Science.gov

Sample records for hyperplastic human prostate

  1. Inhibition of smooth muscle force generation by focal adhesion kinase inhibitors in the hyperplastic human prostate.

    PubMed

    Kunit, Thomas; Gratzke, Christian; Schreiber, Andrea; Strittmatter, Frank; Waidelich, Raphaela; Rutz, Beata; Loidl, Wolfgang; Andersson, Karl-Erik; Stief, Christian G; Hennenberg, Martin

    2014-10-01

    Smooth muscle contraction may be critical for lower urinary tract symptoms (LUTS) in patients with benign prostate hyperplasia and requires stable anchorage of the cytoskeleton to the cell membrane. These connections are regulated by focal adhesion kinase (FAK). Here, we addressed the involvement of FAK in the regulation of smooth muscle contraction in hyperplastic human prostate tissues. Prostate tissues were obtained from radical prostatectomy. Expression of FAK and focal adhesion proteins was assessed by Western blot analysis and immunohistochemical stainings. Effects of the FAK inhibitors PF-573228 and Y-11 on contraction of prostate strips were examined in the organ bath. Expression of FAK and focal adhesion proteins (integrin-5α, paxilin, and c-Src) was detected by Western blot analysis in prostate samples. By double immunofluorescence staining with calponin and pan-cytokeratin, expression of FAK was observed in stromal and epithelial cells. Immunoreactivity for FAK colocalized with integrin-5α, paxilin, talin, and c-Src. Stimulation of prostate tissues with the α1-adrenergic agonist phenylephrine increased the phosphorylation state of FAK at Tyr³⁹⁷ and Tyr⁹²⁵ with different kinetics, which was blocked by the α1-adrenoceptor antagonist tamsulosin. Norepinephrine and phenylephrine induced concentration-dependent contractions of prostate strips. Both FAK inhibitors PF-573228 and Y-11 significantly inhibited norepinephrine- and phenylephrine-induced contractions. Finally, PF-573228 and Y-11 inhibited contractions induced by electric field stimulation, which was significant at the highest frequency. In conclusion, α1-adrenergic smooth muscle contraction or its regulation involves FAK in the human prostate. Consequently, FAK may be involved in the pathophysiology of LUTS and in current or future LUTS therapies. PMID:25056351

  2. Influence of lycopene on cell viability, cell cycle, and apoptosis of human prostate cancer and benign hyperplastic cells.

    PubMed

    Soares, Nathalia da Costa Pereira; Teodoro, Anderson Junger; Oliveira, Felipe Leite; Santos, Carlos Antonio do Nascimento; Takiya, Christina Maeda; Junior, Oswaldo Saback; Bianco, Mario; Junior, Antonio Palumbo; Nasciutti, Luiz Eurico; Ferreira, Luciana Bueno; Gimba, Etel Rodrigues Pereira; Borojevic, Radovan

    2013-01-01

    Prostate cancer is the most common malignancy in men and the second leading cause of cancer-related mortality in men of the Western world. Lycopene has received attention because of its expcted potential to prevent cancer. In the present study, we evaluated the influence of lycopene on cell viability, cell cycle, and apoptosis of human prostate cancer cells and benign prostate hyperplastic cells. Using MTT assay, we observed a decrease of cell viability in all cancer cell lines after treatment with lycopene, which decreased the percentage of cells in G0/G1 phase and increased in S and G2/M phases after 96 h of treatment in metastatic prostate cancer cell lineages. Flow citometry analysis of cell cycle revealed lycopene promoted cell cycle arrest in G0/G1 phase after 48 and 96 h of treatment in a primary cancer cell line. Using real time PCR assay, lycopene also induced apoptosis in prostate cancer cells with altered gene expression of Bax and Bcl-2. No effect was observed in benign prostate hyperplasia cells. These results suggest an effect of lycopene on activity of human prostate cancer cells. PMID:24053141

  3. Alpha 2 adrenergic receptors in hyperplastic human prostate: identification and characterization using (/sup 3/H) rauwolscine

    SciTech Connect

    Shapiro, E.; Lepor, H.

    1986-05-01

    (/sup 3/H)Rauwolscine ((/sup 3/H)Ra), a selective ligand for the alpha 2 adrenergic receptor, was used to identify and characterize alpha 2 adrenergic receptors in prostate glands of men with benign prostatic hyperplasia. Specific binding of (/sup 3/H)Ra to prostatic tissue homogenates was rapid and readily reversible by addition of excess unlabelled phentolamine. Scatchard analysis of saturation experiments demonstrates a single, saturable class of high affinity binding sites (Bmax = 0.31 +/- 0.04 fmol./microgram. DNA, Kd = 0.9 +/- 0.11 nM.). The relative potency of alpha adrenergic drugs (clonidine, alpha-methylnorepinephrine and prazosin) in competing for (/sup 3/H)Ra binding sites was consistent with the order predicted for an alpha 2 subtype. The role of alpha 2 adrenergic receptors in normal prostatic function and in men with bladder outlet obstruction secondary to BPH requires further investigation.

  4. Upregulation of Phosphodiesterase type 5 in the Hyperplastic Prostate

    PubMed Central

    Zhang, Wenhao; Zang, Ning; Jiang, Yaoming; Chen, Ping; Wang, Xinghuan; Zhang, Xinhua

    2015-01-01

    Both erectile dysfunction (ED) and lower urinary tract symptoms (LUTS)/benign prostatic hyperplasia (BPH) are common in the aging male. Numerous clinical trials have demonstrated the efficacy and safety of phosphodiesterase type 5 inhibitors (PDE5-Is) for treating LUTS/BPH with/without ED. However, the influence of BPH on prostatic PDE5 expression has never been studied. A testosterone-induced rat model of BPH was developed and human hyperplastic prostate specimens were harvested during cystoprostatectomy. PDE5, nNOS, eNOS and α1-adrenoreceptor subtypes (α1aARs, α1bARs and α1dARs) were determined with real-time RT-PCR for rat tissues whilst PDE5 and α1-adrenoreceptor subtypes were determined in human samples. PDE5 was further analyzed with Western-blot and histological examination. Serum testosterone was measured with ELISA. The rat BPH model was validated as having a significantly enlarged prostate. PDE5 localized mainly in fibromuscular stroma in prostate. Our data showed a significant and previously undocumented upregulation of PDE5 in both rat and human BPH, along with increased expression of nNOS and α1dARs for rat tissues and α1aARs for human BPH. The upregulation of PDE5 in the hyperplastic prostate could explain the mechanism and contribute to the high effectiveness of PDE5-Is for treating LUTS/BPH. Fibromuscular stroma could be the main target for PDE5-Is within prostate. PMID:26657792

  5. Role of IAPs in prostate cancer progression: immunohistochemical study in normal and pathological (benign hyperplastic, prostatic intraepithelial neoplasia and cancer) human prostate

    PubMed Central

    2010-01-01

    Background In this study was investigate IAPs in normal human prostate (NP), benign prostatic hyperplasia (BPH), prostatic intraepithelial neoplasia (PIN) and prostatic carcinoma (PC), and their involvement in apoptosis/proliferation via NF-kB (TNF-α, IL-1) stimulation. Methods Immunohistochemical and Western blot analyses were performed in 10 samples of normal prostates, 35 samples of BPH, 27 samples diagnosis of PIN (with low-grade PIN or high-grade PIN) and 95 samples of PC (with low, medium or high Gleason grades). Results In NP, cytoplasm of epithelial cells were positive to c-IAP1/2 (80% of samples), c-IAP-2 (60%), ILP (20%), XIAP (20%); negative to NAIP and survivin. In BPH, epithelial cells were immunostained to c-IAP1/2 (57.57%), c-IAP-2 (57.57%), ILP (66.6%), NAIP (60.6%), XIAP (27.27%), survivin (9.1%). Whereas low-grade PIN showed intermediate results between NP and BPH; results in high-grade PIN were similar to those found in PC. In PC, epithelial cells were immunostained to c-IAP1/2, c-IAP-2, ILP, NAIP, XIAP (no Gleason variation) and survivin (increasing with Gleason). Conclusions IAPs could be involved in prostate disorder (BPH, PIN and PC) development since might be provoke inhibition of apoptosis and subsequently cell proliferation. At the same time, different transduction pathway such as IL-1/NIK/NF-kB or TNF/NF-kB (NIK or p38) also promotes proliferation. Inhibitions of IAPs, IL-1α and TNFα might be a possible target for PC treatment since IAPs are the proteins that inhibited apoptosis (favour proliferation) and IL-1α and TNFα would affect all the transduction pathway involucrate in the activation of transcription factors related to survival or proliferation (NF-kB, Elk-1 or ATF-2). PMID:20078866

  6. New Multi-target Antagonists of α1A-, α1D-Adrenoceptors and 5-HT1A Receptors Reduce Human Hyperplastic Prostate Cell Growth and the Increase of Intraurethral Pressure.

    PubMed

    Nascimento-Viana, Jéssica B; Carvalho, Aline R; Nasciutti, Luiz Eurico; Alcántara-Hernández, Rocío; Chagas-Silva, Fernanda; Souza, Pedro A R; Romeiro, Luiz Antonio S; García-Sáinz, J Adolfo; Noël, François; Silva, Claudia Lucia Martins

    2016-01-01

    Benign prostatic hyperplasia (BPH) is characterized by stromal cell proliferation and contraction of the periurethral smooth muscle, causing lower urinary tract symptoms. Current BPH treatment, based on monotherapy with α1A-adrenoceptor antagonists, is helpful for many patients, but insufficient for others, and recent reports suggest that stimulation of α1D-adrenoceptors and 5-hydroxytryptamine (serotonin) (5-HT)1A receptors contributes to cell proliferation. In this study, we investigated the potential of three N-phenylpiperazine derivatives (LDT3, LDT5, and LDT8) as multi-target antagonists of BPH-associated receptors. The affinity and efficacy of LDTs were estimated in isometric contraction and competition-binding assays using tissues (prostate and aorta) and brain membrane samples enriched in specific on- or off-target receptors. LDTs' potency was estimated in intracellular Ca(2+) elevation assays using cells overexpressing human α1-adrenoceptor subtypes. The antiproliferative effect of LDTs on prostate cells from BPH patients was evaluated by viable cell counting and 3-(4,5-dimethythiazol-2-yl)-2,5-diphenyl tetrazolium bromide assays. We also determined LDTs' effects on rat intraurethral and arterial pressure. LDT3 and LDT5 are potent antagonists of α1A-, α1D-adrenoceptors, and 5-HT1A receptors (Ki values in the nanomolar range), and fully inhibited phenylephrine- and 5-HT-induced proliferation of BPH cells. In vivo, LDT3 and LDT5 fully blocked the increase of intraurethral pressure (IUP) induced by phenylephrine at doses (ED50 of 0.15 and 0.09 μg.kg(-1), respectively) without effect on basal mean blood pressure. LDT3 and LDT5 are multi-target antagonists of key receptors in BPH, and are capable of triggering both prostate muscle relaxation and human hyperplastic prostate cell growth inhibition in vitro. Thus, LDT3 and LDT5 represent potential new lead compounds for BPH treatment. PMID:26493747

  7. Histogenesis of human colorectal adenomas and hyperplastic polyps: the role of cell proliferation and crypt fission

    PubMed Central

    Wong, W-M; Mandir, N; Goodlad, R A; Wong, B C Y; Garcia, S B; Lam, S-K; Wright, N A

    2002-01-01

    Background: The histogenesis of human colorectal hyperplastic polyps and colorectal adenomas is poorly understood even now. Method: Human colorectal adenomas, hyperplastic polyps, and normal colorectal mucosae (patients with familial adenomatous polyposis and hereditary non-polyposis colorectal carcinoma were excluded) were obtained during colonoscopy and microdissected into individual crypts. Morphology, cell proliferation characteristics, and fission indices of crypts isolated from these lesions were then studied. Results: Crypts isolated from colorectal adenomas and colorectal hyperplastic polyps were significantly larger (p<0.001) than crypts from normal colorectal mucosae. Crypt fission was an uncommon event in normal colonic mucosae but common in crypts isolated from adenomas and hyperplastic polyps (p<0.001). Analysis of the distribution of mitoses suggested an upward expansion of the proliferation compartment in adenomas to the surface of the crypt with no reversal of proliferating cell distribution, as has previously been described. Conclusions: Sporadic human colorectal adenomas and hyperplastic polyps grow by the process of crypt fission. Expansion of the proliferative compartment was demonstrated in crypts from adenomas, consistent with deregulation of cell cycle control. PMID:11788562

  8. Enforced epithelial expression of IGF-1 causes hyperplastic prostate growth while negative selection is requisite for spontaneous metastogenesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The insulin-like growth factor-1 (IGF-1) signaling axis is important for cell growth, differentiation, and survival, and increased serum IGF is a risk factor for prostate and other cancers. To study IGF-1 action on the prostate, we created transgenic (PB-Des) mice that specifically express human IGF...

  9. P21-Activated Kinase Inhibitors FRAX486 and IPA3: Inhibition of Prostate Stromal Cell Growth and Effects on Smooth Muscle Contraction in the Human Prostate

    PubMed Central

    Wang, Yiming; Gratzke, Christian; Tamalunas, Alexander; Wiemer, Nicolas; Ciotkowska, Anna; Rutz, Beata; Waidelich, Raphaela; Strittmatter, Frank; Liu, Chunxiao; Stief, Christian G.; Hennenberg, Martin

    2016-01-01

    Prostate smooth muscle tone and hyperplastic growth are involved in the pathophysiology and treatment of male lower urinary tract symptoms (LUTS). Available drugs are characterized by limited efficacy. Patients’ adherence is particularly low to combination therapies of 5α-reductase inhibitors and α1-adrenoceptor antagonists, which are supposed to target contraction and growth simultaneously. Consequently, molecular etiology of benign prostatic hyperplasia (BPH) and new compounds interfering with smooth muscle contraction or growth in the prostate are of high interest. Here, we studied effects of p21-activated kinase (PAK) inhibitors (FRAX486, IPA3) in hyperplastic human prostate tissues, and in stromal cells (WPMY-1). In hyperplastic prostate tissues, PAK1, -2, -4, and -6 may be constitutively expressed in catecholaminergic neurons, while PAK1 was detected in smooth muscle and WPMY-1 cells. Neurogenic contractions of prostate strips by electric field stimulation were significantly inhibited by high concentrations of FRAX486 (30 μM) or IPA3 (300 μM), while noradrenaline- and phenylephrine-induced contractions were not affected. FRAX486 (30 μM) inhibited endothelin-1- and -2-induced contractions. In WPMY-1 cells, FRAX486 or IPA3 (24 h) induced concentration-dependent (1–10 μM) degeneration of actin filaments. This was paralleled by attenuation of proliferation rate, being observed from 1 to 10 μM FRAX486 or IPA3. Cytotoxicity of FRAX486 and IPA3 in WPMY-1 cells was time- and concentration-dependent. Stimulation of WPMY-1 cells with endothelin-1 or dihydrotestosterone, but not noradrenaline induced PAK phosphorylation, indicating PAK activation by endothelin-1. Thus, PAK inhibitors may inhibit neurogenic and endothelin-induced smooth muscle contractions in the hyperplastic human prostate, and growth of stromal cells. Targeting prostate smooth muscle contraction and stromal growth at once by a single compound is principally possible, at least under

  10. Hormonal modulation of invitro biosynthesis of inhibin like peptide by human prostate.

    PubMed

    Vanage, G R; Phadke, M A; Bandivdekar, A H; Sheth, A R

    1990-01-01

    The hormonal regulation of inhibin biosynthesis by human benign hyperplastic prostate tissue was studied by determining the incorporation of 3H-leucine. 3H-inhibin, synthesized de novo, was immunoprecipitated from the culture media using specific antibodies to human prostatic inhibin. Testosterone and estradiol had no effect on inhibin biosynthesis whereas hFSH and PMSG had stimulatory effect. A decrease in inhibin biosynthesis was noticed on the addition of LHRH, TRH, hCG, hLH and human prolactin. PMID:2126421

  11. HUMAN PROSTATE CANCER RISK FACTORS

    EPA Science Inventory

    Prostate cancer has the highest prevalence of any non-skin cancer in the human body, with similar likelihood of neoplastic foci found within the prostates of men around the world regardless of diet, occupation, lifestyle, or other factors. Essentially all men with circulating an...

  12. Human Prostate Cancer Hallmarks Map.

    PubMed

    Datta, Dipamoy; Aftabuddin, Md; Gupta, Dinesh Kumar; Raha, Sanghamitra; Sen, Prosenjit

    2016-01-01

    Human prostate cancer is a complex heterogeneous disease that mainly affects elder male population of the western world with a high rate of mortality. Acquisitions of diverse sets of hallmark capabilities along with an aberrant functioning of androgen receptor signaling are the central driving forces behind prostatic tumorigenesis and its transition into metastatic castration resistant disease. These hallmark capabilities arise due to an intense orchestration of several crucial factors, including deregulation of vital cell physiological processes, inactivation of tumor suppressive activity and disruption of prostate gland specific cellular homeostasis. The molecular complexity and redundancy of oncoproteins signaling in prostate cancer demands for concurrent inhibition of multiple hallmark associated pathways. By an extensive manual curation of the published biomedical literature, we have developed Human Prostate Cancer Hallmarks Map (HPCHM), an onco-functional atlas of human prostate cancer associated signaling and events. It explores molecular architecture of prostate cancer signaling at various levels, namely key protein components, molecular connectivity map, oncogenic signaling pathway map, pathway based functional connectivity map etc. Here, we briefly represent the systems level understanding of the molecular mechanisms associated with prostate tumorigenesis by considering each and individual molecular and cell biological events of this disease process. PMID:27476486

  13. Human Prostate Cancer Hallmarks Map

    PubMed Central

    Datta, Dipamoy; Aftabuddin, Md.; Gupta, Dinesh Kumar; Raha, Sanghamitra; Sen, Prosenjit

    2016-01-01

    Human prostate cancer is a complex heterogeneous disease that mainly affects elder male population of the western world with a high rate of mortality. Acquisitions of diverse sets of hallmark capabilities along with an aberrant functioning of androgen receptor signaling are the central driving forces behind prostatic tumorigenesis and its transition into metastatic castration resistant disease. These hallmark capabilities arise due to an intense orchestration of several crucial factors, including deregulation of vital cell physiological processes, inactivation of tumor suppressive activity and disruption of prostate gland specific cellular homeostasis. The molecular complexity and redundancy of oncoproteins signaling in prostate cancer demands for concurrent inhibition of multiple hallmark associated pathways. By an extensive manual curation of the published biomedical literature, we have developed Human Prostate Cancer Hallmarks Map (HPCHM), an onco-functional atlas of human prostate cancer associated signaling and events. It explores molecular architecture of prostate cancer signaling at various levels, namely key protein components, molecular connectivity map, oncogenic signaling pathway map, pathway based functional connectivity map etc. Here, we briefly represent the systems level understanding of the molecular mechanisms associated with prostate tumorigenesis by considering each and individual molecular and cell biological events of this disease process. PMID:27476486

  14. Presence of calcitonin-like immunoreactivity (iCT) in human prostate gland: evidence for iCT secretion by cultured prostate cells.

    PubMed

    Shah, G V; Noble, M J; Austenfeld, M; Weigel, J; Deftos, L J; Mebust, W K

    1992-01-01

    Immunoreactive calcitonin (iCT) has been detected in human prostate tissue extracts as well as seminal plasma. The present studies were undertaken to examine whether iSCT (immunoreactive salmon CT-like human peptide) co-exists with iHCT (thyroid CT-like substance) in human prostate tissue extracts, and whether these substances are secreted by primary prostate cells in culture. Since the local secretion of these substances seems to increase in some neoplasms, a second objective of the study was to examine whether basal secretion of iCTs from primary prostate cells is increased in carcinoma. The present results have shown that both iHCT and iSCT were present in prostate tissue extracts. The mean iHCT levels in extracts of benign hyperplastic prostates (BPH) were 0.59 ng/g prostate, and these were significantly lower than iHCT concentrations in prostatic carcinoma (PC) (2.53 ng/g). No significant differences in their iSCT contents were observed. However, the results from culture of over 90 individual prostate tissue specimens from BPH or PC indicate that primary prostate cells secreted detectable quantities of iSCT and the basal release of this material from PC prostate cultures was almost four-fold higher than that from BPH prostate cultures. These results suggest that a CT-like immunoreactive material is secreted by primary prostate cells in culture, and the basal secretion of this material is significantly higher in PC cells as compared to BPH cells. Endogenous secretion of prostatic CT, and the elevation of its expression in PC suggest that it may serve as a regulatory factor in the pathophysiology of the prostate gland. PMID:1409122

  15. Expression of leukemia/lymphoma related factor (LRF/Pokemon) in human benign prostate hyperplasia and prostate cancer.

    PubMed

    Aggarwal, Himanshu; Aggarwal, Anshu; Hunter, William J; Yohannes, Paulos; Khan, Ansar U; Agrawal, Devendra K

    2011-04-01

    Leukemia/lymphoma related factor (LRF), also known as Pokemon, is a protein that belongs to the POK family of transcriptional repressors. It has an oncogenic role in many different solid tumors. In this study, the expression of LRF was evaluated in benign prostate hyperplastic (BPH) and prostate cancer (PC) tissues. The functional expression of LRF was studied using multiple cellular and molecular methods including RT-PCR, western blotting, immunohistochemistry, and immunofluorescence. Paraffin-embedded human tissues of BPH and PC were used to examine LRF expression. Histological staining of the BPH and PC tissue sections revealed nuclear expression of LRF with minimal expression in the surrounding stroma. The semi-quantitative RT-PCR and western immunoblot analyses demonstrated significantly higher mRNA transcripts and protein expression in PC than BPH. High expression of LRF suggests that it may have a potential role in the pathogenesis of both BPH and prostate cancer. Further studies will help elucidate the mechanisms and signaling pathways that LRF may follow in the pathogenesis of prostate carcinoma. PMID:21251909

  16. Developmental Exposure to Estrogen Alters Differentiation and Epigenetic Programming in a Human Fetal Prostate Xenograft Model

    PubMed Central

    Saffarini, Camelia M.; McDonnell-Clark, Elizabeth V.; Amin, Ali; Huse, Susan M.; Boekelheide, Kim

    2015-01-01

    Prostate cancer is the most frequent non-cutaneous malignancy in men. There is strong evidence in rodents that neonatal estrogen exposure plays a role in the development of this disease. However, there is little information regarding the effects of estrogen in human fetal prostate tissue. This study explored early life estrogen exposure, with and without a secondary estrogen and testosterone treatment in a human fetal prostate xenograft model. Histopathological lesions, proliferation, and serum hormone levels were evaluated at 7, 30, 90, and 200-day time-points after xenografting. The expression of 40 key genes involved in prostatic glandular and stromal growth, cell-cycle progression, apoptosis, hormone receptors and tumor suppressors was evaluated using a custom PCR array. Epigenome-wide analysis of DNA methylation was performed on whole tissue, and laser capture-microdissection (LCM) isolated epithelial and stromal compartments of 200-day prostate xenografts. Combined initial plus secondary estrogenic exposures had the most severe tissue changes as revealed by the presence of hyperplastic glands at day 200. Gene expression changes corresponded with the cellular events in the KEGG prostate cancer pathway, indicating that initial plus secondary exposure to estrogen altered the PI3K-Akt signaling pathway, ultimately resulting in apoptosis inhibition and an increase in cell cycle progression. DNA methylation revealed that differentially methylated CpG sites significantly predominate in the stromal compartment as a result of estrogen-treatment, thereby providing new targets for future investigation. By using human fetal prostate tissue and eliminating the need for species extrapolation, this study provides novel insights into the gene expression and epigenetic effects related to prostate carcinogenesis following early life estrogen exposure. PMID:25799167

  17. Characterization of 17beta-hydroxysteroid dehydrogenase isoenzyme expression in benign and malignant human prostate.

    PubMed

    Elo, J P; Akinola, L A; Poutanen, M; Vihko, P; Kyllönen, A P; Lukkarinen, O; Vihko, R

    1996-03-28

    In the present study, expressions of 17beta-hydroxysteroid dehydrogenase (17HSD) types 1, 2, and 3, 5alpha-reductase type 2 and human androgen receptor mRNAs were determined in 12 benign prostatic hyperplasia and 17 prostatic carcinoma specimens. 17HSD type 2 was found to be the principle isoenzyme expressed in the prostate. Significantly higher expressions of 17HSD type 2 and 5alpha-reductase type 2 were detected in benign prostatic hyperplasia compared with the carcinoma specimens. Expression of the androgen receptor in the 2 groups was not significantly different. 17HSD type 3 mRNA was not detected in any of the specimens investigated. Only low constructive expression of the 2.3 kb mRNA of 17HSD type 1 was seen. Immunohistochemical analysis indicated that this did not lead to significant enzyme expression, only faint staining for the enzyme protein being detected, mainly in uroepithelial cells. No significant correlation was found between any of the mRNAs analysed, but the data on 5alpha-reductase type 2 mRNA support the presence of an increased proportion of 5alpha-dihydrotesterone in the hyperplastic prostate. In cultured PC-3 prostatic cancer cells and in the transiently transfected human embryonic kidney 293 cells, 17HSD type 2 was found exclusively to convert 5alpha-dihydrotestosterone and testosterone into the less potent 17-keto compounds 5alpha-androstanedione and 4-androstenedione, respectively. We suggest that the 17HSD type 2 isoenzyme plays a part in the metabolic pathway, resulting in the inactivation of testosterone and 5alpha-dihydrotestosterone locally in the prostate. The enzyme expressed in the prostate could, therefore, protect cells from excessive androgen action. PMID:8608963

  18. Pumpkin seed extract: Cell growth inhibition of hyperplastic and cancer cells, independent of steroid hormone receptors.

    PubMed

    Medjakovic, Svjetlana; Hobiger, Stefanie; Ardjomand-Woelkart, Karin; Bucar, Franz; Jungbauer, Alois

    2016-04-01

    Pumpkin seeds have been known in folk medicine as remedy for kidney, bladder and prostate disorders since centuries. Nevertheless, pumpkin research provides insufficient data to back up traditional beliefs of ethnomedical practice. The bioactivity of a hydro-ethanolic extract of pumpkin seeds from the Styrian pumpkin, Cucurbita pepo L. subsp. pepo var. styriaca, was investigated. As pumpkin seed extracts are standardized to cucurbitin, this compound was also tested. Transactivational activity was evaluated for human androgen receptor, estrogen receptor and progesterone receptor with in vitro yeast assays. Cell viability tests with prostate cancer cells, breast cancer cells, colorectal adenocarcinoma cells and a hyperplastic cell line from benign prostate hyperplasia tissue were performed. As model for non-hyperplastic cells, effects on cell viability were tested with a human dermal fibroblast cell line (HDF-5). No transactivational activity was found for human androgen receptor, estrogen receptor and progesterone receptor, for both, extract and cucurbitin. A cell growth inhibition of ~40-50% was observed for all cell lines, with the exception of HDF-5, which showed with ~20% much lower cell growth inhibition. Given the receptor status of some cell lines, a steroid-hormone receptor independent growth inhibiting effect can be assumed. The cell growth inhibition for fast growing cells together with the cell growth inhibition of prostate-, breast- and colon cancer cells corroborates the ethnomedical use of pumpkin seeds for a treatment of benign prostate hyperplasia. Moreover, due to the lack of androgenic activity, pumpkin seed applications can be regarded as safe for the prostate. PMID:26976217

  19. Metabolomic Imaging for Human Prostate Cancer Detection

    PubMed Central

    Wu, Chin-Lee; Jordan, Kate W.; Ratai, Eva M.; Sheng, Jinhua; Adkins, Christen B.; DeFeo, Elita M; Jenkins, Bruce G.; Ying, Leslie; McDougal, W. Scott; Cheng, Leo L.

    2010-01-01

    As current radiological approaches cannot accurately localize prostate cancer in vivo, biopsies are conducted at random within prostates for at-risk patients, leading to high false-negative rates. Metabolomic imaging can map cancer-specific biomolecular profile values onto anatomical structures to direct biopsy. In this preliminary study, we evaluated five prostatectomy-removed whole prostates from biopsy-proven cancer patients on a 7 Tesla human, whole-body magnetic resonance scanner. Localized, multi-cross-sectional, multi-voxel magnetic resonance spectra were used to construct a malignancy index based on prostate cancer metabolomic profiles obtained from previous, intact tissue analyses by a 14 Tesla spectrometer. This calculated Malignancy Index shows linear correlation with lesion size (p<0.013) and demonstrates a 93–97% overall accuracy for detecting the presence of prostate cancer lesions. PMID:20371475

  20. Subcellular concentrations of calcium, zinc, and magnesium in benign nodular hyperplasia of the human prostate: X-ray microanalysis of freeze-dried cryosections

    SciTech Connect

    Tvedt, K.E.; Kopstad, G.; Haugen, O.A.; Halgunset, J.

    1987-01-01

    Biopsies from human prostates were obtained from normal and hyperplastic glands. The intracellular concentrations of calcium, zinc, and magnesium were analyzed using X-ray microanalysis of freeze-dried cryosections. Two prostate biopsies were obtained from kidney donors, ages 19 and 50 years, without any sign of benign nodular hyperplasia. The normal tissues were frozen within 15 min after circulatory arrest. The central part of biopsies from eight elderly men suffering from benign nodular hyperplasia were frozen within 30 s after excision. Adjacent tissue was processed for light microscopy and histopathological diagnosis. All samples were fresh-frozen using liquid nitrogen cooled pliers, without the use of any freeze-protection, fixation, or staining. In both the normal and the hyperplastic prostates high concentrations (up to above 100 mmol/kg dry weight) of zinc were present in electron dense bodies in the cytoplasm of the epithelial cells. Together with zinc, about equal concentrations of magnesium were found. Calcium was detected in 4 to 8 times the concentration of zinc. Significant, positive correlation between calcium and zinc as well as between calcium and magnesium in the cytoplasm was a typical finding in both normal and hyperplastic glands. In six of eight patients, older than 60 years of age, high levels of calcium (17.0-38.8 mmol/kg dry weight) were observed in the nuclei of the epithelial cells, while very low values were found in the remaining two. In the two younger cases (19 and 50 years of age), the nuclear calcium level in prostatic epithelium was relatively low (about 10 mmol/kg dry weight). These observations suggest that an increase of intranuclear calcium with advancing age may be of pathogenetic significance to growth disturbances in the prostate.

  1. Induced pluripotency of human prostatic epithelial cells.

    PubMed

    Zhao, Hongjuan; Sun, Ning; Young, Sarah R; Nolley, Rosalie; Santos, Jennifer; Wu, Joseph C; Peehl, Donna M

    2013-01-01

    Induced pluripotent stem (iPS) cells are a valuable resource for discovery of epigenetic changes critical to cell type-specific differentiation. Although iPS cells have been generated from other terminally differentiated cells, the reprogramming of normal adult human basal prostatic epithelial (E-PZ) cells to a pluripotent state has not been reported. Here, we attempted to reprogram E-PZ cells by forced expression of Oct4, Sox2, c-Myc, and Klf4 using lentiviral vectors and obtained embryonic stem cell (ESC)-like colonies at a frequency of 0.01%. These E-PZ-iPS-like cells with normal karyotype gained expression of pluripotent genes typical of iPS cells (Tra-1-81, SSEA-3, Nanog, Sox2, and Oct4) and lost gene expression characteristic of basal prostatic epithelial cells (CK5, CK14, and p63). E-PZ-iPS-like cells demonstrated pluripotency by differentiating into ectodermal, mesodermal, and endodermal cells in vitro, although lack of teratoma formation in vivo and incomplete demethylation of pluripotency genes suggested only partial reprogramming. Importantly, E-PZ-iPS-like cells re-expressed basal epithelial cell markers (CD44, p63, MAO-A) in response to prostate-specific medium in spheroid culture. Androgen induced expression of androgen receptor (AR), and co-culture with rat urogenital sinus further induced expression of prostate-specific antigen (PSA), a hallmark of secretory cells, suggesting that E-PZ-iPS-like cells have the capacity to differentiate into prostatic basal and secretory epithelial cells. Finally, when injected into mice, E-PZ-iPS-like cells expressed basal epithelial cell markers including CD44 and p63. When co-injected with rat urogenital mesenchyme, E-PZ-iPS-like cells expressed AR and expression of p63 and CD44 was repressed. DNA methylation profiling identified epigenetic changes in key pathways and genes involved in prostatic differentiation as E-PZ-iPS-like cells converted to differentiated AR- and PSA-expressing cells. Our results suggest that

  2. Human constitutive androstane receptor (CAR) and pregnane X receptor (PXR) support the hypertrophic but not the hyperplastic response to the murine nongenotoxic hepatocarcinogens phenobarbital and chlordane in vivo.

    PubMed

    Ross, Jillian; Plummer, Simon M; Rode, Anja; Scheer, Nico; Bower, Conrad C; Vogel, Ortwin; Henderson, Colin J; Wolf, C Roland; Elcombe, Clifford R

    2010-08-01

    Mouse nongenotoxic hepatocarcinogens phenobarbital (PB) and chlordane induce hepatomegaly characterized by hypertrophy and hyperplasia. Increased cell proliferation is implicated in the mechanism of tumor induction. The relevance of these tumors to human health is unclear. The xenoreceptors, constitutive androstane receptors (CARs), and pregnane X receptor (PXR) play key roles in these processes. Novel "humanized" and knockout models for both receptors were developed to investigate potential species differences in hepatomegaly. The effects of PB (80 mg/kg/4 days) and chlordane (10 mg/kg/4 days) were investigated in double humanized PXR and CAR (huPXR/huCAR), double knockout PXR and CAR (PXRKO/CARKO), and wild-type (WT) C57BL/6J mice. In WT mice, both compounds caused increased liver weight, hepatocellular hypertrophy, and cell proliferation. Both compounds caused alterations to a number of cell cycle genes consistent with induction of cell proliferation in WT mice. However, these gene expression changes did not occur in PXRKO/CARKO or huPXR/huCAR mice. Liver hypertrophy without hyperplasia was demonstrated in the huPXR/huCAR animals in response to both compounds. Induction of the CAR and PXR target genes, Cyp2b10 and Cyp3a11, was observed in both WT and huPXR/huCAR mouse lines following treatment with PB or chlordane. In the PXRKO/CARKO mice, neither liver growth nor induction of Cyp2b10 and Cyp3a11 was seen following PB or chlordane treatment, indicating that these effects are CAR/PXR dependent. These data suggest that the human receptors are able to support the chemically induced hypertrophic responses but not the hyperplastic (cell proliferation) responses. At this time, we cannot be certain that hCAR and hPXR when expressed in the mouse can function exactly as the genes do when they are expressed in human cells. However, all parameters investigated to date suggest that much of their functionality is maintained. PMID:20403969

  3. Exophytic benign prostatic hyperplasia.

    PubMed

    Blaschko, Sarah D; Eisenberg, Michael L

    2011-08-01

    A 60-year-old man had incidental finding of a multilobular 8 × 7 × 7-cm mass identified posterior to the urinary bladder in continuity with the prostate. The man's prostate-specific antigen was 1.87, and he denied any lower urinary tract symptoms. A transrectal ultrasound-guided biopsy demonstrated benign prostatic tissue. A computed tomography-guided needle aspiration demonstrated a benign epithelium-lined cyst, likely prostatic in origin. Benign prostatic hyperplasia is a proliferation of prostatic epithelial and stromal cells. Although prostatic hyperplasia is usually restricted to the prostate gland, hyperplastic nodules occasionally protrude outside the prostate and rarely form exophytic pelvic masses. PMID:20869104

  4. N-Myc Drives Neuroendocrine Prostate Cancer Initiated from Human Prostate Epithelial Cells.

    PubMed

    Lee, John K; Phillips, John W; Smith, Bryan A; Park, Jung Wook; Stoyanova, Tanya; McCaffrey, Erin F; Baertsch, Robert; Sokolov, Artem; Meyerowitz, Justin G; Mathis, Colleen; Cheng, Donghui; Stuart, Joshua M; Shokat, Kevan M; Gustafson, W Clay; Huang, Jiaoti; Witte, Owen N

    2016-04-11

    MYCN amplification and overexpression are common in neuroendocrine prostate cancer (NEPC). However, the impact of aberrant N-Myc expression in prostate tumorigenesis and the cellular origin of NEPC have not been established. We define N-Myc and activated AKT1 as oncogenic components sufficient to transform human prostate epithelial cells to prostate adenocarcinoma and NEPC with phenotypic and molecular features of aggressive, late-stage human disease. We directly show that prostate adenocarcinoma and NEPC can arise from a common epithelial clone. Further, N-Myc is required for tumor maintenance, and destabilization of N-Myc through Aurora A kinase inhibition reduces tumor burden. Our findings establish N-Myc as a driver of NEPC and a target for therapeutic intervention. PMID:27050099

  5. Androgen Regulated Genes in Human Prostate Xenografts in Mice: Relation to BPH and Prostate Cancer

    PubMed Central

    Love, Harold D.; Booton, S. Erin; Boone, Braden E.; Breyer, Joan P.; Koyama, Tatsuki; Revelo, Monica P.; Shappell, Scott B.; Smith, Jeffrey R.; Hayward, Simon W.

    2009-01-01

    Benign prostatic hyperplasia (BPH) and prostate carcinoma (CaP) are linked to aging and the presence of androgens, suggesting that androgen regulated genes play a major role in these common diseases. Androgen regulation of prostate growth and development depends on the presence of intact epithelial-stromal interactions. Further, the prostatic stroma is implicated in BPH. This suggests that epithelial cell lines are inadequate to identify androgen regulated genes that could contribute to BPH and CaP and which could serve as potential clinical biomarkers. In this study, we used a human prostate xenograft model to define a profile of genes regulated in vivo by androgens, with an emphasis on identifying candidate biomarkers. Benign transition zone (TZ) human prostate tissue from radical prostatectomies was grafted to the sub-renal capsule site of intact or castrated male immunodeficient mice, followed by the removal or addition of androgens, respectively. Microarray analysis of RNA from these tissues was used to identify genes that were; 1) highly expressed in prostate, 2) had significant expression changes in response to androgens, and, 3) encode extracellular proteins. A total of 95 genes meeting these criteria were selected for analysis and validation of expression in patient prostate tissues using quantitative real-time PCR. Expression levels of these genes were measured in pooled RNAs from human prostate tissues with varying severity of BPH pathologic changes and CaP of varying Gleason score. A number of androgen regulated genes were identified. Additionally, a subset of these genes were over-expressed in RNA from clinical BPH tissues, and the levels of many were found to correlate with disease status. Our results demonstrate the feasibility, and some of the problems, of using a mouse xenograft model to characterize the androgen regulated expression profiles of intact human prostate tissues. PMID:20027305

  6. SCRIB expression is deregulated in human prostate cancer, and its deficiency in mice promotes prostate neoplasia

    PubMed Central

    Pearson, Helen B.; Perez-Mancera, Pedro A.; Dow, Lukas E.; Ryan, Andrew; Tennstedt, Pierre; Bogani, Debora; Elsum, Imogen; Greenfield, Andy; Tuveson, David A.; Simon, Ronald; Humbert, Patrick O.

    2011-01-01

    Loss of cellular polarity is a hallmark of epithelial cancers, raising the possibility that regulators of polarity have a role in suppressing tumorigenesis. The Scribble complex is one of at least three interacting protein complexes that have a critical role in establishing and maintaining epithelial polarity. In human colorectal, breast, and endometrial cancers, expression of the Scribble complex member SCRIB is often mislocalized and deregulated. Here, we report that Scrib is indispensable for prostate homeostasis in mice. Scrib heterozygosity initiated prostate hyperplasia, while targeted biallelic Scrib loss predisposed mice to prostate intraepithelial neoplasia. Mechanistically, Scrib was shown to negatively regulate the MAPK cascade to suppress tumorigenesis. Further analysis revealed that prostate-specific loss of Scrib in mice combined with expression of an oncogenic Kras mutation promoted the progression of prostate cancer that recapitulated the human disease. The clinical significance of the work in mice was highlighted by our observation that SCRIB deregulation strongly correlated with poor survival in human prostate cancer. These data suggest that the polarity network could provide a new avenue for therapeutic intervention. PMID:21965329

  7. A human fetal prostate xenograft model of developmental estrogenization.

    PubMed

    Saffarini, Camelia M; McDonnell-Clark, Elizabeth V; Amin, Ali; Boekelheide, Kim

    2015-01-01

    Prostate cancer is a common disease in older men. Rodent models have demonstrated that an early and later-life exposure to estrogen can lead to cancerous lesions and implicated hormonal dysregulation as an avenue for developing future prostate neoplasia. This study utilizes a human fetal prostate xenograft model to study the role of estrogen in the progression of human disease. Histopathological lesions were assessed in 7-, 30-, 90-, 200-, and 400-day human prostate xenografts. Gene expression for cell cycle, tumor suppressors, and apoptosis-related genes (ie, CDKN1A, CASP9, ESR2, PTEN, and TP53) was performed for 200-day estrogen-treated xenografts. Glandular hyperplasia was observed in xenografts given both an initial and secondary exposure to estradiol in both 200- and 400-day xenografts. Persistent estrogenic effects were verified using immunohistochemical markers for cytokeratin 10, p63, and estrogen receptor α. This model provides data on the histopathological state of the human prostate following estrogenic treatment, which can be utilized in understanding the complicated pathology associated with prostatic disease and early and later-life estrogenic exposures. PMID:25633637

  8. Keratin immunoreactivity as an aid to the diagnosis of persistent adenocarcinoma in irradiated human prostates

    SciTech Connect

    Brawer, M.K.; Nagle, R.B.; Pitts, W.; Freiha, F.; Gamble, S.L.

    1989-02-01

    Postirradiation prostatic biopsy is believed by many to be the best measure of radiation effectiveness in prostatic cancer. Therapeutic irradiation may induce prostatic glandular atypia, which in its severe form can be confused with persistent adenocarcinoma on prostatic biopsies. In the current study, 37 postirradiation prostate biopsy specimens were evaluated by immunohistochemistry using a specific monoclonal anticytokeratin antibody (KA1) that reacts with the basal cells of normal or hyperplastic glands, but is nonreactive with the lumenal cells or with prostatic carcinoma cells. Persistent carcinoma was observed in 19 cases in which antibody staining was absent. The noncarcinomatous glands retained reactivity, but this reactivity appeared in a new and previously undescribed pattern. The irradiated lesion was characterized by cellular pleomorphisism, with enlargement of nuclei and loss of polarity. The immunoreactivity was seen in the enlarged basal cells and was seen to focally extend to involve the lumenal cell layer. In five of 37 cases, glands were seen that were so atypical on the routinely stained sections that a distinction from cancer could not be made. These same glands in the adjacent section reacted with KA1 in each case allowing us to conclude that the changes were benign. We conclude that the interpretation of postirradiation prostatic biopsy specimens may be aided by immunohistochemistry with this anticytokeratin antibody.

  9. Differentially Expressed Genes and Signature Pathways of Human Prostate Cancer

    PubMed Central

    Myers, Jennifer S.; von Lersner, Ariana K.; Robbins, Charles J.; Sang, Qing-Xiang Amy

    2015-01-01

    Genomic technologies including microarrays and next-generation sequencing have enabled the generation of molecular signatures of prostate cancer. Lists of differentially expressed genes between malignant and non-malignant states are thought to be fertile sources of putative prostate cancer biomarkers. However such lists of differentially expressed genes can be highly variable for multiple reasons. As such, looking at differential expression in the context of gene sets and pathways has been more robust. Using next-generation genome sequencing data from The Cancer Genome Atlas, differential gene expression between age- and stage- matched human prostate tumors and non-malignant samples was assessed and used to craft a pathway signature of prostate cancer. Up- and down-regulated genes were assigned to pathways composed of curated groups of related genes from multiple databases. The significance of these pathways was then evaluated according to the number of differentially expressed genes found in the pathway and their position within the pathway using Gene Set Enrichment Analysis and Signaling Pathway Impact Analysis. The “transforming growth factor-beta signaling” and “Ran regulation of mitotic spindle formation” pathways were strongly associated with prostate cancer. Several other significant pathways confirm reported findings from microarray data that suggest actin cytoskeleton regulation, cell cycle, mitogen-activated protein kinase signaling, and calcium signaling are also altered in prostate cancer. Thus we have demonstrated feasibility of pathway analysis and identified an underexplored area (Ran) for investigation in prostate cancer pathogenesis. PMID:26683658

  10. Nonylphenol effects on human prostate non tumorigenic cells.

    PubMed

    Forte, Maurizio; Di Lorenzo, Mariana; Carrizzo, Albino; Valiante, Salvatore; Vecchione, Carmine; Laforgia, Vincenza; De Falco, Maria

    2016-05-16

    Nonylphenol (NP) is an industrial chemical with estrogenic activity both in vivo and in vitro; estrogens play a critical role in the development of prostate and may be the cause of some pathological states, including cancer. In this study we examined the effects of NP on human prostate non tumorigenic epithelial cells (PNT1A) investigating on cell proliferation, interaction with estrogen receptors (ERs) and gene expression of genes involved in prostate diseases. We found that NP affects cell proliferation at 10(-6)M, promoting a cytoplasm-nucleus translocation of ERα and not ERβ, like the natural estrogen 17β-estradiol (E2). Moreover, we showed that NP enhances gene expression of key regulators of cell cycle. Estrogen selective antagonist ICI182780 in part reverted the observed effects of NP. These results confirm the estrogenic activity of NP and suggest that other transduction pathways may be involved in NP action on prostate. PMID:27260121

  11. Characterizing the stiffness of Human Prostates using Acoustic Radiation Force

    PubMed Central

    Zhai, Liang; Madden, John; Foo, Wen-Chi; Mouraviev, Vladimir; Polascik, Thomas J.; Palmeri, Mark L.; Nightingale, Kathryn R.

    2012-01-01

    Acoustic Radiation Force Impulse (ARFI) imaging has been previously reported to portray normal anatomic structures and pathologies in ex vivo human prostates with good contrast and resolution. These findings were based on comparison with histological slides and McNeal’s zonal anatomy. In ARFI images, the central zone (CZ) appears darker (smaller displacement) than other anatomic zones, and prostate cancer (PCa) is darker than normal tissue in the peripheral zone (PZ). Since displacement amplitudes in ARFI images are determined by both the underlying tissue stiffness and the amplitude of acoustic radiation force which varies with acoustic attenuation, one question that arises is: how are the relative displacements in prostate ARFI images related to the underlying prostatic tissue stiffness? In linear, isotropic elastic materials and in tissues that are relatively uniform in acoustic attenuation (e.g. liver), relative displacement in ARFI images has been shown to be correlated with underlying tissue stiffness. However, the prostate is known to be heterogeneous. Variations in acoustic attenuation of prostatic structures could confound the interpretation of ARFI images due to the associated variations in the applied acoustic radiation force. Therefore, in this study, co-registered three-dimensional (3D) ARFI datasets and quantitative shear wave elasticity imaging (SWEI) datasets were acquired in freshly excised human prostates to investigate the relationship between displacement amplitudes in ARFI prostate images and the matched reconstructed shear moduli. The lateral time-to-peak (LTTP) algorithm was applied to the SWEI data to compute the shear wave speed and reconstruct the shear moduli. Five types of prostatic tissue (PZ, CZ, transition zone (TZ) and benign prostatic hyperplasia (BPH), PCa, and atrophy) were identified, whose shear moduli were quantified to be 4.1±0.8 kPa, 9.9±0.9 kPa, 4.8±0.6 kPa, 10.0±1.0 kPa and 8.0 kPa, respectively. Linear regression was

  12. Observations on human smooth muscle cell cultures from hyperplastic lesions of prosthetic bypass grafts: Production of a platelet-derived growth factor-like mitogen and expression of a gene for a platelet-derived growth factor receptor--a preliminary study

    SciTech Connect

    Birinyi, L.K.; Warner, S.J.; Salomon, R.N.; Callow, A.D.; Libby, P. )

    1989-08-01

    Prosthetic bypass grafts placed to the distal lower extremity often fail because of an occlusive tissue response in the perianastomotic region. The origin of the cells that comprise this occlusive lesion and the causes of the cellular proliferation are not known. To increase our understanding of this process we cultured cells from hyperplastic lesions obtained from patients at the time of reexploration for lower extremity graft failure, and we studied their identity and growth factor production in tissue culture. These cultures contain cells that express muscle-specific actin isoforms, shown by immunohistochemical staining, consistent with vascular smooth muscle origin. These cultures also released material that stimulated smooth muscle cell growth. A portion of this activity was similar to platelet-derived growth factor, since preincubation with antibody-to-human platelet-derived growth factor partially blocked the mitogenic effect of medium conditioned by human anastomotic hyperplastic cells. These conditioned media also contained material that competed with platelet-derived growth factor for its receptor, as measured in a radioreceptor assay. Northern blot analysis showed that these cells contain messenger RNA that encodes the A chain but not the B chain of platelet-derived growth factor. In addition, these cells contain messenger RNA that encodes a platelet-derived growth factor receptor. We conclude that cultured smooth muscle cells from human anastomotic hyperplastic lesions express genes for platelet-derived growth factor A chain and a platelet-derived growth factor receptor and secrete biologically active molecules similar to platelet-derived growth factor.

  13. Effect of anthralin on cell viability in human prostate adenocarcinoma.

    PubMed

    Raevskaya, A A; Gorbunova, S L; Savvateeva, M V; Severin, S E; Kirpichnikov, M P

    2012-07-01

    The study revealed the key role of serine protease hepsin activity in transition of in situ prostate adenocarcinoma into the metastasizing form. Inhibition of hepsin activity suppresses the invasive growth of the tumor. Hepsin is an convenient target for pharmacological agents, so the study of its inhibitory mechanisms is a promising avenue in drug development. Assay of proteolytic activity in various tumor cell lines in vitro showed that this activity in prostate adenocarcinoma cells significantly surpasses proteolytic activity in other examined tumor cell lines. Selective cytotoxic action of anthralin, an inhibitor of hepsin activity, on human adenocarcinoma cells was demonstrated in comparison with other tumor cell lines. PMID:22866312

  14. SEM and X-ray microanalysis of human prostatic calculi

    SciTech Connect

    Vilches, J.; Lopez, A.; De Palacio, L.; Munoz, C.; Gomez, J.

    1982-02-01

    Calculi removed from human prostates affected with nodular hyperplasia were analyzed with scanning electron microscopy and EDAX system. The general spectrum was made up of Na, Al, Mg, S, P, Ca and Zn. Two types of stone were identified morphostructurally and microanalytically: calculi type I of nodular surface with high peaks of S, and calculi type II polyfaceted with high peaks of P and Ca. Their formation from corpora amylacea and/or exogenous constituents is discussed. The superficial deposit of Zn suggests its incorporation from the prostatic liquid and does not seem to play an important role in the genesis.

  15. Beta-catenin is elevated in human benign prostatic hyperplasia specimens compared to histologically normal prostate tissue

    PubMed Central

    Bauman, Tyler M; Vezina, Chad M; Huang, Wei; Marker, Paul C; Peterson, Richard E; Ricke, William A

    2014-01-01

    Benign prostatic hyperplasia (BPH) is linked to lower urinary tract symptoms (LUTS) such as incomplete bladder emptying, urinary frequency and urgency. Mechanisms responsible for BPH are not fully known. Here, we tested whether beta-catenin (CTNNB1) immunostaining intensity and distribution differ in human glandular BPH tissue specimens compared to normal prostate tissue. Multiplex immunostaining of CTNNB1, its putative transcriptional target gene lymphoid enhancer binding factor 1 (LEF1), and the epithelial marker E-cadherin were examined in clinical human prostate specimens with or without histological BPH (pure epithelial or mixed stromal-epithelial nodules). BPH specimens were obtained from 24 men who experienced LUTS and underwent transurethral resection of the prostate surgery. Control specimens were tumor-adjacent histologically normal prostate tissue from 48 patients who underwent radical prostatectomy. The resulting multispectral images were unmixed and optical densities recorded to quantify staining abundance, cellular (membranous, cytoplasmic, and nuclear) and tissue localization (stromal versus epithelial), and determination of percentage of CTNNB1-positive cells. The following CTNNB1 indices were significantly higher in BPH compared to normal prostate tissue: overall staining intensity, staining intensity in prostate stromal cell membranes, cytoplasm and nuclei, and prostate epithelial cell nuclei. The following LEF1 indices were significantly lower in BPH compared to tumor-adjacent normal prostate tissue: stromal LEF1 staining intensity, percentage of LEF1-positive stromal cells, and intensity of LEF1 staining in stromal cell membranes, cytoplasm, and nuclei. The percentage of stromal cells with CTNNB1+/LEF1- nuclei was higher and percentage of stromal cells with CTNNB1-/LEF1+ nuclei was lower in BPH compared to tumor-adjacent normal prostate tissues. These results support the hypothesis that CTNNB1 expression increases in specific BPH tissue

  16. Serially heterotransplanted human prostate tumours as an experimental model

    PubMed Central

    Lopez-Barcons, Lluis-A

    2010-01-01

    Abstract Preclinical research on prostate cancer (PC) therapies uses several models to represent the human disease accurately. A common model uses patient prostate tumour biopsies to develop a cell line by serially passaging and subsequent implantation, in immunodeficient mice. An alternative model is direct implantation of patient prostate tumour biopsies into immunodeficient mice, followed by serial passage in vivo. The purpose of this review is to compile data from the more than 30 years of human PC serial heterotransplantation research. Serially heterotransplanted tumours are characterized by evaluating the histopathology of the resulting heterotransplants, including cellular differentiation, karyotype, marker expression, hormone sensitivity, cellular proliferation, metastatic potential and stromal and vascular components. These data are compared with the initial patient tumour specimen and, depending on available information, the patient’s clinical outcome was compared with the heterotransplanted tumour. The heterotansplant model is a more accurate preclinical model than older generation serially passaged or genetic models to investigate current and newly developed androgen-deprivation agents, antitumour compounds, anti-angiogenic drugs and positron emission tomography radiotracers, as well as new therapeutic regimens for the treatment of PC. PMID:19874422

  17. Hyperplastic polyps following treatment of acute gastric ulcers.

    PubMed

    Tanaka, J; Fujimoto, K; Iwakiri, R; Koyama, T; Sakata, H; Ohyama, T; Mizuguchi, M; Tokunaga, O

    1994-06-01

    Although hyperplastic polyps are the most common polyps of the stomach, the etiology of these polyps is not completely understood. We report a 61-year-old woman who developed gastric hyperplastic polyps following acute gastric lesions. She was admitted for endoscopic injection sclerotherapy of esophageal varices. After the end of sclerotherapy, acute gastric lesions developed. For treatment of the lesions, omeprazole was used for 8 weeks followed by famotidine for 8 weeks. At the end of the treatment, she developed multiple gastric hyperplastic polyps, suggesting that acute gastric lesions and/or treatment of the gastric lesions are related to the development of hyperplastic polyps in the stomach. PMID:7919626

  18. The prostatic acid phosphatase (ACPP) gene is localized to human chromosome 3q21-q23

    SciTech Connect

    Li, S.S.L.; Sharief, F.S. )

    1993-09-01

    Human prostatic acid phosphatase (ACPP) has been used as a diagnostic marker for prostate cancer. It is synthesized under androgen regulation and secreted by the epithelial cells of the prostate gland. The authors have confirmed the previous assignment of the ACPP gene to chromosome 3 by probing a panel of 25 human-Chinese hamster somatic cell hybrids, and they have further localized the ACPP gene to chromosome 3q21-q23 by fluorescence in situ hybridization. 10 refs., 1 fig.

  19. ICRAC controls the rapid androgen response in human primary prostate epithelial cells and is altered in prostate cancer

    PubMed Central

    Holzmann, Christian; Kilch, Tatiana; Kappel, Sven; Armbrüster, Andrea; Jung, Volker; Stöckle, Michael; Bogeski, Ivan; Schwarz, Eva C.; Peinelt, Christine

    2013-01-01

    Labelled 5α-dihydrotestosterone (DHT) binding experiments have shown that expression levels of (yet unidentified) membrane androgen receptors (mAR) are elevated in prostate cancer and correlate with a negative prognosis. However, activation of these receptors which mediate a rapid androgen response can counteract several cancer hallmark functions such as unlimited proliferation, enhanced migration, adhesion and invasion and the inability to induce apoptosis. Here, we investigate the downstream signaling pathways of mAR and identify rapid DHT induced activation of store-operated Ca2+ entry (SOCE) in primary cultures of human prostate epithelial cells (hPEC) from non-tumorous tissue. Consequently, down-regulation of Orai1, the main molecular component of Ca2+ release-activated Ca2+ (CRAC) channels results in an almost complete loss of DHT induced SOCE. We demonstrate that this DHT induced Ca2+ influx via Orai1 is important for rapid androgen triggered prostate specific antigen (PSA) release. We furthermore identified alterations of the molecular components of CRAC channels in prostate cancer. Three lines of evidence indicate that prostate cancer cells down-regulate expression of the Orai1 homolog Orai3: First, Orai3 mRNA expression levels are significantly reduced in tumorous tissue when compared to non-tumorous tissue from prostate cancer patients. Second, mRNA expression levels of Orai3 are decreased in prostate cancer cell lines LNCaP and DU145 when compared to hPEC from healthy tissue. Third, the pharmacological profile of CRAC channels in prostate cancer cell lines and hPEC differ and siRNA based knock-down experiments indicate changed Orai3 levels are underlying the altered pharmacological profile. The cancer-specific composition and pharmacology of CRAC channels identifies CRAC channels as putative targets in prostate cancer therapy. PMID:24240085

  20. The androgen receptor cistrome is extensively reprogrammed in human prostate tumorigenesis

    PubMed Central

    Pomerantz, Mark M.; Li, Fugen; Takeda, David; Lenci, Romina; Chonkar, Apurva; Chabot, Matthew; Cejas, Paloma; Vazquez, Francisca; Cook, Jennifer; Shivdasani, Ramesh A.; Bowden, Michaela; Lis, Rosina; Hahn, William C.; Kantoff, Philip W.; Brown, Myles; Loda, Massimo; Long, Henry W.; Freedman, Matthew L.

    2015-01-01

    Master transcription factors interact with DNA to establish cell-type identity and to regulate gene expression in mammalian cells1,2. The genome-wide map of these transcription factor binding sites has been termed the cistrome3. Here we show that the androgen receptor (AR) cistrome undergoes extensive reprogramming during prostate epithelial transformation in man. Using human prostate tissue, we observed a core set of AR binding sites that are consistently reprogrammed in tumors. FOXA1 and HOXB13, co-localized with the reprogrammed AR sites in human tumor tissue. Introduction of FOXA1 and HOXB13 into an immortalized prostate cell line reprogrammed the AR cistrome to resemble that of a prostate tumor, functionally linking these specific factors to AR reprogramming. These findings offer mechanistic insights into a key set of events that drive normal prostate epithelium towards transformation and establish the centrality of epigenetic reprogramming in human prostate tumorigenesis. PMID:26457646

  1. Hyperplastic goiter in two adult dairy cows.

    PubMed

    Ong, Chee Bing; Herdt, Thomas H; Fitzgerald, Scott D

    2014-11-01

    Iodine excess and resultant hyperplastic goiter are well documented in neonatal ruminants, but little is reported on iodine excess in adult ruminants and associated histological changes of the thyroid gland. Two adult Holstein cows from a Michigan dairy herd that had lost several other animals had nonspecific clinical signs of illness and were submitted for necropsy. Thyroid glands of one of these 2 animals were grossly and markedly enlarged, and histologically, thyroid glands from both animals had regions of cystic nodular hyperplasia and follicular atrophy. Thyroid glands from both animals had markedly elevated iodine concentrations. Investigation into the potential source of excessive iodine on the farm revealed multiple sources of supplemental dietary iodine and probable uneven feed and mineral mixing. Based on the findings of this investigation, adult cattle could be susceptible to excessive doses of iodine. Possibility of previous iodine deficiency before supplementation period, with subsequent development and persistence of thyroid hyperplasia and cystic change, cannot be completely excluded. Current findings suggested that iodine excess in adult cattle can result in nodular hyperplastic goiter. Use of iodized salt in mineral supplements in adult dairy herds is common practice, and accidental excessive iodine supplement may be more common than reported. Recognizing gross and histological thyroid gland changes, consisting of concurrent cystic follicular hyperplasia, atrophy, and fibrosis should raise suspicion of iodine excess and/or prior deficiency in a cattle herd, and ancillary tests such as serum iodine measurements should be part of the diagnostic workup in suspected cases. PMID:25292195

  2. Early Human Prostate Adenocarcinomas Harbor Androgen-Independent Cancer Cells

    PubMed Central

    Fiñones, Rita R.; Yeargin, Jo; Lee, Melissa; Kaur, Aman Preet; Cheng, Clari; Sun, Paulina; Wu, Christopher; Nguyen, Catherine; Wang-Rodriguez, Jessica; Meyer, April N.; Baird, Stephen M.; Donoghue, Daniel J.; Haas, Martin

    2013-01-01

    Although blockade of androgen receptor (AR) signaling represents the main treatment for advanced prostate cancer (PrCa), many patients progress to a lethal phenotype of “Castration-Resistant” prostate cancer (CR-PrCa). With the hypothesis that early PrCa may harbor a population of androgen-unresponsive cancer cells as precursors to CR-recurrent disease, we undertook the propagation of androgen-independent cells from PrCa-prostatectomy samples of early, localized (Stage-I) cases. A collection of 120 surgical specimens from prostatectomy cases was established, among which 54 were adenocarcinomas. Hormone-free cell culture conditions were developed allowing routine propagation of cells expressing prostate basal cell markers and stem/progenitor cell markers, and which proliferated as spheres/spheroids in suspension cultures. Colonies of androgen-independent epithelial cells grew out from 30/43 (70%) of the adenocarcinoma cases studied in detail. Fluorescence microscopy and flow cytometry showed that CR-PrCa cells were positive for CD44, CD133, CK5/14, c-kit, integrin α2β1, SSEA4, E-Cadherin and Aldehyde Dehydrogenase (ALDH). All 30 CR-PrCa cell cultures were also TERT-positive, but negative for TMPRSS2-ERG. Additionally, a subset of 22 of these CR-PrCa cell cultures was examined by orthotopic xenografting in intact and castrated SCID mice, generating histologically typical locally-invasive human PrCa or undifferentiated cancers, respectively, in 6–8 weeks. Cultured PrCa cells and orthotopically-induced in vivo cancers lacked PSA expression. We report here the propagation of Cancer Initiating Cells (CIC) directly from Stage I human PrCa tissue without selection or genetic manipulation. The propagation of stem/progenitor-like CR-PrCa cells derived from early human prostate carcinomas suggests the existence of a subpopulation of cells resistant to androgen-deprivation therapy and which may drive the subsequent emergence of disseminated CR-PrCa. PMID:24086346

  3. Keratinocyte-Derived Chemokine Induces Prostate Epithelial Hyperplasia and Reactive Stroma in a Novel Transgenic Mouse Model

    PubMed Central

    Schauer, Isaiah G.; Ressler, Steven J.; Rowley, David R.

    2009-01-01

    Background Interleukin-8 (IL-8) is upregulated in fibrotic and malignant diseases and is a key mediator of proliferative responses. Elevated IL-8 was recently correlated with benign prostatic hyperplasia epithelium and a myofibroblast reactive stroma. Thus, we sought to determine whether overexpressed IL-8 and keratinocyte-derived chemokine (KC), the functional murine homolog of IL-8, induce prostate epithelial hyperplasia and a reactive phenotype. Methods Transgenic mice that overexpress KC within prostate epithelia and xenograft models with engineered human cells that overexpress IL-8 were developed. Results Overexpression of KC in transgenic mice produced hyperplastic prostate epithelial acini associated with a periacinar reactive stroma. KC induced an altered epithelial/stroma proliferation index ratio, increased acini diameter, epithelial infolding, and expression of prototypical reactive stroma markers. Overexpression of IL-8 in normal human prostate epithelial xenografts correlated with elevated epithelial proliferation index and altered morphology. Elevated human prostate stromal and epithelial cell proliferation, nodule-like morphology and increased xenograft survival were observed in IL-8-overexpressing orthotopic xenografts. Conclusions Together, these data demonstrate that overexpression of IL-8/KC results in a prostate epithelial hyperplasia with an associated reactive stroma phenotype. The novel transgenic mouse and human xenograft models described here may be useful in dissecting key mechanisms of IL-8 induced prostate hyperplasia and reactive stroma. PMID:19021203

  4. Mutated human androgen receptor gene detected in a prostatic cancer patient is also activated by estradiol

    SciTech Connect

    Elo, J.P.; Kvist, L.; Leinonen, K.; Isomaa, V.

    1995-12-01

    Androgens are necessary for the development of prostatic cancer. The mechanisms by which the originally androgen-dependent prostatic cancer cells are relieved of the requirement to use androgen for their growth are largely unknown. The human prostatic cancer cell line LNCaP has been shown to contain a point mutation in the human androgen receptor gene (hAR), suggesting that changes in the hAR may contribute to the abnormal hormone response of prostatic cells. To search for point mutations in the hAR, we used single strand conformation polymorphism analysis and a polymerase chain reaction direct sequencing method to screen 23 prostatic cancer specimens from untreated patients, 6 prostatic cancer specimens from treated patients, and 11 benign prostatic hyperplasia specimens. One mutation was identified in DNA isolated from prostatic cancer tissue, and the mutation was also detected in the leukocyte DNA of the patient and his offspring. The mutation changed codon 726 in exon E from arginine to leucine and was a germ line mutation. The mutation we found in exon E of the hAR gene does not alter the ligand binding specificity of the AR, but the mutated receptor was activated by estradiol to a significantly greater extent than the wild-type receptor. The AR gene mutation described in this study might be one explanation for the altered biological activity of prostatic cancer. 36 refs., 4 figs.

  5. Molecular effects of soy phytoalexin glyceollins in human prostate cancer cells LNCaP

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Glyceollins are soy–derived phytoalexins that have been proposed to be candidate cancer preventive compounds. The effect of the glyceollins on prostate cancer is unknown. The present study examined the molecular effects of soy phytoalexins, glyceollins, on the human prostate cancer cell line LNCaP t...

  6. Human Prostatic Acid Phosphatase: Structure, Function and Regulation

    PubMed Central

    Muniyan, Sakthivel; Chaturvedi, Nagendra K.; Dwyer, Jennifer G.; LaGrange, Chad A.; Chaney, William G.; Lin, Ming-Fong

    2013-01-01

    Human prostatic acid phosphatase (PAcP) is a 100 kDa glycoprotein composed of two subunits. Recent advances demonstrate that cellular PAcP (cPAcP) functions as a protein tyrosine phosphatase by dephosphorylating ErbB-2/Neu/HER-2 at the phosphotyrosine residues in prostate cancer (PCa) cells, which results in reduced tumorigenicity. Further, the interaction of cPAcP and ErbB-2 regulates androgen sensitivity of PCa cells. Knockdown of cPAcP expression allows androgen-sensitive PCa cells to develop the castration-resistant phenotype, where cells proliferate under an androgen-reduced condition. Thus, cPAcP has a significant influence on PCa cell growth. Interestingly, promoter analysis suggests that PAcP expression can be regulated by NF-κB, via a novel binding sequence in an androgen-independent manner. Further understanding of PAcP function and regulation of expression will have a significant impact on understanding PCa progression and therapy. PMID:23698773

  7. Prediction of alpha1-adrenoceptor occupancy in the human prostate from plasma concentrations of silodosin, tamsulosin and terazosin to treat urinary obstruction in benign prostatic hyperplasia.

    PubMed

    Yamada, Shizuo; Kato, Yasuhiro; Okura, Takashi; Kagawa, Yoshiyuki; Kawabe, Kazuki

    2007-07-01

    Alpha1-adrenoceptor antagonists are clinically useful for the improvement of urinary obstruction due to benign prostatic hyperplasia (BPH), and their therapeutic effects are mediated through the blockade of prostatic alpha(1)-adrenoceptors. The present study was undertaken to predict the magnitude and duration of alpha(1)-adrenoceptor occupancy in the human prostate after oral alpha(1)-adrenoceptor antagonists. Prostatic alpha(1)-adrenoceptor-binding parameters of silodosin were estimated by measuring specific [(3)H]prazosin binding in rat prostate after oral administration of this drug. The plasma concentration of silodosin after oral administration in rats and healthy volunteers was measured using a high-performance liquid chromatographic method. The alpha(1)-adrenoceptor-binding affinities (K(i)) of silodosin, tamsulosin, and terazosin in the human prostate and plasma concentrations of tamsulosin and terazosin were obtained from the literature. Using the alpha(1)-adrenoceptor binding parameters of silodosin in rat prostate, alpha(1)-adrenoceptor occupancy in the human prostate was estimated to be around 60-70% at 1-6 h after oral administration of silodosin at doses of 3.0, 8.1, and 16.1 micromol. Thereafter, the receptor occupancy was periodically decreased, to 24% (8.1 micromol) and 54% (16.1 micromol) 24 h later. A similar magnitude and time course of alpha(1)-adrenoceptor occupancy by silodosin in the human prostate were estimated using alpha(1)-adrenoceptor-binding affinities (K(i)) in the human prostate. Despite about two orders of differences in the plasma unbound concentrations after clinically effective oral dosages of silodosin, tamsulosin, and terazosin, there was a comparable magnitude of prostatic alpha(1)-adrenoceptor occupancy by these drugs. In conclusion, the prediction of alpha(1)-adrenoceptor occupancy in the human prostate by alpha(1)-adrenoceptor antagonists may provide the rationale for the optimum dosage regimen of these drugs in the

  8. Deletion of antigens of the Lewis a/b blood group family in human prostatic carcinoma.

    PubMed Central

    Young, W. W.; Mills, S. E.; Lippert, M. C.; Ahmed, P.; Lau, S. K.

    1988-01-01

    The expression of antigens of the blood group Lewis a/b family were studied in a series of 42 prostatectomy specimens from patients with adenocarcinoma clinically confined to the prostate; 19 of these were later reclassified as pathologic Stage C. Staining of normal or hyperplastic versus neoplastic epithelium was assessed in routinely processed, paraffin-embedded tissue using murine monoclonal antibodies and an avidin-biotin immunoperoxidase technique. Antigens screened and the antibodies used to recognize them were Lewis a (CF4C4), Lewis b and Type 1 H (NS10), monosialosyl Lewis a I (19.9), and disialosyl Lewis a and monosialosyl Lewis a II (FH7). FH7 strongly stained the benign epithelium of all 39 Lewis positive cases, suggesting that the sialyltransferase responsible for synthesis of FH7-reactive determinants is highly active in benign prostatic tissue. When compared to the reactivity of benign epithelium in Lewis positive cases, the staining of the carcinomas was markedly reduced in 18 cases (46%) and absent in 16 cases (41%). This reduction or loss of staining of the malignant epithelium was observed for all antibodies that stained the corresponding benign epithelium of each case. In only five of the cases (13%) was the intensity of staining in the carcinoma equal to that of the surrounding benign epithelium. No cases in this latter group had recurrence of disease, whereas in the other staining groups 25-33% of the cases had recurrences; median follow-up for the entire group was 78 months. No correlation was apparent between Gleason score and the staining pattern with these antigens. In summary, antigens of the Lewis a/b family are deleted in a high percentage of cases of prostatic adenocarcinoma. Images Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:2454582

  9. Carbogen breathing increases prostate cancer oxygenation: a translational MRI study in murine xenografts and humans

    PubMed Central

    Alonzi, R; Padhani, A R; Maxwell, R J; Taylor, N J; Stirling, J J; Wilson, J I; d′Arcy, J A; Collins, D J; Saunders, M I; Hoskin, P J

    2009-01-01

    Hypoxia has been associated with poor local tumour control and relapse in many cancer sites, including carcinoma of the prostate. This translational study tests whether breathing carbogen gas improves the oxygenation of human prostate carcinoma xenografts in mice and in human patients with prostate cancer. A total of 23 DU145 tumour-bearing mice, 17 PC3 tumour-bearing mice and 17 human patients with prostate cancer were investigated. Intrinsic susceptibility-weighted MRI was performed before and during a period of carbogen gas breathing. Quantitative R2* pixel maps were produced for each tumour and at each time point and changes in R2* induced by carbogen were determined. There was a mean reduction in R2* of 6.4% (P=0.003) for DU145 xenografts and 5.8% (P=0.007) for PC3 xenografts. In all, 14 human subjects were evaluable; 64% had reductions in tumour R2* during carbogen inhalation with a mean reduction of 21.6% (P=0.0005). Decreases in prostate tumour R2* in both animal models and human patients as a result of carbogen inhalation suggests the presence of significant hypoxia. The finding that carbogen gas breathing improves prostate tumour oxygenation provides a rationale for testing the radiosensitising effects of combining carbogen gas breathing with radiotherapy in prostate cancer patients. PMID:19190629

  10. Antitumor effects of methotrexate-monoclonal anti-prostatic acid phosphatase antibody conjugate on human prostate tumor

    SciTech Connect

    Deguchi, T.; Chu, T.M.; Leong, S.S.; Horoszewicz, J.S.; Lee, C.L.

    1986-03-01

    Methotrexate (MTX) was conjugated to an IgG/sub 1/ monoclonal antibody (MCA) specific for human prostatic acid phosphatase (PAP) by an active ester method, resulting in a molar ratio of MTX to IgG/sub 1/ of 14. MTX-MCA conjugate retained 94% of free antibody activity and preserved 90% of dihydrofolate reductase inhibitory activity of free MTX. MTX-MCA conjugate was shown to be accumulated in vitro by prostate tumor cells (LNCaP) 1.3 times higher than that of MTX conjugate to normal mouse IgG (NIgG) and 6.2 times higher than that of free MTX. Antitumor activity in vitro exhibited that MTX-MCA conjugate is more effective on inhibition (52%) of /sup 3/H-deoxyuridine incorporation into LNCaP cells than that of MTX-NIgG (39%), but both were less effective than free MTX (70%). The in vivo distribution of /sup 3/H-MTX-MCA conjugate in human prostate tumor xenograft (tumor: blood ratio 5.1) was higher than those of /sup 3/H-MTX-NIgG conjugate (1.1) and of free /sup 3/H-MTX (1.5). Anti-tumor activity in vivo demonstrated that MTX-MCA conjugate retarded the growth of xenografted human prostate tumor greatly and persistently, as compared with the control groups. These results suggested that MTX-monoclonal anti-PAP antibody conjugate represents a potential reagent for immunochemotherapy of human prostate tumor (NIH CA-34536, CA-15437 and ACS CH-269.

  11. Aminomethylphosphonic acid inhibits growth and metastasis of human prostate cancer in an orthotopic xenograft mouse model.

    PubMed

    Parajuli, Keshab Raj; Zhang, Qiuyang; Liu, Sen; You, Zongbing

    2016-03-01

    Aminomethylphosphonic acid (AMPA) has been shown to inhibit prostate cancer cell growth in vitro. The purpose of the present study was to determine if AMPA could inhibit growth and metastasis of prostate cancer in vivo. Human prostate cancer PC-3-LacZ-luciferase cells were implanted into the ventral lateral lobes of the prostate in 39 athymic Nu/Nu nude male mice. Seven days later, mice were randomized into the control group (n = 14, treated intraperitoneally with phosphate buffered saline), low dose group (n = 10, treated intraperitoneally with AMPA at 400 mg/kg body weight/day), and high dose group (n = 15, treated intraperitoneally with AMPA at 800 mg/kg body weight/day). Tumor growth and metastasis were examined every 4-7 days by bioluminescence imaging of live mice. We found that AMPA treatment significantly inhibited growth and metastasis of orthotopic xenograft prostate tumors and prolonged the survival time of the mice. AMPA treatment decreased expression of BIRC2 and activated caspase 3, leading to increased apoptosis in the prostate tumors. AMPA treatment decreased expression of cyclin D1. AMPA treatment also reduced angiogenesis in the prostate tumors. Taken together, these results demonstrate that AMPA can inhibit prostate cancer growth and metastasis, suggesting that AMPA may be developed into a therapeutic agent for the treatment of prostate cancer. PMID:26840261

  12. Long term organ culture of human prostate tissue in a NASA-designed rotating wall bioreactor

    NASA Technical Reports Server (NTRS)

    Margolis, L.; Hatfill, S.; Chuaqui, R.; Vocke, C.; Emmert-Buck, M.; Linehan, W. M.; Duray, P. H.

    1999-01-01

    PURPOSE: To maintain ex vivo integral prostatic tissue including intact stromal and ductal elements using the NASA-designed Rotating Wall Vessel (RWV) which maintains colocalized cells in an environment that promotes both three-dimensional cellular interactions together with the uniform mass transfer of nutrients and metabolic wastes. MATERIALS AND METHODS: Samples of normal prostate were obtained as a byproduct of transurethral prostatectomy or needle biopsy. Prostatic tissue dissected into small 1 x 1 mm. blocks was cultured in the Rotating Wall Vessel (RWV) Bioreactor for various time periods and analyzed using histological, immunochemical, and total cell RNA assays. RESULTS: We report the long term maintenance of benign explanted human prostate tissue grown in simple culture medium, under the simulated microgravity conditions afforded by the RWV bioreactor. Mesenchymal stromal elements including blood vessels and architecturally preserved tubuloglandular acini were maintained for a minimum of 28 days. Cytokeratins, vimentin and TGF-beta2 receptor and ligand were preserved through the entire culture period as revealed by immunocytochemistry. Prostatic acid phosphatase (PAP) was continuously expressed during the culture period, although somewhat decreased. Prostatic specific antigen (PSA) and its transcript were down regulated over time of culture. Prostatic carcinoma cells from the TSU cell line were able to invade RWV-cultured benign prostate tissue explants. CONCLUSIONS: The RWV bioreactor represents an additional new technology for culturing prostate tissue for further investigations concerning the basic physiology and pathobiology of this clinically important tissue.

  13. Aminomethylphosphonic acid inhibits growth and metastasis of human prostate cancer in an orthotopic xenograft mouse model

    PubMed Central

    Parajuli, Keshab Raj; Zhang, Qiuyang; Liu, Sen; You, Zongbing

    2016-01-01

    Aminomethylphosphonic acid (AMPA) has been shown to inhibit prostate cancer cell growth in vitro. The purpose of the present study was to determine if AMPA could inhibit growth and metastasis of prostate cancer in vivo. Human prostate cancer PC-3-LacZ-luciferase cells were implanted into the ventral lateral lobes of the prostate in 39 athymic Nu/Nu nude male mice. Seven days later, mice were randomized into the control group (n = 14, treated intraperitoneally with phosphate buffered saline), low dose group (n = 10, treated intraperitoneally with AMPA at 400 mg/kg body weight/day), and high dose group (n = 15, treated intraperitoneally with AMPA at 800 mg/kg body weight/day). Tumor growth and metastasis were examined every 4-7 days by bioluminescence imaging of live mice. We found that AMPA treatment significantly inhibited growth and metastasis of orthotopic xenograft prostate tumors and prolonged the survival time of the mice. AMPA treatment decreased expression of BIRC2 and activated caspase 3, leading to increased apoptosis in the prostate tumors. AMPA treatment decreased expression of cyclin D1. AMPA treatment also reduced angiogenesis in the prostate tumors. Taken together, these results demonstrate that AMPA can inhibit prostate cancer growth and metastasis, suggesting that AMPA may be developed into a therapeutic agent for the treatment of prostate cancer. PMID:26840261

  14. Obesity and prostate cancer: gene expression signature of human periprostatic adipose tissue

    PubMed Central

    2012-01-01

    Background Periprostatic (PP) adipose tissue surrounds the prostate, an organ with a high predisposition to become malignant. Frequently, growing prostatic tumor cells extend beyond the prostatic organ towards this fat depot. This study aimed to determine the genome-wide expression of genes in PP adipose tissue in obesity/overweight (OB/OW) and prostate cancer patients. Methods Differentially expressed genes in human PP adipose tissue were identified using microarrays. Analyses were conducted according to the donors' body mass index characteristics (OB/OW versus lean) and prostate disease (extra prostatic cancer versus organ confined prostate cancer versus benign prostatic hyperplasia). Selected genes with altered expression were validated by real-time PCR. Ingenuity Pathway Analysis (IPA) was used to investigate gene ontology, canonical pathways and functional networks. Results In the PP adipose tissue of OB/OW subjects, we found altered expression of genes encoding molecules involved in adipogenic/anti-lipolytic, proliferative/anti-apoptotic, and mild immunoinflammatory processes (for example, FADS1, down-regulated, and LEP and ANGPT1, both up-regulated). Conversely, in the PP adipose tissue of subjects with prostate cancer, altered genes were related to adipose tissue cellular activity (increased cell proliferation/differentiation, cell cycle activation and anti-apoptosis), whereas a downward impact on immunity and inflammation was also observed, mostly related to the complement (down-regulation of CFH). Interestingly, we found that the microRNA MIRLET7A2 was overexpressed in the PP adipose tissue of prostate cancer patients. Conclusions Obesity and excess adiposity modified the expression of PP adipose tissue genes to ultimately foster fat mass growth. In patients with prostate cancer the expression profile of PP adipose tissue accounted for hypercellularity and reduced immunosurveillance. Both findings may be liable to promote a favorable environment for

  15. Epigenetic DNA methylation of antioxidative stress regulator NRF2 in human prostate cancer.

    PubMed

    Khor, Tin Oo; Fuentes, Francisco; Shu, Limin; Paredes-Gonzalez, Ximena; Yang, Anne Yuqing; Liu, Yue; Smiraglia, Dominic J; Yegnasubramanian, Srinivasan; Nelson, William G; Kong, Ah-Ng Tony

    2014-12-01

    Epigenetic control of NRF2, a master regulator of many critical antioxidative stress defense genes in human prostate cancer (CaP), is unknown. Our previous animal study found decreased Nrf2 expression through promoter CpG methylation/histone modifications during prostate cancer progression in TRAMP mice. In this study, we evaluated CpG methylation of human NRF2 promoter in 27 clinical prostate cancer samples and in LNCaP cells using MAQMA analysis and bisulfite genomic DNA sequencing. Prostate cancer tissue microarray (TMA) containing normal and prostate cancer tissues was studied by immunohistochemistry. Luciferase reporter assay using specific human NRF2 DNA promoter segments and chromatin immunoprecipitation (ChIP) assay against histone modifying proteins were performed in LNCaP cells. Three specific CpG sites in the NRF2 promoter were found to be hypermethylated in clinical prostate cancer samples (BPHhuman prostate cancer TMA showed a decreasing trend for both intensity and percentage of positive cells from normal tissues to advanced-stage prostate cancer (Gleason score from 3-9). Reporter assays in the LNCaP cells containing these three CpG sites showed methylation-inhibited transcriptional activity of the NRF2 promoter. LNCaP cells treated with 5-aza/TSA restored the expression of NRF2 and NRF2 downstream target genes, decreased expression levels of DNMT and HDAC proteins, and ChIP assays showed increased RNA Pol II and H3Ac with a concomitant decrease in H3K9me3, MBD2, and MeCP2 at CpG sites of human NRF2 promoter. Taken together, these findings suggest that epigenetic modification may contribute to the regulation of transcription activity of NRF2, which could be used as prevention and treatment target of human prostate cancer. PMID:25266896

  16. [Chavanprash in the treatment of hyperplastic processes in the endometrium].

    PubMed

    Kokhanevich, E V; Chervak, N M

    2001-01-01

    Hyperplastic processes in the endometrium are classified as a common gynecological pathology. The drug chavanprash has been shown to improve general bodily resistance, to enhance vital tone of the body. It is endowed with a manifest hepatotropic and antitoxic activity, which fact permits recommending it for use in the combination therapy of hyperplastic processes in the endometrium as well as during the period of rehabilitation in the wake of the course of hormonotherapy. PMID:11519407

  17. Prostate-specific extracellular vesicles as a novel biomarker in human prostate cancer.

    PubMed

    Park, Yong Hyun; Shin, Hyun Woo; Jung, Ae Ryang; Kwon, Oh Sung; Choi, Yeong-Jin; Park, Jaesung; Lee, Ji Youl

    2016-01-01

    Extracellular vesicles (EVs) may play an important role in cancer development and progression. We aimed to investigate the prognostic potential of prostate-specific EVs in prostate cancer (PCa) patients. Plasma and prostate tissue were collected from patients who underwent surgery for PCa (n = 82) or benign prostatic hyperplasia (BPH, n = 28). To analyze the quantity of EVs in prostate, we performed transmission electron microscopy (TEM), immuno-TEM with CD63 and prostate-specific membrane antigen (PSMA), and immunofluorescence staining. After EV isolation from plasma, CD63 and PSMA concentration was measured using ELISA kits. PSMA-positive areas in prostate differed in patients with BPH, and low-, intermediate-, and high-risk PCa (2.4, 8.2, 17.5, 26.5%, p < 0.001). Plasma PSMA-positive EV concentration differed in patients with BPH, and low-, intermediate-, and high-risk PCa (21.9, 43.4, 49.2, 59.9 ng/mL, p < 0.001), and ROC curve analysis indicated that plasma PSMA-positive EV concentration differentiated PCa from BPH (AUC 0.943). Patients with lower plasma PSMA-positive EV concentration had greater prostate volume (50.2 vs. 33.4 cc, p < 0.001) and lower pathologic Gleason score (p = 0.025). During the median follow-up of 18 months, patients with lower plasma PSMA-positive EV concentration tended to have a lower risk of biochemical failure than those with higher levels of prostate-specific EVs (p = 0.085). PMID:27503267

  18. Prostate-specific extracellular vesicles as a novel biomarker in human prostate cancer

    PubMed Central

    Park, Yong Hyun; Shin, Hyun Woo; Jung, Ae Ryang; Kwon, Oh Sung; Choi, Yeong-Jin; Park, Jaesung; Lee, Ji Youl

    2016-01-01

    Extracellular vesicles (EVs) may play an important role in cancer development and progression. We aimed to investigate the prognostic potential of prostate-specific EVs in prostate cancer (PCa) patients. Plasma and prostate tissue were collected from patients who underwent surgery for PCa (n = 82) or benign prostatic hyperplasia (BPH, n = 28). To analyze the quantity of EVs in prostate, we performed transmission electron microscopy (TEM), immuno-TEM with CD63 and prostate-specific membrane antigen (PSMA), and immunofluorescence staining. After EV isolation from plasma, CD63 and PSMA concentration was measured using ELISA kits. PSMA-positive areas in prostate differed in patients with BPH, and low-, intermediate-, and high-risk PCa (2.4, 8.2, 17.5, 26.5%, p < 0.001). Plasma PSMA-positive EV concentration differed in patients with BPH, and low-, intermediate-, and high-risk PCa (21.9, 43.4, 49.2, 59.9 ng/mL, p < 0.001), and ROC curve analysis indicated that plasma PSMA-positive EV concentration differentiated PCa from BPH (AUC 0.943). Patients with lower plasma PSMA-positive EV concentration had greater prostate volume (50.2 vs. 33.4 cc, p < 0.001) and lower pathologic Gleason score (p = 0.025). During the median follow-up of 18 months, patients with lower plasma PSMA-positive EV concentration tended to have a lower risk of biochemical failure than those with higher levels of prostate-specific EVs (p = 0.085). PMID:27503267

  19. Loss of estrogen receptor beta expression in malignant human prostate cells in primary cultures and in prostate cancer tissues.

