

    The role of Wnt signaling in embryonic development and stem cell maintenance is well established and aberrations leading to the constitutive up-regulation of this pathway are frequent in several types of human cancers. Upon ligand-mediated activation, Wnt receptors promote the stabilization of β-catenin, which translocates to the nucleus and binds to the T-cell factor/lymphoid enhancer factor (TCF/LEF) family of transcription factors to regulate the expression of Wnt target genes. When not bound to β-catenin, the TCF/LEF proteins are believed to act as transcriptional repressors. Using a specific lentiviral reporter, we identified hematopoietic tumor cells displaying constitutive TCF/LEF transcriptional activation in the absence of β-catenin stabilization. Suppression of TCF/LEF activity in these cells mediated by an inducible dominant-negative TCF4 (DN-TCF4) inhibited both cell growth and the expression of Wnt target genes. Further, expression of TCF1 and LEF1, but not TCF4, stimulated TCF/LEF reporter activity in certain human cell lines independently of β-catenin. By a complementary approach in vivo, TCF1 mutants, which lacked the ability to bind to β-catenin, induced Xenopus embryo axis duplication, a hallmark of Wnt activation, and the expression of the Wnt target gene Xnr3. Through generation of different TCF1-TCF4 fusion proteins, we identified three distinct TCF1 domains that participate in the β-catenin-independent activity of this transcription factor. TCF1 and LEF1 physically interacted and functionally synergized with members of the activating transcription factor 2 (ATF2) family of transcription factors. Moreover, knockdown of ATF2 expression in lymphoma cells phenocopied the inhibitory effects of DN-TCF4 on the expression of target genes associated with the Wnt pathway and on cell growth. Together, our findings indicate that, through interaction with ATF2 factors, TCF1/LEF1 promote the growth of hematopoietic malignancies in the absence of

  20. Generating Phenotypical Erroneous Human Behavior to Evaluate Human-automation Interaction Using Model Checking

    PubMed Central

    Bolton, Matthew L.; Bass, Ellen J.; Siminiceanu, Radu I.

    2012-01-01

    Breakdowns in complex systems often occur as a result of system elements interacting in unanticipated ways. In systems with human operators, human-automation interaction associated with both normative and erroneous human behavior can contribute to such failures. Model-driven design and analysis techniques provide engineers with formal methods tools and techniques capable of evaluating how human behavior can contribute to system failures. This paper presents a novel method for automatically generating task analytic models encompassing both normative and erroneous human behavior from normative task models. The generated erroneous behavior is capable of replicating Hollnagel’s zero-order phenotypes of erroneous action for omissions, jumps, repetitions, and intrusions. Multiple phenotypical acts can occur in sequence, thus allowing for the generation of higher order phenotypes. The task behavior model pattern capable of generating erroneous behavior can be integrated into a formal system model so that system safety properties can be formally verified with a model checker. This allows analysts to prove that a human-automation interactive system (as represented by the model) will or will not satisfy safety properties with both normative and generated erroneous human behavior. We present benchmarks related to the size of the statespace and verification time of models to show how the erroneous human behavior generation process scales. We demonstrate the method with a case study: the operation of a radiation therapy machine. A potential problem resulting from a generated erroneous human action is discovered. A design intervention is presented which prevents this problem from occurring. We discuss how our method could be used to evaluate larger applications and recommend future paths of development. PMID:23105914

  1. An extended dsRBD is required for post-transcriptional modification in human tRNAs

    PubMed Central

    Bou-Nader, Charles; Pecqueur, Ludovic; Bregeon, Damien; Kamah, Amina; Guérineau, Vincent; Golinelli-Pimpaneau, Béatrice; Guimarães, Beatriz G.; Fontecave, Marc; Hamdane, Djemel

    2015-01-01

    In tRNA, dihydrouridine is a conserved modified base generated by the post-transcriptional reduction of uridine. Formation of dihydrouridine 20, located in the D-loop, is catalyzed by dihydrouridine synthase 2 (Dus2). Human Dus2 (HsDus2) expression is upregulated in lung cancers, offering a growth advantage throughout its ability to interact with components of the translation apparatus and inhibit apoptosis. Here, we report the crystal structure of the individual domains of HsDus2 and their functional characterization. HsDus2 is organized into three major modules. The N-terminal catalytic domain contains the flavin cofactor involved in the reduction of uridine. The second module is the conserved α-helical domain known as the tRNA binding domain in HsDus2 homologues. It is connected via a flexible linker to an unusual extended version of a dsRNA binding domain (dsRBD). Enzymatic assays and yeast complementation showed that the catalytic domain binds selectively NADPH but cannot reduce uridine in the absence of the dsRBD. While in Dus enzymes from bacteria, plants and fungi, tRNA binding is essentially achieved by the α-helical domain, we showed that in HsDus2 this function is carried out by the dsRBD. This is the first reported case of a tRNA-modifying enzyme carrying a dsRBD used to bind tRNAs. PMID:26429968

  2. Generation and Characterization of an Immortalized Human Esophageal Myofibroblast Line.

    PubMed

    Niu, Chao; Chauhan, Uday; Gargus, Matthew; Shaker, Anisa

    2016-01-01

    Stromal cells with a myofibroblast phenotype present in the normal human esophagus are increased in individuals with gastro-esophageal reflux disease (GERD). We have previously demonstrated that myofibroblasts stimulated with acid and TLR4 agonists increase IL-6 and IL-8 secretion using primary cultures of myofibroblasts established from normal human esophagus. While primary cultures have the advantage of reflecting the in vivo environment, a short life span and unavoidable heterogeneity limits the usefulness of this model in larger scale in vitro cellular signaling studies. The major aim of this paper therefore was to generate a human esophageal myofibroblast line with an extended lifespan. In the work presented here we have generated and characterized an immortalized human esophageal myofibroblast line by transfection with a commercially available GFP-hTERT lentivirus. Immortalized human esophageal myofibroblasts demonstrate phenotypic, genotypic and functional similarity to primary cultures of esophageal myofibroblasts we have previously described. We found that immortalized esophageal myofibroblasts retain myofibroblast spindle-shaped morphology at low and high confluence beyond passage 80, and express α-SMA, vimentin, and CD90 myofibroblast markers. Immortalized human esophageal myofibroblasts also express the putative acid receptor TRPV1 and TLR4 and retain the functional capacity to respond to stimuli encountered in GERD with secretion of IL-6. Finally, immortalized human esophageal myofibroblasts also support the stratified growth of squamous esophageal epithelial cells in 3D organotypic cultures. This newly characterized immortalized human esophageal myofibroblast cell line can be used in future cellular signaling and co-culture studies. PMID:27055018

  3. Generation and Characterization of an Immortalized Human Esophageal Myofibroblast Line

    PubMed Central

    Niu, Chao; Chauhan, Uday; Gargus, Matthew; Shaker, Anisa

    2016-01-01

    Stromal cells with a myofibroblast phenotype present in the normal human esophagus are increased in individuals with gastro-esophageal reflux disease (GERD). We have previously demonstrated that myofibroblasts stimulated with acid and TLR4 agonists increase IL-6 and IL-8 secretion using primary cultures of myofibroblasts established from normal human esophagus. While primary cultures have the advantage of reflecting the in vivo environment, a short life span and unavoidable heterogeneity limits the usefulness of this model in larger scale in vitro cellular signaling studies. The major aim of this paper therefore was to generate a human esophageal myofibroblast line with an extended lifespan. In the work presented here we have generated and characterized an immortalized human esophageal myofibroblast line by transfection with a commercially available GFP-hTERT lentivirus. Immortalized human esophageal myofibroblasts demonstrate phenotypic, genotypic and functional similarity to primary cultures of esophageal myofibroblasts we have previously described. We found that immortalized esophageal myofibroblasts retain myofibroblast spindle-shaped morphology at low and high confluence beyond passage 80, and express α-SMA, vimentin, and CD90 myofibroblast markers. Immortalized human esophageal myofibroblasts also express the putative acid receptor TRPV1 and TLR4 and retain the functional capacity to respond to stimuli encountered in GERD with secretion of IL-6. Finally, immortalized human esophageal myofibroblasts also support the stratified growth of squamous esophageal epithelial cells in 3D organotypic cultures. This newly characterized immortalized human esophageal myofibroblast cell line can be used in future cellular signaling and co-culture studies. PMID:27055018

  4. Noncoding RNA in the transcriptional landscape of human neural progenitor cell differentiation

    PubMed Central

    Hecht, Patrick M.; Ballesteros-Yanez, Inmaculada; Grepo, Nicole; Knowles, James A.; Campbell, Daniel B.

