Science.gov

Sample records for hydrogen deuterium carbon

  1. Cryogenic tritium-hydrogen-deuterium and deuterium-tritium layer implosions with high density carbon ablators in near-vacuum hohlraums

    NASA Astrophysics Data System (ADS)

    Meezan, N. B.; Berzak Hopkins, L. F.; Le Pape, S.; Divol, L.; MacKinnon, A. J.; Döppner, T.; Ho, D. D.; Jones, O. S.; Khan, S. F.; Ma, T.; Milovich, J. L.; Pak, A. E.; Ross, J. S.; Thomas, C. A.; Benedetti, L. R.; Bradley, D. K.; Celliers, P. M.; Clark, D. S.; Field, J. E.; Haan, S. W.; Izumi, N.; Kyrala, G. A.; Moody, J. D.; Patel, P. K.; Ralph, J. E.; Rygg, J. R.; Sepke, S. M.; Spears, B. K.; Tommasini, R.; Town, R. P. J.; Biener, J.; Bionta, R. M.; Bond, E. J.; Caggiano, J. A.; Eckart, M. J.; Gatu Johnson, M.; Grim, G. P.; Hamza, A. V.; Hartouni, E. P.; Hatarik, R.; Hoover, D. E.; Kilkenny, J. D.; Kozioziemski, B. J.; Kroll, J. J.; McNaney, J. M.; Nikroo, A.; Sayre, D. B.; Stadermann, M.; Wild, C.; Yoxall, B. E.; Landen, O. L.; Hsing, W. W.; Edwards, M. J.

    2015-06-01

    High Density Carbon (or diamond) is a promising ablator material for use in near-vacuum hohlraums, as its high density allows for ignition designs with laser pulse durations of <10 ns. A series of Inertial Confinement Fusion (ICF) experiments in 2013 on the National Ignition Facility [Moses et al., Phys. Plasmas 16, 041006 (2009)] culminated in a deuterium-tritium (DT) layered implosion driven by a 6.8 ns, 2-shock laser pulse. This paper describes these experiments and comparisons with ICF design code simulations. Backlit radiography of a tritium-hydrogen-deuterium (THD) layered capsule demonstrated an ablator implosion velocity of 385 km/s with a slightly oblate hot spot shape. Other diagnostics suggested an asymmetric compressed fuel layer. A streak camera-based hot spot self-emission diagnostic (SPIDER) showed a double-peaked history of the capsule self-emission. Simulations suggest that this is a signature of low quality hot spot formation. Changes to the laser pulse and pointing for a subsequent DT implosion resulted in a higher temperature, prolate hot spot and a thermonuclear yield of 1.8 × 1015 neutrons, 40% of the 1D simulated yield.

  2. Cryogenic tritium-hydrogen-deuterium and deuterium-tritium layer implosions with high density carbon ablators in near-vacuum hohlraums

    SciTech Connect

    Meezan, N. B. Hopkins, L. F. Berzak; Pape, S. Le; Divol, L.; MacKinnon, A. J.; Döppner, T.; Ho, D. D.; Jones, O. S.; Khan, S. F.; Ma, T.; Milovich, J. L.; Pak, A. E.; Ross, J. S.; Thomas, C. A.; Benedetti, L. R.; Bradley, D. K.; Celliers, P. M.; Clark, D. S.; Field, J. E.; Haan, S. W.; and others

    2015-06-15

    High Density Carbon (or diamond) is a promising ablator material for use in near-vacuum hohlraums, as its high density allows for ignition designs with laser pulse durations of <10 ns. A series of Inertial Confinement Fusion (ICF) experiments in 2013 on the National Ignition Facility [Moses et al., Phys. Plasmas 16, 041006 (2009)] culminated in a deuterium-tritium (DT) layered implosion driven by a 6.8 ns, 2-shock laser pulse. This paper describes these experiments and comparisons with ICF design code simulations. Backlit radiography of a tritium-hydrogen-deuterium (THD) layered capsule demonstrated an ablator implosion velocity of 385 km/s with a slightly oblate hot spot shape. Other diagnostics suggested an asymmetric compressed fuel layer. A streak camera-based hot spot self-emission diagnostic (SPIDER) showed a double-peaked history of the capsule self-emission. Simulations suggest that this is a signature of low quality hot spot formation. Changes to the laser pulse and pointing for a subsequent DT implosion resulted in a higher temperature, prolate hot spot and a thermonuclear yield of 1.8 × 10{sup 15} neutrons, 40% of the 1D simulated yield.

  3. Energy Levels of Hydrogen and Deuterium

    National Institute of Standards and Technology Data Gateway

    SRD 142 Energy Levels of Hydrogen and Deuterium (Web, free access)   This database provides theoretical values of energy levels of hydrogen and deuterium for principle quantum numbers n = 1 to 200 and all allowed orbital angular momenta l and total angular momenta j. The values are based on current knowledge of the revelant theoretical contributions including relativistic, quantum electrodynamic, recoil, and nuclear size effects.

  4. The hydrogen-deuterium exchange at α-carbon atom in N,N,N-trialkylglycine residue: ESI-MS studies.

    PubMed

    Rudowska, Magdalena; Wojewska, Dominika; Kluczyk, Alicja; Bąchor, Remigiusz; Stefanowicz, Piotr; Szewczuk, Zbigniew

    2012-06-01

    Derivatization of peptides as quaternary ammonium salts (QAS) is a known method for sensitive detection by electrospray ionization tandem mass spectrometry. Hydrogens at α-carbon atom in N,N,N-trialkylglycine residue can be easily exchanged by deuterons. The exchange reaction is base-catalyzed and is dramatically slow at lower pH. Introduced deuterons are stable in acidic aqueous solution and are not back-exchanged during LC-MS analysis. Increased ionization efficiency, provided by the fixed positive charge on QAS group, as well as the deuterium labeling, enables the analysis of trace amounts of peptides. PMID:22403022

  5. The Hydrogen-Deuterium Exchange at α-Carbon Atom in N,N,N-Trialkylglycine Residue: ESI-MS Studies

    NASA Astrophysics Data System (ADS)

    Rudowska, Magdalena; Wojewska, Dominika; Kluczyk, Alicja; Bąchor, Remigiusz; Stefanowicz, Piotr; Szewczuk, Zbigniew

    2012-06-01

    Derivatization of peptides as quaternary ammonium salts (QAS) is a known method for sensitive detection by electrospray ionization tandem mass spectrometry. Hydrogens at α-carbon atom in N, N, N-trialkylglycine residue can be easily exchanged by deuterons. The exchange reaction is base-catalyzed and is dramatically slow at lower pH. Introduced deuterons are stable in acidic aqueous solution and are not back-exchanged during LC-MS analysis. Increased ionization efficiency, provided by the fixed positive charge on QAS group, as well as the deuterium labeling, enables the analysis of trace amounts of peptides.

  6. Deuterium inventory in Tore Supra: Coupled carbon-deuterium balance

    NASA Astrophysics Data System (ADS)

    Pgouri, B.; Panayotis, S.; Languille, P.; Martin, C.; Dittmar, T.; Gauthier, E.; Hatchressian, J.-C.; Pascal, J.-Y.; Roubin, P.; Ruffe, R.; Tsitrone, E.; Vartanian, S.; Wang, H.; Beaut, A.; Bouvet, J.; Brosset, C.; Bucalossi, J.; Cabi, M.; Caprin, E.; Courtois, X.; Dachicourt, R.; Delchambre, E.; Dominici, C.; Douai, D.; Ekedahl, A.; Gunn, J. P.; Hakola, A.; Jacob, W.; Khodja, H.; Likonen, J.; Linez, F.; Litnovsky, A.; Marandet, Y.; Markelj, S.; Martinez, A.; Mayer, M.; Meyer, O.; Monier-Garbet, P.; Moreau, P.; Negrier, V.; Oddon, P.; Pardanaud, C.; Pasquet, B.; Pelicon, P.; Petersson, P.; Philipps, V.; Possnert, G.; Reiter, D.; Roth, J.; Roure, I.; Rubel, M.; Saint-Laurent, F.; Samaille, F.; Vavpeti?, P.

    2013-07-01

    This paper presents an analysis of the carbon-deuterium circulation and the resulting balance in Tore Supra over the period 2002-2007. Carbon balance combines the estimation of carbon gross erosion from spectroscopy, net erosion and deposition using confocal microscopy, lock-in thermography and SEM, and a measure of the amount of deposits collected in the vacuum chamber. Fuel retention is determined from post-mortem (PM) analyses and gas balance (GB) measurements. Special attention was paid to the deuterium outgassed during the nights and weekends of the experimental campaign (vessel under vacuum, Plasma Facing Components at 120 C) and during vents (vessel at atmospheric pressure, PFCs at room temperature). It is shown that this outgassing is the main process reconciling the PM and GB estimations of fuel retention, closing the coupled carbon-deuterium balance. In particular, it explains why the deuterium concentration in deposits decreases with increasing depth.

  7. Hydrogen-deuterium exchange in structural biology

    NASA Astrophysics Data System (ADS)

    Schoenborn, B. P.; Ramakrishnan, V.; Schneider, D.

    1986-03-01

    The large difference in neutron scattering length of hydrogen and deuterium atoms provides a unique tool to study biological macromolecules. These molecules exist in an aqueous environment and have an atomic composition of about 50% hydrogen atoms with the rest being mainly carbon, oxygen and nitrogen. By simply changing the ratio of hydrogen to deuterium the contrast of a sample constituent can be changed without altering the chemical composition. The scattering difference between the hydrogen isotopes has now been used to study structural details of proteins, viruses, nucleic acid protein complexes and membranes. The use of small-angle scattering analysis from proteins in solution is a particularly good example of the power of this new technique. From the first experiments with myoglobin, hemoglobin and TMV solutions in 1968 at the HFBR in Brookhaven it became, however, soon evident that the flux was low and the detection system of a conventional spectrometer was inadequate to measure precisely small differences in the scattering pattern. Since these solution scattering patterns are circularly symmetrical, a development of multidetector systems was the first step to alleviate the need for better data. From an early five detector system [1] the development of linear and two-dimensional position sensitive detectors continues to this day [2-6]. Today, position sensitive area-detectors with an efficiency of 80% and 1.3 mm resolution with an active area of 50 cm × 50 cms are available. These detectors have a counting rate capability of 2 × 10 5 neutrons/s. Other instrumentation developments to facilitate the study of biomolecules include (1) cold moderators, (2) thin film multilayer monochromators [7-9], (3) neutron guides made either of multilayer supermirrors or coated with 58Ni [10,11], (4) various crystal and mirror focusing devices [12,13]. Some of these features have been incorporated in a small-angle neutron spectrometer at the High Flux Beam Reactor at the Brookhaven National Laboratory. This spectrometer has a unique combination of features such as a high resolution area-detector, adjustable wavelength bandwidth and automated sample changer.

  8. Balmer ? transitions in antiprotonic hydrogen and deuterium

    NASA Astrophysics Data System (ADS)

    Gotta, D.; Anagnostopoulos, D. F.; Augsburger, M.; Borchert, G.; Castelli, C.; Chatellard, D.; Egger, J.-P.; El-Khoury, P.; Gorke, H.; Hauser, P.; Indelicato, P.; Kirch, K.; Lenz, S.; Nelms, N.; Rashid, K.; Siems, Th.; Simons, L. M.

    1999-12-01

    The strong-interaction shifts ? and broadenings ? of the 2p levels in antiprotonic hydrogen and deuterium have been measured for the first time with a crystal spectrometer. In hydrogen, the 2 3 P 0 hyperfine state could be resolved from the three close-lying states 2 3 P 2, 2 1 P 1, and 2 3 P 1. The hadronic shift was determined to be ? 2 3 P 0=+13928 meV (attractive). The value found for ? 2 3 P 0=12025 meV is much larger than the spin-averaged 2p-level broadening ?bal2p as determined from earlier experiments measuring the intensity balance. The average shift of the three unresolved states is consistent with zero and a mean broadening of ?2( 3P 2, 1P 1, 3P 1) =389 meV was measured. In deuterium, the spin-averaged hadronic shift and broadening were found to be ?2p=-24326 meV (repulsive) and ?2p=48930 meV.

  9. Deuterium retention in tungsten coating layers irradiated with deuterium and carbon ions

    NASA Astrophysics Data System (ADS)

    Fukumoto, M.; Nakano, T.; Ueda, Y.; Itami, K.; Kubo, H.

    2015-07-01

    The effects of carbon ion fraction on deuterium retention in tungsten coating layers were investigated by irradiating the layers with mixed deuterium and carbon ion beams. The mixed ion beams had atomic carbon fractions of up to 3.2% and the sample temperature was either 500 or 700 K. Graphite was formed in the tungsten coating layer at the both temperatures; however, tungsten carbide and ditungsten carbide were not formed at the both temperatures. At 500 K, deuterium was trapped at intrinsic defects and carbon was accumulated in the tungsten coating layer. At 700 K, although trapping deuterium at intrinsic defects was difficult, deuterium was trapped predominantly at carbon accumulated in the tungsten coating layer. Analysis of deuterium desorption spectrum by multipeak fitting suggests that deuterium was retained by C-D bonds in the tungsten coating layer at 700 K.

  10. Carbon Nanotube Based Deuterium Ion Source for Improved Neutron Generators

    SciTech Connect

    Fink, R. L.; Jiang, N.; Thuesen, L.; Leung, K. N.; Antolak, A. J.

    2009-03-10

    Field ionization uses high electric fields to cause the ionization and emission of ions from the surface of a sharp electrode. We are developing a novel field ionization neutron generator using carbon nanotubes (CNT) to produce the deuterium ion current. The generator consists of three major components: a deuterium ion source made of carbon nanotubes, a smooth negatively-biased target electrode, and a secondary electron suppression system. When a negative high voltage is applied on the target electrode, a high gradient electric field is formed at the tips of the carbon nanotubes. This field is sufficiently strong to create deuterium (D) ions at or near the nanotubes which are accelerated to the target causing D-D reactions to occur and the production of neutrons. A cross magnetic field is used to suppress secondary emission electrons generated on the target surface. We have demonstrated field ionization currents of 70 nA (1 {mu}A/cm{sup 2}) at hydrogen gas pressure of 10 mTorr. We have found that the current scales proportionally with CNT area and also with the gas pressure in the range of 1 mTorr to 10 mTorr. We have demonstrated pulse cut-off times as short as 2 {mu}sec. Finally, we have shown the feasibility of generating neutrons using deuterium gas.

  11. Diffusion of muonic deuterium and hydrogen atoms

    SciTech Connect

    Abbott, D.J.; Chen, G.F.; Guss, P.; Hancock, A.D.; Kraiman, J.B.; Siegel, R.T.; Vulcan, W.F.; Viel, D.W.; Welsh, R.E.; Petitjean, C.; Zehnder, A.; Breunlich, W.H.; Cargnelli, M.; Kammel, P.; Scrinzi, A.; Marton, J.; Zmeskal, J.; Reidy, J.J.; Woolverton, H.L.; Hartmann, F.J.; Adamczak, A.; Markushin, V.E.; Melezhik, V.S.

    1997-01-01

    Diffusion of muonic deuterium {mu}d and muonic hydrogen {mu}p atoms produced following the stopping of negative muons in D{sub 2} or H{sub 2} at 300 K was studied at pressures of 47{endash}750 mbar (H{sub 2}) and 94{endash}1520 mbar (D{sub 2}) in two distinct target geometries. Time intervals were recorded between entry of negative muons into the gas and arrival of each resulting {mu}d or {mu}p atom at one of 50 foils immersed in the gas, and spaced regularly along the muon beam axis. The results of such measurements were fitted to time distributions generated by Monte Carlo methods, using theoretical scattering predictions and empirically chosen forms for the initial energy distributions of the muonic atoms in the 1S state. Results indicate muonic atom energy distributions which (a) are different for {mu}d and {mu}p and (b) vary with pressure. The best-fit energy distributions have mean energies ranging from 1.5 eV for {mu}d at 94 mbar to {ge}9 eV for {mu}p at 750 mbar. The data are also sensitive to scattering cross sections for {mu}d and {mu}p, and are consistent with current theoretical calculations for the {mu}d+D{sub 2} cross sections. In the case of {mu}p+H{sub 2} scattering, the experimental data suggest discrepancies with the theoretical predictions. {copyright} {ital 1997} {ital The American Physical Society}

  12. The deuterium content of atmospheric molecular hydrogen

    NASA Astrophysics Data System (ADS)

    Gerst, Steven Gregory

    2000-09-01

    A new technique for the separation of molecular hydrogen (H2) from air and the determination of its deuterium (D) content is presented. A high-pressure air sample in an aluminum cylinder is condensed at -196C, whereby H2 contained in the air sample is enriched in the gaseous headspace above the liquefied air. The H2-enriched headspace is bled into a vacuum extraction line where the H2 is oxidized to H2O for cryogenic isolation from the air stream. The captured water is reduced back to H2 for determination of its D/H ratio via isotope-ratio mass spectrometry (?D is reported in permil () vs. Vienna Standard Mean Ocean Water, where ?D = ((D/H)sample/(D/H) VSMOW - 1)*1000). Air samples for ?D analyses were collected in November-December 1998 on a transect from Seattle, WA, 48N, to McMurdo, Antarctica, 71S (n = 19), and over a two-year interval on the Washington Coast, 48N (n = 11), and Point Barrow, AK, 71N (n = 6). Results indicate that the average ?D of global atmospheric H2 is +130 +/- 4, with average ?D values of +123 +/- 3 and +138 +/- 8 in the northern and southern hemispheres, respectively. Comparison of background and polluted samples in the Seattle area indicate the ?D of H2 produced by anthropogenic activities (e.g. automobiles) is -1961 +/- 10. Laboratory combustion studies of pine needles and pine branches indicate that the ?D of H2 emitted during biomass burning is -293 +/- 60. The results of field experiments (n = 6) using a large chamber to isolate a volume of air in contact with soil imply that the H2 removed during soil uptake has a ?D value 57 +/- 24 lower than that of atmospheric H2. The constraints that these preliminary isotopic measurements place on the global H2 budget are limited by the unmeasured isotopic composition of photochemically produced H2, ?Dh?. However, the global H2 isotope balance implies that the average global value of ?Dh? must be +130, and this value is demonstrated to be plausible. Therefore, it is concluded that the available isotopic measurements are not in disagreement with the global H2 budget, as had been previously suggested.

  13. Deuterium Uptake in Magnetic-Fusion Devices with Lithium-Conditioned Carbon Walls

    SciTech Connect

    Krstic, Predrag S.; Allain, J. P.; Taylor, C. N.; Dadras, J.; Morokuma, K.; Jakowski, J.; Allouche, A.; Skinner, C. H.

    2013-01-01

    Lithium wall conditioning has lowered hydrogenic recycling and dramatically improved plasma performance in many magnetic-fusion devices. In this Letter, we report quantum-classical atomistic simulations and laboratory experiments that elucidate the roles of lithium and oxygen in the uptake of hydrogen in amorphous carbon. Surprisingly, we show that lithium creates a high oxygen concentration on a carbon surface when bombarded by deuterium. Furthermore, surface oxygen, rather than lithium, plays the key role in trapping hydrogen.

  14. Heterogeneous Catalysis: Deuterium Exchange Reactions of Hydrogen and Methane

    ERIC Educational Resources Information Center

    Mirich, Anne; Miller, Trisha Hoette; Klotz, Elsbeth; Mattson, Bruce

    2015-01-01

    Two gas phase deuterium/hydrogen exchange reactions are described utilizing a simple inexpensive glass catalyst tube containing 0.5% Pd on alumina through which gas mixtures can be passed and products collected for analysis. The first of these exchange reactions involves H[subscript 2] + D[subscript 2], which proceeds at temperatures as low as 77…

  15. Heterogeneous Catalysis: Deuterium Exchange Reactions of Hydrogen and Methane

    ERIC Educational Resources Information Center

    Mirich, Anne; Miller, Trisha Hoette; Klotz, Elsbeth; Mattson, Bruce

    2015-01-01

    Two gas phase deuterium/hydrogen exchange reactions are described utilizing a simple inexpensive glass catalyst tube containing 0.5% Pd on alumina through which gas mixtures can be passed and products collected for analysis. The first of these exchange reactions involves H[subscript 2] + D[subscript 2], which proceeds at temperatures as low as 77

  16. Ordered ground states of metallic hydrogen and deuterium

    NASA Technical Reports Server (NTRS)

    Ashcroft, N. W.

    1981-01-01

    The physical attributes of some of the more physically distinct ordered states of metallic hydrogen and metallic deuterium at T = 0 and nearby are discussed. The likelihood of superconductivity in both is considered with respect to the usual coupling via the density fluctuations of the ions.

  17. Laser-driven polarized sources of hydrogen and deuterium

    SciTech Connect

    Young, L.; Holt, R.J.; Green, M.C.; Kowalczyk, R.S.

    1988-01-01

    A novel laser-driven polarized source of hydrogen and deuterium which operates on the principle of spin exchange optical pumping is described. The advantages of this method over conventional polarized sources for internal target experiments are presented. Technological difficulties which prevent ideal source operation are outlined along with proposed solutions. At present, the laser-driven polarized hydrogen source delivers 8 /times/ 10/sup 16/ atoms/s with a polarization (P/sub z/) of 24%. 9 refs., 2 figs.

  18. Equations of state for hydrogen and deuterium.

    SciTech Connect

    Kerley, Gerald Irwin

    2003-12-01

    This report describes the complete revision of a deuterium equation of state (EOS) model published in 1972. It uses the same general approach as the 1972 EOS, i.e., the so-called 'chemical model,' but incorporates a number of theoretical advances that have taken place during the past thirty years. Three phases are included: a molecular solid, an atomic solid, and a fluid phase consisting of both molecular and atomic species. Ionization and the insulator-metal transition are also included. The most important improvements are in the liquid perturbation theory, the treatment of molecular vibrations and rotations, and the ionization equilibrium and mixture models. In addition, new experimental data and theoretical calculations are used to calibrate certain model parameters, notably the zero-Kelvin isotherms for the molecular and atomic solids, and the quantum corrections to the liquid phase. The report gives a general overview of the model, followed by detailed discussions of the most important theoretical issues and extensive comparisons with the many experimental data that have been obtained during the last thirty years. Questions about the validity of the chemical model are also considered. Implications for modeling the 'giant planets' are also discussed.

  19. Lifetimes of Hydrogen and Deuterium Related Vibrational Modes in Silicon

    SciTech Connect

    Budde, M.; Luepke, G.; Chen, E; Zhang, X.; Tolk, N. H.; Feldman, L. C.; Tarhan, E.; Ramdas, A. K.; Stavola, M.

    2001-10-01

    Lifetimes of hydrogen and deuterium related stretch modes in Si are measured by high-resolution infrared absorption spectroscopy and transient bleaching spectroscopy. The lifetimes are found to be extremely dependent on the defect structure, ranging from 2 to 295 ps. Against conventional wisdom, we find that lifetimes of Si-D modes typically are longer than for the corresponding Si-H modes. The potential implications of the results on the physics of electronic device degradation are discussed.

  20. Reactivity of TiO 2 with hydrogen and deuterium

    NASA Astrophysics Data System (ADS)

    Yang, Y.; Sushchikh, M.; Mills, G.; Metiu, H.; McFarland, E.

    2004-05-01

    The reactivity of rutile phase TiO 2 (1 1 0) and polycrystalline anatase surfaces with molecular and ionized deuterium and hydrogen was investigated. Thermal Desorption Spectroscopy (TDS), following exposure to more than 100 kL of molecular deuterium, showed a D 2 desorption peak at ˜440 K on both single crystal rutile and polycrystalline anatase surfaces. The desorption peak was observed following exposure only at surface temperatures between 140-270 K. Ionized D 2 is significantly more reactive with the titania surface and two desorption peaks at 380 K and ˜550 K were observed together with a small D 2O peak observed at ˜440 K. Dosing the surfaces with hydrogen and deuterium either in succession or as a mixture showed HD desorption with no change in the desorption peaks, consistent with dissociative adsorption of both ionized and molecular species. The experimental data was compared to Density Functional Theory calculations and modeled as a two-step process of hydrogen dissociation at oxygen vacancy sites on TiO 2.

  1. HYDROGEN AND DEUTERIUM NMR OF SOLIDS BY MAGIC ANGLE SPINNING

    SciTech Connect

    Eckman, R.R.

    1982-10-01

    The nuclear magnetic resonance of solids has long been characterized by very large spectral broadening which arises from internuclear dipole-dipole coupling or the nuclear electric quadrupole interaction. These couplings can obscure the smaller chemical shift interaction and make that information unavailable. Two important and difficult cases are that of hydrogen and deuterium. For example, the homonuclear dipolar broadening, HD, for hydrogen is usually several tens of kilohertz. For deuterium, HD is relatively small; however, the quadrupole interaction causes a broadening which can be hundreds of kilohertz in polycrystalline or amorphous solids. The development of cross polarization, heteronuclear radiofrequency decoupling, and coherent averaging of nuclear spin interactions has provided measurement of chemical shift tensors in solids. Recently, double quantum NMR and double quantum decoupling have led to measurement of deuterium and proton chemical shift tensors, respectively. A general problem of these experiments is the overlapping of the tensor powder pattern spectra of magnetically distinct sites which cannot be resolved. In this work, high resolution NMR of hydrogen and deuterium in solids is demonstrated. For both nuclei, the resonances are narrowed to obtain liquid-like isotropic spectra by high frequency rotation of the sample about an axis inclined at the magic angle, {beta}{sub m} = Arccos(3{sup -1/2}), with respect to the direction of the external magnetic field. Two approaches have been developed for each nucleus. For deuterium, the powder spectra were narrowed by over three orders of magnitude by magic angle rotation with precise control of {beta}. A second approach was the observation of deuterium double quantum transitions under magic angle rotation. For hydrogen, magic angle rotation alone could be applied to obtain the isotropic spectrum when H{sub D} was small. This often occurs naturally when the nuclei are semi-dilute or involved in internal motion. In the general case of large H{sub D}, isotropic spectra were obtained by dilution of {sup 1}H with {sup 2}H combined with magic angle rotation. The resolution obtained represents the practical limit for proton NMR of solids. Theoretical and technical aspects are described in the text with comments on the application of the principles to other nuclei of interest.

  2. Measurement of the ratio of hydrogen to deuterium at the KSTAR 2009 experimental campaign

    SciTech Connect

    Kwak, Jong-Gu; Wang, Son Jong; Kim, Sun Ho; Park, Jae Min; Na, Hoon Kyun

    2010-10-15

    The control of the ratio of hydrogen to the deuterium is one of the very important issues for ion cyclotron range of frequency (ICRF) minority heating as well as the plasma wall interaction in the tokamak. The ratio of hydrogen to deuterium during the tokamak shot was deduced from the emission spectroscopy measurements during the KSTAR 2009 experimental campaign. Graphite tiles were used for the plasma facing components (PFCs) at KSTAR and its surface area exposed to the plasma was about 11 m{sup 2}. The data showed that it remained as high as around 50% during the campaign period because graphite tiles were exposed to the air for about two months and the hydrogen contents at the tiles are not fully pumped out due to the lack of baking on the PFC in the 2009 campaign. The validation of the spectroscopy method was checked by using the Zeeman effects and the ratio of hydrogen to the deuterium is compared with results from the residual gas analysis. During the tokamak shot, the ratio is low below 10% initially and saturated after around 1 s. When there is a hydrogen injection to the vessel via ion cyclotron wall conditioning and the boronization process where the carbone is used, the ratio of the hydrogen to the deuterium is increased by up to 100% and it recovers to around 50% after one day of operation. However it does not decrease below 50% at the end of the experimental campaign. It was found that the full baking on the PFC (with a high temperature and sufficient vacuum pumping) is required for the ratio control which guarantees the efficient ICRF heating at the KSTAR 2010 experimental campaign.

  3. Excited state muon transfer in hydrogen/deuterium mixtures

    SciTech Connect

    Lauss, B.; Ackerbauer, P.; Breunlich, W.H.; Gartner, B.; Jeitler, M.; Kammel, P.; Marton, J.; Prymas, W.; Zmeskal, J.; Chatellard, D.; Egger, J.; Jeannet, E.; Daniel, H.; Kosak, A.; Hartmann, F.J.; Petitjean, C.

    1996-06-01

    We report the first direct observation of excited state muon transfer in hydrogen/deuterium mixtures by direct measurement of {ital q}{sub 1{ital s}}, the probability that a {mu}{ital p} atom, which is initially formed in an excited state, reaches the 1{ital s} ground state. The dependence of {ital q}{sub 1{ital s}} on deuterium concentration {ital c}{sub {ital d}} was measured for two different densities at cryogenic temperatures using charge coupled devices to detect the muonic x rays. First results based on the analysis of the {ital K}{sub {alpha}} lines of the two isotopes are presented. {copyright} {ital 1996 The American Physical Society.}

  4. The pion nucleon scattering lengths from pionic hydrogen and deuterium

    NASA Astrophysics Data System (ADS)

    Schröder, H.-Ch.; Badertscher, A.; Goudsmit, P. F. A.; Janousch, M.; Leisi, H. J.; Matsinos, E.; Sigg, D.; Zhao, Z. G.; Chatellard, D.; Egger, J.-P.; Gabathuler, K.; Hauser, P.; Simons, L. M.; Rusi El Hassani, A. J.

    2001-07-01

    This is the final publication of the ETH Zurich Neuchâtel PSI collaboration on the pionic hydrogen and deuterium precision X-ray experiments. We describe the recent hydrogen 3 p 1 s measurement, report on the determination of the Doppler effect correction to the transition line width, analyze the deuterium shift measurement and discuss implications of the combined hydrogen and deuterium results. From the pionic hydrogen 3 p 1 s transition experiments we obtain the strong-interaction energy level shift \\varepsilon_{1s} = -7.108±0.013 (stat.)±0.034 (syst.) eV and the total decay width Γ_{1s} = 0.868±0.040 (stat.)±0.038 (syst.) eV of the 1s state. Taking into account the electromagnetic corrections we find the hadronic π N s-wave scattering amplitude a_{π-prightarrowπ-p} = 0.0883±0.0008 m_{π}^{-1} for elastic scattering and a_{π-prightarrowπ0n} = -0.128±0.006 m_{π} ^{-1} for single charge exchange, respectively. We then combine the pionic hydrogen results with the 1 s level shift measurement on pionic deuterium and test isospin symmetry of the strong interaction: our data are still compatible with isospin symmetry. The isoscalar and isovector π N scattering lengths (within the framework of isospin symmetry) are found to be b_0 = -0.0001^{+0.0009}_{-0.0021} m_{π}^{-1} and b1 = -0.0885^{+0.0010}_{-0.0021} m_{π} ^{-1}, respectively. Using the GMO sum rule, we obtain from b_1 a new value of the π N coupling constant (g_{π N} = 13.21_{-0.05}^{+0.11}) from which follows the Goldberger Treiman discrepancy Δ_{{GT}} =0.027_{-0.008}^{+0.012}. The new values of b_0 and g_{π N} imply an increase of the nucleon sigma term by at least 9 MeV.

  5. Deuterium-Labeling Study of the Hydrogenation of 2-Methylfuran and 2,5-Dimethylfuran over Carbon-Supported Noble Metal Catalysts.

    PubMed

    Kang, Jungshik; Vonderheide, Anne; Guliants, Vadim V

    2015-09-21

    2-Methylfuran and 2,5-dimethylfuran were deuterated over Pd and Pt catalysts at 90-220?C. Furan ring saturation over a Pd/C catalyst occurred at low reaction temperatures, which led to deuterated THFs, followed by progressive D exchange in the THF ring at higher temperatures. Finally, H/D exchange occurred in the methyl groups on the THF ring. Cleavage of the C-O bond also occurred over a Pd/C catalyst at elevated temperatures, which resulted in deuterated ketones, for which all H atoms were exchanged for D. Alcohols were produced over a Pt/C catalyst at low temperatures because they are more stable than the corresponding ketones. D replaced H on all carbon atoms of the furan ring and saturated the O and C atoms of the broken C-O bond in both deuterated 2-pentanol and 2-hexanol. At low temperatures (90-105?C), all H atoms in the deuterated alcohols were exchanged for D except for the last two hydrogen atoms on the methyl groups. PMID:26373360

  6. Diffusion of hydrogen and deuterium in Zr-Al

    SciTech Connect

    Knize, R.J.; Cecchi, J.L.

    1982-10-01

    Optimization of getter performance necessitates a detailed understanding of the getter operation for a variety of experimental parameters, including pressure, temperature, getter mass, and getter thickness. For pumping at low pressures or during slow desorption, the getter operation will be dependent primarily on surface kinetics, which have been described previously. During pumping at higher pressures or during rapid desorption, bulk diffusion may play an important role. In this paper we present the first measurements of the diffusivities of hydrogen (D/sub H/) and deuterium (D/sub D/) in Zr-Al as determined from detailed analysis of desorption.

  7. Infrared spectroscopy of solid hydrogen sulfide and deuterium sulfide.

    PubMed

    Fathe, Kristin; Holt, Jennifer S; Oxley, Susan P; Pursell, Christopher J

    2006-09-21

    The infrared spectra of solid hydrogen sulfide (H2S) and deuterium sulfide (D2S) were collected at very low temperatures. Vapor deposition of thin films at the lowest temperature of 10 K produced amorphous solids while deposition at 70 K yielded the crystalline phase III. Infrared interference fringe patterns produced by the films during deposition were used to determine the film thickness. Careful measurement of the integrated absorbance peaks, along with the film thickness, allowed determination of the integrated band intensities. This report represents the first complete presentation of the infrared spectra of the amorphous solids. Observations of peaks near 3.915 and 1.982 microm (ca. 2554 and 5045 cm(-1), respectively) may be helpful in the conclusive identification of solid hydrogen sulfide on the surface of Io, a moon of Jupiter. PMID:16970373

  8. Diffusion of hydrogen, deuterium, and tritium in niobium

    SciTech Connect

    Matusiewicz, Gerald Robert

    1981-01-01

    The diffusion of hydrogen in niobium was investigated over the temperature range 148 to 500 degrees Kelvin, using measurements of the elastic after effect caused by long range diffusion (the Gorsky Effect). Relaxation curves for pure annealed niobium were generally not of the single exponential form expected from the Gorsky Effect theory, but were described well by a sum of two exponential curves with different amplitudes and relaxation times. The effects of oxygen and nitrogen interstitials on the diffusion were studied and were not in agreement with conventional trapping models. Deuterium and tritium diffusion in niobium were also studied, and a non-classical isotope effect was observed. Hydrogen diffusion coefficients in several Nb-Ta alloys were measured, and the diffusivity in all these alloys exhibited a non-Arrhenius temperature dependence. Experimental results were compared to several models for diffusion and trapping. A model is presented which can account for the form of the relaxation curves observed in pure, annealed niobium.

  9. A laser-driven source of polarized hydrogen and deuterium

    SciTech Connect

    Young, L.; Holt, R.J.; Gilman, R.A.; Kowalczyk, R.; Coulter, K.

    1989-01-01

    A novel laser-driven polarized source of hydrogen and deuterium which operates on the principle of spin-exchange optical pumping is being developed. This source is designed to operate as an internal target in an electron storage ring for fundamental studies of spin-dependent structure of nuclei. It has the potential to exceed the flux from existing conventional sources (3 /times/ 10/sup 16//s) by an order of magnitude. Currently, the source delivers hydrogen at a flux of 8 /times/ 10/sup 16/ atoms/s with an atomic polarization of 24% and deuterium at 6 /times/ 10/sup 16/ atoms/s with a polarization of 29%. Technical obstacles which have been overcome, with varying degrees of success are complete Doppler-coverage in the optical-pumping stage without the use of a buffer gas, wall-induced depolarization and radiation-trapping. Future improvements should allow achievement of the design goals of 4 /times/ 10/sup 17/ atoms/s with a polarization of 50%. 8 refs., 2 figs.

  10. Experimental results of hydrogen distillation at the low power cryogenic column for the production of deuterium depleted hydrogen

    SciTech Connect

    Alekseev, I.; Fedorchenko, O.; Kravtsov, P.; Vasilyev, A.; Vznuzdaev, M.

    2008-07-15

    The Deuterium Removal Unit (DRU) has been designed and built at the Petersburg Nuclear Physics Inst. (PNPI) to produce isotopically pure hydrogen with deuterium content less than 1 ppm. The cryogenic distillation column of 2.2 cm inner diameter and 155 cm packing height is the main element of the DRU. Column performances at different hydrogen distillation operating modes have been measured. The height equivalent to theoretical plate (HETP) for the column is 2.2 cm and almost constant over a wide range of vapour flow rates. Deuterium depleted hydrogen with a deuterium content of less than 0.1 ppm was produced in required quantity. (authors)

  11. Modeling the Extreme Deuterium Enrichment in Stratospheric Hydrogen

    NASA Astrophysics Data System (ADS)

    McCarthy, M. C.; Connell, P.; Boering, K. A.

    2003-12-01

    Observations of the isotopic composition of molecular hydrogen in whole air samples collected by the NASA ER-2 aircraft showed extreme enrichment in deuterium of up to 440 per mil on the V-SMOW isotope scale [Rahn et al., Nature, 2003]. In this study, we use the Lawrence Livermore National Laboratory 2D model to investigate the extreme deuterium enrichment in stratospheric H2 and find that kinetic isotope effects (KIEs) in the oxidation of H2 in the stratosphere account for over 60% of the enrichment while production of heavy H2 from CH4 oxidation accounts for the remainder. The sensitivity of the H2 isotopic composition to uncertainties in the CH4 oxidation pathway branching ratios, formaldehyde oxidation KIEs, formaldehyde photolysis isotope effects, and the H2 oxidation KIEs is explored, and recommendations for needed laboratory and field measurements based on these model sensitivities are given. Finally, we investigate the global H2 isotope budget using model estimates of ? D-H2 produced from CH4 oxidation in both the stratosphere and troposphere.

  12. Pion Electroproduction form Helium 3, Deuterium, and Hydrogen

    SciTech Connect

    S. Avery

    2002-05-01

    A series of measurements for pion electroproduction from helium-3, deuterium, and hydrogen were completed at the Thomas Jefferson National Accelerator Facility by the NucPi Collaboration. E91003 began taking data in February 1998 and was completed in April 1998. The longitudinal and transverse parts of the differential cross section were extracted, by means of a Rosenbluth type separation, in the direction parallel to the virtual photon, at Q 2 = 0.4 GeV 2 , for W = 1.15 and W = 1.6 GeV. The mass dependence of the longitudinal cross section should provide insight into the surprising apparent absence of any significant cross section enhancement due to excess pions in the nuclear medium.

  13. Ion Mobility Spectrometry-Hydrogen Deuterium Exchange Mass Spectrometry of Anions: Part 3. Estimating Surface Area Exposure by Deuterium Uptake

    NASA Astrophysics Data System (ADS)

    Khakinejad, Mahdiar; Ghassabi Kondalaji, Samaneh; Donohoe, Gregory C.; Valentine, Stephen J.

    2015-11-01

    Gas-phase hydrogen deuterium exchange (HDX), collision cross section (CCS) measurement, and molecular dynamics simulation (MDS) techniques were utilized to develop and compare three methods for estimating the relative surface area exposure of separate peptide chains within bovine insulin ions. Electrosprayed [M - 3H]3- and [M - 5H]5- insulin ions produced a single conformer type with respective collision cross sections of 528 5 2 and 808 2 2. [M - 4H]4- ions were comprised of more compact (? = 676 3 2) and diffuse (i.e., more elongated, ? = 779 3 2) ion conformer types. Ions were subjected to HDX in the drift tube using D2O as the reagent gas. Collision-induced dissociation was used to fragment mobility-selected, isotopically labeled [M - 4H]4- and [M - 5H]5- ions into the protein subchains. Deuterium uptake levels of each chain can be explained by limited inter-chain isotopic scrambling upon collisional activation. Using nominal ion structures from MDS and a hydrogen accessibility model, the deuterium uptake for each chain was correlated to its exposed surface area. In separate experiments, the per-residue deuterium content for the protonated and deprotonated ions of the synthetic peptide KKDDDDDIIKIIK were compared. The differences in deuterium content indicated the regional HDX accessibility for cations versus anions. Using ions of similar conformational type, this comparison highlights the complementary nature of HDX data obtained from positive- and negative-ion analysis.

  14. Ion Mobility Spectrometry-Hydrogen Deuterium Exchange Mass Spectrometry of Anions: Part 3. Estimating Surface Area Exposure by Deuterium Uptake.

    PubMed

    Khakinejad, Mahdiar; Ghassabi Kondalaji, Samaneh; Donohoe, Gregory C; Valentine, Stephen J

    2016-03-01

    Gas-phase hydrogen deuterium exchange (HDX), collision cross section (CCS) measurement, and molecular dynamics simulation (MDS) techniques were utilized to develop and compare three methods for estimating the relative surface area exposure of separate peptide chains within bovine insulin ions. Electrosprayed [M - 3H](3-) and [M - 5H](5-) insulin ions produced a single conformer type with respective collision cross sections of 528 5(2) and 808 2(2). [M - 4H](4-) ions were comprised of more compact (? = 676 3(2)) and diffuse (i.e., more elongated, ? = 779 3(2)) ion conformer types. Ions were subjected to HDX in the drift tube using D2O as the reagent gas. Collision-induced dissociation was used to fragment mobility-selected, isotopically labeled [M - 4H](4-) and [M - 5H](5-) ions into the protein subchains. Deuterium uptake levels of each chain can be explained by limited inter-chain isotopic scrambling upon collisional activation. Using nominal ion structures from MDS and a hydrogen accessibility model, the deuterium uptake for each chain was correlated to its exposed surface area. In separate experiments, the per-residue deuterium content for the protonated and deprotonated ions of the synthetic peptide KKDDDDDIIKIIK were compared. The differences in deuterium content indicated the regional HDX accessibility for cations versus anions. Using ions of similar conformational type, this comparison highlights the complementary nature of HDX data obtained from positive- and negative-ion analysis. Graphical Abstract ?. PMID:26620531

  15. Ion Mobility Spectrometry-Hydrogen Deuterium Exchange Mass Spectrometry of Anions: Part 3. Estimating Surface Area Exposure by Deuterium Uptake

    NASA Astrophysics Data System (ADS)

    Khakinejad, Mahdiar; Ghassabi Kondalaji, Samaneh; Donohoe, Gregory C.; Valentine, Stephen J.

    2016-03-01

    Gas-phase hydrogen deuterium exchange (HDX), collision cross section (CCS) measurement, and molecular dynamics simulation (MDS) techniques were utilized to develop and compare three methods for estimating the relative surface area exposure of separate peptide chains within bovine insulin ions. Electrosprayed [M - 3H]3- and [M - 5H]5- insulin ions produced a single conformer type with respective collision cross sections of 528 ± 5 Å2 and 808 ± 2 Å2. [M - 4H]4- ions were comprised of more compact (Ω = 676 ± 3 Å2) and diffuse (i.e., more elongated, Ω = 779 ± 3 Å2) ion conformer types. Ions were subjected to HDX in the drift tube using D2O as the reagent gas. Collision-induced dissociation was used to fragment mobility-selected, isotopically labeled [M - 4H]4- and [M - 5H]5- ions into the protein subchains. Deuterium uptake levels of each chain can be explained by limited inter-chain isotopic scrambling upon collisional activation. Using nominal ion structures from MDS and a hydrogen accessibility model, the deuterium uptake for each chain was correlated to its exposed surface area. In separate experiments, the per-residue deuterium content for the protonated and deprotonated ions of the synthetic peptide KKDDDDDIIKIIK were compared. The differences in deuterium content indicated the regional HDX accessibility for cations versus anions. Using ions of similar conformational type, this comparison highlights the complementary nature of HDX data obtained from positive- and negative-ion analysis.

  16. Thermotransport of hydrogen and deuterium in vanadium, niobium and tantalum alloys

    SciTech Connect

    Smith, M.F.

    1981-10-01

    Heats of transport have been determined for thermotransport of hydrogen and deuterium in pure vanadium, niobium and tantalum; in vanadium alloyed with either niobium, titanium or chromium; and in niobium-tantalum alloys. In all cases, thermotransport was toward colder regions and was significantly greater for deuterium than for hydrogen. A mass spectrometric technique was used to simultaneously measure heats of transport for hydrogen and deuterium in a single specimen containing both isotopes. This technique greatly increased the precision with which isotope effects in the heat of transport could be measured. The predominant effect of alloying was to dramatically increase thermotransport; however, thermotransport decreased as niobium was added to tantalum.

  17. Hydrogen-Deuterium Exchange of Meteoritic Dicarboxylic Acids During Aqueous Extraction

    NASA Technical Reports Server (NTRS)

    Fuller, M.; Huang, Y.

    2002-01-01

    This study examines the extent of hydrogen-deuterium exchange on dicarboxylic acids during aqueous extraction. Deuterium enrichment was observed to be a function of diacid structure as well as delta-D. Additional information is contained in the original extended abstract.

  18. Probing protein ensemble rigidity and hydrogen-deuterium exchange.

    PubMed

    Sljoka, Adnan; Wilson, Derek

    2013-10-01

    Protein rigidity and flexibility can be analyzed accurately and efficiently using the program floppy inclusion and rigid substructure topography (FIRST). Previous studies using FIRST were designed to analyze the rigidity and flexibility of proteins using a single static (snapshot) structure. It is however well known that proteins can undergo spontaneous sub-molecular unfolding and refolding, or conformational dynamics, even under conditions that strongly favor a well-defined native structure. These (local) unfolding events result in a large number of conformers that differ from each other very slightly. In this context, proteins are better represented as a thermodynamic ensemble of 'native-like' structures, and not just as a single static low-energy structure. Working with this notion, we introduce a novel FIRST-based approach for predicting rigidity/flexibility of the protein ensemble by (i) averaging the hydrogen bonding strengths from the entire ensemble and (ii) by refining the mathematical model of hydrogen bonds. Furthermore, we combine our FIRST-ensemble rigidity predictions with the ensemble solvent accessibility data of the backbone amides and propose a novel computational method which uses both rigidity and solvent accessibility for predicting hydrogen-deuterium exchange (HDX). To validate our predictions, we report a novel site specific HDX experiment which characterizes the native structural ensemble of Acylphosphatase from hyperthermophile Sulfolobus solfataricus (Sso AcP). The sub-structural conformational dynamics that is observed by HDX data, is closely matched with the FIRST-ensemble rigidity predictions, which could not be attained using the traditional single 'snapshot' rigidity analysis. Moreover, the computational predictions of regions that are protected from HDX and those that undergo exchange are in very good agreement with the experimental HDX profile of Sso AcP. PMID:24104456

  19. Recombinant Nepenthesin II for Hydrogen/Deuterium Exchange Mass Spectrometry.

    PubMed

    Yang, Menglin; Hoeppner, Morgan; Rey, Martial; Kadek, Alan; Man, Petr; Schriemer, David C

    2015-07-01

    The pitcher secretions of the Nepenthes genus of carnivorous plants contain a proteolytic activity that is very useful for hydrogen/deuterium exchange mass spectrometry (HX-MS). Our efforts to reconstitute pitcher fluid activity using recombinant nepenthesin I (one of two known aspartic proteases in the fluid) revealed a partial cleavage profile and reduced enzymatic stability in certain HX-MS applications. We produced and characterized recombinant nepenthesin II to determine if it complemented nepenthesin I in HX-MS applications. Nepenthesin II shares many properties with nepenthesin I, such as fast digestion at reduced temperature and pH, and broad cleavage specificity, but in addition, it cleaves C-terminal to tryptophan. Neither enzyme reproduces the C-terminal proline cleavage we observed in the natural extract. Nepenthesin II is considerably more resistant to chemical denaturants and reducing agents than nepenthesin I, and it possesses a stability profile that is similar to that of pepsin. Higher stability combined with the slightly broader cleavage specificity makes nepenthesin II a useful alternative to pepsin and a more complete replacement for pitcher fluid in HX-MS applications. PMID:25993527

  20. Dynamic deuterium recycling on tungsten under carbon-deuterium implantation circumstance

    NASA Astrophysics Data System (ADS)

    Taguchi, Tomohisa; Kobayashi, Makoto; Kawasaki, Kiyotaka; Miyahara, Yuto; Ashikawa, Naoko; Sagara, Akio; Yoshida, Naoaki; Miyamoto, Mitsutaka; Ono, Kotaro; Hatano, Yuji; Oya, Yasuhisa; Okuno, Kenji

    2013-07-01

    Dynamics of deuterium recycling, including retention and sputtering behaviors was studied for C+ implanted tungsten. The amount of deuterium trapped by irradiation damages was clearly increased in the C+ implantation sample because the irradiation damages in the C+ implanted sample were formed more than those in the only D2+ implanted one. In addition, the deuterium diffusion toward the bulk would be refrained by the formation of W-C mixed layer, which would work as the deuterium diffusion barrier. The in situ sputtered particle measurement system has been established and revealed that the formation of hydrocarbons such as CD4 was directly observed during D2+ implantation into the C+ implanted tungsten. In the lower deuterium fluence, the CD4 sputtering rate was enhanced with increasing the deuterium fluence. It was considered that the sputtering rate of CD4 would be controlled by the concentration of deuterium on the top surface of the W-C mixed layer.

  1. Longitudinal-Transverse Separations of Structure Functions at Low $Q^2$ for Hydrogen and Deuterium

    SciTech Connect

    V. Tvaskis; M. E. Christy; J. Arrington; R. Asaturyan; O. K. Baker; H. P. Blok; P. Bosted; M. Boswell; A. Bruell; A. Cochran; L. Cole; J. Crowder; J. Dunne; R. Ent; H. C. Fenker; B. W. Filippone; K. Garrow; A. Gasparian; J. Gomez; H.E. Jackson; C. E. Keppel; E. Kinney; Y. Liang; W. Lorenzon; A. Lung; D. J. Mack; J. W. Martin; K. McIlhany; D. Meekins; R. G. Milner; J. H. Mitchell; H. Mkrtchyan; B. Moreland; V. Nazaryan; I. Niculescu; A. Opper; R. B. Piercey; D.H. Potterveld; B. Rose; Y. Sato; W. Seo; G. Smith; K. Spurlock; G. van der Steenhoven; S. Stepanyan; V. Tadevosian; A. Uzzle; W. F. Vulcan; S. A. Wood; B. Zihlmann; V. Ziskin

    2006-11-20

    We report on a study of the longitudinal to transverse cross section ratio, R={sigma}{sub L} {sigma}{sub T}, at low values of x and Q{sup 2}, as determined from inclusive inelastic electron-hydrogen and electron-deuterium scattering data from Jefferson Lab Hall C spanning the four-momentum transfer range 0.06 < Q{sup 2} < 2.8 GeV{sup 2}. Even at the lowest values of Q{sup 2}, R remains nearly constant and does not disappear with decreasing Q{sup 2}, as expected. We find a nearly identical behavior for hydrogen and deuterium.

  2. Computation of hyperfine energies of hydrogen, deuterium and tritium quantum dots

    NASA Astrophysics Data System (ADS)

    Çakır, Bekir; Özmen, Ayhan; Yakar, Yusuf

    2016-01-01

    The hyperfine energies and hyperfine constants of the ground and excited states of hydrogen, deuterium and tritium quantum dots(QDs) are calculated. Quantum genetic algorithm (QGA) and Hartree-Fock-Roothaan (HFR) methods are employed to calculate the unperturbed wave functions and energy eigenvalues. The results show that in the medium and strong confinement regions the hyperfine energy and hyperfine constant are strongly affected by dot radius, impurity charge, electron spin orientation, impurity spin and impurity magnetic moment. Besides, in all dot radii, the hyperfine splitting and hyperfine constant of the confined hydrogen and tritium atoms are approximately equivalent to each other and they are greater than the confined deuterium atom.

  3. Measurement of the nuclear polarization of hydrogen and deuterium molecules using a Lamb-shift polarimeter

    SciTech Connect

    Engels, Ralf Gorski, Robert; Grigoryev, Kiril; Mikirtychyants, Maxim; Rathmann, Frank; Seyfarth, Hellmut; Ströher, Hans; Weiss, Philipp; Kochenda, Leonid; Kravtsov, Peter; Trofimov, Viktor; Tschernov, Nikolay; Vasilyev, Alexander; Vznuzdaev, Marat; Schieck, Hans Paetz gen.

    2014-10-15

    Lamb-shift polarimeters are used to measure the nuclear polarization of protons and deuterons at energies of a few keV. In combination with an ionizer, the polarization of hydrogen and deuterium atoms was determined after taking into account the loss of polarization during the ionization process. The present work shows that the nuclear polarization of hydrogen or deuterium molecules can be measured as well, by ionizing the molecules and injecting the H{sub 2}{sup +} (or D{sub 2}{sup +}) ions into the Lamb-shift polarimeter.

  4. Hydrogen/deuterium exchange on aromatic rings during atmospheric pressure chemical ionization mass spectrometry.

    PubMed

    Davies, Noel W; Smith, Jason A; Molesworth, Peter P; Ross, John J

    2010-04-15

    It has been demonstrated that substituted indoles fully labelled with deuterium on the aromatic ring can undergo substantial exchange back to partial and even fully protonated forms during atmospheric pressure chemical ionisation (APCI) liquid chromatography/mass spectrometry (LC/MS). The degree of this exchange was strongly dependent on the absolute quantity of analyte, the APCI desolvation temperature, the nature of the mobile phase, the mobile phase flow rate and the instrument used. Hydrogen/deuterium (H/D) exchange on several other aromatic ring systems during APCI LC/MS was either undetectable (nitrobenzene, aniline) or extremely small (acetanilide) compared to the effect observed for substituted indoles. This observation has major implications for quantitative assays using deuterium-labelled internal standards and for the detection of deuterium-labelled products from isotopically labelled feeding experiments where there is a risk of back exchange to the protonated form during the analysis. PMID:20213724

  5. The ground state properties of spin-aligned atomic hydrogen, deuterium, and tritium

    NASA Technical Reports Server (NTRS)

    Etters, R. D.; Dugan, J. V., Jr.; Palmer, R. W.

    1975-01-01

    The internal energy, pressure, and compressibility of ground-state, spin-aligned atomic hydrogen, deuterium, and tritium are calculated assuming that all pair interactions occur via the atomic triplet (spin-aligned) potential. The conditions required to obtain atomic hydrogen and its isotopes in bulk are discussed; such a development would be of value in propulsion systems because of the light mass and energetic recombination of atomic hydrogen. Results show that atomic triplet hydrogen and deuterium remain gaseous at 0 K, and that tritium forms a liquid with a binding energy of approximately -0.75 K per atom at a molar volume of 130 cu cm per mole. The pair distribution function for these systems is calculated, and the predicted superfluid behavior of atomic triplet hydrogen and tritium is briefly discussed.

  6. Deuterium inventory in Tore Supra: Contribution of carbon deposits outgassing

    NASA Astrophysics Data System (ADS)

    Panayotis, S.; Pégourié, B.; Caprin, E.; Douai, D.; Hatchressian, J.-C.; Negrier, V.; Pascal, J.-Y.; Vartanian, S.; Bucalossi, J.; Monier-Garbet, P.

    2013-07-01

    In carbon dominated devices, the in vessel D inventory obtained from post-mortem analyses of plasma facing component samples is generally smaller by a factor of ˜4 than that estimated from gas balance measurements. However, for an accurate evaluation of the wall inventory, gas balance measurements must be done not only during discharges and conditioning procedures, but also in between discharges and during vents. From the analysis of the whole Tore Supra database for the 2002-2007 period, we show that long term outgassing during nights, weekends and vents is essential for evaluating the deuterium release. Taking these contributions into account reconciles the gas balance and post-mortem estimations of fuel retention.

  7. Helium-3 Generation from the Interaction of Deuterium Plasma inside a Hydrogenated Lattice: Red Fusion

    NASA Astrophysics Data System (ADS)

    Leal-Quiros, Edbertho; Leal-Escalante, David A.

    2015-03-01

    Helium-3 has been created in a nuclear fusion reaction by fusing deuterium ions from deuterium plasma with hydrogen ions in a RED (the Spanish word for net) or crystal lattice, a method we called red fusion ("Fusion en la red cristalina"), because is a new method to make nuclear fusion reaction. In this paper, it will be show the experimental results where the helium-3 has been generated for the first time in this kind of new method to confine deuterium and hydrogen inside the RED or lattice of the hydrogenated crystal and that confinement inside the RED facilitated overcoming the Coulomb barrier between them and helium-3 and phonons are produced in this fusion reaction. The results of a long time research in which helium-3, has been created in a fusion reaction inside the lattice or RED of the crystal that contained hydrogen after adequate interaction of deuterium plasma at appropriate high temperature and magnetic confinement of the Mirror/Cusp Plasma Machine at Polytechnic University of Puerto Rico, designed by the authors. Several mass spectra and visible light spectrum where the presence of helium-3 was detected are shown. The experiment was repeated more than 200 times showing always the generation of helium-3. In this experiment no gamma rays were detected. For this experiment several diagnostic instruments were used. The data collection with these control instrumentation are shown. Thus, it is an important new way to generate Helium-3. reserved.

  8. Dual Studies on a Hydrogen-Deuterium Exchange of Resorcinol and the Subsequent Kinetic Isotope Effect

    ERIC Educational Resources Information Center

    Giles, Richard; Kim, Iris; Chao, Weyjuin Eric; Moore, Jennifer; Jung, Kyung Woon

    2014-01-01

    An efficient laboratory experiment has been developed for undergraduate students to conduct hydrogen-deuterium (H-D) exchange of resorcinol by electrophilic aromatic substitution using D[subscript 2]O and a catalytic amount of H[subscript 2]SO[subscript 4]. The resulting labeled product is characterized by [superscript 1]H NMR. Students also

  9. Dual Studies on a Hydrogen-Deuterium Exchange of Resorcinol and the Subsequent Kinetic Isotope Effect

    ERIC Educational Resources Information Center

    Giles, Richard; Kim, Iris; Chao, Weyjuin Eric; Moore, Jennifer; Jung, Kyung Woon

    2014-01-01

    An efficient laboratory experiment has been developed for undergraduate students to conduct hydrogen-deuterium (H-D) exchange of resorcinol by electrophilic aromatic substitution using D[subscript 2]O and a catalytic amount of H[subscript 2]SO[subscript 4]. The resulting labeled product is characterized by [superscript 1]H NMR. Students also…

  10. IUE observations of neutral hydrogen and deuterium in the local interstellar medium

    NASA Technical Reports Server (NTRS)

    Landsman, W. B.; Murthy, J.; Henry, R. C.; Moos, H. W.; Linsky, J. L.

    1986-01-01

    Small-aperture, high-dispersion IUE spectra have been obtained of seven late-type stars that, in general, confirm previous Copernicus results concerning the distribution of hydrogen and deuterium in the local interstellar medium. In addition, the IUE Ly Alpha spectra of Altair, and of the Alpha Cen components, suggest that multiple velocity components exist in these two directions.

  11. Hydrogen fluoride and deuterium fluoride lasers. Citations from the International Aerospace Abstracts data base

    NASA Technical Reports Server (NTRS)

    Mauk, S. C.

    1980-01-01

    Research cited from the international literature adresses various aspects of hydrogen fluoride and deuterium fluoride lasers. Topics covered include flows, laser outputs, molecular relaxation, molecular rotation, energy conversion efficiency, reaction kinetics, and laser materials. Continous wave and pulsed laser are considered. This updated bibliography contains 283 citations, 53 of which are new additions to the previous edition.

  12. Isotope effects in dense solid hydrogen - Phase transition in deuterium at 190 + or - 20 GPa

    NASA Technical Reports Server (NTRS)

    Hemley, R. J.; Mao, H. K.

    1989-01-01

    Raman measurements of solid normal deuterium compressed in a diamond-anvil cell indicate that the material undergoes a structural phase transformation at 190 + or - 20 GPa and 77 K. Spectroscopically, the transition appears analogous to that observed in hydrogen at 145 + or - 5 GPa. The large isotope effect on the transition pressure suggests there is a significant vibrational contribution to the relative stability of the solid phases of hydrogen at very high densities.

  13. Definitive proof of graphene hydrogenation by Clemmensen reduction: use of deuterium labeling

    NASA Astrophysics Data System (ADS)

    Sofer, Zden?k; Jankovsk, Ond?ej; Libnsk, Alena; imek, Petr; Nov?ek, Michal; Sedmidubsk, David; Mackov, Anna; Mikov, Romana; Pumera, Martin

    2015-06-01

    Graphane is one of the most intensively studied derivatives of graphene. Here we demonstrate the evaluation of exact degree of graphene hydrogenation using the Clemmensen reduction reaction and deuterium labeling. The Clemmensen reduction reaction is based on application of zinc in an acid environment. It effectively reduces various functional groups (like ketones) present in graphite oxide. However, the mechanism of reduction is still unknown and elusive. Here we bring a major insight into the mechanisms of the Clemmensen reduction via deuterium labeling and the topochemical approach applied on graphite oxide. The use of deuterated reactants and the exact measurement of deuterium concentration in reduced/hydrogenated graphene by nuclear methods can be used for accurate estimation of C-H bond abundance in graphene. Various topochemical configurations of experiments showed that the reduction of a ketonic group proceeds in contact with the zinc metal by a carbenoid mechanism. Our results showed that the application of nuclear methods of isotope analysis in combination with deuterium labeling represents a very effective tool for investigation of graphene based materials. Our results demonstrate that graphene based materials can also be effectively used for the investigation of organic reaction mechanisms, because the robust structure of graphene allows the use of various spectroscopic techniques which could not be applied on small organic molecules.Graphane is one of the most intensively studied derivatives of graphene. Here we demonstrate the evaluation of exact degree of graphene hydrogenation using the Clemmensen reduction reaction and deuterium labeling. The Clemmensen reduction reaction is based on application of zinc in an acid environment. It effectively reduces various functional groups (like ketones) present in graphite oxide. However, the mechanism of reduction is still unknown and elusive. Here we bring a major insight into the mechanisms of the Clemmensen reduction via deuterium labeling and the topochemical approach applied on graphite oxide. The use of deuterated reactants and the exact measurement of deuterium concentration in reduced/hydrogenated graphene by nuclear methods can be used for accurate estimation of C-H bond abundance in graphene. Various topochemical configurations of experiments showed that the reduction of a ketonic group proceeds in contact with the zinc metal by a carbenoid mechanism. Our results showed that the application of nuclear methods of isotope analysis in combination with deuterium labeling represents a very effective tool for investigation of graphene based materials. Our results demonstrate that graphene based materials can also be effectively used for the investigation of organic reaction mechanisms, because the robust structure of graphene allows the use of various spectroscopic techniques which could not be applied on small organic molecules. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr01356a

  14. Spontaneous versus induced hydrogen and deuterium helical shaped plasmas with electron internal transport barriers

    NASA Astrophysics Data System (ADS)

    Gobbin, M.; Franz, P.; Auriemma, F.; Lorenzini, R.; Marrelli, L.

    2015-09-01

    Electron internal transport barriers (eITBs) in high current plasmas with helical equilibria of the reversed field pinch experiment RFX-mod are analyzed and characterized in detail thanks to a high time resolution double filter diagnostic for the electron temperature spatial profile determination. The large amount of data provided by this diagnostic has required the development of dedicated algorithms and the identification of suitable parameters, reported and described in this paper, in order to perform automatic statistical studies. These numerical tools have been used to examine the effect of three dimensional (3D) magnetic fields applied by the RFX-mod 192 active coils in deuterium and hydrogen discharges with the aim to improve the sustainment and control of helical equilibria with eITBs. It is shown that 3D fields partially increase the occurring of helical states but with only a moderate effect on the eITBs duration; moreover, they have a different impact on the confinement properties in hydrogen and deuterium discharges. Numerical simulations, by the Hamiltonian guiding center code ORBIT, investigate the effect of magnetic topology in plasmas with and without the application of 3D fields on deuterium and hydrogen test ions transport. Results from numerical studies are in agreement with estimates of the particle confinement times showing that particle transport is reduced in deuterium plasmas but not significantly affected by the application of helical boundary conditions.

  15. Hydrogen storage in carbon nanotubes.

    PubMed

    Hirscher, M; Becher, M

    2003-01-01

    The article gives a comprehensive overview of hydrogen storage in carbon nanostructures, including experimental results and theoretical calculations. Soon after the discovery of carbon nanotubes in 1991, different research groups succeeded in filling carbon nanotubes with some elements, and, therefore, the question arose of filling carbon nanotubes with hydrogen by possibly using new effects such as nano-capillarity. Subsequently, very promising experiments claiming high hydrogen storage capacities in different carbon nanostructures initiated enormous research activity. Hydrogen storage capacities have been reported that exceed the benchmark for automotive application of 6.5 wt% set by the U.S. Department of Energy. However, the experimental data obtained with different methods for various carbon nanostructures show an extreme scatter. Classical calculations based on physisorption of hydrogen molecules could not explain the high storage capacities measured at ambient temperature, and, assuming chemisorption of hydrogen atoms, hydrogen release requires temperatures too high for technical applications. Up to now, only a few calculations and experiments indicate the possibility of an intermediate binding energy. Recently, serious doubt has arisen in relation to several key experiments, causing considerable controversy. Furthermore, high hydrogen storage capacities measured for carbon nanofibers did not survive cross-checking in different laboratories. Therefore, in light of today's knowledge, it is becoming less likely that at moderate pressures around room temperature carbon nanostructures can store the amount of hydrogen required for automotive applications. PMID:12908227

  16. Ultraviolet observations of cool stars. VII - Local interstellar hydrogen and deuterium Lyman-alpha

    NASA Technical Reports Server (NTRS)

    Mcclintock, W.; Henry, R. C.; Linsky, J. L.; Moos, H. W.

    1978-01-01

    High-resolution Copernicus spectra of Epsilon Eri and Epsilon Ind containing interstellar hydrogen and deuterium L-alpha absorption lines are presented, reduced, and analyzed. Parameters of the interstellar hydrogen and deuterium toward these two stars are derived independently, without any assumptions concerning the D/H ratio. Copernicus spectra of Alpha Aur and Alpha Cen A are reanalyzed, and limits on the D/H number-density ratio consistent with the data for all four stars are considered. A comparison of the present estimates for the parameters of the local interstellar medium with those obtained by other techniques shows that there is no compelling evidence for significant variations in the hydrogen density and D/H ratio in the local interstellar medium. On this basis the hypothesis of an approaching local interstellar cloud proposed by Vidal-Madjar et al. (1978) is rejected

  17. A combined deuterium NMR and quantum chemical investigation of inequivalent hydrogen bonds in organic solids.

    PubMed

    Webber, Renee; Penner, Glenn H

    2012-01-01

    Deuterium magic angle spinning (MAS) NMR spectroscopy and quantum chemical calculations are used to investigate organic solids in which inequivalent hydrogen bonds are present. The use of (2)H MAS allows one to measure the chemical shift, ?, quadrupolar coupling constant, C(Q), and asymmetry in the quadrupolar interaction, ?(Q), for each type of hydrogen bond present in the system. Quantum chemical calculations of the magnetic shielding (?, which can be related to ?) and the electric field gradient (EFG, which can be related to C(Q)) are compared to the experimental results and are discussed with respect to the relative strengths of the hydrogen bonds within each system. PMID:22883448

  18. Localizing Carbohydrate Binding Sites in Proteins Using Hydrogen/Deuterium Exchange Mass Spectrometry.

    PubMed

    Zhang, Jingjing; Kitova, Elena N; Li, Jun; Eugenio, Luiz; Ng, Kenneth; Klassen, John S

    2016-01-01

    The application of hydrogen/deuterium exchange mass spectrometry (HDX-MS) to localize ligand binding sites in carbohydrate-binding proteins is described. Proteins from three bacterial toxins, the B subunit homopentamers of Cholera toxin and Shiga toxin type 1 and a fragment of Clostridium difficile toxin A, and their interactions with native carbohydrate receptors, GM1 pentasaccharides (?-Gal-(1?3)-?-GalNAc-(1?4)[?-Neu5Ac-(2?3)]-?-Gal-(1?4)-Glc), Pk trisaccharide (?-Gal-(1?4)-?-Gal-(1?4)-Glc) and CD-grease (?-Gal-(1?3)-?-Gal-(1?4)-?-GlcNAcO(CH2)8CO2CH3), respectively, served as model systems for this study. Comparison of the differences in deuterium uptake for peptic peptides produced in the absence and presence of ligand revealed regions of the proteins that are protected against deuterium exchange upon ligand binding. Notably, protected regions generally coincide with the carbohydrate binding sites identified by X-ray crystallography. However, ligand binding can also result in increased deuterium exchange in other parts of the protein, presumably through allosteric effects. Overall, the results of this study suggest that HDX-MS can serve as a useful tool for localizing the ligand binding sites in carbohydrate-binding proteins. However, a detailed interpretation of the changes in deuterium exchange upon ligand binding can be challenging because of the presence of ligand-induced changes in protein structure and dynamics. Graphical Abstract ?. PMID:26423923

  19. Localizing Carbohydrate Binding Sites in Proteins Using Hydrogen/Deuterium Exchange Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Zhang, Jingjing; Kitova, Elena N.; Li, Jun; Eugenio, Luiz; Ng, Kenneth; Klassen, John S.

    2015-09-01

    The application of hydrogen/deuterium exchange mass spectrometry (HDX-MS) to localize ligand binding sites in carbohydrate-binding proteins is described. Proteins from three bacterial toxins, the B subunit homopentamers of Cholera toxin and Shiga toxin type 1 and a fragment of Clostridium difficile toxin A, and their interactions with native carbohydrate receptors, GM1 pentasaccharides (?-Gal-(1?3)-?-GalNAc-(1?4)[?-Neu5Ac-(2?3)]-?-Gal-(1?4)-Glc), Pk trisaccharide (?-Gal-(1?4)-?-Gal-(1?4)-Glc) and CD-grease (?-Gal-(1?3)-?-Gal-(1?4)-?-GlcNAcO(CH2)8CO2CH3), respectively, served as model systems for this study. Comparison of the differences in deuterium uptake for peptic peptides produced in the absence and presence of ligand revealed regions of the proteins that are protected against deuterium exchange upon ligand binding. Notably, protected regions generally coincide with the carbohydrate binding sites identified by X-ray crystallography. However, ligand binding can also result in increased deuterium exchange in other parts of the protein, presumably through allosteric effects. Overall, the results of this study suggest that HDX-MS can serve as a useful tool for localizing the ligand binding sites in carbohydrate-binding proteins. However, a detailed interpretation of the changes in deuterium exchange upon ligand binding can be challenging because of the presence of ligand-induced changes in protein structure and dynamics.

  20. Hydrogen and deuterium NMR of solids by magic-angle spinning

    SciTech Connect

    Eckman, R.R.

    1982-10-01

    The nuclear magnetic resonance of solids has long been characterized by very large specral broadening which arises from internuclear dipole-dipole coupling or the nuclear electric quadrupole interaction. These couplings can obscure the smaller chemical shift interaction and make that information unavailable. Two important and difficult cases are that of hydrogen and deuterium. The development of cross polarization, heteronuclear radiofrequency decoupling, and coherent averaging of nuclear spin interactions has provided measurement of chemical shift tensors in solids. Recently, double quantum NMR and double quantum decoupling have led to measurement of deuterium and proton chemical shift tensors, respectively. A general problem of these experiments is the overlapping of the tensor powder pattern spectra of magnetically distinct sites which cannot be resolved. In this work, high resolution NMR of hydrogen and deuterium in solids is demonstrated. For both nuclei, the resonances are narrowed to obtain liquid-like isotropic spectra by high frequency rotation of the sample about an axis inclined at the magic angle, ..beta../sub m/ = Arccos (3/sup -1/2/), with respect to the direction of the external magnetic field. For deuterium, the powder spectra were narrowed by over three orders of magnitude by magic angle rotation with precise control of ..beta... A second approach was the observation of deuterium double quantum transitions under magic angle rotation. For hydrogen, magic angle rotation alone could be applied to obtain the isotropic spectrum when H/sub D/ was small. This often occurs naturally when the nuclei are semi-dilute or involved in internal motion. In the general case of large H/sub D/, isotropic spectra were obtained by dilution of /sup 1/H with /sup 2/H combined with magic angle rotation. The resolution obtained represents the practical limit for proton NMR of solids.

  1. Measuring the hydrogen/deuterium exchange of proteins at high spatial resolution by mass spectrometry: overcoming gas-phase hydrogen/deuterium scrambling.

    PubMed

    Rand, Kasper D; Zehl, Martin; Jrgensen, Thomas J D

    2014-10-21

    Proteins are dynamic molecules that exhibit conformational flexibility to function properly. Well-known examples of this are allosteric regulation of protein activity and ligand-induced conformational changes in protein receptors. Detailed knowledge of the conformational properties of proteins is therefore pertinent to both basic and applied research, including drug development, since the majority of drugs target protein receptors and a growing number of drugs introduced to the market are therapeutic peptides or proteins. X-ray crystallography provides a static picture at atomic resolution of the lowest-energy structure of the native ensemble. There is a growing need for sensitive analytical tools to explore all of the significant molecular structures in the conformational landscape of proteins. Hydrogen/deuterium exchange monitored by mass spectrometry (HDX-MS) has recently emerged as a powerful method for characterizing protein conformational dynamics. The basis of this method is the fact that backbone amides in stable hydrogen-bonded structures (e.g., ?-helices and ?-sheets) are protected against exchange with the aqueous solvent. All protein structures are dynamic, however, and eventually all of the protecting hydrogen bonds will transiently break as the protein--according to thermodynamic principles--cycles through partially unfolded states that correspond to excited free energy levels. As a result, all of the backbone amides will eventually become temporarily solvent-exposed and exchange-competent over time. Consequently, a folded protein in D2O will gradually incorporate deuterium into its backbone amides, and the kinetics of the process can be readily monitored by mass spectrometry. The deuterium uptake kinetics for the intact protein (global exchange kinetics) represents the sum of the exchange kinetics for the individual backbone amides. Local exchange kinetics is typically achieved by using pepsin digestion under quench conditions (i.e., under cold acidic conditions where the amide hydrogen exchange rate is slowed by many orders of magnitude). The ability to localize the individual deuterated residues (the spatial resolution) is determined by the size (typically ?7-15 residues) and the number of peptic peptides. These peptides provide a relatively coarse-grained picture of the protein dynamics. A fundamental understanding of the relationship between protein function/dysfunction and conformational dynamics requires in many cases higher resolution and ultimately single-residue resolution. In this Account, we summarize our efforts to achieve single-residue deuterium levels in proteins by electron-based or laser-induced gas-phase fragmentation methods. A crucial analytical requirement for this approach is that the pattern of deuterium labeling from solution is retained in the gas-phase fragment ions. It is therefore essential to control and minimize any occurrence of gas-phase randomization of the solution deuterium label (H/D scrambling) during the MS experiment. For this purpose, we have developed model peptide probes to accurately measure the onset and extent of H/D scrambling. Our analytical procedures to control the occurrence of H/D scrambling are detailed along with the physical parameters that induce it during MS analysis. In light of the growing use of gas-phase dissociation experiments to measure the HDX of proteins in order to obtain a detailed characterization and understanding of the dynamic conformations and interactions of proteins at the molecular level, we discuss the perspectives and challenges of future high-resolution HDX-MS methodology. PMID:25171396

  2. Kinetics study of two-channel hydrogen and deuterium atom reactions with interhalogen molecules

    SciTech Connect

    Bykhalo, I.B.; Filatov, V.V.; Gordon, E.B.

    1994-10-01

    Rate constants and the ratio of rates of two available reaction channels (branching ratios) for the reaction of hydrogen and deuterium atoms with FCl, ICl, and BrF molecules were measured using a fast-flow reactor with RF discharge as source of atoms and with syperheterodyne ESR spectrometer as detector. For the reaction with FCl a substantial difference was found in branching ratios when substituting hydrogen atoms with deuterium ones: {Gamma}{sub D+FCl}/{Gamma}{sub H+FCl}=3.3{plus_minus}0.2. The results are compared with the known experimental data and theoretical calculations; in particular, the possible influence of light atom (H or D) migration in collision complex on reaction mechanism is discussed.

  3. Hydrogen-deuterium exchange on plasma-exposed W and SS surface

    NASA Astrophysics Data System (ADS)

    Takagi, Ikuji; Nomura, Shinji; Minamimoto, Toshihiro; Akiyoshi, Masafumi; Kobayashi, Taishi; Sasaki, Takayuki

    2015-08-01

    The desorption cross section for hydrogen isotopes adsorbed on stainless steel (SS) and tungsten (W) has been evaluated experimentally to provide basic information on tritium exchange. One side of a sample sheet was alternately exposed to H and D plasma, and deuterium density on the surface was repeatedly observed using nuclear reaction analysis (NRA) under continuous plasma exposure. From the time dependent change in the deuterium density, the desorption cross sections for SS and W were estimated to be 6.9 ± 2.3 × 10-23 m2 and 4.6 ± 1.0 × 10-23 m2, respectively. No significant differences in the cross section between H and D plasma were observed. Recombinative desorption was found to dominate the desorption process owing to the low incident energy of hydrogen atoms.

  4. IUE observations of hydrogen and deuterium in the local interstellar medium

    NASA Technical Reports Server (NTRS)

    Murthy, J.; Henry, R. C.; Moos, H. W.; Landsman, W. B.; Linsky, J. L.

    1987-01-01

    High-resolution Ly-alpha spectra of the late-type stars Epsilon Eri, Procyon, Altair, Capella, and HR 1099 taken with the short-wavelength camera on IUE are presented. The density, velocity dispersion, and bulk velocity of the interstellar H I toward each of the stars is derived from the spectra. Lower limits on the deuterium-to-hydrogen ratio toward these stars are obtained.

  5. Scattering of current carriers on a Mo(110) surface covered with hydrogen and deuterium submonolayers

    NASA Astrophysics Data System (ADS)

    Panchenko, O. A.; Sologub, S. V.; Bordenjuk, I. V.

    2011-07-01

    The paper reports the experimental study of current carrier transitions between surface and bulk energy states and their influence on the magneto-resistances of an atomically pure Mo(110) plate and a similar plate covered with adsorbed hydrogen and deuterium monolayer films. Effect of adsorbate submonolayer ordering on the surface scattering of current carriers is investigated. The experiment employs the static skin effect technique under ultrahigh vacuum conditions.

  6. Effects of atomic hydrogen and deuterium exposure on high polarization GaAs photocathodes

    SciTech Connect

    M. Baylac; P. Adderley; J. Brittian; J. Clark; T. Day; J. Grames; J. Hansknecht; M. Poelker; M. Stutzman; A. T. Wu; A. S. Terekhov

    2005-12-01

    Strained-layer GaAs and strained-superlattice GaAs photocathodes are used at Jefferson Laboratory to create high average current beams of highly spin-polarized electrons. High electron yield, or quantum efficiency (QE), is obtained only when the photocathode surface is atomically clean. For years, exposure to atomic hydrogen or deuterium has been the photocathode cleaning technique employed at Jefferson Laboratory. This work demonstrates that atomic hydrogen cleaning is not necessary when precautions are taken to ensure that clean photocathode material from the vendor is not inadvertently dirtied while samples are prepared for installation inside photoemission guns. Moreover, this work demonstrates that QE and beam polarization can be significantly reduced when clean high-polarization photocathode material is exposed to atomic hydrogen from an rf dissociator-style atomic hydrogen source. Surface analysis provides some insight into the mechanisms that degrade QE and polarization due to atomic hydrogen cleaning.

