Sample records for impaired immune response

  1. Impairment of innate immune responses in cirrhotic patients and treatment by branched-chain amino acids

    PubMed Central

    Nakamura, Ikuo

    2014-01-01

    It has been reported that host defense responses, such as phagocytic function of neutrophils and natural killer (NK) cell activity of lymphocytes, are impaired in cirrhotic patients. This review will concentrate on the impairment of innate immune responses in decompensated cirrhotic patients and the effect of the treatment by branched-chain amino acids (BCAA) on innate immune responses. We already reported that phagocytic function of neutrophils was significantly improved by 3-mo BCAA supplementation. In addition, the changes of NK activity were also significant at 3 mo of supplementation compared with before supplementation. Also, Fisher’s ratios were reported to be significantly increased at 3 mo of BCAA supplementation compared with those before oral supplementation. Therefore, administration of BCAA could reduce the risk of bacterial and viral infection in patients with decompensated cirrhosis by restoring impaired innate immune responses of the host. In addition, it was also revealed that BCAA oral supplementation could reduce the risk of development of hepatocellular carcinoma in cirrhotic patients. The mechanisms of the effects will also be discussed in this review article. PMID:24966600

  2. Impaired local immune response in vitamin A-deficient rats.

    PubMed Central

    Sirisinha, S; Darip, M D; Moongkarndi, P; Ongsakul, M; Lamb, A J

    1980-01-01

    The functional integrity of the local immune system in vitamin A-deficient (A-) rats was investigated. Secretory IgA levels in the intestinal fluid of A- rats were significantly lower than in controls. This and the decrease in intensity of immunofluorescent staining for secretory component (SC) in the intestinal cells was related to the duration of vitamin A deprivation. IgG levels in the intestinal fluid, and serum IgA and IgG levels were unaffected in deficiency. Moreover, when the response of animals to DNP50-BGG was evaluated, the local anti-DNP response in the intestine was markedly depressed. These defects may result from impaired synthesis of SC by epithelial cells. On the other hand, the serum antibody response in deficient animals was not noticeably different from that of the controls; if any, htere was a slight reduction in the affinity of antibody. PMID:7389210

  3. Cellular immune responses to HIV

    NASA Astrophysics Data System (ADS)

    McMichael, Andrew J.; Rowland-Jones, Sarah L.

    2001-04-01

    The cellular immune response to the human immunodeficiency virus, mediated by T lymphocytes, seems strong but fails to control the infection completely. In most virus infections, T cells either eliminate the virus or suppress it indefinitely as a harmless, persisting infection. But the human immunodeficiency virus undermines this control by infecting key immune cells, thereby impairing the response of both the infected CD4+ T cells and the uninfected CD8+ T cells. The failure of the latter to function efficiently facilitates the escape of virus from immune control and the collapse of the whole immune system.

  4. Profound impairment of adaptive immune responses by alkylating chemotherapy

    PubMed Central

    Litterman, Adam J.; Zellmer, David M.; Grinnen, Karen L.; Hunt, Matthew A.; Dudek, Arkadiusz Z.; Salazar, Andres M.; Ohlfest, John R.

    2013-01-01

    Cancer vaccines have overall had a record of failure as an adjuvant therapy for malignancies that are treated with alkylating chemotherapy, and the contribution of standard treatment to that failure remains unclear. Vaccines aim to harness the proliferative potential of the immune system by expanding a small number of tumor-specific lymphocytes into a large number of anti-tumor effectors. Clinical trials are often conducted after treatment with alkylating chemotherapy, given either as standard therapy or for immunomodulatory effect. There is mounting evidence for synergy between chemotherapy and adoptive immunotherapy or vaccination against self-antigens; however, the impact of chemotherapy on lymphocytes primed against tumor neo-antigens remains poorly defined. We report here that clinically relevant dosages of standard alkylating chemotherapies such as temozolomide and cyclophosphamide significantly inhibit the proliferative abilities of lymphocytes in mice. This proliferative impairment was long lasting and led to quantitative and qualitative defects in B and T cell responses to neo-antigen vaccines. High affinity responder lymphocytes receiving the strongest proliferative signals from vaccines experienced the greatest DNA damage responses, skewing the response toward lower affinity responders with inferior functional characteristics. Together these defects lead to inferior efficacy and overall survival in murine tumor models treated by neo-antigen vaccines. These results suggest that clinical protocols for cancer vaccines should be designed to avoid exposing responder lymphocytes to alkylating chemotherapy. PMID:23686484

  5. Transient immune impairment after a simulated long-haul flight.

    PubMed

    Wilder-Smith, Annelies; Mustafa, Fatima B; Peng, Chung Mien; Earnest, Arul; Koh, David; Lin, Gen; Hossain, Iqbal; MacAry, Paul A

    2012-04-01

    Almost 2 billion people travel aboard commercial airlines every year, with about 20% developing symptoms of the common cold within 1 wk after air travel. We hypothesize that hypobaric hypoxic conditions associated with air travel may contribute to immune impairment. We studied the effects of hypobaric hypoxic conditions during a simulated flight at 8000 ft (2438 m) cruising altitude on immune and stress markers in 52 healthy volunteers (mean age 31) before and on days 1, 4, and 7 after the flight. We did a cohort study using a generalized estimating equation to examine the differences in the repeated measures. Our findings show that the hypobaric hypoxic conditions of a 10-h overnight simulation flight are not associated with severe immune impairment or abnormal IgA or cortisol levels, but with transient impairment in some parameters: we observed a transient decrease in lymphocyte proliferative responses combined with an upregulation in CD69 and CD14 cells and a decrease in HLA-DR in the immediate days following the simulated flight that normalized by day 7 in most instances. These transient immune changes may contribute to an increased susceptibility to respiratory infections commonly seen after long-haul flights.

  6. Endothelial cells of extremely premature infants display impaired immune response after proinflammatory stimulation.

    PubMed

    Wisgrill, Lukas; Muck, Martina; Wessely, Isabelle; Berger, Angelika; Spittler, Andreas; Förster-Waldl, Elisabeth; Sadeghi, Kambis

    2018-01-01

    BackgroundEndothelial cells (ECs) exert immunological functions such as production of proinflammatory cytokines/chemokines as well as facilitation of extravasation of immune cells into infected tissue. Limited data are available on the functionality of ECs from extremely preterm neonates during infection. Accordingly, the aim of our study was to investigate the immune response of premature ECs after proinflammatory stimulation.MethodsCell adhesion receptors' expression and function, nuclear factor 'kappa-light-chain-enhancer' of activated B-cells (NFκB) signaling, and chemokine production were analyzed in umbilical cord ECs from extremely preterm and term neonates after proinflammatory stimulation.ResultsP-selectin and E-selectin surface expression as well as NFκB signaling were lower after lipopolysaccharide (LPS) stimulation in premature ECs. Preterm ECs exhibited lower, but significant, cell-adhesive functions after LPS stimulation compared with term ECs. CCL2/CXCL8 chemokine secretion was significantly upregulated after proinflammatory stimulation in both groups. CXCL10 production was significantly increased in term but not in preterm ECs upon stimulation with tumor necrosis factor compared with unstimulated ECs.ConclusionExtremely premature ECs showed partly reduced expression levels and function of cell adhesion molecules. Both NFκB signaling and chemokine/cytokine production were reduced in premature ECs. The diminished endothelial proinflammatory immune response might result in impaired infection control of preterm newborns rendering them prone to severe infection.

  7. Constant light suppresses production of Met-enkephalin-containing peptides in cultured splenic macrophages and impairs primary immune response in rats.

    PubMed

    Valdés-Tovar, Marcela; Escobar, Carolina; Solís-Chagoyán, Héctor; Asai, Miguel; Benítez-King, Gloria

    2015-03-01

    The light-dark cycle is an environmental factor that influences immune physiology, and so, variations of the photoperiod length result in altered immune responsivity. Macrophage physiology comprises a spectrum of functions that goes from host defense to immune down-regulation, in addition to their homeostatic activities. Macrophages also play a key role in the transition from innate to adaptive immune responses. Met-enkephalin (MEnk) has been recognized as a modulator of macrophage physiology acting in an autocrine or paracrine fashion to influence macrophage activation, phenotype polarization and production of cytokines that would enhance lymphocyte activation at early stages of an immune response. Previously it was shown that splenic MEnk tissue content is reduced in rats exposed to constant light. In this work, we explored whether production of Met-enkephalin-containing peptides (MECPs) in cultured splenic macrophages is affected by exposure of rats to a constant light regime. In addition, we explored whether primary immune response was impaired under this condition. We found that in rats, 15 days in constant light was sufficient to disrupt their general activity rhythm. Splenic MEnk content oscillations and levels were also blunted throughout a 24-h period in animals subjected to constant light. In agreement, de novo synthesis of MECPs evaluated through incorporation of (35)S-methionine was reduced in splenic macrophages from rats exposed to constant light. Moreover, MECPs immunocytochemistry showed a decrease in the intracellular content and lack of granule-like deposits in this condition. Furthermore, we found that primary T-dependent antibody response was compromised in rats exposed to constant light. In those animals, pharmacologic treatment with MEnk increased IFN-γ-secreting cells. Also, IL-2 secretion from antigen-stimulated splenocytes was reduced after incubation with naloxone, suggesting that immune-derived opioid peptides and stimulation of opioid

  8. Disruption of TNFα/TNFR1 function in resident skin cells impairs host immune response against cutaneous vaccinia virus infection

    PubMed Central

    Tian, Tian; Dubin, Krista; Jin, Qiushuang; Qureshi, Ali; King, Sandra L.; Liu, Luzheng; Jiang, Xiaodong; Murphy, George F.; Kupper, Thomas S.; Fuhlbrigge, Robert C.