    2015-01-01

    Increasing evidence suggests that noncoding RNAs play key roles in cellular processes, particularly in the brain. The present study used RNA sequencing to identify the transcriptional landscape of two human neural progenitor cell lines, SK-N-SH and ReNcell CX, as they differentiate into human cortical projection neurons. Protein coding genes were found to account for 54.8 and 57.0% of expressed genes, respectively, and alignment of RNA sequencing reads revealed that only 25.5–28.1% mapped to exonic regions of the genome. Differential expression analysis in the two cell lines identified altered gene expression in both protein coding and noncoding RNAs as they undergo neural differentiation with 222 differentially expressed genes observed in SK-N-SH cells and 19 differentially expressed genes in ReNcell CX. Interestingly, genes showing differential expression in SK-N-SH cells are enriched in genes implicated in autism spectrum disorder, but not in gene sets related to cancer or Alzheimer's disease. Weighted gene co-expression network analysis (WGCNA) was used to detect modules of co-expressed protein coding and noncoding RNAs in SK-N-SH cells and found four modules to be associated with neural differentiation. These modules contain varying levels of noncoding RNAs ranging from 10.7 to 49.7% with gene ontology suggesting roles in numerous cellular processes important for differentiation. These results indicate that noncoding RNAs are highly expressed in human neural progenitor cells and likely hold key regulatory roles in gene networks underlying neural differentiation and neurodevelopmental disorders. PMID:26557050

  5. Noncoding RNA in the transcriptional landscape of human neural progenitor cell differentiation.

    PubMed

    Hecht, Patrick M; Ballesteros-Yanez, Inmaculada; Grepo, Nicole; Knowles, James A; Campbell, Daniel B

    2015-01-01

    Increasing evidence suggests that noncoding RNAs play key roles in cellular processes, particularly in the brain. The present study used RNA sequencing to identify the transcriptional landscape of two human neural progenitor cell lines, SK-N-SH and ReNcell CX, as they differentiate into human cortical projection neurons. Protein coding genes were found to account for 54.8 and 57.0% of expressed genes, respectively, and alignment of RNA sequencing reads revealed that only 25.5-28.1% mapped to exonic regions of the genome. Differential expression analysis in the two cell lines identified altered gene expression in both protein coding and noncoding RNAs as they undergo neural differentiation with 222 differentially expressed genes observed in SK-N-SH cells and 19 differentially expressed genes in ReNcell CX. Interestingly, genes showing differential expression in SK-N-SH cells are enriched in genes implicated in autism spectrum disorder, but not in gene sets related to cancer or Alzheimer's disease. Weighted gene co-expression network analysis (WGCNA) was used to detect modules of co-expressed protein coding and noncoding RNAs in SK-N-SH cells and found four modules to be associated with neural differentiation. These modules contain varying levels of noncoding RNAs ranging from 10.7 to 49.7% with gene ontology suggesting roles in numerous cellular processes important for differentiation. These results indicate that noncoding RNAs are highly expressed in human neural progenitor cells and likely hold key regulatory roles in gene networks underlying neural differentiation and neurodevelopmental disorders. PMID:26557050

  6. Enhanced hemangioblast generation and improved vascular repair and regeneration from embryonic stem cells by defined transcription factors.

    PubMed

    Liu, Fang; Bhang, Suk Ho; Arentson, Elizabeth; Sawada, Atsushi; Kim, Chan Kyu; Kang, Inyoung; Yu, Jinsheng; Sakurai, Nagisa; Kim, Suk Hyung; Yoo, Judy Ji Woon; Kim, Paul; Pahng, Seong Ho; Xia, Younan; Solnica-Krezel, Lilianna; Choi, Kyunghee

    2013-01-01

    The fetal liver kinase 1 (FLK-1)(+) hemangioblast can generate hematopoietic, endothelial, and smooth muscle cells (SMCs). ER71/ETV2, GATA2, and SCL form a core transcriptional network in hemangioblast development. Transient coexpression of these three factors during mesoderm formation stage in mouse embryonic stem cells (ESCs) robustly enhanced hemangioblast generation by activating bone morphogenetic protein (BMP) and FLK-1 signaling while inhibiting phosphatidylinositol 3-kinase, WNT signaling, and cardiac output. Moreover, etsrp, gata2, and scl inhibition converted hematopoietic field of the zebrafish anterior lateral plate mesoderm to cardiac. FLK-1(+) hemangioblasts generated by transient coexpression of the three factors (ER71-GATA2-SCL [EGS]-induced FLK-1(+)) effectively produced hematopoietic, endothelial, and SMCs in culture and in vivo. Importantly, EGS-induced FLK-1(+) hemangioblasts, when codelivered with mesenchymal stem cells as spheroids, were protected from apoptosis and generated functional endothelial cells and SMCs in ischemic mouse hindlimbs, resulting in improved blood perfusion and limb salvage. ESC-derived, EGS-induced FLK-1(+) hemangioblasts could provide an attractive cell source for future hematopoietic and vascular repair and regeneration. PMID:24052951

  7. Human ISWI complexes are targeted by SMARCA5 ATPase and SLIDE domains to help resolve lesion-stalled transcription

    PubMed Central

    Aydin, Özge Z.; Marteijn, Jurgen A.; Ribeiro-Silva, Cristina; Rodríguez López, Aida; Wijgers, Nils; Smeenk, Godelieve; van Attikum, Haico; Poot, Raymond A.; Vermeulen, Wim; Lans, Hannes

    2014-01-01

    Chromatin compaction of deoxyribonucleic acid (DNA) presents a major challenge to the detection and removal of DNA damage. Helix-distorting DNA lesions that block transcription are specifically repaired by transcription-coupled nucleotide excision repair, which is initiated by binding of the CSB protein to lesion-stalled RNA polymerase II. Using live cell imaging, we identify a novel function for two distinct mammalian ISWI adenosine triphosphate (ATP)-dependent chromatin remodeling complexes in resolving lesion-stalled transcription. Human ISWI isoform SMARCA5/SNF2H and its binding partners ACF1 and WSTF are rapidly recruited to UV-C induced DNA damage to specifically facilitate CSB binding and to promote transcription recovery. SMARCA5 targeting to UV-C damage depends on transcription and histone modifications and requires functional SWI2/SNF2-ATPase and SLIDE domains. After initial recruitment to UV damage, SMARCA5 re-localizes away from the center of DNA damage, requiring its HAND domain. Our studies support a model in which SMARCA5 targeting to DNA damage-stalled transcription sites is controlled by an ATP-hydrolysis-dependent scanning and proofreading mechanism, highlighting how SWI2/SNF2 chromatin remodelers identify and bind nucleosomes containing damaged DNA. PMID:24990377

  8. Transcriptional regulation of the human ALDH1A1 promoter by the oncogenic homeoprotein TLX1/HOX11

    PubMed Central

    Rice, Kim L.; Heidari, Mansour; Taplin, Ross H.; Kees, Ursula R.; Greene, Wayne K.

    2009-01-01

    The homeoprotein TLX1, which is essential to spleen organogenesis and oncogenic when aberrantly expressed in immature T cells, functions as a bifunctional transcriptional regulator, being capable of activation or repression depending on cell type and/or promoter context. However, the detailed mechanisms by which it regulates the transcription of target genes such as ALDH1A1 remains to be elucidated. We therefore functionally assessed the ability of TLX1 to regulate ALDH1A1 expression in two hematopoietic cell lines, PER-117 T-leukemic cells and human erythroleukemic (HEL) cells, by use of luciferase reporter and mobility shift assays. We showed that TLX1 physically interacts with the general transcription factor TFIIB via its homeodomain, and identified two activities in respect to TLX1-mediated regulation of the CCAAT box-containing ALDH1A1 promoter. The first involved CCAAT-dependent transcriptional repression via perturbation of GATA factor-containing protein complexes assembled at a non-canonical TATA (GATA) box. A structurally intact homeodomain was essential for repression by TLX1 although direct DNA binding was not required. The second activity, which involved CCAAT-independent transcriptional activation did not require an intact homeodomain, indicating that the activation and repression functions of TLX1 are distinct. These findings confirm ALDH1A1 gene regulation by TLX1 and support an indirect model for TLX1 function, in which protein-protein interactions, rather than DNA binding at specific sites, are crucial for its transcriptional activity.

  9. Topoisomerase 1 and Single-Strand Break Repair Modulate Transcription-Induced CAG Repeat Contraction in Human Cells ▿ †

    PubMed Central

    Hubert, Leroy; Lin, Yunfu; Dion, Vincent; Wilson, John H.

    2011-01-01

    Expanded trinucleotide repeats are responsible for a number of neurodegenerative diseases, such as Huntington disease and myotonic dystrophy type 1. The mechanisms that underlie repeat instability in the germ line and in the somatic tissues of human patients are undefined. Using a selection assay based on contraction of CAG repeat tracts in human cells, we screened the Prestwick chemical library in a moderately high-throughput assay and identified 18 novel inducers of repeat contraction. A subset of these compounds targeted pathways involved in the management of DNA supercoiling associated with transcription. Further analyses using both small molecule inhibitors and small interfering RNA (siRNA)-mediated knockdowns demonstrated the involvement of topoisomerase 1 (TOP1), tyrosyl-DNA phosphodiesterase 1 (TDP1), and single-strand break repair (SSBR) in modulating transcription-dependent CAG repeat contractions. The TOP1-TDP1-SSBR pathway normally functions to suppress repeat instability, since interfering with it stimulated repeat contractions. We further showed that the increase in repeat contractions when the TOP1-TDP1-SSBR pathway is compromised arises via transcription-coupled nucleotide excision repair, a previously identified contributor to transcription-induced repeat instability. These studies broaden the scope of pathways involved in transcription-induced CAG repeat instability and begin to define their interrelationships. PMID:21628532

  10. Quantitative gene expression profiling of mouse brain regions reveals differential transcripts conserved in human and affected in disease models.