    PubMed

    Pasquali, D; Rossi, V; Esposito, D; Abbondanza, C; Puca, G A; Bellastella, A; Sinisi, A A

    2001-05-01

    The aim of this study was to investigate the expression of estrogen receptor (ER) beta and alpha genes in normal (N) and malignant (C) primary cultures of human prostate epithelial cells (PEC) and fibroblasts (PFC) and in the prostate tissue donors. Both ERbeta and ERalpha messenger ribonucleic acids were found by RT-PCR analysis in six NPECs and normal prostate tissues and in only one of six CPECs and in the respective cancer tissue donor. The other five CPECs and related cancer tissue donors and all normal and cancer PFCs expressed ERalpha messenger ribonucleic acid alone. Immunoblot analysis, using a polyclonal anti-ERbeta (C-terminal) antibody, demonstrated ERbeta protein in all NPEC lysates and in one of the six CPECS: ERalpha protein was expressed in both NPECs and CPECs when a polyclonal antibody directed against the ERalpha N-terminal domain was used. In contrast, ERalpha protein was not detected in two of the six CPEC lysates when ERalpha C-terminal monoclonal antibodies were used. Using a set of primers designed to amplify the region from exons 6-8, RT-PCR analysis demonstrated the absence of the expected transcript in these cells. The present study shows that the ERbeta gene is expressed together with ERalpha in normal prostates and NPECs, whereas it is barely detectable in prostate cancer and CPECS: Moreover, in some CPECs, the ERalpha gene may be transcribed in a changed protein, resulting from the expression of a deletion variant. Together, these data suggest that prostate malignancy is associated with a potential disorder of ER-mediated pathways. PMID:11344205

  20. Influence of zinc deficiency on AKT-MDM2-P53 signaling axes in normal and malignant human prostate cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    With prostate being the highest zinc-accumulating tissue before the onset of cancer, the effects of physiologic levels of zinc on Akt-Mdm2-p53 and Akt-p21 signaling axes in human normal prostate epithelial cells (PrEC) and malignant prostate LNCaP cells were examined. Cells were cultured for 6 d in...

  1. AKT1 and MYC Induce Distinctive Metabolic Fingerprints in Human Prostate Cancer

    PubMed Central

    Priolo, Carmen; Pyne, Saumyadipta; Rose, Joshua; Regan, Erzsébet Ravasz; Zadra, Giorgia; Photopoulos, Cornelia; Cacciatore, Stefano; Schultz, Denise; Scaglia, Natalia; McDunn, Jonathan; De Marzo, Angelo M.; Loda, Massimo

    2014-01-01

    Cancer cells may overcome growth factor dependence by deregulating oncogenic and/or tumor suppressor pathways that affect their metabolism, or by activating metabolic pathways de novo with targeted mutations in critical metabolic enzymes. It is unknown whether human prostate tumors develop a similar metabolic response to different oncogenic drivers or a particular oncogenic event results in its own metabolic reprogramming. Akt and Myc are arguably the most prevalent driving oncogenes in prostate cancer. Mass spectrometry-based metabolite profiling was performed on immortalized human prostate epithelial cells transformed by AKT1 or MYC, transgenic mice driven by the same oncogenes under the control of a prostate-specific promoter, and human prostate specimens characterized for the expression and activation of these oncoproteins. Integrative analysis of these metabolomic datasets revealed that AKT1 activation was associated with accumulation of aerobic glycolysis metabolites, whereas MYC overexpression was associated with dysregulated lipid metabolism. Selected metabolites that differentially accumulated in the MYC-high vs. AKT1-high tumors, or in normal vs. tumor prostate tissue by untargeted metabolomics, were validated using absolute quantitation assays. Importantly, the AKT1/MYC status was independent of Gleason grade and pathologic staging. Our findings show how prostate tumors undergo a metabolic reprogramming which reflects their molecular phenotypes, with implications for the development of metabolic diagnostics and targeted therapeutics. PMID:25322691

  2. Maturation of the developing human fetal prostate in a rodent xenograft model

    PubMed Central

    Saffarini, Camelia M.; McDonnell, Elizabeth V.; Amin, Ali; Spade, Daniel J.; Huse, Susan M.; Kostadinov, Stefan; Hall, Susan J.; Boekelheide, Kim

    2015-01-01

    Background Prostate cancer is the most commonly diagnosed non-skin cancer in men. The etiology of prostate cancer is unknown, although both animal and epidemiologic data suggest that early life exposures to various toxicants, may impact DNA methylation status during development, playing an important role. Methods We have developed a xenograft model to characterize the growth and differentiation of human fetal prostate implants (gestational age 12-24 weeks) that can provide new data on the potential role of early life stressors on prostate cancer. The expression of key immunohistochemical markers responsible for prostate maturation was evaluated, including p63, cytokeratin 18, α-smooth muscle actin, vimentin, caldesmon, Ki-67, prostate specific antigen, estrogen receptor-α, and androgen receptor. Xenografts were separated into epithelial and stromal compartments using laser capture microdissection (LCM), and the DNA methylation status was assessed in >480,000 CpG sites throughout the genome. Results Xenografts demonstrated growth and maturation throughout the 200 days of post-implantation evaluation. DNA methylation profiles of laser capture micro-dissected tissue demonstrated tissue-specific markers clustered by their location in either the epithelium or stroma of human prostate tissue. Differential methylated promoter region CpG-associated gene analysis revealed significantly more stromal than epithelial DNA methylation in the 30 and 90-day xenografts. Functional classification analysis identified CpG-related gene clusters in methylated epithelial and stromal human xenografts. Conclusion This study of human fetal prostate tissue establishes a xenograft model that demonstrates dynamic growth and maturation, allowing for future mechanistic studies of the developmental origins of later life proliferative prostate disease. PMID:24038131

  3. Laser Treatment of Benign Prostatic Hyperplasia: Dosimetric and Thermodynamic Considerations

    NASA Astrophysics Data System (ADS)

    Anvari, Bahman

    1993-01-01

    Benign prostatic hyperplasia (BPH) is the most commonly occurring neoplastic disease in the aging human male. Currently, surgical treatment of BPH is the primary therapeutic method. However, due to surgical complications, less invasive methods of treatment are desirable. In recent years, thermal coagulation of the hyperplastic prostate by a laser has received a considerable amount of attention. Nevertheless, the optimum laser irradiation parameters that lead to a successful and safe treatment of BPH have not been determined. This dissertation studies the physics of laser coagulation of prostate from both basic science and practical perspectives. Optical properties of prostatic tissue are determined over a spectrum of wavelengths. Knowledge of these properties allows for selection of appropriate laser wavelengths and provides a basis for performing dose equivalency studies among various types of lasers. Furthermore, knowledge of optical properties are needed for development of computer simulation models that predict the extent of thermal injury during laser irradiation of prostate. A computer model of transurethral heating of prostate that can be used to guide the clinical studies in determining an optimum dosimetry is then presented. Studies of the effects of non-laser heating devices, optical properties, blood perfusion, surface irrigation, and beam geometry are performed to examine the extent of heat propagation within the prostate. An in vitro model for transurethral laser irradiation of prostate is also presented to examine the effects of an 810 nm diode laser, thermal boundary conditions, and energy deposition rate during Nd:YAG laser irradiation. Results of these studies suggest that in the presence of laminar irrigation, the convective boundary condition is dominated by thermal diffusion as opposed to the bulk motion of the irrigation fluid. Distinct phases of thermal events are also identified during the laser irradiation. The in vivo studies of

  4. Orphan nuclear receptor nurr1 as a potential novel marker for progression in human prostate cancer.

    PubMed

    Wang, Jian; Yang, Jing; Zou, Ying; Huang, Guo-Liang; He, Zhi-Wei

    2013-01-01

    A number of studies have indicated that Nurr1, which belongs to a novel class of orphan nuclear receptors (the NR4A family), is important for carcinogenesis. Here we investigated expression of Nurr1 protein in benign and malignant human prostate tissues and association with clinicopathologic features using immunohistochemical techniques. Moreover, we also investigated the ability of Nurr1 to influence proliferation, migration, invasion and apoptosis of human prostate cancer cells using small interfering RNA silencing. Immunohistochemical analysis revealed that the expression of Nurr1 protein was higher in prostate cancer tissues than in benign prostate tissue (P < 0.001), levels being positively correlated with tumor T classification (P = 0.003), N classification (P = 0.017), M classification (P = 0.011) and the Gleason score (P = 0.020) of prostate cancer patients. In vitro, silencing of endogenous Nurr1 attenuated cell proliferation, migration and invasion, and induced apoptosis of prostate cancer cells. These results suggest that Nurr1 may be used as an indicator for prostate cancer progression and be useful for novel potential therapeutic strategies. PMID:23679312

  5. Berberine-induced apoptosis in human prostate cancer cells is initiated by reactive oxygen species generation

    SciTech Connect

    Meeran, Syed M.; Katiyar, Suchitra; Katiyar, Santosh K.

    2008-05-15

    Phytochemicals show promise as potential chemopreventive or chemotherapeutic agents against various cancers. Here we report the chemotherapeutic effects of berberine, a phytochemical, on human prostate cancer cells. The treatment of human prostate cancer cells (PC-3) with berberine induced dose-dependent apoptosis but this effect of berberine was not seen in non-neoplastic human prostate epithelial cells (PWR-1E). Berberine-induced apoptosis was associated with the disruption of the mitochondrial membrane potential, release of apoptogenic molecules (cytochrome c and Smac/DIABLO) from mitochondria and cleavage of caspase-9,-3 and PARP proteins. This effect of berberine on prostate cancer cells was initiated by the generation of reactive oxygen species (ROS) irrespective of their androgen responsiveness, and the generation of ROS was through the increased induction of xanthine oxidase. Treatment of cells with allopurinol, an inhibitor of xanthine oxidase, inhibited berberine-induced oxidative stress in cancer cells. Berberine-induced apoptosis was blocked in the presence of antioxidant, N-acetylcysteine, through the prevention of disruption of mitochondrial membrane potential and subsequently release of cytochrome c and Smac/DIABLO. In conclusion, the present study reveals that the berberine-mediated cell death of human prostate cancer cells is regulated by reactive oxygen species, and therefore suggests that berberine may be considered for further studies as a promising therapeutic candidate for prostate cancer.

  6. Interleukin-6: a multifunctional targetable cytokine in human prostate cancer.

    PubMed

    Culig, Zoran; Puhr, Martin

    2012-09-01

    Several cytokines are involved in regulation of cellular events in prostate cancer. Interleukin-6 (IL-6) was frequently investigated in prostate cancer models because of its increased expression in cancer tissue at early stages of the disease. In patients with metastatic prostate cancer, it is well-known that IL-6 levels increase in serum. High levels of IL-6 were measured in the supernatants of cells which do not respond to androgenic stimulation. IL-6 expression in prostate cancer increases due to enhanced expression of transforming growth factor-beta, and members of the activating protein-1 complex, and loss of the retinoblastoma tumour suppressor. IL-6 activation of androgen receptor (AR) may contribute to progression of a subgroup of prostate cancers. Results obtained with two prostate cancer cell lines, LNCaP and MDA PCa 2b, indicate that IL-6 activation of AR may cause either stimulatory or inhibitory responses on proliferation. Interestingly, prolonged treatment with IL-6 led to establishment of an IL-6 autocrine loop, suppressed signal transducer and activator of transcription (STAT)3 activation, and increased mitogen-activated protein kinase phosphorylation. In several cell lines IL-6 acts as a survival molecule through activation of the signalling pathway of phosphotidylinositol 3-kinase. Expression of suppressors of cytokine signalling (SOCS) has been studied in prostate cancer. SOCS-3 prevents phosphorylation of STAT3 and is an important anti-apoptotic factor in AR-negative prostate cancer cells. Experimental therapy against IL-6 in prostate cancer is based on the use of the monoclonal antibody siltuximab which may be used for personalised therapy coming in the future. PMID:21664423

  7. The diet as a cause of human prostate cancer.

    PubMed

    Nelson, William G; Demarzo, Angelo M; Yegnasubramanian, Srinivasan

    2014-01-01

    Asymptomatic prostate inflammation and prostate cancer have reached epidemic proportions among men in the developed world. Animal model studies implicate dietary carcinogens, such as the heterocyclic amines from over-cooked meats and sex steroid hormones, particularly estrogens, as candidate etiologies for prostate cancer. Each acts by causing epithelial cell damage, triggering an inflammatory response that can evolve into a chronic or recurrent condition. This milieu appears to spawn proliferative inflammatory atrophy (PIA) lesions, a type of focal atrophy that represents the earliest of prostate cancer precursor lesions. Rare PIA lesions contain cells which exhibit high c-Myc expression, shortened telomere segments, and epigenetic silencing of genes such as GSTP1, encoding the π-class glutathione S-transferase, all characteristic of prostatic intraepithelial neoplasia (PIN) and prostate cancer. Subsequent genetic changes, such as the gene translocations/deletions that generate fusion transcripts between androgen-regulated genes (such as TMPRSS2) and genes encoding ETS family transcription factors (such as ERG1), arise in PIN lesions and may promote invasiveness characteristic of prostatic adenocarcinoma cells. Lethal prostate cancers contain markedly corrupted genomes and epigenomes. Epigenetic silencing, which seems to arise in response to the inflamed microenvironment generated by dietary carcinogens and/or estrogens as part of an epigenetic "catastrophe" affecting hundreds of genes, persists to drive clonal evolution through metastatic dissemination. The cause of the initial epigenetic "catastrophe" has not been determined but likely involves defective chromatin structure maintenance by over-exuberant DNA methylation or histone modification. With dietary carcinogens and estrogens driving pro-carcinogenic inflammation in the developed world, it is tempting to speculate that dietary components associated with decreased prostate cancer risk, such as intake of

  8. Epidermal growth factor increases LRF/Pokemon expression in human prostate cancer cells.

    PubMed

    Aggarwal, Himanshu; Aggarwal, Anshu; Agrawal, Devendra K

    2011-10-01

    Leukemia/lymphoma related factor/POK erythroid myeloid ontogenic factor (LRF/Pokemon) is a member of the POK family of proteins that promotes oncogenesis in several forms of cancer. Recently, we found higher LRF expression in human breast and prostate carcinomas compared to the corresponding normal tissues. The aim of this study was to examine the regulation of LRF expression in human prostate cells. Epidermal growth factor (EGF) and its receptors mediate several tumorigenic cascades that regulate cell differentiation, proliferation, migration and survival of prostate cancer cells. There was significantly higher level of LRF expression in the nucleus of LNCaP and PC-3 cells than RWPE-1 cells. A significant increase in LRF expression was observed with increasing doses of EGF in more aggressive and androgen-sensitive prostate cancer cells suggesting that EGF signaling pathway is critical in upregulating the expression of LRF/Pokemon to promote oncogenesis. PMID:21640721

  9. Exogenous fatty acid binding protein 4 promotes human prostate cancer cell progression.

    PubMed

    Uehara, Hisanori; Takahashi, Tetsuyuki; Oha, Mina; Ogawa, Hirohisa; Izumi, Keisuke

    2014-12-01

    Epidemiologic studies have found that obesity is associated with malignant grade and mortality in prostate cancer. Several adipokines have been implicated as putative mediating factors between obesity and prostate cancer. Fatty acid binding protein 4 (FABP4), a member of the cytoplasmic fatty acid binding protein multigene family, was recently identified as a novel adipokine. Although FABP4 is released from adipocytes and mean circulating concentrations of FABP4 are linked with obesity, effects of exogenous FABP4 on prostate cancer progression are unclear. In this study, we examined the effects of exogenous FABP4 on human prostate cancer cell progression. FABP4 treatment promoted serum-induced prostate cancer cell invasion in vitro. Furthermore, oleic acid promoted prostate cancer cell invasion only if FABP4 was present in the medium. These promoting effects were reduced by FABP4 inhibitor, which inhibits FABP4 binding to fatty acids. Immunostaining for FABP4 showed that exogenous FABP4 was taken up into DU145 cells in three-dimensional culture. In mice, treatment with FABP4 inhibitor reduced the subcutaneous growth and lung metastasis of prostate cancer cells. Immunohistochemical analysis showed that the number of apoptotic cells, positive for cleaved caspase-3 and cleaved PARP, was increased in subcutaneous tumors of FABP4 inhibitor-treated mice, as compared with control mice. These results suggest that exogenous FABP4 might promote human prostate cancer cell progression by binding with fatty acids. Additionally, exogenous FABP4 activated the PI3K/Akt pathway, independently of binding to fatty acids. Thus, FABP4 might be a key molecule to understand the mechanisms underlying the obesity-prostate cancer progression link. PMID:24740818

  10. Co-Targeting Prostate Cancer Epithelium and Bone Stroma by Human Osteonectin-Promoter-Mediated Suicide Gene Therapy Effectively Inhibits Androgen-Independent Prostate Cancer Growth.

    PubMed

    Sung, Shian-Ying; Chang, Junn-Liang; Chen, Kuan-Chou; Yeh, Shauh-Der; Liu, Yun-Ru; Su, Yen-Hao; Hsueh, Chia-Yen; Chung, Leland W K; Hsieh, Chia-Ling

    2016-01-01

    Stromal-epithelial interaction has been shown to promote local tumor growth and distant metastasis. We sought to create a promising gene therapy approach that co-targets cancer and its supporting stromal cells for combating castration-resistant prostate tumors. Herein, we demonstrated that human osteonectin is overexpressed in the prostate cancer epithelium and tumor stroma in comparison with their normal counterpart. We designed a novel human osteonectin promoter (hON-522E) containing positive transcriptional regulatory elements identified in both the promoter and exon 1 region of the human osteonectin gene. In vitro reporter assays revealed that the hON-522E promoter is highly active in androgen receptor negative and metastatic prostate cancer and bone stromal cells compared to androgen receptor-positive prostate cancer cells. Moreover, in vivo prostate-tumor-promoting activity of the hON-522E promoter was confirmed by intravenous administration of an adenoviral vector containing the hON-522E promoter-driven luciferase gene (Ad-522E-Luc) into mice bearing orthotopic human prostate tumor xenografts. In addition, an adenoviral vector with the hON-522E-promoter-driven herpes simplex virus thymidine kinase gene (Ad-522E-TK) was highly effective against the growth of androgen-independent human prostate cancer PC3M and bone stromal cell line in vitro and in pre-established PC3M tumors in vivo upon addition of the prodrug ganciclovir. Because of the heterogeneity of human prostate tumors, hON-522E promoter-mediated gene therapy has the potential for the treatment of hormone refractory and bone metastatic prostate cancers. PMID:27054343

  11. Co-Targeting Prostate Cancer Epithelium and Bone Stroma by Human Osteonectin-Promoter–Mediated Suicide Gene Therapy Effectively Inhibits Androgen-Independent Prostate Cancer Growth

    PubMed Central

    Sung, Shian-Ying; Chang, Junn-Liang; Chen, Kuan-Chou; Yeh, Shauh-Der; Liu, Yun-Ru; Su, Yen-Hao; Hsueh, Chia-Yen; Chung, Leland W. K.; Hsieh, Chia-Ling

    2016-01-01

    Stromal-epithelial interaction has been shown to promote local tumor growth and distant metastasis. We sought to create a promising gene therapy approach that co-targets cancer and its supporting stromal cells for combating castration-resistant prostate tumors. Herein, we demonstrated that human osteonectin is overexpressed in the prostate cancer epithelium and tumor stroma in comparison with their normal counterpart. We designed a novel human osteonectin promoter (hON-522E) containing positive transcriptional regulatory elements identified in both the promoter and exon 1 region of the human osteonectin gene. In vitro reporter assays revealed that the hON-522E promoter is highly active in androgen receptor negative and metastatic prostate cancer and bone stromal cells compared to androgen receptor-positive prostate cancer cells. Moreover, in vivo prostate-tumor–promoting activity of the hON-522E promoter was confirmed by intravenous administration of an adenoviral vector containing the hON-522E promoter-driven luciferase gene (Ad-522E-Luc) into mice bearing orthotopic human prostate tumor xenografts. In addition, an adenoviral vector with the hON-522E-promoter–driven herpes simplex virus thymidine kinase gene (Ad-522E-TK) was highly effective against the growth of androgen-independent human prostate cancer PC3M and bone stromal cell line in vitro and in pre-established PC3M tumors in vivo upon addition of the prodrug ganciclovir. Because of the heterogeneity of human prostate tumors, hON-522E promoter-mediated gene therapy has the potential for the treatment of hormone refractory and bone metastatic prostate cancers. PMID:27054343

  12. Bauhinia purprea agglutinin-modified liposomes for human prostate cancer treatment.

    PubMed

    Ikemoto, Keisuke; Shimizu, Kosuke; Ohashi, Kento; Takeuchi, Yoshihito; Shimizu, Motohiro; Oku, Naoto

    2016-01-01

    Bauhinia purprea agglutinin (BPA) is a well-known lectin that recognizes galactosyl glycoproteins and glycolipids. In the present study, we firstly found that BPA bound to human prostate cancer specimens but not to normal prostate ones. Therefore, we sought to develop BPA-PEG-modified liposomes (BPA-PEG-LP) encapsulating anticancer drugs for the treatment of prostate cancer. We examined the tumor targetability of BPA-PEG-LP with human prostate cancer DU145 cells, and observed that fluorescently labeled BPA-PEG-LP dominantly associated with the cells via the interaction between liposome-surface BPA and cell-surface galactosyl molecules. We also observed that BPA-PEG-LP accumulated in the prostate cancer tissue after the i.v. injection to DU145 solid cancer-bearing mice, and strongly bound to the cancer cells. In a therapeutic study, DU145 solid cancer-bearing mice were i.v. injected thrice with BPA-PEG-LP encapsulating doxorubicin (BPA-PEG-LPDOX, 2 mg/kg/day as the DOX dosage) or PEG-modified liposomes encapsulating DOX (PEG-LPDOX). As a result, BPA-PEG-LPDOX significantly suppressed the growth of the DU145 cancer cells, whereas PEG-LPDOX at the same dosage as DOX showed little anti-cancer effect. The present study suggested that BPA-PEG-LP could be a useful drug carrier for the treatment of human prostate cancers. PMID:26495901

  13. Screening and Characterization of a Novel RNA Aptamer That Specifically Binds to Human Prostatic Acid Phosphatase and Human Prostate Cancer Cells

    PubMed Central

    Kong, Hoon Young; Byun, Jonghoe

    2015-01-01

    Prostatic acid phosphatase (PAP) expression increases proportionally with prostate cancer progression, making it useful in prognosticating intermediate to high-risk prostate cancers. A novel ligand that can specifically bind to PAP would be very helpful for guiding prostate cancer therapy. RNA aptamers bind to target molecules with high specificity and have key advantages such as low immunogenicity and easy synthesis. Here, human PAP-specific aptamers were screened from a 2′-fluoropyrimidine (FY)-modified RNA library by SELEX. The candidate aptamer families were identified within six rounds followed by analysis of their sequences and PAP-specific binding. A gel shift assay was used to identify PAP binding aptamers and the 6N aptamer specifically bound to PAP with a Kd value of 118 nM. RT-PCR and fluorescence labeling analyses revealed that the 6N aptamer bound to PAP-positive mammalian cells, such as PC-3 and LNCaP. IMR-90 negative control cells did not bind the 6N aptamer. Systematic minimization analyses revealed that 50 nucleotide sequences and their two hairpin structures in the 6N 2′-FY RNA aptamer were equally important for PAP binding. Renewed interest in PAP combined with the versatility of RNA aptamers, including conjugation of anti-cancer drugs and nano-imaging probes, could open up a new route for early theragnosis of prostate cancer. PMID:25591398

  14. Glucocorticoid receptor antagonism reverts docetaxel resistance in human prostate cancer

    PubMed Central

    Kroon, Jan; Puhr, Martin; Buijs, Jeroen T; van der Horst, Geertje; Hemmer, Daniëlle M; Marijt, Koen A; Hwang, Ming S; Masood, Motasim; Grimm, Stefan; Storm, Gert; Metselaar, Josbert M; Meijer, Onno C; Culig, Zoran; van der Pluijm, Gabri

    2016-01-01

    Resistance to docetaxel is a major clinical problem in advanced prostate cancer (PCa). Although glucocorticoids (GCs) are frequently used in combination with docetaxel, it is unclear to what extent GCs and their receptor, the glucocorticoid receptor (GR), contribute to the chemotherapy resistance. In this study, we aim to elucidate the role of the GR in docetaxel-resistant PCa in order to improve the current PCa therapies. GR expression was analyzed in a tissue microarray of primary PCa specimens from chemonaive and docetaxel-treated patients, and in cultured PCa cell lines with an acquired docetaxel resistance (PC3-DR, DU145-DR, and 22Rv1-DR). We found a robust overexpression of the GR in primary PCa from docetaxel-treated patients and enhanced GR levels in cultured docetaxel-resistant human PCa cells, indicating a key role of the GR in docetaxel resistance. The capability of the GR antagonists (RU-486 and cyproterone acetate) to revert docetaxel resistance was investigated and revealed significant resensitization of docetaxel-resistant PCa cells for docetaxel treatment in a dose- and time-dependent manner, in which a complete restoration of docetaxel sensitivity was achieved in both androgen receptor (AR)-negative and AR-positive cell lines. Mechanistically, we demonstrated down-regulation of Bcl-xL and Bcl-2 upon GR antagonism, thereby defining potential treatment targets. In conclusion, we describe the involvement of the GR in the acquisition of docetaxel resistance in human PCa. Therapeutic targeting of the GR effectively resensitizes docetaxel-resistant PCa cells. These findings warrant further investigation of the clinical utility of the GR antagonists in the management of patients with advanced and docetaxel-resistant PCa. PMID:26483423

  15. Lack of detection of human papillomavirus DNA in prostate carcinomas in patients from northeastern Brazil.

    PubMed

    Araujo-Neto, Ari P; Ferreira-Fernandes, Hygor; Amaral, Carolina M M; Santos, Lina G; Freitas, Antônio C; Silva-Neto, Jacinto C; Rey, Juan A; Burbano, Rommel R; Silva, Benedito B da; Yoshioka, France K N; Pinto, Giovanny R

    2016-03-01

    Prostate cancer is the second most common cancer among men in western populations, and despite its high mortality, its etiology remains unknown. Inflammatory processes are related to the etiology of various types of tumors, and prostate inflammation, in particular, has been associated with prostate cancer carcinogenesis and progression. Human papillomavirus (HPV) is associated with benign and malignant lesions in the anogenital tract of both females and males. The possible role of HPV in prostate carcinogenesis is a subject of great controversy. In this study, we aimed to examine the prevalence of HPV infections in prostate carcinomas of patients from northeastern Brazil. This study included 104 tissue samples from primary prostate carcinoma cases. HPV DNA was purified and then amplified using MY09/11 and GP5+/GP6+ degenerate primer sets that detect a wide range of HPV types, and with specific PCR primers sets for E6 and E7 HPV regions to detect HPV 16. None of the samples showed amplification products of HPV DNA for primer sets MY09/11 and GP5+/GP6+, or the specific primer set for the E6 and E7 HPV regions. HPV infection, thus, does not seem to be one of the causes of prostate cancer in the population studied. PMID:27007894

  16. Lack of detection of human papillomavirus DNA in prostate carcinomas in patients from northeastern Brazil

    PubMed Central

    Araujo-Neto, Ari P.; Ferreira-Fernandes, Hygor; Amaral, Carolina M.M.; Santos, Lina G.; Freitas, Antônio C.; Silva-Neto, Jacinto C.; Rey, Juan A.; Burbano, Rommel R.; da Silva, Benedito B.; Yoshioka, France K.N.; Pinto, Giovanny R.

    2016-01-01

    Abstract Prostate cancer is the second most common cancer among men in western populations, and despite its high mortality, its etiology remains unknown. Inflammatory processes are related to the etiology of various types of tumors, and prostate inflammation, in particular, has been associated with prostate cancer carcinogenesis and progression. Human papillomavirus (HPV) is associated with benign and malignant lesions in the anogenital tract of both females and males. The possible role of HPV in prostate carcinogenesis is a subject of great controversy. In this study, we aimed to examine the prevalence of HPV infections in prostate carcinomas of patients from northeastern Brazil. This study included 104 tissue samples from primary prostate carcinoma cases. HPV DNA was purified and then amplified using MY09/11 and GP5+/GP6+ degenerate primer sets that detect a wide range of HPV types, and with specific PCR primers sets for E6 and E7 HPV regions to detect HPV 16. None of the samples showed amplification products of HPV DNA for primer sets MY09/11 and GP5+/GP6+, or the specific primer set for the E6 and E7 HPV regions. HPV infection, thus, does not seem to be one of the causes of prostate cancer in the population studied. PMID:27007894

  17. (3H)bunazosin, a novel selective radioligand of alpha 1 adrenoceptors in human prostates

    SciTech Connect

    Yamada, S.; Suzuki, M.; Matsuoka, Y.; Kato, Y.; Kimura, R.; Maruyama, M.; Kawabe, K. )

    1991-09-01

    The binding properties of a new radioligand, (3H)bunazosin, were studied in membranes of human prostates with benign prostatic hypertrophy (BPH). Specific binding of (3H)bunazosin was saturable, reversible, and of high affinity (Kd = 0.55 {plus minus} 0.04 nM). The density of (3H)bunazosin binding sites (Bmax) was 676 {plus minus} 33 fmol/mg. protein. (3H)Bunazosin rapidly associated with its binding sites in membranes of human prostates and reached steady state by 20 min. at 25C. The rate constants for association and dissociation of (3H)bunazosin binding were calculated to be 0.11 {plus minus} 0.01/nM/min. and 0.05 {plus minus} 0.02/min. (n = 4), respectively. Seven alpha 1 adrenoceptor antagonists competed with (3H)bunazosin for the binding sites in the rank order: R-(-)-YM-12617 greater than prazosin greater than SGB-1534 greater than bunazosin greater than terazosin greater than naftopidil greater than urapidil. In parallel studies with (3H)bunazosin, the Kd and Bmax values for (3H)prazosin binding in human prostates were slightly lower. There was a similarity in the potency and rank order of seven alpha 1, adrenoceptor antagonists for the inhibition of (3H) bunazosin and (3H)prazosin binding in human prostates. The new (3H)bunazosin binding assay in human prostates is remarkable for its low degree of nonspecific binding as compared to (3H)prazosin, especially at high ligand concentrations. Thus, (3H)bunazosin may become a useful radioligand for the further analysis of the alph 1 adrenoceptor binding sites in human prostates.

  18. Human Prostate Side Population Cells Demonstrate Stem Cell Properties in Recombination with Urogenital Sinus Mesenchyme

    PubMed Central

    Foster, Barbara A.; Gangavarapu, Kalyan J.; Mathew, Grinu; Azabdaftari, Gissou; Morrison, Carl D.; Miller, Austin; Huss, Wendy J.

    2013-01-01

    Stem cell enrichment provides a tool to examine prostate stem cells obtained from benign and malignant tissue. Functional assays can enrich stem cells based on common stem cell phenotypes, such as high ATP binding cassette (ABC) transporter mediated efflux of Hoechst substrates (side population assay). This functional assay is based upon mechanisms that protect cells from environmental insult thus contributing to the survival and protection of the stem cell population. We have isolated and analyzed cells digested from twelve clinical prostate specimens based on the side population assay. Prostate stem cell properties of the isolated cells were tested by serial recombination with rat urogenital mesenchyme. Recombinants with side population cells demonstrate an increase in the frequency of human ductal growth and the number of glands per recombinant when compared to recombinants with non-side population cells. Isolated cells were capable of prostatic growth for up to three generations in the recombination assay with as little as 125 sorted prostate cells. The ability to reproducibly use cells isolated by fluorescence activated cell sorting from human prostate tissue is an essential step to a better understanding of human prostate stem cell biology. ABC transporter G2 (ABCG2) was expressed in recombinants from side population cells indicating the side population cells have self-renewal properties. Epithelial cell differentiation of recombinants was determined by immunohistochemical analysis for expression of the basal, luminal, and neuroendocrine markers, p63, androgen receptor, prostate specific antigen, and chromogranin A, respectively. Thus, the ABCG2 expressing side population demonstrates multipotency and self-renewal properties indicating stem cells are within this population. PMID:23383057

  19. Human prostate side population cells demonstrate stem cell properties in recombination with urogenital sinus mesenchyme.

    PubMed

    Foster, Barbara A; Gangavarapu, Kalyan J; Mathew, Grinu; Azabdaftari, Gissou; Morrison, Carl D; Miller, Austin; Huss, Wendy J

    2013-01-01

    Stem cell enrichment provides a tool to examine prostate stem cells obtained from benign and malignant tissue. Functional assays can enrich stem cells based on common stem cell phenotypes, such as high ATP binding cassette (ABC) transporter mediated efflux of Hoechst substrates (side population assay). This functional assay is based upon mechanisms that protect cells from environmental insult thus contributing to the survival and protection of the stem cell population. We have isolated and analyzed cells digested from twelve clinical prostate specimens based on the side population assay. Prostate stem cell properties of the isolated cells were tested by serial recombination with rat urogenital mesenchyme. Recombinants with side population cells demonstrate an increase in the frequency of human ductal growth and the number of glands per recombinant when compared to recombinants with non-side population cells. Isolated cells were capable of prostatic growth for up to three generations in the recombination assay with as little as 125 sorted prostate cells. The ability to reproducibly use cells isolated by fluorescence activated cell sorting from human prostate tissue is an essential step to a better understanding of human prostate stem cell biology. ABC transporter G2 (ABCG2) was expressed in recombinants from side population cells indicating the side population cells have self-renewal properties. Epithelial cell differentiation of recombinants was determined by immunohistochemical analysis for expression of the basal, luminal, and neuroendocrine markers, p63, androgen receptor, prostate specific antigen, and chromogranin A, respectively. Thus, the ABCG2 expressing side population demonstrates multipotency and self-renewal properties indicating stem cells are within this population. PMID:23383057

  20. Expression and functional study of estrogen receptor-related receptors in human prostatic cells and tissues.

    PubMed

    Cheung, C P; Yu, Shan; Wong, K B; Chan, L W; Lai, Fernand M M; Wang, Xianghong; Suetsugi, Masatomo; Chen, Shiuan; Chan, Franky L

    2005-03-01

    Estrogen receptor-related receptors (ERRs; alpha, beta, gamma) are orphan nuclear receptors and constitutively active without binding to estrogen. Like estrogen receptors (ERs), ERRs bind to estrogen receptor elements and estrogen receptor element-related repeats. Growing evidence suggests that ERRs can cross-talk with ERs in different cell types via competition for DNA sites and coactivators. We hypothesize that ERRs might play regulatory roles in normal and neoplastic prostatic cells by sharing similar ER-mediated pathways or acting independently. In this study, we investigated mRNA and protein expression patterns of three ERR members in normal human prostate epithelial cells, established cell lines, cancer xenografts, and prostatic tissues. Additionally, effects of transient transfection of ERRs on prostatic cell proliferation and ER expression were also examined. RT-PCR showed that ERRalpha and ERRgamma transcripts were detected in most cell lines and xenografts, whereas ERRbeta was detected in normal epithelial cells and few immortalized cell lines but not in most cancer lines. Similar results were demonstrated in clinical prostatic specimens. Western blottings and immunohistochemistry confirmed similar expression patterns that ERR proteins were detected as nuclear proteins in epithelial cells, whereas their expressions became reduced or undetected in neoplastic prostatic cells. Transient transfection confirmed that ERRs were expressed in prostatic cells as nuclear proteins and transcriptionally active in the absence of estradiol. Transfection results showed that overexpression of ERRs inhibited cell proliferation and repressed ERalpha transcription in PC-3 cells. Our study shows that ERRs, which are coexpressed with ERs in prostatic cells, could regulate cell growth and modulate ER-mediated pathways via interference on ERalpha transcription in prostatic cells. PMID:15598686

  1. Preliminary report on the correlations among pineal concretions, prostatic calculi and age in human adult males.

    PubMed

    Mori, Ryoichi; Kodaka, Tetsuo; Sano, Tsuneyoshi

    2003-09-01

    By using quantitative image analysis of soft X-ray photographs on the bulk of extracted pineal glands and prostates, we made a preliminary investigation into the correlations among pineal concretions (% by mass), prostatic calculi (% by mass) and age (years) in 40 human adult males, ranging in age from 31 to 95 years (mean (+/-SD) 69.9 +/- 15.2 years), who died and underwent the routine dissection course. The mass concentrations of pineal concretions and prostatic calculi were 17.68 +/- 13.56% (range 0-51.34%) and 0.93 +/- 1.31% (range 0-5.82%), respectively. There was no correlation between the mass concentration of pineal concretions and aging (r = 0.03; P < 1.0). There was no correlation between mass concentration of prostatic calculi and aging (r = 0.28; P < 0.5). No pineal concretions and no prostatic calculi were observed in seven and 10 cases, respectively; in addition, in one case, neither-concretions nor calculi were seen. From such data and from the previously reported suggestion on the counteracting functions between the pineal gland and prostate, a negative correlation between the mass concentrations of pineal concretions and prostatic calculi was expected. This was certainly obtained, but the correlation was low (r = -0.39; P < 0.05). Such a low correlation and no correlations between the concentrations of pineal concretions and aging or between prostatic calculi and aging may have been caused by the examination of relatively older humans. Therefore, further investigations using a number of pair samples collected from males including younger age generations will be necessary. PMID:14527133

  2. Suppression of human prostate cancer cell growth by alpha1-adrenoceptor antagonists doxazosin and terazosin via induction of apoptosis.

    PubMed

    Kyprianou, N; Benning, C M

    2000-08-15

    Recent evidence from our laboratory has demonstrated that alpha1-adrenoceptor antagonists doxazosin and terazosin induced apoptosis in prostate epithelial and smooth muscle cells in patients with benign prostatic hypertrophy (BPH; J. Urol., 159: 1810-1815, 1998; J. Urol., 161: 2002-2007, 1999). In this study, we investigated the biological action of three alpha1-adrenoceptor antagonists, doxazosin, terazosin, and tamsulosin, against prostate cancer cell growth. The antigrowth effect of the three alpha1-adrenoceptor antagonists was examined in two human prostate cancer cell lines, PC-3 and DU-145, and a prostate smooth muscle cell primary culture, SMC-1, on the basis of: (a) cell viability assay; (b) rate of DNA synthesis; and (c) induction of apoptosis. Our results indicate that treatment of prostate cancer cells with doxazosin or terazosin results in a significant loss of cell viability, via induction of apoptosis in a dose-dependent manner, whereas tamsulosin had no effect on prostate cell growth. Neither doxazosin nor terazosin exerted a significant effect on the rate of cell proliferation in prostate cancer cells. Exposure to phenoxybenzamine, an irreversible inhibitor of alpha1-adrenoceptors, does not abrogate the apoptotic effect of doxazosin or terazosin against human prostate cancer or smooth muscle cells. This suggests that the apoptotic activity of doxazosin and terazosin against prostate cells is independent of their capacity to antagonize alpha1-adrenoceptors. Furthermore, an in vivo efficacy trial demonstrated that doxazosin administration (at tolerated pharmacologically relevant doses) in SCID mice bearing PC-3 prostate cancer xenografts resulted in a significant inhibition of tumor growth. These findings demonstrate the ability of doxazosin and terazosin (but not tamsulosin) to suppress prostate cancer cell growth in vitro and in vivo by inducing apoptosis without affecting cell proliferation. This evidence provides the rationale for targeting both

  3. The molecular and cellular origin of human prostate cancer.

    PubMed

    Packer, John R; Maitland, Norman J

    2016-06-01

    Prostate cancer is the most commonly diagnosed male malignancy. Despite compelling epidemiology, there are no definitive aetiological clues linking development to frequency. Pre-malignancies such as proliferative inflammatory atrophy (PIA) and prostatic intraepithelial neoplasia (PIN) yield insights into the initiating events of prostate cancer, as they supply a background "field" for further transformation. An inflammatory aetiology, linked to recurrent prostatitis, and heterologous signalling from reactive stroma and infiltrating immune cells may result in cytokine addiction of cancer cells, including a tumour-initiating population also known as cancer stem cells (CSCs). In prostate tumours, the background mutational rate is rarely exceeded, but genetic change via profound sporadic chromosomal rearrangements results in copy number variations and aberrant gene expression. In cancer, dysfunctional differentiation is imposed upon the normal epithelial lineage, with disruption/disappearance of the basement membrane, loss of the contiguous basal cell layer and expansion of the luminal population. An initiating role for androgen receptor (AR) is attractive, due to the luminal phenotype of the tumours, but alternatively a pool of CSCs, which express little or no AR, has also been demonstrated. Indolent and aggressive tumours may also arise from different stem or progenitor cells. Castrate resistant prostate cancer (CRPC) remains the inevitable final stage of disease following treatment. Time-limited effectiveness of second-generation anti-androgens, and the appearance of an AR-neuroendocrine phenotype imply that metastatic disease is reliant upon the plasticity of the CSC population, and indeed CSC gene expression profiles are most closely related to those identified in CRPCs. PMID:26921821

  4. Penetration of piperacillin-tazobactam into human prostate tissue and dosing considerations for prostatitis based on site-specific pharmacokinetics and pharmacodynamics.

    PubMed

    Kobayashi, Ikuo; Ikawa, Kazuro; Nakamura, Kogenta; Nishikawa, Genya; Kajikawa, Keishi; Yoshizawa, Takahiko; Watanabe, Masahito; Kato, Yoshiharu; Zennami, Kenji; Kanao, Kent; Tobiume, Motoi; Yamada, Yoshiaki; Mitsui, Kenji; Narushima, Masahiro; Morikawa, Norifumi; Sumitomo, Makoto

    2015-08-01

    This study aimed to investigate the penetration of PIPC-TAZ into human prostate, and to assess effectiveness of PIPC-TAZ against prostatitis by evaluating site-specific PK-PD. Patients with prostatic hypertrophy (n = 47) prophylactically received a 0.5 h infusion of PIPC-TAZ (8:1.2-0.25 g or 4-0.5 g) before transurethral resection of the prostate. PIPC-TAZ concentrations in plasma (0.5-5 h) and prostate tissue (0.5-1.5 h) were analyzed with a three-compartment PK model. The estimated model parameters were, then used to estimate the drug exposure time above the minimum inhibitory concentration for bacteria (T > MIC, the PD indicator for antibacterial effects) in prostate tissue for six PIPC-TAZ regimens (2.25 or 4.5 g; once, twice, three times or four times daily; 0.5 h infusions). Prostate tissue/plasma ratio of PIPC was about 36% both for the maximum drug concentration (Cmax) and the area under the drug concentration-time curve (AUC). Against MIC distributions for isolates of Escherichia coli, Klebsiella species and Proteus species, regimens of 4.5 g twice daily and 2.25 g three times daily achieved a >90% probability of attaining the bacteriostatic target for PIPC (30% T > MIC) in prostate tissue; regimens of 4.5 g three times daily and 2.25 g four times daily achieved a >90% probability of attaining the bactericidal target for PIPC (50% T > MIC) in prostate tissue. However, against Pseudomonas aeruginosa isolates, none of the tested regimens achieved a >90% probability. PIPC-TAZ is appropriate for the treatment of prostatitis from the site-specific PK-PD perspective. PMID:26050020

  5. Epigenetic Regulation of Vitamin D 24-Hydroxylase/CYP24A1 in Human Prostate Cancer

    PubMed Central

    Luo, Wei; Karpf, Adam R.; Deeb, Kristin K.; Muindi, Josephia R.; Morrison, Carl D.; Johnson, Candace S.; Trump, Donald L.

    2010-01-01

    Calcitriol, a regulator of calcium homeostasis with antitumor properties, is degraded by the product of the CYP24A1 gene which is downregulated in human prostate cancer by unknown mechanisms. We found that CYP24A1 expression is inversely correlated with promoter DNA methylation in prostate cancer cell lines. Treatment with the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (DAC) activates CYP24A1 expression in prostate cancer cells. In vitro methylation of the CYP24A1 promoter represses its promoter activity. Furthermore, inhibition of histone deacetylases by trichostatin A (TSA) enhances the expression of CYP24A1 in prostate cancer cells. ChIP-qPCR reveals that specific histone modifications are associated with the CYP24A1 promoter region. Treatment with TSA increases H3K9ac and H3K4me2 and simultaneously decreases H3K9me2 at the CYP24A1 promoter. ChIP-qPCR assay reveals that treatment with DAC and TSA increases the recruitment of VDR to the CYP24A1 promoter. RT-PCR analysis of paired human prostate samples reveals that CYP24A1 expression is down-regulated in prostate malignant lesions compared to adjacent histologically benign lesions. Bisulfite pyrosequencing shows that CYP24A1 gene is hypermethylated in malignant lesions compared to matched benign lesions. Our findings indicate that repression of CYP24A1 gene expression in human prostate cancer cells is mediated in part by promoter DNA methylation and repressive histone modifications. PMID:20587525

  6. A case-cohort study of human herpesvirus 8 seropositivity and incident prostate cancer in Tobago

    PubMed Central

    2011-01-01

    Background We previously reported a cross-sectional association between the presence of human herpesvirus 8 (HHV-8) serum antibodies and screen-detected prostate cancer in men living in Tobago. In the same study population, we examined the association between HHV-8 seropositivity and incident prostate cancer discovered at later screenings. Methods In 40-81 year-old men without prostate cancer discovered at initial digital rectal examination (DRE) and prostate-specific antigen (PSA) screening, a case-cohort design measured the association between baseline HHV-8 seropositivity (modified immunofluorescence assay for antibodies against HHV-8 lytic antigens) and incident prostate cancer detected at DRE and PSA screenings three or five years later. Results Analyses included 486 unique individuals, 96 incident prostate cancer cases, and 415 randomly selected subjects representing an at-risk cohort. By design, the random sub-cohort contained 25 incident prostate cancer cases. In the sub-cohort, the frequency of HHV-8 seropositivity increased across age groupings (40-49 years: 3.5%, 50-59 years: 13.6%, and ≥ 60 years: 22.9%). HHV-8 seropositivity was higher in men with elevated (≥ 4.0 ng/mL) than men with non-elevated PSA at initial screening (30.4% vs. 9.9% seropositive; crude odds ratio (OR) 3.96, 95% confidence interval (CI) 1.53-10.2; age-adjusted OR 2.42, 95% CI 0.91-6.47). HHV-8 seropositivity did not increase incident prostate cancer risk (age-adjusted hazard ratio (HR) 0.88, 95% CI 0.46-1.69). Conclusions Case-cohort analysis did not identify association between HHV-8 seropositivity and incident prostate cancer. However, analyses uncovered possible association between HHV-8 and PSA (a marker of prostate inflammation). Co-occurrence of HHV-8 seropositivity and PSA elevation may explain cross-sectional association between HHV-8 and PSA screen-detected prostate cancer. PMID:22151996

  7. Neuroanatomical Study of Periprostatic Nerve Distributions Using Human Cadaver Prostate

    PubMed Central

    Sung, Wooseuk; Lee, Sun; Park, Yong-Koo

    2010-01-01

    We investigated the distribution and navigation of periprostatic nerve fibers and constructed a 3-dimensional model of nerve distribution. A total of 5 cadaver specimens were serially sectioned in a transverse direction with 0.5 cm intervals. Hematoxylineosin staining and immunohistochemical staining were then performed on whole-mount sections. Three representative slides from the base, mid-part, and apex of each prostate were subsequently divided into 4 sectors: two lateral, one ventral, and one dorsal (rectal) part. The number of nerve fibers, the distance from nerve fiber to prostate capsule, and the nerve fiber diameters were analyzed on each sector from the representative slides by microscopy. Periprostatic nerve fibers revealed a relatively even distribution in both lateral and dorsal parts of the prostate. There was no difference in the distances from the prostate capsule to nerve fibers. Nerve fibers in the ventral area were also thinner as compared to other areas. In conclusion, periprostatic nerve fibers were observed to be distributed evenly in the periprostatic area, with the exception of the ventral area. As the number of nerve fibers on the ventral part is fewer in comparison, an excessive high up incision is insignificant during the nerve-sparing radical prostatectomy. PMID:20358006

  8. Role of hormonal and other factors in human prostate cancer.

    PubMed

    Wigle, Donald T; Turner, Michelle C; Gomes, James; Parent, Marie-Elise

    2008-03-01

    American men have a lifetime risk of about 18% for prostate cancer diagnosis. Large international variations in prostate cancer risks and increased risks among migrants from low- to high-risk countries indicate important roles for environmental factors. Major known risk factors include age, family history, and country/ethnicity. Type 2 diabetes appears to reduce risk, while high birth weight and adult height are linked to increased risk of aggressive prostate cancer. Limited evidence supports an association with a history of sexually transmitted infections. A previous meta-analysis of eight cohort studies indicated no associations with plasma androgen, estrogen, or sex hormone binding globulin (SHBG) levels. However, there were dose-response relationships with baseline plasma testosterone levels in two studies that adjusted for other serum hormones and obesity. Finasteride (a drug that blocks testosterone activation) reduced prostate cancer risk by 25%. Low-frequency genes linked to familial prostate cancer only explain a small fraction of all cases. Sporadic cases were linked to relatively common polymorphisms of genes involved in (1) androgen synthesis, activation, inactivation and excretion, (2) hormone and vitamin D receptors, (3) carcinogen metabolism, and (4) DNA repair. Epidemiologic evidence supports protective roles for dietary selenium, vitamin E, pulses, tomatoes/lycopene, and soy foods, and high plasma 1,25-dihydroxyvitamin D levels. There is inadequate evidence that vegetables, fruit, carotenoids, and vitamins A and C reduce risk and that animal fat, alpha-linoleic acid, meat, coffee, and tea increase risk. Two major cohort studies found dose-response relationships with dietary calcium intake. Total dietary energy intake may enhance risk. Limited evidence supports a protective role for physical activity and elevated risk for farmers and other men with occupational pesticide exposure, particularly to organochlorine compounds and phenoxy herbicides

  9. Agonist and antagonist switch DNA motifs recognized by human androgen receptor in prostate cancer

    PubMed Central

    Chen, Zhong; Lan, Xun; Thomas-Ahner, Jennifer M; Wu, Dayong; Liu, Xiangtao; Ye, Zhenqing; Wang, Liguo; Sunkel, Benjamin; Grenade, Cassandra; Chen, Junsheng; Zynger, Debra L; Yan, Pearlly S; Huang, Jiaoti; Nephew, Kenneth P; Huang, Tim H-M; Lin, Shili; Clinton, Steven K; Li, Wei; Jin, Victor X; Wang, Qianben

    2015-01-01

    Human transcription factors recognize specific DNA sequence motifs to regulate transcription. It is unknown whether a single transcription factor is able to bind to distinctly different motifs on chromatin, and if so, what determines the usage of specific motifs. By using a motif-resolution chromatin immunoprecipitation-exonuclease (ChIP-exo) approach, we find that agonist-liganded human androgen receptor (AR) and antagonist-liganded AR bind to two distinctly different motifs, leading to distinct transcriptional outcomes in prostate cancer cells. Further analysis on clinical prostate tissues reveals that the binding of AR to these two distinct motifs is involved in prostate carcinogenesis. Together, these results suggest that unique ligands may switch DNA motifs recognized by ligand-dependent transcription factors in vivo. Our findings also provide a broad mechanistic foundation for understanding ligand-specific induction of gene expression profiles. PMID:25535248

  10. Agonist and antagonist switch DNA motifs recognized by human androgen receptor in prostate cancer.

    PubMed

    Chen, Zhong; Lan, Xun; Thomas-Ahner, Jennifer M; Wu, Dayong; Liu, Xiangtao; Ye, Zhenqing; Wang, Liguo; Sunkel, Benjamin; Grenade, Cassandra; Chen, Junsheng; Zynger, Debra L; Yan, Pearlly S; Huang, Jiaoti; Nephew, Kenneth P; Huang, Tim H-M; Lin, Shili; Clinton, Steven K; Li, Wei; Jin, Victor X; Wang, Qianben

    2015-02-12

    Human transcription factors recognize specific DNA sequence motifs to regulate transcription. It is unknown whether a single transcription factor is able to bind to distinctly different motifs on chromatin, and if so, what determines the usage of specific motifs. By using a motif-resolution chromatin immunoprecipitation-exonuclease (ChIP-exo) approach, we find that agonist-liganded human androgen receptor (AR) and antagonist-liganded AR bind to two distinctly different motifs, leading to distinct transcriptional outcomes in prostate cancer cells. Further analysis on clinical prostate tissues reveals that the binding of AR to these two distinct motifs is involved in prostate carcinogenesis. Together, these results suggest that unique ligands may switch DNA motifs recognized by ligand-dependent transcription factors in vivo. Our findings also provide a broad mechanistic foundation for understanding ligand-specific induction of gene expression profiles. PMID:25535248

  11. The Androgen Receptor Regulates PPARγ Expression and Activity in Human Prostate Cancer Cells.

    PubMed

    Olokpa, Emuejevoke; Bolden, Adrienne; Stewart, LaMonica V

    2016-12-01

    The peroxisome proliferator activated receptor gamma (PPARγ) is a ligand-activated transcription factor that regulates growth and differentiation within normal prostate and prostate cancers. However the factors that control PPARγ within the prostate cancers have not been characterized. The goal of this study was to examine whether the androgen receptor (AR) regulates PPARγ expression and function within human prostate cancer cells. qRT-PCR and Western blot analyses revealed nanomolar concentrations of the AR agonist dihydrotestosterone (DHT) decrease PPARγ mRNA and protein within the castration-resistant, AR-positive C4-2 and VCaP human prostate cancer cell lines. The AR antagonists bicalutamide and enzalutamide blocked the ability of DHT to reduce PPARγ levels. In addition, siRNA mediated knockdown of AR increased PPARγ protein levels and ligand-induced PPARγ transcriptional activity within the C4-2 cell line. Furthermore, proteasome inhibitors that interfere with AR function increased the level of basal PPARγ and prevented the DHT-mediated suppression of PPARγ. These data suggest that AR normally functions to suppress PPARγ expression within AR-positive prostate cancer cells. To determine whether increases in AR protein would influence PPARγ expression and activity, we used lipofectamine-based transfections to overexpress AR within the AR-null PC-3 cells. The addition of AR to PC-3 cells did not significantly alter PPARγ protein levels. However, the ability of the PPARγ ligand rosiglitazone to induce activation of a PPARγ-driven luciferase reporter and induce expression of FABP4 was suppressed in AR-positive PC-3 cells. Together, these data indicate AR serves as a key modulator of PPARγ expression and function within prostate tumors. J. Cell. Physiol. 231: 2664-2672, 2016. © 2016 Wiley Periodicals, Inc. PMID:26945682

  12. Androgen Receptor (AR) Suppresses Normal Human Prostate Epithelial Cell Proliferation via AR/β-catenin/TCF-4 Complex Inhibition of c-MYC Transcription

    PubMed Central

    Antony, Lizamma; van der Schoor, Freek; Dalrymple, Susan L.; Isaacs, John T.

    2016-01-01

    INTRODUCTION Physiologic testosterone continuously stimulates prostate stromal cell secretion of paracrine growth factors (PGFs), which if unopposed would induce hyperplastic overgrowth of normal prostate epithelial cells (PrECs). METHODS Lentiviral shRNA stable knock down of c-MYC, β-catenin, or TCF-4 completely inhibits normal (i.e., non-transformed) human PrECs growth. c-MYC enhancer driven reporter expression and growth is inhibited by two chemically distinct molecules, which prevent β-catenin signaling either by blocking TCF-4 binding (i.e., toxoflavin) or by stimulating degradation (i.e., AVX939). Recombinant DKK1 protein at a dose, which inhibits activation of canonical Wnt signaling does not inhibit PrEC growth. Nuclear β-catenin translocation and PrEC growth is prevented by both lack of PGFs or Akt inhibitor-I. Growth inhibition induced by lack of PGFs, toxoflavin, or Akt inhibitor-I is overcome by constitutive c-MYC transcription. RESULTS In the presence of continuous PGF signaling, PrEC hyperplasia is prevented by androgen binding to AR suppressing c-MYC transcription, resulting in G0 arrest/terminal differentiation independent of Rb, p21, p27, FoxP3, or down regulation of growth factors receptors and instead involves androgen-induced formation of AR/β-catenin/TCF-4 complexes, which suppress c-MYC transcription. Such suppression does not occur when AR is mutated in its zinc-finger binding domain. DISCUSSION Proliferation of non-transformed human PrECs is dependent upon c-MYC transcription via formation/binding of β-catenin/TCF-4 complexes at both 5′ and 3′ c-MYC enhancers stimulated by Wnt-independent, PGF induced Akt signaling. In the presence of continuous PGF signaling, PrEC hyperplasia is prevented by androgen-induced formation of AR/β-catenin/TCF-4 complexes, which retains binding to 3′ c-MYC enhancer, but now suppresses c-MYC transcription. PMID:24913829

  13. Prostate biopsy

    MedlinePlus

    Prostate gland biopsy; Transrectal prostate biopsy; Fine needle biopsy of the prostate; Core biopsy of the prostate; Targeted prostate biopsy; Prostate biopsy - transrectal ultrasound (TRUS); Stereotactic ...

  14. Genetic Regulation of Prostate Development

    PubMed Central

    Meeks, Joshua; Schaeffer, Edward M

    2011-01-01

    Prostatic development is a dynamic process in which basic mechanisms of epithelial outgrowth and epithelial-mesenchymal interaction are initiated by androgens and androgen receptor signaling. Even in adulthood, the prostate's function remains tightly regulated by androgens--without them, pathologic diseases including hyperplastic and malignant growth which together plague nearly 50% of aging males does not occur. Unraveling the etiology of these pathologic processes is a complex and important goal. In fact, many insights into these processes have come from an intimate understanding of the complex signaling networks that regulate physiologic prostatic growth in development. This review aims to highlight important key molecules such as Nkx3.1, sonic hedgehog and Sox9 as well as key signaling pathways including the Fibroblast growth factor and Wnt pathways. These molecules and pathways are critical for prostate development with both know and postulated roles in prostatic pathology. PMID:20930191

  15. Coagulation of human prostate volumes with MRI-controlled transurethral ultrasound therapy: Results in gel phantoms

    PubMed Central

    N’Djin, William Apoutou; Burtnyk, Mathieu; Kobelevskiy, Ilya; Hadjis, Stefan; Bronskill, Michael; Chopra, Rajiv

    2012-01-01

    Purpose: The feasibility and safety of magnetic resonance imaging (MRI)-controlled transurethral ultrasound therapy were demonstrated recently in a preliminary human study in which a small subvolume of prostate tissue was treated prior to radical prostatectomy. Translation of this technology to full clinical use, however, requires the capability to generate thermal coagulation in a volume up to that of the prostate gland itself. The aim of this study was to investigate the parameters required to treat a full 3D human prostate accurately with a multi-element transurethral applicator and multiplanar MR temperature control. Methods: The approach was a combination of simulations (to select appropriate parameters) followed by experimental confirmation in tissue-mimicking phantoms. A ten-channel, MRI-compatible transurethral ultrasound therapy system was evaluated using six human prostate models (average volume: 36 cm3) obtained from the preliminary human feasibility study. Real-time multiplanar MR thermometry at 3 T was used to control the spatial heating pattern in up to nine planes simultaneously. Treatment strategies incorporated both single (4.6 or 8.1 MHz) and dual (4.6 and 14.4 MHz) frequencies, as well as maximum acoustic surface powers of 10 or 20 W cm−2. Results: Treatments at 4.6 MHz were capable of coagulating a volume equivalent to 97% of the prostate. Increasing power from 10 to 20 W cm−2 reduced treatment times by approximately 50% with full treatments taking 26 ± 3 min at a coagulation rate of 1.8 ± 0.4 cm3 min−1. A dual-frequency 4.6/14.4 MHz treatment strategy was shown to be the most effective configuration for achieving full human prostate treatment while maintaining good treatment accuracy for small treatment radii. The dual-frequency approach reduced overtreatment close to the prostate base and apex, confirming the simulations. Conclusions: This study reinforces the capability of MRI-controlled transurethral ultrasound therapy to treat

  16. A New Murine Model of Osteoblastic/Osteolytic Lesions from Human Androgen-Resistant Prostate Cancer

    PubMed Central

    Depalle, Baptiste; Serre, Claire Marie; Farlay, Delphine; Turtoi, Andrei; Bellahcene, Akeila; Follet, Hélène; Castronovo, Vincent; Clézardin, Philippe; Bonnelye, Edith

    2013-01-01

    Background Up to 80% of patients dying from prostate carcinoma have developed bone metastases that are incurable. Castration is commonly used to treat prostate cancer. Although the disease initially responds to androgen blockade strategies, it often becomes castration-resistant (CRPC for Castration Resistant Prostate Cancer). Most of the murine models of mixed lesions derived from prostate cancer cells are androgen sensitive. Thus, we established a new model of CRPC (androgen receptor (AR) negative) that causes mixed lesions in bone. Methods PC3 and its derived new cell clone PC3c cells were directly injected into the tibiae of SCID male mice. Tumor growth was analyzed by radiography and histology. Direct effects of conditioned medium of both cell lines were tested on osteoclasts, osteoblasts and osteocytes. Results We found that PC3c cells induced mixed lesions 10 weeks after intratibial injection. In vitro, PC3c conditioned medium was able to stimulate tartrate resistant acid phosphatase (TRAP)-positive osteoclasts. Osteoprotegerin (OPG) and endothelin-1 (ET1) were highly expressed by PC3c while dikkopf-1 (DKK1) expression was decreased. Finally, PC3c highly expressed bone associated markers osteopontin (OPN), Runx2, alkaline phosphatase (ALP), bone sialoprotein (BSP) and produced mineralized matrix in vitro in osteogenic conditions. Conclusions We have established a new CRPC cell line as a useful system for modeling human metastatic prostate cancer which presents the mixed phenotype of bone metastases that is commonly observed in prostate cancer patients with advanced disease. This model will help to understand androgen-independent mechanisms involved in the progression of prostate cancer in bone and provides a preclinical model for testing the effects of new treatments for bone metastases. PMID:24069383

  17. Hydrogen sulfide mediates the anti-survival effect of sulforaphane on human prostate cancer cells

    SciTech Connect

    Pei, Yanxi; Wu, Bo; Cao, Qiuhui; Wu, Lingyun; Yang, Guangdong

    2011-12-15

    Hydrogen sulfide (H{sub 2}S) is a novel gasotransmitter that regulates cell proliferation and other cellular functions. Sulforaphane (SFN) is a sulfur-containing compound that exhibits anticancer properties, and young sprouts of broccoli are particularly rich in SFN. There is consistent epidemiological evidence that the consumption of sulfur-containing vegetables, such as garlic and cruciferous vegetables, may help reduce the occurrence of prostate cancer. Here we found that a large amount of H{sub 2}S is released when SFN is added into cell culture medium or mixed with mouse liver homogenates, respectively. Both SFN and NaHS (a H{sub 2}S donor) decreased the viability of PC-3 cells (a human prostate cancer cell line) in a dose-dependent manner, and supplement of methemoglobin or oxidized glutathione (two H{sub 2}S scavengers) reversed SFN-reduced cell viability. We further found both cystathionine gamma-lyase (CSE) and cystathionine beta-synthase are expressed in PC-3 cells and mouse prostate tissues. H{sub 2}S production in prostate tissues from CSE knockout mice was only 20% of that from wild-type mice, suggesting CSE is a major H{sub 2}S-producing enzyme in prostate. CSE overexpression enhanced H{sub 2}S production and inhibited cell viability in PC-3 cells. In addition, both SFN and NaHS activated p38 mitogen-activated protein kinases (MAPK) and c-Jun N-terminal kinase (JNK). Pre-treatment of PC-3 cells with methemoglobin decreased SFN-stimulated MAPK activities. Suppression of both p38 MAPK and JNK reversed H{sub 2}S- or SFN-reduced viability of PC-3 cells. Our results demonstrated that H{sub 2}S mediates the inhibitory effect of SFN on the proliferation of PC-3 cells, which suggests that H{sub 2}S-releasing diet or drug might be beneficial in the treatment of prostate cancer. Highlights: Black-Right-Pointing-Pointer A large amount of H{sub 2}S is released from sulforaphane. Black-Right-Pointing-Pointer H{sub 2}S mediates the anti-survival effect of

  18. Analysis of the codon 72 polymorphism of TP53 and human papillomavirus infection in Iranian patients with prostate cancer.

    PubMed

    Salehi, Zivar; Hadavi, Mahvash

    2012-09-01

    The TP53 gene is one of the most important tumor suppressor genes controlling DNA transcription and cell regulation. Common polymorphisms in p53 gene may play a role in some cancers. Some studies have reported an association between human papillomavirus (HPV) infections and prostate cancer. The aim of this study was to investigate whether the TP53 codon 72 polymorphism and HPV infection are responsible for susceptibility to prostate cancer in Iranian men. The prostate biopsies were taken during surgery from 68 Iranian prostatic cancer patients, and 85 patients with benign prostate hyperplasia. For genotyping of the p53 polymorphism at codon 72, PCRRFLP methods were used and the PCR products were digested with BstU1. An attempt was also made to detect HPV DNA in benign prostate hyperplasia and prostate cancer specimens. Among cancer cases, the distribution of Arg/Arg, Arg/Pro and Pro/Pro genotypes were 26.5%, 45.4%, and 19.1%, respectively. Among patients with benign prostate hyperplasia, the distribution of Arg/Arg, Arg/Pro, and Pro/Pro genotypes were 27%, 53%, and 20%, respectively. The allele frequencies did not differ significantly between prostate cancer and benign prostate hyperplasia samples. Human papillomavirus was detected only in three patients (4.4%; P = 0.71). The results from this study suggest that the TP53 codon 72 polymorphism and HPV infection do not confer susceptibility to prostate cancer in the Iranian population. Larger population-based studies are needed to clarify the relation between prostate carcinoma and p53 polymorphism and HPV infection. PMID:22825821

  19. Monitoring changes in tissue optical properties following interstitial photothermal therapy of ex vivo human prostate tissue

    NASA Astrophysics Data System (ADS)

    Weersink, Robert A.; He, Jie; Veilleux, Israel; Trachtenberg, John; Wilson, Brian C.

    2013-03-01

    We are developing a method of monitoring treatment progression of interstitial photothermal therapy of focal prostate cancer using transrectal diffuse optical tomography (TRDOT) combined with transrectal 3D ultrasound (3D-TRUS). Measurements of prostate tissue optical properties were made on ex vivo human prostate samples prior to and post coagulation. Interstitial photothermal treatments were delivered to the ex vivo samples and monitored using an interstitial probe near the treatment fiber. After treatment, bulk optical properties were measured on native and coagulated zones of tissue. Changes in optical properties across the boundary between native and coagulated tissues were spatially mapped using a small diffuse reflectance probe. The optical property estimates and spatial information obtained using each method was compared.

  20. A single domain of human prostatic acid phosphatase shows antibody-mediated restoration of catalytic activity.

    PubMed Central

    Choe, B K; Dong, M K; Walz, D; Gleason, S; Rose, N R

    1982-01-01

    By limited proteolysis with mouse submaxillaris protease, human prostatic acid phosphatase (EC 3.1.3.2) was cleaved into three fragments, Sp1, Sp2, and Sp3, which individually had no enzymatic activity. One of the fragments, Sp3, regained enzymatic activity after interaction with rabbit antibody to prostatic acid phosphatase. The Sp3 fragment was purified and characterized as to its molecular weight, amino acid composition, and carbohydrate content. The Sp3 fragment behaved like the parent molecule in L(+)-tartrate affinity and in trapping of a phosphoryl intermediate. The same Sp3 fragment also bears the most prominent antigenic determinants. This evidence suggest that Sp3 is the enzymatically active domain of prostatic acid phosphatase. Images PMID:6193513

  1. The regulation of adiponectin receptors in human prostate cancer cell lines

    SciTech Connect

    Mistry, T.; Digby, J.E.; Chen, J.; Desai, K.M.; Randeva, H.S. . E-mail: H.Randeva@warwick.ac.uk

    2006-09-29

    Obesity is a risk factor for prostate cancer, and plasma levels of the adipokine, adiponectin, are low in the former but high in the latter. Adiponectin has been shown to modulate cell proliferation and apoptosis, suggesting that adiponectin and its receptors (Adipo-R1, Adipo-R2) may provide a molecular association between obesity and prostate carcinogenesis. We show for First time, the protein distribution of Adipo-R1 and Adipo-R2 in LNCaP and PC3 cells, and in human prostate tissue. Using real-time RT-PCR we provide novel data demonstrating the differential regulation of Adipo-R1 and Adipo-R2 mRNA expression by testosterone, 5-{alpha} dihydrotestosterone, {beta}-estradiol, tumour necrosis factor-{alpha}, leptin, and adiponectin in LNCaP and PC3 cells. Our findings suggest that adiponectin and its receptors may contribute to the molecular association between obesity and prostate cancer through a complex interaction with other hormones and cytokines that also play important roles in the pathophysiology of obesity and prostate cancer.

  2. NOTCH3 IS ACTIVATED BY CHRONIC HYPOXIA AND CONTRIBUTES TO THE PROGRESSION OF HUMAN PROSTATE CANCER

    PubMed Central

    Danza, Giovanna; Di Serio, Claudia; Ambrosio, Maria Raffaella; Sturli, Niccolò; Lonetto, Giuseppe; Rosati, Fabiana; Rocca, Bruno Jim; Ventimiglia, Giuseppina; del Vecchio, Maria Teresa; Prudovsky, Igor; Marchionni, Niccolò; Tarantini, Francesca

    2013-01-01

    Prostate cancer is still the second cause of cancer-related death among men. Although patients with metastatic presentation have an ominous outcome, the vast majority of PCs are diagnosed at an early stage. Nonetheless, even among patients with clinically localized disease the outcome may vary considerably. Other than androgen sensitivity, little is known about which other signaling pathways are deranged in aggressive, localized cancers. The elucidation of such pathways may help to develop innovative therapies aimed at specific molecular targets. We report that in a hormone-sensitive prostate cancer cell line, LNCaP, Notch3 was activated by hypoxia and sustained cell proliferation and colony formation in soft agar. Hypoxia also modulated cellular cholesterol content and the number and size of lipid rafts, causing a coalescence of small rafts into bigger clusters; under this experimental condition Notch3 migrated from the non-raft into the raft compartment where it co-localized with the γ-secretase complex. We also looked at human prostate cancer biopsies and found that expression of Notch3 positively correlated with Gleason score and with expression of carbonic anhydrase IX, a marker of hypoxia. In conclusion, hypoxia triggers the activation of Notch3 which, in turn, sustains proliferation of prostate cancer cells. Notch3 pathway represents a promising target for adjuvant therapy in patients with prostate cancer. PMID:23729168

  3. Hyperplastic Polyposis Syndrome Identified with a BRAF Mutation

    PubMed Central

    Ahn, Hyung Su; Kim, Hee Kyung; Yoo, Hee Yong; Kim, Hwa Jong; Ko, Bong Min; Lee, Moon Sung

    2012-01-01

    Hyperplastic polyposis syndrome (HPS) is a rare condition characterized by the presence of numerous hyperplastic polyps (HPs) in the colon and rectum. Patients with HPS have an increased risk of colorectal cancer. This link is associated with gene mutations, especially B type Raf kinase (BRAF). However, a case of HPS associated with gene mutations has seldom been reported in Korea. Here, we describe a case of HPS in which a BRAF mutation was present in a 34-year-old woman. She had more than 110 HPs in the stomach and colorectum, which we removed. All of the polyps were diagnosed histologically as HPs, and no adenomatous or malignant changes were noted. We performed a BRAF and K-ras mutation analysis as well as a microsatellite analysis on the resected colon polyps. BRAF mutations were found in the resected colon polyps, but there was no evidence of K-RAS mutation or microsatellite instability. PMID:22570761

  4. Human and murine prostate basal/stem cells are not direct targets of prolactin.

    PubMed

    Sackmann-Sala, Lucila; Angelergues, Antoine; Boutillon, Florence; d'Acremont, Bruno; Maidenberg, Marc; Oudard, Stéphane; Goffin, Vincent

    2015-09-01

    Local overexpression of prolactin (PRL) in the prostate of Pb-PRL transgenic mice induces benign prostate tumors exhibiting marked amplification of the epithelial basal/stem cell compartment. However, PRL-activated intracellular signaling seems to be restricted to luminal cells, suggesting that basal/stem cells may not be direct targets of PRL. Given their described role as prostate cancer-initiating cells, it is important to understand the mechanisms that regulate basal/stem cells. In this study, we evaluated whether PRL can act directly on these cells, by growing them as prostaspheres. For this, primary 3D prostasphere cultures were prepared from unfractionated cells isolated from freshly harvested human and mouse benign prostate tissues and subjected to PRL stimulation in vitro. None of the various concentrations of PRL tested showed any effects on the sizes or numbers of the prostaspheres generated. In addition, neither activation of canonical PRL-induced signaling pathways (Stat5, Stat3 or Erk1/2) nor increased expression of the proliferation marker Ki-67 were detected by immunostaining in PRL-stimulated prostaspheres. Consistent with the absence of response, PRL receptor mRNA levels were generally undetectable in mouse sphere cells. We conclude that human and mouse prostate basal/stem cells are not direct targets of PRL action. The observed amplification of basal/stem cells in Pb-PRL prostates might be due to paracrine mechanisms originating from PRL action on other cell compartments. Our current efforts are aimed at unraveling these mechanisms. PMID:25888939

  5. Androgen-Sensitized Apoptosis of HPr-1AR Human Prostate Epithelial Cells

    PubMed Central

    Chen, Congcong; Dienhart, Jason A.; Bolton, Eric C.

    2016-01-01

    Androgen receptor (AR) signaling is crucial to the development and homeostasis of the prostate gland, and its dysregulation mediates common prostate pathologies. The mechanisms whereby AR regulates growth suppression and differentiation of luminal epithelial cells in the prostate gland and proliferation of malignant versions of these cells have been investigated in human and rodent adult prostate. However, the cellular stress response of human prostate epithelial cells is not well understood, though it is central to prostate health and pathology. Here, we report that androgen sensitizes HPr-1AR and RWPE-AR human prostate epithelial cells to cell stress agents and apoptotic cell death. Although 5α-dihydrotestosterone (DHT) treatment alone did not induce cell death, co-treatment of HPr-1AR cells with DHT and an apoptosis inducer, such as staurosporine (STS), TNFt, or hydrogen peroxide, synergistically increased cell death in comparison to treatment with each apoptosis inducer by itself. We found that the synergy between DHT and apoptosis inducer led to activation of the intrinsic/mitochondrial apoptotic pathway, which is supported by robust cleavage activation of caspase-9 and caspase-3. Further, the dramatic depolarization of the mitochondrial membrane potential that we observed upon co-treatment with DHT and STS is consistent with increased mitochondrial outer membrane permeabilization (MOMP) in the pro-apoptotic mechanism. Interestingly, the synergy between DHT and apoptosis inducer was abolished by AR antagonists and inhibitors of transcription and protein synthesis, suggesting that AR mediates pro-apoptotic synergy through transcriptional regulation of MOMP genes. Expression analysis revealed that pro-apoptotic genes (BCL2L11/BIM and AIFM2) were DHT-induced, whereas pro-survival genes (BCL2L1/BCL-XL and MCL1) were DHT-repressed. Hence, we propose that the net effect of these AR-mediated expression changes shifts the balance of BCL2-family proteins, such that

  6. Growth inhibition of human prostate cells in vitro by novel inhibitors of androgen synthesis.

    PubMed

    Klus, G T; Nakamura, J; Li, J S; Ling, Y Z; Son, C; Kemppainen, J A; Wilson, E M; Brodie, A M

    1996-11-01

    The long-standing strategy for the treatment of metastatic prostate cancer has been to reduce androgenic stimulation of tumor growth by removal of the testes, the primary site of testosterone synthesis. However, a low level of androgenic stimulation may continue, even after castration, by the conversion of adrenal androgens to 5alpha-dihydrotestosterone (DHT) in the prostate tumor cells. Two important enzymes of the androgen biosynthetic pathway are 17alpha-hydroxylase/C17,20-lyase, which regulates an early step in the synthesis of testosterone and other androgens in both the testes and adrenal glands, and 5alpha-reductase, which converts testosterone to the more potent androgen, DHT, in the prostate. We have identified new inhibitors of these enzymes that may be of use in achieving a more complete ablation of androgens in the treatment of metastatic prostate cancer. Three derivatives of androstene were shown to inhibit 17alpha-hydroxylase/C17,20-lyase with potencies 2-20-fold greater than that of ketoconazole, a previously established inhibitor of this enzyme. Derivatives of pregnane and pregnene displayed activities against 5alpha-reductase that were comparable to that of N-(1,1-dimethyl-ethyl)-3-oxo-4-aza-5alpha-androst-1-ene-17beta-car boxamide. All of the 5alpha-reductase inhibitors were able to at least partially inhibit the mitogenic effect of testosterone in either histocultures of human benign prostatic hypertrophic tissue or in cultures of the LNCaP human prostatic tumor cell line. For these compounds, it appears that this inhibition can be attributed to a reduction of DHT synthesis in these cultures, because no inhibitory effect was observed in DHT-treated cultures, and none of the compounds had a cytotoxic effect. Surprisingly, one of the inhibitors of 17alpha-hydroxylase/C17,20-lyase, 17beta-(4-imidazolyl)-5-pregnen-3beta-ol, was also able to inhibit the mitogenic effect of testosterone in both the histoculture and cell culture assays and had an effect

  7. Multiple calcifying hyperplastic dental follicles: A case report

    PubMed Central

    Aydin, Ulkem; Baykul, Timucin; Yildirim, Benay; Yildirim, Derya; Karaduman, Ayse

    2013-01-01

    This report describes a 31-year-old female patient with six impacted teeth. The crowns of the impacted teeth were surrounded with cyst-like lesions with a mixed internal structure and well-defined cortical borders. Microscopic examination of the specimen obtained from the follicle of the left mandibular third molar tooth revealed loose to moderately dense collagenous connective tissue with abundant calcified material and sparse epithelial islands. A diagnosis of multiple calcifying hyperplastic dental follicles was made. PMID:24380071

  8. Unusual presentation of chronic hyperplastic pulpitis: a case report.

    PubMed

    Faryabi, Javad; Adhami, Shahrzad

    2008-01-01

    Chronic hyperplastic pulpitis (pulp polyps) usually occurs in molar teeth of children and young adults and is characterized by an overgrowth of granulomatous tissue into the carious cavity. Here, we report a rare type of pulp polyp in lower third molar of a 27-year-old woman that not only grow into carious cavity but also extruded in very large size that interfered with occluding of the teeth. PMID:24265640

  9. [PROBLEM OF ENDOMETRIUM HYPERPLASTIC PROCESSES IN REPRODUCTIVE AGE WOMEN].

    PubMed

    Bazyuta, L Z; Polyova, S P; Tsintar, S A

    2015-01-01

    The article presents the risk factors of endometrium hyperplastic processes (EHP) in reproduc- tive age women. It is shown that EHP occur in response to hormonal homeostasis violations of the target tissues. It is established that the biologically active substances, which are closely related to immune mechanisms of the reproductive system functioning take place in regulatory mechanisms of cell growth and differentiation of endometrium. PMID:27491143

  10. Frequency analysis of multispectral photoacoustic images for differentiating malignant region from normal region in excised human prostate

    NASA Astrophysics Data System (ADS)

    Sinha, Saugata; Rao, Navalgund A.; Valluru, Keerthi S.; Chinni, Bhargava K.; Dogra, Vikram S.; Helguera, Maria

    2014-03-01

    Frequency domain analysis of the photoacoustic (PA) radio frequency signals can potentially be used as a tool for characterizing microstructure of absorbers in tissue. This study investigates the feasibility of analyzing the spectrum of multiwavelength PA signals generated by excised human prostate tissue samples to differentiate between malignant and normal prostate regions. Photoacoustic imaging at five different wavelengths, corresponding to peak absorption coefficients of deoxyhemoglobin, whole blood, oxyhemoglobin, water and lipid in the near infrared (NIR) (700 nm - 1000 nm) region, was performed on freshly excised prostate specimens taken from patients undergoing prostatectomy for biopsy confirmed prostate cancer. The PA images were co-registered with the histopathology images of the prostate specimens to determine the region of interest (ROI) corresponding to malignant and normal tissue. The calibrated power spectrum of each PA signal from a selected ROI was fit to a linear model to extract the corresponding slope, midband fit and intercept parameters. The mean value of each parameter corresponding to malignant and adjacent normal prostate ROI was calculated for each of the five wavelengths. The results obtained for 9 different human prostate specimens, show that the mean values of midband fit and intercept are significantly different between malignant and normal regions. In addition, the average midband fit and intercept values show a decreasing trend with increasing wavelength. These preliminary results suggest that frequency analysis of multispectral PA signals can be used to differentiate malignant region from the adjacent normal region in human prostate tissue.

  11. Phenotypic characterization of telomerase-immortalized primary non-malignant and malignant tumor-derived human prostate epithelial cell lines

    SciTech Connect

    Gu Yongpeng; Li Hongzhen; Miki, Jun; Kim, Kee-Hong; Furusato, Bungo; Sesterhenn, Isabell A.; Chu, Wei-Sing; McLeod, David G.; Srivastava, Shiv; Ewing, Charles M.; Isaacs, William B.; Rhim, Johng S. . E-mail: jrhim@cpdr.org

    2006-04-01

    In vitro human prostate cell culture models are critical for clarifying the mechanism of prostate cancer progression and for testing preventive and therapeutic agents. Cell lines ideal for the study of human primary prostate tumors would be those derived from spontaneously immortalized tumor cells; unfortunately, explanted primary prostate cells survive only short-term in culture, and rarely immortalize spontaneously. Therefore, we recently have generated five immortal human prostate epithelial cell cultures derived from both the benign and malignant tissues of prostate cancer patients with telomerase, a gene that prevents cellular senescence. Examination of these cell lines for their morphologies and proliferative capacities, their abilities to grow in low serum, to respond to androgen stimulation, to grow above the agar layer, to form tumors in SCID mice, suggests that they may serve as valid, useful tools for the elucidation of early events in prostate tumorigenesis. Furthermore, the chromosome alterations observed in these immortalized cell lines expressing aspects of the malignant phenotypes imply that these cell lines accurately recapitulate the genetic composition of primary tumors. These novel in vitro models may offer unique models for the study of prostate carcinogenesis and also provide the means for testing both chemopreventive and chemotherapeutic agents.

  12. Tumour-initiating stem-like cells in human prostate cancer exhibit increased NF-κB signalling

    PubMed Central

    Rajasekhar, Vinagolu K.; Studer, Lorenz; Gerald, William; Socci, Nicholas D.; Scher, Howard I.

    2011-01-01

    Androgen depletion is a key strategy for treating human prostate cancer, but the presence of hormone-independent cells escaping treatment remains a major therapeutic challenge. Here, we identify a minor subset of stem-like human prostate tumour-initiating cells (TICs) that do not express prostate cancer markers, such as androgen receptor or prostate specific antigen. These TICs possess stem cell characteristics and multipotency as demonstrated by in vitro sphere-formation and in vivo tumour-initiation, respectively. The cells represent an undifferentiated subtype of basal cells and can be purified from prostate tumours based on coexpression of the human pluripotent stem cell marker TRA-1-60 with CD151 and CD166. Such triple-marker-positive TICs recapitulate the original parent tumour heterogeneity in serial xeno-transplantations indicating a tumour cell hierarchy in human prostate cancer development. These TICs exhibit increased nuclear factor-κB activity. These findings are important in understanding the molecular basis of human prostate cancer. PMID:21245843

  13. Curcumin analogues with high activity for inhibiting human prostate cancer cell growth and androgen receptor activation.