  7. Strong intramolecular hydrogen bonding involving nitro- and acetyl groups. Deuterium isotope effects on chemical shifts

    NASA Astrophysics Data System (ADS)

    West-Nielsen, Mikkel; Dominiak, Paulina M.; Wozniak, Krzystzof; Hansen, Poul Erik

    2006-05-01

    A number of o-hydroxyacetylnitrobenzenes have been synthesized and their structures (X-ray and/or ab initio DFT calculations) have been determined. The intramolecular hydrogen bonds show correlations between the distances: O⋯O, O-H, C dbnd6 O and O⋯H for both hydrogen bonds to acetyl and nitro groups. Rather short O⋯O distances and strong hydrogen bonds are obtained in a number of compounds, e.g. 1,3-diacetyl-5-nitro-2,4,6-trihydroxybenzene. Deuterium isotope effects on 1H and 13C chemical shifts have been determined. 2ΔC(OD) isotope effects correlate well with O⋯O distances, whereas 4ΔC dbnd6 O(OD) isotope effects do not. The latter become unusually large in 3,5-dinitro substituted derivatives. Deuterium isotope effects on 13C chemical shifts especially 2ΔC(OD), 5ΔCH 3(OD) and 4ΔC dbnd6 O(OD) are used to evaluate steric and electronic contributions to resonance assisted hydrogen bonds. The effects are analysed using principal component analysis (PCA) techniques. Direct transmission of isotope effects via hydrogen bonds is demonstrated. DFT calculated NMR chemical shifts are shown to be useful in choosing between possible rotameric structures. X-ray analysis is used to determine structures in the solid. 'Bond localization' is shown to be important in understanding the effects of substituents. Intra molecular hydrogen bonds with acetyl or nitro groups as acceptors and OH groups as donors are compared. They are structurally similar but hydrogen bonds involving nitro groups are weaker for similar compounds. An unusual hydrogen bond pattern is observed in 1-acetyl-3,5-dinitro-2,4,6-trihydroxybenzene (two OH groups forms hydrogen bonds to the same nitro group). OH chemical shifts correlate with calculated Mulliken charges of OH for both hydrogen bonds to acetyl and nitro groups.

  8. Functionalization of Carbon Nanotubes using Atomic Hydrogen

    NASA Technical Reports Server (NTRS)

    Khare, Bishun N.; Cassell, Alan M.; Nguyen, Cattien V.; Meyyappan, M.; Han, Jie; Arnold, Jim (Technical Monitor)

    2001-01-01

    We have investigated the irradiation of multi walled and single walled carbon nanotubes (SWNTs) with atomic hydrogen. After irradiating the SWNT sample, a band at 2940/cm (3.4 microns) that is characteristic of the C-H stretching mode is observed using Fourier transform infrared (FTIR) spectroscopy. Additional confirmation of SWNT functionalization is tested by irradiating with atomic deuterium. A weak band in the region 1940/cm (5.2 micron) to 2450/cm (4.1 micron) corresponding to C-D stretching mode is also observed in the FTIR spectrum. This technique provides a clean gas phase process for the functionalization of SWNTs, which could lead to further chemical manipulation and/or the tuning of the electronic properties of SWNTs for nanodevice applications.

  9. Two-chamber hydrogen generation and application: access to pressurized deuterium gas.

    PubMed

    Modvig, Amalie; Andersen, Thomas L; Taaning, Rolf H; Lindhardt, Anders T; Skrydstrup, Troels

    2014-06-20

    Hydrogen and deuterium gas were produced and directly applied in a two-chamber system. These gaseous reagents were generated by the simple reaction of metallic zinc with HCl in water for H2 and DCl in deuterated water for D2. The setup proved efficient in classical Pd-catalyzed reductions of ketones, alkynes, alkenes, etc. in near-quantitative yields. The method was extended to the synthesis and isotope labeling of quinoline and 1,2,3,4-tetrahydroquinoline derivatives. Finally, CX-546 and Olaparib underwent efficient Ir-catalyzed hydrogen isotope exchange reactions. PMID:24870212

  10. New Precision Studies of Strong Interaction in Exotic Atoms: Kaonic Hydrogen and Deuterium

    SciTech Connect

    Marton, Johann

    2006-11-17

    The DEAR experiment at LNF delivered the most precise data on kaonic hydrogen up to now and triggered new theoretical studies. DEAR and its follow-up experiment SIDDHARTA are using precision X-ray spectroscopy of kaonic hydrogen and kaonic deuterium atoms to measure the strong interaction induced shift and width of the ground state. From these observables the isospin-dependent antikaon-nucleon scattering lengths can be determined, thus contributing to the understanding of aspects of chiral symmetry breaking in the strangeness sector.

  11. Excessive hydrogen and deuterium Balmer lines broadening in a hollow cathode glow discharges

    NASA Astrophysics Data System (ADS)

    iovi?, N. M.; Majstorovi?, G. Lj.; Konjevi?, N.

    2005-03-01

    Results of a Doppler spectroscopy study of hydrogen and deuterium Balmer lines in the stainless steel and copper hollow cathode glow discharge, operated in pure hydrogen, deuterium and mixtures of inert gases with hydrogen, are reported. For all gases and gas mixtures plasma observations perpendicular to electric field revealed the excessively large Doppler broadening. By changing mode of glow discharge operation, the Doppler broadened line profiles in helium-hydrogen mixture are recorded parallel to the discharge electric field as well. The excessively broadened part of the H? line profile is shifted towards blue or red wavelength by changing the direction of electric field vector. The presence of large excessive Balmer lines broadening in pure hydrogen and in its gas mixture with neon as well as shifting of the excessively broadened part of line profile by means of electric field is in contradiction with the resonance transfer model proposed by Mills et al. in several publications, see e.g. [IEEE Trans. Plasma Sci. 31, 338 (2003)].

  12. Kinetic Method for Hydrogen-Deuterium-Tritium Mixture Distillation Simulation

    SciTech Connect

    Sazonov, A.B.; Kagramanov, Z.G.; Magomedbekov, E.P.

    2005-07-15

    Simulation of hydrogen distillation plants requires mathematical procedures suitable for multicomponent systems. In most of the present-day simulation methods a distillation column is assumed to be composed of theoretical stages, or plates. However, in the case of a multicomponent mixture theoretical plate does not exist.An alternative kinetic method of simulation is depicted in the work. According to this method a system of mass-transfer differential equations is solved numerically. Mass-transfer coefficients are estimated with using experimental results and empirical equations.Developed method allows calculating the steady state of a distillation column as well as its any non-steady state when initial conditions are given. The results for steady states are compared with ones obtained via Thiele-Geddes theoretical stage technique and the necessity of using kinetic method is demonstrated. Examples of a column startup period and periodic distillation simulations are shown as well.

  13. A study of isotopic exchange of hydrogen and deuterium in a LaNi 3Al 2 hydride bed

    NASA Astrophysics Data System (ADS)

    Fukada, S.; Matsuo, H.; Okunaga, T.; Mitsuishi, N.

    1992-10-01

    An experimental study was carried out on the isotopic exchange of hydrogen and deuterium in a LaNi 3Al 2 hydride bed. The exchange capacity of the LaNi 3Al 2 hydride for deuterium, the overall mass-transfer coefficient and the height equivalent to a theoretical plate (HETP) were obtained from the analysis of effluent curves for a pulse or step change of an influent deuterium concentration. The exchange capacity for deuterium was found to be almost constant between 200 and 300C and was around 1.7 in a D/metal ratio. The rate of the isotopic exchange was independent of the total hydrogen pressure, and a value of 31.8 kJ/mol was obtained for its activation energy. The minimum HETP value obtained was 0.5 cm at 300C and is smaller than that of a cryogenic distillation column for hydrogen isotopic separation.

  14. The solubility of hydrogen and deuterium in alloyed, unalloyed and impure plutonium metal

    SciTech Connect

    Richmond, Scott; Bridgewater, Jon S; Ward, John W; Allen, Thomas A

    2009-01-01

    Pressure-Composition-Temperature (PCT) data are presented for the plutonium-hydrogen (Pu-H) and plutonium-deuterium (Pu-D) systems in the solubility region up to terminal solubility (precipitation of PuH{sub 2}). The heats of solution for PuH{sub s} and PuD{sub s} are determined from PCT data in the ranges 350-625 C for gallium alloyed Pu and 400-575 C for unalloyed Pu. The solubility of high purity plutonium alloyed with 2 at.% gallium is compared to high purity unalloyed plutonium. Significant differences are found in hydrogen solubility for unalloyed Pu versus gallium alloyed Pu. Differences in hydrogen solubility due to an apparent phase change are observable in the alloyed and unalloyed solubilities. The effect of iron impurities on Pu-Ga alloyed Pu is shown via hydrogen solubility data as preventing complete homogenization.

  15. A polarized hydrogen//deuterium atomic beam source for internal target experiments

    NASA Astrophysics Data System (ADS)

    Szczerba, D.; van Buuren, L. D.; van den Brand, J. F. J.; Bulten, H. J.; Ferro-Luzzi, M.; Klous, S.; Kolster, H.; Lang, J.; Mul, F.; Poolman, H. R.; Simani, M. C.

    2000-12-01

    A high-brightness hydrogen/deuterium atomic beam source is presented. The apparatus, previously used in electron scattering experiments with tensor-polarized deuterium (Ferro-Luzzi et al., Phys. Rev. Lett. 77 (1996) 2630; van den Brand et al., Phys. Rev. Lett. 78 (1997) 1235; Zhou et al., Phys. Rev. Lett. 82 (1998) 687; Bouwhuis et al., Phys. Rev. Lett. 82 (1999) 3755), was configured as a source for internal target experiments to measure single- and double-polarization observables, with either polarized hydrogen or vector/tensor polarized deuterium. The atomic beam intensity was enhanced by a factor of 2.5 by optimizing the Stern-Gerlach focusing system using high tip-field (1.5 T) rare-earth permanent magnets, and by increasing the pumping speed in the beam-formation chamber. Fluxes of (5.90.2)10 16 1H/s were measured in a ?12 mm122 mm compression tube with its entrance at a distance of 27 cm from the last focusing element. The total output flux amounted to (7.60.2)10 16 1H/s.

  16. Deuterium to carbon cross-polarization in liquid crystals

    NASA Astrophysics Data System (ADS)

    Hodgkinson, Paul; Auger, Cline; Emsley, Lyndon

    1998-08-01

    The theory describing nuclear cross-polarization from a spin-1 to spin-1/2 is generalized to sweeps of the radio-frequency field amplitude. This allows efficient cross-polarization over the entire width of the deuterium NMR spectrum of partially oriented systems, such as liquid crystals. Such experiments permit the assignment and measurement of the deuterium quadrupolar couplings, and hence the quantification of the order parameters which characterize the dynamics of such systems. The evolution of the spin system can be understood in terms of individual quasiadiabatic population exchanges, allowing the prediction of the effects of the various experimental parameters on the efficiency of cross-polarization.

  17. Kinetics of hydrogen/deuterium exchanges in cometary ices

    NASA Astrophysics Data System (ADS)

    Faure, Mathilde; Quirico, Eric; Faure, Alexandre; Schmitt, Bernard; Theul, Patrice; Marboeuf, Ulysse

    2015-11-01

    The D/H composition of volatile molecules composing cometary ices brings key constraints on the origin of comets, on the extent of their presolar heritage, as well as on the origin of atmospheres and hydrospheres of terrestrial planets. Nevertheless, the D/H composition may have been modified to various extents in the nucleus when a comet approaches the Sun and experiences deep physical and chemical modifications in its subsurface. We question here the evolution of the D/H ratio of organic species by proton exchanges with water ice. We experimentally studied the kinetics of D/H exchanges on the ice mixtures H2O:CD3OD, H2O:CD3ND2 and D2O:HCN. Our results show that fast exchanges occur on the -OH and -NH2 chemical groups, which are processed through hydrogen bonds exchanges with water and by the molecular mobility triggered by structural changes, such as glass transition or crystallization. D/H exchanges kinetic is best described by a second-order kinetic law with activation energies of 4300 900 K and 3300 100 K for H2O:CD3OD and H2O:CD3ND2 ice mixtures, respectively. The corresponding pre-exponential factors ln(A(s-1)) are 25 7 and 20 1, respectively. No exchange was observed in the case of HCN trapped in D2O ice. These results strongly suggest that upon thermal heating (1) -OH and -NH2 chemical groups of any organic molecules loose their primordial D/H composition and equilibrate with water ice, (2) HCN does not experience proton transfer and keeps a primordial D/H composition and (3) C-H chemical groups are not isotopically modified.

  18. Localizing Carbohydrate Binding Sites in Proteins Using Hydrogen/Deuterium Exchange Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Zhang, Jingjing; Kitova, Elena N.; Li, Jun; Eugenio, Luiz; Ng, Kenneth; Klassen, John S.

    2016-01-01

    The application of hydrogen/deuterium exchange mass spectrometry (HDX-MS) to localize ligand binding sites in carbohydrate-binding proteins is described. Proteins from three bacterial toxins, the B subunit homopentamers of Cholera toxin and Shiga toxin type 1 and a fragment of Clostridium difficile toxin A, and their interactions with native carbohydrate receptors, GM1 pentasaccharides (β-Gal-(1→3)-β-GalNAc-(1→4)[α-Neu5Ac-(2→3)]-β-Gal-(1→4)-Glc), Pk trisaccharide (α-Gal-(1→4)-β-Gal-(1→4)-Glc) and CD-grease (α-Gal-(1→3)-β-Gal-(1→4)-β-GlcNAcO(CH2)8CO2CH3), respectively, served as model systems for this study. Comparison of the differences in deuterium uptake for peptic peptides produced in the absence and presence of ligand revealed regions of the proteins that are protected against deuterium exchange upon ligand binding. Notably, protected regions generally coincide with the carbohydrate binding sites identified by X-ray crystallography. However, ligand binding can also result in increased deuterium exchange in other parts of the protein, presumably through allosteric effects. Overall, the results of this study suggest that HDX-MS can serve as a useful tool for localizing the ligand binding sites in carbohydrate-binding proteins. However, a detailed interpretation of the changes in deuterium exchange upon ligand binding can be challenging because of the presence of ligand-induced changes in protein structure and dynamics.

  19. Hydrogen isotope exchange in tungsten irradiated sequentially with low-energy deuterium and protium ions

    NASA Astrophysics Data System (ADS)

    Alimov, V. Kh; Tyburska-Pschel, B.; 't Hoen, M. H. J.; Roth, J.; Hatano, Y.; Isobe, K.; Matsuyama, M.; Yamanishi, T.

    2011-12-01

    Hydrogen isotope exchange in tungsten was investigated at various temperatures both after sequential exposure to low-energy deuterium (D) and protium (H) plasmas and after sequential irradiation with low-energy D and H ions. The methods used were thermal desorption spectroscopy, and the D(3He,p)4He nuclear reaction at 3He energies varied from 0.69 to 4.0 MeV, allowing the determination of the D concentration at depths of up to 6 ?m. It was found that a major portion of the deuterium initially accumulated in the D-implanted W is released on subsequent exposure to H plasma or irradiation with H ions. Depth profiling of D without and with subsequent H implantation shows strong replacement close to the surface near room temperatures, but extending to all analyzable depths at elevated temperatures.

  20. Raman measurements of phase transitions in dense solid hydrogen and deuterium to 325 GPa

    PubMed Central

    Zha, Chang-sheng; Cohen, R. E.; Mao, Ho-kwang; Hemley, Russell J.

    2014-01-01

    Raman spectroscopy of dense hydrogen and deuterium performed to 325 GPa at 300 K reveals previously unidentified transitions. Detailed analysis of the spectra from multiple experimental runs, together with comparison with previous infrared and Raman measurements, provides information on structural modifications of hydrogen as a function of density through the I–III–IV transition sequence, beginning near 200 GPa at 300 K. The data suggest that the transition sequence at these temperatures proceeds by formation of disordered stacking of molecular and distorted layers. Weaker spectral changes are observed at 250, 285, and 300 GPa, that are characterized by discontinuities in pressure shifts of Raman frequencies, and changes in intensities and linewidths. The results indicate changes in structure and bonding, molecular orientational order, and electronic structure of dense hydrogen at these conditions. The data suggest the existence of new phases, either variations of phase IV, or altogether new structures. PMID:24639543

  1. Quantum interference effects in laser spectroscopy of muonic hydrogen, deuterium, and helium-3

    NASA Astrophysics Data System (ADS)

    Amaro, Pedro; Franke, Beatrice; Krauth, Julian J.; Diepold, Marc; Fratini, Filippo; Safari, Laleh; Machado, Jorge; Antognini, Aldo; Kottmann, Franz; Indelicato, Paul; Pohl, Randolf; Santos, Jos Paulo

    2015-08-01

    Quantum interference between energetically close states is theoretically investigated, with the state structure being observed via laser spectroscopy. In this work, we focus on hyperfine states of selected hydrogenic muonic isotopes, and on how quantum interference affects the measured Lamb shift. The process of photon excitation and subsequent photon decay is implemented within the framework of nonrelativistic second-order perturbation theory. Due to its experimental interest, calculations are performed for muonic hydrogen, deuterium, and helium-3. We restrict our analysis to the case of photon scattering by incident linear polarized photons and the polarization of the scattered photons not being observed. We conclude that while quantum interference effects can be safely neglected in muonic hydrogen and helium-3, in the case of muonic deuterium there are resonances with close proximity, where quantum interference effects can induce shifts up to a few percent of the linewidth, assuming a pointlike detector. However, by taking into account the geometry of the setup used by the CREMA collaboration, this effect is reduced to less than 0.2% of the linewidth in all possible cases, which makes it irrelevant at the present level of accuracy.

  2. Determination of hydrogen/deuterium ratio with neutron measurements on MAST.

    PubMed

    Klimek, I; Cecconello, M; Sharapov, S E; Harrison, J; Ericsson, G

    2014-11-01

    On MAST, compressional Alfvn eigenmodes can be destabilized by the presence of a sufficiently large population of energetic particles in the plasma. This dependence was studied in a series of very similar discharges in which increasing amounts of hydrogen were puffed into a deuterium plasma. A simple method to estimate the isotopic ratio nH/nD using neutron emission measurements is here described. The inferred isotopic ratio ranged from 0.0 to 0.6 and no experimental indication of changes in radial profile of nH/nD were observed. These findings are confirmed by TRANSP/NUBEAM simulations of the neutron emission. PMID:25430288

  3. Determination of hydrogen/deuterium ratio with neutron measurements on MAST

    NASA Astrophysics Data System (ADS)

    Klimek, I.; Cecconello, M.; Sharapov, S. E.; Harrison, J.; Ericsson, G.

    2014-11-01

    On MAST, compressional Alfvn eigenmodes can be destabilized by the presence of a sufficiently large population of energetic particles in the plasma. This dependence was studied in a series of very similar discharges in which increasing amounts of hydrogen were puffed into a deuterium plasma. A simple method to estimate the isotopic ratio nH/nD using neutron emission measurements is here described. The inferred isotopic ratio ranged from 0.0 to 0.6 and no experimental indication of changes in radial profile of nH/nD were observed. These findings are confirmed by TRANSP/NUBEAM simulations of the neutron emission.

  4. Structural Analysis of Diheme Cytochrome c by HydrogenDeuterium Exchange Mass Spectrometry and Homology Modeling

    PubMed Central

    2015-01-01

    A lack of X-ray or nuclear magnetic resonance structures of proteins inhibits their further study and characterization, motivating the development of new ways of analyzing structural information without crystal structures. The combination of hydrogendeuterium exchange mass spectrometry (HDX-MS) data in conjunction with homology modeling can provide improved structure and mechanistic predictions. Here a unique diheme cytochrome c (DHCC) protein from Heliobacterium modesticaldum is studied with both HDX and homology modeling to bring some definition of the structure of the protein and its role. Specifically, HDX data were used to guide the homology modeling to yield a more functionally relevant structural model of DHCC. PMID:25138816

  5. NMR-Based Detection of Hydrogen/Deuterium Exchange in Liposome-Embedded Membrane Proteins

    PubMed Central

    Yao, Xuejun; Drr, Ulrich H. N.; Gattin, Zrinka; Laukat, Yvonne; Narayanan, Rhagavendran L.; Brckner, Ann-Kathrin; Meisinger, Chris; Lange, Adam; Becker, Stefan; Zweckstetter, Markus

    2014-01-01

    Membrane proteins play key roles in biology. Determination of their structure in a membrane environment, however, is highly challenging. To address this challenge, we developed an approach that couples hydrogen/deuterium exchange of membrane proteins to rapid unfolding and detection by solution-state NMR spectroscopy. We show that the method allows analysis of the solvent protection of single residues in liposome-embedded proteins such as the 349-residue Tom40, the major protein translocation pore in the outer mitochondrial membrane, which has resisted structural analysis for many years. PMID:25375235

  6. Hydrogen Storage in Amorphous Phase of Hydrogenated Carbon Nitride

    NASA Astrophysics Data System (ADS)

    Ohkawara, Yoshiaki; Ohshio, Shigeo; Suzuki, Tsuneo; Yatsui, Kiyoshi; Ito, Haruhiko; Saitoh, Hidetoshi

    2002-12-01

    A hydrogen storage characteristic of amorphous phase of hydrogenated carbon nitride (a-CNx:H) was evaluated at room temperature under high-pressure hydrogen. The hydrogen content in the sample was directly measured using a volumetric analysis established for measuring the hydrogen adsorption of metal alloys. The content of stored hydrogen in a-CNx:H was twice as much as those of multiwalled nanotubes, charcoal activated powder and carbon fiber.

  7. Origin of Terrestrial Water: Hydrogen/Deuterium Fractionation into Earth's Core

    NASA Astrophysics Data System (ADS)

    Wu, J.; Buseck, P. R.

    2014-12-01

    Hydrogen isotopic compositions are among the most important constraints on the origin of Earth's water. Earth's bulk water content, which is small but not negligible, is significantly greater than what the thermal gradient of the solar nebula disk would suggest for planetesimal materials condensed at one astronomical unit. The proto-solar nebula is a likely source of early Earth's water, with probable contributions from one or more of the following: water-rich planetesimals, ordinary and carbonaceous meteorites, comets, asteroids, and interplanetary dust particles. However, all of these sources have been questioned, and the proposed proto-solar nebular origin has been disputed in light of the large difference in hydrogen isotopic composition between it and terrestrial water. Current opposition to the solar nebular hypothesis is based on the critical assumption that no processes in the interior of the early Earth changed the isotopic composition of hydrogen. Nevertheless, a hypothesized hydrogenation reaction of liquid iron (2Fe + xH2 ? 2FeHx) during core formation likely provided a fractionation mechanism between hydrogen and deuterium (D). We propose that modern D/H ratios at Earth's surface resulted from this isotopic fractionation and that terrestrial water originated from oxidation of proto-solar hydrogen dissolved in the magma ocean in the early Earth by coexisting oxides (such as FeO). Thus, the isotopic composition of water on Earth can be mainly explained by internal terrestrial processes.

  8. Influence of Murchison Minerals on Hydrogen-Deuterium Exchange of Amino Acids

    NASA Astrophysics Data System (ADS)

    Lerner, N. R.

    1993-07-01

    The amino acids found on the Murchison meteorite are deuterium enriched. For the glycine-alanine fraction, delta D = +2448 per mil, and for the alpha-amino isobutyric acid fraction, delta D = +149 per mil [1]. In order to retain such levels of deuterium enrichment, the amino acids found in Murchison must have not only retained the deuterium enrichment of their interstellar precursors (delta D > +1500 per mil [2]) during synthesis, as has been recently shown [3], but they must have also retained their deuterium label during the aqueous alteration phase [4]. By measuring the rates of deuterium exchange of amino acids with D(sub)2O, limits can be set on the length of time and the conditions under which the Murchison parent body experienced an aqueous environment. The rates of hydrogen-deuterium exchange of nondeuterated glycine, alanine, alpha-amino isobutyric acid, and amino diacetic acid have been measured in D(sub)2O as a function of temperature, pH, and the presence of Murchison minerals. In addition to the amino and carboxylic hydrogens, only the alpha- hydrogens of glycine, alanine, and amino diacetic acid are found to exchange. Even for solutions maintained for weeks at temperatures as high as 120 degrees C, no exchange was observed with the hydrogens of the methyl groups of alanine or alpha-amino isobutyric acid. The rate of exchange for alpha-hydrogens of amino acids is first-order with respect to the amino acid concentration. Increasing the pH of the solution markedly increases the rate of exchange. For example, at 115 degrees C and pH 4.0, 7.0, and 10 the rates are 14, 30, and 125 yr^-1 respectively for glycine and 2.0, 3.5, and 14 yr^-1 respectively for alanine. In a pH-6.0 D(sub)2O solution of amino acids containing Murchison dust the rates are 135 yr^-1 for glycine and 32 yr^-1 for alanine, rates close to those for the pH 10 solution. Activation energies for exchange were obtained from Arrhenius plots constructed from measurements made between 70 degrees C and 155 degrees C in solutions containing Murchison dust. For both glycine and alanine the activation energy is -25 kcal/mole. Using this value, we have calculated the half-lives for complete exchange of the alpha-hydrogens of glycine and alanine for the temperature range thought to have existed on the parent body during aqueous alteration [5]. The half-lives at 0 degrees C and 20 degrees C are 7500 yr and 300 yr respectively for glycine and 55,000 yr and 2100 yr respectively for alanine. Murchison amino acid fraction IV [1] was known to contain impurities and hence the measured delta D value represents a lower limit for alpha-amino isobutyric acid. Assuming that all the deuterium recovered from fraction IV came from alpha-amino isobutryric acid, and that one atom of nitrogen is recovered for each molecule of alpha-amino isobutyric acid, a maximum delta D value of +2600 per mil can be calculated for this amino acid. This is comparable to delta D for the glycine-alanine fraction, which is mainly glycine [6]. In an aqueous environment glycine loses deuterium relatively rapidly while alpha-amino isobutyric acid does not undergo exchange. Hence the similarity in the delta D values of both fractions indicates that the period of aqueous alteration is less than the half-life for hydrogen-deuterium exchange of glycine. References: [1] Pizzarello S. et al. (1991) GCA, 55, 905-910. [2] Zinner E. (1988) In Meteorites and the Early Solar System (J. R. Kerridge and M. S. Matthews, eds.), 956-983, Univ. of Arizona. [3] Lerner N. R. et al. (1993) GCA, in press. [4] Bunch T. E. and Chang S. (1980) GCA, 44, 1543-1577. [5] Clayton R. N. and Mayeda T. K. (1984) EPSL, 67, 151-161. [6] Shock E. L. and Shulte M. D. (1990) GCA, 54, 3159-3173.

  9. Performance of a hydrogen/deuterium polarized gas target in a storage ring

    NASA Astrophysics Data System (ADS)

    van Buuren, L. D.; Szczerba, D.; van den Brand, J. F. J.; Bulten, H. J.; Ferro-Luzzi, M.; Klous, S.; Kolster, H.; Lang, J.; Mul, F. A.; Poolman, H. R.; Simani, M. C.

    2001-12-01

    The performance of a high-density polarized hydrogen/deuterium gas target internal to a medium-energy electron storage ring is presented. Compared to our previous electron scattering experiments with tensor-polarized deuterium at NIKHEF (Zhou et al., Nucl. Instr. and Meth. A 378 (1996) 40; Ferro-Luzzi et al., Phys. Rev. Lett. 77 (1996) 2630; Van den Brand et al., Phys. Rev. Lett. 78 (1997) 1235; Bouwhuis et al., Phys. Rev. Lett. 82 (1999) 687; Zhou et al., Phys. Rev. Lett. 82 (1999) 687) the target figure of merit, ( polarization) 2 luminosity, was improved by more than an order of magnitude. The target density was increased by upgrading the flux of nuclear-polarized atoms injected into the storage cell and by using a longer (60 cm) and colder (70 K) storage cell. A maximal target thickness of 1.2 (1.1)0.110 14 nuclei/ cm2 was achieved with deuterium (hydrogen). With typical beam currents of 110 mA, this corresponds to a luminosity of about 8.4 (7.8)0.810 31e- nuclei cm -2 s-1. By reducing the molecular background and using a stronger target guide field, a higher polarization was achieved. The target was used in combination with a 720 MeV polarized electron beam stored in the AmPS ring (NIKHEF) to measure spin observables in electron-proton and electron-deuteron scattering. Scattered electrons were detected in a large acceptance magnetic spectrometer. Ejected hadrons were detected in a single time-of-flight scintillator array. The product of beam and target vector polarization, PePt, was determined from the known spin-correlation parameters of e' p quasi-elastic (or elastic) scattering. With the deuterium (hydrogen) target, values up to PePt=0.490.03 (0.320.03) were obtained with an electron beam polarization of Pe=0.620.04 (0.560.03) as measured with a Compton backscattering polarimeter (Passchier et al., Nucl. Instr. and Meth. A 414 (1998) 4988). From this, we deduce a cell-averaged target polarization of Pt=0.780.07 (0.580.07), including the dilution by unpolarized molecules.

  10. The deuterium/hydrogen distribution in chondritic organic matter attests to early ionizing irradiation

    PubMed Central

    Laurent, Boris; Roskosz, Mathieu; Remusat, Laurent; Robert, François; Leroux, Hugues; Vezin, Hervé; Depecker, Christophe; Nuns, Nicolas; Lefebvre, Jean-Marc

    2015-01-01

    Primitive carbonaceous chondrites contain a large array of organic compounds dominated by insoluble organic matter (IOM). A striking feature of this IOM is the systematic enrichment in deuterium compared with the solar hydrogen reservoir. This enrichment has been taken as a sign of low-temperature ion-molecule or gas-grain reactions. However, the extent to which Solar System processes, especially ionizing radiation, can affect D/H ratios is largely unknown. Here, we report the effects of electron irradiation on the hydrogen isotopic composition of organic precursors containing different functional groups. From an initial terrestrial composition, overall D-enrichments and differential intramolecular fractionations comparable with those measured in the Orgueil meteorite were induced. Therefore, ionizing radiation can quantitatively explain the deuteration of organics in some carbonaceous chondrites. For these meteorites, the precursors of the IOM may have had the same isotopic composition as the main water reservoirs of the inner Solar System. PMID:26461170

  11. The deuterium/hydrogen distribution in chondritic organic matter attests to early ionizing irradiation

    NASA Astrophysics Data System (ADS)

    Laurent, Boris; Roskosz, Mathieu; Remusat, Laurent; Robert, Franois; Leroux, Hugues; Vezin, Herv; Depecker, Christophe; Nuns, Nicolas; Lefebvre, Jean-Marc

    2015-10-01

    Primitive carbonaceous chondrites contain a large array of organic compounds dominated by insoluble organic matter (IOM). A striking feature of this IOM is the systematic enrichment in deuterium compared with the solar hydrogen reservoir. This enrichment has been taken as a sign of low-temperature ion-molecule or gas-grain reactions. However, the extent to which Solar System processes, especially ionizing radiation, can affect D/H ratios is largely unknown. Here, we report the effects of electron irradiation on the hydrogen isotopic composition of organic precursors containing different functional groups. From an initial terrestrial composition, overall D-enrichments and differential intramolecular fractionations comparable with those measured in the Orgueil meteorite were induced. Therefore, ionizing radiation can quantitatively explain the deuteration of organics in some carbonaceous chondrites. For these meteorites, the precursors of the IOM may have had the same isotopic composition as the main water reservoirs of the inner Solar System.

  12. Probing hydrogen bonding in a DNA triple helix using protium-deuterium fractionation factors.

    PubMed

    Coman, Daniel; Russu, Irina M

    2003-06-01

    In this communication we report protium-deuterium fractionation factors for the intramolecular triple helix formed by the DNA oligonucleotide 5'-d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT)-3'. The fractionation factors of individual Watson-Crick and Hoogsteen hydrogen bonds in the structure are measured by NMR spectroscopy. The results show that, in contrast to proteins, the fractionation factors are all equal or lower than unity. On the average, the values of the fractionation factors are centered between 0.6 and 0.8, and no significant differences are observed between Hoogsteen and Watson-Crick hydrogen bonds. Deviations from the average are observed for the 5'-end region of the molecule where a base triad is absent and the structure is strained by the intramolecular folding of the DNA strand. PMID:12769560

  13. The deuterium/hydrogen distribution in chondritic organic matter attests to early ionizing irradiation.

    PubMed

    Laurent, Boris; Roskosz, Mathieu; Remusat, Laurent; Robert, François; Leroux, Hugues; Vezin, Hervé; Depecker, Christophe; Nuns, Nicolas; Lefebvre, Jean-Marc

    2015-01-01

    Primitive carbonaceous chondrites contain a large array of organic compounds dominated by insoluble organic matter (IOM). A striking feature of this IOM is the systematic enrichment in deuterium compared with the solar hydrogen reservoir. This enrichment has been taken as a sign of low-temperature ion-molecule or gas-grain reactions. However, the extent to which Solar System processes, especially ionizing radiation, can affect D/H ratios is largely unknown. Here, we report the effects of electron irradiation on the hydrogen isotopic composition of organic precursors containing different functional groups. From an initial terrestrial composition, overall D-enrichments and differential intramolecular fractionations comparable with those measured in the Orgueil meteorite were induced. Therefore, ionizing radiation can quantitatively explain the deuteration of organics in some carbonaceous chondrites. For these meteorites, the precursors of the IOM may have had the same isotopic composition as the main water reservoirs of the inner Solar System. PMID:26461170

  14. Hydrogen-deuterium exchange in imidazole as a tool for studying histidine phosphorylation.

    PubMed

    Cebo, Małgorzata; Kielmas, Martyna; Adamczyk, Justyna; Cebrat, Marek; Szewczuk, Zbigniew; Stefanowicz, Piotr

    2014-12-01

    Isotope exchange at the histidine C2 atom of imidazole in D2O solution is well known to occur at a significantly slower rate than the exchange of amide protons. Analysis of the kinetics of this isotope-exchange reaction is proposed herein as a method of detecting histidine phosphorylation. This modification of His-containing peptides is challenging to pinpoint because of its instability under acidic conditions as well as during CID-MS analysis. In this work, we investigated the effect of phosphorylation of the histidine side chain in peptides on deuterium-hydrogen exchange (DHX) in the imidazole. The results demonstrate that phosphorylation dramatically slows the rate of the DHX reaction. This phenomenon can be applied to detect phosphorylation of peptides at the histidine residue (e.g., in enzymatic digests). We also found that the influence of the peptide sequence on the exchange kinetics is relatively small. A CID fragmentation experiment revealed that there was no detectable hydrogen scrambling in peptides deuterated at C2 of the imidazole ring. Therefore, MS/MS can be used to directly identify the locations of deuterium ions incorporated into peptides containing multiple histidine moieties. PMID:25354888

  15. Pulsed hydrogendeuterium exchange mass spectrometry probes conformational changes in amyloid beta (A?) peptide aggregation

    PubMed Central

    Zhang, Ying; Rempel, Don L.; Zhang, Jun; Sharma, Anuj K.; Mirica, Liviu M.; Gross, Michael L.

    2013-01-01

    Probing the conformational changes of amyloid beta (A?) peptide aggregation is challenging owing to the vast heterogeneity of the resulting soluble aggregates. To investigate the formation of these aggregates in solution, we designed an MS-based biophysical approach and applied it to the formation of soluble aggregates of the A?42 peptide, the proposed causative agent in Alzheimers disease. The approach incorporates pulsed hydrogendeuterium exchange coupled with MS analysis. The combined approach provides evidence for a self-catalyzed aggregation with a lag phase, as observed previously by fluorescence methods. Unlike those approaches, pulsed hydrogendeuterium exchange does not require modified A?42 (e.g., labeling with a fluorophore). Furthermore, the approach reveals that the center region of A?42 is first to aggregate, followed by the C and N termini. We also found that the lag phase in the aggregation of soluble species is affected by temperature and Cu2+ ions. This MS approach has sufficient structural resolution to allow interrogation of A? aggregation in physiologically relevant environments. This platform should be generally useful for investigating the aggregation of other amyloid-forming proteins and neurotoxic soluble peptide aggregates. PMID:23959898

  16. Longitudinal-Transverse Separations of Deep-Inelastic Structure Functions at Low Q{sup 2} for Hydrogen and Deuterium

    SciTech Connect

    Tvaskis, V.; Blok, H. P.; Christy, M. E.; Baker, O. K.; Cochran, A.; Cole, L.; Gasparian, A.; Nazaryan, V.; Sato, Y.; Uzzle, A.; Arrington, J.; Jackson, H. E.; Potterveld, D. H.; Asaturyan, R.; Mkrtchyan, H.; Stepanyan, S.; Tadevosian, V.; Bosted, P.; Ent, R.; Fenker, H. C.

    2007-04-06

    We report on a study of the longitudinal to transverse cross section ratio, R={sigma}{sub L}/{sigma}{sub T}, at low values of x and Q{sup 2}, as determined from inclusive inelastic electron-hydrogen and electron-deuterium scattering data from Jefferson Laboratory Hall C spanning the four-momentum transfer range 0.06hydrogen and deuterium.

  17. Isotopic effect study in the LHCD and LHH experiments in hydrogen/deuterium plasmas of the FT-2 tokamak

    SciTech Connect

    Lashkul, S. I.; Altukhov, A. B.; Gusakov, E. Z.; Dyachenko, V. V.; Esipov, L. A.; Irzak, M. A.; Kantor, M. Yu.; Kouprienko, D. V.; Saveliev, A. N.; Shatalin, S. V.; Stepanov, A. Yu.

    2014-02-12

    Results of comparative experimental studies of the efficiency of lower hybrid current drive (LHCD) and lower hybrid heating (LHH) in the FT-2 tokamak in hydrogen and deuterium plasmas are presented. In the new comparative experimental runs in deuterium/hydrogen plasmas suppression of the LHCD and beginning of the interaction of LH waves with ions is controlled by the plasma density rise. Role of parametric instabilities in CD switch-off is considered. In order to analyze the experimentally observed effect of LHCD the GRILL3D and FRTC codes has been used.

  18. Ion Mobility Spectrometry-Hydrogen Deuterium Exchange Mass Spectrometry of Anions: Part 2. Assessing Charge Site Location and Isotope Scrambling.

    PubMed

    Khakinejad, Mahdiar; Ghassabi Kondalaji, Samaneh; Donohoe, Gregory C; Valentine, Stephen J

    2016-03-01

    Ion mobility spectrometry (IMS) coupled with gas-phase hydrogen deuterium exchange (HDX)-mass spectrometry (MS) and molecular dynamic simulations (MDS) has been used for structural investigation of anions produced by electrospraying a sample containing a synthetic peptide having the sequence KKDDDDDIIKIIK. In these experiments the potential of the analytical method for locating charge sites on ions as well as for utilizing collision-induced dissociation (CID) to reveal the degree of deuterium uptake within specific amino acid residues has been assessed. For diffuse (i.e., more elongated) [M - 2H](2-) ions, decreased deuterium content along with MDS data suggest that the D4 and D6 residues are charge sites, whereas for the more diffuse [M - 3H](3-) ions, the data suggest that the D4, D7, and the C-terminus are deprotonated. Fragmentation of mobility-selected, diffuse [M - 2H](2-) ions to determine deuterium uptake at individual amino acid residues reveals a degree of deuterium retention at incorporation sites. Although the diffuse [M - 3H](3-) ions may show more HD scrambling, it is not possible to clearly distinguish HD scrambling from the expected deuterium uptake based on a hydrogen accessibility model. The capability of the IMS-HDX-MS/MS approach to provide relevant details about ion structure is discussed. Additionally, the ability to extend the approach for locating protonation sites on positively-charged ions is presented. Graphical Abstract ᅟ. PMID:26802030

  19. Ion Mobility Spectrometry-Hydrogen Deuterium Exchange Mass Spectrometry of Anions: Part 2. Assessing Charge Site Location and Isotope Scrambling

    NASA Astrophysics Data System (ADS)

    Khakinejad, Mahdiar; Ghassabi Kondalaji, Samaneh; Donohoe, Gregory C.; Valentine, Stephen J.

    2016-01-01

    Ion mobility spectrometry (IMS) coupled with gas-phase hydrogen deuterium exchange (HDX)-mass spectrometry (MS) and molecular dynamic simulations (MDS) has been used for structural investigation of anions produced by electrospraying a sample containing a synthetic peptide having the sequence KKDDDDDIIKIIK. In these experiments the potential of the analytical method for locating charge sites on ions as well as for utilizing collision-induced dissociation (CID) to reveal the degree of deuterium uptake within specific amino acid residues has been assessed. For diffuse (i.e., more elongated) [M - 2H]2- ions, decreased deuterium content along with MDS data suggest that the D4 and D6 residues are charge sites, whereas for the more diffuse [M - 3H]3- ions, the data suggest that the D4, D7, and the C-terminus are deprotonated. Fragmentation of mobility-selected, diffuse [M - 2H]2- ions to determine deuterium uptake at individual amino acid residues reveals a degree of deuterium retention at incorporation sites. Although the diffuse [M - 3H]3- ions may show more HD scrambling, it is not possible to clearly distinguish HD scrambling from the expected deuterium uptake based on a hydrogen accessibility model. The capability of the IMS-HDX-MS/MS approach to provide relevant details about ion structure is discussed. Additionally, the ability to extend the approach for locating protonation sites on positively-charged ions is presented.

  20. Ion Mobility Spectrometry-Hydrogen Deuterium Exchange Mass Spectrometry of Anions: Part 2. Assessing Charge Site Location and Isotope Scrambling

    NASA Astrophysics Data System (ADS)

    Khakinejad, Mahdiar; Ghassabi Kondalaji, Samaneh; Donohoe, Gregory C.; Valentine, Stephen J.

    2016-03-01

    Ion mobility spectrometry (IMS) coupled with gas-phase hydrogen deuterium exchange (HDX)-mass spectrometry (MS) and molecular dynamic simulations (MDS) has been used for structural investigation of anions produced by electrospraying a sample containing a synthetic peptide having the sequence KKDDDDDIIKIIK. In these experiments the potential of the analytical method for locating charge sites on ions as well as for utilizing collision-induced dissociation (CID) to reveal the degree of deuterium uptake within specific amino acid residues has been assessed. For diffuse (i.e., more elongated) [M - 2H]2- ions, decreased deuterium content along with MDS data suggest that the D4 and D6 residues are charge sites, whereas for the more diffuse [M - 3H]3- ions, the data suggest that the D4, D7, and the C-terminus are deprotonated. Fragmentation of mobility-selected, diffuse [M - 2H]2- ions to determine deuterium uptake at individual amino acid residues reveals a degree of deuterium retention at incorporation sites. Although the diffuse [M - 3H]3- ions may show more HD scrambling, it is not possible to clearly distinguish HD scrambling from the expected deuterium uptake based on a hydrogen accessibility model. The capability of the IMS-HDX-MS/MS approach to provide relevant details about ion structure is discussed. Additionally, the ability to extend the approach for locating protonation sites on positively-charged ions is presented.

  1. Carbon Aerogels for Hydrogen Storage

    SciTech Connect

    Baumann, T F; Worsley, M; Satcher, J H

    2008-08-11

    This effort is focused on the design of new nanostructured carbon-based materials that meet the DOE 2010 targets for on-board vehicle hydrogen storage. Carbon aerogels (CAs) are a unique class of porous materials that possess a number of desirable structural features for the storage of hydrogen, including high surface areas (over 3000 m{sup 2}/g), continuous and tunable porosities, and variable densities. In addition, the flexibility associated with CA synthesis allows for the incorporation of modifiers or catalysts into the carbon matrix in order to alter hydrogen sorption enthalpies in these materials. Since the properties of the doped CAs can be systematically modified (i.e. amount/type of dopant, surface area, porosity), novel materials can be fabricated that exhibit enhanced hydrogen storage properties. We are using this approach to design new H{sub 2} sorbent materials that can storage appreciable amounts of hydrogen at room temperature through a process known as hydrogen spillover. The spillover process involves the dissociative chemisorption of molecular hydrogen on a supported metal catalyst surface (e.g. platinum or nickel), followed by the diffusion of atomic hydrogen onto the surface of the support material. Due to the enhanced interaction between atomic hydrogen and the carbon support, hydrogen can be stored in the support material at more reasonable operating temperatures. While the spillover process has been shown to increase the reversible hydrogen storage capacities at room temperature in metal-loaded carbon nanostructures, a number of issues still exist with this approach, including slow kinetics of H{sub 2} uptake and capacities ({approx} 1.2 wt% on carbon) below the DOE targets. The ability to tailor different structural aspects of the spillover system (i.e. the size/shape of the catalyst particle, the catalyst-support interface and the support morphology) should provide valuable mechanistic information regarding the critical aspects of the spillover process (i.e. kinetics of hydrogen dissociation, diffusion and recombination) and allow for optimization of these materials to meet the DOE targets for hydrogen storage. In a parallel effort, we are also designing CA materials as nanoporous scaffolds for metal hydride systems. Recent work by others has demonstrated that nanostructured metal hydrides show enhanced kinetics for reversible hydrogen storage relative to the bulk materials. This effect is diminished, however, after several hydriding/dehydriding cycles, as the material structure coarsens. Incorporation of the metal hydride into a porous scaffolding material can potentially limit coarsening and, therefore, preserve the enhanced kinetics and improved cycling behavior of the nanostructured metal hydride. Success implementation of this approach, however, requires the design of nanoporous solids with large accessible pore volumes (> 4 cm{sup 3}/g) to minimize the gravimetric and volumetric capacity penalties associated with the use of the scaffold. In addition, these scaffold materials should be capable of managing thermal changes associated with the cycling of the incorporated metal hydride. CAs are promising candidates for the design of such porous scaffolds due to the large pore volumes and tunable porosity of aerogel framework. This research is a joint effort with HRL Laboratories, a member of the DOE Metal Hydride Center of Excellence. LLNL's efforts have focused on the design of new CA materials that can meet the scaffolding requirements, while metal hydride incorporation into the scaffold and evaluation of the kinetics and cycling performance of these composites is performed at HRL.

  2. Influence of helium on hydrogen isotope exchange in tungsten at sequential exposures to deuterium and helium-protium plasmas

    NASA Astrophysics Data System (ADS)

    Bobyr, N. P.; Alimov, V. Kh.; Khripunov, B. I.; Spitsyn, A. V.; Mayer, M.; Hatano, Y.; Golubeva, A. V.; Petrov, V. B.

    2015-08-01

    Hydrogen isotopes exchange in tungsten was investigated after sequential exposures to low energy deuterium (D) and helium-seeded protium (He-seeded H) plasmas at sample temperatures of 403 and 533 K. Deuterium depth profiles were measured by the D(3He, p)4He nuclear reaction with 3He+ energies between 0.69 and 4.5 MeV allowing determination of the D concentration up to a depth of 8 ?m. It was found that a significant part of the deuterium initially retained in tungsten after D plasma exposure was released during sequential exposure to a protium plasma. However, exposure of the D-plasma-exposed W samples to the He-seeded H plasma reduces the amount of released deuterium as compared to pure H plasma exposure.

  3. Carbon-14 and deuterium isotope effects in the borderline solvolysis of isopropyl. beta. -naphthalenesulfonate

    SciTech Connect

    Ando, T.; Yamataka, H.; Tamura, S.; Hanafusa, T.

    1982-10-06

    The present investigation verifies that ..cap alpha..- and ..beta..-carbon-14 kinetic isotope effects are sensitive to mechanistic changes in the borderline solvolysis. Model calculations of kinetic isotope effects using the observed data for all the carbons and deuteriums enables one to describe the variable transition-state structures of the solvolysis of simple secondary substrates, which is still a subject of much debate in recent years. A study along this line is now in progress.

  4. Structural Insights into Fibrinogen Dynamics Using Amide Hydrogen/Deuterium Exchange Mass Spectrometry

    PubMed Central

    Marsh, James J.; Guan, Henry S.; Li, Sheng; Chiles, Peter G.; Tran, Danny; Morris, Timothy A.

    2013-01-01

    We determined the amide hydrogen/deuterium exchange profile of native human fibrinogen under physiologic conditions. After optimization of the quench and proteolysis conditions, more than 1,200 peptides were identified by mass spectrometry, spanning more than 90% of the constituent A?, B?, and ? chain amino acid sequences. The compact central and distal globular regions of fibrinogen were well protected from deuterium exchange, with the exception of the unfolded amino-terminal segments of the A? and B? chains extending from the central region, and the short ? chain tail extending from each distal globular region. The triple-helical coiled-coil regions, which bridge the central region to each distal region, were also well protected with the exception of a moderately fast-exchanging area in the middle of each coiled coil adjacent to the ? chain carbohydrate attachment site. These dynamic regions appear to provide flexibility to the fibrinogen molecule. The ? chain out loop contained within each coiled-coil also exchanged rapidly. The ?C domain (A? 392610) exchanged rapidly, with the exception of a short segment sandwiched between a conserved disulfide linkage in the N-terminal ?C subdomain. This latter finding is consistent with a mostly disordered structure for the ?C domain in native fibrinogen. Analysis of the dysfibrinogen B? 235 Pro/Leu, which exhibits abnormal fibrin structure, revealed enhanced deuterium exchange surrounding the Pro/Leu substitution site as well as in the vicinity of the high affinity calcium binding site and the A knob polymerization pocket within the ?C domain. The implication of these changes with respect to fibrin structure is discussed. PMID:23875785

  5. Localized hydration in lyophilized myoglobin by hydrogen-deuterium exchange mass spectrometry. 2. Exchange kinetics.

    PubMed

    Sophocleous, Andreas M; Topp, Elizabeth M

    2012-04-01

    Solid-state hydrogen-deuterium exchange with mass spectrometric analysis (ssHDX) is a promising method for characterizing proteins in amorphous solids. Though analysis of HDX kinetics is informative and well-established in solution, application of these methods to solid samples is complicated by possible heterogeneities in the solid. The studies reported here provide a detailed analysis of the kinetics of hydration and ssHDX for equine myoglobin (Mb) in solid matrices containing sucrose or mannitol. Water sorption was rapid relative to ssHDX, indicating that ssHDX kinetics was not limited by bulk water transport. Deuterium uptake in solids was well-characterized by a biexponential model; values for regression parameters provided insight into differences between the two solid matrices. Analysis of the widths of peptide mass envelopes revealed that, in solution, an apparent EX2 mechanism prevails, consistent with native conformation of the protein. In contrast, in mannitol-containing samples, a smaller non-native subpopulation exchanges by an EX1-like mechanism. Together, the results indicate that the analysis of ssHDX kinetic data and of the widths of peptide mass envelopes is useful in screening solid formulations of protein drugs for the presence of non-native species that cannot be detected by amide I FTIR. PMID:22352990

  6. Structural changes of ultrasonicated bovine serum albumin revealed by hydrogen-deuterium exchange and mass spectrometry.

    PubMed

    Zhang, Qiuting; Tu, Zongcai; Wang, Hui; Huang, Xiaoqin; Sha, Xiaomei; Xiao, Hui

    2014-11-01

    The structural changes of bovine serum albumin (BSA) under high-intensity ultrasonication were investigated by fluorescence spectroscopy and mass spectrometry. Evidence for the ultrasonication-induced conformational changes of BSA was provided by the intensity changes and maximum-wavelength shift in fluorescence spectrometry. Matrix-assisted laser desorption-ionization time-of-flight mass spectroscopy (MALDI-TOF MS) revealed the increased intensity of the peak at the charge state +5 and a newly emerged peak at charge state +6, indicating that the protein became unfolded after ultrasonication. Prevalent unfolding of BSA after ultrasonication was revealed by hydrogen-deuterium exchange coupled with mass spectrometry (HDX-MS). Increased intensity and duration of ultrasonication further promoted the unfolding of the protein. The unfolding induced by ultrasonication goes through an intermediate state similar to that induced by a low concentration of denaturant. PMID:25224638

  7. Method and source for producing a high concentration of positively charged molecular hydrogen or deuterium ions

    DOEpatents

    Ehlers, Kenneth W. (Alamo, CA); Leung, Ka-Ngo (Hercules, CA)

    1988-01-01

    A high concentration of positive molecular ions of hydrogen or deuterium gas is extracted from a positive ion source having a short path length of extracted ions, relative to the mean free path of the gas molecules, to minimize the production of other ion species by collision between the positive ions and gas molecules. The ion source has arrays of permanent magnets to produce a multi-cusp magnetic field in regions remote from the plasma grid and the electron emitters, for largely confining the plasma to the space therebetween. The ion source has a chamber which is short in length, relative to its transverse dimensions, and the electron emitters are at an even shorter distance from the plasma grid, which contains one or more extraction apertures.

  8. Aspartic protease nepenthesin-1 as a tool for digestion in hydrogen/deuterium exchange mass spectrometry.

    PubMed

    Kadek, Alan; Mrazek, Hynek; Halada, Petr; Rey, Martial; Schriemer, David C; Man, Petr

    2014-05-01

    Hydrogen/deuterium exchange coupled to mass spectrometry (HXMS) utilizes enzymatic digestion of proteins to localize the information about altered exchange patterns in protein structure. The ability of the protease to produce small peptides and overlapping fragments and provide sufficient coverage of the protein sequence is essential for localizing regions of interest. Recently, it was shown that there is an interesting group of proteolytic enzymes from carnivorous pitcher plants of the genus Nepenthes. In this report, we describe successful immobilization and the use of one of these enzymes, nepenthesin-1, in HXMS workflow. In contrast to pepsin, it has different cleavage specificities, and despite its high inherent susceptibility to reducing and denaturing agents, it is very stable upon immobilization and withstands even high concentration of guanidine hydrochloride and reducing agents. We show that denaturing agents can alter digestion by reducing protease activity and/or substrate solubility, and additionally, they influence the trapping of proteolytic peptides onto the reversed phase resin. PMID:24661217

  9. Development of a hydrogen and deuterium polarized gas target for application in storage rings. Progress report

    SciTech Connect

    Haeberli, W.

    1992-02-01

    Polarized gas targets of atomic hydrogen and deuterium have significant advantages over conventional polarized targets, e.g. chemical and isotopic purity, large polarization including deuteron tensor polarization, absence of strong magnetic fields, rapid polarization reversal. While in principle the beam of polarized atoms from an atomic beam source (Stern-Gerlach spin separation) can be used as a polarized target, the target thickness achieved is too small for most applications. We propose to increase the target thickness by injecting the polarized atoms into a storage cell. Provided the atoms survive several hundred wall collisions without losing their polarization, it will be possible to achieve a target thickness of 10{sup 13} to 10{sup 14} atoms/cm{sup 2} by injection of polarized atoms from an atomic-beam source into suitable cells. Such targets are very attractive as internal targets in storage rings.

  10. Development of a hydrogen and deuterium polarized gas target for application in storage rings

    SciTech Connect

    Haeberli, W.

    1992-02-01

    Polarized gas targets of atomic hydrogen and deuterium have significant advantages over conventional polarized targets, e.g. chemical and isotopic purity, large polarization including deuteron tensor polarization, absence of strong magnetic fields, rapid polarization reversal. While in principle the beam of polarized atoms from an atomic beam source (Stern-Gerlach spin separation) can be used as a polarized target, the target thickness achieved is too small for most applications. We propose to increase the target thickness by injecting the polarized atoms into a storage cell. Provided the atoms survive several hundred wall collisions without losing their polarization, it will be possible to achieve a target thickness of 10{sup 13} to 10{sup 14} atoms/cm{sup 2} by injection of polarized atoms from an atomic-beam source into suitable cells. Such targets are very attractive as internal targets in storage rings.

  11. Volume production of negative hydrogen and deuterium ions in a reflex-type ion source

    NASA Astrophysics Data System (ADS)

    Jimbo, K.; Ehlers, K. W.; Leung, K. N.; Pyle, R. V.

    1986-08-01

    The extraction of negative and positive hydrogen and deuterium ions from a reflex-type negative ion source has been investigated. Extracted positive and negative ion currents were measured as functions of the gas flow rate, the axial magnetic field, and the bias potential of the cylindrical wall of the arc-chamber. By biasing the cylindrical wall several volts negative relative to the anode, a maximum H - current of 9.7 mA ( J - ? 100 mA/cm2) and D - current of 4.1 mA ( J - ? 42 mA/cm2) were obtained in steady state operation. This result shows a factor of two improvement over previous data. The total impurity negative ion content was less than 1%. When the source was arranged for positive ion extraction, a high proton ratio (90%) was observed. The extracted negative ion current was approximately as large as the positive ion current.

  12. Dual Studies on a HydrogenDeuterium Exchange of Resorcinol and the Subsequent Kinetic Isotope Effect

    PubMed Central

    2015-01-01

    An efficient laboratory experiment has been developed for undergraduate students to conduct hydrogendeuterium (HD) exchange of resorcinol by electrophilic aromatic substitution using D2O and a catalytic amount of H2SO4. The resulting labeled product is characterized by 1H NMR. Students also visualize a significant kinetic isotope effect (kH/kD ? 3 to 4) by adding iodine tincture to solutions of unlabeled resorcinol and the HD exchange product. This method is highly adaptable to fit a target audience and has been successfully implemented in a pedagogical capacity with second-year introductory organic chemistry students as part of their laboratory curriculum. It was also adapted for students at the advanced high school level. PMID:25132687

  13. Mapping Protein-Ligand Interactions with Proteolytic Fragmentation, Hydrogen/Deuterium Exchange-Mass Spectrometry.

    PubMed

    Gallagher, Elyssia S; Hudgens, Jeffrey W

    2016-01-01

    Biological processes are the result of noncovalent, protein-ligand interactions, where the ligands range from small organic and inorganic molecules to lipids, nucleic acids, peptides, and proteins. Amide groups within proteins constantly exchange protons with water. When immersed in heavy water (D2O), mass spectrometry (MS) can measure the change of mass associated with the hydrogen to deuterium exchange (HDX). Protein-ligand interactions modify the hydrogen exchange rates of amide protons, and the measurement of the amide exchange rates can provide rich information regarding the dynamical structure of the protein-ligand complex. This chapter describes a protocol for conducting bottom-up, continuous uptake, proteolytic fragmentation HDX-MS experiments that can help identify and map the interacting peptides of a protein-ligand interface. This tutorial outlines the fundamental theory governing hydrogen exchange; provides practical information regarding the preparation of protein samples and solutions; and describes the exchange reaction, reaction quenching, enzymatic digestion, chromatographic separation, and peptide analysis by MS. Tables list representative combinations of fluidic components used by HDX-MS researchers and summarize the available HDX-MS analysis software packages. Additionally, two HDX-MS case studies are used to illustrate protein-ligand interactions involving: (1) a continuous sequence of interacting residues and (2) a set of discontinuously numbered residues, residing spatially near each other. PMID:26791987

  14. TDS Investigation of the Influence of Helium on Hydrogen Isotope Exchange in Tungsten at Sequential Exposures to Deuterium and Helium-Protium Plasmas

    NASA Astrophysics Data System (ADS)

    Bobyr, N. P.; Alimov, V. Kh.; Efimov, V. S.; Khripunov, B. I.; Gasparyan, Yu. M.; Spitsyn, A. V.; Golubeva, A. V.

    In the present work hydrogen isotopes exchange in recrystallized tungsten was investigated after sequential exposures to low energy deuterium (D) and helium-seeded protium (He-seeded H) plasmas at sample temperatures of 403 and 533 K. The total amount of deuterium retained in the recrystallized tungsten was measured by termodesorption spectroscopy (TDS). The results were compared with the amounts of deuterium retained in the top 8?m layer measured by the D(3He, p)4He nuclear reaction (NRA). It was found that deuterium mainly accumulates in a relatively thin surface layer (10-20 microns) at Texp = 403K and a thicker layer at Texp = 533K. A significant part of the deuterium retained in tungsten after primary D plasma exposure was released during sequential exposure to a protium plasma. However, seeding of He ions into the H plasma reduces the amount of released deuterium. Deuterium depletion strongly depends on the temperature of the sample.

  15. Dissociative adsorption of molecular deuterium and thermal stability onto hydrogenated, bare and ion beam damaged poly- and single crystalline diamond surfaces

    NASA Astrophysics Data System (ADS)

    Michaelson, Sh.; Chandran, M.; Zalkind, S.; Shamir, N.; Akhvlediani, R.; Hoffman, A.

    2015-12-01

    In this work we report on dissociative adsorption of deuterium (D2) on bare, hydrogenated and ion beam bombarded polycrystalline and single crystalline diamond surfaces. Polycrystalline diamond films with an average grain size of ~ 300 nm were deposited on silicon substrates by hot filament chemical vapor deposition technique from methane/hydrogen gas mixture. Deposited films were characterized using Raman spectroscopy, atomic force microscopy and scanning electron microscopy to estimate the phase composition and microstructure. High resolution electron energy loss spectroscopy and direct recoil spectrometry were used to study hydrogen (deuterium) bonding configuration of the upper surface region. Near surface amorphization was achieved by 1 keV Ar+ implantation at ~ 1 × 1015 ions/cm2 at room temperature (RT). As deposited and Ar+ bombarded films are annealed to 500-1000 °C in ultra-high vacuum conditions and also under D2 partial pressure of 5 × 10- 6 Torr. For comparison, key experiments were repeated on the single crystal (100) diamond. Our results clearly show the preferential dissociative adsorption of D2 on low hybridized carbon (sp/sp2) states with activation temperature as low as RT, but with a lower thermal stability compared to pure diamond Csbnd D bonds.

  16. In situ study of erosion and deposition of amorphous hydrogenated carbon films by exposure to a hydrogen atom beam

    SciTech Connect

    Markelj, Sabina; Pelicon, Primoz; Cadez, Iztok; Schwarz-Selinger, Thomas; Jacob, Wolfgang

    2012-07-15

    This paper reports on the first dual-beam experiment employing a hydrogen atom beam for sample exposure and an ion beam for analysis, enabling in situ and real-time studies of hydrogen atom interaction with materials. The erosion of an amorphous hydrogenated carbon (a-C:H) layer by deuterium atoms at 580 K sample temperature was studied and the uptake of deuterium during the erosion process was measured in real time. The deuterium areal density increased at the beginning to 7.3 Multiplication-Sign 10{sup 15} D cm{sup -2}, but then stabilized at a constant value of 5.5 Multiplication-Sign 10{sup 15} D cm{sup -2}. Formation of a polymer-like deposit on an a-C:H layer held at room temperature and subjected to the deuterium atom beam was observed and also studied in situ. For both erosion and deposition studies an a-{sup 13}C:H layer on top of an Si substrate was used as a sample, making the experiments isotopically fully specified and thereby differentiating the deposited from the original layer and the interacting D atoms from H atoms present in the layer and in the residual vacuum. From the deposition study it was shown that carbon in the deposited layer originates from carbon-carrying species in the background vacuum that interact with hydrogen atoms. The areal density of the carbon at the surface was determined from the energy shift of the Si edge in the Rutherford backscattering spectrum. The cross section for {sup 7}Li on D at 4.3 MeV Li ion energy and at a recoil angle of 30 Degree-Sign was also determined to be (236 {+-} 16) Multiplication-Sign 10{sup -27} cm{sup 2}/sr. This is a factor of 3 {+-} 0.2 times higher than the Rutherford elastic cross section.

  17. Absorption and desorption of hydrogen, deuterium, and tritium for Zr--V--Fe getter

    SciTech Connect

    Ichimura, K.; Inoue, N.; Watanabe, K.; Takeuchi, T.

    1984-07-01

    Nonevaporable getters have wide applicability for developing the tritium handling techniques for thermonuclear fusion devices. From this viewpoint, mechanisms of the absorption and desorption of hydrogen isotopes and the isotope effects were investigated for a Zr--V--Fe alloy (St-707) by means of the mass analyzed thermal desorption spectroscopy. It was observed that the absorption rate was proportional to the first power of the pressure, indicating that the rate limiting step is the dissociative adsorption of hydrogen isotopes on the surface. The activation energy was very small, in the order of magnitude of a few tens of calories per mole in a temperature range from -196 to 200 /sup 0/C. The desorption rate was proportional to the square of the amount of absorption, indicating that the rate limiting step is the associative desorption reaction of hydrogen atoms or ions diffused to the surface from the bulk. The rate constants for hydrogen and deuterium were determined as k/sub d/(H/sub 2/) = (5.3/sup +2.6//sub -1.7/)exp(-(28.0 +- 0.7) x 10/sup 3//RT) and k/sub d/(D/sub 2/) = (5.0/sup +2.7//sub -1.7/)exp(-(28.6 +- 0.8) x 10/sup 3//RT) in (1/Pa 1 s), respectively, where R is in (cal/mol deg). With regard to tritium, the rate constant was evaluated as k/sub d/(T/sub 2/) = (5.0/sup +20//sub -4.0/)exp(-(29.3 +- 3) x 10/sup 3//RT), however, the frequency factor will have to be corrected by knowing the relative sensitivity factor of the mass spectrometer for tritium (T/sub 2/).

  18. ORFEUS II echelle spectra: deuterium and molecular hydrogen in the ISM towards BD +39 3226

    NASA Astrophysics Data System (ADS)

    Bluhm, H.; Marggraf, O.; de Boer, K. S.; Richter, P.; Heber, U.

    1999-12-01

    In ORFEUS II spectra of the sdO star BD +39 3226 interstellar hydrogen and deuterium is detected. >From Ly alpha profile fitting and a curve of growth analysis of the Lyman series of H I and D I we derive the column densities N_H = 1.20+0.28}-0.22}{*10{20 cm-2 and N_D = 1.45+0.50}-0.38}{*10{15 cm-2. >From the analysis of metal absorption lines in ORFEUS and IUE spectra we obtain column densities for 11 elements. In addition, we examine absorption lines of H_2 for rotational excitation states up to J=7. We find an H_2 ortho-to-para ratio of 2.5, the fractional abundance of molecular hydrogen has a low value of log f=-4.08 for a total amount of N(H_2)=4.8+2.0}-1.6}{*10{15cm- 2. The column densities of the excitation states reveal a moderate Boltzmann excitation temperature of 130 K and an equivalent excitation temperature for the excited upper states due to UV pumping of <1800 K. Based on data obtained under the DARA ORFEUS guest observer programme

  19. Nepenthesin from Monkey Cups for Hydrogen/Deuterium Exchange Mass Spectrometry*

    PubMed Central

    Rey, Martial; Yang, Menglin; Burns, Kyle M.; Yu, Yaping; Lees-Miller, Susan P.; Schriemer, David C.

    2013-01-01

    Studies of protein dynamics, structure and interactions using hydrogen/deuterium exchange mass spectrometry (HDX-MS) have sharply increased over the past 510 years. The predominant technology requires fast digestion at pH 23 to retain deuterium label. Pepsin is used almost exclusively, but it provides relatively low efficiency under the constraints of the experiment, and a selectivity profile that renders poor coverage of intrinsically disordered regions. In this study we present nepenthesin-containing secretions of the pitcher plant Nepenthes, commonly called monkey cups, for use in HDX-MS. We show that nepenthesin is at least 1400-fold more efficient than pepsin under HDX-competent conditions, with a selectivity profile that mimics pepsin in part, but also includes efficient cleavage C-terminal to forbidden residues K, R, H, and P. High efficiency permits a solution-based analysis with no detectable autolysis, avoiding the complication of immobilized enzyme reactors. Relaxed selectivity promotes high coverage of disordered regions and the ability to tune the mass map for regions of interest. Nepenthesin-enriched secretions were applied to an analysis of protein complexes in the nonhomologous end-joining DNA repair pathway. The analysis of XRCC4 binding to the BRCT domains of Ligase IV points to secondary interactions between the disordered C-terminal tail of XRCC4 and remote regions of the BRCT domains, which could only be identified with a nepenthesin-based workflow. HDX data suggest that stalk-binding to XRCC4 primes a BRCT conformation in these remote regions to support tail interaction, an event which may be phosphoregulated. We conclude that nepenthesin is an effective alternative to pepsin for all HDX-MS applications, and especially for the analysis of structural transitions among intrinsically disordered proteins and their binding partners. PMID:23197791

  20. Nepenthesin from monkey cups for hydrogen/deuterium exchange mass spectrometry.

    PubMed

    Rey, Martial; Yang, Menglin; Burns, Kyle M; Yu, Yaping; Lees-Miller, Susan P; Schriemer, David C

    2013-02-01

    Studies of protein dynamics, structure and interactions using hydrogen/deuterium exchange mass spectrometry (HDX-MS) have sharply increased over the past 5-10 years. The predominant technology requires fast digestion at pH 2-3 to retain deuterium label. Pepsin is used almost exclusively, but it provides relatively low efficiency under the constraints of the experiment, and a selectivity profile that renders poor coverage of intrinsically disordered regions. In this study we present nepenthesin-containing secretions of the pitcher plant Nepenthes, commonly called monkey cups, for use in HDX-MS. We show that nepenthesin is at least 1400-fold more efficient than pepsin under HDX-competent conditions, with a selectivity profile that mimics pepsin in part, but also includes efficient cleavage C-terminal to "forbidden" residues K, R, H, and P. High efficiency permits a solution-based analysis with no detectable autolysis, avoiding the complication of immobilized enzyme reactors. Relaxed selectivity promotes high coverage of disordered regions and the ability to "tune" the mass map for regions of interest. Nepenthesin-enriched secretions were applied to an analysis of protein complexes in the nonhomologous end-joining DNA repair pathway. The analysis of XRCC4 binding to the BRCT domains of Ligase IV points to secondary interactions between the disordered C-terminal tail of XRCC4 and remote regions of the BRCT domains, which could only be identified with a nepenthesin-based workflow. HDX data suggest that stalk-binding to XRCC4 primes a BRCT conformation in these remote regions to support tail interaction, an event which may be phosphoregulated. We conclude that nepenthesin is an effective alternative to pepsin for all HDX-MS applications, and especially for the analysis of structural transitions among intrinsically disordered proteins and their binding partners. PMID:23197791

  1. Structural analysis of the interleukin-8/glycosaminoglycan interactions by amide hydrogen/deuterium exchange mass spectrometry.

    PubMed

    Hofmann, Tommy; Samsonov, Sergey A; Pichert, Annelie; Lemmnitzer, Katharina; Schiller, Jrgen; Huster, Daniel; Pisabarro, M Teresa; von Bergen, Martin; Kalkhof, Stefan

    2015-11-01

    The recruitment of different chemokines and growth factors by glycosaminoglycans (GAGs) such as chondroitin sulfate or hyaluronan plays a critical role in wound healing processes. Thus, there is a special interest in the design of artificial extracellular matrices with improved properties concerning GAG interaction with common regulating proteins. In this study, amide hydrogen/deuterium (H/D) exchange mass spectrometry (HDX MS) combined with molecular modeling and docking experiments was used to obtain structural models of proinflammatory chemokine interleukin-8 (IL-8) in complex with hexameric chondroitin sulfate. Experiments on the intact protein showed a difference in deuterium labeling of IL-8 due to chondroitin sulfate binding. The extent of deuteration was reduced from 24% to 13% after 2min exchange time, which corresponds to a reduced exchange of approximately 10 backbone amides. By local HDX MS experiments, H/D exchange information on the complete sequence of IL-8 could be obtained. A significantly reduced H/D exchange, especially of the C-terminal ?-helical region comprising amino acids 70-77 and to the loop comprising amino acids 27-29 was observed in the presence of chondroitin sulfate. HDX MS data were used to model the IL-8/chondroitin sulfate complex. The binding interface of IL-8 and chondroitin sulfate determined this way correlated excellently with the corresponding NMR based atomistic model previously published. Our results demonstrate that HDX-MS in combination with molecular modeling is a valuable approach for the analysis of protein/GAG complexes at physiological pH, temperature, and salt concentration. The fact that HDX-MS requires only micrograms of protein and GAGs makes it a very promising technique to address protein-GAG interactions. PMID:25726910

  2. Catalytic hydrogenation of carbon monoxide

    SciTech Connect

    Wayland, B.B.

    1992-12-01

    This project is focused on developing strategies to accomplish the reduction and hydrogenation of carbon monoxide to produce organic oxygenates at mild conditions. Our approaches to this issue are based on the recognition that rhodium macrocycles have unusually favorable thermodynamic values for producing a series of intermediate implicated in the catalytic hydrogenation of CO. Observations of metalloformyl complexes produced by reactions of H{sub 2} and CO, and reductive coupling of CO to form metallo {alpha}-diketone species have suggested a multiplicity of routes to organic oxygenates that utilize these species as intermediates. Thermodynamic and kinetic-mechanistic studies are used in constructing energy profiles for a variety of potential pathways, and these schemes are used in guiding the design of new metallospecies to improve the thermodynamic and kinetic factors for individual steps in the overall process. Variation of the electronic and steric effects associated with the ligand arrays along with the influences of the reaction medium provide the chemical tools for tuning these factors. Emerging knowledge of the factors that contribute to M-H, M-C and M-O bond enthalpies is directing the search for ligand arrays that will expand the range of metal species that have favorable thermodynamic parameters to produce the primary intermediates for CO hydrogenation. Studies of rhodium complexes are being extended to non-macrocyclic ligand complexes that emulate the favorable thermodynamic features associated with rhodium macrocycles, but that also manifest improved reaction kinetics. Multifunctional catalyst systems designed to couple the ability of rhodium complexes to produce formyl and diketone intermediates with a second catalyst that hydrogenates these imtermediates are promising approaches to accomplish CO hydrogenation at mild conditions.

  3. Infrared spectroscopic study of photoreceptor membrane and purple membrane. Protein secondary structure and hydrogen deuterium exchange

    SciTech Connect

    Downer, N.W.; Bruchman, T.J.; Hazzard, J.H.

    1986-03-15

    Infrared spectroscopy in the interval from 1800 to 1300 cm-1 has been used to investigate the secondary structure and the hydrogen/deuterium exchange behavior of bacteriorhodopsin and bovine rhodopsin in their respective native membranes. The amide I' and amide II' regions from spectra of membrane suspensions in D2O were decomposed into constituent bands by use of a curve-fitting procedure. The amide I' bands could be fit with a minimum of three theoretical components having peak positions at 1664, 1638, and 1625 cm-1 for bacteriorhodopsin and 1657, 1639, and 1625 cm-1 for rhodopsin. For both of these membrane proteins, the amide I' spectrum suggests that alpha-helix is the predominant form of peptide chain secondary structure, but that a substantial amount of beta-sheet conformation is present as well. The shape of the amide I' band was pH-sensitive for photoreceptor membranes, but not for purple membrane, indicating that membrane-bound rhodopsin undergoes a conformation change at acidic pH. Peptide hydrogen exchange of bacteriorhodopsin and rhodopsin was monitored by observing the change in the ratio of integrated absorbance (Aamide II'/Aamide I') during the interval from 1.5 to 25 h after membranes were introduced into buffered D2O. The fraction of peptide groups in a very slowly exchanging secondary structure was estimated to be 0.71 for bacteriorhodopsin at pD 7. The corresponding fraction in vertebrate rhodopsin was estimated to be less than or equal to 0.60. These findings are discussed in relationship to previous studies of hydrogen exchange behavior and to structural models for both proteins.

  4. A deuterium-calibrated groundwater flow model of a regional carbonate-alluvial system

    NASA Astrophysics Data System (ADS)

    Kirk, Stephen T.; Campana, Michael E.

    1990-11-01

    The White River Flow System (WRFS), a regional carbonate-alluvial groundwater system in southeastern Nevada, U.S.A., contains large amounts of water in storage, especially in the underlying carbonate reservoir. As the population of Nevada grows, it may become necessary to tap the resources of this and other regional carbonate systems. Because of the depth to the carbonate reservoir and, until now, lack of motivation to collect detailed hydrogeological data on it, the state of knowledge of flow in the carbonate system is poor. However, a simple mixing-cell flow model of the WRFS can be constructed and calibrated with the spatial distribution of the stable isotope deuterium. This type of model subdivides the system into carbonate and alluvial cells and routes water and deuterium through the entire cell network. It provides estimates of recharge rates, groundwater ages and volumes of water in storage. Transience in recharge rates and their deuterium signatures are unaccounted for by the model. The lack of constraints on the system mandates the calibration of three different flow scenarios, each of which differs slightly from the other. Despite these differences, some consistent quantitative results are obtained. Foremost among these are: (1) the carbonate aquifer may contain as much as 752 km 3 of water in storage; (2) recharge from the Sheep Range to Coyote Spring Valley is at least 90% greater than previously believed; (3) Lower Meadow Valley is part of the WRFS and contributes underflow to Upper Moapa Valley; (4) underflow with an average value of 0.163 m 3 s -1 flows westward out of the system along the Pahranagat Shear Zone; (5) recharge to the alluvial system is greater than that to the carbonate system; (6) groundwater mean ages range from 1600 to 34 000 years, with the oldest waters exceeding 100 000 years old. The results also demonstrate that deuterium can be used to calibrate simple flow models and provide groundwater ages. Despite the uncertainties and lack of constraints in mixing-cell models, they provide first approximations to information which, until now, has been difficult, if not impossible, to obtain. These models are especially useful for analyzing sparse-data systems, testing different flow hypotheses with minimal effort, providing ranges in parameter estimates, guiding future data collection and serving as precursors for the development of more sophisticated models.

  5. Hydrogen on Cobalt: The Effects of Carbon Monoxide and Sulphur Additives on the D2/Co(0001) System

    NASA Astrophysics Data System (ADS)

    Habermehl-Cwirzen, K. M. E.; Kauraala, K.; Lahtinen, J.

    Hydrogen reaction on catalytic surfaces is an important field of research in fuel cell science. The adsorption of hydrogen (deuterium) on Co(0001) and the influence of carbon monoxide and sulphur on the adsorption were studied by XPS, TDS, WF measurements and LEED. The WF increased due to D2 adsorption, revealing the electronegative character of deuterium. It was found that the deuterium saturation coverage is e 1/4 0.17 ML at 320 K and e 1/4 0.27 ML at 180 K. The activation energy for desorption was estimated to be 33 kJ/mol. The coadsorption measurements with CO indicated a decrease in the deuterium yield by 50%. A downward shift of 50 K in the deuterium desorption temperature was observed as a consequence of coadsorbed CO, but changes in the CO desorption were minimal. At small CO exposures the (2 A~ 2) LEED structure of deuterium was seen, while at exposures of above 5 L the (2 e 3 A~ 2 e 3)R30… structure was detected by LEED as with pure CO adsorption. Coadsorption with sulphur led also to a decrease in the D2 yield leading to a complete inhibition of hydrogen adsorption at sulphur saturation. The sulphur (2 A~ 2) LEED structure did not underwent changes due to deuterium adsorption. As assumed, sulphur worked as a strong poison to the adsorption on Co(0001).

  6. Carbon and hydrogen isotope fractionation by moderately thermophilic methanogens

    NASA Astrophysics Data System (ADS)

    Valentine, David L.; Chidthaisong, Amnat; Rice, Andrew; Reeburgh, William S.; Tyler, Stanley C.