    2012-01-01

    One strategy adopted by vaccinia virus (VV) to evade the host immune system is to encode homologs of TNF receptors (TNFR) that block TNFα function. The response to VV skin infection under conditions of TNFα deficiency, however, has not been reported. We found that TNFR1−/− mice developed larger primary lesions, numerous satellite lesions and higher skin virus levels after VV scarification. Following their recovery, these TNFR1−/− mice were fully protected against challenge with a lethal intranasal dose of VV, suggesting these mice developed an effective memory immune response. A functional systemic immune response of TNFR1−/− mice was further demonstrated by enhanced production of VV-specific IFNγ and VV-specific CD8+ T cells in spleens and draining lymph nodes. Interestingly, bone marrow (BM) reconstitution studies using WT BM in TNFR1−/− host mice, but not TNFR1−/− BM in WT host mice, reproduced the original results seen in TNFR1−/− mice, indicating that TNFR1 deficiency in resident skin cells, rather than hematopoietic cells, accounts for the impaired cutaneous immune response. Our data suggest that lack of TNFR1 leads to a skin-specific immune deficiency and that resident skin cells play a crucial role in mediating an optimal immune defense to VV cutaneous infection via TNFα/TNFR1 signaling. PMID:22318381

  9. Immune Responses to HCV and Other Hepatitis Viruses

    PubMed Central

    Park, Su-Hyung; Rehermann, Barbara

    2014-01-01

    Summary Five human hepatitis viruses cause most acute and chronic liver disease worldwide. Over the past 25 years hepatitis C virus (HCV) in particular has received much interest because of its ability to persist in most immunocompetent adults and the lack of a protective vaccine. Here we examine innate and adaptive immune responses to HCV infection. Although HCV activates an innate immune response, it employs an elaborate set of mechanisms to evade interferon (IFN)-based antiviral immunity. By comparing innate and adaptive immune responses to HCV with those to hepatitis A and B viruses, we suggest that prolonged innate immune activation impairs the development of successful adaptive immune responses. Comparative immunology furthermore provides insights into the maintenance of immune protection. We conclude by discussing prospects for an HCV vaccine and future research needs for the hepatitis viruses. PMID:24439265

  10. Impairment of the humoral and CD4+ T cell responses in HTLV-1-infected individuals immunized with tetanus toxoid

    PubMed Central

    Souza, Anselmo; Santos, Silvane; Carvalho, Lucas P.; Grassi, Maria Fernanda R.; Carvalho, Edgar M.

    2016-01-01

    T cells from HTLV-1-infected individuals have a decreased ability to proliferate after stimulation with recall antigens. This abnormality may be due to the production of regulatory cytokine or a dysfunctional antigen presentation. The aims of this study were to evaluate the antibody production and cytokine expression by lymphocytes before and after immunization with tetanus toxoid (TT) and to evaluate the immune response of monocytes after stimulation with TT and frequency of dendritic cells (DC) subsets. HTLV-1 carriers (HC) and uninfected controls with negative serology for TT were immunized with TT, and the antibody titers were determined by ELISA as well as the cell activation markers expression by monocytes. The frequencies of DC subsets were determined by flow cytometry. Following immunization, the IgG anti-TT titers and the frequency of CD4+ T cells expressing IFN-γ, TNF and IL-10 in response to TT were lower in the (HC) than in the controls. Additionally, monocytes from HC did not exhibit increased HLA-DR expression after stimulation with TT, and presented low numbers of DC subsets, therefore, it’s necessary to perform functional studies with antigen-presenting cells. Collectively, our finding suggests that HC present an impairment of the humoral and CD4+ T cell immune responses after vaccination. PMID:27282836

  11. Evaluation of the humoral immune response of children with low level lead exposure

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reigart, J.R.; Graber, C.D.

    1976-07-01

    Twelve lead-exposed children, with evidence of metabolic impairment, and seven non-lead exposed children were examined for evidence of impairment of their immunological response. There were no differences between the control group and the lead exposed group with reference to complement levels, immunoglobulins, or anamnestic response to the tetanus toxoid antigen. It remains to be demonstrated whether or not there is deficient response to primary immunization, whether other antigens are more affected by lead, or whether impairment of humoral immune response requires a more serious degree of lead intoxication.

  12. Periodontitis induced by Porphyromonas gingivalis drives periodontal microbiota dysbiosis and insulin resistance via an impaired adaptive immune response

    PubMed Central

    Blasco-Baque, Vincent; Garidou, Lucile; Pomié, Céline; Escoula, Quentin; Loubieres, Pascale; Le Gall-David, Sandrine; Lemaitre, Mathieu; Nicolas, Simon; Klopp, Pascale; Waget, Aurélie; Azalbert, Vincent; Colom, André; Bonnaure-Mallet, Martine; Kemoun, Philippe; Serino, Matteo; Burcelin, Rémy

    2017-01-01

    Objective To identify a causal mechanism responsible for the enhancement of insulin resistance and hyperglycaemia following periodontitis in mice fed a fat-enriched diet. Design We set-up a unique animal model of periodontitis in C57Bl/6 female mice by infecting the periodontal tissue with specific and alive pathogens like Porphyromonas gingivalis (Pg), Fusobacterium nucleatum and Prevotella intermedia. The mice were then fed with a diabetogenic/non-obesogenic fat-enriched diet for up to 3 months. Alveolar bone loss, periodontal microbiota dysbiosis and features of glucose metabolism were quantified. Eventually, adoptive transfer of cervical (regional) and systemic immune cells was performed to demonstrate the causal role of the cervical immune system. Results Periodontitis induced a periodontal microbiota dysbiosis without mainly affecting gut microbiota. The disease concomitantly impacted on the regional and systemic immune response impairing glucose metabolism. The transfer of cervical lymph-node cells from infected mice to naive recipients guarded against periodontitis-aggravated metabolic disease. A treatment with inactivated Pg prior to the periodontal infection induced specific antibodies against Pg and protected the mouse from periodontitis-induced dysmetabolism. Finally, a 1-month subcutaneous chronic infusion of low rates of lipopolysaccharides from Pg mimicked the impact of periodontitis on immune and metabolic parameters. Conclusions We identified that insulin resistance in the high-fat fed mouse is enhanced by pathogen-induced periodontitis. This is caused by an adaptive immune response specifically directed against pathogens and associated with a periodontal dysbiosis. PMID:26838600

  13. Cutting edge: impairment of dendritic cells and adaptive immunity by Ebola and Lassa viruses.

    PubMed

    Mahanty, Siddhartha; Hutchinson, Karen; Agarwal, Sudhanshu; McRae, Michael; Rollin, Pierre E; Pulendran, Bali

    2003-03-15

    Acute infection of humans with Ebola and Lassa viruses, two principal etiologic agents of hemorrhagic fevers, often results in a paradoxical pattern of immune responses: early infection, characterized by an outpouring of inflammatory mediators such as TNF-alpha, IL-1 beta, and IL-6, vs late stage infections, which are associated with poor immune responses. The mechanisms underlying these diverse outcomes are poorly understood. In particular, the role played by cells of the innate immune system, such as dendritic cells (DC), is not known. In this study, we show that Ebola and Lassa viruses infect human monocyte-derived DC and impair their function. Monocyte-derived DC exposed to either virus fail to secrete proinflammatory cytokines, do not up-regulate costimulatory molecules, and are poor stimulators of T cells. These data represent the first evidence for a mechanism by which Ebola and Lassa viruses target DC to impair adaptive immunity.

  14. Impairment of the humoral and CD4(+) T cell responses in HTLV-1-infected individuals immunized with tetanus toxoid.

    PubMed

    Souza, Anselmo; Santos, Silvane; Carvalho, Lucas P; Grassi, Maria Fernanda R; Carvalho, Edgar M

    2016-08-01

    T cells from HTLV-1-infected individuals have a decreased ability to proliferate after stimulation with recall antigens. This abnormality may be due to the production of regulatory cytokine or a dysfunctional antigen presentation. The aims of this study were to evaluate the antibody production and cytokine expression by lymphocytes before and after immunization with tetanus toxoid (TT) and to evaluate the immune response of monocytes after stimulation with TT and frequency of dendritic cells (DC) subsets. HTLV-1 carriers (HC) and uninfected controls (UC) with negative serology for TT were immunized with TT, and the antibody titers were determined by ELISA as well as the cell activation markers expression by monocytes. The frequencies of DC subsets were determined by flow cytometry. Following immunization, the IgG anti-TT titers and the frequency of CD4(+) T cells expressing IFN-γ, TNF-α and IL-10 in response to TT were lower in the HC than in the UC. Additionally, monocytes from HC did not exhibit increased HLA-DR expression after stimulation with TT, and presented low numbers of DC subsets, therefore, it's necessary to perform functional studies with antigen-presenting cells. Collectively, our finding suggests that HC present an impairment of the humoral and CD4(+) T cell immune responses after vaccination. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  15. Microbial Degradation of Cellular Kinases Impairs Innate Immune Signaling and Paracrine TNFα Responses

    PubMed Central

    Barth, Kenneth; Genco, Caroline Attardo

    2016-01-01

    The NFκB and MAPK signaling pathways are critical components of innate immunity that orchestrate appropriate immune responses to control and eradicate pathogens. Their activation results in the induction of proinflammatory mediators, such as TNFα a potent bioactive molecule commonly secreted by recruited inflammatory cells, allowing for paracrine signaling at the site of an infection. In this study we identified a novel mechanism by which the opportunistic pathogen Porphyromonas gingivalis dampens innate immune responses by disruption of kinase signaling and degradation of inflammatory mediators. The intracellular immune kinases RIPK1, TAK1, and AKT were selectively degraded by the P. gingivalis lysine-specific gingipain (Kgp) in human endothelial cells, which correlated with dysregulated innate immune signaling. Kgp was also observed to attenuate endothelial responsiveness to TNFα, resulting in a reduction in signal flux through AKT, ERK and NFκB pathways, as well as a decrease in downstream proinflammatory mRNA induction of cytokines, chemokines and adhesion molecules. A deficiency in Kgp activity negated decreases to host cell kinase protein levels and responsiveness to TNFα. Given the essential role of kinase signaling in immune responses, these findings highlight a unique mechanism of pathogen-induced immune dysregulation through inhibition of cell activation, paracrine signaling, and dampened cellular proinflammatory responses. PMID:27698456

  16. Malnutrition: Modulator of Immune Responses in Tuberculosis

    PubMed Central

    Chandrasekaran, Padmapriyadarsini; Saravanan, Natarajan; Bethunaickan, Ramalingam; Tripathy, Srikanth

    2017-01-01

    Nutrition plays a major role in the management of both acute and chronic diseases, in terms of body’s response to the pathogenic organism. An array of nutrients like macro- and micro-nutrients, vitamins, etc., are associated with boosting the host’s immune responses against intracellular pathogens including mycobacterium tuberculosis (M.tb). These nutrients have an immunomodulatory effects in controlling the infection and inflammation process and nutritional deficiency of any form, i.e., malnutrition may lead to nutritionally acquired immunodeficiency syndrome, which greatly increases an individual’s susceptibility to progression of infection to disease. This narrative review looks at the various mechanisms by which nutrition or its deficiency leads to impaired cell mediated and humoral immune responses, which in turn affects the ability of an individual to fight M.tb infection or disease. There is very little evidence in the literature that any specific food on its own or a specific quantity can alter the course of TB disease or be effective in the treatment of malnutrition. Further clinical trials or studies will be needed to recommend and to better understand the link between malnutrition, tuberculosis, and impaired immunity. PMID:29093710

  17. Immune responses in space flight

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, G.