    PubMed

    Brochier, Camille; Gaillard, Marie-Claude; Diguet, Elsa; Caudy, Nicolas; Dossat, Carole; Ségurens, Béatrice; Wincker, Patrick; Roze, Emmanuel; Caboche, Jocelyne; Hantraye, Philippe; Brouillet, Emmanuel; Elalouf, Jean-Marc; de Chaldée, Michel

    2008-04-22

    Using serial analysis of gene expression, we collected quantitative transcriptome data in 11 regions of the adult wild-type mouse brain: the orbital, prelimbic, cingulate, motor, somatosensory, and entorhinal cortices, the caudate-putamen, the nucleus accumbens, the thalamus, the substantia nigra, and the ventral tegmental area. With >1.2 million cDNA tags sequenced, this database is a powerful resource to explore brain functions and disorders. As an illustration, we performed interregional comparisons and found 315 differential transcripts. Most of them are poorly characterized and 20% lack functional annotation. For 78 differential transcripts, we provide independent expression level measurements in mouse brain regions by real-time quantitative RT-PCR. We also show examples where we used in situ hybridization to achieve infrastructural resolution. For 30 transcripts, we next demonstrated that regional enrichment is conserved in the human brain. We then quantified the expression levels of region-enriched transcripts in the R6/2 mouse model of Huntington disease and the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) mouse model of Parkinson disease and observed significant alterations in the striatum, cerebral cortex, thalamus and substantia nigra of R6/2 mice and in the striatum of MPTP-treated mice. These results show that the gene expression data provided here for the mouse brain can be used to explore pathophysiological models and disclose transcripts differentially expressed in human brain regions. PMID:18252803

  11. In vitro generation of human pluripotent stem cell derived lung organoids

    PubMed Central

    Dye, Briana R; Hill, David R; Ferguson, Michael AH; Tsai, Yu-Hwai; Nagy, Melinda S; Dyal, Rachel; Wells, James M; Mayhew, Christopher N; Nattiv, Roy; Klein, Ophir D; White, Eric S; Deutsch, Gail H; Spence, Jason R

    2015-01-01

    Recent breakthroughs in 3-dimensional (3D) organoid cultures for many organ systems have led to new physiologically complex in vitro models to study human development and disease. Here, we report the step-wise differentiation of human pluripotent stem cells (hPSCs) (embryonic and induced) into lung organoids. By manipulating developmental signaling pathways hPSCs generate ventral-anterior foregut spheroids, which are then expanded into human lung organoids (HLOs). HLOs consist of epithelial and mesenchymal compartments of the lung, organized with structural features similar to the native lung. HLOs possess upper airway-like epithelium with basal cells and immature ciliated cells surrounded by smooth muscle and myofibroblasts as well as an alveolar-like domain with appropriate cell types. Using RNA-sequencing, we show that HLOs are remarkably similar to human fetal lung based on global transcriptional profiles, suggesting that HLOs are an excellent model to study human lung development, maturation and disease. DOI: http://dx.doi.org/10.7554/eLife.05098.001 PMID:25803487

  12. Human T-cell lymphotropic virus type 1 Tax mediates enhanced transcription in CD4+ T lymphocytes.

    PubMed Central

    Newbound, G C; Andrews, J M; O'Rourke, J P; Brady, J N; Lairmore, M D

    1996-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is the etiologic agent of adult T-cell leukemia/lymphoma and is associated with a variety of immunoregulatory disorders. HTLV-1 has been shown to bind to and infect a variety of hematopoietic and nonhematopoietic cells. However, both in vivo and in vitro, the provirus is mostly detected in and preferentially transforms CD4+ T cells. The molecular mechanism that determines the CD4+ T-cell tropism of HTLV-1 has not been determined. Using cocultures of purified CD4+ and CD8+ T cells with an HTLV-1 producing cell line, we measured viral transcription by using Northern (RNA) blot analysis, protein production by using a p24 antigen capture assay and flow cytometric analysis for viral envelope, and proviral integration by using DNA slot blot analysis. We further measured HTLV-1 long terminal repeat-directed transcription in purified CD4+ and CD8+ T cells by using transient transfection assays and in vitro transcription. We demonstrate a higher rate of viral transcription in primary CD4+ T cells than in CD8+ T cells. HTLV-1 protein production was 5- to 25-fold greater in CD4+ cocultures and mRNA levels were 5-fold greater in these cultures than in the CD8+ cocultures. Transient transfection and in vitro transcription indicated a modest increase in basal transcription in CD4+ T cells, whereas there was a 20-fold increase in reporter gene activity in CD4+ T cells cotransfected with tax. These data suggest that unique or activated transcription factors, particularly Tax-responsive factors in CD4+ T cells, recognize regulatory sequences within the HTLV-1 long terminal repeat, and this mediates the observed enhanced viral transcription and ultimately the cell tropism and leukemogenic potential of the virus. PMID:8642630

  13. The CCAAT-box binding transcription factor, Nuclear Factor-Y (NF-Y) regulates transcription of human aldo-keto reductase 1C1 (AKR1C1) gene

    PubMed Central

    Pallai, Rajash; Simpkins, Henry; Chen, Jianli; Parekh, Hemant K.

    2010-01-01

    Dihydrodiol dehydrogenases are a family of aldo-keto reductases (AKR1Cs) involved in the metabolism of steroid hormones and xenobiotics. Herein, we have cloned and characterized the proximal promoter region of the human AKR1C1 gene. The 5’ flanking proximal promoter region of the AKR1C1 gene consists of a TATA box and an inverted CCAAT binding site. Deletion analysis of the 5’-flanking, ~3.0 kb region of the human AKR1C1 gene identified the region between −128 to −88 as the minimal proximal promoter essential for basal transcription of AKR1C1 in human ovarian (2008 & 2008/C13*), lung (H23 & A549) and liver carcinoma (HepG2) cells. Site-directed mutagenesis studies indicated that the transcription factor binding sites for NF-Y/CEBP were involved in controlling the basal transcription of AKR1C1 in all the cancer cells studied. Electrophoretic mobility shift (EMSAs) and gel supershift assays demonstrated that the transcription factor NF-Y preferentially binds to the inverted CCAAT box at −109ATTGG−105 of the AKR1C1 gene. Chromatin immunoprecipitation (ChIP) analysis confirmed the in vivo association between NF-Y and human AKR1C1 gene promoter in human ovarian, lung and liver carcinoma cells. Ectopic expression of NF-Y’s increased the AKR1C1 gene transcription, whereas expression of a dominant-negative NF-YA or suppression of NF-YA decreased the AKR1C1 gene transcription. A 2-fold increase in AKR1C1 transcription was observed specifically in cisplatin-treated 2008 cells that was CCAAT box-dependent. These results indicate that the NF-Y regulates the basal transcription of AKR1C1 in human ovarian, lung and liver carcinoma cells and the cisplatin-induced transcription in human ovarian carcinoma cells. PMID:20338228

  14. Strand-specific community RNA-seq reveals prevalent and dynamic antisense transcription in human gut microbiota

    PubMed Central

    Bao, Guanhui; Wang, Mingjie; Doak, Thomas G.; Ye, Yuzhen

    2015-01-01

    Metagenomics and other meta-omics approaches (including metatranscriptomics) provide insights into the composition and function of microbial communities living in different environments or animal hosts. Metatranscriptomics research provides an unprecedented opportunity to examine gene regulation for many microbial species simultaneously, and more importantly, for the majority that are unculturable microbial species, in their natural environments (or hosts). Current analyses of metatranscriptomic datasets focus on the detection of gene expression levels and the study of the relationship between changes of gene expression and changes of environment. As a demonstration of utilizing metatranscriptomics beyond these common analyses, we developed a computational and statistical procedure to analyze the antisense transcripts in strand-specific metatranscriptomic datasets. Antisense RNAs encoded on the DNA strand opposite a gene’s CDS have the potential to form extensive base-pairing interactions with the corresponding sense RNA, and can have important regulatory functions. Most studies of antisense RNAs in bacteria are rather recent, are mostly based on transcriptome analysis, and have been applied mainly to single bacterial species. Application of our approaches to human gut-associated metatranscriptomic datasets allowed us to survey antisense transcription for a large number of bacterial species associated with human beings. The ratio of protein coding genes with antisense transcription ranges from 0 to 35.8% (median = 10.0%) among 47 species. Our results show that antisense transcription is dynamic, varying between human individuals. Functional enrichment analysis revealed a preference of certain gene functions for antisense transcription, and transposase genes are among the most prominent ones (but we also observed antisense transcription in bacterial house-keeping genes). PMID:26388849

  15. Transcriptional Regulation of Cytosolic Sulfotransferase 1C2 by Vitamin D Receptor in LS180 Human Colorectal Adenocarcinoma Cells.