    2004-04-01

    A series of laboratory studies were conducted to increase understanding of stable carbon ( 13C/ 12C) and hydrogen (D/H) isotope fractionation arising from methanogenesis by moderately thermophilic acetate- and hydrogen-consuming methanogens. Studies of the aceticlastic reaction were conducted with two closely related strains of Methanosaeta thermophila. Results demonstrate a carbon isotope fractionation of only 7 (? = 1.007) between the methyl position of acetate and the resulting methane. Methane formed by this process is enriched in 13C when compared with other natural sources of methane; the magnitude of this isotope effect raises the possibility that methane produced at elevated temperature by the aceticlastic reaction could be mistaken for thermogenic methane based on carbon isotopic content. Studies of H 2/CO 2 methanogenesis were conducted with Methanothermobacter marburgensis. The fractionation of carbon isotopes between CO 2 and CH 4 was found to range from 22 to 58 (1.023 ? ? ? 1.064). Greater fractionation was associated with low levels of molecular hydrogen and steady-state metabolism. The fractionation of hydrogen isotopes between source H 2O and CH 4 was found to range from 127 to 275 (1.16 ? ? ? 1.43). Fractionation was dependent on growth phase with greater fractionation associated with later growth stages. The maximum observed fractionation factor was 1.43, independent of the ?D-H 2 supplied to the culture. Fractionation was positively correlated with temperature and/or metabolic rate. Results demonstrate significant variability in both hydrogen and carbon isotope fractionation during methanogenesis from H 2/CO 2. The relatively small fractionation associated with deuterium during H 2/CO 2 methanogenesis provides an explanation for the relatively enriched deuterium content of biogenic natural gas originating from a variety of thermal environments. Results from these experiments are used to develop a hypothesis that differential reversibility in the enzymatic steps of the H 2/CO 2 pathway gives rise to variability in the observed carbon isotope fractionation. Results are further used to constrain the overall efficiency of electron consumption by way of the hydrogenase system in M. marburgensis, which is calculated to be less than 55%.

  7. HDX match software for the data analysis of top-down ECD-FTMS hydrogen/deuterium exchange experiments.

    PubMed

    Petrotchenko, Evgeniy V; Borchers, Christoph H

    2015-11-01

    Hydrogen/deuterium exchange (HDX) combined with mass spectrometry is a powerful technique for studying protein structure. The recently developed top-down ECD-FTMS HDX approach (Pan J. et al., JACS, 2008) allows determination of the hydrogen/deuterium exchange of a protein's amide bonds, down to the single residue resolution. One of the existing limitations of this technology has been the laborious manual analysis of the MS/MS spectra. Here we present a software program for processing the data from these experiments. This program assigns the c- and z-fragment ion series of the protein, and calculates the number of the exchanged amide protons for each fragment by fitting the theoretically predicted isotopic envelopes of the deuterated fragments to the experimental data. Graphical Abstract ?. PMID:26162650

  8. HDX Match Software for the Data Analysis of Top-Down ECD-FTMS Hydrogen/Deuterium Exchange Experiments

    NASA Astrophysics Data System (ADS)

    Petrotchenko, Evgeniy V.; Borchers, Christoph H.

    2015-11-01

    Hydrogen/deuterium exchange (HDX) combined with mass spectrometry is a powerful technique for studying protein structure. The recently developed top-down ECD-FTMS HDX approach (Pan J. et al., JACS, 2008) allows determination of the hydrogen/deuterium exchange of a protein's amide bonds, down to the single residue resolution. One of the existing limitations of this technology has been the laborious manual analysis of the MS/MS spectra. Here we present a software program for processing the data from these experiments. This program assigns the c- and z-fragment ion series of the protein, and calculates the number of the exchanged amide protons for each fragment by fitting the theoretically predicted isotopic envelopes of the deuterated fragments to the experimental data.

  9. Ion Mobility Spectrometry-Hydrogen Deuterium Exchange Mass Spectrometry of Anions: Part 1. Peptides to Proteins

    NASA Astrophysics Data System (ADS)

    Donohoe, Gregory C.; Khakinejad, Mahdiar; Valentine, Stephen J.

    2015-04-01

    Ion mobility spectrometry (IMS) coupled with hydrogen deuterium exchange (HDX)-mass spectrometry (MS) has been used to study the conformations of negatively-charged peptide and protein ions. Results are presented for ion conformers of angiotensin 1, a synthetic peptide (SP), bovine insulin, ubiquitin, and equine cytochrome c. In general, the SP ion conformers demonstrate a greater level of HDX efficiency as a greater proportion of the sites undergo HDX. Additionally, these ions exhibit the fastest rates of exchange. Comparatively, the angiotensin 1 ions exhibit a lower rate of exchange and HDX level presumably because of decreased accessibility of exchange sites by charge sites. The latter are likely confined to the peptide termini. Insulin ions show dramatically reduced HDX levels and exchange rates, which can be attributed to decreased conformational flexibility resulting from the disulfide bonds. For the larger ubiquitin and protein ions, increased HDX is observed for larger ions of higher charge state. For ubiquitin, a conformational transition from compact to more elongated species (from lower to higher charge states) is reflected by an increase in HDX levels. These results can be explained by a combination of interior site protection by compact conformers as well as decreased access by charge sites. The elongated cytochrome c ions provide the largest HDX levels where higher values correlate with charge state. These results are consistent with increased exchange site accessibility by additional charge sites. The data from these enhanced IMS-HDX experiments are described in terms of charge site location, conformer rigidity, and interior site protection.

  10. Microscopic self-dynamics in liquid hydrogen and in its mixtures with deuterium

    SciTech Connect

    Colognesi, D.; Celli, M.; Zoppi, M.; Neumann, M.

    2004-12-01

    We have measured the dynamic structure factor of liquid parahydrogen, pure and mixed with deuterium, in various thermodynamic conditions using incoherent inelastic neutron scattering. The experiments were carried out on TOSCA-II, a new time-of-flight, inverse-geometry, crystal-analyzer spectrometer. After an accurate data reduction, the high-energy parts of the neutron spectra recorded in backward scattering were studied through the modified Young and Koppel model, from which the mean kinetic energy values for a hydrogen molecule were estimated. In addition the low-energy parts of the neutron spectra recorded in forward scattering were analyzed in the framework of the Gaussian approximation and fitted through a Levesque-Verlet model for the velocity autocorrelation function. Thus various physical quantities are determined and compared with accurate path integral Monte Carlo simulations. Despite the excellent quality of these fits, the velocity autocorrelation functions derived from the forward-scattering data appear totally unable to properly describe the backward-scattering ones. These findings prove an unquestionable breakdown of the Gaussian approximation in semiquantum liquids. The present results appear of great interest and suggest further investigation on the limits of the widely used Gaussian approximation.

  11. Differential hydrogen/deuterium exchange mass spectrometry analysis of protein–ligand interactions

    PubMed Central

    Chalmers, Michael J; Busby, Scott A; Pascal, Bruce D; West, Graham M; Griffin, Patrick R

    2011-01-01

    Functional regulation of ligand-activated receptors is driven by alterations in the conformational dynamics of the protein upon ligand binding. Differential hydrogen/deuterium exchange (HDX) coupled with mass spectrometry has emerged as a rapid and sensitive approach for characterization of perturbations in conformational dynamics of proteins following ligand binding. While this technique is sensitive to detecting ligand interactions and alterations in receptor dynamics, it also can provide important mechanistic insights into ligand regulation. For example, HDX has been used to determine a novel mechanism of ligand activation of the nuclear receptor peroxisome proliferator activated receptor-γ, perform detailed analyses of binding modes of ligands within the ligand-binding pocket of two estrogen receptor isoforms, providing insight into selectivity, and helped classify different types of estrogen receptor-α ligands by correlating their pharmacology with the way they interact with the receptor based solely on hierarchical clustering of receptor HDX signatures. Beyond small-molecule–receptor interactions, this technique has also been applied to study protein–protein complexes, such as mapping antibody–antigen interactions. In this article, we summarize the current state of the differential HDX approaches and the future outlook. We summarize how HDX analysis of protein–ligand interactions has had an impact on biology and drug discovery. PMID:21329427

  12. Rapid refinement of crystallographic protein construct definition employing enhanced hydrogen/deuterium exchange MS.

    PubMed

    Pantazatos, Dennis; Kim, Jack S; Klock, Heath E; Stevens, Raymond C; Wilson, Ian A; Lesley, Scott A; Woods, Virgil L

    2004-01-20

    Crystallographic efforts often fail to produce suitably diffracting protein crystals. Unstructured regions of proteins play an important role in this problem and considerable advantage can be gained in removing them. We have developed a number of enhancements to amide hydrogen/high-throughput and high-resolution deuterium exchange MS (DXMS) technology that allow rapid identification of unstructured regions in proteins. To demonstrate the utility of this approach for improving crystallization success, DXMS analysis was attempted on 24 Thermotoga maritima proteins with varying crystallization and diffraction characteristics. Data acquisition and analysis for 21 of these proteins was completed in 2 weeks and resulted in the localization and prediction of several unstructured regions within the proteins. When compared with those targets of known structure, the DXMS method correctly localized even small regions of disorder. DXMS analysis was then correlated with the propensity of such targets to crystallize and was further used to define truncations that improved crystallization. Truncations that were defined solely on DXMS analysis demonstrated greatly improved crystallization and have been used for structure determination. This approach represents a rapid and generalized method that can be applied to structural genomics or other targets in a high-throughput manner. PMID:14715906

  13. Volume Production of Negative Hydrogen and Deuterium Ions in aReflex-Type Ion Source

    SciTech Connect

    Jimbo, K.; Ehlers, K.W.; Leung, K.N.; Pyle, R.V.

    1986-01-01

    The extraction of negative and positive hydrogen and deuterium ions from a reflex-type negative ion source has been investigated. Extracted positive and negative ion currents were measured as functions of the gas flow rate, the axial magnetic field, and the bias potential of the cylindrical wall of the arc-chamber. By biasing the cylindrical wall several volts negative relative to the anode, a maximum H{sup -} current of 9.7 mA(J{sup -} {approx_equal} 100 mA/cm{sup 2}) and D{sup -} current of 4.1 mA (J{sup -} {approx_equal} 42 mA/cm{sup 2})were obtained in steady state operation. This result shows a factor of two improvement over previous data. The total impurity negative ion content was less than 1%. When the source was arranged for positive ion extraction, a high proton ratio (90%) was observed. The extracted negative ion current was approximately as large as the positive ion current.

  14. Start2Fold: a database of hydrogen/deuterium exchange data on protein folding and stability

    PubMed Central

    Pancsa, Rita; Varadi, Mihaly; Tompa, Peter; Vranken, Wim F.

    2016-01-01

    Proteins fulfil a wide range of tasks in cells; understanding how they fold into complex three-dimensional (3D) structures and how these structures remain stable while retaining sufficient dynamics for functionality is essential for the interpretation of overall protein behaviour. Since the 1950's, solvent exchange-based methods have been the most powerful experimental means to obtain information on the folding and stability of proteins. Considerable expertise and care were required to obtain the resulting datasets, which, despite their importance and intrinsic value, have never been collected, curated and classified. Start2Fold is an openly accessible database (http://start2fold.eu) of carefully curated hydrogen/deuterium exchange (HDX) data extracted from the literature that is open for new submissions from the community. The database entries contain (i) information on the proteins investigated and the underlying experimental procedures and (ii) the classification of the residues based on their exchange protection levels, also allowing for the instant visualization of the relevant residue groups on the 3D structures of the corresponding proteins. By providing a clear hierarchical framework for the easy sharing, comparison and (re-)interpretation of HDX data, Start2Fold intends to promote a better understanding of how the protein sequence encodes folding and structure as well as the development of new computational methods predicting protein folding and stability. PMID:26582925

  15. Localized Hydration in Lyophilized Myoglobin by Hydrogen-Deuterium Exchange Mass Spectrometry. 1. Exchange Mapping

    PubMed Central

    Sophocleous, Andreas M.; Zhang, Jun; Topp, Elizabeth M.

    2012-01-01

    The local effects of hydration on myoglobin (Mb) in solid matrices containing mannitol or sucrose (1:1 w/w, protein:additive) were mapped using hydrogen-deuterium exchange with mass spectrometric analysis (HDX-MS) at 5°C and compared to solution controls. Solid powders were exposed to D2O(g) at controlled activity (aw) followed by reconstitution and analysis of the intact protein and peptides produced by pepsin digestion. HDX varied with matrix type, aw, and position along the protein backbone. HDX was less in sucrose matrices than in mannitol matrices at all aw while the difference in solution was negligible. Differences in HDX in the two matrices were detectable despite similarities in their bulk water content. The extent of exchange in solids is proposed as a measure of the hydration of exchangeable amide groups, as well as protein conformation and dynamics; pepsin digestion allows these effects to be mapped with peptide-level resolution. PMID:22352965

  16. Start2Fold: a database of hydrogen/deuterium exchange data on protein folding and stability.

    PubMed

    Pancsa, Rita; Varadi, Mihaly; Tompa, Peter; Vranken, Wim F

    2016-01-01

    Proteins fulfil a wide range of tasks in cells; understanding how they fold into complex three-dimensional (3D) structures and how these structures remain stable while retaining sufficient dynamics for functionality is essential for the interpretation of overall protein behaviour. Since the 1950's, solvent exchange-based methods have been the most powerful experimental means to obtain information on the folding and stability of proteins. Considerable expertise and care were required to obtain the resulting datasets, which, despite their importance and intrinsic value, have never been collected, curated and classified. Start2Fold is an openly accessible database (http://start2fold.eu) of carefully curated hydrogen/deuterium exchange (HDX) data extracted from the literature that is open for new submissions from the community. The database entries contain (i) information on the proteins investigated and the underlying experimental procedures and (ii) the classification of the residues based on their exchange protection levels, also allowing for the instant visualization of the relevant residue groups on the 3D structures of the corresponding proteins. By providing a clear hierarchical framework for the easy sharing, comparison and (re-)interpretation of HDX data, Start2Fold intends to promote a better understanding of how the protein sequence encodes folding and structure as well as the development of new computational methods predicting protein folding and stability. PMID:26582925

  17. Deuterium isotope effects and fractionation factors of hydrogen-bonded A:T base pairs of DNA.

    PubMed

    Vakonakis, Ioannis; Salazar, Miguel; Kang, Mijeong; Dunbar, Kim R; LiWang, Andy C

    2003-02-01

    Deuterium isotope effects and fractionation factors of N1.H3-N3 hydrogen bonded Watson-Crick A:T base pairs of two DNA dodecamers are presented here. Specifically, two-bond deuterium isotope effects on the chemical shifts of (13)C2 and (13)C4, (2)delta(13)C2 and (2)delta(13)C4, and equilibrium deuterium/protium fractionation factors of H3, Phi, were measured and seen to correlate with the chemical shift of the corresponding imino proton, delta(H3). Downfield-shifted imino protons associated with larger values of (2)delta(13)C2 and (2)delta(13)C4 and smaller Phi values, which together suggested that the effective H3-N3 vibrational potentials were more anharmonic in the stronger hydrogen bonds of these DNA molecules. We anticipate that (2)delta(13)C2, (2)delta(13)C4 and Phi values can be useful gauges of hydrogen bond strength of A:T base pairs. PMID:12652119

  18. Optical multi-slit and x-ray measurements from carbon and deuterium pinches

    SciTech Connect

    Aliaga-Rossel, R.; Lebedev, S. V.; Chittenden, J. P.; Dangor, A. E.; Haines, M. G.

    1997-05-05

    Experiments carried out on the MAGPIE generator to study the optical and x-ray emission from carbon and deuterium fibres are presented. The generator was operated at 1.4 MV, peak current of 1 MA, rise time 150 ns. Carbon fibres of diameter of 33 {mu}m and 300 {mu}m were used. The following diagnostics were used: single pass interferometry, two frames schlieren photography, optical and x-ray streak cameras, four frames x-ray camera, single frame optical camera and time integrated pinhole camera. Rogowski coils and capacitive divider were used to monitor the electrical signals of the generator and the plasma. Time resolved measurements of x-ray emission were performed with a four frame x-ray camera. Each frame with a set of three filtered pinholes was used. The novel feature of this measurement is the employment of an optical streak camera with a set of slits arranged along the fibre axis, but displaced in the radial direction. This permitted us to study the axial and radial movement of the plasma regions that are emitting in the visible part of the spectra. Correlation between these regions of the plasma and the location of x-ray hot spots is discussed. Comparison between carbon and deuterium fibres is presented.

  19. Controlling hydrogen scrambling in multiply charged protein ions during collisional activation: implications for top-down hydrogen/deuterium exchange MS utilizing collisional activation in the gas phase.

    PubMed

    Abzalimov, Rinat R; Kaltashov, Igor A

    2010-02-01

    Hydrogen exchange in solution combined with ion fragmentation in the gas phase followed by MS detection emerged in recent years as a powerful tool to study higher order protein structure and dynamics. However, a certain type of ion chemistry in the gas phase, namely, internal rearrangement of labile hydrogen atoms (the so-called hydrogen scrambling), is often cited as a factor limiting the utility of this experimental technique. Although several studies have been carried out to elucidate the roles played by various factors in the occurrence and the extent of hydrogen scrambling, there is still no consensus as to what experimental protocol should be followed to avoid or minimize it. In this study we employ fragmentation of mass-selected subpopulations of protein ions to assess the extent of internal proton mobility prior to dissociation. A unique advantage of tandem MS is that it not only provides a means to map the deuterium content of protein ions whose overall levels of isotope incorporation can be precisely defined by controlling the mass selection window, but also correlates this spatial isotope distribution with such global characteristic as the protein ion charge state. Hydrogen scrambling does not occur when the charge state of the precursor protein ions selected for fragmentation is high. Fragment ions derived from both N- and C-terminal parts of the protein are equally unaffected by scrambling. However, spatial distribution of deuterium atoms obtained by fragmenting low-charge-density protein ions is consistent with a very high degree of scrambling prior to the dissociation events. The extent of hydrogen scrambling is also high when multistage fragmentation is used to probe deuterium incorporation locally. Taken together, the experimental results provide a coherent picture of intramolecular processes occurring prior to the dissociation event and provide guidance for the design of experiments whose outcome is unaffected by hydrogen scrambling. PMID:20055445

  20. Guanine nucleotide induced conformational change of Cdc42 revealed by hydrogen/deuterium exchange mass spectrometry.

    PubMed

    Yang, Sheng-Wei; Ting, Hsiu-Chi; Lo, Yi-Ting; Wu, Ting-Yuan; Huang, Hung-Wei; Yang, Chia-Jung; Chan, Jui-Fen Riva; Chuang, Min-Chieh; Hsu, Yuan-Hao Howard

    2016-01-01

    Cdc42 regulates pathways related to cell division. Dysregulation of Cdc42 can lead to cancer, cardiovascular diseases and neurodegenerative diseases. GTP induced activation mechanism plays an important role in the activity and biological functions of Cdc42. P-loop, Switch I and Switch II are critical regions modulating the enzymatic activity of Cdc42. We applied amide hydrogen/deuterium exchange coupled with liquid chromatography mass spectrometry (HDXMS) to investigate the dynamic changes of apo-Cdc42 after GDP, GTP and GMP-PCP binding. The natural substrate GTP induced significant decreases of deuteration in P-loop and Switch II, moderate changes of deuteration in Switch I and significant changes of deuteration in the ?7 helix, a region far away from the active site. GTP binding induced similar effects on H/D exchange to its non-hydrolysable analog, GMP-PCP. HDXMS results indicate that GTP binding blocked the solvent accessibility in the active site leading to the decrease of H/D exchange rate surrounding the active site, and further triggered a conformational change resulting in the drastic decrease of H/D exchange rate at the remote ?7 helix. Comparing the deuteration levels in three activation states of apo-Cdc42, Cdc42-GDP and Cdc42-GMP-PCP, the apo-Cdc42 has the most flexible structure, which can be stabilized by guanine nucleotide binding. The rates of H/D exchange of Cdc42-GDP are between the GMP-PCP-bound and the apo form, but more closely to the GMP-PCP-bound form. Our results show that the activation of Cdc42 is a process of conformational changes involved with P-loop, Switch II and ?7 helix for structural stabilization. PMID:26542736

  1. Operation of a cw rf driven ion source with hydrogen and deuterium gas{sup a}

    SciTech Connect

    Melnychuk, S.T.; Debiak, T.W.; Sredniawski, J.J.

    1996-04-01

    We will describe the operation of a cw rf driven multicusp ion source designed for extraction of high current hydrogen and deuterium beams. The source is driven at 2 MHz by a 2.5 turn induction antenna immersed in the plasma. Bare stainless-steel and porcelain-coated Cu antennas have been used. The plasma load is matched to the rf generator by a variable tap {ital N}:1 transformer isolated to 46 kV, and an LC network on the secondary. With H{sub 2} gas the source can be operated at pressures between 5 and 60 mT with power reflection coefficients {lt}0.01. The extracted ion current density with a porcelain-coated antenna is approximately given by 35 mA/cm{sup 2}/kW with an 80 G dipole filter field for input powers from 3.5 to 6.6 kW. The current density remained constant for operation with a 6 and an 8 mm aperture. The source has been operated for 260 h at 3.6 kW with a single-porcelain-coated antenna. Mass spectrometer measurements of the extracted beam at this power show a species mix for H{sup +}:H{sup +}{sub 2}:H{sup +}{sub 3}:OH{sup +} of 0.49: 0.04: 0.42: 0.04. The calculated beam divergence using the IGUN code is compared with the measured divergence from an electrostatic sweep emittance scanner designed for high-power cw beam diagnostics. Phase space measurements at 40 kV and 23 mA beam current result in a normalized rms emittance of 0.09 {pi}mmmrad. {copyright} {ital 1996 American Institute of Physics.}

  2. Theoretical modeling of infrared spectra of the hydrogen and deuterium bond in aspirin crystal

    NASA Astrophysics Data System (ADS)

    Ghalla, Houcine; Rekik, Najeh; Michta, Anna; Oujia, Brahim; Flakus, Henryk T.

    2010-01-01

    An extended quantum theoretical approach of the ? IR lineshape of cyclic dimers of weakly H-bonded species is proposed. We have extended a previous approach [M.E.-A. Benmalti, P. Blaise, H.T. Flakus, O. Henri-Rousseau, Chem. Phys. 320 (2006) 267] by accounting for the anharmonicity of the slow mode which is described by a "Morse" potential in order to reproduce the polarized infrared spectra of the hydrogen and deuterium bond in acetylsalicylic acid (aspirin) crystals. From comparison of polarized IR spectra of isotopically neat and isotopically diluted aspirin crystals it resulted that centrosymmetric aspirin dimer was the bearer of the crystal main spectral properties. In this approach, the adiabatic approximation is performed for each separate H-bond bridge of the dimer and a strong non-adiabatic correction is introduced into the model via the resonant exchange between the fast mode excited states of the two moieties. Within the strong anharmonic coupling theory, according to which the X-H?⋯Y high-frequency mode is anharmonically coupled to the H-bond bridge, this model incorporated the Davydov coupling between the excited states of the two moieties, the quantum direct and indirect dampings and the anharmonicity for the H-bond bridge. The spectral density is obtained within the linear response theory by Fourier transform of the damped autocorrelation functions. The evaluated spectra are in fairly good agreement with the experimental ones by using a minimum number of independent parameters. The effect of deuteration has been well reproduced by reducing simply the angular frequency of the fast mode and the anharmonic coupling parameter.

  3. Gas phase recombination of hydrogen and deuterium atoms. Ph.D. Thesis

    NASA Technical Reports Server (NTRS)

    Trainor, D. W.; Ham, D. O.; Kaufman, F.

    1973-01-01

    Rate constants for the reaction H + H + M - H2 + M, with M = H2, He, and Ar were measured over the temperature range 77 to 298 K. Hydrogen atoms were produced by thermal dissociation and absolute atom concentrations were measured through use of self-balancing, isothermal catalytic probe detector. The specific rate constants were 8.1 + or - 0.4 x 10 to the minus 33rd power, 7.0 + or - 0.4 x 10 to the minus 33rd power, and 9.2 + or - 0.6 x at 298 K for M = H2, He, and Ar respectively; these values rising to 18.5 + or - 2.2 x 10 to the minus 33rd power, 12.0 + or - 1.5 x 10 to the minus 33rd power, and 27.4 + or - 4.6 x 10 to the minus 33rd power cm to the 6th power/molecules sq/sec at 77 K. for the equivalent deuterium atom process with D2 as the third body, the rate constants are 6.1 + or - 0.3 x 10 to the minus 33rd power cm to the 6th power/molecules sq/sec at 298 K and 15.1 + or - 1.0 x 10 to the minus 33rd power cm to the 6th power/molecules sq/sec at 77 K. These values are compared with previous experimental measurements and with recent theoretical calculations.

  4. 2D IR cross peaks reveal hydrogen-deuterium exchange with single residue specificity.

    PubMed

    Dunkelberger, Emily B; Woys, Ann Marie; Zanni, Martin T

    2013-12-12

    A form of chemical exchange, hydrogen-deuterium exchange (HDX), has long been used as a method for studying the secondary and tertiary structure of peptides and proteins using mass spectrometry and NMR spectroscopy. Using two-dimensional infrared (2D IR) spectroscopy, we resolve cross peaks between the amide II band and a (13)C(18)O isotope-labeled amide I band, which we show measures HDX with site-specific resolution. By rapidly scanning 2D IR spectra using mid-IR pulse shaping, we monitor the kinetics of HDX exchange on-the-fly. For the antimicrobial peptide ovispirin bound to membrane bilayers, we find that the amide II peak decays with a biexponential with rate constants of 0.54 0.02 and 0.12 0.01 min(-1), which is a measure of the overall HDX in the peptide. The cross peaks between Ile-10-labeled ovispirin and the amide II mode, which specifically monitor HDX kinetics at Ile-10, decay with a single rate constant of 0.36 0.1 min(-1). Comparing this exchange rate to theoretically determined exchange rates of Ile-10 for ovispirin in a solution random coil configuration, the exchange rate at Ile-10 is at least 100 times slower, consistent with the known ?-helix structure of ovispirin in bilayers. Because backbone isotope labels produce only a very small shift of the amide II band, site-specific HDX cannot be measured with FTIR spectroscopy, which is why 2D IR spectroscopy is needed for these measurements. PMID:23659731

  5. Nondissociative electron and photon ionization cross sections of molecular hydrogen and deuterium

    NASA Astrophysics Data System (ADS)

    Liu, Xianming; Shemansky, Donald E.

    2012-05-01

    State-to-state [X 1Σ+g(vi) → X 2Σ+g(vj)] and quasi state-specific [X 1Σ+g(vi, Ji) → X 2Σ+g(vj)] photon and electron-impact ionization cross sections of hydrogen and deuterium molecules have been obtained with a combined analysis of experimental measurement and theoretical calculations. Rotation state ionization transitions are considered using the p-partial wave approximation. Previously calculated photoionization transition moments are refined and extended to ˜300 eV using accurate experimental photoionization cross sections. The transition moments are used to obtain the photoionization cross sections and oscillator strengths for the H2 and D2 X 1Σ+g(vi, Ji) → H+2 and D+2 X 2Σ+g(vj, Jj) transitions. The calculated ionization oscillator strengths, together with excitation functions derived from electron-impact ionization measurements of H2, enable accurate determination of electron-impact ionization cross sections for both H2 and D2 transitions to (vj, Jj) levels of the X 2Σ+g state at energies ranging from threshold to the non-relativistic limit. The autoionizing singlet-ungerade states contribute at least 0.6-1% of the total e+H2 →H+2 cross section. The e+D2 →D+2 and e+H2 →H+2 cross sections are very similar above the threshold energy region. The D2 cross section is ˜1.6% larger than the H2 cross section. Thermally averaged nondissociative ionization cross sections of H2 and D2 at temperatures appropriate for plasma and planetary applications have been tabulated.

  6. Theoretical modeling of infrared spectra of the hydrogen and deuterium bond in aspirin crystal.

    PubMed

    Ghalla, Houcine; Rekik, Najeh; Michta, Anna; Oujia, Brahim; Flakus, Henryk T

    2010-01-01

    An extended quantum theoretical approach of the nu(X-H) IR lineshape of cyclic dimers of weakly H-bonded species is proposed. We have extended a previous approach [M.E.-A. Benmalti, P. Blaise, H.T. Flakus, O. Henri-Rousseau, Chem. Phys. 320 (2006) 267] by accounting for the anharmonicity of the slow mode which is described by a "Morse" potential in order to reproduce the polarized infrared spectra of the hydrogen and deuterium bond in acetylsalicylic acid (aspirin) crystals. From comparison of polarized IR spectra of isotopically neat and isotopically diluted aspirin crystals it resulted that centrosymmetric aspirin dimer was the bearer of the crystal main spectral properties. In this approach, the adiabatic approximation is performed for each separate H-bond bridge of the dimer and a strong non-adiabatic correction is introduced into the model via the resonant exchange between the fast mode excited states of the two moieties. Within the strong anharmonic coupling theory, according to which the X-H...Y high-frequency mode is anharmonically coupled to the H-bond bridge, this model incorporated the Davydov coupling between the excited states of the two moieties, the quantum direct and indirect dampings and the anharmonicity for the H-bond bridge. The spectral density is obtained within the linear response theory by Fourier transform of the damped autocorrelation functions. The evaluated spectra are in fairly good agreement with the experimental ones by using a minimum number of independent parameters. The effect of deuteration has been well reproduced by reducing simply the angular frequency of the fast mode and the anharmonic coupling parameter. PMID:19884041

  7. Investigations of adsorption states of protium and deuterium in redeposited carbon flakes formed in tokamak T-10

    NASA Astrophysics Data System (ADS)

    Svechnikov, N. Yu.; Stankevich, V. G.; Sukhanov, L. P.; Menshikov, K. A.; Lebedev, A. M.; Kolbasov, B. N.; Zubavichus, Y. V.; Rajarathnam, D.

    2008-05-01

    This work reports thermal desorption spectroscopy (TDS), Fourier-transform infrared (FT-IR) spectroscopy and X-ray diffraction (XRD) analyses on free standing redeposited hydrocarbon films (flakes) with a high deuterium to hydrogen isotopic ratio, produced in the T-10 tokamak in the Kurchatov Institute. XRD pattern showed that the carbon flakes differ substantially from graphite and are non-crystalline. The TDS D2(H2) curves consist of two groups of peaks (450-800 K and 900-1000 K), and appeared to be rather similar to those obtained for a mechanically milled nanostructured graphite. As a result, two main adsorption states with activation energies of about 0.65 and 1.25 eV/H were found, implying a hopping diffusion and a resonance mechanism, respectively. The IR spectral differences between reddish-gold and dark-brown flakes showed a less degree of C-H hybridization for dark films and a disordered carbon network, to which the CD2,3 end-groups are connected.

  8. Impact of temperature during He+ implantation on deuterium retention in tungsten, tungsten with carbon deposit and tungsten carbide

    NASA Astrophysics Data System (ADS)

    Oya, Yasuhisa; Sato, Misaki; Li, Xiaochun; Yuyama, Kenta; Fujita, Hiroe; Sakurada, Shodai; Uemura, Yuki; Hatano, Yuji; Yoshida, Naoaki; Ashikawa, Naoko; Sagara, Akio; Chikada, Takumi

    2016-02-01

    Temperature dependence on deuterium (D) retention for He+ implanted tungsten (W) was studied by thermal desorption spectroscopy (TDS) to evaluate the tritium retention behavior in W. The activation energies were evaluated using Hydrogen Isotope Diffusion and Trapping (HIDT) simulation code and found to be 0.55 eV, 0.65 eV, 0.80 eV and 1.00 eV. The heating scenarios clearly control the D retention behavior and, dense and large He bubbles could work as a D diffusion barrier toward the bulk, leading to D retention enhancement at lower temperature of less than 430 K, even if the damage was introduced by He+ implantation. By comparing the D retention for W, W with carbon deposit and tungsten carbide (WC), the dense carbon layer on the surface enhances the dynamic re-emission of D as hydrocarbons, and induces the reduction of D retention. However, by He+ implantation, the D retention was increased for all the samples.

  9. Nanostructural activated carbons for hydrogen storage

    NASA Astrophysics Data System (ADS)

    Li, Suoding

    A series of nanostructured activated carbons have been synthesized from poly(ether ether ketone) (PEEK), and its derivatives. These carbons, with surface area exceeding 3000 m2/g and with average pore diameters of ? 20 A, are proven to be superior hydrogen storage materials, with hydrogen storage capacities up to 5.5 wt% at 77 K and 45 atm. The porous texture of these carbons was controlled via optimizing three synthetic steps: thermo-oxidation of PEEK in air, pyrolysis or carbonization of the oxidized PEEK in an inert atmosphere, and activation of the pre-carbonized PEEK with metal hydroxide. Thermo-oxidation of PEEK and carbonization process were thoroughly studied. These processes have been investigated by MDSC, FTIR, TGA and Py-MS. The pyrolysis or carbonization of PEEK involves the degradation of PEEK chains in three stages. Carbon morphology, including crystallinity and porous texture, is readily controlled by adjusting carbonization temperature. Activation of PEEK carbons, using inorganic bases and other activation agents, produces microporous carbons having a very narrow pore size distribution and an average pore diameter of ? 20 A. The activation control parameters including activation agent, activation temperature, time and carbon morphology have been investigated extensively. High surface area activated carbon is obtained by activating a highly amorphous carbon with a high activation agent/carbon ratio at 800C. Theoretical calculations show that the pores with smaller diameter, especially smaller than 7 A, favor hydrogen adsorption. The experimental results confirm this fact and show that: (1) the hydrogen adsorption capacity per unit surface area at 77 K and 1 bar is larger in the smaller pores, (2) gravimetric hydrogen storage capacity (W(H2)) is directly proportional to the ultramicropore (< 7 A) volume; and (3) the volumetric hydrogen storage capacity is directly proportional to the volume fraction of ultramicropores in carbon. Hydrogen adsorption in activated carbons synthesized from PEEK and poly(ether imide) blends, poly(phenylene oxide), polybenzimidazole and lignin show similar trends. In addition, W( H2) progressively increases as surface area increases for the carbons with similar average pore diameters. Keywords. carbon, activated carbon, poly(ether ether ketone), poly(ether imide), poly(phenylene oxide), polybenzimidazole, lignin, gas adsorption, hydrogen storage

  10. Screen-printed digital microfluidics combined with surface acoustic wave nebulization for hydrogen-deuterium exchange measurements.

    PubMed

    Monkkonen, Lucas; Edgar, J Scott; Winters, Daniel; Heron, Scott R; Mackay, C Logan; Masselon, Christophe D; Stokes, Adam A; Langridge-Smith, Patrick R R; Goodlett, David R

    2016-03-25

    An inexpensive digital microfluidic (DMF) chip was fabricated by screen-printing electrodes on a sheet of polyimide. This device was manually integrated with surface acoustic wave nebulization (SAWN) MS to conduct hydrogen/deuterium exchange (HDX) of peptides. The HDX experiment was performed by DMF mixing of one aqueous droplet of angiotensin II with a second containing various concentrations of D2O. Subsequently, the degree of HDX was measured immediately by SAWN-MS. As expected for a small peptide, the isotopically resolved mass spectrum for angiotensin revealed that maximum deuterium exchange was achieved using 50% D2O. Additionally, using SAWN-MS alone, the global HDX kinetics of ubiquitin were found to be similar to published NMR data and back exchange rates for the uncooled apparatus using high inlet capillary temperatures was less than 6%. PMID:26826755

  11. A critical compilation of experimental data on spectral lines and energy levels of hydrogen, deuterium, and tritium

    SciTech Connect

    Kramida, A.E.

    2010-11-15

    For more than 50 years, Charlotte Moore's compilation of atomic energy levels and its subsequent revisions have been the standard source of reference data for the spectra of hydrogen and its isotopes. In those publications, theoretical data based on quantum-electrodynamic calculations have been given. This reflects the fact that the theory of the hydrogen spectrum has been perfected to an extent far exceeding the capabilities of the best measurements. However, rapid advances in the techniques of laser spectroscopy and optical frequency metrology have recently put experiments on a par with theory in terms of precision. This calls for construction of new comprehensive data sets for H, D, and T that summarize the latest experimental work and can be directly compared with the modern theoretical reference data. The present work compiles several tens of recent measurements of the hydrogen, deuterium, and tritium fine and hyperfine structure intervals and presents sets of energy levels and Ritz wavelengths derived from those measurements. Data exist for the fine structure of energy levels of hydrogen and deuterium up to principal quantum number n = 12. For higher lying levels, there are many observed lines with unresolved fine structure. From those observations, level centers (centers of the fine structure) are derived by a least-squares optimization, and Ritz wavelengths of series with upper levels up to n = 40 are obtained. For tritium, the n = 2 and 3 energy level intervals are derived from experimental observations.

  12. Hydrogen-deuterium exchange of aromatic amines and amides using deuterated trifluoroacetic acid

    PubMed Central

    Giles, Richard; Lee, Amy; Jung, Erica; Kang, Aaron; Jung, Kyung Woon

    2014-01-01

    The H-D exchange of aromatic amines and amides, including pharmaceutically relevant compounds such as acetaminophen and diclofenac, was investigated using CF3COOD as both the sole reaction solvent and source of deuterium label. The described method is amenable to efficient deuterium incorporation for a wide variety of substrates possessing both electron-donating and electron-withdrawing substituents. Best results were seen with less basic anilines and highly activated acetanilides, reflecting the likelihood of different mechanistic pathways. PMID:25641994

  13. Carbon-hydrogen bonding in near-frictionless carbon

    NASA Astrophysics Data System (ADS)

    Johnson, J. A.; Woodford, J. B.; Rajput, D.; Kolesnikov, A. I.; Schleuter, J. A.; Eryilmaz, O. L.; Erdemir, A.

    2008-09-01

    The uniquely low friction behavior of near-frictionless carbon (NFC) as compared to conventional diamondlike carbon (DLC) is determined by the bonding within the film. Inelastic neutron scattering (INS) and Fourier transform infrared (FTIR) spectroscopy were used to probe the bonding environment of carbon and hydrogen; both INS and FTIR can probe the whole sample. Previous work has focused on surface studies; the present results show that in the film as a whole the majority of the hydrogen is adjacent to sp3-bonded carbon. In addition this work has determined the absence of any molecular hydrogen in NFC.

  14. Carbon-hydrogen bonding in near-frictionless carbon.

    SciTech Connect

    Johnson, J. A.; Woodford, J. B.; Rajput, D.; Kolesnikov, A. I.; Schleuter, J. A.; Eryilmaz, O. L.; Erdemir, A.; Univ. of Tennessee Space Inst.; ORNL

    2008-01-01

    The uniquely low friction behavior of near-frictionless carbon (NFC) as compared to conventional diamondlike carbon (DLC) is determined by the bonding within the film. Inelastic neutron scattering (INS) and Fourier transform infrared (FTIR) spectroscopy were used to probe the bonding environment of carbon and hydrogen; both INS and FTIR can probe the whole sample. Previous work has focused on surface studies; the present results show that in the film as a whole the majority of the hydrogen is adjacent to sp{sup 3}-bonded carbon. In addition this work has determined the absence of any molecular hydrogen in NFC.

  15. Carbon-hydrogen bonding in near-frictionless carbon

    SciTech Connect

    Johnson, Jackie A.; Woodford, John B; Rajput, Deepak; Kolesnikov, Alexander I; Schleuter, John A; Eryilmaz, Osman L; Erdemir, Ali

    2008-01-01

    The uniquely low friction behavior of near frictionless carbon (NFC) as compared to conventional diamond-like carbon (DLC) is determined by the bonding within the film. Inelastic neutron scattering (INS) and Fourier Transform Infrared (FTIR) spectroscopy were used to probe the bonding environment of carbon and hydrogen; both INS and FTIR can probe the whole sample. Previous work has focused on surface studies; the present results show that in the film as a whole the majority of the hydrogen is adjacent to sp3-bonded carbon. In addition this work has determined the absence of any molecular hydrogen in NFC.

  16. Carbon and hydrogen isotopic composition of bacterial methane in a shallow freshwater lake

    SciTech Connect

    Woltemate, I.; Whiticar, M.J.; Schoell, M.

    1984-09-01

    Anoxic sediments from freshwater environments such as bogs, swamps, and lakes undergoing early diagenesis are frequently characterized by the formation of biogenic methane. Freshwater biogenic methanes exhibit carbon and hydrogen isotopic values strongly depleted in C-13 and deuterium relative to the respective values for carbon dioxide and formation water. The percentages of methane generated by fermentation and carbon dioxide reduction can be estimated by comparison of hydrogen isotopes in the formation water and methane. On the basis of these hydrogen isotope data, about 75% of the methane formation in Wurmsee comes from acetate reduction. Fermentation is thus the dominant although not exclusive process. Carbon dioxide reduction contributed the balance of the bacterial methane generated. 35 references, 5 figures, 1 table.

  17. Hydrogen attack - Influence of hydrogen sulfide. [on carbon steel

    NASA Technical Reports Server (NTRS)

    Eliezer, D.; Nelson, H. G.

    1978-01-01

    An experimental study is conducted on 12.5-mm-thick SAE 1020 steel (plain carbon steel) plate to assess hydrogen attack at room temperature after specimen exposure at 525 C to hydrogen and a blend of hydrogen sulfide and hydrogen at a pressure of 3.5 MN/sq m for exposure times up to 240 hr. The results are discussed in terms of tensile properties, fissure formation, and surface scales. It is shown that hydrogen attack from a high-purity hydrogen environment is severe, with the formation of numerous methane fissures and bubbles along with a significant reduction in the room-temperature tensile yield and ultimate strengths. However, no hydrogen attack is observed in the hydrogen/hydrogen sulfide blend environment, i.e. no fissure or bubble formation occurred and the room-temperature tensile properties remained unchanged. It is suggested that the observed porous discontinuous scale of FeS acts as a barrier to hydrogen entry, thus reducing its effective equilibrium solubility in the iron lattice. Therefore, hydrogen attack should not occur in pressure-vessel steels used in many coal gasification processes.

  18. Variability of Deuterium Fractionation Associated With Soil Uptake of Atmospheric Molecular Hydrogen

    NASA Astrophysics Data System (ADS)

    Rahn, T.; Randerson, J. T.; Eiler, J.

    2005-12-01

    Molecular hydrogen (H2) is the second most abundant reduced gas in the atmosphere (after methane) with a globally averaged mixing ratio of ~530 nmol/mol. Its largest sources are photochemical oxidation of methane and non-methane hydrocarbons with other recognized sources that include biomass burning, fossil fuel burning, nitrogen fixation, and ocean degassing. These sources are balanced by reaction of H2 with hydroxyl radicals (~25%) in the atmosphere and by deposition at the terrestrial soil surface (~75%). As with other atmospheric trace gases, the stable isotopic content of H2 has the potential to help quantify the various aspects of its production and destruction. The average deuterium content of H2 is dDH2 = ~130 relative to Standard Mean Ocean Water. While recent studies have begun to elucidate the deuterium content of the individual sources of H2 and the fractionation associated with hydroxyl oxidation has been well established in the laboratory, there are still few data documenting the fractionation associated with soil uptake. We measured the fractionation associated with soil uptake in May, June and August of 2002 in three upland ecosystems that were part of an Alaskan fire chronosequence. Fire occurred at these sites in 1999, 1987, and ~1920. Grasses and herbaceous vegetation establish initially after fire and are gradually replaced by deciduous trees and finally by evergreen trees and moss. All three sites were in interior Alaska near the town of Delta Junction (63 54'N, 145 40'W). Fluxes were measured with a Plexiglas flux chamber (8 liter volume) with a manifold of four ~400 ml double-valved glass flasks in parallel and a diaphragm pump for circulation (5 SLPM). Flasks were continuously flushed by the circulating system and isolated sequentially; they were then returned to the laboratory at Caltech for subsequent analysis. In the field, the chamber was seated on Plexiglas collars that were installed prior to initiating the study and left in place for the duration of the study. Permanent collars insured that placement of the chamber/collar system did not cause any localized disturbance and unintentionally perturb the H2 flux and that sampling locations could be reoccupied to investigate seasonal differences. Prior to field deployment the entire system was tested on a plain sheet of Plexiglas to ensure that no H2 was produced or consumed by the diaphragm pump or any of the system parts. While earlier studies have measured HD/HH deposition velocities with a ratio of ~0.96, results of our Alaskan study show deposition velocity ratios of 0.89 0.03 (n=17). Furthermore, sorting of data by season reveals no significant variability in this ratio but sorting by location over all seasons reveals the greatest fractionation at the most recent burn, 0.87 0.02 (n=8) and the least fractionation at the mature spruce forest, 0.93 0.01 (n=3) with fractionation at the intermediate burn site being 0.90 0.02 (n=6). While not statistically conclusive, our results suggest that soil/ecosystem variability may affect fractionation associated with soil uptake of H2, adding further complication to modeling efforts that until now have assumed this parameter to be a constant value.

  19. Determination of diffusion coefficients of hydrogen and deuterium in Zr-2.5%Nb pressure tube material using hot vacuum extraction-quadrupole mass spectrometry

    NASA Astrophysics Data System (ADS)

    Shrivastava, Komal Chandra; Kulkarni, A. S.; Ramanjaneyulu, P. S.; Sunil, Saurav; Saxena, M. K.; Singh, R. N.; Tomar, B. S.; Ramakumar, K. L.

    2015-06-01

    The diffusion coefficients of hydrogen and deuterium in Zr-2.5%Nb alloy were measured in the temperature range 523 to 673 K, employing hot vacuum extraction-quadrupole mass spectrometry (HVE-QMS). One end of the Zr-2.5%Nb alloy specimens was charged electrolytically with the desired hydrogen isotope. After annealing at different temperatures for a predetermined time, the specimens were cut into thin slices, which were analyzed for their H2/D2 content using the HVE-QMS technique. The depth profile data were fitted into the equation representing the solution of Fick's second law of diffusion. The activation energy of hydrogen/deuterium diffusion was obtained from the Arrhenius relation between the diffusion coefficient and temperature. The temperature dependent diffusion coefficient can be represented as DH = 1.41 10-7 exp(-36,000/RT) and DD = 6.16 10-8 exp(-35,262/RT) for hydrogen and deuterium, respectively.

  20. Stainless-Steel Ball-Milling Method for Hydro-/Deutero-genation using H2 O/D2 O as a Hydrogen/Deuterium Source.

    PubMed

    Sawama, Yoshinari; Kawajiri, Takahiro; Niikawa, Miki; Goto, Ryota; Yabe, Yuki; Takahashi, Tohru; Marumoto, Takahisa; Itoh, Miki; Kimura, Yuuichi; Monguchi, Yasunari; Kondo, Shin-Ichi; Sajiki, Hironao

    2015-11-01

    A one-pot continuous-flow method for hydrogen (deuterium) generation and subsequent hydrogenation (deuterogenation) was developed using a stainless-steel (SUS304)-mediated ball-milling approach. SUS304, especially zero-valent Cr and Ni as constituents of the SUS304, and mechanochemical processing played crucial roles in the development of the reactions. PMID:26493945

  1. Designing Microporus Carbons for Hydrogen Storage Systems

    SciTech Connect

    Alan C. Cooper

    2012-05-02

    An efficient, cost-effective hydrogen storage system is a key enabling technology for the widespread introduction of hydrogen fuel cells to the domestic marketplace. Air Products, an industry leader in hydrogen energy products and systems, recognized this need and responded to the DOE 'Grand Challenge' solicitation (DOE Solicitation DE-PS36-03GO93013) under Category 1 as an industry partner and steering committee member with the National Renewable Energy Laboratory (NREL) in their proposal for a center-of-excellence on Carbon-Based Hydrogen Storage Materials. This center was later renamed the Hydrogen Sorption Center of Excellence (HSCoE). Our proposal, entitled 'Designing Microporous Carbons for Hydrogen Storage Systems,' envisioned a highly synergistic 5-year program with NREL and other national laboratory and university partners.

  2. Desorption of hydrogen trapped in carbon and graphite

    NASA Astrophysics Data System (ADS)

    Atsumi, H.; Takemura, Y.; Miyabe, T.; Konishi, T.; Tanabe, T.; Shikama, T.

    2013-11-01

    Thermal desorption behavior of deuterium (D2) from isotropic graphites and a carbon fiber carbon composite (CFC) charged with D2 gas has been investigated to obtain information concerning hydrogen recycling and tritium inventory in fusion experimental devices as well as a futuristic fusion reactor. After thermal desorption experiments were conducted at temperatures up to 1740 K, a desorption peak at approximately 1600 K (peak 4) was discovered. This is in addition to the previously known peak at approximately 1300 K (peak 3). Peak 3 can be attributed to the release of deuterium controlled by the diffusion process in a graphite filler grain and peak 4 can be attributed to the detrapping of deuterium released from an interstitial cluster loop edge site. Activation energies of peaks 3 and 4 are estimated to be 3.48 and 6.93 eV, respectively. TDS spectra of D2 from graphite and CFCs had previously not been thoroughly investigated. A desorption peak at approximately 1600 K was discovered in the TDS spectra for all samples heated with a linear ramp rate of 0.1 K/s. For an isotropic graphite, ISO-880U, four desorption peaks were recognized in the TDS spectra at approximately 660 K, 900 K, 1300 K, and 1600 K. These peaks were named as peaks 1, 2, 3, and 4 in order of increasing temperature. Major desorption peaks (i.e., peaks 3 and 4) were analyzed and discussed in detail. The temperature of peak 3 was dependent on the size of a graphite filler grain. The desorption process is suggested to be controlled by deuterium diffusion within the filler grain with a strong influence of trapping sites, where the migration takes place as a sequence of detrapping and retrapping. The desorption for peak 4 can be ascribed to the detrapping reaction from an interstitial cluster loop edge site. Activation energies were estimated from the peak shift by varying the heating rate of TDS to be 3.48 and 6.93 eV for peaks 3 and 4, respectively. Theoretical desorption curves for peaks 3 and 4 with the above mentioned activation energies were narrower than those for the experimental desorption curve. The observed peak broadening can be attributed to the effects of grain size and activation energy distributions.

  3. Using Hydrogen/Deuterium Exchange Mass Spectrometry to Study Conformational Changes in Granulocyte Colony Stimulating Factor upon PEGylation

    NASA Astrophysics Data System (ADS)

    Wei, Hui; Ahn, Joomi; Yu, Ying Qing; Tymiak, Adrienne; Engen, John R.; Chen, Guodong

    2012-03-01

    PEGylation is the covalent attachment of polyethylene glycol to proteins, and it can be used to alter immunogenicity, circulating half life and other properties of therapeutic proteins. To determine the impact of PEGylation on protein conformation, we applied hydrogen/deuterium exchange mass spectrometry (HDX MS) to analyze granulocyte colony stimulating factor (G-CSF) upon PEGylation as a model system. The combined use of HDX automation technology and data analysis software allowed reproducible and robust measurements of the deuterium incorporation levels for peptic peptides of both PEGylated and non-PEGylated G-CSF. The results indicated that significant differences in deuterium incorporation were induced by PEGylation of G-CSF, although the overall changes observed were quite small. PEGylation did not result in gross conformational rearrangement of G-CSF. The data complexity often encountered in HDX MS measurements was greatly reduced through a data processing and presentation format designed to facilitate the comparison process. This study demonstrates the practical utility of HDX MS for comparability studies, process monitoring, and protein therapeutic characterization in the biopharmaceutical industry.

  4. Exclusive Photoproduction of Charged Pions in Hydrogen and Deuterium from 1 to 6 GeV

    SciTech Connect

    Lingyan Zhu

    2004-02-28

    The study of the transition region in the description of exclusive processes and hadron structure, from the nucleon-meson degrees of freedom in meson-exchange models at low energy to the quark-gluon degrees of freedom in pQCD at high energy, is essential for us to understand the strong interaction. The differential cross section measurements for exclusive reactions at fixed center-of-mass angles enable us to investigate the constituent counting rule, which explicitly connects the quark-gluon degrees of freedom to the energy dependence of differential cross sections. JLab Experiment E94-104 was carried out in Hall A with two high resolution spectrometers. It included the coincidence cross section measurement for the [gamma]n --> pi{sup -}[p] process with a deuterium target and the singles measurement for the [gamma]p --> pi{sup +}[n] process with a hydrogen target. The untagged real photons were generated by the electron beam impinging on a copper radiator. The photon energies ranged from 1.1 to 5.5 GeV, corresponding to the center-of-mass energies from 1.7 to 3.4 GeV. The pion center-of-mass angles were fixed at 50 deg, 70 deg, 90 deg, and also 100 deg, 110 deg at a few energies. The JLab E94-104 data presented in this thesis contain four interesting features. The data exhibit a global scaling behavior for both [pi]{sup -} and [pi]{sup +} photoproduction at high energies and high transverse momenta, consistent with the constituent counting rule and the existing [pi]{sup +} photoproduction data. This implies that the quark-gluon degrees of freedom start to play a role at this energy scale. The data suggests possible substructure of the scaling behavior, which might be oscillations around the scaling value. There are several possible mechanisms that can cause oscillations, for example the one associated with the generalized constituent counting rule involving quark orbital angular momentum. The data show an enhancement in the scaled cross section at center-of-mass energy near 2.2 GeV, where baryon resonances are not as well known as those at low energies. The differential cross section ratios for exclusive [gamma]n --> pi{sup -}[p] to [gamma]p --> pi{sup +}[n] process at [theta]{sub cm} = 90 deg start to show consistency with the prediction based on one-hard-gluon-exchange diagrams at high energies.

  5. A deuterium and carbon nuclear magnetic resonance spectroscopic investigation of blood flow and carbohydrate metabolism

    SciTech Connect

    Bosch, C.S.E.

    1988-01-01

    The purpose of this study is the development and application of nuclear magnetic resonance (NMR) spectroscopic techniques for this study of whole tissue metabolism, tissue perfusion and blood flow. The feasibility of spin imaging deuterium-enriched tissue water is demonstrated in cat brain in vivo and in situ. The potential application of D{sub 2}O administration to deuterium-flow-imaging is considered. NMR investigations of hepatic carbohydrate metabolism were performed in rat liver in vivo and in situ. A coaxial, double-surface-coil, double-resonance probe was developed for carbon detection while decoupling neighboring proton scalar interactions ({sup 13}C-({sup 1}H)) in hepatic tissue within the living animal. Hormonal and substrate regulation of hepatic glucose and glycogen metabolism was investigated by monitoring the metabolic fate of an administered c-dose of (1-{sup 13}C)glucose. Label flux was directed primarily into newly-synthesized {sup 13}C-labeled glycogen. A multiple resonance ({sup 1}H, {sup 13}C, {sup 31}P) liver perfusion probe was designed for complimentary carbohydrate metabolic studies in rat liver in vitro. A description of the {sup 13}C-({sup 1}H)/{sup 31}P NMR perfusion probe is given. The surgical technique used for liver excision and peripheral life-support apparatus required to maintain hepatic function are also detailed.

  6. Investigation of atomic deuterium (hydrogen) emission from the surface of some transition metal deuterides (hydrides)

    NASA Astrophysics Data System (ADS)

    Nowicka, E.; Wolfram, Z.; Lisowski, W.; Du?, R.

    1996-01-01

    Deuterium desorption from the surface of decomposing palladium deuteride was studied while monitoring the atomic component of the desorbing gas by means of an adsorption method. A thin gold film was applied as an adsorbent active for D adsorption, but inert against interaction with D 2. The deuterium deposit thereby collected on the Au surface was analysed by means of thermal desorption mass spectrometry (TDMS). The atomic component of deuterium arising by desorption from decomposing PdD y was clearly detected. The experimental results obtained for PdD y are compared with those observed during the decomposition of PdH x, as well as the decomposition of other hydrides including TiH z and VH u.

  7. Interaction of hydrogen with novel carbon materials

    NASA Astrophysics Data System (ADS)

    Ye, Yun

    The hydrogen storage properties of some carbon materials were studied. Graphite nanofibers (GNF) were synthesized by catalytic decomposition of ethylene and hydrogen. Catalyst supported carbon materials were prepared by impregnation process. Hydrogen desorption and adsorption properties of graphite nanofibers, single-walled carbon nanotubes (SWNT), fullerene materials and catalysts supported carbon materials were measured volumetrically using a Sievert's apparatus. The hydrogen desorption capacity of GNF was typically less than 0.2 wt%. A phase transition between crystal SWNT and a new hydride phase was found at high pressures at 80K. The phase transition was of first order, and involved the separation of the individual tubes within a rope, exposing a high surface area for hydrogen adsorption. From the change in chemical potential of the hydrogen gas upon adsorption, we were able to calculate the cohesive van der Waals energy between the tubes as 5 meV/C atom. This is much smaller than expected from previous theoretical work, and shows that defects in the crystal structure cause large suppressions of the cohesive energy. We were able to alter this cohesive energy by changing the state of the material. Over several cycles of isotherm measurements at 77 K, the hydrogen storage capacities of one of the fullerite samples increased from an initial value of 0.4 wt% for the first cycle to a capacity of 4.2 wt% for the fourth cycle. Correspondingly, the surface area increased from 0.9 m2/gm to 11 m2/gm, and showed a phase transformation, characterized by X-ray powder diffraction. By adding Ni particles onto the sample, the hydrogen storage capacity of fullerite and activated carbon sample was increased. The adsorption of hydrogen on Ni particle can not account for the total increased capacity even by assuming complete coverage of hydrogen molecules on the Ni particle surface.

  8. Synthesis of carbon-14 and deuterium labeled N-nitroso-2 (3',7'-dimethyl-2',6'-octadienyl) aminoethanols

    USGS Publications Warehouse

    Abidi, S.L.; Idelson, A.L.

    1981-01-01

    Methods of preparation of carbon-14 and deuterium labeled N-nitroso-2(3,7-dimethyl-2,6-octadienyl) aminoethanols are described. The primary synthetic method involved alkylation of ethanolamine or ethylglycine with suitable chlorides and subsequent mild nitrosation. Isomeric 14C-nitrosamines were also prepared by selective -cleavage of the di-substituted ethanolamine with nitrous acid.

  9. Hydrogen storage on activated carbon. Final report

    SciTech Connect

    Schwarz, J.A.

    1994-11-01

    The project studied factors that influence the ability of carbon to store hydrogen and developed techniques to enhance that ability in naturally occurring and factory-produced commercial carbon materials. During testing of enhanced materials, levels of hydrogen storage were achieved that compare well with conventional forms of energy storage, including lead-acid batteries, gasoline, and diesel fuel. Using the best materials, an electric car with a modern fuel cell to convert the hydrogen directly to electricity would have a range of over 1,000 miles. This assumes that the total allowable weight of the fuel cell and carbon/hydrogen storage system is no greater than the present weight of batteries in an existing electric vehicle. By comparison, gasoline cars generally are limited to about a 450-mile range, and battery-electric cars to 40 to 60 miles. The project also developed a new class of carbon materials, based on polymers and other organic compounds, in which the best hydrogen-storing factors discovered earlier were {open_quotes}molecularly engineered{close_quotes} into the new materials. It is believed that these new molecularly engineered materials are likely to exceed the performance of the naturally occurring and manufactured carbons seen earlier with respect to hydrogen storage.

  10. Investigating the Interaction between the Neonatal Fc Receptor and Monoclonal Antibody Variants by Hydrogen/Deuterium Exchange Mass Spectrometry*

    PubMed Central

    Jensen, Pernille Foged; Larraillet, Vincent; Schlothauer, Tilman; Kettenberger, Hubert; Hilger, Maximiliane; Rand, Kasper D.

    2015-01-01

    The recycling of immunoglobulins by the neonatal Fc receptor (FcRn) is of crucial importance in the maintenance of antibody levels in plasma and is responsible for the long half-lives of endogenous and recombinant monoclonal antibodies. From a therapeutic point of view there is great interest in understanding and modulating the IgGFcRn interaction to optimize antibody pharmacokinetics and ultimately improve efficacy and safety. Here we studied the interaction between a full-length human IgG1 and human FcRn via hydrogen/deuterium exchange mass spectrometry and targeted electron transfer dissociation to map sites perturbed by binding on both partners of the IgGFcRn complex. Several regions in the antibody Fc region and the FcRn were protected from exchange upon complex formation, in good agreement with previous crystallographic studies of FcRn in complex with the Fc fragment. Interestingly, we found that several regions in the IgG Fab region also showed reduced deuterium uptake. Our findings indicate the presence of hitherto unknown FcRn interaction sites in the Fab region or a possible conformational link between the IgG Fc and Fab regions upon FcRn binding. Further, we investigated the role of IgG glycosylation in the conformational response of the IgGFcRn interaction. Removal of antibody glycans increased the flexibility of the FcRn binding site in the Fc region. Consequently, FcRn binding did not induce a similar conformational stabilization of deglycosylated IgG as observed for the wild-type glycosylated IgG. Our results provide new molecular insight into the IgGFcRn interaction and illustrate the capability of hydrogen/deuterium exchange mass spectrometry to advance structural proteomics by providing detailed information on the conformation and dynamics of large protein complexes in solution. PMID:25378534

  11. DISPLACEMENT AND HELIUM-INDUCED ENHANCEMENT OF HYDROGEN AND DEUTERIUM RETENTION IN ION-IRRADIATED 18Cr10NiTi STAINLESS STEEL

    SciTech Connect

    Tolstolutskaya, G D.; Ruzhytskiy, V. V.; Kopanets, , I. E.; Karpov, S. A.; Bryk, V. V.; Voyevodin, Victor N.; Garner, Francis A.

    2006-09-15

    There is strong interest in the Accelerator-Driven Transmutation Technology community on the synergistic effects of displacement damage and co-generated helium and hydrogen on property changes such as void swelling, irradiation creep, hardening, and possibly on corrosion and cracking. Substituting deuterium for protium offers advantages in experimental studies of the helium-hydrogen-damage synergisms. The influence of preimplanted helium and self-ion induced damage on deuterium trapping in 18Cr10NiTi stainless steel was studied using thermal desorption spectrometry, the nuclear reactions 3He(D,p)4He and D(3He,p)4He, and transmission electron microscopy. Reemission, retention and evolution of depth distribution profiles of deuterium in 18Cr10NiTi SS were studied for 10 keV D2+ and 10 keV He+ implantation at room temperature followed by annealing at 300 to 1500K. The amounts of trapped and released deuterium and helium atoms were measured as a function of implantation dose at various temperatures. It was found that retention of hydrogen and deuterium is strongly enhanced by the presence of large amounts of helium and also strongly enhanced by damage introduced by 2 MeV Cr+3 ions. These results are consistent with recent observations of hydrogen storage in stainless steels after irradiation in LANSCE with high energy protons and neutrons and also after irradiation in light water reactors.

  12. Displacement and helium-induced enhancement of hydrogen and deuterium retention in ion-irradiated 18Cr10NiTi stainless steel

    NASA Astrophysics Data System (ADS)

    Tolstolutskaya, G. D.; Ruzhytskiy, V. V.; Kopanets, I. E.; Karpov, S. A.; Bryk, V. V.; Voyevodin, V. N.; Garner, F. A.

    2006-09-01

    There is strong interest in the accelerator-driven transmutation technology community on the synergistic effects of displacement damage and co-generated helium and hydrogen on property changes such as void swelling, irradiation creep, hardening, and possibly on corrosion and cracking. Substituting deuterium for protium offers advantages in experimental studies of the helium-hydrogen-damage synergisms. The influence of preimplanted helium and self-ion induced damage on deuterium trapping in 18Cr10NiTi stainless steel was studied using thermal desorption spectrometry, the nuclear reactions 3He(D, p) 4He and D( 3He, p) 4He, and transmission electron microcopy. Reemission, retention and evolution of depth distribution profiles of deuterium in 18Cr10NiTi SS were studied for 10 keV D2+ and 10 keV He + implantation at room temperature followed by annealing at 300-1500 K. The amounts of trapped and released deuterium and helium atoms were measured as a function of implantation dose at various temperatures. It was found that retention of hydrogen and deuterium is strongly enhanced by the presence of large amounts of helium and also strongly enhanced by damage introduced by 2 MeV Cr 3+ ions. These results are consistent with recent observations of hydrogen storage in stainless steels after irradiation in LANSCE with high energy protons and neutrons and also after irradiation in light water reactors.

  13. Qualitative and quantitative analysis of mixtures of compounds containing both hydrogen and deuterium

    NASA Technical Reports Server (NTRS)

    Crespi, H. L.; Harkness, L.; Katz, J. J.; Norman, G.; Saur, W.

    1969-01-01

    Method allows qualitative and quantitative analysis of mixtures of partially deuterated compounds. Nuclear magnetic resonance spectroscopy determines location and amount of deuterium in organic compounds but not fully deuterated compounds. Mass spectroscopy can detect fully deuterated species but not the location.

  14. L-H transition physics in hydrogen and deuterium: key role of the edge radial electric field and ion heat flux

    NASA Astrophysics Data System (ADS)

    Ryter, F.; Cavedon, M.; Happel, T.; McDermott, R. M.; Viezzer, E.; Conway, G. D.; Fischer, R.; Kurzan, B.; Ptterich, T.; Tardini, G.; Willensdorfer, M.; the ASDEX Upgrade Team

    2016-01-01

    Previous work carried out in the ASDEX Upgrade tokamak on the role of the edge radial electric field and ion heat flux in the L-H transition physics in deuterium plasmas has been extended in hydrogen plasmas. Similar discharges were performed in the two gases providing a detailed comparison of the edge kinetic profiles and heat fluxes in L-mode up to the L-H transition, as the heating power is increased. At the L-H transition, the edge ion heat flux just inside the separatrix is about two times higher in hydrogen than in deuterium. However, the ion plasma parameters at the plasma edge, T i and \

  15. A matrix-isolation study of the water- d1 iodine atom complex and the equilibrium between its hydrogen-bonded and deuterium-bonded forms

    NASA Astrophysics Data System (ADS)

    Engdahl, Anders; Nelander, Bengt

    1985-12-01

    The interaction between water (H 2O, HDO, D 2O) or hydrogen chloride and iodine or bromine, (I -, I 2, Br -, Br 2) in argon matrices has been studied with IR spectroscopy. The spectra show that water forms a hydrogen bond to atomic iodine. Molecular iodine, atomic and molecular bromine are bound to the water oxygen. Hydrogen chloride forms hydrogen-bonded complexes with I -, I 2, Br - and Br 2. HDO forms preferentially deuterium bonds with atomic iodine but hydrogen-bonded HDO is present in equilibrium with the deuterium-bonded form. Temperature-dependency studies make it possible to estimate that the H-bonded form is 26 cm -1 less stable than the D-bonded form.

  16. Influence of beryllium carbide formation on deuterium retention and release

    NASA Astrophysics Data System (ADS)

    Porosnicu, C.; Anghel, A.; Sugiyama, K.; Krieger, K.; Roth, J.; Lungu, C. P.

    2011-08-01

    The inconel cladding tiles of the ITER-like-wall to be tested at JET will be coated by a beryllium layer. Carbon containing tiles will be also present. These materials are sputtered in the high flux (1022 m-2 s-1 or higher) of the deuterium-tritium plasma. Ionized by the energetic electrons and with hydrogen isotope ions they will be implanted or re-deposited, creating composite layers.In order to study the deuterium retention and release, mixed layers were prepared using the thermionic arc method.Deuterium implantation was performed using a high current ion source at room temperature using a deuterium ion beam with energy of 200 eV/D. Thermal Desorption Spectroscopy (TDS) analyses were correlated with the beryllium/carbon relative concentrations of the prepared films. At higher carbon concentrations the peak value from TDS spectra corresponding to beryllium was lower and an increased peak corresponding to the carbon was observed.

  17. The solubility of hydrogen and deuterium in alloyed, unalloyed and impure plutonium metal

    SciTech Connect

    Richmond, Scott; Bridgewater, Jon S; Ward, John W; Allen, Thomas H

    2010-01-01

    Hydrogen is exothermically absorbed in many transition metals, all rare earths and the actinides. The hydrogen gas adsorbs, dissociates and diffuses into these metals as atomic hydrogen. Absorbed hydrogen is generally detrimental to Pu, altering its properties and greatly enhancing corrosion. Measuring the heat of solution of hydrogen in Pu and its alloys provides significant insight into the thermodynamics driving these changes. Hydrogen is present in all Pu metal unless great care is taken to avoid it. Heats of solution and formation are provided along with evidence for spinodal decomposition.

  18. Peptide-Column Interactions and Their Influence on Back Exchange Rates in Hydrogen/Deuterium Exchange-MS

    NASA Astrophysics Data System (ADS)

    Sheff, Joey G.; Rey, Martial; Schriemer, David C.

    2013-07-01

    Hydrogen/deuterium exchange (HDX) methods generate useful information on protein structure and dynamics, ideally at the individual residue level. Most MS-based HDX methods involve a rapid proteolytic digestion followed by LC/MS analysis, with exchange kinetics monitored at the peptide level. Localizing specific sites of HDX is usually restricted to a resolution the size of the host peptide because gas-phase processes can scramble deuterium throughout the peptide. Subtractive methods may improve resolution, where deuterium levels of overlapping and nested peptides are used in a subtractive manner to localize exchange to smaller segments. In this study, we explore the underlying assumption of the subtractive method, namely, that the measured back exchange kinetics of a given residue is independent of its host peptide. Using a series of deuterated peptides, we show that secondary structure can be partially retained under quenched conditions, and that interactions between peptides and reversed-phase LC columns may both accelerate and decelerate residue HDX, depending upon peptide sequence and length. Secondary structure is induced through column interactions in peptides with a solution-phase propensity for structure, which has the effect of slowing HDX rates relative to predicted random coil values. Conversely, column interactions can orient random-coil peptide conformers to accelerate HDX, the degree to which correlates with peptide charge in solution, and which can be reversed by using stronger ion pairing reagents. The dependency of these effects on sequence and length suggest that subtractive methods for improving structural resolution in HDX-MS will not offer a straightforward solution for increasing exchange site resolution.

  19. Combining Ion Mobility Spectrometry with Hydrogen-Deuterium Exchange and Top-Down MS for Peptide Ion Structure Analysis

    NASA Astrophysics Data System (ADS)

    Khakinejad, Mahdiar; Kondalaji, Samaneh Ghassabi; Maleki, Hossein; Arndt, James R.; Donohoe, Gregory C.; Valentine, Stephen J.

    2014-12-01

    The gas-phase conformations of electrosprayed ions of the model peptide KKDDDDIIKIIK have been examined by ion mobility spectrometry (IMS) and hydrogen deuterium exchange (HDX)-tandem mass spectrometry (MS/MS) techniques. [M+4H]4+ ions exhibit two conformers with collision cross sections of 418 Å2 and 471 Å2. [M+3H]3+ ions exhibit a predominant conformer with a collision cross section of 340 Å2 as well as an unresolved conformer (shoulder) with a collision cross section of ~367 Å2. Maximum HDX levels for the more compact [M+4H]4+ ions and the compact and partially-folded [M+3H]3+ ions are ~12.9, ~15.5, and ~14.9, respectively. Ion structures obtained from molecular dynamics simulations (MDS) suggest that this ordering of HDX level results from increased charge-site/exchange-site density for the more compact ions of lower charge. Additionally, a new model that includes two distance calculations (charge site to carbonyl group and carbonyl group to exchange site) for the computer-generated structures is shown to better correlate to the experimentally determined per-residue deuterium uptake. Future comparisons of IMS-HDX-MS data with structures obtained from MDS are discussed with respect to novel experiments that will reveal the HDX rates of individual residues.

  20. Probing the dynamic regulation of peripheral membrane proteins using hydrogen deuterium exchange-MS (HDX-MS).

    PubMed

    Vadas, Oscar; Burke, John E

    2015-10-01

    Many cellular signalling events are controlled by the selective recruitment of protein complexes to membranes. Determining the molecular basis for how lipid signalling complexes are recruited, assembled and regulated on specific membrane compartments has remained challenging due to the difficulty of working in conditions mimicking native biological membrane environments. Enzyme recruitment to membranes is controlled by a variety of regulatory mechanisms, including binding to specific lipid species, protein-protein interactions, membrane curvature, as well as post-translational modifications. A powerful tool to study the regulation of membrane signalling enzymes and complexes is hydrogen deuterium exchange-MS (HDX-MS), a technique that allows for the interrogation of protein dynamics upon membrane binding and recruitment. This review will highlight the theory and development of HDX-MS and its application to examine the molecular basis of lipid signalling enzymes, specifically the regulation and activation of phosphoinositide 3-kinases (PI3Ks). PMID:26517882

  1. Characterizing rapid, activity-linked conformational transitions in proteins via sub-second hydrogen deuterium exchange mass spectrometry.

    PubMed

    Resetca, Diana; Wilson, Derek J

    2013-11-01

    This review outlines the application of time-resolved electrospray ionization mass spectrometry (TRESI-MS) and hydrogen-deuterium exchange (HDX) to study rapid, activity-linked conformational transitions in proteins. The method is implemented on a microfluidic chip which incorporates all sample-handling steps required for a 'bottom-up' HDX workflow: a capillary mixer for sub-second HDX labeling, a static mixer for HDX quenching, a microreactor for rapid protein digestion, and on-chip electrospray. By combining short HDX labeling pulses with rapid digestion, this approach provides a detailed characterization of the structural transitions that occur during protein folding, ligand binding, post-translational modification and catalytic turnover in enzymes. This broad spectrum of applications in areas largely inaccessible to conventional techniques means that microfluidics-enabled TRESI-MS/HDX is a unique and powerful approach for investigating the dynamic basis of protein function. PMID:23663649

  2. Influence of domain interactions on conformational mobility of the progesterone receptor detected by hydrogen/deuterium exchange mass spectrometry

    PubMed Central

    Goswami, Devrishi; Callaway, Celetta; Pascal, Bruce D.; Kumar, Raj; Edwards, Dean P.; Griffin, Patrick R.

    2015-01-01

    Structural and functional details of the N-terminal activation function 1 (AF1) of most nuclear receptors are poorly understood due to the highly dynamic intrinsically disordered nature of this domain. A hydrogen/deuterium exchange (HDX) mass spectrometry based investigation of TATA box binding protein (TBP) interaction with various domains of progesterone receptor (PR) demonstrate that agonist bound PR interaction with TBP via AF1 impacts the mobility of the C-terminal AF2. Results from HDX and other biophysical studies involving agonist and antagonist bound full length PR and isolated PR domains reveals the molecular mechanism underlying synergistic transcriptional activation mediated by AF1 and AF2, dominance of PR-B isoform over PR-A, and the necessity of AF2 for full AF1-mediated transcriptional activity. These results provide a comprehensive picture elaborating the underlying mechanism of PR-TBP interactions as a model for studying NR-transcription factor functional interactions. PMID:24909783

  3. Testing the performance of a cryogenic visualization system on thermal counterflow by using hydrogen and deuterium solid tracers

    NASA Astrophysics Data System (ADS)

    La Mantia, M.; Chagovets, T. V.; Rotter, M.; Skrbek, L.

    2012-05-01

    An experimental apparatus has been designed to analyze by visualization cryogenic flows of liquid 4He and consequently address unresolved problems of quantum turbulence. The newly implemented flow visualization setup is described and its specific features discussed. Thermal counterflow experiments have been performed and the motion of solid hydrogen and deuterium tracers studied by using the particle tracking velocimetry technique in order to probe the system capabilities. It is shown that the obtained results are consistent with the two-fluid model describing the behavior of superfluid 4He. A number of technical and fundamental issues, such as particles' aggregation, role of rotating particles in counterflow and evidence of non-Gaussian distribution of tracers' velocities, are also discussed. The apparatus appears to be well-suited to the task of analyzing cryogenic flows and potentially capable of obtaining new results stimulating further understanding of the underlying physics.

  4. Water on Mars: Clues from Deuterium/Hydrogen and Water Contents of Hydrous Phases in SNC Meteorites.

    PubMed

    Watson, L L; Hutcheon, I D; Epstein, S; Stolper, E M

    1994-07-01

    Ion microprobe studies of hydrous amphibole, biotite, and apatite in shergottite-nakhlite-chassignite (SNC) meteorites, probable igneous rocks from Mars, indicate high deuterium/hydrogen (D/H) ratios relative to terrestrial values. The amphiboles contain roughly one-tentn as much water as expected, suggesting that SNC magmas were less hydrous than previously proposed. The high but variable D/H values of these minerals are best explained by postcrystallization D enrichment of initially D-poor phases by martian crustal fluids with near atmospheric D/H (about five times the terrestrial value). These igneous phases do not directly reflect the D/H ratios of martian "magmatic" water but provide evidence for a D-enriched martian crustal water reservoir. PMID:17774694

  5. Erosion and redeposition behavior of selected NET-candidate materials under high-flux hydrogen, deuterium plasma bombardment in pisces

    NASA Astrophysics Data System (ADS)

    Franconi, E.; Hirooka, Y.; Conn, R. W.; Leung, W. K.; Labombard, B.; Nygren, R. E.

    1989-04-01

    Plasma erosion and redeposition behavior of selected candidate materials for plasma-facing components in the NET-machine have been investigated using the PISCES-A facility. Materials studied include SiC-impregnated graphite, 2D graphite weaves with and without CVD-SiC coatings, and isotropic graphite. These specimens were exposed to continuous hydrogen or deuterium plasmas under the following conditions: electron temperature range from 5 to 35 eV; plasma density range from 5 10 11 to 1 10 12 cm -3; flux range from 5 10 17 to 2 10 18 ions cm -2 s -1; fluence of the order from 10 21 to 10 22 ions/cm 2; bombarding energies of 50 and 100 eV; target temperature range from 300 to 1000C. The erosion yield of SiC-impregnated graphite due to deuterium plasma bombardment is found to be a factor of 2 to 3 less than that of isotropic graphite materials. A further factor of 2-3 reduction in the erosion yield is observed in when redeposition associated with reionization of sputtered particle becomes significant. From post-bombardment surface analysis with AES, the surface composition in terms of the Si/C of SiC-impregnated graphite ratio is found to increase from 0.15 to 0.7 after hydrogen plasma bombardment to a fluence around 4 10 21 ions/cm 2 at 350 C. However, the final surface composition appears to remain unchanged up to 4 10 22 ions/cm 2, the highest fluence in the present study. Significant surface morphological modifications of SiC-impregnated graphite are observed after the high-fluence plasma exposure. Several structural problems such as coating-substrate adhesion have been pointed out for SiC-coated 2D graphite weave.

  6. Analysis of palladium coatings to remove hydrogen isotopes from zirconium fuel rods in Canada deuterium uranium-pressurized heavy water reactors; Thermal and neutron diffusion effects

    SciTech Connect

    Stokes, C.L.; Buxbaum, R.E. )

    1992-05-01

    This paper reports that, in pressurized heavy water nuclear reactors of the type standardly used in Canada (Canada deuterium uranium-pressurized heavy water reactors), the zirconium alloy pressure tubes of the core absorb deuterium produced by corrosion reactions. This deuterium weakens the tubes through hydrogen embrittlement. Thin palladium coatings on the outside of the zirconium are analyzed as a method for deuterium removal. This coating is expected to catalyze the reaction D{sub 2} + 1/2O{sub 2} {r reversible} D{sub 2}O when O{sub 2} is added to the annular (insulating) gas in the tubes. Major reductions in the deuterium concentration and, hence, hydrogen embrittlement are predicted. Potential problems such as plating the tube geometry, neutron absorption, catalyst deactivation, radioactive waste production, and oxygen corrosion are shown to be manageable. Also, a simple set of equations are derived to calculate the effect on diffusion caused by neutron interactions. Based on calculations of ordinary and neutron flux induced diffusion, a palladium coating of 1 {times} 10{sup {minus}6} m is recommended. This would cost approximately $60,000 per reactor unit and should more than double reactor lifetime. Similar coatings and similar interdiffusion calculations might have broad applications.