    1998-01-01

    significance of space flight-induced changes in immune parameters remains to be established; however, as duration of flights increases, the potential for difficulties due to impaired immune responses also increases.

  18. Impaired airway mucociliary function reduces antigen-specific IgA immune response to immunization with a claudin-4-targeting nasal vaccine in mice.

    PubMed

    Suzuki, Hidehiko; Nagatake, Takahiro; Nasu, Ayaka; Lan, Huangwenxian; Ikegami, Koji; Setou, Mitsutoshi; Hamazaki, Yoko; Kiyono, Hiroshi; Yagi, Kiyohito; Kondoh, Masuo; Kunisawa, Jun

    2018-02-13

    Vaccine delivery is an essential element for the development of mucosal vaccine, but it remains to be investigated how physical barriers such as mucus and cilia affect vaccine delivery efficacy. Previously, we reported that C-terminal fragment of Clostridium perfringens enterotoxin (C-CPE) targeted claudin-4, which is expressed by the epithelium associated with nasopharynx-associated lymphoid tissue (NALT), and could be effective as a nasal vaccine delivery. Mice lacking tubulin tyrosine ligase-like family, member 1 (Ttll1-KO mice) showed mucus accumulation in nasal cavity due to the impaired motility of respiratory cilia. Ttll1-KO mice nasally immunized with C-CPE fused to pneumococcal surface protein A (PspA-C-CPE) showed reduced PspA-specific nasal IgA responses, impaired germinal center formation, and decreased germinal center B-cells and follicular helper T cells in the NALT. Although there was no change in the expression of claudin-4 in the NALT epithelium in Ttll1-KO mice, the epithelium was covered by a dense mucus that prevented the binding of PspA-C-CPE to NALT. However, administration of expectorant N-acetylcysteine removed the mucus and rescued the PspA-specific nasal IgA response. These results show that the accumulation of mucus caused by impaired respiratory cilia function is an interfering factor in the C-CPE-based claudin-4-targeting nasal vaccine.

  19. Periodontitis induced by Porphyromonas gingivalis drives periodontal microbiota dysbiosis and insulin resistance via an impaired adaptive immune response.

    PubMed

    Blasco-Baque, Vincent; Garidou, Lucile; Pomié, Céline; Escoula, Quentin; Loubieres, Pascale; Le Gall-David, Sandrine; Lemaitre, Mathieu; Nicolas, Simon; Klopp, Pascale; Waget, Aurélie; Azalbert, Vincent; Colom, André; Bonnaure-Mallet, Martine; Kemoun, Philippe; Serino, Matteo; Burcelin, Rémy

    2017-05-01

    To identify a causal mechanism responsible for the enhancement of insulin resistance and hyperglycaemia following periodontitis in mice fed a fat-enriched diet. We set-up a unique animal model of periodontitis in C57Bl/6 female mice by infecting the periodontal tissue with specific and alive pathogens like Porphyromonas gingivalis ( Pg ), Fusobacterium nucleatum and Prevotella intermedia . The mice were then fed with a diabetogenic/non-obesogenic fat-enriched diet for up to 3 months. Alveolar bone loss, periodontal microbiota dysbiosis and features of glucose metabolism were quantified. Eventually, adoptive transfer of cervical (regional) and systemic immune cells was performed to demonstrate the causal role of the cervical immune system. Periodontitis induced a periodontal microbiota dysbiosis without mainly affecting gut microbiota. The disease concomitantly impacted on the regional and systemic immune response impairing glucose metabolism. The transfer of cervical lymph-node cells from infected mice to naive recipients guarded against periodontitis-aggravated metabolic disease. A treatment with inactivated Pg prior to the periodontal infection induced specific antibodies against Pg and protected the mouse from periodontitis-induced dysmetabolism. Finally, a 1-month subcutaneous chronic infusion of low rates of lipopolysaccharides from Pg mimicked the impact of periodontitis on immune and metabolic parameters. We identified that insulin resistance in the high-fat fed mouse is enhanced by pathogen-induced periodontitis. This is caused by an adaptive immune response specifically directed against pathogens and associated with a periodontal dysbiosis. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  20. The entomopathogenic fungus Nomuraea rileyi impairs cellular immunity of its host Helicoverpa armigera.

    PubMed

    Zhong, Ke; Liu, Zhan-Chi; Wang, Jia-Lin; Liu, Xu-Sheng

    2017-09-01

    In this study, we investigated the effect of the entomopathogenic fungus Nomuraea rileyi on Helicoverpa armigera cellular immune responses. Nomuraea rileyi infection had no effect on total hemocyte count (THC), but impaired hemocyte-mediated phagocytosis, nodulation, and encapsulation responses. Nomuraea rileyi infection led to a significant reduction in hemocyte spreading. An in vitro assay revealed that plasma from N. rileyi infected H. armigera larvae suppressed the spreading ability of hemocytes from naïve larvae. We infer that N. rileyi suppresses the cellular immune response of its host, possibly by secreting exogenous, cytotoxic compounds into the host's hemolymph. © 2017 Wiley Periodicals, Inc.

  1. Crude oil impairs immune function and increases susceptibility to pathogenic bacteria in southern flounder

    PubMed Central

    Bayha, Keith M.; Ortell, Natalie; Ryan, Caitlin N.; Griffitt, Kimberly J.; Krasnec, Michelle; Sena, Johnny; Ramaraj, Thiruvarangan; Takeshita, Ryan; Mayer, Gregory D.; Schilkey, Faye; Griffitt, Robert J.

    2017-01-01

    Exposure to crude oil or its individual constituents can have detrimental impacts on fish species, including impairment of the immune response. Increased observations of skin lesions in northern Gulf of Mexico fish during the 2010 Deepwater Horizon oil spill indicated the possibility of oil-induced immunocompromisation resulting in bacterial or viral infection. This study used a full factorial design of oil exposure and bacterial challenge to examine how oil exposure impairs southern flounder (Paralichthys lethostigma) immune function and increases susceptibility to the bacteria Vibrio anguillarum, a causative agent of vibriosis. Fish exposed to oil prior to bacterial challenge exhibited 94.4% mortality within 48 hours of bacterial exposure. Flounder challenged with V. anguillarum without prior oil exposure had <10% mortality. Exposure resulted in taxonomically distinct gill and intestine bacterial communities. Mortality strongly correlated with V. anguillarum levels, where it comprised a significantly higher percentage of the microbiome in Oil/Pathogen challenged fish and was nearly non-existent in the No Oil/Pathogen challenged fish bacterial community. Elevated V. anguillarum levels were a direct result of oil exposure-induced immunosuppression. Oil-exposure reduced expression of immunoglobulin M, the major systemic fish antibody, and resulted in an overall downregulation in transcriptome response, particularly in genes related to immune function, response to stimulus and hemostasis. Ultimately, sediment-borne oil exposure impairs immune function, leading to increased incidences of bacterial infections. This type of sediment-borne exposure may result in long-term marine ecosystem effects, as oil-bound sediment in the northern Gulf of Mexico will likely remain a contamination source for years to come. PMID:28464028

  2. Immune response

    MedlinePlus

    Innate immunity; Humoral immunity; Cellular immunity; Immunity; Inflammatory response; Acquired (adaptive) immunity ... normal and usually does not react against them. INNATE IMMUNITY Innate, or nonspecific, immunity is the defense ...

  3. Arginine and Citrulline and the Immune Response in Sepsis

    PubMed Central

    Wijnands, Karolina A.P.; Castermans, Tessy M.R.; Hommen, Merel P.J.; Meesters, Dennis M.; Poeze, Martijn

    2015-01-01

    Arginine, a semi-essential amino acid is an important initiator of the immune response. Arginine serves as a precursor in several metabolic pathways in different organs. In the immune response, arginine metabolism and availability is determined by the nitric oxide synthases and the arginase enzymes, which convert arginine into nitric oxide (NO) and ornithine, respectively. Limitations in arginine availability during inflammatory conditions regulate macrophages and T-lymfocyte activation. Furthermore, over the past years more evidence has been gathered which showed that arginine and citrulline deficiencies may underlie the detrimental outcome of inflammatory conditions, such as sepsis and endotoxemia. Not only does the immune response contribute to the arginine deficiency, also the impaired arginine de novo synthesis in the kidney has a key role in the eventual observed arginine deficiency. The complex interplay between the immune response and the arginine-NO metabolism is further underscored by recent data of our group. In this review we give an overview of physiological arginine and citrulline metabolism and we address the experimental and clinical studies in which the arginine-citrulline NO pathway plays an essential role in the immune response, as initiator and therapeutic target. PMID:25699985

  4. Age-Dependent Cell Trafficking Defects in Draining Lymph Nodes Impair Adaptive Immunity and Control of West Nile Virus Infection.

    PubMed

    Richner, Justin M; Gmyrek, Grzegorz B; Govero, Jennifer; Tu, Yizheng; van der Windt, Gerritje J W; Metcalf, Talibah U; Haddad, Elias K; Textor, Johannes; Miller, Mark J; Diamond, Michael S

    2015-07-01

    Impaired immune responses in the elderly lead to reduced vaccine efficacy and increased susceptibility to viral infections. Although several groups have documented age-dependent defects in adaptive immune priming, the deficits that occur prior to antigen encounter remain largely unexplored. Herein, we identify novel mechanisms for compromised adaptive immunity that occurs with aging in the context of infection with West Nile virus (WNV), an encephalitic flavivirus that preferentially causes disease in the elderly. An impaired IgM and IgG response and enhanced vulnerability to WNV infection during aging was linked to delayed germinal center formation in the draining lymph node (DLN). Adoptive transfer studies and two-photon intravital microscopy revealed a decreased trafficking capacity of donor naïve CD4+ T cells from old mice, which manifested as impaired T cell diapedesis at high endothelial venules and reduced cell motility within DLN prior to antigen encounter. Furthermore, leukocyte accumulation in the DLN within the first few days of WNV infection or antigen-adjuvant administration was diminished more generally in old mice and associated with a second aging-related defect in local cytokine and chemokine production. Thus, age-dependent cell-intrinsic and environmental defects in the DLN result in delayed immune cell recruitment and antigen recognition. These deficits compromise priming of early adaptive immune responses and likely contribute to the susceptibility of old animals to acute WNV infection.