    PubMed

    Zhou, Dai-Ying; Ding, Ning; Du, Zhi-Yun; Cui, Xiao-Xing; Wang, Hong; Wei, Xing-Chuan; Conney, Allan H; Zhang, Kun; Zheng, Xi

    2014-09-01

    The androgen receptor (AR) has a critical role in prostate cancer development and progression. Several curcumin analogues (A10, B10, C10, E10 and F10) with different linker groups were investigated for their effects in human prostate cancer CWR‑22Rv1 and LNCaP cell lines. The ability of these compounds to inhibit testosterone (TT)‑ or dihydrotestosterone (DHT)‑induced AR activity was determined by an AR‑linked luciferase assay and by TT‑ or DHT‑induced expression of prostate specific antigen. Compounds F10 and E10 had stronger inhibitory effects on the growth of cultured CWR‑22Rv1 and LNCaP cell lines, and they also had enhanced stimulatory effects on apoptosis compared with curcumin and other curcumin analogues (A10, B10, C10) in CWR‑22Rv1 cells. E10 and F10 were more potent inhibitors of AR activity than curcumin, A10 and B10. The higher activities of E10 and F10 may be correlated with a heteroatom linker. The results indicate that one of the potential mechanisms for the anticancer effect of the curcumin analogues was inhibition of AR pathways in human prostate cancer cells. PMID:25060817

  14. Hydrogen sulfide mediates the anti-survival effect of sulforaphane on human prostate cancer cells.

    PubMed

    Pei, Yanxi; Wu, Bo; Cao, Qiuhui; Wu, Lingyun; Yang, Guangdong

    2011-12-15

    Hydrogen sulfide (H(2)S) is a novel gasotransmitter that regulates cell proliferation and other cellular functions. Sulforaphane (SFN) is a sulfur-containing compound that exhibits anticancer properties, and young sprouts of broccoli are particularly rich in SFN. There is consistent epidemiological evidence that the consumption of sulfur-containing vegetables, such as garlic and cruciferous vegetables, may help reduce the occurrence of prostate cancer. Here we found that a large amount of H(2)S is released when SFN is added into cell culture medium or mixed with mouse liver homogenates, respectively. Both SFN and NaHS (a H(2)S donor) decreased the viability of PC-3 cells (a human prostate cancer cell line) in a dose-dependent manner, and supplement of methemoglobin or oxidized glutathione (two H(2)S scavengers) reversed SFN-reduced cell viability. We further found both cystathionine gamma-lyase (CSE) and cystathionine beta-synthase are expressed in PC-3 cells and mouse prostate tissues. H(2)S production in prostate tissues from CSE knockout mice was only 20% of that from wild-type mice, suggesting CSE is a major H(2)S-producing enzyme in prostate. CSE overexpression enhanced H(2)S production and inhibited cell viability in PC-3 cells. In addition, both SFN and NaHS activated p38 mitogen-activated protein kinases (MAPK) and c-Jun N-terminal kinase (JNK). Pre-treatment of PC-3 cells with methemoglobin decreased SFN-stimulated MAPK activities. Suppression of both p38 MAPK and JNK reversed H(2)S- or SFN-reduced viability of PC-3 cells. Our results demonstrated that H(2)S mediates the inhibitory effect of SFN on the proliferation of PC-3 cells, which suggests that H(2)S-releasing diet or drug might be beneficial in the treatment of prostate cancer. PMID:22005276

  15. Alterations of Gene Expression in the Development of Early Hyperplastic Precursors of Breast Cancer

    PubMed Central

    Lee, Sangjun; Medina, Dan; Tsimelzon, Anna; Mohsin, Syed K.; Mao, Sufeng; Wu, Yun; Allred, D. Craig

    2007-01-01

    Enlargement of normal terminal duct lobular units (TDLUs) by hyperplastic columnar epithelial cells is one of the most common abnormalities of growth in the adult female human breast. These hyperplastic enlarged lobular units (HELUs) are important clinically as the earliest histologically identifiable potential precursor of breast cancer. The causes of the hyperplasia are unknown but may include estrogen-simulated growth mediated by estrogen receptor-α, which is highly elevated in HELUs and may be fundamental to their development. The present study used DNA microarray technology and RNA from microdissected pure epithelial cells to examine changes in gene expression and molecular pathways associated with the development of HELUs from TDLUs. The results suggest that HELUs evolve from TDLUs primarily by reactivation of pathways involved in embryonic development and suppression of terminal differentiation. Changes in ERBB genes were particularly prominent, including a uniform switch in ligands for the ERBB1 receptor (14-fold decrease in epidermal growth factor and 10-fold increase in amphiregulin, respectively) in HELUs compared with TDLUs. Epidermal growth factor regulates terminal differentiation in adult breast and amphiregulin is critical to normal embryonic breast development. Because HELUs are such early potential precursors of breast cancer, targeting some of these alterations may be especially promising strategies for breast cancer prevention. PMID:17591970

  16. Regulation of mRNA and Protein Levels of β1 Integrin Variants in Human Prostate Carcinoma

    PubMed Central

    Perlino, Elda; Lovecchio, Mariarosaria; Vacca, Rosa A.; Fornaro, Mara; Moro, Loredana; Ditonno, Pasquale; Battaglia, Michele; Selvaggi, Francesco P.; Mastropasqua, Mauro G.; Bufo, Pantaleo; Languino, Lucia R.

    2000-01-01

    Alterations of integrin expression levels in cancer cells correlate with changes in invasiveness, tumor progression, and metastatic potential. The β1C integrin, an alternatively spliced form of the human β1 integrin, has been shown to inhibit prostate cell proliferation. Furthermore, β1C protein levels were found to be abundant in normal prostate glandular epithelium and down-regulated in prostatic adenocarcinoma. To gain further insights into the molecular mechanisms underlying abnormal cancer cell proliferation, we have studied β1C and β1 integrin expression at both mRNA and protein levels by Northern and immunoblotting analysis using freshly isolated neoplastic and normal human prostate tissue specimens. Steady-state mRNA levels were evaluated in 38 specimens: 33 prostatic adenocarcinomas exhibiting different Gleason’s grade and five normal tissue specimens that did not show any histological manifestation of benign prostatic hypertrophy. Our results demonstrate that β1C mRNA is expressed in normal prostate and is significantly down-regulated in neoplastic prostate specimens. In addition, using a probe that hybridizes with all β1 variants, mRNA levels of β1 are found reduced in neoplastic versus normal prostate tissues. We demonstrate that β1C mRNA down-regulation does not correlate with either tumor grade or differentiation according to Gleason’s grade and TNM system evaluation, and that β1C mRNA levels are not affected by hormonal therapy. In parallel, β1C protein levels were analyzed. As expected, β1C is found to be expressed in normal prostate and dramatically reduced in neoplastic prostate tissues; in contrast, using an antibody to β1 that recognizes all β1 variants, the levels of β1 are comparable in normal and neoplastic prostate, thus indicating a selective down-regulation of the β1C protein in prostate carcinoma. These results demonstrate for the first time that β1C and β1 mRNA expression is down-regulated in prostate carcinoma

  17. Targeted chemotherapy with cytotoxic bombesin analogue AN-215 inhibits growth of experimental human prostate cancers.

    PubMed

    Stangelberger, Anton; Schally, Andrew V; Letsch, Markus; Szepeshazi, Karoly; Nagy, Attila; Halmos, Gabor; Kanashiro, Celia A; Corey, Eva; Vessella, Robert

    2006-01-01

    We developed a powerful cytotoxic analogue of bombesin AN-215, in which the bombesin (BN)-like carrier peptide is conjugated to 2-pyrrolino doxorubicin (AN-201). Human prostate cancers express high levels of receptors for BN/gastrin releasing peptide (GRP) that can be used for targeted chemotherapy. The effects of targeted chemotherapy with cytotoxic BN analogue AN-215 were evaluated in nude mice bearing subcutaneous xenografts of DU-145, LuCaP-35, MDA-PCa-2b and intraosseous implants of C4-2 human prostate cancers. Intraosseous growth of C4-2 tumors was monitored by serum PSA. BN/GRP receptors were evaluated by 125I-[Tyr4]BN binding assays and RT-PCR. The effects of AN-215 on apoptosis and cell proliferation were followed by histology, and the expression of Bcl-2 and Bax protein was determined by Western blot analysis. Targeted analog AN-215 significantly inhibited growth of subcutaneously implanted DU-145, LuCaP-35 and MDA-PCa-2b prostate cancers by 81% to 91% compared to controls, while cytotoxic radical AN-201 was less effective and more toxic. Serum PSA levels of mice bearing intraosseous C4-2 prostate tumors were significantly reduced. In LuCaP-35 tumors administration of BN antagonist RC-3095 prior to AN-215 blocked the receptors for BN/GRP and inhibited the effects of AN-215. High affinity receptors for BN/GRP and their m-RNA were detected on membranes of all 4 tumor models. Therapy with AN-215, but not with AN-201, decreased the ratio of Bcl-2/Bax in DU-145 and the expression of antiapoptotic Bcl-2 in LuCaP-35 tumors. The presence of BN/GRP receptors on primary and metastatic prostate cancers makes possible targeted chemotherapy with AN-215 for the treatment of this malignancy. PMID:16003723

  18. Tetrandrine suppresses proliferation, induces apoptosis, and inhibits migration and invasion in human prostate cancer cells

    PubMed Central

    Liu, Wei; Kou, Bo; Ma, Zhen-Kun; Tang, Xiao-Shuang; Lv, Chuan; Ye, Min; Chen, Jia-Qi; Li, Lei; Wang, Xin-Yang; He, Da-Lin

    2015-01-01

    Tetrandrine (TET), a traditional Chinese medicine, exerts remarkable anticancer activity on various cancer cells. However, little is known about the effect of TET on human prostate cancer cells, and the mechanism of function of TET on prostate cancer has not yet been elucidated. To investigate the effects of TET on the suppression of proliferation, induction of apoptosis, and inhibition of migration and invasion in human prostate cancer cell lines, DU145 and PC-3. Inhibition of growth was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and clone formation assay, and flow cytometry analysis was performed to detect the induction of apoptosis. Activation of poly (ADP-ribose) polymerase, caspase-3, Akt, phospho-Akt, Bcl-2, and Bax was analyzed by Western blotting. Wound healing assay and transwell migration assay were used to evaluate the effect of TET on migration and invasion of cancer cells. TET inhibited the growth of DU145 and PC–3 cells in a dose- and time-dependent manner. Cell cloning was inhibited in the presence of TET in DU145 and PC-3 cells. TET suppressed the migration of DU145 and PC-3 cells. Transwell invasion assay showed that TET significantly weakened invasion capacity of DU145 and PC-3 cells. TET exhibited strong inhibitory effect on proliferation, migration, and invasion of prostate cancer cells. In addition, TET induced apoptosis in a dose-dependent manner by activating the caspase cascade and inhibiting phosphoinositide 3-kinase-Akt signal pathway. The accumulating evidence suggests that TET could be a potential therapeutic candidate against prostate cancer in a clinical setting. PMID:25677131

  19. Tetrandrine suppresses proliferation, induces apoptosis, and inhibits migration and invasion in human prostate cancer cells.

    PubMed

    Liu, Wei; Kou, Bo; Ma, Zhen-Kun; Tang, Xiao-Shuang; Lv, Chuan; Ye, Min; Chen, Jia-Qi; Li, Lei; Wang, Xin-Yang; He, Da-Lin

    2015-01-01

    Tetrandrine (TET), a traditional Chinese medicine, exerts remarkable anticancer activity on various cancer cells. However, little is known about the effect of TET on human prostate cancer cells, and the mechanism of function of TET on prostate cancer has not yet been elucidated. To investigate the effects of TET on the suppression of proliferation, induction of apoptosis, and inhibition of migration and invasion in human prostate cancer cell lines, DU145 and PC-3. Inhibition of growth was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and clone formation assay, and flow cytometry analysis was performed to detect the induction of apoptosis. Activation of poly (ADP-ribose) polymerase, caspase-3, Akt, phospho-Akt, Bcl-2, and Bax was analyzed by Western blotting. Wound healing assay and transwell migration assay were used to evaluate the effect of TET on migration and invasion of cancer cells. TET inhibited the growth of DU145 and PC-3 cells in a dose- and time-dependent manner. Cell cloning was inhibited in the presence of TET in DU145 and PC-3 cells. TET suppressed the migration of DU145 and PC-3 cells. Transwell invasion assay showed that TET significantly weakened invasion capacity of DU145 and PC-3 cells. TET exhibited strong inhibitory effect on proliferation, migration, and invasion of prostate cancer cells. In addition, TET induced apoptosis in a dose-dependent manner by activating the caspase cascade and inhibiting phosphoinositide 3-kinase-Akt signal pathway. The accumulating evidence suggests that TET could be a potential therapeutic candidate against prostate cancer in a clinical setting. PMID:25677131

  20. Expression of melanocortin receptors in human prostate cancer cell lines: MC2R activation by ACTH increases prostate cancer cell proliferation.

    PubMed

    Hafiz, Saly; Dennis, John C; Schwartz, Dean; Judd, Robert; Tao, Ya-Xiong; Khazal, Kamel; Akingbemi, Benson; Mo, Xiu-Lei; Abdel-Mageed, Asim B; Morrison, Edward; Mansour, Mahmoud

    2012-10-01

    The melanocortin receptors (MCRs 1-5) are G protein coupled-receptors (GPCRs) that regulate food intake, inflammation, skin pigmentation, sexual function and steroidogenesis. Their peptide ligands, the melanocortins, are α-, β- and γ-melanocyte-stimulating hormone and adrenocorticotropic hormone (ACTH) all of which are secreted from the anterior pituitary gland under hypothalamic control. MC2R binds ACTH but has no affinity for the other melanocortins and is, thereby, pharmacologically different from MCRs that bind those ligands. Evidence suggests that elevated GPCRs transactivate the androgen receptor (AR), the critical mediator of prostate cell growth, and consequently promote prostate cancer cell proliferation. It may be that reduced central melanocortin signaling is coincidental with reversal of prostate cancer cachexia, but no data are available on the expression of, or the role for, MCRs in prostate cancer. Here, we show that MCR (1-5) mRNAs are expressed in androgen-dependent LNCaP and androgen-independent PC3 and DU-145 human prostate cancer cell lines. Further, MC2R, the specific target of ACTH, is expressed in LNCaP, PC3 and DU-145 cells. Among the several synthetic MCR peptide ligands that we used, only ACTH promoted concentration-dependent cell proliferation in the three cell lines as shown by MTT cell proliferation assay. In LNCaP cells, the effect was additive with testosterone stimulation and was partially blunted with SHU9119, a non-selective MCR antagonist. In the same cells, ACTH induced cAMP production and increased AR nuclear labeling in immunocytochemical assays. Our observations suggest that MC2R is involved in prostate carcinogenesis and that targeting MC2R signaling may provide a novel avenue in prostate carcinoma treatment. PMID:22842514

  1. Multiphoton gradient index endoscopy for evaluation of diseased human prostatic tissue ex vivo

    NASA Astrophysics Data System (ADS)

    Huland, David M.; Jain, Manu; Ouzounov, Dimitre G.; Robinson, Brian D.; Harya, Diana S.; Shevchuk, Maria M.; Singhal, Paras; Xu, Chris; Tewari, Ashutosh K.

    2014-11-01

    Multiphoton microscopy can instantly visualize cellular details in unstained tissues. Multiphoton probes with clinical potential have been developed. This study evaluates the suitability of multiphoton gradient index (GRIN) endoscopy as a diagnostic tool for prostatic tissue. A portable and compact multiphoton endoscope based on a 1-mm diameter, 8-cm length GRIN lens system probe was used. Fresh ex vivo samples were obtained from 14 radical prostatectomy patients and benign and malignant areas were imaged and correlated with subsequent H&E sections. Multiphoton GRIN endoscopy images of unfixed and unprocessed prostate tissue at a subcellular resolution are presented. We note several differences and identifying features of benign versus low-grade versus high-grade tumors and are able to identify periprostatic tissues such as adipocytes, periprostatic nerves, and blood vessels. Multiphoton GRIN endoscopy can be used to identify both benign and malignant lesions in ex vivo human prostate tissue and may be a valuable diagnostic tool for real-time visualization of suspicious areas of the prostate.

  2. Effect of resveratrol and zinc on intracellular zinc status in normal human prostate epithelial cells

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To evaluate the influence of resveratrol on cellular zinc status, normal human prostate epithelial (NHPrE) cells were treated with 6 levels of resveratrol (0, 0.5, 1, 2.5, 5 and 10 microM) and 4 levels of zinc [0, 4, 16, and 32 microM for zinc-deficient (ZD), zinc-normal (ZN), zinc-adequate (ZA), an...

  3. Analysis of the Human Prostate-Specific Proteome Defined by Transcriptomics and Antibody-Based Profiling Identifies TMEM79 and ACOXL as Two Putative, Diagnostic Markers in Prostate Cancer

    PubMed Central

    O'Hurley, Gillian; Busch, Christer; Fagerberg, Linn; Hallström, Björn M.; Stadler, Charlotte; Tolf, Anna; Lundberg, Emma; Schwenk, Jochen M.; Jirström, Karin; Bjartell, Anders; Gallagher, William M.; Uhlén, Mathias; Pontén, Fredrik

    2015-01-01

    To better understand prostate function and disease, it is important to define and explore the molecular constituents that signify the prostate gland. The aim of this study was to define the prostate specific transcriptome and proteome, in comparison to 26 other human tissues. Deep sequencing of mRNA (RNA-seq) and immunohistochemistry-based protein profiling were combined to identify prostate specific gene expression patterns and to explore tissue biomarkers for potential clinical use in prostate cancer diagnostics. We identified 203 genes with elevated expression in the prostate, 22 of which showed more than five-fold higher expression levels compared to all other tissue types. In addition to previously well-known proteins we identified two poorly characterized proteins, TMEM79 and ACOXL, with potential to differentiate between benign and cancerous prostatic glands in tissue biopsies. In conclusion, we have applied a genome-wide analysis to identify the prostate specific proteome using transcriptomics and antibody-based protein profiling to identify genes with elevated expression in the prostate. Our data provides a starting point for further functional studies to explore the molecular repertoire of normal and diseased prostate including potential prostate cancer markers such as TMEM79 and ACOXL. PMID:26237329

  4. Production and Characterization of Monoclonal Antibodies against Human Prostate Specific Antigen

    PubMed Central

    Bayat, Ali Ahmad; Ghods, Roya; Shabani, Mahdi; Mahmoudi, Ahmad Reza; Yeganeh, Omid; Hassannia, Hadi; Sadeghitabar, Ali; Balay-Goli, Leila; Noutash-Haghighat, Farzaneh; Sarrafzadeh, Ali reza; Jeddi-Tehrani, Mahmood

    2015-01-01

    Background Prostate Specific Antigen (PSA) is an important laboratory marker for diagnosis of prostatic cancer. Thus, development of diagnostic tools specific for PSA plays an important role in screening, monitoring and early diagnosis of prostate cancer. In this paper, the production and characterization of a panel of murine monoclonal antibodies (mAbs) against PSA have been presented. Methods Balb/c mice were immunized with PSA, which was purified from seminal plasma. Splenocytes of hyperimmunized mice were extracted and fused with Sp2/0 cells. By adding selective HAT medium, hybridoma cells were established and positive clones were selected by ELISA after four times of cloning. The isotypes of produced mAbs were determined by ELISA and then purified from ascitic fluids using Hi-Trap protein G column. The reactivities of the mAbs were examined with the purified PSA and seminal plasma by ELISA and western blot techniques. Furthermore, the reactivities of the mAbs were assessed in Prostate Cancer (PCa), Benign Prostatic Hyperplasia (BPH) and brain cancer tissues by Immunohistochemistry (IHC). Results Five anti-PSA mAbs (clones: 2G2-B2, 2F9-F4, 2D6-E8, IgG1/К) and clones (2C8-E9, 2G3-E2, IgG2a/К) were produced and characterized. All mAbs, except 2F9-F4 detected the expression of PSA in PCa and BPH tissues and none of them reacted with PSA in brain cancer tissue in IHC. Besides, all mAbs could detect a protein band around 33 kDa in human seminal plasma in western blot. Conclusion These mAbs can specifically recognize PSA and may serve as a component of PSA diagnostic kit in various biological fluids. PMID:25926946

  5. Lectin-Like Oxidized LDL Receptor-1 Is an Enhancer of Tumor Angiogenesis in Human Prostate Cancer Cells

    PubMed Central

    González-Chavarría, Iván; Cerro, Rita P.; Parra, Natalie P.; Sandoval, Felipe A.; Zuñiga, Felipe A.; Omazábal, Valeska A.; Lamperti, Liliana I.; Jiménez, Silvana P.; Fernandez, Edelmira A.; Gutiérrez, Nicolas A.; Rodriguez, Federico S.; Onate, Sergio A.; Sánchez, Oliberto; Vera, Juan C.; Toledo, Jorge R.

    2014-01-01

    Altered expression and function of lectin-like oxidized low-density lipoprotein receptor-1 (LOX-1) has been associated with several diseases such as endothelial dysfunction, atherosclerosis and obesity. In these pathologies, oxLDL/LOX-1 activates signaling pathways that promote cell proliferation, cell motility and angiogenesis. Recent studies have indicated that olr1 mRNA is over-expressed in stage III and IV of human prostatic adenocarcinomas. However, the function of LOX-1 in prostate cancer angiogenesis remains to be determined. Our aim was to analyze the contribution of oxLDL and LOX-1 to tumor angiogenesis using C4-2 prostate cancer cells. We analyzed the expression of pro-angiogenic molecules and angiogenesis on prostate cancer tumor xenografts, using prostate cancer cell models with overexpression or knockdown of LOX-1 receptor. Our results demonstrate that the activation of LOX-1 using oxLDL increases cell proliferation, and the expression of the pro-angiogenic molecules VEGF, MMP-2, and MMP-9 in a dose-dependent manner. Noticeably, these effects were prevented in the C4-2 prostate cancer model when LOX-1 expression was knocked down. The angiogenic effect of LOX-1 activated with oxLDL was further demonstrated using the aortic ring assay and the xenograft model of tumor growth on chorioallantoic membrane of chicken embryos. Consequently, we propose that LOX-1 activation by oxLDL is an important event that enhances tumor angiogenesis in human prostate cancer cells. PMID:25170920

  6. Deep RNA sequencing analysis of readthrough gene fusions in human prostate adenocarcinoma and reference samples

    PubMed Central

    2011-01-01

    Background Readthrough fusions across adjacent genes in the genome, or transcription-induced chimeras (TICs), have been estimated using expressed sequence tag (EST) libraries to involve 4-6% of all genes. Deep transcriptional sequencing (RNA-Seq) now makes it possible to study the occurrence and expression levels of TICs in individual samples across the genome. Methods We performed single-end RNA-Seq on three human prostate adenocarcinoma samples and their corresponding normal tissues, as well as brain and universal reference samples. We developed two bioinformatics methods to specifically identify TIC events: a targeted alignment method using artificial exon-exon junctions within 200,000 bp from adjacent genes, and genomic alignment allowing splicing within individual reads. We performed further experimental verification and characterization of selected TIC and fusion events using quantitative RT-PCR and comparative genomic hybridization microarrays. Results Targeted alignment against artificial exon-exon junctions yielded 339 distinct TIC events, including 32 gene pairs with multiple isoforms. The false discovery rate was estimated to be 1.5%. Spliced alignment to the genome was less sensitive, finding only 18% of those found by targeted alignment in 33-nt reads and 59% of those in 50-nt reads. However, spliced alignment revealed 30 cases of TICs with intervening exons, in addition to distant inversions, scrambled genes, and translocations. Our findings increase the catalog of observed TIC gene pairs by 66%. We verified 6 of 6 predicted TICs in all prostate samples, and 2 of 5 predicted novel distant gene fusions, both private events among 54 prostate tumor samples tested. Expression of TICs correlates with that of the upstream gene, which can explain the prostate-specific pattern of some TIC events and the restriction of the SLC45A3-ELK4 e4-e2 TIC to ERG-negative prostate samples, as confirmed in 20 matched prostate tumor and normal samples and 9 lung cancer

  7. Cadmium Induces p53-Dependent Apoptosis in Human Prostate Epithelial Cells

    PubMed Central

    Aimola, Pierpaolo; Carmignani, Marco; Volpe, Anna Rita; Di Benedetto, Altomare; Claudio, Luigi; Waalkes, Michael P.; van Bokhoven, Adrie; Tokar, Erik J.; Claudio, Pier Paolo

    2012-01-01

    Cadmium, a widespread toxic pollutant of occupational and environmental concern, is a known human carcinogen. The prostate is a potential target for cadmium carcinogenesis, although the underlying mechanisms are still unclear. Furthermore, cadmium may induce cell death by apoptosis in various cell types, and it has been hypothesized that a key factor in cadmium-induced malignant transformation is acquisition of apoptotic resistance. We investigated the in vitro effects produced by cadmium exposure in normal or tumor cells derived from human prostate epithelium, including RWPE-1 and its cadmium-transformed derivative CTPE, the primary adenocarcinoma 22Rv1 and CWR-R1 cells and LNCaP, PC-3 and DU145 metastatic cancer cell lines. Cells were treated for 24 hours with different concentrations of CdCl2 and apoptosis, cell cycle distribution and expression of tumor suppressor proteins were analyzed. Subsequently, cellular response to cadmium was evaluated after siRNA-mediated p53 silencing in wild type p53-expressing RWPE-1 and LNCaP cells, and after adenoviral p53 overexpression in p53-deficient DU145 and PC-3 cell lines. The cell lines exhibited different sensitivity to cadmium, and 24-hour exposure to different CdCl2 concentrations induced dose- and cell type-dependent apoptotic response and inhibition of cell proliferation that correlated with accumulation of functional p53 and overexpression of p21 in wild type p53-expressing cell lines. On the other hand, p53 silencing was able to suppress cadmium-induced apoptosis. Our results demonstrate that cadmium can induce p53-dependent apoptosis in human prostate epithelial cells and suggest p53 mutation as a possible contributing factor for the acquisition of apoptotic resistance in cadmium prostatic carcinogenesis. PMID:22448262

  8. Bifunctional Phage-Based Pretargeted Imaging of Human Prostate Carcinoma Bifunctional Phage Based Pretargeted Imaging

    PubMed Central

    Newton-Northup, Jessica R.; Figueroa, Said D.; Quinn, Thomas P.; Deutscher, Susan L.

    2009-01-01

    Introduction Two-step and three-step pretargeting systems utilizing biotinylated prostate tumor-homing bacteriophage (phage) and 111In-radiolabeled- streptavidin or biotin were developed for use in cancer radioimaging. The in vivo selected prostate carcinoma-specific phage (G1) displaying up to five copies of the peptide IAGLATPGWSHWLAL, was the focus of the present study. Methods The ability of G1 phage to extravasate and target prostate tumor cells was investigated using immunohistochemistry. G1 phage were biotinylated, streptavidin was conjugated to diethylenetriaminepentaacetic acid (DTPA), and biotin was conjugated to 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA). Biodistribution studies and single photon emission computed tomography (SPECT)/CT imaging of xenografted PC-3 tumors via two-step pretargeted 111In-labeled streptavidin and three-step pretargeted 111In-labeled biotin were performed in SCID mice to determine the optimal pretargeting method. Results The ability of G1 phage to extravasate the vasculature and bind directly to human PC-3 prostate carcinoma tumor cells in vivo was demonstrated via immunocytochemical analysis. Comparative biodistribution studies of the two-step and three-step pretargeting strategies indicated increased PC-3 human prostate carcinoma tumor uptake in SCID mice of 4.34 ±0.26 %ID/g at 0.5 hours post-injection of 111In radiolabeled biotin (utilized in a three-step protocol) compared to that of 0.67 ±0.06 %ID/g at twenty four hour postinjection of 111In radiolabeled streptavidin (employed in a two-step protocol). In vivo SPECT/CT imaging of xenografted PC-3 tumors in SCID mice with the three-step pretargeting method was superior to that of the two-step pretargeting method, and, importantly, blocking studies demonstrated specificity of tumor uptake of 111In-labeled biotin in the three-step pretargeting scheme. Conclusion This study demonstrates the use of multivalent bifunctional phage in a three

  9. Extracts of various species of Epilobium inhibit proliferation of human prostate cells.

    PubMed

    Vitalone, Annabella; Guizzetti, Marina; Costa, Lucio G; Tita, Beatrice

    2003-05-01

    This study examined whether various species of Epilobium, a phytotherapeutic agent used in folk medicine as a treatment for benign prostatic hyperplasia, may have an antiproliferative effect in PZ-HPV-7 human prostatic epithelial cells in-vitro. The MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl-tetrazolium bromide) test, [methyl-(3)H]thymidine incorporation into DNA and flow cytometry analysis were used to evaluate cell proliferation. Ethanolic extracts of E. spicatum, E. rosmarinifolium and E. tetragonum inhibited DNA synthesis in PZ-HPV-7 cells. While at high concentrations all extracts were cytotoxic, DNA synthesis was also decreased at levels that caused no or little cytotoxicity. Treatment of cells with Epilobium extracts did not result in a formation of DNA fragments (evaluated by the TUNEL assay) or chromatin condensation (assessed by Hoechst staining). Flow cytometry analysis indicated that Epilobium extracts inhibit the progression of the cell cycle from the G(0)/G(1) phase. These results suggest that extracts of Epilobium inhibit proliferation of human PZ-HPV-7 cells in-vitro by affecting progression of the cell cycle. This study provides some initial biological plausibility for the use of Epilobium extracts in benign prostatic hyperplasia. PMID:12831512

  10. Decreased sensitivity to aspirin is associated with altered polyamine metabolism in human prostate cancer cells.

    PubMed

    Li, Jun; Cameron, Gary A; Wallace, Heather M

    2016-04-01

    Aspirin is a well-known analgesic, anti-inflammatory and antipyretic drug and is recognised as a chemopreventative agent in cardiovascular disease and, more recently, in colorectal cancer. Although several studies indicate that aspirin is capable of reducing the risk of developing cancers, there is a lack of convincing evidence that aspirin can prevent prostate cancer in man. In this study, aspirin was shown to be an effective inhibitor of the growth of human prostate cancer cells. In order to investigate the link between polyamine catabolism and the effects of aspirin we used a "Tet off" system that induced the activity of spermidine/spermine N (1)-acetyltransferase (SSAT) in human prostate cancer cells (LNCap). Treatment with aspirin was found to decrease induced SSAT activity in these cells. A negative correlation was observed between increased polyamine catabolism via increased SSAT activity and the sensitivity to aspirin. In the presence of increased SSAT activity high amounts of N (1)-acetylspermidine and putrescine were observed. These cells were also found to grow more slowly than the non-induced cells. The results indicate that SSAT and its related polyamine metabolism may play a key role in sensitivity of cancer cells to aspirin and possibly other NSAIDs and this may have implications for the development of novel chemopreventative agents. PMID:26704566

  11. Fatty acid regulates gene expression and growth of human prostate cancer PC-3 cells

    NASA Technical Reports Server (NTRS)

    Hughes-Fulford, M.; Chen, Y.; Tjandrawinata, R. R.

    2001-01-01

    It has been proposed that the omega-6 fatty acids increase the rate of tumor growth. Here we test that hypothesis in the PC-3 human prostate tumor. We found that the essential fatty acids, linoleic acid (LA) and arachidonic acid (AA), and the AA metabolite PGE(2) stimulate tumor growth while oleic acid (OA) and the omega-3 fatty acid, eicosapentaenoic acid (EPA) inhibited growth. In examining the role of AA in growth response, we extended our studies to analyze changes in early gene expression induced by AA. We demonstrate that c-fos expression is increased within minutes of addition in a dose-dependent manner. Moreover, the immediate early gene cox-2 is also increased in the presence of AA in a dose-dependent manner, while the constitutive cox-1 message was not increased. Three hours after exposure to AA, the synthesis of PGE(2) via COX-2 was also increased. Previous studies have demonstrated that AA was primarily delivered by low density lipoprotein (LDL) via its receptor (LDLr). Since it is known that hepatomas, acute myelogenous leukemia and colorectal tumors lack normal cholesterol feedback, we examined the role of the LDLr in growth regulation of the PC-3 prostate cancer cells. Analysis of ldlr mRNA expression and LDLr function demonstrated that human PC-3 prostate cancer cells lack normal feedback regulation. While exogenous LDL caused a significant stimulation of cell growth and PGE(2) synthesis, no change was seen in regulation of the LDLr by LDL. Taken together, these data show that normal cholesterol feedback of ldlr message and protein is lost in prostate cancer. These data suggest that unregulated over-expression of LDLr in tumor cells would permit increased availability of AA, which induces immediate early genes c-fos and cox-2 within minutes of uptake.

  12. Intraprostatic injection of botulinum toxin type- A relieves bladder outlet obstruction in human and induces prostate apoptosis in dogs

    PubMed Central

    Chuang, Yao-Chi; Tu, Chieh-Hsien; Huang, Chao-Cheng; Lin, Hsin-Ju; Chiang, Po-Hui; Yoshimura, Naoki; Chancellor, Michael B

    2006-01-01

    Background With the increasing interest with botulinum toxin – A (BTX-A) application in the lower urinary tract, we investigated the BTX-A effects on the canine prostate and also in men with bladder outlet obstruction (BOO) due to benign prostatic hyperplasia (BPH). Methods Transperineal injection into the prostate using transrectal ultrasound (TRUS) was performed throughout the study. Saline with or without 100 U of BTX-A was injected into mongrel dogs prostate. One or 3 months later, the prostate was harvested for morphologic and apoptotic study. In addition, eight BPH patients refractory to α-blockers were treated with ultrasound guided intraprostatic injection of 200 U of BTX-A. Results In the BTX-A treated dogs, atrophy and diffuse apoptosis was observed with H&E stain and TUNEL stain at 1 and 3 months. Clinically, the mean prostate volume, symptom score, and quality of life index were significantly reduced by 18.8%, 73.1%, and 61.5% respectively. Maximal flow rate significantly increased by 72.0%. Conclusion Intraprostatic BTX-A injection induces prostate apotosis in dogs and relieves BOO in humans. It is therefore a promising alternative treatment for refractory BOO due to BPH. PMID:16620393

  13. Defined conditions for the isolation and expansion of basal prostate progenitor cells of mouse and human origin.

    PubMed

    Höfner, Thomas; Eisen, Christian; Klein, Corinna; Rigo-Watermeier, Teresa; Goeppinger, Stephan M; Jauch, Anna; Schoell, Brigitte; Vogel, Vanessa; Noll, Elisa; Weichert, Wilko; Baccelli, Irène; Schillert, Anja; Wagner, Steve; Pahernik, Sascha; Sprick, Martin R; Trumpp, Andreas

    2015-03-10

    Methods to isolate and culture primary prostate epithelial stem/progenitor cells (PESCs) have proven difficult and ineffective. Here, we present a method to grow and expand both murine and human basal PESCs long term in serum- and feeder-free conditions. The method enriches for adherent mouse basal PESCs with a Lin(-)SCA-1(+)CD49f(+)TROP2(high) phenotype. Progesterone and sodium selenite are additionally required for the growth of human Lin(-)CD49f(+)TROP2(high) PESCs. The gene-expression profiles of expanded basal PESCs show similarities to ESCs, and NF-kB function is critical for epithelial differentiation of sphere-cultured PESCs. When transplanted in combination with urogenital sinus mesenchyme, expanded mouse and human PESCs generate ectopic prostatic tubules, demonstrating their stem cell activity in vivo. This novel method will facilitate the molecular, genomic, and functional characterization of normal and pathologic prostate glands of mouse and human origin. PMID:25702639

  14. Proapoptotic effects of new pentabromobenzylisothiouronium salts in a human prostate adenocarcinoma cell line.

    PubMed

    Koronkiewicz, Mirosława; Kazimierczuk, Zygmunt; Szarpak, Kinga; Chilmonczyk, Zdzisław

    2012-01-01

    Prostate cancer is the second most common cancer in elderly men worldwide and its incidence rate is rising continuously. Agents capable of inducing apoptosis in prostate cancer cells seem a promising approach to treat this malignancy. In this study we describe the synthesis of a number of novel N- and N,N'-substituted S-2,3,4,5,6-pentabromobenzylisothiouronium bromides and their activity against the human prostate adenocarcinoma PC3 cell line. All the compounds produced changes in mitochondrial transmembrane potential and cell cycle progression, showed a cytostatic effect and induced apoptosis in the tested cancer line in a concentration- and time-dependent manner. The most effective compounds ZKK-3, ZKK-9 and ZKK-13 produced, at 20 microM concentration, apoptosis in 42, 46, and 66% of the cells, respectively, after 48 h incubation. Two selected S-2,3,4,5,6-pentabromobenzylisothiouronium bromides (ZKK-3, ZKK-9) showed also a synergic proapoptotic effect with the new casein kinase II inhibitor 2-(4-methylpiperazin-1-yl)-4,5,6,7-tetrabromo-1H-benzimidazole (TBIPIP) in the PC3 cell line. PMID:23285698

  15. Frequent somatic mutations of the transcription factor ATBF1 in human prostate cancer.

    PubMed

    Sun, Xiaodong; Frierson, Henry F; Chen, Ceshi; Li, Changling; Ran, Qimei; Otto, Kristen B; Cantarel, Brandi L; Cantarel, Brandi M; Vessella, Robert L; Gao, Allen C; Petros, John; Miura, Yutaka; Simons, Jonathan W; Dong, Jin-Tang

    2005-04-01

    Cancer often results from the accumulation of multiple genetic alterations. Although most malignancies are sporadic, only a small number of genes have been shown to undergo frequent mutations in sporadic cancers. The long arm of chromosome 16 is frequently deleted in human cancers, but the target gene for this deletion has not been identified. Here we report that ATBF1, which encodes a transcription factor that negatively regulates AFP and MYB but transactivates CDKN1A, is a good candidate for the 16q22 tumor-suppressor gene. We narrowed the region of deletion at 16q22 to 861 kb containing ATBF1. ATBF1 mRNA was abundant in normal prostates but more scarce in approximately half of prostate cancers tested. In 24 of 66 (36%) cancers examined, we identified 22 unique somatic mutations, many of which impair ATBF1 function. Furthermore, ATBF1 inhibited cell proliferation. Hence, loss of ATBF1 is one mechanism that defines the absence of growth control in prostate cancer. PMID:15750593

  16. Suppression of β-catenin Signaling Pathway in Human Prostate Cancer PC3 Cells by Delphinidin

    PubMed Central

    Lee, Wooje; Yun, Jung-Mi

    2016-01-01

    Delphinidin possesses strong anti-oxidant, anti-inflammatory, and anti-cancer properties. Suppression of the Wnt/β-catenin signaling pathway is a potential strategy for chemoprevention and therapy. As aberrant activation of the β-catenin signaling pathway contributes to prostate cancer progression, we evaluated the effect of delphinidin on this pathway in human PC3 prostate cancer cells. An MTT assay showed that treatment with delphinidin (15–180 μM, 72 hours) resulted in a dose-dependent growth inhibition of cells. Treatment with delphinidin increased the phosphorylation of serine or threonine residues on β-catenin and decreased the levels of cytoplasmic β-catenin. Moreover, treatment with delphinidin inhibited the nuclear translocation of β-catenin and the expression of β-catenin target genes such as cyclin D1, c-myc, Axin-2, and T cell factor-1. Delphinidin also induced the phosphorylation of glycogen synthase kinase 3β and the expression of adenomatous polyposis coli and Axin proteins. Our results indicate that inhibition of cell growth by delphinidin is mediated, at least in part, through modulation of the β-catenin signaling pathway. We suggest that delphinidin is a potent inhibitor of Wnt/β-catenin signaling in prostate cancer cells. PMID:27390740

  17. Transceive surface coil array for MRI of the human prostate at 4T.

    PubMed

    Pinkerton, Robert G; Near, James P; Barberi, Enzo A; Menon, Ravi S; Bartha, Robert

    2007-02-01

    A novel torso transceive surface coil array for prostate magnetic resonance imaging (MRI) and spectroscopy (MRS) at 4T is presented. It is shown that with the use of a conformal transceive surface coil array with 50 Omega transmitter amplifiers and receiver preamplifiers, one can perform whole-volume torso imaging while maintaining the high signal-to-noise ratio (SNR) inherent to surface coil designs. Recent theoretical considerations have shown that by focusing the infringing radiofrequency (RF) electromagnetic field, one can achieve increased penetration and signal homogeneity compared to a conventional circularly polarized driving scheme. A variation of this driving scheme particular to the proposed coil design resulted in a twofold increase in SNR in the prostate compared to that achieved with a conventional circularly polarized driving scheme. The novel transceive surface coil array presented is capable of full-volume imaging of the human torso at 4T while maintaining signal penetration in the deep region of the prostate gland. PMID:17260367

  18. Tocopherols and saponins derived from Argania spinosa exert, an antiproliferative effect on human prostate cancer.

    PubMed

    Drissi, A; Bennani, H; Giton, F; Charrouf, Z; Fiet, J; Adlouni, A

    2006-10-01

    The aim of our study is to evaluate the antiproliferative effect of tocopherols obtained from alimentary virgin argan oil extracted from the endemic argan tree of Morocco and of saponins extracted from argan press cake on three human prostatic cell lines (DU145, LNCaP, and PC3). The results were compared to 2-methoxyestradiol as antiproliferative drug candidates. Cytotoxicity and antiproliferative effects were investigated after cells' treatment with tocopherols and saponins compared to 2-Methoxyoestradiol as the positive control. Tocopherols and saponins extracted from argan tree and 2-methoxyestradiol exhibit a dose-response cytotoxic effect and an antiproliferative action on the tested cell lines. The best antiproliferative effect of tocopherols is obtained with DU145 and LNCaP cell lines (28 microg/ml and 32 microg/ml, respectively, as GI50). The saponins fraction displayed the best antiproliferative effect on the PC3 cell line with 18 microg/ml as GI50. Our results confirm the antiproliferative effect of 2-methoxyestradiol and show for the first time the antiproliferative effect of tocopherols and saponins extracted from the argan tree on hormone-dependent and hormone-independent prostate cancer cell lines. These data suggest that argan oil is of potential interest in developing new strategies for prostate cancer prevention. PMID:16982463

  19. Genetic deletion of osteopontin in TRAMP mice skews prostate carcinogenesis from adenocarcinoma to aggressive human-like neuroendocrine cancers

    PubMed Central

    Mauri, Giorgio; Jachetti, Elena; Comuzzi, Barbara; Dugo, Matteo; Arioli, Ivano; Miotti, Silvia; Sangaletti, Sabina; Di Carlo, Emma; Tripodo, Claudio; Colombo, Mario P.

    2016-01-01

    Osteopontin (OPN) is a secreted glycoprotein, that belongs to the non-structural extracellular matrix (ECM), and its over expression in human prostate cancer has been associated with disease progression, androgen independence and metastatic ability. Nevertheless, the pathophysiology of OPN in prostate tumorigenesis has never been studied. We crossed TRansgenic Adenocarcinoma of the Mouse Prostate (TRAMP) mice with OPN deficient (OPN−/−) mice and followed tumor onset and progression in these double mutants. Ultrasound examination detected the early onset of a rapidly growing, homogeneous and spherical tumor in about 60% of OPN−/− TRAMP mice. Such neoplasms seldom occurred in parental TRAMP mice otherwise prone to adenocarcinomas and were characterized for being androgen receptor negative, highly proliferative and endowed with neuroendocrine (NE) features. Gene expression profiling showed up-regulation of genes involved in tumor progression, cell cycle and neuronal differentiation in OPN-deficient versus wild type TRAMP tumors. Down-regulated genes included key genes of TGFa pathway, including SMAD3 and Filamin, which were confirmed at the protein level. Furthermore, NE genes and particularly those characterizing early prostatic lesions of OPN-deficient mice were found to correlate with those of human prostate NE tumours. These data underscore a novel role of OPN in the early stages of prostate cancer growth, protecting against the development of aggressive NE tumors. PMID:26700622

  20. Genetic deletion of osteopontin in TRAMP mice skews prostate carcinogenesis from adenocarcinoma to aggressive human-like neuroendocrine cancers.

    PubMed

    Mauri, Giorgio; Jachetti, Elena; Comuzzi, Barbara; Dugo, Matteo; Arioli, Ivano; Miotti, Silvia; Sangaletti, Sabina; Di Carlo, Emma; Tripodo, Claudio; Colombo, Mario P

    2016-01-26

    Osteopontin (OPN) is a secreted glycoprotein, that belongs to the non-structural extracellular matrix (ECM), and its over expression in human prostate cancer has been associated with disease progression, androgen independence and metastatic ability. Nevertheless, the pathophysiology of OPN in prostate tumorigenesis has never been studied. We crossed TRansgenic Adenocarcinoma of the Mouse Prostate (TRAMP) mice with OPN deficient (OPN-/-) mice and followed tumor onset and progression in these double mutants. Ultrasound examination detected the early onset of a rapidly growing, homogeneous and spherical tumor in about 60% of OPN-/- TRAMP mice. Such neoplasms seldom occurred in parental TRAMP mice otherwise prone to adenocarcinomas and were characterized for being androgen receptor negative, highly proliferative and endowed with neuroendocrine (NE) features. Gene expression profiling showed up-regulation of genes involved in tumor progression, cell cycle and neuronal differentiation in OPN-deficient versus wild type TRAMP tumors. Down-regulated genes included key genes of TGFa pathway, including SMAD3 and Filamin, which were confirmed at the protein level. Furthermore, NE genes and particularly those characterizing early prostatic lesions of OPN-deficient mice were found to correlate with those of human prostate NE tumours. These data underscore a novel role of OPN in the early stages of prostate cancer growth, protecting against the development of aggressive NE tumors. PMID:26700622

  1. Activated α2-Macroglobulin Binding to Human Prostate Cancer Cells Triggers Insulin-like Responses

    PubMed Central

    Misra, Uma Kant; Pizzo, Salvatore Vincent

    2015-01-01

    Ligation of cell surface GRP78 by activated α2-macroglobulin (α2M*) promotes cell proliferation and suppresses apoptosis. α2M*-treated human prostate cancer cells exhibit a 2–3-fold increase in glucose uptake and lactate secretion, an effect similar to insulin treatment. In both α2M* and insulin-treated cells, the mRNA levels of SREBP1-c, SREBP2, fatty-acid synthase, acetyl-CoA carboxylase, ATP citrate lyase, and Glut-1 were significantly increased together with their protein levels, except for SREBP2. Pretreatment of cells with α2M* antagonist antibody directed against the carboxyl-terminal domain of GRP78 blocks these α2M*-mediated effects, and silencing GRP78 expression by RNAi inhibits up-regulation of ATP citrate lyase and fatty-acid synthase. α2M* induces a 2–3-fold increase in lipogenesis as determined by 6-[14C]glucose or 1-[14C]acetate incorporation into free cholesterol, cholesterol esters, triglycerides, free fatty acids, and phosphatidylcholine, which is blocked by inhibitors of fatty-acid synthase, PI 3-kinase, mTORC, or an antibody against the carboxyl-terminal domain of GRP78. We also assessed the incorporation of [14CH3]choline into phosphatidylcholine and observed similar effects. Lipogenesis is significantly affected by pretreatment of prostate cancer cells with fatostatin A, which blocks sterol regulatory element-binding protein proteolytic cleavage and activation. This study demonstrates that α2M* functions as a growth factor, leading to proliferation of prostate cancer cells by promoting insulin-like responses. An antibody against the carboxyl-terminal domain of GRP78 may have important applications in prostate cancer therapy. PMID:25720493

  2. Activated α2-macroglobulin binding to human prostate cancer cells triggers insulin-like responses.

    PubMed

    Misra, Uma Kant; Pizzo, Salvatore Vincent

    2015-04-10

    Ligation of cell surface GRP78 by activated α2-macroglobulin (α2M*) promotes cell proliferation and suppresses apoptosis. α2M*-treated human prostate cancer cells exhibit a 2-3-fold increase in glucose uptake and lactate secretion, an effect similar to insulin treatment. In both α2M* and insulin-treated cells, the mRNA levels of SREBP1-c, SREBP2, fatty-acid synthase, acetyl-CoA carboxylase, ATP citrate lyase, and Glut-1 were significantly increased together with their protein levels, except for SREBP2. Pretreatment of cells with α2M* antagonist antibody directed against the carboxyl-terminal domain of GRP78 blocks these α2M*-mediated effects, and silencing GRP78 expression by RNAi inhibits up-regulation of ATP citrate lyase and fatty-acid synthase. α2M* induces a 2-3-fold increase in lipogenesis as determined by 6-[(14)C]glucose or 1-[(14)C]acetate incorporation into free cholesterol, cholesterol esters, triglycerides, free fatty acids, and phosphatidylcholine, which is blocked by inhibitors of fatty-acid synthase, PI 3-kinase, mTORC, or an antibody against the carboxyl-terminal domain of GRP78. We also assessed the incorporation of [(14)CH3]choline into phosphatidylcholine and observed similar effects. Lipogenesis is significantly affected by pretreatment of prostate cancer cells with fatostatin A, which blocks sterol regulatory element-binding protein proteolytic cleavage and activation. This study demonstrates that α2M* functions as a growth factor, leading to proliferation of prostate cancer cells by promoting insulin-like responses. An antibody against the carboxyl-terminal domain of GRP78 may have important applications in prostate cancer therapy. PMID:25720493

  3. Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle

    PubMed Central

    Hennenberg, Martin; Strittmatter, Frank; Beckmann, Christer; Rutz, Beata; Füllhase, Claudius; Waidelich, Raphaela; Montorsi, Francesco; Hedlund, Petter; Andersson, Karl-Erik; Stief, Christian G.; Gratzke, Christian

    2012-01-01

    Background The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. Objective To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Methods Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Results Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Conclusions Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors

  4. Argyrophil cells in normal, hyperplastic, and neoplastic endometrium.

    PubMed Central

    Sivridis, E; Buckley, C H; Fox, H

    1984-01-01

    Scanty argyrophil cells are present in a substantial proportion of normal endometria, particularly during the secretory stage of the cycle. Argyrophil cells are also present in the various types of hyperplastic endometria and are found in more than half of endometrial adenocarcinomas. In some endometrial neoplasms they are present in abundance, but tumours rich in such cells do not have any features suggestive of a carcinoid tumour and are morphologically identical to adenocarcinomas of similar grade which are devoid of argyrophil cells. Endometrial adenocarcinomas containing argyrophil cells tend to be well differentiated and tend not to invade deeply into the myometrium. It is suggested that Müllerian epithelial stem cells possess a potentiality for differentiation into APUD cells. Images PMID:6200507

  5. Multiplexed quantum dot labeling of activated c-Met signaling in castration-resistant human prostate cancer.

    PubMed

    Hu, Peizhen; Chu, Gina C-Y; Zhu, Guodong; Yang, Hua; Luthringer, Daniel; Prins, Gail; Habib, Fouad; Wang, Yuzhuo; Wang, Ruoxiang; Chung, Leland W K; Zhau, Haiyen E

    2011-01-01

    The potential application of multiplexed quantum dot labeling (MQDL) for cancer detection and prognosis and monitoring therapeutic responses has attracted the interests of bioengineers, pathologists and cancer biologists. Many published studies claim that MQDL is effective for cancer biomarker detection and useful in cancer diagnosis and prognosis, these studies have not been standardized against quantitative biochemical and molecular determinations. In the present study, we used a molecularly characterized human prostate cancer cell model exhibiting activated c-Met signaling with epithelial to mesenchymal transition (EMT) and lethal metastatic progression to bone and soft tissues as the gold standard, and compared the c-Met cell signaling network in this model, in clinical human prostate cancer tissue specimens and in a castration-resistant human prostate cancer xenograft model. We observed c-Met signaling network activation, manifested by increased phosphorylated c-Met in all three. The downstream survival signaling network was mediated by NF-κB and Mcl-1 and EMT was driven by receptor activator of NF-κB ligand (RANKL), at the single cell level in clinical prostate cancer specimens and the xenograft model. Results were confirmed by real-time RT-PCR and western blots in a human prostate cancer cell model. MQDL is a powerful tool for assessing biomarker expression and it offers molecular insights into cancer progression at both the cell and tissue level with high degree of sensitivity. PMID:22205960

  6. Selenite Treatment Inhibits LAPC-4 Tumor Growth and Prostate-Specific Antigen Secretion in a Xenograft Model of Human Prostate Cancer

    SciTech Connect

    Bhattacharyya, Rumi S.; Husbeck, Bryan; Feldman, David; Knox, Susan J.

    2008-11-01

    Purpose: Selenium compounds have known chemopreventive effects on prostate cancer. However selenite, an inorganic form of selenium, has not been extensively studied as a treatment option for prostate cancer. Our previous studies have demonstrated the inhibition of androgen receptor expression and androgen stimulated prostate-specific antigen (PSA) expression by selenite in human prostate cancer cell lines. In this study, we investigated the in vivo effects of selenite as a therapy to treat mice with established LAPC-4 tumors. Methods and Materials: Male mice harboring androgen-dependent LAPC-4 xenograft tumors were treated with selenite (2 mg/kg intraperitoneally three times per week) or vehicle for 42 days. In addition, androgen-independent LAPC-4 xenograft tumors were generated in female mice over 4 to 6 months. Once established, androgen-independent LAPC-4 tumor fragments were passaged into female mice and were treated with selenite or vehicle for 42 days. Changes in tumor volume and serum PSA levels were assessed. Results: Selenite significantly decreased androgen-dependent LAPC-4 tumor growth in male mice over 42 days (p < 0.001). Relative tumor volume was decreased by 41% in selenite-treated animals compared with vehicle-treated animals. The inhibition of LAPC-4 tumor growth corresponded to a marked decrease in serum PSA levels (p < 0.01). In the androgen-independent LAPC-4 tumors in female mice, selenite treatment decreased tumor volume by 58% after 42 days of treatment (p < 0.001). Conclusions: These results suggest that selenite may have potential as a novel therapeutic agent to treat both androgen-dependent and androgen-independent prostate cancer.

  7. MOLECULAR EVENTS ASSOCIATED WITH ARSENIC-INDUCED MALIGNANT TRANSFORMATION OF HUMAN PROSTATIC EPITHELIAL CELLS: ABERRANT GENOMIC DNA METHYLATION AND K-RAS ONCOGENE ACTIVATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Numerous studies link arsenic exposure to human cancers in a variety of tissues, including the prostate. Our prior work showed that chronic arsenic exposure of the non-tumorigenic, human prostate epithelial cell line, RWPE-1, to low levels of (5 microM) sodium arsenite for 29 weeks resulted in malig...

  8. Contouring variability of human- and deformable-generated contours in radiotherapy for prostate cancer

    NASA Astrophysics Data System (ADS)

    Gardner, Stephen J.; Wen, Ning; Kim, Jinkoo; Liu, Chang; Pradhan, Deepak; Aref, Ibrahim; Cattaneo, Richard, II; Vance, Sean; Movsas, Benjamin; Chetty, Indrin J.; Elshaikh, Mohamed A.

    2015-06-01

    This study was designed to evaluate contouring variability of human-and deformable-generated contours on planning CT (PCT) and CBCT for ten patients with low-or intermediate-risk prostate cancer. For each patient in this study, five radiation oncologists contoured the prostate, bladder, and rectum, on one PCT dataset and five CBCT datasets. Consensus contours were generated using the STAPLE method in the CERR software package. Observer contours were compared to consensus contour, and contour metrics (Dice coefficient, Hausdorff distance, Contour Distance, Center-of-Mass [COM] Deviation) were calculated. In addition, the first day CBCT was registered to subsequent CBCT fractions (CBCTn: CBCT2-CBCT5) via B-spline Deformable Image Registration (DIR). Contours were transferred from CBCT1 to CBCTn via the deformation field, and contour metrics were calculated through comparison with consensus contours generated from human contour set. The average contour metrics for prostate contours on PCT and CBCT were as follows: Dice coefficient—0.892 (PCT), 0.872 (CBCT-Human), 0.824 (CBCT-Deformed); Hausdorff distance—4.75 mm (PCT), 5.22 mm (CBCT-Human), 5.94 mm (CBCT-Deformed); Contour Distance (overall contour)—1.41 mm (PCT), 1.66 mm (CBCT-Human), 2.30 mm (CBCT-Deformed); COM Deviation—2.01 mm (PCT), 2.78 mm (CBCT-Human), 3.45 mm (CBCT-Deformed). For human contours on PCT and CBCT, the difference in average Dice coefficient between PCT and CBCT (approx. 2%) and Hausdorff distance (approx. 0.5 mm) was small compared to the variation between observers for each patient (standard deviation in Dice coefficient of 5% and Hausdorff distance of 2.0 mm). However, additional contouring variation was found for the deformable-generated contours (approximately 5.0% decrease in Dice coefficient and 0.7 mm increase in Hausdorff distance relative to human-generated contours on CBCT). Though deformable contours provide a reasonable starting point for contouring on

  9. Transcription Factor Stat3 Stimulates Metastatic Behavior of Human Prostate Cancer Cells in Vivo, whereas Stat5b Has a Preferential Role in the Promotion of Prostate Cancer Cell Viability and Tumor Growth

    PubMed Central

    Gu, Lei; Dagvadorj, Ayush; Lutz, Jacqueline; Leiby, Benjamin; Bonuccelli, Gloria; Lisanti, Michael P.; Addya, Sankar; Fortina, Paolo; Dasgupta, Abhijit; Hyslop, Terry; Bubendorf, Lukas; Nevalainen, Marja T.

    2010-01-01

    Identification of the molecular changes that promote viability and metastatic behavior of prostate cancer is critical for the development of improved therapeutic interventions. Stat5a/b and Stat3 are both constitutively active in locally-confined and advanced prostate cancer, and both transcription factors have been reported to be critical for the viability of prostate cancer cells. We recently showed that Stat3 promotes metastatic behavior of human prostate cancer cells not only in vitro but also in an in vivo experimental metastases model. In this work, we compare side-by-side Stat5a/b versus Stat3 in the promotion of prostate cancer cell viability, tumor growth, and induction of metastatic colonization in vivo. Inhibition of Stat5a/b induced massive death of prostate cancer cells in culture and reduced both subcutaneous and orthotopic prostate tumor growth, whereas Stat3 had a predominant role over Stat5a/b in promoting metastases formation of prostate cancer cells in vivo in nude mice. The molecular mechanisms underlying the differential biological effects induced by these two transcription factors involve largely different sets of genes regulated by Stat5a/b versus Stat3 in human prostate cancer model systems. Of the two Stat5 homologs, Stat5b was more important for supporting growth of prostate cancer cells than Stat5a. This work provides the first mechanistic comparison of the biological effects induced by transcription factors Stat5a/b versus Stat3 in prostate cancer. PMID:20167868

  10. Optimization and comprehensive characterization of a faithful tissue culture model of the benign and malignant human prostate.

    PubMed

    Maund, Sophia Lisette; Nolley, Rosalie; Peehl, Donna Mae

    2014-02-01

    Few preclinical models accurately depict normal human prostate tissue or primary prostate cancer (PCa). In vitro systems typically lack complex cellular interactions among structured prostatic epithelia and a stromal microenvironment, and genetic and molecular fidelity are concerns in both in vitro and in vivo models. 'Tissue slice cultures' (TSCs) provide realistic preclinical models of diverse tissues and organs, but have not been fully developed or widely utilized for prostate studies. Problems encountered include degeneration of differentiated secretory cells, basal cell hyperplasia, and poor survival of PCa. Here, we optimized, characterized, and applied a TSC model of primary human PCa and benign prostate tissue that overcomes many deficiencies of current in vitro models. Tissue cores from fresh prostatectomy specimens were precision-cut at 300 μm and incubated in a rotary culture apparatus. The ability of varied culture conditions to faithfully maintain benign and cancer cell and tissue structure and function over time was evaluated by immunohistological and biochemical assays. After optimization of the culture system, molecular and cellular responses to androgen ablation and to piperlongumine (PL), purported to specifically reduce androgen signaling in PCa, were investigated. Optimized culture conditions successfully maintained the structural and functional fidelity of both benign and PCa TSCs for 5 days. TSCs exhibited androgen dependence, appropriately undergoing ductal degeneration, reduced proliferation, and decreased prostate-specific antigen expression upon androgen ablation. Further, TSCs revealed cancer-specific reduction of androgen receptor and increased apoptosis upon treatment with PL, validating data from cell lines. We demonstrate a TSC model that authentically recapitulates the structural, cellular, and genetic characteristics of the benign and malignant human prostate, androgen dependence of the native tissue, and cancer-specific response

  11. First Evidence that Sika Deer (Cervus nippon) Velvet Antler Extract Suppresses Migration of Human Prostate Cancer Cells.

    PubMed

    Tang, YuJiao; Jeon, Byong-Tae; Wang, Yanmei; Choi, Eun-Ju; Kim, Yon-Suk; Hwang, Jin-Woo; Park, Pyo-Jam; Moon, Sang Ho; Kim, Eun-Kyung

    2015-01-01

    Deer velvet antler (DVA) is one of the most popular medicines in China. Numerous studies have demonstrated that velvet antler possess biological effects. However, data regarding its anti-migration activity on prostate cancer is scarce. In this study, we investigated the inhibitory effect of top DVA (T-DVA) on the expression of prostate-specific antigen (PSA) and migration-related genes in the human prostate cancer cell, LNCaP. The T-DVA down-regulated the expression of PSA. In addition, the Radius(TM) assay revealed that T-DVA inhibited the migration behavior of prostate cancer cells. Furthermore, the expression of matrix metalloproteinase (MMP)-9 and vascular endothelial growth factor (VEGF) was also decreased with T-DVA. On the contrary, T-DVA increased the tissue inhibition of metalloproteinase (TIMP)-1 and (TIMP)-2. Taken together, our findings indicate that the T-DVA possesses anti-migration activity on prostate cancer cells. This is the first study of DVA to report the anti-migration activity on prostate cancer. PMID:26761873

  12. First Evidence that Sika Deer (Cervus nippon) Velvet Antler Extract Suppresses Migration of Human Prostate Cancer Cells

    PubMed Central

    Tang, YuJiao; Jeon, Byong-Tae; Wang, Yanmei; Choi, Eun-Ju; Kim, Yon-Suk; Hwang, Jin-Woo; Park, Pyo-Jam; Moon, Sang Ho; Kim, Eun-Kyung

    2015-01-01

    Deer velvet antler (DVA) is one of the most popular medicines in China. Numerous studies have demonstrated that velvet antler possess biological effects. However, data regarding its anti-migration activity on prostate cancer is scarce. In this study, we investigated the inhibitory effect of top DVA (T-DVA) on the expression of prostate-specific antigen (PSA) and migration-related genes in the human prostate cancer cell, LNCaP. The T-DVA down-regulated the expression of PSA. In addition, the RadiusTM assay revealed that T-DVA inhibited the migration behavior of prostate cancer cells. Furthermore, the expression of matrix metalloproteinase (MMP)-9 and vascular endothelial growth factor (VEGF) was also decreased with T-DVA. On the contrary, T-DVA increased the tissue inhibition of metalloproteinase (TIMP)-1 and (TIMP)-2. Taken together, our findings indicate that the T-DVA possesses anti-migration activity on prostate cancer cells. This is the first study of DVA to report the anti-migration activity on prostate cancer. PMID:26761873

  13. The bioavailability of different zinc compounds used as human dietary supplements in rat prostate: a comparative study.

    PubMed

    Sapota, Andrzej; Daragó, Adam; Skrzypińska-Gawrysiak, Małgorzata; Nasiadek, Marzenna; Klimczak, Michał; Kilanowicz, Anna

    2014-06-01

    The normal human prostate accumulates the highest levels of zinc (Zn) of any soft tissue in the body. The pool of zinc available to the body is known to significantly decrease with age. It is suggested that dietary Zn supplementation protects against oxidative damage and reduces the risk of cancer. Zinc sulfate and zinc gluconate were the most frequently mentioned in per os administration in studies on Zn supplementation. The major aim of the study was to compare the bioavailability of different Zn compounds (sulfate, gluconate and citrate) in the prostate after their daily administration to male rats at three different doses (3.0; 15.0; and 50.0 mg Zn/kg b.w.) for 30 days. The results show that bioavailability in the prostate differs significantly between individual zinc preparations. A significantly elevated Zn concentration in the dorso-lateral lobe of the prostate, compared to controls, was found in the rats supplemented with two compounds only: zinc gluconate and zinc citrate. However, after administration of zinc gluconate, this effect occurred even at the lowest dose. The lowest zinc bioavailability in the prostate was found in the rats administered zinc sulfate: no significant Zn increase was seen in particular zones of the prostate. To sum up, the use of zinc gluconate is worth considering as a possible means of zinc supplementation in men. PMID:24619814

  14. Mineralized human primary osteoblast matrices as a model system to analyse interactions of prostate cancer cells with the bone microenvironment.

    PubMed

    Reichert, Johannes C; Quent, Verena M C; Burke, Leslie J; Stansfield, Scott H; Clements, Judith A; Hutmacher, Dietmar W

    2010-11-01

    Prostate cancer metastasis is reliant on the reciprocal interactions between cancer cells and the bone niche/micro-environment. The production of suitable matrices to study metastasis, carcinogenesis and in particular prostate cancer/bone micro-environment interaction has been limited to specific protein matrices or matrix secreted by immortalised cell lines that may have undergone transformation processes altering signaling pathways and modifying gene or receptor expression. We hypothesize that matrices produced by primary human osteoblasts are a suitable means to develop an in vitro model system for bone metastasis research mimicking in vivo conditions. We have used a decellularized matrix secreted from primary human osteoblasts as a model for prostate cancer function in the bone micro-environment. We show that this collagen I rich matrix is of fibrillar appearance, highly mineralized, and contains proteins, such as osteocalcin, osteonectin and osteopontin, and growth factors characteristic of bone extracellular matrix (ECM). LNCaP and PC3 cells grown on this matrix, adhere strongly, proliferate, and express markers consistent with a loss of epithelial phenotype. Moreover, growth of these cells on the matrix is accompanied by the induction of genes associated with attachment, migration, increased invasive potential, Ca(2+) signaling and osteolysis. In summary, we show that growth of prostate cancer cells on matrices produced by primary human osteoblasts mimics key features of prostate cancer bone metastases and thus is a suitable model system to study the tumor/bone micro-environment interaction in this disease. PMID:20688384

  15. Antiinflammatory effect of androgen receptor activation in human benign prostatic hyperplasia cells.

    PubMed

    Vignozzi, Linda; Cellai, Ilaria; Santi, Raffaella; Lombardelli, Letizia; Morelli, Annamaria; Comeglio, Paolo; Filippi, Sandra; Logiodice, Federica; Carini, Marco; Nesi, Gabriella; Gacci, Mauro; Piccinni, Marie-Pierre; Adorini, Luciano; Maggi, Mario

    2012-07-01

    Progression of benign prostatic hyperplasia (BPH) involves chronic inflammation and immune dysregulation. Preclinical studies have demonstrated that prostate inflammation and tissue remodeling are exacerbated by hypogonadism and prevented by testosterone supplementation. We now investigated whether, in humans, hypogonadism was associated with more severe BPH inflammation and the in vitro effect of the selective androgen receptor agonist dihydrotestosterone (DHT) on cultures of stromal cells derived from BPH patients (hBPH). Histological analysis of inflammatory infiltrates in prostatectomy specimens from a cohort of BPH patients and correlation with serum testosterone level was performed. Even after adjusting for confounding factors, hypogonadism was associated with a fivefold increased risk of intraprostatic inflammation, which was also more severe than that observed in eugonadal BPH patients. Triggering hBPH cells by inflammatory stimuli (tumor necrosis factor α, lipopolysaccharide, or CD4(+)T cells) induced abundant secretion of inflammatory/growth factors (interleukin 6 (IL6), IL8, and basic fibroblast growth factor (bFGF)). Co-culture of CD4(+)T cells with hBPH cells induced secretion of Th1 inducer (IL12), Th1-recruiting chemokine (interferon γ inducible protein 10, IP10), and Th2 (IL9)- and Th17 (IL17)-specific cytokines. Pretreatment with DHT inhibited NF-κB activation and suppressed secretion of several inflammatory/growth factors, with the most pronounced effects on IL8, IL6, and bFGF. Reduced inflammatory cytokine production by T-cells, an increase in IL10, and a significant reduction of T cells proliferation suggested that DHT exerted a broad anti inflammatory effect on testosterone cells [corrected]. In conclusion, our data demonstrate that DHT exerts an immune regulatory role on human prostatic stromal cells, inhibiting their potential to actively induce and/or sustain autoimmune and inflammatory responses. PMID:22562653

  16. Daytime Blue Light Enhances the Nighttime Circadian Melatonin Inhibition of Human Prostate Cancer Growth

    PubMed Central

    Dauchy, Robert T; Hoffman, Aaron E; Wren-Dail, Melissa A; Hanifin, John P; Warfield, Benjamin; Brainard, George C; Xiang, Shulin; Yuan, Lin; Hill, Steven M; Belancio, Victoria P; Dauchy, Erin M; Smith, Kara; Blask, David E

    2015-01-01

    Light controls pineal melatonin production and temporally coordinates circadian rhythms of metabolism and physiology in normal and neoplastic tissues. We previously showed that peak circulating nocturnal melatonin levels were 7-fold higher after daytime spectral transmittance of white light through blue-tinted (compared with clear) rodent cages. Here, we tested the hypothesis that daytime blue-light amplification of nocturnal melatonin enhances the inhibition of metabolism, signaling activity, and growth of prostate cancer xenografts. Compared with male nude rats housed in clear cages under a 12:12-h light:dark cycle, rats in blue-tinted cages (with increased transmittance of 462–484 nm and decreased red light greater than 640 nm) evinced over 6-fold higher peak plasma melatonin levels at middark phase (time, 2400), whereas midlight-phase levels (1200) were low (less than 3 pg/mL) in both groups. Circadian rhythms of arterial plasma levels of linoleic acid, glucose, lactic acid, pO2, pCO2, insulin, leptin, and corticosterone were disrupted in rats in blue cages as compared with the corresponding entrained rhythms in clear-caged rats. After implantation with tissue-isolated PC3 human prostate cancer xenografts, tumor latency-to-onset of growth and growth rates were markedly delayed, and tumor cAMP levels, uptake–metabolism of linoleic acid, aerobic glycolysis (Warburg effect), and growth signaling activities were reduced in rats in blue compared with clear cages. These data show that the amplification of nighttime melatonin levels by exposing nude rats to blue light during the daytime significantly reduces human prostate cancer metabolic, signaling, and proliferative activities. PMID:26678364

  17. Targeting Prostate Cancer Cells In Vivo Using a Rapidly Internalizing Novel Human Single-Chain Antibody Fragment

    PubMed Central

    He, Jiang; Wang, Yong; Feng, Jinjin; Zhu, Xiaodong; Lan, Xiaoli; Iyer, Arun K.; Zhang, Niu; Seo, Youngho; VanBrocklin, Henry F.; Liu, Bin

    2010-01-01

    Human antibodies targeting prostate cancer cell surface epitopes may be useful for imaging and therapy. The objective of this study was to evaluate the tumor targeting of an internalizing human antibody fragment, a small-size platform, to provide high contrast in a mouse model of human prostate carcinoma. Methods A prostate tumor-targeting single-chain antibody fragment (scFv), UA20, along with a nonbinding control scFv, N3M2, were labeled with 99mTc and evaluated for binding and rapid internalization into human prostate tumor cells in vitro and tumor homing in vivo using xenograft models. For the in vitro studies, the labeled UA20 scFv was incubated at 37°C for 1 h with metastatic prostate cancer cells (DU145) to assess the total cellular uptake versus intracellular uptake. For the animal studies, labeled UA20 and N3M2 scFvs were administered to athymic mice implanted subcutaneously with DU145 cells. Mice were imaged with small-animal SPECT/CT with concomitant biodistribution at 1 and 3 h after injection. Results The UA20 scFv was labeled in 55%–65% yield and remained stable in phosphate buffer within 24 h. The labeled UA20 scFv was taken up specifically by prostate tumor cells. Internalization was rapid, because incubation at 37°C for less than 1 h resulted in 93% internalization of total cell-associated scFvs. In animal studies, SPECT/CT showed significant tumor uptake as early as 1 h after injection. At 3 h after injection, tumor uptake was 4.4 percentage injected dose per gram (%ID/g), significantly greater than all organs or tissues studied (liver, 2.7 %ID/g; other organs or tissues, <1 %ID/g), except the kidneys (81.4 %ID/g), giving tumor-to-blood and tumor-to-muscle ratios of 12:1 and 70:1, respectively. In contrast, the control antibody exhibited a tumor uptake of only 0.26 %ID/g, similar to that of muscle and fat. Tumor-specific targeting was evidenced by reduced tumor uptake of nearly 70% on administration of a 10-fold excess of unlabeled UA20 sc

  18. Localization and physical mapping of the prostate-specific membrane antigen (PSM) gene to human chromosome 11

    SciTech Connect

    Rinker-Schaeffer, C.W.; Hawkins, A.L.; Griffin, C.A.; Isaacs, J.T.

    1995-11-01

    The prostate-specific membrane antigen (PSM) was identified by the monoclonal antibody 7E11-C5.3, which was raised against the human prostatic carcinoma cell line LNCaP. The PSM antigen is expressed by normal, neoplastic, and metastatic prostatic tissues. The 2.65-kb cDNA encoding the 100-kDa PSM glycoprotein was cloned from LNCaP cells. Studies have shown that the expression of PSM is tissue-specific. In the present study monochromosomal somatic cell hybrids were used to localize the PSM gene to human chromosome 11. Using this information, initial mapping studies identified two potential PSM gene loci at 11p11.1-p13 and 11q14. Further high-stringency analysis using cosmid probes identified the 11q14 region as the location of the PSM gene. 10 refs., 2 figs.

  19. The retinoblastoma tumor suppressor controls androgen signaling and human prostate cancer progression.

    PubMed

    Sharma, Ankur; Yeow, Wen-Shuz; Ertel, Adam; Coleman, Ilsa; Clegg, Nigel; Thangavel, Chellappagounder; Morrissey, Colm; Zhang, Xiaotun; Comstock, Clay E S; Witkiewicz, Agnieszka K; Gomella, Leonard; Knudsen, Erik S; Nelson, Peter S; Knudsen, Karen E

    2010-12-01

    Retinoblastoma (RB; encoded by RB1) is a tumor suppressor that is frequently disrupted in tumorigenesis and acts in multiple cell types to suppress cell cycle progression. The role of RB in tumor progression, however, is poorly defined. Here, we have identified a critical role for RB in protecting against tumor progression through regulation of targets distinct from cell cycle control. In analyses of human prostate cancer samples, RB loss was infrequently observed in primary disease and was predominantly associated with transition to the incurable, castration-resistant state. Further analyses revealed that loss of the RB1 locus may be a major mechanism of RB disruption and that loss of RB function was associated with poor clinical outcome. Modeling of RB dysfunction in vitro and in vivo revealed that RB controlled nuclear receptor networks critical for tumor progression and that it did so via E2F transcription factor 1-mediated regulation of androgen receptor (AR) expression and output. Through this pathway, RB depletion induced unchecked AR activity that underpinned therapeutic bypass and tumor progression. In agreement with these findings, disruption of the RB/E2F/nuclear receptor axis was frequently observed in the transition to therapy resistance in human disease. Together, these data reveal what we believe to be a new paradigm for RB function in controlling prostate tumor progression and lethal tumor phenotypes. PMID:21099110

  20. Personalized Medicine Approaches in Prostate Cancer Employing Patient Derived 3D Organoids and Humanized Mice

    PubMed Central

    Bartucci, Monica; Ferrari, Anna C.; Kim, Isaac Yi; Ploss, Alexander; Yarmush, Martin; Sabaawy, Hatem E.

    2016-01-01

    Prostate cancer (PCa) is the most common malignancy and the second most common cause of cancer death in Western men. Despite its prevalence, PCa has proven very difficult to propagate in vitro. PCa represents a complex organ-like multicellular structure maintained by the dynamic interaction of tumoral cells with parenchymal stroma, endothelial and immune cells, and components of the extracellular matrix (ECM). The lack of PCa models that recapitulate this intricate system has hampered progress toward understanding disease progression and lackluster therapeutic responses. Tissue slices, monolayer cultures and genetically engineered mouse models (GEMM) fail to mimic the complexities of the PCa microenvironment or reproduce the diverse mechanisms of therapy resistance. Moreover, patient derived xenografts (PDXs) are expensive, time consuming, difficult to establish for prostate cancer, lack immune cell-tumor regulation, and often tumors undergo selective engraftments. Here, we describe an interdisciplinary approach using primary PCa and tumor initiating cells (TICs), three-dimensional (3D) tissue engineering, genetic and morphometric profiling, and humanized mice to generate patient-derived organoids for examining personalized therapeutic responses in vitro and in mice co-engrafted with a human immune system (HIS), employing adaptive T-cell- and chimeric antigen receptor- (CAR) immunotherapy. The development of patient specific therapies targeting the vulnerabilities of cancer, when combined with antiproliferative and immunotherapy approaches could help to achieve the full transformative power of cancer precision medicine. PMID:27446916

  1. Personalized Medicine Approaches in Prostate Cancer Employing Patient Derived 3D Organoids and Humanized Mice.

    PubMed

    Bartucci, Monica; Ferrari, Anna C; Kim, Isaac Yi; Ploss, Alexander; Yarmush, Martin; Sabaawy, Hatem E

    2016-01-01

    Prostate cancer (PCa) is the most common malignancy and the second most common cause of cancer death in Western men. Despite its prevalence, PCa has proven very difficult to propagate in vitro. PCa represents a complex organ-like multicellular structure maintained by the dynamic interaction of tumoral cells with parenchymal stroma, endothelial and immune cells, and components of the extracellular matrix (ECM). The lack of PCa models that recapitulate this intricate system has hampered progress toward understanding disease progression and lackluster therapeutic responses. Tissue slices, monolayer cultures and genetically engineered mouse models (GEMM) fail to mimic the complexities of the PCa microenvironment or reproduce the diverse mechanisms of therapy resistance. Moreover, patient derived xenografts (PDXs) are expensive, time consuming, difficult to establish for prostate cancer, lack immune cell-tumor regulation, and often tumors undergo selective engraftments. Here, we describe an interdisciplinary approach using primary PCa and tumor initiating cells (TICs), three-dimensional (3D) tissue engineering, genetic and morphometric profiling, and humanized mice to generate patient-derived organoids for examining personalized therapeutic responses in vitro and in mice co-engrafted with a human immune system (HIS), employing adaptive T-cell- and chimeric antigen receptor- (CAR) immunotherapy. The development of patient specific therapies targeting the vulnerabilities of cancer, when combined with antiproliferative and immunotherapy approaches could help to achieve the full transformative power of cancer precision medicine. PMID:27446916

  2. A Prospective Randomized Trial of Two Different Prostate Biopsy Schemes

    ClinicalTrials.gov

    2016-07-03

    Prostate Cancer; Local Anesthesia; Prostate-Specific Antigen/Blood; Biopsy/Methods; Image-guided Biopsy/Methods; Prostatic Neoplasms/Diagnosis; Prostate/Pathology; Prospective Studies; Humans; Male; Ultrasonography, Interventional/Methods

  3. Effects of a human plasma membrane-associated sialidase siRNA on prostate cancer invasion

    SciTech Connect

    Li, Xiaojie; Zhang, Ling; Shao, Yueting; Liang, Zuowen; Shao, Chen; Wang, Bo; Guo, Baofeng; Li, Na; Zhao, Xuejian; Li, Yang; Xu, Deqi

    2011-12-16

    Highlights: Black-Right-Pointing-Pointer Neu3 is as one of the sialidases and regulates cell surface functions. Black-Right-Pointing-Pointer A Neu3-specific siRNA inhibited prostrate cancer cell invasion and migration. Black-Right-Pointing-Pointer The Neu3-specific siRNA inhibited prostate cancer metastasis in mice. Black-Right-Pointing-Pointer Targeting Neu3 may have utility for gene-based therapy of human cancer metastasis. -- Abstract: Human plasma membrane-associated sialidase (Neu3) is one of several sialidases that hydrolyze sialic acids in the terminal position of the carbohydrate groups of glycolipids and glycoproteins. Neu3 is mainly localized in plasma membranes and plays crucial roles in the regulation of cell surface functions. In this study, we investigated the effects and molecular mechanisms of Neu3 on cell invasion and migration in vivo and in vitro. Initially, we found that the levels of Neu3 expression were higher in prostate cancer tissues and cell lines than in normal prostate tissues based on RT-PCR and Western blotting analyses. We then applied a Neu3 siRNA approach to block Neu3 signaling using PC-3M cells as model cells. Transwell invasion assays and wound assays showed significantly decreased invasion and migration potential in the Neu3 siRNA-transfected cells. RT-PCR and Western blotting analyses revealed that Neu3 knockdown decreased the expressions of the matrix metalloproteinases MMP-2 and MMP-9. In vivo, mice injected with PC-3M cell tumors were evaluated by SPECT/CT to determine the presence of bone metastases. Mice treated with attenuated Salmonella carrying the Neu3 siRNA developed fewer bone metastases than mice treated with attenuated Salmonella carrying a control Scramble siRNA, attenuated Salmonella alone or PBS. The results for bone metastasis detection by pathology were consistent with the data obtained by SPECT/CT. Tumor blocks were evaluated by histochemical, RT-PCR and Western blotting analyses. The results revealed

  4. Telomerase-immortalized non-malignant human prostate epithelial cells retain the properties of multipotent stem cells

    SciTech Connect

    Li Hongzhen; Zhou Jianjun; Miki, Jun; Furusato, Bungo; Gu Yongpeng; Srivastava, Shiv; McLeod, David G.; Vogel, Jonathan C.; Rhim, Johng S.

    2008-01-01

    Understanding prostate stem cells may provide insight into the origin of prostate cancer. Primary cells have been cultured from human prostate tissue but they usually survive only 15-20 population doublings before undergoing senescence. We report here that RC-170N/h/clone 7 cells, a clonal cell line from hTERT-immortalized primary non-malignant tissue-derived human prostate epithelial cell line (RC170N/h), retain multipotent stem cell properties. The RC-170N/h/clone 7 cells expressed a human embryonic stem cell marker, Oct-4, and potential prostate epithelial stem cell markers, CD133, integrin {alpha}2{beta}1{sup hi} and CD44. The RC-170N/h/clone 7 cells proliferated in KGM and Dulbecco's Modified Eagle Medium with 10% fetal bovine serum and 5 {mu}g/ml insulin (DMEM + 10% FBS + Ins.) medium, and differentiated into epithelial stem cells that expressed epithelial cell markers, including CK5/14, CD44, p63 and cytokeratin 18 (CK18); as well as the mesenchymal cell markers, vimentin, desmin; the neuron and neuroendocrine cell marker, chromogranin A. Furthermore the RC170 N/h/clone 7 cells differentiated into multi tissues when transplanted into the sub-renal capsule and subcutaneously of NOD-SCID mice. The results indicate that RC170N/h/clone 7 cells retain the properties of multipotent stem cells and will be useful as a novel cell model for studying the mechanisms of human prostate stem cell differentiation and transformation.

  5. PRUNE2 is a human prostate cancer suppressor regulated by the intronic long noncoding RNA PCA3.

    PubMed

    Salameh, Ahmad; Lee, Alessandro K; Cardó-Vila, Marina; Nunes, Diana N; Efstathiou, Eleni; Staquicini, Fernanda I; Dobroff, Andrey S; Marchiò, Serena; Navone, Nora M; Hosoya, Hitomi; Lauer, Richard C; Wen, Sijin; Salmeron, Carolina C; Hoang, Anh; Newsham, Irene; Lima, Leandro A; Carraro, Dirce M; Oliviero, Salvatore; Kolonin, Mikhail G; Sidman, Richard L; Do, Kim-Anh; Troncoso, Patricia; Logothetis, Christopher J; Brentani, Ricardo R; Calin, George A; Cavenee, Webster K; Dias-Neto, Emmanuel; Pasqualini, Renata; Arap, Wadih

    2015-07-01

    Prostate cancer antigen 3 (PCA3) is the most specific prostate cancer biomarker but its function remains unknown. Here we identify PRUNE2, a target protein-coding gene variant, which harbors the PCA3 locus, thereby classifying PCA3 as an antisense intronic long noncoding (lnc)RNA. We show that PCA3 controls PRUNE2 levels via a unique regulatory mechanism involving formation of a PRUNE2/PCA3 double-stranded RNA that undergoes adenosine deaminase acting on RNA (ADAR)-dependent adenosine-to-inosine RNA editing. PRUNE2 expression or silencing in prostate cancer cells decreased and increased cell proliferation, respectively. Moreover, PRUNE2 and PCA3 elicited opposite effects on tumor growth in immunodeficient tumor-bearing mice. Coregulation and RNA editing of PRUNE2 and PCA3 were confirmed in human prostate cancer specimens, supporting the medical relevance of our findings. These results establish PCA3 as a dominant-negative oncogene and PRUNE2 as an unrecognized tumor suppressor gene in human prostate cancer, and their regulatory axis represents a unique molecular target for diagnostic and therapeutic intervention. PMID:26080435

  6. Effect of Small Molecules Modulating Androgen Receptor (SARMs) in Human Prostate Cancer Models

    PubMed Central

    Tesei, Anna; Leonetti, Carlo; Di Donato, Marzia; Gabucci, Elisa; Porru, Manuela; Varchi, Greta; Guerrini, Andrea; Amadori, Dino; Arienti, Chiara; Pignatta, Sara; Paganelli, Giulia; Caraglia, Michele; Castoria, Gabriella; Zoli, Wainer

    2013-01-01

    The management of hormone-refractory prostate cancer represents a major challenge in the therapy of this tumor, and identification of novel androgen receptor antagonists is needed to render treatment more effective. We analyzed the activity of two novel androgen receptor antagonists, (S)-11 and (R)-9, in in vitro and in vivo experimental models of hormone-sensitive or castration-resistant prostate cancer (CRPC). In vitro experiments were performed on LNCaP, LNCaP-AR, LNCaP-Rbic and VCaP human prostate cancer cells. Cytotoxic activity was assessed by SRB and BrdU uptake, AR transactivation by luciferase reporter assay and PSA levels by Real Time RT-PCR and ELISA assays. Cell cycle progression-related markers were evaluated by western blot. In vivo experiments were performed on SCID mice xenografted with cells with different sensitivity to hormonal treatment. In hormone-sensitive LNCaP and LNCaP-AR cells, the latter expressing high androgen receptor levels, (R)-9 and (S)-11 exhibited a higher cytotoxic effect compared to that of the reference compound ((R)-bicalutamide), also in the presence of the synthetic androgen R1881. Furthermore, the cytotoxic effect produced by (R)-9 was higher than that of (S)-11 in the two hormone-resistant LNCaP-AR and VCaP cells. A significant reduction in PSA levels was observed after exposure to both molecules. Moreover, (S)-11 and (R)-9 inhibited DNA synthesis by blocking the androgen-induced increase in cyclin D1 protein levels. In vivo studies on the toxicological profile of (R)-9 did not reveal the presence of adverse events. Furthermore, (R)-9 inhibited tumor growth in various in vivo models, especially LNCaP-Rbic xenografts, representative of recurrent disease. Our in vitro results highlight the antitumor activity of the two novel molecules (R)-9 and (S)-11, making them a potentially attractive option for the treatment of CRPC. PMID:23667504

  7. Dietary tocopherols inhibit PhIP-induced prostate carcinogenesis in CYP1A-humanized mice.

    PubMed

    Chen, Jayson X; Li, Guangxun; Wang, Hong; Liu, Anna; Lee, Mao-Jung; Reuhl, Kenneth; Suh, Nanjoo; Bosland, Maarten C; Yang, Chung S

    2016-02-01

    Tocopherols, the major forms of vitamin E, exist as alpha-tocopherol (α-T), β-T, γ-T and δ-T. The cancer preventive activity of vitamin E is suggested by epidemiological studies, but recent large-scale cancer prevention trials with high dose of α-T yielded disappointing results. Our hypothesis that other forms of tocopherols have higher cancer preventive activities than α-T was tested, herein, in a novel prostate carcinogenesis model induced by 2-amino-1-methyl-6-phenylimidazo [4,5-b] pyridine (PhIP), a dietary carcinogen, in the CYP1A-humanized (hCYP1A) mice. Treatment of hCYP1A mice with PhIP (200 mg/kg b.w., i.g.) induced high percentages of mouse prostatic intraepithelial neoplasia (mPIN), mainly in the dorsolateral glands. Supplementation with a γ-T-rich mixture of tocopherols (γ-TmT, 0.3% in diet) significantly inhibited the development of mPIN lesions and reduced PhIP-induced elevation of 8-oxo-deoxyguanosine, COX-2, nitrotyrosine, Ki-67 and p-AKT, and the loss of PTEN and Nrf2. Further studies with purified δ-T, γ-T or α-T (0.2% in diet) showed that δ-T was more effective than γ-T or α-T in preventing mPIN formations and p-AKT elevation. These results indicate that γ-TmT and δ-T could be effective preventive agents of prostate cancer. PMID:26582657

  8. Inhibition of prostaglandin synthesis and actions by genistein in human prostate cancer cells and by soy isoflavones in prostate cancer patients.