  7. Gas-Phase Hydrogen-Deuterium Exchange Labeling of Select Peptide Ion Conformer Types: a Per-Residue Kinetics Analysis

    NASA Astrophysics Data System (ADS)

    Khakinejad, Mahdiar; Kondalaji, Samaneh Ghassabi; Tafreshian, Amirmahdi; Valentine, Stephen J.

    2015-07-01

    The per-residue, gas-phase hydrogen deuterium exchange (HDX) kinetics for individual amino acid residues on selected ion conformer types of the model peptide KKDDDDDIIKIIK have been examined using ion mobility spectrometry (IMS) and HDX-tandem mass spectrometry (MS/MS) techniques. The [M + 4H]4+ ions exhibit two major conformer types with collision cross sections of 418 Å2 and 446 Å2; the [M + 3H]3+ ions also yield two different conformer types having collision cross sections of 340 Å2 and 367 Å2. Kinetics plots of HDX for individual amino acid residues reveal fast- and slow-exchanging hydrogens. The contributions of each amino acid residue to the overall conformer type rate constant have been estimated. For this peptide, N- and C-terminal K residues exhibit the greatest contributions for all ion conformer types. Interior D and I residues show decreased contributions. Several charge state trends are observed. On average, the D residues of the [M + 3H]3+ ions show faster HDX rate contributions compared with [M + 4H]4+ ions. In contrast the interior I8 and I9 residues show increased accessibility to exchange for the more elongated [M + 4H]4+ ion conformer type. The contribution of each residue to the overall uptake rate showed a good correlation with a residue hydrogen accessibility score model calculated using a distance from charge site and initial incorporation site for nominal structures obtained from molecular dynamic simulations (MDS).

  8. Hydrogen Storage in Nanostructured Carbon Materials at Room Temperature

    NASA Astrophysics Data System (ADS)

    Chen, Xiaohong; Dettlaff-Weglikowska, Urszula; Haluska, Miro; Hirscher, Michael; Becher, Marion; Roth, Siegmar

    2002-10-01

    Room temperature hydrogen sorption capacities of nanostructured carbon materials including single-walled carbon nanotubes (SWNTs), multi-walled carbon nanotubes (MWNTs), carbon nanohorns (CNH), activated carbon, carbon black and graphite are determined by the volumetric method. All carbon materials investigated, including the samples with high specific surface area as purified SWNTs prepared by the HiPco process and activated carbon, show a hydrogen storage capacity of less than 1 wt % at room temperature and pressures below 100 bar.

  9. Hydrogen-bond-dynamics-based switching of conductivity and magnetism: a phase transition caused by deuterium and electron transfer in a hydrogen-bonded purely organic conductor crystal.

    PubMed

    Ueda, Akira; Yamada, Shota; Isono, Takayuki; Kamo, Hiromichi; Nakao, Akiko; Kumai, Reiji; Nakao, Hironori; Murakami, Youichi; Yamamoto, Kaoru; Nishio, Yutaka; Mori, Hatsumi

    2014-08-27

    A hydrogen bond (H-bond) is one of the most fundamental and important noncovalent interactions in chemistry, biology, physics, and all other molecular sciences. Especially, the dynamics of a proton or a hydrogen atom in the H-bond has attracted increasing attention, because it plays a crucial role in (bio)chemical reactions and some physical properties, such as dielectricity and proton conductivity. Here we report unprecedented H-bond-dynamics-based switching of electrical conductivity and magnetism in a H-bonded purely organic conductor crystal, ?-D3(Cat-EDT-TTF)2 (abbreviated as ?-D). This novel crystal ?-D, a deuterated analogue of ?-H3(Cat-EDT-TTF)2 (abbreviated as ?-H), is composed only of a H-bonded molecular unit, in which two crystallographically equivalent catechol-fused ethylenedithiotetrathiafulvalene (Cat-EDT-TTF) skeletons with a +0.5 charge are linked by a symmetric anionic [ODO](-1)-type strong H-bond. Although the deuterated and parent hydrogen systems, ?-D and ?-H, are isostructural paramagnetic semiconductors with a dimer-Mott-type electronic structure at room temperature (space group: C2/c), only ?-D undergoes a phase transition at 185 K, to change to a nonmagnetic insulator with a charge-ordered electronic structure (space group: P1). The X-ray crystal structure analysis demonstrates that this dramatic switching of the electronic structure and physical properties originates from deuterium transfer or displacement within the H-bond accompanied by electron transfer between the Cat-EDT-TTF ?-systems, proving that the H-bonded deuterium dynamics and the conducting TTF ?-electron are cooperatively coupled. Furthermore, the reason why this unique phase transition occurs only in ?-D is qualitatively discussed in terms of the H/D isotope effect on the H-bond geometry and potential energy curve. PMID:25127315

  10. Synthesis of hydrogen-carbon clathrate material and hydrogen evolution therefrom at moderate temperatures and pressures

    DOEpatents

    Lueking, Angela; Narayanan, Deepa

    2011-03-08

    A process for making a hydrogenated carbon material is provided which includes forming a mixture of a carbon source, particularly a carbonaceous material, and a hydrogen source. The mixture is reacted under reaction conditions such that hydrogen is generated and/or released from the hydrogen source, an amorphous diamond-like carbon is formed, and at least a portion of the generated and/or released hydrogen associates with the amorphous diamond-like carbon, thereby forming a hydrogenated carbon material. A hydrogenated carbon material including a hydrogen carbon clathrate is characterized by evolution of molecular hydrogen at room temperature at atmospheric pressure in particular embodiments of methods and compositions according to the present invention.

  11. Simultaneous profiling of hydrogen and deuterium by 2.6 MeV He4e ERDA using a ?E - E telescope detector

    NASA Astrophysics Data System (ADS)

    Wielunski, M.; Mayer, M.; Behrisch, R.; Roth, J.; Scherzer, B. M. U.

    1997-01-01

    For depth profiling of hydrogen isotopes by elastic recoil detection analysis (ERDA) with 2.6 MeV He4e ions a special ?E - E telescope type detector system was tested. It allows the separation of hydrogen and deuterium recoils as well as backscattered helium particles. For particle identification from the energy loss ? E a thin 3.7 ?m silicon transmission detector was used while the residual energy was measured with a standard 100 ?m PIPS silicon surface barrier detector. The depth profiles of deuterium and hydrogen were measured at plasma deposited a-C:H:D layers as well as at samples exposed to plasma discharges in the tokamak experiment ASDEX-Upgrade.

  12. Ultrahigh vacuum scanning tunneling microscopy nanofabrication and hydrogen/deuterium desorption from silicon surfaces: implications for complementary metal oxide semiconductor technology

    NASA Astrophysics Data System (ADS)

    Lyding, J. W.; Hess, K.; Abeln, G. C.; Thompson, D. S.; Moore, J. S.; Hersam, M. C.; Foley, E. T.; Lee, J.; Chen, Z.; Hwang, S. T.; Choi, H.; Avouris, Ph.; Kizilyalli, I. C.

    1998-06-01

    The development of ultrahigh vacuum-scanning tunneling microscopy (UHV-STM)-based nanofabrication capability for hydrogen passivated silicon surfaces has opened new opportunities for selective chemical processing, down to the atomic scale. The chemical contrast between clean and H-passivated Si(100) surfaces has been used to achieve nanoscale selective oxidation, nitridation, molecular functionalization, and metallization by thermal chemical vapor deposition (CVD). Further understanding of the hydrogen desorption mechanisms has been gained by extending the studies to deuterated surfaces. In these experiments, it was discovered that deuterium is nearly two orders of magnitude more difficult to desorb than hydrogen in the electronic desorption regime. This giant isotope effect provided the basis for an idea that has since led to the extension of complementary metal oxide semiconductor (CMOS) transistor lifetimes by factors of 10 or greater. Low temperature hydrogen and deuterium desorption experiments were performed to gain further insight into the underlying physical mechanisms. The desorption shows no temperature dependence in the high energy electronic desorption regime. However, in the low energy vibrational heating regime, hydrogen is over two orders of magnitude easier to desorb at 11 K than at room temperature. The enhanced desorption in the low temperature vibrational regime has enabled the quantification of a dramatic increase in the deuterium isotope effect at low voltages. These results may have direct implications for low voltage and/or low temperature scaled CMOS operation.

  13. Optimization and Application of APCI Hydrogen-Deuterium Exchange Mass Spectrometry (HDX MS) for the Speciation of Nitrogen Compounds.

    PubMed

    Acter, Thamina; Cho, Yunju; Kim, Sungji; Ahmed, Arif; Kim, Byungjoo; Kim, Sunghwan

    2015-09-01

    A systematic study was performed to investigate the utility of atmospheric pressure chemical ionization hydrogen-deuterium exchange mass spectrometry (APCI HDX MS) to identify the structures of nitrogen-containing aromatic compounds. First, experiments were performed to determine the optimized experimental conditions, with dichloromethane and CH(3)OD found to be good cosolvents for APCI HDX. In addition, a positive correlation between the heated capillary temperature and the observed HDX signal was observed, and it was suggested that the HDX reaction occurred when molecules were contained in the solvent cluster. Second, 20 standard nitrogen-containing compounds were analyzed to investigate whether speciation could be determined based on the different types of ions produced from nitrogen-containing compounds with various functional groups. The number of exchanges occurring within the compounds correlated well with the number of active hydrogen atoms attached to nitrogen, and it was confirmed that APCI HDX MS could be used to determine speciation. The results obtained by APCI HDX MS were combined with the subsequent investigation of the double bond equivalence distribution and indicated that resins of shale oil extract contained mostly pyridine type nitrogen compounds. This study confirmed that APCI HDX MS can be added to previously reported chemical ionization, electrospray ionization, and atmospheric pressure photo ionization-based HDX methods, which can be used for structural elucidation by mass spectrometry. PMID:26115964

  14. Optimization and Application of APCI Hydrogen-Deuterium Exchange Mass Spectrometry (HDX MS) for the Speciation of Nitrogen Compounds

    NASA Astrophysics Data System (ADS)

    Acter, Thamina; Cho, Yunju; Kim, Sungji; Ahmed, Arif; Kim, Byungjoo; Kim, Sunghwan

    2015-09-01

    A systematic study was performed to investigate the utility of atmospheric pressure chemical ionization hydrogen-deuterium exchange mass spectrometry (APCI HDX MS) to identify the structures of nitrogen-containing aromatic compounds. First, experiments were performed to determine the optimized experimental conditions, with dichloromethane and CH3OD found to be good cosolvents for APCI HDX. In addition, a positive correlation between the heated capillary temperature and the observed HDX signal was observed, and it was suggested that the HDX reaction occurred when molecules were contained in the solvent cluster. Second, 20 standard nitrogen-containing compounds were analyzed to investigate whether speciation could be determined based on the different types of ions produced from nitrogen-containing compounds with various functional groups. The number of exchanges occurring within the compounds correlated well with the number of active hydrogen atoms attached to nitrogen, and it was confirmed that APCI HDX MS could be used to determine speciation. The results obtained by APCI HDX MS were combined with the subsequent investigation of the double bond equivalence distribution and indicated that resins of shale oil extract contained mostly pyridine type nitrogen compounds. This study confirmed that APCI HDX MS can be added to previously reported chemical ionization, electrospray ionization, and atmospheric pressure photo ionization-based HDX methods, which can be used for structural elucidation by mass spectrometry.

  15. Effective Application of Bicelles for Conformational Analysis of G Protein-Coupled Receptors by Hydrogen/Deuterium Exchange Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Duc, Nguyen Minh; Du, Yang; Thorsen, Thor S.; Lee, Su Youn; Zhang, Cheng; Kato, Hideaki; Kobilka, Brian K.; Chung, Ka Young

    2015-05-01

    G protein-coupled receptors (GPCRs) have important roles in physiology and pathology, and 40% of drugs currently on the market target GPCRs for the treatment of various diseases. Because of their therapeutic importance, the structural mechanism of GPCR signaling is of great interest in the field of drug discovery. Hydrogen/deuterium exchange mass spectrometry (HDX-MS) is a useful tool for analyzing ligand binding sites, the protein-protein interaction interface, and conformational changes of proteins. However, its application to GPCRs has been limited for various reasons, including the hydrophobic nature of GPCRs and the use of detergents in their preparation. In the present study, we tested the application of bicelles as a means of solubilizing GPCRs for HDX-MS studies. GPCRs (e.g., β2-adrenergic receptor [β2AR], μ-opioid receptor, and protease-activated receptor 1) solubilized in bicelles produced better sequence coverage (greater than 90%) than GPCRs solubilized in n-dodecyl-β-D-maltopyranoside (DDM), suggesting that bicelles are a more effective method of solubilization for HDX-MS studies. The HDX-MS profile of β2AR in bicelles showed that transmembrane domains (TMs) undergo lower deuterium uptake than intracellular or extracellular regions, which is consistent with the fact that the TMs are highly ordered and embedded in bicelles. The overall HDX-MS profiles of β2AR solubilized in bicelles and in DDM were similar except for intracellular loop 3. Interestingly, we detected EX1 kinetics, an important phenomenon in protein dynamics, at the C-terminus of TM6 in β2AR. In conclusion, we suggest the application of bicelles as a useful method for solubilizing GPCRs for conformational analysis by HDX-MS.

  16. Patterns of structural dynamics in RACK1 protein retained throughout evolution: A hydrogen-deuterium exchange study of three orthologs

    PubMed Central

    Tarnowski, Krzysztof; Fituch, Kinga; Szczepanowski, Roman H; Dadlez, Michal; Kaus-Drobek, Magdalena

    2014-01-01

    RACK1 is a member of the WD repeat family of proteins and is involved in multiple fundamental cellular processes. An intriguing feature of RACK1 is its ability to interact with at least 80 different protein partners. Thus, the structural features enabling such interactomic flexibility are of great interest. Several previous studies of the crystal structures of RACK1 orthologs described its detailed architecture and confirmed predictions that RACK1 adopts a seven-bladed ?-propeller fold. However, this did not explain its ability to bind to multiple partners. We performed hydrogen-deuterium (H-D) exchange mass spectrometry on three orthologs of RACK1 (human, yeast, and plant) to obtain insights into the dynamic properties of RACK1 in solution. All three variants retained similar patterns of deuterium uptake, with some pronounced differences that can be attributed to RACK1's divergent biological functions. In all cases, the most rigid structural elements were confined to B-C turns and, to some extent, strands B and C, while the remaining regions retained much flexibility. We also compared the average rate constants for H-D exchange in different regions of RACK1 and found that amide protons in some regions exchanged at least 1000-fold faster than in others. We conclude that its evolutionarily retained structural architecture might have allowed RACK1 to accommodate multiple molecular partners. This was exemplified by our additional analysis of yeast RACK1 dimer, which showed stabilization, as well as destabilization, of several interface regions upon dimer formation. PMID:24591271

  17. Effective application of bicelles for conformational analysis of G protein-coupled receptors by hydrogen/deuterium exchange mass spectrometry.

    PubMed

    Duc, Nguyen Minh; Du, Yang; Thorsen, Thor S; Lee, Su Youn; Zhang, Cheng; Kato, Hideaki; Kobilka, Brian K; Chung, Ka Young

    2015-05-01

    G protein-coupled receptors (GPCRs) have important roles in physiology and pathology, and 40% of drugs currently on the market target GPCRs for the treatment of various diseases. Because of their therapeutic importance, the structural mechanism of GPCR signaling is of great interest in the field of drug discovery. Hydrogen/deuterium exchange mass spectrometry (HDX-MS) is a useful tool for analyzing ligand binding sites, the protein-protein interaction interface, and conformational changes of proteins. However, its application to GPCRs has been limited for various reasons, including the hydrophobic nature of GPCRs and the use of detergents in their preparation. In the present study, we tested the application of bicelles as a means of solubilizing GPCRs for HDX-MS studies. GPCRs (e.g., β2-adrenergic receptor [β2AR], μ-opioid receptor, and protease-activated receptor 1) solubilized in bicelles produced better sequence coverage (greater than 90%) than GPCRs solubilized in n-dodecyl-β-D-maltopyranoside (DDM), suggesting that bicelles are a more effective method of solubilization for HDX-MS studies. The HDX-MS profile of β2AR in bicelles showed that transmembrane domains (TMs) undergo lower deuterium uptake than intracellular or extracellular regions, which is consistent with the fact that the TMs are highly ordered and embedded in bicelles. The overall HDX-MS profiles of β2AR solubilized in bicelles and in DDM were similar except for intracellular loop 3. Interestingly, we detected EX1 kinetics, an important phenomenon in protein dynamics, at the C-terminus of TM6 in β2AR. In conclusion, we suggest the application of bicelles as a useful method for solubilizing GPCRs for conformational analysis by HDX-MS. PMID:25740347

  18. Characterization of IgG1 Conformation and Conformational Dynamics by Hydrogen/Deuterium Exchange Mass Spectrometry

    SciTech Connect

    Houde, Damian; Arndt, Joseph; Domeier, Wayne; Berkowitz, Steven; Engen, John R.

    2009-04-22

    Protein function is dictated by protein conformation. For the protein biopharmaceutical industry, therefore, it is important to have analytical tools that can detect changes in protein conformation rapidly, accurately, and with high sensitivity. In this paper we show that hydrogen/deuterium exchange mass spectrometry (H/DX-MS) can play an important role in fulfilling this need within the industry. H/DX-MS was used to assess both global and local conformational behavior of a recombinant monoclonal IgG1 antibody, a major class of biopharmaceuticals. Analysis of exchange into the intact, glycosylated IgG1 (and the Fab and Fc regions thereof) showed that the molecule was folded, highly stable, and highly amenable to analysis by this method using less than a nanomole of material. With improved chromatographic methods, peptide identification algorithms and data-processing steps, the analysis of deuterium levels in peptic peptides produced after labeling was accomplished in 1--2 days. On the basis of peptic peptide data, exchange was localized to specific regions of the antibody. Changes to IgG1 conformation as a result of deglycosylation were determined by comparing exchange into the glycosylated and deglycosylated forms of the antibody. Two regions of the IgG1 (residues 236-253 and 292-308) were found to have altered exchange properties upon deglycosylation. These results are consistent with previous findings concerning the role of glycosylation in the interaction of IgG1 with Fc receptors. Moreover, the data clearly illustrate how H/DX-MS can provide important characterization information on the higher order structure of antibodies and conformational changes that these molecules may experience upon modification.

  19. Hydrogen/Deuterium Exchange and Electron-Transfer Dissociation Mass Spectrometry Determine the Interface and Dynamics of Apolipoprotein E Oligomerization

    PubMed Central

    Huang, Richard Y-C.; Garai, Kanchan; Frieden, Carl; Gross, Michael L.

    2011-01-01

    Apolipoprotein E, a 34 kDa protein, plays a key role in triglyceride and cholesterol metabolism. Of the three common isoforms (ApoE2, 3 and 4), only ApoE4 is a risk factor for Alzheimers Disease. All three isoforms of wild-type ApoE self-associate to form oligomers, a process that may have functional consequences. Although the C-terminal domain, residues 216299, of ApoE is believed to mediate self-association, the specific residues involved in this process are not known. Here we report the use of hydrogen/deuterium exchange (H/DX) coupled with enzymatic digestion to identify those regions in the sequence of full-length apoE involved in oligomerization. For this determination, we compared the results of H/DX of the wild-type proteins and those of monomeric forms obtained by modifying four residues in the C-terminal domain. The three wild type and mutant isoforms show similar structures based on their similar H/DX kinetics and extents of exchange. Regions of the C-terminus (residues 230270) of the ApoE isoforms show significant differences of deuterium uptake between oligomeric and monomeric forms, confirming that oligomerization occurs at these regions. To achieve single amino acid resolution, we examined the extents of H/DX by using electron transfer dissociation (ETD) fragmentation of peptides representing selected regions of both the monomeric and the oligomeric forms of ApoE4. From these experiments, we could identify the specific residues involved in ApoE oligomerization. In addition, our results verify that ApoE4 is composed of a compact structure at its N-terminal domain. Regions of C-terminal domain, however, appear to lack defined structure. PMID:21899263

  20. Catalytic carbon membranes for hydrogen production

    SciTech Connect

    Damle, A.S.; Gangwal, S.K.

    1992-01-01

    Commercial carbon composite microfiltration membranes may be modified for gas separation applications by providing a gas separation layer with pores in the 1- to 10-nm range. Several organic polymeric precursors and techniques for depositing a suitable layer were investigated in this project. The in situ polymerization technique was found to be the most promising, and pure component permeation tests with membrane samples prepared with this technique indicated Knudsen diffusion behavior. The gas separation factors obtained by mixed-gas permeation tests were found to depend strongly on gas temperature and pressure indicating significant viscous flow at high-pressure conditions. The modified membranes were used to carry out simultaneous water gas shift reaction and product hydrogen separation. These tests indicated increasing CO conversions with increasing hydrogen separation. A simple process model was developed to simulate a catalytic membrane reactor. A number of simulations were carried out to identify operating conditions leading to product hydrogen concentrations over 90 percent. (VC)

  1. NRA of hydrogen in glassy polymeric carbon

    NASA Astrophysics Data System (ADS)

    Zimmerman, R. L.; Ila, D.; Jenkins, G. M.; Hirvonen, J. K.; Maleki, H.

    1997-02-01

    Glassy Polymeric Carbon (GPC) is prepared from a precursor resin by careful heat treatment. Heat Treatment Temperatures (HTT) above 1500 C are believed to expel all hydrogen and oxygen from the grafene structure of GPC. However, we have shown that significant amounts of oxygen remain sequestered in the pores of GPC even at HTT's above 1500 C. In the present study we report the detection of similar amounts of hydrogen for various heat treatment temperatures up to 2500 C. A Nuclear Reaction Analysis (NRA) method with the 1H(15N,??)12C reaction and a specifically designed coincidence array is used to detect the 4.43 MeV gamma ray whose yield is proportional to the hydrogen content in the GPC. The H:C atomic ratio decreases with increasing HTT and we show that it exceeds 1:100 even for a HTT of 2500 C.

  2. SISGR - Hydrogen Caged in Carbon-Exploration of Novel Carbon-Hydrogen Interactions

    SciTech Connect

    Lueking, Angela; Badding, John; Crespi, Vinent

    2015-12-01

    Hydrogen trapped in a carbon cage, captured through repulsive interactions, is a novel concept in hydrogen storage. Trapping hydrogen via repulsive interactions borrows an idea from macroscale hydrogen storage (i.e. compressed gas storage tanks) and reapplies these concepts on the nanoscale in specially designed molecular containers. Under extreme conditions of pressure, hydrogen solubility in carbon materials is expected to increase and carbon is expected to restructure to minimize volume via a mixed sp2/sp3 hydrogenated state. Thermodynamics dictate that pre-formed C-H structures will rearrange with increased pressure, yet the final carbon-hydrogen interactions may be dependent upon the mechanism by which hydrogen is introduced. Gas “trapping” is meant to denote gas present in a solid in a high density, adsorbed-like state, when the external pressure is much less than that necessary to provide a comparable fluid density. Trapping thus denotes a kinetically metastable state rather than thermodynamic equilibrium. This project probed mechanochemical means to polymerize select hydrocarbons in the presence of gases, in an attempt to form localized carbon cages that trap gases via repulsive interactions. Aromatic, polyaromatic, and hydroaromatic molecules expected to undergo cyclo-addition reactions were polymerized at high (~GPa) pressures to form extended hydrogenated amorphous carbon networks. Notably, aromatics with a pre-existing internal free volume (such as Triptycene) appeared to retain an internal porosity upon application of pressure. However, a high photoluminescence background after polymerization precluded in situ identification of trapped gases. No spectroscopic evidence was found after depressurization that would be indicative of pockets of trapped gases in a localized high-pressure environment. Control studies suggested this measurement may be insensitive to gases at low pressure. Similarly, no spectral fingerprint was found for gas-imbued spherical carbon nanoshells, even after chemical “capping” of the gas-imbued nanoshells to limit gas diffusivity. Subsequently, spectral probes of gas vibrational modes adsorbed in various carbon nanostructures (including activated carbons, single-wall carbon nanotubes, polymers of intrinsic microporosity (PIMs), and UV-irradiated PIMs with decreased pore size) were found only at high pressure. The vibrational mode of the adsorbed film became perturbed in high density films, and the perturbation was sensitive to surface functional groups, pore size, and pore dimension. Experimental results were corroborated with first-principle modeling using density functional theory. Development of semi-empirical correlations that relate the spectral features to pore dimension, geometry, and chemical potential of the adsorbed film are on-going.

  3. Production of highly spin-polarized atomic hydrogen and deuterium by spin-exchange optical pumping

    SciTech Connect

    Redsun, S.G.; Knize, R.J.; Cates, G.D.; Happer, W. )

    1990-08-01

    We have produced highly spin-polarized atomic hydrogen by spin-exchange optical pumping. A tunable ring dye laser is used to polarize rubidium atoms by optical pumping. The cell containing the rubidium vapor is coated with paraffin in order to reduce spin relaxation due to wall collisions. Hydrogen gas is dissociated in an inductive discharge and flows continuously through the cell, in which the hydrogen atoms are polarized by spin-exchange collisions with the polarized rubidium atoms. Atomic-hydrogen polarization as high as 2{l angle}{ital J}{sub {ital z}}{r angle}{sub H}=0.72(6) has been observed, which is the highest polarization yet produced by this method. However, the rubidium polarization may be limited to this value due to radiation trapping at higher rubidium densities. The spin-relaxation rate of atomic hydrogen on a paraffin-coated cell is also measured and corresponds to about 7600 wall bounces between wall relaxation.

  4. Spherical cauliflower-like carbon dust formed by interaction between deuterium plasma and graphite target and its internal structure

    NASA Astrophysics Data System (ADS)

    Ohno, N.; Yoshimi, M.; Tokitani, M.; Takamura, S.; Tokunaga, K.; Yoshida, N.

    2009-06-01

    Simulated experiments to produce carbon dust particles with cauliflower structure have been performed in a liner plasma device, NAGDIS-II by exposing high density deuterium plasma to a graphite sample (IG-430U). Formation of carbon dust depends on the surface temperature and the incident ion energy. At a surface temperature 600-700 K, a lot of isolated spherical dust particles are observed on the graphite target. The internal structure of an isolated dust particle was observed with Focused Ion Beam (FIB) system and Transmission Electron Microscope (TEM) in detail. FIB analysis clearly shows there exist honey-combed cell structure with thin carbon walls in the dust particle and the dust particle grows from the graphite surface. TEM image also shows that the dust particle is made of amorphous carbon with crystallized grains with diameters of 10-50 nm.

  5. Study of order and dynamics in liquid crystalline materials by carbon-13 and deuterium NMR spectroscopy

    NASA Astrophysics Data System (ADS)

    Xu, Jiadi

    This dissertation investigates the phase structures, molecular structures and diffusion motions in some recently discovered liquid crystals using 1D and 2D carbon-13 and deuterium NMR spectroscopy. Two classes of liquid crystals are involved: chiral rod-like liquid crystals and banana mesogens. Our investigations of these new materials were divided into five main sections. The ordering and structures of banana liquid crystals and chiral rod-like mesogens were extracted from solid-state 13C NMR experiments including Separated-Local-Field study based on Lee-Goldberg Cross-Polarization (LGCP-SLF) and temperature dependent chemical shifts. The principal values of CSA tensor were measured using Separation of Undistorted CSA Powder patterns by Effortless Recoupling (SUPER) experiment. Some ID and 2D pulse experiments were performed for the assignment of carbon peaks, such as Cross-Polarization Polarization-Inversion (CPPI), HECTOR and so on. The soliton-like distortion of the helicoidal structure in the chiral smectic C phase (SmC*) of 8BEF5 liquid crystal was observed by the angular dependent DNMR patterns, and quantitatively interpreted based on Landau theory. The distortion was induced by the NMR magnetic field. The phase structure and interlayer diffusion in anticlinic Sm C* phases (Sm C*A , Sm C*Fi1 and Sm C*Fi2 ) of 10B1M7 liquid crystal were measured using angular dependent DNMR lineshapes and echo intensities. This work represents the first study of ferrielectric smectic phases by means of NMR. Measurements of the interlayer diffusion in synclinic and anticlinic SmC* phases (SmC*, Sm C*Fi1 and Sm C*Fi2 ) of 10B1M7 were carried out using 2H NMR exchange experiments. The phase structures of anticlinic SmC* phases were also determined using the same technique. A 'deformed clock model' was found to be appropriate for these phases. Molecular structures and dynamics were investigated in an exotic B 2 phase of a banana liquid crystal Pbis11BB by means of CP-MAS 13C NMR, MAS 2D 13C NMR exchange and LGCP-SLF (with MAS) experiments. These experiments showed that the molecules have asymmetric conformation in the solid state and carry on much slower motions in solid and liquid states compared to banana molecules in the same homologous series.

  6. Hydrogenated amorphous carbon grains in Comet Halley

    SciTech Connect

    Colangeli, L.; Schwehm, G.; Bussoletti, E.; Fonti, S.; Blanco, A. ESA, Space Science Dept., Noordwijk Osservatorio Astronomico di Capodimonte, Naples Lecce Universita )

    1990-01-01

    Recent IR observations of Comets Halley, Wilson, and Bradfield have shown the existence of an emission feature falling at around 3.4 microns. In this paper, it is shown that a good fit of both the IR continuum and the band can be obtained by assuming a simple thermal emission model based upon the optical properties of hydrogenated amorphous carbon (HAC) grains, measured in laboratory. The best fits of P/Halley's spectra are obtained for HAC dust amounts which appear consistent with the constraints imposed by the observed production rates. The presence of amorphous carbon solid particles is also supported on the basis of in situ mass spectrometry measurements performed by the Vega 1/2 and Giotto spacecraft in the environment of P/Halley. At present, it appears reasonable to suggest that amorphous carbon grains are able to match the observations and can be considered among likely candidates for cometary materials. 51 refs.

  7. Thermochemical generation of hydrogen and carbon dioxide

    NASA Technical Reports Server (NTRS)

    Lawson, Daniel D. (Inventor); England, Christopher (Inventor)

    1984-01-01

    Mixing of carbon in the form of high sulfur coal with sulfuric acid reduces the temperature of sulfuric acid decomposition from 830.degree. C. to between 300.degree. C. and 400.degree. C. The low temperature sulfuric acid decomposition is particularly useful in thermal chemical cycles for splitting water to produce hydrogen. Carbon dioxide is produced as a commercially desirable byproduct. Lowering of the temperature for the sulfuric acid decomposition or oxygen release step simplifies equipment requirements, lowers thermal energy input and reduces corrosion problems presented by sulfuric acid at conventional cracking temperatures. Use of high sulfur coal as the source of carbon for the sulfuric acid decomposition provides an environmentally safe and energy efficient utilization of this normally polluting fuel.

  8. Functionalized carbon nanostructures for hydrogen catalysis

    NASA Astrophysics Data System (ADS)

    Hu, Lung-Hao

    Sodium borohydride, NaBH4, is widely used as a source of pure hydrogen. Hydrogen is of interest because it is a source of clean energy. It can be converted directly into electrical energy by means of fuel cells. One of the objectives of this thesis was to develop a new catalytic process to (i) enhance the rate of hydrogen generation, and (ii) to achieve hydrogen generation equal to 100% of the theoretically expected value. The catalyst investigated in this research is constructed by starting from single wall carbon nanotubes (SWNT). This material has a very high specific surface area and good conductivity. The SWNT were formed into a paper by a special filtration process. Polysilazane, a polymeric precursor (Ceraset(TM)-SN from KiON Corp., Wiesbaden, Germany) was diluted by acetone and then layered onto SWNT paper. The Ceraset coated SWNT was then pyrolyzed at 1100°C for three hours to form a silicon carbonitride (SiCN), polymer derived ceramic (PDC), layer on the surface of SWNT filtered paper. This functionalized SiCN carbon nanotube paper (SiCN/CNT) was used as the substrate for catalyst dispersions. The catalyst consisted of transition metals, Pt/Pd/Ru. Suspension solutions of Pt, Pd and Ru were impregnated onto the SiCN/CNT paper with the expectation of creating a monolayer of these transition metals on surface of the SiCN/CNT substrate. It is likely that an interaction could occur between the transition metals and the silicon atoms present in the SiCN layer on the surface of the carbon nanotubes. It is known that transition metals and silicon react to form silicides, suggesting the formation of a strong Si-transition metal bond. Therefore, it is possible that this bond could provide good wetting of metal atoms on SiCN functionalized carbon nanotube substrate. In the limit a monolayer of the transition metals may be achieved, which would correspond to a near zero dihedral angle between the substrate and the cluster of transition metals. In such a scenario a very high activity of the catalyst can be achieved raising the figure of merit for hydrogen generation nearly to its highest possible value. The catalytic performance is also related to the intrinsic activity of chemical composition of the catalyst. In the present work, the use of catalysts of a ternary composition has been discovered to enhance the activity of the catalyst. The experiments presented in this work use Pt/Pd/Ru catalyzed SiCN/CNT as the catalyst to react with sodium borohydride for the hydrogen generation. The thickness of SiCN/CNT paper is one of the factors, which influences the hydrogen generation rate: thinner papers produce higher rates of hydrogen generation. The likely reason for this phenomenon is that hydrogen bubbles can become trapped within the mesh of carbon nanotubes that constitute the paper-like structure of the catalyst. It is hypothesized that hydrogen bubbles can escape more easily from the interior of the paper if the paper is thinner. The effect of the paper thickness on the hydrogen generation rate forms the first part of the thesis. In the next phase of the thesis, thin film structures of carbon nanotubes, about 300 nm high, were created to serve as the catalyst substrates. Transition metals were deposited on to these substrates by an electrophoretic process. In these catalysts huge increases in hydrogen generation rates, relative to the CNT-paper architecture, were achieved. Indeed the Figure of Merit (FOM), expressed as liters per minute of hydrogen generated per gram of the precious metals, per unit molar concentration of NaBH4, (Lmin-1g met-1[NaBH4]-1), of these "thin film CNT" catalysts was up to three orders of magnitude greater than could be achieved with the thick CNT paper, as described in the first part of the thesis. These values for the FOM are more than two orders of magnitude greater than the highest values for hydrogen generation from NaBH4 reported in the literature. The reaction mechanism and the catalytic efficiency in the present work is described in terms of an electric charge transfer, as has been proposed in the literature. In this mechanism the negative charge on the BH4 - ion is transferred with one hydrogen atom via SiCN/CNT structure, which increases the catalytic activity. (Abstract shortened by UMI.)

  9. Liquid–solid phase transition of hydrogen and deuterium in silica aerogel

    SciTech Connect

    Van Cleve, E.; Worsley, M. A.; Kucheyev, S. O.

    2014-10-28

    Behavior of hydrogen isotopes confined in disordered low-density nanoporous solids remains essentially unknown. Here, we use relaxation calorimetry to study freezing and melting of H{sub 2} and D{sub 2} in an ∼85%-porous base-catalyzed silica aerogel. We find that liquid–solid transition temperatures of both isotopes inside the aerogel are depressed. The phase transition takes place over a wide temperature range of ∼4 K and non-trivially depends on the liquid filling fraction, reflecting the broad pore size distribution in the aerogel. Undercooling is observed for both H{sub 2} and D{sub 2} confined inside the aerogel monolith. Results for H{sub 2} and D{sub 2} are extrapolated to tritium-containing hydrogens with the quantum law of corresponding states.

  10. Applications of nuclear reaction analysis for determining hydrogen and deuterium distribution in metals

    SciTech Connect

    Altstetter, C.J.

    1981-01-01

    The use of ion beams for materials analysis has made a successful transition from the domain of the particle physicist to that of the materials scientist. The subcategory of this field, nuclear reaction analysis, is just now undergoing the transition, particularly in applications to hydrogen in materials. The materials scientist must locate the nearest accelerator, because now he will find that using it can solve mysteries that do not yield to other techniques. 9 figures

  11. Analysis of Protein Conformation and Dynamics by Hydrogen/Deuterium Exchange MS

    PubMed Central

    Engen, John R.

    2009-01-01

    synopsis Recent technological advances hydrogen exchange MS have led to improvements in the techniques ability to analyze the shape and movements of proteins. John Engen of Northeastern University gives a much needed update on the field. The cover, created by Engen, shows proteins swimming in an H2O/D2O solution with a sample mass spectrum in the background. PMID:19788312

  12. Photobiological hydrogen production and carbon dioxide sequestration

    NASA Astrophysics Data System (ADS)

    Berberoglu, Halil

    Photobiological hydrogen production is an alternative to thermochemical and electrolytic technologies with the advantage of carbon dioxide sequestration. However, it suffers from low solar to hydrogen energy conversion efficiency due to limited light transfer, mass transfer, and nutrient medium composition. The present study aims at addressing these limitations and can be divided in three parts: (1) experimental measurements of the radiation characteristics of hydrogen producing and carbon dioxide consuming microorganisms, (2) solar radiation transfer modeling and simulation in photobioreactors, and (3) parametric experiments of photobiological hydrogen production and carbon dioxide sequestration. First, solar radiation transfer in photobioreactors containing microorganisms and bubbles was modeled using the radiative transport equation (RTE) and solved using the modified method of characteristics. The study concluded that Beer-Lambert's law gives inaccurate results and anisotropic scattering must be accounted for to predict the local irradiance inside a photobioreactor. The need for accurate measurement of the complete set of radiation characteristics of microorganisms was established. Then, experimental setup and analysis methods for measuring the complete set of radiation characteristics of microorganisms have been developed and successfully validated experimentally. A database of the radiation characteristics of representative microorganisms have been created including the cyanobacteria Anabaena variabilis, the purple non-sulfur bacteria Rhodobacter sphaeroides and the green algae Chlamydomonas reinhardtii along with its three genetically engineered strains. This enabled, for the first time, quantitative assessment of the effect of genetic engineering on the radiation characteristics of microorganisms. In addition, a parametric experimental study has been performed to model the growth, CO2 consumption, and H 2 production of Anabaena variabilis as functions of irradiance and CO2 concentration. Kinetic models were successfully developed based on the Monod model and on a novel scaling analysis employing the CO2 consumption half-time as the time scale. Finally, the growth and hydrogen production of Anabaena variabilis have been compared in a flat panel photobioreactor using three different nutrient media under otherwise similar conditions. Light to hydrogen energy conversion efficiency for Allen-Arnon medium was superior by a factor of 5.5 to both BG-11 and BG-11o media. This was attributed to the presence of vanadium and larger heterocyst frequency observed in the Allen-Arnon medium.

  13. Application of a new ensemble conserving quantum dynamics simulation algorithm to liquid para-hydrogen and ortho-deuterium

    NASA Astrophysics Data System (ADS)

    Smith, Kyle K. G.; Poulsen, Jens Aage; Nyman, Gunnar; Cunsolo, Alessandro; Rossky, Peter J.

    2015-06-01

    We apply the Feynman-Kleinert Quasi-Classical Wigner (FK-QCW) method developed in our previous work [Smith et al., J. Chem. Phys. 142, 244112 (2015)] for the determination of the dynamic structure factor of liquid para-hydrogen and ortho-deuterium at state points of (T = 20.0 K, n = 21.24 nm-3) and (T = 23.0 K, n = 24.61 nm-3), respectively. When applied to this challenging system, it is shown that this new FK-QCW method consistently reproduces the experimental dynamic structure factor reported by Smith et al. [J. Chem. Phys. 140, 034501 (2014)] for all momentum transfers considered. This shows that FK-QCW provides a substantial improvement over the Feynman-Kleinert linearized path-integral method, in which purely classical dynamics are used. Furthermore, for small momentum transfers, it is shown that FK-QCW provides nearly the same results as ring-polymer molecular dynamics (RPMD), thus suggesting that FK-QCW provides a potentially more appealing algorithm than RPMD since it is not formally limited to correlation functions involving linear operators.

  14. Lattice vibrations of para-hydrogen impurities in a solid deuterium matrix: An inelastic neutron scattering study

    NASA Astrophysics Data System (ADS)

    Colognesi, D.; Celli, M.; Ramirez-Cuesta, A. J.; Zoppi, M.

    2007-11-01

    In the present study, we report inelastic neutron scattering measurements from para-hydrogen defects in solid normal deuterium at three different concentrations (between 3% and 11%) using the time-of-flight spectrometer TOSCA-II. The measured double-differential cross sections give access to the self-inelastic structure factors for the H2 centers of mass. Corrected experimental data, analyzed through the Young-Koppel model and the Gaussian approximation, are transformed into defect densities of phonon states, which come out to be broad, structured, and nearly concentration independent. Two experimentally determined Bose-corrected spectral moments are found to be in agreement with independent estimates, providing a strong validation of our data reduction procedure. Subsequently, experimental phonon spectra are compared to three calculations, namely, a simple harmonic model at infinite dilution, a more advanced harmonic model with concentration effects, and finally a lattice dynamics simulation based on self-consistent phonon and coherent potential approximations. However, while the first part of the defect spectral density, attributed to the propagating modes, turns out to be roughly explained, the localized part is properly described by none of these models, except for its mean frequency position. The large overall width appears so far impossible to be reproduced, representing a challenge for the physicists involved in quantum dynamics simulations.

  15. Recombinant immobilized rhizopuspepsin as a new tool for protein digestion in hydrogen/deuterium exchange mass spectrometry.

    PubMed

    Rey, Martial; Man, Petr; Brandolin, Grard; Forest, Eric; Pelosi, Ludovic

    2009-11-01

    Hydrogen/deuterium (H/D) exchange coupled to mass spectrometry is nowadays routinely used to probe protein interactions or conformational changes. The method has many advantages, e.g. very low sample consumption, but offers limited spatial resolution. One way to higher resolution leads through the use of different proteases or their combinations. In the present work we describe recombinant production, purification and use of aspartic protease zymogen from Rhizopus chimensis, protease type XVIII (EC 3.4.23.6), commonly referred to as rhizopuspepsinogen (Rpg). The enzyme was expressed in Escherichia coli, refolded and purified to homogeneity. A typical yield was approximately 100 mg of pure enzyme per 1 L of original bacterial culture. The kinetics of protease activation, i.e. removal of the propeptide achieved by autolysis in an acidic environment, was followed by mass spectrometry. The digestion efficiency was tested for the protease in solution as well as for the immobilized enzyme. Apomyoglobin was successfully digested under all conditions tested and the protease displayed very low or no autodigestion. The results outperformed those obtained with commercial protease where the digestion of apomyoglobin was incomplete and accompanied by many contaminating peptides. Taken together, the recombinant protease type XVIII can be considered as a new and highly efficient tool for H/D exchange followed by mass spectrometry. PMID:19827048

  16. Effect of deuterium substitution for hydrogen in surface functionalisation of hydrophilic nanosilicon particles on their spectral and dynamic properties

    NASA Astrophysics Data System (ADS)

    Kompanets, V. O.; Chekalin, S. V.; Dorofeev, S. G.; Kononov, N. N.; Barzilovich, P. Yu; Ishchenko, A. A.

    2014-06-01

    Broadband femtosecond spectroscopy has been used to study two types of hydrophilic silicon nanoparticles: (1) photoluminescent, passivated with deuterium and oxidised in fully deuterated dimethyl sulphoxide, and (2) nonluminescent (control samples having a similar crystalline core), passivated with hydrogen and oxidised in dimethyl sulphoxide. We have found significant differences in ultrafast spectral - temporal induced absorption dynamics between the two types of nanoparticles in the energy range corresponding to their calculated band gap. The observed distinction is due to the considerably higher oxidation rate of silicon on the surface of the deuterated samples in comparison with the undeuterated ones and with the associated increase in the number of photoluminescence centres on the surface of the nanoparticles. In the samples containing self-trapped exciton (STE) energy states responsible for the photoluminescence in the red spectral region, carrier capture at these levels and carrier relaxation to the ground state have characteristic times in the femtosecond range. In the samples free of STE states, excited carriers relax to the conduction band bottom in a characteristic time of several picoseconds.

  17. Substrate binding affinity of Pseudomonas aeruginosa membrane-bound lytic transglycosylase B by hydrogen-deuterium exchange MALDI MS.

    PubMed

    Reid, Christopher W; Brewer, Dyanne; Clarke, Anthony J

    2004-09-01

    Lytic transglycosylases cleave the beta-(1-->4)-glycosidic bond in the bacterial cell wall heteropolymer, peptidoglycan, between the N-acetylmuramic acid (MurNAc) and N-acetylglucosamine (GlcNAc) residues with the concomitant formation of a 1,6-anhydromuramoyl residue. With 72% amino acid sequence identity between the enzymes, the theoretical structure of the membrane-bound lytic transglycosylase B (MltB) from Psuedomonas aeruginosa was modeled on the known crystal structure of Escherichia coli Slt35, the soluble derivative of its MltB. Of the twelve residues in Slt35 known to make contacts with peptidoglycan derivatives in Slt35, nine exist in the same position in the P. aeruginosa homologue, with two others only slightly displaced. To probe the binding properties of an engineered soluble form of the P. aeruginosa MltB, a SUPREX method involving hydrogen/deuterium exchange coupled with MALDI mass spectrometry detection was developed. Dissociation constants were calculated for a series of peptidoglycan components and compared to those obtained by difference UV absorption spectroscopy. These data indicated that GlcNAc alone does not bind to MltB with any measurable affinity but it does contribute to the binding of GlcNAc-MurNAc-dipeptide. With the MurNAc series of ligands, significant binding contributions are made through both the N-acetyl and C-3 lactyl moieties of the aminosugar with additional contributions to binding provided by associated peptides. PMID:15366937

  18. Application of a New Ensemble Conserving Quantum Dynamics Simulation Algorithm to Liquid para-Hydrogen and ortho-Deuterium

    DOE PAGESBeta

    Smith, Kyle K.G.; Poulsen, Jens Aage; Nyman, Gunnar; Cunsolo, Alessandro; Rossky, Peter J.

    2015-06-30

    Here, we apply the Feynman-Kleinert Quasi-Classical Wigner (FK-QCW) method developed in our previous work [Smith et al., J. Chem. Phys. 142, 244112 (2015)] for the determination of the dynamic structure factor of liquid para-hydrogen and ortho-deuterium at state points of (T = 20.0 K, n = 21.24 nm-3) and (T = 23.0 K, n = 24.61 nm-3), respectively. When applied to this challenging system, it is shown that this new FK-QCW method consistently reproduces the experimental dynamic structure factor reported by Smith et al. [J. Chem. Phys. 140, 034501 (2014)] for all momentum transfers considered. Moreover, this shows that FK-QCWmore » provides a substantial improvement over the Feynman-Kleinert linearized path-integral method, in which purely classical dynamics are used. Furthermore, for small momentum transfers, it is shown that FK-QCW provides nearly the same results as ring-polymer molecular dynamics (RPMD), thus suggesting that FK-QCW provides a potentially more appealing algorithm than RPMD since it is not formally limited to correlation functions involving linear operators.« less

  19. Conformational Analysis of Proteins in Highly Concentrated Solutions by Dialysis-Coupled Hydrogen/Deuterium Exchange Mass Spectrometry.

    PubMed

    Houde, Damian; Nazari, Zeinab E; Bou-Assaf, George M; Weiskopf, Andrew S; Rand, Kasper D

    2016-04-01

    When highly concentrated, an antibody solution can exhibit unusual behaviors, which can lead to unwanted properties, such as increased levels of protein aggregation and unusually high viscosity. Molecular modeling, along with many indirect biophysical measurements, has suggested that the cause for these phenomena can be due to short range electrostatic and/or hydrophobic protein-protein interactions. Hydrogen/deuterium exchange mass spectrometry (HDX-MS) is a useful tool for investigating protein conformation, dynamics, and interactions. However, "traditional" continuous dilution labeling HDX-MS experiments have limited utility for the direct analysis of solutions with high concentrations of protein. Here, we present a dialysis-based HDX-MS (di-HDX-MS) method as an alternative HDX-MS labeling format, which takes advantage of passive dialysis rather than the classic dilution workflow. We applied this approach to a highly concentrated antibody solution without dilution or significant sample manipulation, prior to analysis. Such a method could pave the way for a deeper understanding of the unusual behavior of proteins at high concentrations, which is highly relevant for development of biopharmaceuticals in industry. Graphical Abstract ᅟ. PMID:26860088

  20. Study of the conformational change of adsorbed proteins on biomaterial surfaces using hydrogen-deuterium exchange with mass spectroscopy.

    PubMed

    Kim, Jinku

    2016-05-01

    There is no doubt that protein adsorption plays a crucial role in determining biocompatibility of biomaterials. Despite the information of the identity and composition of blood plasma/serum proteins adsorbed on surfaces of biomaterials to understand which proteins are involved in blood/biomaterial interactions, it still does not provide information about the conformations and orientations of adsorbed protein, which are very important in determining biological responses to biomaterials. Therefore, our laboratory has developed an experimental technology to probe protein conformations on materials that is applicable to mixtures of proteins. Herein, the new application of hydrogen/deuterium (H/D) exchange combined with mass spectrometry was applied to determine conformational changes of adsorbed proteins at biomaterial surfaces. The results suggest that there may be a significant conformational change in adsorbed proteins at 'low' bulk concentrations that leads to a large change in the kinetics of H/D exchange as compared to 'high' bulk concentrations. This technique may eventually be useful for the study of the kinetics of protein conformational changes. PMID:26896658

  1. Polarized Fourier transform infrared spectroscopy of bacteriorhodopsin. Transmembrane alpha helices are resistant to hydrogen/deuterium exchange

    SciTech Connect

    Earnest, T.N.; Herzfeld, J.; Rothschild, K.J. )

    1990-12-01

    The secondary structure of bacteriorhodopsin has been investigated by polarized Fourier transform infrared spectroscopy combined with hydrogen/deuterium exchange, isotope labeling and resolution enhancement methods. Oriented films of purple membrane were measured at low temperature after exposure to H2O or D2O. Resolution enhancement techniques and isotopic labeling of the Schiff base were used to assign peaks in the amide I region of the spectrum. alpha-helical structure, which exhibits strong infrared dichroism, undergoes little H/D exchange, even after 48 h of D2O exposure. In contrast, non-alpha-helical structure, which exhibits little dichroism, undergoes rapid H/D exchange. A band at 1,640 cm-1, which has previously been assigned to beta-sheet structure, is found to be due in part to the C = N stretching vibration of protonated Schiff base of the retinylidene chromophore. We conclude that the membrane spanning regions of bR consist predominantly of alpha-helical structure whereas most beta-type structure is located in surface regions directly accessible to water.

  2. Application of hydrogen/deuterium exchange mass spectrometry to study protein tyrosine phosphatase dynamics, ligand binding, and substrate specificity

    PubMed Central

    Zhou, Bo; Zhang, Zhong-Yin

    2007-01-01

    Protein tyrosine phosphatases (PTPs) are signaling enzymes that control a diverse array of cellular processes. Further insight into the specific functional roles of PTPs in cellular signaling requires detailed understanding of the molecular basis for substrate recognition by the PTPs. A central question is how PTPs discriminate between multiple structurally diverse substrates that they encounter in the cell. Although x-ray crystallography is capable of revealing the intimate structural details for molecular interaction, structures of higher order PTPsubstrate complexes are often difficult to obtain. Hydrogen/deuterium exchange mass spectrometry (H/DX-MS) is a powerful tool for mapping protein-protein interfaces, as well as identifying conformational and dynamic perturbations in proteins. In addition, H/DX-MS enables analysis of large protein complexes at physiological concentrations and provides insight into the solution behavior of these complexes that can not be gleaned from crystal structures. We have utilized H/DX-MS to probe PTP dynamics, ligand binding, and the structural basis of substrate recognition. In this article, we review general principles of H/DX-MS technology as applied to study protein-protein interactions and dynamics. We also provide protocols for H/DX-MS successfully used in our laboratory to define the molecular basis of ERK2 substrate recognition by MKP3. Many of the aspects that we cover in detail should be applicable to the study of other PTPs with their specific targets. PMID:17532509

  3. Proton nuclear magnetic resonance spectroscopy of human transferrin N-terminal half-molecule: titration and hydrogen-deuterium exchange

    SciTech Connect

    Valcour, A.A.; Woodworth, R.C.

    1987-06-02

    The binding of Ga(III) to the proteolytically derived N-terminal half-molecule of human transferrin (HTF/2N) was studied by proton nuclear magnetic resonance spectroscopy. The pH-dependent titration curves of the histidinyl C(2) proton chemical shifts were altered upon formation of the GaIIIHTF/2N(C/sub 2/O/sub 4/) ternary complex. Two high-pK'a histidines failed to titrate when the metal and synergistic anion formed a complex with the protein. These results implicated two histidinyl residues as direct ligands to the metal. The rates of hydrogen-deuterium exchange for the C(2) protons of certain histidinyl residues were substantially decreased by metal ion binding. The two ligand histidines were protected from exchange, and a third, low-pK'a, histidinyl residue was protected. We propose that this third histidinyl residue is involved in anion binding and may serve as the base in the putative proton-relay scheme proposed for complex formation.

  4. NMR-Based Amide Hydrogen-Deuterium Exchange Measurements for Complex Membrane Proteins: Development and Critical Evaluation

    NASA Astrophysics Data System (ADS)

    Czerski, Lech; Vinogradova, Olga; Sanders, Charles R.

    2000-01-01

    A method for measuring site-specific amide hydrogen-deuterium exchange rates for membrane proteins in bilayers is reported and evaluated. This method represents an adaptation and extension of the approach of Dempsey and co-workers (Biophys. J. 70, 1777-1788 (1996)) and is based on reconstituting 15N-labeled membrane proteins into phospholipid bilayers, followed by lyophilization and rehydration with D2O or H2O (control). Following incubation for a time t under hydrated conditions, samples are again lyophilized and then solubilized in an organic solvent system, where 1H-15N HSQC spectra are recorded. Comparison of spectra from D2O-exposed samples to spectra from control samples yields the extent of the H-D exchange which occurred in the bilayers during time t. Measurements are site specific if specific 15N labeling is used. The first part of this paper deals with the search for a suitable solvent system in which to solubilize complex membrane proteins in an amide "exchange-trapped" form for NMR quantitation of amide peak intensities. The second portion of the paper documents application of the overall procedure to measuring site-specific amide exchange rates in diacylglycerol kinase, a representative integral membrane protein. Both the potential usefulness and the significant limitations of the new method are documented.

  5. Characterization of Stress-Exposed Granulocyte Colony Stimulating Factor Using ELISA and Hydrogen/Deuterium Exchange Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Tsuchida, Daisuke; Yamazaki, Katsuyoshi; Akashi, Satoko

    2014-10-01

    Information on the higher-order structure is important in the development of biopharmaceutical drugs. Recently, hydrogen/deuterium exchange coupled with mass spectrometry (HDX-MS) has been widely used as a tool to evaluate protein conformation, and unique automated systems for HDX-MS are now commercially available. To investigate the potential of this technique for the prediction of the activity of biopharmaceuticals, granulocyte colony stimulating factor (G-CSF), which had been subjected to three different stress types, was analyzed using HDX-MS and through comparison with receptor-binding activity. It was found that HDX-MS, in combination with ion mobility separation, was able to identify conformational changes in G-CSF induced by stress, and a good correlation with the receptor-binding activity was demonstrated, which cannot be completely determined by conventional peptide mapping alone. The direct evaluation of biological activity using bioassay is absolutely imperative in biopharmaceutical development, but HDX-MS can provide the alternative information in a short time on the extent and location of the structural damage caused by stresses. Furthermore, the present study suggests the possibility of this system being a versatile evaluation method for the preservation stability of biopharmaceuticals.

  6. Simultaneous reduction and digestion of proteins with disulfide bonds for hydrogen/deuterium exchange monitored by mass spectrometry.

    PubMed

    Zhang, Hui-Min; McLoughlin, Shaun M; Frausto, Stephen D; Tang, Hengli; Emmett, Mark R; Marshall, Alan G

    2010-02-15

    Proteolyzed peptides provide the basis for mass-analyzed hydrogen/deuterium exchange (HDX) for mapping solvent access to various segments of solution-phase proteins. Aspergillus saitoi protease type XIII and porcine pepsin can generate peptides of overlapping sequences and high sequence coverage. However, if disulfide bonds are present, proteolysis can be severely limited, particularly in the vicinity of the disulfide linkage(s). Disulfide bonds cannot be reduced before or during the H/D exchange reaction without affecting the protein higher-order structure. Here, we demonstrate simultaneous quench/digestion/reduction following H/D exchange, for subsequent mass analysis. Proteolysis is conducted in the presence of tris(2-carboxyethyl)phosphine hydrochloride (TCEP.HCl) and urea, and all other steps of the H/D exchange and analysis are maintained. This method yields dramatically increased sequence coverage and localization of solvent-exposed segments for mass-analyzed solution-phase H/D exchange of proteins containing disulfide bonds. PMID:20099838

  7. Effect of deuterium substitution for hydrogen in surface functionalisation of hydrophilic nanosilicon particles on their spectral and dynamic properties

    SciTech Connect

    Kompanets, V O; Chekalin, S V; Dorofeev, S G; Kononov, N N; Barzilovich, P Yu; Ishchenko, A A

    2014-06-30

    Broadband femtosecond spectroscopy has been used to study two types of hydrophilic silicon nanoparticles: (1) photoluminescent, passivated with deuterium and oxidised in fully deuterated dimethyl sulphoxide, and (2) nonluminescent (control samples having a similar crystalline core), passivated with hydrogen and oxidised in dimethyl sulphoxide. We have found significant differences in ultrafast spectral temporal induced absorption dynamics between the two types of nanoparticles in the energy range corresponding to their calculated band gap. The observed distinction is due to the considerably higher oxidation rate of silicon on the surface of the deuterated samples in comparison with the undeuterated ones and with the associated increase in the number of photoluminescence centres on the surface of the nanoparticles. In the samples containing self-trapped exciton (STE) energy states responsible for the photoluminescence in the red spectral region, carrier capture at these levels and carrier relaxation to the ground state have characteristic times in the femtosecond range. In the samples free of STE states, excited carriers relax to the conduction band bottom in a characteristic time of several picoseconds. (extreme light fields and their applications)

  8. Activity-regulating structural changes and autoantibody epitopes in transglutaminase 2 assessed by hydrogen/deuterium exchange.

    PubMed

    Iversen, Rasmus; Mysling, Simon; Hnida, Kathrin; Jrgensen, Thomas J D; Sollid, Ludvig M

    2014-12-01

    The multifunctional enzyme transglutaminase 2 (TG2) is the target of autoantibodies in the gluten-sensitive enteropathy celiac disease. In addition, the enzyme is responsible for deamidation of gluten peptides, which are subsequently targeted by T cells. To understand the regulation of TG2 activity and the enzyme's role as an autoantigen in celiac disease, we have addressed structural properties of TG2 in solution by using hydrogen/deuterium exchange monitored by mass spectrometry. We demonstrate that Ca(2+) binding, which is necessary for TG2 activity, induces structural changes in the catalytic core domain of the enzyme. Cysteine oxidation was found to abolish these changes, suggesting a mechanism whereby disulfide bond formation inactivates the enzyme. Further, by using TG2-specific human monoclonal antibodies generated from intestinal plasma cells of celiac disease patients, we observed that binding of TG2 by autoantibodies can induce structural changes that could be relevant for the pathogenesis. Detailed mapping of two of the main epitopes targeted by celiac disease autoantibodies revealed that they are located adjacent to each other in the N-terminal part of the TG2 molecule. PMID:25404341

  9. Fast Comparative Structural Characterization of Intact Therapeutic Antibodies Using Hydrogen-Deuterium Exchange and Electron Transfer Dissociation.

    PubMed

    Pan, Jingxi; Zhang, Suping; Chou, Albert; Hardie, Darryl B; Borchers, Christoph H

    2015-06-16

    Higher-order structural characterization plays an important role in many stages of therapeutic antibody production. Herein, we report a new top-down mass spectrometry approach for characterizing the higher-order structure of intact antibodies, by combining hydrogen/deuterium exchange (HDX), subzero temperature chromatography, and electron transfer dissociation on the Orbitrap mass spectrometer. Individual IgG domain-level deuteration information was obtained for 6 IgG domains on Herceptin (HER), which included the antigen binding sites. This is the first time that top-down HDX has been applied to an intact protein as large as 150 kDa, which has never been done before on any instrument. Ligand-binding induced structural differences in HER were determined to be located only on the variable region of the light chain. Global glycosylation profile of antibodies and HDX property of the glycoforms were also determined by accurate intact mass measurements. Although the presence of disulfide bonds prevent the current approach from being able to obtain amino acid level structural information within the disulfide-linked regions, the advantages such as minimal sample manipulation, fast workflow, very low level of back exchange, and simple data analysis, make it well-suited for fast comparative structural evaluation of intact antibodies. PMID:25927482

  10. Application of a New Ensemble Conserving Quantum Dynamics Simulation Algorithm to Liquid para-Hydrogen and ortho-Deuterium

    SciTech Connect

    Smith, Kyle K.G.; Poulsen, Jens Aage; Nyman, Gunnar; Cunsolo, Alessandro; Rossky, Peter J.

    2015-06-30

    Here, we apply the Feynman-Kleinert Quasi-Classical Wigner (FK-QCW) method developed in our previous work [Smith et al., J. Chem. Phys. 142, 244112 (2015)] for the determination of the dynamic structure factor of liquid para-hydrogen and ortho-deuterium at state points of (T = 20.0 K, n = 21.24 nm-3) and (T = 23.0 K, n = 24.61 nm-3), respectively. When applied to this challenging system, it is shown that this new FK-QCW method consistently reproduces the experimental dynamic structure factor reported by Smith et al. [J. Chem. Phys. 140, 034501 (2014)] for all momentum transfers considered. Moreover, this shows that FK-QCW provides a substantial improvement over the Feynman-Kleinert linearized path-integral method, in which purely classical dynamics are used. Furthermore, for small momentum transfers, it is shown that FK-QCW provides nearly the same results as ring-polymer molecular dynamics (RPMD), thus suggesting that FK-QCW provides a potentially more appealing algorithm than RPMD since it is not formally limited to correlation functions involving linear operators.

  11. Applications of hydrogen deuterium exchange (HDX) for the characterization of conformational dynamics in light-activated photoreceptors

    PubMed Central

    Lindner, Robert; Heintz, Udo; Winkler, Andreas

    2015-01-01

    Rational design of optogenetic tools is inherently linked to the understanding of photoreceptor function. Structural analysis of elements involved in signal integration in individual sensor domains provides an initial idea of their mode of operation, but understanding how local structural rearrangements eventually affect signal transmission to output domains requires inclusion of the effector regions in the characterization. However, the dynamic nature of these assemblies renders their structural analysis challenging and therefore a combination of high- and low-resolution techniques is required to appreciate functional aspects of photoreceptors. This review focuses on the potential of hydrogen-deuterium exchange coupled to mass spectrometry (HDX-MS) for complementing the structural characterization of photoreceptors. In this respect, the ability of HDX-MS to provide information on conformational dynamics and the possibility to address multiple functionally relevant states in solution render this methodology ideally suitable. We highlight recent examples demonstrating the potential of HDX-MS and discuss how these results can help to improve existing optogenetic systems or guide the design of novel optogenetic tools. PMID:26157802

  12. Antibody structural integrity of site-specific antibody-drug conjugates investigated by hydrogen/deuterium exchange mass spectrometry.

    PubMed

    Pan, Lucy Yan; Salas-Solano, Oscar; Valliere-Douglass, John F

    2015-06-01

    We present the results of a hydrogen/deuterium exchange mass spectrometric (HDX-MS) investigation of an antibody-drug conjugate (ADC) comprised of drug-linkers conjugated to cysteine residues that have been engineered into heavy chain (HC) fragment crystallizable (Fc) domain at position 239. A side-by-side comparison of the HC Ser239 wild type (wt) monoclonal antibody (mAb) and the engineered Cys239 mAb indicates that site directed mutagenesis of Ser239 to cysteine has no impact on the HDX kinetics of the mAb. According to the crystal structure of a homologous immunoglobulin G1 (IgG1) antibody (PDB: 1HZH ), the backbone amide of Ser239 is hydrogen-bonded to Val264 backbone amide in the wt-mAb studied here. Replacing Ser239 with a Cys residue does not alter the exchange kinetics of the backbone amide of Val264 suggesting that either Ser or Cys at position 239 has similar amide-hydrogen bonding with Val264. However, a small segment in CH2 domain of the ADC ((264)VDVS) was found to have a slightly increased HDX rate compared to the wt- and C239-mAb constructs. The slightly increased HDX rate of the segment (264)VDVS in ADCs indicates that the further modification of Cys239 with drug-linkers only attenuates the local backbone amide hydrogen-bonding network between Cys239 and Val264. All other regions which are proximal to the site of drug conjugation are unaffected. The results demonstrate that the site-specific drug conjugation at the engineered Cys residue at the position 239 of HC does not impact the structural integrity of antibodies. The results also highlight the utility of applying HDX-MS to ADCs to gain a molecular level insight into the impact of site-specific conjugation technologies on the higher-order structure (HOS) of mAbs. The methodology can be applied generally to site-specific ADC modalities to understand the individual contributions of site-mutagenesis and drug-linker conjugation on the HOS of therapeutic candidate ADCs. PMID:25938577

  13. Evidence for site-specific intra-ionic hydrogen/deuterium exchange in the low-energy collision-induced dissociation product ion spectra of protonated small molecules generated by electrospray ionisation.

    PubMed

    Holman, Stephen W; Wright, Patricia; Wells, Neil J; Langley, G John

    2010-04-01

    The experimental investigation of site-specific intra-ionic hydrogen/deuterium (H/D) exchange in the low-energy collision-induced dissociation (CID) product ion spectra of protonated small molecules generated by electrospray ionisation (ESI) is presented. The observation of intra-ionic H/D exchange in such ions under low-energy CID conditions has hitherto been rarely reported. The data suggest that the intra-ionic H/D exchange takes place in a site-specific manner between the ionising deuteron, localised at either a tertiary amine or a tertiary amine-N-oxide, and a gamma-hydrogen relative to the nitrogen atom. Nuclear magnetic resonance (NMR) spectroscopy measurements showed that no H/D exchange takes place in solution, indicating that the reaction occurs in the gas phase. The compounds analysed in this study suggested that electron-withdrawing groups bonded to the carbon atom bearing the gamma-hydrogen can preclude exchange. The effect of the electron-withdrawing group appears dependent upon its electronegativity, with lower chi value groups still allowing exchange to take place. However, the limited dataset available in this study prevented robust conclusions being drawn regarding the effect of the electron-withdrawing group. The observation of site-specific intra-ionic H/D exchange has application in the area of structural elucidation, where it could be used to introduce an isotopic label into the carbon skeleton of a molecule containing specific structural features. This could increase the throughput, and minimise the cost, of such studies due to the obviation of the need to produce a deuterium-labelled analogue by synthetic means. PMID:20069530

  14. Bleaching using 30% hydrogen peroxide and sodium hydrogen carbonate.

    PubMed

    Ito, Yuko; Momoi, Yasuko

    2011-01-01

    This study investigated the bleaching efficacy of a mixture of sodium hydrogen carbonate (NaHCO(3)) and 30% hydrogen peroxide (H(2)O(2)), the latter being an active ingredient in in-office bleaching products. A commercially available 35% H(2)O(2)-based in-office bleaching product was used as a control and for comparison. Enamel surfaces after bleaching were evaluated for post-bleaching color change, Vickers hardness, surface roughness, erosion depth, and surface morphology (SEM images). The bleaching efficacy of 30%H(2)O(2)-NaHCO(3) was comparable to that of control, and favorable results over the control were obtained after bleaching with 30%H(2)O(2)-NaHCO(3), lower increase in surface roughness, smaller erosion depth, and reduced extent of enamel erosion based on SEM images. These results were obtained because an addition of NaHCO(3) to H(2)O(2) changed the initially low pH to a higher one. PMID:21422668

  15. Tunneling effects in the kinetics of helium and hydrogen isotopes desorption from single-walled carbon nanotube bundles

    NASA Astrophysics Data System (ADS)

    Danilchenko, B. A.; Yaskovets, I. I.; Uvarova, I. Y.; Dolbin, A. V.; Esel'son, V. B.; Basnukaeva, R. M.; Vinnikov, N. A.

    2014-04-01

    The kinetics of desorption both helium isotopes and molecules of hydrogen and deuterium from open-ended or ?-irradiated single-walled carbon nanotube bundles was investigated in temperature range of 10-300 K. The gases desorption rates obey the Arrhenius law at high temperatures, deviate from it with temperature reduction and become constant at low temperatures. These results indicate the quantum nature of gas outflow from carbon nanotube bundles. We had deduced the crossover temperature below which the quantum corrections to the effective activation energy of desorption become significant. This temperature follows linear dependence against the inverse mass of gas molecule and is consistent with theoretical prediction.

  16. Tunneling effects in the kinetics of helium and hydrogen isotopes desorption from single-walled carbon nanotube bundles

    SciTech Connect

    Danilchenko, B. A. Yaskovets, I. I.; Uvarova, I. Y.; Dolbin, A. V.; Esel'son, V. B.; Basnukaeva, R. M.; Vinnikov, N. A.

    2014-04-28

    The kinetics of desorption both helium isotopes and molecules of hydrogen and deuterium from open-ended or ?-irradiated single-walled carbon nanotube bundles was investigated in temperature range of 10300?K. The gases desorption rates obey the Arrhenius law at high temperatures, deviate from it with temperature reduction and become constant at low temperatures. These results indicate the quantum nature of gas outflow from carbon nanotube bundles. We had deduced the crossover temperature below which the quantum corrections to the effective activation energy of desorption become significant. This temperature follows linear dependence against the inverse mass of gas molecule and is consistent with theoretical prediction.

  17. High-resolution NMR of hydrogen in organic solids by DNP enhanced natural abundance deuterium spectroscopy.

    PubMed

    Rossini, Aaron J; Schlagnitweit, Judith; Lesage, Anne; Emsley, Lyndon

    2015-10-01

    We demonstrate that high field (9.4 T) dynamic nuclear polarization (DNP) at cryogenic (?100 K) sample temperatures enables the rapid acquisition of natural abundance (1)H-(2)H cross-polarization magic angle spinning (CPMAS) solid-state NMR spectra of organic solids. Spectra were obtained by impregnating substrates with a solution of the stable DNP polarizing agent TEKPol in tetrachloroethane. Tetrachloroethane is a non-solvent for the solids, and the unmodified substrates are then polarized through spin diffusion. High quality natural abundance (2)H CPMAS spectra of histidine hydrochloride monohydrate, glycylglycine and theophylline were acquired in less than 2h, providing direct access to hydrogen chemical shifts and quadrupolar couplings. The spectral resolution of the (2)H solid-state NMR spectra is comparable to that of (1)H spectra obtained with state of the art homonuclear decoupling techniques. PMID:26363582

  18. High-resolution NMR of hydrogen in organic solids by DNP enhanced natural abundance deuterium spectroscopy

    NASA Astrophysics Data System (ADS)

    Rossini, Aaron J.; Schlagnitweit, Judith; Lesage, Anne; Emsley, Lyndon

    2015-10-01

    We demonstrate that high field (9.4 T) dynamic nuclear polarization (DNP) at cryogenic (?100 K) sample temperatures enables the rapid acquisition of natural abundance 1H-2H cross-polarization magic angle spinning (CPMAS) solid-state NMR spectra of organic solids. Spectra were obtained by impregnating substrates with a solution of the stable DNP polarizing agent TEKPol in tetrachloroethane. Tetrachloroethane is a non-solvent for the solids, and the unmodified substrates are then polarized through spin diffusion. High quality natural abundance 2H CPMAS spectra of histidine hydrochloride monohydrate, glycylglycine and theophylline were acquired in less than 2 h, providing direct access to hydrogen chemical shifts and quadrupolar couplings. The spectral resolution of the 2H solid-state NMR spectra is comparable to that of 1H spectra obtained with state of the art homonuclear decoupling techniques.

  19. Carbon assisted water electrolysis for hydrogen generation

    NASA Astrophysics Data System (ADS)

    Sabareeswaran, S.; Balaji, R.; Ramya, K.; Rajalakshmi, N.; Dhathathereyan, K. S.

    2013-06-01

    Carbon Assisted Water Electrolysis (CAWE) is an energy efficient process in that H2 can be produced at lower applied voltage (1.0 V) compared to nearly 2.0 V needed for ordinary water electrolysis for the same H2 evolution rate. In this process, carbon is oxidized to oxides of carbon at the anode of an electrochemical cell and hydrogen is produced at the cathode. These gases are produced in relatively pure state and would be collected in a separate chamber. In this paper, we present the results of influence of various operating parameters on efficiency of CAWE process. The results showed that H2 can be produced at applied voltages Eo as low as 1.0V (vs. SHE) and its production rate is strongly dependent on the type of the carbon used and its concentration in the electrolyte. It has also been found that the performance of CAWE process is higher in acidic electrolyte than in alkaline electrolyte.

  20. Deuterium Retention in the Co-Deposition Carbon Layers Deposited by Radio-Frequency Magnetron Sputtering in D2 Atmosphere

    NASA Astrophysics Data System (ADS)

    Zhang, Wei-Yuan; Shi, Li-Qun; Zhang, Bin; Hu, Jian-Sheng

    2014-05-01

    Carbon is deposited on C and Si substrates by rf magnetron plasma sputtering in a D2 atmosphere. The deposited layers are examined with ion beam analysis and thermal desorption spectroscopy (TDS). The growth rates of the layers deposited on Si decrease with increasing substrate temperature, while increase significantly with the increase of D2 pressure. Meanwhile, the deuterium concentrations in the layers deposited on the Si substrates decrease from 30% to 2% and from 31% to 1% on the C substrates, respectively, when the substrate temperature varies from 350K to 900 K. Similarly, the D concentration in the layer on the Si substrates increases from 3.4% to 47%, and from 8% to 35% on the C substrates when the D2 pressure increases from 0.3Pa to 8.0Pa. D desorption characterized by TDS is mainly in the forms of D2, HD, HDO, CD4, and C2D4, and a similar release peak occurs at 645 K. The release peak of D2 molecules at 960K can be attributed to the escaped gas from the thin co-deposited deuterium-rich carbon layer in the form of C-D bonding.

  1. Confinement of hydrogen at high pressure in carbon nanotubes

    DOEpatents

    Lassila, David H.; Bonner, Brian P.

    2011-12-13

    A high pressure hydrogen confinement apparatus according to one embodiment includes carbon nanotubes capped at one or both ends thereof with a hydrogen-permeable membrane to enable the high pressure confinement of hydrogen and release of the hydrogen therethrough. A hydrogen confinement apparatus according to another embodiment includes an array of multi-walled carbon nanotubes each having first and second ends, the second ends being capped with palladium (Pd) to enable the high pressure confinement of hydrogen and release of the hydrogen therethrough as a function of palladium temperature, wherein the array of carbon nanotubes is capable of storing hydrogen gas at a pressure of at least 1 GPa for greater than 24 hours. Additional apparatuses and methods are also presented.

  2. Combined hydrogen production and storage with subsequent carbon crystallization.

    PubMed

    Lueking, Angela D; Gutierrez, Humberto R; Fonseca, Dania A; Narayanan, Deepa L; Van Essendelft, Dirk; Jain, Puja; Clifford, Caroline E B

    2006-06-21

    We provide evidence of low-temperature hydrogen evolution and possible hydrogen trapping in an anthracite coal derivative, formed via reactive ball milling with cyclohexene. No molecular hydrogen is added to the process. Raman-active molecular hydrogen vibrations are apparent in samples at atmospheric conditions (300 K, 1 bar) for samples prepared 1 year previously and stored in ambient air. Hydrogen evolves slowly at room temperature and is accelerated upon sample heating, with a first increase in hydrogen evolution occurring at approximately 60 degrees C. Subsequent chemical modification leads to the observation of crystalline carbons, including nanocrystalline diamond surrounded by graphene ribbons, other sp2-sp3 transition regions, purely graphitic regions, and a previously unidentified crystalline carbon form surrounded by amorphous carbon. The combined evidence for hydrogen trapping and carbon crystallization suggests hydrogen-induced crystallization of the amorphous carbon materials, as metastable hydrogenated carbons formed via the high-energy milling process rearrange into more thermodynamically stable carbon forms and molecular hydrogen. PMID:16771488

  3. Structural basis of specific interactions of Lp-PLA2 with HDL revealed by hydrogen deuterium exchange mass spectrometry.

    PubMed

    Cao, Jian; Hsu, Yuan-Hao; Li, Sheng; Woods, Virgil L; Dennis, Edward A

    2013-01-01

    Lipoprotein-associated phospholipase A(2) (Lp-PLA(2)), specifically Group VIIA PLA(2), is a member of the phospholipase A(2) superfamily and is found mainly associated with LDL and HDL in human plasma. Lp-PLA(2) is considered as a risk factor, a potential biomarker, a target for therapy in the treatment of cardiovascular disease, and evidence suggests that the level of Lp-PLA(2) in plasma is associated with the risk of future cardiovascular and stroke events. The differential location of the enzyme in LDL/HDL lipoproteins has been suggested to affect Lp-PLA(2) function and/or its physiological role and an abnormal distribution of the enzyme may correlate with diseases. Although a mutagenesis study suggested that a surface helix (residues 362-369) mediates the association between Lp-PLA(2) and HDL, the molecular details and mechanism of association has remained unknown. We have now employed hydrogen deuterium exchange mass spectrometry to characterize the interaction between recombinant human Lp-PLA(2) and human HDL. We have found that specific residues 113-120, 192-204, and 360-368 likely mediate HDL binding. In a previous study, we showed that residues 113-120 are important for Lp-PLA(2)-liposome interactions. We now find that residues 192-204 show a decreased deuteration level when Lp-PLA(2) is exposed to apoA-I, but not apoA-II, the most abundant apoproteins in HDL, and additionally, residues 360-368 are only affected by HDL.The results suggest that apoA-I and phospholipid membranes play crucial roles in Lp-PLA(2) localization to HDL. PMID:23089916

  4. Operation of a cw rf driven ion source with hydrogen and deuterium gas (abstract){sup a}

    SciTech Connect

    Melnychuk, S.T.; Debiak, T.W.; Sredniawski, J.J.