  5. An immune risk phenotype, cognitive impairment, and survival in very late life: impact of allostatic load in Swedish octogenarian and nonagenarian humans.

    PubMed

    Wikby, Anders; Ferguson, Frederick; Forsey, Rosalyn; Thompson, Julie; Strindhall, Jan; Löfgren, Sture; Nilsson, Bengt-Olof; Ernerudh, Jan; Pawelec, Graham; Johansson, Boo

    2005-05-01

    In the previous OCTO longitudinal study, we identified an immune risk phenotype (IRP) of high CD8 and low CD4 numbers and poor proliferative response. We also demonstrated that cognitive impairment constitutes a major predictor of nonsurvival. In the present NONA longitudinal study, we simultaneously examine in a model of allostatic load IRP and compromised cognition in 4-year survival in a population-based sample (n = 138, 86-94 years). Immune system measurements consisted of determinations of T-cell subsets, plasma interleukin 6 and cytomegalovirus and Epstein-Barr virus serology. Interleukin 2 responsiveness to concanavalin A, using data from the previous OCTO (octogenarians) immune study, hereafter OCTO immune, was also examined. Cognitive status was rated using a battery of neuropsychological tests. Logistic regression indicated that the IRP and cognitive impairment together predicted 58% of observed deaths. IRP was associated with late differentiated CD8+CD28-CD27- cells (p < .001), decreased interleukin 2 responsiveness (p < .05) and persistent viral infection (p < .01). Cognitive impairment was associated with increased plasma interleukin 6 (p < .001). IRP individuals with cognitive impairment were all deceased at the follow-up, indicating an allostatic overload.

  6. Impaired immune function in seals and laboratory rats exposed to dioxin-like compounds from Baltic herring

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ross, P.S.; Swart, R.L. de; Timmerman, H.H.

    Complex mixtures of lipophilic contaminants have been shown to affect certain top predators in the aquatic food chain, including seals. A recent demonstration that harbor seals (Phoca vitulina) fed Baltic Sea herring displayed impaired natural killer cell activity and T-lymphocyte function represented the first demonstration of immunotoxicity induced by ambient levels of contaminants in the environment. While these animals had a lower ability to respond to immunizations with inactivated vaccines, specific antibody responses, and in vitro antigen-specific lymphoproliferative responses, obvious constraints limited the ability to extend these results with host resistance tests or an evaluation of thymus and other lymphoidmore » organs. The authors therefore set up a parallel study by exposing pregnant laboratory rats to the same Baltic herring contaminant mixture as received the seals. They then examined immune function parameters and host resistance to virus infection. As in the seals, rat pups of the Baltic group had impaired T-lymphocyte function. In addition, thymus cells and/or their precursors appeared to be targeted, as their numbers and function were reduced in the rats. Following challenge with rat cytomegalovirus in a host resistance study, rat pups in the Baltic group had impaired natural killer cell responses to the virus infection, and lower specific CD8 + (cytotoxic T-lymphocyte) responses following in vitro stimulation. By extrapolation, these results suggest that the impaired immune responses observed in the Baltic group of seals may lead to a less effective defense against virus infections in marine mammals inhabiting polluted coastal waters. Toxicological profiles and results of both the captive seal and laboratory rat experiments tend to implicate the 2,3,7,8-TCDD-like PCB, dioxin and furan congeners in the immunosuppression, and point to a major role for the PCBs.« less

  7. Immune response in asymptomatic smokers.

    PubMed

    Zeidel, A; Beilin, B; Yardeni, I; Mayburd, E; Smirnov, G; Bessler, H

    2002-09-01

    It has been demonstrated that cigarette smoking affects the immune system. Impairment of alveolar mononuclear cell function, described previously, may contribute to the higher rate of postoperative respiratory infections. However, increased susceptibility of smokers to infections of other origin (e.g. wound-related) implies that tobacco effect is not restricted to the respiratory immune competent cells. The present study was designed to investigate the systemic effect of tobacco smoking as it exerted on blood-derived immune cells. We measured systemic cytotoxic activity of natural killer cells, production of pro- and anti-inflammatory cytokines by blood mononuclear cells and their proliferation in response to mitogens. To minimize the immunosuppressive effect of other smoke-related factors, the smokers with chronic obstructive pulmonary disease (COPD) were excluded from this study. Peripheral blood mononuclear cells (PBMC) from 24 chronic asymptomatic smokers, and 28 controls, age and gender matched, were isolated and incubated in vitro with lipopolysaccharide (LPS) or phytohemagglutinin (PHA) to induce secretion of IL-1beta, IL-1ra, IL-6, IL-10, TNFalpha and IL-2, respectively, from mononuclear cells. The level of the cytokines in the supernatants was measured using ELISA kits. The proliferative response to the mitogens PHA and concanavalin A (ConA) was evaluated by 3H-thymidine incorporation and NK cell cytotoxicity by 51Cr release assay. Mononuclear cells from smokers showed increased production of the pro-inflammatory cytokines IL-1beta, IL-6 and TNFalpha and enhanced proliferative response to mitogens as compared to non-smoking population. The secretion of IL-2 and the anti-inflammatory cytokines IL-1ra and IL-10 was similar in both groups. NK cell cytotoxic activity was suppressed in the smokers. Cigarette smokers without chronic obstructive pulmonary disease (COPD) exhibit impaired NK cytotoxic activity in peripheral blood and unbalanced systemic production

  8. Prenatal vitamin A deficiency impairs adaptive immune responses to pentavalent rotavirus vaccine (RotaTeq®) in a neonatal gnotobiotic pig model.

    PubMed

    Kandasamy, Sukumar; Chattha, Kuldeep S; Vlasova, Anastasia N; Saif, Linda J

    2014-02-07

    Vitamin A deficiency (VAD) is associated with increased childhood mortality and morbidity in impoverished Asian and African countries, but the impact of VAD on rotavirus (RV) vaccine or infection is poorly understood. We assessed effects of gestational and dietary induced pre- and post-natal VAD and vitamin A supplementation on immune responses to a pentavalent rotavirus vaccine, RotaTeq(®) in a neonatal gnotobiotic pig model. Vaccine efficacy was assessed against virulent G1P[8] human rotavirus (HRV) challenge. VAD and vitamin A sufficient (VAS) piglets were derived from dietary VAD and VAS sows, respectively. VAD piglets had significantly lower levels of hepatic vitamin A compared to that of VAS piglets. RotaTeq(®)-vaccinated VAD piglets had 350-fold higher fecal virus shedding titers compared to vaccinated VAS piglets post-challenge. Only 25% of vaccinated non-vitamin A supplemented VAD piglets were protected against diarrhea compared with 100% protection rate in vaccinated non-supplemented VAS piglets post-challenge. Intestinal HRV specific immune responses were compromised in VAD piglets. Vaccinated VAD piglets had significantly lower ileal HRV IgG antibody secreting cell (ASC) responses (pre-challenge) and duodenal HRV IgA ASC responses (post-challenge) compared to vaccinated VAS piglets. Also, intestinal HRV IgA antibody titers were 11-fold lower in vaccinated VAD compared to vaccinated VAS piglets post-challenge. Persistently elevated levels of IL-8, a pro-inflammatory mediator, and lower IL-10 responses (anti-inflammatory) in vaccinated VAD compared to VAS piglets suggest more severe inflammatory responses in VAD piglets post-challenge. Moreover higher IFN-γ responses pre-challenge were observed in VAD compared to VAS piglets. The impaired vaccine-specific intestinal antibody responses and decreased immunoregulatory cytokine responses coincided with reduced protective efficacy of the RV vaccine against virulent HRV challenge in VAD piglets. In

  9. Humoral Immune Response against Neural Antigens and Its Effects on Cognition in Lung Cancer Patients.

    PubMed

    Rybacka-Mossakowska, J; Ramlau, R; Gazdulska, J; Gołda-Gocka, I; Kozubski, W; Michalak, S

    2016-01-01

    Cognitive impairment develops as a clinical manifestation of immune-mediated indirect effects of malignancy in lung cancer patients. This study aimed to evaluate the effects of humoral immune response on cognition in lung cancer patients. Fifty-one lung cancer patients were subjected to neurological examination: Mini Mental State Examination (MMSE), Trail Making Test (TMT), and Hamilton scale. The Psychology Experiment Building Language software was used for the evaluation of digit span, simple reaction time (SRT), and choice reaction time (CRT) tests. Serum samples were tested for the presence of onconeuronal antibodies and antineural antibodies. The results demonstrate that autoantibodies were found in 31 % patients. MMSE scores were lower (26.7 ± 2.7) in seropositive patients than in seronegative subjects (28.7 ± 1.2; p = 0.013). Executive functions were also influenced by the presence of autoantibodies. The humoral immune response in lung cancer patients affected both SRT and CRT. We conclude that the humoral immune response in lung cancer patients is associated with cognitive impairment. Cognitive impairment is associated with both specific reactions against onconeuronal or antineural antigens and non-organ specific reactions against nucleosome antigens.

  10. Neuroblastoma arginase activity creates an immunosuppressive microenvironment that impairs autologous and engineered immunity

    PubMed Central

    Mussai, Francis; Egan, Sharon; Hunter, Stuart; Webber, Hannah; Fisher, Jonathan; Wheat, Rachel; McConville, Carmel; Sbirkov, Yordan; Wheeler, Kate; Bendle, Gavin; Petrie, Kevin; Anderson, John; Chesler, Louis; De Santo, Carmela

    2015-01-01

    Neuroblastoma is the most common extra cranial solid tumour of childhood, and survival remains poor for patients with advanced disease. Novel immune therapies are currently in development, but clinical outcomes have not matched preclinical results. Here, we describe key mechanisms in which neuroblastoma inhibits the immune response. We show that murine and human neuroblastoma tumour cells suppress T cell proliferation, through increased arginase activity. Arginase II is the predominant isoform expressed and creates an arginine deplete local and systemic microenvironment. Neuroblastoma arginase activity results in inhibition of myeloid cell activation and suppression of bone marrow CD34+ progenitor proliferation. Finally we demonstrate that the arginase activity of neuroblastoma impairs NY-ESO-1 specific TCR and GD2-specific CAR engineered T cell proliferation and cytotoxicity. High arginase II expression correlates with poor survival for neuroblastoma patients. The results support the hypothesis that neuroblastoma creates an arginase-dependent immunosuppressive microenvironment in both the tumour and blood that leads to impaired immune surveillance and sub-optimal efficacy of immunotherapeutic approaches. PMID:26054597