    PubMed

    Swami, Srilatha; Krishnan, Aruna V; Moreno, Jacqueline; Bhattacharyya, Rumi S; Gardner, Christopher; Brooks, James D; Peehl, Donna M; Feldman, David

    2009-05-01

    Soy and its constituent isoflavone genistein inhibit the development and progression of prostate cancer (PCa). Our study in both cultured cells and PCa patients reveals a novel pathway for the actions of genistein, namely the inhibition of the synthesis and biological actions of prostaglandins (PGs), known stimulators of PCa growth. In the cell culture experiments, genistein decreased cyclooxygenase-2 (COX-2) mRNA and protein expression in both human PCa cell lines (LNCaP and PC-3) and primary prostate epithelial cells and increased 15-hydroxyprostaglandin dehydrogenase (15-PGDH) mRNA levels in primary prostate cells. As a result genistein significantly reduced the secretion of PGE(2) by these cells. EP4 and FP PG receptor mRNA were also reduced by genistein, providing an additional mechanism for the suppression of PG biological effects. Further, the growth stimulatory effects of both exogenous PGs and endogenous PGs derived from precursor arachidonic acid were attenuated by genistein. We also performed a pilot randomised double blind clinical study in which placebo or soy isoflavone supplements were given to PCa patients in the neo-adjuvant setting for 2 weeks before prostatectomy. Gene expression changes were measured in the prostatectomy specimens. In PCa patients ingesting isoflavones, we observed significant decreases in prostate COX-2 mRNA and increases in p21 mRNA. There were significant correlations between COX-2 mRNA suppression, p21 mRNA stimulation and serum isoflavone levels. We propose that the inhibition of the PG pathway contributes to the beneficial effect of soy isoflavones in PCa chemoprevention and/or treatment. PMID:19127598

  9. Tocotrienol-rich fraction of palm oil induces cell cycle arrest and apoptosis selectively in human prostate cancer cells

    SciTech Connect

    Srivastava, Janmejai K.; Gupta, Sanjay . E-mail: sanjay.gupta@case.edu

    2006-07-28

    One of the requisite of cancer chemopreventive agent is elimination of damaged or malignant cells through cell cycle inhibition or induction of apoptosis without affecting normal cells. In this study, employing normal human prostate epithelial cells (PrEC), virally transformed normal human prostate epithelial cells (PZ-HPV-7), and human prostate cancer cells (LNCaP, DU145, and PC-3), we evaluated the growth-inhibitory and apoptotic effects of tocotrienol-rich fraction (TRF) extracted from palm oil. TRF treatment to PrEC and PZ-HPV-7 resulted in almost identical growth-inhibitory responses of low magnitude. In sharp contrast, TRF treatment resulted in significant decreases in cell viability and colony formation in all three prostate cancer cell lines. The IC{sub 5} values after 24 h TRF treatment in LNCaP, PC-3, and DU145 cells were in the order 16.5, 17.5, and 22.0 {mu}g/ml. TRF treatment resulted in significant apoptosis in all the cell lines as evident from (i) DNA fragmentation (ii) fluorescence microscopy, and (iii) cell death detection ELISA, whereas the PrEC and PZ-HPV-7 cells did not undergo apoptosis, but showed modestly decreased cell viability only at a high dose of 80 {mu}g/ml. In cell cycle analysis, TRF (10-40 {mu}g/ml) resulted in a dose-dependent G0/G1 phase arrest and sub G1 accumulation in all three cancer cell lines but not in PZ-HPV-7 cells. These results suggest that the palm oil derivative TRF is capable of selectively inhibiting cellular proliferation and accelerating apoptotic events in prostate cancer cells. TRF offers significant promise as a chemopreventive and/or therapeutic agent against prostate cancer.

  10. Bortezomib and etoposide combinations exert synergistic effects on the human prostate cancer cell line PC-3

    PubMed Central

    ARAS, BEKIR; YERLIKAYA, AZMI

    2016-01-01

    Novel treatment modalities are urgently required for androgen-independent prostate cancer. In order to develop an alternative treatment for prostate cancer, the cytotoxic effects of the 26S proteasome inhibitor bortezomib, either alone or in combination with the two commonly used chemotherapeutic agents irinotecan and etoposide, on the human prostate cancer cell line PC-3 were evaluated in the present study. The PC-3 cell line was maintained in Dulbecco's modified Eagle's medium with 10% fetal bovine serum and treated with various doses of bortezomib, irinotecan, etoposide or their combinations. The growth inhibitory and cytotoxic effects were determined by water-soluble tetrazolium (WST)-1 assay, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay or iCELLigence system. The combination index values were determined by the Chou-Talalay method. The half maximal inhibitory concentration (IC50) value of bortezomib on the PC-3 cell line was determined to be 53.4 nM by WST-1 assay, whereas the IC50 values of irinotecan and etoposide were determined to be 2.1 and 26.5 µM, respectively. These results suggest that the 26S proteasome inhibitor bortezomib is more potent, compared with irinotecan and etoposide, in the androgen-insensitive and tumor protein p53-null cell line PC-3. The combined effects of bortezomib+irinotecan and bortezomib+etoposide were also tested on PC-3 cells. The effect of bortezomib+irinotecan combination was not significantly different than that produced by either monotherapy, according to the results of iCELLigence system and MTT assay. However, 40 nM bortezomib+5 µM etoposide or 40 nM bortezomib+20 µM etoposide combinations were observed to be more effective than each drug tested alone. The results of the current study suggest that bortezomib and etoposide combination may be additionally evaluated in clinical trials for the treatment of hormone-refractory prostate cancer. PMID:27123085

  11. In vivo determination of the absorption and scattering spectra of the human prostate during photodynamic therapy

    PubMed Central

    Finlay, Jarod C.; Zhu, Timothy C; Dimofte, Andreea; Stripp, Diana; Malkowicz, S. Bruce; Whittington, Richard; Miles, Jeremy; Glatstein, Eli; Hahn, Stephen M.

    2015-01-01

    A continuing challenge in photodynamic therapy is the accurate in vivo determination of the optical properties of the tissue being treated. We have developed a method for characterizing the absorption and scattering spectra of prostate tissue undergoing PDT treatment. Our current prostate treatment protocol involves interstitial illumination of the organ via cylindrical diffusing optical fibers (CDFs) inserted into the prostate through clear catheters. We employ one of these catheters to insert an isotropic white light point source into the prostate. An isotropic detection fiber connected to a spectrograph is inserted into a second catheter a known distance away. The detector is moved along the catheter by a computer-controlled step motor, acquiring diffuse light spectra at 2 mm intervals along its path. We model the fluence rate as a function of wavelength and distance along the detector’s path using an infinite medium diffusion theory model whose free parameters are the absorption coefficient µa at each wavelength and two variables A and b which characterize the reduced scattering spectrum of the form µ’s = Aλ−b. We analyze our spectroscopic data using a nonlinear fitting algorithm to determine A, b, and µa at each wavelength independently; no prior knowledge of the absorption spectrum or of the sample’s constituent absorbers is required. We have tested this method in tissue simulating phantoms composed of intralipid and the photosensitizer motexafin lutetium (MLu). The MLu absorption spectrum recovered from the phantoms agrees with that measured in clear solution, and µa at the MLu absorption peak varies linearly with concentration. The µ’s spectrum reported by the fit is in agreement with the known scattering coefficient of intralipid. We have applied this algorithm to spectroscopic data from human patients sensitized with MLu (2 mg kg−1) acquired before and after PDT. Before PDT, the absorption spectra we measure include the characteristic

  12. Dietary Carcinogen 2-Amino-1-Methyl-6-Phenylimidazo[4,5-b]Pyridine Induced Prostate Carcinogenesis in CYP1A-humanized Mice

    PubMed Central

    Li, Guangxun; Wang, Hong; Liu, Anna B.; Cheung, Connie; Reuhl, Kenneth R.; Bosland, Maarten C.; Yang, Chung S.

    2014-01-01

    To develop a relevant mouse model for prostate cancer prevention research, we administered a dietary carcinogen, 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), to CYP1A-humanized mice. In comparison to mouse Cyp1a2, human CYP1A2 preferentially activates PhIP to a proximate carcinogen. Following a single oral dose of PhIP (200 mg/kg body weight), we observed inflammation, atrophy of acini, low-grade prostatic intraepithelial neoplasia (PIN) (after 20 weeks) and high-grade PIN (HgPIN) (after 30 to 50 weeks) in dorso-lateral, ventral and coagulating anterior prostate glands of these mice. These lesions were androgen receptor positive and featured the loss of expression of the basal cell marker p63 and the tumor suppressor PTEN. Similar to human prostate carcinogenesis, glutathione-S-transferase P1 (GSTP1) expression was lost or partially lost in HgPIN. E-Cadherin expression was also lost in HgPIN. The expression of DNA methyltransferase 1 was elevated, possibly to enhance promoter hypermethylation for the silencing of GSTP1 and E-cadherin. Prostate carcinogenesis was promoted by a high-fat stress diet, resulting in HgPIN that developed earlier and in advanced lesions displayed features consistent with carcinoma in situ. This dietary carcinogen-induced prostate cancer model, recapitulating important features of early human prostate carcinogenesis, constitutes a new experimental system for prostate cancer research. PMID:22581815

  13. Cabazitaxel-loaded human serum albumin nanoparticles as a therapeutic agent against prostate cancer

    PubMed Central

    Qu, Na; Lee, Robert J; Sun, Yating; Cai, Guangsheng; Wang, Junyang; Wang, Mengqiao; Lu, Jiahui; Meng, Qingfan; Teng, Lirong; Wang, Di; Teng, Lesheng

    2016-01-01

    Cabazitaxel-loaded human serum albumin nanoparticles (Cbz-NPs) were synthesized to overcome vehicle-related toxicity of current clinical formulation of the drug based on Tween-80 (Cbz-Tween). A salting-out method was used for NP synthesis that avoids the use of chlorinated organic solvent and is simpler compared to the methods based on emulsion-solvent evaporation. Cbz-NPs had a narrow particle size distribution, suitable drug loading content (4.9%), and superior blood biocompatibility based on in vitro hemolysis assay. Blood circulation, tumor uptake, and antitumor activity of Cbz-NPs were assessed in prostatic cancer xenograft-bearing nude mice. Cbz-NPs exhibited prolonged blood circulation and greater accumulation of Cbz in tumors along with reduced toxicity compared to Cbz-Tween. Moreover, hematoxylin and eosin histopathological staining of organs revealed consistent results. The levels of blood urea nitrogen and serum creatinine in drug-treated mice showed that Cbz-NPs were less toxic than Cbz-Tween to the kidneys. In conclusion, Cbz-NPs provide a promising therapeutic for prostate cancer. PMID:27555767

  14. Real Time Metastatic Route Tracking of Orthotopic PC-3-GFP Human Prostate Cancer Using Intravital Imaging.

    PubMed

    Zhang, Yong; Wang, Xiaoen; Hoffman, Robert M; Seki, Naohiko

    2016-04-01

    The cellular basis of metastasis is poorly understood. An important step to understanding this process is to be able to visualize the routes by which cancer cells migrate from the primary tumor to various distant sites to eventually form metastasis. Our laboratory previously developed single-cell in vivo imaging using fluorescent proteins to label cancer cells. In the present study, using PC-3 human prostate cancer cells labeled with green fluorescent protein (GFP) and orthotopic tumor transplantation, we have imaged in live mice various highly diverse routes by which PC-3 cells metastasize superiorly and inferiorly to distant sites, including in the portal area, stomach area, and urogenital system. Imaging began at day 9, at which time distant metastasis had already occurred, and increased at each imaging point at days 10, 13, 14, and 16. Metastatic cells were observed migrating superiorly and inferiorly from the primary tumor as well as in lymphatic channels and trafficking in various organ systems demonstrating that PC-3 has multiple metastatic routes similar to hormone-independent advanced-stage prostate cancer in the clinic. PMID:26515240

  15. Delivery of retinoic acid to LNCap human prostate cancer cells using solid lipid nanoparticles.

    PubMed

    Akanda, Mushfiq H; Rai, Rajeev; Slipper, Ian J; Chowdhry, Babur Z; Lamprou, Dimitrios; Getti, Giulia; Douroumis, Dennis

    2015-09-30

    In this study retinoic acid (RTA) loaded solid lipid nanoparticles (SLNs) were optimized by tuning the process parameters (pressure/temperature) and using different lipids to develop nanodispersions with enhanced anticancer activity. The RTA-SLN dispersions were produced by high-pressure homogenization and characterized in terms of particle size, zeta potential, drug entrapment efficiency, stability, transmission electron microscopy (TEM), atomic force microscopy (AFM), X-ray diffraction (XRD) and in vitro drug release. Thermal and X-ray analysis showed the RTA to be in the amorphous state, whilst microscopic images revealed a spherical shape and uniform particle size distribution of the nanoparticles. Anticancer efficiency was evaluated by incubating RTA-SLNs with human prostate cancer (LNCap) cells, which demonstrated reduced cell viability with increased drug concentrations (9.53% at 200 ug/ml) while blank SLNs displayed negligible cytotoxicity. The cellular uptake of SLN showed localization within the cytoplasm of cells and flow cytometry analysis indicated an increase in the fraction of cells expressing early apoptotic markers, suggesting that the RTA loaded SLNs are able to induce apoptosis in LNCap cells. The RTA-SLN dispersions have the potential to be used for prostate anticancer treatment. PMID:26200751

  16. Cabazitaxel-loaded human serum albumin nanoparticles as a therapeutic agent against prostate cancer.

    PubMed

    Qu, Na; Lee, Robert J; Sun, Yating; Cai, Guangsheng; Wang, Junyang; Wang, Mengqiao; Lu, Jiahui; Meng, Qingfan; Teng, Lirong; Wang, Di; Teng, Lesheng

    2016-01-01

    Cabazitaxel-loaded human serum albumin nanoparticles (Cbz-NPs) were synthesized to overcome vehicle-related toxicity of current clinical formulation of the drug based on Tween-80 (Cbz-Tween). A salting-out method was used for NP synthesis that avoids the use of chlorinated organic solvent and is simpler compared to the methods based on emulsion-solvent evaporation. Cbz-NPs had a narrow particle size distribution, suitable drug loading content (4.9%), and superior blood biocompatibility based on in vitro hemolysis assay. Blood circulation, tumor uptake, and antitumor activity of Cbz-NPs were assessed in prostatic cancer xenograft-bearing nude mice. Cbz-NPs exhibited prolonged blood circulation and greater accumulation of Cbz in tumors along with reduced toxicity compared to Cbz-Tween. Moreover, hematoxylin and eosin histopathological staining of organs revealed consistent results. The levels of blood urea nitrogen and serum creatinine in drug-treated mice showed that Cbz-NPs were less toxic than Cbz-Tween to the kidneys. In conclusion, Cbz-NPs provide a promising therapeutic for prostate cancer. PMID:27555767

  17. Expression and potential role of the peptide orexin-A in prostate cancer

    SciTech Connect

    Valiante, Salvatore; Liguori, Giovanna; Tafuri, Simona; Pavone, Luigi Michele; Campese, Roberto; Monaco, Roberto; Iachetta, Giuseppina; Assisi, Loredana; Mirabella, Nicola; Forte, Maurizio; Costagliola, Anna; Vittoria, Alfredo

    2015-09-04

    The peptides orexin-A and orexin-B and their G protein-coupled OX1 and OX2 receptors are involved in multiple physiological processes in the central nervous system and peripheral organs. Altered expression or signaling dysregulation of orexins and their receptors have been associated with a wide range of human diseases including narcolepsy, obesity, drug addiction, and cancer. Although orexin-A, its precursor molecule prepro-orexin and OX1 receptor have been detected in the human normal and hyperplastic prostate tissues, their expression and function in the prostate cancer (PCa) remains to be addressed. Here, we demonstrate for the first time the immunohistochemical localization of orexin-A in human PCa specimens, and the expression of prepro-orexin and OX1 receptor at both protein and mRNA levels in these tissues. Orexin-A administration to the human androgen-dependent prostate carcinoma cells LNCaP up-regulates OX1 receptor expression resulting in a decrease of cell survival. Noteworthy, nanomolar concentrations of the peptide counteract the testosterone-induced nuclear translocation of the androgen receptor in the cells: the orexin-A action is prevented by the addition of the OX1 receptor antagonist SB-408124 to the test system. These findings indicate that orexin-A/OX1 receptor interaction interferes with the activity of the androgen receptor which regulates PCa onset and progression, thus suggesting that orexin-A and its receptor might represent novel therapeutic targets to challenge this aggressive cancer. - Highlights: • Orexin-A and OX1 receptor are present in human cancer prostate tissues. • Orexin-A up-regulates OX1 receptor expression in LNCaP cells. • Orexin-A inhibits testosterone-induced nuclear translocation of androgen receptor.

  18. Improved prostate cancer detection with a human kallikrein 11 and percentage free PSA-based artificial neural network.

    PubMed

    Stephan, Carsten; Meyer, Hellmuth-Alexander; Cammann, Henning; Nakamura, Terukazu; Diamandis, Eleftherios P; Jung, Klaus

    2006-06-01

    Human kallikrein 11 (hK11) was evaluated in a percentage free PSA-based artificial neural network (ANN) to reduce unnecessary prostate biopsies. Serum samples from 357 patients with (n=132) and without (n=225) prostate cancer (PCa) were analyzed and ANN models were constructed and compared to all parameters. The discriminatory power of hK11 was lower than that of PSA, but receiver operator characteristic (ROC) analyses demonstrated significantly larger areas under the curves for the ANN compared to all other parameters. ANNs with hK11 may lead to a further reduction in unnecessary prostate biopsies, especially when analyzing patients with less than 15% free PSA. PMID:16800743

  19. Herpes simplex virus type 2 or human herpesvirus 8 infection and prostate cancer risk: A meta-analysis.

    PubMed

    Ge, Xiaoxiao; Wang, Xiao; Shen, Peng

    2013-05-01

    Prostate cancer is the second most frequently diagnosed type of cancer and the sixth leading cause of cancer mortality among males worldwide. The aim of this study was to investigate the association between the infection by herpes simplex virus type 2 (HSV-2) or human herpesvirus 8 (HHV-8) and the risk of prostate cancer. A systematic literature search was performed using PubMed, Cochrane Library, Web of Science, Scopus, CNKI and CBM. The association of HSV-2 or HHV-8 infection with the risk of prostate cancer was separately assessed. Estimates of the odds ratio (OR) with 95% confidence interval (CI) were pooled by the fixed- or random-effects model. A total of 11 articles with 2,996 cases and 3,875 controls were included in this meta-analysis. HSV-2 infection was associated with increased prostate cancer risk (OR=1.209; 95% CI, 1.003-1.456). Results of the stratified analysis suggested that such an association existed among participants from North and South America (OR=1.226; 95% CI, 1.000-1.503). No significant correlation was observed in the HHV-8 group (OR=1.106; 95% CI, 0.765-1.598). Further investigations and large-sample studies are required to elucidate the possible mechanism underlying viral carcinogenesis and the association between herpes virus infection and the risk of prostate cancer. PMID:24648964

  20. The systemic delivery of an oncolytic adenovirus expressing decorin inhibits bone metastasis in a mouse model of human prostate cancer

    DOE PAGESBeta

    Xu, Weidong; Neill, Thomas; Yang, Yuefeng; Hu, Zebin; Cleveland, Elyse; Wu, Ying; Hutten, Ryan; Xiao, Xianghui; Stock, Stuart R.; Shevrin, Daniel; et al

    2014-12-11

    In an effort to develop a new therapy for prostate cancer bone metastases, we have created Ad.dcn, a recombinant oncolytic adenovirus carrying the human decorin gene. Infection of PC-3 and DU-145, the human prostate tumor cells, with Ad.dcn or a non-replicating adenovirus Ad(E1-).dcn resulted in decorin expression; Ad.dcn produced high viral titers and cytotoxicity in human prostate tumor cells. Adenoviral-mediated decorin expression inhibited Met, the Wnt/β- catenin signaling axis, vascular endothelial growth factor A, reduced mitochondrial DNA levels, and inhibited tumor cell migration. To examine the anti-tumor response of Ad.dcn, PC-3-luc cells were inoculated in the left heart ventricle tomore » establish bone metastases in nude mice. Ad.dcn, in conjunction with control replicating and non-replicating vectors were injected via tail vein. The real-time monitoring of mice, once a week, by bioluminescence imaging and X-ray radiography showed that Ad.dcn produced significant inhibition of skeletal metastases. Analyses of the mice at the terminal time point indicated a significant reduction in the tumor burden, osteoclast number, serum TRACP 5b levels, osteocalcin levels, hypercalcemia, inhibition of cancer cachexia, and an increase in the animal survival. Finally, based on these studies, we believe that Ad.dcn can be developed as a potential new therapy for prostate cancer bone metastasis.« less

  1. The systemic delivery of an oncolytic adenovirus expressing decorin inhibits bone metastasis in a mouse model of human prostate cancer

    SciTech Connect

    Xu, Weidong; Neill, Thomas; Yang, Yuefeng; Hu, Zebin; Cleveland, Elyse; Wu, Ying; Hutten, Ryan; Xiao, Xianghui; Stock, Stuart R.; Shevrin, Daniel; Kaul, Karen; Brendler, Charles; Iozzo, Renato V.; Seth, Prem

    2014-12-11

    In an effort to develop a new therapy for prostate cancer bone metastases, we have created Ad.dcn, a recombinant oncolytic adenovirus carrying the human decorin gene. Infection of PC-3 and DU-145, the human prostate tumor cells, with Ad.dcn or a non-replicating adenovirus Ad(E1-).dcn resulted in decorin expression; Ad.dcn produced high viral titers and cytotoxicity in human prostate tumor cells. Adenoviral-mediated decorin expression inhibited Met, the Wnt/β- catenin signaling axis, vascular endothelial growth factor A, reduced mitochondrial DNA levels, and inhibited tumor cell migration. To examine the anti-tumor response of Ad.dcn, PC-3-luc cells were inoculated in the left heart ventricle to establish bone metastases in nude mice. Ad.dcn, in conjunction with control replicating and non-replicating vectors were injected via tail vein. The real-time monitoring of mice, once a week, by bioluminescence imaging and X-ray radiography showed that Ad.dcn produced significant inhibition of skeletal metastases. Analyses of the mice at the terminal time point indicated a significant reduction in the tumor burden, osteoclast number, serum TRACP 5b levels, osteocalcin levels, hypercalcemia, inhibition of cancer cachexia, and an increase in the animal survival. Finally, based on these studies, we believe that Ad.dcn can be developed as a potential new therapy for prostate cancer bone metastasis.

  2. Adenoviral-Mediated Endothelial Precursor Cell Delivery of Soluble CD115 Suppresses Human Prostate Cancer Xenograft Growth in Mice

    PubMed Central

    Lucas, Trevor; Abraham, Dietmar; Untergasser, Gerold; Zins, Karin; Hofer, Erhard; Gunsilius, Eberhard; Aharinejad, Seyedhossein

    2009-01-01

    Prostate cancer tumor growth and neovascularization is promoted by an interplay between migratory tumor stromal cells such as specialized tumor-associated macrophages (TAMs) and circulating endothelial precursor cells (CEPs). As vehicles for tumor therapy, human CEPs are relatively easy to isolate from peripheral blood, are able to proliferate long-term in vitro, are amenable to viral manipulation, and preferentially home to regions of ischemia found in growing tumors. We show here that human peripheral blood CEPs expanded ex vivo migrate to prostate cancer cells in vitro and efficiently home to human prostate tumor xenografts in vivo. Infection of precursors ex vivo with an adenovirus constructed to secrete a soluble form of the colony-stimulating factor-1 receptor CD115 that inhibits macrophage viability and migration in vitro significantly decreases the number of TAMs in xenografts (p < .05), reduces proliferation (p < .01) and vascular density (p < .03), and suppresses the growth of xenografts (p < .03). These data show for the first time that targeting stromal cell processes with cellular therapy has the potential to retard prostate tumor growth. PMID:19522014

  3. Ca²⁺ Movement Induced by Deltamethrin in PC3 Human Prostate Cancer Cells.

    PubMed

    Lee, Hai-Hsiang; Chou, Chiang-Ting; Liang, Wei-Zhe; Chen, Wei-Chuan; Wang, Jue-Long; Yeh, Jeng-Hsien; Kuo, Chun-Chi; Shieh, Pochuen; Kuo, Daih-Huang; Chen, Fu-An; Jan, Chung-Ren

    2016-06-30

    This study explored the effect of deltamethrin, a pesticide, on intracellular free Ca²⁺ concentration ([Ca²⁺]i) in PC3 human prostate cancer cells. Deltamethrin at concentrations between 5 μM and 20 μM evoked [Ca²⁺]i rises in a concentration-dependent manner. This Ca²⁺ signal was inhibited by 22% by removal of extracellular Ca²⁺. Nifedipine, econazole, and SKF96365 also inhibited the Ca²⁺ signal. Treatment with the endoplasmic reticulum Ca²⁺ pump inhibitor 2,5-di-tert-butylhydroquinone (BHQ) in Ca²⁺-free medium nearly abolished deltamethrin-induced [Ca²⁺]i rises. Treatment with deltamethrin also inhibited most of BHQ-induced [Ca²⁺]i rises. Inhibition of phospholipase C (PLC) with U73122 failed to alter deltamethrin-evoked [Ca²⁺]i rises. Deltamethrin killed cells at concentrations of 20-100 μM in a concentration-dependent fashion. Chelation of cytosolic Ca²⁺ with 1,2-bis (2-aminophenoxy) ethane-N, N, N', N'-tetraacetic acid/acetoxymethyl ester (BAPTA/AM) did not prevent deltamethrin's cytotoxicity. Together, in PC3 human prostate cancer cells, deltamethrin induced [Ca²⁺]i rises that involved Ca²⁺ entry through store-operated Ca²⁺ channels and PLC-independent Ca²⁺ release from the endoplasmic reticulum. Deltamethrin induced cytotoxicity in a Ca²⁺-independent manner. PMID:27188467

  4. Responsiveness of neoplastic and hyperplastic parathyroid tissues to calcium in vitro.

    PubMed Central

    Habener, J F

    1978-01-01

    Secretory and biosynthetic responses of adenomatous, carcinomatous, and hyperplastic parathyroid tissues to variable concentrations of extracellular calcium were assessed in vitro. Tissues, obtained at the time of parathyroidectomy, were incubated for 4 h in media containing radioactive amino acids and varying (0.5-5.0 mM) concentrations of calcium. Amounts of newly synthesized and total parathyroid hormone and proparathyroid hormone in extracts of tissues and media were measured by polyacrylamide gel electrophoresis and by radioimmunoassay, respectively. All tissues studied (six adenomas, two specimens of chief-cell hyperplasia, one carcinoma, and normal bovine and human glands) responded to changes in calcium concentrations; decreasing concentrations of calcium stimulated release and decreased tissue storage of hormone. Six of the abnormal tissues required greater than normal concentrations of calcium (1.8-2.4 mM for 50% of effect) to elicit secretory responses comparable with those of normal glands (1.4 mM). Maximum effects of calcium on release of hormone varied from 2- to 10-fold among different tissues. Release of some hormone persisted even in concentrations of calcium as high as 5.0 mM. Relative amounts of hormone released from and retained in the tissues varied greatly among the tissues, as did the absolute amounts of hormone produced; newly synthesized, labeled hormone ranged between 0.6 and 12% of total labeled protein, and immunoreactive hormone ranged between 0.015 and 0.9% of total tissue protein. Effects of calcium on hormone biosynthesis, as determined by analyses of amounts of proparathyroid hormone in the tissues, were variable among tissues and in many cases were negligible. These results indicate that neoplastic and hyperplastic parathyroid tissues retain secretory responsiveness to changes in extracellular concentrations of calcium. Responses, however, are highly variable among different tissues, and in many instances are abnormal, inasmuch as

  5. Prostate cancer detection using combined auto-fluorescence and light reflectance spectroscopy: ex vivo study of human prostates

    PubMed Central

    Sharma, Vikrant; Olweny, Ephrem O.; Kapur, Payal; Cadeddu, Jeffrey A.; Roehrborn, Claus G.; Liu, Hanli

    2014-01-01

    This study was conducted to evaluate the capability of detecting prostate cancer (PCa) using auto-fluorescence lifetime spectroscopy (AFLS) and light reflectance spectroscopy (LRS). AFLS used excitation at 447 nm with four emission wavelengths (532, 562, 632, and 684 nm), where their lifetimes and weights were analyzed using a double exponent model. LRS was measured between 500 and 840 nm and analyzed by a quantitative model to determine hemoglobin concentrations and light scattering. Both AFLS and LRS were taken on n = 724 distinct locations from both prostate capsular (nc = 185) and parenchymal (np = 539) tissues, including PCa tissue, benign peripheral zone tissue and benign prostatic hyperplasia (BPH), of fresh ex vivo radical prostatectomy specimens from 37 patients with high volume, intermediate-to-high-grade PCa (Gleason score, GS ≥7). AFLS and LRS parameters from parenchymal tissues were analyzed for statistical testing and classification. A feature selection algorithm based on multinomial logistic regression was implemented to identify critical parameters in order to classify high-grade PCa tissue. The regression model was in turn used to classify PCa tissue at the individual aggressive level of GS = 7,8,9. Receiver operating characteristic curves were generated and used to determine classification accuracy for each tissue type. We show that our dual-modal technique resulted in accuracies of 87.9%, 90.1%, and 85.1% for PCa classification at GS = 7, 8, 9 within parenchymal tissues, and up to 91.1%, 91.9%, and 94.3% if capsular tissues were included for detection. Possible biochemical and physiological mechanisms causing signal differences in AFLS and LRS between PCa and benign tissues were also discussed. PMID:24877012

  6. Significant systemic therapeutic effects of high-LET immunoradiation by 212Pb-trastuzumab against prostatic tumors of androgen-independent human prostate cancer in mice.

    PubMed

    Tan, Zongqing; Chen, Pingping; Schneider, Nathan; Glover, Samuel; Cui, Lingling; Torgue, Julien; Rixe, Olivier; Spitz, Henry B; Dong, Zhongyun

    2012-06-01

    The purpose of this study was to determine therapeutic effects and systemic toxicity of 212Pb-trastuzumab in an orthotopic model of human prostate cancer cells in nude mice. TCMC-Trastuzumab was radiolabeled with 212Pb. The 212Pb-trastuzumab generated from the procedure was intact and had high binding affinity with a dissociation constant (of 3.9±0.99 nM. PC-3MM2 cells, which expressed a lower level of HER2 both in culture and in tumors, were used in therapy studies. A single intravenous injection of 212Pb-trastuzumab reduced tumor growth by 60-80%, reduced aortic lymph node metastasis, and prolonged the survival of tumor-bearing mice. Treatment with 212Pb-trastuzumab did not cause significant changes in body weight, serum glutamic pyruvic transaminase (SGPT), blood urea nitrogen (BUN), hematological profiles, and histological morphology of several major organs of tumor-bearing mice. These findings suggest that a systemic delivery of 212Pb-trastuzumab could be an effective modality for management of advanced human prostate cancer. PMID:22322558

  7. Comprehensively Evaluating cis-Regulatory Variation in the Human Prostate Transcriptome by Using Gene-Level Allele-Specific Expression

    PubMed Central

    Larson, Nicholas B.; McDonnell, Shannon; French, Amy J.; Fogarty, Zach; Cheville, John; Middha, Sumit; Riska, Shaun; Baheti, Saurabh; Nair, Asha A.; Wang, Liang; Schaid, Daniel J.; Thibodeau, Stephen N.

    2015-01-01

    The identification of cis-acting regulatory variation in primary tissues has the potential to elucidate the genetic basis of complex traits and further our understanding of transcriptomic diversity across cell types. Expression quantitative trait locus (eQTL) association analysis using RNA sequencing (RNA-seq) data can improve upon the detection of cis-acting regulatory variation by leveraging allele-specific expression (ASE) patterns in association analysis. Here, we present a comprehensive evaluation of cis-acting eQTLs by analyzing RNA-seq gene-expression data and genome-wide high-density genotypes from 471 samples of normal primary prostate tissue. Using statistical models that integrate ASE information, we identified extensive cis-eQTLs across the prostate transcriptome and found that approximately 70% of expressed genes corresponded to a significant eQTL at a gene-level false-discovery rate of 0.05. Overall, cis-eQTLs were heavily concentrated near the transcription start and stop sites of affected genes, and effects were negatively correlated with distance. We identified multiple instances of cis-acting co-regulation by using phased genotype data and discovered 233 SNPs as the most strongly associated eQTLs for more than one gene. We also noted significant enrichment (25/50, p = 2E−5) of previously reported prostate cancer risk SNPs in prostate eQTLs. Our results illustrate the benefit of assessing ASE data in cis-eQTL analyses by showing better reproducibility of prior eQTL findings than of eQTL mapping based on total expression alone. Altogether, our analysis provides extensive functional context of thousands of SNPs in prostate tissue, and these results will be of critical value in guiding studies examining disease of the human prostate. PMID:25983244

  8. Examining the Relationship Between Cu-ATSM Hypoxia Selectivity and Fatty Acid Synthase Expression in Human Prostate Cancer Cell Lines

    PubMed Central

    Vāvere, Amy L.; Lewis, Jason S.

    2013-01-01

    Introduction PET imaging with Cu-ATSM for delineating hypoxia has provided valuable clinical information, but investigations in animal models of prostate cancer have shown some inconsistencies. As a defense mechanism in prostate cancer cells, the fatty acid synthesis pathway harnesses its oxidizing power for improving the redox balance despite conditions of extreme hypoxia, potentially altering Cu-ATSM hypoxia-selectivity. Methods Human prostate tumor cultured cell lines (PC-3, 22Rv1, LNCaP, and LAPC-4), were treated with an FAS inhibitor (C75, 100 μM) under anoxia. 64Cu-ATSM uptake into these treated cells, and non-treated anoxic cells, was then examined. Fatty acid synthase (FAS) expression level in each cell line was subsequently quantified by ELISA. An additional study was performed in PC-3 cells to examine the relationship between the restoration of 64Cu-ATSM hypoxia-selectivity and the concentration of C75 (100, 20, 4, or 0.8 μM) administered to the cells. Results Inhibition of fatty acid synthesis with C75 resulted in a significant increase in 64Cu-ATSM retention into prostate tumor cells in vitro under anoxia over 60 mins. Inhibition studies demonstrated higher uptake values of 20.9 ± 3.27, 103.0 ± 32.6, 144.2 ± 32.3, and 200.1 ± 79.3% at 15 mins over control values for LAPC-4, PC-3, LNCaP, and 22Rv1 cells, respectively. A correlation was seen (R2 = 0.911) with FAS expression plotted against % change in 64Cu-ATSM uptake with C75 treatment. Conclusions Although Cu-ATSM has clinical relevance in the PET imaging of hypoxia in many tumor types, its translation to the imaging of prostate cancer may be limited by the over-expression of FAS associated with prostatic malignancies. PMID:18355682

  9. Matched Cohort Analysis of Outcomes of Definitive Radiotherapy for Prostate Cancer in Human Immunodeficiency Virus-Positive Patients

    SciTech Connect

    Kahn, Shannon; Jani, Ashesh; Edelman, Scott; Rossi, Peter; Godette, Karen; Landry, Jerome; Anderson, Cynthia

    2012-05-01

    Purpose: To compare the biochemical outcome and toxicity scores of men with human immunodeficiency virus (HIV) and prostate cancer with a matched control population with negative or unknown HIV status when treated with external-beam radiotherapy (EBRT). Methods and Materials: A single-institution database of men with prostate cancer treated with EBRT from 1999 to 2009 was reviewed. Thirteen men with HIV were identified and matched to 2 control patients according to age, race, T stage, prostate-specific antigen level, Gleason score, RT dose, intensity-modulated RT vs. three-dimensional conformal RT, and whole-pelvis vs. prostate-only RT, for a total of 39 cases. The median follow-up time was 39 months (range, 3-110 months). Results: The 4-year biochemical failure (BF)-free survival rate was 87% in the HIV-positive group vs. 89% in the controls (p = 0.94). Pre- and post-RT viral loads were found to be predictive of BF (p = 0.04 and p = 0.04, respectively). No men with HIV died, whereas 2 in the control group died of causes unrelated to prostate cancer. Acute and chronic genitourinary and gastrointestinal toxicity were less in the HIV-positive patients than in controls (p < 0.001, p < 0.001, p = 0.003, and p < 0.001, respectively). The HIV-positive men experienced an average decline in CD4 count of 193 cells/mm{sup 3}. Conclusions: Our findings suggest that men with HIV treated with EBRT have a similar risk of BF; however, high viral loads may contribute to an increased risk. This analysis supports that HIV-positive men with prostate cancer can be treated with definitive EBRT with similar disease control and toxicity outcomes as in the general population.

  10. Multifunctional iron platinum stealth immunomicelles: targeted detection of human prostate cancer cells using both fluorescence and magnetic resonance imaging

    PubMed Central

    Huber, Dale L.; Monson, Todd C.; Ali, Abdul-Mehdi S.; Bisoffi, Marco; Sillerud, Laurel O.

    2011-01-01

    Superparamagnetic iron oxide nanoparticles (SPIONs) are the most common type of contrast agents used in contrast agent-enhanced magnetic resonance imaging (MRI). Still, there is a great deal of room for improvement, and nanoparticles with increased MRI relaxivities are needed to increase the contrast enhancement in MRI applied to various medical conditions including cancer. We report the synthesis of superparamagnetic iron platinum nanoparticles (SIPPs) and subsequent encapsulation using PEGylated phospholipids to create stealth immunomicelles (DSPE-SIPPs) that can be specifically targeted to human prostate cancer cell lines and detected using both MRI and fluorescence imaging. SIPP cores and DSPE-SIPPs were 8.5 ± 1.6 nm and 42.9 ± 8.2 nm in diameter, respectively, and the SIPPs had a magnetic moment of 120 A m2/kg iron. J591, a monoclonal antibody against prostate specific membrane antigen (PSMA), was conjugated to the DSPE-SIPPs (J591-DSPE-SIPPs), and specific targeting of J591-DSPE-SIPPs to PSMA-expressing human prostate cancer cell lines was demonstrated using fluorescence confocal microscopy. The transverse relaxivity of the DSPE-SIPPs, measured at 4.7 Tesla, was 300.6 ± 8.5 s−1 mM−1, which is 13-fold better than commercially available SPIONs (23.8 ± 6.9 s−1 mM−1) and ~3-fold better than reported relaxivities for Feridex® and Resovist®. Our data suggest that J591-DSPE-SIPPs specifically target human prostate cancer cells in vitro, are superior contrast agents in T2-weighted MRI, and can be detected using fluorescence imaging. To our knowledge, this is the first report on the synthesis of multifunctional SIPP micelles and using SIPPs for the specific detection of prostate cancer. PMID:22121333

  11. Worldwide Prevalence of Human Papillomavirus and Relative Risk of Prostate Cancer: A Meta-analysis

    PubMed Central

    Yang, Lin; Xie, Shuanghua; Feng, Xiaoshuang; Chen, Yuheng; Zheng, Tongzhang; Dai, Min; Ke Zhou, Cindy; Hu, Zhibin; Li, Ni; Hang, Dong

    2015-01-01

    Despite the increasing number of studies conducted recently to evaluate the association between HPV infections and the risk of prostate cancer, the results remain inconclusive. Furthermore, the prevalence and distribution of overall and individual HPV types worldwide in prostate cancer has not been reported until now. Therefore, we estimated the prevalence of HPV in prostate cancer by pooling data of 46 studies with 4919 prostate cancer cases, taking into account the heterogeneity of major related parameters, including study region, specimen type, HPV DNA source, detection method, publication calendar period and Gleason score. Moreover, we tested the association of HPV infections with prostate cancer risks by a meta-analysis of 26 tissue-based case-control studies. We found that the prevalence of HPV infection was 18.93% (95% CI = 17.84–20.05%) in prostate cancer cases, and most of which were high-risk HPV types (17.73%, 95% CI = 16.52–18.99%). The prevalence varied by region, PCR primers used, publication calendar period and Gleason score. Our study also showed a significantly increased risk of prostate cancer with the positivity of overall HPV detected in prostate tissues (OR = 1.79, 95% CI = 1.29–2.49) and revealed the geographic variation of association strength (P < 0.001). In conclusion, HPV infections may contribute to the risk of prostate cancer. PMID:26441160

  12. Magnetic nanoparticle hyperthermia enhances radiation therapy: A study in mouse models of human prostate cancer

    PubMed Central

    Attaluri, Anilchandra; Kandala, Sri Kamal; Wabler, Michele; Zhou, Haoming; Cornejo, Christine; Armour, Michael; Hedayati, Mohammad; Zhang, Yonggang; DeWeese, Theodore L.; Herman, Cila; Ivkov, Robert

    2015-01-01

    Purpose We aimed to characterise magnetic nanoparticle hyperthermia (mNPH) with radiation therapy (RT) for prostate cancer. Methods Human prostate cancer subcutaneous tumours, PC3 and LAPC-4, were grown in nude male mice. When tumours measured 150 mm3 magnetic iron oxide nanoparticles (MIONPs) were injected into tumours to a target dose of 5.5 mg Fe/cm3 tumour, and treated 24 h later by exposure to alternating magnetic field (AMF). Mice were randomly assigned to one of four cohorts to characterise (1) intratumour MIONP distribution, (2) effects of variable thermal dose mNPH (fixed AMF peak amplitude 24 kA/m at 160±5 kHz) with/without RT (5 Gy), (3) effects of RT (RT5: 5 Gy; RT8: 8 Gy), and (4) fixed thermal dose mNPH (43 °C for 20min) with/without RT (5 Gy). MIONP concentration and distribution were assessed following sacrifice and tissue harvest using inductively coupled plasma mass spectrometry (ICP-MS) and Prussian blue staining, respectively. Tumour growth was monitored and compared among treated groups. Results LAPC-4 tumours retained higher MIONP concentration and more uniform distribution than did PC3 tumours. AMF power modulation provided similar thermal dose for mNPH and combination therapy groups (CEM43: LAPC-4: 33.6 ± 3.4 versus 25.9 ± 0.8, and PC3: 27.19 ± 0.7 versus 27.50 ± 0.6), thereby overcoming limitations of MIONP distribution and yielding statistically significant tumour growth delay. Conclusion PC3 and LAPC-4 tumours represent two biological models that demonstrate different patterns of nanoparticle retention and distribution, offering a model to make comparisons of these effects for mNPH. Modulating power for mNPH offers potential to overcome limitations of MIONP distribution to enhance mNPH. PMID:25811736

  13. Combination Therapy with Epigallocatechin-3-Gallate and Doxorubicin in Human Prostate Tumor Modeling Studies

    PubMed Central

    Stearns, Mark E.; Amatangelo, Michael D.; Varma, Devika; Sell, Chris; Goodyear, Shaun M.

    2010-01-01

    The polyphenol epigallocatechin-3-gallate (EGCG) in combination with doxorubicin (Dox) exhibits a synergistic activity in blocking the growth and colony-forming ability of human prostate cell lines in vitro. EGCG has been found to disrupt the mitochondrial membrane potential, induce vesiculation of mitochondria, and induce elevated poly (ADP-ribose) polymerase (PARP) cleavage and apoptosis. EGCG in combination with low levels of Dox had a synergistic effect in blocking tumor cell growth. In vivo tumor modeling studies with a highly metastatic tumor line, PC-3ML cells, revealed that EGCG (228 mg/kg or 200 μmol/L) appeared to sensitize tumors to Dox. EGCG combined with low levels of Dox (0.14 mg/kg or 2 μmol/L) blocked tumor growth by PC-3ML cells injected intraperitoneally (ie, in CB17 severe combined immunodeficiencies) and significantly increased mouse survival rates. Similarly, relatively low levels of EGCG (57 mg/kg or 50 μmol/L) plus Dox (0.07 mg/kg or 1 μmol/L) eradicated established tumors (ie, in nonobese diabetic–severe combined immunodeficiencies) that were derived from CD44hi tumor-initiating cells isolated from PCa-20a cells. Flow cytometry results showed that EGCG appeared to enhance retention of Dox by tumor cells to synergistically inhibit tumor growth and eradicate tumors. These data suggest that localized delivery of high dosages of EGCG combined with low levels of Dox may have significant clinical application in the treatment of metastatic prostate and/or eradication of primary tumors derived from tumor-initiating cells. PMID:20971741

  14. Novel Imidazopyridine Derivatives Possess Anti-Tumor Effect on Human Castration-Resistant Prostate Cancer Cells

    PubMed Central

    Muniyan, Sakthivel; D’Cunha, Napoleon; Robinson, Tashika; Hoelting, Kyle; Dwyer, Jennifer G.; Bu, Xiu R.; Batra, Surinder K.; Lin, Ming-Fong

    2015-01-01

    Prostate cancer (PCa) is the second leading cause of cancer-related death afflicting United States males. Most treatments to-date for metastatic PCa include androgen-deprivation therapy and second-generation anti-androgens such as abiraterone acetate and enzalutamide. However, a majority of patients eventually develop resistance to these therapies and relapse into the lethal, castration-resistant form of PCa to which no adequate treatment option remains. Hence, there is an immediate need to develop effective therapeutic agents toward this patient population. Imidazopyridines have recently been shown to possess Akt kinase inhibitory activity; thus in this study, we investigated the inhibitory effect of novel imidazopyridine derivatives HIMP, M-MeI, OMP, and EtOP on different human castration-resistant PCa cells. Among these compounds, HIMP and M-MeI were found to possess selective dose- and time-dependent growth inhibition: they reduced castration-resistant PCa cell proliferation and spared benign prostate epithelial cells. Using LNCaP C-81 cells as the model system, these compounds also reduced colony formation as well as cell adhesion and migration, and M-MeI was the most potent in all studies. Further investigation revealed that while HIMP primarily inhibits PCa cell growth via suppression of PI3K/Akt signaling pathway, M-MeI can inhibit both PI3K/Akt and androgen receptor pathways and arrest cell growth in the G2 phase. Thus, our results indicate the novel compound M-MeI to be a promising candidate for castration-resistant PCa therapy, and future studies investigating the mechanism of imidazopyridine inhibition may aid to the development of effective anti-PCa agents. PMID:26121643

  15. Human prostatic acid phosphatase directly stimulates collagen synthesis and alkaline phosphatase content of isolated bone cells

    SciTech Connect

    Ishibe, M.; Rosier, R.N.; Puzas, J.E. )

    1991-10-01

    Human prostatic acid phosphatase (hPAP) directly enhances the differentiated characteristics of isolated bone cells in vitro. This enzyme, when added to cell cultures for 24 h in vitro stimulates collagen synthesis and the production of alkaline phosphatase. The effects are dose dependent, with statistically significant effects occurring from 0.1-100 nM hPAP. Concentrations higher than 100 nM do not evoke greater effects. The maximal effect of hPAP occurs between 12 and 24 h of exposure. The cells stimulated to the greatest degree are osteoprogenitor cells and osteoblasts. Fibroblasts isolated from the same tissue show a lesser sensitivity to hPAP. hPAP has no detectable effect on cell proliferation, as measured by radiolabeled thymidine incorporation or total DNA synthesis. None of the observations reported in this work can be attributed to contaminating proteins in the hPAP preparation. hPAP was radiolabeled with 125I and was used for affinity binding and cross-linking studies. Scatchard analysis of specific binding indicated the presence of 1.0 X 10(5) high affinity binding sites/cell, with a Kd of 6.5 nM. Cross-linking studies demonstrated the presence of one 320-kDa binding complex. The pH profile and kinetic determinations of Km and maximum velocity for hPAP were similar to those previously reported, except for the finding of positive cooperativity of the substrate with the enzyme under the conditions of our assay. We believe that the direct stimulation of bone-forming cells by hPAP may contribute to the sclerotic nature of skeletal bone around sites of neoplastic prostatic metastases and that the effect of the enzyme is probably mediated by a plasma membrane receptor.

  16. Celastrol Potentiates Radiotherapy by Impairment of DNA Damage Processing in Human Prostate Cancer

    SciTech Connect

    Dai Yao; DeSano, Jeffrey T.; Meng Yang; J, Qing; Ljungman, Mats; Lawrence, Theodore S.; Xu Liang

    2009-07-15

    Purpose: Celastrol is an active ingredient of traditional herbal medicine and has recently been identified as a potent natural proteasome inhibitor. In the present study, we evaluated the radiosensitizing potential of celastrol in the human prostate cancer PC-3 model. Methods and Materials: Clonogenic assays were performed to determine the radiosensitizing effect of celastrol. Apoptosis was examined by flow cytometry using Annexin V and propidium iodide staining and by a caspase-3 activation assay. DNA damage processing was examined by immunofluorescent staining and Western blot for phosphorylated H2AX ({gamma}H2AX). The PC-3 xenograft model in the athymic nude mouse was used for the determination of the in vivo efficacy of celastrol combined with radiotherapy. The tumor samples were also analyzed for apoptosis and angiogenesis. Results: Celastrol sensitized PC-3 cells to ionizing radiation (IR) in a dose- and schedule-dependent manner, in which pretreatment with celastrol for 1 h followed by IR achieved maximal radiosensitization. Celastrol significantly prolonged the presence of IR-induced {gamma}H2AX and increased IR-induced apoptosis. Celastrol, combined with fractionated radiation, significantly inhibited PC-3 tumor growth in vivo without obvious systemic toxicity. The combination treatment increased {gamma}H2AX levels and apoptosis, induced cleavage of poly(adenosine diphosphate-ribose)polymerase and Mcl-1, and reduced angiogenesis in vivo compared with either treatment alone. Conclusion: Celastrol sensitized PC-3 cells to radiation both in vitro and in vivo by impairing DNA damage processing and augmenting apoptosis. Celastrol might represent a promising new adjuvant regimen for the treatment of hormone-refractory prostate cancer.

  17. Cytotoxic Effects of the Ethanol Bane Skin Extract in Human Prostate Cancer Pc3 Cells

    PubMed Central

    Amiri, Maryam; Kazerouni, Faranak; Namaki, Saeed; Darbandi Tamijani, Hassan; Rahimipour, Hooman; Boroumand, Nasrin; Barghi, Siyamak; Ebrahimi, Nazanin; Gheibi Hayat, Seyed Mohammad

    2016-01-01

    Background: It is extensively supposed that vegetarian diet could affect cancer progress and increase the influence of formal chemotherapy. Objectives: The present study was designed to determine the effect of the ethanol Bane skin extract against chemo resistant prostate cancer PC3 cells. Materials and Methods: PC3 and L929 cells were cultivated and then incubated in the ethanol Bane skin extract with various concentrations of 0.78, 1.5, 3.13, 6.25, 12.5 mg/mL in 3 times 24, 48, 72 hours. Cytotoxic effect of the ethanol Bane skin extract on PC3 and L929 cells was examined by MTT assay after 24, 48, and 72 hours. Morphology of PC3 cells was evaluated by Gimsa staining. Results: The ethanol Bane skin extract inhibited proliferation and caused cell death with IC50 values of 2.8 mg/mL on PC3 cells and the IC50 was 6.1 mg/mL on l929 cells. Morphological changes and apoptotic bodies were observed in PC3 cells faced with the ethanol Bane skin extract by staining with Gimsa. Conclusions: The ethanol Bane skin extract could repress the growth of PC3 cell line. This inhibitory effect of the Bane extract depended on the dose and the time on PC3. The result of this study shows that the ethanol Bane skin extract includes photochemical and inhibitory function against proliferation and inducer of apoptosis in human prostate cancer PC3 cells and also has less cytotoxic effect on l929 than PC3 cells. The ethanol Bane skin extract might be a good candidate for the new herbal anticancer drug. PMID:27482333

  18. Isolation and genome-wide expression and methylation characterization of CD31+ cells from normal and malignant human prostate tissue

    PubMed Central

    Luo, Wei; Hu, Qiang; Wang, Dan; Deeb, Kristin K.; Ma, Yingyu; Morrison, Carl D.; Liu, Song; Johnson, Candace S.; Trump, Donald L.

    2013-01-01

    Endothelial cells (ECs) are an important component involved in the angiogenesis. Little is known about the global gene expression and epigenetic regulation in tumor endothelial cells. The identification of gene expression and epigenetic difference between human prostate tumor-derived endothelial cells (TdECs) and those in normal tissues may uncover unique biological features of TdEC and facilitate the discovery of new anti-angiogenic targets. We established a method for isolation of CD31+ endothelial cells from malignant and normal prostate tissues obtained at prostatectomy. TdECs and normal-derived ECs (NdECs) showed >90% enrichment in primary culture and demonstrated microvascular endothelial cell characteristics such as cobblestone morphology in monolayer culture, diI-acetyl-LDL uptake and capillary-tube like formation in Matrigel®. In vitro primary cultures of ECs maintained expression of endothelial markers such as CD31, von Willebrand factor, intercellular adhesion molecule, vascular endothelial growth factor receptor 1, and vascular endothelial growth factor receptor 2. We then conducted a pilot study of transcriptome and methylome analysis of TdECs and matched NdECs from patients with prostate cancer. We observed a wide spectrum of differences in gene expression and methylation patterns in endothelial cells, between malignant and normal prostate tissues. Array-based expression and methylation data were validated by qRT-PCR and bisulfite DNA pyrosequencing. Further analysis of transcriptome and methylome data revealed a number of differentially expressed genes with loci whose methylation change is accompanied by an inverse change in gene expression. Our study demonstrates the feasibility of isolation of ECs from histologically normal prostate and prostate cancer via CD31+ selection. The data, although preliminary, indicates that there exist widespread differences in methylation and transcription between TdECs and NdECs. Interestingly, only a small

  19. Prostate Cancer

    MedlinePlus

    ... version of this page please turn Javascript on. Prostate Cancer What is Prostate Cancer? How Tumors Form The body is made up ... the Escape (Esc) button on your keyboard.) How Prostate Cancer Occurs Prostate cancer occurs when a tumor forms ...

  20. Antivascular Effects of Neoadjuvant Androgen Deprivation for Prostate Cancer: An In Vivo Human Study Using Susceptibility and Relaxivity Dynamic MRI

    SciTech Connect

    Alonzi, Roberto; Padhani, Anwar R.; Taylor, N. Jane; Collins, David J.; D'Arcy, James A.; Stirling, J. James; Saunders, Michele I.; Hoskin, Peter J.

    2011-07-01

    Purpose: The antivascular effects of androgen deprivation have been investigated in animal models; however, there has been minimal investigation in human prostate cancer. This study tested the hypothesis that androgen deprivation causes significant reductions in human prostate tumor blood flow and the induction of hypoxia at a magnitude and in a time scale relevant to the neoadjuvant setting before radiotherapy. Methods and Materials: Twenty patients were examined, each with five multi-parameter magnetic resonance imaging scans: two scans before the commencement of androgen suppression, one scan after 1 month of hormone treatment, and two further scans after 3 months of therapy. Quantitative parametric maps of the prostate informing on relative blood flow (rBF), relative blood volume (rBV), vascular permeability (transfer constant [K{sup trans}]), leakage space (v{sub e}) and blood oxygenation (intrinsic relaxivity [R{sub 2}*]) were calculated. Results: Tumor blood volume and blood flow decreased by 83% and 79%, respectively, in the first month (p < 0.0001), with 74% of patients showing significant changes. The proportion of individual patients who achieved significant changes in T1 kinetic parameter values after 3 months of androgen deprivation for tumor measurements was 68% for K{sup trans} and 53% for v{sub e} By 3 months, significant increases in R{sub 2}* had occurred in prostate tumor, with a rise of 41.1% (p < 0.0001). Conclusions: Androgen deprivation induces profound vascular collapse within 1 month of starting treatment. Increased R{sub 2}* in regions of prostate cancer and a decrease in blood volume suggest a reduction in tumor oxygenation.

  1. The cancer-promoting gene fatty acid-binding protein 5 (FABP5) is epigenetically regulated during human prostate carcinogenesis.

    PubMed

    Kawaguchi, Koichiro; Kinameri, Ayumi; Suzuki, Shunsuke; Senga, Shogo; Ke, Youqiang; Fujii, Hiroshi

    2016-02-15

    FABPs (fatty-acid-binding proteins) are a family of low-molecular-mass intracellular lipid-binding proteins consisting of ten isoforms. FABPs are involved in binding and storing hydrophobic ligands such as long-chain fatty acids, as well as transporting these ligands to the appropriate compartments in the cell. FABP5 is overexpressed in multiple types of tumours. Furthermore, up-regulation of FABP5 is strongly associated with poor survival in triple-negative breast cancer. However, the mechanisms underlying the specific up-regulation of the FABP5 gene in these cancers remain poorly characterized. In the present study, we determined that FABP5 has a typical CpG island around its promoter region. The DNA methylation status of the CpG island in the FABP5 promoter of benign prostate cells (PNT2), prostate cancer cells (PC-3, DU-145, 22Rv1 and LNCaP) and human normal or tumour tissue was assessed by bisulfite sequencing analysis, and then confirmed by COBRA (combined bisulfite restriction analysis) and qAMP (quantitative analysis of DNA methylation using real-time PCR). These results demonstrated that overexpression of FABP5 in prostate cancer cells can be attributed to hypomethylation of the CpG island in its promoter region, along with up-regulation of the direct trans-acting factors Sp1 (specificity protein 1) and c-Myc. Together, these mechanisms result in the transcriptional activation of FABP5 expression during human prostate carcinogenesis. Importantly, silencing of Sp1, c-Myc or FABP5 expression led to a significant decrease in cell proliferation, indicating that up-regulation of FABP5 expression by Sp1 and c-Myc is critical for the proliferation of prostate cancer cells. PMID:26614767

  2. Defined Conditions for the Isolation and Expansion of Basal Prostate Progenitor Cells of Mouse and Human Origin

    PubMed Central

    Höfner, Thomas; Eisen, Christian; Klein, Corinna; Rigo-Watermeier, Teresa; Goeppinger, Stephan M.; Jauch, Anna; Schoell, Brigitte; Vogel, Vanessa; Noll, Elisa; Weichert, Wilko; Baccelli, Irène; Schillert, Anja; Wagner, Steve; Pahernik, Sascha; Sprick, Martin R.; Trumpp, Andreas

    2015-01-01

    Summary Methods to isolate and culture primary prostate epithelial stem/progenitor cells (PESCs) have proven difficult and ineffective. Here, we present a method to grow and expand both murine and human basal PESCs long term in serum- and feeder-free conditions. The method enriches for adherent mouse basal PESCs with a Lin−SCA-1+CD49f+TROP2high phenotype. Progesterone and sodium selenite are additionally required for the growth of human Lin−CD49f+TROP2high PESCs. The gene-expression profiles of expanded basal PESCs show similarities to ESCs, and NF-kB function is critical for epithelial differentiation of sphere-cultured PESCs. When transplanted in combination with urogenital sinus mesenchyme, expanded mouse and human PESCs generate ectopic prostatic tubules, demonstrating their stem cell activity in vivo. This novel method will facilitate the molecular, genomic, and functional characterization of normal and pathologic prostate glands of mouse and human origin. PMID:25702639

  3. Proteomic Upregulation of Fatty Acid Synthase and Fatty Acid Binding Protein 5 and Identification of Cancer- and Race-Specific Pathway Associations in Human Prostate Cancer Tissues

    PubMed Central

    Myers, Jennifer S.; von Lersner, Ariana K.; Sang, Qing-Xiang Amy

    2016-01-01

    Protein profiling studies of prostate cancer have been widely used to characterize molecular differences between diseased and non-diseased tissues. When combined with pathway analysis, profiling approaches are able to identify molecular mechanisms of prostate cancer, group patients by cancer subtype, and predict prognosis. This strategy can also be implemented to study prostate cancer in very specific populations, such as African Americans who have higher rates of prostate cancer incidence and mortality than other racial groups in the United States. In this study, age-, stage-, and Gleason score-matched prostate tumor specimen from African American and Caucasian American men, along with non-malignant adjacent prostate tissue from these same patients, were compared. Protein expression changes and altered pathway associations were identified in prostate cancer generally and in African American prostate cancer specifically. In comparing tumor to non-malignant samples, 45 proteins were significantly cancer-associated and 3 proteins were significantly downregulated in tumor samples. Notably, fatty acid synthase (FASN) and epidermal fatty acid-binding protein (FABP5) were upregulated in human prostate cancer tissues, consistent with their known functions in prostate cancer progression. Aldehyde dehydrogenase family 1 member A3 (ALDH1A3) was also upregulated in tumor samples. The Metastasis Associated Protein 3 (MTA3) pathway was significantly enriched in tumor samples compared to non-malignant samples. While the current experiment was unable to detect statistically significant differences in protein expression between African American and Caucasian American samples, differences in overrepresentation and pathway enrichment were found. Structural components (Cytoskeletal Proteins and Extracellular Matrix Protein protein classes, and Biological Adhesion Gene Ontology (GO) annotation) were overrepresented in African American but not Caucasian American tumors. Additionally, 5

  4. High-power diode laser at 980 nm for the treatment of benign prostatic hyperplasia: ex vivo investigations on porcine kidneys and human cadaver prostates.

    PubMed

    Seitz, Michael; Reich, Oliver; Gratzke, Christian; Schlenker, Boris; Karl, Alexander; Bader, Markus; Khoder, Wael; Fischer, Florian; Stief, Christian; Sroka, Ronald

    2009-03-01

    Diode laser systems at 980 nm have been introduced for the treatment of lower-urinary-tract-symptoms (LUTS) suggestive of benign prostatic enlargement (BPE). However, the coagulation and vaporization properties are unknown. We therefore aimed to evaluate these properties in ex vivo models in comparison with the kalium-titanyl-phosphate-(KTP) laser. The diode laser treatment was applied to isolated, blood-perfused porcine kidneys and fresh human cadaver prostates (HCPs) at different generator settings. We performed histological examination to compare the depth of coagulation and vaporization. The diode laser showed larger ablation and coagulation characteristics than the KTP laser did. Ablation of the diode laser was found to be 1.79-times (120 W in porcine kidney, P < 0.0001) and 3.0-5 times (200 W in HCP, P < 0.0005) larger. The diode laser created a nine-times (120 W in porcine kidney, P < 0.0001) and seven-times (200 W in HCP, P < 0.0001) deeper necrosis zone. The diode laser vaporization was highly effective ex vivo. Owing to the laser's deep coagulation zones, in vivo animal experiments are mandatory before the diode laser (980 nm) is applied in a clinical setting, so that damage to underlying structures is prevented. PMID:18270761

  5. Human prostate cancer cells lack feedback regulation of low-density lipoprotein receptor and its regulator, SREBP2.

    PubMed

    Chen, Y; Hughes-Fulford, M

    2001-01-01

    The low-density lipoprotein receptor (LDLR) pathway provides cells with essential fatty acids for prostaglandin E2 (PGE2) synthesis. Regulation of LDLR expression by LDL was compared between the human normal and cancer prostate cells using semi-quantitative RT-PCR and LDL uptake assays. LDLR mRNA expression and LDL uptake by LDLR were down-regulated in the presence of exogenous LDL or whole serum in the normal prostate cells, but not in the prostate cancer cells. Addition of exogenous cholesterol down-regulated both LDLR and a potent regulator of the ldlr promoter, sterol regulatory element binding protein 2 (SREBP2), in normal cells but not in cancer cells. PGE2 synthesis in prostate cancer cells was significantly increased in response to LDL. Our study suggests that over-production of LDLR is an important mechanism in cancer cells for obtaining more essential fatty acids through LDLR endocytosis, allowing increased synthesis of prostaglandins, which subsequently stimulate cell growth. The data also suggest that the sterol regulatory element and SREBP2 play a role in the loss of sterol feedback regulation in cancer cells. PMID:11149418

  6. Prostate Diseases

    MedlinePlus

    ... our e-newsletter! Aging & Health A to Z Prostate Diseases Basic Facts & Information What are Prostate Diseases? The prostate—one of the components of ... out anything serious. The Most Common Types of Prostate Diseases Benign prostatic hyperplasia (BPH) Prostatitis Prostate cancer ...

  7. Immunocytochemical localization of gamma-glutamyltransferase in induced hyperplastic nodules of rat liver.

    PubMed Central

    Spater, H W; Quintana, N; Becker, F F; Novikoff, A B

    1983-01-01

    The immunocytochemical localization of gamma-glutamyltransferase [(5-glutamyl)-peptide:amino-acid 5-glutamyltransferase, EC 2.3.2.2; gamma-GluTase] was demonstrated in hyperplastic liver induced by the carcinogen 2-acetylaminofluorene (2-AAF). The method used a specific antiserum and protein A-horseradish peroxidase and permitted visualization of antigenic sites at both the light and electron microscopic levels. Electron microscopy revealed deposits of 3,3'-diaminobenzidine (DAB) reaction product in the plasma membranes of (i) hyperplastic cells, (ii) bile canaliculi, (iii) endothelial cell membranes, and (iv) lymphocytes. The so-called ATPase activity was localized in the plasma membrane in bile canaliculi and in endothelial cells; the hyperplastic cells show marked variability in the levels of this activity. Images PMID:6136038

  8. Human castration resistant prostate cancer rather prefer to decreased 5α-reductase activity

    PubMed Central

    Kosaka, Takeo; Miyajima, Akira; Nagata, Hirohiko; Maeda, Takahiro; Kikuchi, Eiji; Oya, Mototsugu

    2013-01-01

    Physiologically relevant steroid 5α-reductase (SRD5A) activity that is essential for dihydrotestosterone (DHT) biosynthesis in human castration-resistant prostate cancer (CRPC) has not been fully characterized yet. In this study to ascertain the potential SRD5A activity, we cultured two human CRPC cell lines, C4-2 and C4-2AT6, with the steroid precursor: 13C-[2,3,4]-androstenedione (13C-Adione), and analyzed the sequential biosynthesis of 13C-[2,3,4]-testosterone (13C-T) and 13C-[2,3,4]-DHT (13C-DHT) by liquid chromatography/mass spectrometry (LC/MS/MS). The 13C-DHT/13C-T concentration ratio detected by LC/MS/MS in C4-2AT6 cells appeared to reflect the SRD5A activity. The ratio in C4-2AT6 was significantly lower than that in C4-2. An increased concentration of DHT did not have a positive effect on cell proliferation, rather it exhibited inhibitory effects. 5α-reductase inhibitors did not have any inhibitory effect at clinically achievable concentrations. These results indicate that CRPC cells may have an unknown regulation system to protect themselves from an androgenic suppressive effect mediated by SRD5A activity. PMID:23429215

  9. Evaluation of polymer shielding for adenovirus serotype 6 (Ad6) for systemic virotherapy against human prostate cancers

    PubMed Central

    Nguyen, Tien V; Heller, Greg J; Barry, Mary E; Crosby, Catherine M; Turner, Mallory A; Barry, Michael A

    2016-01-01

    Oncolytic viruses hold promise as “self-amplifying” cancer therapies wherein a virally killed cell can produce thousands of new viral “drugs” that can kill more cancer cells. Adenoviruses (Ads) are one family of oncolytic viruses. Most human studies have used human Ad serotype 5 (Ad5). Unfortunately, most patients are already immune to Ad5 increasing the likelihood that the agent will be neutralized if used as a cancer therapy. In this work, lower seroprevalence Ad6 was tested as a systemic therapy for prostate cancer. Ad5 and Ad6 were injected intravenously a single time in nude mice bearing human prostate tumors, and toxicity and efficacy were assessed. Ad6 was chemically shielded with polyethylene glycol (PEG) to test if this would further improve its pharmacology. Ad6 produced 30-fold lower liver damage and less toxicity than Ad5. Ad6 significantly repressed the growth of androgen-resistant human DU145 prostate tumors and androgen-sensitive LNCaP tumors after single intravenous injection. PEGylation did not change virus distribution, but blunted liver damage and cytokine production by Ad6. PEGylated Ad6 eradicated LNCaP tumors and maintained body mass, but lost potency against the more challenging DU145 tumors. These and other data suggest that low seroprevalent Ad6 has better efficacy and safety than the benchmark oncolytic virus Ad5 for systemic therapy of prostate cancer. These data also indicate that PEGylation may improve Ad6 safety, but that this shielding may reduce oncolytic efficacy after intravenous treatment. PMID:26900598

  10. Response of Human Prostate Cancer Cells to Mitoxantrone Treatment in Simulated Microgravity Environment

    NASA Astrophysics Data System (ADS)

    Zhang, Ye; Wu, Honglu

    2012-07-01

    RESPONSE OF HUMAN PROSTATE CANCER CELLS TO MITOXANTRONE TREATMENT IN SIMULATED MICROGRAVITY ENVIRONMENT Ye Zhang1,2, Christopher Edwards3, and Honglu Wu1 1 NASA-Johnson Space Center, Houston, TX 2 Wyle Integrated Science and Engineering Group, Houston, TX 3 Oregon State University, Corvallis, OR This study explores the changes in growth of human prostate cancer cells (LNCaP) and their response to the treatment of an antineoplastic agent, mitoxantrone, under the simulated microgravity condition. In comparison to static 1g, microgravity and simulated microgravity have been shown to alter global gene expression patterns and protein levels in various cultured cell models or animals. However, very little is known about the effect of altered gravity on the responses of cells to the treatment of drugs, especially chemotherapy drugs. To test the hypothesis that zero gravity would result in altered regulations of cells in response to antineoplastic agents, we cultured LNCaP cells in either a High Aspect Ratio Vessel (HARV) bioreactor at the rotating condition to model microgravity in space or in the static condition as control, and treated the cells with mitoxantrone. Cell growth, as well as expressions of oxidative stress related genes, were analyzed after the drug treatment. Compared to static 1g controls, the cells cultured in the simulated microgravity environment did not present significant differences in cell viability, growth rate, or cell cycle distribution. However, after mitoxantrone treatment, a significant proportion of bioreactor cultured cells became apoptotic or was arrested in G2. Several oxidative stress related genes also showed a higher expression level post mitoxantrone treatment. Our results indicate that simulated microgravity may alter the response of LNCaP cells to mitoxantrone treatment. Understanding the mechanisms by which cells respond to drugs differently in an altered gravity environment will be useful for the improvement of cancer treatment on

  11. Radioguided Parathyroidectomy Is Equally Effective for Both Adenomatous and Hyperplastic Glands

    PubMed Central

    Chen, Herbert; Mack, Eberhard; Starling, James R.

    2003-01-01

    Objective: To determine the utility of radioguided parathyroidectomy for patients with hyperparathyroidism, we studied the properties of 180 resected, hyperfunctioning parathyroid glands. Summary and Background Data: Radioguided resection of hyperfunctioning parathyroid glands has been shown to be technically feasible in patients with parathyroid adenomas. Radioguided excision may obviate the need for intraoperative frozen section because excised parathyroid adenomas uniformly have radionuclide ex vivo counts >20% of background. The feasibility and applicability of radioguided techniques for patients with parathyroid hyperplasia are unclear. Methods: Between March 2001 and September 2002, 102 patients underwent neck exploration for primary (n = 77) and secondary/tertiary (n = 25) hyperparathyroidism. All patients received an injection of 10 mCi of Tc-99m sestamibi the day of surgery. Using a gamma probe, intraoperative scanning was performed, looking for in vivo radionuclide counts > background to localize abnormal parathyroid glands. After excision, radionuclide counts of each ex vivo parathyroid gland were determined and expressed as a percentage of background counts. Results: Although patients with single adenomas had higher mean background radionuclide counts, the average in vivo counts of all enlarged glands were higher than background. Notably, in vivo counts did not differ between adenomatous and hyperplastic glands, suggesting equal sensitivity for intraoperative gamma detection. Ectopically located glands were identified in 22 cases and all were accurately localized using the gamma probe. Postresection, mean ex vivo radionuclide counts were highest in the single parathyroid adenomas and lowest in hyperplastic glands. Importantly, in all hyperplastic glands, the ex vivo counts were >20%. Conclusions: In patients with hyperparathyroidism, radioguided surgery is a sensitive adjunct for the intraoperative localization of both adenomatous and hyperplastic

  12. Circulating 25-Hydroxyvitamin-D and Risk of Colorectal Adenomas and Hyperplastic Polyps

    PubMed Central

    Adams, Scott V.; Newcomb, Polly A.; Burnett-Hartman, Andrea N.; White, Emily; Mandelson, Margaret T.; Potter, John D.

    2011-01-01

    Colorectal adenomas are clear precursors of cancer; hyperplastic polyps may also have malignant potential. An inverse association between circulating vitamin D metabolites and adenoma risk has been reported, but less is known about vitamin D and hyperplastic polyps. We conducted a case-control study of adenomas and hyperplastic polyps among 459 members of an integrated health plan evaluated via colonoscopy. Questionnaires provided information on colorectal polyp risk factors, and plasma samples were assayed for 25-hydroxyvitamin-D (25(OH)D). Polytomous regression was used to estimate odds ratios for adenomas (N=149) and hyperplastic polyps (N=85) compared to polyp-free controls (N=225) by tertile of 25(OH)D. An inverse association between 25(OH)D and adenomas was suggested after adjustment for potential confounding factors (comparing upper to lower tertiles, OR[95%CI]: 0.71 [0.38–1.30]). After restriction of the analyses to study participants with no history of polyps, this OR estimate was reduced further (adjusted OR [95%CI]: 0.52 [0.23–1.20]). In comparison, no inverse association between hyperplastic polyps and 25(OH)D was observed among the full study participants (adjusted OR [95%CI]: 1.17 [0.55–2.51]) or among those without prior polyps (adjusted OR [95%CI]: 1.42 [0.55–3.65]). Our study suggests that the established inverse association between circulating 25(OH)D and adenoma may not apply to hyperplastic polyps. PMID:21432725

  13. Role of androgen and vitamin D receptors in endothelial cells from benign and malignant human prostate

    PubMed Central

    Chung, Ivy; Montecinos, Viviana P.; Buttyan, Ralph; Johnson, Candace S.; Smith, Gary J.

    2013-01-01

    Forty years ago, Judah Folkman (Folkman. N Engl J Med 285: 1182–1186, 1971) proposed that tumor growth might be controlled by limiting formation of new blood vessels (angiogenesis) needed to supply a growing tumor with oxygen and nutrients. To this end, numerous “antiangiogenic” agents have been developed and tested for therapeutic efficacy in cancer patients, including prostate cancer (CaP) patients, with limited success. Despite the lack of clinical efficacy of lead anti-angiogenic therapeutics in CaP patients, recent published evidence continues to support the idea that prostate tumor vasculature provides a reasonable target for development of new therapeutics. Particularly relevant to antiangiogenic therapies targeted to the prostate is the observation that specific hormones can affect the survival and vascular function of prostate endothelial cells within normal and malignant prostate tissues. Here, we review the evidence demonstrating that both androgen(s) and vitamin D significantly impact the growth and survival of endothelial cells residing within prostate cancer and that systemic changes in circulating androgen or vitamin D drastically affect blood flow and vascularity of prostate tissue. Furthermore, recent evidence will be discussed about the expression of the receptors for both androgen and vitamin D in prostate endothelial cells that argues for direct effects of these hormone-activated receptors on the biology of endothelial cells. Based on this literature, we propose that prostate tumor vasculature represents an unexplored target for modulation of tumor growth. A better understanding of androgen and vitamin D effects on prostate endothelial cells will support development of more effective angiogenesis-targeting therapeutics for CaP patients. PMID:23548616

  14. Gastric inverted hyperplastic polyp: A rare cause of iron deficiency anemia

    PubMed Central

    Yun, Jin Tak; Lee, Seung Woo; Kim, Dong Pil; Choi, Seung Hwa; Kim, Seok-Hwan; Park, Jun Kyu; Jang, Sun Hee; Park, Yun Jung; Sung, Ye Gyu; Sul, Hae Jung

    2016-01-01

    Gastric inverted hyperplastic polyp (IHP) is a rare gastric polyp characterized by the downward growth of hyperplastic mucosal components into the submucosal layer. Macroscopically, a gastric IHP resembles a subepithelial tumor (SET); as a result, accurately diagnosing gastric IHP is difficult. This issue has clinical significance because gastric IHP can be misdiagnosed as SET or as malignant neoplasm In addition, adenocarcinoma can accompany benign gastric IHP. Although in most cases, gastric IHPs are asymptomatic and are found incidentally, these polyps may cause anemia secondary to chronic bleeding. Here, we report one case involving gastric IHP accompanied by chronic iron deficiency anemia that was successfully managed using endoscopic submucosal dissection. PMID:27099452

  15. Light propagation in paint and prostate human tissues using visible to mid-IR spectroscopy and imaging techniques

    NASA Astrophysics Data System (ADS)

    Ali, Jamal Hafiez

    The topic of the thesis is to understand the structural and molecular changes in scattering media for bio-medical applications such as animal, and human prostate tissues and non-biomedical applications such as corrosion and cracks beneath paint using steady and time-resolved light spectroscopy and imaging techniques in the visible to mid-IR spectral region. The thesis focuses also on understanding the randomization of coherence and polarization in thin scattering paint medium. Temporal polarization emission profiles of Fluorescein dye attached to different molecular weight ranging from 4 K to 500 K were measured. Images of an object containing varying molecular weight of Fluorescein dye embedded inside intralipid media were investigated. The non-invasive spectral polarization difference imaging and the fluorescence polarization difference imaging techniques using Cardio Green dye are introduced in the optical imaging studies to enhance the image quality. The measured transport length for prostate tissues using time-resolved pulse transmission is ℓtr = 0.86 mm. Four modeling samples of human rectum-membrane-prostate tissue were investigated using the near-infrared spectral polarization imaging technique to detect small foreign objects at different depths inside prostate tissues. The content of water in cancerous and normal human prostate tissues was shown to be different using near infrared spectroscopy and imaging techniques. The OH stretching vibrational overtone mode at 980 nm, 1195 nm, 1444 nm and other water overtone modes provide key spectroscopic fingerprints to detect non-invasively cancer in prostate tissue. The value of the transport length (ℓtr) for paint medium obtained from time-resolved pulse transmission, steady state, and degree of polarization measurements is 28mum, 34mu m, and 29mum, respectively. The correlation of time-resolved interference (coherence) and polarization in a scattering thin paint medium has been determined for the first time

  16. Abrogation of prostaglandin E-EP4 signaling in osteoblasts prevents the bone destruction induced by human prostate cancer metastases.

    PubMed

    Watanabe, Kenta; Tominari, Tsukasa; Hirata, Michiko; Matsumoto, Chiho; Maruyama, Takayuki; Murphy, Gillian; Nagase, Hideaki; Miyaura, Chisato; Inada, Masaki

    2016-09-01

    The metastasis of tumors to bone is known to be promoted by prostaglandin E2 (PGE2) produced by the tumor host stromal tissue. Although bone metastases frequently occur in prostate cancer patients, the significance of PGE2 in stromal responses to the tumor is not known. In this study, we report that PGE2 and its receptor EP4 play a pivotal role in bone destruction and metastasis in an experimental metastasis model of prostate cancer in nude mice. Using human prostate cancer PC-3 cells that are stably transfected with luciferase, we showed that the development of bone metastasis was accompanied by increased osteoclastic bone resorption in the bone metastasis microenvironment, and could be abrogated by an EP4 receptor antagonist. The growth of PC-3 cells in vitro was not influenced by PGE2 or by the EP4 receptor. However, cell-cell interactions between fixed PC-3 cells and host osteoblasts induced PGE2 production and RANKL expression in the osteoblasts. Addition of an EP4 antagonist suppressed both PGE2 and RANKL expression induced by the PC3-osteoblast interaction, which would have consequent effects on osteoclast activation and osteolysis. These results indicate that the blockage of PGE2-EP4 signaling prevents the bone destruction required for prostate cancer metastases, and that this is, in part due to the abrogation of bone cell responses. The study provides further evidence that an EP4 antagonist is a candidate for the treatment of prostate cancer in the blockade of bone metastasis. PMID:27450806

  17. β4-integrin-mediated cytotoxic activity of AexU in human prostate cancer PC3 cells.

    PubMed

    Kumano, Masafumi; Miyake, Hideaki; Abolghait, Said K; Behnsawy, Hosny M; Fujisawa, Masato

    2013-11-01

    The present study aimed to characterize the cytotoxic activity of AexU, an effector-mediating type three secretion system (TTSS) of gram-negative bacteria, in human prostate cancer cells, focusing on the association with β4-integrin expression. The cytotoxic effects of AexU either alone or in combination with chemotherapeutic agents were evaluated using several human prostate cancer cell lines. Human prostate cancer PC3 cells, in which an expression vector containing siRNA targeting β4-integrin had been introduced, were established (PC3/sh-In), and the cytotoxic effects of AexU on the PC3/sh-In cells were compared with the PC3 cells that were transfected with a control vector (PC3/C). The expression levels of β4-integrin in the PC3 cells were markedly higher compared with those in the LNCaP or DU145 cells, and the cytotoxic effects of AexU in the PC3 cells were more pronounced compared with those in the LNCaP or DU145 cells. The sensitivity of the PC3 cells to docetaxel and cisplatin was significantly enhanced following treatment with AexU, resulting in a decrease in the IC50 of the two agents by ~90%. The cytotoxic effect of AexU in the PC3/C cells was more marked compared with that in the PC3/sh-In cells, and the phosphorylation of Akt in the PC3/C cells appeared to be significantly more inhibited by the treatment with AexU compared with the PC3/sh-In cells. In conclusion, treatment with AexU may be a useful therapeutic option for prostate cancer when β4-integrin is overexpressed. The treatment appears to exert its effects through growth inhibition and by enhancing the sensitivity of the cancer cells to chemotherapeutic agents. PMID:24179545

  18. Dysregulation of cholesterol homeostasis in human prostate cancer through loss of ABCA1

    PubMed Central

    Lee, Byron H.; Taylor, Margaret G.; Robinet, Peggy; Smith, Jonathan D.; Schweitzer, Jessica; Sehayek, Ephraim; Falzarano, Sara M.; Magi-Galluzzi, Cristina; Klein, Eric A.; Ting, Angela H.

    2012-01-01

    Recent epidemiologic data show that low serum cholesterol level as well as statin use is associated with a decreased risk of developing aggressive or advanced prostate cancer, suggesting a role for cholesterol in aggressive prostate cancer development. Intracellular cholesterol promotes prostate cancer progression as a substrate for de novo androgen synthesis and through regulation of AKT signaling. By performing next-generation sequencing-based DNA methylome analysis, we have discovered marked hypermethylation at the promoter of the major cellular cholesterol efflux transporter, ABCA1, in LNCaP prostate cancer cells. ABCA1 promoter hypermethylation renders the promoter unresponsive to trans-activation and leads to elevated cholesterol levels in LNCaP. ABCA1 promoter hypermethylation is enriched in intermediate to high grade prostate cancers and not detectable in benign prostate. Remarkably, ABCA1 down-regulation is evident in all prostate cancers examined, and expression levels are inversely correlated with Gleason grade. Our results suggest cancer-specific ABCA1 hypermethylation and loss of protein expression direct high intracellular cholesterol levels and hence contribute to an environment conducive to tumor progression. PMID:23233737

  19. Pseudohyperplastic Adenocarcinoma With Foamy Changes in Needle Prostate Biopsy and Prostatectomy.

    PubMed

    Arista-Nasr, Julian; Barrañon-Martìnez, Isidoro; Aguilar-Ayala, Elizmara; Bornstein, Leticia; Trolle-Silva, Alicia; Aleman-Sanchez, Claudia Natalia; Martinez-Benitez, Braulio

    2016-09-01

    Pseudohyperplastic adenocarcinoma (PHA) with foamy changes is composed of neoplastic glands that show a cytoarchitectural combination of both neoplasms. However, none of the previously reported cases have shown typical areas of foamy or PHA. We report on the clinicopathological characteristics of 5 cases consisting predominantly of pseudohyperplastic and foamy adenocarcinomas. In several histological fields, this neoplasm mimicked hyperplastic nodules or prostatic adenosis because they showed the nodular pattern of the PHA and the inconspicuous cytological atypia of foamy gland carcinoma. Four cases had a Gleason score of 6. In the prostatectomies, the neoplasm was limited to the prostatic gland. The evolution has been favorable in all patients after 3 years of follow-up, on average. The cases reported herein demonstrate that PHA and foamy adenocarcinoma may be associated and occasionally show overlapping histological criteria. The PHA with foamy changes must be distinguished from conventional foamy adenocarcinoma and PHA because it can closely resemble hyperplastic glands mainly in needle prostatic biopsy. PMID:27020374

  20. Review of Prostate Anatomy and Embryology and the Etiology of Benign Prostatic Hyperplasia.

    PubMed

    Aaron, LaTayia; Franco, Omar E; Hayward, Simon W

    2016-08-01

    Prostate development follows a common pattern between species and depends on the actions of androgens to induce and support ductal branching morphogenesis of buds emerging from the urogenital sinus. The human prostate has a compact zonal anatomy immediately surrounding the urethra and below the urinary bladder. Rodents have a lobular prostate with lobes radiating away from the urethra. The human prostate is the site of benign hyperplasia, prostate cancer, and prostatitis. The rodent prostate has little naturally occurring disease. Rodents can be used to model aspects of human benign hyperplasia, but care should be taken in data interpretation and extrapolation to the human condition. PMID:27476121

  1. Cytotoxicity of obacunone and obacunone glucoside in human prostate cancer cells involves Akt-mediated programmed cell death.