    1996-03-01

    We will describe the operation of a cw rf driven multicusp ion source designed for extraction of high current hydrogen and deuterium beams. The source is driven at 2 MHz by a 2.5 turn induction antenna immersed in the plasma. Bare stainless-steel and porcelain-coated Cu antennas have been used. The plasma load is matched to the rf generator by a variable tap {ital N}:1 transformer isolated to 46 kV, and an LC network on the secondary. With H{sub 2} gas the source can be operated at pressures between 5 and 60 mT with power reflection coefficients {lt}0.01. The extracted ion current density with a porcelain-coated antenna is approximately given by 35 mA/cm{sup 2}/kW with an 80 G dipole filter field for input powers from 3.5 to 6.6 kW. The current density remained constant for operation with a 6 and an 8 mm aperture. The source has been operated for 260 h at 3.6 kW with a single-porcelain-coated antenna. Mass spectrometer measurements of the extracted beam at this power show a species mix for H{sup +}:H{sup +}{sub 2}:H{sup +}{sub 3}:OH{sup +} of 0.49: 0.04: 0.42: 0.04. The calculated beam divergence using the IGUN code is compared with the measured divergence from an electrostatic sweep emittance scanner designed for high-power cw beam diagnostics. Phase space measurements at 40 kV and 23 mA beam current result in a normalized rms emittance of 0.09 {pi}mmmrad. {copyright} {ital 1996 American Institute of Physics.}

  5. Comparative Analysis of Oxy-Hemoglobin and Aquomet-Hemoglobin by Hydrogen/Deuterium Exchange Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Sowole, Modupeola A.; Konermann, Lars

    2013-07-01

    The function of hemoglobin (Hb) as oxygen transporter is mediated by reversible O2 binding to Fe(2+) heme in each of the ? and ? subunits. X-ray crystallography revealed different subunit arrangements in oxy-Hb and deoxy-Hb. The deoxy state is stabilized by additional contacts, causing a rigidification that results in strong protection against hydrogen/deuterium exchange (HDX). Aquomet-Hb is a dysfunctional degradation product with four water-bound Fe(3+) centers. Heme release from aquomet-Hb is relatively facile, triggering oxidative damage of membrane lipids. Aquomet-Hb crystallizes in virtually the same conformation as oxy-Hb. Hence, it is commonly implied that the solution-phase properties of aquomet-Hb should resemble those of the oxy state. This work compares the structural dynamics of oxy-Hb and aquomet-Hb by HDX mass spectrometry (MS). It is found that the aquomet state exhibits a solution-phase structure that is significantly more dynamic, as manifested by elevated HDX levels. These enhanced dynamics affect the aquomet ? and ? subunits in a different fashion. The latter undergoes global destabilization, whereas the former shows elevated HDX levels only in the heme binding region. It is proposed that these enhanced dynamics play a role in facilitating heme release from aquomet-Hb. Our findings should be of particular interest to the MS community because oxy-Hb and aquomet-Hb serve as widely used test analytes for probing the relationship between biomolecular structure in solution and in the gas phase. We are not aware of any prior comparative HDX/MS experiments on oxy-Hb and aquomet-Hb.

  6. Differential isotopic enrichment to facilitate characterization of asymmetric multimeric proteins using hydrogen/deuterium exchange mass spectrometry

    PubMed Central

    Pascal, Bruce D.; Bauman, Joseph D.; Patel, Disha; Arnold, Eddy; Griffin, Patrick R.

    2015-01-01

    Hydrogen/deuterium exchange (HDX) coupled to mass spectrometry has emerged as a powerful tool for analyzing the conformational dynamics of protein-ligand and protein-protein interactions. Recent advances in instrumentation and methodology have expanded the utility of HDX for the analysis of large and complex proteins; however, asymmetric dimers with shared amino acid sequence present a unique challenge for HDX because assignment of peptides with identical sequence to their subunit of origin remains ambiguous. Here we report the use of differential isotopic labeling to facilitate HDX analysis of multimers using HIV-1 reverse transcriptase (RT) as a model. RT is an asymmetric heterodimer of 51 kDa (p51) and 66 kDa (p66) subunits. The first 440 residues of p51 and p66 are identical. In this study differentially labeled RT was reconstituted from isotopically enriched (15N-labeled) p51 and unlabeled p66. In order to enable detection of 15N-deuterated RT peptides, the software HDX Workbench was modified to follow a 100% 15N model. Our results demonstrated that 15N enrichment of p51 did not affect its conformational dynamics compared to unlabeled p51, but 15N-labeled p51 did show different conformational dynamics than p66 in the RT heterodimer. Differential HDX-MS of isotopically labeled RT in the presence of the nonnucleoside reverse transcriptase inhibitor (NNRTI) efavirenz (EFV) showed subunit-specific perturbation in the rate of HDX consistent with previously published results and the RT-EFV co-crystal structure. PMID:25763479

  7. IL-1beta epitope mapping using site-directed mutagenesis and hydrogen-deuterium exchange mass spectrometry analysis.

    PubMed

    Lu, Jirong; Witcher, Derrick R; White, Melissa A; Wang, Xiliang; Huang, Lihua; Rathnachalam, Radhakrishnan; Beals, John M; Kuhstoss, Stuart

    2005-08-23

    Hu007, a humanized IgG1 monoclonal antibody, binds and neutralizes human, cynomolgus, and rabbit IL-1beta but only weakly binds to mouse and rat IL-1beta. Biacore experiments demonstrated that Hu007 and the type-I IL-1 receptor competed for binding to IL-1beta. Increasing salt concentrations decrease the association rate with only moderate effects on the dissociation rate, suggesting that long-range electrostatics are critical for formation of the initial complex. To understand the ligand-binding specificity of Hu007, we have mapped the critical residues involved in the recognition of IL-1beta. Selected residues in cynomolgus IL-1beta were mutated to the corresponding residues in mouse IL-1beta, and the effects of the changes on binding were evaluated by surface plasmon resonance measurements using Biacore. Specifically, substitution of F150S decreased binding affinity by 100-fold, suggesting the importance of hydrophobic interactions in stabilizing the antibody/antigen complex. Substitution of three amino acids near the N- and C-terminal regions of cIL-1beta with those found in mouse IL-1beta (V3I/S5Q/F150S) decreased the binding affinity of Hu007 to IL-1beta by about 1000-fold. Conversely, mutating the corresponding residues in mouse IL-1beta to the human sequence resulted in an increase in binding affinity of about 1000-fold. Hydrogen-deuterium exchange/mass spectrometry analysis confirmed that these regions of IL-1beta were protected from exchange because of antibody binding. The results from this study demonstrate that Hu007 binds to a region located in the open end of the beta-barrel structure of IL-1beta and blocks binding of IL-1beta to its receptor. PMID:16101294

  8. Carbonate thermochemical cycle for the production of hydrogen

    DOEpatents

    Collins, Jack L (Knoxville, TN) [Knoxville, TN; Dole, Leslie R (Knoxville, TN) [Knoxville, TN; Ferrada, Juan J (Knoxville, TN) [Knoxville, TN; Forsberg, Charles W (Oak Ridge, TN) [Oak Ridge, TN; Haire, Marvin J (Oak Ridge, TN) [Oak Ridge, TN; Hunt, Rodney D (Oak Ridge, TN) [Oak Ridge, TN; Lewis Jr., Benjamin E (Knoxville, TN) [Knoxville, TN; Wymer, Raymond G (Oak Ridge, TN) [Oak Ridge, TN

    2010-02-23

    The present invention is directed to a thermochemical method for the production of hydrogen from water. The method includes reacting a multi-valent metal oxide, water and a carbonate to produce an alkali metal-multi-valent metal oxide compound, carbon dioxide, and hydrogen.

  9. Formation of Cosmic Carbon Dust Analogs in Partially Hydrogenated Atmospheres

    NASA Technical Reports Server (NTRS)

    Blanco, A.; Fonti, S.; Muci, A. M.; Orofino, V.

    1996-01-01

    We present here UV-visible spectra of carbon grains produced by direct condensation of the carbon vapors in partially hydrogenated atmospheres. The freshly formed grains exhibit an extinction peak in the wavelength range 200-240 nm whose exact position depends on the hydrogen abundance. The results are discussed in terms of formation and evolution of circumstellar and interstellar cosmic dust.

  10. Carbonate Thermochemical Cycle for the Production of Hydrogen

    SciTech Connect

    Ferrada, Juan J; Collins, Jack Lee; Dole, Leslie Robert; Forsberg, Charles W; Haire, Marvin Jonathan; Hunt, Rodney Dale; Lewis Jr, Benjamin E; Wymer, Raymond; Ladd-Lively, Jennifer L

    2009-01-01

    The present invention is directed to a thermochemical method for the production of hydrogen from water. The method includes reacting a multi-valent metal oxide, water and a carbonate to produce an alkali metal-multi-valent metal oxide compound, carbon dioxide, and hydrogen.

  11. Carbon and hydrogen isotopic compositions of products of open-system catalytic hydrogenation of CO2: Implications for abiogenic hydrocarbons in Earth’s crust

    NASA Astrophysics Data System (ADS)

    Taran, Y. A.; Kliger, G. A.; Cienfuegos, E.; Shuykin, A. N.

    2010-11-01

    This paper reports the isotope effects in an open-system Fischer-Tropsch type (FTT) synthesis, with implications for the origin of natural abiogenic hydrocarbons. The starting form of carbon was CO 2, with carbon and hydrogen isotopic compositions measured for products of catalytic hydrogenation of CO 2 on iron and cobalt catalysts (FTCO 2-Fe and FTCO 2-Co) at 350 and 245 °C, respectively, and 10 MPa. The carbon isotopic composition of the resulting saturated hydrocarbons (alkanes) as a function of carbon number shows a positive trend for both FTCO 2-Fe and FTCO 2-Co, with a fractionation of 2-4‰ and 3-6‰ between CH 4 and C 2H 6 over the Fe and Co catalysts, respectively. The unsaturated hydrocarbons (alkenes) do not show any trend. A strong kinetic isotope fractionation (>40‰) occurred between CO 2 and CH 4 in both experiments. The hydrogen isotope fractionation between alkanes appeared to be similar to that found in natural (thermogenic and biogenic) gases, with enrichment in deuterium of longer hydrocarbon chains; the dominant H/D fractionation occurred between CH 4 and C 2H 6. Alkenes in the products of the FTCO 2-Fe reaction are enriched in deuterium (˜50‰) and do not show any trend versus carbon number. We suggest that other than FTT reactions or a simple mixing are responsible for the occurrence of the inverse isotopic trends in both δ 13C and δD found in light hydrocarbons in some terrestrial environments and meteorites.

  12. CO/sub 2/DBr precursor geometry limited reaction of deuterium with carbon dioxide

    SciTech Connect

    Buelow, S.; Radhakrishnan, G.; Wittig, C.

    1987-10-08

    The authors report nascent OD(X/sup 2/II) rotational, vibrational, spin-orbit, and ..lambda..-doublet excitations from reactions of deuterium atoms with CO/sub 2/. D atoms are produced by the 193-nm photolysis of DBr (h nu - D/sub 0/ = 244 kJ mol/sup -1/) (i) within a weakly bonded CO/sub 2/DBr complex, and (ii) under 300 K single-collision bulk conditions. The differences between the resulting OD distributions are modest, and the present results are similar to those of the analogous H + CO/sub 2/ system.

  13. DEVELOPMENT OF DOPED NANOPOROUS CARBONS FOR HYDROGEN STORAGE

    SciTech Connect

    Angela D. Lueking; Qixiu Li; John V. Badding; Dania Fonseca; Humerto Gutierrez; Apurba Sakti; Kofi Adu; Michael Schimmel

    2010-03-31

    Hydrogen storage materials based on the hydrogen spillover mechanism onto metal-doped nanoporous carbons are studied, in an effort to develop materials that store appreciable hydrogen at ambient temperatures and moderate pressures. We demonstrate that oxidation of the carbon surface can significantly increase the hydrogen uptake of these materials, primarily at low pressure. Trace water present in the system plays a role in the development of active sites, and may further be used as a strategy to increase uptake. Increased surface density of oxygen groups led to a significant enhancement of hydrogen spillover at pressures less than 100 milibar. At 300K, the hydrogen uptake was up to 1.1 wt. % at 100 mbar and increased to 1.4 wt. % at 20 bar. However, only 0.4 wt% of this was desorbable via a pressure reduction at room temperature, and the high lowpressure hydrogen uptake was found only when trace water was present during pretreatment. Although far from DOE hydrogen storage targets, storage at ambient temperature has significant practical advantages oner cryogenic physical adsorbents. The role of trace water in surface modification has significant implications for reproducibility in the field. High-pressure in situ characterization of ideal carbon surfaces in hydrogen suggests re-hybridization is not likely under conditions of practical interest. Advanced characterization is used to probe carbon-hydrogen-metal interactions in a number of systems and new carbon materials have been developed.

  14. ETD in a Traveling Wave Ion Guide at Tuned Z-Spray Ion Source Conditions Allows for Site-Specific Hydrogen/Deuterium Exchange Measurements

    PubMed Central

    Rand, Kasper D.; Pringle, Steven D.; Morris, Michael; Engen, John R.; Brown, Jeffery M.

    2012-01-01

    The recent application of electron transfer dissociation (ETD) to measure the hydrogen exchange of proteins in solution at single-residue resolution (HX-ETD) paves the way for mass spectrometry-based analyses of biomolecular structure at an unprecedented level of detail. The approach requires that activation of polypeptide ions prior to ETD is minimal so as to prevent undesirable gas-phase randomization of the deuterium label from solution (i.e., hydrogen scrambling). Here we explore the use of ETD in a traveling wave ion guide of a quadrupole-time-of-flight (Q-TOF) mass spectrometer with a “Z-spray” type ion source, to measure the deuterium content of individual residues in peptides. We systematically identify key parameters of the Z-spray ion source that contribute to collisional activation and define conditions that allow ETD experiments to be performed in the traveling wave ion guide without gas-phase hydrogen scrambling. We show that ETD and supplemental collisional activation in a subsequent traveling wave ion guide allows for improved extraction of residue-specific deuterium contents in peptides with low charge. Our results demonstrate the feasibility, and illustrate the advantages of performing HX-ETD experiments on a high-resolution Q-TOF instrument equipped with traveling wave ion guides. Determination of parameters of the Z-spray ion source that contribute to ion heating are similarly pertinent to a growing number of MS applications that also rely on an energetically gentle transfer of ions into the gas-phase, such as the analysis of biomolecular structure by native mass spectrometry in combination with gas-phase ion-ion/ion-neutral reactions or ion mobility spectrometry. PMID:21952892

  15. Detection of Hydrogen Spillover in Palladium-Modified Activated Carbon Fibers During Hydrogen Adsorption

    SciTech Connect

    Contescu, Cristian I; Brown, Craig; Liu, Yun; Bhat, Vinay V; Gallego, Nidia C

    2009-01-01

    Palladium-modified activated carbon fibers (Pd-ACF) are being evaluated for adsorptive hydrogen storage at near-ambient conditions because of their enhanced hydrogen uptake in comparison to Pd-free activated carbon fibers (ACF). The net uptake enhancement (at room temperature and 20 bar) is in excess of the amount corresponding to formation of Pd hydride, and is usually attributed to hydrogen spillover. In this paper, inelastic neutron scattering was used to demonstrate the formation of new C-H bonds in Pd-containing activated carbon fibers after exposure to hydrogen at 20 oC and 1.6 MPa, at the expense of physisorbed H2. This finding is a post-factum proof of the atomic nature of H species formed in presence of a Pd catalyst, and of their subsequent spillover and binding to the carbon support. Chemisorption of hydrogen may explain the reduction in hydrogen uptake from first to second adsorption cycle.

  16. Carbon nanotubes in hydrogen fuel cells

    NASA Astrophysics Data System (ADS)

    Tang, Jason Ming-Young

    2007-12-01

    Carbon nanotubes possess exceptional mechanical and electrical properties such as high tensile strength, great resilience, high thermal and electrical conductivity, high specific surface area, and high temperature stability. The coexistence of these desirable properties in one material makes carbon nanotubes a fascinating candidate for incorporation into a fuel cell to improve its performance and decrease the thickness of the fuel cell structure. SWNTs were formed into a free-standing film as a gas diffusion layer in a fuel cell, taking the place of the more traditional carbon fiber based paper and potentially offer a thinner gas diffusion layer. Fuel cell membrane electrode assemblies with ultralow Pt cathode loadings of 6 mug Pt/cm2 and 12 pmug Pt/cm2 at the cathode have been fabricated using thin films of Pt supported on MWNTs (Pt/MWNTs). These loadings are lower than conventional Pt cathode loadings by a factor of 16 to 33. Surprisingly high fuel cell performance is obtained for such a low Pt loading. This simple and promising new fuel cell architecture uses no Nafion in the catalyst layer as is of conventional fuel cells. A free-standing thin film of Pt/SWNTs also was successfully demonstrated without the use of Nafion in the catalyst layer. Both the Pt/SWNT free-standing thin film and Pt/MWNT thin film catalyst layers exhibit higher performance when compared with a catalyst layer (without Nafion) made from commercially available E-TEK electrocatalyst made of Pt supported on XC-72 carbon black. Additionally, Pt/MWNTs were also found to allow for the consolidation of the microporous layer and catalyst layer into one layer. This is just another simplification of the fuel cell architecture that was provided by the introduction of carbon nanotubes into the different components of the hydrogen fuel cell. The sum of these improvements could potentially revolutionize the fuel cell architecture and provide thinner fuel cells with higher volumetric power densities for use in automotive applications and space exploration where system size is crucial.

  17. Carbon and hydrogen isotope effects in the open-system Fischer-Tropsch type reactions. Implications for abiogenic hydrocarbons in the Earth Crust

    NASA Astrophysics Data System (ADS)

    Taran, Y.

    2009-05-01

    This study aims to clarify the isotope effects in the open-system Fischer-Tropsh type (FTT) synthesis with application to the problem of 'abiogenic' hydrocarbons. Carbon and hydrogen isotopic compositions were measured for products of catalytic hydrogenation of CO2 on cobalt and iron catalysts at 245° C and 350° C and 10 MPa in a flow-through reactor. No carbon isotope fractionation between methane and longer hydrocarbons was observed, independently on the CO2 conversion. The hydrogen isotope fractionation appeared to be similar to that found in natural ('thermogenic' and 'biogenic') gases with the enrichment in deuterium of longer hydrocarbon chains and the higher effects for the Co-catalyst. It can be suggested that other than FTT reactions or a simple mixing are responsible for the occurrence of 'inverse' isotopic trends in both carbon and hydrogen isotopic composition found in light hydrocarbons in some specific terrestrial environments and meteorites.

  18. Deuterium and carbon-13 kinetic isotope effects for the reaction of OH with CH4

    NASA Astrophysics Data System (ADS)

    Melissas, Vasilios S.; Truhlar, Donald G.

    1993-09-01

    Interpolated variational transition state theory calculations with centrifugal-dominant, small-curvature tunneling coefficients have been carried out for the case of the deuterium kinetic isotope effect (KIE) in the reaction OH+12CD4?HDO+12CD3 and for the 13C KIE for the reaction OH+13CH4?H2O+13CH3. The interpolated variationally optimized generalized transition states predict notably different nontunneling KIEs than the conventional ones, and factorization analyses of the KIEs are presented to illustrate the origin of the differences. The zero-point energies at the variational transition states differ from those at the saddle point by up to 0.19 kcal/mol for the OH+12CD4 reaction and by up to 0.34 kcal/mol for the OH+13CH4 reaction. The incorporation of multidimensional tunneling effects partly cancels the effect of variational optimization of the transition state.

  19. Stable carbon and hydrogen isotope fractionation of dissolved organic groundwater pollutants by equilibrium sorption

    NASA Astrophysics Data System (ADS)

    Hhener, Patrick; Yu, Xianjing

    2012-03-01

    Linear free energy relationships (LFERs) were established which relate equilibrium vapor-liquid isotope effects to stable carbon and hydrogen isotope enrichment factors for equilibrium sorption to geosorbents. The LFERs were established for normal, cyclic or branched alkanes, monoaromatic hydrocarbons, and chloroethenes. These LFERs predict that isotopic light compounds sorb more strongly than their heavy counterparts. Defining fractionation as in classical literature by "heavy divided by light", carbon enrichment factors for equilibrium sorption were derived which ranged from - 0.13 0.04 (benzene) to - 0.52 0.19 (trichloroethene at 5-15 C). Hydrogen enrichment factors for sorption of 14 different compounds were between - 2.4 and - 9.2. For perdeuterated hydrocarbons the predicted enrichment factors ranged from - 19 5.4 (benzene) to - 64 30 (cyclohexane). Equilibrium sorption experiments with a soil and activated carbon as sorbents were performed in the laboratory for perdeuterocyclohexane and perdeuterotoluene. The measured D/H enrichments agreed with the LFER prediction for both compounds and both sorbents within the uncertainty estimate of the prediction. The results of this work suggest that equilibrium sorption does create only very small isotope shifts for 13C in groundwater pollutants in aquifers. It is also suggested that deuterium shifts are expected to be higher, especially for strongly sorbing pollutants.

  20. Study on the influence of isotope exchange of hydrogen with deuterium on the vibrational spectrum of lysozyme by inelastic neutron scattering

    SciTech Connect

    Svanidze, A. V. Lushnikov, S. G.; Sashin, I. L.; Gvasaliya, S. N.

    2007-09-15

    The influence of isotope exchange of hydrogen with deuterium on the lysozyme dynamics was studied by incoherent inelastic neutron scattering. The generalized vibrational densities of states G({omega}) were constructed from experimental results for protonated and deuterated protein samples at 200, 280, and 311 K. The major isotope effect was observed in G({omega}) in the frequency region higher than 100 cm{sup -1}. At all temperatures, both the Debye mode and the region of G({omega}), whose spectral dimension corresponds to the fracton mode, are observed in the low-frequency region of the densities of states of both protonated and deuterated lysozyme. The influence of the hydrogen isotope exchange on the low-frequency region of G({omega}) is insignificant.

  1. Deuterium-tritium pulse propulsion with hydrogen as propellant and the entire space-craft as a gigavolt capacitor for ignition

    NASA Astrophysics Data System (ADS)

    Winterberg, F.

    2013-08-01

    A deuterium-tritium (DT) nuclear pulse propulsion concept for fast interplanetary transport is proposed utilizing almost all the energy for thrust and without the need for a large radiator: By letting the thermonuclear micro-explosion take place in the center of a liquid hydrogen sphere with the radius of the sphere large enough to slow down and absorb the neutrons of the DT fusion reaction, heating the hydrogen to a fully ionized plasma at a temperature of ?105 K. By using the entire spacecraft as a magnetically insulated gigavolt capacitor, igniting the DT micro-explosion with an intense GeV ion beam discharging the gigavolt capacitor, possible if the space craft has the topology of a torus.

  2. Intramolecular hydrogen bonding of the enol forms of β-ketoamides and β-ketothioamides. Deuterium isotope effects on 13C chemical shifts

    NASA Astrophysics Data System (ADS)

    Hansen, Poul Erik; Duus, Fritz; Bolvig, Simon; Jagodzinski, Tadeusz S.

    1996-04-01

    Deuterium isotope effects of 13C chemical shifts are studied in a series of enol and keto forms of β-ketoamides and the corresponding thioamides. In addition, the 2,6-cyclohexanediketo-1-amides and thioamides are studied. The effects of ring size (five- and six-membered rings) on the isotope effects and the tautomeric nature of the systems are also looked into. Rather unusual isotope effects are found for the amides, indicating a tautomeric system of the CONHRCOHNHR type. This is supported by the 17O chemical shift studies. The isotope effects of the simple amides are compared with those of the tetracyclines and piroxicams. The study of N-phenyl-3-phenyl-3-oxo-propiothioamide at low temperature reveals that this thioamide exists as a mixture of s-cis and s-trans species. The isotope effects and the influence of intramolecular hydrogen bonding in the two species can thus be studied. Thioamides of indan-1,3-diones show tautomeric behaviour, as revealed by very large deuterium isotope effects of both signs. Deuteriation shifts the equilibrium in the direction of the thioamide. Finally, the tendency of a series of β-hydroxy esters, thioesters, anhydrides, amides, thioamides, aldehydes and ketones to become tautomeric is discussed in terms of hydrogen bonding, isotope effects, 2ΔC(OD), and the nature of the acceptor.

  3. Investigation of the role of the micro-porous layer in polymer electrolyte fuel cells with hydrogen deuterium contrast neutron radiography.

    PubMed

    Cho, Kyu Taek; Mench, Matthew M

    2012-03-28

    In this study, the high resolution hydrogen-deuterium contrast radiography method was applied to elucidate the impact of the micro-porous layer (MPL) on water distribution in the porous fuel cell media. At the steady state, deuterium replaced hydrogen in the anode stream, and the large difference in neutron attenuation of the D(2)O produced at the cathode was used to track the produced water. It was found that the water content peaked in the cathode-side diffusion media (DM) for the cell without MPL, but with an MPL on the anode and cathode DM, the peak water amount was pushed toward the anode, resulting in a relatively flattened water profile through components and demonstrating a liquid barrier effect. Additionally, the dynamic water behavior in diffusion media was analyzed to understand the effect of a MPL and operating conditions. The water content in the DM changed with applied current, although there is a significant amount of residual liquid content that does not appear to be part of capillary channels. The effect of the MPL on irreducible saturation in DM and cell performance was also investigated. PMID:22337210

  4. Report on the evening discussion: ``Hydrogen storage in carbon materials''

    NASA Astrophysics Data System (ADS)

    Quintel, Andrea

    2000-11-01

    Hydrogen may be the most important energy carrier of the future as soon as the problem of hydrogen storage is solved. Storing of hydrogen under high pressure or as liquid costs much energy. Furthermore, a high pressure or liquid hydrogen tank in a fuel cell driven vehicle would be much larger and heavier compared to a typical gasoline tank. In metal hydride tanks the stored hydrogen density is higher, but the tank would be much too heavy (for a comparison see Fig. 1). Since the first promising results of Heben et al. in 1997 on hydrogen storage in single walled carbon nanotubes and the spectacularly large storage capacities in carbon nanofibers from the Baker and Rodriguez group in 1998, considerable research activity has been started all over the world to investigate hydrogen storage in carbon materials. Especially, car industry is very interested and is waiting for a material with a reversible hydrogen storage capacity above 6.5 wt%. In this report, the evening discussion on "Hydrogen storage in carbon materials" is summarized.

  5. Microwave characteristics of nonuniform hydrogen gas in carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Babaei, S.; Babaei, Sh

    2009-04-01

    Absorption, reflection and transmission of microwaves (MWs) from nonuniform hydrogen gas in carbon nanotubes immersed by an ambient uniform magnetic field of various strengths are studied in this paper. The effects of the hydrogen parameters and the magnetic field strength on the absorbed, reflected and transmitted powers are discussed. The hydrogen slab is modelled by a series of uniform hydrogen subslabs. The calculation results show that the effects of the magnetic field strength and the density gradient on the absorbed power, as well as the frequency band of resonant absorption, are significant. Broadband absorption of MWs can be achieved by changing the magnetic field strength and hydrogen density.

  6. On the role of atomic metastability in the production of Balmer line radiation from cold atomic hydrogen, deuterium and hydrogenic ion impurities in fusion edge plasmas

    NASA Astrophysics Data System (ADS)

    Hey, J. D.

    2012-03-01

    Published arguments, which assign an important role to atomic metastability in the production of narrow Zeeman component radiation from the boundary region of fusion plasmas, are examined critically in relation to l-redistribution by proton and electron collisions, and mixing of unperturbed atomic states by the ion microfield and microfield gradient. It is concluded that these important processes indeed severely constrain the contribution from metastable states to the generation of the hydrogen Balmer spectra, for electron concentrations above 1012 cm-3, as pointed out before by the present author (Hey et al 1999 J. Phys. B: At. Mol. Opt. Phys. 32 3555). The analysis of collision-induced l-redistribution represents an extension of that used previously (Hey et al 1996 Contrib. Plasma Phys. 36 583), applicable up to higher electron densities. For comparison purposes, we also consider the question of metastability of ionized helium in a low-temperature plasma, and that of some common hydrogenic impurities (C5+ and Ne9+) in a hydrogen (deuterium) fusion plasma. While for low nuclear charge Z the metastability of 2s1/2 levels is quenched by the plasma environment, it is much reduced in high-Z ions owing to the rapid increase with Z of the two-photon electric dipole (2E1) and magnetic dipole (M1) spontaneous transition rates to the ground state, whereas the role of the plasma in these cases is less important. The main new principle elaborated in this work is the sensitivity of atomic line strengths, and hence collision strengths, to perturbation by the plasma environment for transitions between fine-structure sublevels of the same principal quantum number. As the plasma microfield strength grows, allowed transitions diminish in strength, while forbidden transitions grow. However, owing to violation of the parity selection rule, there is an overall loss of collision strength available to transitions, resulting from the appearance of significant self-strength contributions, in accord with the sum rules for the line strengths, which remain valid over the range of fields considered. Thus, the relative effectiveness per perturber of both electron and ion collisions, for inducing population transfer between fine-structure sublevels, diminishes as the sublevels evolve from a fine-structure dominated to a Stark-effect-dominated regime. In the concluding discussion, we mention that this finding may have a bearing on discrepancies claimed between Stark broadening theory developed by Griem (1967 Astrophys. J. 148 547) and by Watson (2006 J. Phys.B: At. Mol. Opt. Phys. 39 1889), and the measurements of Bell and co-workers (2000 Publ. Astron. Soc. Pac. 112 1236; 2011 Astrophys. Space Sci. 335 451) for high-n radio recombination lines from galactic H II regions. In the absence of detailed modelling to test this suggestion, however, it would be premature to attempt to draw any firm conclusions along these lines. This manuscript is dedicated to the memory of my esteemed colleague Dr. rer. nat. Manfred Korten (1940-2010).

  7. Preparation and characterization of highly porous carbons for hydrogen storage.

    PubMed

    Kim, Byung-Joo; An, Kay Hyeok; Park, Soo-Jin

    2011-01-01

    In this work, Porous Carbons (PCs) were prepared by using a chemical acid treatment, and the hydrogen storage behaviors of PCs doped by Pt nanoparticles were investigated. The hydrogen storage capacities of the Pt-doped carbons with a platinum content of 0.2-1.5 wt% were evaluated by a volumetric adsorption method at 298 K and 10 MPa. The microstructures of samples were examined by XRD and SEM. It was found that the hydrogen storage capacities of the PCs dramatically increased, but the amount of hydrogen stored from the samples began to decrease after 0.6 wt% of Pt content due to the pore blocking. These results indicate that a suitable amount of supported catalysts and layer intervals of carbons had a very important impact on hydrogen storage behaviors. PMID:21446562

  8. Measurements of hydrogen spillover in platinum doped superactivated carbon.

    PubMed

    Stadie, Nicholas P; Purewal, Justin J; Ahn, Channing C; Fultz, Brent

    2010-10-01

    Hydrogen uptake was measured for platinum doped superactivated carbon at 296 K where hydrogen spillover was expected to occur. High pressure adsorption measurements using a Sieverts apparatus did not show an increase in gravimetric storage capacity over the unmodified superactivated carbon. Measurements of small samples (?0.2 g) over long equilibration times, consistent with the reported procedure, showed significant scatter and were not well above instrument background. In larger samples (?3 g), the hydrogen uptake was significantly above background but did not show enhancement due to spillover; total uptake scaled with the available surface area of the superactivated carbon. Any hydrogen spillover sorption was thus below the detection limit of standard volumetric gas adsorption measurements. Due to the additional mass of the catalyst nanoparticles and decreased surface area in the platinum doped system, the net effect of spillover sorption is detrimental for gravimetric density of hydrogen. PMID:20187626

  9. Prediction of the hydrogen storage capacity of carbon nanoscrolls

    NASA Astrophysics Data System (ADS)

    Coluci, V. R.; Braga, S. F.; Baughman, R. H.; Galvo, D. S.

    2007-03-01

    Classical grand-canonical Monte Carlo simulations were performed to investigate the equilibrium hydrogen storage capacity of carbon nanoscrolls. The results show that hydrogen molecules can be absorbed in the internal cavity as well as on the external surface of the scroll when the interlayer spacing is less than 4.4 . When the interlayer spacing is increased to 6.4 , by assuming spacing increase due to intercalation of other species, the hydrogen molecules can also be incorporated in the interlayer galleries, doubling the gravimetric storage capacity and reaching 5.5wt% hydrogen per weight carbon at 150K and 1MPa . Our results showed that intercalated carbon nanoscrolls may be a promissing material for hydrogen storage.

  10. Multiscale study of hydrogen diffusion and clustering on carbon nanotube.

    PubMed

    Vehvilinen, T T; Ganchenkova, M G; Borodin, V A; Nieminen, R M

    2009-07-01

    In this paper we report the results of a multiscale study of hydrogen clusterization at the surface of (10,0) carbon nanotube. For this purpose, a systematic study of the binding energies and migration barriers of hydrogen adatom and various close adatom pairs of has been undertaken using density-functional theory approach. The interaction between hydrogen atoms on the surface of nanotube is shown to be long ranged and anisotropic. On applying the obtained potential energy surfaces for lattice kinetic Monte Carlo simulations of chemisorbed hydrogen annealihg, a noticeable influence of the annealing conditions on cluster sizes, shapes and relative populations has bean revealed, which opens a possibility for the control of hydrogen clusterization kinetics. The effect on carbon nanotube electronic structure from hydrogen dimers and trimers most frequently met in lattice kinetic Monte Carlo simulations is discussed. PMID:19916438

  11. Hysteresis during lithium insertion in hydrogen-containing carbons

    SciTech Connect

    Zheng, T.; Dahn, J.R.; McKinnon, W.R.

    1996-07-01

    The authors studied lithium insertion in hydrogen-containing carbons heated at temperatures near 700 C. High capacities with large hysteresis (lithium insertion into these carbons at nearly 0 V and removal at nearly 1 V) were shown to be proportional to the hydrogen content of the samples. It is believed that the lithium atoms may bind on hydrogen-terminated edges of hexagonal carbon fragments, causing a change in the bond from sp{sup 2} to sp{sup 3}. The authors have carefully studied the electrochemical insertion of lithium in hydrogen-containing carbons using a variety of charge-discharge rates and cycling temperatures. These measurements allow the hysteresis to be quantified. A simple model, which treats the bonding change as an activated process, is used to model the hysteresis in the cells qualitatively.

  12. Hydrogen storage in carbon materialspreliminary results

    NASA Astrophysics Data System (ADS)

    Jrissen, Ludwig; Klos, Holger; Lamp, Peter; Reichenauer, Gudrun; Trapp, Victor

    1998-08-01

    Recent developments aiming at the accelerated commercialization of fuel cells for automotive applications have triggered an intensive research on fuel storage concepts for fuel cell cars. The fuel cell technology currently lacks technically and economically viable hydrogen storage technologies. On-board reforming of gasoline or methanol into hydrogen can only be regarded as an intermediate solution due to the inherently poor energy efficiency of such processes. Hydrogen storage in carbon nanofibers may lead to an efficient solution to the above described problems.

  13. [Determination of deuterium concentration in foods and influence of water with modified isotopic composition on oxidation parameters and heavy hydrogen isotopes content in experimental animals].

    PubMed

    Basov, A A; Bykov, I M; Baryshev, M G; Dzhimak, S S; Bykov, M I

    2014-01-01

    The article presents the results of the study of the deuterium (D) content in food products as well as the influence of deuterium depleted water (DDW) on the concentration of heavy hydrogen isotopes in the blood and lyophilized tissues of rats. The most significant difference in the content of D was found between potato and pork fat, which indexes the standard delta notation (?) D in promille, related to the international standard SMOW (Standard Mean Ocean of Water) amounted to -83,2 per thousand and -250,7 per thousand, respectively (p<0,05). Among the investigated samples of water deuterium concentration ranged from -75,5 per thousand (Narzan) to +72,1 per thousand (Kubai), that indicates the ability of some food products to increase the concentration of heavy hydrogen atoms in the body. The data obtained in the experimental modeling of the diet of male Wistar rats in the age of 5-6 mo (weight 235 16 g) using DDW (?D = -743,2 per thousand) instead of drinking water (?D = -37,0 per thousand) with identical mineral composition showed that after 2 weeks significant (p <0,05) formation of isotopic (deuterium-protium, D/H) gradient in the body is possible. Changing the direction of isotopic D/H gradient in laboratory animals in comparison with its physiological indicators (72-127 per thousand, "plasma>tissue") is due to different rates ofisotopic exchange reactions in plasma and tissues (liver, kidney, heart), which can be explained by entering into the composition of a modified diet of organic substrates with more than DDW concentration D, which are involved in the construction of cellular structures and eventually lead to a redistribution of D and change direction of D/H gradient "plasma

  14. Characterization of hydrogen absorption/desorption states on lithium-carbon-hydrogen system by neutron diffraction

    NASA Astrophysics Data System (ADS)

    Miyaoka, Hiroki; Itoh, Keiji; Fukunaga, Toshiharu; Ichikawa, Takayuki; Kojima, Yoshitsugu; Fuji, Hironobu

    2008-09-01

    The nanostructural hydrogenated graphite (CnanoHx) was synthesized from graphite by ball milling under hydrogen (H2) atmosphere. In this product, characteristic hydrogenated states in the form of polarized hydrocarbon groups (?CH, ?CH2, and ?CH3) are realized in the nanoscale. By synthesizing the composite of CnanoHx and lithium hydride (LiH), known as the Li ?C?H system, hydrogen was desorbed at 350C, which is a lower temperature compared to the decomposition temperature of each component. It is considered that this hydrogen desorption would be induced by destabilization of each hydrogen absorbed state due to an interaction between the polarized C ?H groups in CnanoHx and LiH. Therefore, in order to understand the hydrogen absorption/desorption mechanism of the Li ?C?H system, it is an important issue to investigate the change in the C ?H groups during hydrogen absorption/desorption reactions in the composite. The correlations among atoms contained in this composite are examined by neutron diffraction measurements, where the protium/deuterium (H/D) isotopic substitution was used to clarify the location of hydrogen atoms in this composite. Some C ?D and Li ?D correlations are found from the radial distribution function [RDF(r)] obtained by the neutron diffraction for the CnanoDx and LiD composite. After dehydrogenation, C ?C triple bond and Li ?C bond, ascribed to lithium carbide (Li2C2), are observed. Furthermore, the RDF(r ) corresponding to rehydrogenated composite indicates the presence of not only the Li ?D correlation but also the C ?D one.

  15. Polar Aprotic Modifiers for Chromatographic Separation and Back-Exchange Reduction for Protein Hydrogen/Deuterium Exchange Monitored by Fourier Transform Ion Cyclotron Resonance Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Valeja, Santosh G.; Emmett, Mark R.; Marshall, Alan G.

    2012-04-01

    Hydrogen/deuterium exchange monitored by mass spectrometry is an important non-perturbing tool to study protein structure and protein-protein interactions. However, water in the reversed-phase liquid chromatography mobile phase leads to back-exchange of D for H during chromatographic separation of proteolytic peptides following H/D exchange, resulting in incorrect identification of fast-exchanging hydrogens as unexchanged hydrogens. Previously, fast high-performance liquid chromatography (HPLC) and supercritical fluid chromatography have been shown to decrease back-exchange. Here, we show that replacement of up to 40% of the water in the LC mobile phase by the modifiers, dimethylformamide (DMF) and N-methylpyrrolidone (NMP) (i.e., polar organic modifiers that lack rapid exchanging hydrogens), significantly reduces back-exchange. On-line LC micro-ESI FT-ICR MS resolves overlapped proteolytic peptide isotopic distributions, allowing for quantitative determination of the extent of back-exchange. The DMF modified solvent composition also improves chromatographic separation while reducing back-exchange relative to conventional solvent.

  16. Polar Aprotic Modifiers for Chromatographic Separation and Back-Exchange Reduction for Protein Hydrogen/Deuterium Exchange Monitored by Fourier Transform Ion Cyclotron Resonance Mass Spectrometry

    PubMed Central

    Valeja, Santosh G.; Emmett, Mark R.; Marshall, Alan G.

    2013-01-01

    Hydrogen/deuterium exchange monitored by mass spectrometry is an important non-perturbing tool to study protein structure and protein–protein interactions. However, water in the reversed-phase liquid chromatography mobile phase leads to back-exchange of D for H during chromatographic separation of proteolytic peptides following H/D exchange, resulting in incorrect identification of fast-exchanging hydrogens as unexchanged hydrogens. Previously, fast high-performance liquid chromatography (HPLC) and supercritical fluid chromatography have been shown to decrease back-exchange. Here, we show that replacement of up to 40% of the water in the LC mobile phase by the modifiers, dimethylformamide (DMF) and N-methylpyrrolidone (NMP) (i.e., polar organic modifiers that lack rapid exchanging hydrogens), significantly reduces back-exchange. On-line LC micro-ESI FT-ICR MS resolves overlapped proteolytic peptide isotopic distributions, allowing for quantitative determination of the extent of back-exchange. The DMF modified solvent composition also improves chromatographic separation while reducing back-exchange relative to conventional solvent. PMID:22298288

  17. Microwave interaction with nonuniform hydrogen gas in carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Babaei, S.; Babaei, Sh.

    2009-03-01

    In this paper we study the reflection, absorption, and transmission of microwave from nonuniform hydrogen gas in carbon nanotubes, grown by iron-catalyzed high-pressure carbon monoxide disproportionate (HiPco) process. A discussion on the effect of various hydrogen gas parameters on the reflected power, absorbed power, and transmitted power is presented. The nonuniform hydrogen gas slab is modeled by a series of subslabs. The overall number density profile across the whole slab follows a parabolic function. The total reflected, absorbed, and transmitted powers are then deduced and their functional dependence on the number density, collision frequency, and angle of propagation is studied.

  18. Predicting Protein Aggregation during Storage in Lyophilized Solids Using Solid State Amide Hydrogen/Deuterium Exchange with Mass Spectrometric Analysis (ssHDX-MS)

    PubMed Central

    2015-01-01

    Solid state amide hydrogen/deuterium exchange with mass spectrometric analysis (ssHDX-MS) was used to assess the conformation of myoglobin (Mb) in lyophilized formulations, and the results correlated with the extent of aggregation during storage. Mb was colyophilized with sucrose (1:1 or 1:8 w/w), mannitol (1:1 w/w), or NaCl (1:1 w/w) or in the absence of excipients. Immediately after lyophilization, samples of each formulation were analyzed by ssHDX-MS and Fourier transform infrared spectroscopy (FTIR) to assess Mb conformation, and by dynamic light scattering (DLS) and size exclusion chromatography (SEC) to determine the extent of aggregation. The remaining samples were then placed on stability at 25 °C and 60% RH or 40 °C and 75% RH for up to 1 year, withdrawn at intervals, and analyzed for aggregate content by SEC and DLS. In ssHDX-MS of samples immediately after lyophilization (t = 0), Mb was less deuterated in solids containing sucrose (1:1 and 1:8 w/w) than in those containing mannitol (1:1 w/w), NaCl (1:1 w/w), or Mb alone. Deuterium uptake kinetics and peptide mass envelopes also indicated greater Mb structural perturbation in mannitol, NaCl, or Mb-alone samples at t = 0. The extent of deuterium incorporation and kinetic parameters related to rapidly and slowly exchanging amide pools (Nfast, Nslow), measured at t = 0, were highly correlated with the extent of aggregation on storage as measured by SEC. In contrast, the extent of aggregation was weakly correlated with FTIR band intensity and peak position measured at t = 0. The results support the use of ssHDX-MS as a formulation screening tool in developing lyophilized protein drug products. PMID:24816133

  19. Deuterium-free water ( 1H2O) in complex life-support systems of long-term space missions

    NASA Astrophysics Data System (ADS)

    Sinyak, Y.; Grigoriev, A.; Gaydadimov, V.; Gurieva, T.; Levinskih, M.; Pokrovskii, B.

    Heavy water containing deuterium displays toxic property. It is stated that any quantity of a heavy isotope of hydrogendeuteriumis undesirable to animals and plants. It was earlier shown by us that physical-chemical life support systems on board the "MIR" station fractionate (change) isotopes of hydrogen, oxygen and carbon. Therefore, the problem of regenerative systems in habitable space objects should include removal, from water, of a heavy stable isotope of hydrogendeuterium. In this article we consider one method of obtaining deuterium-free waterdecomposition of distillate water in an electrolyser to hydrogen and oxygen with subsequent synthesis in a catalytic or high-temperature reactor. The influence of deuterium-free water on the growth and development of Arabidopsis thaliana and Japanese quail is investigated. It is shown that with the help of the electrolysis method it is possible to fabricate water containing 80% less deuterium in comparison with SMOW. Experimentally, it is proved on a culture of Arabidopsis thaliana and Japanese quail that water with reduced contents of deuterium (80%) displays positive biological activity.

  20. Hydrogen-deficient atmospheres for cool carbon stars

    NASA Technical Reports Server (NTRS)

    Johnson, H. R.; Bower, C. D.; Lemke, D. A.; Luttermoser, D. G.; Petrakis, J. P.; Reinhart, M. D.; Welch, K. A.; Alexander, D. R.; Goebel, J. H.

    1985-01-01

    Motivated by recent work which hints at a possible deficiency of hydrogen in non-Mira N-type carbon stars and to further explore the parameter space of chemical composition, computations have been made of a series of hydrogen-deficient models for carbon stars. For these models Teff = 3000 K, and log g = 0.0. Solar abundances are used for all elements except for carbon (which is enhanced to give C/O = 1.05), hydrogen, and helium. As the fractional abundance of hydrogen is decreased, being replaced by helium, the temperature-optical depth relation is affected only slightly, but the temperature-pressure relation is changed. The most striking change in the emergent flux is the decrease of the H(-) peak at 1.65 micron compared with the blackbody peak at 1.00 micron.

  1. Large deuterium isotope effects and their use: a historical review.

    PubMed

    Krumbiegel, Peter

    2011-03-01

    Isotope effects are differences in the properties of the isotopes of an element resulting in different reaction rates of a corresponding compound, in equilibrium constants and in the spectra. Shortly after the discovery of stable isotopes of hydrogen, oxygen, and carbon, Jacob Bigeleisen formulated a theory of isotope effects and calculated possible maximum values. Large isotope effects of (2)H (deuterium) against (1)H (protium) were seen to possibly influence interpretations of reaction mechanisms if corresponding labelling is used. Much work was invested to ensure the safety of deuterium use in men in spite of the large isotope effect. On the other hand, large deuterium isotope effects gave rise to several practical applications. Examples are the enhancement of the stability of some technical products against oxidative and against hydrolytic degradation (oils, pharmaceuticals) as well as alterations of the detoxification metabolism of pharmaceuticals in vivo. PMID:21390986

  2. Deuterium Gas Analysis by Residual Gas Analyzer

    NASA Astrophysics Data System (ADS)

    Das, B. K.; Shukla, R.; Das, R.; Shyam, A.; Rao, A. D. P.

    2012-11-01

    Hydrogen gas is generated by electrolysis method in a compact hydrogen generator. A simple procedure reduces handling and storage of hydrogen cylinders for laboratory applications. In such a system, we are producing deuterium gas from heavy water by electrolysis method. After production of the deuterium gas, we have checked the purity level of the outgoing deuterium from the electrolyser. The test was carried out in a high vacuum system in which one residual gas analyser (RGA) was mounted. The deuterium gas was inserted by one manual gas leak valve in to the vacuum system. In this study, the effect of the emission current of the RGA on the detection of the deuterium was performed. In this paper, we will discuss the detail analysis of the deuterium gas and the effect of the emission current on the partial pressure measurement.

  3. Conformational dynamics of human FXR-LBD ligand interactions studied by hydrogen/deuterium exchange mass spectrometry: insights into the antagonism of the hypolipidemic agent Z-guggulsterone.

    PubMed

    Yang, Liping; Broderick, David; Jiang, Yuan; Hsu, Victor; Maier, Claudia S

    2014-09-01

    Farnesoid X receptor (FXR) is a member of the nuclear receptor superfamily of transcription factors that plays a key role in the regulation of bile acids, lipid and glucose metabolisms. The regulative function of FXR is governed by conformational changes of the ligand binding domain (LBD) upon ligand binding. Although FXR is a highly researched potential therapeutic target, only a limited number of FXR-agonist complexes have been successfully crystallized and subsequently yielded high resolution structures. There is currently no structural information of any FXR-antagonist complexes publically available. We therefore explored the use of amide hydrogen/deuterium exchange (HDX) coupled with mass spectrometry for characterizing conformational changes in the FXR-LBD upon ligand binding. Ligand-specific deuterium incorporation profiles were obtained for three FXR ligand chemotypes: GW4064, a synthetic non-steroidal high affinity agonist; the bile acid chenodeoxycholic acid (CDCA), the endogenous low affinity agonist of FXR; and Z-guggulsterone (GG), an in vitro antagonist of the steroid chemotype. A comparison of the HDX profiles of their ligand-bound FXR-LBD complexes revealed a unique mode of interaction for GG. The conformational features of the FXR-LBD-antagonist interaction are discussed. PMID:24953769

  4. Conformational dynamics of human FXR-LBD ligand interactions studied by hydrogen/deuterium exchange mass spectrometry: Insights into the antagonism of the hypolipidemic agent Z-guggulsterone

    PubMed Central

    Yang, Liping; Broderick, David; Jiang, Yuan; Hsu, Victor; Maier, Claudia S.

    2014-01-01

    Farnesoid X Receptor (FXR) is a member of the nuclear receptor superfamily of transcription factors that plays a key role in the regulation of bile acids, lipid and glucose metabolisms. The regulative function of FXR is governed by conformational changes of the ligand binding domain (LBD) upon ligand binding. Although FXR is a highly researched potential therapeutic target, only a limited number of FXR-agonist complexes have been successfully crystallized and subsequently yielded high resolution structures. There is currently no structural information of any FXR-antagonist complexes publically available. We therefore explored the use of amide hydrogen/deuterium exchange (HDX) coupled with mass spectrometry for characterizing conformational changes in the FXR-LBD upon ligand binding. Ligand-specific deuterium incorporation profiles were obtained for three FXR ligand chemotypes: GW4064, a synthetic non-steroidal high affinity agonist; the bile acid chenodeoxycholic acid (CDCA), the endogenous low affinity agonist of FXR; and Z-guggulsterone (GG), an in vitro antagonist of the steroid chemotype. Comparison of the HDX profiles of their ligand-bound FXR-LBD complexes revealed a unique mode of interaction for GG. The conformational features of the FXR-LBD-antagonist interaction are discussed. PMID:24953769

  5. Hydrogen and carbon kinetic isotope effects during soil uptake of atmospheric methane

    NASA Astrophysics Data System (ADS)

    Snover, Amy K.; Quay, Paul D.

    2000-03-01

    The hydrogen and carbon kinetic isotope effects (KJEs) occurring during uptake of atmospheric methane (CH4) by soils were measured using in situ static flux chambers in a native grassland and a temperate forest in Washington State. The hydrogen KIE was ?Dsoil =k(CH4)/k(CH3D) = 1.099 0.030 and 1.066 0.007 for the grassland and forest, respectively. The carbon KIE of ?Csoil =k(12CH4)/k(13CH4) = 1.0173 0.0010 and 1.0181 0.0004 for the grassland and forest, respectively, compares well to previous determinations in other ecosystems. Local spatial variability in ?soil was as large as the between-ecosystem variability. The dependence of ?soil on ?ox and the KIE during diffusion is described. The apparent KIE associated with microbial oxidation, ?ox, was determined from ?soil and the relative rates of CH4 oxidation and diffusion in the soil column, derived from observed steady state profiles of soil air CH4 concentration. The apparent ?ox ranged from 1.094 to 1.209 for ?Dox and from 1.0121 to 1.0183 for ?Cox. These are the first determinations of the hydrogen KIEs during soil uptake of atmospheric CH4 and during aerobic microbial oxidation of CH4 at or below atmospheric concentrations. The KIE during uptake of atmospheric CH4 by soils is significantly different than the KIEs associated with the other sinks of atmospheric CH4. The interhemispheric asymmetry in the strength of the soil sink of atmospheric CH4 suggests a difference of 6 between the overall hydrogen KIEs in the two hemispheres. Modeling studies of the global atmospheric CH4 budget using deuterium as a tracer must therefore include ?Dsoil.

  6. TENSILE TESTING OF CARBON STEEL IN HIGH PRESSURE HYDROGEN

    SciTech Connect

    Duncan, A; Thad Adams, T; Ps Lam, P

    2007-05-02

    An infrastructure of new and existing pipelines and systems will be required to carry and to deliver hydrogen as an alternative energy source under the hydrogen economy. Carbon and low alloy steels of moderate strength are currently used in hydrogen delivery systems as well as in the existing natural gas systems. It is critical to understand the material response of these standard pipeline materials when they are subjected to pressurized hydrogen environments. The methods and results from a testing program to quantify hydrogen effects on mechanical properties of carbon steel pipeline and pipeline weld materials are provided. Tensile properties of one type of steel (A106 Grade B) in base metal, welded and heat affected zone conditions were tested at room temperature in air and high pressure (10.34 MPa or 1500 psig) hydrogen. A general reduction in the materials ability to plastically deform was noted in this material when specimens were tested in hydrogen. Furthermore, the primary mode of fracture was changed from ductile rupture in air to cleavage with secondary tearing in hydrogen. The mechanical test results will be applied in future analyses to evaluate service life of the pipelines. The results are also envisioned to be part of the bases for construction codes and structural integrity demonstrations for hydrogen service pipeline and vessels.

  7. Investigation of Morphology and Hydrogen Adsorption Capacity of Disordered Carbons

    NASA Astrophysics Data System (ADS)

    He, Lilin; Melnichenko, Yuri; Gallego, Nidia; Contescu, Cristian

    2014-03-01

    We have applied small angle neutron scattering (SANS) technique to study the morphologies and hydrogen adsorption capabilities of wood-based ultramicroporous carbon and poly(furfuryl alcohol) derived carbon. The Polydispersed Spherical model and chord length analysis of the scattering profiles were performed to obtain morphological parameters such as average pore size and pore size distribution of the dry carbons, which agreed reasonably well with the independent gas sorption measurements. The hydrogen physisorbed in these two carbons at room temperature and moderate pressures was investigated by In-situ SANS measurements. The experimental data analyzed using a modified Kalliat model for decoupling scattering contributions from pores with different sizes indicates that the molecular hydrogen condenses preferentially in narrow micropores at all measured pressures, which supports the theoretical prediction by quantum mechanical and thermodynamical models.

  8. A comparative neutronic feasibility study for a hydrogen, deuterium and helium cold neutron sources situated in the center of a nuclear reactor core

    NASA Astrophysics Data System (ADS)

    Chatila, Malek

    A tool was developed to calculate the average cold neutron flux that could be generated for a spherically shaped cold neutron source situated in the center of a nuclear reactor core. The tool also estimates the subsequent nuclear heating of the cold source. The results were compared for three different cold source mediums; hydrogen, deuterium and helium. The tool utilizes the consistent energy dependent P1 equations to generate the fast neutron energy spectrum, the Grueling-Goertzel equations to generate the slow spectrum and the Proton Gas Model to generate the cold energy spectrum. These spectrums are then used to collapse the group constants into three energy groups. The cold flux that can be generated in different mediums is then calculated by utilizing the three energy group constants in SN-6, 2 regions calculations.

  9. Hydrogen sensing characteristics from carbon nanotube field emissions.

    PubMed

    Dong, Changkun; Luo, Haijun; Cai, Jianqiu; Wang, Fuquan; Zhao, Yangyang; Li, Detian

    2016-03-01

    An innovative hydrogen sensing concept is demonstrated based on the field emission from multi-walled carbon nanotubes, where the low emission currents rise in proportion to hydrogen partial pressures above 10(-9) Torr. Experimental and first principles studies reveal that the sensing mechanism is attributed to the effective work function reduction from dissociative hydrogen chemisorption. The embedded Ni catalyst would assist both the hydrogen dissociation and work function reduction. This technique is promising to build miniature low cost hydrogen sensors for multiple applications. This work is valuable for studies of nanocarbon-gas reaction mechanisms and the work function properties in adsorption related applications, including field emission, hydrogen storage, energy cells, and gas sensing. PMID:26890686

  10. Hydrogen sensing characteristics from carbon nanotube field emissions

    NASA Astrophysics Data System (ADS)

    Dong, Changkun; Luo, Haijun; Cai, Jianqiu; Wang, Fuquan; Zhao, Yangyang; Li, Detian

    2016-03-01

    An innovative hydrogen sensing concept is demonstrated based on the field emission from multi-walled carbon nanotubes, where the low emission currents rise in proportion to hydrogen partial pressures above 10-9 Torr. Experimental and first principles studies reveal that the sensing mechanism is attributed to the effective work function reduction from dissociative hydrogen chemisorption. The embedded Ni catalyst would assist both the hydrogen dissociation and work function reduction. This technique is promising to build miniature low cost hydrogen sensors for multiple applications. This work is valuable for studies of nanocarbon-gas reaction mechanisms and the work function properties in adsorption related applications, including field emission, hydrogen storage, energy cells, and gas sensing.

  11. Shock compression of precompressed deuterium

    SciTech Connect

    Armstrong, M R; Crowhurst, J C; Zaug, J M; Bastea, S; Goncharov, A F; Militzer, B

    2011-07-31

    Here we report quasi-isentropic dynamic compression and thermodynamic characterization of solid, precompressed deuterium over an ultrafast time scale (< 100 ps) and a microscopic length scale (< 1 {micro}m). We further report a fast transition in shock wave compressed solid deuterium that is consistent with the ramp to shock transition, with a time scale of less than 10 ps. These results suggest that high-density dynamic compression of hydrogen may be possible on microscopic length scales.

  12. Hydrogen storage: a comparison of hydrogen uptake values in carbon nanotubes and modified charcoals

    NASA Astrophysics Data System (ADS)

    Miao, H.-Y.; Chen, G. R.; Chen, D. Y.; Lue, J. T.; Yu, M. S.

    2010-11-01

    We compared the hydrogen uptake weight percentages (wt.%) of different carbonized materials, before and after modification, for their application in hydrogen storage at room temperature. The Sievert's method [T.P. Blach, E. Mac, A. Gray, J. Alloys Compd. 446-447, 692 (2007)] was used to measure hydrogen uptake values on: (1) Taiwan bamboo charcoal (TBC), (2) white charcoal (WC), (3) single-walled carbon nanotubes (SWCNTs) bought from CBT Inc. and (4) homemade multi-walled carbon nanotubes (MWCNTs) grown on TBC. Modified samples were coated with a metal catalyst by dipping in KOH solutions of different concentrations and then activated in a high temperature oven (800 C) under the atmospheric pressure of inert gas. The results showed that unmodified SWCNTs had superior uptake but that Taiwan bamboo charcoal, after modification, showed enhanced uptake comparable to the SWCNTs. Due to TBC's low cost and high mass production rate, they will be the key candidate for future hydrogen storage applications.

  13. Approach to characterization of the higher order structure of disulfide-containing proteins using hydrogen/deuterium exchange and top-down mass spectrometry.

    PubMed

    Wang, Guanbo; Kaltashov, Igor A

    2014-08-01

    Top-down hydrogen/deuterium exchange (HDX) with mass spectrometric (MS) detection has recently matured to become a potent biophysical tool capable of providing valuable information on higher order structure and conformational dynamics of proteins at an unprecedented level of structural detail. However, the scope of the proteins amenable to the analysis by top-down HDX MS still remains limited, with the protein size and the presence of disulfide bonds being the two most important limiting factors. While the limitations imposed by the physical size of the proteins gradually become more relaxed as the sensitivity, resolution and dynamic range of modern MS instrumentation continue to improve at an ever accelerating pace, the presence of the disulfide linkages remains a much less forgiving limitation even for the proteins of relatively modest size. To circumvent this problem, we introduce an online chemical reduction step following completion and quenching of the HDX reactions and prior to the top-down MS measurements of deuterium occupancy of individual backbone amides. Application of the new methodology to the top-down HDX MS characterization of a small (99 residue long) disulfide-containing protein ?2-microglobulin allowed the backbone amide protection to be probed with nearly a single-residue resolution across the entire sequence. The high-resolution backbone protection pattern deduced from the top-down HDX MS measurements carried out under native conditions is in excellent agreement with the crystal structure of the protein and high-resolution NMR data, suggesting that introduction of the chemical reduction step to the top-down routine does not trigger hydrogen scrambling either during the electrospray ionization process or in the gas phase prior to the protein ion dissociation. PMID:24988145

  14. Kaon Electroproduction on Deuterium

    SciTech Connect

    David Abbott; Abdellah Ahmidouch, Pawel Ambrozewicz; Chris Armstrong; John Arrington; K. Assamagan; Kevin Bailey; Oliver K. Baker; Shelton Beedoe; Elizabeth Beise; Herbert Breuer; Roger Carlini; Jinseok Cha; G. Collins; C. Cothran; W.J. Cummings; Samuel Danagoulian; Fraser Duncan; Jim Dunne; Dipangkar Dutta; Tom Eden; Rolf Ent; Lars Ewell; H.T. Fortune; Haiyan Gao; Donald Geesaman; Kenneth Gustafsson; Paul Gueye; Jens-Ole Hansen; Wendy Hinton; Hal Jackson; Cynthia Keppel; Andi Klein; D. Koltenok; David Mack; Richard Madey; Pete Markowitz; C.J. Martoff; David Meekins; Joseph Mitchell; R. Mohring; Hamlet Mkrtchyan; S.K. Mtingwa; Tom O'Neill; Gabriel Niculescu; Ioana Niculescu; Dave Potterveld; John Price; Philip Roos; Brian Raue; J.J. Reidy; Juerg Reinhold; G. Savage; Reyad Sawafta; J.P. Schiffer; Ralph Segel; Stepan Stepanyan; V. Tadevosian; Liguang Tang; B. Terburg; Stephen Wood; Chen Yan; Ben Zeidman; Beni Zihlmann

    1998-08-01

    Kaon electroproduction on deuterium and hydrogen targets has been measured at beam energies of 3.245 and 2.445GeV and momentum transfer Q{sup 2}=0.38 and O.5(GeV/c ){sup 2} Associated production off a proton in the deuteron exhibits a quasifree production mechanism. The electroproduction of a Sigma - off the neutron could be extracted for the first time with reasonable errors.

  15. Kaon electroproduction on deuterium.

    SciTech Connect

    Reinhold, J.

    1998-01-12

    Kaon electroproduction on deuterium and hydrogen targets has been measured at beam energies of 3.245 and 2.445 GeV and momentum transfer Q{sup 2}=0.38 and 0.5 GeV{sup 2}. Associated {Lambda} production off a proton in the deuteron exhibits a quasifree production mechanism. The production of {Sigma}{sup {minus}} off the neutron could be extracted for the first time with reasonable errors.

  16. Nucleotide- and activator-dependent structural and dynamic changes of Arp2/3 complex monitored by hydrogen/deuterium exchange and mass spectrometry

    PubMed Central

    Zencheck, Wendy D.; Xiao, Hui; Nolen, Bradley J.; Angeletti, Ruth; Pollard, Thomas D.; Almo, Steven C.

    2010-01-01

    Arp2/3 complex plays a central role in the de novo nucleation of filamentous actin as branches on existing filaments. To form a new actin filament the complex must bind ATP, protein activators (e.g. Wiskott-Aldrich syndrome proteins, WASp) and the side of an actin filament. Amide Hydrogen/Deuterium exchange (HDX) coupled with mass spectrometry (MS) was used to examine the structural and dynamic properties of the mammalian Arp2/3 complex in the presence of both ATP and the activating peptide segment from WASp. Changes in the rate of hydrogen exchange indicate that ATP binding causes conformational rearrangements of Arp2 and Arp3 that are transmitted allosterically to the ArpC1, ArpC2, ArpC4 and ArpC5 subunits. These data are consistent with the closure of nucleotide-binding cleft of Arp3 upon ATP binding, resulting in structural rearrangements that propagate throughout the complex. Binding of the VCA domain of WASp to ATP-Arp2/3 further modulates the rates of hydrogen exchange in these subunits, indicating that a global conformational reorganization is occurring. These effects may include the direct binding of activators to Arp3, Arp2 and ARPC1; alterations in the relative orientations of Arp2 and Arp3; and the long-range transmission of activator-dependent signals to segments proposed to be involved in binding the F-actin mother filament. PMID:19298826

  17. THE REMOVAL OF CARBON/BEUTERIUM FROM STAINLESS STEEL AND TUNGSTEN BY TRANSFERRED-ARC CLEANING

    SciTech Connect

    K. J. HOLLIS; R. G. CASTRO; ET AL

    2001-04-01

    Tungsten and stainless steel samples have been contaminated with deuterium and carbon to simulate deposited layers in magnetic-confinement fusion devices. Deuterium and carbon were co-deposited onto the sample surfaces using a deuterium plasma seeded with varying amounts of deuterated methane. Deuterium was also implanted into the samples in an accelerator to simulate hydrogen isotope ion implantation conditions in magnetic confinement fusion devices. Cathodic arc, or transferred-arc (TA) cleaning was employed to remove the deposits from the samples. The samples were characterized by ion beam analysis both before and after cleaning to determine deuterium and carbon concentrations present. The deuterium content was greatly reduced by the cleaning thus demonstrating the possibility of using the TA cleaning technique for removing deuterium and/or tritium from components exposed to D-T fuels. Removal of surface layers and significant reduction of subsurface carbon concentrations was also observed.

  18. The ratio of deuterium to hydrogen in interstellar space. IV - The lines of sight to Delta, Epsilon, and Iota Orionis

    NASA Technical Reports Server (NTRS)

    Laurent, C.; Vidal-Madjar, A.; York, D. G.

    1979-01-01

    Deuterium absorption features in spectra of Delta, Epsilon, and Iota Ori obtained with Copernicus are analyzed. The Iota Ori line-of-sight analysis, which is quite detailed because of the high-velocity H I components superposed on the deuterium features, gives a D/H ratio (which is uncertain because of a complex profile) of 0.000014. A D/H ratio of the order of 7 millionths is determined for Delta and Epsilon Ori. For the complex line profiles involved, one may regard this as a formal lower limit. Several attempts were made to increase the ratio N(D I)/N(H I) in the context of reasonable models for the line of sight, but with no success; the derived values are therefore regarded as actual values, not lower limits. Since the derived value is an average on the line of sight, the possibility cannot be ruled out that the true ratios N(D I)/N(H I) in individual nearby components differ from the mean values. The mean value for these two directions is lower by a factor of 4 than the best value for the Zeta Pup line of sight (the highest yet derived for path lengths greater than 50 pc).

  19. MECHANICAL TESTING OF CARBON STEEL IN HIGH PRESSURE HYDROGEN

    SciTech Connect

    Duncan, A

    2006-05-11

    The methods and interim results from a testing program to quantify hydrogen effects on mechanical properties of carbon steel pipeline and pipeline weld materials are provided. The scope is carbon steels commonly used for natural gas pipelines in the United States that are candidates for hydrogen service in the hydrogen economy. The mechanical test results will be applied in future analyses to evaluate service life of the pipelines. The results are also envisioned to be part of the bases for construction codes and structural integrity demonstrations for hydrogen service pipeline and vessels. Tensile properties of one type of steel (A106 Grade B) in base metal, welded and heat affected zone conditions were tested at room temperature in air and high pressure (1500 psig) hydrogen. A general reduction in the materials ability to plastically deform was noted in this material when specimens were tested in 1500 psig hydrogen. Furthermore, the primary mode of fracture was changed from ductile rupture in air to cleavage with secondary tearing in hydrogen. The mechanical test program will continue with tests to quantify the fracture behavior in terms of J-R curves for these materials at air and hydrogen pressure conditions.

  20. Hydrogen Confinement in Carbon Nanopores: Extreme Densification at Ambient Temperature

    SciTech Connect

    Gallego, Nidia C; He, Lilin; Saha, Dipendu; Contescu, Cristian I; Melnichenko, Yuri B

    2011-01-01

    In-situ small angle neutron scattering (SANS) studies of hydrogen confined in small pores of polyfurfuryl alcohol-derived activated carbon (PFAC) at room-temperature provided for the first time its phase behavior in equilibrium with external H2 at pressures up to 200 bar. The data was used to evaluate the density of the adsorbed fluid, which appears to be a function of both pore size and pressure, and approaches the liquid hydrogen density in narrow nanopores at 200 bar. The surface-molecule interactions responsible for densification of hydrogen within the pores create internal pressures which exceed by a factor of up to ~ 60 the external gas pressures, confirming the benefits of adsorptive over compressive storage. These results can be utilized to guide the development of new carbon adsorbents tailored for maximum hydrogen storage capacities at near ambient temperatures.

  1. Methanation of gas streams containing carbon monoxide and hydrogen

    DOEpatents

    Frost, Albert C. (Congers, NY)

    1983-01-01

    Carbon monoxide-containing gas streams having a relatively high concentration of hydrogen are pretreated so as to remove the hydrogen in a recoverable form for use in the second step of a cyclic, essentially two-step process for the production of methane. The thus-treated streams are then passed over a catalyst to deposit a surface layer of active surface carbon thereon essentially without the formation of inactive coke. This active carbon is reacted with said hydrogen removed from the feed gas stream to form methane. The utilization of the CO in the feed gas stream is appreciably increased, enhancing the overall process for the production of relatively pure, low-cost methane from CO-containing waste gas streams.

  2. Theoretical analysis of hydrogen spillover mechanism on carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Juarez Mosqueda, Rosalba; Mavrandonakis, Andreas; Kuc, Agnieszka; Pettersson, Lars; Heine, Thomas

    2015-02-01

    The spillover mechanism of molecular hydrogen on carbon nanotubes in the presence of catalytically active platinum clusters was critically and systematically investigated by using density-functional theory. Our simulation model includes a Pt4 cluster for the catalyst nanoparticle and curved and planar circumcoronene for two exemplary single-walled carbon nanotubes (CNT), the (10,10) CNT and one of large diameter, respectively. Our results show that the H2 molecule dissociates spontaneously on the Pt4 cluster. However, the dissociated H atoms have to overcome a barrier of more than 2 eV to migrate from the catalyst to the CNT, even if the Pt4 cluster is at full saturation with six adsorbed and dissociated hydrogen molecules. Previous investigations have shown that the mobility of hydrogen atoms on the CNT surface is hindered by a barrier. We find that instead the Pt4 catalyst may move along the outer surface of the CNT with activation energy of only 0.16 eV, and that this effect offers the possibility of full hydrogenation of the CNT. Thus, although we have not found a low-energy pathway to spillover onto the CNT, we suggest, based on our calculations and calculated data reported in the literature, that in the hydrogen-spillover process the observed saturation of the CNT at hydrogen background pressure occurs through mobile Pt nanoclusters, which move on the substrate more easily than the substrate-chemisorbed hydrogens, and deposit or reattach hydrogens in the process. Initial hydrogenation of the carbon substrate, however, is thermodynamically unfavoured, suggesting that defects should play a significant role.

  3. Theoretical analysis of hydrogen spillover mechanism on carbon nanotubes

    PubMed Central

    Juarez-Mosqueda, Rosalba; Mavrandonakis, Andreas; Kuc, Agnieszka B.; Pettersson, Lars G. M.; Heine, Thomas

    2015-01-01

    The spillover mechanism of molecular hydrogen on carbon nanotubes in the presence of catalytically active platinum clusters was critically and systematically investigated by using density-functional theory. Our simulation model includes a Pt4 cluster for the catalyst nanoparticle and curved and planar circumcoronene for two exemplary single-walled carbon nanotubes (CNT), the (10,10) CNT and one of large diameter, respectively. Our results show that the H2 molecule dissociates spontaneously on the Pt4 cluster. However, the dissociated H atoms have to overcome a barrier of more than 2 eV to migrate from the catalyst to the CNT, even if the Pt4 cluster is at full saturation with six adsorbed and dissociated hydrogen molecules. Previous investigations have shown that the mobility of hydrogen atoms on the CNT surface is hindered by a barrier. We find that instead the Pt4 catalyst may move along the outer surface of the CNT with activation energy of only 0.16 eV, and that this effect offers the possibility of full hydrogenation of the CNT. Thus, although we have not found a low-energy pathway to spillover onto the CNT, we suggest, based on our calculations and calculated data reported in the literature, that in the hydrogen-spillover process the observed saturation of the CNT at hydrogen background pressure occurs through mobile Pt nanoclusters, which move on the substrate more easily than the substrate-chemisorbed hydrogens, and deposit or reattach hydrogens in the process. Initial hydrogenation of the carbon substrate, however, is thermodynamically unfavoured, suggesting that defects should play a significant role. PMID:25699250

  4. Isotopic inferences of ancient biochemistries - Carbon, sulfur, hydrogen, and nitrogen

    NASA Technical Reports Server (NTRS)

    Schidlowski, M.; Hayes, J. M.; Kaplan, I. R.

    1983-01-01

    In processes of biological incorporation and subsequent biochemical processing sizable isotope effects occur as a result of both thermodynamic and kinetic fractionations which take place during metabolic and biosynthetic reactions. In this chapter a review is provided of earlier work and recent studies on isotope fractionations in the biogeochemical cycles of carbon, sulfur, hydrogen, and nitrogen. Attention is given to the biochemistry of carbon isotope fractionation, carbon isotope fractionation in extant plants and microorganisms, isotope fractionation in the terrestrial carbon cycle, the effects of diagenesis and metamorphism on the isotopic composition of sedimentary carbon, the isotopic composition of sedimentary carbon through time, implications of the sedimentary carbon isotope record, the biochemistry of sulfur isotope fractionation, pathways of the biogeochemical cycle of nitrogen, and the D/H ratio in naturally occurring materials.

  5. Material processing with hydrogen and carbon monoxide on Mars

    NASA Technical Reports Server (NTRS)

    Hepp, Aloysius F.; Landis, Geoffrey A.; Linne, Diane L.

    1991-01-01

    Several novel proposals are examined for propellant production from carbon dioxide and monoxide and hydrogen. Potential uses were also examined of CO as a fuel or as a reducing agent in metal oxide processing as obtained or further reduced to carbon. Hydrogen can be reacted with CO to produce a wide variety of hydrocarbons, alcohols, and other organic compounds. Methanol, produced by Fischer-Tropsch chemistry may be useful as a fuel; it is easy to store and handle because it is a liquid at Mars temperatures. The reduction of CO2 to hydrocarbons such as methane or acetylene can be accomplished with hydrogen. Carbon monoxide and hydrogen require cryogenic temperatures for storage as liquids. Noncryogenic storage of hydrogen may be accomplished using hydrocarbons, inorganic hydrides, or metal hydrides. Noncryogenic storage of CO may be accomplished in the form of iron carbonyl (FE(CO)5) or other metal carbonyls. Low hydrogen content fuels such as acetylene (C2H2) may be effective propellants with low requirements for earth derived resources. The impact on manned Mars missions of alternative propellant production and utilization is discussed.

  6. Carbon and Hydrogen Isotopic Fractionation during Anaerobic Biodegradation of Benzene

    PubMed Central

    Mancini, Silvia A.; Ulrich, Ania C.; Lacrampe-Couloume, Georges; Sleep, Brent; Edwards, Elizabeth A.; Sherwood Lollar, Barbara

    2003-01-01

    Compound-specific isotope analysis has the potential to distinguish physical from biological attenuation processes in the subsurface. In this study, carbon and hydrogen isotopic fractionation effects during biodegradation of benzene under anaerobic conditions with different terminal-electron-accepting processes are reported for the first time. Different enrichment factors (?) for carbon (range of ?1.9 to ?3.6) and hydrogen (range of ?29 to ?79) fractionation were observed during biodegradation of benzene under nitrate-reducing, sulfate-reducing, and methanogenic conditions. These differences are not related to differences in initial biomass or in rates of biodegradation. Carbon isotopic enrichment factors for anaerobic benzene biodegradation in this study are comparable to those previously published for aerobic benzene biodegradation. In contrast, hydrogen enrichment factors determined for anaerobic benzene biodegradation are significantly larger than those previously published for benzene biodegradation under aerobic conditions. A fundamental difference in the previously proposed initial step of aerobic versus proposed anaerobic biodegradation pathways may account for these differences in hydrogen isotopic fractionation. Potentially, C-H bond breakage in the initial step of the anaerobic benzene biodegradation pathway may account for the large fractionation observed compared to that in aerobic benzene biodegradation. Despite some differences in reported enrichment factors between cultures with different terminal-electron-accepting processes, carbon and hydrogen isotope analysis has the potential to provide direct evidence of anaerobic biodegradation of benzene in the field. PMID:12513995

  7. A novel five-lipoxygenase activity protein inhibitor labeled with carbon-14 and deuterium.

    PubMed

    Latli, Bachir; Hrapchak, Matt; Gao, Joe J; Busacca, Carl A; Senanayake, Chris H

    2015-07-01

    2-[4-(3-{(1R)-1-[4-(2-Aminopyrimidin-5-yl)phenyl]-1-cyclopropylethyl}-1,2,4-oxadiazol-5-yl)-1H-pyrazol-1-yl]-N,N-dimethylacetamide (1), is a novel and selective five-lipoxygenase activity protein (FLAP) inhibitor with excellent pharmacokinetics properties. The availability of a key chiral intermediate allowed the synthesis of [(14) C]-(1) in six radiochemical steps and in 47% overall radiochemical yield with a specific activity of 51 mCi/mmol using carbon-14 zinc cyanide. 2-Chloro-N,N-dimethyl-(2)H6-acetamide was prepared and condensed with a penultimate intermediate to give [(2)H6]-(1) in very high yield and in more than 99% isotopic enrichment. PMID:26190342

  8. Adsorption Enthalpies of Hydrogen on Chemically Enhanced Carbon Nanospaces

    NASA Astrophysics Data System (ADS)

    Gillespie, Andrew; Dohnke, Elmar; Schaeperkoetter, Joseph; Stalla, David; Pfeifer, Peter

    2014-03-01

    Chemical functionalization of carbon nanopore spaces has been shown to significantly increase the differential enthalpy of adsorption of hydrogen (ca. 9kJ/mol). This improved surface interaction corresponds to an increased density of the adsorbed film. Functionalized carbon samples have been produced through KOH activation, deposition of decaborane, and high temperature annealing. Hydrogen sorption measurements have shown significant improvements to stored film densities and binding energies. In this talk, a systematic study of the effect that boron concentration has on the samples' pore structures, binding energies, surface excess concentrations, and volumetric storage capacities is presented. Work supported by DOE-EERE, Award No. DE-FG36-08GO18142.

  9. Inelastic Neutron Scattering from Hydrogen Adsorbed in Carbon

    NASA Astrophysics Data System (ADS)

    Olsen, Raina; Beckner, Matthew; Taub, Haskell; Pfeifer, Peter; Wexler, Carlos

    2011-03-01

    Inelastic neutron scattering (INS) from adsorbed hydrogen offers a powerful tool to probe the local adsorption environment of storage material. We will show recently measured INS spectra of hydrogen adsorbed on four different carbon samples and discuss the interpretation of their spectral features, using previous theoretical calculations. Both rotational and vibrational transitions can be observed, along with free recoil scattering parallel to the adsorption plane. The spectra from carbon nanotubes and activated carbon are well explained by theory. However, the spectra from PVDC carbon is quite unusual. This material is based upon work supported in part by the Department of Energy under Award Nos. DE-FG02-07ER46411, DE-FG36-08GO18142, and DE-AC02-06CH11357.