  11. Parasitism and venom of ectoparasitoid Scleroderma guani impairs host cellular immunity.

    PubMed

    Li, Li-Fang; Xu, Zhi-Wen; Liu, Nai-Yong; Wu, Guo-Xing; Ren, Xue-Min; Zhu, Jia-Ying

    2018-06-01

    Venom is a prominently maternal virulent factor utilized by parasitoids to overcome hosts immune defense. With respect to roles of this toxic mixture involved in manipulating hosts immunity, great interest has been mostly restricted to Ichneumonoidea parasitoids associated with polydnavirus (PDV), of which venom is usually considered as a helper component to enhance the role of PDV, and limited Chalcidoidea species. In contrast, little information is available in other parasitoids, especially ectoparasitic species not carrying PDV. The ectoparasitoid Scleroderma guani injects venom into its host, Tenebrio molitor, implying its venom was involved in suppression of hosts immune response for successful parasitism. Thus, we investigated the effects of parasitism and venom of this parasitoid on counteracting the cellular immunity of its host by examining changes of hemocyte counts, and hemocyte spreading and encapsulation ability. Total hemocyte counts were elevated in parasitized and venom-injected pupae. The spreading behavior of both granulocytes and plasmatocytes was impaired by parasitization and venom. High concentration of venom led to more severely increased hemocyte counts and suppression of hemocyte spreading. The ability of hemocyte encapsulation was inhibited by venom in vitro. In addition to immediate effects observed, venom showed persistent interference in hosts cellular immunity. These results indicate that venom alone from S. guani plays a pivotal role in blocking hosts cellular immune response, serving as a regulator that guarantees the successful development of its progenies. The findings provide a foundation for further investigation of the underlying mechanisms in immune inhibitory action of S. guani venom. © 2018 Wiley Periodicals, Inc.

  12. Impaired humoral immunity and tolerance in K14-VEGFR-3-Ig mice that lack dermal lymphatic drainage

    PubMed Central

    Thomas, Susan N.; Rutkowski, Joseph M.; Pasquier, Miriella; Kuan, Emma L.; Alitalo, Kari; Randolph, Gwendalyn J.; Swartz, Melody A.

    2012-01-01

    Lymphatic vessels transport interstitial fluid, soluble antigen, and immune cells from peripheral tissues to lymph nodes (LNs), yet the contribution of peripheral lymphatic drainage to adaptive immunity remains poorly understood. We examined immune responses to dermal vaccination and contact hypersensitivity (CHS) challenge in K14-VEGFR-3-Ig mice, which lack dermal lymphatic capillaries and experience markedly depressed transport of solutes and dendritic cells from the skin to draining LNs. In response to dermal immunization, K14-VEGFR-3-Ig mice produced lower antibody titers. In contrast, although delayed, T cell responses were robust after 21 days, including high levels of antigen-specific CD8+ T cells and production of IFN-γ, IL-4 and IL-10 upon restimulation. T cell-mediated CHS responses were strong in K14-VEGFR-3-Ig mice, but importantly, their ability to induce CHS tolerance in the skin was impaired. Additionally, one-year-old mice displayed multiple signs of autoimmunity. These data suggest that lymphatic drainage plays more important roles in regulating humoral immunity and peripheral tolerance than in effector T cell immunity. PMID:22844119

  13. T cell-derived Lymphotoxin is Essential for anti-HSV-1 Humoral Immune Response.

    PubMed

    Yang, Kaiting; Liang, Yong; Sun, Zhichen; Xue, Diyuan; Xu, Hairong; Zhu, Mingzhao; Fu, Yang-Xin; Peng, Hua

    2018-05-09

    B cell-derived lymphotoxin (LT) is required for the development of follicular dendritic cell clusters for the formation of primary and secondary lymphoid follicles, but the role of T cell-derived LT in antibody response has not been well demonstrated. We observed that lymphotoxin-β-receptor (LTβR) signaling is essential for optimal humoral immune response and protection against an acute HSV-1 infection. Blocking the LTβR pathway caused poor maintenance of germinal center B (GC-B) cells and follicular helper T (Tfh) cells. Using bone marrow chimeric mice and adoptive transplantation, we determined that T cell-derived LT played an indispensable role in the humoral immune response to HSV-1. Up-regulation of IFNγ by the LTβR-Ig blockade impairs the sustainability of Tfh-like cells, thus leading to an impaired humoral immune response. Our findings have identified a novel role of T cell-derived LT in the humoral immune response against HSV-1 infection. IMPORTANCE Immunocompromised people are susceptible for HSV-1 infection and lethal recurrence, which could be inhibited by anti-HSV-1 humoral immune response in the host. This study sought to explore the role of T cell-derived LT in the anti-HSV-1 humoral immune response using LT-LTβR signaling deficient mice and the LTβR-Ig blockade. The data indicate that the T cell-derived LT may play an essential role in sustaining Tfh-like cells and ensure Tfh-like cells' migration into primary or secondary follicles for further maturation. This study provides insights for vaccine development against infectious diseases. Copyright © 2018 American Society for Microbiology.

  14. Anthrax Lethal Toxin Impairs Innate Immune Functions of Alveolar Macrophages and Facilitates Bacillus anthracis Survival

    PubMed Central

    Ribot, Wilson J.; Panchal, Rekha G.; Brittingham, Katherine C.; Ruthel, Gordon; Kenny, Tara A.; Lane, Douglas; Curry, Bob; Hoover, Timothy A.; Friedlander, Arthur M.; Bavari, Sina

    2006-01-01

    Alveolar macrophages (AM) are very important for pulmonary innate immune responses against invading inhaled pathogens because they directly kill the organisms and initiate a cascade of innate and adaptive immune responses. Although several factors contribute to inhalational anthrax, we hypothesized that unimpeded infection of Bacillus anthracis is directly linked to disabling the innate immune functions contributed by AM. Here, we investigated the effects of lethal toxin (LT), one of the binary complex virulence factors produced by B. anthracis, on freshly isolated nonhuman primate AM. Exposure of AM to doses of LT that killed susceptible macrophages had no effect on the viability of AM, despite complete MEK1 cleavage. Intoxicated AM remained fully capable of B. anthracis spore phagocytosis. However, pretreatment of AM with LT resulted in a significant decrease in the clearance of both the Sterne strain and the fully virulent Ames strain of B. anthracis, which may have been a result of impaired AM secretion of proinflammatory cytokines. Our data imply that cytolysis does not correlate with MEK1 cleavage, and this is the first report of LT-mediated impairment of nonhuman primate AM bactericidal activity against B. anthracis. PMID:16926394

  15. Unfolded protein response (UPR) signaling regulates arsenic trioxide-mediated macrophage innate immune function disruption

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Srivastava, Ritesh K.; Li, Changzhao; Chaudhary, Sandeep C.

    Arsenic exposure is known to disrupt innate immune functions in humans and in experimental animals. In this study, we provide a mechanism by which arsenic trioxide (ATO) disrupts macrophage functions. ATO treatment of murine macrophage cells diminished internalization of FITC-labeled latex beads, impaired clearance of phagocytosed fluorescent bacteria and reduced secretion of pro-inflammatory cytokines. These impairments in macrophage functions are associated with ATO-induced unfolded protein response (UPR) signaling pathway characterized by the enhancement in proteins such as GRP78, p-PERK, p-eIF2α, ATF4 and CHOP. The expression of these proteins is altered both at transcriptional and translational levels. Pretreatment with chemical chaperon,more » 4-phenylbutyric acid (PBA) attenuated the ATO-induced activation in UPR signaling and afforded protection against ATO-induced disruption of macrophage functions. This treatment also reduced ATO-mediated reactive oxygen species (ROS) generation. Interestingly, treatment with antioxidant N-acetylcysteine (NAC) prior to ATO exposure, not only reduced ROS production and UPR signaling but also improved macrophage functions. These data demonstrate that UPR signaling and ROS generation are interdependent and are involved in the arsenic-induced pathobiology of macrophage. These data also provide a novel strategy to block the ATO-dependent impairment in innate immune responses. - Highlights: • Inorganic arsenic to humans and experimental animals disrupt innate immune responses. • The mechanism underlying arsenic impaired macrophage functions involves UPR signaling. • Chemical chaperon attenuates arsenic-mediated macrophage function impairment. • Antioxidant, NAC blocks impairment in arsenic-treated macrophage functions.« less

  16. Targeting Peripheral-Derived Regulatory T Cells as a Means of Enhancing Immune Responses Directed against Prostate Cancer

    DTIC Science & Technology

    2017-08-01

    Award Number: W81XWH-15-1-0328 TITLE: Targeting Peripheral-Derived Regulatory T Cells as a Means of Enhancing Immune Responses Directed against...1 August 2016 - 31 July 2017 4. TITLE AND SUBTITLE Targeting Peripheral-Derived Regulatory T Cells as a Means of Enhancing Immune Responses Directed...discovered that a subset of regulatory T cells (Tregs), termed peripheral-derived Tregs (pTregs), impair immune responses directed against tumor

  17. Intrauterine Growth Restriction Impairs Small Intestinal Mucosal Immunity in Neonatal Piglets

    PubMed Central

    Dong, Li; Zhong, Xiang; Ahmad, Hussain; Li, Wei; Wang, Yuanxiao; Zhang, Lili

    2014-01-01

    Intrauterine growth restriction (IUGR) is a very common problem in both piglet and human neonate populations. We hypothesized that IUGR neonates have impaired intestinal mucosal immunity from birth. Using neonatal piglets as IUGR models, immune organ weights, the weight and length of the small intestine (SI), intestinal morphology, intraepithelial immune cell numbers, levels of cytokines and immunoglobulins, and the relative gene expression of cytokines in the SI were investigated. IUGR neonatal piglets were observed to have lower absolute immune organ weight and SI length, decreased relative weights of the thymus, spleen, mesenteric lymph node, and thinner but longer SIs. Damaged and jagged villi, shorter microvilli, presence of autophagosomes, swelled mitochondria, and decreased villus surface areas were also found in the SIs of IUGR neonatal piglets. We also found a smaller number of epithelial goblet cells and lymphocytes in the SIs of IUGR neonates. In addition, we detected reduced levels of the cytokines TNF-α and IFN-γ and decreased gene expression of cytokines in IUGR neonates. In conclusion, IUGR was shown to impair the mucosal immunity of the SI in neonatal piglets, and the ileum was the major site of impairment. PMID:24710659