    PubMed

    Murthy, Kotamballi N Chidambara; Jayaprakasha, Guddadarangavvanahally K; Patil, Bhimanagouda S

    2015-03-01

    Obacunone and obacunone glucoside (OG) are naturally occurring triterpenoids commonly found in citrus and other plants of the Rutaceae family. The current study reports the mechanism of cytotoxicity of citrus-derived obacunone and OG on human androgen-dependent prostate cancer LNCaP cells. Both limonoids exhibited time- and dose-dependent inhibition of cell proliferation, with more than 60% inhibition of cell viability at 100 μM, after 24 and 48 h. Analysis of fragmentation of DNA, activity of caspase-3, and cytosolic cytochrome-c in the cells treated with limonoids provided evidence for activation of programmed cell death by limonoids. Treatment of LNCaP cells with obacunone and OG resulted in dose-dependent changes in expression of proteins responsible for the induction of programmed cell death through the intrinsic pathway and down-regulation of Akt, a key molecule in cell signaling pathways. In addition, obacunone and OG also negatively regulated an inflammation-associated transcription factor, androgen receptor, and prostate-specific antigen, and activated proteins related to the cell cycle, confirming the ability of limonoids to induce cytotoxicity through multiple pathways. The results of this study provided, for the first time, an evidence of the cytotoxicity of obacunone and OG in androgen-dependent human prostate cancer cells. PMID:25592883

  2. Caffeic acid phenethyl ester suppresses the proliferation of human prostate cancer cells through inhibition of AMPK and Akt signaling networks

    PubMed Central

    Chuu, Chih-Pin; Lin, Hui-Ping; Ciaccio, Mark F.; Kokontis, John M.; Hause, Ronald J.; Hiipakka, Richard A.; Liao, Shutsung; Jones, Richard Baker

    2016-01-01

    Caffeic acid phenethyl ester (CAPE) is a bioactive component derived from honeybee hive propolis. CAPE has been shown to have anti-mitogenic, anti-carcinogenic, and other beneficial medicinal properties. Many of its effects have been shown to be mediated through its inhibition of NF-κB signaling pathways. We took a systematic approach to uncover CAPE’s effects from hours to days on the signaling networks in human prostate cancer cells. We observed that CAPE dosage-dependently suppressed the proliferation of LNCaP, DU-145, and PC-3 human prostate cancer cells. Administration of CAPE by gavage significantly inhibited the tumor growth of LNCaP xenografts in nude mice. Using LNCaP cells as a model system, we examined CAPE’s effect on gene expression, protein signaling, and transcriptional regulatory networks using Micro-Western Arrays and PCR arrays. We built a model of CAPE’s impact on cell signaling which suggested that it acted through inhibition of Akt-related protein signaling networks. Over-expression of Akt1 or cMyc, a downstream target of Akt signaling, significantly blocked the anti-proliferative effects of CAPE. In summary, our results suggest that CAPE administration may be useful as an adjuvant therapy for prostate and potentially other types of cancers that are driven by the AMPK and Akt signaling networks. PMID:22562408

  3. Combined Effects of Nonylphenol and Bisphenol A on the Human Prostate Epithelial Cell Line RWPE-1

    PubMed Central

    Gan, Weidong; Zhou, Ming; Xiang, Zou; Han, Xiaodong; Li, Dongmei

    2015-01-01

    The xenoestrogens nonylphenol (NP) and bisphenol A (BPA) are regarded as endocrine disrupting chemicals (EDCs) which have widespread occurrence in our daily life. In the present study, the purpose was to analyze the combined effects of NP and BPA on the human prostate epithelial cell line RWPE-1 using two mathematical models based on the Loewe additivity (LA) theory and the Bliss independence (BI) theory. RWPE-1 cells were treated with NP (0.01–100 µM) and BPA (1–5000 µM) in either a single or a combined format. A cell viability assay and lactate dehydrogenase (LDH) leakage rate assay were employed as endpoints. As predicted by the two models and based on the cell viability assay, significant synergism between NP and BPA were observed. However, based on the LDH assay, the trends were reversed. Given that environmental contaminants are frequently encountered simultaneously, these data indicated that there were potential interactions between NP and BPA, and the combined effects of the chemical mixture might be stronger than the additive values of individual chemicals combined, which should be taken into consideration for the risk assessment of EDCs. PMID:25874684

  4. Endothelin receptors and their cellular signal transduction mechanism in human cultured prostatic smooth muscle cells.

    PubMed

    Saita, Y; Koizumi, T; Yazawa, H; Morita, T; Takenaka, T; Honda, K

    1997-06-01

    1. Endothelin (ET) receptors, and their cellular signal transduction mechanism, were characterized in a primary culture of human prostatic smooth muscle cells (HP cell). 2. [125I]-ET-1 and [125I]-ET-3 binding studies revealed that both ETA and ETB receptors were present in the HP cells, and the ratio of ETA to ETB receptors was 1.4:1. 3. Analysis of ET receptor mRNA by reverse transcription-polymerase chain reaction also demonstrated that HP cells express both ETA and ETB receptors. 4. ET-1 and ET-3 increased intracellular free Ca2+ concentration ([Ca2+]i) in the HP cells in a concentration-dependent manner. Use of subtype selective antagonists BQ-123 and BQ-788, indicated that both ETA and ETB receptors were coupled to an increase in [Ca2+]i. 5. Pretreatment of the cells with pertussis toxin resulted in a significant but partial attenuation of the [Ca2+]i increase mediated through the ETA and ETB receptors. However, sensitivity to pertussis toxin (PTX) was significantly different between them. 6. In conclusion, HP cells possess ETA and ETB receptors. Further, these two endothelin receptor subtypes evoke an increase in [Ca2+]i possibly via the action of different GTP-binding proteins. PMID:9208135

  5. Anti-proliferative activity of 25-hydroxyvitamin D3 in human prostate cells.

    PubMed

    Munetsuna, Eiji; Kawanami, Rie; Nishikawa, Miyu; Ikeda, Shinnosuke; Nakabayashi, Sachie; Yasuda, Kaori; Ohta, Miho; Kamakura, Masaki; Ikushiro, Shinichi; Sakaki, Toshiyuki

    2014-02-15

    1α-Hydroxylation of 25-hydroxyvitamin D3 is believed to be essential for its biological effects. In this study, we evaluated the biological activity of 25(OH)D3 itself comparing with the effect of cell-derived 1α,25-dihydroxyvitamin D3 (1α,25(OH)2D3). First, we measured the cell-derived 1α,25(OH)2D3 level in immortalized human prostate cell (PZ-HPV-7) using [(3)H]-25(OH)D3. The effects of the cell-derived 1α,25(OH)2D3 on vitamin D3 24-hydroxylase (CYP24A1) mRNA level and the cell growth inhibition were significantly lower than the effects of 25(OH)D3 itself added to cell culture. 25-Hydroxyvitamin D3 1α-hydroxylase (CYP27B1) gene knockdown had no significant effects on the 25(OH)D3-dependent effects, whereas vitamin D receptor (VDR) gene knockdown resulted in a significant decrease in the 25(OH)D3-dependent effects. These results strongly suggest that 25(OH)D3 can directly bind to VDR and exerts its biological functions. DNA microarray and real-time RT-PCR analyses suggest that semaphorin 3B, cystatin E/M, and cystatin D may be involved in the antiproliferative effect of 25(OH)D3. PMID:24291609

  6. Antitumor Activity of Garcinol in Human Prostate Cancer Cells and Xenograft Mice.

    PubMed

    Wang, Yu; Tsai, Mei-Ling; Chiou, Li-Yu; Ho, Chi-Tang; Pan, Min-Hsiung

    2015-10-21

    Garcinol, which is isolated from fruit rinds of Garcinia indica, is a polyisoprenylated benzophenone. It has been studied for its antitumor activity by inducing apoptosis and inhibiting autophagy in human prostate cancer cells. The Bax/Bcl-2 ratio increased when garcinol was applied to PC-3 cells indicating a presence of apoptosis. Meanwhile, procaspases-9 and -3 were suppressed with attenuating PARP and DFF-45. Autophagy was inhibited through activating p-mTOR and p-PI3 Kinase/AKT by garcinol, which as a result induced the cells to apoptosis directly. In addition, the apoptosis effect of garcinol in a xenograft mouse model was also tested, suggesting a consistent result with PC-3 cell model. The tumor size was reduced more than 80 percent after the mouse accepted the garcinol treatment. Garcinol was demonstrated to have a strong antitumor activity through inhibiting autophagy and inducing apoptosis, which was discovered for the first time. Based on these findings, our data suggests that garcinol deserves further investigation as a potent chemopreventive agent. PMID:26442822

  7. Endothelin receptors and their cellular signal transduction mechanism in human cultured prostatic smooth muscle cells

    PubMed Central

    Saita, Yuji; Koizumi, Tomonobu; Yazawa, Hidenori; Morita, Takashi; Takenaka, Toichi; Honda, Kazuo

    1997-01-01

    Endothelin (ET) receptors, and their cellular signal transduction mechanism, were characterized in a primary culture of human prostatic smooth muscle cells (HP cell). [125I]-ET-1 and [125I]-ET-3 binding studies revealed that both ETA and ETB receptors were present in the HP cells, and the ratio of ETA to ETB receptors was 1.4:1. Analysis of ET receptor mRNA by reverse transcription-polymerase chain reaction also demonstrated that HP cells express both ETA and ETB receptors. ET-1 and ET-3 increased intracellular free Ca2+ concentration ([Ca2+]i) in the HP cells in a concentration-dependent manner. Use of subtype selective antagonists BQ-123 and BQ-788, indicated that both ETA and ETB receptors were coupled to an increase in [Ca2+]i. Pretreatment of the cells with pertussis toxin resulted in a significant but partial attenuation of the [Ca2+]i increase mediated through the ETA and ETB receptors. However, sensitivity to pertussis toxin (PTX) was significantly different between them. In conclusion, HP cells possess ETA and ETB receptors. Further, these two endothelin receptor subtypes evoke an increase in [Ca2+]i possibly via the action of different GTP-binding proteins. PMID:9208135

  8. The liver X receptor agonist T0901317 acts as androgen receptor antagonist in human prostate cancer cells

    SciTech Connect

    Chuu, Chih-pin; Chen, Rou-Yu; Hiipakka, Richard A.; Kokontis, John M.; Warner, Karen V.; Xiang, Jialing; Liao, Shutsung . E-mail: sliao@uchicago.edu

    2007-06-01

    T0901317 is a potent non-steroidal synthetic liver X receptor (LXR) agonist. T0901317 blocked androgenic stimulation of the proliferation of androgen-dependent LNCaP 104-S cells and androgenic suppression of the proliferation of androgen-independent LNCaP 104-R2 cells, inhibited the transcriptional activation of an androgen-dependent reporter gene by androgen, and suppressed gene and protein expression of prostate specific antigen (PSA), a target gene of androgen receptor (AR) without affecting gene and protein expression of AR. T0901317 also inhibited binding of a radiolabeled androgen to AR, but inhibition was much weaker compared to the effect of the antiandrogens, bicalutamide and hydroxyflutamide. The LXR agonist T0901317, therefore, acts as an antiandrogen in human prostate cancer cells.

  9. Pomegranate extract induces apoptosis in human prostate cancer cells by modulation of the IGF-IGFBP axis

    PubMed Central

    Koyama, Satomi; Cobb, Laura J; Mehta, Hemal H; Seeram, Navindra P.; Heber, David; Pantuck, Allan J.; Cohen, Pinchas

    2009-01-01

    The IGF axis is critical for the regulation of apoptosis in many human cancer cell lines. Recently, potent anti-tumorigenic effects of pomegranate juice and extracts have been reported. Consequently, pomegranate has potential not only as a treatment but also as a preventative measure against certain types of cancer, including prostate. In this study, we investigated the relationship between pomegranate-induced apoptosis in human prostate cancer cells and the IGF/IGFBP system. Treatment of LAPC4 prostate cancer cells with 10 μg/ml POMx, a highly potent pomegranate extract prepared from skin and arils minus seeds and standardized to ellagitannin content (37% punicalagins by HPLC), resulted in inhibition of cell proliferation and induction of apoptosis. Interestingly, co-treatment with POMx and IGFBP-3 revealed synergistic stimulation of apoptosis and additive inhibition of cell growth. Western blot analysis revealed that treatment with POMx or POMx/IGFBP-3 combination resulted in increased JNK phosphorylation, and decreased Akt and mTOR activation, consistent with a growth inhibitory, pro-apoptotic function. We also investigated the relationship between IGF-1 and pomegranate-induced apoptosis in 22RV1 prostate cancer cells. Co-treatment with 100 ng/ml IGF-1 completely blocked apoptosis induction by POMx. In contrast, IGF-I failed to inhibit POMx-induced apoptosis in R- cells, suggesting the importance of IGF-IR. POMx-treatment decreased Igf1 mRNA expression in a dose-dependent manner indicating that its actions also involve tumor-specific suppression of IGF-1. These studies revealed novel interactions between the IGF system and pomegranate-induced apoptosis. PMID:19853487

  10. Quantification of phase I / II metabolizing enzyme gene expression and polycyclic aromatic hydrocarbon-DNA adduct levels in human prostate

    PubMed Central

    John, Kaarthik; Ragavan, Narasimhan; Pratt, M. Margaret; Singh, Paras B.; Al-Buheissi, Salah; Matanhelia, Shyam S.; Phillips, David H.; Poirier, Miriam C.; Martin, Francis L.

    2008-01-01

    BACKGROUND Studies of migrant populations suggest that dietary and/or environmental factors play a crucial role in the aetiology of prostatic adenocarcinoma (CaP). The human prostate consists of the peripheral zone (PZ), transition zone (TZ) and central zone (CZ); CaP occurs most often in the PZ. METHODS To investigate the notion that an underlying differential expression of phase I/II genes, and/or the presence of polycyclic aromatic hydrocarbon (PAH)-DNA adducts might explain the elevated PZ susceptibility, we examined prostate tissues (matched tissue sets consisting of PZ and TZ) from men undergoing radical retropubic prostatectomy for CaP (n=26) or cystoprostatectomy (n=1). Quantitative gene expression analysis was employed for cytochrome P450 (CYP) isoforms CYP1A1, CYP1B1 and CYP1A2, as well as N-acetyltransferase 1 and 2 (NAT1 and NAT2) and catechol-O-methyl transferase (COMT). RESULTS CYP1B1, NAT1 and COMT were expressed in all tissue sets; levels of CYP1B1 and NAT1 were consistently higher in the PZ compared to TZ. Immunohistochemistry confirmed the presence of CYP1B1 (nuclear-associated and primarily in basal epithelial cells) and NAT1. Tissue sections from 23 of these aforementioned 27 matched tissue sets were analyzed for PAH-DNA adduct levels using antiserum elicited against DNA modified with r7, t8-dihydroxy-t-9,10-oxy-7,8,9,10-tetrahydro-benzo[a]pyrene (BPDE). PAH-DNA adduct levels were highest in glandular epithelial cells, but a comparison of PZ and TZ showed no significant differences. CONCLUSION Although expression of activating and/or detoxifying enzymes may be higher in the PZ, PAH-DNA adduct levels appear to be similar in both zones. Therefore, factors other than PAH-DNA adducts may be responsible for promotion of tumour formation in the human prostate. PMID:19143007

  11. Effect of lycopene isolated from Chlorella marina on proliferation and apoptosis in human prostate cancer cell line PC-3.

    PubMed

    Renju, G L; Muraleedhara Kurup, G; Bandugula, Venkata Reddy

    2014-11-01

    Even though the role of lycopene from tomato (trans form) in controlling prostate cancer was reported, lycopene (cis and trans 60:40) isolated from green algae Chlorella marina was not reported so far. The present study aimed to assess the anti-proliferative and apoptotic effect of lycopene from a new source and to compare the activity with available trans lycopene by using androgen-independent human prostate cancer cell lines. Exposure of PC-3 and DU-145 cell lines to algal lycopene (AL) at a dose of 20 and 50 μM significantly inhibited the growth and colony formation, and the percentage of inhibition was higher than tomatal lycopene (TL)-treated groups. The stability of AL in cell culture medium was high, when compared to TL under standard cell culture conditions. The level of lycopene was not detected in PC-3 cell lines cultured in medium lacking lycopene. Staining cells with acridine orange and ethidium bromide, the PC-3 control cells showed largely non-fragmented intact nucleoid. Stronger apoptosis signal was induced with higher concentrations (50 μM) of algal lycopene. Increased DNA damage was observed in AL- and TL-treated cells which appear as comet during single-cell gel electrophoresis. Flow cytometry results revealed that AL caused PC-3 cells to accumulate in the G0/G1 phase and to undergo apoptosis. The effect was higher in AL groups than TL-treated groups. Algal lycopene showed very significant anti-proliferative and apoptotic effect in human prostate cancer cell lines. Therefore, algal lycopene from C.marina would be recommended for the treatment of prostate cancer. PMID:25073513

  12. Expression and potential role of the peptide orexin-A in prostate cancer.

    PubMed

    Valiante, Salvatore; Liguori, Giovanna; Tafuri, Simona; Pavone, Luigi Michele; Campese, Roberto; Monaco, Roberto; Iachetta, Giuseppina; Assisi, Loredana; Mirabella, Nicola; Forte, Maurizio; Costagliola, Anna; Vittoria, Alfredo

    2015-09-01

    The peptides orexin-A and orexin-B and their G protein-coupled OX1 and OX2 receptors are involved in multiple physiological processes in the central nervous system and peripheral organs. Altered expression or signaling dysregulation of orexins and their receptors have been associated with a wide range of human diseases including narcolepsy, obesity, drug addiction, and cancer. Although orexin-A, its precursor molecule prepro-orexin and OX1 receptor have been detected in the human normal and hyperplastic prostate tissues, their expression and function in the prostate cancer (PCa) remains to be addressed. Here, we demonstrate for the first time the immunohistochemical localization of orexin-A in human PCa specimens, and the expression of prepro-orexin and OX1 receptor at both protein and mRNA levels in these tissues. Orexin-A administration to the human androgen-dependent prostate carcinoma cells LNCaP up-regulates OX1 receptor expression resulting in a decrease of cell survival. Noteworthy, nanomolar concentrations of the peptide counteract the testosterone-induced nuclear translocation of the androgen receptor in the cells: the orexin-A action is prevented by the addition of the OX1 receptor antagonist SB-408124 to the test system. These findings indicate that orexin-A/OX1 receptor interaction interferes with the activity of the androgen receptor which regulates PCa onset and progression, thus suggesting that orexin-A and its receptor might represent novel therapeutic targets to challenge this aggressive cancer. PMID:26220343

  13. Comparative Analysis of Metastasis Variants Derived from Human Prostate Carcinoma Cells

    PubMed Central

    Conn, Erin M.; Botkjaer, Kenneth A.; Kupriyanova, Tatyana A.; Andreasen, Peter A.; Deryugina, Elena I.; Quigley, James P.

    2009-01-01

    To analyze the process of tumor cell intravasation, we used the human tumor-chick embryo spontaneous metastasis model to select in vivo high (PC-hi/diss) and low (PC-lo/diss) disseminating variants from the human PC-3 prostate carcinoma cell line. These variants dramatically differed in their intravasation and dissemination capacities in both chick embryo and mouse spontaneous metastasis models. Concomitant with enhanced intravasation, PC-hi/diss exhibited increased angiogenic potential in avian and murine models. PC-hi/diss angiogenesis and intravasation were dependent on increased secretion of vascular endothelial growth factor (VEGF), since treating developing tumors with a function-blocking anti-VEGF antibody simultaneously inhibited both processes without affecting primary tumor growth. PC-hi/diss cells were also more migratory and invasive, suggestive of heightened ability to escape from primary tumors due to matrix-degrading activity. Consistent with this suggestion, PC-hi/diss cells produced more of the serine protease urokinase-type plasminogen activator (uPA) as compared with PC-lo/diss. The functional role of uPA in PC-hi/diss dissemination was confirmed by inhibition of invasion, angiogenesis, and intravasation with specific function-blocking antibodies that prevented uPA activation and blocked uPA activity. These processes were similarly sensitive to aprotinin, a potent inhibitor of serine proteases, including uPA-generated plasmin. Thus, our comparison of the PC-3 intravasation variants points to key roles for the uPA-plasmin system in PC-hi/diss intravasation, possibly via (1) promoting tumor cell matrix invasion and (2) facilitating development of VEGF-dependent angiogenic blood vessels. PMID:19729488

  14. Expression of Beta-Defensin 131 Promotes an Innate Immune Response in Human Prostate Epithelial Cells

    PubMed Central

    Kim, Hae Jong; Lee, Jaehyouk; Myung, Soon Chul

    2015-01-01

    Previously, using the Illumina HumanHT-12 microarray we found that β-defensin 131 (DEFB131), an antimicrobial peptide, is upregulated in the human prostate epithelial cell line RWPE-1 upon stimulation with lipoteichoic acid (LTA; a gram-positive bacterial component), than that in the untreated RWPE-1 cells. In the current study, we aimed to investigate the role of DEFB131 in RWPE-1 cells during bacterial infection. We examined the intracellular signaling pathways and nuclear responses in RWPE-1 cells that contribute to DEFB131 gene induction upon stimulation with LTA. Chromatin immunoprecipitation was performed to determine whether NF-κB directly binds to the DEFB131 promoter after LTA stimulation in RWPE-1 cells. We found that DEFB131 expression was induced by LTA stimulation through TLR2 and p38MAPK/NF-κB activation, which was evident in the phosphorylation of both p38MAPK and IκBα. We also found that SB203580 and Bay11-7082, inhibitors of p38MAPK and NF-κB, respectively, suppressed LTA-induced DEFB131 expression. The chromatin immunoprecipitation assay showed that NF-κB directly binds to the DEFB131 promoter, suggesting that NF-κB is a direct regulator, and is necessary for LTA-induced DEFB131 expression in RWPE-1 cells. Interestingly, with DEFB131 overexpression in RWPE-1 cells, the accumulation of mRNA and protein secretion of cytokines (IL-1α, IL-1β, IL-6, and IL-12α) and chemokines (CCL20, CCL22, and CXCL8) were significantly enhanced. In addition, DEFB131-transfected RWPE-1 cells markedly induced chemotactic activity in THP-1 monocytes. We concluded that DEFB131 induces cytokine and chemokine upregulation through the TLR2/NF-κB signaling pathway in RWPE-1 cells during bacterial infection and promotes an innate immune response. PMID:26649771

  15. PROSTATE AND ENDOCRINE DISRUPTION

    EPA Science Inventory

    This project offers the very distinct advantages of human relevance and enhanced susceptibility in the evaluation of environmental impacts on prostate development. The goal of this pilot project is to build a platform to evaluate the developmental origins of later life prostat...

  16. Discovery and horizontal follow-up of an autoantibody signature in human prostate cancer.

    PubMed

    Mintz, Paul J; Rietz, Anna Cecilia; Cardó-Vila, Marina; Ozawa, Michael G; Dondossola, Eleonora; Do, Kim-Anh; Kim, Jeri; Troncoso, Patricia; Logothetis, Christopher J; Sidman, Richard L; Pasqualini, Renata; Arap, Wadih

    2015-02-24

    In response to an urgent need for improved diagnostic and predictive serum biomarkers for management of metastatic prostate cancer, we used phage display fingerprinting to analyze sequentially acquired serum samples from a patient with advancing prostate cancer. We identified a peptide ligand, CTFAGSSC, demonstrating an increased recovery frequency over time. Serum antibody reactivity to this peptide epitope increased in the index patient, in parallel with development of deteriorating symptoms. The antigen mimicking the peptide epitope was identified as alpha-2-Heremans-Schmid glycoprotein, also known as fetuin-A. Metastatic prostate cancer cell lines and bone metastasis samples displayed robust fetuin-A expression, and we demonstrated serum immune reactivity to fetuin-A with concomitant development of metastatic castrate-resistant disease in a large cohort of prostate cancer patients. Whereas fetuin-A is an established tumor antigen in several types of cancer, including breast cancer, glioblastoma, and pancreas cancer, this report is to our knowledge the first study implicating fetuin-A in prostate cancer and indicating that autoantibodies specific for fetuin-A show utility as a prognostic indicator for prostate cancer patients prone to progress to metastatic disease. PMID:25675522

  17. MK591, a second generation leukotriene biosynthesis inhibitor, prevents invasion and induces apoptosis in the bone-invading C4-2B human prostate cancer cells: implications for the treatment of castration-resistant, bone-metastatic prostate cancer.

    PubMed

    Sarveswaran, Sivalokanathan; Ghosh, Ritisha; Morisetty, Shravan; Ghosh, Jagadananda

    2015-01-01

    Castration-resistant prostate cancer (CRPC) is a major clinical challenge for which no cure is currently available primarily because of the lack of proper understanding about appropriate molecular target(s). Previously we observed that inhibition of 5-lipoxygenase (5-Lox) activity induces apoptosis in some types of prostate cancer cells, suggesting an important role of 5-Lox in the viability of prostate cancer cells. However, nothing is known about the role of 5-Lox in the survival of castration-resistant, metastatic prostate cancer cells. Thus, we tested the effects of MK591, a second-generation, specific inhibitor of 5-Lox activity, on the viability and metastatic characteristics of CRPC cells. We observed that MK591 effectively kills the bone-invading C4-2B human prostate cancer cells (which bear characteristics of CRPC), but does not affect normal, non-cancer fibroblasts (which do not express 5-Lox) in the same experimental conditions. We also observed that MK591 dramatically inhibits the in vitro invasion and soft-agar colony formation of C4-2B cells. Interestingly, we found that treatment with MK591 dramatically down-regulates the expression of c-Myc and its targets at sub-lethal doses. In light of frequent over-activation of c-Myc in a spectrum of aggressive cancers (including CRPC), and the challenges associated with inhibition of c-Myc (because of its non-enzymatic nature), our novel findings of selective killing, and blockade of invasive and soft-agar colony-forming abilities of the castration-resistant, bone-metastatic C4-2B prostate cancer cells by MK591, open up a new avenue to attack CRPC cells for better management of advanced prostate cancer while sparing normal, non-cancer body cells. PMID:25875826

  18. Epidermal growth factor receptor-dependent stimulation of amphiregulin expression in androgen-stimulated human prostate cancer cells.

    PubMed Central

    Sehgal, I; Bailey, J; Hitzemann, K; Pittelkow, M R; Maihle, N J

    1994-01-01

    Amphiregulin is a heparin-binding epidermal growth factor (EGF)-related peptide that binds to the EGF receptor (EGF-R) with high affinity. In this study, we report a role for amphiregulin in androgen-stimulated regulation of prostate cancer cell growth. Androgen is known to enhance EGF-R expression in the androgen-sensitive LNCaP human prostate carcinoma cell line, and it has been suggested that androgenic stimuli may regulate proliferation, in part, through autocrine mechanisms involving the EGF-R. In this study, we demonstrate that LNCaP cells express amphiregulin mRNA and peptide and that this expression is elevated by androgenic stimulation. We also show that ligand-dependent EGF-R stimulation induces amphiregulin expression and that androgenic effects on amphiregulin synthesis are mediated through this EGF-R pathway. Parallel studies using the estrogen-responsive breast carcinoma cell line, MCF-7, suggest that regulation of amphiregulin by estrogen may also be mediated via an EGF-R pathway. In addition, heparin treatment of LNCaP cells inhibits androgen-stimulated cell growth further suggesting that amphiregulin can mediate androgen-stimulated LNCaP proliferation. Together, these results implicate an androgen-regulated autocrine loop composed of amphiregulin and its receptor in prostate cancer cell growth and suggest that the mechanism of steroid hormone regulation of amphiregulin synthesis may occur through androgen upregulation of the EGF-R and subsequent receptor-dependent pathways. Images PMID:8049525

  19. Skip Regulates TGF- β 1-Induced Extracellular Matrix Degrading Proteases Expression in Human PC-3 Prostate Cancer Cells.

    PubMed

    Villar, Victor; Kocic, Jelena; Santibanez, Juan F

    2013-01-01

    Purpose. To determine whether Ski-interacting protein (SKIP) regulates TGF- β 1-stimulated expression of urokinase-type plasminogen activator (uPA), matrix metalloproteinase-9 (MMP-9), and uPA Inhibitor (PAI-1) in the androgen-independent human prostate cancer cell model. Materials and Methods. PC-3 prostate cancer cell line was used. The role of SKIP was evaluated using synthetic small interference RNA (siRNA) compounds. The expression of uPA, MMP-9, and PAI-1 was evaluated by zymography assays, RT-PCR, and promoter transactivation analysis. Results. In PC-3 cells TGF- β 1 treatment stimulated uPA, PAI-1, and MMP-9 expressions. The knockdown of SKIP in PC-3 cells enhanced the basal level of uPA, and TGF- β 1 treatment inhibited uPA production. Both PAI-1 and MMP-9 production levels were increased in response to TGF- β 1. The ectopic expression of SKIP inhibited both TGF- β 1-induced uPA and MMP-9 promoter transactivation, while PAI-1 promoter response to the factor was unaffected. Conclusions. SKIP regulates the expression of uPA, PAI-1, and MMP-9 stimulated by TGF- β 1 in PC-3 cells. Thus, SKIP is implicated in the regulation of extracellular matrix degradation and can therefore be suggested as a novel therapeutic target in prostate cancer treatment. PMID:23766912

  20. Intratumor Cellular Heterogeneity and Alterations in ras Oncogene and p53 Tumor Suppressor Gene in Human Prostate Carcinoma

    PubMed Central

    Konishi, Noboru; Hiasa, Yoshio; Matsuda, Hirofumi; Tao, Ming; Tsuzuki, Toshihide; Hayashi, Isao; Kitahori, Yoshiteru; Shiraishi, Taizo; Yatani, Ryuichi; Shimazaki, Jun; Lin, Jung-Chung

    1995-01-01

    To assess the potential role of ras oncogene activation and P53 tumor suppressor gene mutations in the development of human prostate carcinoma, nine cases of histologically heterogeneous prostate tumors obtained from total prostatectomies were probed for these specific events. Each tumor was divided into 5 to 10 areas according to different growth or histological patterns. Targeted DNA sequences coding for ras and p53 were amplified by the polymerase chain reaction, analyzed by single-strand conformational polymorphisms, and confirmed by direct DNA sequencing. Point mutations of the ras gene were found in three of the nine tumors. Two contained K-ras codon 13 and H-ras codon 61 mutations, found in only one and three areas of each lesion, respectively. The third tumor contained two different point mutations in K-ras codons 13 and 61 in different foci of the sample. Loss of heterozygosity at the polymorphic codon 72 in the p53 gene was detected in two of four informative cases (50%) showing fragment cleavage by restriction fragment length polymorphism analysis. Mutations in p53, missense transversions, single base insertions, and two base deletions were also detected in three tumors. The present results reveal mutated ras and p53 occasionally occurring in small foci of the tumor and that genetic mutations in p53, as opposed to those in ras, are more closely associated with invasive growth of heterogeneous prostate carcinoma. ImagesFigure 1Figure 2Figure 3Figure 4Figure 5 PMID:7573356

  1. Colocalisation of CD9 and mortalin in CD9-induced mitotic catastrophe in human prostate cancer cells

    PubMed Central

    Zvereff, V; Wang, J-C; Shun, K; Lacoste, J; Chevrette, M

    2007-01-01

    CD9, a member of the tetraspanin family of proteins, is involved in a variety of cellular interactions with many other proteins and molecules. Although CD9 has been implicated in cell fusion, migration and cancer progression, the detailed function of this protein is not completely understood and likely depends on interactions with different protein partners, which are not yet all known. Using co-immunoprecipitation and mass-spectrometric protein sequencing, we have identified in prostate cancer cells, a novel CD9 partner, the 75-kDa protein HSPA9B, also known as mortalin. We further show that introduction and overexpression of wild-type CD9 into human PC-3 prostate cancer cells induces mitotic catastrophe. We also demonstrate, by immunocolocalisation studies, the interaction of CD9 and mortalin in PC-3 cells undergoing mitotic catastrophe. Our results not only identified mortalin as a new CD9 partner, but also clarify the mechanisms by which CD9 may control prostate cancer progression. PMID:17848953

  2. SPOCK1 promotes tumor growth and metastasis in human prostate cancer

    PubMed Central

    Chen, Qi; Yao, Yuan-ting; Xu, Huan; Chen, Yan-bo; Gu, Meng; Cai, Zhi-kang; Wang, Zhong

    2016-01-01

    Prostate cancer is the most diagnosed noncutaneous cancer and ranks as the second leading cause of cancer-related deaths in American males. Metastasis is the primary cause of prostate cancer mortality. Survival rate is only 28% for metastatic patients, but is nearly 100% for patients with localized prostate cancers. Molecular mechanisms that underlie this malignancy remain obscure, and this study investigated the role of SPARC/osteonectin, cwcv, and kazal-like domain proteoglycan 1 (SPOCK1) in prostate cancer progression. Initially, we found that SPOCK1 expression was significantly higher in prostate cancer tissues relative to noncancerous tissues. In particular, SPOCK1 expression was also markedly high in metastatic tissues compared with nonmetastatic cancerous tissues. SPOCK1 expression knockdown by specific short hairpin RNA in PC3 cells was significantly inhibited, whereas SPOCK1 overexpression in RWPE-1 cells promoted cell viability, colony formation in vitro, and tumor growth in vivo. Moreover, the SPOCK1 knockdown in PC3 cells was associated with cell cycle arrest in G0/G1 phase, while the SPOCK1 overexpression in RWPE-1 cells induced cell cycle arrest in S phase. The SPOCK1 knockdown in PC3 cells even increased cell apoptosis. SPOCK1 modulation was also observed to affect cancerous cell proliferation and apoptotic processes in the mouse model of prostate cancer. Additionally, the SPOCK1 knockdown decreased, whereas the SPOCK1 overexpression increased cell migration and invasion abilities in vitro. Injection of SPOCK1-depleted PC3 cells significantly decreased metastatic nodules in mouse lungs. These findings suggest that SPOCK1 is a critical mediator of tumor growth and metastasis in prostate cancer. PMID:27486308

  3. ILs-3, 6 and 11 increase, but ILs-10 and 24 decrease stemness of human prostate cancer cells in vitro

    PubMed Central

    Yu, Dandan; Zhong, Yali; Li, Xiaoran; Li, Yaqing; Li, Xiaoli; Cao, Jing; Fan, Huijie; Yuan, Yuan; Ji, Zhenyu; Qiao, Baoping; Wen, Jian-Guo; Zhang, Mingzhi; Kvalheim, Gunnar; Nesland, Jahn M.; Suo, Zhenhe

    2015-01-01

    Cancer stem cells (CSCs) are associated with cancer recurrence and metastasis. Prostate cancer cells often metastasize to the bone with a complex microenvironment of cytokines favoring cell survival. In this study, the cell stemness influence of a group of interleukins including IL-3, 6, 10, 11 and 24 on human prostate cancer cell lines LNCaP and PC-3 was explored in vitro. Sulforhodamine B(SRB) and 5-ethynyl-2′-deoxyuridine (EdU) assays were applied to examine the effect on cell proliferation, and wound healing and transwell assays were used for migration and invasion studies, in addition to colony formation, Western blotting and flowcytometry for the expression of stemness factors and chemotherapy sensitivity. We observed that ILs-3, 6 and 11 stimulated while ILs-10 and 24 inhibited the growth, invasion and migration of both cell lines. Interestingly, ILs-3, 6 and 11 significantly promoted colony formation and increased the expression of SOX2, CD44 and ABCG2 in both prostate cancer cell lines. However, ILs-10 and 24 showed the opposite effect on the expression of these factors. In line with the above findings, treatment with either IL-3 or IL-6 or IL-11 decreased the chemosensitivity to docetaxel while treatment with either IL-10 or IL-24 increased the sensitivity of docetaxel chemotherapy. In conclusion, our results suggest that ILs-3, 6 and 11 function as tumor promoters while ILs-10 and 24 function as tumor suppressors in the prostate cancer cell lines PC-3 and LNCaP in vitro, and such differences may attribute to their different effect on the stemness of PCa cells. PMID:26528857

  4. Prostate cancer

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/000380.htm Prostate cancer To use the sharing features on this page, please enable JavaScript. Prostate cancer is cancer that starts in the prostate gland. ...

  5. Prostate brachytherapy

    MedlinePlus

    Implant therapy - prostate cancer; Radioactive seed placement; Internal radiation therapy - prostate; High dose radiation (HDR) ... CT scan to plan and then place the seeds that deliver radiation into your prostate. The seeds ...

  6. Prostatitis - bacterial

    MedlinePlus

    ... or tender scrotum The provider may perform a digital rectal exam to examine your prostate. During this ... samples may be collected for urinalysis and urine culture . Prostatitis may affect the results of the prostate- ...

  7. Enlarged prostate

    MedlinePlus

    ... doctor if you should still take it. SURGERY Prostate surgery may be recommended if you have: Incontinence Recurrent ... of your prostate gland. Most men who have prostate surgery have improvement in urine flow rates and symptoms. ...

  8. The Prostate

    MedlinePlus

    ... Renal Cell) Cancer Leukemia Lung Cancer Lymphoma Pancreatic Cancer Prostate Cancer Skin Cancer Thyroid Cancer Uterine Cancer All ... Publications Reports What You Need To Know About™ Prostate Cancer This booklet is about prostate cancer. Learning about ...

  9. Enlarged prostate

    MedlinePlus

    BPH; Benign prostatic hyperplasia (hypertrophy); Prostate - enlarged ... The actual cause of prostate enlargement is unknown. Factors linked to aging and changes in the cells of the testicles may have a role in the growth ...

  10. Long non-coding RNA ATB promotes growth and epithelial-mesenchymal transition and predicts poor prognosis in human prostate carcinoma.

    PubMed

    Xu, Song; Yi, Xiao-Ming; Tang, Chao-Peng; Ge, Jing-Ping; Zhang, Zheng-Yu; Zhou, Wen-Quan

    2016-07-01

    Long non-coding RNAs (lncRNAs) have been identified to be critical mediators in various tumors associated with cancer progression. Long non-coding RNA activated by TGF-β (lncRNA-ATB) is a stimulator of epithelial-mesenchymal transition (EMT) and serves as a novel prognostic biomarker for hepatocellular carcinoma. However, the biological role and clinical significance of lncRNA-ATB in human prostate cancer have yet to be fully elucidated. The present study was designed to explore the expression of lncRNA-ATB in human prostate cancer patients and the role of lncRNA-ATB in prostate cancer cells. We showed that lncRNA-ATB expression was significantly upregulated in tumor tissues in patients with prostate cancer in comparison with adjacent non-tumor tissues. Further analysis indicted that high lncRNA-ATB expression may be an independent prognostic factor for biochemical recurrence (BCR)-free survival in prostate cancer patients. Overexpression of lncRNA-ATB promoted, and knockdown of lncRNA-ATB inhibited the growth of prostate cancer cells via regulations of cell cycle regulatory protein expression levels. In addition, lncRNA-ATB stimulated epithelial-mesenchymal transition (EMT) associated with ZEB1 and ZNF217 expression levels via ERK and PI3K/AKT signaling pathways. These results indicated that lncRNA-ATB may be considered as a new predictor in the clinical prognosis of patients with prostate cancer. Overexpression of lncRNA-ATB exerts mitogenic and EMT effects of prostate cancer via activation of ERK and PI3K/AKT signaling pathways. PMID:27176634

  11. Differential vitamin D 24-hydroxylase/CYP24A1 gene promoter methylation in endothelium from benign and malignant human prostate

    PubMed Central

    Karpf, Adam R; Omilian, Angela R; Bshara, Wiam; Tian, Lili; Tangrea, Michael A; Morrison, Carl D; Johnson, Candace S

    2011-01-01

    Epigenetic alterations occur in tumor-associated vessels in the tumor microenvironment. Methylation of the CYP24A1 gene promoter differs in endothelial cells isolated from tumors and non-tumor microenvironments in mice. The epigenetic makeup of endothelial cells of human tumor-associated vasculature is unknown due to difficulty of isolating endothelial cells populations from a heterogeneous tissue microenvironment. To ascertain CYP24A1 promoter methylation in tumor-associated endothelium, we utilized laser microdissection guided by CD31 immunohistochemistry to procure endothelial cells from human prostate tumor specimens. Prostate tissues were obtained following robotic radical prostatectomy from men with clinically localized prostate cancer. Adjacent histologically benign prostate tissues were used to compare endothelium from benign versus tumor microenvironments. Sodium bisulfite sequencing of CYP24A1 promoter region showed that the average CYP24A1 promoter methylation in the endothelium was 20% from the tumor microenvironment compared with 8.2% in the benign microenvironment (p < 0.05). A 2-fold to 17-fold increase in CYP24A1 promoter methylation was observed in the prostate tumor endothelium compared with the matched benign prostate endothelium in four patient samples, while CYP24A1 promoter methylation remained unchanged in two patient samples. In addition, there is no correlation of the level of CYP24A1 promoter methylation in prostate tumor-associated endothelium with that of epithelium/stroma. This study demonstrates that the CYP24A1 promoter is methylated in tumor-associated endothelium, indicating that epigenetic alterations in CYP24A1 may play a role in determining the phenotype of tumor-associated vasculature in the prostate tumor microenvironment. PMID:21725204

  12. Long non-coding RNA ATB promotes growth and epithelial-mesenchymal transition and predicts poor prognosis in human prostate carcinoma

    PubMed Central

    XU, SONG; YI, XIAO-MING; TANG, CHAO-PENG; GE, JING-PING; ZHANG, ZHENG-YU; ZHOU, WEN-QUAN

    2016-01-01

    Long non-coding RNAs (lncRNAs) have been identified to be critical mediators in various tumors associated with cancer progression. Long non-coding RNA activated by TGF-β (lncRNA-ATB) is a stimulator of epithelial-mesenchymal transition (EMT) and serves as a novel prognostic biomarker for hepatocellular carcinoma. However, the biological role and clinical significance of lncRNA-ATB in human prostate cancer have yet to be fully elucidated. The present study was designed to explore the expression of lncRNA-ATB in human prostate cancer patients and the role of lncRNA-ATB in prostate cancer cells. We showed that lncRNA-ATB expression was significantly upregulated in tumor tissues in patients with prostate cancer in comparison with adjacent non-tumor tissues. Further analysis indicted that high lncRNA-ATB expression may be an independent prognostic factor for biochemical recurrence (BCR)-free survival in prostate cancer patients. Overexpression of lncRNA-ATB promoted, and knockdown of lncRNA-ATB inhibited the growth of prostate cancer cells via regulations of cell cycle regulatory protein expression levels. In addition, lncRNA-ATB stimulated epithelial-mesenchymal transition (EMT) associated with ZEB1 and ZNF217 expression levels via ERK and PI3K/AKT signaling pathways. These results indicated that lncRNA-ATB may be considered as a new predictor in the clinical prognosis of patients with prostate cancer. Overexpression of lncRNA-ATB exerts mitogenic and EMT effects of prostate cancer via activation of ERK and PI3K/AKT signaling pathways. PMID:27176634

  13. VHF-induced thermoacoustic imaging of fresh human prostates using a clinical ultrasound transducer array

    NASA Astrophysics Data System (ADS)

    Patch, S. K.; See, W. A.

    2016-03-01

    The purpose of this work was to demonstrate that a clinical ultrasound transducer array can practically detect thermoacoustic pulses induced by irradiation by very high frequency (VHF) electromagnetic energy. This is an important step because thermoacoustic signal strength is directly proportional to the specific absorption rate (SAR), which is lower in the VHF regime than in microwave or optical regimes. A 96-channel transducer array (P4-1) providing 3 cm coverage was incorporated into a benchtop thermoacoustic imaging system for imaging fresh surgical specimens. Thermoacoustic signal was generated by 700 ns irradiation pulses with 11 kV/m electric field strength and 108 MHz carrier frequency. To improve SNR 1024 pulses were averaged at a 250 Hz repetition rate. Two sets of sinograms were acquired, separated by a 2 cm translation along the tomographic axis and reconstructed over a 6 x 6 x 5 cm3 volume. Contrast and in-plane resolution were measured by imaging a homogeneous cylindrical phantom and an 80- micron wire designed to highlight E-field polarization effects. FWHM of the in-plane point spread function varied from 250 microns to 1.1 mm, depending upon transducer used and phantom orientation relative to the electric field. Several fresh human prostates were imaged immediately after surgery. Rudimentary comparison to histology was performed and volumetric reconstruction of the multi-channel P4-1 data visualizes anatomic features that are rarely seen in ultrasound, CT, or MRI. The single element transducer provided superior image contrast, but with inferior resolution.

  14. Regulation of Erk1/2 activation by osteopontin in PC3 human prostate cancer cells

    PubMed Central

    2010-01-01

    Background Osteopontin (OPN) has been shown to play many roles in the progression of cancer. We have recently demonstrated the activation of Akt by OPN. Integrin-linked kinase and PI3-kinase are integral proteins in OPN/AKT pathway in PC3 cells. To investigate the role of the extracellular receptors in OPN signaling, we have examined the spatio-temporal regulation of CD44 and integrin αvβ3 receptor in OPN-induced Akt activation in PC3 cells. Results Here, our studies demonstrate that OPN can activate Akt either through the αVβ3 integrin or the CD44 cell surface receptor. Members of the Mitogen Activated Protein Kinase (MAPK) family have been shown to be up-regulated in a variety of human cancers and have been implicated in the metastatic behavior. Our studies have demonstrated an increase in the phosphorylation of c-Raf at Ser259 and Ser338 in PC3 cells over-expressing OPN. This increase matches up with the Erk1/2 phosphorylation at Thr202/204 and activation. However, the inhibition of Akt activity augments the phosphorylation state of ERK1/2 to two to three fold with a concomitant reduction in the phosphorylation state of c-Raf at Ser259. Conclusions Regulation c-Raf phosphorylation at Ser259 has a role in the anti-apoptotic pathways mediated by Akt or Raf/MEK/ERK proteins. OPN may have dual effects in the activation of Erk1/2. We propose this based on the observations that while OPN activates c-Raf and Erk1/2; it also acts to inhibit c-Raf and Erk1/2 activation through Akt pathway. Our observations suggest that the activation of c-Raf-ERK cascade may promote cell cycle arrest in prostate cancer cells and OPN signaling has a role in the anti-apoptotic mechanism. PMID:20868520

  15. MPC1, a key gene in cancer metabolism, is regulated by COUPTFII in human prostate cancer

    PubMed Central

    Wang, Leiming; Xu, Mafei; Qin, Jun; Lin, Shih-Chieh; Lee, Hui-Ju; Tsai, Sophia Y.; Tsai, Ming-Jer

    2016-01-01

    Mitochondrial pyruvate carrier 1 (MPC1) and MPC 2 form a transporter complex in cells to control pyruvate transportation into mitochondria. Reduced expression of MPC1 disrupts the transporter function, induces metabolic shift to increase glycolysis, and thus plays important roles in several diseases, including cancer. However, the role of MPC1 in prostate cancer and the underlying mechanism causing the down-regulation of MPC1 in tumor cells remain to be defined. Here, we show that MPC1 serves as a critical regulator of glycolysis in prostate cancer cells, which in turn controls cancer cell growth, invasion, and the tumorigenic capability. More importantly, we identified that chicken ovalbumin upstream promoter-transcription factor II (COUP-TFII), a steroid receptor superfamily member, transcriptionally regulates the expression of MPC1. We further demonstrate that COUP-TFII, which is upregulated in the prostate cancer patient, regulates MPC1 and glycolysis to promote tumor growth and metastasis. Our findings reveal that COUP-TFII represses MPC1 expression in prostate cancer cells to facilitate a metabolism switch to increase glycolysis and promote cancer progression. This observation raises an intriguing possibility of targeting COUP-TFII to modulate cancer cell metabolism for prostate cancer intervention. PMID:26895100

  16. Subditine, a New Monoterpenoid Indole Alkaloid from Bark of Nauclea subdita (Korth.) Steud. Induces Apoptosis in Human Prostate Cancer Cells

    PubMed Central

    Liew, Sook Yee; Looi, Chung Yeng; Paydar, Mohammadjavad; Cheah, Foo Kit; Leong, Kok Hoong; Wong, Won Fen; Mustafa, Mohd Rais; Litaudon, Marc; Awang, Khalijah

    2014-01-01

    In this study, a new apoptotic monoterpenoid indole alkaloid, subditine (1), and four known compounds were isolated from the bark of Nauclea subdita. Complete 1H- and 13C- NMR data of the new compound were reported. The structures of isolated compounds were elucidated with various spectroscopic methods such as 1D- and 2D- NMR, IR, UV and LCMS. All five compounds were screened for cytotoxic activities on LNCaP and PC-3 human prostate cancer cell-lines. Among the five compounds, the new alkaloid, subditine (1), demonstrated the most potent cell growth inhibition activity and selective against LNCaP with an IC50 of 12.24±0.19 µM and PC-3 with an IC50 of 13.97±0.32 µM, compared to RWPE human normal epithelial cell line (IC50 = 30.48±0.08 µM). Subditine (1) treatment induced apoptosis in LNCaP and PC-3 as evidenced by increased cell permeability, disruption of cytoskeletal structures and increased nuclear fragmentation. In addition, subditine (1) enhanced intracellular reactive oxygen species (ROS) production, as reflected by increased expression of glutathione reductase (GR) to scavenge damaging free radicals in both prostate cancer cell-lines. Excessive ROS could lead to disruption of mitochondrial membrane potential (MMP), release of cytochrome c and subsequent caspase 9, 3/7 activation. Further Western blot analyses showed subditine (1) induced down-regulation of Bcl-2 and Bcl-xl expression, whereas p53 was up-regulated in LNCaP (p53-wild-type), but not in PC-3 (p53-null). Overall, our data demonstrated that the new compound subditine (1) exerts anti-proliferative effect on LNCaP and PC-3 human prostate cancer cells through induction of apoptosis. PMID:24551054

  17. LET-Dependent Bystander Effects Caused by Irradiation of Human Prostate Carcinoma Cells with X Rays or Alpha Particles

    PubMed Central

    Anzenberg, Vered; Chandiramani, Sarika; Coderre, Jeffrey A.

    2014-01-01

    Radiation-induced bystander effects have been demonstrated in both normal and tumor cells using a variety of different radiation qualities. Literature reports are contradictory, however, on whether there is an LET dependence of the bystander effect. This study investigated the ability of DU-145 human prostate carcinoma cells irradiated with either α particles or 250 kVp X rays to cause medium-mediated bystander effects in unirradiated populations of DU-145 cells or in AG01522 human fibroblasts. The end points measured in both of the bystander cell lines were micronucleus formation, γ-H2AX focus induction, and the surviving fraction. The incidence of micronuclei increased 1.5–2.0-fold in both tumor and fibroblast bystander cells after 4 h of co-culture with DU-145 tumor cells that had been directly irradiated with either α particles or X rays. Only the AG01522 fibroblasts showed bystander effects for the γ-H2AX focus (a 1.5-fold increase) and surviving fraction (a decrease to 0.8) end points when co-cultured with X-irradiated tumor cells. Alpha-particle irradiation of DU-145 tumor cells produced no decrease in the surviving fraction and no increase in γ-H2AX focus induction in co-cultured bystander cells of either cell line. These results indicate that there are LET-dependent differences in the signal released from DU-145 human prostate carcinoma cells and that, for some end points, bystander AG01522 fibroblasts and bystander DU-145 prostate carcinoma cells respond differently to the same medium-mediated signal. PMID:19024654

  18. Effect of urokinase on the proliferation of primary cultures of human prostatic cells

    SciTech Connect

    Kirchheimer, J.C.; Wojta, J.; Hienert, G.; Christ, G.; Heger, M.E.; Pflueger, H.B.; Binder, B.R.

    1987-11-01

    The effects of exogenously added urokinase type plasminogen activator, tissue type plasminogen activator, plasmin and thrombin on the proliferation of primary cultures of cells derived from prostatic hyperplasia or prostatic carcinomas were investigated by measuring the incorporation of /sup 3/H-thymidine into the cultures. Addition of urokinase type plasminogen activator (1.35 x 10(-9) M) or thrombin (10(-7) M) to the culture medium caused a two-fold increase of /sup 3/H-thymidine incorporation, regardless of the origin of the prostatic cells. Tissue type plasminogen activator did not alter the rate of /sup 3/H-thymidine incorporation, whereas plasmin caused a 25% decrease of /sup 3/H-thymidine incorporation in all cultures.

  19. Oxidative phosphorylation and mitochondrial function differ between human prostate tissue and cultured cells.

    PubMed

    Schöpf, Bernd; Schäfer, Georg; Weber, Anja; Talasz, Heribert; Eder, Iris E; Klocker, Helmut; Gnaiger, Erich

    2016-06-01

    Altered mitochondrial metabolism plays a pivotal role in the development and progression of various diseases, including cancer. Cell lines are frequently used as models to study mitochondrial (dys)function, but little is known about their mitochondrial respiration and metabolic properties in comparison to the primary tissue of origin. We have developed a method for assessment of oxidative phosphorylation in prostate tissue samples of only 2 mg wet weight using high-resolution respirometry. Reliable protocols were established to investigate the respiratory activity of different segments of the mitochondrial electron transfer system (ETS) in mechanically permeabilized tissue biopsies. Additionally, the widely used immortalized prostate epithelial and fibroblast cell lines, RWPE1 and NAF, representing the major cell types in prostate tissue, were analyzed and compared to the tissue of origin. Our results show that mechanical treatment without chemical permeabilization agents or sample processing constitutes a reliable preparation method for OXPHOS analysis in small amounts of prostatic tissue typically obtained by prostate biopsy. The cell lines represented the bioenergetic properties of fresh tissue to a limited extent only. Particularly, tissue showed a higher oxidative capacity with succinate and glutamate, whereas pyruvate was a substrate supporting significantly higher respiratory activities in cell lines. Several fold higher zinc levels measured in tissue compared to cells confirmed the role of aconitase for prostate-specific metabolism in agreement with observed respiratory properties. In conclusion, combining the flexibility of cell culture models and tissue samples for respirometric analysis are powerful tools for investigation of mitochondrial function and tissue-specific metabolism. PMID:27060259

  20. Use of macrophages to target therapeutic adenovirus to human prostate tumors.

    PubMed

    Muthana, Munitta; Giannoudis, Athina; Scott, Simon D; Fang, Hsin-Yu; Coffelt, Seth B; Morrow, Fiona J; Murdoch, Craig; Burton, Julian; Cross, Neil; Burke, Bernard; Mistry, Roshna; Hamdy, Freddie; Brown, Nicola J; Georgopoulos, Lindsay; Hoskin, Peter; Essand, Magnus; Lewis, Claire E; Maitland, Norman J

    2011-03-01

    New therapies are required to target hypoxic areas of tumors as these sites are highly resistant to conventional cancer therapies. Monocytes continuously extravasate from the bloodstream into tumors where they differentiate into macrophages and accumulate in hypoxic areas, thereby opening up the possibility of using these cells as vehicles to deliver gene therapy to these otherwise inaccessible sites. We describe a new cell-based method that selectively targets an oncolytic adenovirus to hypoxic areas of prostate tumors. In this approach, macrophages were cotransduced with a hypoxia-regulated E1A/B construct and an E1A-dependent oncolytic adenovirus, whose proliferation is restricted to prostate tumor cells using prostate-specific promoter elements from the TARP, PSA, and PMSA genes. When such cotransduced cells reach an area of extreme hypoxia, the E1A/B proteins are expressed, thereby activating replication of the adenovirus. The virus is subsequently released by the host macrophage and infects neighboring tumor cells. Following systemic injection into mice bearing subcutaneous or orthotopic prostate tumors, cotransduced macrophages migrated into hypoxic tumor areas, upregulated E1A protein, and released multiple copies of adenovirus. The virus then infected neighboring cells but only proliferated and was cytotoxic in prostate tumor cells, resulting in the marked inhibition of tumor growth and reduction of pulmonary metastases. This novel delivery system employs 3 levels of tumor specificity: the natural "homing" of macrophages to hypoxic tumor areas, hypoxia-induced proliferation of the therapeutic adenovirus in host macrophages, and targeted replication of oncolytic virus in prostate tumor cells. PMID:21233334

  1. Selective cell cycle arrest and induction of apoptosis in human prostate cancer cells by a polyphenol-rich extract of Solanum nigrum

    PubMed Central

    NAWAB, AKBAR; THAKUR, VIJAY S.; YUNUS, MOHAMMAD; MAHDI, ABBAS ALI; GUPTA, SANJAY

    2012-01-01

    Progression of prostate cancer is associated with escape of tumor cells from cell cycle arrest and apoptosis. Agents capable of selectively eliminating cancer cells by cell cycle arrest and/or induction of apoptosis offer a highly desirable approach. Here we demonstrate that a polyphenolic extract derived from ripe berries of Solanum nigrum (SN) differentially causes cell cycle arrest and apoptosis in various human prostate cancer cells without affecting normal prostate epithelial cells. Virally transformed normal human prostate epithelial PZ-HPV-7 cells and their cancer counterpart CA-HPV-10 cells, were used to evaluate the growth-inhibitory effects of the SN extract. SN treatment (5–20 μg/ml) of PZ-HPV-7 cells resulted in growth inhibitory responses of low magnitude. In sharp contrast, SN treatment of CA-HPV-10 cells increased cytotoxicity, decreased cell viability and induced apoptosis. Similar results were noted in the human prostate cancer LNCaP, 22Rv1, DU145 and PC-3 cell lines, where significant reductions in cell viability and induction of apoptosis was observed in all these cells, an effect independent of disease stage and androgen association. Cell cycle analysis revealed that SN treatment (5–20 μg/ml) resulted in a dose-dependent G2/M phase arrest and subG1 accumulation in the CA-HPV-10 but not in the PZ-HPV-7 cell line. Our results, for the first time, demonstrate that the SN extract is capable of selectively inhibiting cellular proliferation and accelerating apoptotic events in prostate cancer cells. SN may be developed as a promising therapeutic and/or preventive agent against prostate cancer. PMID:22076244

  2. Selective cell cycle arrest and induction of apoptosis in human prostate cancer cells by a polyphenol-rich extract of Solanum nigrum.

    PubMed

    Nawab, Akbar; Thakur, Vijay S; Yunus, Mohammad; Ali Mahdi, Abbas; Gupta, Sanjay

    2012-02-01

    Progression of prostate cancer is associated with escape of tumor cells from cell cycle arrest and apoptosis. Agents capable of selectively eliminating cancer cells by cell cycle arrest and/or induction of apoptosis offer a highly desirable approach. Here we demonstrate that a polyphenolic extract derived from ripe berries of Solanum nigrum (SN) differentially causes cell cycle arrest and apoptosis in various human prostate cancer cells without affecting normal prostate epithelial cells. Virally transformed normal human prostate epithelial PZ-HPV-7 cells and their cancer counterpart CA-HPV-10 cells, were used to evaluate the growth-inhibitory effects of the SN extract. SN treatment (5-20 µg/ml) of PZ-HPV-7 cells resulted in growth inhibitory responses of low magnitude. In sharp contrast, SN treatment of CA-HPV-10 cells increased cytotoxicity, decreased cell viability and induced apoptosis. Similar results were noted in the human prostate cancer LNCaP, 22Rv1, DU145 and PC-3 cell lines, where significant reductions in cell viability and induction of apoptosis was observed in all these cells, an effect independent of disease stage and androgen association. Cell cycle analysis revealed that SN treatment (5-20 µg/ml) resulted in a dose-dependent G2/M phase arrest and subG1 accumulation in the CA-HPV-10 but not in the PZ-HPV-7 cell line. Our results, for the first time, demonstrate that the SN extract is capable of selectively inhibiting cellular proliferation and accelerating apoptotic events in prostate cancer cells. SN may be developed as a promising therapeutic and/or preventive agent against prostate cancer. PMID:22076244

  3. Quercetin inhibits angiogenesis through thrombospondin-1 upregulation to antagonize human prostate cancer PC-3 cell growth in vitro and in vivo.

    PubMed

    Yang, Feiya; Jiang, Xian; Song, Liming; Wang, Huiping; Mei, Zhu; Xu, Zhiqing; Xing, Nianzeng

    2016-03-01

    The rapid growth, morbidity and mortality of prostate cancer, and the lack of effective treatment have attracted great interests of researchers to find novel cancer therapies aiming to inhibit angiogenesis and tumor growth. Quercetin is a flavonoid compound that widely exists in the nature. Our previous study preliminarily demonstrated that quercetin effectively inhibited human prostate cancer cell xenograft tumor growth by inhibiting angiogenesis. Thrombospondin-1 (TSP-1) is the first reported endogenous anti-angiogenic factor that can inhibit angiogenesis and tumorigenesis. However, the relationship between quercetin inhibiting angiogenesis and TSP-1 upregulation in prostate cancer has not been determined. Thus, we explored the important role of TSP-1 upregulation in reducing angiogenesis and anti-prostate cancer effect of quercetin both in vitro and in vivo for the first time. After the selected doses were used for a certain time, quercetin i) significantly inhibited PC-3 and human umbilical vein endothelial cells (HUVECs) proliferation, migration and invasion in a dose-dependent manner; ⅱ) effectively inhibited prostate cancer PC-3 cell xenograft tumor growth by 37.5% with 75 mg/kg as compared to vehicle control group, more effective than 25 (22.85%) and 50 mg/kg (29.6%); ⅲ) was well tolerated by BALB/c mice and no obvious toxic reactions were observed; ⅳ) greatly reduced angiogenesis and led to higher TSP-1 protein and mRNA expression both in vitro and in vivo in a dose-dependent manner. Therefore, quercetin could increase TSP-1 expression to inhibit angiogenesis resulting in antagonizing prostate cancer PC-3 cell and xenograft tumor growth. The present study can lay a good basis for the subsequent concrete mechanism study and raise the possibility of applying quercetin to clinical for human prostate cancer in the near future. PMID:26676551

  4. Naftopidil, a novel alpha1-adrenoceptor antagonist, displays selective inhibition of canine prostatic pressure and high affinity binding to cloned human alpha1-adrenoceptors.

    PubMed

    Takei, R; Ikegaki, I; Shibata, K; Tsujimoto, G; Asano, T

    1999-04-01

    The pharmacological profiles of the alpha1-adrenoceptor antagonists naftopidil, tamsulosin and prazosin were studied in an anesthetized dog model that allowed the simultaneous assessment of their antagonist potency against phenylephrine-mediated increases in prostatic pressure and mean blood pressure. The intravenous administration of each of these compounds dose-dependently inhibited phenylephrine-induced increases in prostatic pressure and mean blood pressure. To further assess the ability of the three compounds to inhibit phenylephrine-induced responses, the doses required to produce a 50% inhibition of the phenylephrine-induced increases in prostatic and mean blood pressure and the selectivity index obtained from the ratio of those two doses were determined for each test compound. Forty minutes after the intravenous administration of naftopidil, the selectivity index was 3.76, and those of tamsulosin and prazosin were 1.23 and 0.61, respectively. These findings demonstrated that naftopidil selectively inhibited the phenylephrine-induced increase in prostatic pressure compared with mean blood pressure in the anesthetized dog model. The selectivity of naftopidil for prostatic pressure was the most potent among the test compounds. In addition, using cloned human alpha1-adrenoceptor subtypes, naftopidil was selective for the alpha1d-adrenoceptor with approximately 3- and 17-fold higher affinity than for the alpha1a- and alpha1b-adrenoceptor subtypes, respectively. The selectivity of naftopidil for prostatic pressure may be attributable to its high binding affinity for alpha1a- and alpha1d-adrenoceptor subtypes. PMID:10361884

  5. CDK2 and mTOR are direct molecular targets of isoangustone A in the suppression of human prostate cancer cell growth.

    PubMed

    Lee, Eunjung; Son, Joe Eun; Byun, Sanguine; Lee, Seung Joon; Kim, Yeong A; Liu, Kangdong; Kim, Jiyoung; Lim, Soon Sung; Park, Jung Han Yoon; Dong, Zigang; Lee, Ki Won; Lee, Hyong Joo

    2013-10-01

    Licorice extract which is used as a natural sweetener has been shown to possess inhibitory effects against prostate cancer, but the mechanisms responsible are poorly understood. Here, we report a compound, isoangustone A (IAA) in licorice that potently suppresses the growth of aggressive prostate cancer and sought to clarify its mechanism of action. We analyzed its inhibitory effects on the growth of PTEN-deleted human prostate cancer cells, in vitro and in vivo. Administration of IAA significantly attenuated the growth of prostate cancer cell cultures and xenograft tumors. These effects were found to be attributable to inhibition of the G1/S phase cell cycle transition and the accumulation of p27(kip1). The elevated p27(kip1) expression levels were concurrent with the decrease of its phosphorylation at threonine 187 through suppression of CDK2 kinase activity and the reduced phosphorylation of Akt at Serine 473 by diminishing the kinase activity of the mammalian target of rapamycin (mTOR). Further analysis using recombinant proteins and immunoprecipitated cell lysates determined that IAA exerts suppressive effects against CDK2 and mTOR kinase activity by direct binding with both proteins. These findings suggested that the licorice compound IAA is a potent molecular inhibitor of CDK2 and mTOR, with strong implications for the treatment of prostate cancer. Thus, licorice-derived extracts with high IAA content warrant further clinical investigation for nutritional sources for prostate cancer patients. PMID:23707764

  6. The Effects of the Organic Flame-Retardant 1,2-Dibromo-4-(1,2-dibromoethyl) Cyclohexane (TBECH) on Androgen Signaling in Human Prostate Cancer Cell Lines.

    PubMed

    Wong, Lilian I L; Reers, Alexandra R; Currier, Heidi A; Williams, Tony D; Cox, Michael E; Elliott, John E; Beischlag, Timothy V

    2016-05-01

    The effects of the organic flame retardant 1,2-Dibromo-4-(1,2-dibromoethyl) cyclohexane (TBECH) on androgen receptor target gene expression were examined in the human LNCaP prostate cancer cell line. While γ-/δ-TBECH alone led to a significant increase in prostate-specific antigen (PSA) mRNA accumulation, both the α-/-TBECH and γ-/δ-TBECH mixtures repressed androgen-inducible PSA mRNA and protein accumulation in human LNCaP cells. Thus, we hypothesize that isomeric mixtures of TBECH may act as partial agonists of the androgen receptor. PMID:26729308

  7. CDK2 and mTOR are direct molecular targets of isoangustone A in the suppression of human prostate cancer cell growth

    SciTech Connect

    Lee, Eunjung; Son, Joe Eun; Byun, Sanguine; Lee, Seung Joon; Kim, Yeong A; Liu, Kangdong; Kim, Jiyoung; Lim, Soon Sung; Park, Jung Han Yoon; Dong, Zigang; Lee, Ki Won; Lee, Hyong Joo

    2013-10-01

    Licorice extract which is used as a natural sweetener has been shown to possess inhibitory effects against prostate cancer, but the mechanisms responsible are poorly understood. Here, we report a compound, isoangustone A (IAA) in licorice that potently suppresses the growth of aggressive prostate cancer and sought to clarify its mechanism of action. We analyzed its inhibitory effects on the growth of PTEN-deleted human prostate cancer cells, in vitro and in vivo. Administration of IAA significantly attenuated the growth of prostate cancer cell cultures and xenograft tumors. These effects were found to be attributable to inhibition of the G1/S phase cell cycle transition and the accumulation of p27{sup kip1}. The elevated p27{sup kip1} expression levels were concurrent with the decrease of its phosphorylation at threonine 187 through suppression of CDK2 kinase activity and the reduced phosphorylation of Akt at Serine 473 by diminishing the kinase activity of the mammalian target of rapamycin (mTOR). Further analysis using recombinant proteins and immunoprecipitated cell lysates determined that IAA exerts suppressive effects against CDK2 and mTOR kinase activity by direct binding with both proteins. These findings suggested that the licorice compound IAA is a potent molecular inhibitor of CDK2 and mTOR, with strong implications for the treatment of prostate cancer. Thus, licorice-derived extracts with high IAA content warrant further clinical investigation for nutritional sources for prostate cancer patients. - Highlights: • Isoangustone A suppresses growth of PC3 and LNCaP prostate cancer cells. • Administration of isoangustone A inhibits tumor growth in mice. • Treatment of isoangustone A induces cell cycle arrest and accumulation of p27{sup kip1}. • Isoangustone A inhibits CDK2 and mTOR activity. • Isoangustone A directly binds with CDK2 and mTOR complex in prostate cancer cells.

  8. Cardiac glycosides induce resistance to tubulin-dependent anticancer drugs in androgen-independent human prostate cancer.

    PubMed

    Huang, Dong-Ming; Guh, Jih-Hwa; Huang, Yao-Ting; Chueh, Shih-Chieh; Wang, Hui-Po; Teng, Che-Ming

    2002-01-01

    Due to high prevalence and mortality and the lack of effective therapies, prostate cancer is one of the most crucial health problems in men. Drug resistance aggravates the situation, not only in human prostate cancer but also in other cancers. In this study, we report for the first time that cardiac glycosides (e.g. ouabain and digitoxin) induced resistance of human prostate cancer cells (PC-3) in vitro to tubulin-binding anticancer drugs, such as paclitaxel, colchicine, vincristine and vinblastine. Cardiac glycosides exhibited amazing ability to reverse the G2/M arrest of the cell cycle and cell apoptosis induced by tubulin-binding agents. However, neither ionomycin (a Ca(2+) ionophore) nor veratridine (a Na(+) ionophore) mimicked the preventive action of cardiac glycosides, indicating that elevation of the intracellular Ca(2+) concentration and Na(+) accumulation were not involved in the cardiac glycoside action. Furthermore, cardiac glycosides showed little influence on the effects induced by actinomycin D, anisomycin and doxorubicin, suggesting selectivity for microtubule-targeted anticancer drugs. Using in situ immunofluorescent detection of mitotic spindles, our data showed that cardiac glycosides diminished paclitaxel-induced accumulation of microtubule spindles; however, in a non-cell assay system, cardiac glycosides had little influence on colchicine- and paclitaxel-induced microtubule dynamics. Using an isotope-labeled assay method, we found that ouabain modestly but significantly inhibited the transport of [(14)C]paclitaxel from the cytosol into the nucleus. It is suggested that cardiac glycosides inhibit the G2/M arrest induced by tubulin-binding anticancer drugs via an indirect blockade on microtubule function. The decline in transport of these drugs into the nucleus may partly explain the action of cardiac glycosides. PMID:12218360

  9. Management of Chronic Hyperplastic Pulpitis in Mandibular Molars of Middle Aged Adults- A Multidisciplinary Approach

    PubMed Central

    Lingeswaran, Somiya; Ari, Geetha; Thyagarajan, Ramakrishnan; Logaranjani, Anitha

    2016-01-01

    The molar tooth of children and young adults is a common site for chronic hyperplastic pulpitis (pulp polyp). It rarely occurs in middle aged adults. This condition is usually characterized by extensive involvement of the pulp, dictating the extraction of involved tooth. Extraction of permanent molars can lead to transient or permanent malocclusion, aesthetic, phonetic and functional problems. Here we report a case of pulp polyp in mandibular first molar of a 33-year-old woman that grew into the carious cavity. The aim of this case report is to describe the diagnosis of a chronic hyperplastic pulpitis involving the permanent molar as well as to describe its management in order to preserve them as a functional unit of the dentition. PMID:26894192

  10. Management of Chronic Hyperplastic Pulpitis in Mandibular Molars of Middle Aged Adults- A Multidisciplinary Approach.

    PubMed

    Anilkumar, Kanakamedala; Lingeswaran, Somiya; Ari, Geetha; Thyagarajan, Ramakrishnan; Logaranjani, Anitha

    2016-01-01

    The molar tooth of children and young adults is a common site for chronic hyperplastic pulpitis (pulp polyp). It rarely occurs in middle aged adults. This condition is usually characterized by extensive involvement of the pulp, dictating the extraction of involved tooth. Extraction of permanent molars can lead to transient or permanent malocclusion, aesthetic, phonetic and functional problems. Here we report a case of pulp polyp in mandibular first molar of a 33-year-old woman that grew into the carious cavity. The aim of this case report is to describe the diagnosis of a chronic hyperplastic pulpitis involving the permanent molar as well as to describe its management in order to preserve them as a functional unit of the dentition. PMID:26894192

  11. Human xenograft models as useful tools to assess the potential of novel therapeutics in prostate cancer

    PubMed Central

    van Weerden, W M; Bangma, C; de Wit, R

    2008-01-01

    With docetaxel as effective chemotherapy for hormone refractory prostate cancer (HRPC), the number of new treatment combinations for HRPC is expanding demanding a fast-track screening system. This review elaborates on the use of xenograft models to select the most promising combination therapies for entering into phase II clinical trials. PMID:19088719

  12. Superior In Vivo Inhibitory Efficacy of Methylseleninic Acid Against Human Prostate Cancer over Selenomethionine or Selenite

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Methylselenol has been implicated as an active anti-cancer selenium metabolite. Its in vivo efficacy for prostate cancer has yet to be established. Methods: We evaluated the in vivo growth inhibitory effects of two presumed methylselenol precursors methylseleninic acid (MSeA) and ...

  13. Human prostatic carcinoma in tissue culture: correlations between histological diagnosis and in vitro parameters.

    PubMed

    Bologna, M; Vicentini, C; Festuccia, C; Muzi, P; Angeletti, P V; Miano, L

    1985-01-01

    Prostatic cell biology is still largely unknown so that even the natural history of prostatic carcinoma is unpredictable. In order to correlate new observations with the prognosis of patients with prostatic carcinoma of various grades, we followed up 24 in vitro samples from surgical specimens of prostatic carcinoma. Fragments from 7 grade-I, 10 grade-II, 6 grade-III; and 1 grade-IV tumors were cultivated in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, 10% horse serum and 50 ng/ml each of hydrocortisone and insulin. Epithelial cells grown from the explants continued to grow for a maximum of 120 days and their morphology varied from a fairly regular monolayer of polygonal cells to irregular patterns of overlapping growth with many giant multinucleated cells. Although our data need a longer clinical follow-up time and larger numbers to achieve any statistical significance, the present findings seem to indicate rather clearly that a short life span in culture, a regular growth and a positive secretion activity is typical of low-grade tumors and that a longer life span, an irregular growth and a negative secretion in vitro are characteristics of high-grade tumors. A longer clinical follow-up of these patients will be important in the future to indicate whether these findings can be of any real prognostic value. PMID:4076272

  14. Micro and bulk analysis of prostate tissues classified as hyperplasia

    NASA Astrophysics Data System (ADS)

    Kwiatek, W. M.; Banaś, A.; Banaś, K.; Cinque, G.; Dyduch, G.; Falkenberg, G.; Kisiel, A.; Marcelli, A.; Podgórczyk, M.

    2007-07-01

    BPH (Benign Prostatic Hyperplasia) is the most common benign neoplasm (non cancerous enlargement of the prostate gland), whose prevalence increases with age. The gland, when increased in size, exerts pressure on the urethra, causing obstruction to urine flow. The latter may result in severe urinary tract and kidney conditions. In this work prostate samples from patients diagnosed with BPH were analyzed using synchrotron radiation. Micro-analysis of the hyperplastic samples was carried out on the L-beam line at HASYLAB, DESY (Germany), while bulk analysis on selected samples was performed at the DRX2 beamline at LNF, Frascati (Italy). Microanalysis with a mono-energetic beam 15 μm in diameter confirmed that concentrations of certain elements, such as S, Mn, Cu, Fe and Zn, are good indicators of pathological disorders in prostate tissue that may be considered effective tracers of developing compliant. The concentrations of Mn, Cu, Fe and Zn are higher in hyperplastic tissues, as compared to normal ones, while for sulphur the opposite is observed. Additionally, Fe and S K-edge XANES (X-ray Absorption Near Edge Structure) spectroscopy experiments were carried out in order to determine the chemical speciation of these elements in our samples.

  15. Adipose Tissue–derived Mesenchymal Stem Cells Expressing Prodrug-converting Enzyme Inhibit Human Prostate Tumor Growth

    PubMed Central

    Cavarretta, Ilaria T; Altanerova, Veronika; Matuskova, Miroslava; Kucerova, Lucia; Culig, Zoran; Altaner, Cestmir

    2009-01-01

    The ability of human adipose tissue–derived mesenchymal stem cells (AT-MSCs), engineered to express the suicide gene cytosine deaminase::uracil phosphoribosyltransferase (CD::UPRT), to convert the relatively nontoxic 5-fluorocytosine (5-FC) into the highly toxic antitumor 5-fluorouracil (5-FU) together with their ability to track and engraft into tumors and micrometastases makes these cells an attractive tool to activate prodrugs directly within the tumor mass. In this study, we tested the feasibility and efficacy of these therapeutic cells to function as cellular vehicles of prodrug-activating enzymes in prostate cancer (PC) therapy. In in vitro migration experiments we have shown that therapeutic AT-MSCs migrated to all the prostate cell lines tested. In a pilot preclinical study, we observed that coinjections of human bone metastatic PC cells along with the transduced AT-MSCs into nude mice treated with 5-FC induced a complete tumor regression in a dose dependent manner or did not even allow the establishment of the tumor. More importantly, we also demonstrated that the therapeutic cells were effective in significantly inhibiting PC tumor growth after intravenous administration that is a key requisite for any clinical application of gene-directed enzyme prodrug therapies. PMID:19844197

  16. The anticancer effects of Saccharina japonica on 267B1/K-ras human prostate cancer cells.

    PubMed

    Jo, Mi Jeong; Kim, Hyung Rak; Kim, Gun Do

    2012-11-01

    Saccharina japonica (S. japonica), a brown macro-alga, has been used as a traditional medicine in Korea for thousands of years. In this study, the potential anticancer effects of S. japonica were evaluated on 267B1/K-ras human prostate cancer cells. The exposure of cells to the extract induced inhibition of cell growth by increasing the number of apoptotic cells with cell shrinkage and inhibition of cell cycle progression. The effects of the extract on the cells were assessed by studying the cleavage of caspases and the target proteins of caspases. The increased expression of various cleaved caspases and changed expression of other proteins related in the apoptosis pathway were observed. 4'-6-Diamidino-2-phenylindole (DAPI) and immunofluorescence staining showed the cells undergoing apoptosis. Apoptosis induced changes in the expression of proteins involved in a variety of signaling pathways such as endocellular reticulum (ER) stress, death receptor and mammalian target of rapamycin (mTOR)-FoxO-mediated pathways. The data suggest that the extract (n-hexane sub-fraction) of S. japonica, induces apoptosis and cell cycle arrest in 267B1/K-ras human prostate cancer cells, and has potential as a complementary agent for cancer prevention. PMID:22941421

  17. Regulation of cholesterol 25-hydroxylase expression by vitamin D{sub 3} metabolites in human prostate stromal cells

    SciTech Connect

    Wang, J.-H. . E-mail: Jinghuan.Wang@uta.fi; Tuohimaa, Pentti

    2006-06-30

    Vitamin D{sub 3} plays an important role in the control of cell proliferation and differentiation. Cholesterol 25-hydroxylase (CH25H) is an enzyme converting cholesterol into 25-hydroxycholesterol. Vitamin D{sub 3} as well as 25-hydroxycholesterol has been shown to inhibit cell growth and induce cell apoptosis. Here we show that 10 nM 1{alpha},25(OH){sub 2}D{sub 3} and 500 nM 25OHD{sub 3} upregulate CH25H mRNA expression in human primary prostate stromal cells (P29SN). Protein synthesis inhibitor cycloheximide does not block 1{alpha},25(OH){sub 2}D{sub 3} mediated upregulation of CH25H mRNA. Transcription inhibitor actinomycin D blocks basal level as well as 1{alpha},25(OH){sub 2}D{sub 3} induced CH25H mRNA expression. 1{alpha},25(OH){sub 2}D{sub 3} has no effect on CH25H mRNA stability. 25-Hydroxycholesterol significantly decreased the P29SN cell number. A CH25H enzyme inhibitor, desmosterol, increases basal cell number but has no significant effect on vitamin D{sub 3} treated cells. Our data suggest that ch25h could be a vitamin D{sub 3} target gene and may partly mediate anti-proliferative action of vitamin D{sub 3} in human primary prostate stromal cells.

  18. Some general remarks on hyperplasticity modelling and its extension to partially saturated soils

    NASA Astrophysics Data System (ADS)

    Lei, Xiaoqin; Wong, Henry; Fabbri, Antonin; Bui, Tuan Anh; Limam, Ali

    2016-06-01

    The essential ideas and equations of classic plasticity and hyperplasticity are successively recalled and compared, in order to highlight their differences and complementarities. The former is based on the mathematical framework proposed by Hill (The mathematical theory of plasticity. Oxford University Press, Oxford, 1950), whereas the latter is founded on the orthogonality hypothesis of Ziegler (An introduction to thermomechanics. Elsevier, North-Holland, 1983). The main drawback of classic plasticity is the possibility of violating the second principle of thermodynamics, while the relative ease to conjecture the yield function in order to approach experimental results is its main advantage. By opposition, the a priori satisfaction of thermodynamic principles constitutes the chief advantage of hyperplasticity theory. Noteworthy is also the fact that this latter approach allows a finer energy partition; in particular, the existence of frozen energy emerges as a natural consequence from its theoretical formulation. On the other hand, the relative difficulty to conjecture an efficient dissipation function to produce accurate predictions is its main drawback. The two theories are thus better viewed as two complementary approaches. Following this comparative study, a methodology to extend the hyperplasticity approach initially developed for dry or saturated materials to the case of partially saturated materials, accounting for interface energies and suction effects, is developed. A particular example based on the yield function of modified Cam-Clay model is then presented. It is shown that the approach developed leads to a model consistent with other existing works.

  19. Depressed expression of Klotho and FGF receptor 1 in hyperplastic parathyroid glands from uremic patients.

    PubMed

    Komaba, Hirotaka; Goto, Shunsuke; Fujii, Hideki; Hamada, Yasuhiro; Kobayashi, Akira; Shibuya, Koji; Tominaga, Yoshihiro; Otsuki, Naoki; Nibu, Ken-Ichi; Nakagawa, Kimie; Tsugawa, Naoko; Okano, Toshio; Kitazawa, Riko; Fukagawa, Masafumi; Kita, Tomoyuki

    2010-02-01

    Fibroblast growth factor 23 (FGF23) exerts its effect by binding to its cognate FGF receptor 1 (FGFR1) in the presence of its co-receptor Klotho. Parathyroid glands express both FGFR1 and Klotho, and FGF23 decreases parathyroid hormone gene expression and hormone secretion directly. In uremic patients with secondary hyperparathyroidism (SHPT), however, parathyroid hormone secretion remains elevated despite extremely high FGF23 levels. To determine the mechanism of this resistance, we measured the expression of Klotho, FGFR1, and the proliferative marker Ki67 in 7 normal and 80 hyperplastic parathyroid glands from uremic patients by immunohistochemistry. All uremic patients had severe SHPT along with markedly high FGF23 levels. Quantitative real-time reverse transcription PCR showed that the mRNA levels for Klotho and FGFR1correlated significantly with their semi-quantitative immunohistochemical intensity. Compared with normal tissue, the immunohistochemical expression of Klotho and FGFR1 decreased, but Ki67 expression increased significantly in hyperplastic parathyroid glands, particularly in glands with nodular hyperplasia. These results suggest that the depressed expression of the Klotho-FGFR1 complex in hyperplastic glands underlies the pathogenesis of SHPT and its resistance to extremely high FGF23 levels in uremic patients. PMID:19890272

  20. Geranylated 4-Phenylcoumarins Exhibit Anticancer Effects against Human Prostate Cancer Cells through Caspase-Independent Mechanism

    PubMed Central

    Suparji, Noor Shahirah; Chan, Gomathi; Sapili, Hani; Arshad, Norhafiza M.; In, Lionel L. A.; Awang, Khalijah; Hasima Nagoor, Noor

    2016-01-01

    Geranylated 4-phenylcoumarins, DMDP-1 & -2 isolated from Mesua elegans were investigated for anticancer potential against human prostate cancer cells. Treatment with DMDP-1 & -2 resulted in cell death in a time and dose dependent manner in an MTT assay on all cancer cell lines tested with the exception of lung adenocarcinoma cells. DMDP-1 showed highest cytotoxic efficacy in PC-3 cells while DMDP-2 was most potent in DU 145 cells. Flow cytometry indicated that both coumarins were successful to induce programmed cell death after 24 h treatment. Elucidation on the mode-of-action via protein arrays and western blotting demonstrated death induced without any significant expressions of caspases, Bcl-2 family proteins and cleaved PARP, thus suggesting the involvement of caspase-independent pathways. In identifying autophagy, analysis of GFP-LC3 showed increased punctate in PC-3 cells pre-treated with CQ and treated with DMDP-1. In these cells decreased expression of autophagosome protein, p62 and cathepsin B further confirmed autophagy. In contrary, the DU 145 cells pre-treated with CQ and treated with DMDP-2 has reduced GFP-LC3 punctate although the number of cells with obvious GFP-LC3 puncta was significantly increased in the inhibitor-treated cells. The increase level of p62 suggested leakage of cathepsin B into the cytosol to trigger potential downstream death mediators. This correlated with increased expression of cathepsin B and reduced expression after treatment with its inhibitor, CA074. Also auto-degradation of calpain-2 upon treatment with DMDP-1 &-2 and its inhibitor alone, calpeptin compared with the combination treatment, further confirmed involvement of calpain-2 in PC-3 and DU 145 cells. Treatment with DMDP-1 & -2 also showed up-regulation of total and phosphorylated p53 levels in a time dependent manner. Hence, DMDP-1 & -2 showed ability to activate multiple death pathways involving autophagy, lysosomal and endoplasmic reticulum death proteins which could

  1. Response of Human Prostate Cancer Cells to Mitoxantrone Treatment in Simulated Microgravity Environment

    NASA Technical Reports Server (NTRS)

    Zhang, Ye; Edwards, Christopher; Wu, Honglu

    2011-01-01

    This study explores the changes in growth of human prostate cancer cells (LNCaP) and their response to the treatment of antineoplastic agent, mitoxantrone, under the simulated microgravity condition. In comparison to static 1g, microgravity and simulated microgravity have been shown to alter global gene expression patterns and protein levels in various cultured cell models or animals. However, very little is known about the effect of altered gravity on the responses of cells to drugs, especially chemotherapy drugs. To test the hypothesis that zero gravity would result in altered regulation of cells in response to antineoplastic agents, we cultured LNCaP cells for 96 hr either in a High Aspect Ratio Vessel (HARV) bioreactor at the rotating condition to model microgravity in space or in the static condition as a control. 24 hr after the culture started, mitoxantrone was introduced to the cells at a final concentration of 1 M. The mitoxantrone treatment lasted 72 hr and then the cells were collected for various measurements. Compared to static 1g controls, the cells cultured in the simulated microgravity environment did not show significant differences in cell viability, growth rate, or cell cycle distribution. However, in response to mitoxantrone (1uM), a significant proportion of bioreactor cultured cells (30%) was arrested at G2 phase and a significant number of these cells were apoptotic in comparison to their static controls. The expressions of 84 oxidative stress related genes were analyzed using Qiagen PCR array to identify the possible mechanism underlying the altered responses of bioreactor culture cells to mitoxantrone. Nine out of 84 genes showed higher expression at four hour post mitoxantrone treatment in cells cultured at rotating condition compared to those at static. Taken together, the results reported here indicate that simulated microgravity may alter the responses of LNCaP cells to mitoxantrone treatment. The alteration of oxidative stress pathways

  2. Human prostate-specific antigen: structural and functional similarity with serine proteases.

    PubMed Central

    Watt, K W; Lee, P J; M'Timkulu, T; Chan, W P; Loor, R

    1986-01-01

    The complete amino acid sequence of the prostate-specific antigen (PA) from human seminal plasma has been determined from analyses of the peptides generated by cyanogen bromide, hydroxylamine, endoproteinases Arg-C and Lys-C. The single polypeptide chain of PA contains 240-amino acid residues and has a calculated Mr of 26,496. An N-linked carbohydrate side chain is predicted at asparagine-45, and O-linked carbohydrate side chains are possibly attached to serine-69, threonine-70, and serine-71. The primary structure of PA shows a high degree of sequence homology with other serine proteases of the kallikrein family. The active site residues of histidine, aspartic acid, and serine comprising the charge-relay system of typical serine proteases were found in similar positions in PA (histidine-41, aspartic acid-96, and serine-192). At pH 7.8, PA hydrolyzed insulin A and B chains, recombinant interleukin 2, and--to a lesser extent--gelatin, myoglobin, ovalbumin, and fibrinogen. The cleavage sites of these proteins by PA were chemically analyzed as the alpha-carboxyl side of some hydrophobic residues, tyrosine, leucine, valine, and phenylalanine, and of basic residues histidine, lysine, and arginine. The chymotrypsin-like activity of PA exhibited with the chromogenic substrate N-succinyl-L-alanyl-L-alanyl-L-prolyl-L-phenylalanine p-nitroanilide yielded a specific activity of 9.21 microM per min per mg of PA and Km and kcat values of 15.3 mM and 0.075s-1, respectively. "Trypsin-like" activity of PA was also detected with N alpha-benzoyl-DL-arginine p-nitroanilide and gave a specific activity of 1.98 microM per min per mg of PA. Protease inhibitors such as phenylmethylsulfonyl fluoride, diisopropyl fluorophosphate, L-1-tosylamido-2-phenylethyl chloromethyl ketone, aprotinin, leupeptin, soybean trypsin inhibitor as well as Zn2+ and spermidine were effective inhibitors of PA enzymatic activity. PMID:2422647

  3. Ultra-high performance liquid chromatographic determination of levofloxacin in human plasma and prostate tissue with use of experimental design optimization procedures.