    PubMed

    Barrett, Kathleen G; Fang, Hailin; Kocarek, Thomas A; Runge-Morris, Melissa

    2016-08-01

    The factors that regulate expression of genes in the 1C family of human cytosolic sulfotransferases (SULT1C) are not well understood. In a recent study evaluating the effects of a panel of transcription factor activators on SULT1C family member expression in LS180 human colorectal adenocarcinoma cells, we found that SULT1C2 expression was significantly increased by 1α,25-dihydroxyvitamin D3 (VitD3) treatment. The objective of our current study was to identify the mechanism responsible for VitD3-mediated activation of SULT1C2 transcription. VitD3 treatment of LS180 cells activated transcription of a transfected luciferase reporter plasmid that contained ∼5 kilobase pairs (kbp) of the SULT1C2 gene, which included 402 nucleotides (nt) of the noncoding exon 1, all of intron 1, and 21 nt of exon 2. Although computational analysis of the VitD3-responsive region of the SULT1C2 gene identified a pregnane X receptor (PXR)-binding site within exon 1, the transfected 5 kbp SULT1C2 reporter was not activated by treatment with rifampicin, a prototypical PXR agonist. However, deletion or mutation of the predicted PXR-binding site abolished VitD3-mediated SULT1C2 transcriptional activation, identifying the site as a functional vitamin D response element (VDRE). We further demonstrated that vitamin D receptor (VDR) can interact directly with the SULT1C2 VDRE sequence using an enzyme-linked immunosorbent assay-based transcription factor binding assay. In conclusion, VitD3-inducible SULT1C2 transcription is mediated through a VDRE in exon 1. These results suggest a role for SULT1C2 in VitD3-regulated physiologic processes in human intestine. PMID:27130351

  16. The H-Invitational Database (H-InvDB), a comprehensive annotation resource for human genes and transcripts.

    PubMed

    Yamasaki, Chisato; Murakami, Katsuhiko; Fujii, Yasuyuki; Sato, Yoshiharu; Harada, Erimi; Takeda, Jun-ichi; Taniya, Takayuki; Sakate, Ryuichi; Kikugawa, Shingo; Shimada, Makoto; Tanino, Motohiko; Koyanagi, Kanako O; Barrero, Roberto A; Gough, Craig; Chun, Hong-Woo; Habara, Takuya; Hanaoka, Hideki; Hayakawa, Yosuke; Hilton, Phillip B; Kaneko, Yayoi; Kanno, Masako; Kawahara, Yoshihiro; Kawamura, Toshiyuki; Matsuya, Akihiro; Nagata, Naoki; Nishikata, Kensaku; Noda, Akiko Ogura; Nurimoto, Shin; Saichi, Naomi; Sakai, Hiroaki; Sanbonmatsu, Ryoko; Shiba, Rie; Suzuki, Mami; Takabayashi, Kazuhiko; Takahashi, Aiko; Tamura, Takuro; Tanaka, Masayuki; Tanaka, Susumu; Todokoro, Fusano; Yamaguchi, Kaori; Yamamoto, Naoyuki; Okido, Toshihisa; Mashima, Jun; Hashizume, Aki; Jin, Lihua; Lee, Kyung-Bum; Lin, Yi-Chueh; Nozaki, Asami; Sakai, Katsunaga; Tada, Masahito; Miyazaki, Satoru; Makino, Takashi; Ohyanagi, Hajime; Osato, Naoki; Tanaka, Nobuhiko; Suzuki, Yoshiyuki; Ikeo, Kazuho; Saitou, Naruya; Sugawara, Hideaki; O'Donovan, Claire; Kulikova, Tamara; Whitfield, Eleanor; Halligan, Brian; Shimoyama, Mary; Twigger, Simon; Yura, Kei; Kimura, Kouichi; Yasuda, Tomohiro; Nishikawa, Tetsuo; Akiyama, Yutaka; Motono, Chie; Mukai, Yuri; Nagasaki, Hideki; Suwa, Makiko; Horton, Paul; Kikuno, Reiko; Ohara, Osamu; Lancet, Doron; Eveno, Eric; Graudens, Esther; Imbeaud, Sandrine; Debily, Marie Anne; Hayashizaki, Yoshihide; Amid, Clara; Han, Michael; Osanger, Andreas; Endo, Toshinori; Thomas, Michael A; Hirakawa, Mika; Makalowski, Wojciech; Nakao, Mitsuteru; Kim, Nam-Soon; Yoo, Hyang-Sook; De Souza, Sandro J; Bonaldo, Maria de Fatima; Niimura, Yoshihito; Kuryshev, Vladimir; Schupp, Ingo; Wiemann, Stefan; Bellgard, Matthew; Shionyu, Masafumi; Jia, Libin; Thierry-Mieg, Danielle; Thierry-Mieg, Jean; Wagner, Lukas; Zhang, Qinghua; Go, Mitiko; Minoshima, Shinsei; Ohtsubo, Masafumi; Hanada, Kousuke; Tonellato, Peter; Isogai, Takao; Zhang, Ji; Lenhard, Boris; Kim, Sangsoo; Chen, Zhu; Hinz, Ursula; Estreicher, Anne; Nakai, Kenta; Makalowska, Izabela; Hide, Winston; Tiffin, Nicola; Wilming, Laurens; Chakraborty, Ranajit; Soares, Marcelo Bento; Chiusano, Maria Luisa; Suzuki, Yutaka; Auffray, Charles; Yamaguchi-Kabata, Yumi; Itoh, Takeshi; Hishiki, Teruyoshi; Fukuchi, Satoshi; Nishikawa, Ken; Sugano, Sumio; Nomura, Nobuo; Tateno, Yoshio; Imanishi, Tadashi; Gojobori, Takashi

    2008-01-01

    Here we report the new features and improvements in our latest release of the H-Invitational Database (H-InvDB; http://www.h-invitational.jp/), a comprehensive annotation resource for human genes and transcripts. H-InvDB, originally developed as an integrated database of the human transcriptome based on extensive annotation of large sets of full-length cDNA (FLcDNA) clones, now provides annotation for 120 558 human mRNAs extracted from the International Nucleotide Sequence Databases (INSD), in addition to 54 978 human FLcDNAs, in the latest release H-InvDB_4.6. We mapped those human transcripts onto the human genome sequences (NCBI build 36.1) and determined 34 699 human gene clusters, which could define 34 057 (98.1%) protein-coding and 642 (1.9%) non-protein-coding loci; 858 (2.5%) transcribed loci overlapped with predicted pseudogenes. For all these transcripts and genes, we provide comprehensive annotation including gene structures, gene functions, alternative splicing variants, functional non-protein-coding RNAs, functional domains, predicted sub cellular localizations, metabolic pathways, predictions of protein 3D structure, mapping of SNPs and microsatellite repeat motifs, co-localization with orphan diseases, gene expression profiles, orthologous genes, protein-protein interactions (PPI) and annotation for gene families. The current H-InvDB annotation resources consist of two main views: Transcript view and Locus view and eight sub-databases: the DiseaseInfo Viewer, H-ANGEL, the Clustering Viewer, G-integra, the TOPO Viewer, Evola, the PPI view and the Gene family/group. PMID:18089548

  17. Regulation of RNA polymerase II-mediated transcriptional elongation: Implications in human disease.

    PubMed

    Sharma, Nimisha

    2016-09-01

    Expression of protein-coding genes is primarily regulated at the level of transcription. Most of the earlier studies focussed on understanding the assembly of the pre-initiation complex at the promoter of genes and subsequent initiation of transcription as the regulatory steps in transcription. However, research over the last decade has demonstrated the significance of regulating transcription of genes at the elongation stage. Several new proteins have been identified that control this step and our knowledge about their functions is expanding rapidly. Moreover, an increasing body of evidence suggests that a dysfunction of these transcription elongation factors is related to several diseases. Here, we review the latest advances in our understanding about the in vivo roles of the transcription elongation factors and their link with diseases. © 2016 IUBMB Life, 68(9):709-716, 2016. PMID:27473825

  18. The Viral Transcription Group Determines the HLA Class I Cellular Immune Response Against Human Respiratory Syncytial Virus*

    PubMed Central

    Johnstone, Carolina; Lorente, Elena; Barriga, Alejandro; Barnea, Eilon; Infantes, Susana; Lemonnier, François A.; David, Chella S.; Admon, Arie; López, Daniel

    2015-01-01

    The cytotoxic T-lymphocyte-mediated killing of virus-infected cells requires previous recognition of short viral antigenic peptides bound to human leukocyte antigen class I molecules that are exposed on the surface of infected cells. The cytotoxic T-lymphocyte response is critical for the clearance of human respiratory syncytial virus infection. In this study, naturally processed viral human leukocyte antigen class I ligands were identified with mass spectrometry analysis of complex human leukocyte antigen-bound peptide pools isolated from large amounts of human respiratory syncytial virus-infected cells. Acute antiviral T-cell response characterization showed that viral transcription determines both the immunoprevalence and immunodominance of the human leukocyte antigen class I response to human respiratory syncytial virus. These findings have clear implications for antiviral vaccine design. PMID:25635267

  19. Signaling by Mechanical Strain Involves Transcriptional Regulation of Proinflammatory Genes in Human Periodontal Ligament Cells In Vitro

    PubMed Central

    LONG, P.; LIU, F.; PIESCO, N. P.; KAPUR, R.; AGARWAL, S.