  18. Candesartan ameliorates impaired fear extinction induced by innate immune activation.

    PubMed

    Quiñones, María M; Maldonado, Lizette; Velazquez, Bethzaly; Porter, James T

    2016-02-01

    Patients with post-traumatic stress disorder (PTSD) tend to show signs of a relatively increased inflammatory state suggesting that activation of the immune system may contribute to the development of PTSD. In the present study, we tested whether activation of the innate immune system can disrupt acquisition or recall of auditory fear extinction using an animal model of PTSD. Male adolescent rats received auditory fear conditioning in context A. The next day, an intraperitoneal injection of lipopolysaccharide (LPS; 100 μg/kg) prior to auditory fear extinction in context B impaired acquisition and recall of extinction. LPS (100 μg/kg) given after extinction training did not impair extinction recall suggesting that LPS did not affect consolidation of extinction. In contrast to cued fear extinction, contextual fear extinction was not affected by prior injection of LPS (100 μg/kg). Although LPS also reduced locomotion, we could dissociate the effects of LPS on extinction and locomotion by using a lower dose of LPS (50 μg/kg) which impaired locomotion without affecting extinction. In addition, 15 h after an injection of 250 μg/kg LPS in adult rats, extinction learning and recall were impaired without affecting locomotion. A sub-chronic treatment with candesartan, an angiotensin II type 1 receptor blocker, prevented the LPS-induced impairment of extinction in adult rats. Our results demonstrate that activation of the innate immune system can disrupt auditory fear extinction in adolescent and adult animals. These findings also provide direction for clinical studies of novel treatments that modulate the innate immune system for stress-related disorders like PTSD. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Inherited BCL10 deficiency impairs hematopoietic and nonhematopoietic immunity

    PubMed Central

    Torres, Juan Manuel; Martinez-Barricarte, Rubén; García-Gómez, Sonia; Mazariegos, Marina S.; Itan, Yuval; Boisson, Bertrand; ρlvarez, Rita; Jiménez-Reinoso, Anaïs; del Pino, Lucia; Rodríguez-Pena, Rebeca; Ferreira, Antonio; Hernández-Jiménez, Enrique; Toledano, Victor; Cubillos-Zapata, Carolina; Díaz-Almirón, Mariana; López-Collazo, Eduardo; Unzueta-Roch, José L.; Sánchez-Ramón, Silvia; Regueiro, Jose R.; López-Granados, Eduardo; Casanova, Jean-Laurent; Pérez de Diego, Rebeca

    2014-01-01

    Heterotrimers composed of B cell CLL/lymphoma 10 (BCL10), mucosa-associated lymphoid tissue lymphoma translocation protein 1 (MALT1), and caspase recruitment domain–containing (CARD) family adaptors play a role in NF-κB activation and have been shown to be involved in both the innate and the adaptive arms of immunity in murine models. Moreover, individuals with inherited defects of MALT1, CARD9, and CARD11 present with immunological and clinical phenotypes. Here, we characterized a case of autosomal-recessive, complete BCL10 deficiency in a child with a broad immunodeficiency, including defects of both hematopoietic and nonhematopoietic immunity. The patient died at 3 years of age and was homozygous for a loss-of-expression, loss-of-function BCL10 mutation. The effect of BCL10 deficiency was dependent on the signaling pathway, and, for some pathways, the cell type affected. Despite the noted similarities to BCL10 deficiency in mice, including a deficient adaptive immune response, human BCL10 deficiency in this patient resulted in a number of specific features within cell populations. Treatment of the patient’s myeloid cells with a variety of pathogen-associated molecular pattern molecules (PAMPs) elicited a normal response; however, NF-κB–mediated fibroblast functions were dramatically impaired. The results of this study indicate that inherited BCL10 deficiency should be considered in patients with combined immunodeficiency with B cell, T cell, and fibroblast defects. PMID:25365219

  20. Interference of Aspergillus fumigatus with the immune response.

    PubMed

    Heinekamp, Thorsten; Schmidt, Hella; Lapp, Katrin; Pähtz, Vera; Shopova, Iordana; Köster-Eiserfunke, Nora; Krüger, Thomas; Kniemeyer, Olaf; Brakhage, Axel A

    2015-03-01

    Aspergillus fumigatus is a saprotrophic filamentous fungus and also the most prevalent airborne fungal pathogen of humans. Depending on the host's immune status, the variety of diseases caused by A. fumigatus ranges from allergies in immunocompetent hosts to life-threatening invasive infections in patients with impaired immunity. In contrast to the majority of other Aspergillus species, which are in most cases nonpathogenic, A. fumigatus features an armory of virulence determinants to establish an infection. For example, A. fumigatus is able to evade the human complement system by binding or degrading complement regulators. Furthermore, the fungus interferes with lung epithelial cells, alveolar macrophages, and neutrophil granulocytes to prevent killing by these immune cells. This chapter summarizes the different strategies of A. fumigatus to manipulate the immune response. We also discuss the potential impact of recent advances in immunoproteomics to improve diagnosis and therapy of an A. fumigatus infection.

  1. Absorption of PCB126 by upper airways impairs G protein-coupled receptor-mediated immune response

    NASA Astrophysics Data System (ADS)

    Shimada, Ana Lúcia B.; Cruz, Wesley S.; Loiola, Rodrigo A.; Drewes, Carine C.; Dörr, Fabiane; Figueiredo, Natália G.; Pinto, Ernani; Farsky, Sandra H. P.

    2015-10-01

    PCB126 is a dioxin-like polychlorinated biphenyl (PCB) environmental pollutant with a significant impact on human health, as it bioaccumulates and causes severe toxicity. PCB126-induced immune toxicity has been described, although the mechanisms have not been fully elucidated. In this study, an in vivo protocol of PCB126 intoxication into male Wistar rats by intranasal route was used, which has not yet been described. The intoxication was characterised by PCB126 accumulation in the lungs and liver, and enhanced aryl hydrocarbon receptor expression in the liver, lungs, kidneys, and adipose tissues. Moreover, an innate immune deficiency was characterised by impairment of adhesion receptors on blood leukocytes and by reduced blood neutrophil locomotion and oxidative burst activation elicited by ex vivo G protein-coupled receptor (GPCR) activation. Specificity of PCB126 actions on the GPCR pathway was shown by normal burst oxidative activation evoked by Toll-like receptor 4 and protein kinase C direct activation. Moreover, in vivo PCB180 intoxication did not alter adhesion receptors on blood leukocytes either blood neutrophil locomotion, and only partially reduced the GPCR-induced burst oxidative activation on neutrophils. Therefore, a novel mechanism of in vivo PCB126 toxicity is described which impairs a pivotal inflammatory pathway to the host defence against infections.

  2. Innate Immune Responses of Drosophila melanogaster Are Altered by Spaceflight

    PubMed Central

    Marcu, Oana; Lera, Matthew P.; Sanchez, Max E.; Levic, Edina; Higgins, Laura A.; Shmygelska, Alena; Fahlen, Thomas F.; Nichol, Helen; Bhattacharya, Sharmila

    2011-01-01

    Alterations and impairment of immune responses in humans present a health risk for space exploration missions. The molecular mechanisms underpinning innate immune defense can be confounded by the complexity of the acquired immune system of humans. Drosophila (fruit fly) innate immunity is simpler, and shares many similarities with human innate immunity at the level of molecular and genetic pathways. The goals of this study were to elucidate fundamental immune processes in Drosophila affected by spaceflight and to measure host-pathogen responses post-flight. Five containers, each containing ten female and five male fruit flies, were housed and bred on the space shuttle (average orbit altitude of 330.35 km) for 12 days and 18.5 hours. A new generation of flies was reared in microgravity. In larvae, the immune system was examined by analyzing plasmatocyte number and activity in culture. In adults, the induced immune responses were analyzed by bacterial clearance and quantitative real-time polymerase chain reaction (qPCR) of selected genes following infection with E. coli. The RNA levels of relevant immune pathway genes were determined in both larvae and adults by microarray analysis. The ability of larval plasmatocytes to phagocytose E. coli in culture was attenuated following spaceflight, and in parallel, the expression of genes involved in cell maturation was downregulated. In addition, the level of constitutive expression of pattern recognition receptors and opsonins that specifically recognize bacteria, and of lysozymes, antimicrobial peptide (AMP) pathway and immune stress genes, hallmarks of humoral immunity, were also reduced in larvae. In adults, the efficiency of bacterial clearance measured in vivo following a systemic infection with E. coli post-flight, remained robust. We show that spaceflight altered both cellular and humoral immune responses in Drosophila and that the disruption occurs at multiple interacting pathways. PMID:21264297

  3. Immune-responsiveness of CD4+ T cells during Streptococcus suis serotype 2 infection

    PubMed Central

    Lecours, Marie-Pier; Letendre, Corinne; Clarke, Damian; Lemire, Paul; Galbas, Tristan; Benoit-Biancamano, Marie-Odile; Thibodeau, Jacques; Gottschalk, Marcelo; Segura, Mariela

    2016-01-01

    The pathogenesis of Streptococcus suis infection, a major swine and human pathogen, is only partially understood and knowledge on the host adaptive immune response is critically scarce. Yet, S. suis virulence factors, particularly its capsular polysaccharide (CPS), enable this bacterium to modulate dendritic cell (DC) functions and potentially impair the immune response. This study aimed to evaluate modulation of T cell activation during S. suis infection and the role of DCs in this response. S. suis-stimulated total mouse splenocytes readily produced TNF-α, IL-6, IFN-γ, CCL3, CXCL9, and IL-10. Ex vivo and in vivo analyses revealed the involvement of CD4+ T cells and a Th1 response. Nevertheless, during S. suis infection, levels of the Th1-derived cytokines TNF-α and IFN-γ were very low. A transient splenic depletion of CD4+ T cells and a poor memory response were also observed. Moreover, CD4+ T cells secreted IL-10 and failed to up-regulate optimal levels of CD40L and CD69 in coculture with DCs. The CPS hampered release of several T cell-derived cytokines in vitro. Finally, a correlation was established between severe clinical signs of S. suis disease and impaired antibody responses. Altogether, these results suggest S. suis interferes with the adaptive immune response. PMID:27905502

  4. Leptin, immune responses and autoimmune disease. Perspectives on the use of leptin antagonists.

    PubMed

    Peelman, F; Iserentant, H; Eyckerman, S; Zabeau, L; Tavernier, J

    2005-01-01

    The pivotal role of leptin in regulating body weight and energy homeostasis is very well established. More recently, leptin also emerged as an important regulator of T-cell-dependent immunity. Reduced leptin levels, as observed during periods of starvation, correlate with an impaired cellular immune response, whereby especially the T(H)1 pro-inflammatory immune response appears to be affected. Physiologically, this could reflect the high energy demand of such processes, which are suppressed in animals or people with nutrient shortage. Several autoimmune diseases are T(H)1 T-cell dependent. In line with a pro-inflammatory role for leptin, animal models of leptin deficiency are markedly resistant to a variety of T-cell dependent autoimmune diseases. Here, we review the role of leptin in immune responses, with emphasis on autoimmune diseases. The design and potential use of leptin antagonists is also discussed.