  10. Palladium-doped Nanoporous Carbon Fibers for Hydrogen Storage

    SciTech Connect

    Gallego, Nidia C; Contescu, Cristian I; Bhat, Vinay V; van Benthem, Klaus; Tekinalp, Halil; Edie, Dan

    2008-01-01

    Pd-free and Pd-containing activated carbon fibers (Pd-ACF) were synthesized from isotropic pitch as a carbon precursor. The source of Pd was a palladium salt that was premixed with pitch before carbonization. Hydrogen adsorption was measured at near-ambient temperatures (5 to 80 oC) and moderate pressures (up to 20 bar). It was found that adsorption on Pd-ACF is always higher than that on corresponding ACF, and in excess of what it would be expected based solely on formation of Pd hydride. This fact can be explained based on the mechanism of hydrogen spillover. It was also found that temperature and pressure have opposite effects on physisorption and spillover. It was hypothesized that a narrow temperature range exists, where the kinetic advantage of H2 spillover in Pd-ACF overlaps synergistically with the thermodynamic advantage of physisorption, thus contributing to enhanced uptakes compared with the Pd-free carbons.

  11. Automated data reduction for hydrogen/deuterium exchange experiments, enabled by high-resolution Fourier transform ion cyclotron resonance mass spectrometry.

    PubMed

    Kazazic, Sasa; Zhang, Hui-Min; Schaub, Tanner M; Emmett, Mark R; Hendrickson, Christopher L; Blakney, Gregory T; Marshall, Alan G

    2010-04-01

    Mass analysis of proteolytic fragment peptides following hydrogen/deuterium exchange offers a general measure of solvent accessibility/hydrogen bonding (and thus conformation) of solution-phase proteins and their complexes. The primary problem in such mass analyses is reliable and rapid assignment of mass spectral peaks to the correct charge state and degree of deuteration of each fragment peptide, in the presence of substantial overlap between isotopic distributions of target peptides, autolysis products, and other interferant species. Here, we show that at sufficiently high mass resolving power (m/Delta m(50%) > or = 100,000), it becomes possible to resolve enough of those overlaps so that automated data reduction becomes possible, based on the actual elemental composition of each peptide without the need to deconvolve isotopic distributions. We demonstrate automated, rapid, reliable assignment of peptide masses from H/D exchange experiments, based on electrospray ionization FT-ICR mass spectra from H/D exchange of solution-phase myoglobin. Combined with previously demonstrated automated data acquisition for such experiments, the present data reduction algorithm enhances automation (and thus expands generality and applicability) for high-resolution mass spectrometry-based analysis of H/D exchange of solution-phase proteins. PMID:20116280

  12. Isotopic effect on the vibrational lifetime of the carbon-deuterium stretch excitation on graphene

    NASA Astrophysics Data System (ADS)

    Sakong, Sung; Kratzer, Peter

    2011-09-01

    The relaxation of vibrational energy in the H and D stretch modes has been studied on the graphene surface using ab initio calculations. The dissipation of the vibrational energy stored in the stretching modes proceeds through vibration-phonon coupling, while the dissipation through electronic excitations makes only minor contributions. Recently, we reported the fast relaxation of the H stretch energy on graphene [S. Sakong and P. Kratzer, J. Chem. Phys. 133, 054505 (2010)], 10.1063/1.3474806. Interestingly, we predict the lifetime of the D stretch to be markedly longer compared to the relaxation of the H stretch. This is unexpected since the vibrational amplitudes at carbon atoms in the joint C-D vibrational modes are larger than in the joint C-H modes, due to the mass ratio mD/mC > mH/mC. However, the vibrational relaxation rate for the D stretch is smaller than for the H stretch, because the energy is dissipated to an acoustic phonon of graphene in the case of C-D rather than an optical phonon as is the case in C-H, and hence, the corresponding phonon density of states is lower in the C-D case. To rationalize our findings, we propose a general scheme for estimating vibrational lifetimes of adsorbates based on four factors: the density of states of the phonons that mediates the transitions, the vibration-phonon coupling strength, the anharmonic coupling between local modes, and the number of quanta involved in the transitions. Mainly the first two of these factors are responsible for the differences in the lifetimes of the C-H and C-D stretches. The possible role of the other factors is illustrated in the context of vibrational lifetimes in other recently studied systems.

  13. Deuterium transport through device structures

    NASA Astrophysics Data System (ADS)

    Chen, P. J.; Wallace, R. M.

    1999-08-01

    We use secondary ion mass spectrometry to characterize the hydrogen/deuterium distribution and concentration on complimentary "metal" oxide silicon (CMOS) test structures subjected to molecular deuterium (D2) anneals. We examine the temperature dependence and the influence of doping on the transport of deuterium to the gate oxide interfaces resulting in interface passivation. We find that undoped polycrystalline silicon appears to be an efficient barrier for deuterium transport at typical postmetallization sintering temperatures. We also examine the permeability of device structures that include dielectric encapsulation layers after typical postmetal sintering conditions employed in a conventional CMOS process flow. It is found that typical low temperature deposited oxide dielectrics are quite permeable by molecular deuterium at typical sintering temperatures (435 C). In contrast, chemical vapor deposited silicon nitride dielectrics appear to form a complete barrier to deuterium diffusion (even for layers as thin as 300 ). We also find that nitrides which receive a high thermal budget exposure, such as the source/drain anneal, appears to regain permeability to deuterium diffusion/transport.

  14. A Hydrogen-Deuterium Exchange Study on Nickel-based Binary-Ternary Amorphous and Crystalline Membranes

    NASA Astrophysics Data System (ADS)

    Adibhatla, Anasuya

    Hydrogen is a major role player in current global sustainable energy scenario. Research around the world is carried out to harness hydrogen from all possible sources. One of these sources is water gas shift reaction after the coal gasification process. Sustainable infrastructure can be viable in countries like USA and Australia, making this process viable. Various methods are used to harness this hydrogen from the water gas. One of these methods is the use of inorganic membranes based on Pd, Ag, Ni, Zr and other transition metals. Pd addition to the membranes makes the membranes more expensive for commercial use. Various bulk properties like hydrogen permeation and absorption are studied on Pd and Pd-based alloys. Alternate alloys based on Ni, V, Ta etc are being studied to substitute the use of Pd making this technology more cost efficient. A current balance in research in this area is fund to exist by coating the non-precious metal membranes with Pd to improve the surface interaction with hydrogen. The nature of membranes used for hydrogen separation is important aspect for the overall performance. Crystalline materials provide better bulk properties, however, are not durable under high temperature and hydrogen pressure. In this research, non-Pd coated Ni-based amorphous membranes were made by melt spin technique, which have been studied for their surface properties. Gas phase H2-D2 exchange reaction has been carried out on the membrane surface. This provides a measure of catalytic activity of the above mentioned membranes. More studies included the crystallographic phase change determination, bulk hydrogen solubility measurements, surface conduction measurements and surface morphological studies. During this research, it has been observed that crystalline materials provide more surface activity for hydrogen than their amorphous counterparts. Ni64Zr36 alloy has been shown to exhibit similar kinetic rates as metallic Ni. Also, microkinetic analysis was performed to determine the heat of hydrogen absorption and desorption on the alloy surface. Electrochemical Impedance Spectroscopy was conducted on the membranes to determine the surface resistance and it was found that Ni64Zr36 as-spun ribbon displayed highest resistance while Ni60Ta20Zr20 showed lowest resistance. Absorption studies on Ni60V 40 binary alloy and Ni60V20Zr20 ternary alloy indicated that the addition of Zr to these non-coated alloys increased the hydrogen solubility in the bulk. SEM and TEM analyses showed the presence of possible nano crystalline phases in Ni64Zr36 membrane. XRD and SEM studies conducted on post treated samples showed the possible phase segregation of Ni and ZrO2. Ni60Nb40 did not show any phase transformations after hydrogen heat treated unlike its ternary composition, Ni60Nb20Zr20. It is noteworthy to mention that bubbles were observed during SEM on Ni 64Zr36 post-treated sample on the surface due to possible hydrogen trapping and subsequent release of hydrogen gas.

  15. Hydrogen pumping in amorphous deutered carbon films irradiated by swift heavy ions

    NASA Astrophysics Data System (ADS)

    Pawlak, F.; Balanzat, E.; Dufour, Ch.; Laurent, A.; Paumier, E.; Perriere, J.; Stoquert, J. P.; Toulemonde, M.

    1997-02-01

    Deutered amorphous carbon films have been irradiated at GANIL using 5 to 10 MeV/u sulfur beam with an electronic stopping power from 1 to 1.4 keV/nm. Such films have been deposited on silicon substrates by decomposition of CD 4 gas containing 10% of CH 4 in a dc multipolar plasma. After irradiation, they were analyzed firstly using absorption infrared spectroscopy to determine the number of CD and CH bonds. Secondly, deuterium, hydroge and carbon areal density were determined by ERDA and RBS. The results analysis shows a decrease of the atomic ratio ( {D}/{C}) as well as CD bonds down to a minimum value versus the fluence without a threshold fluence and in the same time an increase of the atomic ratio ( {H}/{C}) as well as CH bonds to a maximum value. So we may conclude that the hydrogen pumped after the irradiation is stabilized on broken (or unpaired) bonds.

  16. Estimating groundwater mixing and origin in an overexploited aquifer in Guanajuato, Mexico, using stable isotopes (strontium-87, carbon-13, deuterium and oxygen-18).

    PubMed

    Horst, Axel; Mahlknecht, Jrgen; Merkel, Broder J

    2007-12-01

    Stable Isotopes (strontium-87, deuterium and oxygen-18, carbon-13) have been used to reveal different sources of groundwater and mixing processes in the aquifer of the Silao-Romita Valley in the state of Guanajuato, Mexico. Calcite dissolution appeared to be the main process of strontium release leading to relatively equal (87)Sr/(86)Sr ratios of 0.7042-0.7062 throughout the study area which could be confirmed by samples of carbonate rocks having similar Sr ratios (0.7041-0.7073). delta(13)C values (-11.91- -6.87 per thousand VPDB) of groundwaters confirmed the solution of carbonates but indicated furthermore influences of soil-CO(2). Deuterium and (18)O contents showed a relatively narrow range of-80.1- -70.0 per thousand VSMOW and -10.2- -8.8 per thousand, VSMOW, respectively but are affected by evaporation and mixing processes. The use of delta(13)C together with (87)Sr/(86)Sr revealed three possible sources: (i) carbonate-controlled waters showing generally higher Sr-concentrations, (ii) fissure waters with low-strontium contents and (iii) infiltrating water which is characterized by low delta(13)C and (87)Sr/(86)Sr ratios. The third component is affected by evaporation processes taking place before and during infiltration which might be increased by extraction and reinfiltration (irrigation return flow). PMID:18041622

  17. Carbon-13 and deuterium isotope effects on the catalytic reactions of biotin carboxylase

    SciTech Connect

    Tipton, P.A.; Cleland, W.W.

    1988-06-14

    /sup 13/C and /sup 2/H kinetic isotope effects have been used to investigate the mechanism of enzymic biotin carboxylation. /sup D/(V/K) is 0.50 in 80% D/sub 2/O at pD 8.0 for the forward reaction and 0.57 at pD 8.5 for the phosphorylation of ADP by carbamoyl phosphate. These values approach the theoretical maximum limit for a reaction in which a proton is transferred from a sulfhydryl to a nitrogen or oxygen base. Therefore, it appears that this portion of the reaction is at or near equilibrium. /sup 13/(V/K) at pH 8 is 1.007; the small magnitude of this number suggests that the reaction is almost fully committed by the time the carbon-sensitive steps are reached. There does not appear to be a reverse commitment to the reaction under the conditions in which /sup 13/(V/K) was determined. A large forward commitment is consistent with the failure to observe positional isotope exchange from the ..beta gamma..-bridge position to the ..beta..-nonbridge position in (/sup 18/O/sub 4/)ATP or washout of /sup 18/O from the ..gamma..-nonbridge positions. Transfer of /sup 18/O from bicarbonate to inorganic phosphate in the forward reaction was clearly observed, however. These observations suggest that biotin carboxylase exists in two distinct forms which differ in the protonation states of the two active-site bases, one of which is a sulfhydryl. Only when the sulfhydryl is ionized and the second base protonated can catalysis take place. Carboxylation of biotin is postulated to occur via a pathway in which carboxyphosphate is formed by nucleophilic attack of bicarbonate on ATP. Decarboxylation of carboxyphosphate in the active site generates CO/sub 2/, which serves to carboxylate the isourea tautomer of biotin that is generated by the removal of the proton on N1' by the ionized sulfhydryl.

  18. Material processing with hydrogen and carbon monoxide on Mars

    NASA Technical Reports Server (NTRS)

    Hepp, Aloysius F.; Linne, Diane L.; Landis, Geoffrey A.

    1991-01-01

    Several novel proposals are examined for propellant production from carbon dioxide and monoxide and hydrogen. Potential uses were also examined of CO as a fuel or as a reducing agent in metal oxide processing as obtained or further reduced to carbon. Hydrogen can be reacted with CO to produce a wide variety of hydrocarbons, alcohols, and other organic compounds. Methanol, produced by Fischer-Tropsch chemistry may be useful as a fuel; it is easy to store and handle because it is a liquid at Mars temperatures. The reduction of CO2 to hydrocarbons such as methane or acetylene can be accomplished with hydrocarbons. Carbon monoxide and hydrogen require cryogenic temperatures for storage as liquid. Noncryogenic storage of hydrogen may be accomplished using hydrocarbons, inorganic hydrides, or metal hydrides. Noncryogenic storage of CO may be accomplished in the form of iron carbonyl (FE(CO)5) or other metal carbonyls. Low hydrogen content fuels such as acetylene (C2H2) may be effective propellants with low requirements for earth derived resources. The impact on manned Mars missions of alternative propellant production and utilization is discussed.

  19. Properties Of Plasma-Deposited Amorphous Hydrogenated Carbon

    NASA Technical Reports Server (NTRS)

    Miyoshi, Kazuhisa; Pouch, John J.; Alterovitz, Samuel A.

    1992-01-01

    Report reviews experimental research on plasma-deposited films of hydrogenated amorphous carbon. Such films exhibit electrical resistivity, semi-transparency, mechanical hardness, and chemical inertness. Useful as gate dielectrics and passivating layers in semiconductor devices, insulators for metal/insulator/metal devices, and masks in nanometer lithography. Show promise as wear-resistant, hard solid lubricating coats for bearings and optical components.

  20. Retention and enrichment of tungsten-containing carbon films under deuterium beam impact

    NASA Astrophysics Data System (ADS)

    Sauter, P. A.; Balden, M.

    2013-09-01

    Retention and enrichment of a model system for mixed layers, tungsten-containing carbon films (a-C:W), were investigated with respect to the interaction with D ions. a-C:W was exposed to a mass-separated, mono-energetic D beam (200 eV/D, 1.2 × 1015 D cm-2 s-1). The W concentration in the films (0-7.5 at.%), the specimen temperature during D beam exposure (300-1300 K) and the fluence (Φ) of incident D (1015-1020 D cm-2) were varied. Analysis of retention and enrichment were performed by nuclear reaction analysis and Rutherford backscattering spectrometry, respectively. At 300 K and fluences up to 1019 D cm-2, the increase of the D inventory with fluence in a-C:W cannot be distinguished from a-C and pyrolytic graphite, e.g., above ˜1017 D cm-2 the D inventory increases with fluence according to Φx (x = 0.1). Above a fluence of 1019 D cm-2, however, the D inventory depends strongly on the W concentration. At a fluence of 1020 D cm-2 the D inventory is increased to the 1.5-fold of the D inventory of pyrolytic graphite for 1% and 2.5% a-C:W and it is decreased to the half value of the D inventory of pyrolytic graphite for 7.5% a-C:W. At temperatures above 300 K, following trends are observed: With increasing temperature, the D inventory increases more strongly with fluence and D reaches depths far beyond the width of the ion range. However, the D inventory does not increase with fluence according to Φx, especially at fluences above 1019 D cm-2. The peak near the surface (<70 nm) in Fig. 2a, which was increasing with decreasing temperature, is caused by an accumulation of D at surface near zones, which can be reached by energetic D. This is interpreted in the following way: Bonding states with a lower binding energy than the thermal energy at 900 K, which were unoccupied before decreasing the temperature, were becoming occupied during the decrease of the temperature; the saturation level of the implantation zone is lowered at 900 K compared to 300 K. Before the decrease of the temperature, D was able to reach depths (⩽600 nm; Fig. 2a), which are beyond the peak near the surface and thus cannot be reached by energetic D. Consequently, it can be concluded that the tail to lower energies in the NRA spectrum is caused by a diffusive process of D into depth (˜90% of the total inventory), i.e., a-C:W allows a kind of diffusive transport of D into depths beyond the implantation zone. (Note that these depths will be denoted as the diffusion depth in the following.) Bonding states occupied at 900 K during beam exposure are not depleted after the exposure is stopped (Fig. 2b). This interpretation is confirmed by the release of D towards the surface after the heat treatment at 1300 K (Fig. 2c). Additional bonding states, which were occupied at 1100 K, were depleted raising the temperature above 1100 K. Heat treatment at 1100 K and at 1300 K (Fig. 2c) showed a diffusive transport of D, which is directed towards the surface without the presence of an impacting D beam. In other words, the presence of a D beam is a necessary condition for the diffusive transport of D into depth.

  1. Formaldehyde metabolism by Escherichia coli. Carbon and solvent deuterium incorporation into glycerol, 1,2-propanediol, and 1,3-propanediol

    SciTech Connect

    Hunter, B.K.; Nicholls, K.M.; Sanders, J.K.

    1985-07-16

    Escherichia coli were grown on 14.3% uniformly TC-labeled glucose as the sole carbon source and challenged anaerobically with 90% TC-labeled formaldehyde. The major multiply labeled metabolites were identified by TC NMR spectroscopy to be glycerol and 1,2-propanediol, and a minor metabolite was shown to be 1,3-propanediol. In each case, formaldehyde is incorporated only into the C1 position. A novel form of TC NMR isotope dilution analysis of the major products reveals that all the 1,2-diol C1 is formaldehyde derived but that about 40% of the glycerol C1 is derived from bacterial sources. Glycerokinase converted the metabolite (1- TC)glycerol to equal amounts of (3- TC)glycerol 3-phosphate and (1- TC)glycerol 3-phosphate, demonstrating that the metabolite is racemic. When ( TC)formaldehyde incubation was carried out in H2O/D2O mixtures, deuterium incorporation was detected by beta- and gamma-isotope shifts. The 1,3-diol is deuterium labeled only at C2 and only once, while the 1,2-diol and glycerol are each labeled independently at both C2 and C3; C3 is multiply labeled. Deuterium incorporation levels are different for each metabolite, indicating that the biosynthetic pathways probably diverge early.

  2. The calcium-modulated structures of calmodulin and S100b proteins are useful to monitor hydrogen/deuterium exchange efficiency using matrix-assisted laser desorption ionization time-of-flight mass spectrometry.

    PubMed

    Pingerelli, Peter L; Ozols, Victor V; Saleem, Haroon; Anderson, Carly R; Burns, Richard S

    2009-01-01

    Hydrogen/deuterium exchange (HDX) using matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF) is a sensitive, salt-tolerant and high-throughput method useful to probe protein conformation and molecular interactions. However, a drawback of the MALDI HDX technique is that sample preparation methods can typically result in higher levels of artificial deuterium in-exchange and/or hydrogen back- exchange just prior to or during mass analysis; this may impair data reproducibility and impede structural and kinetic data interpretation. While methods to minimize effects of back-exchange during protein analyte deposition on MALDI plates have been reported, this study presents a readily available, highly sensitive protein control set to facilitate rapid MALDI HDX protocol workup. The Ca(2+)-induced solvent accessible surface area (ASA) changes of calmodulin (CaM) and S100 proteins were employed to monitor and optimize HDX protocol efficiency. Under non- stringent room temperature conditions, the Ca(2+)-induced deuterium exchange of CaM, DeltaD(ca2+ -apo), MH(+) shifts -17 to -24 Da, while S100 DeltaD(ca2+ -apo) MH(+) shifts +8 to +12 Da. By comparing the divergent CaM and S100 Ca(2+)-induced deuterium mass shift differences, HDX sample workup and MALDI plate spotting conditions can easily be monitored. PMID:19940340

  3. Liquid-like hydrogen densities in engineered carbon nanospaces

    NASA Astrophysics Data System (ADS)

    Dohnke, Elmar; Gillespie, Andrew; Pfeifer, Peter

    2014-03-01

    High surface area materials, such as those engineered from synthetic carbon compounds, have narrow pore sizes resulting in exceptionally high stored densities for hydrogen. Stored density is a measurement of the average hydrogen density within a pore. At supercritical temperatures and high pressures, these materials can achieve stored densities 20% higher than liquid hydrogen at 1 bar and 20 K. At 77 K and 200 bar, we have achieved stored densities of up to 85 g/L. We can show, depending on the pore structure, a maximum of gravimetric hydrogen excess adsorption at 100 bar and 296 K and binding energies of 8-10 kJ/mol. The occurrence of a maximum of gravimetric excess adsorption at relatively low pressures, indicating a high binding energy, is due to the overlapping adsorption potentials in narrow pores.

  4. Atypical Hydrogen Uptake on Chemically Activated, Ultramicroporous Carbon

    SciTech Connect

    Bhat, Vinay V; Contescu, Cristian I; Gallego, Nidia C; Baker, Frederick S

    2010-01-01

    Hydrogen adsorption at near-ambient temperatures on ultramicroporous carbon (UMC), derived through secondary chemical activation from a wood-based activated carbon was studied using volumetric and gravimetric methods. The results showed that physisorption is accompanied by a process of different nature that causes slow uptake at high pressures and hysteresis on desorption. In combination, this results in unusually high levels of hydrogen uptake at near-ambient temperatures and pressures (e.g. up to 0.8 wt % at 25 oC and 2 MPa). The heat of adsorption corresponding to the slow process leading to high uptake (17 20 kJ/mol) is higher than usually reported for carbon materials, but the adsorption kinetics is slow, and the isotherms exhibit pronounced hysteresis. These unusual properties were attributed to contributions from polarization-enhanced physisorption caused by traces of alkali metals residual from chemical activation. The results support the hypothesis that polarization-induced physisorption in high surface area carbons modified with traces of alkali metal ions is an alternate route for increasing the hydrogen storage capacity of carbon adsorbents.

  5. Hydrogen storage in nanoporous carbon materials: myth and facts.

    PubMed

    Kowalczyk, Piotr; Ho?yst, Robert; Terrones, Mauricio; Terrones, Humberto

    2007-04-21

    We used Grand canonical Monte Carlo simulation to model the hydrogen storage in the primitive, gyroid, diamond, and quasi-periodic icosahedral nanoporous carbon materials and in carbon nanotubes. We found that none of the investigated nanoporous carbon materials satisfy the US Department of Energy goal of volumetric density and mass storage for automotive application (6 wt% and 45 kg H(2) m(-3)) at considered storage condition. Our calculations indicate that quasi-periodic icosahedral nanoporous carbon material can reach the 6 wt% at 3.8 MPa and 77 K, but the volumetric density does not exceed 24 kg H(2) m(-3). The bundle of single-walled carbon nanotubes can store only up to 4.5 wt%, but with high volumetric density of 42 kg H(2) m(-3). All investigated nanoporous carbon materials are not effective against compression above 20 MPa at 77 K because the adsorbed density approaches the density of the bulk fluid. It follows from this work that geometry of carbon surfaces can enhance the storage capacity only to a limited extent. Only a combination of the most effective structure with appropriate additives (metals) can provide an efficient storage medium for hydrogen in the quest for a source of "clean" energy. PMID:17415489

  6. Deuterium trapping in tungsten

    NASA Astrophysics Data System (ADS)

    Poon, Michael

    Tungsten is one of the primary material candidates being investigated for use in the first-wall of a magnetic confinement fusion reactor. An ion accelerator was used to simulate the type of ion interaction that may occur at a plasma-facing material. Thermal desorption spectroscopy (TDS) was the primary tool used to analyze the effects of the irradiation. Secondary ion mass spectroscopy (SIMS) was used to determine the distribution of trapped D in the tungsten specimen. The tritium migration analysis program (TMAP) was used to simulate thermal desorption profiles from the D depth distributions. Fitting of the simulated thermal desorption profiles with the measured TDS results provided values of the D trap energies. Deuterium trapping in single crystal tungsten was studied as a function of the incident ion fluence, ion flux, irradiation temperature, irradiation history, and surface impurity levels during irradiation. The results show that deuterium was trapped at vacancies and voids. Two deuterium atoms could be trapped at a tungsten vacancy, with trapping energies of 1.4 eV and 1.2 eV for the first and second D atoms, respectively. In a tungsten void, D is trapped as atoms adsorbed on the inner walls of the void with a trap energy of 2.1 eV, or as D2 molecules inside the void with a trap energy of 1.2 eV. Deuterium trapping in polycrystalline tungsten was also studied as a function of the incident fluence, irradiation temperature, and irradiation history. Deuterium trapping in polycrystalline tungsten also occurs primarily at vacancies and voids with the same trap energies as in single crystal tungsten; however, the presence of grain boundaries promotes the formation of large surface blisters with high fluence irradiations at 500 K. In general, D trapping is greater in polycrystalline tungsten than in single crystal tungsten. To simulate mixed materials comprising of carbon (C) and tungsten, tungsten specimens were pre-irradiated with carbon ions prior to D irradiation. Deuterium trapping could be characterized by three regimes: (i) enhanced D retention in a graphitic film formed by the C+ irradiation; (ii) decreased D retention in a modified tungsten-carbon layer; and (iii) D retention in pure tungsten.

  7. Closed system Fischer-Tropsch synthesis over meteoritic iron, iron ore and nickel-iron alloy. [deuterium-carbon monoxide reaction catalysis

    NASA Technical Reports Server (NTRS)

    Nooner, D. W.; Gibert, J. M.; Gelpi, E.; Oro, J.

    1976-01-01

    Experiments were performed in which meteoritic iron, iron ore and nickel-iron alloy were used to catalyze (in Fischer-Tropsch synthesis) the reaction of deuterium and carbon monoxide in a closed vessel. Normal alkanes and alkenes and their monomethyl substituted isomers and aromatic hydrocarbons were synthesized. Iron oxide and oxidized-reduced Canyon Diablo used as Fischer-Tropsch catalysts were found to produce aromatic hydrocarbons in distributions having many of the features of those observed in carbonaceous chondrites, but only at temperatures and reaction times well above 300 C and 6-8 h.

  8. Differentiating the role of lithium and oxygen in retaining deuterium on lithiated plasma-facing components

    NASA Astrophysics Data System (ADS)

    Taylor, Chase

    2013-10-01

    Lithium wall conditioning has been implemented in nearly a dozen fusion devices, resulting in significantly improved plasma performance. Improvements are manifest as a reduction and eventual elimination of edge localized modes, reduced edge neutral density, reduced deuterium recycling, and some reduction in impurities. Initially, researchers assumed that lithium, via a direct lithium-deuterium bond, was directly responsible for these improvements. Our experiments and atomistic simulations have revealed that lithium coatings play a much more indirect role in improving plasma performance. The presence of oxygen in tokamaks is ubiquitously viewed as unfavorable. However, recent results show that lithium reduces oxygen impurities and surprisingly uses the oxygen to retain deuterium. Experiments using X-ray photoelectron spectroscopy identify that oxygen immediately begins to accumulate on lithium conditioned surfaces. Tight-binding density functional theory simulations tested various carbon matrices with and without lithium, oxygen, and hydrogen, and identified that oxygen plays the key role in retaining deuterium. In fact, a simulated PFC with 20% oxygen in carbon retains more deuterium than does 20% lithium in carbon. Recent experiments implanted oxygen in graphite to match simulations; however, we were unable to achieve the simulated results because all implanted oxygen was released upon deuterium bombardment. We therefore conclude that while oxygen retains deuterium, lithium plays an indispensible role in this process. Lithium attracts and retains oxygen, and then oxygen binds and retains deuterium. Work supported by USDOE Contracts DE-FG02-08ER54990 and DOE ID Field Office contract DE-AC07-05ID14517.

  9. Restricted dynamics of molecular hydrogen confined in activated carbon nanopores

    SciTech Connect

    Contescu, Cristian I; Saha, Dipendu; Gallego, Nidia C; Mamontov, Eugene; Kolesnikov, Alexander I; Bhat, Vinay V

    2012-01-01

    Quasi-elastic neutron scattering was used for characterization of dynamics of molecular hydrogen confined in narrow nanopores of two activated carbon materials: PFAC (derived from polyfurfuryl alcohol) and UMC (ultramicroporous carbon). Fast, but incomplete ortho-para conversion was observed at 10 K, suggesting that scattering originates from the fraction of unconverted ortho isomer which is rotation-hindered because of confinement in nanopores. Hydrogen molecules entrapped in narrow nanopores (<7 ) were immobile below 22-25 K. Mobility increased rapidly with temperature above this threshold, which is 8 K higher than the melting point of bulk hydrogen. Diffusion obeyed fixed-jump length mechanism, indistinguishable between 2D and 3D processes. Thermal activation of diffusion was characterized between ~22 and 37 K, and structure-dependent differences were found between the two carbons. Activation energy of diffusion was higher than that of bulk solid hydrogen. Classical notions of liquid and solid do not longer apply for H2 confined in narrow nanopores.

  10. Carbon Nanotube/Magnesium Composite as a Hydrogen Source.

    PubMed

    Yu, Min Kyu; Se, Kwon Oh; Kim, Min Joong; Hwang, Jae Won; Yoon, Byoung Young; Kwon, Hyuk Sang

    2015-11-01

    Hydrogen produced using the steam reforming process contains sulfur and carbon monoxide that are harmful to the Pt catalyst in proton-exchange-membrane fuel cells (PEMFCs). However, CO-free hydrogen can be generated from the hydrolysis of either Al in strongly alkaline water or Mg in neutral water with chlorides such as sea water. The hydrogen generation rate from the hydrolysis of Mg is extremely slow and linearly proportional to the corrosion rate of Mg in chloride water. In this work, we fabricated a carbon nanotube (CNT)--reinforced Mg--matrix composite by Spark Plasma Sintering as a fast hydrogen generation source for a PEMFC. The CNTs distributed in the Mg matrix act as numerous local cathodes, and hence cause severe galvanic corrosion between the Mg-matrix anode and CNT-cathode in NaCl solution. It was found that the hydrogen generation rate from the hydrolysis of the 5 vol.% CNT/Mg composite is 3300 times faster than that of the Mg without CNTs due primarily to the galvanic corrosion effect. PMID:26726603

  11. Carbon-palladium films as gas sensors (hydrogen, ammonia, methane)

    NASA Astrophysics Data System (ADS)

    Rymarczyk, Joanna; Kamińska, Anna; Krawczyk, Sławomir

    2014-11-01

    In this paper we present the results of the resistances changes of carbon-palladium films under the influences of gas like hydrogen, ammonia and methane. Our research has shown that carbon-palladium films (C-Pd films) according to the form and the structure in which they appear, they can respond to a variety of gases. The C-Pd film obtained by Physical Vapor Deposition (PVD) method is sensitive to hydrogen and do not respond to the ammonia. Thermal modification of the C-Pd film in Chemical Vapor Deposition (CVD) process affects the morphology of the film, increases its resistance and it causes that this film begins to react to the ammonia. This change causes that this film stops responding on hydrogen. Film sensitive to methane was obtained by changing the technology conditions of the PVD process. The reaction of C-Pd film on the hydrogen and the ammonia is increase resistance, while film sensitive to methane reacts by decrease of initial resistance value. In both cases, the changes are reversible after cleaning by air atmosphere. Different varieties of C-Pd films can be used to build selective sensors for hydrogen, ammonia and methane.

  12. Hydrogen-bond detection, configuration assignment and rotamer correction of side-chain amides in large proteins by NMR spectroscopy through protium/deuterium isotope effects.

    PubMed

    Liu, Aizhuo; Wang, Jifeng; Lu, Zhenwei; Yao, Lishan; Li, Yue; Yan, Honggao

    2008-11-24

    The configuration and hydrogen-bonding network of side-chain amides in a 35 kDa protein were determined by measuring differential and trans-hydrogen-bond H/D isotope effects by using the isotopomer-selective (IS)-TROSY technique, which leads to a reliable recognition and correction of erroneous rotamers that are frequently found in protein structures. First, the differential two-bond isotope effects on carbonyl (13)C' shifts, which are defined as Delta(2)Delta(13)C'(ND) = (2)Delta(13)C'(ND(E))-(2)Delta(13)C'(ND(Z)), provide a reliable means for the configuration assignment for side-chain amides, because environmental effects (hydrogen bonds and charges, etc.) are greatly attenuated over the two bonds that separate the carbon and hydrogen atoms, and the isotope effects fall into a narrow range of positive values. Second and more importantly, the significant variations in the differential one-bond isotope effects on (15)N chemical shifts, which are defined as Delta(1)Delta(15)N(D) = (1)Delta(15)N(D(E))-(1)Delta(15)N(D(Z)) can be correlated with hydrogen-bonding interactions, particularly those involving charged acceptors. The differential one-bond isotope effects are additive, with major contributions from intrinsic differential conjugative interactions between the E and Z configurations, H-bonding interactions, and charge effects. Furthermore, the pattern of trans-H-bond H/D isotope effects can be mapped onto more complicated hydrogen-bonding networks that involve bifurcated hydrogen-bonds. Third, the correlations between Delta(1)Delta(15)N(D) and hydrogen-bonding interactions afford an effective means for the correction of erroneous rotamer assignments of side-chain amides. Rotamer correction by differential isotope effects is not only robust, but also simple and can be applied to large proteins. PMID:18973166

  13. Correlating excipient effects on conformational and storage stability of an IgG1 monoclonal antibody with local dynamics as measured by hydrogen/deuterium-exchange mass spectrometry.

    PubMed

    Manikwar, Prakash; Majumdar, Ranajoy; Hickey, John M; Thakkar, Santosh V; Samra, Hardeep S; Sathish, Hasige A; Bishop, Steven M; Middaugh, C Russell; Weis, David D; Volkin, David B

    2013-07-01

    The effects of sucrose and arginine on the conformational and storage stability of an IgG1 monoclonal antibody (mAb) were monitored by differential scanning calorimetry (DSC) and size-exclusion chromatography (SEC), respectively. Excipient effects on protein physical stability were then compared with their effects on the local flexibility of the mAb in solution at pH 6, 25°C using hydrogen/deuterium-exchange mass spectrometry (H/D-MS). Compared with a 0.1 M NaCl control, sucrose (0.5 M) increased conformational stability (T(m) values), slowed the rate of monomer loss, reduced the formation of insoluble aggregates, and resulted in a global trend of small decreases in local flexibility across most regions of the mAb. In contrast, the addition of arginine (0.5 M) decreased the mAb's conformational stability, increased the rate of loss of monomer with elevated levels of soluble and insoluble aggregates, and led to significant increases in the local flexibility in specific regions of the mAb, most notably within the constant domain 2 of the heavy chain (C(H)2). These results provide new insights into the effect of sucrose and arginine on the local dynamics of IgG1 domains as well as preliminary correlations between local flexibility within specific segments of the C(H)2 domain (notably heavy chain 241-251) and the mAb's overall physical stability. PMID:23620222

  14. Identification of Pharmacological Chaperones for Gaucher Disease and Characterization of Their Effects on ?-Glucocerebrosidase by Hydrogen/Deuterium Exchange Mass Spectrometry

    PubMed Central

    Tropak, Michael B.; Kornhaber, Gregory J.; Rigat, Brigitte A.; Maegawa, Gustavo H.; Buttner, Justin D.; Blanchard, Jan E.; Murphy, Cecilia; Tuske, Steven J.; Coales, Stephen J.; Hamuro, Yoshitomo; Brown, Eric D.

    2010-01-01

    Point mutations in ?-glucocerebrosidase (GCase) can result in a deficiency of both GCase activity and protein in lysosomes thereby causing Gaucher Disease (GD). Enzyme inhibitors such as isofagomine, acting as pharmacological chaperones (PCs), increase these levels by binding and stabilizing the native form of the enzyme in the endoplasmic reticulum (ER), and allow increased lysosomal transport of the enzyme. A high-throughput screen of the 50 000-compound Maybridge library identified two, non-carbohydrate-based inhibitory molecules, a 2,4-diamino-5-substituted quinazoline (IC50 5 ?M) and a 5-substituted pyridinyl-2-furamide (IC50 8 ?M). They raised the levels of functional GCase 1.52.5-fold in N370S or F213I GD fibroblasts. Immunofluorescence confirmed that treated GD fibroblasts had decreased levels of GCase in their ER and increased levels in lysosomes. Changes in protein dynamics, monitored by hydrogen/deuterium-exchange mass spectrometry, identified a domain III active-site loop (residues 243249) as being significantly stabilized upon binding of isofagomine or either of these two new compounds; this suggests a common mechanism for PC enhancement of intracellular transport. PMID:18972510

  15. Load-dependent destabilization of the γ-rotor shaft in FOF1 ATP synthase revealed by hydrogen/deuterium-exchange mass spectrometry.

    PubMed

    Vahidi, Siavash; Bi, Yumin; Dunn, Stanley D; Konermann, Lars

    2016-03-01

    FoF1 is a membrane-bound molecular motor that uses proton-motive force (PMF) to drive the synthesis of ATP from ADP and Pi. Reverse operation generates PMF via ATP hydrolysis. Catalysis in either direction involves rotation of the γε shaft that connects the α3β3 head and the membrane-anchored cn ring. X-ray crystallography and other techniques have provided insights into the structure and function of FoF1 subcomplexes. However, interrogating the conformational dynamics of intact membrane-bound FoF1 during rotational catalysis has proven to be difficult. Here, we use hydrogen/deuterium exchange mass spectrometry to probe the inner workings of FoF1 in its natural membrane-bound state. A pronounced destabilization of the γ C-terminal helix during hydrolysis-driven rotation was observed. This behavior is attributed to torsional stress in γ, arising from γ⋅⋅⋅α3β3 interactions that cause resistance during γ rotation within the apical bearing. Intriguingly, we find that destabilization of γ occurs only when FoF1 operates against a PMF-induced torque; the effect disappears when PMF is eliminated by an uncoupler. This behavior resembles the properties of automotive engines, where bearings inflict greater forces on the crankshaft when operated under load than during idling. PMID:26884184

  16. Structure-dependent degradation of polar compounds in weathered oils observed by atmospheric pressure photo-ionization hydrogen/deuterium exchange ultrahigh resolution mass spectrometry.

    PubMed

    Islam, Ananna; Kim, Donghwi; Yim, Un Hyuk; Shim, Won Joon; Kim, Sunghwan

    2015-10-15

    The resin fractions of fresh mixtures of three oils spilled during the M/V Hebei Spirit oil spill, as well as weathered oils collected at weathering stages II and IV from the oil spill site were analyzed and compared by atmospheric pressure photo-ionization hydrogen/deuterium exchange mass spectrometry (HDX MS). The significantly decreased abundance of N(+) and [N-H+D](+) ions suggested that secondary and tertiary amine-containing compounds were preferentially degraded during the early stage of weathering. [N+H](+) and [N+D](+) ions previously attributed to pyridine-type compounds degraded more slowly than secondary and tertiary amine-containing compounds. The preferential degradation of nitrogen-containing compounds was confirmed by photo-degradation experiments using 15 standard compounds. In addition, significant increases of [S1O1+H](+) and [S1O1+D](+) ions with higher DBE values were observed from fresh oil mixtures as compared to stages II and IV samples, and that could be linked with the decrease of higher DBE compounds of the S1 class. This study presented convincing arguments and evidence demonstrating that secondary and tertiary amines were more vulnerable to photo-degradation than compounds containing pyridine, and hence, preferential degradation depending on chemical structures must be considered in the production of hazardous or toxic components. PMID:25913675

  17. Electronic and Mechanical Properties of Hydrogen Functionalized Carbon Nanotubes

    NASA Technical Reports Server (NTRS)

    Yang, Liu; Han, Jie; Jaffe, Richard L.; Arnold, Jim (Technical Monitor)

    2001-01-01

    We examined the electronic and mechanical properties of hydrogen functionalized carbon nanotubes. The functionalization pattern covers two extreme groups. One group has randomly selected functionalization sites including one to twenty percent of the carbon atoms. The other group has regularly patterned functional sites parallel to the tube axis. Metallic, small-gap semiconducting and large-gap semiconducting carbon nanotubes are studied. The results reveal that the electronic properties of the tubes are very sensitive to the degree of functionalization, with even one percent functionalization being enough to render metallic tubes semiconducting. On the other hand, the mechanical properties, like tensile modulus, are much less sensitive to functionalization. For carbon nanotubes functionalized with specific patterns, the electric properties depends strongly on the nature of the functionalization pattern.

  18. Theoretical investigation of planar square carbon allotrope and its hydrogenation

    NASA Astrophysics Data System (ADS)

    Pujari, Bhalchandra S.; Tokarev, Andrey; Saraf, Deepashri A.

    2012-05-01

    Using density functional theory we investigate a novel carbon allotrope SqC: a square planar material that can be more than tetracoordinated. Carbon atoms in this 2D square Bravais lattice form an unusual five-center four-electron bond with neighboring four carbon atoms (tetracoordination). Such an electron-deficient bonding leaves an empty orbital which enables penta- or hexa-coordinated carbon atom. Indeed, our simulations demonstrate such penta- and hexa-coordinated configurations upon partial and complete hydrogenation, respectively. Surprisingly, in all the forms SqC shows the metallic character. SqC has the binding energy of 6.7 eV and it also satisfies the Born stability criteria. Yet our phonon calculations show that it may only be considered as quasi-stable.

  19. Mechanism of enhanced hydrogen adsorption on palladium-doped nanoporous carbon fibers

    SciTech Connect

    Contescu, Cristian I; Gallego, Nidia C; Wu, Xianxian; Tekinalp, Halil; Edie, Dan; Thies, Mark C; Baker, Frederick S

    2007-01-01

    Recent work at Oak Ridge National Laboratory was directed towards adsorptive storage of hydrogen in nanoporous carbon fibers in which palladium was incorporated prior to spinning and carbonization/activation of the fibers. Palladium doped carbon fibers exhibited enhanced hydrogen uptake compared to the corresponding palladium-free nanoporous carbon fibers (at room temperature and 2 MPa pressure). However, the mechanism responsible for the enhanced hydrogen uptake is not fully understood. New findings are presented in this paper in support of a mechanism that encompasses both hydrogen spillover on palladium metal sites and hydrogen physisorption on nanostructured carbon sites.

  20. Hydrogen Storage in Carbon SWNTs: Atomic or Molecular?

    NASA Astrophysics Data System (ADS)

    Haluska, M.; Hirscher, M.; Becher, M.; Dettlaff-Weglikowska, U.; Chen, X.; Roth, S.

    2002-10-01

    The atomistic nature of hydrogen storage in carbon SWNTs has been investigated by thermal desorption spectroscopy utilizing mass spectrometry. The partial pressures of desorbed H2, D2 and HD have been simultaneously recorded after sample loading with a 1:1 mixture of H2 and D2 gases. The amount of desorbed HD molecules approaches the ratio 2:1:1 for HD:H2:D2 in the case of atomic storage. In the case of molecular storage the concentration of HD approaches the background level. It was found that hydrogen isotopes are stored as atoms in SWNT samples containing transition metals from either sample production (Ni, Fe, ) and/or activation (opening) process (Ni, Fe, Ti, ). Purified SWNTs store hydrogen in the molecular state, if any.

  1. Catalytic carbon membranes for hydrogen production. Final report

    SciTech Connect

    Damle, A.S.; Gangwal, S.K.

    1992-01-01

    Commercial carbon composite microfiltration membranes may be modified for gas separation applications by providing a gas separation layer with pores in the 1- to 10-nm range. Several organic polymeric precursors and techniques for depositing a suitable layer were investigated in this project. The in situ polymerization technique was found to be the most promising, and pure component permeation tests with membrane samples prepared with this technique indicated Knudsen diffusion behavior. The gas separation factors obtained by mixed-gas permeation tests were found to depend strongly on gas temperature and pressure indicating significant viscous flow at high-pressure conditions. The modified membranes were used to carry out simultaneous water gas shift reaction and product hydrogen separation. These tests indicated increasing CO conversions with increasing hydrogen separation. A simple process model was developed to simulate a catalytic membrane reactor. A number of simulations were carried out to identify operating conditions leading to product hydrogen concentrations over 90 percent. (VC)

  2. Hydrogenated 5-carbon compound and method of making

    DOEpatents

    Elliott, D.C.; Frye, J.G.

    1999-03-16

    The present invention is based upon the surprising discovery that a 5-carbon compound selected from the group of 4-oxopentanoic acid, at least one lactone of 4-oxopentanoic acid, and combinations thereof, may be hydrogenated with a bimetallic catalyst of a noble metal in combination with a second metal and preserve the pendant methyl group. It was further unexpectedly discovered that the same conditions of bimetallic catalyst in the presence of hydrogen are useful for catalyzing the different intermediate reactions, for example, angelicalactone to gamma-valerolactone and gamma-valerolactone to 1,4-pentanediol. Finally, it was surprising that levulinic acid could be converted to 2-methyltetrahydrofuran with heating in the presence of the bimetallic catalyst and hydrogen in a single process vessel. The method of the present invention unexpectedly produced a fuel or fuel component having 2-methyltetrahydrofuran either in a yield greater than 4.5 mol % or in combination with alcohols. 8 figs.

  3. Hydrogenated 5-carbon compound and method of making

    DOEpatents

    Elliott, Douglas C. (Richland, WA); Frye, John G. (Richland, WA)

    1999-01-01

    The present invention is based upon the surprising discovery that a 5-carbon compound selected from the group of 4-oxopentanoic acid, at least one lactone of 4-oxopentanoic acid, and combinations thereof, may be hydrogenated with a bimetallic catalyst of a noble metal in combination with a second metal and preserve the pendant methyl group. It was further unexpectedly discovered that the same conditions of bimetallic catalyst in the presence of hydrogen are useful for catalyzing the different intermediate reactions for example angelicalactone to gamma-valerolactone and gamma-valerolactone to 1,4-pentanediol. Finally, it was surprising that levulinic acid could be converted to 2-methyltetrahydrofuran with heating in the presence of the bimetallic catalyst and hydrogen in a single process vessel. The method of the present invention unexpectedly produced a fuel or fuel component having 2-methyltetrahydrofuran either in a yield greater than 4.5 mol % or in combination with alcohols.

  4. Nanotube-derived carbon foam for hydrogen sorption.

    PubMed

    Ding, Feng; Lin, Yu; Krasnov, Pavel O; Yakobson, Boris I

    2007-10-28

    A new kind of carbon foam, which is based on the welding of single-walled carbon nanotubes, is built in a computer simulation. Its precisely defined architecture and all atomic positions allow one to perform detailed theoretical analysis of the properties. Such foam is as light as 19 of steel, while its stiffness is similar and nearly isotropic, and it represents a strong three-dimensional material with various possible applications. Furthermore, its nanoporous structure is accessible to molecular hydrogen and the potential surface analysis indicates that it should be an excellent hydrogen storage medium. Importantly, such foam is a feasible structure that can be produced based on the known tube/fullerene welding techniques. PMID:17979367

  5. Renewable hydrogen and carbon nanotubes from biodiesel waste glycerol

    PubMed Central

    Wu, Chunfei; Wang, Zichun; Williams, Paul T.; Huang, Jun

    2013-01-01

    In this report, we introduce a novel and commercially viable method to recover renewable hydrogen and carbon nanotubes from waste glycerol produced in the biodiesel process. Gas-phase catalytic reforming converts glycerol to clean hydrogen fuel and by replacing the problematical coke formed on the catalyst with high value carbon nanotubes, added value can be realised. Additional benefits of around 2.8?kg CNTs from the reforming of 1 tonne of glycerol and the production of 500?Nm3 H2 could have a considerable impact on the economics of glycerol utilization. Thereby, the contribution of this research will be a significant step forward in solving a current major technical and economic challenge faced by the biofuels industry. PMID:24067754

  6. Optimization of Nano-Carbon Materials for Hydrogen Sorption

    SciTech Connect

    Yakobson, Boris I

    2013-08-02

    Research undertaken has added to the understanding of several critical areas, by providing both negative answers (and therefore eliminating expensive further studies of unfeasible paths) and positive feasible options for storage. Theoretical evaluation of the early hypothesis of storage on pure carbon single wall nanotubes (SWNT) has been scrutinized with the use of comprehensive computational methods (and experimental tests by the Center partners), and demonstrated that the fundamentally weak binding energy of hydrogen is not sufficiently enhanced by the SWNT curvature or even defects, which renders carbon nanotubes not practical media. More promising direction taken was towards 3-dimensional architectures of high porosity where concurrent attraction of H2 molecule to surrounding walls of nano-scale cavities can double or even triple the binding energy and therefore make hydrogen storage feasible even at ambient or somewhat lower temperatures. An efficient computational tool has been developed for the rapid capacity assessment combining (i) carbon-foam structure generation, (ii) accurate empirical force fields, with quantum corrections for the lightweight H2, and (iii) grand canonical Monte Carlo simulation. This made it possible to suggest optimal designs for carbon nanofoams, obtainable via welding techniques from SWNT or by growth on template-zeolites. As a precursor for 3D-foams, we have investigated experimentally the synthesis of VANTA (Vertically Aligned NanoTube Arrays). This can be used for producing nano-foams. On the other hand, fluorination of VANTA did not show promising increase of hydrogen sorption in several tests and may require further investigation and improvements. Another significant result of this project was in developing a fundamental understanding of the elements of hydrogen spillover mechanisms. The benefit of developed models is the ability to foresee possible directions for further improvement of the spillover mechanism.

  7. Sulfur and Hydrogen Isotope Anomalies in Meteorite Sulfonic Acids

    NASA Technical Reports Server (NTRS)

    Cooper, George W.; Thiemens, Mark H.; Jackson, Teresa L.; Chang, Sherwood

    1997-01-01

    Intramolecular carbon, hydrogen, and sulfur isotope ratios were measured on a homologous series of organic sulfonic acids discovered in the Murchison meteorite. Mass-independent sulfur isotope fractionations were observed along with high deuterium/hydrogen ratios. The deuterium enrichments indicate formation of the hydrocarbon portion of these compounds in a low-temperature environment that is consistent with that of interstellar clouds. Sulfur-33 enrichments observed in methanesulfonic acid could have resulted from gas-phase ultraviolet irradiation of a precursor, carbon disulfide. The source of the sulfonic acid precursors may have been the reactive interstellar molecule carbon monosulfide.

  8. Enhanced hydrogen adsorption in boron substituted carbon nanospaces.

    PubMed

    Firlej, L; Roszak, Sz; Kuchta, B; Pfeifer, P; Wexler, Carlos

    2009-10-28

    Activated carbons are one of promising groups of materials for reversible storage of hydrogen by physisorption. However, the heat of hydrogen adsorption in such materials is relatively low, in the range of about 4-8 kJ/mol, which limits the total amount of hydrogen adsorbed at P=100 bar to approximately 2 wt % at room temperature and approximately 8 wt % at 77 K. To improve the sorption characteristics the adsorbing surfaces must be modified either by substitution of some atoms in the all-carbon skeleton by other elements, or by doping/intercalation with other species. In this letter we present ab initio calculations and Monte Carlo simulations showing that substitution of 5%-10% of atoms in a nanoporous carbon by boron atoms results in significant increases in the adsorption energy (up to 10-13.5 kJ/mol) and storage capacity ( approximately 5 wt % at 298 K, 100 bar) with a 97% delivery rate. PMID:19894965

  9. Towards efficient solar hydrogen production by intercalated carbon nitride photocatalyst.

    PubMed

    Gao, Honglin; Yan, Shicheng; Wang, Jiajia; Huang, Yu An; Wang, Peng; Li, Zhaosheng; Zou, Zhigang

    2013-11-01

    The development of efficient photocatalytic material for converting solar energy to hydrogen energy as viable alternatives to fossil-fuel technologies is expected to revolutionize energy shortage and environment issues. However, to date, the low quantum yield for solar hydrogen production over photocatalysts has hindered advances in the practical applications of photocatalysis. Here, we show that a carbon nitride intercalation compound (CNIC) synthesized by a simple molten salt route is an efficient polymer photocatalyst with a high quantum yield. We found that coordinating the alkali metals into the C-N plane of carbon nitride will induce the un-uniform spatial charge distribution. The electrons are confined in the intercalated region while the holes are in the far intercalated region, which promoted efficient separation of photogenerated carriers. The donor-type alkali metal ions coordinating into the nitrogen pots of carbon nitrides increase the free carrier concentration and lead to the formation of novel nonradiative paths. This should favor improved transport of the photogenerated electron and hole and decrease the electron-hole recombination rate. As a result, the CNIC exhibits a quantum yield as high as 21.2% under 420 nm light irradiation for solar hydrogen production. Such high quantum yield opens up new opportunities for using cheap semiconducting polymers as energy transducers. PMID:24061109

  10. Infrared emission from hydrogenated amorphous carbon and amorphous carbon grains in the interstellar medium

    NASA Technical Reports Server (NTRS)

    Duley, W. W.; Jones, A. P.; Taylor, S. D.; Williams, D. A.

    1993-01-01

    The correlations deduced by Boulanger et al. (1990) from IRAS maps of the Chamaeleon, Taurus and Ursa Major molecular cloud complexes are interpreted in terms of the evolutionary hydrogenated amorphous carbon model of interstellar dust. In particular, regions of relatively strong 12-micron emission may be regions where recently accreted carbon is being converted by ambient UV to small PAHs in situ. Regions of weak 12-micron emission are probably quiescent regions where carbon has been annealed to amorphous carbon. Observational consequences of these inferences are briefly described.

  11. Hydrogen storage reactions on titanium decorated carbon nanocones theoretical study

    NASA Astrophysics Data System (ADS)

    Shalabi, A. S.; Taha, H. O.; Soliman, K. A.; Abeld Aal, S.

    2014-12-01

    Hydrogen storage reactions on Ti decorated carbon nanocones (CNC) are investigated by using the state of the art density functional theory calculations. The single Ti atom prefers to bind at the bridge site between two hexagonal rings, and can bind up to 6 hydrogen molecules with average adsorption energies of -1.73, -0.74, -0.57, -0.45, -0.42, and -0.35 eV per hydrogen molecule. No evidence for metal clustering in the ideal circumstances, and the hydrogen storage capacity is expected to be as large as 14.34 wt%. Two types of interactions are recognized. While the interaction of 2H2 with Ti-CNC is irreversible at 532 K, the interaction of 3H2 with Ti-CNC is reversible at 392 K. Further characterizations of the former two reactions are considered in terms of projected densities of states, simulated infrared and proton magnetic resonance spectra, electrophilicity, and statistical thermodynamic stability. The free energy of the highest hydrogen storage capacity reaction between 6H2 and Ti-CNC meets the ultimate targets of department of energy at (233.15 K) and (11.843 atm) with surface coverage (0.941) and (direct/inverse) rate constants ratio (1.35).

  12. Characterization of the International Humic Substances Society standard and reference fulvic and humic acids by solution state carbon-13 (13C) and hydrogen-1 (1H) nuclear magnetic resonance spectrometry

    USGS Publications Warehouse

    Thorn, Kevin A.; Folan, Daniel W.; MacCarthy, Patrick

    1989-01-01

    Standard and reference samples of the International Humic Substances Society have been characterized by solution state carbon-13 and hydrogen-1 nuclear magnetic resonance (NMR) spectrometry. Samples included the Suwannee River, soil, and peat standard fulvic and humic acids, the Leonardite standard humic acid, the Nordic aquatic reference fulvic and humic acids, and the Summit Hill soil reference humic acid. Aqueous-solution carbon-13 NMR analyses included the measurement of spin-lattice relaxation times, measurement of nuclear Overhauser enhancement factors, measurement of quantitative carbon distributions, recording of attached proton test spectra, and recording of spectra under nonquantitative conditions. Distortionless enhancement by polarization transfer carbon-13 NMR spectra also were recorded on the Suwannee River fulvic acid in deuterated dimethyl sulfoxide. Hydrogen-1 NMR spectra were recorded on sodium salts of the samples in deuterium oxide. The carbon aromaticities of the samples ranged from 0.24 for the Suwannee River fulvic acid to 0.58 for the Leonardite humic acid.

  13. Noncatalytic hydrogenation of decene-1 with hydrogen accumulated in a hybrid carbon nanostructure in nanosized membrane reactors

    NASA Astrophysics Data System (ADS)

    Soldatov, A. P.

    2014-08-01

    Studies on the creation of nanosized membrane reactors (NMRs) of a new generation with accumulated hydrogen and a regulated volume of reaction zone were continued at the next stage. Hydrogenation was performed in the pores of ceramic membranes with hydrogen preliminarily adsorbed in mono- and multilayered orientated carbon nanotubes with graphene walls (OCNTGs)a new hybrid carbon nanostructure formed on the inner pore surface. Quantitative determination of hydrogen adsorption in OCNTGs was performed using TRUMEM ultrafiltration membranes with D av = 50 and 90 nm and showed that hydrogen adsorption was up to 1.5% of the mass of OCNTG. The instrumentation and procedure for noncatalytic hydrogenation of decene-1 at 250-350C using hydrogen accumulated and stored in OCNTG were developed. The conversion of decene-1 into decane was 0.2-1.8% at hydrogenation temperatures of 250 and 350C, respectively. The rate constants and activation energy of hydrogenation were determined. The latter was found to be 94.5 kJ/mol, which is much smaller than the values typical for noncatalytic hydrogenations and very close to the values characteristic for catalytic reactions. The quantitative distribution of the reacting compounds in each pore regarded as a nanosized membrane reactor was determined. The activity of hydrogen adsorbed in a 2D carbon nanostructure was evaluated. Possible mechanisms of noncatalytic hydrogenation were discussed.

  14. Biochemical hydrogen isotope fractionation during biosynthesis in higher plants reflects carbon metabolism of the plant

    NASA Astrophysics Data System (ADS)

    Cormier, Marc-André; Kahmen, Ansgar

    2015-04-01

    Compound-specific isotope analyses of plant material are frequently applied to understand the response of plants to the environmental changes. As it is generally assume that the main factors controlling δ2H values in plants are the plant's source water and evaporative deuterium enrichment of leaf water, hydrogen isotope analyses of plant material are mainly applied regarding hydrological conditions at different time scales. However, only few studies have directly addressed the variability of the biochemical hydrogen isotope fractionation occurring during biosynthesis of organic compounds (ɛbio), accounting also for a large part in the δ2H values of plants but generally assumed to be constant. Here we present the results from a climate-controlled growth chambers experiment where tested the sensitivity of ɛbio to different light treatments. The different light treatments were applied to induce different metabolic status (autotrophic vs. heterotrophic) in 9 different plant species that we grew from large storage organs (e.g. tubers or roots). The results show a systematic ɛbio shift (up to 80 ) between the different light treatments for different compounds (i.e. long chain n-alkanes and cellulose). We suggest that this shift is due to the different NADPH pools used by the plants to build up the compounds from stored carbohydrates in heterotrophic or autotrophic conditions. Our results have important implications for the calibration and interpretation of sedimentary and tree rings records in geological studies. In addition, as the δ2H values reflect also strongly the carbon metabolism of the plant, our findings support the idea of δ2H values as an interesting proxy for plant physiological studies.

  15. Assessment of differences in the conformational flexibility of hepatitis B virus core-antigen and e-antigen by hydrogen deuterium exchange-mass spectrometry

    PubMed Central

    Bereszczak, Jessica Z; Watts, Norman R; Wingfield, Paul T; Steven, Alasdair C; Heck, Albert J R

    2014-01-01

    Hepatitis B virus core-antigen (capsid protein) and e-antigen (an immune regulator) have almost complete sequence identity, yet the dimeric proteins (termed Cp149d and Cp(?10)149d, respectively) adopt quite distinct quaternary structures. Here we use hydrogen deuterium exchange-mass spectrometry (HDX-MS) to study their structural properties. We detect many regions that differ substantially in their HDX dynamics. Significantly, whilst all regions in Cp(?10)149d exchange by EX2-type kinetics, a number of regions in Cp149d were shown to exhibit a mixture of EX2- and EX1-type kinetics, hinting at conformational heterogeneity in these regions. Comparison of the HDX of the free Cp149d with that in assembled capsids (Cp149c) indicated increased resistance to exchange at the C-terminus where the inter-dimer contacts occur. Furthermore, evidence of mixed exchange kinetics were not observed in Cp149c, implying a reduction in flexibility upon capsid formation. Cp(?10)149d undergoes a drastic structural change when the intermolecular disulphide bridge is reduced, adopting a Cp149d-like structure, as evidenced by the detected HDX dynamics being more consistent with Cp149d in many, albeit not all, regions. These results demonstrate the highly dynamic nature of these similar proteins. To probe the effect of these structural differences on the resulting antigenicity, we investigated binding of the antibody fragment (Fab E1) that is known to bind a conformational epitope on the four-helix bundle. Whilst Fab E1 binds to Cp149c and Cp149d, it does not bind non-reduced and reduced Cp(?10)149d, despite unhindered access to the epitope. These results imply a remarkable sensitivity of this epitope to its structural context. PMID:24715628

  16. Effect of Fc-Glycan Structure on the Conformational Stability of IgG Revealed by Hydrogen/Deuterium Exchange and Limited Proteolysis.

    PubMed

    Fang, Jing; Richardson, Jason; Du, Zhimei; Zhang, Zhongqi

    2016-02-16

    Human therapeutic immunoglobulin gamma (IgG) molecules contain an N-glycan on each of their Fc CH2 domains. These glycans include high-mannose, hybrid, and complex types. Recombinant IgG molecules containing high-mannose glycans have been shown to clear faster in human blood, and exhibit decreased thermal stability. The molecular mechanism behind these observations, however, is not well understood. In this work, we used hydrogen/deuterium exchange combined with mass spectrometry (HDX MS), as well as proteolytic degradation under a native-like condition, to assess the impact of different glycoforms on the molecular structure and stability of recombinant IgG1 and IgG2 molecules expressed from Chinese hamster ovary cells. Our HDX MS data indicate that the conformation of these IgG molecules was indeed influenced by the glycan structure. IgG molecules containing high-mannose and hybrid glycans showed more conformational flexibility in the CH2 domain. This conclusion was further supported by the analysis of glycopeptides released from these molecules by trypsin digestion under a native-like condition. The higher CH2 conformational flexibility of IgG molecules with high-mannose and hybrid glycans contributes to their decreased thermal stability. IgG molecules containing sialylated glycans in the CH2 domain exhibited similar enzymatic degradation behavior as high-mannose glycans, suggesting decreased CH2-domain stability compared to shorter complex glycans, likely resulting from steric effect that decreased the glycan-CH2 domain interaction. PMID:26812426

  17. Hydrogen/Deuterium Exchange Mass Spectrometry and Site-Directed Disulfide Cross-Linking Suggest an Important Dynamic Interface between the Two Lysostaphin Domains

    PubMed Central

    Lu, Hai-Rong; Gu, Mei-Gang; Huang, Qiang; Huang, Jin-Jiang; Lu, Wan-Ying; Lu, Hong

    2013-01-01

    Lysostaphin is a peptidoglycan hydrolase secreted by Staphylococcus simulans. It can specifically lyse Staphylococcus aureus and is being tested as a novel antibacterial agent. The protein contains an N-terminal catalytic domain and a C-terminal cell wall targeting domain. Although the two domains from homologous enzymes were structurally determined, the structural organization of lysostaphin domains remains unknown. We used hydrogen/deuterium exchange mass spectrometry (H/DX-MS) and site-directed disulfide cross-linking to probe the interface between the lysostaphin catalytic and targeting domains. H/DX-MS-mediated comparison of peptides from full-length lysostaphin and the separated domains identified four peptides of lower solvent accessibility in the full-length protein. Cross-linking analysis using cysteine pair substitutions within those peptides showed that two pairs of cysteines can form disulfide bonds, supporting the domain association role of the targeted peptides. The cross-linked mutant exhibited a binding capacity to S. aureus that was similar to that of the wild-type protein but reduced bacteriolytic activity probably because of restraint in conformation. The diminished activity was further reduced with increasing NaCl concentrations that can cause contractions of bacterial peptidoglycan. The lytic activity, however, could be fully recovered by reducing the disulfide bonds. These results suggest that lysostaphin may require dynamic association of the two domains for coordinating substrate binding and target cleavage on the elastic peptidoglycan. Our study will help develop site-specific PEGylated lysostaphin to treat systemic S. aureus infections. PMID:23380729

  18. Structural basis of specific interactions of Lp-PLA2 with HDL revealed by hydrogen deuterium exchange mass spectrometry[S

    PubMed Central

    Cao, Jian; Hsu, Yuan-Hao; Li, Sheng; Woods, Virgil L.; Dennis, Edward A.

    2013-01-01

    Lipoprotein-associated phospholipase A2 (Lp-PLA2), specifically Group VIIA PLA2, is a member of the phospholipase A2 superfamily and is found mainly associated with LDL and HDL in human plasma. Lp-PLA2 is considered as a risk factor, a potential biomarker, a target for therapy in the treatment of cardiovascular disease, and evidence suggests that the level of Lp-PLA2 in plasma is associated with the risk of future cardiovascular and stroke events. The differential location of the enzyme in LDL/HDL lipoproteins has been suggested to affect Lp-PLA2 function and/or its physiological role and an abnormal distribution of the enzyme may correlate with diseases. Although a mutagenesis study suggested that a surface helix (residues 362369) mediates the association between Lp-PLA2 and HDL, the molecular details and mechanism of association has remained unknown. We have now employed hydrogen deuterium exchange mass spectrometry to characterize the interaction between recombinant human Lp-PLA2 and human HDL. We have found that specific residues 113120, 192204, and 360368 likely mediate HDL binding. In a previous study, we showed that residues 113120 are important for Lp-PLA2-liposome interactions. We now find that residues 192204 show a decreased deuteration level when Lp-PLA2 is exposed to apoA-I, but not apoA-II, the most abundant apoproteins in HDL, and additionally, residues 360368 are only affected by HDL.The results suggest that apoA-I and phospholipid membranes play crucial roles in Lp-PLA2 localization to HDL. PMID:23089916

  19. Water electrolysis with a conducting carbon cloth: subthreshold hydrogen generation and superthreshold carbon quantum dot formation.

    PubMed

    Biswal, Mandakini; Deshpande, Aparna; Kelkar, Sarika; Ogale, Satishchandra

    2014-03-01

    A conducting carbon cloth, which has an interesting turbostratic microstructure and functional groups that are distinctly different from other ordered forms of carbon, such as graphite, graphene, and carbon nanotubes, was synthesized by a simple one-step pyrolysis of cellulose fabric. This turbostratic disorder and surface chemical functionalities had interesting consequences for water splitting and hydrogen generation when such a cloth was used as an electrode in the alkaline electrolysis process. Importantly, this work also gives a new twist to carbon-assisted electrolysis. During electrolysis, the active sites in the carbon cloth allow slow oxidation of its surface to transform the surface groups from C?OH to COOH and so forth at a voltage as low as 0.2?V in a two-electrode system, along with platinum as the cathode, instead of 1.23?V (plus overpotential), which is required for platinum, steel, or even graphite anodes. The quantity of subthreshold hydrogen evolved was 24?mL?cm(-2) ?h(-1) at 1?V. Interestingly, at a superthreshold potential (>1.23?V+overpotential), another remarkable phenomenon was found. At such voltages, along with the high rate and quantity of hydrogen evolution, rapid exfoliation of the tiny nanoscale (5-7?nm) units of carbon quantum dots (CQDs) are found in copious amounts due to an enhanced oxidation rate. These CQDs show bright-blue fluorescence under UV light. PMID:24492961

  20. Hydrogen storage and delivery: the carbon dioxide - formic acid couple.

    PubMed

    Laurenczy, Gábor

    2011-01-01

    Carbon dioxide and the carbonates, the available natural C1 sources, can be easily hydrogenated into formic acid and formates in water; the rate of this reduction strongly depends on the pH of the solution. This reaction is catalysed by ruthenium(II) pre-catalyst complexes with a large variety of water-soluble phosphine ligands; high conversions and turnover numbers have been realised. Although ruthenium(II) is predominant in these reactions, the iron(II) - tris[(2-diphenylphosphino)-ethyl]phosphine (PP3) complex is also active, showing a new perspective to use abundant and inexpensive iron-based compounds in the CO2 reduction. In the catalytic hydrogenation cycles the in situ formed metal hydride complexes play a key role, their structures with several other intermediates have been proven by multinuclear NMR spectroscopy. In the other hand safe and convenient hydrogen storage and supply is the fundamental question for the further development of the hydrogen economy; and carbon dioxide has been recognised to be a viable H2 vector. Formic acid--containing 4.4 weight % of H2, that is 53 g hydrogen per litre--is suitable for H2 storage; we have shown that in aqueous solutions it can be selectively decomposed into CO-free (CO < 10 ppm) CO2 and H2. The reaction takes place under mild experimental conditions and it is able to generate high pressure H2 (up to 600 bar). The cleavage of HCOOH is catalysed by several hydrophilic Ru(II) phosphine complexes (meta-trisulfonated triphenylphosphine, mTPPTS, being the most efficient one), either in homogeneous systems or as immobilised catalysts. We have also shown that the iron(II)--hydrido tris[(2-diphenylphosphino)ethyl]phosphine complex catalyses with an exceptionally high rate and efficiency (turnover frequency, TOF = 9425 h(-1)mol(-1); turnover number, TON = 92400) the formic acid cleavage, in environmentally friendly propylene carbonate solution, opening the way to use cheap, non-noble metal based catalysts for this reaction, too. PMID:22026175

  1. Dimerization of the type IV pilin from Pseudomonas aeruginosa strain K122-4 results in increased helix stability as measured by time-resolved hydrogen-deuterium exchange

    PubMed Central

    Lento, Cristina; Wilson, Derek J.; Audette, Gerald F.

    2015-01-01

    Truncated pilin monomers from Pseudomonas aeruginosa strain K122-4 (ΔK122) have been shown to enter a monomer-dimer equilibrium in solution prior to oligomerization into protein nanotubes. Here, we examine the structural changes occurring between the monomeric and dimeric states of ΔK122 using time-resolved hydrogen-deuterium exchange mass spectrometry. Based on levels of deuterium uptake, the N-terminal α-helix and the loop connecting the second and third strands of the anti-parallel β-sheet contribute significantly to pilin dimerization. Conversely, the antiparallel β-sheet and αβ loop region exhibit increased flexibility, while the receptor binding domain retains a rigid conformation in the equilibrium state. PMID:26798830

  2. Secondary deuterium kinetic isotope effects in irreversible additions of hydride and carbon nucleophiles to aldehydes: A spectrum of transition states from complete bond formation to single electron transfer

    SciTech Connect

    Gajewski, J.J.; Bocian, W.; Harris, N.J.; Olson, L.P.; Gajewski, J.P.

    1999-01-20

    The competitive kinetics of hydride and organometallic additions to benzaldehyde-H and -D were determined at {minus}78 C using LiAlH{sub 4}, LiBEt{sub 3}H, NaBH{sub 4}, LiBH{sub 4}, LiAl(O-tert-butoxy){sub 3}H, NaB(OMe){sub 3}H, NaB-(Ac){sub 3}H (at 20 C) methyl, phenyl, and allyl Grignard, and methyl-, phenyl-, n-butyl-, tert-butyl-, and allyllithium. The additions of hydride were found to have an inverse secondary deuterium kinetic isotope effects in all cases, but the magnitude of the effect varied inversely with the apparent reactivity of the hydride. In the additions of methyl Grignard reagent and of methyllithium and phenyllithium, inverse secondary deuterium isotope effects were observed; little if any isotope effect was observed with phenyl Grignard or n-butyl- and tert-butyllithium. With allyl Grignard and allyllithium, a normal secondary deuterium kinetic isotope effect was observed. The results indicate that rate-determining single-electron transfer occurs with allyl reagents, but direct nucleophilic reaction occurs with all of the other reagents, with the extent of bond formation dependent on the reactivity of the reagent. In the addition of methyllithium to cyclohexanecarboxyaldehyde, a less inverse secondary deuterium kinetic isotope effect was observed than that observed in the addition of methyllithium to benzaldehyde, and allyllithium addition to cyclohexanecarboxaldehyde had a kinetic isotope effect near unity. The data with organometallic additions, which are not incompatible with observations of carbonyl carbon isotope effects, suggest that electrochemically determined redox potentials which indicate endoergonic electron transfer with energies less than ca. 13 kcal/mol allow electron-transfer mechanisms to compete well with direct polar additions to aldehydes, provided that the reagent is highly stabilized, like allyl species. Methyllithium and phenyllithium and methyl and phenyl Grignard reagents are estimated to undergo electron transfer with endoergonicities greater than 30 kcal/mol with benzaldehyde, so these react by direct polar additions. A working hypothesis is that butyllithium reagents undergo polar additions, despite redox potentials which indicate less than 13 kcal/mol endoergonic electron transfer, because of the great exoergonicity associated with the two-electron addition, which is responsible for a low barrier for polar reactions.

  3. Facile synthesis of hydrogenated carbon nanospheres with a graphite-like ordered carbon structure.

    PubMed

    Xiao, Junping; Yao, Mingguang; Zhu, Kai; Zhang, Dong; Zhao, Shijia; Lu, Shuangchen; Liu, Bo; Cui, Wen; Liu, Bingbing

    2013-11-21

    We report a synthesis of hydrogenated carbon nanospheres (HCNSs) via a facile solvothermal route at low temperatures (60-100 C), using CHCl3 as the carbon source and potassium (K) as the reductant. Selective cleavage of the relatively lower stable C-Cl bonds (compared to C-H bonds) of the carbon precursor (CHCl3) by K metal results in the growth of HCNSs. The diameter of HCNSs ranges from 40 to 90 nm. The HCNSs have a graphite-like ordered carbon structure in spite of their high degree of hydrogenation. The HCNSs exhibit an average Brunauer-Emmett-Teller (BET) surface area of 43 m(2) g(-1), containing a small amount of mesopores and macropores in the structure. The nanospheres' sample as an anode material for lithium ion batteries (LIBs) has been studied. It exhibits a high discharge capacity (3539 mA h g(-1) in the first cycle, 978 mA h g(-1) after 50 cycles) and good cycling stability, demonstrating advantages as a promising candidate for anode materials in LIBs. The high capacity of the HCNSs is due to their unique nanostructures and high percentage hydrogenation, as well as hydrogenation induced structural defects. PMID:24096808

  4. Gas phase hydrogen permeation in alpha titanium and carbon steels

    NASA Technical Reports Server (NTRS)

    Johnson, D. L.; Shah, K. K.; Reeves, B. H.; Gadgeel, V. L.

    1980-01-01

    Commercially pure titanium and heats of Armco ingot iron and steels containing from 0.008-1.23 w/oC were annealed or normalized and machined into hollow cylinders. Coefficients of diffusion for alpha-Ti and alpha-Fe were determined by the lag-time technique. Steady state permeation experiments yield first power pressure dependence for alpha-Ti and Sievert's law square root dependence for Armco iron and carbon steels. As in the case of diffusion, permeation data confirm that alpha-titanium is subject to at least partial phase boundary reaction control while the steels are purely diffusion controlled. The permeation rate in steels also decreases as the carbon content increases. As a consequence of Sievert's law, the computed hydrogen solubility decreases as the carbon content increases. This decreases in explained in terms of hydrogen trapping at carbide interfaces. Oxidizing and nitriding the surfaces of alpha-titanium membranes result in a decrease in the permeation rate for such treatment on the gas inlet surfaces but resulted in a slight increase in the rate for such treatment on the gas outlet surfaces. This is explained in terms of a discontinuous TiH2 layer.

  5. Deuterium trapping in deep traps of differently oriented pyrolytic graphite exposed to D 2 gas at 1473 K

    NASA Astrophysics Data System (ADS)

    Chernikov, V. N.; Wampler, W. R.; Zakharov, A. P.; Gorodetsky, A. E.

    1999-01-01

    Due to their importance for tritium inventories in future DT fueled fusion machines, experimental data on H isotope diffusion, absorption and retention in deep traps ( Eb ? 4.3 eV) of graphites exposed to hydrogen at elevated temperatures have been reviewed. Deuterium retention was studied in edge- and basal-oriented pyrolytic graphite (PG) and polycrystalline RG-Ti-91 damaged by irradiation with 200 keV carbon ions. Deuterium loading was done by soaking in D 2 gas at 1473 K, and the resulting D retention was measured by nuclear reaction analysis. The microstructure was studied by cross-sectional TEM, SEM and microprofilometry. The concentration of strong traps created by irradiation and estimated by the amount of accumulated deuterium was shown to saturate with the damage above ?1 dpa at about 1000 appm. In non-damaged and damaged graphites deuterium diffuses via porous grain boundaries and along basal planes within crystallites, while its migration through the graphite lattice along the c direction was found to be negligible. Radiation modifications of PG retard deuterium diffusion and decrease the rate of its chemical erosion by a factor of five. The amount of deuterium accumulated in strong traps in graphites is mainly influenced by their macro- and microstructure, while the degree of graphitization seems to be less important. Derivations are made of the susceptibility of damaged graphites, in particular, CFCs to the retention of hydrogen isotopes in deep traps.

  6. Polarizability calculations on water, hydrogen, oxygen, and carbon dioxide

    NASA Technical Reports Server (NTRS)

    Nir, S.; Adams, S.; Rein, R.

    1973-01-01

    A semiclassical model of damped oscillators is used as a basis for the calculation of the dispersion of the refractive index, polarizability, and dielectric permeability in water, hydrogen, and oxygen in liquid and gaseous states, and in gaseous carbon dioxide. The absorption coefficient and the imaginary part of the refractive index are also calculated at corresponding wavelengths. A good agreement is obtained between the observed and calculated values of refractive indices, and between those of absorption coefficients in the region of absorption bands. The calculated values of oscillator strengths and damping factors are also discussed. The value of the polarizability of liquid water was about 2.8 times that of previous calculations.