    2016-01-01

    Intracellular signals generated by mechanical strain profoundly affect the metabolic function of osteoblast-like periodontal ligament (PDL) cells, which reside between the tooth and alveolar bone. In response to applied mechanical forces, PDL cells synthesize bone-resorptive cytokines to induce bone resorption at sites exposed to compressive forces and deposit bone at sites exposed to tensile forces in an environment primed for catabolic processes. The intracellular mechanisms that regulate this bone remodeling remain unclear. Here, in an in vitro model system, we show that tensile strain is a critical determinant of PDL-cell metabolic functions. Equibiaxial tensile strain (TENS), when applied at low magnitudes, acts as a potent antagonist of interleukin (IL)-1β actions and suppresses transcriptional regulation of multiple proinflammatory genes. This is evidenced by the fact that TENS at low magnitude: (i) inhibits recombinant human (rh)IL-1β-dependent induction of cyclooxygenase-2 (COX-2) mRNA expression and production of prostaglandin estradiol (PGE2); (ii) inhibits rhIL-1β-dependent induction matrix metalloproteinase-1 (MMP-1) and MMP-3 synthesis by suppressing their mRNA expression; (iii) abrogates rhIL-1β-induced suppression of tissue inhibitor of metalloprotease-II (TIMP-II) expression; and (iv) reverses IL-1β-dependent suppression of osteocalcin and alkaline phosphatase synthesis. Nevertheless, these actions of TENS were observed only in the presence of IL-1β, as TENS alone failed to affect any of the aforementioned responses. The present findings are the first to show that intra-cellular signals generated by low-magnitude mechanical strain interfere with one or more critical step(s) in the signal transduction cascade of rhIL-1β upstream of mRNA expression, while concurrently promoting the expression of osteogenic proteins in PDL cells. PMID:11934644

  20. Specific interactions between transcription factors and the promoter-regulatory region of the human cytomegalovirus major immediate-early gene

    SciTech Connect

    Ghazal, P.; Lubon, H.; Hennighausen, L. )

    1988-03-01

    Repeat sequence motifs as well as unique sequences between nucleotides {minus}150 and {minus}22 of the human cytomegalovirus immediate-early 1 gene interact in vitro with nuclear proteins. The authors show that a transcriptional element between nucleotides {minus}91 and {minus}65 stimulated promoter activity in vivo and in vitro by binding specific cellular transcription factors. Finally, a common sequence motif, (T)TGG/AC, present in 15 of the determined binding sites suggests a particular class of nuclear factors associated with the immediate-early 1 gene.

  1. Two different motor systems are needed to generate human speech.

    PubMed

    Holstege, Gert; Subramanian, Hari H

    2016-06-01

    Vocalizations such as mews and cries in cats or crying and laughter in humans are examples of expression of emotions. These vocalizations are generated by the emotional motor system, in which the mesencephalic periaqueductal gray (PAG) plays a central role, as demonstrated by the fact that lesions in the PAG lead to complete mutism in cats, monkeys, as well as in humans. The PAG receives strong projections from higher limbic regions and from the anterior cingulate, insula, and orbitofrontal cortical areas. In turn, the PAG has strong access to the caudal medullary nucleus retroambiguus (NRA). The NRA is the only cell group that has direct access to the motoneurons involved in vocalization, i.e., the motoneuronal cell groups innervating soft palate, pharynx, and larynx as well as diaphragm, intercostal, abdominal, and pelvic floor muscles. Together they determine the intraabdominal, intrathoracic, and subglottic pressure, control of which is necessary for generating vocalization. Only humans can speak, because, via the lateral component of the volitional or somatic motor system, they are able to modulate vocalization into words and sentences. For this modulation they use their motor cortex, which, via its corticobulbar fibers, has direct access to the motoneurons innervating the muscles of face, mouth, tongue, larynx, and pharynx. In conclusion, humans generate speech by activating two motor systems. They generate vocalization by activating the prefrontal-PAG-NRA-motoneuronal pathway, and, at the same time, they modulate this vocalization into words and sentences by activating the corticobulbar fibers to the face, mouth, tongue, larynx, and pharynx motoneurons. PMID:26355872

  2. A Third-Generation Evidence Base for Human Spaceflight Risks

    NASA Technical Reports Server (NTRS)

    Kundrot, Craig E.; Lumpkins, Sarah; Steil, Jennifer; Pellis, Neal; Charles, John

    2014-01-01

    NASA's Human Research Program seeks to understand and mitigate risks to crew health and performance in exploration missions center dot HRP's evidence base consists of an Evidence Report for each HRP risk center dot Three generations of Evidence Reports 1) Review articles + Good content - Limited authorship, infrequent updates 2) Wikipedia articles + Viewed often, very open to contributions - Summary of reviews, very few contributions 3) HRP-controlled wiki articles + Incremental additions to review articles with editorial control

  3. Rapid and Highly Efficient Generation of Induced Pluripotent Stem Cells from Human Umbilical Vein Endothelial Cells

    PubMed Central

    Yi, Fei; Herrerías, Aída; Batchelder, Erika M.; Belmonte, Juan Carlos Izpisua

    2011-01-01

    The ability to induce somatic cells to pluripotency by ectopic expression of defined transcription factors (e.g. KLF-4, OCT4, SOX2, c-MYC, or KOSM) has transformed the future of regenerative medicine. Here we report somatic cell reprogramming of human umbilical vein endothelial cells (HUVECs), yielding induced pluripotent stem (iPS) cells with the fastest kinetics, and one of the highest reprogramming efficiencies for a human somatic cell to date. HUVEC-derived iPS (Huv-iPS) cell colonies appeared as early as 6 days after a single KOSM infection, and were generated with a 2.5–3% reprogramming efficiency. Furthermore, when HUVEC reprogramming was performed under hypoxic conditions in the presence of a TGF-beta family signaling inhibitor, colony formation increased an additional ∼2.5-fold over standard conditions. Huv-iPS cells were indistinguishable from human embryonic stem (ES) cells with regards to morphology, pluripotent marker expression, and their ability to generate all embryonic germ layers in vitro and in vivo. The high efficiency and rapid kinetics of Huv-iPS cell formation, coupled with the ease by which HUVECs can be collected, expanded and stored, make these cells an attractive somatic source for therapeutic application, and for studying the reprogramming process. PMID:21603572

  4. Steroid sulfotransferase 2A1 gene transcription is regulated by steroidogenic factor 1 and GATA-6 in the human adrenal.

    PubMed

    Saner, Karla J; Suzuki, Takashi; Sasano, Hironobu; Pizzey, John; Ho, Clement; Strauss, Jerome F; Carr, Bruce R; Rainey, William E

    2005-01-01

    Sulfonation is a phase II conjugation reaction responsible for the biotransformation of many compounds including steroids, bile acids, and drugs. Humans are presently known to express at least five cytosolic sulfotransferase (SULT) enzymes, of which only two are hydroxysteroid SULT, SULT2A1, commonly known as steroid sulfotransferase, and the cholesterol sulfotransferase SULT2B1. SULT2A1 is highly expressed in the adrenal where it is responsible for the sulfation of hydroxysteroids including conversion of dehydroepiandrosterone to dehydroepiandrosterone sulfate and in the liver where it is responsible for sulfation of bile acids and circulating hydroxysteroids. Little is known concerning the transcriptional regulation of human SULT2A1 in adrenal. Herein we demonstrate the role of two transcription factors, steroidogenic factor 1 (SF1) and GATA-6, in the regulation of SULT2A1 transcription. These transcription factors were quantified by real-time RT-PCR in normal human adrenal tissue. Transient transfection assays with deleted and mutated SULT2A1 promoter constructs allowed for the determination of specific SF1 and GATA binding cis-regulatory elements necessary for transactivation of SULT2A1 promoter, and binding was confirmed by EMSA analysis. Both SF1 and GATA-6 were positive regulators of SULT2A1 promoter constructs. These data support the hypothesis that adrenal SULT2A1 expression is regulated by SF1 and GATA-6. PMID:15388788

  5. A human Polycomb isoform lacking the Pc box does not participate to PRC1 complexes but forms protein assemblies and represses transcription.