  5. Impairment of immunity to Candida and Mycobacterium in humans with bi-allelic RORC mutations*

    PubMed Central

    Halwani, Rabih; Ma, Cindy S.; Wong, Natalie; Soudais, Claire; Henderson, Lauren A.; Marzouqa, Hiyam; Shamma, Jamal; Gonzalez, Marcela; Martinez-Barricarte, Rubén; Okada, Chizuru; Avery, Danielle T.; Latorre, Daniela; Deswarte, Caroline; Jabot-Hanin, Fabienne; Torrado, Egidio; Fountain, Jeffrey; Belkadi, Aziz; Itan, Yuval; Boisson, Bertrand; Migaud, Mélanie; Arlehamn, Cecilia S. Lindestam; Sette, Alessandro; Breton, Sylvain; McCluskey, James; Rossjohn, Jamie; de Villartay, Jean-Pierre; Moshous, Despina; Hambleton, Sophie; Latour, Sylvain; Arkwright, Peter D.; Picard, Capucine; Lantz, Olivier; Engelhard, Dan; Kobayashi, Masao; Abel, Laurent; Casanova, Jean-Laurent

    2015-01-01

    Human inborn errors of immunity mediated by the cytokines interleukin (IL)-17A/F underlie mucocutaneous candidiasis, whereas inborn errors of interferon (IFN)-γ immunity underlie mycobacterial disease. We report the discovery of bi-allelic RORC loss-of-function mutations in seven individuals from three kindreds of different ethnic origins with both candidiasis and mycobacteriosis. The lack of functional RORγ and RORγT isoforms resulted in the absence of IL-17A/F-producing T cells in these individuals, probably accounting for their chronic candidiasis. Unexpectedly, leukocytes from RORγ- and RORγT-deficient individuals also displayed an impaired IFN-γ response to Mycobacterium. This principally reflected profoundly defective IFN-γ production by circulating γδ T cells and CD4+CCR6+ CXCR3+ αβ T cells. In humans, both mucocutaneous immunity to Candida and systemic immunity to Mycobacterium require RORγ, or RORγT, or both. PMID:26160376

  6. Ebola haemorrhagic fever virus: pathogenesis, immune responses, potential prevention.

    PubMed

    Marcinkiewicz, Janusz; Bryniarski, Krzysztof; Nazimek, Katarzyna

    2014-01-01

    Ebola zoonotic RNA filovirus represents human most virulent and lethal pathogens, which induces acute hemorrhagic fever and death within few days in a range of 60-90% of symptomatic individuals. Last outbreak in 2014 in West Africa caused panic that Ebola epidemic can be spread to other continents. Number of deaths in late December reached almost 8,000 individuals out of more than 20,000 symptomatic patients. It seems that only a coordinated international response could counteract the further spread of Ebola. Major innate immunity mechanisms against Ebola are associated with the production of interferons, that are inhibited by viral proteins. Activation of host NK cells was recognized as a leading immune function responsible for recovery of infected people. Uncontrolled cell infection by Ebola leads to an impairment of immunity with cytokine storm, coagulopathy, systemic bleeding, multi-organ failure and death. Tested prevention strategies to induce antiviral immunity include: i. recombinant virus formulations (vaccines); ii. cocktail of monoclonal antibodies (serotherapy); iii. alternative RNA-interference-based antiviral methods. Maintaining the highest standards of aseptic and antiseptic precautions is equally important. Present brief review summarizes a current knowledge concerning pathogenesis of Ebola hemorrhagic disease and the virus interaction with the immune system and discusses recent advances in prevention of Ebola infection by vaccination and serotherapy.

  7. Impaired Cytokine Responses to Epstein-Barr Virus Antigens in Systemic Lupus Erythematosus Patients

    PubMed Central

    Draborg, Anette Holck; Sandhu, Noreen; Larsen, Nanna; Lisander Larsen, Janni; Jacobsen, Søren; Houen, Gunnar

    2016-01-01

    We analyzed cytokine responses against latent and lytic Epstein-Barr virus (EBV) antigens in systemic lupus erythematosus (SLE) patients and healthy controls (HCs) to obtain an overview of the distinctive immune regulatory response in SLE patients and to expand the previously determined impaired EBV-directed T-cell response. The concentrations of 14 cytokines (IL2, IL4, IL5, IL6, IL10, IL12, IL17, IL18, IL1β, IFNγ, TNFα, TNFβ, TGFβ, and GM-CSF) were quantified upon stimulation of whole blood with latent state antigen EBNA1, lytic cycle antigen EBV-EA/D, and the superantigen SEB. To avoid results affected by lack of lymphocytes, we focused on SLE patients with normal levels. Decreased induction of IL12, IFNγ, IL17, and IL6 upon EBNA1 stimulation and that of IFNγ, IL6, TNFβ, IL1β, and GM-CSF upon EBV-EA/D stimulation were detected in SLE patients compared to HCs. IFNγ responses, especially, were shown to be reduced. Induction of several cytokines was furthermore impaired in SLE patients upon SEB stimulation, but no difference was observed in basic levels. Results substantiate the previously proposed impaired regulation of the immune response against latent and lytic cycle EBV infection in SLE patients without lymphopenia. Furthermore, results indicate general dysfunction of leukocytes and their cytokine regulations in SLE patients. PMID:27110576

  8. Impaired cellular immune response to tetanus toxoid but not to cytomegalovirus in effectively HAART-treated HIV-infected children.

    PubMed

    Alsina, Laia; Noguera-Julian, Antoni; Fortuny, Clàudia

    2013-05-07

    Despite of highly active antiretroviral therapy, the response to vaccines in HIV-infected children is poor and short-lived, probably due to a defect in cellular immune responses. We compared the cellular immune response (assessed in terms of IFN-γ production) to tetanus toxoid and to cytomegalovirus in a series of 13 HIV-perinatally-infected children and adolescents with optimal immunovirological response to first line antiretroviral therapy, implemented during chronic infection. A stronger cellular response to cytomegalovirus (11 out of 13 patients) was observed, as compared to tetanus toxoid (1 out of 13; p=0.003). These results suggest that the repeated exposition to CMV, as opposed to the past exposition to TT, is able to maintain an effective antigen-specific immune response in stable HIV-infected pediatric patients and strengthen current recommendations on immunization practices in these children. Copyright © 2013. Published by Elsevier Ltd.

  9. [Mucosal immunity with emphasis on urinary tract immunity and diabetes].

    PubMed

    Krejsek, J; Kudlová, M; Kolácková, M; Novosad, J

    2008-05-01

    Protective immune response in urinary tract is frequently impaired in patients with diabetes. Immunity in this mucosal compartment displays unique characteristics; e.g. absence of physiological microflora and lack of mucus. Pathogens are identified by the PRR receptors expressed on both epithelial and immune cells. Inflammatory response characterised by the acumulation ofgranulocytes is followed. Both protective and harm characteristics of inflammatory response are inseparable linked and delineated by gene polymorphisms in PRR receptors.

  10. Impaired interferon signaling is a common immune defect in human cancer

    PubMed Central

    Critchley-Thorne, Rebecca J.; Simons, Diana L.; Yan, Ning; Miyahira, Andrea K.; Dirbas, Frederick M.; Johnson, Denise L.; Swetter, Susan M.; Carlson, Robert W.; Fisher, George A.; Koong, Albert; Holmes, Susan; Lee, Peter P.

    2009-01-01

    Immune dysfunction develops in patients with many cancer types and may contribute to tumor progression and failure of immunotherapy. Mechanisms underlying cancer-associated immune dysfunction are not fully understood. Efficient IFN signaling is critical to lymphocyte function; animals rendered deficient in IFN signaling develop cancer at higher rates. We hypothesized that altered IFN signaling may be a key mechanism of immune dysfunction common to cancer. To address this, we assessed the functional responses to IFN in peripheral blood lymphocytes from patients with 3 major cancers: breast cancer, melanoma, and gastrointestinal cancer. Type-I IFN (IFN-α)-induced signaling was reduced in T cells and B cells from all 3 cancer-patient groups compared to healthy controls. Type-II IFN (IFN-γ)-induced signaling was reduced in B cells from all 3 cancer patient groups, but not in T cells or natural killer cells. Impaired-IFN signaling was equally evident in stage II, III, and IV breast cancer patients, and downstream functional defects in T cell activation were identified. Taken together, these findings indicate that defects in lymphocyte IFN signaling arise in patients with breast cancer, melanoma, and gastrointestinal cancer, and these defects may represent a common cancer-associated mechanism of immune dysfunction. PMID:19451644

  11. Impairment of blood brain barrier is related with the neuroinflammation induced peripheral immune status in intracerebroventricular colchicine injected rats: An experimental study with mannitol.

    PubMed

    Sil, Susmita; Ghosh, Arijit; Ghosh, Tusharkanti

    2016-09-01

    The neurodegeneration in AD patients may be associated with changes of peripheral immune responses. Some peripheral immune responses are altered due to neuroinflammation in colchicine induced AD (cAD) rats. The leaky blood brain barrier (BBB) in cAD-rats may be involved in inducing peripheral inflammation, though there is no report in this regard. Therefore, the present study was designed to investigate the role of BBB in cADrats by altering the BBB in a time dependent manner with injection (i.v.) of mannitol (BBB opener). The inflammatory markers in the brain and serum along with the peripheral immune responses were measured after 30 and 60min of mannitol injection in cAD rats. The results showed higher inflammatory markers in the hippocampus and serum along with alterations in peripheral immune parameters in cAD rats. Although the hippocampal inflammatory markers did not further change after mannitol injection in cAD rats, the serum inflammatory markers and peripheral immune responses were altered and these changes were greater after 60min than that of 30min of mannitol injection. The present study shows that the peripheral immune responses in cAD rats after 30 and 60min of mannitol injection are related to magnitude of impairment of BBB in these conditions. It can be concluded from this study that impairment of BBB in cAD rats is related to the changes of peripheral immune responses observed in that condition. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Assessment of the innate immune response in the periparturient cow.