  7. Single Membrane Reactor Configuration for Separation of Hydrogen, Carbon Dioxide and Hydrogen Sulfide

    SciTech Connect

    Micheal Roberts; Robert Zabransky; Shain Doong; Jerry Lin

    2008-05-31

    The objective of the project was to develop a novel complementary membrane reactor process that can consolidate two or more downstream unit operations of a coal gasification system into a single module for production of a pure stream of hydrogen and a pure stream of carbon dioxide. The overall goals were to achieve higher hydrogen production efficiencies, lower capital costs and a smaller overall footprint than what could be achieved by utilizing separate components for each required unit process/operation in conventional coal-to-hydrogen systems. Specifically, this project was to develop a novel membrane reactor process that combines hydrogen sulfide removal, hydrogen separation, carbon dioxide separation and water-gas shift reaction into a single membrane configuration. The carbon monoxide conversion of the water-gas-shift reaction from the coal-derived syngas stream is enhanced by the complementary use of two membranes within a single reactor to separate hydrogen and carbon dioxide. Consequently, hydrogen production efficiency is increased. The single membrane reactor configuration produces a pure H{sub 2} product and a pure CO{sub 2} permeate stream that is ready for sequestration. This project focused on developing a new class of CO{sub 2}-selective membranes for this new process concept. Several approaches to make CO{sub 2}-selective membranes for high-temperature applications have been tested. Membrane disks using the technique of powder pressing and high temperature sintering were successfully fabricated. The powders were either metal oxide or metal carbonate materials. Experiments on CO{sub 2} permeation testing were also performed in the temperature range of 790 to 940 C for the metal carbonate membrane disks. However, no CO{sub 2} permeation rate could be measured, probably due to very slow CO{sub 2} diffusion in the solid state carbonates. To improve the permeation of CO{sub 2}, one approach is to make membranes containing liquid or molten carbonates. Several different types of dual-phase membranes were fabricated and tested for their CO{sub 2} permeation in reducing conditions without the presence of oxygen. Although the flux was quite low, on the order of 0.01-0.001 cc STP/cm{sup 2}/min, the selectivity of CO{sub 2}/He was almost infinite at temperatures of about 800 C. A different type of dual-phase membrane prepared by Arizona State University (ASU) was also tested at GTI for CO{sub 2} permeation. The measured CO{sub 2} fluxes were 0.015 and 0.02 cc STP/cm{sup 2}/min at 750 and 830 C, respectively. These fluxes were higher than the previous flux obtained ({approx}0.01 cc STP/cm{sup 2}/min) using the dual-phase membranes prepared by GTI. Further development in membrane development should be conducted to improve the CO{sub 2} flux. ASU has also focused on high temperature permeation/separation experiments to confirm the carbon dioxide separation capabilities of the dual-phase membranes with La{sup 0.6}Sr{sub 0.4}Co{sub 0.8}Fe{sub 0.2}O{sub 3-{delta}} (LSCF6482) supports infiltrated with a Li/Na/K molten carbonate mixture (42.5/32.5/25.0 mole %). The permeation experiments indicated that the addition of O{sub 2} does improve the permeance of CO{sub 2} through the membrane. A simplified membrane reactor model was developed to evaluate the performance of the process. However, the simplified model did not allow the estimation of membrane transport area, an important parameter for evaluating the feasibility of the proposed membrane reactor technology. As a result, an improved model was developed. Results of the improved membrane reactor model show that the membrane shift reaction has promise as a means to simplify the production of a clean stream of hydrogen and a clean stream of carbon dioxide. The focus of additional development work should address the large area required for the CO{sub 2} membrane as identified in the modeling calculations. Also, a more detailed process flow diagram should be developed that includes integration of cooling and preheating feed streams as well as particulate removal so that steam and power generation could be optimized. For the tubular membranes that were fabricated by solution impregnation with metal carbonates, difficulties were encountered in removing the impurity salts that were trapped inside the porous support tube. The membrane tube would continue losing weight even after being heated up to 500 C in air and could not maintain its nonporous characteristics. This approach was therefore abandoned. Dual-phase membranes with molten carbonates were subsequently shown to have CO{sub 2} permeability in reducing conditions without the presence of oxygen; they were also tested for H{sub 2}S permeation. Permeation tests were conducted with a gas feed composition consisting of 33.6% CO{sub 2}, 8.4% He, 57.6% H{sub 2} and 0.4% H{sub 2}S at temperatures between 820 and 850 C and a pressure of 1 bar.

  8. Microwave attenuation of hydrogen plasma in carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Babaei, S.; Solari, M. Sh.

    2008-12-01

    The attenuation (ATT) of hydrogen plasma in carbon nanotubes, grown by iron-catalyzed high-pressure carbon monoxide disproportionate process, is investigated. The effects of the incident wave, the electron density, the collision frequency, the thermal frequency, and the cyclotron frequency on the ATT of the microwave are discussed. Moreover, the impacts of thermal frequency and cyclotron frequency on the ATT are investigated separately. Numerical results indicate that position of the ATT peak and the ATT level depend on the incident frequency, the electron density, the collision frequency, the thermal frequency, and the cyclotron frequency. The results show that the cyclotron frequency highly influences the ATT level. In contrast, the shift frequency is more affected by the thermal frequency. The ATT is more sensitive at the middle band of incident frequency.

  9. Deuterium enrichment by selective photo-induced dissociation of an organic carbonyl compound

    DOEpatents

    Marling, John B. (Livermore, CA)

    1981-01-01

    A method for producing a deuterium enriched material by photoinduced dissociation which uses as the working material a gas phase photolytically dissociable organic carbonyl compound containing at least one hydrogen atom bonded to an atom which is adjacent to a carbonyl group and consisting of molecules wherein said hydrogen atom is present as deuterium and molecules wherein said hydrogen atom is present as another isotope of hydrogen. The organic carbonyl compound is subjected to intense infrared radiation at a preselected wavelength to selectively excite and thereby induce dissociation of the deuterium containing species to yield a deuterium enriched stable molecular product. Undissociated carbonyl compound, depleted in deuterium, is preferably redeuterated for reuse.

  10. Membrane-based systems for carbon capture and hydrogen purification

    SciTech Connect

    Berchtold, Kathryn A

    2010-11-24

    This presentation describes the activities being conducted at Los Alamos National Laboratory to develop carbon capture technologies for power systems. This work is aimed at continued development and demonstration of a membrane based pre- and post-combustion carbon capture technology and separation schemes. Our primary work entails the development and demonstration of an innovative membrane technology for pre-combustion capture of carbon dioxide that operates over a broad range of conditions relevant to the power industry while meeting the US DOE's Carbon Sequestration Program goals of 90% CO{sub 2} capture at less than a 10% increase in the cost of energy services. Separating and capturing carbon dioxide from mixed gas streams is a first and critical step in carbon sequestration. To be technically and economically viable, a successful separation method must be applicable to industrially relevant gas streams at realistic temperatures and pressures as well as be compatible with large gas volumes. Our project team is developing polymer membranes based on polybenzimidazole (PBI) chemistries that can purify hydrogen and capture CO{sub 2} at industrially relevant temperatures. Our primary objectives are to develop and demonstrate polymer-based membrane chemistries, structures, deployment platforms, and sealing technologies that achieve the critical combination of high selectivity, high permeability, chemical stability, and mechanical stability all at elevated temperatures (> 150 C) and packaged in a scalable, economically viable, high area density system amenable to incorporation into an advanced Integrated Gasification Combined-Cycle (IGCC) plant for pre-combustion CO{sub 2} capture. Stability requirements are focused on tolerance to the primary synthesis gas components and impurities at various locations in the IGCC process. Since the process stream compositions and conditions (temperature and pressure) vary throughout the IGCC process, the project is focused on the optimization of a technology that could be positioned upstream or downstream of one or more of the water-gas-shift reactors (WGSRs) or integrated with a WGSR.

  11. Combustion characteristics of hydrogen. Carbon monoxide based gaseous fuels

    NASA Technical Reports Server (NTRS)

    Notardonato, J. J.; White, D. J.; Kubasco, A. J.; Lecren, R. T.

    1981-01-01

    An experimental rig program was conducted with the objective of evaluating the combuston performance of a family of fuel gases based on a mixture of hydrogen and carbon monoxide. These gases, in addition to being members of a family, were also representative of those secondary fuels that could be produced from coal by various gasification schemes. In particular, simulated Winkler, Lurgi, and Blue-water low and medium energy content gases were used as fuels in the experimental combustor rig. The combustor used was originally designed as a low NOx rich-lean system for burning liquid fuels with high bound nitrogen levels. When used with the above gaseous fuels this combustor was operated in a lean-lean mode with ultra long residence times. The Blue-water gas was also operated in a rich-lean mode. The results of these tests indicate the possibility of the existence of an 'optimum' gas turbine hydrogen - carbon monoxide based secondary fuel. Such a fuel would exhibit NOx and high efficiency over the entire engine operating range. It would also have sufficient stability range to allow normal light-off and engine acceleration. Solar Turbines Incorporated would like to emphasize that the results presented here have been obtained with experimental rig combustors. The technologies generated could, however, be utilized in future commercial gas turbines.

  12. Isotopic exchange of carbon-bound hydrogen over geologic timescales

    NASA Astrophysics Data System (ADS)

    Sessions, Alex L.; Sylva, Sean P.; Summons, Roger E.; Hayes, John M.

    2004-04-01

    The increasing popularity of compound-specific hydrogen isotope (D/H) analyses for investigating sedimentary organic matter raises numerous questions about the exchange of carbon-bound hydrogen over geologic timescales. Important questions include the rates of isotopic exchange, methods for diagnosing exchange in ancient samples, and the isotopic consequences of that exchange. This article provides a review of relevant literature data along with new data from several pilot studies to investigate such issues. Published experimental estimates of exchange rates between organic hydrogen and water indicate that at warm temperatures (50-100C) exchange likely occurs on timescales of 10 4 to 10 8 yr. Incubation experiments using organic compounds and D-enriched water, combined with compound-specific D/H analyses, provide a new and highly sensitive method for measuring exchange at low temperatures. Comparison of ?D values for isoprenoid and n-alkyl carbon skeletons in sedimentary organic matter provides no evidence for exchange in young (<1 Ma), cool sediments, but strong evidence for exchange in ancient (>350 Ma) rocks. Specific rates of exchange are probably influenced by the nature and abundance of organic matter, pore-water chemistry, the presence of catalytic mineral surfaces, and perhaps even enzymatic activity. Estimates of equilibrium fractionation factors between organic H and water indicate that typical lipids will be depleted in D relative to water by 75 to 140 at equilibrium (30C). Thus large differences in ?D between organic molecules and water cannot be unambiguously interpreted as evidence against hydrogen exchange. A better approach may be to use changes in stereochemistry as a proxy for hydrogen exchange. For example, estimated rates of H exchange in pristane are similar to predicted rates for stereochemical inversion in steranes and hopanes. The isotopic consequences of this exchange remain in question. Incubations of cholestene with D 2O indicate that the number of D atoms incorporated during structural rearrangements can be far less than the number of C-H bonds that are broken. Sample calculations indicate that, for steranes in immature sediments, the D/H ratio imparted by biosynthesis may be largely preserved in spite of significant structural changes.

  13. Magnetic Carbon Supported Palladium Nanoparticles: An Efficient and Sustainable Catalyst for Hydrogenation Reactions

    EPA Science Inventory

    Magnetic carbon supported Pd catalyst has been synthesized via in situ generation of nanoferrites and incorporation of carbon from renewable cellulose via calcination; the catalyst can be used for the hydrogenation of alkenes and reduction of aryl nitro compounds.

  14. Performance of carbon-based hot frit substrates: I, Low pressure helium and hydrogen testing

    SciTech Connect

    Barletta, R.; Adams, J.; Svandrlik, J.; Powell, J.R.

    1993-07-01

    The performance of various carbon-based materials in flowing, high-temperature helium and hydrogen is described. These materials which are candidate hot frit substrates for possible application in a PBR include various grades of graphite, carbon-carbon and vitreous carbon. Vitreous carbon showed extremely good performance in helium, while that of the various graphite grades was quite variable and, in some cases, poor. Purified grades performed better than unpurified grades, but in all cases large sample-to-sample variations in weight loss were observed. For carbon-carbon samples, the performance was intermediate. Since the weight loss in these samples was in large measure due to the loss of the densification media, improvements in the performance of carbon-carbon may be possible. With respect to the performance in hydrogen, high weight losses were observed, re-enforcing the need for coating carbon-based materials for service in a flowing hydrogen environment.

  15. Interaction between adsorbed hydrogen and potassium on a carbon nanocone containing material as studied by photoemission

    NASA Astrophysics Data System (ADS)

    Yu, Xiaofeng; Raaen, Steinar

    2015-09-01

    Hydrogen adsorption on a potassium doped carbon nanocone containing material was studied by photoelectron spectroscopy and work function measurement. The valence band spectra indicate that there is charge transfer from potassium to carbon. Upon deposition on carbon potassium is in its ionic state for lower doping and shows both ionic and metallic behavior at higher doping. Adsorption of hydrogen facilitates diffusion of potassium on the carbon material as seen by changes in the K2p core level spectrum. Variations in the measured sample work function indicate that hydrogen initially adsorb on the K dopants and subsequently adsorb on the carbon cone containing material.

  16. Trapping state of hydrogen isotopes in carbon and graphite investigated by thermal desorption spectrometry

    SciTech Connect

    Atsumi, H.; Tanabe, T.; Shikama, T.

    2015-03-15

    Thermal desorption spectrometry (TDS) has been investigated to obtain fundamental information of tritium behavior in graphite and carbon materials especially at high temperatures. 29 brands of graphite, HOPG, glassy carbon and CFC materials charged with deuterium gas are tested up to the temperature of 1735 K with a heating rate of 0.1 K/s. TDS spectra have five peaks at 600-700 K, around 900 K, 1200 K, 1300-1450 K and 1600-1650 K. The amounts of released deuterium have been compared with crystallographic parameters derived from XRD analysis. The results can be summarized as follows. First, TDS spectra of deuterium were quite varied among the samples tested, such as existence of peaks, peak temperatures and release amounts of deuterium. Secondly, TDS spectra may consist of five peaks, which are peak 1 (600-700 K), peak 2 (around 900 K), peak 3 (around 1200 K), peak 4 (1300-1450 K) and peak 5 (1600-1650 K). Thirdly, the correlations between the estimated surface area of edge surface and the total amount of released deuterium could be observed for peaks 4 and 5. Fourthly, high energy trapping site (peak 5) may exist even at edge surface or a near surface region, not only for intercalary. And fifth, in order to obtain the lower tritium retention for graphite and CFC materials, the material should be composed of a filler grain with a smaller crystallite size or having the smaller net edge surface in its structure. It is shown that heat treatment does not reduce originally existing trapping sites but trapping sites generated by neutron irradiation for instance can be reduced in some degree.

  17. Hypothetical high-surface-area carbons with exceptional hydrogen storage capacities: open carbon frameworks.

    PubMed

    Kuchta, Bogdan; Firlej, Lucyna; Mohammadhosseini, Ali; Boulet, Pascal; Beckner, Matthew; Romanos, Jimmy; Pfeifer, Peter

    2012-09-12

    A class of high-surface-area carbon hypothetical structures has been investigated that goes beyond the traditional model of parallel graphene sheets hosting layers of physisorbed hydrogen in slit-shaped pores of variable width. The investigation focuses on structures with locally planar units (unbounded or bounded fragments of graphene sheets), and variable ratios of in-plane to edge atoms. Adsorption of molecular hydrogen on these structures was studied by performing grand canonical Monte Carlo simulations with appropriately chosen adsorbent-adsorbate interaction potentials. The interaction models were tested by comparing simulated adsorption isotherms with experimental isotherms on a high-performance activated carbon with well-defined pore structure (approximately bimodal pore-size distribution), and remarkable agreement between computed and experimental isotherms was obtained, both for gravimetric excess adsorption and for gravimetric storage capacity. From this analysis and the simulations performed on the new structures, a rich spectrum of relationships between structural characteristics of carbons and ensuing hydrogen adsorption (structure-function relationships) emerges: (i) Storage capacities higher than in slit-shaped pores can be obtained by fragmentation/truncation of graphene sheets, which creates surface areas exceeding of 2600 m(2)/g, the maximum surface area for infinite graphene sheets, carried mainly by edge sites; we call the resulting structures open carbon frameworks (OCF). (ii) For OCFs with a ratio of in-plane to edge sites ?1 and surface areas 3800-6500 m(2)/g, we found record maximum excess adsorption of 75-85 g of H(2)/kg of C at 77 K and record storage capacity of 100-260 g of H(2)/kg of C at 77 K and 100 bar. (iii) The adsorption in structures having large specific surface area built from small polycyclic aromatic hydrocarbons cannot be further increased because their energy of adsorption is low. (iv) Additional increase of hydrogen uptake could potentially be achieved by chemical substitution and/or intercalation of OCF structures, in order to increase the energy of adsorption. We conclude that OCF structures, if synthesized, will give hydrogen uptake at the level required for mobile applications. The conclusions define the physical limits of hydrogen adsorption in carbon-based porous structures. PMID:22897685

  18. Hydrogen Adsorption on Activated Carbon an Carbon Nanotubes Using Volumetric Differential Pressure Technique

    SciTech Connect

    Sanip, S. M.; Saidin, M. A. R.; Aziz, M.; Ismail, A. F.

    2010-03-11

    A simple hydrogen adsorption measurement system utilizing the volumetric differential pressure technique has been designed, fabricated and calibrated. Hydrogen adsorption measurements have been carried out at temperatures 298 K and 77 K on activate carbon and carbon nanotubes with different surface areas. The adsorption data obtained will be helpful in understanding the adsorption property of the studied carbon materials using the fundamentals of adsorption theory. The principle of the system follows the Sievert-type method. The system measures a change in pressure between the reference cell, R1 and the sample cell S1, S2, S3 over a certain temperature range, R1, S1, S2, and S3 having known fixed volume. The sample temperatures will be monitored by thermocouple TC while the pressures in R1 an S1, S2, S3 will be measured using a digital pressure transducer. The maximum operating pressure of the pressure transducer is 20 bar and calibrated with an accuracy of +-0.01 bar. High purity hydrogen is being used in the system and the amount of samples for the study is between 1.0-2.0 grams. The system was calibrated using helium gas without any samples in S1, S2 an S3. This will provide a correction factor during the adsorption process providing an adsorption free reference point when using hydrogen gas resulting in a more accurate reading of the adsorption process by eliminating the errors caused by temperature expansion effects and other non-adsorption related phenomena. The ideal gas equation of state is applied to calculate the hydrogen adsorption capacity based on the differential pressure measurements. Activated carbon with a surface area of 644.87 m{sup 2}/g showed a larger amount of adsorption as compared to multiwalled nanotubes (commercial) with a surface area of 119.68 m{sup 2}/g. This study als indicated that there is a direct correlation between the amounts of hydrogen adsorbed an surface area of the carbon materials under the conditions studied and that the adsorption significant at 77 K.

  19. Thermocatalytic process for CO.sub.2-free production of hydrogen and carbon from hydrocarbons

    DOEpatents

    Muradov, Nazim Z.

    2011-08-23

    A novel process and apparatus are disclosed for sustainable CO.sub.2-free production of hydrogen and carbon by thermocatalytic decomposition (dissociation, pyrolysis, cracking) of hydrocarbon fuels over carbon-based catalysts in the absence of air and/or water. The apparatus and thermocatalytic process improve the activity and stability of carbon catalysts during the thermocatalytic process and produce both high purity hydrogen (at least, 99.0 volume %) and carbon, from any hydrocarbon fuel, including sulfurous fuels. In a preferred embodiment, production of hydrogen and carbon is achieved by both internal and external activation of carbon catalysts. Internal activation of carbon catalyst is accomplished by recycling of hydrogen-depleted gas containing unsaturated and aromatic hydrocarbons back to the reactor. External activation of the catalyst can be achieved via surface gasification with hot combustion gases during catalyst heating. The process and apparatus can be conveniently integrated with any type of fuel cell to generate electricity.

  20. Deep inelastic structure functions from electron scattering on hydrogen, deuterium, and iron at 0. 6 GeV sup 2 le Q sup 2 le 30. 0 GeV sup 2

    SciTech Connect

    Whitlow, L.W.

    1990-03-01

    We report the final results from experiment E140, a recent deep inelastic electron-deuterium and electron-iron scattering experiment at SLAC. In addition, we present the results of a combined global analysis of all SLAC deep inelastic electron-hydrogen and electron-deuterium cross section measurements between 1970 and 1983. Data from seven earlier experiments are re-radiatively corrected and normalized to experiment E140. We report extractions of R(x,Q{sup 2}) and F{sub 2}(x,Q{sup 2}) for hydrogen and deuterium over the entire SLAC kinematic range: .06{le} x {le}.90 and 0.6{le} Q{sup 2} {le}30.0 (GeV{sup 2}). We fine that R{sup p} = R{sup d}, as expected by QCD. Extracted values of R(x,Q{sup 2}) are significantly larger than predictions based on QCD and on QCD with the inclusion of kinematic target mass terms. This difference indicates that dynamical higher twist effects may be important in the SLAC kinematic range. A best fit empirical model of R(x,Q{sup 2}) is used to extract F{sub 2} from each cross section measurement. These F{sub 2} extractions are compared with F{sub 2} data from EMC and BCDMS. Agreement is observed with EMC when the EMC data are multiplied by 1.07. Agreement is observed with BCDMS over a limited range in x. The ratios of F{sub 2}{sup d}/F{sub 2}{sup p} are examined for Q{sup 2} dependence. We observe a significant negative slope for x {le} .6, and a significant positive slope above x > .7, in excellent agreement with predictions based on QCD with the inclusion of kinematic target mass terms. 111 refs., 40 figs., 34 tabs.

  1. Development of Affordable, Low-Carbon Hydrogen Supplies at an Industrial Scale

    ERIC Educational Resources Information Center

    Roddy, Dermot J.

    2008-01-01

    An existing industrial hydrogen generation and distribution infrastructure is described, and a number of large-scale investment projects are outlined. All of these projects have the potential to generate significant volumes of low-cost, low-carbon hydrogen. The technologies concerned range from gasification of coal with carbon capture and storage…

  2. Development of Affordable, Low-Carbon Hydrogen Supplies at an Industrial Scale

    ERIC Educational Resources Information Center

    Roddy, Dermot J.

    2008-01-01

    An existing industrial hydrogen generation and distribution infrastructure is described, and a number of large-scale investment projects are outlined. All of these projects have the potential to generate significant volumes of low-cost, low-carbon hydrogen. The technologies concerned range from gasification of coal with carbon capture and storage

  3. A STUDY TO EVALUATE CARBON MONOXIDE AND HYDROGEN SULFIDE CONTINUOUS EMISSION MONITORS AT AN OIL REFINERY

    EPA Science Inventory

    An eleven month field evaluation was done on five hydrogen sulfide and four carbon monoxide monitors located at an oil refinery. The hydrogen sulfide monitors sampled a fuel gas feed line and the carbon monoxide monitors sampled the emissions from a fluid cat cracker (FCC). Two o...

  4. Cometary deuterium.

    PubMed

    Meier, R; Owen, T C

    1999-01-01

    Deuterium fractionations in cometary ices provide important clues to the origin and evolution of comets. Mass spectrometers aboard spaceprobe Giotto revealed the first accurate D/H ratios in the water of Comet 1P/Halley. Ground-based observations of HDO in Comets C/1996 B2 (Hyakutake) and C/1995 O1 (Hale-Bopp), the detection of DCN in Comet Hale-Bopp, and upper limits for several other D-bearing molecules complement our limited sample of D/H measurements. On the basis of this data set all Oort cloud comets seem to exhibit a similar (D/H)H2O ratio in H2O, enriched by about a factor of two relative to terrestrial water and approximately one order of magnitude relative to the protosolar value. Oort cloud comets, and by inference also classical short-period comets derived from the Kuiper Belt cannot be the only source for the Earth's oceans. The cometary O/C ratio and dynamical reasons make it difficult to defend an early influx of icy planetesimals from the Jupiter zone to the early Earth. D/H measurements of OH groups in phyllosilicate rich meteorites suggest a mixture of cometary water and water adsorbed from the nebula by the rocky grains that formed the bulk of the Earth may be responsible for the terrestrial D/H. The D/H ratio in cometary HCN is 7 times higher than the value in cometary H2O. Species-dependent D-fractionations occur at low temperatures and low gas densities via ion-molecule or grain-surface reactions and cannot be explained by a pure solar nebula chemistry. It is plausible that cometary volatiles preserved the interstellar D fractionation. The observed D abundances set a lower limit to the formation temperature of (30 +/- 10) K. Similar numbers can he derived from the ortho-to-para ratio in cometary water, from the absence of neon in cometary ices and the presence of S2. Noble gases on Earth and Mars, and the relative abundance of cometary hydrocarbons place the comet formation temperature near 50 K. So far all cometary D/H measurements refer to bulk compositions, and it is conceivable that significant departures from the mean value could occur at the grain-size level. Strong isotope effects as a result of coma chemistry can be excluded for molecules H2O and HCN. A comparison of the cometary (D/H)H2O ratio with values found in the atmospheres of the outer planets is consistent with the long-held idea that the gas planets formed around icy cores with a high cometary D/H ratio and subsequently accumulated significant amounts of H2 from the solar nebula with a low protosolar D/H. PMID:11543290

  5. Production of carbon monoxide-free hydrogen and helium from a high-purity source

    DOEpatents

    Golden, Timothy Christopher; Farris, Thomas Stephen

    2008-11-18

    The invention provides vacuum swing adsorption processes that produce an essentially carbon monoxide-free hydrogen or helium gas stream from, respectively, a high-purity (e.g., pipeline grade) hydrogen or helium gas stream using one or two adsorber beds. By using physical adsorbents with high heats of nitrogen adsorption, intermediate heats of carbon monoxide adsorption, and low heats of hydrogen and helium adsorption, and by using vacuum purging and high feed stream pressures (e.g., pressures of as high as around 1,000 bar), pipeline grade hydrogen or helium can purified to produce essentially carbon monoxide -free hydrogen and helium, or carbon monoxide, nitrogen, and methane-free hydrogen and helium.

  6. Extreme hydrogen, oxygen and carbon isotope anomalies in the pore waters and carbonates of the sediments and basalts from the Norwegian Sea: Methane and hydrogen from the mantle

    SciTech Connect

    Lawrence, J.R. ); Taviani, M. )

    1988-08-01

    D/H ratios in the pore waters of the sediments from the Norwegian Sea decrease as a function of depth to values as low as {minus}14{per thousand}. Oxygen isotope ratios in the pore waters and carbon and oxygen isotope ratios in carbonates both in the sediments and basalts are low. Extensive alteration of basalt has been given as the explanation for the low oxygen isotope ratios. Material balance calculations suggest that alteration of volcanic material and oxidation of organic matter cannot explain the hydrogen and carbon isotope anomalies. Arguments are presented suggesting that methane and hydrogen from the mantle are oxidized to carbon dioxide and water by sulfate and ferric iron in the basaltic crust to yield the low hydrogen and carbon isotope ratios.

  7. Deuterium implantation in magnetic garnets

    SciTech Connect

    Wilts, C.H.; Urai, A.

    1988-11-01

    The magnetic effects of deuterium implantation and subsequent annealing were measured in Gd, Tm, and Ga-substituted yttrium iron garnet films for comparison with measurements made earlier with hydrogen implantation. Implantation energy was 60 keV and the dose ranged from 0.5 to 3 x 10/sup 16/ ions/cm/sup 2/ for D/sup +//sub 2/ ions, as compared to an energy of 120 keV and a dose from 0.3 to 4 x 10/sup 16/ ions/cm/sup 2/ for H/sup +//sub 2/ in the earlier study. Measurements made included x-ray rocking curves and ferromagnetic resonance spectra measured at 9.5 GHz. For all doses the implanted layer remained crystalline. Implanted layer thickness was about 4200 A and peak strain occured at a depth of 2600 A. Peak strain increased monotonically, but departed from a linear relation with dose. For the highest dose, the peak strain was 2.5%. Relaxation of strain with annealing was intermediate between that found earlier for hydrogen and neon implantation. As compared to all other implant elements, both deuterium and hydrogen show a large anomalous magnetic anisotropy which can exceed 10 000 Oe for either ion. The absence of this effect for He, Ne, and other ions supports the conjecture that the effect is chemical and related to electronic bonding rather than strain or disorder. The anomalous anisotropy for deuterium decreases and shifts location with annealing. It has largely disappeared at temperatures of 300--350 /sup 0/C. The shape of the profile is consistent with the hypothesis that the shift in anisotropy is associated with diffusion of the deuterium atoms to the surface of the garnet film. At the highest dose, crystalline damage in the region of highest strain is sufficient to radically alter magnetic properties and in particular reduces even the excess anisotropy so that a two-peak profile results until modified by annealing.

  8. Sustainable production of green feed from carbon dioxide and hydrogen.

    PubMed

    Landau, Miron V; Vidruk, Roxana; Herskowitz, Moti

    2014-03-01

    Carbon dioxide hydrogenation to form hydrocarbons was conducted on two iron-based catalysts, prepared according to procedures described in the literature, and on a new iron spinel catalyst. The CO2 conversion measured in a packed-bed reactor was limited to about 60% because of excessive amounts of water produced in this process. Switching to a system of three packed-bed reactors in series with interim removal of water and condensed hydrocarbons increased CO2 conversion to as much as 89%. The pure spinel catalyst displayed a significantly higher activity and selectivity than those of the other iron catalysts. This process produces a product called green feed, which is similar in composition to the product of a high-temperature, iron-based Fischer–Tropsch process from syngas. The green feed can be readily converted into renewable fuels by well-established technologies. PMID:24678062

  9. Deposition of hard elastic hydrogenated fullerenelike carbon films

    NASA Astrophysics Data System (ADS)

    Wang, Zhou; Zhang, Junyan

    2011-05-01

    Hydrogenated fullerenelike carbon (H-FLC) films, with high hardness of 41.7 1.4 GPa and elastic recovery of 75.1%, have been uniformly deposited at low temperature by pulse direct current plasma enhanced chemical vapor deposition (pulse DC PECVD). The superior mechanical properties of the H-FLC films are attributed to the unique curvature and interconnection of graphitic basal planes. We propose the fullerenelike structures are formed in the far nonequilibrium pulse plasma environment and stabilized in the sequential fast quenching process. It is expected that the facile deposition of H-FLC films will promote the large-scale low-temperature preparation of engineering protective films for industrial applications.

  10. Kinetic modelling of molecular hydrogen transport in microporous carbon materials.

    PubMed

    Hankel, Marlies; Zhang, Hong; Nguyen, Thanh X; Bhatia, Suresh K; Gray, Stephen K; Smith, Sean C

    2011-05-01

    The proposal of kinetic molecular sieving of hydrogen isotopes is explored by employing statistical rate theory methods to describe the kinetics of molecular hydrogen transport in model microporous carbon structures. A Lennard-Jones atom-atom interaction potential is utilized for the description of the interactions between H(2)/D(2) and the carbon framework, while the requisite partition functions describing the thermal flux of molecules through the transition state are calculated quantum mechanically in view of the low temperatures involved in the proposed kinetic molecular sieving application. Predicted kinetic isotope effects for initial passage from the gas phase into the first pore mouth are consistent with expectations from previous modeling studies, namely, that at sufficiently low temperatures and for sufficiently narrow pore mouths D(2) transport is dramatically favored over H(2). However, in contrast to expectations from previous modeling, the absence of any potential barrier along the minimum energy pathway from the gas phase into the first pore mouth yields a negative temperature dependence in the predicted absolute rate coefficients-implying a negative activation energy. In pursuit of the effective activation barrier, we find that the minimum potential in the cavity is significantly higher than in the pore mouth for nanotube-shaped models, throwing into question the common assumption that passage through the pore mouths should be the rate-determining step. Our results suggest a new mechanism that, depending on the size and shape of the cavity, the thermal activation barrier may lie in the cavity rather than at the pore mouth. As a consequence, design strategies for achieving quantum-mediated kinetic molecular sieving of H(2)/D(2) in a microporous membrane will need, at the very least, to take careful account of cavity shape and size in addition to pore-mouth size in order to ensure that the selective step, namely passage through the pore mouth, is also the rate determining step. PMID:21442120

  11. Kinetic modelling of molecular hydrogen transport in microporous carbon materials.

    SciTech Connect

    Hankel, M.; Zhang, H.; Nguyen, T. X.; Bhatia, S. K.; Gray, S. K.; Smith, S. C.

    2011-01-01

    The proposal of kinetic molecular sieving of hydrogen isotopes is explored by employing statistical rate theory methods to describe the kinetics of molecular hydrogen transport in model microporous carbon structures. A Lennard-Jones atom-atom interaction potential is utilized for the description of the interactions between H{sub 2}/D{sub 2} and the carbon framework, while the requisite partition functions describing the thermal flux of molecules through the transition state are calculated quantum mechanically in view of the low temperatures involved in the proposed kinetic molecular sieving application. Predicted kinetic isotope effects for initial passage from the gas phase into the first pore mouth are consistent with expectations from previous modeling studies, namely, that at sufficiently low temperatures and for sufficiently narrow pore mouths D{sub 2} transport is dramatically favored over H{sub 2}. However, in contrast to expectations from previous modeling, the absence of any potential barrier along the minimum energy pathway from the gas phase into the first pore mouth yields a negative temperature dependence in the predicted absolute rate coefficients - implying a negative activation energy. In pursuit of the effective activation barrier, we find that the minimum potential in the cavity is significantly higher than in the pore mouth for nanotube-shaped models, throwing into question the common assumption that passage through the pore mouths should be the rate-determining step. Our results suggest a new mechanism that, depending on the size and shape of the cavity, the thermal activation barrier may lie in the cavity rather than at the pore mouth. As a consequence, design strategies for achieving quantum-mediated kinetic molecular sieving of H{sub 2}/D{sub 2} in a microporous membrane will need, at the very least, to take careful account of cavity shape and size in addition to pore-mouth size in order to ensure that the selective step, namely passage through the pore mouth, is also the rate determining step.

  12. Hydrogen induced redox mechanism in amorphous carbon resistive random access memory

    PubMed Central

    2014-01-01

    We investigated the bipolar resistive switching characteristics of the resistive random access memory (RRAM) device with amorphous carbon layer. Applying a forming voltage, the amorphous carbon layer was carbonized to form a conjugation double bond conductive filament. We proposed a hydrogen redox model to clarify the resistive switch mechanism of high/low resistance states (HRS/LRS) in carbon RRAM. The electrical conduction mechanism of LRS is attributed to conductive sp2 carbon filament with conjugation double bonds by dehydrogenation, while the electrical conduction of HRS resulted from the formation of insulating sp3-type carbon filament through hydrogenation process. PMID:24475979

  13. Catalytic Metal Free Production of Large Cage Structure Carbon Particles: A Candidate for Hydrogen Storage

    NASA Technical Reports Server (NTRS)

    Kimura, Yuki; Nuth, Joseph A., III; Ferguson, Frank T.

    2005-01-01

    We will demonstrate that carbon particles consisting of large cages can be produced without catalytic metal. The carbon particles were produced in CO gas as well as by introduction of 5% methane gas into the CO gas. The gas-produced carbon particles were able to absorb approximately 16.2 wt% of hydrogen. This value is 2.5 times higher than the 6.5 wt% goal for the vehicular hydrogen storage proposed by the Department of Energy in the USA. Therefore, we believe that this carbon particle is an excellent candidate for hydrogen storage for fuel cells.

  14. Apparatus for hydrogen and carbon production via carbon aerosol-catalyzed dissociation of hydrocarbons

    NASA Technical Reports Server (NTRS)

    Muradov, Nazim Z. (Inventor); Smith, Franklyn (Inventor); Tabatabaie-Raissi, Ali (Inventor)

    2012-01-01

    A novel process and apparatus is disclosed for sustainable, continuous production of hydrogen and carbon by catalytic dissociation or decomposition of hydrocarbons at elevated temperatures using in-situ generated carbon particles. Carbon particles are produced by decomposition of carbonaceous materials in response to an energy input. The energy input can be provided by at least one of a non-oxidative and oxidative means. The non-oxidative means of the energy input includes a high temperature source, or different types of plasma, such as, thermal, non-thermal, microwave, corona discharge, glow discharge, dielectric barrier discharge, or radiation sources, such as, electron beam, gamma, ultraviolet (UV). The oxidative means of the energy input includes oxygen, air, ozone, nitrous oxide (NO.sub.2) and other oxidizing agents. The method, apparatus and process of the present invention is applicable to any gaseous or liquid hydrocarbon fuel and it produces no or significantly less CO.sub.2 emissions compared to conventional processes.

  15. Synthesis of deuterium-labeled fluphenazine.

    PubMed

    Shetty, H U; Hawes, E M; Midha, K K

    1984-01-01

    The propylpiperazine side chain of fluphenazine has been labeled with two, four, and six deuterium atoms by lithium aluminum deuteride reduction of the appropriate ester or imide. The gamma-carbon of the propyl group was labeled with two deuterium atoms by reduction of 10- (2-methoxycarbonylethyl) -2-trifluoromethyl-10H-phenothiazine, while four deuterium atoms were incorporated into the piperazine ring by reduction of 10-[3-(3,5-dioxo-1-piperazinyl)propyl]-2-trifluoromethyl-10H-pheno thiazine. The latter reduction gave the d4-labeled N-deshydroxyethyl metabolite of fluphenazine. PMID:6694091

  16. Thermodynamic analysis of Glycerol Steam Reforming for hydrogen production with in situ hydrogen and carbon dioxide separation

    NASA Astrophysics Data System (ADS)

    Silva, Joel M.; Soria, M. A.; Madeira, Luis M.

    2015-01-01

    A thermodynamic study of Glycerol Steam Reforming (GSR) for hydrogen production with in situ carbon dioxide and hydrogen (reaction products) simultaneous removal was performed. The sorption-enhanced membrane reactor (SEMR) was divided into multiple sub-Gibbs reactors and the Gibbs free energy minimization method was employed. The effects of temperature (600-800 K), molar water-to-glycerol feed ratio (WGFR) (3-9), pressure (1-5 atm) and fraction of hydrogen and carbon dioxide removal (f, 0-0.99) on the GSR process were target of investigation. A hydrogen yield (total moles of hydrogen produced/mole of reacted glycerol) very close to the stoichiometric value of 7 was obtained at 700 K, WGFR of 9, 1 atm and for fCO2 = 0.99 and fH2 = 0.80. This corresponds to an enhancement of 217%, 47% and 22% in terms of hydrogen yield comparatively to the traditional reactor (TR), sorption-enhanced reactor (SER) with carbon dioxide capture (fCO2 = 0.99) and membrane reactor (MR) with hydrogen separation (fH2 = 0.80) , respectively. In terms of coke, its formation was only observed under WGFRs below the stoichiometric value of 3.

  17. Exploring the Origins of Deuterium Enrichments in Solar Nebular Organics

    NASA Astrophysics Data System (ADS)

    Cleeves, L. Ilsedore; Bergin, Edwin A.; O’D. Alexander, Conel M.; Du, Fujun; Graninger, Dawn; Öberg, Karin I.; Harries, Tim J.

    2016-03-01

    Deuterium-to-hydrogen (D/H) enrichments in molecular species provide clues about their original formation environment. The organic materials in primitive solar system bodies generally have higher D/H ratios and show greater D/H variation when compared to D/H in solar system water. We propose this difference arises at least in part due to (1) the availability of additional chemical fractionation pathways for organics beyond that for water, and (2) the higher volatility of key carbon reservoirs compared to oxygen. We test this hypothesis using detailed disk models, including a sophisticated, new disk ionization treatment with a low cosmic-ray ionization rate, and find that disk chemistry leads to higher deuterium enrichment in organics compared to water, helped especially by fractionation via the precursors CH2D+/CH3+. We also find that the D/H ratio in individual species varies significantly depending on their particular formation pathways. For example, from ∼20–40 au, CH4 can reach {{D}}/{{H}}∼ 2× {10}-3, while D/H in CH3OH remains locally unaltered. Finally, while the global organic D/H in our models can reproduce intermediately elevated D/H in the bulk hydrocarbon reservoir, our models are unable to reproduce the most deuterium-enriched organic materials in the solar system, and thus our model requires some inheritance from the cold interstellar medium from which the Sun formed.

  18. Role of Nonmetallic Inclusions in Hydrogen Embrittlement of High-Strength Carbon Steels with Different Microalloying

    NASA Astrophysics Data System (ADS)

    Todoshchenko, Olga Madelen Ingrid; Yagodzinskyy, Yuriy; Saukkonen, Tapio; Hänninen, Hannu

    2014-10-01

    High-strength carbon steels of 1200 MPa strength level with different microalloying were tensile tested at constant extension rate and constant load under continuous electrochemical hydrogen charging. The results show that hydrogen markedly reduces elongation and time to fracture of all the studied steels. Fractography of the steels shows that nonmetallic inclusions (NMIs) play the major role in crack initiation in hydrogen-charged specimens. The role of NMIs in the hydrogen-induced fracture of steels is discussed.

  19. Dynamic Monte-Carlo modeling of hydrogen isotope reactive diffusive transport in porous graphite

    NASA Astrophysics Data System (ADS)

    Schneider, R.; Rai, A.; Mutzke, A.; Warrier, M.; Salonen, E.; Nordlund, K.

    2007-08-01

    An equal mixture of deuterium and tritium will be the fuel used in a fusion reactor. It is important to study the recycling and mixing of these hydrogen isotopes in graphite from several points of view: (i) impact on the ratio of deuterium to tritium in a reactor, (ii) continued use of graphite as a first wall and divertor material, and (iii) reaction with carbon atoms and the transport of hydrocarbons will provide insight into chemical erosion. Dynamic Monte-Carlo techniques are used to study the reactive-diffusive transport of hydrogen isotopes and interstitial carbon atoms in a 3-D porous graphite structure irradiated with hydrogen and deuterium and is compared with published experimental results for hydrogen re-emission and isotope exchange.

  20. Hydrogen Adsorption on Activated Carbon an Carbon Nanotubes Using Volumetric Differential Pressure Technique

    NASA Astrophysics Data System (ADS)

    Sanip, S. M.; Saidin, M. A. R.; Aziz, M.; Ismail, A. F.

    2010-03-01

    A simple hydrogen adsorption measurement system utilizing the volumetri differential pressure technique has been designed, fabricated and calibrated. Hydroge adsorption measurements have been carried out at temperatures 298 K and 77 K on activate carbon and carbon nanotubes with different surface areas. The adsorption data obtained will b helpful in understanding the adsorption property of the studied carbon materials using th fundamentals of adsorption theory. The principle of the system follows the Sievert-type metho The system measures a change in pressure between the reference cell, R1 and the sample cell S1, S2, S3 over a certain temperature range. R1, S1, S2, and S3 having known fixed volume The sample temperatures will be monitored by thermocouple TC while the pressures in R1 an S1, S2, S3 will be measured using a digital pressure transducer. The maximum operatin pressure of the pressure transducer is 20 bar and calibrated with an accuracy of ±0.01 bar. Hig purity hydrogen is being used in the system and the amount of samples for the study is betwee 1.0-2.0 grams. The system was calibrated using helium gas without any samples in S1, S2 an S3. This will provide a correction factor during the adsorption process providing an adsorption free reference point when using hydrogen gas resulting in a more accurate reading of th adsorption process by eliminating the errors caused by temperature expansion effects and oth non-adsorption related phenomena. The ideal gas equation of state is applied to calculate th hydrogen adsorption capacity based on the differential pressure measurements. Activated carbo with a surface area of 644.87 m2/g showed a larger amount of adsorption as compared to multiwalled nanotubes (commercial) with a surface area of 119.68 m2/g. This study als indicated that there is a direct correlation between the amounts of hydrogen adsorbed an surface area of the carbon materials under the conditions studied and that the adsorption significant at 77 K.

  1. 40 CFR 415.330 - Applicability; description of the carbon monoxide and by-product hydrogen production subcategory.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... carbon monoxide and by-product hydrogen production subcategory. 415.330 Section 415.330 Protection of... MANUFACTURING POINT SOURCE CATEGORY Carbon Monoxide and By-Product Hydrogen Production Subcategory § 415.330 Applicability; description of the carbon monoxide and by-product hydrogen production subcategory. The...

  2. 40 CFR 415.330 - Applicability; description of the carbon monoxide and by-product hydrogen production subcategory.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... carbon monoxide and by-product hydrogen production subcategory. 415.330 Section 415.330 Protection of... MANUFACTURING POINT SOURCE CATEGORY Carbon Monoxide and By-Product Hydrogen Production Subcategory § 415.330 Applicability; description of the carbon monoxide and by-product hydrogen production subcategory. The...

  3. 40 CFR 415.330 - Applicability; description of the carbon monoxide and by-product hydrogen production subcategory.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... carbon monoxide and by-product hydrogen production subcategory. 415.330 Section 415.330 Protection of... MANUFACTURING POINT SOURCE CATEGORY Carbon Monoxide and By-Product Hydrogen Production Subcategory § 415.330 Applicability; description of the carbon monoxide and by-product hydrogen production subcategory. The...

  4. 40 CFR 415.330 - Applicability; description of the carbon monoxide and by-product hydrogen production subcategory.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... carbon monoxide and by-product hydrogen production subcategory. 415.330 Section 415.330 Protection of... MANUFACTURING POINT SOURCE CATEGORY Carbon Monoxide and By-Product Hydrogen Production Subcategory § 415.330 Applicability; description of the carbon monoxide and by-product hydrogen production subcategory. The...

  5. 40 CFR 415.330 - Applicability; description of the carbon monoxide and by-product hydrogen production subcategory.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... carbon monoxide and by-product hydrogen production subcategory. 415.330 Section 415.330 Protection of... MANUFACTURING POINT SOURCE CATEGORY Carbon Monoxide and By-Product Hydrogen Production Subcategory § 415.330 Applicability; description of the carbon monoxide and by-product hydrogen production subcategory. The...

  6. The role of carbon dioxide in chemoselective hydrogenation of halonitroaromatics over supported noble metal catalysts in supercritical carbon dioxide.

    PubMed

    Ichikawa, Shinichiro; Tada, Mizuki; Iwasawa, Yasuhiro; Ikariya, Takao

    2005-02-21

    Chemoselective hydrogenation of halogenated nitrobenzenes over Pt/C catalysts proceeds effectively in supercritical carbon dioxide (scCO2) to produce halogenated anilines with excellent selectivity; the rate of the hydrogenation of nitro groups is markedly enhanced in scCO2 compared to the neat reaction, and the dehalogenation reaction is significantly suppressed. PMID:15700083

  7. Atomically isolated nickel species anchored on graphitized carbon for efficient hydrogen evolution electrocatalysis

    PubMed Central

    Fan, Lili; Liu, Peng Fei; Yan, Xuecheng; Gu, Lin; Yang, Zhen Zhong; Yang, Hua Gui; Qiu, Shilun; Yao, Xiangdong

    2016-01-01

    Hydrogen production through electrochemical process is at the heart of key renewable energy technologies including water splitting and hydrogen fuel cells. Despite tremendous efforts, exploring cheap, efficient and durable electrocatalysts for hydrogen evolution still remains as a great challenge. Here we synthesize a nickel–carbon-based catalyst, from carbonization of metal-organic frameworks, to replace currently best-known platinum-based materials for electrocatalytic hydrogen evolution. This nickel-carbon-based catalyst can be activated to obtain isolated nickel atoms on the graphitic carbon support when applying electrochemical potential, exhibiting highly efficient hydrogen evolution performance with high exchange current density of 1.2 mA cm−2 and impressive durability. This work may enable new opportunities for designing and tuning properties of electrocatalysts at atomic scale for large-scale water electrolysis. PMID:26861684

  8. Atomically isolated nickel species anchored on graphitized carbon for efficient hydrogen evolution electrocatalysis

    NASA Astrophysics Data System (ADS)

    Fan, Lili; Liu, Peng Fei; Yan, Xuecheng; Gu, Lin; Yang, Zhen Zhong; Yang, Hua Gui; Qiu, Shilun; Yao, Xiangdong

    2016-02-01

    Hydrogen production through electrochemical process is at the heart of key renewable energy technologies including water splitting and hydrogen fuel cells. Despite tremendous efforts, exploring cheap, efficient and durable electrocatalysts for hydrogen evolution still remains as a great challenge. Here we synthesize a nickel-carbon-based catalyst, from carbonization of metal-organic frameworks, to replace currently best-known platinum-based materials for electrocatalytic hydrogen evolution. This nickel-carbon-based catalyst can be activated to obtain isolated nickel atoms on the graphitic carbon support when applying electrochemical potential, exhibiting highly efficient hydrogen evolution performance with high exchange current density of 1.2 mA cm-2 and impressive durability. This work may enable new opportunities for designing and tuning properties of electrocatalysts at atomic scale for large-scale water electrolysis.

  9. Two different carbon-hydrogen complexes in silicon with closely spaced energy levels

    NASA Astrophysics Data System (ADS)

    Stbner, R.; Kolkovsky, Vl.; Weber, J.

    2015-08-01

    An acceptor and a single donor state of carbon-hydrogen defects (CHA and CHB) are observed by Laplace deep level transient spectroscopy at 90 K. CHA appears directly after hydrogenation by wet chemical etching or hydrogen plasma treatment, whereas CHB can be observed only after a successive annealing under reverse bias at about 320 K. The activation enthalpies of these states are 0.16 eV for CHA and 0.14 eV for CHB. Our results reconcile previous controversial experimental results. We attribute CHA to the configuration where substitutional carbon binds a hydrogen atom on a bond centered position between carbon and the neighboring silicon and CHB to another carbon-hydrogen defect.

  10. Atomically isolated nickel species anchored on graphitized carbon for efficient hydrogen evolution electrocatalysis.

    PubMed

    Fan, Lili; Liu, Peng Fei; Yan, Xuecheng; Gu, Lin; Yang, Zhen Zhong; Yang, Hua Gui; Qiu, Shilun; Yao, Xiangdong

    2016-01-01

    Hydrogen production through electrochemical process is at the heart of key renewable energy technologies including water splitting and hydrogen fuel cells. Despite tremendous efforts, exploring cheap, efficient and durable electrocatalysts for hydrogen evolution still remains as a great challenge. Here we synthesize a nickel-carbon-based catalyst, from carbonization of metal-organic frameworks, to replace currently best-known platinum-based materials for electrocatalytic hydrogen evolution. This nickel-carbon-based catalyst can be activated to obtain isolated nickel atoms on the graphitic carbon support when applying electrochemical potential, exhibiting highly efficient hydrogen evolution performance with high exchange current density of 1.2?mA?cm(-2) and impressive durability. This work may enable new opportunities for designing and tuning properties of electrocatalysts at atomic scale for large-scale water electrolysis. PMID:26861684

  11. Structure and hydrogen adsorption properties in low density nanoporous carbons from simulations

    SciTech Connect

    Peng, L.; Morris, James R

    2012-01-01

    We systematically model the hydrogen adsorption in nanoporous carbons over a wide range of carbon bulk densities (0.6 - 2.4 g/cm3) by using tight binding molecular dynamics simulations for the carbon structures and thermodynamics calculations of the hydrogen adsorption. The resulting structures are in good agreement with the experimental data of ultra-microporous carbon (UMC), a wood-based activated carbon, as indicated by comparisons of the microstructure at atomic level, pair distribution function, and pore size distribution. The hydrogen adsorption calculations in carbon structures demonstrate both a promising hydrogen storage capacity (excess uptake of 1.33 wt% at 298K and 5 MPa, for carbon structures at the lower range of densities) and a reasonable heat of adsorption (12-22 kJ/mol). This work demonstrates that increasing the heat of adsorption does not necessarily increase the hydrogen uptake. In fact, the available adsorption volume is as important as the isosteric heat of adsorption for hydrogen storage in nanoporous carbons.

  12. Fast-quench reactor for hydrogen and elemental carbon production from natural gas and other hydrocarbons

    DOEpatents

    Detering, Brent A.; Kong, Peter C.

    2006-08-29

    A fast-quench reactor for production of diatomic hydrogen and unsaturated carbons is provided. During the fast quench in the downstream diverging section of the nozzle, such as in a free expansion chamber, the unsaturated hydrocarbons are further decomposed by reheating the reactor gases. More diatomic hydrogen is produced, along with elemental carbon. Other gas may be added at different stages in the process to form a desired end product and prevent back reactions. The product is a substantially clean-burning hydrogen fuel that leaves no greenhouse gas emissions, and elemental carbon that may be used in powder form as a commodity for several processes.

  13. Metal doped carbon nanoneedles and effect of carbon organization with activity for hydrogen evolution reaction (HER).

    PubMed

    Araujo, Rafael A; Rubira, Adley F; Asefa, Tewodros; Silva, Rafael

    2016-02-10

    Cellulose nanowhiskers (CNW) from cotton, was prepared by acid hydrolysis and purified using a size selection process to obtain homogeneous samples with average particle size of 270nm and 85.5% crystallinity. Purified CNW was used as precursor to carbon nanoneedles (CNN) synthesis. The synthesis of CNN loaded with different metals dopants were carried out by a nanoreactor method and the obtained CNNs applied as electrocatalysts for hydrogen evolution reaction (HER). In the carbon nanoneedles synthesis, Ni, Cu, or Fe worked as graphitization catalyst and the metal were found present as dopants in the final material. The used metal appeared to have direct influence on the degree of organization of the particles and also in the surface density of polar groups. It was evaluated the influence of the graphitic organization on the general properties and nickel was found as the more appropriate metal since it leads to a more organized material and also to a high activity toward HER. PMID:26686184

  14. Palladium on Nitrogen-Doped Mesoporous Carbon: A Bifunctional Catalyst for Formate-Based, Carbon-Neutral Hydrogen Storage.

    PubMed

    Wang, Fanan; Xu, Jinming; Shao, Xianzhao; Su, Xiong; Huang, Yanqiang; Zhang, Tao

    2016-02-01

    The lack of safe, efficient, and economical hydrogen storage technologies is a hindrance to the realization of the hydrogen economy. Reported herein is a reversible formate-based carbon-neutral hydrogen storage system that is established over a novel catalyst comprising palladium nanoparticles supported on nitrogen-doped mesoporous carbon. The support was fabricated by a hard template method and nitridated under a flow of ammonia. Detailed analyses demonstrate that this bicarbonate/formate redox equilibrium is promoted by the cooperative role of the doped nitrogen functionalities and the well-dispersed, electron-enriched palladium nanoparticles. PMID:26763714

  15. Hydrogen-deuterium exchange between TpRu(PMe3)(L)X (L = PMe3 and X = OH, OPh, Me, Ph, or NHPh; L = NCMe and X = Ph) and deuterated arene solvents: evidence for metal-mediated processes.

    PubMed

    Feng, Yuee; Lail, Marty; Foley, Nicholas A; Gunnoe, T Brent; Barakat, Khaldoon A; Cundari, Thomas R; Petersen, Jeffrey L

    2006-06-21

    At elevated temperatures (90-130 degrees C), complexes of the type TpRu(PMe3)2X (X = OH, OPh, Me, Ph, or NHPh; Tp = hydridotris(pyrazolyl)borate) undergo regioselective hydrogen-deuterium (H/D) exchange with deuterated arenes. For X = OH or NHPh, H/D exchange occurs at hydroxide and anilido ligands, respectively. For X = OH, OPh, Me, Ph, or NHPh, isotopic exchange occurs at the Tp 4-positions with only minimal deuterium incorporation at the Tp 3- or 5-positions or PMe3 ligands. For TpRu(PMe3)(NCMe)Ph, the H/D exchange occurs at 60 degrees C at all three Tp positions and the phenyl ring. TpRu(PMe3)2Cl, TpRu(PMe3)2OTf (OTf = trifluoromethanesulfonate), and TpRu(PMe3)2SH do not initiate H/D exchange in C6D6 after extended periods of time at elevated temperatures. Mechanistic studies indicate that the likely pathway for the H/D exchange involves ligand dissociation (PMe3 or NCMe), Ru-mediated activation of an aromatic C-D bond, and deuteration of basic nondative ligand (hydroxide or anilido) or Tp positions via net D+ transfer. PMID:16771513

  16. Ellipsometric and optical study of amorphous hydrogenated carbon films

    NASA Technical Reports Server (NTRS)

    Alterovitz, S. A.; Warner, J. D.; Liu, D. C.; Pouch, J. J.

    1986-01-01

    A low-frequency plasma deposition system was used to prepare amorphous hydrogenated carbon (a-C:H) films. The growth energy was varied by changing the power and/or pressure of the plasma. Ellipsometry and optical absorption were used to obtain the optical energy gap, the density of states, and the refractive index. Ion sputtering was used in conjunction with ellipsometry and Auger electron spectroscopy to get absolute sputtering rates. The plasma deposited a-C:H is amorphous with an optical energy gap of approximately 2.0-2.4 eV. These a-C:H films have higher density and/or hardness, higher refractive index, and lower optical energy gaps with increasing energy of the particles in the plasma, while the density of states remains unchanged. These results are in agreement with, and give a fine-tuned positive confirmation to, an existing conjecture on the nature of the a-C:H films (Kaplan et al., 1985).

  17. The key role of carbon in hydrogen solubility in copper

    NASA Astrophysics Data System (ADS)

    Zhou, Hong-Bo; Yan, Wen-Li; Ou, Xin

    2014-06-01

    We investigate the effects of carbon (C) on hydrogen (H) solubility in copper (Cu) using a first-principles method. We show C can increase the solution energy of H in the bulk Cu originated from the charge density redistribution, which leads to a weak repulsion between H and C in Cu. On the contrary, we demonstrate the C-vacancy (C-V) complex can serve as a trapping centre of H, and one C-V complex can hold up to six H atoms. Moreover, it is found that C can effectively decrease the solution energy of a single H in the vacancy, 0.68 eV lower than that of H in the C-free vacancy, changing the solution process of H in the vacancy from endothermic to exothermic. This can be attributed to the strong bonding interaction between H and C in the vacancy. Based on analyzing the role of C in different metals, we propose that the effects of C on the H solubility in the vacancy mainly depend on the difference between the H-C interaction and the C-metal atom interaction. These indicate that C plays a key role in H trapping behavior in Cu.

  18. Hydrogen storage in different carbon materials: Influence of the porosity development by chemical activation

    NASA Astrophysics Data System (ADS)

    Jimnez, Vicente; Ramrez-Lucas, Ana; Snchez, Paula; Valverde, Jos Lus; Romero, Amaya

    2012-01-01

    The hydrogen adsorption capacity of different types of carbon nanofibers (platelet, fishbone and ribbon) and amorphous carbon have been measured as a function of pressure and temperature. The results showed that the more graphitic carbon materials adsorbed less hydrogen than more amorphous materials. After a chemical activation process, the hydrogen storage capacities of the carbon materials increased markedly in comparison with the non-activated ones. BET surface area of amorphous carbon increased by a factor of 3.5 and the ultramicropore volume doubled, thus increasing the hydrogen adsorption by a factor of 2. However, BET surface area in platelet CNFs increased by a factor of 3 and the ultramicropore volume by a factor of 6, thus increasing the hydrogen storage by a factor of 4.5. The dependency of hydrogen storage capacity of carbon materials on the BET surface area was evaluated using both a condensation model and experimental results. Comparison of data suggests that the hydrogen adsorption capacity clearly depends on the pore structure and so, on the accessibility to the internal surface.

  19. Insight into the mechanism of the thermal reduction of graphite oxide: deuterium-labeled graphite oxide is the key.

    PubMed

    Sofer, Zden?k; Jankovsk, Ond?ej; imek, Petr; Sedmidubsk, David; turala, Ji?; Kosina, Ji?; Mikov, Romana; Mackov, Anna; Mikulics, Martin; Pumera, Martin

    2015-05-26

    For the past decade, researchers have been trying to understand the mechanism of the thermal reduction of graphite oxide. Because deuterium is widely used as a marker in various organic reactions, we wondered if deuterium-labeled graphite oxide could be the key to fully understand this mechanism. Graphite oxides were prepared by the Hofmann, Hummers, Staudenmaier, and Brodie methods, and a deuterium-labeled analogue was synthesized by the Hofmann method. All graphite oxides were analyzed not only using the traditional techniques but also by gas chromatography-mass spectrometry (GC-MS) during exfoliation in hydrogen and nitrogen atmospheres. GC-MS enabled us to compare differences between the chemical compositions of the organic exfoliation products formed during the thermal reduction of these graphite oxides. Nuclear analytical methods (Rutherford backscattering spectroscopy, elastic recoil detection analysis) were used to calculate the concentrations of light elements, including the ratio of hydrogen to deuterium. Combining all of these results we were able to determine graphite oxide's thermal reduction mechanism. Carbon dioxide, carbon monoxide, and water are formed from the thermal reduction of graphite oxide. This process is also accompanied by various radical reactions that lead to the formation of a large amount of carcinogenic volatile organic compounds, and this will have major safety implications for the mass production of graphene. PMID:25894311

  20. The Effect of Carbon Monoxide on the Hydrogen Permeability of a Palladium Membrane

    NASA Astrophysics Data System (ADS)

    Katoh, Masahiro; Nishihara, Katsunori; Kinouchi, Koji; Chohama, Koichi; Horikawa, Toshihide; Tomida, Tahei; Sotowa, Ken-Ichiro

    Plating thin Palladium (Pd) film on the outer surface of a porous stainless steel tube enables very rapid hydrogen permeation with an absolute selectivity. Methane steam reforming for hydrogen production is performed in a Pd membrane reactor. In this reaction, carbon monoxide (CO) synthesized is known to affect hydrogen permeability. The effect on hydrogen permeability and the membrane stability were investigated. After hydrogen was flowed through Pd membrane for 1 hour, CO (1%, 10%, 100% diluted by helium) was flowed on the membrane for 1 hour, and hydrogen was re-permeated through the membrane. Under the all experiment, the temperature, the differential pressure and the flow rate of non-permeation side were 823K, 0.1 MPa and 10 mlmin-1, respectively. After the re-permeating hydrogen, the hydrogen permeation rate increased gradually. Finally the rate arrived at the constant value before CO was flowed. But the necessary time was depend on the concentration of CO. The necessary time for three concentration of CO 1%, 10%, and 100% were 30min, 60min, and 180min, respectively. The reason was that depositing carbon from CO affected to hydrogen permeability. The carbon was changed to methane by hydrogen flow and the membrane was recycled.

  1. Nonrelativistic contributions of order {alpha}{sup 5}m{sub {mu}c}{sup 2} to the Lamb shift in muonic hydrogen and deuterium, and in the muonic helium ion

    SciTech Connect

    Karshenboim, S. G.; Ivanov, V. G.; Korzinin, E. Yu.; Shelyuto, V. A.

    2010-06-15

    Contributions to the energy levels in light muonic atoms and, in particular, to the Lamb shift fall into a few well-distinguished classes. The related diagrams are calculated using different approaches. In particular, there is a specific type of nonrelativistic (NR) contribution. Here, we consider such corrections to the Lamb shift of order {alpha}{sup 5}m{sub {mu}.} These contributions are due to free vacuum-polarization loops as well as to various effects of light-by-light scattering. The closed loop in the related diagrams is an electronic one, which allows an NR consideration of the muon. Both types of contributions have been known for some time, however, the results obtained to date are only partial results. We complete a calculation of the {alpha}{sup 5}m{sub {mu}}contributions for muonic hydrogen. The results are also adjusted for muonic deuterium atom and helium ion.

  2. Combined hydrogenation of carbon oxides on catalysts bearing iron and nickel nanoparticles

    NASA Astrophysics Data System (ADS)

    Sheshko, T. F.; Serov, Yu. M.

    2011-01-01

    The reaction of the hydrogenation of a mixture of carbon oxides on ultradisperse powder (UDP) catalysts containing Fe and Ni nanoparticles and their bimetallic mechanical mixtures was investigated. It was established that the main reaction product on UDP Ni is methane, while the main products on the bimetallic systems are methane and ethylene. A synergetic effect was observed on the bimetallic catalyst under investigation. It was revealed that the hydrogenation of a mixture of carbon oxides proceeds through the stage of dissociative adsorption of both components, CO and CO2. The olefin selectivity of the process was explained by the participation of different forms of adsorbed hydrogen (HI: HII) at the catalyst surface. It is assumed that the hydrogenation of carbon oxides on iron-nickel catalysts proceeds either through the jumpover effect or via hydrogen spillover.

  3. Temperature dependence of deuterium retention in tungsten deposits by deuterium ion irradiation

    NASA Astrophysics Data System (ADS)

    Katayama, K.; Uehara, K.; Date, H.; Fukada, S.; Watanabe, H.

    2015-08-01

    Tungsten (W) deposits were formed by hydrogen plasma sputtering and blisters were observed on the surface. The W deposits and W foils were exposed to deuterium ions with 2 keV-D2+ to doses of 1.0 1021 D2+/m2 at 294 and 773 K in addition to 573 K in the present authors' previous work. Hydrogen isotopes release behaviors from the W deposits and W foils were observed by the thermal desorption spectroscopy method. The amount of deuterium released from the W deposit was considerably larger than that from W foil. The obtained deuterium retention in D/m2 was in the range of deuterium retention in polycrystalline tungsten. Not only implanted deuterium but also hydrogen, which was incorporated during the sputtering-deposition process, were released from the W deposits. A hydrogen release peak at around 1100 K was observed for the W deposits. This is considered to be due to the rupture of the blisters.

  4. Molten metal reactor and method of forming hydrogen, carbon monoxide and carbon dioxide using the molten alkaline metal reactor

    DOEpatents

    Bingham, Dennis N.; Klingler, Kerry M.; Turner, Terry D.; Wilding, Bruce M.

    2012-11-13

    A molten metal reactor for converting a carbon material and steam into a gas comprising hydrogen, carbon monoxide, and carbon dioxide is disclosed. The reactor includes an interior crucible having a portion contained within an exterior crucible. The interior crucible includes an inlet and an outlet; the outlet leads to the exterior crucible and may comprise a diffuser. The exterior crucible may contain a molten alkaline metal compound. Contained between the exterior crucible and the interior crucible is at least one baffle.

  5. Tribological studies of amorphous hydrogenated carbon films in a vacuum, spacelike environment

    NASA Technical Reports Server (NTRS)

    Miyoshi, Kazuhisa

    1991-01-01

    Recent work on the adhesion and friction properties of plasma-deposited amorphous hydrogenated carbon films and their dependence on preparation conditions are reviewed. The results of the study indicate that plasma deposition enables one to deposit a variety of amorphous hydrogenated carbon (a-C:H) exhibiting diamondlike friction behavior. The plasma-deposited a-C:H films can be effectively used as hard lubricating films on ceramic materials such as silicon nitride in vacuum.

  6. Heterogeneous selective hydrogenation of ethylene carbonate to methanol and ethylene glycol over a copper chromite nanocatalyst.

    PubMed

    Lian, Chao; Ren, Fumin; Liu, Yuxi; Zhao, Guofeng; Ji, Yongjun; Rong, Hongpan; Jia, Wei; Ma, Lei; Lu, Haiyuan; Wang, Dingsheng; Li, Yadong

    2015-01-25

    Heterogeneous selective hydrogenation of ethylene carbonate (EC), a key step in indirect conversion of CO2, was realized over a copper chromite nanocatalyst prepared via a hydrothermal method followed by calcination. The selectivities towards methanol (60%) and ethylene glycol (93%) were higher than those achieved over other usual hydrogenation catalysts. PMID:25474043

  7. Direct Evidence for Solid-like Hydrogen in a Nanoporous Carbon Hydrogen Storage Material at Supercritical Temperatures.

    PubMed

    Ting, Valeska P; Ramirez-Cuesta, Anibal J; Bimbo, Nuno; Sharpe, Jessica E; Noguera-Diaz, Antonio; Presser, Volker; Rudic, Svemir; Mays, Timothy J

    2015-08-25

    Here we report direct physical evidence that confinement of molecular hydrogen (H2) in an optimized nanoporous carbon results in accumulation of hydrogen with characteristics commensurate with solid H2 at temperatures up to 67 K above the liquid-vapor critical temperature of bulk H2. This extreme densification is attributed to confinement of H2 molecules in the optimally sized micropores, and occurs at pressures as low as 0.02 MPa. The quantities of contained, solid-like H2 increased with pressure and were directly evaluated using in situ inelastic neutron scattering and confirmed by analysis of gas sorption isotherms. The demonstration of the existence of solid-like H2 challenges the existing assumption that supercritical hydrogen confined in nanopores has an upper limit of liquid H2 density. Thus, this insight offers opportunities for the development of more accurate models for the evaluation and design of nanoporous materials for high capacity adsorptive hydrogen storage. PMID:26171656

  8. Carbon hybridized halloysite nanotubes for high-performance hydrogen storage capacities

    NASA Astrophysics Data System (ADS)

    Jin, Jiao; Fu, Liangjie; Yang, Huaming; Ouyang, Jing

    2015-07-01

    Hybrid nanotubes of carbon and halloysite nanotubes (HNTs) with different carbon:HNTs ratio were hydrothermally synthesized from natural halloysite and sucrose. The samples display uniformly cylindrical hollow tubular structure with different morphologies. These hybrid nanotubes were concluded to be promising medium for physisorption-based hydrogen storage. The hydrogen adsorption capacity of pristine HNTs was 0.35% at 2.65?MPa and 298?K, while that of carbon coated HNTs with the pre-set carbon:HNTs ratio of 3:1 (3C-HNTs) was 0.48% under the same condition. This carbon coated method could offer a new pattern for increasing the hydrogen adsorption capacity. It was also possible to enhance the hydrogen adsorption capacity through the spillover mechanism by incorporating palladium (Pd) in the samples of HNTs (Pd-HNTs) and 3C-HNTs (Pd-3C-HNTs and 3C-Pd-HNTs are the samples with different location of Pd nanoparticles). The hydrogen adsorption capacity of the Pd-HNTs was 0.50% at 2.65?MPa and 298?K, while those of Pd-3C-HNTs and 3C-Pd-HNTs were 0.58% and 0.63%, respectively. In particular, for this spillover mechanism of Pd-carbon-HNTs ternary system, the bidirectional transmission of atomic and molecular hydrogen (3C-Pd-HNTs) was concluded to be more effective than the unidirectional transmission (Pd-3C-HNTs) in this work for the first time.

  9. Influence of the source gas ratio on the hydrogen and deuterium content of a-C:H and a-C:D films: Plasma-enhanced CVD with CH4/H2, CH4/D2, CD4/H2 and CD4/D2

    NASA Astrophysics Data System (ADS)

    Ozeki, K.; Sekiba, D.; Suzuki, T.; Kanda, K.; Niibe, M.; Hirakuri, K. K.; Masuzawa, T.

    2013-01-01

    Amorphous hydrogenated carbon (a-C:H) and amorphous deuterated carbon (a-C:D) films were prepared using plasma-enhanced chemical vapor deposition (PECVD) from CD4, H2, CD4 and D2 source gases. Fourteen different samples were prepared by changing the source gas ratios of CH4/H2, CH4/D2, CD4/H2, and CD4/D2. The concentrations of hydrogen (H) and deuterium (D) relative to carbon (C) in the films were determined by elastic recoil detection analysis (ERDA) and Rutherford backscattering spectroscopy (RBS). The sp2/(sp2 + sp3) ratios of the films were analyzed by near-edge X-ray absorption fine structure (NEXAFS) measurements. Hardness and mass density of the films were measured using a nanoindenter and X-ray reflectivity (XRR), respectively. For all combinations of source gas, the H and D concentrations varied by only 4.0 at.%. For the CH4/D2 source gas, the D concentration in the film increased from 0 at.% with the D2/(CH4 + D2) source gas combination to 11.2 at.% for the 80% D2/(CH4 + D2) source gas combination. The increase in D concentration exceeded the increase in total H and D concentration (3.4 at.%). For CH4/D2 source gas, the H concentration decreased as the D concentration increased. For the CD4/H2 source gas, we observed the opposite tendency. Additionally, an isotope effect between the a-C:H films and the a-C:D films was observed, with preferential incorporation of H over D. From the NEXAFS measurements, the sp2/(sp2 + sp3) ratios in all of the samples were between 38.8% and 40.8%. A correlation between the sp2/(sp2 + sp3) ratio and the H2 or D2 gas source ratio was not observed. The hardness and density of the films decreased when the H2 or D2 source gas ratio increased. Even though the H concentration in the a-C:H films was higher than the D concentration in the a-C:D films, the a-C:D films had lower hardness and mass density values. These findings suggest that information concerning the voids, nanostructures, sp2/sp3 ratios and H concentrations of hydrogenated amorphous carbon films is crucial for evaluation of their mechanical properties.

  10. Biofiltration for control of carbon disulfide and hydrogen sulfide vapors

    SciTech Connect

    Fucich, W.J.; Yang, Y.; Togna, A.P.; Alibeckoff, D.

    1997-12-31

    A full-scale biofiltration system has been installed to control carbon disulfide (CS{sub 2}) and hydrogen sulfide (H{sub 2}S) vapor emissions at Nylonge Corporation (Nylonge), a cellulose sponge manufacturing facility in Elyria, Ohio. Both CS{sub 2} and H{sub 2}S are toxic and odorous. In addition, the US Environmental Protection Agency (EPA) has classified CS{sub 2} as one of the 189 hazardous air pollutants listed under Title 3 of the 1990 Clean Air Act Amendments. Nylonge evaluated several technologies to control CS{sub 2} and H{sub 2}S vapor emissions. After careful consideration of both removal efficiency requirements and cost, Nylonge selected biological treatment as the best overall technology for their application. A biological based technology has been developed to effectively degrade CS{sub 2} and H{sub 2}S vapors. Biofiltration is a process that aerobically converts particular vapor phase compounds into CO{sub 2}, biomass, and water vapor. In this process, microorganisms, in the form of a moistened biofilm layer, immobilized on an organic packing material, such as compost, peat, wood chips, etc., are used to catalyze beneficial chemical reactions. As a contaminated vapor stream passes through the biofilter bed, the contaminants are transferred to the biofilm and are degraded by the microorganisms. This paper describes the CS{sub 2} and H{sub 2}S biofiltration process and the full-scale biofilter system installed at Nylonge`s facility. The system was started in October of 1995, and is designed to treat a 30,000 CFM exhaust stream contaminated with CS{sub 2} and H{sub 2}S vapors.

  11. Transition metal activation and functionalization of carbon-hydrogen bonds

    SciTech Connect

    Jones, W.D.

    1990-07-01

    This project is directed toward the continued investigation of the fundamental thermodynamic and kinetic factors that influence carbon-hydrogen bond activation at homogeneous transition metal centers. The project is also directed toward the conversion of hydrocarbons into functionalized products of potential use to chemical industry. In the past year, advances have been made in both understanding the interactions of hydrocarbons with metals and in the functionalized of hydrocarbons. Major advanced that have been made include: (1) We have found that RhCl(PR{sub 3}){sub 2}(CNR) complexes can catalyze the insertion of isonitriles into the C-H bonds of arenes upon photolysis. (2) We have also examined reactions of a series of arenes with (C{sub 5}Me{sub 5})Rh(PMe{sub 3})PhH and begun to map out the kinetic and thermodynamic preferences for arene coordination. (3) We have begun to examine the reactions of rhodium pyrazolylborates for isonitrile functionalization of C-H bonds. (4) We have completed studies of the reactions of (C{sub 5}Me{sub 5})Rh(PMe{sub 3})H{sub 2} with D{sub 2} and PMe{sub 3} that indicate that both {eta}{sup 5} {yields} {eta}{sup 3} ring slippage and metal to ring hydride migration occur more faciley than reductive elimination of H{sub 12}. (5) We have examined the reactions of heterocycles with (C{sub 5}Me{sub 5})Rh(PMe{sub 3})PhH and found that pyrrole and furan undergo C-H or N-H activation.

  12. Transition metal activation and functionalization of carbon-hydrogen bonds

    SciTech Connect

    Jones, W.D.

    1991-06-01

    This project is directed towards the continued investigation of the fundamental thermodynamic and kinetic factors that influence carbon-hydrogen bond activation at homogeneous transition metal centers. The project is also directed towards the conversion of hydrocarbons into functionalized products of potential use to the chemical industry. In the past two years, advances have been made in both understanding the interactions of hydrocarbons with metals and in the functionalization of hydrocarbons. Major advances that have been made include: (1) We have found that RhCl(PR{sub 3}){sub 2}(CNR) complexes can catalyze the insertion of isonitriles into the C-H bonds of arenes upon photolysis. (2) We have also examined reactions of a series of arenes with (C{sub 5}Me{sub 5})Rh(PMe{sub 3})PhH and begun to map out the kinetic and thermodynamic preferences for arene coordination. (3) We have begun to examine the reactions of rhodium isonitrile pyrazolylborates for alkane and arene C-H bond activation. A new, labile, carbodiimide precursor has been developed for these studies. (4) We have completed studies of the reactions of (C{sub 5}Me{sub 5)}Rh(PMe{sub 3})H{sub 2} with D{sub 2} and PMe{sub 3} that indicate that both {eta}{sup 5} {yields} {eta}{sup 3} ring slippage and metal to ring hydride migration occur more facilely than thermal reductive elimination of H{sub 2}. (5) We have examined the reactions of heterocycles with (C{sub 5}Me{sub 5})Rh(PMe{sub 3})PhH and found that pyrrole and furan undergo C-H or N-H activation. Thiophene, however, undergoes C-S bond oxidative addition, and the mechanism of activation has been shown to proceed through sulfur coordination prior to C-S insertion. 43 refs., 9 figs., 4 tabs.

  13. Structure, hydrogen bonding and thermal expansion of ammonium carbonate monohydrate.

    PubMed

    Fortes, A Dominic; Wood, Ian G; Alf, Dario; Hernndez, Eduardo R; Gutmann, Matthias J; Sparkes, Hazel A

    2014-12-01

    We have determined the crystal structure of ammonium carbonate monohydrate, (NH4)2CO3H2O, using Laue single-crystal diffraction methods with pulsed neutron radiation. The crystal is orthorhombic, space group Pnma (Z = 4), with unit-cell dimensions a = 12.047?(3), b = 4.453?(1), c = 11.023?(3)? and V = 591.3?(3)?(3) [?calc = 1281.8?(7)?kg?m(-3)] at 10?K. The single-crystal data collected at 10 and 100?K are complemented by X-ray powder diffraction data measured from 245 to 273?K, Raman spectra measured from 80 to 263?K and an athermal zero-pressure calculation of the electronic structure and phonon spectrum carried out using density functional theory (DFT). We find no evidence of a phase transition between 10 and 273?K; above 273?K, however, the title compound transforms first to ammonium sesquicarbonate monohydrate and subsequently to ammonium bicarbonate. The crystallographic and spectroscopic data and the calculations reveal a quite strongly hydrogen-bonded structure (EHB ? 30-40?kJ?mol(-1)), on the basis of H...O bond lengths and the topology of the electron density at the bond critical points, in which there is no free rotation of the ammonium cation at any temperature. The barrier to free rotation of the ammonium ions is estimated from the observed librational frequency to be ??36?kJ?mol(-1). The c-axis exhibits negative thermal expansion, but the thermal expansion behaviour of the a and b axes is ormal. PMID:25449618

  14. Structure, hydrogen bonding and thermal expansion of ammonium carbonate monohydrate

    PubMed Central

    Fortes, A. Dominic; Wood, Ian G.; Alfè, Dario; Hernández, Eduardo R.; Gutmann, Matthias J.; Sparkes, Hazel A.