    PubMed

    Völkel, Pamela; Le Faou, Perrine; Vandamme, Julien; Pira, Dorcas; Angrand, Pierre-Olivier

    2012-05-01

    Polycomb repression controls the expression of hundreds of genes involved in development and is mediated by essentially two classes of chromatin-associated protein complexes. The Polycomb repressive complex 2 (PRC2) trimethylates histone H3 at lysine 27, an epigenetic mark that serves as a docking site for the PRC1 protein complex. Drosophila core PRC1 is composed of four subunits: Polycomb (Pc), Posterior sex combs (Psc), Polyhomeotic (Ph) and Sex combs extra (Sce). Each of these proteins has multiple orthologs in vertebrates, thus generating an enormous scope for potential combinatorial diversity. In particular, mammalian genomes encode five Pc family members: CBX2, CBX4, CBX6, CBX7 and CBX8. To complicate matters further, distinct isoforms might arise from single genes. Here, we address the functional role of the two human CBX2 isoforms. Owing to different polyadenylation sites and alternative splicing events, the human CBX2 locus produces two transcripts: a 5-exon transcript that encodes the 532-amino acid CBX2-1 isoform that contains the conserved chromodomain and Pc box and a 4-exon transcript encoding a shorter isoform, CBX2-2, lacking the Pc box but still possessing a chromodomain. Using biochemical approaches and a novel in vivo imaging assay, we show that the short CBX2-2 isoform lacking the Pc box, does not participate in PRC1 protein complexes, but self-associates in vivo and forms complexes of high molecular weight. Furthermore, the CBX2 short isoform is still able to repress transcription, suggesting that Polycomb repression might occur in the absence of PRC1 formation. PMID:22419124

  6. Generation and characterization of human insulin-releasing cell lines

    PubMed Central

    Labriola, Leticia; Peters, Maria G; Krogh, Karin; Stigliano, Iván; Terra, Letícia F; Buchanan, Cecilia; Machado, Marcel CC; Joffé, Elisa Bal de Kier; Puricelli, Lydia; Sogayar, Mari C

    2009-01-01

    Background The in vitro culture of insulinomas provides an attractive tool to study cell proliferation and insulin synthesis and secretion. However, only a few human beta cell lines have been described, with long-term passage resulting in loss of insulin secretion. Therefore, we set out to establish and characterize human insulin-releasing cell lines. Results We generated ex-vivo primary cultures from two independent human insulinomas and from a human nesidioblastosis, all of which were cultured up to passage number 20. All cell lines secreted human insulin and C-peptide. These cell lines expressed neuroendocrine and islets markers, confirming the expression profile found in the biopsies. Although all beta cell lineages survived an anchorage independent culture, none of them were able to invade an extracellular matrix substrate. Conclusion We have established three human insulin-releasing cell lines which maintain antigenic characteristics and insulin secretion profiles of the original tumors. These cell lines represent valuable tools for the study of molecular events underlying beta cell function and dysfunction. PMID:19545371

  7. Frequent somatic mutations of the transcription factor ATBF1 in human prostate cancer.

    PubMed

    Sun, Xiaodong; Frierson, Henry F; Chen, Ceshi; Li, Changling; Ran, Qimei; Otto, Kristen B; Cantarel, Brandi L; Cantarel, Brandi M; Vessella, Robert L; Gao, Allen C; Petros, John; Miura, Yutaka; Simons, Jonathan W; Dong, Jin-Tang

    2005-04-01

    Cancer often results from the accumulation of multiple genetic alterations. Although most malignancies are sporadic, only a small number of genes have been shown to undergo frequent mutations in sporadic cancers. The long arm of chromosome 16 is frequently deleted in human cancers, but the target gene for this deletion has not been identified. Here we report that ATBF1, which encodes a transcription factor that negatively regulates AFP and MYB but transactivates CDKN1A, is a good candidate for the 16q22 tumor-suppressor gene. We narrowed the region of deletion at 16q22 to 861 kb containing ATBF1. ATBF1 mRNA was abundant in normal prostates but more scarce in approximately half of prostate cancers tested. In 24 of 66 (36%) cancers examined, we identified 22 unique somatic mutations, many of which impair ATBF1 function. Furthermore, ATBF1 inhibited cell proliferation. Hence, loss of ATBF1 is one mechanism that defines the absence of growth control in prostate cancer. PMID:15750593

  8. Transcriptional consequences of schizophrenia candidate miR-137 manipulation in human neural progenitor cells

    PubMed Central

    Hill, Matthew J.; Donocik, Jacek G.; Nuamah, Rosamond A.; Mein, Charles A.; Sainz-Fuertes, Ricardo; Bray, Nicholas J.

    2014-01-01

    MIR137, transcribed as the microRNA miR-137, is one of the leading candidate schizophrenia susceptibility genes to arise from large genome-wide association studies (GWAS) of the disorder. Recent data suggest that miR-137 modulates the expression of other schizophrenia susceptibility genes. Although bioinformatic resources are available with which to predict genes regulated by individual microRNA, there has been a lack of empirical data on genome-wide gene expression changes following miR-137 manipulation. We have therefore performed a genome-wide assessment of transcriptional changes in a human neural progenitor cell line after miR-137 over-expression and inhibition in order to elucidate molecular pathways by which genetic perturbation of miR-137 could promote susceptibility to schizophrenia. Bioinformatically-predicted miR-137 targets showed a small but highly significant down-regulation following miR-137 over-expression. Genes that were significantly down-regulated in association with miR-137 over-expression were enriched for involvement in neuronal differentiation. Differentially expressed genes that were confirmed by qPCR included others at genome-wide significant risk loci for schizophrenia (MAD1L1 and DPYD) and BDNF. These data point to molecular pathways through which genetic variation at the MIR137 locus could confer risk for schizophrenia. PMID:24556472

  9. CpG methylation suppresses transcriptional activity of human syncytin-1 in non-placental tissues

    SciTech Connect

    Matouskova, Magda; Blazkova, Jana; Pajer, Petr; Pavlicek, Adam; Hejnar, Jiri . E-mail: hejnar@img.cas.cz

    2006-04-15

    Syncytin-1 is a captive envelope glycoprotein encoded by one of human endogenous retroviruses W. It is expressed exclusively in the placental trophoblast where it participates in cell-to-cell fusion during differentiation of syncytiotrophobast. In other tissues, however, syncytin-1 expression must be kept in check because inadvertent cell fusion might be dangerous for tissue organization and integrity. We describe here an inverse correlation between CpG methylation of syncytin-1 5' long terminal repeat and its expression. Hypomethylation of the syncytin-1 5' long terminal repeat in the placenta and in the choriocarcinoma-derived cell line BeWo was detected. However, other analyzed primary cells and cell lines non-expressing syncytin-1 contain proviruses heavily methylated in this sequence. CpG methylation of syncytin-1 is resistant to the effect of the demethylating agent 5-azacytidine. The inhibitory role of CpG methylation is further confirmed by transient transfection of in-vitro-methylated syncytin-1 promoter-driven reporter construct. Altogether, we conclude that CpG methylation plays a principal role in the transcriptional suppression of syncytin-1 in non-placental tissues, and, in contrast, demethylation of the syncytin-1 promoter in trophoblast is a prerequisite for its expression and differentiation of multinucleated syncytiotrophoblast.

  10. Ribonucleotide Discrimination and Reverse Transcription by the Human Mitochondrial DNA Polymerase*

    PubMed Central

    Kasiviswanathan, Rajesh; Copeland, William C.

    2011-01-01

    During DNA synthesis, DNA polymerases must select against ribonucleotides, present at much higher levels compared with deoxyribonucleotides. Most DNA polymerases are equipped to exclude ribonucleotides from their active site through a bulky side chain residue that can sterically block the 2′-hydroxyl group of the ribose ring. However, many nuclear replicative and repair DNA polymerases incorporate ribonucleotides into DNA, suggesting that the exclusion mechanism is not perfect. In this study, we show that the human mitochondrial DNA polymerase γ discriminates ribonucleotides efficiently but differentially based on the base identity. Whereas UTP is discriminated by 77,000-fold compared with dTTP, the discrimination drops to 1,100-fold for GTP versus dGTP. In addition, the efficiency of the enzyme was reduced 3–14-fold, depending on the identity of the incoming nucleotide, when it extended from a primer containing a 3′-terminal ribonucleotide. DNA polymerase γ is also proficient in performing single-nucleotide reverse transcription reactions from both DNA and RNA primer terminus, although its bypass efficiency is significantly diminished with increasing stretches of ribonucleotides in template DNA. Furthermore, we show that the E895A mutant enzyme is compromised in its ability to discriminate ribonucleotides, mainly due to its defects in deoxyribonucleoside triphosphate binding, and is also a poor reverse transcriptase. The potential biochemical defects of a patient harboring a disease mutation in the same amino acid (E895G) are discussed. PMID:21778232

  11. Transcriptional profiling of human smooth muscle cells infected with gingipain and fimbriae mutants of Porphyromonas gingivalis.

    PubMed

    Zhang, Boxi; Sirsjö, Allan; Khalaf, Hazem; Bengtsson, Torbjörn

    2016-01-01

    Porphyromonas gingivalis (P. gingivalis) is considered to be involved in the development of atherosclerosis. However, the role of different virulence factors produced by P. gingivalis in this process is still uncertain. The aim of this study was to investigate the transcriptional profiling of human aortic smooth muscle cells (AoSMCs) infected with wild type, gingipain mutants or fimbriae mutants of P. gingivalis. AoSMCs were exposed to wild type (W50 and 381), gingipain mutants (E8 and K1A), or fimbriae mutants (DPG-3 and KRX-178) of P. gingivalis. We observed that wild type P. gingivalis changes the expression of a considerable larger number of genes in AoSMCs compare to gingipain and fimbriae mutants, respectively. The results from pathway analysis revealed that the common differentially expressed genes for AoSMCs infected by 3 different wild type P. gingivalis strains were enriched in pathways of cancer, cytokine-cytokine receptor interaction, regulation of the actin cytoskeleton, focal adhesion, and MAPK signaling pathway. Disease ontology analysis showed that various strains of P. gingivalis were associated with different disease profilings. Our results suggest that gingipains and fimbriae, especially arginine-specific gingipain, produced by P. gingivalis play important roles in the association between periodontitis and other inflammatory diseases, including atherosclerosis. PMID:26907358

  12. Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene

    SciTech Connect

    Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.