    PubMed

    Szerkus, O; Jacyna, J; Wiczling, P; Gibas, A; Sieczkowski, M; Siluk, D; Matuszewski, M; Kaliszan, R; Markuszewski, M J

    2016-09-01

    Fluoroquinolones are considered as gold standard for the prevention of bacterial infections after transrectal ultrasound guided prostate biopsy. However, recent studies reported that fluoroquinolone- resistant bacterial strains are responsible for gradually increasing number of infections after transrectal prostate biopsy. In daily clinical practice, antibacterial efficacy is evaluated only in vitro, by measuring the reaction of bacteria with an antimicrobial agent in culture media (i.e. calculation of minimal inhibitory concentration). Such approach, however, has no relation to the treated tissue characteristics and might be highly misleading. Thus, the objective of this study was to develop, with the use of Design of Experiments approach, a reliable, specific and sensitive ultra-high performance liquid chromatography- diode array detection method for the quantitative analysis of levofloxacin in plasma and prostate tissue samples obtained from patients undergoing prostate biopsy. Moreover, correlation study between concentrations observed in plasma samples vs prostatic tissue samples was performed, resulting in better understanding, evaluation and optimization of the fluoroquinolone-based antimicrobial prophylaxis during transrectal ultrasound guided prostate biopsy. Box-Behnken design was employed to optimize chromatographic conditions of the isocratic elution program in order to obtain desirable retention time, peak symmetry and resolution of levofloxacine and ciprofloxacine (internal standard) peaks. Fractional Factorial design 2(4-1) with four center points was used for screening of significant factors affecting levofloxacin extraction from the prostatic tissue. Due to the limited number of tissue samples the prostatic sample preparation procedure was further optimized using Central Composite design. Design of Experiments approach was also utilized for evaluation of parameter robustness. The method was found linear over the range of 0.030-10μg/mL for human

  4. Prostate cancer

    SciTech Connect

    Murphy, G.P.; Kuss, R., Khoury, S.; Chatelain, C.; Denis, L.

    1987-01-01

    This book contains over 70 selections. Some of the titles are: Place of the Computed Tomography in the Staging of Prostatic Cancer; Magnetic Resonance Imaging (MRI) in Staging of the Prostatic Cancer; Magnetic Resonance Imaging of the Prostate; Long-Term Results in Radiotherapy of Prostatic Cancer; Interstitial Irradiation Using I-125 Seeds; and Treatment of Cancer of the Prostate by Use of Physiotherapy: Long-Term Results.

  5. A Novel Model of Urinary Tract Differentiation, Tissue Regeneration, and Disease: Reprogramming Human Prostate and Bladder Cells into Induced Pluripotent Stem Cells

    PubMed Central

    Moad, Mohammad; Pal, Deepali; Hepburn, Anastasia C.; Williamson, Stuart C.; Wilson, Laura; Lako, Majlinda; Armstrong, Lyle; Hayward, Simon W.; Franco, Omar E.; Cates, Justin M.; Fordham, Sarah E.; Przyborski, Stefan; Carr-Wilkinson, Jane; Robson, Craig N.; Heer, Rakesh

    2013-01-01

    Background Primary culture and animal and cell-line models of prostate and bladder development have limitations in describing human biology, and novel strategies that describe the full spectrum of differentiation from foetal through to ageing tissue are required. Recent advances in biology demonstrate that direct reprogramming of somatic cells into pluripotent embryonic stem cell (ESC)-like cells is possible. These cells, termed induced pluripotent stem cells (iPSCs), could theoretically generate adult prostate and bladder tissue, providing an alternative strategy to study differentiation. Objective To generate human iPSCs derived from normal, ageing, human prostate (Pro-iPSC), and urinary tract (UT-iPSC) tissue and to assess their capacity for lineage-directed differentiation. Design, setting, and participants Prostate and urinary tract stroma were transduced with POU class 5 homeobox 1 (POU5F1; formerly OCT4), SRY (sex determining region Y)-box 2 (SOX2), Kruppel-like factor 4 (gut) (KLF4), and v-myc myelocytomatosis viral oncogene homolog (avian) (MYC, formerly C-MYC) genes to generate iPSCs. Outcome measurements and statistical analysis The potential for differentiation into prostate and bladder lineages was compared with classical skin-derived iPSCs. The student t test was used. Results and limitations Successful reprogramming of prostate tissue into Pro-iPSCs and bladder and ureter into UT-iPSCs was demonstrated by characteristic ESC morphology, marker expression, and functional pluripotency in generating all three germ-layer lineages. In contrast to conventional skin-derived iPSCs, Pro-iPSCs showed a vastly increased ability to generate prostate epithelial-specific differentiation, as characterised by androgen receptor and prostate-specific antigen induction. Similarly, UT-iPSCs were shown to be more efficient than skin-derived iPSCs in undergoing bladder differentiation as demonstrated by expression of urothelial-specific markers: uroplakins, claudins, and

  6. Three distinct commonly deleted regions of chromosome arm 16q in human primary and metastatic prostate cancers.

    PubMed

    Suzuki, H; Komiya, A; Emi, M; Kuramochi, H; Shiraishi, T; Yatani, R; Shimazaki, J

    1996-12-01

    Human prostate cancers frequently show loss of heterozygosity (LOH) at loci on the long arm of chromosome 16 (16q). In this study, we analyzed prostate cancer specimens from 48 patients (Stage B, 20 cases; Stage C, 10 cases; cancer death, 18 cases) for allelic loss on 16q, using either restriction fragment length polymorphism (RFLP)- or polymerase chain reaction (PCR)-based methods. Allelic losses were observed in 20 (42%) of 48 cases, all of which were informative with at least one locus. Detailed deletion mapping identified three distinct commonly deleted regions on this chromosome arm: q22.1-q22.3, q23.2-q24.1, and q24.3-qter. On the basis of a published sex-averaged framework map, the estimated sizes of the commonly deleted regions were 4.7 (16q22.1-q22.3), 17.2 (16q23.2-q24.1) and 8.4 cM (16q24.3-qter). Allelic losses on 16q were observed more frequently in the cancer-death cases (11 of 18; 61%) than in early-stage tumor cases (9 of 30; 30%; P < 0.05). In 7 of 11 patients from whom DNA was available from metastatic cancers as well as from normal tissues and primary tumors, the primary cancer foci had no detectable abnormality of 16q, but the metastatic tumors showed LOH. These results suggest that inactivation of tumor suppressor genes on 16q plays an important role in the progression of prostate cancer. We also analyzed exons 5-8 of the E-cadherin gene, located at 16q22.1, in tumor DNA by means of PCR-single strand conformation polymorphism and direct sequencing, but we detected no somatic mutations in this candidate gene. PMID:8946204

  7. 3-Bromopyruvate induces rapid human prostate cancer cell death by affecting cell energy metabolism, GSH pool and the glyoxalase system.

    PubMed

    Valenti, Daniela; Vacca, Rosa A; de Bari, Lidia

    2015-12-01

    3-bromopyruvate (3-BP) is an anti-tumour drug effective on hepatocellular carcinoma and other tumour cell types, which affects both glycolytic and mitochondrial targets, depleting cellular ATP pool. Here we tested 3-BP on human prostate cancer cells showing, differently from other tumour types, efficient ATP production and functional mitochondrial metabolism. We found that 3-BP rapidly induced cultured androgen-insensitive (PC-3) and androgen-responsive (LNCaP) prostate cancer cell death at low concentrations (IC(50) values of 50 and 70 μM, respectively) with a multimodal mechanism of action. In particular, 3-BP-treated PC-3 cells showed a selective, strong reduction of glyceraldeide 3-phosphate dehydrogenase activity, due to the direct interaction of the drug with the enzyme. Moreover, 3-BP strongly impaired both glutamate/malate- and succinate-dependent mitochondrial respiration, membrane potential generation and ATP synthesis, concomitant with the inhibition of respiratory chain complex I, II and ATP synthase activities. The drastic reduction of cellular ATP levels and depletion of GSH pool, associated with significant increase in cell oxidative stress, were found after 3-BP treatment of PC-3 cells. Interestingly, the activity of both glyoxalase I and II, devoted to the elimination of the cytotoxic methylglyoxal, was strongly inhibited by 3-BP. Both N-acetylcysteine and aminoguanidine, GSH precursor and methylglyoxal scavenger, respectively, prevented 3-BP-induced PC-3 cell death, showing that impaired cell antioxidant and detoxifying capacities are crucial events leading to cell death. The provided information on the multi-target cytotoxic action of 3-BP, finally leading to PC-3 cell necrosis, might be useful for future development of 3-BP as a therapeutic option for prostate cancer treatment. PMID:26530987

  8. Docetaxel induces Bcl-2- and pro-apoptotic caspase-independent death of human prostate cancer DU145 cells

    PubMed Central

    OGURA, TAKEHARU; TANAKA, YOSHIYUKI; TAMAKI, HIROKI; HARADA, MAMORU

    2016-01-01

    Docetaxel is a useful chemotherapeutic agent for the first-line treatment of hormone-refractory prostate cancer. Abnormal expression of Bcl-2 is commonly found in cancer cells, which increases their anti-apoptotic potency and chemo-resistance. We investigated the effects of Bcl-2 expression status on the susceptibility of DU145 cells, an androgen-independent human prostate cancer cell line, to docetaxel and other anticancer agents. A panel of Bcl-2-expressing DU145 cell lines was established. Bcl-2 expression levels were unrelated to the susceptibility of DU145 cells to docetaxel. The sensitivity of DU145 cells to cisplatin fluctuated, and the sensitivity to tumor necrosis factor (TNF)-α was decreased by Bcl-2 overexpression. In a xenograft mouse model, overexpression of Bcl-2 drastically decreased the sensitivity of DU145 cells to cisplatin and TNF-α; however, there was no change in the response to docetaxel. Fluorescent microscopy revealed that Bcl-2-overexpression had no effect on the docetaxel-induced death of DU145 cells, but significantly decreased DU145 cell death induced by cisplatin or TNF-α. Interestingly, docetaxel hardly induced caspase-3/7 activation in control or Bcl-2-overexpressing DU145 cells, but did at a low level in LNCaP cells, another prostate cancer cell line. Moreover, in contrast to LNCaP cells, the reduced viabilities of docetaxel-treated control and Bcl-2-overexpressing DU145 cells were not restored by the addition of either a Bid inhibitor or a panel of pro-apoptotic caspase inhibitors. These findings indicate that the antitumor effects of docetaxel on DU145 cells are independent of both Bcl-2 and pro-apoptotic caspases. PMID:27082738

  9. Decreased expression of SLC 39A14 is associated with tumor aggressiveness and biochemical recurrence of human prostate cancer

    PubMed Central

    Xu, Xiao-Ming; Wang, Cheng-Gong; Zhu, Yu-Di; Chen, Wei-Hua; Shao, Si-Liang; Jiang, Fu-Neng; Liao, Qian-De

    2016-01-01

    Objective Solute carrier family 39, member 14 (SLC39A14), has been identified as a potential biomarker for various cancers. However, its roles in prostate cancer (PCa) are still unclear. The aim of this study was to investigate the clinical significance of SLC39A14 in patients with PCa and its functions in malignant phenotypes of PCa cells. Patients and methods Subcellular localization and expression pattern of SLC39A14 protein were examined by immunohistochemistry. Then, the associations of SLC39A14 expression with various clinicopathological features and clinical outcome of patients with PCa were statistically evaluated. Subsequently, the effects of SLC39A14 overexpression and knockdown on PCa cell proliferation and motility were, respectively, examined by Cell Counting Kit-8, transwell, and wound-healing assays. Results The immunoreactive scores of SLC39A14 protein in human PCa tissues were significantly lower than those in normal prostate tissues. Based on the Taylor dataset, SLC39A14 downregulation occurred more frequently in patients with PCa with a higher Gleason score (P<0.001), advanced clinical stage (P=0.008), presence of metastasis (P=0.009), and prostate-specific antigen failure (P=0.006). More interestingly, the survival analysis identified SLC39A14 as an independent factor for predicting the biochemical recurrence-free survival of patients with PCa (P=0.017). Functionally, the enforced expression of SLC39A14 could suppress cell proliferation, invasion, and migration of PCa cell lines in vitro, which could be reversed by the knockdown of SLC39A14. Conclusion Decreased expression of SLC39A14 may lead to malignant phenotypes of PCa cells and aggressive tumor progression in patients with PCa. Importantly, SLC39A14 may function as a tumor suppressor and a biomarker for screening patients with biochemical recurrence following radical prostatectomy. PMID:27471394

  10. Docetaxel induces Bcl-2- and pro-apoptotic caspase-independent death of human prostate cancer DU145 cells.

    PubMed

    Ogura, Takeharu; Tanaka, Yoshiyuki; Tamaki, Hiroki; Harada, Mamoru

    2016-06-01

    Docetaxel is a useful chemotherapeutic agent for the first-line treatment of hormone-refractory prostate cancer. Abnormal expression of Bcl-2 is commonly found in cancer cells, which increases their anti-apoptotic potency and chemoresistance. We investigated the effects of Bcl-2 expression status on the susceptibility of DU145 cells, an androgen-independent human prostate cancer cell line, to docetaxel and other anticancer agents. A panel of Bcl-2-expressing DU145 cell lines was established. Bcl-2 expression levels were unrelated to the susceptibility of DU145 cells to docetaxel. The sensitivity of DU145 cells to cisplatin fluctuated, and the sensitivity to tumor necrosis factor (TNF)-α was decreased by Bcl-2 overexpression. In a xenograft mouse model, overexpression of Bcl-2 drastically decreased the sensitivity of DU145 cells to cisplatin and TNF-α; however, there was no change in the response to docetaxel. Fluorescent microscopy revealed that Bcl-2-overexpression had no effect on the docetaxel-induced death of DU145 cells, but significantly decreased DU145 cell death induced by cisplatin or TNF-α. Interestingly, docetaxel hardly induced caspase-3/7 activation in control or Bcl-2-overexpressing DU145 cells, but did at a low level in LNCaP cells, another prostate cancer cell line. Moreover, in contrast to LNCaP cells, the reduced viabilities of docetaxel-treated control and Bcl-2-overexpressing DU145 cells were not restored by the addition of either a Bid inhibitor or a panel of pro-apoptotic caspase inhibitors. These findings indicate that the antitumor effects of docetaxel on DU145 cells are independent of both Bcl-2 and pro-apoptotic caspases. PMID:27082738

  11. Sulforaphane-cysteine suppresses invasion via downregulation of galectin-1 in human prostate cancer DU145 and PC3 cells.

    PubMed

    Tian, Hua; Zhou, Yan; Yang, Gaoxiang; Geng, Yang; Wu, Sai; Hu, Yabin; Lin, Kai; Wu, Wei

    2016-09-01

    Our previous study showed that sulforaphane (SFN) inhibits invasion in human prostate cancer DU145 cells; however, the underlying mechanisms were not profoundly investigated. In the present study, we found that sulforaphane-cysteine (SFN-Cys), as a metabolite of SFN, inhibits invasion and possesses a novel mechanism in prostate cancer DU145 and PC3 cells. The scratch and Transwell assays showed that SFN-Cys (15 µM) inhibited both migration and invasion, with cell morphological changes, such as cell shrinkage and pseudopodia shortening. The cell proliferation (MTS) assay indicated that cell viability was markedly suppressed with increasing concentrations of SFN‑Cys. Furthermore, the Transwell assay showed that inhibition of SFN‑Cys‑triggered invasion was tightly linked to the sustained extracellular signal-regulated kinase 1/2 (ERK1/2) phosphorylation. Western blot analysis revealed that SFN-Cys downregulated galectin-1 protein, an invasion‑related protein, and that the galectin‑1 reduction could be blocked by ERK1/2 inhibitor PD98059 (25 µM). Moreover, immunofluorescence staining showed that the expression level of galectin-1 protein was significantly reduced in the cells treated with SFN‑Cys. Hence, SFN‑Cys‑inhibited invasion resulted from the sustained ERK1/2 phosphorylation and ERK1/2‑triggered galectin-1 downregulation, suggesting that galectin-1 is a new SFN-Cys target inhibiting invasion apart from ERK1/2, in the treatment of prostate cancer. PMID:27430422

  12. Increased Potency of the PHSCN Dendrimer as an Inhibitor of Human Prostate Cancer Cell Invasion, Extravasation, and Lung Colony Formation

    PubMed Central

    Yao, Hongren; Zeng, Zhao-Zhu; Fay, Kevin S.; Staszewski, Evan D.; Veine, Donna M.; Livant, Donna L.

    2011-01-01

    Background Activated α5β1 integrin occurs specifically on tumor cells and on endothelial cells of tumor–associated vasculature, and plays a key role in invasion and metastasis. The PHSCN peptide (Ac-PHSCN-NH2) preferentially binds activated α5β1, to block invasion in vitro, and inhibit growth, metastasis and tumor recurrence in preclinical models of prostate cancer. In Phase I clinical trial, systemic Ac-PHSCN-NH2 monotherapy was well tolerated, and metastatic disease progression was prevented for 4–14 months in one third of treated patients. Results We have developed a significantly more potent derivative, the PHSCN-polylysine dendrimer (Ac-PHSCNGGK-MAP). Using in vitro invasion assays with naturally serum-free basement membranes, we observed that the PHSCN dendrimer was 130– to 1900–fold more potent than the PHSCN peptide at blocking α5β1–mediated invasion by DU 145 and PC-3 human prostate cancer cells, whether invasion was induced by serum, or by the Ac-PHSRN-NH2 peptide, under serum-free conditions. The PHSCN dendrimer was also approximately 800 times more effective than PHSCN peptide at preventing DU 145 and PC-3 extravasation in the lungs of athymic mice. Chou-Talalay analysis suggested that inhibition of both invasion in vitro and extravasation in vivo by the PHSCN dendrimer are highly synergistic. We found that many extravasated DU 145 and PC-3 cells go on to develop into metastatic colonies, and that a single pretreatment with the PHSCN dendrimer was 100–fold more affective than the PHSCN peptide at reducing lung colony formation. Conclusions Since many patients newly diagnosed with prostate cancer already have locally advanced or metastatic disease, the availability of a well-tolerated, nontoxic systemic therapy, like the PHSCN dendrimer, which prevents metastatic progression by inhibiting invasion, could be very beneficial. PMID:20339907

  13. Human periprostatic white adipose tissue is rich in stromal progenitor cells and a potential source of prostate tumor stroma.

    PubMed

    Ribeiro, Ricardo; Monteiro, Cátia; Silvestre, Ricardo; Castela, Angela; Coutinho, Helena; Fraga, Avelino; Príncipe, Paulo; Lobato, Carlos; Costa, Carla; Cordeiro-da-Silva, Anabela; Lopes, José Manuel; Lopes, Carlos; Medeiros, Rui

    2012-10-01

    A body of growing evidence now implicates white adipose tissue as a relevant source of stromal progenitor cells recruited to the tumor microenvironment to form supportive tumor stroma. While the role of periprostatic (PP) adipose tissue in prostate cancer progression has been barely appreciated, we sought to determine the progenitor cell population in PP adipose tissue and the association with prostate cancer. We isolated and characterized CD31(-)CD34(+)CD45(-)CD146(-) progenitor cells (adipose-derived stem cells [ASC]) in paired samples of PP and preperitoneal visceral adipose tissue from prostate tissue and peripheral blood mononuclear cells of prostate cancer and nodular prostatic hyperplasia patients. ASC were quantified by flow cytometry and confirmed through target gene expression. Here we show a significantly higher amount of ASC in PP than in visceral adipose tissue, independent of body mass index and prostatic disease. In the prostate, ASC are increased in cancer compared with prostatic nodular hyperplasia patients. Concordantly, adipsin gene (CFD) expression, which is known to be up-regulated in adipose stem cells, was overexpressed in PP adipose tissue, in the prostate of cancer patients and in prostate CD31(-)CD34(+)CD45(-)CD146(-) sorted cells. ASC were found at higher levels in the blood of prostate cancer patients simultaneously overweight/obese. Present findings indicate that PP adipose tissue is a reservoir of progenitor cells with the potential to migrate towards prostate tumors, although its clinical significance merits further evaluation. PMID:23038706

  14. RNAi-mediated knockdown of pituitary tumor-transforming gene-1 (PTTG1) suppresses the proliferation and invasive potential of PC3 human prostate cancer cells

    PubMed Central

    Huang, S.Q.; Liao, Q.J.; Wang, X.W.; Xin, D.Q.; Chen, S.X.; Wu, Q.J.; Ye, G.

    2012-01-01

    Pituitary tumor-transforming gene-1 (PTTG1) is a proto-oncogene that promotes tumorigenesis and metastasis in numerous cell types and is overexpressed in a variety of human tumors. We have demonstrated that PTTG1 expression was up-regulated in both human prostate cancer specimens and prostate cancer cell lines. For a more direct assessment of the function of PTTG1 in prostate tumorigenesis, RNAi-mediated knockdown was used to selectively decrease PTTG1 expression in PC3 human prostate tumor cells. After three weeks of selection, colonies stably transfected with PTTG1-targeted RNAi (the knockdown PC3 cell line) or empty vector (the control PC3 cell line) were selected and expanded to investigate the role of PTTG1 expression in PC3 cell growth and invasion. Cell proliferation rate was significantly slower (28%) in the PTTG1 knockdown line after 6 days of growth as indicated by an MTT cell viability assay (P < 0.05). Similarly, a soft agar colony formation assay revealed significantly fewer (66.7%) PTTG1 knockdown PC3 cell colonies than control colonies after three weeks of growth. In addition, PTTG1 knockdown resulted in cell cycle arrest at G1 as indicated by fluorescence-activated cell sorting. The PTTG1 knockdown PC3 cell line also exhibited significantly reduced migration through Matrigel in a transwell assay of invasive potential, and down-regulation of PTTG1 could lead to increased sensitivity of these prostate cancer cells to a commonly used anticancer drug, taxol. Thus, PTTG1 expression is crucial for PC3 cell proliferation and invasion, and could be a promising new target for prostate cancer therapy. PMID:22872288

  15. Inverse association between gluthathione peroxidase activity and both selenium-binding protein 1 levels and gleason score in human prostate tissue

    Technology Transfer Automated Retrieval System (TEKTRAN)

    BACKGROUND. Data from human epidemiological studies, cultured mammalian cells, and animal models have supported a potentially beneficial role of selenium (Se) in prostate cancer prevention. In addition, Se-containing proteins including members of the gutathione peroxidase (GPx) family and Selenium-B...

  16. Enterococcus hirae, an unusual pathogen in humans causing urinary tract infection in a patient with benign prostatic hyperplasia: first case report in Algeria.

    PubMed

    Bourafa, N; Loucif, L; Boutefnouchet, N; Rolain, J-M

    2015-11-01

    Enterococcus hirae is a zoonotic pathogen rarely isolated from human infections. This case is the first description of E. hirae causing urinary tract infection in a diabetic man with benign prostatic hyperplasia from Algeria. The clinical isolate was identified by MALDI-TOF MS and displayed a multisensitivity antibiotic profile. PMID:26543562

  17. iTRAQ identification of candidate serum biomarkers associated with metastatic progression of human prostate cancer.

    PubMed

    Rehman, Ishtiaq; Evans, Caroline A; Glen, Adam; Cross, Simon S; Eaton, Colby L; Down, Jenny; Pesce, Giancarlo; Phillips, Joshua T; Yen, Ow Saw; Thalmann, George N; Wright, Phillip C; Hamdy, Freddie C

    2012-01-01

    A major challenge in the management of patients with prostate cancer is identifying those individuals at risk of developing metastatic disease, as in most cases the disease will remain indolent. We analyzed pooled serum samples from 4 groups of patients (n = 5 samples/group), collected prospectively and actively monitored for a minimum of 5 yrs. Patients groups were (i) histological diagnosis of benign prostatic hyperplasia with no evidence of cancer 'BPH', (ii) localised cancer with no evidence of progression, 'non-progressing' (iii) localised cancer with evidence of biochemical progression, 'progressing', and (iv) bone metastasis at presentation 'metastatic'. Pooled samples were immuno-depleted of the 14 most highly abundant proteins and analysed using a 4-plex iTRAQ approach. Overall 122 proteins were identified and relatively quantified. Comparisons of progressing versus non-progressing groups identified the significant differential expression of 25 proteins (p<0.001). Comparisons of metastatic versus progressing groups identified the significant differential expression of 23 proteins. Mapping the differentially expressed proteins onto the prostate cancer progression pathway revealed the dysregulated expression of individual proteins, pairs of proteins and 'panels' of proteins to be associated with particular stages of disease development and progression. The median immunostaining intensity of eukaryotic translation elongation factor 1 alpha 1 (eEF1A1), one of the candidates identified, was significantly higher in osteoblasts in close proximity to metastatic tumour cells compared with osteoblasts in control bone (p = 0.0353, Mann Whitney U). Our proteomic approach has identified leads for potentially useful serum biomarkers associated with the metastatic progression of prostate cancer. The panels identified, including eEF1A1 warrant further investigation and validation. PMID:22355332

  18. Effects of interferons and double-stranded RNA on human prostate cancer cell apoptosis.

    PubMed

    Tan, Haiyan; Zeng, Chun; Xie, Junbo; Alghamdi, Norah J; Song, Ya; Zhang, Hongbing; Zhou, Aimin; Jin, Di

    2015-11-17

    Prostate cancer is the second most commonly diagnosed cancer among men in the United States. Prostate cancer therapy is severely hampered by lack of response and development of resistance to conventional chemotherapeutic drugs in patients. Therefore, the development and discovery of new drugs have become an urgent clinical need. Interferons (IFNs), a family of pleiotropic cytokines, exert antitumor activities due to their anti-proliferative, immunomodulatory and proapoptotic functions. Here, we report that pretreatment of prostate cancer PC-3 cells with IFNs sensitized these cells to double-stranded RNAs (dsRNAs)-induced apoptosis. The enhancement effect of IFN treatment was dependent on IFN subtypes, in particular, IFN γ. In comparison with IFN α or β, IFN γ treatment remarkably augmented apoptosis in PC-3 cells induced with polyinosinic:polycytidylic acid (poly I:C), a synthesized form of dsRNA. We demonstrated that IFN-signaling was necessary for these effects by using mutant cell lines. Transfection of 2-5A, the activator of RNase L, or silencing of dsRNA-dependent protein kinase R (PKR) by siRNA did not have any significant impact on this event, suggesting that neither RNase L nor PKR was involved in poly I:C/IFN γ-induced apoptosis in the cells. Further investigation of the apoptotic pathway revealed that Bak, a pro-apoptotic member of the Bcl-2family, was synergistically up-regulated by IFN γ and poly I:C, whereas other members of the family were not affected. Knocking down of Bak demonstrated its contribution to poly I:C/IFN γ-induced apoptosis in the cells. We believeour findings will precipitate the design of novel therapeutic strategies for prostate cancer. PMID:26452032

  19. Urtica dioica dichloromethane extract induce apoptosis from intrinsic pathway on human prostate cancer cells (PC3).

    PubMed

    Mohammadi, A; Mansoori, B; Aghapour, M; Baradaran, B

    2016-01-01

    Prostate cancer is considered as the major cause of death among men around the world. There are a number of medicinal plants triggering apoptosis response in cancer cells, thus have a therapeutic potential. Therefore, further studies to characterize beneficial properties of these plants in order to introduce novel anti-cancer drugs are the interest of recent researches on the alternative medicine. On the other hand, due to traditional uses and availability of Urtica dioica extract, we decided to evaluate the efficacy of this medicinal herb on pc3 prostate cancer cell line. In the present study the cytotoxic effects of Urtica dioica extract were assessed by 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay and trypan blue viability dye. Then, DNA fragmentation and terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay were exploited to measure cell death and apoptosis stage. The expression levels of caspase 3, caspase 9 and Bcl-2 genes were quantified by Real-Time PCR. Finally, Cell cycle was analyzed by flow cytometry. MTT assay showed that dichloromethanolic extract of Urtica dioica significantly inhibited the cell growth. According to the DNA fragmentation and TUNEL assay results, the herbal extract was able to induce apoptosis in prostate cancer cells. Our findings also demonstrated that the plant extract substantially increases the caspase 3 and 9 mRNA expression, while decreases Bcl-2. Cell cycle arrest was occurred in G2 stage, due to the results of flow cytometry. These results indicate that dichloromethanolic extract of Urtica dioica can successfully induce apoptosis in PC3 cells. Therefore, it could be used as a novel therapeutic candidate for prostate tumor treatment. PMID:27064877

  20. Effects of interferons and double-stranded RNA on human prostate cancer cell apoptosis

    PubMed Central

    Tan, Haiyan; Zeng, Chun; Xie, Junbo; Alghamdi, Norah J.; Song, Ya; Zhang, Hongbing; Zhou, Aimin; Jin, Di

    2015-01-01

    Prostate cancer is the second most commonly diagnosed cancer among men in the United States. Prostate cancer therapy is severely hampered by lack of response and development of resistance to conventional chemotherapeutic drugs in patients. Therefore, the development and discovery of new drugs have become an urgent clinical need. Interferons (IFNs), a family of pleiotropic cytokines, exert antitumor activities due to their anti-proliferative, immunomodulatory and proapoptotic functions. Here, we report that pretreatment of prostate cancer PC-3 cells with IFNs sensitized these cells to double-stranded RNAs (dsRNAs)-induced apoptosis. The enhancement effect of IFN treatment was dependent on IFN subtypes, in particular, IFN γ. In comparison with IFN α or β, IFN γ treatment remarkably augmented apoptosis in PC-3 cells induced with polyinosinic:polycytidylic acid (poly I:C), a synthesized form of dsRNA. We demonstrated that IFN-signaling was necessary for these effects by using mutant cell lines. Transfection of 2–5A, the activator of RNase L, or silencing of dsRNA-dependent protein kinase R (PKR) by siRNA did not have any significant impact on this event, suggesting that neither RNase L nor PKR was involved in poly I:C/IFN γ-induced apoptosis in the cells. Further investigation of the apoptotic pathway revealed that Bak, a pro-apoptotic member of the Bcl-2family, was synergistically up-regulated by IFN γ and poly I:C, whereas other members of the family were not affected. Knocking down of Bak demonstrated its contribution to poly I:C/IFN γ-induced apoptosis in the cells. We believeour findings will precipitate the design of novel therapeutic strategies for prostate cancer. PMID:26452032

  1. Frequent HLA class I alterations in human prostate cancer: molecular mechanisms and clinical relevance.

    PubMed

    Carretero, Francisco Javier; Del Campo, Ana Belen; Flores-Martín, Jose Francisco; Mendez, Rosa; García-Lopez, Cesar; Cozar, Jose Manuel; Adams, Victoria; Ward, Stephen; Cabrera, Teresa; Ruiz-Cabello, Francisco; Garrido, Federico; Aptsiauri, Natalia

    2016-01-01

    Reduced expression of HLA class I is an important immune escape mechanism from cytotoxic T cells described in various types of malignancy. It often correlates with poor prognosis and resistance to therapy. However, current knowledge about the frequency, underlying molecular mechanisms, and prognostic value of HLA class I and II alterations in prostate cancer (PC) is limited. Immunohistochemical analysis demonstrated that 88 % of the 42 studied cryopreserved prostate tumors have at least one type of HLA alteration as compared to adjacent normal prostate epithelium or benign hyperplasia. Total loss of HLA-I expression found in 50 % of tumors showed an association with increased incidence of tumor relapse, perineural invasion, and high D'Amico risk. The remaining HLA-I-positive tumors demonstrated locus and allelic losses detected in 26 and 12 % of samples, respectively. Loss of heterozygosity at chromosome 6 was detected in 32 % of the studied tumors. Molecular analysis revealed a reduced expression of B2M, TAP2, tapasin and NLRC5 mRNA in microdissected HLA-I-negative tumors. Analysis of twelve previously unreported cell lines derived from neoplastic and normal epithelium of cancerous prostate revealed different types of HLA-I aberration, ranging from locus and/or allelic downregulation to a total absence of HLA-I expression. The high incidence of HLA-I loss observed in PC, caused by both regulatory and structural defects, is associated with more aggressive disease development and may pose a real threat to patient health by increasing cancer progression and resistance to T-cell-based immunotherapy. PMID:26611618

  2. Biomarker Discovery in Human Prostate Cancer: an Update in Metabolomics Studies.

    PubMed

    Lima, Ana Rita; Bastos, Maria de Lourdes; Carvalho, Márcia; Guedes de Pinho, Paula

    2016-08-01

    Prostate cancer (PCa) is the most frequently diagnosed cancer and the second leading cause of cancer death among men in Western countries. Current screening techniques are based on the measurement of serum prostate specific antigen (PSA) levels and digital rectal examination. A decisive diagnosis of PCa is based on prostate biopsies; however, this approach can lead to false-positive and false-negative results. Therefore, it is important to discover new biomarkers for the diagnosis of PCa, preferably noninvasive ones. Metabolomics is an approach that allows the analysis of the entire metabolic profile of a biological system. As neoplastic cells have a unique metabolic phenotype related to cancer development and progression, the identification of dysfunctional metabolic pathways using metabolomics can be used to discover cancer biomarkers and therapeutic targets. In this study, we review several metabolomics studies performed in prostatic fluid, blood plasma/serum, urine, tissues and immortalized cultured cell lines with the objective of discovering alterations in the metabolic phenotype of PCa and thus discovering new biomarkers for the diagnosis of PCa. Encouraging results using metabolomics have been reported for PCa, with sarcosine being one of the most promising biomarkers identified to date. However, the use of sarcosine as a PCa biomarker in the clinic remains a controversial issue within the scientific community. Beyond sarcosine, other metabolites are considered to be biomarkers for PCa, but they still need clinical validation. Despite the lack of metabolomics biomarkers reaching clinical practice, metabolomics proved to be a powerful tool in the discovery of new biomarkers for PCa detection. PMID:27567960

  3. Antibody microarray profiling of human prostate cancer sera: antibody screening and identification of potential biomarkers.

    PubMed

    Miller, Jeremy C; Zhou, Heping; Kwekel, Joshua; Cavallo, Robert; Burke, Jocelyn; Butler, E Brian; Teh, Bin S; Haab, Brian B

    2003-01-01

    We developed a practical strategy for serum protein profiling using antibody microarrays and applied the method to the identification of potential biomarkers in prostate cancer serum. Protein abundances from 33 prostate cancer and 20 control serum samples were compared to abundances from a common reference pool using a two-color fluorescence assay. Robotically spotted microarrays containing 184 unique antibodies were prepared on two different substrates: polyacrylamide based hydrogels on glass and poly-1-lysine coated glass with a photoreactive cross-linking layer. The hydrogel substrate yielded an average six-fold higher signal-to-noise ratio than the other substrate, and detection of protein binding was possible from a greater number of antibodies using the hydrogels. A statistical filter based on the correlation of data from "reverse-labeled" experiment sets accurately predicted the agreement between the microarray measurements and enzyme-linked immunosorbent assay measurements, showing that this parameter can serve to screen for antibodies that are functional on microarrays. Having defined a set of reliable microarray measurements, we identified five proteins (von Willebrand Factor, immunoglobulinM, Alpha1-antichymotrypsin, Villin and immunoglobulinG) that had significantly different levels between the prostate cancer samples and the controls. These developments enable the immediate use of high-density antibody and protein microarrays in biomarker discovery studies. PMID:12548634

  4. Impact of Hypoxia on the Metastatic Potential of Human Prostate Cancer Cells

    SciTech Connect

    Dai Yao; Bae, Kyungmi; Siemann, Dietmar W.

    2011-10-01

    Purpose: Intratumoral hypoxia is known to be associated with radioresistance and metastasis. The present study examined the effect of acute and chronic hypoxia on the metastatic potential of prostate cancer PC-3, DU145, and LNCaP cells. Methods and Materials: Cell proliferation and clonogenicity were tested by MTT assay and colony formation assay, respectively. 'Wound-healing' and Matrigel-based chamber assays were used to monitor cell motility and invasion. Hypoxia-inducible factor 1 alpha (HIF-1{alpha}) expression was tested by Western blot, and HIF-1-target gene expression was detected by real-time polymerase chain reaction. Secretion of matrix metalloproteinases (MMPs) was determined by gelatin zymography. Results: When PC-3 cells were exposed to 1% oxygen (hypoxia) for various periods of time, chronic hypoxia ({>=}24 h) decreased cell proliferation and induced cell death. In contrast, prostate cancer cells exposed to acute hypoxia ({<=}6 h) displayed increased motility, clonogenic survival, and invasive capacity. At the molecular level, both hypoxia and anoxia transiently stabilized HIF-1{alpha}. Exposure to hypoxia also induced the early expression of MMP-2, an invasiveness-related gene. Treatment with the HIF-1 inhibitor YC-1 attenuated the acute hypoxia-induced migration, invasion, and MMP-2 activity. Conclusions: The length of oxygen deprivation strongly affected the functional behavior of all three prostate cancer cell lines. Acute hypoxia in particular was found to promote a more aggressive metastatic phenotype.

  5. Differential effects of blueberry proanthocyanidins on androgen sensitive and insensitive human prostate cancer cell lines.

    PubMed

    Schmidt, Barbara M; Erdman, John W; Lila, Mary Ann

    2006-01-18

    Blueberries are rich in health-promoting polyphenolic compounds including proanthocyanidins. The purpose of this study was to determine if proanthocyanidin-rich fractions from both wild and cultivated blueberry fruit have the same inhibitory effects on the proliferation of LNCaP, an androgen-sensitive prostate cancer cell line, and DU145, a more aggressive androgen insensitive prostate cancer cell line. When 20 microg/ml of a wild blueberry proanthocyanidin fraction (fraction 5) was added to LNCaP media, growth was inhibited to 11% of control with an IC50 of 13.3 microg/ml. Two similar proanthocyanidin-rich fractions from cultivated blueberries (fractions 4 and 5) at the same concentration inhibited LNCaP growth to 57 and 26% of control with an IC50 of 22.7 and 5.8 microg/ml, respectively. In DU145 cells, the only fraction that significantly reduced growth compared to control was fraction 4 from cultivated blueberries with an IC50 value of 74.4 microg/ml, indicating only minor inhibitory activity. Differences in cell growth inhibition of LNCaP and DU145 cell lines by blueberry fractions rich in proanthocyanidins indicate that blueberry proanthocyanidins have an effect primarily on androgen-dependant growth of prostate cancer cells. Possible molecular mechanisms for growth inhibition are reviewed. PMID:16399225

  6. A biospectroscopic analysis of human prostate tissue obtained from different time periods points to a trans-generational alteration in spectral phenotype.

    PubMed

    Theophilou, Georgios; Lima, Kássio M G; Briggs, Matthew; Martin-Hirsch, Pierre L; Stringfellow, Helen F; Martin, Francis L

    2015-01-01

    Prostate cancer is the most commonly-diagnosed malignancy in males worldwide; however, there is marked geographic variation in incidence that may be associated with a Westernised lifestyle. We set out to determine whether attenuated total reflection Fourier-transform infrared (ATR-FTIR) or Raman spectroscopy combined with principal component analysis-linear discriminant analysis or variable selection techniques employing genetic algorithm or successive projection algorithm could be utilised to explore differences between prostate tissues from differing years. In total, 156 prostate tissues from transurethral resection of the prostate procedures for benign prostatic hyperplasia from 1983 to 2013 were collected. These were distributed to form seven categories: 1983-1984 (n = 20), 1988-1989 (n = 25), 1993-1994 (n = 21), 1998-1999 (n = 21), 2003-2004 (n = 21), 2008-2009 (n = 20) and 2012-2013 (n = 21). Ten-μm-thick tissue sections were floated onto Low-E (IR-reflective) slides for ATR-FTIR or Raman spectroscopy. The prostate tissue spectral phenotype altered in a temporal fashion. Examination of the two categories that are at least one generation (30 years) apart indicated highly-significant segregation, especially in spectral regions containing DNA and RNA bands (≈1,000-1,490 cm(-1)). This may point towards alterations that have occurred through genotoxicity or through epigenetic modifications. Immunohistochemical studies for global DNA methylation supported this. This study points to a trans-generational phenotypic change in human prostate. PMID:26310632

  7. A biospectroscopic analysis of human prostate tissue obtained from different time periods points to a trans-generational alteration in spectral phenotype

    PubMed Central

    Theophilou, Georgios; Lima, Kássio M. G.; Briggs, Matthew; Martin-Hirsch, Pierre L.; Stringfellow, Helen F.; Martin, Francis L.

    2015-01-01

    Prostate cancer is the most commonly-diagnosed malignancy in males worldwide; however, there is marked geographic variation in incidence that may be associated with a Westernised lifestyle. We set out to determine whether attenuated total reflection Fourier-transform infrared (ATR-FTIR) or Raman spectroscopy combined with principal component analysis-linear discriminant analysis or variable selection techniques employing genetic algorithm or successive projection algorithm could be utilised to explore differences between prostate tissues from differing years. In total, 156 prostate tissues from transurethral resection of the prostate procedures for benign prostatic hyperplasia from 1983 to 2013 were collected. These were distributed to form seven categories: 1983–1984 (n = 20), 1988–1989 (n = 25), 1993–1994 (n = 21), 1998–1999 (n = 21), 2003–2004 (n = 21), 2008–2009 (n = 20) and 2012–2013 (n = 21). Ten-μm-thick tissue sections were floated onto Low-E (IR-reflective) slides for ATR-FTIR or Raman spectroscopy. The prostate tissue spectral phenotype altered in a temporal fashion. Examination of the two categories that are at least one generation (30 years) apart indicated highly-significant segregation, especially in spectral regions containing DNA and RNA bands (≈1,000–1,490 cm−1). This may point towards alterations that have occurred through genotoxicity or through epigenetic modifications. Immunohistochemical studies for global DNA methylation supported this. This study points to a trans-generational phenotypic change in human prostate. PMID:26310632

  8. Designed modulation of sex steroid signaling inhibits telomerase activity and proliferation of human prostate cancer cells

    SciTech Connect

    Verma, Vikas; Sharma, Vikas; Singh, Vishal; Sharma, Siddharth; Bishnoi, Ajay Kumar; Chandra, Vishal; Maikhuri, J.P.; Dwivedi, Anila; Kumar, Atul; Gupta, Gopal

    2014-10-15

    The predominant estrogen-receptor (ER)-β signaling in normal prostate is countered by increased ER-α signaling in prostate cancer (CaP), which in association with androgen-receptor (AR) signaling results in pathogenesis of the disease. However CaP treatments mostly target AR signaling which is initially effective but eventually leads to androgen resistance, hence simultaneous targeting of ERs has been proposed. A novel series of molecules were designed with multiple sex-steroid receptor modulating capabilities by coalescing the pharmacophores of known anti-CaP molecules that act via modulation of ER(α/β) and/or AR, viz. 3,3′diindolylmethane (DIM), mifepristone, toremifene, tamoxifen and raloxifene. N,N-diethyl-4-((2-(4-methoxyphenyl)-1H-indol-3-yl)methyl) aniline (DIMA) was identified as the most promising structure of this new series. DIMA increased annexin-V labelling, cell-cycle arrest and caspase-3 activity, and decreased expression of AR and prostate specific antigen in LNCaP cells, in vitro. Concurrently, DIMA increased ER-β, p21 and p27 protein levels in LNCaP cells and exhibited ∼ 5 times more selective binding for ER-β than ER-α, in comparison to raloxifene. DIMA exhibited a dose-dependent ER-β agonism and ER-α antagonism in classical gene reporter assay and decreased hTERT (catalytic subunit of telomerase) transcript levels in LNCaP at 3.0 μM (P < 0.05). DIMA also dose-dependently decreased telomerase enzyme activity in prostate cancer cells. It is thus concluded that DIMA acts as a multi-steroid receptor modulator and effectively inhibits proliferation of prostate cancer cells through ER-β mediated telomerase inhibition, by countering actions of ER-α and AR. Its unique molecular design can serve as a lead structure for generation of potent agents against endocrine malignancies like the CaP.

  9. Suppression of rat and human androgen biosynthetic enzymes by apigenin: Possible use for the treatment of prostate cancer.

    PubMed

    Wang, Xiudi; Wang, Guimin; Li, Xiaoheng; Liu, Jianpeng; Hong, Tingting; Zhu, Qiqi; Huang, Ping; Ge, Ren-Shan

    2016-06-01

    Apigenin is a natural flavone. It has recently been used as a chemopreventive agent. It may also have some beneficial effects to treat prostate cancer by inhibiting androgen production. The objective of the present study was to investigate the effects of apigenin on the steroidogenesis of rat immature Leydig cells and some human testosterone biosynthetic enzyme activities. Rat immature Leydig cells were incubated for 3h with 100μM apigenin without (basal) or with 1ng/ml luteinizing hormone (LH), 10mM 8-bromoadenosine 3',5'-cyclic monophosphate (8BR), and 20μM of the following steroid substrates: 22R-hydroxychloesterol (22R), pregnenolone (P5), progesterone (P4), and androstenedione (D4). The medium levels of 5α-androstane-3α, 17β-diol (DIOL), the primary androgen produced by rat immature Leydig cells, were measured. Apigenin significantly inhibited basal, 8BR, 22R, PREG, P4, and D4 stimulated DIOL production in rat immature Leydig cells. Further study showed that apigenin inhibited rat 3β-hydroxysteroid dehydrogenase, 17α-hydroxylase/17, 20-lyase, and 17β-hydroxysteroid dehydrogenase 3 with IC50 values of 11.41±0.7, 8.98±0.10, and 9.37±0.07μM, respectively. Apigenin inhibited human 3β-hydroxysteroid dehydrogenase and 17β-hydroxysteroid dehydrogenase 3 with IC50 values of 2.17±0.04 and 1.31±0.09μM, respectively. Apigenin is a potent inhibitor of rat and human steroidogenic enzymes, being possible use for the treatment of prostate cancer. PMID:27102611

  10. Annatto Tocotrienol Induces a Cytotoxic Effect on Human Prostate Cancer PC3 Cells via the Simultaneous Inhibition of Src and Stat3.

    PubMed

    Sugahara, Ryosuke; Sato, Ayami; Uchida, Asuka; Shiozawa, Shinya; Sato, Chiaki; Virgona, Nantiga; Yano, Tomohiro

    2015-01-01

    Prostate cancer is one of the most frequently occurring cancers and often acquires the potential of androgen-independent growth as a malignant phenotype. Androgen-independent prostate cancer has severe chemoresistance towards conventional chemotherapeutic agents, so a new treatment approach is required for curing such prostate cancer. In this context, the present study was undertaken to check if annatto tocotrienol (main component δ-tocotrienol) could suppress cell growth in human prostate cancer (PC3, androgen-independent type) cells via the inhibition of Src and Stat3. The tocotrienol showed cytotoxic effects on PC3 cells in a dose-dependent manner, and the effect depended on G1 arrest in the cell cycle and subsequent induction of apoptosis. In a cytotoxic dose, the tocotrienol suppressed cellular growth via the simultaneous inhibition of Src and Stat3. Similarly, the treatment combination of both Src and Stat3 inhibitors induced cytotoxic effects in PC3 cells in an additive manner compared to each by itself. With respect to cell cycle regulation and the induction of apoptosis, the combination treatment showed a similar effect to that of the tocotrienol treatment. These results suggest that annatto tocotrienol effectively induces cytotoxicity in androgen-independent prostate cancer cells via the suppression of Src and Stat3. PMID:26875492

  11. Bioenergetic and Antiapoptotic Properties of Mitochondria from Cultured Human Prostate Cancer Cell Lines PC-3, DU145 and LNCaP

    PubMed Central

    Panov, Alexander; Orynbayeva, Zulfiya

    2013-01-01

    The purpose of this work was to reveal the metabolic features of mitochondria that might be essential for inhibition of apoptotic potential in prostate cancer cells. We studied mitochondria isolated from normal prostate epithelial cells (PrEC), metastatic prostate cancer cell lines LNCaP, PC-3, DU145; and non-prostate cancer cells - human fibrosarcoma HT1080 cells; and normal human lymphoblastoid cells. PrEC cells contained 2 to 4 times less mitochondria per gram of cells than the three PC cell lines. Respiratory activities of PrEC cell mitochondria were 5-20-fold lower than PC mitochondria, depending on substrates and the metabolic state, due to lower content and lower activity of the respiratory enzyme complexes. Mitochondria from the three metastatic prostate cancer cell lines revealed several features that are distinctive only to these cells: low affinity of Complex I for NADH, 20-30 mV higher electrical membrane potential (ΔΨ). Unprotected with cyclosporine A (CsA) the PC-3 mitochondria required 4 times more Ca2+ to open the permeability transition pore (mPTP) when compared with the PrEC mitochondria, and they did not undergo swelling even in the presence of alamethicin, a large pore forming antibiotic. In the presence of CsA, the PC-3 mitochondria did not open spontaneously the mPTP. We conclude that the low apoptotic potential of the metastatic PC cells may arise from inhibition of the Ca2+-dependent permeability transition due to a very high ΔΨ and higher capacity to sequester Ca2+. We suggest that due to the high ΔΨ, mitochondrial metabolism of the metastatic prostate cancer cells is predominantly based on utilization of glutamate and glutamine, which may promote development of cachexia. PMID:23951286

  12. A possible role of BDNF in prostate cancer detection.

    PubMed

    Bronzetti, E; Artico, M; Forte, F; Pagliarella, G; Felici, L M; D'Ambrosio, A; Vespasiani, G; Bronzetti, B

    2008-04-01

    Many studies have demonstrated that both normal and malignant prostate cells respond to a variety of growth factors, while several significant differences were found between normal and tumoural cells. The aim of this study was to focus on the localization and distribution of the immuno-reactivity for neurotrophins (NTs) and neurotrophin receptors (NTRs) in normal, hyperplastic and prostate cancer cells, obtained from 40 subjects. We studied samples obtained from 16 prostate cancer (PC, retropubic radical prostatectomy), 20 benign prostatic hyperplasia (BPH, supra-pubic prostatectomy) and normal peripheral prostate tissue from four fresh male cadavers. Samples were examined via immunohistochemical techniques in order to detect the expression of nerve growth factor (NGF), brain derived neurotrophic factor (BDNF), neurotrophin 3 (NT3) and their own receptors TrkA, p75, TrkB and TrkC. We observed a high expression of BDNF and TrkB in PC and BPH, though no immuno-reactivity was found for p75. Low expression was reported by other NTs and NTRs in the normal peripheral prostate zone, BPH and PC. These data suggest a possible predictive role for NTs and NTRs, especially for BDNF and TrkB, in the diagnosis and/or management of prostate cancer. The absence of p75 expression confirms its supposed role in apoptotic phenomenon. PMID:18357383

  13. Expression and Localization of Aquaporins in Benign Prostate Hyperplasia and Prostate Cancer

    PubMed Central

    Hwang, Insang; Hwang, Eu-Chang; Song, Seung Hee; Lee, Hyun-Suk; Kim, Sun-Ouck; Kang, Taek-Won; Kwon, Dongdeuk; Park, Kwangsung

    2012-01-01

    The aquaporin (AQP) families of water channels are intrinsic membrane proteins that facilitate selective water and small solute movement across the plasma membrane. The purposes of this study were to determine the expression and localization of AQPs in benign prostatic hyperplasia and prostate cancer. Prostatic tissue was collected from patients with benign prostatic hyperplasia or prostate cancer by transurethral resection of the prostate. The expression and cellular localization of the AQPs were determined in the human prostate by Western blot and immunohistochemistry. AQP1, 3, and 9 were expressed in the human prostate. Western blot analysis revealed bands at 28-36 kDa for the AQP1, 3, and 9 proteins. Of these proteins, AQP3 and 9 were expressed in the epithelium. Immunolabeling showed that AQP1 was mainly expressed in the capillaries and venules of the prostate, AQP9 was expressed in the cytoplasm of the epithelium, and AQP3 was mainly associated with the plasma membrane of the prostatic epithelium. Only AQP3 expression was localized in the cell membrane, and expressed AQP3 was translocated to the cytoplasm in prostate cancer. The epithelium in the human prostate expresses AQP3 and 9 proteins, and the capillaries and venules of the prostate express AQP1. Characterizing or modifying the expression of AQP3 may lead to an understanding of the role of the AQPs in human prostatic disease. PMID:23323224

  14. Oxidative stress in prostate hyperplasia and carcinogenesis.

    PubMed

    Udensi, Udensi K; Tchounwou, Paul B

    2016-01-01

    Prostatic hyperplasia (PH) is a common urologic disease that affects mostly elderly men. PH can be classified as benign prostatic hyperplasia (BPH), or prostate cancer (PCa) based on its severity. Oxidative stress (OS) is known to influence the activities of inflammatory mediators and other cellular processes involved in the initiation, promotion and progression of human neoplasms including prostate cancer. Scientific evidence also suggests that micronutrient supplementation may restore the antioxidant status and hence improve the clinical outcomes for patients with BPH and PCa. This review highlights the recent studies on prostate hyperplasia and carcinogenesis, and examines the role of OS on the molecular pathology of prostate cancer progression and treatment. PMID:27609145

  15. Quercetin-loaded nanomicelles to circumvent human castration-resistant prostate cancer in vitro and in vivo

    NASA Astrophysics Data System (ADS)

    Zhao, Jing; Liu, Juan; Wei, Tuo; Ma, Xiaowei; Cheng, Qiang; Huo, Shuaidong; Zhang, Chunqiu; Zhang, Yanan; Duan, Xianglin; Liang, Xing-Jie

    2016-02-01

    Prostate cancer is highly prevalent and has become the second leading cause of cancer-related death in men. Its treatment remains a challenge in the clinic, particularly in patients who have advanced to ``castration-resistant prostate cancer'' (CRPC). Thus, more effective therapeutic strategies are required. Quercetin (QCT) is a natural flavonoid compound that has attracted increasing interest due to its anticancer activity. However, the clinical application of quercetin is largely hampered by its poor water solubility and low bioavailability. The objective of this study was to evaluate the therapeutic potential of novel QCT-loaded nanomicelles (M-QCTs) assembled from DSPE-PEG2000 for prostate cancer treatment. Our results indicated that QCT was efficiently encapsulated into micelles up to 1 mg mL-1, which corresponds to a 450-fold increase of its water solubility. In vitro studies showed that the half-maximal inhibitory concentration (IC50) value (20.2 μM) of M-QCTs was much lower than free QCT (>200 μM). Thus, M-QCTs were considerably more effective than free QCT in proliferation inhibition and apoptosis induction of human androgen-independent PC-3 cells. Furthermore, M-QCTs showed superior antitumor efficacy and the tumor proliferation rate reduced by 52.03% compared to the control group in the PC-3 xenograft mouse model, possibly due to increased accumulation of M-QCTs at the tumor site by the enhanced permeability and retention (EPR) effect. Collectively, our studies demonstrated that M-QCTs significantly increase drug accumulation at the tumor site and exhibit superior anticancer activity in prostate cancer. Thus, our nanomicelle-based drug delivery system constitutes a promising and effective therapeutic strategy for clinical treatment.Prostate cancer is highly prevalent and has become the second leading cause of cancer-related death in men. Its treatment remains a challenge in the clinic, particularly in patients who have advanced to ``castration

  16. Quercetin-loaded nanomicelles to circumvent human castration-resistant prostate cancer in vitro and in vivo

    NASA Astrophysics Data System (ADS)

    Zhao, Jing; Liu, Juan; Wei, Tuo; Ma, Xiaowei; Cheng, Qiang; Huo, Shuaidong; Zhang, Chunqiu; Zhang, Yanan; Duan, Xianglin; Liang, Xing-Jie

    2016-02-01

    Prostate cancer is highly prevalent and has become the second leading cause of cancer-related death in men. Its treatment remains a challenge in the clinic, particularly in patients who have advanced to ``castration-resistant prostate cancer'' (CRPC). Thus, more effective therapeutic strategies are required. Quercetin (QCT) is a natural flavonoid compound that has attracted increasing interest due to its anticancer activity. However, the clinical application of quercetin is largely hampered by its poor water solubility and low bioavailability. The objective of this study was to evaluate the therapeutic potential of novel QCT-loaded nanomicelles (M-QCTs) assembled from DSPE-PEG2000 for prostate cancer treatment. Our results indicated that QCT was efficiently encapsulated into micelles up to 1 mg mL-1, which corresponds to a 450-fold increase of its water solubility. In vitro studies showed that the half-maximal inhibitory concentration (IC50) value (20.2 μM) of M-QCTs was much lower than free QCT (>200 μM). Thus, M-QCTs were considerably more effective than free QCT in proliferation inhibition and apoptosis induction of human androgen-independent PC-3 cells. Furthermore, M-QCTs showed superior antitumor efficacy and the tumor proliferation rate reduced by 52.03% compared to the control group in the PC-3 xenograft mouse model, possibly due to increased accumulation of M-QCTs at the tumor site by the enhanced permeability and retention (EPR) effect. Collectively, our studies demonstrated that M-QCTs significantly increase drug accumulation at the tumor site and exhibit superior anticancer activity in prostate cancer. Thus, our nanomicelle-based drug delivery system constitutes a promising and effective therapeutic strategy for clinical treatment.Prostate cancer is highly prevalent and has become the second leading cause of cancer-related death in men. Its treatment remains a challenge in the clinic, particularly in patients who have advanced to ``castration

  17. Functional and Structural Consequences of Damaging Single Nucleotide Polymorphisms in Human Prostate Cancer Predisposition Gene RNASEL

    PubMed Central

    Datta, Amit; Mazumder, Md. Habibul Hasan; Chowdhury, Afrin Sultana; Hasan, Md. Anayet

    2015-01-01

    A commonly diagnosed cancer, prostate cancer (PrCa), is being regulated by the gene RNASEL previously known as PRCA1 codes for ribonuclease L which is an integral part of interferon regulated system that mediates antiviral and antiproliferative role of the interferons. Both somatic and germline mutations have been implicated to cause prostate cancer. With an array of available Single Nucleotide Polymorphism data on dbSNP this study is designed to sort out functional SNPs in RNASEL by implementing different authentic computational tools such as SIFT, PolyPhen, SNPs&GO, Fathmm, ConSurf, UTRScan, PDBsum, Tm-Align, I-Mutant, and Project HOPE for functional and structural assessment, solvent accessibility, molecular dynamics, and energy minimization study. Among 794 RNASEL SNP entries 124 SNPs were found nonsynonymous from which SIFT predicted 13 nsSNPs as nontolerable whereas PolyPhen-2 predicted 28. SNPs found on the 3′ and 5′ UTR were also assessed. By analyzing six tools having different perspectives an aggregate result was produced where nine nsSNPs were found to be most likely to exert deleterious effect. 3D models of mutated proteins were generated to determine the functional and structural effect of the mutations on ribonuclease L. The initial findings were reinforced by the results from I-Mutant and Project HOPE as these tools predicted significant structural and functional instability of the mutated proteins. Expasy-ProSit tool defined the mutations to be situated in the functional domains of the protein. Considering previous analysis this study revealed a conclusive result deducing the available SNP data on the database by identifying the most damaging three nsSNP rs151296858 (G59S), rs145415894 (A276V), and rs35896902 (R592H). As such studies involving polymorphisms of RNASEL were none to be found, the results of the current study would certainly be helpful in future prospects concerning prostate cancer in males. PMID:26236721

  18. Proteomic analysis of cancer stem cells in human prostate cancer cells

    SciTech Connect

    Lee, Eun-Kyung; Cho, Hyungdon; Kim, Chan-Wha

    2011-08-26

    Highlights: {yields} DU145 prostate cancer cell line was isolated into CD44+ or CD44- cells. {yields} We confirmed CD44+ DU145 cells are more proliferative and tumorigenic than CD44- DU145 cells. {yields} We analyzed and identified proteins that were differentially expressed between CD44+ and CD44- DU145 cells. {yields} Cofilin and Annexin A5 associated with cancer were found to be positively correlated with CD44 expression. -- Abstract: Results from recent studies support the hypothesis that cancer stem cells (CSCs) are responsible for tumor initiation and formation. Here, we applied a proteome profiling approach to investigate the mechanisms of CSCs and to identify potential biomarkers in the prostate cancer cell line DU145. Using MACS, the DU145 prostate cancer cell line was isolated into CD44+ or CD44- cells. In sphere culture, CD44+ cells possessed stem cell characteristics and highly expressed genes known to be important in stem cell maintenance. In addition, they showed strong tumorigenic potential in the clonogenic assay and soft agar colony formation assay. We then analyzed and identified proteins that were differentially expressed between CD44+ and CD44- using two-dimensional gel electrophoresis and LC-MS/MS. Cofilin and Annexin A5, which are associated with proliferation or metastasis in cancer, were found to be positively correlated with CD44 expression. These results provide information that will be important to the development of new cancer diagnostic tools and understanding the mechanisms of CSCs although a more detailed study is necessary to investigate the roles of Cofilin and Annexin A5 in CSCs.

  19. Functional and Structural Consequences of Damaging Single Nucleotide Polymorphisms in Human Prostate Cancer Predisposition Gene RNASEL.

    PubMed

    Datta, Amit; Mazumder, Md Habibul Hasan; Chowdhury, Afrin Sultana; Hasan, Md Anayet

    2015-01-01

    A commonly diagnosed cancer, prostate cancer (PrCa), is being regulated by the gene RNASEL previously known as PRCA1 codes for ribonuclease L which is an integral part of interferon regulated system that mediates antiviral and antiproliferative role of the interferons. Both somatic and germline mutations have been implicated to cause prostate cancer. With an array of available Single Nucleotide Polymorphism data on dbSNP this study is designed to sort out functional SNPs in RNASEL by implementing different authentic computational tools such as SIFT, PolyPhen, SNPs&GO, Fathmm, ConSurf, UTRScan, PDBsum, Tm-Align, I-Mutant, and Project HOPE for functional and structural assessment, solvent accessibility, molecular dynamics, and energy minimization study. Among 794 RNASEL SNP entries 124 SNPs were found nonsynonymous from which SIFT predicted 13 nsSNPs as nontolerable whereas PolyPhen-2 predicted 28. SNPs found on the 3' and 5' UTR were also assessed. By analyzing six tools having different perspectives an aggregate result was produced where nine nsSNPs were found to be most likely to exert deleterious effect. 3D models of mutated proteins were generated to determine the functional and structural effect of the mutations on ribonuclease L. The initial findings were reinforced by the results from I-Mutant and Project HOPE as these tools predicted significant structural and functional instability of the mutated proteins. Expasy-ProSit tool defined the mutations to be situated in the functional domains of the protein. Considering previous analysis this study revealed a conclusive result deducing the available SNP data on the database by identifying the most damaging three nsSNP rs151296858 (G59S), rs145415894 (A276V), and rs35896902 (R592H). As such studies involving polymorphisms of RNASEL were none to be found, the results of the current study would certainly be helpful in future prospects concerning prostate cancer in males. PMID:26236721

  20. Label-free electrochemical aptasensing of the human prostate-specific antigen using gold nanospears.

    PubMed

    Rahi, A; Sattarahmady, N; Heli, H

    2016-08-15

    Gold nanospears were electrodeposited with the assistance of arginine as a soft template and precise selection of experimental parameters. The nanospears were then employed as a transducer to immobilize an aptamer of prostate-specific antigen (PSA) and fabrication of a label-free electrochemical aptasensor. The aptasensor was employed for the detection of PSA with a linear concentration range of 0.125-200ngmL(-1) and a limit of detection of 50pgmL(-1). The aptasensor was successfully applied to detect PSA in blood serum samples of healthy and patient persons. PMID:27260456

  1. Prostate brachytherapy

    MedlinePlus

    Implant therapy - prostate cancer; Radioactive seed placement; Internal radiation therapy - prostate; High dose radiation (HDR) ... radiation safety precautions. If you have a permanent implant, your provider may tell you to limit the ...

  2. Prostate Cancer

    MedlinePlus

    ... man's bladder that produces fluid for semen. Prostate cancer is common among older men. It is rare ... younger than 40. Risk factors for developing prostate cancer include being over 65 years of age, family ...

  3. Prostate biopsy

    MedlinePlus

    Aliotta PJ, Fowler GC. Prostate and seminal vesicle ultrasonography and biopsy. In: Pfenninger JL, Fowler GC, eds. ... 1/2015. Trabulsi EJ, Halpern EJ, Gomella LG. Ultrasonography and biopsy of the prostate. In: Wein AJ, ...

  4. Prostate Cancer

    MedlinePlus

    ... a man's bladder that produces fluid for semen. Prostate cancer is common among older men. It is rare ... men younger than 40. Risk factors for developing prostate cancer include being over 65 years of age, family ...

  5. Combination Treatment of Hydrogen Peroxide and X-Rays Induces Apoptosis in Human Prostate Cancer PC-3 Cells

    SciTech Connect

    Kariya, Shinji Sawada, Ken; Kobayashi, Toshihiro; Karashima, Takashi; Shuin, Taro; Nishioka, Akihito; Ogawa, Yasuhiro

    2009-10-01

    Purpose: To study the effect of hydrogen peroxide (H{sub 2}O{sub 2}) on radiation-induced apoptosis in human prostate cancer PC-3 cells. Methods and Materials: At 4h before the irradiation, PC-3 cells were exposed to 10mM ammonium chloride (NH{sub 4}Cl) concentrations. Subsequently, cells were exposed to 0.1mM H{sub 2}O{sub 2} just before the irradiations, which were administered with 10-MV X-rays at doses of 10Gy. Results: The percentage of apoptotic cells at 48h after X-irradiation alone, H{sub 2}O{sub 2} alone, and combined X-irradiation and H{sub 2}O{sub 2} was 1.85%, 4.85%, and 28.4%, respectively. With use of combined X-irradiation and H{sub 2}O{sub 2}, production of reactive oxygen species (ROS) occurred 4h after the irradiation. This resulted in lysosomal rupturing, mitochondrial fragmentation, and the release of cytochrome c into the cytoplasm from the mitochondria. In contrast, when cells were exposed to NH{sub 4}Cl before the X-irradiation and H{sub 2}O{sub 2} administration, apoptosis was almost completely suppressed, ROS production did not occur, lysosomal rupture and mitochondrial fragmentation were blocked, and cytochrome c was not released. Conclusions: Hydrogen peroxide strongly enhanced lysosome-dependent radiation-induced apoptosis in human prostate cancer PC-3 cells. A combined use of X-rays and H{sub 2}O{sub 2} can also injure the mitochondrial cytoplasmic organelles and lead to the production of ROS that in and of itself might possibly induce apoptosis.

  6. Suppression of growth and invasive behavior of human prostate cancer cells by ProstaCaid™: mechanism of activity.

    PubMed

    Jiang, Jiahua; Eliaz, Isaac; Sliva, Daniel

    2011-06-01

    Since the use of dietary supplements as alternative treatments or adjuvant therapies in cancer treatment is growing, a scientific verification of their biological activity and the detailed mechanisms of their action are necessary for the acceptance of dietary supplements in conventional cancer treatments. In the present study we have evaluated the anti-cancer effects of dietary supplement ProstaCaid™ (PC) which contains mycelium from medicinal mushrooms (Ganoderma lucidum, Coriolus versicolor, Phellinus linteus), saw palmetto berry, pomegranate, pumpkin seed, green tea [40% epigallocatechin-3-gallate (EGCG)], Japanese knotweed (50% resveratrol), extracts of turmeric root (BCM-95®), grape skin, pygeum bark, sarsaparilla root, Scutellaria barbata, eleuthero root, Job's tears, astragalus root, skullcap, dandelion, coptis root, broccoli, and stinging nettle, with purified vitamin C, vitamin D3, selenium, quercetin, citrus bioflavonoid complex, β sitosterolzinc, lycopene, α lipoic acid, boron, berberine and 3.3'-diinodolymethane (DIM). We show that PC treatment resulted in the inhibition of cell proliferation of the highly invasive human hormone refractory (independent) PC-3 prostate cancer cells in a dose- and time-dependent manner with IC50 56.0, 45.6 and 39.0 µg/ml for 24, 48 and 72 h, respectively. DNA-microarray analysis demonstrated that PC inhibits proliferation through the modulation of expression of CCND1, CDK4, CDKN1A, E2F1, MAPK6 and PCNA genes. In addition, PC also suppresses metastatic behavior of PC-3 by the inhibition of cell adhesion, cell migration and cell invasion, which was associated with the down-regulation of expression of CAV1, IGF2, NR2F1, and PLAU genes and suppressed secretion of the urokinase plasminogen activator (uPA) from PC-3 cells. In conclusion, the dietary supplement PC is a promising natural complex with the potency to inhibit invasive human prostate cancer. PMID:21468543

  7. Gastric hyperplastic polyps coexisting with early gastric cancers, adenoma and neuroendocrine cell hyperplasia.

    PubMed

    Karpińska-Kaczmarczyk, K; Lewandowska, M; Białek, A; Ławniczak, M; Urasińska, E

    2016-03-01

    Gastric hyperplastic polyps (GHP) constitute up to 93% of all benign epithelial polyps of the stomach. The average probability of malignant transformation in GHP is 0.6-22% in large series. The aim of the study was to present the coexistence of GHP with early gastric cancer (EGC), gastric adenoma (GA), neuroendocrine cell hyperplasia (NH) and well-differentiated neuroendocrine tumour (NET G1). Three cases were studied to reveal clinical data and morphological changes and to assess the relationship between GHP and accompanying gastric neoplastic lesions. PMID:27179272

  8. Prostate cancer.

    PubMed

    Castillejos-Molina, Ricardo Alonso; Gabilondo-Navarro, Fernando Bernardo

    2016-04-01

    Prostate cancer is the most frequent tumor found in men worldwide and in Mexico in particular. Age and family history are the main risk factors. The diagnosis is made by prostate biopsy in patients with abnormalities detected in their prostate-specific antigen (PSA) levels or digital rectal exam (DRE). This article reviews screening and diagnostic methods as well as treatment options for patients diagnosed with prostate cancer. PMID:27557386

  9. The role of the prostate in male fertility, health and disease.

    PubMed

    Verze, Paolo; Cai, Tommaso; Lorenzetti, Stefano

    2016-07-01

    Ejaculation is a synchronized cascade of events that has the ultimate goal of activating sperm and enabling them to reach an egg for fertilization. The seminal plasma contains a complex mixture of fluids that is secreted from the testes, epididymis and male accessory glands. The prostate gland has a pivotal role in this process, as prostatic fluid enriched in Zn(2+), citrate and kallikreins is crucial for the molecular synchronization of the functional cascade triggered by ejaculatory stimuli. The prostate is the target of a number of common diseases that can affect male fertility at different ages. In both young and aged men, prostatic diseases or an unhealthy prostate can affect spermatozoa functioning and, therefore, male fertility. Consideration of prostate physiology emphasizes a number of points: the central role of Zn(2+) and citrate in the regulation of prostate epithelium homeostasis and in ejaculation; the influence of bacteria-related prostatic inflammation on male fertility; and the potential role of prostatic inflammation in promoting the development of prostatic hyperplastic growth and carcinogenesis. PMID:27245504

  10. Membrane type-1-matrix metalloproteinase expressed by prostate carcinoma cells cleaves human laminin-5 beta3 chain and induces cell migration.

    PubMed

    Udayakumar, Thirupandiyur S; Chen, Man Ling; Bair, Elisabeth L; Von Bredow, Dorothea C; Cress, Anne E; Nagle, Raymond B; Bowden, G Timothy

    2003-05-01

    Degradation of the extracellular matrix by proteolytic enzymes is a central aspect of physiological and pathologic tissue-remodeling processes such as trophoblastic implantation, wound healing, and tumor invasion. We have hypothesized that prostate adenocarcinoma cell invasion through the normal basal lamina is attributable in part to metalloproteinase-induced cleavage of laminin-5 (Ln-5) and enhanced motility of the cancer cells. We studied the role of membrane type-1-matrix metalloproteinase (MT1-MMP) expressed on the surface of prostate tumor cells in cleaving Ln-5 and enhancing the migration of prostate tumor cells. We also determined the nature of the MT1-MMP cleavage of human Ln-5 and how this altered Ln-5 changes the migration of prostate carcinoma cells. We found that human MT1-MMP cleaves purified human Ln-5 to an 80-kDa fragment. Mass spectrometry analyses of the 80-kDa cleaved product by trypsin and chymotrypsin gave 14 and 9 different peptide sequences, respectively, that were identical to the expected amino acid sequence of the Ln-5-beta3 chain. The recovered peptides represent 14.4% (trypsin) and 10.3% (chymotrypsin) of Ln-5-beta3 chain by amino acid count. Both trypsin and chymotrypsin digestion of MT1-MMP-cleaved product of Ln-5 did not show any other peptides that were identical to the other chains of Ln-5. Using a linear migration assay we found that the Ln-5 cleaved by MT1-MMP enhanced the migration of DU-145 prostate carcinoma cells by 2-fold compared with uncleaved Ln-5. The use of blocked antisense MT1-MMP oligonucleotides inhibited the migration of DU-145 cells on Ln-5. We also found that the prostate carcinoma cells expressing high levels of MT1-MMP, such as PC3N and PPC, demonstrated enhanced migration on human Ln-5-coated substrate, and this migration was inhibited using blocked antisense MT1-MMP oligonucleotides. In conclusion, this is a novel and important finding where we have shown that beta3-chain is cleaved by MT1-MMP, and this

  11. Prostate Diseases

    MedlinePlus

    The prostate is a gland in men. It helps make semen, the fluid that contains sperm. The prostate surrounds the tube that carries urine away from ... and out of the body. A young man's prostate is about the size of a walnut. It ...

  12. Effects of Sorafenib on C-Terminally Truncated Androgen Receptor Variants in Human Prostate Cancer Cells

    PubMed Central

    Zengerling, Friedemann; Streicher, Wolfgang; Schrader, Andres J.; Schrader, Mark; Nitzsche, Bianca; Cronauer, Marcus V.; Höpfner, Michael

    2012-01-01

    Recent evidence suggests that the development of castration resistant prostate cancer (CRPCa) is commonly associated with an aberrant, ligand-independent activation of the androgen receptor (AR). A putative mechanism allowing prostate cancer (PCa) cells to grow under low levels of androgens, is the expression of constitutively active, C-terminally truncated AR lacking the AR-ligand binding domain (LBD). Due to the absence of a LBD, these receptors, termed ARΔLBD, are unable to respond to any form of anti-hormonal therapies. In this study we demonstrate that the multikinase inhibitor sorafenib inhibits AR as well as ARΔLBD-signalling in CRPCa cells. This inhibition was paralleled by proteasomal degradation of the AR- and ARΔLBD-molecules. In line with these observations, maximal antiproliferative effects of sorafenib were achieved in AR and ARΔLBD-positive PCa cells. The present findings warrant further investigations on sorafenib as an option for the treatment of advanced AR-positive PCa. PMID:23109869

  13. Effects of sorafenib on C-terminally truncated androgen receptor variants in human prostate cancer cells.

    PubMed

    Zengerling, Friedemann; Streicher, Wolfgang; Schrader, Andres J; Schrader, Mark; Nitzsche, Bianca; Cronauer, Marcus V; Höpfner, Michael

    2012-01-01

    Recent evidence suggests that the development of castration resistant prostate cancer (CRPCa) is commonly associated with an aberrant, ligand-independent activation of the androgen receptor (AR). A putative mechanism allowing prostate cancer (PCa) cells to grow under low levels of androgens, is the expression of constitutively active, C-terminally truncated AR lacking the AR-ligand binding domain (LBD). Due to the absence of a LBD, these receptors, termed ARΔLBD, are unable to respond to any form of anti-hormonal therapies. In this study we demonstrate that the multikinase inhibitor sorafenib inhibits AR as well as ARΔLBD-signalling in CRPCa cells. This inhibition was paralleled by proteasomal degradation of the AR- and ARΔLBD-molecules. In line with these observations, maximal antiproliferative effects of sorafenib were achieved in AR and ARΔLBD-positive PCa cells. The present findings warrant further investigations on sorafenib as an option for the treatment of advanced AR-positive PCa. PMID:23109869

  14. Prazosin displays anticancer activity against human prostate cancers: targeting DNA and cell cycle.

    PubMed

    Lin, Ssu-Chia; Chueh, Shih-Chieh; Hsiao, Che-Jen; Li, Tsia-Kun; Chen, Tzu-Hsuan; Liao, Cho-Hwa; Lyu, Ping-Chiang; Guh, Jih-Hwa

    2007-10-01

    Quinazoline-based alpha1-adrenoceptor antagonists, in particular doxazosin and terazosin, are suggested to display antineoplastic activity against prostate cancers. However, there are few studies elucidating the effect of prazosin. In this study, prazosin displayed antiproliferative activity superior to that of other alpha1-blockers, including doxazosin, terazosin, tamsulosin, and phentolamine. Prazosin induced G2 checkpoint arrest and subsequent apoptosis in prostate cancer PC-3, DU-145, and LNCaP cells. In p53-null PC-3 cells, prazosin induced an increase in DNA strand breaks and ATM/ATR checkpoint pathways, leading to the activation of downstream signaling cascades, including Cdc25c phosphorylation at Ser216, nuclear export of Cdc25c, and cyclin-dependent kinase (Cdk) 1 phosphorylation at Tyr15. The data, together with sustained elevated cyclin A levels (other than cyclin B1 levels), suggested that Cdk1 activity was inactivated by prazosin. Moreover, prazosin triggered mitochondria-mediated and caspase-executed apoptotic pathways in PC-3 cells. The oral administration of prazosin significantly reduced tumor mass in PC-3-derived cancer xenografts in nude mice. In summary, we suggest that prazosin is a potential antitumor agent that induces cell apoptosis through the induction of DNA damage stress, leading to Cdk1 inactivation and G2 checkpoint arrest. Subsequently, mitochondria-mediated caspase cascades are triggered to induce apoptosis in PC-3 cells. PMID:17971903

  15. Invasive characteristics of human prostatic epithelial cells: understanding the metastatic process

    PubMed Central

    Hart, C A; Brown, M; Bagley, S; Sharrard, M; Clarke, N W

    2005-01-01

    Prostate cancer has a predilection to metastasise to the bone marrow stroma (BMS) by an as yet uncharacterised mechanism. We have defined a series of coculture models of invasion, which simulate the blood/BMS boundary and allow the elucidation of the signalling and mechanics of trans-endothelial migration within the complex bone marrow environment. Confocal microscopy shows that prostate epithelial cells bind specifically to bone marrow endothelial-to-endothelial cell junctions and initiate endothelial cell retraction. Trans-endothelial migration proceeds via an epithelial cell pseudopodial process, with complete epithelial migration occurring after 232±43 min. Stromal-derived factor-1 (SDF-1)/CXCR4 signalling induced PC-3 to invade across a basement membrane although the level of invasion was 3.5-fold less than invasion towards BMS (P=0.0007) or bone marrow endothelial cells (P=0.004). Maximal SDF-1 signalling of invasion was completely inhibited by 10 μM of the SDF-1 inhibitor T140. However, 10 μM T140 only reduced invasion towards BMS and bone marrow endothelial cells by 59% (P=0.001) and 29% (P=0.011), respectively. This study highlights the need to examine the potential roles of signalling molecules and/or inhibitors, not just in single-cell models but in coculture models that mimic the complex environment of the bone marrow. PMID:15668715

  16. Prostate cancer chemoprevention by soy isoflavones: role of intestinal bacteria as the "second human genome".

    PubMed

    Akaza, Hideyuki

    2012-06-01

    It has been found that the composition of intestinal microbiota can indicate the risk of disease to each individual. The concepts of biodynamics as used by the Benziger Winery in California, which treats every part of an agricultural environment as a living, breathing entity, can be usefully used in the construction of a system for cancer prevention, which seeks to use the relationship of coexistence (symbiosis) shared between people and intestinal symbiosis, that is, microbiota. Changes in the incidence rate of cancer among Japanese emigrants to Hawaii demonstrate the effect of the changes in the living environment. This leads to the hypothesis that an intake of soy-derived food products and the metabolization of the isoflavones they contain by intestinal microbiota is one of the factors for the significant difference in the incidence rate of prostate cancer among Asian and European/North American populations. It is further hypothesized that isoflavones, particularly equol, are a key factor in the difference in incidence rate between Asia and the West. It is suggested that not having equol converting bacteria in the intestine (non-equol producers) can be a risk factor for prostate cancer and that one direction for future research will be to examine the possibility of improving the intestinal environment to enable equol production. PMID:22372745

  17. Irradiation of Human Prostate Cancer Cells Increases Uptake of Antisense Oligodeoxynucleotide

    SciTech Connect

    Anai, Satoshi; Brown, Bob D.; Nakamura, Kogenta; Goodison, Steve; Hirao, Yoshihiko; Rosser, Charles J. . E-mail: charles.rosser@urology.ufl.edu

    2007-07-15

    Purpose: To investigate whether irradiation before antisense Bcl-2 oligodeoxynucleotide (ODN) administration enhances tissue uptake, and whether periodic dosing enhances cellular uptake of fluorescently labeled ODN relative to constant dosing. Methods and Materials: PC-3-Bcl-2 cells (prostate cancer cell line engineered to overexpress Bcl-2) were subjected to increasing doses of irradiation (0-10 Gy) with or without increasing concentrations of fluorescently labeled antisense Bcl-2 ODN (G4243). The fluorescent signal intensity was quantified as the total grain area with commercial software. In addition, PC-3-Bcl-2 subcutaneous xenograft tumors were treated with or without irradiation in combination with various dosing schemas of G4243. The uptake of fluorescent G4243 in tumors was quantitated. Results: The uptake of G4243 was increased in prostate cancer cells exposed to low doses of irradiation both in vitro and in vivo. Irradiation before G4243 treatment resulted in increased fluorescent signal intensity in xenograft tumors compared with those irradiated after G4243 treatment. A single weekly dose of G4243 produced higher G4243 uptake in xenograft tumors than daily dosing, even when the total dose administered per week was held constant. Conclusions: These findings suggest that ionizing radiation increases the uptake of therapeutic ODN in target tissues and, thus, has potential to increase the efficacy of ODN in clinical applications.

  18. Characteristics of a human prostate stromal cell line related to its use in a stromal-epithelial coculture model for the study of cancer chemoprevention.