    2014-01-01

    We have determined the crystal structure of ammonium carbonate monohydrate, (NH4)2CO3·H2O, using Laue single-crystal diffraction methods with pulsed neutron radiation. The crystal is orthorhombic, space group Pnma (Z = 4), with unit-cell dimensions a = 12.047 (3), b = 4.453 (1), c = 11.023 (3) Å and V = 591.3 (3) Å3 [ρcalc = 1281.8 (7) kg m−3] at 10 K. The single-crystal data collected at 10 and 100 K are complemented by X-ray powder diffraction data measured from 245 to 273 K, Raman spectra measured from 80 to 263 K and an athermal zero-pressure calculation of the electronic structure and phonon spectrum carried out using density functional theory (DFT). We find no evidence of a phase transition between 10 and 273 K; above 273 K, however, the title compound transforms first to ammonium sesquicarbonate monohydrate and subsequently to ammonium bicarbonate. The crystallographic and spectroscopic data and the calculations reveal a quite strongly hydrogen-bonded structure (E HB ≃ 30–40 kJ mol−1), on the basis of H⋯O bond lengths and the topology of the electron density at the bond critical points, in which there is no free rotation of the ammonium cation at any temperature. The barrier to free rotation of the ammonium ions is estimated from the observed librational frequency to be ∼ 36 kJ mol−1. The c-axis exhibits negative thermal expansion, but the thermal expansion behaviour of the a and b axes is ormal. PMID:25449618

  15. Merging allylic carbon-hydrogen and selective carbon-carbon bond activation

    NASA Astrophysics Data System (ADS)

    Masarwa, Ahmad; Didier, Dorian; Zabrodski, Tamar; Schinkel, Marvin; Ackermann, Lutz; Marek, Ilan

    2014-01-01

    Since the nineteenth century, many synthetic organic chemists have focused on developing new strategies to regio-, diastereo- and enantioselectively build carbon-carbon and carbon-heteroatom bonds in a predictable and efficient manner. Ideal syntheses should use the least number of synthetic steps, with few or no functional group transformations and by-products, and maximum atom efficiency. One potentially attractive method for the synthesis of molecular skeletons that are difficult to prepare would be through the selective activation of C-H and C-C bonds, instead of the conventional construction of new C-C bonds. Here we present an approach that exploits the multifold reactivity of easily accessible substrates with a single organometallic species to furnish complex molecular scaffolds through the merging of otherwise difficult transformations: allylic C-H and selective C-C bond activations. The resulting bifunctional nucleophilic species, all of which have an all-carbon quaternary stereogenic centre, can then be selectively derivatized by the addition of two different electrophiles to obtain more complex molecular architecture from these easily available starting materials.

  16. Design and Development of New Carbon-Based Sorbent Systems for an Effective Containment of Hydrogen

    SciTech Connect

    Alan C. Cooper

    2012-05-03

    This is a summary for work performed under cooperative agreement DE FC36 04GO14006 (Design and Development of New Carbon-based Sorbent Systems for an Effective Containment of Hydrogen). The project was directed to discover new solid and liquid materials that use reversible catalytic hydrogenation as the mechanism for hydrogen capture and storage. After a short period of investigation of solid materials, the inherent advantages of storing and transporting hydrogen using liquid-phase materials focused our attention exclusively on organic liquid hydrogen carriers (liquid carriers). While liquid carriers such as decalin and methylcyclohexane were known in the literature, these carriers suffer from practical disadvantages such as the need for very high temperatures to release hydrogen from the carriers and difficult separation of the carriers from the hydrogen. In this project, we were successful in using the prediction of reaction thermodynamics to discover liquid carriers that operate at temperatures up to 150 C lower than the previously known carriers. The means for modifying the thermodynamics of liquid carriers involved the use of certain molecular structures and incorporation of elements other than carbon into the carrier structure. The temperature decrease due to the more favorable reaction thermodynamics results in less energy input to release hydrogen from the carriers. For the first time, the catalytic reaction required to release hydrogen from the carriers could be conducted with the carrier remaining in the liquid phase. This has the beneficial effect of providing a simple means to separate the hydrogen from the carrier.

  17. Catalytic role of carbons in methane decomposition for CO- and CO2-free hydrogen generation

    NASA Astrophysics Data System (ADS)

    Huang, Liping; Santiso, Erik E.; Nardelli, Marco Buongiorno; Gubbins, Keith E.

    2008-06-01

    Decomposition of methane is an environmentally attractive approach to CO- and CO2-free hydrogen production. Using first principles calculations at the density functional theory level, our studies demonstrate that the defective carbons can be used as catalysts for methane decomposition, without the need for other catalysts, such as transition metals or oxides, and the catalytic sites can be regenerated by the deposition of carbon decomposed from methane, to make the hydrogen production a continuous process. Additionally, since no other gases are produced in the process, the cost of CO2 sequestration and hydrogen purification from CO contamination will be dramatically reduced.

  18. Hydrogen and elemental carbon production from natural gas and other hydrocarbons

    DOEpatents

    Detering, Brent A.; Kong, Peter C.

    2002-01-01

    Diatomic hydrogen and unsaturated hydrocarbons are produced as reactor gases in a fast quench reactor. During the fast quench, the unsaturated hydrocarbons are further decomposed by reheating the reactor gases. More diatomic hydrogen is produced, along with elemental carbon. Other gas may be added at different stages in the process to form a desired end product and prevent back reactions. The product is a substantially clean-burning hydrogen fuel that leaves no greenhouse gas emissions, and elemental carbon that may be used in powder form as a commodity for several processes.

  19. Analysis of diffential absorption lidar technique for measurements of anhydrous hydrogen chloride from solid rocket motors using a deuterium fluoride laser

    NASA Technical Reports Server (NTRS)

    Bair, C. H.; Allario, F.

    1977-01-01

    An active optical technique (differential absorption lidar (DIAL)) for detecting, ranging, and quantifying the concentration of anhydrous HCl contained in the ground cloud emitted by solid rocket motors (SRM) is evaluated. Results are presented of an experiment in which absorption coefficients of HCl were measured for several deuterium fluoride (DF) laser transitions demonstrating for the first time that a close overlap exists between the 2-1 P(3) vibrational transition of the DF laser and the 1-0 P(6) absorption line of HCl, with an absorption coefficient of 5.64 (atm-cm) to the -1 power. These measurements show that the DF laser can be an appropriate radiation source for detecting HCl in a DIAL technique. Development of a mathematical computer model to predict the sensitivity of DIAL for detecting anhydrous HCl in the ground cloud is outlined, and results that assume a commercially available DF laser as the radiation source are presented.

  20. Nature of the Bound States of Molecular Hydrogen in Carbon Nanohorns

    SciTech Connect

    Fernandez-Alonso, F.; Bermejo, F. J.; Cabrillo, C.; Leon, V.; Saboungi, M. L.

    2007-05-25

    The effects of confining molecular hydrogen within carbon nanohorns are studied via high-resolution quasielastic and inelastic neutron spectroscopies. Both sets of data are remarkably different from those obtained in bulk samples in the liquid and crystalline states. At temperatures where bulk hydrogen is liquid, the spectra of the confined sample show an elastic component indicating a significant proportion of immobile molecules as well as distinctly narrower quasielastic line widths and a strong distortion of the line shape of the para{yields}ortho rotational transition. The results show that hydrogen interacts far more strongly with such carbonous structures than it does to carbon nanotubes, suggesting that nanohorns and related nanostructures may offer significantly better prospects as lightweight media for hydrogen storage applications.

  1. Performance of allotropic forms of carbon in hydrogen at high temperatures

    SciTech Connect

    Schweitzer, D.G.; Sastre, C.

    1991-01-02

    There is considerable evidence that at temperatures near 3000{degree}K the mass loss of many graphites in at least pressure (1 atm) hydrogen cannot be accounted for by the formation of methane, acetylene, or other hydrocarbons. Although some data indicate that some graphitic carbons exhibit particulate mass loss in vacuum and inert gas, there is sufficient data comparing mass loss in hydrogen and inert environments to determine if hydrogen catalyzes particulate mass loss through evaporation in some materials, or if heavy inert gases reduce evaporation rates. Data pertinent to these effects are particularly important for the high temperature heat treated glassy carbons that appear resistant to both chemical oxidation and abnormally high mass loss due to particulate emission. At the present time, it is our belief that some factors of carbon may have the potential to retain integrity for short times in hydrogen at temperatures near 3000{degree}K. 29 refs., 5 figs., 2 tabs.

  2. The Path of Carbon in Photosynthesis IX. Photosynthesis, Photoreduction, and the Hydrogen-Oxygen-Carbon Dioxide Dark Reaction

    DOE R&D Accomplishments Database

    Badin, E. J.; Calvin, M.

    1950-02-01

    A comparison of the rates of fixation of Carbon 14 dioxide in algae for the processes of photosynthesis, photoreduction and the hydrogen-oxygen-carbon dioxide dark reaction has been made. For the same series of experiments, rates of incorporation of tracer carbon into the separate soluble components using the radiogram method have been determined. The mechanism of carbon dioxide uptake has been shown to occur via two distinct paths. In all cases studied, essentially the same compounds appear radioactive. The distribution with time, however, differs markedly.

  3. Measuring the primordial deuterium abundance during the cosmic dark ages.

    PubMed

    Sigurdson, Kris; Furlanetto, Steven R

    2006-09-01

    We discuss how measurements of fluctuations in the absorption of cosmic microwave background photons by neutral gas at redshifts z approximately 7-200 could reveal the primordial deuterium abundance of the Universe. The strength of the cross-correlation of brightness-temperature fluctuations in the redshifted 21-cm line of hydrogen with those in the redshifted 92-cm line of deuterium is proportional to the value of the deuterium-to-hydrogen ratio [D/H] fixed during big bang nucleosynthesis. Although challenging, this measurement would provide the cleanest possible determination of [D/H], free from contamination by structure formation processes at lower redshifts. We additionally report our result for the thermal spin-change cross section in deuterium-hydrogen scattering. PMID:17026353

  4. Direct and reversible hydrogenation of CO2 to formate by a bacterial carbon dioxide reductase.

    PubMed

    Schuchmann, K; Müller, V

    2013-12-13

    Storage and transportation of hydrogen is a major obstacle for its use as a fuel. An increasingly considered alternative for the direct handling of hydrogen is to use carbon dioxide (CO2) as an intermediate storage material. However, CO2 is thermodynamically stable, and developed chemical catalysts often require high temperatures, pressures, and/or additives for high catalytic rates. Here, we present the discovery of a bacterial hydrogen-dependent carbon dioxide reductase from Acetobacterium woodii directly catalyzing the hydrogenation of CO2. We also demonstrate a whole-cell system able to produce formate as the sole end product from dihydrogen (H2) and CO2 as well as syngas. This discovery opens biotechnological alternatives for efficient CO2 hydrogenation either by using the isolated enzyme or by employing whole-cell catalysis. PMID:24337298

  5. Sidewall fluorination and hydrogenation of single-walled carbon nanotubes: a density functional theory study

    NASA Astrophysics Data System (ADS)

    Yu, Li-Mei; Zhao, Ji-Jun; Qiu, Jie-Shan; Hao, Ce; Wang, Hai

    2009-09-01

    The fluorination and hydrogenation reactions on (6, 6) and (10, 0) single-walled carbon nanotubes (SWCNTs) have been examined via computing the reaction energy for the chemisorption. The examined nanotubes have comparable lengths and diameters, with or without Stone-Wales defects on the sidewall. The two fluorine or hydrogen atoms are anchored to the external walls of the SWCNTs. The computed chemisorption energies of these virtual reactions reveal that the fluorination and hydrogenation of the nanotubes are moderately sensitive to the nanotube chirality and the sidewall topology, and the (10, 0) SWCNT with Stone-Wales defect can be easily fluorinated and hydrogenated.

  6. A trimodal porous carbon as an effective catalyst for hydrogen production by methane decomposition.

    PubMed

    Shen, Yi; Lua, Aik Chong

    2016-01-15

    A new type of porous carbon with an interconnected trimodal pore system is synthesized by a nanocasting method using nanoparticulated bimodal micro-mesoporous silica particles as the template. The synthesized template and carbon material are characterized using transmission electron microscopy (TEM), field emission electron scanning microscopy (FESEM) and nitrogen adsorption-desorption test. The synthesized carbon material has an extremely high surface area, a large pore volume and an interconnected pore structure, which could provide abundant active sites and space for chemical reactions and minimize the diffusion resistance of the reactants. The resulting carbon is used as the catalyst for hydrogen production by the thermal decomposition of methane. The catalytic results show that the as-synthesized carbon in this study produces much higher methane conversion and hydrogen yield than the commercial carbon materials. PMID:26433477

  7. Carbide-Derived Carbons with Tunable Porosity Optimized for Hydrogen Storage

    SciTech Connect

    Fisher, John E.; Gogotsi, Yury; Yildirim, Taner

    2010-01-07

    On-board hydrogen storage is a key requirement for fuel cell-powered cars and trucks. Porous carbon-based materials can in principle adsorb more hydrogen per unit weight at room temperature than liquid hydrogen at -176 oC. Achieving this goal requires interconnected pores with very high internal surface area, and binding energies between hydrogen and carbon significantly enhanced relative to H2 on graphite. In this project a systematic study of carbide-derived carbons, a novel form of porous carbon, was carried out to discover a high-performance hydrogen sorption material to meet the goal. In the event we were unable to improve on the state of the art in terms of stored hydrogen per unit weight, having encountered the same fundamental limit of all porous carbons: the very weak interaction between H2 and the carbon surface. On the other hand we did discover several strategies to improve storage capacity on a volume basis, which should be applicable to other forms of porous carbon. Further discoveries with potentially broader impacts include • Proof that storage performance is not directly related to pore surface area, as had been previously claimed. Small pores (< 1.5 nm) are much more effective in storing hydrogen than larger ones, such that many materials with large total surface areas are sub-par performers. • Established that the distribution of pore sizes can be controlled during CDC synthesis, which opens the possibility of developing high performance materials within a common family while targeting widely disparate applications. Examples being actively pursued with other funding sources include methane storage, electrode materials for batteries and supercapacitors with record high specific capacitance, and perm-selective membranes which bind cytokines for control of infections and possibly hemodialysis filters.

  8. Rhodium-catalyzed hydrogenation of carbon dioxide to formic acid

    SciTech Connect

    Tsai, Jing-Cherng; Nicholas, K.M.

    1992-06-17

    The complex [Rh(NBD)(PMe{sub 2}Ph){sub 3}]BF{sub 4} (2; NBD = norbornadiene) has been found to serve as a precatalyst for the hydrogenation of carbon dioxide to formic acid at moderate temperatures in THF solution, with turnover numbers of 10-60/day. Water accelerates formic acid production, whereas PMe{sub 2}Ph is an inhibitor. Kinetic studies show that the rate of formic acid appearance in first order each in [2], pH{sub 2}, and p{sub CO2} in the range 50-300 psi (following prehydrogenation). In situ high-pressure IR and NMR experiments reveal that the addition of H{sub 2} to [Rh(NBD)(PMe{sub 2}Ph){sub 3}]BF{sub 4} (2) produces rhodium dihydride complexes [H{sub 2}Rh(PMe{sub 2}Ph){sub 3}(S)]BF{sub 4}(4, 5; S = H{sub 2}O, THF) and [H{sub 2}Rh(PMe{sub 2}Ph){sub 4}]BF{sub 4} (3). IR and NMR studies of the reaction of 3-5 with CO{sub 2} indicate that 3 is unreactive toward CO{sub 2} but that 4 and 5 insert CO{sub 2} to give species 6 and 7, formulated as formato complexes [HRh(S)(PMe{sub 2}Ph){sub 2}({eta}{sup 2}-OCHO)]BF{sub 4}, respectively; complexes 6 and 7 are also detected under catalytic conditions by IR spectroscopy. Aquo dihydride complex 4 has been found to insert CO{sub 2} more rapidly than the THF complex 5. [H{sub 2}Rh(PMe{sub 2}Ph){sub 3}(S)]BF{sub 4} (4, 5) also catalyze the decomposition of formic acid to CO{sub 2} and H{sub 2}. Combined kinetic and spectroscopic results suggest that reductive elimination of formic acid from the intermediate formato complexes is the rate-limiting step in the catalytic cycle. 30 refs., 11 figs., 1 tab.

  9. Transition metal activation and functionalization of carbon-hydrogen bonds

    SciTech Connect

    Jones, W.D.

    1992-06-01

    We are investigating the fundamental thermodynamic and kinetic factors that influence carbon-hydrogen bond activation at homogeneous transition metal centers and the conversion of hydrocarbons into functionalized products of potential use to the chemical industry. Advances have been made in both understanding the interactions of hydrocarbons with metals and in the functionalization of hydrocarbons. We have found that RhCl(PR{sub 3}){sub 2}(CNR) complexes can catalyze the insertion of isonitriles into the C-H bonds or arenes upon photolysis. The mechanism of these reactions was found to proceed by way of initial phosphine dissociation, followed by C-H activation and isonitrile insertion. We have also examined reactions of a series of arenes with (C{sub 5}Me{sub 5})Rh(PMe{sub 3})PhH and begun to map out the kinetic and thermodynamic preferences for arene coordination. The effects of resonance, specifically the differences in the Hueckel energies of the bound vs free ligand, are now believed to fully control the C-H activation/{eta}{sup 2}-coordination equilibria. We have begun to examine the reactions of rhodium isonitrile pyrazolylborates for alkane and arene C-H bond activation. A new, labile, carbodiimide precursor has been developed for these studies. We have completed studies of the reactions of (C{sub 5}Me{sub 5})Rh(PMe{sub 3})H{sub 2} with D{sub 2} and PMe{sub 3} that indicate that both {eta}{sup 5} {yields} {eta}{sup 3} ring slippage and metal to ring hydride migration occur more facilely than thermal reductive elimination of H{sub 2}. We have examined the reactions of heterocycles with (C{sub 5}Me{sub 5})Rh(PMe{sub 3})PhH and found that pyrrole and furan undergo C-H or N-H activation. Thiophene, however, undergoes C-S bond oxidative addition, and the mechanism of activation has been shown to proceed through sulfur coordination prior to C-S insertion.

  10. Continuous monitoring of hydrogen and carbon dioxide at Stromboli volcano

    NASA Astrophysics Data System (ADS)

    Di Martino, Roberto M. R.; Camarda, Marco; Gurrieri, Sergio; Valenza, Mariano

    2015-04-01

    Geochemical monitoring of fumarole and soil gases is a powerful tool for volcano surveillance, for investigating the subsurface magma dynamics, and for hazard assessment in volcanic areas. The monitoring of both carbon dioxide (CO2) flux, and hydrogen (H2) concentration in active volcanic areas helps to improve the understanding of the processes linking the surface gas emissions, the chemistry of the magmatic gases, and the volcanic activity. The CO2 flux measurement is a routine technique for volcano monitoring purposes, because of CO2 is the second-abundant component of the gas phase in silicate magmas, attaining saturation at the mantle to deep crustal level. The H2 concentration has provided indications concerning the oxygen fugacity of magmatic gases, a parameter that changes over a wide range of low values (10-16 - 10-8 bar), and affects the redox state of multivalent elements. This study reports on the use a tailor-made automatic system developed for continuous monitoring purposes of H2 concentration and CO2 flux in the summit area of Stromboli volcano (Aeolian islands). The automatic device consists of an H2-selective electrochemical sensor, and two IR-spectrophotometers for measuring the CO2 flux in agreement with the dynamic concentration method. The data collected by the automatic system deployed at Stromboli from 19 May 2009 to 15 December 2010 are presented herein. The data processing provides a better understanding of the relationships between the evolution of the low temperature fumarolic emissions, and the volcanic activity. The results of the data analysis indicates that the high frequency variations exhibited by CO2 flux and H2 concentration are positively correlated with the eruptive activity of Stromboli, typically changing on time scale of hours or days. Furthermore, the investigation of the relationships between CO2 flux and H2 concentration provides an evaluation of the depth of the degassing source, by which the gas mixture containing H2 and CO2 starts to move through the rock fractures. Our data indicates that the depth of the degassing source ranges between 2 and 4 km in the volcano plumbing system, in agreement with the magma storage zone that has been proposed by other geochemical, volcanological, petrological and geophysical investigations.

  11. Carbon, Hydrogen, and Oxygen Isotope Ratios of Cellulose from Plants Having Intermediary Photosynthetic Modes 1

    PubMed Central

    Sternberg, Leonel O'Reilly; Deniro, Michael J.; Ting, Irwin P.

    1984-01-01

    Carbon and hydrogen isotope ratios of cellulose nitrate and oxygen isotope ratios of cellulose from species of greenhouse plants having different photosynthetic modes were determined. When hydrogen isotope ratios are plotted against carbon isotope ratios, four clusters of points are discernible, each representing different photosynthetic modes: C3 plants, C4 plants, CAM plants, and C3 plants that can shift to CAM or show the phenomenon referred to as CAM-cycling. The combination of oxygen and carbon isotope ratios does not distinguish among the different photosynthetic modes. Analysis of the carbon and hydrogen isotope ratios of cellulose nitrate should prove useful for screening different photosynthetic modes in field specimens that grew near one another. This method will be particularly useful for detection of plants which show CAM-cycling. PMID:16663360

  12. Synthesis of Sulfur-Containing Heterocycles through Oxidative CarbonHydrogen Bond Functionalization

    PubMed Central

    Cui, Yubo; Floreancig, Paul E.

    2012-01-01

    Vinyl sulfides react rapidly and efficiently with 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (DDQ) to form ?,?-unsaturated thiocarbenium ions through oxidative carbonhydrogen bond cleavage. These electrophiles couple with appended ?-nucleophiles to yield sulfur-containing heterocycles through carboncarbon bond formation. Several nucleophiles are compatible with the procedure and the reactions generally proceed through readily-predictable transition states. PMID:22420412

  13. SPITZER OBSERVATIONS OF SHOCK-EXCITED HYDROGEN DEUTERIDE IN IC 443C, HH 7, AND HH 54: PROBING THE GAS-PHASE DEUTERIUM ABUNDANCE IN THE DENSE INTERSTELLAR MEDIUM

    SciTech Connect

    Yuan Yuan; Neufeld, David A.; Sonnentrucker, Paule; Melnick, Gary J.; Watson, Dan M.

    2012-07-10

    We present and analyze observations-carried out using the Infrared Spectrograph (IRS) on the Spitzer Space Telescope-of the R(3) and R(4) pure rotational lines of hydrogen deuteride (HD) detected from shock-heated material associated with the supernova remnant IC 443C and with the Herbig-Haro objects HH 7 and HH 54. Assuming a continuous temperature distribution for gas observed along the sight lines, we have constrained the gas density to be in the {approx}10{sup 3}-10{sup 4} cm{sup -3} range, using both spectroscopic data for H{sub 2}, HD, and CO from IRS and from the Infrared Space Observatory (ISO), as well as photometric data from Spitzer's Infrared Array Camera. The derived HD abundance relative to H{sub 2} is quite sensitive to the assumed excitation conditions in the emitting gas. Assuming that HD accounts for all gas-phase deuterium in the emitting material, and using all the available spectroscopic data to constrain the excitation conditions, we obtained gas-phase deuterium abundances [D/H]{sub gas} of 0.95{sup +0.54}{sub -0.27} Multiplication-Sign 10{sup -5} and 0.87{sup +0.31}{sub -0.27} Multiplication-Sign 10{sup -5} (statistical errors only) for IC 443C and HH 54, respectively. The uncertainties in the HD abundance are dominated by systematic effects related to the poorly known excitation conditions, and more accurate estimates of the HD abundance in shocked molecular clouds will require measurements of the emission in additional HD rotational transitions.

  14. Wafer Mapping Using Deuterium Enhanced Defect Characterization

    NASA Astrophysics Data System (ADS)

    Hossain, K.; Holland, O. W.; Hellmer, R.; Vanmil, B.; Bubulac, L. O.; Golding, T. D.

    2010-07-01

    Deuterium (as well as other hydrogen isotopes) binds with a wide range of morphological defects in semiconductors and, as such, becomes distributed similarly to those defects. Thus, the deuterium profile within the sample serves as the basis of a technique for defect mapping known as amethyst wafer mapping (AWM). The efficiency of this technique has been demonstrated by evaluation of ion-induced damage in implanted Si, as well as as-grown defects in HgCdTe (MCT) epilayers. The defect tagging or decoration capability of deuterium is largely material independent and applicable to a wide range of defect morphologies. A number of analytical techniques including ion channeling and etch pit density measurements were used to evaluate the AWM results.

  15. Preparation and characterization of ordered porous carbons for increasing hydrogen storage behaviors

    SciTech Connect

    Lee, Seul-Yi; Park, Soo-Jin

    2011-10-15

    We prepared ordered porous carbons (PCs) by using a replication method that had well-organized mesoporous silica as a template with various carbonization temperatures in order to investigate the possibility of energy storage materials. The microstructure and morphologies of the samples are characterized by XRD, TEM, and FT-Raman spectroscopy. N{sub 2} adsorption isotherms are analyzed by the t-plot method, as well as the BET and the H-K method in order to characterize the specific surface area, pore volume, and pore size distribution of the samples, respectively. The capacity of the hydrogen adsorption of the samples is evaluated by BEL-HP at 77 K and 1 bar. From the results, we are able to confirm that the synthesis of the samples can be accurately governed by the carbonization temperature, which is one of the effective parameters for developing the textural properties of the carbon materials, which affects the behaviors of the hydrogen storage. - Graphical abstract: It is described that the considerable long-range ordering and the presence of mono-dimensional aligned channels between the two aligned nanorods of the porous framework from the SBA-15 was retained in the T-950 sample during the carbonization process. Highlights: > Ordered porous carbons (PCs) are synthesized with various carbonization temperatures by using a replication method. > Carbonization temperature plays an important role in shrinking the micropores during the carbonization process of PCs. > The textural and structural properties of the PCs are good parameters for enhancing the hydrogen storage capacity.

  16. Hydrogen Storage Property of Nanoporous Carbon Materials Prepared from Rice Husks

    NASA Astrophysics Data System (ADS)

    Toda, Ikumi; Ono, Hiroki; Takahata, Tomokazu; Ohshio, Shigeo; Akasaka, Hiroki; Himeno, Syuuji; Kokubu, Toshinori; Saitoh, Hidetoshi

    Nanoporous carbon materials for use as hydrogen storage materials were fabricated from rice husks. Rice husks from agricultural waste changed to porous carbon materials by heat treating and KOH activation. The specific surface area of the porous carbon materials increased from 11 to 2061 m2/g as the KOH weight ratio increased. The pore volume of the materials also increased from 0.01 to 0.88 cm3/g by KOH activation. The pore sizes of the activated porous carbon materials were distributed around 0.6 and 1.2 nm at micro-pore ranges. These results suggested porous carbon material have micro-pore structure. The hydrogen storage capacity of the porous carbon materials showed a 0.62 wt.% at 298 K under 12 MPa. The fabrication of hydrogen storage materials from agricultural waste rice husks was achieved. The results indicate that porous carbon materials synthesized from rice husks have micro-pore structures which influence their hydrogen storage capabilities.

  17. An international multi-laboratory investigation of carbon-based hydrogen sorbent materials

    NASA Astrophysics Data System (ADS)

    Hurst, Katherine E.; Parilla, Philip A.; O'Neill, Kevin J.; Gennett, Thomas

    2016-01-01

    New materials are needed to achieve the hydrogen storage targets set out by the US Department of Energy for fuel cell vehicular applications. In order to enable the pathway toward this discovery, precise and accurate characterization of the hydrogen storage performance of these materials is needed. Determining the precise and accurate hydrogen storage capacity of materials requires rigorous attention to detailed experimental parameters and methodology. Slight errors in even small experimental details can result in a large deviation in the determination of the material's true characteristics. Here, we compare measurements of the gravimetric excess hydrogen uptake capacities for two different carbon sorbent materials measured by different laboratories at ambient and liquid N2 temperatures. The participants for this study consist of research laboratories led by experienced scientists in the hydrogen storage field. This collaborative evaluation of standard sorbents illustrated considerable reproducibility over a broad range of materials' hydrogen sorption gravimetric capacities.

  18. Carbon Dioxide in Exoplanetary Atmospheres: Rarely Dominant Compared to Carbon Monoxide and Water in Hot, Hydrogen-dominated Atmospheres

    NASA Astrophysics Data System (ADS)

    Heng, Kevin; Lyons, James R.

    2016-02-01

    We present a comprehensive study of the abundance of carbon dioxide in exoplanetary atmospheres in hot, hydrogen-dominated atmospheres. We construct novel analytical models of systems in chemical equilibrium that include carbon monoxide, carbon dioxide, water, methane and acetylene and relate the equilibrium constants of the chemical reactions to temperature and pressure via the tabulated Gibbs free energies. We prove that such chemical systems may be described by a quintic equation for the mixing ratio of methane. By examining the abundances of these molecules across a broad range of temperatures (spanning equilibrium temperatures from 600 to 2500 K), pressures (via temperature–pressure profiles that explore albedo and opacity variations) and carbon-to-oxygen ratios, we conclude that carbon dioxide is subdominant compared to carbon monoxide and water. Atmospheric mixing does not alter this conclusion if carbon dioxide is subdominant everywhere in the atmosphere. Carbon dioxide and carbon monoxide may attain comparable abundances if the metallicity is greatly enhanced, but this property is negated by temperatures above 1000 K. For hydrogen-dominated atmospheres, our generic result has the implication that retrieval studies may wish to set the subdominance of carbon dioxide as a prior of the calculation and not let its abundance completely roam free as a fitting parameter, because it directly affects the inferred value of the carbon-to-oxygen ratio and may produce unphysical conclusions. We discuss the relevance of these implications for the hot Jupiter WASP-12b and suggest that some of the previous results are chemically impossible. The relative abundance of carbon dioxide to acetylene is potentially a sensitive diagnostic of the carbon-to-oxygen ratio.

  19. Contrasting H-mode behaviour with deuterium fuelling and nitrogen seeding in the all-carbon and metallic versions of JET

    NASA Astrophysics Data System (ADS)

    Maddison, G. P.; Giroud, C.; Alper, B.; Arnoux, G.; Balboa, I.; Beurskens, M. N. A.; Boboc, A.; Brezinsek, S.; Brix, M.; Clever, M.; Coelho, R.; Coenen, J. W.; Coffey, I.; da Silva Aresta Belo, P. C.; Devaux, S.; Devynck, P.; Eich, T.; Felton, R. C.; Flanagan, J.; Frassinetti, L.; Garzotti, L.; Groth, M.; Jachmich, S.; Jrvinen, A.; Joffrin, E.; Kempenaars, M. A. H.; Kruezi, U.; Lawson, K. D.; Lehnen, M.; Leyland, M. J.; Liu, Y.; Lomas, P. J.; Lowry, C. G.; Marsen, S.; Matthews, G. F.; McCormick, G. K.; Meigs, A. G.; Morris, A. W.; Neu, R.; Nunes, I. M.; Oberkofler, M.; Rimini, F. G.; Saarelma, S.; Sieglin, B.; Sips, A. C. C.; Sirinelli, A.; Stamp, M. F.; van Rooij, G. J.; Ward, D. J.; Wischmeier, M.; EFDA Contributors, JET

    2014-07-01

    The former all-carbon wall on JET has been replaced with beryllium in the main torus and tungsten in the divertor to mimic the surface materials envisaged for ITER. Comparisons are presented between type I H-mode characteristics in each design by examining respective scans over deuterium fuelling and impurity seeding, required to ameliorate exhaust loads both in JET at full capability and in ITER. Attention is focused upon a common high-triangularity, single-null divertor configuration at 2.5 MA, q95 ? 3.5 yielding the most robust all-C performance. Contrasting results between the alternative linings are found firstly in unseeded plasmas, for which purity is improved and intrinsic radiation reduced in the ITER-like wall (ILW) but normalized energy confinement is ?30% lower than in all-C counterparts, owing to a commensurately lower (electron) pedestal temperature. Divertor recycling is also radically altered, with slower, inboard-outboard asymmetric transients at ELMs and spontaneous oscillations in between them. Secondly, nitrogen seeding elicits opposite responses in the ILW to all-C experience, tending to raise plasma density, reduce ELM frequency, and above all to recover (electron) pedestal pressure, hence global confinement, almost back to previous levels. A hitherto unrecognized role of light impurities in pedestal stability and dynamics is consequently suggested. Thirdly, while heat loads on the divertor outboard target between ELMs are successfully reduced in proportion to the radiative cooling and ELM frequency effects of N in both wall environments, more surprisingly, average power ejected by ELMs also declines in the same proportion for the ILW. Detachment between transients is simultaneously promoted. Finally, inter-ELM W sources in the ILW divertor tend to fall with N input, although core accumulation possibly due to increased particle confinement still leads to significantly less steady conditions than in all-C plasmas. This limitation of ILW H-modes so far will be readdressed in future campaigns to continue progress towards a fully integrated scenario suitable for D-T experiments on JET and for baseline operation on ITER. The diverse changes in behaviour between all-C and ILW contexts demonstrate essentially the strong impact which boundary conditions and intrinsic impurities can have on tokamak-plasma states.

  20. Compound-Specific Carbon, Nitrogen, and Hydrogen Isotopic Ratios for Amino Acids in CM and CR Chondrites and their use in Evaluating Potential Formation Pathways

    NASA Technical Reports Server (NTRS)

    Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.

    2012-01-01

    Stable hydrogen, carbon, and nitrogen isotopic ratios (oD, 013C, and olSN) of organic compounds can revcal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1I2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CRZ Graves Nunataks (GRA) 95229, CRZ Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing ODC and increasing oD with increasing carbon number in the aH, (l-NH2 amino acids that correspond to predictions made for formation via Streckercyanohydrin synthesis. We also observe light ODC signatures for -alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-ro-amino acids). Higher deuterium enrichments are observed in amethyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than CM chondrites, reflecting different parent-body chemistry.

  1. Compound-specific carbon, nitrogen, and hydrogen isotopic ratios for amino acids in CM and CR chondrites and their use in evaluating potential formation pathways

    NASA Astrophysics Data System (ADS)

    Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.

    2012-09-01

    Stable hydrogen, carbon, and nitrogen isotopic ratios (δD, δ13C, and δ15N) of organic compounds can reveal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1/2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CR2 Graves Nunataks (GRA) 95229, CR2 Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing δ13C and increasing δD with increasing carbon number in the α-H, α-NH2 amino acids that correspond to predictions made for formation via Strecker-cyanohydrin synthesis. We also observe light δ13C signatures for β-alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-ω-amino acids). Higher deuterium enrichments are observed in α-methyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than in CM chondrites, reflecting different parent-body chemistry.

  2. Hydrogen venting characteristics of commercial carbon-composite filters and applications to TRU waste

    SciTech Connect

    Callis, E.L.; Marshall, R.S.; Cappis, J.H.

    1997-04-01

    The generation of hydrogen (by radiolysis) and of other potentially flammable gases in radioactive wastes which are in contact with hydrogenous materials is a source of concern, both from transportation and on-site storage considerations. Because very little experimental data on the generation and accumulation of hydrogen was available in actual waste materials, work was initiated to experimentally determine factors affecting the concentration of hydrogen in the waste containers, such as the hydrogen generation rate, (G-values) and the rate of loss of hydrogen through packaging and commercial filter-vents, including a new design suitable for plastic bags. This report deals only with the venting aspect of the problem. Hydrogen venting characteristics of two types of commercial carbon-composite filter-vents, and two types of PVC bag closures (heat-sealed and twist-and-tape) were measured. Techniques and equipment were developed to permit measurement of the hydrogen concentration in various layers of actual transuranic (TRU) waste packages, both with and without filter-vents. A test barrel was assembled containing known configuration and amounts of TRU wastes. Measurements of the hydrogen in the headspace verified a hydrogen release model developed by Benchmark Environmental Corporation. These data were used to calculate revised wattage Emits for TRU waste packages incorporating the new bag filter-vent.

  3. Pumping carbon and hydrogen out of the ground using the hydrocarb process

    SciTech Connect

    Steinberg, M.; Grohse, E.W.

    1989-07-01

    A new concept for UCG is proposed in which underground coal seams are hydrogenated with a hydrogen-rich gas in an injection-well to form a methane-rich production-well gas stream. The exit methane-rich gas stream, is decomposed to carbon black and a hydrogen-rich gas stream above ground. Part of the hydrogen-rich gas stream is withdrawn as a clean product gas and the remainder is recycled underground to, once again, hydrogenate the coal underground. Unlike conventional steam gasification of coal, which is an endothermic process requiring either oxygen or air to combust with coal underground to provide the endothermic heat of reaction, the hydrogenation of coal underground is exothermic which maintains the temperature of the bed in the reaction between the coal and hydrogen to methane. This process thus, in effect, pumps carbon fuel out of the ground with the use of hydrogen. Furthermore, it is a much safer system to operate than the steam-oxygen gasification of underground coal. 2 refs., 2 figs.

  4. Selective Catalytic Oxidation of Hydrogen Sulfide on Activated Carbons Impregnated with Sodium Hydroxide

    SciTech Connect

    Schwartz, Viviane; Baskova, Svetlana; Armstrong, Timothy R.

    2009-01-01

    Two activated carbons of different origin were impregnated with the solution of sodium hydroxide (NaOH) of various concentrations up to 10 wt %, and the effect of impregnation on the catalytic performance of the carbons was evaluated. The catalytic activity was analyzed in terms of the capacity of carbons for hydrogen sulfide (H2S) conversion and removal from hydrogen-rich fuel streams and the emission times of H2S and the products of its oxidation [e.g., sulfur dioxide (SO2) and carbonyl sulfide (COS)]. The results of impregnation showed a significant improvement in the catalytic activity of both carbons proportional to the amount of NaOH introduced. NaOH introduces hydroxyl groups (OH-) on the surface of the activated carbon that increase its surface reactivity and its interaction with sulfur-containing compounds.

  5. Effects of Microstructure of Carbon Nanofibers for Amperometric Detection of Hydrogen Peroxide

    SciTech Connect

    Li, Zhizhou; Cui, Xiaoli; Zheng, Junsheng; Wang, Qingfei; Lin, Yuehe

    2007-08-10

    Carbon nanofibers (CNFs) with different microstructures, including platelet-carbon nanofibers (PCNFs), fish-bone-carbon nanofibers (FCNFs), and tube-carbon nanofibers (TCNFs), were synthesized, characterized, and evaluated for electrochemical sensing of hydrogen peroxide. The CNFs studied here can show several microstructures in which various stacked morphologies and their sizes and graphite-layer ordering can be well controlled. Glassy carbon (GC) electrodes modified by CNFs were fabricated and compared for amperometric detection of hydrogen peroxide. Sensors of PCNFs/GC, FCNFs/GC, and TCNFs/GC were used in the amperometric detection of H2O2 in a solution of 0.05 M phosphate buffered saline solution (pH 7.4).

  6. Suppression of hydrogenated carbon film deposition and hydrogen isotope retention by nitrogen addition into cold remote H/D and CH4 mixture plasmas

    NASA Astrophysics Data System (ADS)

    Iida, K.; Notani, M.; Uesugi, Y.; Tanaka, Y.; Ishijima, T.

    2015-08-01

    Control of tritium retention and its removal from the first wall of future fusion devices are one of the most crucial issues for safety and effective use for fuel. Nitrogen addition into remote edge plasmas has been considered and tested as an effective method for suppression of carbon film deposition and reduction of hydrogen isotope absorption in the deposited films. In this paper we have investigated the scavenger effects of nitrogen injected into low temperature D2/CH4 plasmas on hydrogenated carbon film growth using a small helical device. The result of the deposition shows that the key reactive particles with CN and ND(H) bonds to suppression of hydrogenated carbon film growth and hydrogen isotope absorption are much slowly generated compared with hydrocarbon particles such as CD(H)x and C2D(H)x. This may be due to the slow atomic nitrogen diffusion into hydrogenated carbon layer and the chemical equilibrium between nitrogen absorption.

  7. Tailoring of nanoscale porosity in carbide-derived carbons for hydrogen storage.

    PubMed

    Gogotsi, Yury; Dash, Ranjan K; Yushin, Gleb; Yildirim, Taner; Laudisio, Giovanna; Fischer, John E

    2005-11-23

    The poor performance of hydrogen storage materials continues to hinder development of fuel cell-powered automobiles. Nanoscale carbons, in particular (activated carbon, exfoliated graphite, fullerenes, nanotubes, nanofibers, and nanohorns), have not fulfilled their initial promise. Here we show that carbon materials can be rationally designed for H2 storage. Carbide-derived carbons (CDC), a largely unknown class of porous carbons, are produced by high-temperature chlorination of carbides. Metals and metalloids are removed as chlorides, leaving behind a collapsed noncrystalline carbon with up to 80% open pore volume. The detailed nature of the porosity-average size and size distribution, shape, and total specific surface area (SSA)-can be tuned with high sensitivity by selection of precursor carbide (composition, lattice type) and chlorination temperature. The optimum temperature is bounded from below by thermodynamics and kinetics of chlorination reactions and from above by graphitization, which decreases SSA and introduces H2-sorbing surfaces with binding energies too low to be useful. Intuitively, pores of different size and shape should not contribute equally to hydrogen storage. By correlating pore properties with 77 K H2 isotherms from a wide variety of CDCs, we experimentally confirm that gravimetric hydrogen storage capacity normalized to total pore volume is optimized in materials with primarily micropores ( approximately 1 nm) rather than mesopores. Thus, in agreement with theoretical predictions, a narrow size distribution of small pores is desirable for storing hydrogen, while large pores merely degrade the volumetric storage capacity. PMID:16287270

  8. Process for producing methane from gas streams containing carbon monoxide and hydrogen

    DOEpatents

    Frost, Albert C. (Congers, NY)

    1980-01-01

    Carbon monoxide-containing gas streams are passed over a catalyst capable of catalyzing the disproportionation of carbon monoxide so as to deposit a surface layer of active surface carbon on the catalyst essentially without formation of inactive coke thereon. The surface layer is contacted with steam and is thus converted to methane and CO.sub.2, from which a relatively pure methane product may be obtained. While carbon monoxide-containing gas streams having hydrogen or water present therein can be used only the carbon monoxide available after reaction with said hydrogen or water is decomposed to form said active surface carbon. Although hydrogen or water will be converted, partially or completely, to methane that can be utilized in a combustion zone to generate heat for steam production or other energy recovery purposes, said hydrogen is selectively removed from a CO--H.sub.2 -containing feed stream by partial oxidation thereof prior to disproportionation of the CO content of said stream.

  9. Functionalization of carbon-based nanostructures with light transition-metal atoms for hydrogen storage

    NASA Astrophysics Data System (ADS)

    Durgun, E.; Ciraci, S.; Yildirim, T.

    2008-02-01

    In a recent letter [T. Yildirim and S. Ciraci, Phys. Rev. Lett. 94, 175501 (2005)], the unusual hydrogen storage capacity of Ti decorated carbon nanotubes has been revealed. The present paper extends this study further to investigate the hydrogen uptake by light transition-metal atoms decorating various carbon-based nanostructures in different types of geometry and dimensionality, such as carbon linear chain, graphene, and nanotubes. Using first-principles plane-wave method we show that not only outer but also inner surface of a large carbon nanotube can be utilized to bind more transition-metal atoms and hence to increase the storage capacity. We also found that scandium and vanadium atoms adsorbed on a carbon nanotube can bind up to five hydrogen molecules. Similarly, light transition-metal atoms can be adsorbed on both sides of graphene and each adsorbate can hold up to four hydrogen molecules yielding again a high-storage capacity. Interestingly, our results suggest that graphene can be considered as a potential high-capacity H2 storage medium. We also performed transition state analysis on the possible dimerization of Ti atoms adsorbed on the graphene and single-wall carbon nanotube.

  10. Single Pd atoms in activated carbon fibers and their contribution to hydrogen storage

    SciTech Connect

    Contescu, Cristian I; van Benthem, Klaus; Li, Sa; Bonifacio, Cecile S; Pennycook, Stephen J; Jena, Puru; Gallego, Nidia C

    2011-01-01

    Palladium-modified activated carbon fibers (Pd-ACF) were synthesized by meltspinning, carbonization and activation of an isotropic pitch carbon precursor premixed with an organometallic Pd compound. The hydrogen uptake at 25 oC and 20 bar on Pd- ACF exceeded the expected capacity based solely on Pd hydride formation and hydrogen physisorption on the microporous carbon support. Aberration-corrected scanning transmission electron microscopy (STEM) with sub- ngstrom spatial resolution provided unambiguous identification of isolated Pd atoms occurring in the carbon matrix that coexist with larger Pd particles. First principles calculations revealed that each single Pd atom can form Kubas-type complexes by binding up to three H2 molecules in the pressure range of adsorption measurements. Based on Pd atom concentration determined from STEM images, the contribution of various mechanisms to the excess hydrogen uptake measured experimentally was evaluated. With consideration of Kubas binding as a viable mechanism (along with hydride formation and physisorption to carbon support) the role of hydrogen spillover in this system may be smaller than previously thought.

  11. "TOF2H": A precision toolbox for rapid, high density/high coverage hydrogen-deuterium exchange mass spectrometry via an LC-MALDI approach, covering the data pipeline from spectral acquisition to HDX rate analysis

    PubMed Central

    Nikamanon, Pornpat; Pun, Elroy; Chou, Wayne; Koter, Marek D; Gershon, Paul D

    2008-01-01

    Background Protein-amide proton hydrogen-deuterium exchange (HDX) is used to investigate protein conformation, conformational changes and surface binding sites for other molecules. To our knowledge, software tools to automate data processing and analysis from sample fractionating (LC-MALDI) mass-spectrometry-based HDX workflows are not publicly available. Results An integrated data pipeline (Solvent Explorer/TOF2H) has been developed for the processing of LC-MALDI-derived HDX data. Based on an experiment-wide template, and taking an ab initio approach to chromatographic and spectral peak finding, initial data processing is based on accurate mass-matching to fully deisotoped peaklists accommodating, in MS/MS-confirmed peptide library searches, ambiguous mass-hits to non-target proteins. Isotope-shift re-interrogation of library search results allows quick assessment of the extent of deuteration from peaklist data alone. During raw spectrum editing, each spectral segment is validated in real time, consistent with the manageable spectral numbers resulting from LC-MALDI experiments. A semi-automated spectral-segment editor includes a semi-automated or automated assessment of the quality of all spectral segments as they are pooled across an XIC peak for summing, centroid mass determination, building of rates plots on-the-fly, and automated back exchange correction. The resulting deuterium uptake rates plots from various experiments can be averaged, subtracted, re-scaled, error-barred, and/or scatter-plotted from individual spectral segment centroids, compared to solvent exposure and hydrogen bonding predictions and receive a color suggestion for 3D visualization. This software lends itself to a "divorced" HDX approach in which MS/MS-confirmed peptide libraries are built via nano or standard ESI without source modification, and HDX is performed via LC-MALDI using a standard MALDI-TOF. The complete TOF2H package includes additional (eg LC analysis) modules. Conclusion "TOF2H" provides a comprehensive HDX data analysis package that has accelerated the processing of LC-MALDI-based HDX data in the authors' lab from weeks to hours. It runs in a standard MS Windows (XP or Vista) environment, and can be downloaded or obtained from the authors at no cost. PMID:18803853

  12. Spot-free catalysis using gold carbon nanotube & gold graphene composites for hydrogen evolution reaction

    NASA Astrophysics Data System (ADS)

    Sai Siddhardha, R. S.; Lakshminarayanan, V.; Ramamurthy, Sai Sathish

    2015-08-01

    Hydrogen has been proposed as the green fuel of the future in the wake of depleting fossil fuels. Recently, carbon paste electrodes (CPE) modified with nanomaterials as electrocatalysts have drawn wide attention for hydrogen evolution reaction (HER) in acid medium. The CPEs are advantageous owing to their chemical stability and ease of fabrication. Their applications for HER without any modification, however, are hampered on account of large hydrogen overpotential associated with carbon surface. In the present study, CPE has been modified with novel gold composites as electro-catalysts for HER in acid medium. The nanocomposites have shown ∼100 fold increased current density than unmodified CPE at -0.3 V. Most strikingly for the first time, this study has quantitatively brought out the difference in catalysis between surfactant capped and pristine gold nanoparticles in terms of their application as spot-free catalysts towards hydrogen gas production by electrochemical route.

  13. Hydrogen-bond acidic functionalized carbon nanotubes (CNTs) with covalently-bound hexafluoroisopropanol groups

    SciTech Connect

    Fifield, Leonard S.; Grate, Jay W.

    2010-06-01

    Fluorinated hydrogen-bond acidic groups are directly attached to the backbone of single walled carbon nanotubes (SWCNTs) without the introduction of intermediate electron donating surface groups. Hexafluoroalcohol functional groups are exceptionally strong hydrogen bond acids, and are added to the nanotube surface using the aryl diazonium approach to create hydrogen-bond acidic carbon nanotube (CNT) surfaces. These groups can promote strong hydrogen-bonding interactions with matrix materials in composites or with molecular species to be concentrated and sensed. In the latter case, this newly developed material is expected to find useful application in chemical sensors and in CNT-based preconcentrator devices for the detection of pesticides, chemical warfare agents and explosives.

  14. Dissociation of CH4 by electron impact: Production of metastable hydrogen and carbon fragments

    NASA Technical Reports Server (NTRS)

    Finn, T. G.; Carnahan, B. L.; Zipf, E. C.

    1974-01-01

    Metastable fragments produced by electron impact excitation of CH4 have been investigated for incident electron energies from threshold to 300 eV. Only metastable hydrogen and carbon atoms were observed. Onset energies for the production of metastable hydrogen atoms were observed at electron impact energies of 22.0 + or - .5 eV, 25.5 + or - .6 eV, 36.7 + or - .6 eV and 66 + or - 3 eV, and at 26.6 + or - .6 eV for the production of metastable carbon atoms. Most of the fragments appear to have been formed in high-lying Rydberg states. The total metastable hydrogen cross section reaches a maximum value of approximately 1 X 10 to the minus 18th power sq cm at 100 eV. At the same energy, the metastable carbon cross section is 2 x 10 to the minus 19th power sq cm.

  15. Hydrogenolysis Of 5-Carbon Sugars, Sugar Alcohols And Compositions For Reactions Involving Hydrogen

    SciTech Connect

    Werpy, Todd A.; Frye, Jr., John G.; Zacher, Alan H.; Miller, Dennis J.

    2004-01-13

    Methods and compositions for reactions of hydrogen over a Re-containing catalyst with compositions containing a 5-carbon sugar, sugar alcohol, or lactic acid are described. It has been surprisingly discovered that reaction with hydrogen over a Re-containing multimetallic catalyst resulted in superior conversion and selectivity to desired products such as propylene glycol. A process for the synthesis of PG from lactate or lactic acid is also described.

  16. Hydrogenolysis of 5-carbon sugars, sugar alcohols, and other methods and compositions for reactions involving hydrogen

    SciTech Connect

    Werpy, Todd A; Zacher, Alan H

    2002-11-12

    Methods and compositions for reactions of hydrogen over a Re-containing catalyst with compositions containing a 5-carbon sugar, sugar alcohol, or lactic acid are described. It has been surprisingly discovered that reaction with hydrogen over a Re-containing multimetallic catalyst resulted in superior conversion and selectivity to desired products such as propylene glycol. A process for the synthesis of PG from lactate or lactic acid is also described.

  17. Relation of Hydrogen and Methane to Carbon Monoxide in Exhaust Gases from Internal-Combustion Engines

    NASA Technical Reports Server (NTRS)

    Gerrish, Harold C; Tessmann, Arthur M

    1935-01-01

    The relation of hydrogen and methane to carbon monoxide in the exhaust gases from internal-combustion engines operating on standard-grade aviation gasoline, fighting-grade aviation gasoline, hydrogenated safety fuel, laboratory diesel fuel, and auto diesel fuel was determined by analysis of the exhaust gases. Two liquid-cooled single-cylinder spark-ignition, one 9-cylinder radial air-cooled spark-ignition, and two liquid-cooled single-cylinder compression-ignition engines were used.

  18. Evaluation of the isosteric heat of adsorption at zero coverage for hydrogen on activated carbons

    NASA Astrophysics Data System (ADS)

    Dohnke, E.; Beckner, M.; Romanos, J.; Olsen, R.; Wexler, C.; Pfeifer, P.

    2011-03-01

    Activated carbons made from corn cob show promise as materials for high-capacity hydrogen storage. As part of our characterization of these materials, we are interested in learning how different production methods affect the adsorption energies. In this talk, we will show how hydrogen adsorption isotherms may be used to calculate these adsorption energies at zero coverage using Henry's law. We will additionally discuss differences between the binding energy and the isosteric heat of adsorption by applying this analysis at different temperatures.

  19. Dynamic response of a carbon nanotube-based rotary nano device with different carbon-hydrogen bonding layout

    NASA Astrophysics Data System (ADS)

    Yin, Hang; Cai, Kun; Wan, Jing; Gao, Zhaoliang; Chen, Zhen

    2016-03-01

    In a nano rotational transmission system (RTS) which consists of a single walled carbon nanotube (SWCNT) as the motor and a coaxially arranged double walled carbon nanotube (DWCNT) as a bearing, the interaction between the motor and the rotor in bearing, which has great effects on the response of the RTS, is determined by their adjacent edges. Using molecular dynamics (MD) simulation, the interaction is analyzed when the adjacent edges have different carbon-hydrogen (Csbnd H) bonding layouts. In the computational models, the rotor in bearing and the motor with a specific input rotational speed are made from the same armchair SWCNT. Simulation results demonstrate that a perfect rotational transmission could happen when the motor and rotor have the same Csbnd H bonding layout on their adjacent ends. If only half or less of the carbon atoms on the adjacent ends are bonded with hydrogen atoms, the strong attraction between the lower speed (100 GHz) motor and rotor leads to a synchronous rotational transmission. If only the motor or the rotor has Csbnd H bonds on their adjacent ends, no rotational transmission happens due to weak interaction between the bonded hydrogen atoms on one end with the sp1 bonded carbon atoms on the other end.

  20. Synthesis of superlow friction carbon films from highly hydrogenated methane plasmas.

    SciTech Connect

    Erdemir, A.; Eryilmaz, O. L.; Nilufer, I. B.; Fenske, G. R.

    2000-10-13

    In this study, we investigated the friction and wear performance of diamondlike carbon films (DLC) derived from increasingly hydrogenated methane plasmas. The films were deposited on steel substrates by a plasma-enhanced chemical vapor deposition process at room temperature and the tribological tests were performed in dry nitrogen. Tests results revealed a close correlation between the hydrogen in source gas plasma and the friction and wear coefficients of the DLC films. Specifically, films grown in plasmas with higher hydrogen-to-carbon ratios had much lower friction coefficients and wear rates than did films derived from source gases with lower hydrogen-to-carbon ratios. The lowest friction coefficient (0.003) was achieved with a film derived from 25% methane--75% hydrogen, while a coefficient of 0.015 was found for films derived from pure methane. Similar correlations were observed for wear rates. Films derived from hydrogen-rich plasmas had the least wear, while films derived from pure methane suffered the highest wear. We used a combination of surface analytical methods to characterize the structure and chemistry of the DLC films and worn surfaces.

  1. Optimizing the Binding Energy of Hydrogen on Nanostructured Carbon Materials through Structure Control and Chemical Doping

    SciTech Connect

    Jie Liu

    2011-02-01

    The DOE Hydrogen Sorption Center of Excellence (HSCoE) was formed in 2005 to develop materials for hydrogen storage systems to be used in light-duty vehicles. The HSCoE and two related centers of excellence were created as follow-on activities to the DOE Office of Energy Efficiency and Renewable Energy’s (EERE’s) Hydrogen Storage Grand Challenge Solicitation issued in FY 2003. The Hydrogen Sorption Center of Excellence (HSCoE) focuses on developing high-capacity sorbents with the goal to operate at temperatures and pressures approaching ambient and be efficiently and quickly charged in the tank with minimal energy requirements and penalties to the hydrogen fuel infrastructure. The work was directed at overcoming barriers to achieving DOE system goals and identifying pathways to meet the hydrogen storage system targets. To ensure that the development activities were performed as efficiently as possible, the HSCoE formed complementary, focused development clusters based on the following four sorption-based hydrogen storage mechanisms: 1. Physisorption on high specific surface area and nominally single element materials 2. Enhanced H2 binding in Substituted/heterogeneous materials 3. Strong and/or multiple H2 binding from coordinated but electronically unsatruated metal centers 4. Weak Chemisorption/Spillover. As a member of the team, our group at Duke studied the synthesis of various carbon-based materials, including carbon nanotubes and microporous carbon materials with controlled porosity. We worked closely with other team members to study the effect of pore size on the binding energy of hydrogen to the carbon –based materials. Our initial project focus was on the synthesis and purification of small diameter, single-walled carbon nanotubes (SWNTs) with well-controlled diameters for the study of their hydrogen storage properties as a function of diameters. We developed a chemical vapor deposition method that synthesized gram quantities of carbon nanotubes with average diameter size at less than 1 nm. However, initial tests performed at our collaborator’s lab at the National Renewable Energy Laboratory (NREL) did not indicate improved hydrogen sorption properties for the smaller-diameter nanotubes (compared with other types of nanotubes). As work continued, the difficulties in purification, large-scale synthesis, and stability of small diameter SWNTs became a major concern. In 2008, the Department of Energy (DOE) made a no-go decision on future applied R&D investment in pure, undoped, single-walled carbon nanotubes for vehicular hydrogen storage.2 The second phase of the project involved developing a low-cost and scalable approach for the synthesis of microporous carbon materials with well-controlled pore sizes that would be suitable for hydrogen storage. The team studied several approaches, including the use of different zeolites as a template, the use of organic micelle structures as a template, and the slow oxidation of polymer precursors. Among them, the slow activation of Polyether ether ketone (PEEK) under either CO2 environment or H2O vapor produced microporous carbon with an average pore size of less than 2 nm. Initial testing at 77K at both NREL and the California Institute of Technology (CalTech) showed that these materials can store ~5.1 wt% hydrogen (excess) at 40 bar and 77K. The main feature to note with this material is that while the excess gravimetric capacities (>5 wt% at 77K) and specific surface areas (>3100 m2/g) are similar to AX-21 and other “super activated” commercial carbon sorbents at the same temperatures and pressures, due to the smaller pore sizes, bulk densities greater than 0.7 g/ml can be achieved, enabling excess volumetric capacities greater than 35 g/L; more than double that of AX-21.

  2. Percolative metal-organic framework/carbon composites for hydrogen storage

    NASA Astrophysics Data System (ADS)

    Xie, Shuqian; Hwang, Jiann-Yang; Sun, Xiang; Shi, Shangzhao; Zhang, Zheng; Peng, Zhiwei; Zhai, Yuchun

    2014-05-01

    Percolative Metal-organic framework/Carbon (MOFAC) composites are synthesized by IRMOF8 (isoreticular metal-organic frameworks) directly depositing on activated carbon via heterogeneous nucleation. Carbon content is calculated by TGA (Thermogravimetric analysis) tests. XRD (X-ray diffraction) and FESEM (Field emission-scanning electron microscope) are carried out to characterize the structures of the samples. BET surface areas and the pore size distribution are measured. The dielectric constant is measured with impedance analyzer and a specially designed sample holder. The dielectric constants of the MOFAC composites rise with increasing the carbon content, and the composites possess the insulator-conductor transition as the carbon content increases from 17.77 wt% to 22.2 wt%. The composites are further tested for hydrogen storage capability under assist of the PMN-PT (single crystal lead magnesium niobate-lead titanate) generated electric field. With help from the PMN-PT, the hydrogen uptake capability is increased about 31.5% over the MOFAC3 (MOF-Carbon composite with 22.2 wt% of carbon) without PMN-PT, which is elucidated by the charge distribution mechanisms. The improved storage is due to a stronger electrostatic interaction between IRMOF8 and hydrogen molecule caused by field polarization. Meanwhile, rapid adsorption/desorption kinetics and total reversibility on the samples are observed in the present or absence of external electric field.

  3. Migration Mechanism for Atomic Hydrogen in Porous Carbon Materials

    SciTech Connect

    Narayanan, B.; Zhao, Y. F.; Ciobanu, C. V.

    2012-05-14

    To explain the fast kinetics of H in porous carbon, we propose that the migration relies on H hopping from a carbon nanotube (CNT) to another. Using density functional theory, we have found that the barrier for H hopping becomes smaller than that for diffusion along a tube for certain CNT separations, decreasting to less than 0.5 eV for separations of -3.1 {angstrom}. Such significant reduction occurs irrespective of radius, chirality, registry, and orientation of the two CNTs: the diffusion is thus facilitated by the porous nature of the material itself. The mechanism proposed is applicable for any porous carbon-based nanomaterials.

  4. Efficient and durable hydrogen evolution electrocatalyst based on nonmetallic nitrogen doped hexagonal carbon

    PubMed Central

    Liu, Yanming; Yu, Hongtao; Quan, Xie; Chen, Shuo; Zhao, Huimin; Zhang, Yaobin

    2014-01-01

    The feasibility of renewable energy technology, hydrogen production by water electrolysis, depends on the design of efficient and durable electrocatalyst composed of earth-abundant elements. Herein, a highly active and stable nonmetallic electrocatalyst, nitrogen doped hexagonal carbon (NHC), was developed for hydrogen production. It exhibited high activity for hydrogen evolution with a low overpotential of only 65 mV, an apparent exchange current density of 5.7 × 10−2 mA cm−2 and a high hydrogen production rate of 20.8 mL cm−2 h−1 at −0.35 V. The superior hydrogen evolution activity of NHC stemmed from the intrinsic electrocatalytic property of hexagonal nanodiamond, the rapid charge transfer and abundance of electrocatalytic sites after nitrogen doping. Moreover, NHC was stable in a corrosive acidic solution during electrolysis under high current density. PMID:25354806

  5. Efficient and durable hydrogen evolution electrocatalyst based on nonmetallic nitrogen doped hexagonal carbon

    NASA Astrophysics Data System (ADS)

    Liu, Yanming; Yu, Hongtao; Quan, Xie; Chen, Shuo; Zhao, Huimin; Zhang, Yaobin

    2014-10-01

    The feasibility of renewable energy technology, hydrogen production by water electrolysis, depends on the design of efficient and durable electrocatalyst composed of earth-abundant elements. Herein, a highly active and stable nonmetallic electrocatalyst, nitrogen doped hexagonal carbon (NHC), was developed for hydrogen production. It exhibited high activity for hydrogen evolution with a low overpotential of only 65 mV, an apparent exchange current density of 5.7 10-2 mA cm-2 and a high hydrogen production rate of 20.8 mL cm-2 h-1 at -0.35 V. The superior hydrogen evolution activity of NHC stemmed from the intrinsic electrocatalytic property of hexagonal nanodiamond, the rapid charge transfer and abundance of electrocatalytic sites after nitrogen doping. Moreover, NHC was stable in a corrosive acidic solution during electrolysis under high current density.

  6. LITERATURE SURVEY OF GASEOUS HYDROGEN EFFECTS ON THE MECHANICAL PROPERTIES OF CARBON AND LOW ALLOY STEELS

    SciTech Connect

    Lam, P; Robert Sindelar, R; Thad Adams, T

    2007-04-18

    Literature survey has been performed for a compendium of mechanical properties of carbon and low alloy steels following hydrogen exposure. The property sets include yield strength, ultimate tensile strength, uniform elongation, reduction of area, threshold stress intensity factor, fracture toughness, and fatigue crack growth. These properties are drawn from literature sources under a variety of test methods and conditions. However, the collection of literature data is by no means complete, but the diversity of data and dependency of results in test method is sufficient to warrant a design and implementation of a thorough test program. The program would be needed to enable a defensible demonstration of structural integrity of a pressurized hydrogen system. It is essential that the environmental variables be well-defined (e.g., the applicable hydrogen gas pressure range and the test strain rate) and the specimen preparation be realistically consistent (such as the techniques to charge hydrogen and to maintain the hydrogen concentration in the specimens).

  7. Blending materials composed of boron, nitrogen and carbon to transform approaches to liquid hydrogen stores.

    PubMed

    Whittemore, Sean M; Bowden, Mark; Karkamkar, Abhijeet; Parab, Kshitij; Neiner, Doinita; Autrey, Tom; Ishibashi, Jacob S A; Chen, Gang; Liu, Shih-Yuan; Dixon, David A

    2016-04-14

    Mixtures of hydrogen storage materials containing the elements of boron, nitrogen, carbon, i.e., isomers of BN cyclopentanes are examined to find a 'fuel blend' that remains a liquid phase throughout hydrogen release, maximizes hydrogen storage density, minimizes impurities and remains thermally stable at ambient temperatures. We find that the mixture of ammonia borane dissolved in 3-methyl-1,2-dihydro-1,2-azaborolidine (compound B) provide a balance of these properties and provides ca. 5.6 wt% hydrogen. The two hydrogen storage materials decompose at a faster rate than either individually and products formed are a mixture of molecular trimers. Digestion of the product mixture formed from the decomposition of the AB + B fuel blend with methanol leads to the two corresponding methanol adducts of the starting material and not a complex mixture of adducts. The work shows the utility of using blends of materials to reduce volatile impurities and preserve liquid phase. PMID:26629961

  8. LITERATURE SURVEY OF GASEOUS HYDROGEN EFFECTS ON THE MECHANICAL PROPERTIES OF CARBON AND LOW ALLOY STEELS

    SciTech Connect

    Lam, P; Andrew Duncan, A; Robert Sindelar, R; Thad Adams, T

    2009-04-27

    Literature survey has been performed for a compendium of mechanical properties of carbon and low alloy steels following hydrogen exposure. The property sets include yield strength, ultimate tensile strength, uniform elongation, reduction of area, threshold stress intensity factor, fracture toughness, and fatigue crack growth. These properties are drawn from literature sources under a variety of test methods and conditions. However, the collection of literature data is by no means complete, but the diversity of data and dependency of results in test method is sufficient to warrant a design and implementation of a thorough test program. The program would be needed to enable a defensible demonstration of structural integrity of a pressurized hydrogen system. It is essential that the environmental variables be well-defined (e.g., the applicable hydrogen gas pressure range and the test strain rate) and the specimen preparation be realistically consistent (such as the techniques to charge hydrogen and to maintain the hydrogen concentration in the specimens).

  9. Microwave absorption by hydrogen plasma in carbon nanotubes films with layered dielectric structure

    NASA Astrophysics Data System (ADS)

    Peng, Zhihua; Liu, Baoxing; Peng, Yanfeng; Jia, Peng; Zhan, Xiaogui; Xie, Ningyu

    2015-05-01

    A layered structure model is proposed for microwave dielectric properties of nonhomogeneous hydrogen plasma in carbon nanotubes (CNTs) film. Using the transfer matrix method for solving electromagnetic wave propagation equation, the microwave attenuation of the film is calculated in the range of 0-30 GHz under different conditions. It is found theoretically that with the increase of hydrogen plasma nonhomogeneity, the frequency bandwidth of strong microwave absorption by the film increases markedly. The application of a moderate static magnetic field can effectively improve microwave attenuation properties of hydrogen plasma in CNTs. The numerical results are in good agreement with the available experimental data.

  10. The effect of hydrogen on the parameters of plastic deformation localization in low carbon steel

    SciTech Connect

    Lunev, Aleksey G. E-mail: nadjozhkin@ispms.tsc.ru; Nadezhkin, Mikhail V. E-mail: nadjozhkin@ispms.tsc.ru; Shlyakhova, Galina V.; Barannikova, Svetlana A.; Zuev, Lev B.

    2014-11-14

    In the present study, the effect of interstitial hydrogen atoms on the mechanical properties and plastic strain localization patterns in tensile tested polycrystals of low-carbon steel Fe-0.07%C has been studied using double exposure speckle photography technique. The main parameters of plastic flow localization at various stages of deformation hardening have been determined in polycrystals of steel electrolytically saturated with hydrogen in a three-electrode electrochemical cell at a controlled constant cathode potential. Also, the effect of hydrogen on changing of microstructure by using optical microscopy has been demonstrated.

  11. Microwave response of magnetized hydrogen plasma in carbon nanotubes: multiple reflection effects.

    PubMed

    Moradi, Afshin

    2010-04-01

    We derived simple sets of equations to describe the microwave response of the magnetized hydrogen plasma slab embedded inside carbon nanotubes, which were grown by iron-catalyzed high-pressure disproportionation. These equations, which are useful when interference effects due to multiple reflections between plasma film interfaces are small, were used to analyze the reflection, absorption, and transmission coefficients of the magnetized hydrogen plasma slab. A discussion on the effects of the continuously changing external magnetic field and hydrogen plasma parameters on the reflected power, absorbed power, and transmitted power in the system is presented. PMID:20357852

  12. Stable hydrogen and carbon isotope ratios of extractable hydrocarbons in the Murchison meteorite

    NASA Technical Reports Server (NTRS)

    Krishnamurthy, R. V.; Epstein, S.; Pizzarello, S.; Cronin, J. R.; Yuen, G. U.

    1991-01-01

    A fairly fool-proof method to ensure that the compounds isolated from meteorites are truly part of the meteorites and not an artifact introduced by exposure to the terrestrial environment, storage, or handling is presented. The stable carbon and hydrogen isotope ratios in several of the chemical compounds extracted from the Murchison meteorite were measured. The results obtained by studying the amino acids in this meteorite gave very unusual hydrogen and carbon isotope ratios. The technique was extended to the different classes of hydrocarbons and the hydrocarbons were isolated using a variety of separation techniques. The results and methods used in this investigation are described in this two page paper.

  13. Carbon Sources for Yeast Growth as a Precondition of Hydrogen Peroxide Induced Hormetic Phenotype

    PubMed Central

    Vasylkovska, Ruslana; Petriv, Natalia; Semchyshyn, Halyna

    2015-01-01

    Hormesis is a phenomenon of particular interest in biology, medicine, pharmacology, and toxicology. In this study, we investigated the relationship between H2O2-induced hormetic response in S. cerevisiae and carbon sources in yeast growth medium. In general, our data indicate that (i) hydrogen peroxide induces hormesis in a concentration-dependent manner; (ii) the effect of hydrogen peroxide on yeast reproductive ability depends on the type of carbon substrate in growth medium; and (iii) metabolic and growth rates as well as catalase activity play an important role in H2O2-induced hormetic response in yeast. PMID:26843865

  14. Improvement of Electron Field Emission in Patterned Carbon Nanotubes by High Temperature Hydrogen Plasma Treatment.

    PubMed

    Wang, Sigen; Sellin, Paul J; Lian, Jun; Ozsan, Ersin; Chang, Sha

    2009-02-01

    In this paper, we report a significant improvement of electron field emission property in patterned carbon nanotubes films by using a high temperature (650 °C) hydrogen plasma treatment. This treatment was found to greatly increase the emission current, emission uniformity and stability. The mechanism study showed that these enhanced properties are attributed to the lowering of the potential barrier and the creation of geometrical features through the removal of amorphous carbon, catalyst particles and the saturation of dangling bonds after such a hydrogen plasma treatment. PMID:19946566

  15. Improvement of Electron Field Emission in Patterned Carbon Nanotubes by High Temperature Hydrogen Plasma Treatment

    PubMed Central

    Wang, Sigen; Sellin, Paul. J.; Lian, Jun; Özsan, Ersin; Chang, Sha

    2009-01-01

    In this paper, we report a significant improvement of electron field emission property in patterned carbon nanotubes films by using a high temperature (650 °C) hydrogen plasma treatment. This treatment was found to greatly increase the emission current, emission uniformity and stability. The mechanism study showed that these enhanced properties are attributed to the lowering of the potential barrier and the creation of geometrical features through the removal of amorphous carbon, catalyst particles and the saturation of dangling bonds after such a hydrogen plasma treatment. PMID:19946566

  16. New Pathways and Metrics for Enhanced, Reversible Hydrogen Storage in Boron-Doped Carbon Nanospaces

    SciTech Connect

    Pfeifer, Peter; Wexler, Carlos; Hawthorne, M. Frederick; Lee, Mark W.; Jalistegi, Satish S.

    2014-08-14

    This project, since its start in 2007—entitled “Networks of boron-doped carbon nanopores for low-pressure reversible hydrogen storage” (2007-10) and “New pathways and metrics for enhanced, reversible hydrogen storage in boron-doped carbon nanospaces” (2010-13)—is in support of the DOE's National Hydrogen Storage Project, as part of the DOE Hydrogen and Fuel Cells Program’s comprehensive efforts to enable the widespread commercialization of hydrogen and fuel cell technologies in diverse sectors of the economy. Hydrogen storage is widely recognized as a critical enabling technology for the successful commercialization and market acceptance of hydrogen powered vehicles. Storing sufficient hydrogen on board a wide range of vehicle platforms, at energy densities comparable to gasoline, without compromising passenger or cargo space, remains an outstanding technical challenge. Of the main three thrust areas in 2007—metal hydrides, chemical hydrogen storage, and sorption-based hydrogen storage—sorption-based storage, i.e., storage of molecular hydrogen by adsorption on high-surface-area materials (carbons, metal-organic frameworks, and other porous organic networks), has emerged as the most promising path toward achieving the 2017 DOE storage targets of 0.055 kg H2/kg system (“5.5 wt%”) and 0.040 kg H2/liter system. The objective of the project is to develop high-surface-area carbon materials that are boron-doped by incorporation of boron into the carbon lattice at the outset, i.e., during the synthesis of the material. The rationale for boron-doping is the prediction that boron atoms in carbon will raise the binding energy of hydro- gen from 4-5 kJ/mol on the undoped surface to 10-14 kJ/mol on a doped surface, and accordingly the hydro- gen storage capacity of the material. The mechanism for the increase in binding energy is electron donation from H2 to electron-deficient B atoms, in the form of sp2 boron-carbon bonds. Our team is proud to have demonstrated the predicted increase in binding energy experimentally, currently at ~10 kJ/mol. The synthetic route for incorporation of boron at the outset is to create appropriately designed copoly- mers, with a boron-free and a boron-carrying monomer, followed by pyrolysis of the polymer, yielding a bo- ron-substituted carbon scaffold in which boron atoms are bonded to carbon atoms by synthesis. This is in contrast to a second route (funded by DE-FG36-08GO18142) in which first high-surface area carbon is cre- ated and doped by surface vapor deposition of boron, with incorporation of the boron into the lattice the final step of the fabrication. The challenge in the first route is to create high surface areas without compromising sp2 boron-carbon bonds. The challenge in the second route is to create sp2 boron-carbon bonds without com- promising high surface areas.

  17. Hydrogen Generation During the Corrosion of Carbon Steel in Oxalic Acid

    SciTech Connect

    WIERSMA, BRUCEJ.

    2004-08-01

    A literature review of the corrosion mechanism for carbon steel in oxalic acid was performed to determine the ratio of moles of iron corroded to moles of hydrogen evolved during the corrosion of iron in oxalic acid. The theory of corrosion of carbon steel in oxalic acid and experimental work were reviewed. It was concluded that the maximum ratio of moles of hydrogen evolved to moles of iron corroded is 1:1. This ratio would be observed in a de-aerated environment. If oxygen or other oxidizing species are present, the ratio could be much less than 1:1. Testing would be necessary to determine how much less than 1:1 the ratio might be. Although the ratio of hydrogen evolution to iron corroded will not exceed 1:1, the total amount of hydrogen evolved can be influenced by such things as a decrease in the exposed surface area, suppression of hydrogen generation by gamma radiation, the presence of corrosion products on steel surface, etc. These and other variables present during chemical cleaning operations of the waste tank have not been examined by the tests reported in the literature i.e., the tests have focused on clean corrosion coupons in oxalic acid solutions. It is expected that most of these variables would reduce the total amount of hydrogen evolved. Further testing would need to be performed to quantify the reduction in hydrogen generation rate associated with these variables.

  18. Renewable Hydrogen Carrier Carbohydrate: Constructing the Carbon-Neutral Carbohydrate Economy

    SciTech Connect

    Zhang, Y.-H. Percival; Mielenz, Jonathan R

    2011-01-01

    Abstract The hydrogen economy presents an appealing energy future but its implementation must solve numerous problems ranging from low-cost sustainable production, high-density storage, costly infrastructure, to eliminating safety concern. The use of renewable carbohydrate as a high-density hydrogen carrier and energy source for hydrogen production is possible due to emerging cell-free synthetic biology technology called cell-free synthetic pathway biotransformation (SyPaB). Assembly of numerous enzymes and co-enzymes in vitro can create complicated set of biological reactions or pathways that microorganisms cannot complete, for example, C6H10O5 (aq) + 7 H2O (l) 12 H2 (g) + 6 CO2 (g) (PLoS One 2007, 2:e456). Thanks to 100% selectivity of enzymes, modest reaction conditions, and high-purity of generated hydrogen, carbohydrate is a promising hydrogen carrier for end users. Gravimetric density of carbohydrate is 14.8 H2 mass% if water can be recycled from PEM fuel cells or 8.33% H2 mass% without water recycling. Renewable carbohydrate can be isolated from plant biomass or would be produced from a combination of solar electricity/hydrogen and carbon dioxide fixation mediated by high-efficiency artificial photosynthesis mediated by SyPaB. The construction of this carbon-neutral carbohydrate economy would address numerous sustainability challenges, such as electricity and hydrogen storage, CO2 fixation and long-term storage, water conservation, transportation fuel production, plus feed and food production.

  19. Preparation of hydrogenated amorphous carbon films from polymers by nano- and femtosecond pulsed laser deposition

    NASA Astrophysics Data System (ADS)

    Budai, Judit; Bereznai, Mikls; Szakcs, Gbor; Szilgyi, Edit; Tth, Zsolt

    2007-07-01

    Hydrogenated amorphous carbon (a-C:H) films can be simply produced by pulsed laser deposition (PLD) from targets containing hydrogen and carbon, e.g. polymers. Films deposited from polyethyleneterephtalate (PET) and polycarbonate (PC) were compared to samples prepared from glassy carbon. Several lasers were used to explore the influence of pulse duration (30 ns and 500 fs) and wavelength (248 and 193 nm) on the properties of laser deposited films. The film composition was characterized by Rutherford backscattering spectrometry and elastic recoil detection analysis. Variable angle spectroscopic ellipsometry gave information about the thickness and optical properties of the films. It was demonstrated that a consistent interpretation of the laser ablation, caused by rather different laser sources on various targets, is possible using the parameter of volumetric power density (intensity divided by light or heat penetration depth). PLD from polymer targets resulted in amorphous hydrogenated films, where hydrogen and oxygen content was decreased compared to the composition of the original target. PLD from glassy carbon target resulted in graphitic, diamond like and porous carbon films with increasing volumetric power density.

  20. Unmodified versus caustics-impregnated carbons for control of hydrogen sulfide emissions from sewage treatment plants

    SciTech Connect

    Bandosz, T.J.; Bagreev, A.; Adib, F.; Turk, A.

    2000-03-15

    Unmodified and caustic-impregnated carbons were compared as adsorbents for hydrogen sulfide in the North River Water Pollution Control Plant in New York City over a period of 2 years. The carbons were characterized using accelerated H{sub 2}S breakthrough capacity tests, sorption of nitrogen, potentiometric titration, and thermal analysis. The accelerated laboratory tests indicate that the initial capacity of caustic-impregnated carbons exceeds that of unmodified carbon, but the nature of real-life challenge streams, particularly their lower H{sub 2}S concentrations, nullifies this advantage. As the caustic content of the impregnated carbon is consumed, the situation reverses, and the unmodified carbon becomes more effective. When the concentration of H{sub 2}S is low, the developed surface area and pore volume along with the affinity to retain water create a favorable environment for dissociative adsorption of hydrogen sulfide and its oxidation to elemental sulfur, S{sup 4+}, and S{sup 6+}. In the case of the caustic carbon, the catalytic impact of the carbon surface is limited, and its good performance lasts only while active base is present. The results also show the significant differences in performance of unmodified carbons due to combined effects of their porosity and surface chemistry.