    1987-01-01

    DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus.

  13. Transcriptional profiling of human smooth muscle cells infected with gingipain and fimbriae mutants of Porphyromonas gingivalis

    PubMed Central

    Zhang, Boxi; Sirsjö, Allan; Khalaf, Hazem; Bengtsson, Torbjörn

    2016-01-01

    Porphyromonas gingivalis (P. gingivalis) is considered to be involved in the development of atherosclerosis. However, the role of different virulence factors produced by P. gingivalis in this process is still uncertain. The aim of this study was to investigate the transcriptional profiling of human aortic smooth muscle cells (AoSMCs) infected with wild type, gingipain mutants or fimbriae mutants of P. gingivalis. AoSMCs were exposed to wild type (W50 and 381), gingipain mutants (E8 and K1A), or fimbriae mutants (DPG-3 and KRX-178) of P. gingivalis. We observed that wild type P. gingivalis changes the expression of a considerable larger number of genes in AoSMCs compare to gingipain and fimbriae mutants, respectively. The results from pathway analysis revealed that the common differentially expressed genes for AoSMCs infected by 3 different wild type P. gingivalis strains were enriched in pathways of cancer, cytokine-cytokine receptor interaction, regulation of the actin cytoskeleton, focal adhesion, and MAPK signaling pathway. Disease ontology analysis showed that various strains of P. gingivalis were associated with different disease profilings. Our results suggest that gingipains and fimbriae, especially arginine-specific gingipain, produced by P. gingivalis play important roles in the association between periodontitis and other inflammatory diseases, including atherosclerosis. PMID:26907358

  14. Generating a Metal-responsive Transcriptional Regulator to Test What Confers Metal Sensing in Cells.

    PubMed

    Osman, Deenah; Piergentili, Cecilia; Chen, Junjun; Chakrabarti, Buddhapriya; Foster, Andrew W; Lurie-Luke, Elena; Huggins, Thomas G; Robinson, Nigel J

    2015-08-01

    FrmR from Salmonella enterica serovar typhimurium (a CsoR/RcnR-like transcriptional de-repressor) is shown to repress the frmRA operator-promoter, and repression is alleviated by formaldehyde but not manganese, iron, cobalt, nickel, copper, or Zn(II) within cells. In contrast, repression by a mutant FrmRE64H (which gains an RcnR metal ligand) is alleviated by cobalt and Zn(II). Unexpectedly, FrmR was found to already bind Co(II), Zn(II), and Cu(I), and moreover metals, as well as formaldehyde, trigger an allosteric response that weakens DNA affinity. However, the sensory metal sites of the cells' endogenous metal sensors (RcnR, ZntR, Zur, and CueR) are all tighter than FrmR for their cognate metals. Furthermore, the endogenous metal sensors are shown to out-compete FrmR. The metal-sensing FrmRE64H mutant has tighter metal affinities than FrmR by approximately 1 order of magnitude. Gain of cobalt sensing by FrmRE64H remains enigmatic because the cobalt affinity of FrmRE64H is substantially weaker than that of the endogenous cobalt sensor. Cobalt sensing requires glutathione, which may assist cobalt access, conferring a kinetic advantage. For Zn(II), the metal affinity of FrmRE64H approaches the metal affinities of cognate Zn(II) sensors. Counter-intuitively, the allosteric coupling free energy for Zn(II) is smaller in metal-sensing FrmRE64H compared with nonsensing FrmR. By determining the copies of FrmR and FrmRE64H tetramers per cell, then estimating promoter occupancy as a function of intracellular Zn(II) concentration, we show how a modest tightening of Zn(II) affinity, plus weakened DNA affinity of the apoprotein, conspires to make the relative properties of FrmRE64H (compared with ZntR and Zur) sufficient to sense Zn(II) inside cells. PMID:26109070

  15. Generating a Metal-responsive Transcriptional Regulator to Test What Confers Metal Sensing in Cells*

    PubMed Central

    Osman, Deenah; Piergentili, Cecilia; Chen, Junjun; Chakrabarti, Buddhapriya; Foster, Andrew W.; Lurie-Luke, Elena; Huggins, Thomas G.; Robinson, Nigel J.

    2015-01-01

    FrmR from Salmonella enterica serovar typhimurium (a CsoR/RcnR-like transcriptional de-repressor) is shown to repress the frmRA operator-promoter, and repression is alleviated by formaldehyde but not manganese, iron, cobalt, nickel, copper, or Zn(II) within cells. In contrast, repression by a mutant FrmRE64H (which gains an RcnR metal ligand) is alleviated by cobalt and Zn(II). Unexpectedly, FrmR was found to already bind Co(II), Zn(II), and Cu(I), and moreover metals, as well as formaldehyde, trigger an allosteric response that weakens DNA affinity. However, the sensory metal sites of the cells' endogenous metal sensors (RcnR, ZntR, Zur, and CueR) are all tighter than FrmR for their cognate metals. Furthermore, the endogenous metal sensors are shown to out-compete FrmR. The metal-sensing FrmRE64H mutant has tighter metal affinities than FrmR by approximately 1 order of magnitude. Gain of cobalt sensing by FrmRE64H remains enigmatic because the cobalt affinity of FrmRE64H is substantially weaker than that of the endogenous cobalt sensor. Cobalt sensing requires glutathione, which may assist cobalt access, conferring a kinetic advantage. For Zn(II), the metal affinity of FrmRE64H approaches the metal affinities of cognate Zn(II) sensors. Counter-intuitively, the allosteric coupling free energy for Zn(II) is smaller in metal-sensing FrmRE64H compared with nonsensing FrmR. By determining the copies of FrmR and FrmRE64H tetramers per cell, then estimating promoter occupancy as a function of intracellular Zn(II) concentration, we show how a modest tightening of Zn(II) affinity, plus weakened DNA affinity of the apoprotein, conspires to make the relative properties of FrmRE64H (compared with ZntR and Zur) sufficient to sense Zn(II) inside cells. PMID:26109070

  16. The Significance of Microspore Division and Division Symmetry for Vegetative Cell-Specific Transcription and Generative Cell Differentiation.

    PubMed Central

    Eady, C.; Lindsey, K.; Twell, D.

    1995-01-01

    The significance of the onset and symmetry of pollen mitosis I (PMI) for the subsequent differentiation of the vegetative and generative cells was investigated by the in vitro maturation of isolated microspores of transgenic tobacco. Free uninucleate microspores of transgenic plants harboring the vegetative cell (VC)-specific late anther tomato lat52 promoter fused to the [beta]-glucuronidase (gus) gene showed normal asymmetric cell division at PMI and activated the lat52 promoter specifically in the nascent VC during in vitro maturation. In vitro maturation in the presence of high levels of colchicine effectively blocked PMI, resulting in the formation of uninucleate pollen grains in which the lat52 promoter was activated. Furthermore, matured uninucleate pollen grains were capable of germination and pollen tube growth despite the absence of a functional generative cell (GC). Lower levels of colchicine induced symmetric division at PMI, producing two similar daughter cells in which typical GC chromatin condensation was prevented. Similar cultures of transgenic microspores harboring the lat52 promoter driving the expression of a nuclear-targeted GUS fusion protein showed that lat52 promoter activation occurred in both symmetric daughter cells. These results directly demonstrate that division asymmetry at PMI is essential for correct GC differentiation and that activation of VC-specific transcription and functional VC maturation may be uncoupled from cytokinesis at PMI. These results are discussed in relation to models proposed to account for the role and distribution of factors controlling the differing fates of the vegetative and generative cells. PMID:12242352

  17. Humans cannot consciously generate random numbers sequences: Polemic study.

    PubMed

    Figurska, Małgorzata; Stańczyk, Maciej; Kulesza, Kamil

    2008-01-01

    It is widely believed, that randomness exists in Nature. In fact such an assumption underlies many scientific theories and is embedded in the foundations of quantum mechanics. Assuming that this hypothesis is valid one can use natural phenomena, like radioactive decay, to generate random numbers. Today, computers are capable of generating the so-called pseudorandom numbers. Such series of numbers are only seemingly random (bias in the randomness quality can be observed). Question whether people can produce random numbers, has been investigated by many scientists in the recent years. The paper "Humans can consciously generate random numbers sequences..." published recently in Medical Hypotheses made claims that were in many ways contrary to state of art; it also stated far-reaching hypotheses. So, we decided to repeat the experiments reported, with special care being taken of proper laboratory procedures. Here, we present the results and discuss possible implications in computer and other sciences. PMID:17888582