    PubMed

    Diaw, Lena; Roth, Mark; Schwinn, Debra A; d'Alelio, Mary E; Green, Lisa J; Tangrea, Joseph A

    2005-01-01

    An immortalized human prostate stromal cell line (PS30) was previously established using recombinant retrovirus encoding human papillomavirus 16 gene products. In this study, we further characterize this stromal cell line for its potential use in a stromal-epithelial coculture model for prostate cancer prevention. Using reverse transcriptase-polymerase chain reaction, enzyme-linked immunosorbent assay, and immunocytochemistry, we examined expression of androgen receptor (AR), vitamin D receptor (VDR), prostate-specific antigen (PSA), transforming growth factor-beta (TGF-beta), and insulin-like growth factors (IGF) families and their receptors, metalloproteinases (MMP) MMP-2 and MMP-9, as well as the cells' ability to respond to the synthetic androgen R1881. The PS30 stromal cells do not express PSA, confirming their stromal origin. They are positive for both AR messenger ribonucleic acid (mRNA) and protein; however, they do not respond to growth stimulation by the synthetic androgen R1881. The PS30 cells express mRNA for VDR, TGF-betas, IGFs and their receptors, as well as the MMPs. Moreover, they produce significant amounts of TGF-beta1, TGF-beta2, IGFBP-3, and MMP-2 proteins. Our observations confirm the use of PS30 for the study of stromal-epithelial interactions in the modulation of prostate carcinogenesis. PMID:16153146

  19. Prostaglandin E2 and the protein kinase A pathway mediate arachidonic acid induction of c-fos in human prostate cancer cells

    NASA Technical Reports Server (NTRS)

    Chen, Y.; Hughes-Fulford, M.

    2000-01-01

    Arachidonic acid (AA) is the precursor for prostaglandin E2 (PGE2) synthesis and increases growth of prostate cancer cells. To further elucidate the mechanisms involved in AA-induced prostate cell growth, induction of c-fos expression by AA was investigated in a human prostate cancer cell line, PC-3. c-fos mRNA was induced shortly after addition of AA, along with a remarkable increase in PGE2 production. c-fos expression and PGE2 production induced by AA was blocked by a cyclo-oxygenase inhibitor, flurbiprofen, suggesting that PGE2 mediated c-fos induction. Protein kinase A (PKA) inhibitor H-89 abolished induction of c-fos expression by AA, and partially inhibited PGE2 production. Protein kinase C (PKC) inhibitor GF109203X had no significant effect on c-fos expression or PGE2 production. Expression of prostaglandin (EP) receptors, which mediate signal transduction from PGE2 to the cells, was examined by reverse transcription polymerase chain reaction in several human prostate cell lines. EP4 and EP2, which are coupled to the PKA signalling pathway, were expressed in all cells tested. Expression of EP1, which activates the PKC pathway, was not detected. The current study showed that induction of the immediate early gene c-fos by AA is mediated by PGE2, which activates the PKA pathway via the EP2/4 receptor in the PC-3 cells.

  20. Pyridine analogues of curcumin exhibit high activity for inhibiting CWR-22Rv1 human prostate cancer cell growth and androgen receptor activation

    PubMed Central

    ZHOU, DAI-YING; ZHAO, SU-QING; DU, ZHI-YUN; ZHENG, XI; ZHANG, KUN

    2016-01-01

    The concentrations required for curcumin to exert its anticancer activity (IC50, 20 µM) are difficult to achieve in the blood plasma of patients, due to the low bioavailability of the compound. Therefore, much effort has been devoted to the development of curcumin analogues that exhibit stronger anticancer activity and a lower IC50 than curcumin. The present study investigated twelve pyridine analogues of curcumin, labeled as groups AN, BN, EN and FN, to determine their effects in CWR-22Rv1 human prostate cancer cells. The inhibitory effects of these compounds on testosterone (TT)-induced androgen receptor (AR) activity was determined by performing an AR-linked luciferase assay and by TT-induced expression of prostate-specific antigen. The results of the current study suggested that the FN group of analogues had the strongest inhibitory effect of growth on CWR-22Rv1 cultured cells, and were the most potent inhibitor of AR activity compared with curcumin, and the AN, BN and EN analogues. Thus, the results of the present study indicate the inhibition of the AR pathways as a potential mechanism for the anticancer effect of curcumin analogues in human prostate cancer cells. Furthermore, curcumin analogues with pyridine as a distal ring and tetrahydrothiopyran-4-one as a linker may be good candidates for the development of novel drugs for the treatment of prostate cancer, by targeting the AR signaling pathway. PMID:27313760

  1. Loss of Hes1 Differentiates Sessile Serrated Adenoma/polyp from Hyperplastic Polyp

    PubMed Central

    Cui, Min; Awadallah, Amad; Liu, Wendy; Zhou, Lan; Xin, Wei

    2016-01-01

    Sessile serrated adenoma/polyp (SSA/p) is a precancerous lesion, and its differential diagnosis from hyperplastic polyp (HP) could be challenging in certain circumstances based on morphology alone. Hes1 is a downstream target of Notch signaling pathway and plays an important role in intestinal development by regulating differentiation of enterocytes. In this study, we evaluated the expression patterns of Hes1 in SSA/p and hyperplastic polyp (HP), and determine whether Hes1 immunostaining can help differentiate between these two entities. Serrated polyps with cytological dysplasia (sessile serrated adenoma with cytological dysplasia, tubular adenoma, and traditional serrated adenoma) were also studied. Hes1 is ubiquitously expressed in the nuclei of normal colon epithelial cells. The complete loss or a very weak expression of Hes1 is observed in the majority of the SSA/p in the study (58/63, 92%) compared to the normal expression of Hes1 in HP (35/35,100%). In SSA/p with cytological dysplasia, dysplastic area demonstrated cytoplasmic and/or nuclear staining for Hes1. Tubular adenoma and traditional serrated adenoma showed variability of Hes1 staining within the polyp with a mixed positive and negative staining pattern. Our study suggests that loss of Hes1 could be used as a sensitive and specific marker to differentiate SSA/p from HP, which helps the diagnosis in morphologically challenging cases. PMID:26448192

  2. Severe hemophilia in a girl infant with mosaic Turner syndrome and persistent hyperplastic primary vitreous.

    PubMed

    Shahriari, Mahdi; Bazrafshan, Asghar; Moghadam, Mohamad; Karimi, Mehran

    2016-04-01

    A 6-month-old girl was referred by an ophthalmologist because of postoperative bleeding. She was scheduled for operation because of persistent hyperplastic primary vitreous. Workups were done and prolonged partial thromboplastin time with normal platelet count, normal bleeding time, and prothrombin time were detected. There was negative family history of bleeding tendency in both maternal and paternal family, so at the first step, Factor XI assay was requested which was normal. Then, von Willebrand factor and factor VIII were assayed which was 127% and less than 1%, respectively. Severe factor VIII deficiency was not suspected in a girl unless in siblings of a hemophilic patient who gets married with her carrier cousin. Chromosomal study and genetic testing were requested and mosaic Turner syndrome (45 XO) with ring X (p22, 2q13) along with inversion 22 (hemizygote) was detected. Abdominal and pelvic sonography showed absence of both ovaries with presence of infantile uterus. Maternal genetic study was in favor of carrier of hemophilia (heterozygote inversion 22). To the best of our knowledge, this is the first case of association of Turner syndrome with severe hemophilia A and persistent hyperplastic primary vitreous. PMID:26484646

  3. Synergistic Effects of the Green Tea Extract Epigallocatechin-3-gallate and Taxane in Eradication of Malignant Human Prostate Tumors1

    PubMed Central

    Stearns, Mark E; Wang, Min

    2011-01-01

    We have examined whether epigallocatechin-3-gallate (EGCG), and extract of green tea, in combination with taxane (i.e., paclitaxel and docetaxel), exerts a synergistic activity in blocking human prostate PC-3ML tumor cell growth in vitro and in vivo. Growth assays in vitro revealed that the IC50 values were ∼30 µM, ∼3 nM, and ∼6 nM, for EGCG, paclitaxel and docetaxel, respectively. Isobolograms generated from the data clearly indicated that EGCG in combination with paclitaxel or docetaxel had an additive effect in blocking tumor cell growth. EGCG combined with taxane also had an additive effect to increase the expression of apoptotic genes, (p53, p73, p21, and caspase 3) and the percent apoptosis observed in vitro and in tumor modeling studies in severe combined immunodeficient mice. The tumor modeling studies clearly showed that EGCG plus taxane injected intraperitoneally (i.p.) induced a significant increase in apoptosis rates (TUNEL assays) and eliminated preexisting tumors generated from PC-3ML cells implanted i.p., increasing disease-free survival rates to greater than 90%. More importantly, the combination therapy (i.p. biweekly) blocked metastases after intravenous injection of PC-3ML cells through the tail vein. In mice treated with EGCG plus taxane, the disease-free survival rates increased from 0% (in untreated mice) to more than 70% to 80% in treated mice. Taken together, these data demonstrate for the first time that EGCG in combination with taxane may provide a novel therapeutic treatment of advanced prostate cancer. PMID:21633670

  4. Effects of lycopene and tomato paste extracts on DNA and lipid oxidation in LNCaP human prostate cancer cells.

    PubMed

    Hwang, Eun-Sun; Bowen, Phyllis E

    2005-01-01

    Animal and epidemiological studies point to a cancer preventive/therapeutic role for tomato products and its antioxidant, lycopene. It is hypothesized that lycopene will behave as an antioxidant at low concentrations and as a prooxidant at high concentrations in LNCaP human prostate cancer cell culture systems. We characterized the antioxidant, and prooxidant effects of a hexane extract of tomato paste (TP) and water solubilized lycopene at different concentrations using a prostate cancer cell line. Placebo (5% triglyceride, Roche Inc.) was used as a control. After 6, 24 hr and 48 hr incubation, LNCaP cells were harvested and used for each measurement. Cellular proliferation was determined using the MTT colorimetric assay. Lycopene and TP hexane extract inhibited cell growth in a dose-dependent (0.1-50 microM lycopene) manner and growth inhibition was 55% and 35% at 1 microM lycopene and TP hexane extract, respectively after 48 hr incubation. The levels of 8-hydroxydeoxyguanosine/deoxyguanosine (an oxidative DNA damage product) was significantly increased starting at 5 microM lycopene from both TP hexane extract and pure lycopene after 24 and 48 hr incubation with no protection at the lower concentrations. Malondialdehyde formation (a lipid peroxidation product measured by HPLC separation of the MDA-TBA adduct) was significantly reduced at low concentrations (0.1-1 microM) of lycopene in all treatments. Clinically relevant concentrations of lycopene and the tomato fraction containing lycopene significantly reduced LNCaP cancer cell survival which can only be partially explained by increased DNA damage at high lycopene concentrations (> 5 microM). Low concentrations of lycopene acted as a lipid antioxidant but did not protect DNA. PMID:16179751

  5. Capsaicin-induced genotoxic stress does not promote apoptosis in A549 human lung and DU145 prostate cancer cells.

    PubMed

    Lewinska, Anna; Jarosz, Paulina; Czech, Joanna; Rzeszutek, Iwona; Bielak-Zmijewska, Anna; Grabowska, Wioleta; Wnuk, Maciej

    2015-02-01

    Capsaicin is the major pungent component of the hot chili peppers of the genus Capsicum, which are consumed worldwide as a food additive. More recently, the selective action of capsaicin against cancer cells has been reported. Capsaicin was found to induce apoptosis and inhibit proliferation of a wide range of cancer cells in vitro, whereas being inactive against normal cells. As data on capsaicin-induced genotoxicity are limited and the effects of capsaicin against human lung A549 and DU145 prostate cancer cells were not explored in detail, we were interested in determining whether capsaicin-associated genotoxicity may also provoke A549 and DU145 cell death. Capsaicin-induced decrease in metabolic activity and cell proliferation, and changes in the cell cycle were limited to high concentrations used (≥ 100 μM), whereas, at lower concentrations, capsaicin stimulated both DNA double strand breaks and micronuclei production. Capsaicin was unable to provoke apoptotic cell death when used up to 250 μM concentrations. Capsaicin induced oxidative stress, but was ineffective in provoking the dissipation of the mitochondrial inner transmembrane potential. A different magnitude of p53 binding protein 1 (53BP1) recruitment contributed to diverse capsaicin-induced genotoxic effects in DU145 and A549 cells. Capsaicin was also found to be a DNA hypermethylating agent in A549 cells. In summary, we have shown that genotoxic effects of capsaicin may contribute to limited susceptibility of DU145 and A549 cancer cells to apoptosis in vitro, which may question the usefulness of capsaicin-based anticancer therapy, at least in a case of lung and prostate cancer. PMID:25813723

  6. DNA damage signalling barrier, oxidative stress and treatment-relevant DNA repair factor alterations during progression of human prostate cancer.

    PubMed

    Kurfurstova, Daniela; Bartkova, Jirina; Vrtel, Radek; Mickova, Alena; Burdova, Alena; Majera, Dusana; Mistrik, Martin; Kral, Milan; Santer, Frederic R; Bouchal, Jan; Bartek, Jiri

    2016-06-01

    The DNA damage checkpoints provide an anti-cancer barrier in diverse tumour types, however this concept has remained unexplored in prostate cancer (CaP). Furthermore, targeting DNA repair defects by PARP1 inhibitors (PARPi) as a cancer treatment strategy is emerging yet requires suitable predictive biomarkers. To address these issues, we performed immunohistochemical analysis of multiple markers of DNA damage signalling, oxidative stress, DNA repair and cell cycle control pathways during progression of human prostate disease from benign hyperplasia, through intraepithelial neoplasia to CaP, complemented by genetic analyses of TMPRSS2-ERG rearrangement and NQO1, an anti-oxidant factor and p53 protector. The DNA damage checkpoint barrier (γH2AX, pATM, p53) mechanism was activated during CaP tumorigenesis, albeit less and with delayed culmination compared to other cancers, possibly reflecting lower replication stress (slow proliferation despite cases of Rb loss and cyclin D1 overexpression) and progressive loss of ATM activator NKX3.1. Oxidative stress (8-oxoguanine lesions) and NQO1 increased during disease progression. NQO1 genotypes of 390 men did not indicate predisposition to CaP, yet loss of NQO1 in CaP suggested potential progression-opposing tumour suppressor role. TMPRSS2-ERG rearrangement and PTEN loss, events sensitizing to PARPi, occurred frequently along with heterogeneous loss of DNA repair factors 53BP1, JMJD1C and Rev7 (all studied here for the first time in CaP) whose defects may cause resistance to PARPi. Overall, our results reveal an unorthodox DNA damage checkpoint barrier scenario in CaP tumorigenesis, and provide novel insights into oxidative stress and DNA repair, with implications for biomarker guidance of future targeted therapy of CaP. PMID:26987799

  7. Soy milk digestion extract inhibits progression of prostate cancer cell growth via regulation of prostate cancer‑specific antigen and cell cycle-regulatory genes in human LNCaP cancer cells.

    PubMed

    Kang, Nam-Hee; Shin, Hee-Chang; Oh, Seunghyun; Lee, Kyun-Hee; Lee, Yoon-Bok; Choi, Kyung-Chul

    2016-08-01

    Soy milk, which is produced from whole soybeans, contains a variety of biologically active components. Isoflavones are a class of soy-derived phytoestrogens with beneficial effects, among which genistein (GEN) has been previously indicated to reduce the risk of prostate cancer. The present study evaluated the effects of soy milk digestion extract (SMD) on the progression of prostate cancer via the estrogen receptor (ER)β in human LNCaP prostate cancer cells. To evaluate the effects of SMD (daizein, 1.988 mg/100g, glycitein, 23.537 mg/100 g and GEN, 0.685 mg/100g) on cell proliferation, LNCaP cells were cultured in media containing vehicle (0.1% dimethyl sulfoxide), 17β‑estradiol (E2; 2.7x10‑7 mg/ml), GEN (2.7x10-2 mg/ml) of SMD (total aglycon concentration, 0.79 mg/ml), after which the cell viability was examined using an MTT assay. The cell viability was significantly elevated by E2 (by 45±0.18%), while it was markedly reduced by GEN (73.2±0.03%) or SMD (74.8±0.09%). Semi‑quantitative reverse transcription polymerase chain reaction analysis was performed to assess the mRNA expression levels of target genes, including ERβ, prostate cancer‑specific antigen (PSA) and cell cycle regulators p21, Cyclin D1 and cyclin-dependent kinase (CDK)4. The expression of ERβ was almost completely diminished by E2, whereas it was significantly elevated by SMD. In addition, the expression levels of PSA were considerably reduced by SMD. The expression of p21 was significantly elevated by SMD, while it was markedly reduced by E2. Of note, the expression levels of Cyclin D1 and CDK4 were considerably elevated by E2, while being significantly reduced by GEN and SMD. All of these results indicated that SMD may inhibit the proliferation of human prostate cancer cells via regulating the expression of ERβ, PSA, p21, Cyclin D1 and CDK4 in an ER-dependent manner. PMID:27315510

  8. Defining Molecular Signature of Pro-Immunogenic Radiotherapy Targets in Human Prostate Cancer Cells

    PubMed Central

    Aryankalayil, Molykutty J.; Makinde, Adeola Y.; Gameiro, Sofia R.; Hodge, James W.; Rivera-Solis, Patricia P.; Palayoor, Sanjeewani T.; Ahmed, Mansoor M.; Coleman, C. Norman

    2014-01-01

    To understand the impact of clinically relevant radiation therapy (RT) on tumor immune gene expression and to utilize the changes that occur during treatment to improve cancer treatment outcome, we examined how immune response genes are modulated in prostate cancer cells of varying p53 status. LNCaP (p53 wild-type), PC3 (p53 null) and DU145 (p53 mutant) cells received a 10 Gy single dose or 1 Gy × 10 multifractionated radiation dose to simulate hypofractionated and conventionally fractionated prostate radiotherapy. Total RNA was isolated 24 h after multi-fractionated radiation treatment and single-dose treatments and subjected to microarray analysis and later validated by RT-PCR. RT-PCR was utilized to identify total-dose inflection points for significantly upregulated genes in response to multifractionated radiation therapy. Radiation-induced damage-associated molecular pattern molecules (DAMPs) and cytokine analyses were performed using bioluminescence and ELISA. Multifractionated doses activated immune response genes more robustly than single-dose treatment, with a relatively larger number of immune genes upregulated in PC3 compared to DU145 and LNCaP cells. The inflection point of multifractionated radiation-induced immune genes in PC3 cells was observed in the range of 8–10 Gy total radiation dose. Although both multifractionated and single-dose radiation-induced proinflammatory DAMPs and positively modulated the cytokine environment, the changes were of higher magnitude with multifractionated therapy. The findings of this study together with the gene expression data suggest that cells subjected to multifractionated radiation treatment would promote productive immune cell–tumor cell interactions. PMID:25003313

  9. Inhibition of N-acetylglucosaminyltransferase V enhances sensitivity of radiotherapy in human prostate cancer

    SciTech Connect

    Huang, Huiyi; Chen, Wenxia; Liu, Qiulian; Wei, Ting; Zhu, Weiliang; Meng, Hui; Guo, Linlang; Zhang, Jian

    2014-08-29

    Highlights: • We first evaluated the effect of GnT-V on radiation sensitivity of prostate cancer. • Higher level of GnT-V was detected more frequently in the PCa advanced tumors. • Attenuation of GnT-V inhibited cell proliferation, migration and increased apoptosis. • Knockdown of GnT-V could decrease radiation-induced G2/M arrest and NF-κB activity. • Inhibition of GnT-V may be involved in increasing radiation sensitivity of PCa cells. - Abstract: The purpose of this study was to investigate the relationship between N-acetylglucosaminyltransferase V (GnT-V) and radiation sensitivity of prostate cancer (PCa) cells both in vitro and in vivo. Firstly, the GnT-V expression was studied in 84 cases of PCa tissues, in which higher level of GnT-V was detected more frequently in the advanced tumors. Secondly, the GnT-V stably suppressed cell lines PCa/1079 (Lncap/1079 and PC3/1079) were constructed from PCa cell lines (Lncap and PC3) in vitro. Attenuation of GnT-V inhibited cell proliferation, migration and increased apoptosis, which resulted in enhanced radiation sensitivity of PCa cells. The underlying mechanism may be relevant to the increasing ratio of Bax/Bcl-2, the blocking transcription of NF-κB and the reduction of cell cycle G2-M arrest. Finally, in in vivo study, compared with control groups, the irradiated PCa xenograft nude mice of PCa/1079 indicated to reduce tumor-growth rate and enhance survival time. Summary, our studies showed that inhibition of GnT-V probably improved PCa cells’ radiation sensitivity.

  10. Therapeutic efficiency of rhenium-188-HEDP in human prostate cancer skeletal metastases.

    PubMed

    Liepe, K; Kropp, J; Runge, R; Kotzerke, J

    2003-08-18

    Rhenium-188-HEDP ((188)Re-HEDP) is a new and attractive radiopharmaceutical for the treatment of metastatic bone pain. As a product of (188)W/(188)Re generator, it is convenient for clinical therapeutic use with a short physical half-life of 16.9 h and a maximal beta-energy of 2.1 MeV. We investigated the effect of (188)Re-HEDP on pain relief, analgesic intake and impairment of bone marrow function in 27 patients with bone metastases induced from prostate cancer. All patients were interviewed using a standardised set of questions before, and after therapy for 12 weeks. The patients were treated with 2700-3459 MBq of (188)Re-HEDP. Blood samples were taken weekly for 12 weeks, and a blood count was performed. Patients described an improvement on the Karnofsky performance scale from 74+/-7 to 85+/-9% 12 weeks after therapy (P=0.001). The pain score showed a maximum decrease from 44+/-18 to 27+/-20% in the third to the eight week after therapy (P=0.009). Seventy-six percent of the patients described a pain relief without increase of analgesic intake. Twenty percent of the patients could discontinue their analgesics and were pain free. Mean platelet count decreased from (286+/-75)*10(3) microl(-1) to (215+/-92)*10(3) microl(-1), and mean leucocyte count from (7.7+/-1.5)*10(3) microl(-1) to (6.0+/-1.9)*10(3) microl(-1) in the second to the fourth week after therapy. The maximal differences between the values of platelets and leucocytes before and after therapy were not statistically significant (P=0.021 and 0.094). In conclusion, (188)Re-HEDP is an effective radiopharmaceutical used in the palliative treatment of metastatic bone pain in prostate cancer and shows minimal bone marrow toxicity. PMID:12915868

  11. What is Prostate Cancer?

    MedlinePlus

    ... Topic Key statistics for prostate cancer What is prostate cancer? Cancer starts when cells in the body begin ... through the center of the prostate. Types of prostate cancer Almost all prostate cancers are adenocarcinomas . These cancers ...

  12. miR-17-92 plays an oncogenic role and conveys chemo-resistance to cisplatin in human prostate cancer cells.

    PubMed

    Zhou, Peng; Ma, Liang; Zhou, Jun; Jiang, Min; Rao, Enyu; Zhao, Yong; Guo, Feng

    2016-04-01

    The mir-17-92 cluster consists of six mature miRNAs and is implicated in diverse human cancers by targeting mRNAs involved in distinct pathways that either promote or inhibit carcinogenesis. However, the molecular mechanism underlying the mir-17-92 cluster-mediated pro-tumorigenic or anti-tumorigenic effects has not been clearly elucidated in prostate cancer. In the present study, the role of the mir-17-92 cluster in diverse aspects of prostate cancer cells has been thoroughly investigated. Forced introduction of the mir-17-92 cluster into the androgen-independent DU145 prostate cancer cells evidently promoted cell growth due to disruption of the balance between cellular proliferation and apoptosis. Overexpression of the mir-17-92 cluster significantly improved the migration and invasion of the DU145 cells, attributed to the induction of integrin β-1. Notably, the mir-17-92 cluster conveyed chemo-resistance to cisplatin. We demonstrated that the mir-17-92 cluster suppressed the expression of inhibitor of the AKT signaling pathway and activated the AKT pathway subsequently, which played a central role in regulating cellular proliferation, apoptosis and chemo-resistance. Continuously activated ERK1/2 signaling also contributed importantly to these processes. The present study provides key evidence for crucial oncogenic role of the miR-17-92 cluster in prostate cancer cells. Further investigations are warranted to determine whether miR-17-92 cluster can be targeted for future treatment of human prostate cancer. PMID:26891588

  13. Examination of CK2α and NF-κB p65 expression in human benign prostatic hyperplasia and prostate cancer tissues.

    PubMed

    Qaiser, Fatima; Trembley, Janeen H; Sadiq, Sarah; Muhammad, Iqbal; Younis, Rubina; Hashmi, Shoaib Naiyar; Murtaza, Badar; Rector, Thomas S; Naveed, Abdul Khaliq; Ahmed, Khalil

    2016-09-01

    Protein kinase CK2 plays a critical role in cell growth, proliferation, and suppression of cell death. CK2 is overexpressed, especially in the nuclear compartment, in the majority of cancers, including prostate cancer (PCa). CK2-mediated activation of transcription factor nuclear factor kappa B (NF-κB) p65 is a key step in cellular proliferation, resulting in translocation of NF-κB p65 from the cytoplasm to the nucleus. As CK2 expression and activity are also elevated in benign prostatic hyperplasia (BPH), we sought to increase the knowledge of CK2 function in benign and malignant prostate by examination of the relationships between nuclear CK2 and nuclear NF-κB p65 protein expression. The expression level and localization of CK2α and NF-κB p65 proteins in PCa and BPH tissue specimens was determined. Nuclear CK2α and NF-κB p65 protein levels are significantly higher in PCa compared with BPH, and these proteins are positively correlated with each other in both diseases. Nuclear NF-κB p65 levels correlated with Ki-67 or with cytoplasmic NF-κB p65 expression in BPH, but not in PCa. The findings provide information that combined analysis of CK2α and NF-κB p65 expression in prostate specimens relates to the disease status. Increased nuclear NF-κB p65 expression levels in PCa specifically related to nuclear CK2α levels, indicating a possible CK2-dependent relationship in malignancy. In contrast, nuclear NF-κB p65 protein levels related to both Ki-67 and cytoplasmic NF-κB p65 levels exclusively in BPH, suggesting a potential separate impact for NF-κB p65 function in proliferation for benign disease as opposed to malignant disease. PMID:27435858

  14. A Preliminary Analysis of Calcifying Particles in the Serum and Prostates of Patients with Prostatic Inflammation

    NASA Technical Reports Server (NTRS)

    Jones, Jeffrey A.; Carlson, Grant; Kajander, E. Olavi; Warmflash, David; Taylor, Karen; Ayala, Gustavo; Shoskes, Daniel; Everett, Meg; Feedback, Dan; Ciftcioglu, Neva

    2006-01-01

    of prostatitis. Preliminary immunohistologic studies, suggest that NB may be found within the gland itself at a higher rate in patients with BPH relative to patients with adenocarcinoma, however confirmatory studies with a more specific ELISA technique, primary cultures, & with larger numbers of patients in a prospective design are required to determine if 1) NB are a causative organism for clinical hyperplastic and inflammatory disease, & if 2) serological testing can be used to discriminate patients with nanobacterial-associated prostatic disease.

  15. Inositol hexaphosphate represses telomerase activity and translocates TERT from the nucleus in mouse and human prostate cancer cells via the deactivation of Akt and PKC{alpha}

    SciTech Connect

    Jagadeesh, Shankar; Banerjee, Partha P. . E-mail: ppb@georgetown.edu

    2006-11-03

    Inositol hexaphosphate (IP6) has anti-proliferative effects on a variety of cancer cells, including prostate cancer. However, the molecular mechanism of anti-proliferative effects of IP6 is not entirely understood. Since the activation of telomerase is crucial for cells to gain immortality and proliferation ability, we examined the role of IP6 in the regulation of telomerase activity in prostate cancer cells. Here, we show that IP6 represses telomerase activity in mouse and human prostate cancer cells dose-dependently. In addition, IP6 prevents the translocation of TERT to the nucleus. Since phosphorylation of TERT by Akt and/or PKC{alpha} is necessary for nuclear translocation, we examined phosphorylation of Akt and PKC{alpha} after IP6 treatments. Our results show that IP6 inhibits phosphorylation of Akt and PKC{alpha}. These results show for the first time that IP6 represses telomerase activity in prostate cancer cells by posttranslational modification of TERT via the deactivation of Akt and PKC{alpha}.

  16. Nerve growth factor signaling following unilateral pelvic ganglionectomy in the rat ventral prostate is age dependent.

    PubMed

    Podlasek, Carol A; Ghosh, Rudrani; Onur Cakir, Omer; Bond, Christopher; McKenna, Kevin E; McVary, Kevin T

    2013-11-01

    Benign prostatic hyperplasia (BPH) is a serious health concern and is an underlying cause of lower urinary tract symptoms (LUTS) in many men. In affected men, LUTS/BPH is believed to result from benign proliferation of the prostate resulting in bladder outlet obstruction. Postnatal growth of the prostate is controlled via growth factor and endocrine mechanisms. However, little attention had been given to the function of the autonomic nervous system in prostate growth and differentiation. Nerve growth factor (NGF) is a prostatic mitogen that has a trophic role in autonomic sensory end organ interaction. In this study, we examine how the autonomic nervous system influences prostate growth as a function of age by quantifying NGF in the rat ventral prostate (VP) after pelvic ganglionectomy. Unilateral pelvic ganglionectomy was performed on postnatal days 30 (P30), 60 and 120 Sprague-Dawley rats in comparison to sham controls (n=39). Semiquantitative RT-PCR, Western blotting and immunohistochemical analysis for NGF were performed on denervated, intact (contralateral side) and sham control VP 7 days after surgery. Ngf RNA expression was significantly increased in the denervated and intact hyperplastic VP. Western blotting showed age-dependent increases in NGF protein at P60 in the contralateral intact VP. NGF was localized in the nerves, basal cells and columnar epithelium of the prostatic ducts. Denervation causes age-dependent increases in NGF in the VP, which is a potential mechanism by which the autonomic nervous system may regulate prostate growth and lead to BPH/LUTS. PMID:23872662

  17. Radioimmunoscintigraphy of prostate cancer

    SciTech Connect

    Babaian, R.J.; Lamki, L.M. )

    1989-10-01

    The development of hybridoma technology has increased research efforts and clinical applications in the area of radioimmunodetection. Despite the many investigative antibodies directed against prostatic tissue or prostate cancer cell lines, only two have been tested in clinical trials. A 111In-labeled antibody directed against prostate-specific antigen, the best available serum tumor marker for prostate cancer, has shown poor sensitivity in limited clinical radioimmunoimaging trials. Monoclonal antibodies against prostatic acid phosphatase have shown better imaging results, particularly at higher antibody doses (greater than or equal to 40 mg). The limitations of this antibody include the poor results in detecting soft tissue lesions, including the primary lesion; the development of human antimouse antibodies in 50% of the patients at doses greater than or equal to 40 mg; the expense of the antibody; and the fact that better results are currently attainable by other less expensive imaging modalities. If and when a more suitable antibody or fragment is developed, the prospect of improved staging and new treatments using immunologic conjugates carrying therapeutic agents may become realities. Until such time, prostatic cancer will be staged with other currently available imaging modalities and conventional therapies with their limitations will remain state of the art. 56 references.

  18. NSK-01105, a Novel Sorafenib Derivative, Inhibits Human Prostate Tumor Growth via Suppression of VEGFR2/EGFR-Mediated Angiogenesis

    PubMed Central

    Yu, Pengfei; Ye, Liang; Wang, Hongbo; Du, Guangying; Zhang, Jianzhao; Zuo, Yanhua; Zhang, Jinghai; Tian, Jingwei

    2014-01-01

    The purpose of this study is to investigate the anti-angiogenic activities of NSK-01105, a novel sorafenib derivative, in in vitro, ex vivo and in vivo models, and explore the potential mechanisms. NSK-01105 significantly inhibited vascular endothelial growth factor (VEGF)-induced migration and tube formation of human umbilical vein endothelial cells at non-cytotoxic concentrations as shown by wound-healing, transwell migration and endothelial cell tube formation assays, respectively. Cell viability and invasion of LNCaP and PC-3 cells were significantly inhibited by cytotoxicity assay and matrigel invasion assay. Furthermore, NSK-01105 also inhibited ex vivo angiogenesis in matrigel plug assay. Western blot analysis showed that NSK-01105 down-regulated VEGF-induced phosphorylation of VEGF receptor 2 (VEGFR2) and the activation of epidermal growth factor receptor (EGFR). Tumor volumes were significantly reduced by NSK-01105 at 60 mg/kg/day in both xenograft models. Immunohistochemical staining demonstrated a close association between inhibition of tumor growth and neovascularization. Collectively, our results suggest a role of NSK-01105 in treatment for human prostate tumors, and one of the potential mechanisms may be attributed to anti-angiogenic activities. PMID:25551444

  19. Antiproliferative effects of Dangyuja (Citrus grandis Osbeck) leaves through suppression of constitutive signal transducer and activator of transcription 3 activation in human prostate carcinoma DU145 cells.

    PubMed

    Chiang, Shu Yuan; Kim, Sung-Moo; Kim, Chulwon; Um, Jae-Young; Park, Kyung-Ran; Kim, Seong Won; Lee, Seok-Geun; Jang, Hyeung-Jin; Nam, Dongwoo; Ahn, Kyoo Seok; Kim, Sung-Hoon; Choi, Seung-Hoon; Shim, Bum Sang; Na, Yun-Cheol; Jeong, Eun-Kyung; Cho, Somi K; Ahn, Kwang Seok

    2012-02-01

    Although Dangyuja (Citrus grandis Osbeck) exhibits anti-inflammatory and anticancer activities, its molecular targets and pathways, especially in human prostate cancer cells, are not fully understood. In this study, the antiproliferative effect of Dangyuja leaves through the signal transducer and activator of transcription (STAT) 3 signaling pathway was investigated in human prostate carcinoma DU145 cells. The solvent fractions (n-hexane, chloroform, ethyl acetate, and n-butanol) were obtained from a crude extract (80% methanol extract) of Dangyuja leaves. We first found that the chloroform fraction of Dangyuja leaves (DCF) was the most cytotoxic against DU145 cells. DCF inhibited constitutive STAT3 activation through blocking upstream Janus-like kinase 2 and c-Src. Consistent with STAT3 inactivation, DCF down-regulated the expression of STAT3 target genes, including bcl-2, bcl-xl, and cyclin D1; this correlated with the suppression of proliferation, the accumulation of cell cycle at the sub-G(1) phase, and the induction of apoptosis. Furthermore, DCF exerted a relatively minor effect on the growth of human prostate noncancerous RWPE-1 cells. Nobiletin, a major active constituent of DCF, could induce apoptosis via the suppression of constitutive STAT3 activation. Overall, our results indicate that the anti-inflammatory and anticancer activities previously assigned to DCF may be mediated partially through the suppression of the STAT3 signaling. PMID:22273151

  20. Proteomic-based identification of multiple pathways underlying n-butylidenephthalide-induced apoptosis in LNCaP human prostate cancer cells.

    PubMed

    Pang, Cheng-Yoong; Chiu, Sheng-Chun; Harn, Horng-Jyh; Zhai, Wei-Jun; Lin, Shinn-Zong; Yang, Hsueh-Hui

    2013-09-01

    Although numerous studies have shown the cancer-preventive properties of butylidenephthalide (BP), there is little report of BP affecting human prostate cancer cells. In the present study, proteomic-based approaches were used to elucidate the anticancer mechanism of BP in LNCaP human prostate cancer cells. BP treatment decreased the viability of LNCaP human prostate cancer cells in a concentration- and time-dependent manner, which was correlated with G0/G1 phase cell cycle arrest. Increased cell cycle arrest was associated with a decrease in the level of CCND1, CDK2, and PCNA proteins and an increase in the level of CDKN2A, CDKN1A, and SFN proteins. Proteomic studies revealed that among 48 differentially expressed proteins, 25 proteins were down-regulated and 23 proteins were up-regulated and these proteins fall into one large protein protein interaction network. Among these proteins, FAS, AIFM1, BIK, CYCS, SFN, PPP2R1A, CALR, HSPA5, DDIT3, and ERN1 are apoptosis and endoplasmic reticulum (ER) stress associated proteins. Proteomic data suggested that multiple signaling pathways including FAS-dependent pathway, mitochondrial pathway, and ER stress pathway are involved in the apoptosis induced by BP. PMID:23770345

  1. The In Vitro and In Vivo Anti-Cancer Activities of a Standardized Quassinoids Composition from Eurycoma longifolia on LNCaP Human Prostate Cancer Cells

    PubMed Central

    Tong, Kind Leng; Chan, Kit Lam; AbuBakar, Sazaly; Low, Bin Seng; Ma, Hai Qiu; Wong, Pooi Fong

    2015-01-01

    Quassinoids are a group of diterpenoids found in plants from the Simaroubaceae family. They are also the major bioactive compounds found in Eurycoma longifolia which is commonly used as traditional medicine in South East Asia to treat various ailments including sexual dysfunction and infertility. These uses are attributed to its ability to improve testosterone level in men. Chronic consumption of E. longifolia extracts has been reported to increase testosterone level in men and animal model but its effect on prostate growth remains unknown. Therefore, the present study investigates the effects of a standardized total quassinoids composition (SQ40) containing 40% of the total quassinoids found in E. longifolia on LNCaP human prostate cancer cell line. SQ40 inhibited LNCaP cell growth at IC50 value of 5.97 μg/mL while the IC50 on RWPE-1 human prostate normal cells was 59.26 μg/mL. SQ40 also inhibited 5α-dihydrotestosterone-stimulated growth in LNCaP cells dose-dependently. The inhibitory effect of SQ40 in anchorage-independent growth of LNCaP cells was also demonstrated using soft agar assay. SQ40 suppressed LNCaP cell growth via G0/G1 phase arrest which was accompanied by the down-regulation of CDK4, CDK2, Cyclin D1 and Cyclin D3 and up-regulation of p21Waf1/Cip1 protein levels. SQ40 at higher concentrations or longer treatment duration can cause G2M growth arrest leading to apoptotic cell death as demonstrated by the detection of poly(ADP-ribose) polymerase cleavage in LNCaP cells. Moreover, SQ40 also inhibited androgen receptor translocation to nucleus which is important for the transactivation of its target gene, prostate-specific antigen (PSA) and resulted in a significant reduction of PSA secretion after the treatment. In addition, intraperitoneal injection of 5 and 10 mg/kg of SQ40 also significantly suppressed the LNCaP tumor growth on mouse xenograft model. Results from the present study suggest that the standardized total quassinoids composition from E

  2. Dual targeting of mTORC1 and mTORC2 by INK-128 potently inhibits human prostate cancer cell growth in vitro and in vivo.

    PubMed

    Jiang, Shang-Jun; Wang, Shuo

    2015-09-01

    Both mammalian target of rapamycin (mTOR) complexes 1 and 2 (mTORC1/2) are often over-activated in prostate cancer cells and are associated with cancer progression. In the current study, we evaluated the potential anti-prostate cancer activity of INK-128, an ATP-competitive mTORC1/2 dual inhibitor, both in vitro and in vivo. Our results showed that INK-128 exerted potent anti-proliferative activity in established (PC-3 and LNCaP lines) and primary (patient-derived) human prostate cancer cells by inducing cell apoptosis. The latter was evidenced by increase of annexin V percentage, formation of cytoplasmic histone-associated DNA fragments, and cleavage of caspase-3. INK-128-induced prostate cancer cell apoptosis and cytotoxicity were alleviated upon pretreatment of cells with the pan-caspase inhibitor z-VAD-FMK or the specific caspase-3 inhibitor z-DVED-FMK. At the molecular level, INK-18 blocked mTORC1/2 activation in PC-3 cells and LNCaP cells and downregulated mTOR-regulated genes including cyclin D1, hypoxia-inducible factor 1α (HIF-1α), and HIF-2α. ERK-MAPK activation and androgen receptor expression were, however, not affected by INK-128 treatment. In vivo, oral administration of INK-128 significantly inhibited growth of PC-3 xenografts in nude mice. The preclinical results of this study suggest that INK-128 could be further investigated as a promising anti-prostate cancer agent. PMID:25990456

  3. Simvastatin blocks TGF-β1-induced epithelial-mesenchymal transition in human prostate cancer cells

    PubMed Central

    XIE, FENG; LIU, JIE; LI, CHENGWEN; ZHAO, YAORUI

    2016-01-01

    In recent years, the use of statins has been reported to be associated with a reduced risk of prostate cancer (PCa), particularly metastatic PCa. The mechanisms underlying these epidemiological observations are poorly understood. Epithelial-mesenchymal transition (EMT) is a critical initial step and a hallmark for cancer metastasis. In the present study, the relationship between simvastatin and EMT in PCa and the mechanism involved was investigated. It was demonstrated that simvastatin inhibited the EMT as assessed by reduced expression of N-cadherin and vimentin, and increased E-cadherin in TGF-β1 treated DU145 PCa cells. Furthermore, simvastatin inhibited TGF-β1-induced migration and invasion of DU145 cells. The TGF-β1/Smad pathway and non-Smad pathway were investigated in simvastatin-treated DU145 cells. Simvastatin had no effect on TGF-β1-induced phosphorylation of Smad2 and Smad3. In the non-Smad pathway, simvastatin reduced TGF-β1-induced p38 MAPK phosphorylation, but had no effect on TGF-β1-induced Erk1/2 phosphorylation. Simvastatin attenuated TGF-β1-induced EMT, cell migration and invasion in DU145 cells. These effects may have been mediated by the inhibition of p38 MAPK phosphorylation, not through the canonical Smad pathway. Therefore simvastatin may be a promising therapeutic agent for treating PCa. PMID:27123120

  4. KLF6-SV1 overexpression accelerates human and mouse prostate cancer progression and metastasis

    PubMed Central

    Narla, Goutham; DiFeo, Analisa; Fernandez, Yolanda; Dhanasekaran, Saravana; Huang, Fei; Sangodkar, Jaya; Hod, Eldad; Leake, Devin; Friedman, Scott L.; Hall, Simon J.; Chinnaiyan, Arul M.; Gerald, William L.; Rubin, Mark A.; Martignetti, John A.

    2008-01-01

    Metastatic prostate cancer (PCa) is one of the leading causes of death from cancer in men. The molecular mechanisms underlying the transition from localized tumor to hormone-refractory metastatic PCa remain largely unknown, and their identification is key for predicting prognosis and targeted therapy. Here we demonstrated that increased expression of a splice variant of the Kruppel-like factor 6 (KLF6) tumor suppressor gene, known as KLF6-SV1, in tumors from men after prostatectomy predicted markedly poorer survival and disease recurrence profiles. Analysis of tumor samples revealed that KLF6-SV1 levels were specifically upregulated in hormone-refractory metastatic PCa. In 2 complementary mouse models of metastatic PCa, KLF6-SV1–overexpressing PCa cells were shown by in vivo and ex vivo bioluminescent imaging to metastasize more rapidly and to disseminate to lymph nodes, bone, and brain more often. Interestingly, while KLF6-SV1 overexpression increased metastasis, it did not affect localized tumor growth. KLF6-SV1 inhibition using RNAi induced spontaneous apoptosis in cultured PCa cell lines and suppressed tumor growth in mice. Together, these findings demonstrate that KLF6-SV1 expression levels in PCa tumors at the time of diagnosis can predict the metastatic behavior of the tumor; thus, KLF-SV1 may represent a novel therapeutic target. PMID:18596922

  5. ROLE OF HYPERPLASTIC NODULES IN DICHLOROACETIC ACID INDUCED HEPATOCARCINOGENESIS IN B6C3F1 MALE MICE

    EPA Science Inventory

    Dichloroacetic acid (DCA) is a hepatocarcinogen in the male B6C3FI mouse. t induces primarily hyperplastic nodules (HN) prior to the appearance of hepatocellular adenoma (HA) or carcinoma (HC). his study was undertaken to determine the role of HN in the progression of DCA-induced...

  6. MYC and Prostate Cancer

    PubMed Central

    Koh, Cheryl M.; Bieberich, Charles J.; Dang, Chi V.; Nelson, William G.; Yegnasubramanian, Srinivasan; De Marzo, Angelo M.

    2010-01-01

    Prostate cancer, the majority of which is adenocarcinoma, is the most common epithelial cancer affecting a majority of elderly men in Western nations. Its manifestation, however, varies from clinically asymptomatic insidious neoplasms that progress slowly and do not threaten life to one that is highly aggressive with a propensity for metastatic spread and lethality if not treated in time. A number of somatic genetic and epigenetic alterations occur in prostate cancer cells. Some of these changes, such as loss of the tumor suppressors PTEN and p53, are linked to disease progression. Others, such as ETS gene fusions, appear to be linked more with early phases of the disease, such as invasion. Alterations in chromosome 8q24 in the region of MYC have also been linked to disease aggressiveness for many years. However, a number of recent studies in human tissues have indicated that MYC appears to be activated at the earliest phases of prostate cancer (e.g., in tumor-initiating cells) in prostatic intraepithelial neoplasia, a key precursor lesion to invasive prostatic adenocarcinoma. The initiation and early progression of prostate cancer can be recapitulated in genetically engineered mouse models, permitting a richer understanding of the cause and effects of loss of tumor suppressors and activation of MYC. The combination of studies using human tissues and mouse models paints an emerging molecular picture of prostate cancer development and early progression. This picture reveals that MYC contributes to disease initiation and progression by stimulating an embryonic stem cell–like signature characterized by an enrichment of genes involved in ribosome biogenesis and by repressing differentiation. These insights pave the way to potential novel therapeutic concepts based on MYC biology. PMID:21779461

  7. Fate of the human Y chromosome linked genes and loci in prostate cancer cell lines DU145 and LNCaP

    PubMed Central

    2013-01-01

    Background Prostate cancer is a known cause of mortality in men worldwide although the risk factor varies among different ethnic groups. Loss of the Y chromosome is a common chromosomal abnormality observed in the human prostate cancer. Results We screened 51 standard sequence tagged sites (STSs) corresponding to a male-specific region of the Y chromosome (MSY), sequenced the coding region of the SRY gene and assessed the status of the DYZ1 arrays in the human prostate cancer cell lines DU145 and LNCaP. The MSY was found to be intact and coding region of SRY showed no sequence variation in both the cell lines. However, DYZ1 arrays showed sequence and copy number variations. DU145 and LNCaP cells were found to carry 742 and 1945 copies of the DYZ1, respectively per 3.3 pg of genomic DNA. The DYZ1 copies detected in these cell lines are much below the average of that reported in normal human males. Similarly, the number of “TTCCA” repeat and its derivatives within the DYZ1 arrays showed variation compared to those of the normal males. Conclusions Clearly, the DYZ1 is maximally affected in both the cell lines. Work on additional cell lines and biopsied samples would augment our understanding about the susceptibility of this region. Based on the present work, we construe that copy number status of the DYZ1 may be exploited as a supplementary prognostic tool to monitor the occurrence of prostate cancer using biopsied samples. PMID:23663454

  8. A unique Critical State two-surface hyperplasticity model for fine-grained particulate media

    NASA Astrophysics Data System (ADS)

    Coombs, W. M.; Crouch, R. S.; Augarde, C. E.

    2013-01-01

    Even mild compression can cause re-arrangement of the internal structure of clay-like geomaterials, whereby clusters of particles rotate and collapse as face-to-face contacts between the constituent mineral platelets increase at the expense of edge-to-face (or edge-to-edge) contacts. The collective action of local particle re-orientation ultimately leads to path-independent isochoric macroscopic deformation under continuous shearing. This asymptotic condition is the governing feature of Critical State elasto-plasticity models. Unlike earlier formulations, the two-surface anisotropic model proposed herein is able to reproduce a unique isotropic Critical State stress envelope which agrees well with test data. Material point predictions are compared against triaxial experimental results and five other existing constitutive models. The hyperplastic formulation is seen to offer a significantly improved descriptor of the anisotropic behaviour of fine-grained particulate materials.

  9. Induction of cyclo-oxygenase-2 mRNA by prostaglandin E2 in human prostatic carcinoma cells

    NASA Technical Reports Server (NTRS)

    Tjandrawinata, R. R.; Dahiya, R.; Hughes-Fulford, M.

    1997-01-01

    Prostaglandins are synthesized from arachidonic acid by the enzyme cyclo-oxygenase. There are two isoforms of cyclooxygenases: COX-1 (a constitutive form) and COX-2 (an inducible form). COX-2 has recently been categorized as an immediate-early gene and is associated with cellular growth and differentiation. The purpose of this study was to investigate the effects of exogenous dimethylprostaglandin E2 (dmPGE2) on prostate cancer cell growth. Results of these experiments demonstrate that administration of dmPGE2 to growing PC-3 cells significantly increased cellular proliferation (as measured by the cell number), total DNA content and endogenous PGE2 concentration. DmPGE2 also increased the steady-state mRNA levels of its own inducible synthesizing enzyme, COX-2, as well as cellular growth to levels similar to those seen with fetal calf serum and phorbol ester. The same results were observed in other human cancer cell types, such as the androgen-dependent LNCaP cells, breast cancer MDA-MB-134 cells and human colorectal carcinoma DiFi cells. In PC-3 cells, the dmPGE2 regulation of the COX-2 mRNA levels was both time dependent, with maximum stimulation seen 2 h after addition, and dose dependent on dmPGE2 concentration, with maximum stimulation seen at 5 microg ml(-1). The non-steroidal anti-inflammatory drug flurbiprofen (5 microM), in the presence of exogenous dmPGE2, inhibited the up-regulation of COX-2 mRNA and PC-3 cell growth. Taken together, these data suggest that PGE2 has a specific role in the maintenance of human cancer cell growth and that the activation of COX-2 expression depends primarily upon newly synthesized PGE2, perhaps resulting from changes in local cellular PGE2 concentrations.

  10. Differential Expression of Cell Cycle Regulators During Hyperplastic and Hypertrophic Growth of Broiler Subcutaneous Adipose Tissue.

    PubMed

    Zhang, J; Suh, Y; Choi, Y M; Chen, P R; Davis, M E; Lee, K

    2015-10-01

    Hyperplastic growth and hypertrophic growth within adipose tissue is tightly associated with cell cycle activity. In this study, CCNG2 and CDKN2C were found to be correlated with cell cycle inhibition during fat cell differentiation, whereas CCND3, CCNA1, and ANAPC5 were positively associated with cell cycle activity during fat cell proliferation after selection based on GEO datasets available on the NCBI website. The findings were validated through comparison of expressions of these genes among different tissues/fractions in broiler chickens and time points during primary cell culture using quantitative real-time PCR. Development of broiler subcutaneous adipose tissue was investigated on embryonic days 15 and 17 and on post-hatch days 0, 5, 11, and 33 using H&E staining and PCNA immunostaining with DAPI counter stain. In addition, mRNA expressions of five cell cycle regulators as well as precursor cell and adipocyte markers were measured at those time points. The results suggest that cellular proliferation activity decreased as the fat pad grows, but a population of precursor cells seemed to be maintained until post-hatch day 5 despite increasing differentiation activity. Hypertrophic growth gradually intensified despite a slight cessation on post-hatch day 0 due to increased energy expenditure during hatching and delayed food access. From post-hatch day 5 to day 11, most of the precursor cells may become differentiated. After post-hatch day 11, hyperplastic growth seemed to slow, while hypertrophic growth may become dominant. This study provides further understanding about broiler fat tissue development which is imperative for effective control of fat deposition. PMID:26017028

  11. Fangchinoline induced G1/S arrest by modulating expression of p27, PCNA, and cyclin D in human prostate carcinoma cancer PC3 cells and tumor xenograft.

    PubMed

    Wang, Chang-Dong; Huang, Jian-Guo; Gao, Xuan; Li, Yi; Zhou, Shi-Yi; Yan, Xu; Zou, An; Chang, Jun-Li; Wang, Yue-Sheng; Yang, Guang-Xiao; He, Guang-Yuan

    2010-01-01

    Prostate cancer (PCA) is the most common invasive malignancy and the second leading cause of cancer-related death in males. The present study investigated the effects of fangchinoline (Fan), an important compound in Stephania Tetradra S. Moore (Fenfangji) with pain-relieving, blood pressure-depressing, and antibiotic activities, on human PCA. It was found that Fan inhibited human prostate cancer cell lines (PC3) cell proliferation in a dose- and time-dependent manner. Studies of cell-cycle progression showed that the anti-proliferative effect of Fan was associated with an increase in the G1/S phase of PC3 cells. Western blot results indicated that Fan-induced G1/S phase arrest was mediated through inhibition of cyclin-regulated signaling pathways. Fan induced p27 expression and inhibited cyclin D and proliferating cell nuclear antigen (PCNA) expression in PC3 cells. Increased exposure time to Fan caused apoptosis of PC3 cells, which was associated with up-regulation of pro-apoptotic proteins Bax and caspase 3, and down-regulation of anti-apoptotic protein Bcl-2. Furthermore, Fan had anti-tumorigenic activity in vivo, including reduction of tumor volume and pro-apoptotic and anti-proliferative effects in a PC3 nude mouse xenograft. Taking all this together, it can be concluded that Fan is an effective anti-proliferative agent that modulates cell growth regulators in prostate cancer cells. PMID:20208355

  12. Targeting TARP, a novel breast and prostate tumor-associated antigen, with T-cell receptor- like human recombinant antibodies

    PubMed Central

    Epel, Malka; Carmi, Irit; Soueid- Baumgarten, Sharon; Oh, SangKon; Bera, Tapan; Pastan, Ira; Berzofsky, Jay; Reiter, Yoram

    2009-01-01

    MHC class I molecules are important components of immune surveillance. There are no available methods to directly visualize and determine the quantity and distribution of MHC/peptide complexes on individual cells or to detect such complexes on antigen presenting cells in tissues. MHC-restricted recombinant antibodies with the same specificity of T-cell receptors may become a valuable tool to address these questions. They may also serve as valuable targeting molecules that mimic the specificity of cytotoxic T cells. We isolated by phage display a panel of human recombinant Fab antibodies with peptide-specific, MHC-restricted TCR-like reactivity directed toward HLA-A2-restricted T-cell epitope derived from a novel antigen termed TCRγ Alternative Reading frame Protein (TARP) which is expressed on prostate and breast cancer cells. We have characterized one of these recombinant antibodies and demonstrated its capacity to directly detect specific HLA-A2/TARP T-cell epitopes on antigen presenting cells that have complexes formed by naturally occurring active intracellular processing of the antigen as well as on the surface of tumor cells. Moreover, by genetic fusion we armed the TCR-like antibody with a potent toxin and demonstrated that it can serve as a targeting moiety killing tumor cells in a peptide-specific, MHC-restricted manner similar to cytotoxic T-cell Lymphocytes. PMID:18446790

  13. Effect of ionizing radiation on acinar morphogenesis of human prostatic epithelial cells under three-dimensional culture conditions.

    PubMed

    Wang, T; X, S Ma; Kong, D; Yi, H; Wang, X; Liang, B; Xu, H; He, M; Jia, L; Qased, A B; Yang, Y; Liu, X

    2012-01-01

    Homeostasis is maintained by the interplay of multiple factors that directly or indirectly regulate cell proliferation and cell death. Complex multiple interactions between cells and the extracellular matrix occur during acinar morphogenesis and changes in these might indicate carcinogenesis of cells from a normal to a malignant, invasive phenotype. In this study, the human prostatic epithelial cell line RWPE-1 was cultured under three-dimensional (3-D) culture conditions, and the effect of ionizing radiation on acinar morphogenesis and its association with autophagy were discussed. The results illustrated that formation of specific spheroid (acinar) structures was detectable under 3-D culture conditions. Radiation induced the disruption of acini in different cell models using either gene overexpression (Akt) or gene knock-down (Beclin 1 and ATG7). Introduction of Akt not only accelerated the growth of cells (i.e., caused the cells to manifest elongating and microspike-like structures that are obviously different from structures seen in wild-type RWPE-1 cells under two-dimensional conditions), but also changed their morphological characteristics under 3-D culture conditions. Knock-down of autophagy-related genes (Beclin 1 and ATG7) increased the radiosensitivity of cells under 3-D culture conditions, and cells died of non-apoptotic death after radiation. The results suggested that ionizing radiation may change the cell phenotype and the formation of acini. Additionally even the autophagy mechanism may play a role in these processes. PMID:22296497

  14. Benzoxazinoids from Scoparia dulcis (sweet broomweed) with antiproliferative activity against the DU-145 human prostate cancer cell line.

    PubMed

    Wu, Wan-Hsun; Chen, Tzu-Yu; Lu, Rui-Wen; Chen, Shui-Tein; Chang, Chia-Chuan

    2012-11-01

    Sweet broomweed (Scoparia dulcis) is an edible perennial medicinal herb widely distributed in tropical and subtropical regions of Asia, Africa, and the Americas. Four compounds, (2R)-7-methoxy-2H-1,4-benzoxazin-3(4H)-one 2-O-β-galactopyranoside [(2R)-HMBOA-2-O-Gal], 3,6-dimethoxy-benzoxazolin-2(3H)-one (3,6-M2BOA), 3-hydroxy-6-methoxy-2-benzoxazolinone (3-OH-MBOA), and scutellarein 7-O-β-glucuronamide, along with eight known compounds, including two 7-methoxy-1,4-benzoxazin-3(2H)-one 3-O-hexopyranosides [(2R)-HMBOA-2-O-Glc and (2R)-HDMBOA-2-O-Glc], 6-methoxy-benzoxazolin-2(3H)-one (MBOA), acteoside, sodium scutellarin, p-coumaric acid, and two monosaccharides (fructose and glucose), were isolated from the aqueous extract of S. dulcis. Antiproliferative activities of the six benzoxazinoid compounds against the DU-145 human prostate cancer cell line were assayed, and one of these displayed an IC₅₀ of 65.8 μg/mL. PMID:22944352

  15. Human prostate cancer metastases target the hematopoietic stem cell niche to establish footholds in mouse bone marrow

    PubMed Central

    Shiozawa, Yusuke; Pedersen, Elisabeth A.; Havens, Aaron M.; Jung, Younghun; Mishra, Anjali; Joseph, Jeena; Kim, Jin Koo; Patel, Lalit R.; Ying, Chi; Ziegler, Anne M.; Pienta, Michael J.; Song, Junhui; Wang, Jingcheng; Loberg, Robert D.; Krebsbach, Paul H.; Pienta, Kenneth J.; Taichman, Russell S.

    2011-01-01

    HSC homing, quiescence, and self-renewal depend on the bone marrow HSC niche. A large proportion of solid tumor metastases are bone metastases, known to usurp HSC homing pathways to establish footholds in the bone marrow. However, it is not clear whether tumors target the HSC niche during metastasis. Here we have shown in a mouse model of metastasis that human prostate cancer (PCa) cells directly compete with HSCs for occupancy of the mouse HSC niche. Importantly, increasing the niche size promoted metastasis, whereas decreasing the niche size compromised dissemination. Furthermore, disseminated PCa cells could be mobilized out of the niche and back into the circulation using HSC mobilization protocols. Finally, once in the niche, tumor cells reduced HSC numbers by driving their terminal differentiation. These data provide what we believe to be the first evidence that the HSC niche serves as a direct target for PCa during dissemination and plays a central role in bone metastases. Our work may lead to better understanding of the molecular events involved in bone metastases and new therapeutic avenues for an incurable disease. PMID:21436587

  16. ZnFe2O4 nanoparticles as radiosensitizers in radiotherapy of human prostate cancer cells.

    PubMed

    Meidanchi, Alireza; Akhavan, Omid; Khoei, Samideh; Shokri, Ali A; Hajikarimi, Zahra; Khansari, Nakisa

    2015-01-01

    Nanoparticles of high-Z elements exhibit stronger photoelectric effects than soft tissues under gamma irradiation. Hence, they can be used as effective radiosensitizers for increasing the efficiency of current radiotherapy. In this work, superparamagnetic zinc ferrite spinel (ZnFe2O4) nanoparticles were synthesized by a hydrothermal reaction method and used as radiosensitizers in cancer therapy. The magnetic nanoparticles showed fast separation from solutions (e.g., ~1 min for 2 mg mL(-1) of the nanoparticles in ethanol) by applying an external magnetic field (~1T). The ZnFe2O4 nanoparticles were applied in an in vitro radiotherapy of lymph node carcinoma of prostate cells (as high radioresistant cells) under gamma irradiation of (60)Co source. The nanoparticles exhibited no significant effects on the cancer cells up to the high concentration of 100 μg mL(-1), in the absence of gamma irradiation. The gamma irradiation alone (2Gy dose) also showed no significant effects on the cells. However, gamma irradiation in the presence of 100 μg mL(-1) ZnFe2O4 nanoparticles resulted in ~53% inactivation of the cells (~17 times higher than the inactivation that occurred under gamma irradiation alone) after 24h. The higher cell inactivation was assigned to interaction of gamma radiation with nanoparticles (photoelectric effect), resulting in a high level electron release in the media of the radioresistant cells. Our results indicated that ZnFe2O4 nanoparticles not only can be applied in increasing the efficiency of radiotherapy, but also can be easily separated from the cell environment by using an external magnetic field after the radiotherapy. PMID:25492003

  17. Multifaceted preventive effects of single agent quercetin on a human prostate adenocarcinoma cell line (PC-3): implications for nutritional transcriptomics and multi-target therapy.

    PubMed

    Noori-Daloii, Mohammad R; Momeny, Majid; Yousefi, Mehdi; Shirazi, Forough Golsaz; Yaseri, Mehdi; Motamed, Nasrin; Kazemialiakbar, Nazanin; Hashemi, Saeed

    2011-12-01

    The aim of the present study is to evaluate the effects of quercetin, a dietary flavonoid, on human prostate adenocarcinoma PC-3 cells. Lactate dehydrogenase (LDH) release, microculture tetrazolium test (MTT assay) and real-time PCR array were employed to evaluate the effects of quercetin on cell cytotoxicity, cell proliferation and expression of various genes in PC-3 cell line. Quercetin inhibited cell proliferation and modulated the expression of genes involved in DNA repair, matrix degradation and tumor invasion, angiogenesis, apoptosis, cell cycle, metabolism and glycolysis. No cytotoxicity of quercetin on PC-3 cells was observed. Taken together, as shown by the issues of the current study, the manifold inhibitory effects of quercetin on PC-3 cells may introduce quercetin as an efficacious anticancer agent in order to be used in the future nutritional transcriptomic investigations and multi-target therapy to overcome the therapeutic impediments against prostate cancer. PMID:20596804

  18. Caffeic Acid Phenethyl Ester Causes p21Cip1 Induction, Akt Signaling Reduction, and Growth Inhibition in PC-3 Human Prostate Cancer Cells

    PubMed Central

    Lin, Hui-Ping; Jiang, Shih Sheng; Chuu, Chih-Pin

    2012-01-01

    Caffeic acid phenethyl ester (CAPE) treatment suppressed proliferation, colony formation, and cell cycle progression in PC-3 human prostate cancer cells. CAPE decreased protein expression of cyclin D1, cyclin E, SKP2, c-Myc, Akt1, Akt2, Akt3, total Akt, mTOR, Bcl-2, Rb, as well as phosphorylation of Rb, ERK1/2, Akt, mTOR, GSK3α, GSK3β, PDK1; but increased protein expression of KLF6 and p21Cip1. Microarray analysis indicated that pathways involved in cellular movement, cell death, proliferation, and cell cycle were affected by CAPE. Co-treatment of CAPE with chemotherapeutic drugs vinblastine, paclitaxol, and estramustine indicated synergistic suppression effect. CAPE administration may serve as a potential adjuvant therapy for prostate cancer. PMID:22347457

  19. 17beta-estradiol-induced activation of ERK1/2 through endogenous androgen receptor-estradiol receptor alpha-Src complex in human prostate cells.

    PubMed

    Chieffi, Paolo; Kisslinger, Annamaria; Sinisi, Antonio A; Abbondanza, Ciro; Tramontano, Donatella

    2003-09-01

    We examined the effect of estrogens on mitogen-activated protein kinase (MAPK) in EPN cells, a line of epithelial cells derived from human normal prostate. 17beta-estradiol (E2) caused a rapid and transient activation of MAPK (ERK1/2) within 5 min. This effect was counteracted by the anti-estrogen ICI 182-780 and by MEK inhibitor PD098059. The activation of ERK1/2 through 17beta-estradiol triggered simultaneous association of endogenous androgen receptor, estrogen receptor alpha and Src. In addition, E2 stimulated the proliferation of EPN cells, suggesting that the formation of the ternary complex and the consequent activation of ERKs are implicated in the mechanism regulating proliferation of epithelial prostate cells. PMID:12888920

  20. Calcitriol and 20(S)-protopanaxadiol synergistically inhibit growth and induce apoptosis in human prostate cancer cells.

    PubMed

    Ben-Eltriki, Mohamed; Deb, Subrata; Adomat, Hans; Tomlinson Guns, Emma S

    2016-04-01

    The potential cancer preventive roles of calcitriol, the dihydroxylated metabolite of Vitamin D3, as well as 20(S)-protopanaxadiol (aPPD), the aglycone of the protopanaxadiol family of ginsenosides, have gained much attention in recent years for the prevention/treatment of prostate cancer (PCa). In the present study, we evaluated the anticancer and chemosensitization effects of calcitriol at clinically relevant concentrations and aPPD, either alone or in combination, in two well-characterized human PCa cell lines: androgen-sensitive non-metastatic LNCaP cells and androgen-independent metastatic C4-2 cells. The effects of the treatments on PCa cell viability and proliferation rates were evaluated by MTS and Brdu assays, respectively. Combination Indices (CI) and Dose Reduction Indices (DRI) were estimated to assess synergistic anticancer activity using Calcusyn software (Biosoft, Cambridge, UK). Then, we determined the potential Pharmacodynamic interaction mechanisms as follows: The protein expression levels of the genes those are known to control cell cycle (cyclin D1 and cdk2); apoptosis (Bcl-2, Bax, and Capspases 3), androgen receptor and Vitamin D receptors were examined upon combinational treatment. The cell viability assay data show that addition of 10nM calcitriol to aPPD significantly lowered its IC50 values from the range of 41-53μM to 13-23μM, in LNCaP and C4-2 prostate cancer cells. The cell proliferation rate was significantly lower for combination treatments compared to the cells treated with aPPD alone. Similarly, Western blot results indicate that aPPD significantly upregulated Vitamin D receptor (VDR) expression, while calcitriol further enhanced the ability of aPPD to induce pro-apoptotic BAX, increased cleaved caspase-3 and downregulate cdk2 protein levels. Thus, the pharmacodynamic interaction between aPPD and calcitriol in impacting growth inhibition and apoptosis appears to be synergistic in nature. In conclusion, calcitriol sensitizes PCa

  1. Prostate cancer and toxicity from critical use exemptions of methyl bromide: Environmental protection helps protect against human health risks

    PubMed Central

    2012-01-01

    Background Although ozone-depleting methyl bromide was destined for phase-out by 2005, it is still widely applied as a consequence of various critical-use-exemptions and mandatory international regulations aiming to restrict the spread of pests and alien species (e.g. in globalized transport and storage). The withdrawal of methyl bromide because of its environmental risk could fortuitously help in the containment of its human toxicity. Methods We performed a systematic review of the literature, including in vitro toxicological and epidemiological studies of occupational and community exposure to the halogenated hydrocarbon pesticide methyl bromide. We focused on toxic (especially chronic) or carcinogenic effects from the use of methyl bromide, on biomonitoring data and reference values. Eligible epidemiological studies were subjected to meta-analysis. Results Out of the 542 peer reviewed publications between 1990-2011, we found only 91 referring to toxicity of methyl bromide and 29 using the term "carcinogenic", "neoplastic" or "mutagenic". Several studies provide new additional data pertaining to the mechanistic aspects of methyl bromide toxicity. Few studies have performed a detailed exposure assessment including biomonitoring. Three evaluated epidemiological studies assessed a possible association between cancer and methyl bromide. Overall, exposure to methyl bromide is associated with an increased risk of prostate cancer OR, 1.21; 95% CI (0,98-1.49), P = 0.076. Two epidemiological studies have analyzed environmental, non-occupational exposure to methyl bromide providing evidence for its health risk to the general public. None of the epidemiological studies addressed its use as a fumigant in freight containers, although recent field and case reports do refer to its toxic effects associated with its use in shipping and storage. Conclusions Both the epidemiological evidence and toxicological data suggest a possible link between methyl bromide exposure and serious

  2. Induction of steroid sulfatase expression in PC-3 human prostate cancer cells by insulin-like growth factor II.

    PubMed

    Sung, Chul-Hoon; Im, Hee-Jung; Park, Nahee; Kwon, Yeojung; Shin, Sangyun; Ye, Dong-Jin; Cho, Nam-Hyeon; Park, Young-Shin; Choi, Hyung-Kyoon; Kim, Donghak; Chun, Young-Jin

    2013-11-25

    Human steroid sulfatase (STS) plays an important role in regulating the formation of biologically active estrogens and may be a promising target for treating estrogen-mediated carcinogenesis. The molecular mechanism of STS gene expression, however, is still not clear. Growth factors are known to increase STS activity but the changes in STS expression have not been completely understood. To determine whether insulin-like growth factor (IGF)-II can induce STS gene expression, the effects of IGF-II on STS expression were studied in PC-3 human prostate cancer cells. RT-PCR and Western blot analysis showed that IGF-II treatment significantly increased the expression of STS mRNA and protein in concentration- and time-dependent manners. To understand the signaling pathway by which IGF-II induces STS gene expression, the effects of specific PI3-kinase/Akt and NF-κB inhibitors were determined. When the cells were treated with IGF-II and PI3-kinase/Akt inhibitors, such as LY294002, wortmannin, or Akt inhibitor IV, STS expression induced by IGF-II was significantly blocked. Moreover, we found that NF-κB inhibitors, such as MG-132, bortezomib, Bay 11-7082 or Nemo binding domain (NBD) binding peptide, also strongly prevented IGF-II from inducing STS gene expression. We assessed whether IGF-II activates STS promoter activity using transient transfection with a luciferase reporter. IGF-II significantly stimulated STS reporter activity. Furthermore, IGF-II induced expression of 17β-hydroxysteroid dehydrogenase (HSD) 1 and 3, whereas it reduced estrone sulfotransferase (EST) gene expression, causing enhanced estrone and β-estradiol production. Taken together, these results strongly suggest that IGF-II induces STS expression via a PI3-kinase/Akt-NF-κB signaling pathway in PC-3 cells and may induce estrogen production and estrogen-mediated carcinogenesis. PMID:24055520

  3. Prostasin induces protease-dependent and independent molecular changes in the human prostate carcinoma cell line PC-3

    PubMed Central

    Chen, Mengqian; Fu, Ya-Yuan; Lin, Chen-Yong; Chen, Li-Mei; Chai, Karl X.

    2007-01-01

    Summary Expression of prostasin in the PC-3 human prostate carcinoma cells inhibited in vitro invasion, but the molecular mechanisms are unknown. Wild-type human prostasin or a serine active-site mutant prostasin was expressed in the PC-3 cells. Molecular changes were measured at the mRNA and the protein levels. Cell signaling changes were evaluated by measuring phosphorylation of the extracellular signal-regulated kinases (Erk1/2) following epidermal growth factor (EGF) treatment of the cells. Protein expression of the EGF receptor (EGFR) was differentially down-regulated by the wild-type and the active-site mutant prostasin. The mRNA expression of EGFR and the transcription repressor SLUG was reduced in cells expressing wild-type prostasin but not the active-site mutant. Phosphorylation of Erk1/2 in response to EGF was greatly reduced by the wild-type prostasin but not by the active-site mutant. The mRNA expression of the urokinase-type plasminogen activator (uPA), the uPA receptor (uPAR), cyclooxygenase-2 (COX-2), and the inducible nitric oxide synthase (iNOS) was decreased by the wild-type and the active-site mutant prostasin. The mRNA or protein expression of granulocyte-macrophage colony-stimulating factor (GM-CSF), matriptase, and E-cadherin was greatly increased by the active-site mutant prostasin. In conclusion, prostasin expression elicits both protease-dependent and independent molecular changes in the PC-3 cells. PMID:17532063

  4. Prostate cancer.

    PubMed

    Attard, Gerhardt; Parker, Chris; Eeles, Ros A; Schröder, Fritz; Tomlins, Scott A; Tannock, Ian; Drake, Charles G; de Bono, Johann S

    2016-01-01

    Much progress has been made in research for prostate cancer in the past decade. There is now greater understanding for the genetic basis of familial prostate cancer with identification of rare but high-risk mutations (eg, BRCA2, HOXB13) and low-risk but common alleles (77 identified so far by genome-wide association studies) that could lead to targeted screening of patients at risk. This is especially important because screening for prostate cancer based on prostate-specific antigen remains controversial due to the high rate of overdiagnosis and unnecessary prostate biopsies, despite evidence that it reduces mortality. Classification of prostate cancer into distinct molecular subtypes, including mutually exclusive ETS-gene-fusion-positive and SPINK1-overexpressing, CHD1-loss cancers, could allow stratification of patients for different management strategies. Presently, men with localised disease can have very different prognoses and treatment options, ranging from observation alone through to radical surgery, with few good-quality randomised trials to inform on the best approach for an individual patient. The survival of patients with metastatic prostate cancer progressing on androgen-deprivation therapy (castration-resistant prostate cancer) has improved substantially. In addition to docetaxel, which has been used for more than a decade, in the past 4 years five new drugs have shown efficacy with improvements in overall survival leading to licensing for the treatment of metastatic castration-resistant prostate cancer. Because of this rapid change in the therapeutic landscape, no robust data exist to inform on the selection of patients for a specific treatment for castration-resistant prostate cancer or the best sequence of administration. Moreover, the high cost of the newer drugs limits their widespread use in several countries. Data from continuing clinical and translational research are urgently needed to improve, and, crucially, to personalise management. PMID

  5. Prolactin-induced prostate tumorigenesis.

    PubMed

    Sackmann-Sala, Lucila; Goffin, Vincent

    2015-01-01

    The physiological role of prolactin (PRL) in the prostate gland is not clearly understood. Genetically-modified mouse models that have invalidated actors of the PRL signaling axis failed to identify an essential regulatory function on this tissue. However, a large body of evidence suggests an important role for PRL in prostate tumorigenesis. Mainly through the activation of its downstream target STAT5, PRL can induce growth and survival of prostate cancer cells and tissues in several experimental settings. In the clinic, PRL expression and STAT5 activation in human prostate tumors correlate with disease severity. Available data point to a role of local (autocrine/paracrine) rather than circulating (endocrine) PRL in the induction of disease progression. In mice, transgenic expression of PRL in the prostate leads to enhanced epithelial hyperplasia and dysplasia, with amplification of basal/stem cells which have been recently identified as prostate cancer-initiating cells. Thus, targeting PRL receptor (PRLR)/STAT5 signaling may provide an alternative therapy for the treatment of prostate cancer. Corresponding targeted therapies currently in preclinical development include antagonists or blocking antibodies for the PRLR and small molecule inhibitors directed against the tyrosine kinase JAK2 upstream of STAT5. Present efforts are aimed at validating these therapies for the treatment of prostate cancer, while understanding the mechanisms of disease progression induced by PRL/STAT5. PMID:25472541

  6. Prostate PDT dosimetry

    PubMed Central

    Zhu, Timothy C.; Finlay, Jarod C.

    2015-01-01

    Summary We provide a review of the current state of dosimetry in prostate photodynamic therapy (PDT). PDT of the human prostate has been performed with a number of different photosensitizers and with a variety of dosimetry schemes. The simplest clinical light dose prescription is to quantify the total light energy emitted per length (J/cm) of cylindrical diffusing fibers (CDF) for patients treated with a defined photosensitizer injection per body weight. However, this approach does not take into account the light scattering by tissue and usually underestimates the local light fluence rate, and consequently the fluence. Techniques have been developed to characterize tissue optical properties and light fluence rates in vivo using interstitial measurements during prostate PDT. Optical methods have been developed to characterize tissue absorption and scattering spectra, which in turn provide information about tissue oxygenation and drug concentration. Fluorescence techniques can be used to quantify drug concentrations and photobleaching rates of photosensitizers. PMID:25046988

  7. Detection of DNA viruses in prostate cancer

    PubMed Central

    Smelov, Vitaly; Bzhalava, Davit; Arroyo Mühr, Laila Sara; Eklund, Carina; Komyakov, Boris; Gorelov, Andrey; Dillner, Joakim; Hultin, Emilie

    2016-01-01

    We tested prostatic secretions from men with and without prostate cancer (13 cases and 13 matched controls) or prostatitis (18 cases and 18 matched controls) with metagenomic sequencing. A large number (>200) of viral reads was only detected among four prostate cancer cases (1 patient each positive for Merkel cell polyomavirus, JC polyomavirus and Human Papillomavirus types 89 or 40, respectively). Lower numbers of reads from a large variety of viruses were detected in all patient groups. Our knowledge of the biology of the prostate may be furthered by the fact that DNA viruses are commonly shed from the prostate and can be readily detected by metagenomic sequencing of expressed prostate secretions. PMID:27121729

  8. The effects of SB 216469, an antagonist which discriminates between the alpha 1A-adrenoceptor and the human prostatic alpha 1-adrenoceptor.

    PubMed Central

    Chess-Williams, R.; Chapple, C. R.; Verfurth, F.; Noble, A. J.; Couldwell, C. J.; Michel, M. C.

    1996-01-01

    1. The affinity of the alpha 1-adrenoceptor antagonist SB 216469 (also known as REC 15/2739) has been determined at native and cloned alpha 1-adrenoceptor subtypes by radioligand binding and at functional alpha 1-adrenoceptor subtypes in isolated tissues. 2. In radioligand binding studies with [3H]-prazosin, SB 216469 had a high affinity at the alpha 1A-adrenoceptors of the rat cerebral cortex and kidney (9.5-9.8) but a lower affinity at the alpha 1B-adrenoceptors of the rat spleen and liver (7.7-8.2). 3. At cloned rat alpha 1-adrenoceptor subtypes transiently expressed in COS-1 cells and also at cloned human alpha 1-adrenoceptor subtypes stably transfected in Rat-1 cells, SB 216469 exhibited a high affinity at the alpha 1a-adrenoceptors (9.6-10.4) with a significantly lower affinity at the alpha 1b-adrenoceptor (8.0-8.4) and an intermediate affinity at the alpha 1d-adrenoceptor (8.7-9.2). 4. At functional alpha 1-adrenoceptors, SB 216469 had a similar pharmacological profile, with a high affinity at the alpha 1A-adrenoceptors of the rat vas deferens and anococcygeus muscle (pA2 = 9.5-10.0), a low affinity at the alpha 1B-adrenoceptors of the rat spleen (6.7) and guinea-pig aorta (8.0), and an intermediate affinity at the alpha 1D-adrenoceptors of the rat aorta (8.8). 5. Several recent studies have concluded that the alpha 1-adrenoceptor present in the human prostate has the pharmacological characteristics of the alpha 1A-adrenoceptor subtype. However, the affinity of SB 216469 at human prostatic alpha 1-adrenoceptors (pA2 = 8.1) determined in isolated tissue strips, was significantly lower than the values obtained at either the cloned alpha 1a-adrenoceptors (human, rat, bovine) or the native alpha 1A-adrenoceptors in radioligand binding and functional studies in the rat. 6. Our results with SB 216469, therefore, suggest that the alpha 1-adrenoceptor mediating contractile responses of the human prostate has properties which distinguish it from the cloned alpha 1a

  9. Does diabetes affect the distribution and number of interstitial cells and neuronal tissue in the ureter, bladder, prostate, and urethra of humans?

    PubMed Central

    Dogan, Hayriye; Kandemir, Olcay; Atmaca, Ali Fuat; Akbulut, Ziya; Balbay, Mevlana Derya

    2014-01-01

    Introduction The aim of this study was to investigate and compare the distribution and number of interstitial cells (ICs) and neuronal tissue in the ureter, bladder, prostate, and urethra of human patients with and without diabetes. Material and methods Human tissue was obtained from patients who had undergone radical cystectomy for bladder cancer (10 diabetic and 11 non–diabetic males). Interstitial cells were stained immunohistochemically with anti–human CD117 (c–kit) rabbit polyclonal antibody, Vimentin, and Connexin–43. Neural tissue was stained with synaptophysin. The number of ICs and neurons was evaluated and compared between the groups (diabetic versus non–diabetic). Results The mean number of c–kit (+) ICs in bladder lamina propria was significantly decreased in diabetics (32.40 ±12.96 versus 57.18 ±25.37, p = 0.036). The mean number of ICs in the detrusor muscle was significantly decreased in diabetics (40.50 ±16.79 versus 64.55 ±22.08, p = 0.013). Between the groups, no significant differences were detected regarding the number of ICs at the level of the ureter, urethra, and prostate. No significant differences were detected regarding the number of nerves in the ureter, bladder, prostate, and urethra of both groups. Conclusions The number of ICs may be decreased in the lamina propria and detrusor muscle of the human bladder in diabetes. This can be an underlying cause of lower urinary tract (LUT) dysfunction in diabetics. Research into the development of drugs targeting or stimulating IC function in order to prevent diabetic LUT dysfunction is warranted. PMID:25667756

  10. p66Shc--a longevity redox protein in human prostate cancer progression and metastasis : p66Shc in cancer progression and metastasis.

    PubMed

    Rajendran, Mythilypriya; Thomes, Paul; Zhang, Li; Veeramani, Suresh; Lin, Ming-Fong

    2010-03-01

    p66Shc, a 66 kDa proto-oncogene Src homologous-collagen homologue (Shc) adaptor protein, is classically known in mediating receptor tyrosine kinase signaling and recently identified as a sensor to oxidative stress-induced apoptosis and as a longevity protein in mammals. The expression of p66Shc is decreased in mice and increased in human fibroblasts upon aging and in aging-related diseases, including prostate cancer. p66Shc protein level correlates with the proliferation of several carcinoma cells and can be regulated by steroid hormones. Recent advances point that p66Shc protein plays a role in mediating cross-talk between steroid hormones and redox signals by serving as a common convergence point in signaling pathways on cell proliferation and apoptosis. This article first reviews the unique function of p66Shc protein in regulating oxidative stress-induced apoptosis. Subsequently, we discuss its novel role in androgen-regulated prostate cancer cell proliferation and metastasis and the mechanism by which it mediates androgen action via the redox signaling pathway. The data together indicate that p66Shc might be a useful biomarker for the prognosis of prostate cancer and serve as an effective target for its cancer treatment. PMID:20111892

  11. The Flame-Retardant Tris(1,3-dichloro-2-propyl) Phosphate Represses Androgen Signaling in Human Prostate Cancer Cell Lines.

    PubMed

    Reers, Alexandra R; Eng, Margaret L; Williams, Tony D; Elliott, John E; Cox, Michael E; Beischlag, Timothy V

    2016-05-01

    The effects of six organophosphate flame retardants (OPFRs) tris(2-butoxyethyl) phosphate, tris(2-chloroethyl) phosphate, tris(1-chloro-2-propyl) phosphate, tris(methylphenyl) phosphate, tris(1,3-dichloro-2-propyl) phosphate (TDCIPP), and triethyl phosphate on the activities of androgen receptor (AR), estrogen receptor (ER), and aryl hydrocarbon receptor (AhR) were assessed in human prostate and endometrial cancer cells. OPFRs had no effect on ER or AhR target gene activation in ECC-1 cells. The effect of TDCIPP on mRNA and protein accumulation of AR target genes was examined further. AR-inducible gene and protein expression were significantly altered by TDCIPP exposure and repressed PSA levels in conditioned media of prostate cancer cells. We demonstrated that TDCIPP has no affinity for the AR ligand binding domain (AR-LBD) and exerts its antiandrogenic effects in a noncompetitive fashion. Thus, the clinical relevance of TDCIPP exposure on prostate cancer detection and progression to a therapeutically refractile state ought to be investigated further. PMID:26709203

  12. Prostate cancer immunotherapy: beyond immunity to curability.

    PubMed

    Simons, Jonathan W

    2014-11-01

    Metastatic prostate cancer is the second leading cause of death from cancer in the United States. It is the first prevalent cancer in which overall survival in advanced disease is modestly, but objectively, improved with outpatient delivered dendritic cell-based immunotherapy. More prostate cancer patients have enrolled through Facebook and trusted-site Internet searches in clinical trials for prostate cancer vaccine-based immunotherapy than in immunotherapy trials for lung, breast, colon, pancreas, ovarian, and bladder cancer combined in the past 7 years. Exceptional responses to anti-CTLA-4 treatment have been documented in clinics, and prostate cancer neoantigen characterization and T-cell clonotyping are in their research ascendancy. The prostate is an accessory organ; it is not required for fertility, erectile function, or urinary continence. The true evolutionary advantage of having a prostate for male mammalian physiology is a topic of speculation in seminar rooms and on bar stools, but it remains unknown. Hundreds of prostate lineage-unique proteins (PLUP) exist among the >37,000 normal human prostate lineage-unique open reading frames that can be targeted for immunologic ablation of PLUP(+) prostate cancer cells by prostate-specific autoimmunity. This bioengineered graft-versus-prostate disease is a powerful strategy that can eliminate deaths from prostate cancer. Immunologic tolerance to prostate cancer can be overcome at every clinical stage of presentation. This Cancer Immunology at the Crossroads article aims to present advances in the past two decades of basic, translational, and clinical research in prostate cancer, including bioengineering B-cell and T-cell responses, and ongoing prostate cancer immunotherapy trials. PMID:25367978

  13. In vitro anti-oxidant, cytotoxic and pro-apoptotic effects of Achillea teretifolia Willd extracts on human prostate cancer cell lines

    PubMed Central

    Bali, Elif Burcu; Açık, Leyla; Elçi, Pınar; Sarper, Meral; Avcu, Ferit; Vural, Mecit

    2015-01-01

    Background: The majority of Achillea species are the most important native economic plants of Anatolia. They include highly bioactive compounds, so they have therapeutic applications. Objective: In the present study, the aim was to investigate in vitro anti-oxidant, cytotoxic and pro-apoptotic effects of Achillea teretifolia Willd extracts (Turkish name: Beyaz civanperÇemi). Materials and Methods: The anti-oxidant potential of the extracts was analyzed by the free radical 1,1-diphenyl-2-picryl-hydrazyl (DPPH) and total phenolic content methods. 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay was used to detect cytotoxicity of the extracts onhuman prostate cancer cell lines (DU145 and PC-3) and human gingival fibroblast (HGF) cells. mRNA expression levels of pro-apoptotic (bax, caspase-3) and anti-apoptotic (bcl-2) genes were measured by quantitative real-time polymerase chain reaction. Results: The results showed that extracts exhibited a remarkable DPPH scavenging activity, and total phenolic content of the methanol extract was higher than that of the water extract. As time and concentration were increased, the methanol extract exhibited a more powerful cytotoxic effect on prostate cancer cells. In prostate cancer cells, the levels of mRNA expression of the bax and caspase-3 genes were significantly up-regulated (P < 0.05), whereas the expression of bcl-2 was down-regulated (P < 0.05). In HGF cells, there were no cytotoxic effect and apoptosis induction triggered by the extracts. Conclusion: The methanol extract had more powerful anti-oxidant, cytotoxic and pro-apoptotic effects than the water extract. The extracts could be good anti-oxidant sources, and they might include anti-cancer compounds triggering the cytotoxicity and the apoptosis on prostate cancer cells. PMID:26664020

  14. Effects of ρ-Da1a a peptidic α1A-adrenoceptor antagonist in human isolated prostatic adenoma and anaesthetized rats

    PubMed Central

    Palea, S; Maiga, A; Guilloteau, V; Rekik, M; Guérard, M; Rouget, C; Rischmann, P; Botto, H; Camparo, P; Lluel, P; Gilles, N

    2013-01-01

    Background and Purpose ρ-Da1a, a 65 amino-acid peptide, has subnanomolar affinity and high selectivity for the human α1A-adrenoceptor subtype. The purpose of this study was to characterize the pharmacological effects of ρ-Da1a on prostatic function, both in vivo and in vitro. Experimental Approach ρ-Da1a was tested as an antagonist of adrenaline-induced effects on COS cells transfected with the human α1A-adrenoceptor as well as on human isolated prostatic adenoma obtained from patients suffering from benign prostatic hyperplasia. Moreover, we compared the effects of ρ-Da1a and tamsulosin on phenylephrine (PHE)-induced increases in intra-urethral (IUP) and arterial pressures (AP) in anaesthetized rats, following i.v. or p.o. administration. Key Results On COS cells expressing human α1A-adrenoceptors and on human prostatic strips, ρ-Da1a inhibited adrenaline- and noradrenaline-induced effects. In anaesthetized rats, ρ-Da1a and tamsulosin administered i.v. 30 min before PHE significantly antagonized the effects of PHE on IUP. The pKB values for tamsulosin and ρ-Da1a for this effect were similar. With regards to AP, ρ-Da1a only reduced the effect of PHE on AP at the lowest dose tested (10 μg·kg−1), whereas tamsulosin significantly reduced PHE effects at doses between 10 and 150 μg·kg−1. Conclusions and Implications ρ-Da1a exhibited a relevant effect on IUP and a small effect on AP. In contrast, tamsulosin antagonized the effects of PHE on both IUP and AP. We conclude that ρ-Da1a is more uroselective than tamsulosin. ρ-Da1a is the most selective peptidic antagonist for α1A-adenoceptors identified to date and could be a new treatment for various urological diseases. PMID:23005263

  15. Discovery of Novel N-alkyl 4-anilinofuro[2,3-b]quinoline Derivatives (CIL-102 Derivatives) Against Castration-resistant Human Prostate Cancers.

    PubMed

    Lo, We-Fen; Chou, Yu-Wei; Tseng, Chih-Hua; Shiu, Yia-Huei; Chen, Yu-Wen; Yang, Shyh-Chyun; Chen, Yeh-Long; Lin, Ming-Fong; Tzeng, Cherng-Chyi

    2015-01-01

    A number of N-alkylated 4-anilinofuro[2,3-b]quinoline derivatives were synthesized and evaluated in vitro against PC-3, A549, and MCF-7 cancer cells and M-10 normal human mammary epithelial cells. The known antimitotic CIL-102 was moderately active against the growth of PC-3 prostate cancer cells with an IC50 value of 2.69 μM while it was more potent against the growth of A549, MCF-7 and M-10 cells with IC50 values of 0.61, 0.31 and 0.95 μM, respectively. However, the cytotoxic profiles of its N-alkylated derivatives, 6a - 6c, were reversed and strongly inhibited PC-3 cell growth with IC50 values of less than 1.0 μM but only weakly against the growth of A549, MCF-7 and M-10 cells. These results indicated that N-alkylation of CIL-102 increased not only selectivity but also the antiproliferative potency against PC-3 cell growth. Among these derivatives synthesized, N-(4-acetylphenyl)-N-(furo[2,3-b]quinolin- 4-yl)methylamine (6a) and its N-ethyl counterpart 6b are the two most active CIL-102 derivatives against PC-3 cell growth with IC50 value of 0.22 and 0.20 μM, respectively. Compound 6a is less cytotoxic to normal human M-10 cells than 6b and therefore was selected for further mechanism studies. The flow cytometry studies clearly indicated that compound 6a induced cell accumulation in G2/M phase in a dose-dependent manner after 24 h-treatment. While the proliferation of LNCaP C-81 prostate cancer cells was also strongly suppressed by compound 6a; compound 11a exhibited better selective activity toward LNCaP C-81 prostate cancer cells over RWPE-1 non-cancerous prostate epithelia. Thus, this group of compounds has a potential of serving as therapeutic agents toward advanced castration-resistant prostate cancers. PMID:25612680

  16. Diosgenin, a Steroidal Saponin, Inhibits Migration and Invasion of Human Prostate Cancer PC-3 Cells by Reducing Matrix Metalloproteinases Expression

    PubMed Central

    Chen, Pin-Shern; Shih, Yuan-Wei; Huang, Hsiang-Ching; Cheng, Hsing-Wen

    2011-01-01

    Background Diosgenin, a steroidal saponin obtained from fenugreek (Trigonella foenum graecum), was found to exert anti-carcinogenic properties, such as inhibiting proliferation and inducing apoptosis in a variety of tumor cells. However, the effect of diosgenin on cancer metastasis remains unclear. The aim of the study is to examine the effect of diosgenin on migration and invasion in human prostate cancer PC-3 cells. Methods and Principal Findings Diosgenin inhibited proliferation of PC-3 cells in a dose-dependent manner. When treated with non-toxic doses of diosgenin, cell migration and invasion were markedly suppressed by in vitro wound healing assay and Boyden chamber invasion assay, respectively. Furthermore, diosgenin reduced the activities of matrix metalloproteinase-2 (MMP-2) and MMP-9 by gelatin zymography assay. The mRNA level of MMP-2, -9, -7 and extracellular inducer of matrix metalloproteinase (EMMPRIN) were also suppressed while tissue inhibitor of metalloproteinase-2 (TIMP-2) was increased by diosgenin. In addition, diosgenin abolished the expression of vascular endothelial growth factor (VEGF) in PC-3 cells and tube formation of endothelial cells. Our immunoblotting assays indicated that diosgenin potently suppressed the phosphorylation of phosphatidylinositide-3 kinase (PI3K), Akt, extracellular signal regulating kinase (ERK) and c-Jun N-terminal kinase (JNK). In addition, diosgenin significantly decreased the nuclear level of nuclear factor kappa B (NF-κB), suggesting that diosgenin inhibited NF-κB activity. Conclusion/Significance The results suggested that diosgenin inhibited migration and invasion of PC-3 cells by reducing MMPs expression. It also inhibited ERK, JNK and PI3K/Akt signaling pathways as well as NF-κB activity. These findings reveal new therapeutic potential for diosgenin in anti-metastatic therapy. PMID:21629786

  17. The Carboxyl Tail of Connexin32 Regulates Gap Junction Assembly in Human Prostate and Pancreatic Cancer Cells*

    PubMed Central

    Katoch, Parul; Mitra, Shalini; Ray, Anuttoma; Kelsey, Linda; Roberts, Brett J.; Wahl, James K.; Johnson, Keith R.; Mehta, Parmender P.

    2015-01-01

    Connexins, the constituent proteins of gap junctions, are transmembrane proteins. A connexin (Cx) traverses the membrane four times and has one intracellular and two extracellular loops with the amino and carboxyl termini facing the cytoplasm. The transmembrane and the extracellular loop domains are highly conserved among different Cxs, whereas the carboxyl termini, often called the cytoplasmic tails, are highly divergent. We have explored the role of the cytoplasmic tail of Cx32, a Cx expressed in polarized and differentiated cells, in regulating gap junction assembly. Our results demonstrate that compared with the full-length Cx32, the cytoplasmic tail-deleted Cx32 is assembled into small gap junctions in human pancreatic and prostatic cancer cells. Our results further document that the expression of the full-length Cx32 in cells, which express the tail-deleted Cx32, increases the size of gap junctions, whereas the expression of the tail-deleted Cx32 in cells, which express the full-length Cx32, has the opposite effect. Moreover, we show that the tail is required for the clustering of cell-cell channels and that in cells expressing the tail-deleted Cx32, the expression of cell surface-targeted cytoplasmic tail alone is sufficient to enhance the size of gap junctions. Our live-cell imaging data further demonstrate that gap junctions formed of the tail-deleted Cx32 are highly mobile compared with those formed of full-length Cx32. Our results suggest that the cytoplasmic tail of Cx32 is not required to initiate the assembly of gap junctions but for their subsequent growth and stability. Our findings suggest that the cytoplasmic tail of Cx32 may be involved in regulating the permeability of gap junctions by regulating their size. PMID:25548281

  18. Tumor-targeting Salmonella typhimurium A1-R inhibits human prostate cancer experimental bone metastasis in mouse models

    PubMed Central

    Toneri, Makoto; Miwa, Shinji; Zhang, Yong; Hu, Cameron; Yano, Shuya; Matsumoto, Yasunori; Bouvet, Michael; Nakanishi, Hayao; Hoffman, Robert M.; Zhao, Ming

    2015-01-01

    Bone metastasis is a frequent occurrence in prostate cancer patients and often is lethal. Zoledronic acid (ZOL) is often used for bone metastasis with limited efficacy. More effective models and treatment methods are required to improve the outcome of prostate cancer patients. In the present study, the effects of tumor-targeting Salmonella typhimurium A1-R were analyzed in vitro and in vivo on prostate cancer cells and experimental bone metastasis. Both ZOL and S. typhimurium A1-R inhibited the growth of PC-3 cells expressing red fluorescent protien in vitro. To investigate the efficacy of S. typhimurium A1-R on prostate cancer experimental bone metastasis, we established models of both early and advanced stage bone metastasis. The mice were treated with ZOL, S. typhimurium A1-R, and combination therapy of both ZOL and S. typhimurium A1-R. ZOL and S. typhimurium A1-R inhibited the growth of solitary bone metastases. S. typhimurium A1-R treatment significantly decreased bone metastasis and delayed the appearance of PC-3 bone metastases of multiple mouse models. Additionally, S. typhimurium A1-R treatment significantly improved the overall survival of the mice with multiple bone metastases. The results of the present study indicate that S. typhimurium A1-R is useful to prevent and inhibit prostate cancer bone metastasis and has potential for future clinical use in the adjuvant setting. PMID:26431498

  19. Effect of SIRT1 Gene on Epithelial-Mesenchymal Transition of Human Prostate Cancer PC-3 Cells

    PubMed Central

    Cui, Ying; Li, Jiang; Zheng, Fei; Ouyang, Yongri; Chen, Xi; Zhang, Lei; Chen, Yang; Wang, Lin; Mu, Shijie; Zhang, Huizhong

    2016-01-01

    Background The epithelial-mesenchymal transition (EMT) has been shown to be involved in the process of invasion and metastasis of prostate cancer. SIRT1 is the mammalian homologue of the silent information regulator 2 (Sir2) gene, and is abnormally expressed in prostate cancer cells. Therefore, it is hypothesized that SIRT1 mediates the invasion/metastatic ability of prostate cancer via EMT regulation. This study thus investigated the effect of SIRT1 gene on the invasion and migration of prostate cancer cell line PC-3 via the small interference RNA (siRNA) against SIRT1. Material/Methods SiRNA construct was transfected into PC-3 cells, which were tested for the cell migration and invasion ability by scratch assay and Transwell migration assay, respectively. Expression levels of vimentin, E-cadherin, and N-cadherin were further quantified by Western blotting and RT-PCR. Results Both mRNA and protein levels of SIRT1 were depressed after siRNA transfection, along with weakened migration and invasion ability of PC-3 cells. Elevated E-cadherin and suppressed N-cadherin and vimentin were observed in those transfected cells. Conclusions The silencing of SIRT1 gene in PC-3 cells can suppress the movement, migration, and invasion functions of prostate cancer cells, possibly via the down-regulation of mesenchymal markers vimentin and N-cadherin accompanied with up-regulation of epithelial marker N-cadherin, thus reversing the EMT process. PMID:26847404

  20. Three dimensional pharmacophore modeling of human CYP17 inhibitors. Potential agents for prostate cancer therapy.

    PubMed

    Clement, Omoshile O; Freeman, Clive M; Hartmann, Rolf W; Handratta, Venkatesh D; Vasaitis, Tadas S; Brodie, Angela M H; Njar, Vincent C O

    2003-06-01

    We report here a molecular modeling investigation of steroidal and nonsteroidal inhibitors of human cytochrome P450 17alpha-hydroxylase-17,20-lyase (CYP17). Using the pharmacophore perception technique, we have generated common-feature pharmacophore model(s) to explain the putative binding requirements for two classes of human CYP17 inhibitors. Common chemical features in the steroid and nonsteroid human CYP17 enzyme inhibitors, as deduced by the Catalyst/HipHop program, are one to two hydrogen bond acceptors (HBAs) and three hydrophobic groups. For azole-steroidal ligands, the 3beta-OH group of ring A and the N-3 of the azole ring attached to ring D at C-17 act as hydrogen bond acceptors. A model that permits hydrogen bond interaction between the azole functionality on ring D and the enzyme is consistent with experimental deductions for type II CYP17 inhibitors where a sixth ligating atom interacts with Fe(II) of heme. In general, pharmacophore models derived for steroid and nonsteroidal compounds bear striking similarities to all azole sites mapping the HBA functionality and to three hydrophobic features describing the hydrophobic interactions between the ligands and the enzyme. Using the pharmacophore model derived for azole-steroidal inhibitors as a 3D search query against several 3D multiconformational Catalyst formatted databases, we identified several steroidal compounds with potential inhibition of this enzyme. Biological testing of some of these compounds show low to high inhibitory potency against the human CYP17 enzyme. This shows the potential of our pharmacophore model in identifying new and potent CYP17 inhibitors. Further refinement of the model is in progress with a view to identifying and optimizing new leads. PMID:12773039

  1. Tubeimoside-1 induces oxidative stress-mediated apoptosis and G0/G1 phase arrest in human prostate carcinoma cells in vitro

    PubMed Central

    Yang, Jing-bo; Khan, Muhammad; He, Yang-yang; Yao, Min; Li, Yong-ming; Gao, Hong-wen; Ma, Tong-hui

    2016-01-01

    Aim: Tubeimoside-1 (TBMS1), a triterpenoid saponin extracted from the Chinese herbal medicine Bolbostemma paniculatum (Maxim) Franquet (Cucurbitaceae), has shown anticancer activities in various cancer cell lines. The aim of this study was to investigate the anticancer activity and molecular targets of TBMS1 in human prostate cancer cells in vitro. Methods: DU145 and P3 human prostate cancer cells were treated with TBMS1. Cell viability and apoptosis were detected. ROS generation, mitochondrial membrane potential and cell cycle profile were examined. Western blotting was used to measure the expression of relevant proteins in the cells. Results: TBMS1 (5–100 μmol/L) significantly suppressed the viability of DU145 and P3 cells with IC50 values of approximately 10 and 20 μmol/L, respectively. Furthermore, TBMS1 dose-dependently induced apoptosis and cell cycle arrest at G0/G1 phase in DU145 and P3 cells. In DU145 cells, TBMS1 induced mitochondrial apoptosis, evidenced by ROS generation, mitochondrial dysfunction, endoplasmic reticulum stress, modulated Bcl-2 family protein and cleaved caspase-3, and activated ASK-1 and its downstream targets p38 and JNK. The G0/G1 phase arrest was linked to increased expression of p53 and p21 and decreased expression of cyclin E and cdk2. Co-treatment with Z-VAD-FMK (pan-caspase inhibitor) could attenuate TBMS1-induced apoptosis but did not prevent G0/G1 arrest. Moreover, co-treatment with NAC (ROS scavenger), SB203580 (p38 inhibitor), SP600125 (JNK inhibitor) or salubrinal (ER stress inhibitor) significantly attenuated TBMS1-induced apoptosis. Conclusion: TBMS1 induces oxidative stress-mediated apoptosis in DU145 human prostate cancer cells in vitro via the mitochondrial pathway. PMID:27292614

  2. Increase in apoptotic effect of Panax ginseng by microwave processing in human prostate cancer cells: in vitro and in vivo studies

    PubMed Central

    Park, Jun Yeon; Choi, Pilju; Kim, Ho-kyong; Kang, Ki Sung; Ham, Jungyeob

    2015-01-01

    Background Ginseng, which is widely used in functional foods and as an herbal medicine, has been reported to reduce the proliferation of prostate cancer cells by mechanisms that are not yet fully understood. Methods This study was designed to investigate the changes in ginsenoside content in ginseng after treatment with a microwave-irradiation thermal process and to verify the anticancer effects of the extracts. To confirm the anticancer effect of microwave-irradiated processed ginseng (MG), it was tested in three human prostate cancer cell lines (DU145, LNCaP, and PC-3 cells). Involvements of apoptosis and autophagy were assessed using Western blotting. Results After microwave treatment, the content of ginsenosides Rg1, Re, Rb1, Rc, Rb2, and Rd in the extracts decreased, whereas the content of ginsenosides 20(S)-Rg3, 20(R)-Rg3, Rk1, and Rg5 increased. Antiproliferation results for the human cancer cell lines treated with ginseng extracts indicate that PC-3 cells treated with MG showed the highest activity with an half maximal inhibitory concentration of 48 μg/mL. We also showed that MG suppresses the growth of human prostate cancer cell xenografts in athymic nude mice as an in vivo model. This growth suppression by MG is associated with the inductions of cell death and autophagy. Conclusion Therefore, heat processing by microwave irradiation is a useful method to enhance the anticancer effect of ginseng by increasing the content of ginsenosides Rg3, Rg5, and Rk1. PMID:26843823

  3. First evidence of sphingosine 1-phosphate lyase protein expression and activity downregulation in human neoplasm: implication for resistance to therapeutics in prostate cancer.

    PubMed

    Brizuela, Leyre; Ader, Isabelle; Mazerolles, Catherine; Bocquet, Magalie; Malavaud, Bernard; Cuvillier, Olivier

    2012-09-01

    This is the first report of sphingosine 1-phosphate lyase (SPL) protein expression and enzymatic activity in human neoplasm. This enzyme drives irreversible degradation of sphingosine 1-phosphate (S1P), a bioactive lipid associated with resistance to therapeutics in various cancers, including prostate adenocarcinoma. In fresh human prostatectomy specimens, a remarkable decrease in SPL enzymatic activity was found in tumor samples, as compared with normal adjacent tissues. A significant relationship between loss of SPL expression and higher Gleason score was confirmed in tissue microarray (TMA) analysis. Moreover, SPL protein expression and activity were inversely correlated with those of sphingosine kinase-1 (SphK1), the enzyme producing S1P. SPL and SphK1 expressions were independently predictive of aggressive cancer on TMA, supporting the relevance of S1P in prostate cancer. In human C4-2B and PC-3 cell lines, silencing SPL enhanced survival after irradiation or chemotherapy by decreasing expression of proteins involved in sensing and repairing DNA damage or apoptosis, respectively. In contrast, enforced expression of SPL sensitized cancer cells to irradiation or docetaxel by tilting the ceramide/S1P balance toward cell death. Interestingly, the S1P degradation products failed to sensitize to chemo- and radiotherapy, supporting the crucial role of ceramide/S1P balance in cancer. Of note, the combination of SPL enforced expression with a SphK1 silencing strategy by further decreasing S1P content made prostate cancer cells even more sensitive to anticancer therapies, suggesting that a dual strategy aimed at stimulating SPL, and inhibiting SphK1 could represent a future approach to sensitize cancer cells to cancer treatments. PMID:22784711

  4. Benign prostate hyperplasia (BPH) - resources

    MedlinePlus

    Resources - benign prostatic hyperplasia (BPH); Prostate enlargement resources; BPH resources ... organizations provide information on benign prostatic hyperplasia ( prostate enlargement ): National Kidney and Urologic Diseases Information Clearinghouse -- www. ...

  5. Effects of dihydroxy gymnemic triacetate (DGT) on expression of apoptosis associated proteins in human prostate cancer cell lines (PC3).

    PubMed

    Pon Nivedha, Rajamanickam; Selvaraj, Jayaraman; Lalitha, Keddal Govindaram; Rajalakshmi, Manikkam

    2015-01-01

    Prostate cancer is the most common malignancies among men. The present study is aimed at the investigation of dihydroxy gymnemic triacetate (DGT) from Gymnema sylvestre on mitochondrial apoptotic pathway and cell cycle arrest. Treatment of DGT resulted in a dose-dependent inhibition of growth of PC-3 cells. The cell cycle arrest was observed at the G2/M phase and accumulation of apoptotic cells was observed in DGT-treated prostate cancer cell lines. The occurrence of apoptosis in these cells was observed by DNA fragmentation. These events were associated with increased levels of pro-apoptotic proteins Bax, Bad and reduced levels of the antiapoptotic proteins Bcl-2, Bcl-xL and Mcl-1. DGT also induces the activation of caspase-9 and caspase-3. The above results, clearly, suggest that DGT induces apoptosis by the intrinsic pathways which could be very useful for the treatment of prostate cancer. PMID:26053511

  6. Isolation of three new annonaceous acetogenins from Graviola fruit (Annona muricata) and their anti-proliferation on human prostate cancer cell PC-3.

    PubMed

    Sun, Shi; Liu, Jingchun; Zhou, Ninghui; Zhu, Wenjun; Dou, Q Ping; Zhou, Kequan

    2016-09-01

    Bioassay-guided fractionation of the fruit powder of Graviola (Annona muricata) was continued to be conducted and yielded three more novel bioactive compounds: C-35 annonaceous acetogenins, muricins M and N, and C-37 annonaceous acetogenins, muricenin. They all contain a mono-tetrahydrofuran ring and four hydroxyl groups. The structures were elucidated by spectral methods and chemical modification after isolation via open column chromatographic separation and HPLC purification. Especially, murices M and N demonstrated more potent anti-proliferative activities against human prostate cancer PC-3 cells. PMID:27499453

  7. Prostate Problems

    MedlinePlus

    ... F Race . Prostate cancer is most common among African-American men. F Family History . If your father or ... Healthcare Research and Quality Publications Clearinghouse P.O. Box 8547 Silver Spring, MD 20907-8547 1-800- ...

  8. Prostate Problems

    MedlinePlus

    ... risk. Race . Prostate cancer is most common among African-American men. Family history . If your father or brother ... Healthcare Research and Quality Publications Clearinghouse P.O. Box 8547 Silver Spring, MD 20907-8547 1-800- ...

  9. Prostatitis - acute

    MedlinePlus

    ... bladder, such as alcohol, caffeinated foods and drinks, citrus juices, and hot or spicy foods. Drink more ... A.D.A.M. Editorial team. Related MedlinePlus Health Topics Prostate Diseases Browse the Encyclopedia A.D. ...

  10. Prostatitis - nonbacterial

    MedlinePlus

    ... lower urinary tract Parasites Pelvic floor muscle problem Sexual abuse Viruses Life stresses and emotional factors may play a part in the problem. Most men with chronic prostatitis have the nonbacterial form.

  11. Evaluation of discoidin domain receptor-2 (DDR2) expression level in normal, benign, and malignant human prostate tissues

    PubMed Central

    Azemikhah, Mitra; Ashtiani, Hamidreza Ahmadi; Aghaei, Mahmoud; Rastegar, Hosein

    2015-01-01

    Discoidin domain receptor (DDR) is a new member of the receptor tyrosine kinase family. There are two isoforms of discoidin domain receptor (DDR), DDR1 and DDR2. These receptors play a major role in the adhesion, motility and cell proliferation. Due to the important role of DDR2 in the development of tumor extension, this receptor is pivotal in the field of carcinogenesis. The aim of this study was to investigate the mRNA and protein expression of DDR2, in the malignant, benign prostatic hyperplasia (BPH) and normal tissues of patients with prostate cancer. In this study the gene and protein expression of DDR2 in adjacent normal (n=40), BPH (n=40), and malignant (n=40) prostate tissue were measured using real-time PCR and Western blotting. Then, the correlation of DDR2 gene and protein expression with prognostic factors such as age, tumor grade, tumor stage, lymph node involvement, and serum prostate-specific antigen (PSA) concentration were evaluated. The relative mRNA and protein expression level of DDR2 in malignant and benign prostate tissue was significantly higher than those of adjacent normal tissues (P<0.01). This expression was found to increase approximately 3.5 and 2.1 fold for mRNA and protein levels, respectively. Spearman test indicated a significant correlation between DDR2 mRNA and protein expression with prognostic factors such as tumor grade, stage, lymph node involvement, and serum PSA concentration. However, significant correlation with age was not observed. These findings suggest that DDR2 is a cancer-related gene associated with the aggressive progression of prostate cancer patients. PMID:26600862

  12. Evaluation of discoidin domain receptor-2 (DDR2) expression level in normal, benign, and malignant human prostate tissues.

    PubMed

    Azemikhah, Mitra; Ashtiani, Hamidreza Ahmadi; Aghaei, Mahmoud; Rastegar, Hosein

    2015-01-01

    Discoidin domain receptor (DDR) is a new member of the receptor tyrosine kinase family. There are two isoforms of discoidin domain receptor (DDR), DDR1 and DDR2. These receptors play a major role in the adhesion, motility and cell proliferation. Due to the important role of DDR2 in the development of tumor extension, this receptor is pivotal in the field of carcinogenesis. The aim of this study was to investigate the mRNA and protein expression of DDR2, in the malignant, benign prostatic hyperplasia (BPH) and normal tissues of patients with prostate cancer. In this study the gene and protein expression of DDR2 in adjacent normal (n=40), BPH (n=40), and malignant (n=40) prostate tissue were measured using real-time PCR and Western blotting. Then, the correlation of DDR2 gene and protein expression with prognostic factors such as age, tumor grade, tumor stage, lymph node involvement, and serum prostate-specific antigen (PSA) concentration were evaluated. The relative mRNA and protein expression level of DDR2 in malignant and benign prostate tissue was significantly higher than those of adjacent normal tissues (P<0.01). This expression was found to increase approximately 3.5 and 2.1 fold for mRNA and protein levels, respectively. Spearman test indicated a significant correlation between DDR2 mRNA and protein expression with prognostic factors such as tumor grade, stage, lymph node involvement, and serum PSA concentration. However, significant correlation with age was not observed. These findings suggest that DDR2 is a cancer-related gene associated with the aggressive progression of prostate cancer patients. PMID:26600862

  13. Hyperplastic stomatitis and esophagitis in a tortoise (Testudo graeca) associated with an adenovirus infection.

    PubMed

    Garcia-Morante, Beatriz; Pénzes, Judit J; Costa, Taiana; Martorell, Jaime; Martínez, Jorge

    2016-09-01

    A 2-year-old female, spur-thighed tortoise (Testudo graeca) was presented with poor body condition (1/5) and weakness. Fecal analysis revealed large numbers of oxyurid-like eggs, and radiographs were compatible with gastrointestinal obstruction. Despite supportive medical treatment, the animal died. At gross examination, an intestinal obstruction was confirmed. Histopathology revealed severe hyperplastic esophagitis and stomatitis with marked epithelial cytomegaly and enormous basophilic intranuclear inclusion bodies. Electron microscopy examination revealed a large number of 60-80 nm, nonenveloped, icosahedral virions arranged in crystalline arrays within nuclear inclusions of esophageal epithelial cells, morphologically compatible with adenovirus-like particles. PCR for virus identification was performed with DNA extracted from formalin-fixed, paraffin-embedded tissues. A nested, consensus pan-adenovirus PCR and sequencing analysis showed a novel adenovirus. According to phylogenetic calculations, it clustered to genus Atadenovirus in contrast with all other chelonian adenoviruses described to date. The present report details the pathologic findings associated with an adenovirus infection restricted to the upper digestive tract. PMID:27486139

  14. Loss of White Adipose Hyperplastic Potential Is Associated with Enhanced Susceptibility to Insulin Resistance

    PubMed Central

    Kim, Soo M.; Lun, Mingyue; Wang, Mei; Senyo, Samuel E.; Guillermier, Christelle; Patwari, Parth; Steinhauser, Matthew L.

    2016-01-01

    SUMMARY Fat mass expansion occurs by adipocyte hypertrophy or recruitment of differentiating adipocyte progenitors, the relative balance of which may impact systemic metabolism. We measured adipogenesis in murine subcutaneous (sWAT) and visceral white adipose tissue (vWAT) using stable isotope methodology and then modeled adipocyte turnover. Birth and death rates were similar within depots; however, turnover was higher in vWAT relative to sWAT. In juvenile mice, obesity increased adipogenesis, but in adults, this was only seen in vWAT after prolonged high-fat feeding. Statistical modeling suggests differentiation of adipocyte progenitors without an accompanying self-renewing division step may partially explain the age-dependent decline in hyperplastic potential. Additional metabolic interrogation of obese mice demonstrated an association between adipocyte turnover and insulin sensitivity. These data therefore identify adipocyte hypertrophy as the dominant mechanism of adult fat mass expansion and support the paradoxical concept that metabolic disease ensues due to a failure of adipose tissue plasticity. PMID:25456741

  15. Prostate stem cell antigen vaccination induces a long-term protective immune response against prostate cancer in the absence of autoimmunity.

    PubMed

    Garcia-Hernandez, Maria de la Luz; Gray, Andrew; Hubby, Bolyn; Klinger, Otto J; Kast, W Martin

    2008-02-01

    Prostate stem cell antigen (PSCA) is an attractive antigen to target using therapeutic vaccines because of its overexpression in prostate cancer, especially in metastatic tissues, and its limited expression in other organs. Our studies offer the first evidence that a PSCA-based vaccine can induce long-term protection against prostate cancer development in prostate cancer-prone transgenic adenocarcinoma mouse prostate (TRAMP) mice. Eight-week-old TRAMP mice displaying prostate intraepithelial neoplasia were vaccinated with a heterologous prime/boost strategy consisting of gene gun-delivered PSCA-cDNA followed by Venezuelan equine encephalitis virus replicons encoding PSCA. Our results show the induction of an immune response against a newly defined PSCA epitope that is mediated primarily by CD8 T cells. The prostates of PSCA-vaccinated mice were infiltrated by CD4-positive, CD8-positive, CD11b-positive, and CD11c-positive cells. Vaccination induced MHC class I expression and cytokine production [IFN-gamma, tumor necrosis factor-alpha, interleukin 2 (IL-2), IL-4, and IL-5] within prostate tumors. This tumor microenvironment correlated with low Gleason scores and weak PSCA staining on tumor cells present in hyperplastic zones and in areas that contained focal and well-differentiated adenocarcinomas. PSCA-vaccinated TRAMP mice had a 90% survival rate at 12 months of age. In contrast, all control mice had succumbed to prostate cancer or had heavy tumor loads. Crucially, this long-term protective immune response was not associated with any measurable induction of autoimmunity. The possibility of inducing long-term protection against prostate cancer by vaccination at the earliest signs of its development has the potential to cause a dramatic paradigm shift in the treatment of this disease. PMID:18245488

  16. Antagonistic effect of Lepidium meyenii (red maca) on prostatic hyperplasia in adult mice.

    PubMed

    Gonzales, G F; Gasco, M; Malheiros-Pereira, A; Gonzales-Castañeda, C

    2008-06-01

    The plants from the Lepidium gender have demonstrated to have effect on the size of the prostate. Lepidium meyenii (Maca) is a Peruvian plant that grows exclusively over 4000 m above sea level. The present study was designed to determine the effect of red maca (RM) in the prostate hyperplasia induced with testosterone enanthate (TE) in adult mice. Prostate hyperplasia was induced by administering TE, and then these animals (n = 6, each group) were treated with RM or Finasteride (positive control) for 21 days. There was an additional group without prostate hyperplasia (vehicle). Mice were killed on days 7, 14 and 21 after treatment with RM. Testosterone and oestradiol levels were measured on the last day of treatment. Prostatic stroma, epithelium and acini were measured histologically. RM reduced prostate weight at 21 days of treatment. Weights of seminal vesicles, testis and epididymis were not affected by RM treatment. The reduction in prostate size by RM was 1.59 times. Histological analysis showed that TE increased 2-fold the acinar area, effect prevented in the groups receiving TE + RM for 14 (P < 0.05) and 21 (P < 0.05) days and the group receiving TE + Finasteride for 21 days (P < 0.05). TE increased prostatic stroma area and this effect was prevented by treatment with RM since 7 days of treatment or Finasteride. The reduction in prostatic stroma area by RM was 1.42 times. RM has an anti-hyperplastic effect on the prostate of adult mice when hyperplasia was induced with TE acting first at prostatic stromal level. PMID:18477205

  17. Biochemical signatures of in vitro radiation response in human lung, breast and prostate tumour cells observed with Raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Matthews, Q.; Jirasek, A.; Lum, J. J.; Brolo, A. G.

    2011-11-01

    This work applies noninvasive single-cell Raman spectroscopy (RS) and principal component analysis (PCA) to analyze and correlate radiation-induced biochemical changes in a panel of human tumour cell lines that vary by tissue of origin, p53 status and intrinsic radiosensitivity. Six human tumour cell lines, derived from prostate (DU145, PC3 and LNCaP), breast (MDA-MB-231 and MCF7) and lung (H460), were irradiated in vitro with single fractions (15, 30 or 50 Gy) of 6 MV photons. Remaining live cells were harvested for RS analysis at 0, 24, 48 and 72 h post-irradiation, along with unirradiated controls. Single-cell Raman spectra were acquired from 20 cells per sample utilizing a 785 nm excitation laser. All spectra (200 per cell line) were individually post-processed using established methods and the total data set for each cell line was analyzed with PCA using standard algorithms. One radiation-induced PCA component was detected for each cell line by identification of statistically significant changes in the PCA score distributions for irradiated samples, as compared to unirradiated samples, in the first 24-72 h post-irradiation. These RS response signatures arise from radiation-induced changes in cellular concentrations of aromatic amino acids, conformational protein structures and certain nucleic acid and lipid functional groups. Correlation analysis between the radiation-induced PCA components separates the cell lines into three distinct RS response categories: R1 (H460 and MCF7), R2 (MDA-MB-231 and PC3) and R3 (DU145 and LNCaP). These RS categories partially segregate according to radiosensitivity, as the R1 and R2 cell lines are radioresistant (SF2 > 0.6) and the R3 cell lines are radiosensitive (SF2 < 0.5). The R1 and R2 cell lines further segregate according to p53 gene status, corroborated by cell cycle analysis post-irradiation. Potential radiation-induced biochemical response mechanisms underlying our RS observations are proposed, such as (1) the regulated

  18. Novel C-4 heteroaryl 13-cis-retinamide Mnk/AR degrading agents inhibit cell proliferation and migration and induce apoptosis in human breast and prostate cancer cells and suppress growth of MDA-MB-231 human breast and CWR22Rv1 human prostate tumor xenografts in mice.

    PubMed

    Mbatia, Hannah W; Ramalingam, Senthilmurugan; Ramamurthy, Vidya P; Martin, Marlena S; Kwegyir-Afful, Andrew K; Njar, Vincent C O

    2015-02-26

    The synthesis and in vitro and in vivo antibreast and antiprostate cancers activities of novel C-4 heteroaryl 13-cis-retinamides that modulate Mnk-eIF4E and AR signaling are discussed. Modifications of the C-4 heteroaryl substituents reveal that the 1H-imidazole is essential for high anticancer activity. The most potent compounds against a variety of human breast and prostate cancer (BC/PC) cell lines were compounds 16 (VNHM-1-66), 20 (VNHM-1-81), and 22 (VNHM-1-73). In these cell lines, the compounds induce Mnk1/2 degradation to substantially suppress eIF4E phosphorylation. In PC cells, the compounds induce degradation of both full-length androgen receptor (fAR) and splice variant AR (AR-V7) to inhibit AR transcriptional activity. More importantly, VNHM-1-81 has strong in vivo antibreast and antiprostate cancer activities, while VNHM-1-73 exhibited strong in vivo antibreast cancer activity, with no apparent host toxicity. Clearly, these lead compounds are strong candidates for development for the treatments of human breast and prostate cancers. PMID:25634130

  19. Potent increased risk of the initiation of DNA replication in human prostate cancer with the use of 5α-reductase inhibitors

    PubMed Central

    Kosaka, Takeo; Yasumizu, Yota; Miyazaki, Yasumasa; Miyajima, Akira; Kikuchi, Eiji; Oya, Mototsugu

    2014-01-01

    Recent clinical studies have raised the clinically important question of the relationship between dihydrotestosterone (DHT) and prostate cancer (PCa) progression. The significance of DHT or 5α-reductase inhibitors (5ARI) in PCa development and progression has not yet been fully characterized. The aim of this study was to determine whether the initiation of DNA replication was influenced by DHT in PCa. Three cell lines were used. LNCaP: a human PCa cell line that exhibits androgen-dependent proliferation, C4-2: a human PCa cell line that exhibits androgen-independent proliferation, and C4-2AT6: a castration resistant prostate cancer cell line. Two 5ARIs, finasteride and dutasteride, were used. We examined the mRNA expression of the components of pre-replication complex (Pre-RC), CDC6, CDT1, and MCM2-7. DHT induced cell proliferation of LNCaP accompanied by significantly increased CDC6, CDT1, and MCM2-7 expression. In contrast to LNCaP, DHT inhibited cell proliferation in C4-2AT6 cells accompanied by decreased expression of CDC6, CDT1, and MCM2-7. These reverse effects resemble the effects of 5ARIs in Pre-RC. Treatment with finasteride or dutasteride inhibited CDC6 expression in LNCaP, but both 5ARIs induced CDC6 expression in C4-2 and C4-2AT6 cells.These results indicate that DHT showed reversal effects on PCa cell proliferation among prostate cancer cells based on androgen-dependence, accompanied by regulation of the initiation of DNA replication. 5ARIs may modulate the DNA replication system in someaggressive PCa through up-regulation of CDC6 expression. PMID:25374915

  20. Expression and functional analysis of voltage-activated Na+ channels in human prostate cancer cell lines and their contribution to invasion in vitro.

    PubMed Central

    Laniado, M. E.; Lalani, E. N.; Fraser, S. P.; Grimes, J. A.; Bhangal, G.; Djamgoz, M. B.; Abel, P. D.

    1997-01-01

    Ion channels are important for many cellular functions and disease states including cystic fibrosis and multidrug resistance. Previous work in the Dunning rat model of prostate cancer has suggested a relationship between voltage-activated Na+ channels (VASCs) and the invasive phenotype in vitro. The objectives of this study were to 1) evaluate the expression of VASCs in the LNCaP and PC-3 human prostate cancer cell lines by Western blotting, flow cytometry, and whole-cell patch clamping, 2) determine their role in invasion in vitro using modified Boyden chambers with and without a specific blocker of VASCs (tetrodotoxin). A 260-kd protein representing VASCs was found only in the PC-3 cell line, and these were shown to be membrane expressed on flow cytometry. Patch clamping studies indicated that functional VASCs were present in 10% of PC-3 cells and blocking these by tetrodotoxin (600 nmol/L) reduced their invasiveness by 31% (P = 0.02) without affecting the invasiveness of the LNCaP cells. These results indicate that the reduction of invasion is a direct result of VASC blockade and not a nonspecific action of the drug. This is the first report of VASCs in a human prostatic cell line. VASCs are present in PC-3 but not LNCaP cells as determined by both protein and functional studies. Tetrodotoxin reduced the invasiveness of PC-3 but not LNCaP cells, and these data suggest that ion channels may play an important functional role in tumor invasion. Images Figure 1 PMID:9094978

  1. Hepatocyte growth factor increases the invasive potential of PC-3 human prostate cancer cells via an ERK/MAPK and Zeb-1 signaling pathway

    PubMed Central

    HAN, YILI; LUO, YONG; WANG, YONGXING; CHEN, YATONG; LI, MINGCHUAN; JIANG, YONGGUANG

    2016-01-01

    Hepatocyte growth factor (HGF) has been implicated in epithelial-mesenchymal transition (EMT) in numerous types of cancer. However, to the best of our knowledge, there has been no previous evidence that HGF has a role in prostate cancer. The present study aimed to investigate the effect of HGF on EMT and invasive potential, as well as the underlying molecular mechanisms, in a human prostate cancer cell line. Therefore, PC-3 cells were treated with various concentrations of HGF for varying durations. EMT-associated proteins, including E-cadherin and vimentin, were examined by western blot analysis. The effects of HGF on cell proliferation, migration, invasion and tumorigenicity were assessed using MTT, wound-healing, Transwell and soft-agar assays. Subsequently, the role of c-Met in the mediation of EMT-like changes was investigated using reverse transcription-polymerase chain reaction, western blot analysis and gene knockdown by small interfering RNA. Finally, western blot analysis was used to quantify the expression of a downstream transcription factor and extracellular signal-related kinase/mitogen activated protein kinase (ERK/MAPK) signaling pathway proteins. The results indicated that treatment with HGF induced EMT-like changes and enhanced the invasive potential of PC-3 cells. There was an increase in the expression of ERK, phosphorylated-ERK and zinc finger E-box binding homeobox-1 (Zeb-1), suggesting that EMT-like changes may be mediated through the ERK/MAPK and Zeb-1 signaling pathway. Furthermore, HGF-mediated EMT-like changes were associated with c-Met activation, and these changes were able to be blocked by c-Met knockdown. The present study demonstrated that HGF-induced EMT increased the invasive potential of PC-3 human prostate cancer cells through activating the ERK/MAPK and Zeb-1 signaling pathway. PMID:26870279

  2. Potent increased risk of the initiation of DNA replication in human prostate cancer with the use of 5α-reductase inhibitors.

    PubMed

    Kosaka, Takeo; Yasumizu, Yota; Miyazaki, Yasumasa; Miyajima, Akira; Kikuchi, Eiji; Oya, Mototsugu

    2014-01-01

    Recent clinical studies have raised the clinically important question of the relationship between dihydrotestosterone (DHT) and prostate cancer (PCa) progression. The significance of DHT or 5α-reductase inhibitors (5ARI) in PCa development and progression has not yet been fully characterized. The aim of this study was to determine whether the initiation of DNA replication was influenced by DHT in PCa. Three cell lines were used. LNCaP: a human PCa cell line that exhibits androgen-dependent proliferation, C4-2: a human PCa cell line that exhibits androgen-independent proliferation, and C4-2AT6: a castration resistant prostate cancer cell line. Two 5ARIs, finasteride and dutasteride, were used. We examined the mRNA expression of the components of pre-replication complex (Pre-RC), CDC6, CDT1, and MCM2-7. DHT induced cell proliferation of LNCaP accompanied by significantly increased CDC6, CDT1, and MCM2-7 expression. In contrast to LNCaP, DHT inhibited cell proliferation in C4-2AT6 cells accompanied by decreased expression of CDC6, CDT1, and MCM2-7. These reverse effects resemble the effects of 5ARIs in Pre-RC. Treatment with finasteride or dutasteride inhibited CDC6 expression in LNCaP, but both 5ARIs induced CDC6 expression in C4-2 and C4-2AT6 cells.These results indicate that DHT showed reversal effects on PCa cell proliferation among prostate cancer cells based on androgen-dependence, accompanied by regulation of the initiation of DNA replication. 5ARIs may modulate the DNA replication system in someaggressive PCa through up-regulation of CDC6 expression. PMID:25374915

  3. Diallyl trisulfide, a constituent of processed garlic, inactivates Akt to trigger mitochondrial translocation of BAD and caspase-mediated apoptosis in human prostate cancer cells.

    PubMed

    Xiao, Dong; Singh, Shivendra V

    2006-03-01

    We have shown previously that apoptosis induction by diallyl trisulfide (DATS), a constituent of processed garlic, in PC-3 and DU145 human prostate cancer cells is associated with c-Jun N-terminal kinase and extracellular signal-regulated kinase-mediated phosphorylation of Bcl-2. However, pharmacological inhibition of these kinases offers only partial protection against the cell death caused by DATS. Here, we demonstrate that DATS inactivates Akt to trigger apoptosis in prostate cancer cells. Treatment of PC-3/DU145 cells with apoptosis inducing concentration of DATS (40 microM) resulted in a rapid decrease in Ser(473) and Thr(308) phosphorylation of Akt leading to inhibition of its kinase activity. The DATS-mediated inactivation of Akt was associated with downregulation of insulin-like growth factor receptor 1 protein level and inhibition of its autophosphorylation. DATS treatment (40 microM) also caused a decrease in Ser(155) and Ser(136) phosphorylation of BAD (a proapoptotic protein), which is a downstream target of Akt. Phosphorylation sequesters BAD in the cytoplasm owing to increased binding with 14-3-3 proteins. The interaction between BAD and 14-3-3beta was reduced markedly upon a 4 h treatment with 40 microM DATS in both cell lines. Consistent with these results, DATS treatment (40 microM, 4 h) promoted mitochondrial translocation of BAD as revealed by immunocytochemistry. Ectopic expression of constitutively active Akt conferred statistically significant protection against DATS-induced apoptosis. The DATS-induced apoptosis in both cell lines was significantly attenuated in the presence of pan caspase inhibitor zVAD-fmk and caspase 9 specific inhibitor zLEHD-fmk. In conclusion, the present study demonstrates that DATS-induced apoptosis in human prostate cancer cells is mediated, at least in part, by inactivation of Akt signaling axis. PMID:16169930

  4. Combination of α-Tomatine and Curcumin Inhibits Growth and Induces Apoptosis in Human Prostate Cancer Cells.

    PubMed

    Huang, Huarong; Chen, Xuan; Li, Dongli; He, Yan; Li, Yu; Du, Zhiyun; Zhang, Kun; DiPaola, Robert; Goodin, Susan; Zheng, Xi

    2015-01-01

    α-Tomatine is a glycoalkaloid found in tomatoes and curcumin is a major yellow pigment of turmeric. In the present study, the combined effect of these two compounds on prostate cancer cells was studied. Treatment of different prostate cancer cells with curcumin or α-tomatine alone resulted in growth inhibition and apoptosis in a concentration-dependent manner. Combinations of α-tomatine and curcumin synergistically inhibited the growth and induced apoptosis in prostate cancer PC-3 cells. Effects of the α-tomatine and curcumin combination were associated with synergistic inhibition of NF-κB activity and a potent decrease in the expression of its downstream gene Bcl-2 in the cells. Moreover, strong decreases in the levels of phospho-Akt and phosphor-ERK1/2 were found in PC-3 cells treated with α-tomatine and curcumin in combination. In animal experiment, SCID mice with PC-3 xenograft tumors were treated with α-tomatine and curcumin. Combination of α-tomatine and curcumin more potently inhibited the growth of PC-3 tumors than either agent alone. Results from the present study indicate that α-tomatine in combination with curcumin may be an effective strategy for inhibiting the growth of prostate cancer. PMID:26630272

  5. Combination of α-Tomatine and Curcumin Inhibits Growth and Induces Apoptosis in Human Prostate Cancer Cells

    PubMed Central

    Li, Dongli; He, Yan; Li, Yu; Du, Zhiyun; Zhang, Kun; DiPaola, Robert; Goodin, Susan; Zheng, Xi

    2015-01-01

    α-Tomatine is a glycoalkaloid found in tomatoes and curcumin is a major yellow pigment of turmeric. In the present study, the combined effect of these two compounds on prostate cancer cells was studied. Treatment of different prostate cancer cells with curcumin or α-tomatine alone resulted in growth inhibition and apoptosis in a concentration-dependent manner. Combinations of α-tomatine and curcumin synergistically inhibited the growth and induced apoptosis in prostate cancer PC-3 cells. Effects of the α-tomatine and curcumin combination were associated with synergistic inhibition of NF-κB activity and a potent decrease in the expression of its downstream gene Bcl-2 in the cells. Moreover, strong decreases in the levels of phospho-Akt and phosphor-ERK1/2 were found in PC-3 cells treated with α-tomatine and curcumin in combination. In animal experiment, SCID mice with PC-3 xenograft tumors were treated with α-tomatine and curcumin. Combination of α-tomatine and curcumin more potently inhibited the growth of PC-3 tumors than either agent alone. Results from the present study indicate that α-tomatine in combination with curcumin may be an effective strategy for inhibiting the growth of prostate cancer. PMID:26630272

  6. Lycopene and apo-12'-lycopenal reduce cell proliferation and alter cell cycle progression in human prostate cancer cells.

    PubMed

    Ford, Nikki A; Elsen, Amy C; Zuniga, Krystle; Lindshield, Brian L; Erdman, John W

    2011-01-01

    Lycopene is associated with a reduced risk of prostate cancer. However, lycopene may not be wholly responsible for the effects seen in vivo or in cell culture systems. Apo-lycopenals or other lycopene metabolites, whether produced by cleavage enzymes within the body or consumed with tomato products, can be found in tissues at concentrations equivalent to physiological retinoid concentrations. Therefore, it is plausible that lycopenoids, like retinoids, are bioactive within tissues. Androgen-independent DU145 prostate cancer cells were treated with lycopene, apo-8'-lycopenal, or apo-12'-lycopenal. DU145 cell proliferation was significantly reduced by supra-physiological levels of lycopene and apo-12'-lycopenal, in part, through alteration of the normal cell cycle. Levels of the gap junction protein, connexin 43, were unaltered by lycopene or apo-lycopenal treatment while cell apoptosis rates significantly decreased. We further confirmed that connexin 43 protein levels were unaltered by lycopene treatment in mouse embryonic fibroblasts, or in Dunning R3327-H rat prostate tumor. The present data indicate that lycopene and apo-12'-lycopenal reduce the proliferation of prostate cancer cells, in part, by inhibiting normal cell cycle progression. PMID:21207319

  7. Automatic classification of prostate stromal tissue in histological images using Haralick descriptors and Local Binary Patterns

    NASA Astrophysics Data System (ADS)

    Oliveira, D. L. L.; Nascimento, M. Z.; Neves, L. A.; Batista, V. R.; Godoy, M. F.; Jacomini, R. S.; Duarte, Y. A. S.; Arruda, P. F. F.; Neto, D. S.

    2014-03-01

    In this paper we presente a classification system that uses a combination of texture features from stromal regions: Haralick features and Local Binary Patterns (LBP) in wavelet domain. The system has five steps for classification of the tissues. First, the stromal regions were detected and extracted using segmentation techniques based on thresholding and RGB colour space. Second, the Wavelet decomposition was applied in the extracted regions to obtain the Wavelet coefficients. Third, the Haralick and LBP features were extracted from the coefficients. Fourth, relevant features were selected using the ANOVA statistical method. The classication (fifth step) was performed with Radial Basis Function (RBF) networks. The system was tested in 105 prostate images, which were divided into three groups of 35 images: normal, hyperplastic and cancerous. The system performance was evaluated using the area under the ROC curve and resulted in 0.98 for normal versus cancer, 0.95 for hyperplasia versus cancer and 0.96 for normal versus hyperplasia. Our results suggest that texture features can be used as discriminators for stromal tissues prostate images. Furthermore, the system was effective to classify prostate images, specially the hyperplastic class which is the most difficult type in diagnosis and prognosis.

  8. Acoustic Cluster Therapy (ACT) enhances the therapeutic efficacy of paclitaxel and Abraxane® for treatment of human prostate adenocarcinoma in mice.

    PubMed

    van Wamel, Annemieke; Sontum, Per Christian; Healey, Andrew; Kvåle, Svein; Bush, Nigel; Bamber, Jeffrey; de Lange Davies, Catharina

    2016-08-28

    Acoustic cluster therapy (ACT) is a novel approach for ultrasound mediated, targeted drug delivery. In the current study, we have investigated ACT in combination with paclitaxel and Abraxane® for treatment of a subcutaneous human prostate adenocarcinoma (PC3) in mice. In combination with paclitaxel (12mg/kg given i.p.), ACT induced a strong increase in therapeutic efficacy; 120days after study start, 42% of the animals were in stable, complete remission vs. 0% for the paclitaxel only group and the median survival was increased by 86%. In combination with Abraxane® (12mg paclitaxel/kg given i.v.), ACT induced a strong increase in the therapeutic efficacy; 60days after study start 100% of the animals were in stable, remission vs. 0% for the Abraxane® only group, 120days after study start 67% of the animals were in stable, complete remission vs. 0% for the Abraxane® only group. For the ACT+Abraxane group 100% of the animals were alive after 120days vs. 0% for the Abraxane® only group. Proof of concept for Acoustic Cluster Therapy has been demonstrated; ACT markedly increases the therapeutic efficacy of both paclitaxel and Abraxane® for treatment of human prostate adenocarcinoma in mice. PMID:27297780

  9. New steroidal 17β-carboxy derivatives present anti-5α-reductase activity and anti-proliferative effects in a human androgen-responsive prostate cancer cell line.

    PubMed

    Amaral, Cristina; Varela, Carla; Correia-da-Silva, Georgina; Tavares da Silva, Elisiário; Carvalho, Rui A; Costa, Saul C P; Cunha, Sara C; Fernandes, José O; Teixeira, Natércia; Roleira, Fernanda M F

    2013-11-01

    The androgens testosterone (T) and dihydrotestosterone (DHT), besides playing an important role in prostate development and growth, are also responsible for the development and progression of benign prostate hyperplasia (BPH) and prostate cancer. Therefore, the actions of these hormones can be antagonized by preventing the irreversible conversion of T into DHT by inhibiting 5α-reductase (5α-R). This has been a useful therapeutic approach for the referred diseases and can be achieved by using 5α-reductase inhibitors (RIs). Steroidal RIs, finasteride and dutasteride, are used in clinic for BPH treatment and were also proposed for chemoprevention of prostate cancer. Nevertheless, due to the increase in bone and muscle loss, impotency and occurrence of high-grade prostate tumours, it is important to seek for other potent and specific molecules with lower side effects. In the present work, we designed and synthesized steroids with the 3-keto-Δ(4) moiety in the A-ring, as in the 5α-R substrate T, and with carboxamide, carboxyester or carboxylic acid functions at the C-17β position. The inhibitory 5α-R activity, in human prostate microsomes, as well as the anti-proliferative effects of the most potent compounds, in a human androgen-responsive prostate cancer cell line (LNCaP cells), were investigated. Our results showed that steroids 3, 4 and 5 are good RIs, which suggest that C-17β lipophylic amides favour 5α-R inhibition. Moreover, these steroids induce a decrease in cell viability of stimulated LNCaP cells, in a 5α-R dependent-manner, similarly to finasteride. PMID:23933094

  10. Silibinin inhibits fibronectin induced motility, invasiveness and survival in human prostate carcinoma PC3 cells via targeting integrin signaling.

    PubMed

    Deep, Gagan; Kumar, Rahul; Jain, Anil K; Agarwal, Chapla; Agarwal, Rajesh

    2014-10-01

    Prostate cancer (PCA) is the 2nd leading cause of cancer-related deaths among men in the United States. Preventing or inhibiting metastasis-related events through non-toxic agents could be a useful approach for lowering high mortality among PCA patients. We have earlier reported that natural flavonoid silibinin possesses strong anti-metastatic efficacy against PCA however, mechanism/s of its action still remains largely unknown. One of the major events during metastasis is the replacement of cell-cell interaction with integrins-based cell-matrix interaction that controls motility, invasiveness and survival of cancer cells. Accordingly, here we examined silibinin effect on advanced human PCA PC3 cells' interaction with extracellular matrix component fibronectin. Silibinin (50-200 μM) treatment significantly decreased the fibronectin (5 μg/ml)-induced motile morphology via targeting actin cytoskeleton organization in PC3 cells. Silibinin also decreased the fibronectin-induced cell proliferation and motility but significantly increased cell death in PC3 cells. Silibinin also inhibited the PC3 cells invasiveness in Transwell invasion assays with fibronectin or cancer associated fibroblasts (CAFs) serving as chemoattractant. Importantly, PC3-luc cells cultured on fibronectin showed rapid dissemination and localized in lungs following tail vein injection in athymic male nude mice; however, in silibinin-treated PC3-luc cells, dissemination and lung localization was largely compromised. Molecular analyses revealed that silibinin treatment modulated the fibronectin-induced expression of integrins (α5, αV, β1 and β3), actin-remodeling (FAK, Src, GTPases, ARP2 and cortactin), apoptosis (cPARP and cleaved caspase 3), EMT (E-cadherin and β-catenin), and cell survival (survivin and Akt) related signaling molecules in PC3 cells. Furthermore, PC3-xenograft tissue analyses confirmed the inhibitory effect of silibinin on fibronectin and integrins expression. Together, these

  11. High-Dose-Rate Endobronchial Brachytherapy for Recurrent Airway Obstruction From Hyperplastic Granulation Tissue

    SciTech Connect

    Tendulkar, Rahul D. Fleming, Peter A.; Reddy, Chandana A.; Gildea, Thomas R.; Machuzak, Michael; Mehta, Atul C.

    2008-03-01

    Purpose: Benign endobronchial granulation tissue causes airway obstruction in up to 20% of patients after lung transplantation or stent placement. High-dose-rate endobronchial brachytherapy (HDR-EB) has been successful in some cases refractory to standard bronchoscopic interventions. Methods and Materials: Between September 2004 and May 2005, 8 patients with refractory benign airway obstruction were treated with HDR-EB, using one to two fractions of Ir-192 prescribed to 7.1 Gy at a radius of 1 cm. Charts were retrospectively reviewed to evaluate subjective clinical response, forced expiratory volume in 1 second (FEV{sub 1}), and frequency of therapeutic bronchoscopies over 6-month periods before and after HDR-EB. Results: The median follow-up was 14.6 months, and median survival was 10.5 months. The mean number of bronchoscopic interventions improved from 3.1 procedures in the 6-month pretreatment period to 1.8 after HDR-EB. Mean FEV{sub 1} improved from 36% predicted to 46% predicted. Six patients had a good-to-excellent subjective early response, but only one maintained this response beyond 6 months, and this was the only patient treated with HDR-EB within 24 h from the most recent bronchoscopic intervention. Five patients have expired from causes related to their chronic pulmonary disease, including one from hemoptysis resulting from a bronchoarterial fistula. Conclusion: High-dose-rate-EB may be an effective treatment for select patients with refractory hyperplastic granulation tissue causing recurrent airway stenosis. Performing HDR-EB within 24-48 h after excision of obstructive granulation tissue could further improve outcomes. Careful patient selection is important to maximize therapeutic benefit and minimize toxicity. The optimal patient population, dose, and timing of HDR-EB should be investigated prospectively.

  12. Varied manifestations of persistent hyperplastic primary vitreous with graded somatic mosaic deletion of a single gene

    PubMed Central

    Mary-Sinclair, Michelle N.; Wang, XiaoFei; Swanson, Douglas J.; Sung, Caroline Y.; Mendonca, Eneida A.; Wroblewski, Kristen; Baumer, Shannon H.; Goldowitz, Dan; Jablonski, Monica M.

    2014-01-01

    Purpose Persistent hyperplastic primary vitreous (PHPV) represents a developmental eye disease known to have diverse manifestations ranging from a trivial remnant of hyaloid vessels to a dense fibrovascular mass causing lens opacity and retinal detachment. PHPV can be modeled in mice lacking individual genes, but certain features of such models differ from the clinical realm. For example, mice lacking the Arf gene have uniformly severe disease with consistent autosomal recessive disease penetrance. We tested whether the graded somatic loss of Arf in a subset of cells in chimeric mice mimics the range of disease in a non-heritable manner. Methods Wild type ↔ Arf −/− mouse chimeras were generated by morulae fusion, and when the mice were 10 weeks old, fundoscopic, slit-lamp, and histological evaluations were performed. The relative fraction of cells of the Arf −/− lineage was assessed with visual, molecular genetic, and histological analysis. Objective quantification of various aspects of the phenotype was correlated with the genotype. Results Sixteen chimeras were generated and shown to have low, medium, and high contributions of Arf −/− cells to tail DNA, the cornea, and the retinal pigment epithelium (RPE), with excellent correlation between chimerism in the tail DNA and the RPE. Phenotypic differences (coat color and severity of eye disease) were evident, objectively quantified, and found to correlate with the contribution of Arf −/− cells to the RPE and tail-derived DNA, but not the cornea. Conclusions Generating animals composed of different numbers of Arf −/− cells mimicked the range of disease severity observed in patients with PHPV. This establishes the potential for full manifestations of PHPV to be caused by somatic mutations of a single gene during development. PMID:24623965

  13. Classification and surgical treatment for 180 cases of adrenocortical hyperplastic disease

    PubMed Central

    Zhang, Yushi; Li, Hanzhong

    2015-01-01

    Objective: To review and discuss the diagnostic and surgical therapeutic methods of adrenocortical hyperplastic disease. Methods: A retrospective analysis was done to 180 adrenocortical hyperplasia patients (74 males, 109 females, aged 6~76 (average 40.1). Studies were done to the relationship between patients’ clinical characteristics, biochemical, endocrinological and imaging examination results, the therapeutic effects. Results: Among all 180 cases, there are 107 Cushing disease (CD), 19 ectopic adrenocorticotropin adrenal hyperplasia (EAAH), 28 adrenocorticotropin independent macronodular adrenal hyperplasia (AIMAH), 4 primary pigmented nodular adrenocortical hyperplasia (PPNAH), and 28 Idiopathic Hyperaldosteronism (IHA). Twenty-four-hour urinary free cortisol (24 h UFC) excretion of CD, EAAH, AIMAH and PPNAH patients were 95.2~535.7 µg (average 287.6 µg), 24.8~808.2 µg (average 307.9 µg), 102.5~3127.0 µg (average 852.5 µg), and 243.8~1124.6 µg (average 564.3 µg). Both low and high-dose dexamethasone suppression tests (DDST) were not suppressed in AIMAH, PPNAH and EAAH groups, but HDDST was suppressed in CD group. CT thin scanning results of 180 patients all showed enlargements in the affected side adrenal gland. Unilateral adrenalectomies were performed in 102 hypercortisolism cases. Local lesion excisions were done to 21 IHA patients. 57 patients had surgeries in both sides of the adrenal glands (39 bilateral total adrenalectomies, 16 total adrenalectomy in one side andsubtotal adrenalectomy in the other, 2 bilateral subtotal adrenalectomies). 106 (59%) patients were followed up for 4~158 (average 32) months. Conclusion: Unilateral adrenalectomy was the first choice for operable adrenocortical hyperplasia patients. The operation mode for the other adrenal gland should be based on the type of hyperplasia and clinical observation. PMID:26770569

  14. Prostate cancer progression. Implications of histopathology.

    PubMed Central

    Ware, J. L.

    1994-01-01

    This review examines selected areas of contemporary prostate cancer research in terms of the impact of prostatic cellular and histopathological heterogeneity. Prostate tumor progression is accompanied by dysregulation of multiple growth factor networks as well as disruption of normal patterns of cell-cell interactions. Molecular and cytogenetic studies demonstrate that prostate cancer results from the accumulation of several different genetic defects. No single event predominates, but modifications in tumor suppressor genes or functional elimination of the suppressor gene product are more common than activation of known oncogenes. Intratumor heterogeneity is also detectable at the genetic level. This further complicates efforts to correlate modifications at specific loci with progression or outcome. The development of new in vitro and in vivo systems for the study of human prostate cancer should increase our understanding of this complex disease. In each approach, knowledge of the histopathology of the normal and neoplastic prostate is essential. PMID:7977655

  15. Differential expression of estrogen-related receptors beta and gamma (ERRbeta and ERRgamma) and their clinical significance in human prostate cancer.

    PubMed

    Fujimura, Tetsuya; Takahashi, Satoru; Urano, Tomohiko; Ijichi, Nobuhiro; Ikeda, Kazuhiro; Kumagai, Jinpei; Murata, Taro; Takayama, Kenichi; Horie-Inoue, Kuniko; Ouchi, Yasuyoshi; Muramatsu, Masami; Homma, Yukio; Inoue, Satoshi

    2010-03-01

    Estrogen-related receptor (ERR) is a nuclear receptor that modulates the estrogen-signaling pathway. Here, we investigated the expression of both ERRbeta and ERRgamma in human prostate tissues. Using original rabbit polyclonal anti-ERRbeta and anti-ERRgamma antibodies, the expression of ERRbeta and ERRgamma was evaluated by immunohistochemical analysis of cancerous lesions (n = 107) and benign foci (n = 92), obtained by radical prostatectomy. Stained slides were evaluated for the proportion of immunoreactive cells and their staining intensity. Total immunoreactivity scores (IR scores; range, 0-8) were calculated as the sum of the proportion and intensity scores. The relationship between the clinicopathological characteristics of the patients and the expression of the three ERRs (ERRalpha, ERR beta, and ERR gamma) was evaluated. IR scores for ERRbeta and ERRgamma were significantly lower in cancerous lesions than that in benign foci (P < 0.0001, for both). Clinicopathological analyses revealed that the patients with low ERRgamma IR scores (prostate tissue. The combined evaluation of the expression of ERRalpha and ERRgamma could be a significant prognostic factor for prostate cancer. PMID:20128821

  16. Induction of apoptosis and autophagy via sirtuin1- and PI3K/Akt/mTOR-mediated pathways by plumbagin in human prostate cancer cells

    PubMed Central

    Zhou, Zhi-Wei; Li, Xing-Xiao; He, Zhi-Xu; Pan, Shu-Ting; Yang, Yinxue; Zhang, Xueji; Chow, Kevin; Yang, Tianxin; Qiu, Jia-Xuan; Zhou, Qingyu; Tan, Jun; Wang, Dong; Zhou, Shu-Feng

    2015-01-01

    Plumbagin (PLB) has been shown to have anticancer activities in animal models, but the role of PLB in prostate cancer treatment is unclear. This study aimed to investigate the effects of PLB on apoptosis and autophagy and the underlying mechanisms in human prostate cancer cell lines PC-3 and DU145. Our study has shown that PLB had potent pro-apoptotic and pro-autophagic effects on PC-3 and DU145 cells. PLB induced mitochondria-mediated apoptosis and autophagy in concentration- and time-dependent manners in both PC-3 and DU145 cells. PLB induced inhibition of phosphatidylinositol 3-kinase (PI3K)/protein kinase B (Akt)/mammalian target of rapamycin (mTOR) and p38 mitogen-activated protein kinase (MAPK) pathways and activation of 5′-AMP-dependent kinase (AMPK) as indicated by their altered phosphorylation, contributing to the pro-autophagic activity of PLB. Modulation of autophagy altered basal and PLB-induced apoptosis in both cell lines. Furthermore, PLB downregulated sirtuin 1 (Sirt1), and inhibition of Sirt1 enhanced autophagy, whereas the induction of Sirt1 abolished PLB-induced autophagy in PC-3 and DU145 cells. In addition, PLB downregulated pre-B cell colony-enhancing factor/visfatin, and the inhibition of pre-B cell colony-enhancing factor/visfatin significantly enhanced basal and PLB-induced apoptosis and autophagy in both cell lines. Moreover, reduction of intracellular reactive oxygen species (ROS) level attenuated the apoptosis- and autophagy-inducing effects of PLB on both PC-3 and DU145 cells. These findings indicate that PLB promotes apoptosis and autophagy in prostate cancer cells via Sirt1- and PI3K/Akt/mTOR-mediated pathways with contribution from AMPK-, p38 MAPK-, visfatin-, and ROS-associated pathways. PMID:25834399

  17. Sequence analysis of the Ras-MAPK pathway genes SOS1, EGFR & GRB2 in silver foxes (Vulpes vulpes): candidate genes for hereditary hyperplastic gingivitis.

    PubMed

    Clark, Jo-Anna B J; Tully, Sara J; Dawn Marshall, H

    2014-12-01

    Hereditary hyperplastic gingivitis (HHG) is an autosomal recessive disease that presents with progressive gingival proliferation in farmed silver foxes. Hereditary gingival fibromatosis (HGF) is an analogous condition in humans that is genetically heterogeneous with several known autosomal dominant loci. For one locus the causative mutation is in the Son of sevenless homologue 1 (SOS1) gene. For the remaining loci, the molecular mechanisms are unknown but Ras pathway involvement is suspected. Here we compare sequences for the SOS1 gene, and two adjacent genes in the Ras pathway, growth receptor bound protein 2 (GRB2) and epidermal growth factor receptor (EGFR), between HHG-affected and unaffected foxes. We conclude that the known HGF causative mutation does not cause HHG in foxes, nor do the coding regions or intron-exon boundaries of these three genes contain any candidate mutations for fox gum disease. Patterns of molecular evolution among foxes and other mammals reflect high conservation and strong functional constraints for SOS1 and GRB2 but reveal a lineage-specific pattern of variability in EGFR consistent with mutational rate differences, relaxed functional constraints, and possibly positive selection. PMID:25377643

  18. Regulation of hedgehog Ligand Expression by the N-End Rule Ubiquitin-Protein Ligase Hyperplastic Discs and the Drosophila GSK3β Homologue, Shaggy

    PubMed Central

    Moncrieff, Sophie; Moncan, Matthieu; Scialpi, Flavia; Ditzel, Mark

    2015-01-01

    Hedgehog (Hh) morphogen signalling plays an essential role in tissue development and homeostasis. While much is known about the Hh signal transduction pathway, far less is known about the molecules that regulate the expression of the hedgehog (hh) ligand itself. Here we reveal that Shaggy (Sgg), the Drosophila melanogaster orthologue of GSK3β, and the N-end Rule Ubiquitin-protein ligase Hyperplastic Discs (Hyd) act together to co-ordinate Hedgehog signalling through regulating hh ligand expression and Cubitus interruptus (Ci) expression. Increased hh and Ci expression within hyd mutant clones was effectively suppressed by sgg RNAi, placing sgg downstream of hyd. Functionally, sgg RNAi also rescued the adult hyd mutant head phenotype. Consistent with the genetic interactions, we found Hyd to physically interact with Sgg and Ci. Taken together we propose that Hyd and Sgg function to co-ordinate hh ligand and Ci expression, which in turn influences important developmental signalling pathways during imaginal disc development. These findings are important as tight temporal/spatial regulation of hh ligand expression underlies its important roles in animal development and tissue homeostasis. When deregulated, hh ligand family misexpression underlies numerous human diseases (e.g., colorectal, lung, pancreatic and haematological cancers) and developmental defects (e.g., cyclopia and polydactyly). In summary, our Drosophila-based findings highlight an apical role for Hyd and Sgg in initiating Hedgehog signalling, which could also be evolutionarily conserved in mammals. PMID:26334301

  19. Effect of Silodosin, an Alpha1A-Adrenoceptor Antagonist, on Ventral Prostatic Hyperplasia in the Spontaneously Hypertensive Rat

    PubMed Central

    Shimizu, Shogo; Shimizu, Takahiro; Tsounapi, Panagiota; Higashi, Youichirou; Martin, Darryl T.; Nakamura, Kumiko; Honda, Masashi; Inoue, Keiji; Saito, Motoaki

    2015-01-01

    Background A decreased prostatic blood flow could be one of the risk factors for benign prostatic hyperplasia/benign prostatic enlargement. The spontaneously hypertensive rat (SHR) shows a chronic prostatic ischemia and hyperplastic morphological abnormalities in the ventral prostate. The effect of silodosin, a selective alpha1A-adrenoceptor antagonist, was investigated in the SHR prostate as a prostatic hyperplasia model focusing on prostatic blood flow. Methods Twelve-week-old male SHRs were administered perorally with silodosin (100 μg/kg/day) or vehicle once daily for 6 weeks. Wistar Kyoto (WKY) rats were used as normotensive controls and were treated with the vehicle. The effect of silodosin on blood pressure and prostatic blood flow were estimated and then the prostates were removed and weighed. The tissue levels of malondialdehyde (MDA), interleukin-6 (IL-6), chemokine (C-X-C motif) ligand 1/cytokine-induced neutrophil chemoattractant 1 (CXCL1/CINC1), tumor necrosis factor-alpha (TNF-α), transforming growth factor beta 1 (TGF-β1), basic fibroblast growth factor (bFGF) and alpha-smooth muscle actin (α-SMA) were measured. The histological evaluation was also performed by hematoxylin and eosin staining. Results There was a significant increase in blood pressure, prostate weight, prostate body weight ratio (PBR), tissue levels of MDA, IL-6, CXCL1/CINC1, TNF-α, TGF-β1, bFGF and α-SMA in the SHR compared to the WKY rat. The ventral prostate in the SHR showed the morphological abnormalities compared to the WKY rat. Prostatic blood flow was decreased in the SHR. However, treatment with silodosin significantly restored the decreased prostatic blood flow in the SHR. Moreover, silodosin normalized tissue levels of MDA, IL-6, CXCL1/CINC1, TNF-α, TGF-β1, bFGF and α-SMA, and it ameliorated ventral prostatic hyperplasia in the SHR excluding blood pressure. Silodosin decreased PBR but not prostate weight in the SHR. Conclusions Silodosin can inhibit the

  20. Characterization of Heterogeneous Prostate Tumors in Targeted Pten Knockout Mice

    PubMed Central

    Korsten, Hanneke; Ziel-van der Made, Angelique C. J.; van Weerden, Wytske M.; van der Kwast, Theo; Trapman, Jan; Van Duijn, Petra W.

    2016-01-01

    Previously, we generated a preclinical mouse prostate tumor model based on PSA-Cre driven inactivation of Pten. In this model homogeneous hyperplastic prostates (4-5m) developed at older age (>10m) into tumors. Here, we describe the molecular and histological characterization of the tumors in order to better understand the processes that are associated with prostate tumorigenesis in this targeted mouse Pten knockout model. The morphologies of the tumors that developed were very heterogeneous. Different histopathological growth patterns could be identified, including intraductal carcinoma (IDC), adenocarcinoma and undifferentiated carcinoma, all strongly positive for the epithelial cell marker Cytokeratin (CK), and carcinosarcomas, which were negative for CK. IDC pattern was already detected in prostates of 7–8 month old mice, indicating that it could be a precursor stage. At more than 10 months IDC and carcinosarcoma were most frequently observed. Gene expression profiling discriminated essentially two molecular subtypes, denoted tumor class 1 (TC1) and tumor class 2 (TC2). TC1 tumors were characterized by high expression of epithelial markers like Cytokeratin 8 and E-Cadherin whereas TC2 tumors showed high expression of mesenchyme/stroma markers such as Snail and Fibronectin. These molecular subtypes corresponded with histological growth patterns: where TC1 tumors mainly represented adenocarcinoma / intraductal carcinoma, in TC2 tumors carcinosarcoma was the dominant growth pattern. Further molecular characterization of the prostate tumors revealed an increased expression of genes associated with the inflammatory response. Moreover, functional markers for senescence, proliferation, angiogenesis and apoptosis were higher expressed in tumors compared to hyperplasia. The highest expression of proliferation and angiogenesis markers was detected in TC2 tumors. Our data clearly showed that in the genetically well-defined PSA-Cre;Pten-loxP/loxP prostate tumor model

  1. Mangiferin inhibition of proliferation and induction of apoptosis in human prostate cancer cells is correlated with downregulation of B-cell lymphoma-2 and upregulation of microRNA-182

    PubMed Central

    LI, MINGLIN; MA, HUILI; YANG, LIXIN; LI, PENG

    2016-01-01

    Mangiferin, a flavonoid extracted from the mango tree, possesses anti-inflammatory, antibacterial, anti-herpes simplex and antitumor activity, and is able to affect immune function. The present study investigated the anticancer effects of mangiferin treatment on PC3 human prostate cancer cells, and the potential underlying mechanisms. In the present study, an MTT assay was used to analyze the proliferation of PC3 cells. Subsequently, flow cytometry and colorimetric assay kits were utilized to measure the PC3 cell apoptotic rate. The expression levels of B-cell lymphoma-2 (Bcl-2) and microRNA-182 (miR-182) were detected using western blot analysis and quantitative reverse transcription-polymerase chain reaction, respectively. Finally, miR-182 and anti-miR-182 were transfected into PC3 cells, which were used to investigate the effects of mangiferin. Mangiferin treatment reduced the proliferation of PC3 human prostate cancer cells in a concentration- and time-dependent manner. In addition, mangiferin was able to promote apoptosis and induce the caspase-3 activity of PC3 human prostate cancer cells. Mangiferin treatment was also able to significantly reduce Bcl-2 expression levels and enhance miR-182 expression in PC3 cells. Finally, it was observed that mangiferin inhibited proliferation and induced apoptosis in PC3 human prostate cancer cells, and this effect was correlated with downregulation of Bcl-2 and upregulation of miR-182. PMID:26870290

  2. Predicting microRNA modulation in human prostate cancer using a simple String IDentifier (SID1.0).

    PubMed

    Albertini, Maria C; Olivieri, Fabiola; Lazzarini, Raffaella; Pilolli, Francesca; Galli, Francesco; Spada, Giorgio; Accorsi, Augusto; Rippo, Maria R; Procopio, Antonio D

    2011-08-01

    To make faster and efficient the identification of mRNA targets common to more than one miRNA, and to identify new miRNAs modulated in specific pathways, a computer program identified as SID1.0 (simple String IDentifier) was developed and successfully applied in the identification of deregulated miRNAs in prostate cancer cells. This computationally inexpensive Fortran program is based on the strategy of exhaustive search and specifically designed to screen shared data (target genes, miRNAs and pathways) available from PicTar and DIANA-MicroT 3.0 databases. As far as we know this is the first software designed to filter data retrieved from available miRNA databases. SID1.0 takes advantage of the standard Fortran intrinsic functions for manipulating text strings and requires ASCII input files. In order to demonstrate SID1.0 applicability, some miRNAs expected from the literature to associate with cancerogenesis (miR-125b, miR-148a and miR-141), were randomly identified as main entries for SID1.0 to explore matching sequences of mRNA targets and also to explore KEGG pathways for the presence of ID codes of targeted genes. Besides genes and pathways already described in the literature, SID1.0 has proven to useful for predicting other genes involved in prostate carcinoma. These latter were used to identify new deregulated miRNAs: miR-141, miR-148a, miR-19a and miR-19b. Prediction data were preliminary confirmed by expression analysis of the identified miRNAs in androgen-dependent (LNCaP) and independent (PC3) prostate carcinoma cell lines and in normal prostatic epithelial cells (PrEC). PMID:21334455

  3. Lysophosphatidic acid induces reactive oxygen species generation by activating protein kinase C in PC-3 human prostate cancer cells

    SciTech Connect

    Lin, Chu-Cheng; Lin, Chuan-En; Lin, Yueh-Chien; Ju, Tsai-Kai; Huang, Yuan-Li; Lee, Ming-Shyue; Chen, Jiun-Hong; Lee, Hsinyu

    2013-11-01

    Highlights: •LPA induces ROS generation through LPA{sub 1} and LPA{sub 3}. •LPA induces ROS generation by activating PLC. •PKCζ mediates LPA-induced ROS generation. -- Abstract: Prostate cancer is one of the most frequently diagnosed cancers in males, and PC-3 is a cell model popularly used for investigating the behavior of late stage prostate cancer. Lysophosphatidic acid (LPA) is a lysophospholipid that mediates multiple behaviors in cancer cells, such as proliferation, migration and adhesion. We have previously demonstrated that LPA enhances vascular endothelial growth factor (VEGF)-C expression in PC-3 cells by activating the generation of reactive oxygen species (ROS), which is known to be an important mediator in cancer progression. Using flow cytometry, we showed that LPA triggers ROS generation within 10 min and that the generated ROS can be suppressed by pretreatment with the NADPH oxidase (Nox) inhibitor diphenylene iodonium. In addition, transfection with LPA{sub 1} and LPA{sub 3} siRNA efficiently blocked LPA-induced ROS production, suggesting that both receptors are involved in this pathway. Using specific inhibitors and siRNA, phospholipase C (PLC) and protein kinase C (PKC) were also suggested to participate in LPA-induced ROS generation. Overall, we demonstrated that LPA induces ROS generation in PC-3 prostate cancer cells and this is mediated through the PLC/PKC/Nox pathway.

  4. Plumbagin elicits differential proteomic responses mainly involving cell cycle, apoptosis, autophagy, and epithelial-to-mesenchymal transition pathways in human prostate cancer PC-3 and DU145 cells

    PubMed Central

    Qiu, Jia-Xuan; Zhou, Zhi-Wei; He, Zhi-Xu; Zhao, Ruan Jin; Zhang, Xueji; Yang, Lun; Zhou, Shu-Feng; Mao, Zong-Fu

    2015-01-01

    Plumbagin (PLB) has exhibited a potent anticancer effect in preclinical studies, but the molecular interactome remains elusive. This study aimed to compare the quantitative proteomic responses to PLB treatment in human prostate cancer PC-3 and DU145 cells using the approach of stable-isotope labeling by amino acids in cell culture (SILAC). The data were finally validated using Western blot assay. First, the bioinformatic analysis predicted that PLB could interact with 78 proteins that were involved in cell proliferation and apoptosis, immunity, and signal transduction. Our quantitative proteomic study using SILAC revealed that there were at least 1,225 and 267 proteins interacting with PLB and there were 341 and 107 signaling pathways and cellular functions potentially regulated by PLB in PC-3 and DU145 cells, respectively. These proteins and pathways played a critical role in the regulation of cell cycle, apoptosis, autophagy, epithelial to mesenchymal transition (EMT), and reactive oxygen species generation. The proteomic study showed substantial differences in response to PLB treatment between PC-3 and DU145 cells. PLB treatment significantly modulated the expression of critical proteins that regulate cell cycle, apoptosis, and EMT signaling pathways in PC-3 cells but not in DU145 cells. Consistently, our Western blotting analysis validated the bioinformatic and proteomic data and confirmed the modulating effects of PLB on important proteins that regulated cell cycle, apoptosis, autophagy, and EMT in PC-3 and DU145 cells. The data from the Western blot assay could not display significant differences between PC-3 and DU145 cells. These findings indicate that PLB elicits different proteomic responses in PC-3 and DU145 cells involving proteins and pathways that regulate cell cycle, apoptosis, autophagy, reactive oxygen species production, and antioxidation/oxidation homeostasis. This is the first systematic study with integrated computational, proteomic, and

  5. Adenoviral-E2F-1 radiosensitizes p53{sup wild-type} and p53{sup null} human prostate cancer cells

    SciTech Connect

    Nguyen, Khanh H.; Hachem, Paul; Khor, L.-Y.; Salem, Naji; Hunt, Kelly K.; Calkins, Peter R.; Pollack, Alan . E-mail: Alan.Pollack@fccc.edu

    2005-09-01

    Purpose: E2F-1 is a transcription factor that enhances the radiosensitivity of various cell lines by inducing apoptosis. However, there are conflicting data concerning whether this enhancement is mediated via p53 dependent pathways. Additionally, the role of E2F-1 in the response of human prostate cancer to radiation has not been well characterized. In this study, we investigated the effect of Adenoviral-E2F-1 (Ad-E2F-1) on the radiosensitivity of p53{sup wild-type} (LNCaP) and p53{sup null} (PC3) prostate cancer cell lines. Methods and Materials: LNCaP and PC3 cells were transduced with Ad-E2F-1, Adenoviral-Luciferase (Ad-Luc) control vector, or Adenoviral-p53 (Ad-p53). Expression of E2F-1 and p53 was examined by Western blot analysis. Annexin V and caspase 3 + 7 assays were performed to estimate the levels of apoptosis. Clonogenic survival assays were used to determine overall cell death. Statistical significance was determined by analysis of variance, using the Bonferroni method to correct for multiple comparisons. Results: Western blot analysis confirmed the efficacy of transductions with Ad-E2F-1 and Ad-p53. Ad-E2F-1 transduction significantly enhanced apoptosis and decreased clonogenic survival in both cell lines. These effects were compounded by the addition of RT. Although E2F-1-mediated radiosensitization was independent of p53 status, this effect was more pronounced in p53{sup wild-type} LNCaP cells. When PC3 cells were treated with Ad-p53 in combination with RT and Ad-E2F-1, there was at least an additive reduction in clonogenic survival. Conclusions: Our results suggest that Ad-E2F-1 significantly enhances the response of p53{sup wild-type} and p53{sup null} prostate cancer cells to radiation therapy, although radiosensitization is more pronounced in the presence of p53. Ad-E2F-1 may be a useful adjunct to radiation therapy in the treatment of prostate cancer.

  6. The use of matrix coating assisted by an electric field (MCAEF) to enhance mass spectrometric imaging of human prostate cancer biomarkers.

    PubMed

    Wang, Xiaodong; Han, Jun; Hardie, Darryl B; Yang, Juncong; Borchers, Christoph H

    2016-01-01

    In this work, we combined a newly developed matrix coating technique - matrix coating assisted by an electric field (MCAEF) and matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) to enhance the imaging of peptides and proteins in tissue specimens of human prostate cancer. MCAEF increased the signal-to-noise ratios of the detected proteins by a factor of 2 to 5, and 232 signals were detected within the m/z 3500-37500 mass range on a time-of-flight mass spectrometer and with the sinapinic acid MALDI matrix. Among these species, three proteins (S100-A9, S100-A10, and S100-A12) were only observed in the cancerous cell region and 14 proteins, including a fragment of mitogen-activated protein kinase/extracellular signal-regulated kinase kinase kinase 2, a fragment of cAMP-regulated phosphoprotein 19, 3 apolipoproteins (C-I, A-I, and A-II), 2 S100 proteins (A6 and A8), β-microseminoprotein, tumor protein D52, α-1-acid glycoprotein 1, heat shock protein β-1, prostate-specific antigen, and 2 unidentified large peptides at m/z 5002.2 and 6704.2, showed significantly differential distributions at the p < 0.05 (t-test) level between the cancerous and the noncancerous regions of the tissue. Among these 17 species, the distributions of apolipoprotein C-I, S100-A6, and S100-A8 were verified by immunohistological staining. In summary, this study resulted in the imaging of the largest group of proteins in prostate cancer tissues by MALDI-MS reported thus far, and is the first to show a correlation between S100 proteins and prostate cancer in a MS imaging study. The successful imaging of the three proteins only found in the cancerous tissues, as well as those showing differential expressions demonstrated the potential of MCAEF-MALDI/MS for the in situ detection of potential cancer biomarkers. Copyright © 2015 John Wiley & Sons, Ltd. PMID:26757076