  18. Human teneurin-1 is a direct target of the homeobox transcription factor EMX2 at a novel alternate promoter

    PubMed Central

    2011-01-01

    Background Teneurin-1 is a member of a family of type II transmembrane proteins conserved from C.elegans to vertebrates. Teneurin expression in vertebrates is best studied in mouse and chicken, where the four members teneurin-1 to -4 are predominantly expressed in the developing nervous system in area specific patterns. Based on their distinct, complementary expression a possible function in the establishment of proper connectivity in the brain was postulated. However, the transcription factors contributing to these distinctive expression patterns are largely unknown. Emx2 is a homeobox transcription factor, known to be important for area specification in the developing cortex. A study of Emx2 knock-out mice suggested a role of Emx2 in regulating patterned teneurin expression. Results 5'RACE of human teneurin-1 revealed new alternative untranslated exons that are conserved in mouse and chicken. Closer analysis of the conserved region around the newly identified transcription start revealed promoter activity that was induced by EMX2. Mutation of a predicted homeobox binding site decreased the promoter activity in different reporter assays in vitro and in vivo in electroporated chick embryos. We show direct in vivo binding of EMX2 to the newly identified promoter element and finally confirm that the endogenous alternate transcript is specifically upregulated by EMX2. Conclusions We found that human teneurin-1 is directly regulated by EMX2 at a newly identified and conserved promoter region upstream of the published transcription start site, establishing teneurin-1 as the first human EMX2 target gene. We identify and characterize the EMX2 dependent promoter element of human teneurin-1. PMID:21651764

  19. Transcriptional and post‐transcriptional regulation of monocyte chemoattractant protein‐3 gene expression in human endothelial cells by phorbol ester and cAMP signalling

    PubMed Central

    Kondo, A; Isaji, S; Nishimura, Y; Tanaka, T

    2000-01-01

    Monocyte chemoattractant protein‐3 (MCP‐3) is one of the most broadly active chemokines, potentially inducing chemotaxis of all leucocytic cells. In the present study, we examined the regulation of MCP‐3 mRNA and protein production in endothelial cells by protein kinase C (PKC) activator, phorbol 12‐myristate 13‐acetate (PMA) and cAMP signalling. On stimulation of endothelial cells with 10 nm PMA, MCP‐3 mRNA increased to 300‐fold the basal level at 3 hr and rapidly declined to 0·2‐fold the basal level at 24 hr. PMA‐induced MCP‐3 mRNA and protein production of human endothelial cells were partially inhibited by pretreatment with the adenylate cyclase activator, forskolin, or membrane‐permeable cAMP derivative. The PMA‐induced MCP‐3 mRNA increase was almost abrogated when cells were pretreated with cycloheximide (CHX). Forskolin inhibited the transcription of PMA‐induced MCP‐3 gene expression. Following PMA stimulation for 3 hr, subsequent addition of actinomycin D suppressed the rapid decay of PMA‐induced MCP‐3 mRNA. These results suggest that PMA induces the transcriptional activation of the MCP‐3 gene through de novo protein synthesis and the rapid decay of PMA‐induced MCP‐3 mRNA through de novo synthesis of adenosine/uridine (AU)‐rich element binding proteins and cAMP signalling inhibits the PMA‐induced transcriptional activation of the MCP‐3 gene expression. PMID:10792504

  20. Regulation of human hepatic hydroxysteroid sulfotransferase gene expression by the peroxisome proliferator-activated receptor alpha transcription factor.

    PubMed

    Fang, Hai-Lin; Strom, Stephen C; Cai, Hongbo; Falany, Charles N; Kocarek, Thomas A; Runge-Morris, Melissa

    2005-04-01

    Human hydroxysteroid sulfotransferase or (HUMAN)SULT2A1 catalyzes the sulfonation of procarcinogen xenobiotics, hydroxysteroids, and bile acids and plays a dynamic role in hepatic cholesterol homeostasis. The treatment of primary cultured human hepatocytes with a peroxisome proliferator-activated receptor alpha (PPARalpha)-activating concentration of ciprofibrate (10(-) (4) M) increased (HUMAN)SULT2A1 mRNA, immunoreactive protein, and enzymatic activity levels by approximately 2-fold. By contrast, expression of (RAT)SULT2A3, the rat counterpart to (HUMAN)SULT2A1, was induced by treatment of primary hepatocyte cultures with an activator of the pregnane X receptor, but not PPARalpha. In HepG2 cells, transient transfection analyses of luciferase reporter constructs containing upstream regions of the (HUMAN)SULT2A1 gene implicated a candidate peroxisome proliferator response element (PPRE) at nucleotides (nt) -5949 to -5929 relative to the transcription start site. Site-directed mutagenesis and electrophoretic mobility shift assay studies confirmed that this distal PPRE (dPPRE), a direct repeat nuclear receptor motif containing one intervening nt, represented a functional PPRE. Chromatin immunoprecipitation analysis indicated that the (HUMAN)SULT2A1 dPPRE was also a functional element in the context of the human genome. These data support a major role for the PPARalpha transcription factor in the regulation of hepatic (HUMAN)SULT2A1. Results also indicate that important species differences govern the transactivation of SULT2A gene transcription by nuclear receptors. PMID:15635043

  1. Simulated binding of transcription factors to active and inactive regions folds human chromosomes into loops, rosettes and topological domains

    PubMed Central

    Brackley, Chris A.; Johnson, James; Kelly, Steven; Cook, Peter R.; Marenduzzo, Davide

    2016-01-01

    Biophysicists are modeling conformations of interphase chromosomes, often basing the strengths of interactions between segments distant on the genetic map on contact frequencies determined experimentally. Here, instead, we develop a fitting-free, minimal model: bivalent or multivalent red and green ‘transcription factors’ bind to cognate sites in strings of beads (‘chromatin’) to form molecular bridges stabilizing loops. In the absence of additional explicit forces, molecular dynamic simulations reveal that bound factors spontaneously cluster—red with red, green with green, but rarely red with green—to give structures reminiscent of transcription factories. Binding of just two transcription factors (or proteins) to active and inactive regions of human chromosomes yields rosettes, topological domains and contact maps much like those seen experimentally. This emergent ‘bridging-induced attraction’ proves to be a robust, simple and generic force able to organize interphase chromosomes at all scales. PMID:27060145

  2. Simulated binding of transcription factors to active and inactive regions folds human chromosomes into loops, rosettes and topological domains.

    PubMed

    Brackley, Chris A; Johnson, James; Kelly, Steven; Cook, Peter R; Marenduzzo, Davide

    2016-05-01

    Biophysicists are modeling conformations of interphase chromosomes, often basing the strengths of interactions between segments distant on the genetic map on contact frequencies determined experimentally. Here, instead, we develop a fitting-free, minimal model: bivalent or multivalent red and green 'transcription factors' bind to cognate sites in strings of beads ('chromatin') to form molecular bridges stabilizing loops. In the absence of additional explicit forces, molecular dynamic simulations reveal that bound factors spontaneously cluster-red with red, green with green, but rarely red with green-to give structures reminiscent of transcription factories. Binding of just two transcription factors (or proteins) to active and inactive regions of human chromosomes yields rosettes, topological domains and contact maps much like those seen experimentally. This emergent 'bridging-induced attraction' proves to be a robust, simple and generic force able to organize interphase chromosomes at all scales. PMID:27060145

  3. c-MYC Generates Repair Errors via Increased Transcription of Alternative-NHEJ Factors, LIG3 and PARP1, in Tyrosine Kinase-activated Leukemias

    PubMed Central

    Muvarak, Nidal; Kelley, Shannon; Robert, Carine; Baer, Maria R.; Perrotti, Danilo; Gambacorti-Passerini, Carlo; Civin, Curt; Scheibner, Kara; Rassool, Feyruz

    2015-01-01

    Leukemias expressing the constitutively activated tyrosine kinases (TKs) BCR-ABL1 and FLT3/ITD activate signaling pathways that increase genomic instability through generation of reactive oxygen species (ROS), DNA double-strand breaks (DSBs) and error-prone repair. The non-homologous end-joining (NHEJ) pathway is a major pathway for DSB repair and is highly aberrant in TK-activated-leukemias; an alternative form of NHEJ (ALT-NHEJ) predominates, evidenced by increased expression of DNA ligase IIIα (LIG3) and poly (ADP-ribose) polymerase (PARP1), increased frequency of large genomic deletions, and repair using DNA sequence microhomologies. This study, for the first time, demonstrates that the TK target c-MYC plays a role in transcriptional activation and subsequent expression of LIG3 and PARP1 and contributes to the increased error-prone repair observed in TK-activated leukemias. c-MYC negatively regulates microRNAs miR-150 and miR-22 which demonstrate an inverse correlation with LIG3 and PARP1 expression in primary and cultured leukemia cells and chronic myelogenous leukemia (CML) human patient samples. Notably, inhibition of c-MYC and overexpression of miR-150 and -22 decreases ALT-NHEJ activity. Thus, BCR-ABL1