    PubMed

    Trevisi, Erminio; Minuti, Andrea

    2018-02-01

    The transition period is the most critical phase in the life of high yielding dairy cows. Within a few weeks, cows are submitted to many challenges (physiological, nutritional, psychological, management) that require prompt and effective adaptive responses. The immune system is involved in this process, and many changes of the cow's immune system components have been observed around calving. Cows are considered to be immunosuppressed in late lactation, and available data suggest that the immune system is dysregulated around parturition. Significant attention has been focused on modification of cellular functions (e.g. the reduction of phagocytosis and diapedesis), but growing interest concerns the components of the innate immune system, which often exhibits increased responses such as susceptibility to inflammatory events and the related acute phase response (APR). Systemic inflammation plays a significant role in early lactation, affects many liver functions and has been associated with the impairment of cow performance (i.e. reduced feed intake, milk yield, fertility, welfare). The assessment of variations in immune-metabolic indices offers opportunities to predict the onset of the health troubles and to anticipate the proper therapies needed to guarantee health, good welfare and fertility in the following lactation. The frequency of diseases (metabolic and infectious) before calving is rare, but several clues suggest that various metabolic and immune variations can begin during the dry period. Interesting preliminary results encourage this perspective and possible candidates are suggested. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. [T-lymphocytes--do they control rheumatic immune responses?].

    PubMed

    Wagner, U; Schulze-Koops, H

    2005-09-01

    T cells, in particular CD4(+) T cells, have been implicated in mediating many aspects of rheumatoid inflammation. In rheumatoid arthritis (RA), CD4(+) T cells display various functional abnormalities in the synovium as well as in the peripheral circulation. Current evidence suggests, however, that the role of CD4(+) T cells in the development of rheumatoid inflammation exceeds that of activated pro-inflammatory effector T cells that drive the chronic autoimmune response. Subsets of CD4(+) T cells with regulatory capacity, such as CD25(+) Tregs, have been identified in mice and man, and recent observations suggest that in RA, the function of these regulatory T cells is severely impaired. Thus, in RA, defective regulatory immune mechanisms might allow the breakdown of peripheral tolerance, following which the detrimental CD4(+) T-cell-driven immune response evolves and proceeds to chronic inflammation. Here, we review the functional abnormalities and the contribution of different T-cell subsets to rheumatoid inflammation.

  14. Connecting impairment, disability, and handicap in immune mediated polyneuropathies

    PubMed Central

    Merkies, I; Schmitz, P; van der Meche, F G A; Samijn, J; van Doorn, P A

    2003-01-01

    Background: In the World Health Organisation (WHO) International Classification of Impairments, Disabilities, and Handicaps (ICIDH), it is suggested that various levels of outcome are associated with one another. However, the ICIDH has been criticised on the grounds that it only represents a general, non-specific relation between its entities. Objective: To examine the significance of the ICIDH in immune mediated polyneuropathies. Methods: Four impairment measures (fatigue severity scale, MRC sum score, "INCAT" sensory sum score, grip strength with the Vigorimeter), five disability scales (nine hole peg test, 10 metres walking test, an overall disability sum score (ODSS), Hughes functional grading scale, Rankin scale), and a handicap scale (Rotterdam nine items handicap scale (RIHS9)) were assessed in 113 clinically stable patients (83 with Guillain–Barré syndrome, 22 with chronic inflammatory demyelinating polyneuropathy, eight with a gammopathy related polyneuropathy). Regression analyses with backward and forward stepwise strategies were undertaken to determine the correlation between the various levels of outcome (impairment on disability, impairment on handicap, disability leading to handicap, and impairment plus disability on handicap). Results: Impairment measures explained a substantial part of disability (R2 = 0.64) and about half of the variance in handicap (R2 = 0.52). Disability measures showed a stronger association with handicap (R2 = 0.76). Combining impairment and disability scales accounted for 77% of the variance in handicap (RIHS9) scores. Conclusions: In contrast to some suggestions, support for the ICIDH model is found in the current study because significant associations were shown between its various levels in patients with immune mediated polyneuropathies. Further studies are required to examine other possible contributors to deficits in daily life and social functioning in these conditions. PMID:12486276

  15. Maternal immunity enhances systemic recall immune responses upon oral immunization of piglets with F4 fimbriae.

    PubMed

    Nguyen, Ut V; Melkebeek, Vesna; Devriendt, Bert; Goetstouwers, Tiphanie; Van Poucke, Mario; Peelman, Luc; Goddeeris, Bruno M; Cox, Eric

    2015-06-23

    F4 enterotoxigenic Escherichia coli (ETEC) cause diarrhoea and mortality in piglets leading to severe economic losses. Oral immunization of piglets with F4 fimbriae induces a protective intestinal immune response evidenced by an F4-specific serum and intestinal IgA response. However, successful oral immunization of pigs with F4 fimbriae in the presence of maternal immunity has not been demonstrated yet. In the present study we aimed to evaluate the effect of maternal immunity on the induction of a systemic immune response upon oral immunization of piglets. Whereas F4-specific IgG and IgA could be induced by oral immunization of pigs without maternal antibodies and by intramuscular immunization of pigs with maternal antibodies, no such response was seen in the orally immunized animals with maternal antibodies. Since maternal antibodies can mask an antibody response, we also looked by ELIspot assays for circulating F4-specific antibody secreting cells (ASCs). Enumerating the F4-specific ASCs within the circulating peripheral blood mononuclear cells, and the number of F4-specific IgA ASCs within the circulating IgA(+) B-cells revealed an F4-specific immune response in the orally immunized animals with maternal antibodies. Interestingly, results suggest a more robust IgA booster response by oral immunization of pigs with than without maternal antibodies. These results demonstrate that oral immunization of piglets with F4-specific maternal antibodies is feasible and that these maternal antibodies seem to enhance the secondary systemic immune response. Furthermore, our ELIspot assay on enriched IgA(+) B-cells could be used as a screening procedure to optimize mucosal immunization protocols in pigs with maternal immunity.

  16. IMMUNODEFICIENCIES. Impairment of immunity to Candida and Mycobacterium in humans with bi-allelic RORC mutations.

    PubMed

    Okada, Satoshi; Markle, Janet G; Deenick, Elissa K; Mele, Federico; Averbuch, Dina; Lagos, Macarena; Alzahrani, Mohammed; Al-Muhsen, Saleh; Halwani, Rabih; Ma, Cindy S; Wong, Natalie; Soudais, Claire; Henderson, Lauren A; Marzouqa, Hiyam; Shamma, Jamal; Gonzalez, Marcela; Martinez-Barricarte, Rubén; Okada, Chizuru; Avery, Danielle T; Latorre, Daniela; Deswarte, Caroline; Jabot-Hanin, Fabienne; Torrado, Egidio; Fountain, Jeffrey; Belkadi, Aziz; Itan, Yuval; Boisson, Bertrand; Migaud, Mélanie; Arlehamn, Cecilia S Lindestam; Sette, Alessandro; Breton, Sylvain; McCluskey, James; Rossjohn, Jamie; de Villartay, Jean-Pierre; Moshous, Despina; Hambleton, Sophie; Latour, Sylvain; Arkwright, Peter D; Picard, Capucine; Lantz, Olivier; Engelhard, Dan; Kobayashi, Masao; Abel, Laurent; Cooper, Andrea M; Notarangelo, Luigi D; Boisson-Dupuis, Stéphanie; Puel, Anne; Sallusto, Federica; Bustamante, Jacinta; Tangye, Stuart G; Casanova, Jean-Laurent

    2015-08-07

    Human inborn errors of immunity mediated by the cytokines interleukin-17A and interleukin-17F (IL-17A/F) underlie mucocutaneous candidiasis, whereas inborn errors of interferon-γ (IFN-γ) immunity underlie mycobacterial disease. We report the discovery of bi-allelic RORC loss-of-function mutations in seven individuals from three kindreds of different ethnic origins with both candidiasis and mycobacteriosis. The lack of functional RORγ and RORγT isoforms resulted in the absence of IL-17A/F-producing T cells in these individuals, probably accounting for their chronic candidiasis. Unexpectedly, leukocytes from RORγ- and RORγT-deficient individuals also displayed an impaired IFN-γ response to Mycobacterium. This principally reflected profoundly defective IFN-γ production by circulating γδ T cells and CD4(+)CCR6(+)CXCR3(+) αβ T cells. In humans, both mucocutaneous immunity to Candida and systemic immunity to Mycobacterium require RORγ, RORγT, or both. Copyright © 2015, American Association for the Advancement of Science.

  17. Dietary Animal Plasma Proteins Improve the Intestinal Immune Response in Senescent Mice.

    PubMed

    Miró, Lluïsa; Garcia-Just, Alba; Amat, Concepció; Polo, Javier; Moretó, Miquel; Pérez-Bosque, Anna

    2017-12-11

    Increased life expectancy has promoted research on healthy aging. Aging is accompanied by increased non-specific immune activation (inflammaging) which favors the appearance of several disorders. Here, we study whether dietary supplementation with spray-dried animal plasma (SDP), which has been shown to reduce the activation of gut-associated lymphoid tissue (GALT) in rodents challenged by S. aureus enterotoxin B (SEB), and can also prevent the effects of aging on immune system homeostasis. We first characterized GALT in a mouse model of accelerated senescence (SAMP8) at different ages (compared to mice resistant to accelerated senescence; SAMR1). Second, we analyzed the SDP effects on GALT response to an SEB challenge in SAMP8 mice. In GALT characterization, aging increased the cell number and the percentage of activated Th lymphocytes in mesenteric lymph nodes and Peyer's patches (all, p < 0.05), as well as the expression of IL-6 and TNF-α in intestinal mucosa (both, p < 0.05). With respect to GALT response to the SEB challenge, young mice showed increased expression of intestinal IL-6 and TNF-α, as well as lymphocyte recruitment and activation (all, p < 0.05). However, the immune response of senescent mice to the SEB challenge was weak, since SEB did not change cell recruitment or the percentage of activated Th lymphocytes. Mice supplemented with SDP showed improved capacity to respond to the SEB challenge, similar to the response of the young mice. These results indicate that senescent mice have an impaired mucosal immune response characterized by unspecific GALT activation and a weak specific immune response. SDP supplementation reduces non-specific basal immune activation, allowing for the generation of specific responses.

  18. Arsenic and Immune Response to Infection During Pregnancy and Early Life.

    PubMed

    Attreed, Sarah E; Navas-Acien, Ana; Heaney, Christopher D

    2017-06-01

    Arsenic, a known carcinogen and developmental toxicant, is a major threat to global health. While the contribution of arsenic exposure to chronic diseases and adverse pregnancy and birth outcomes is recognized, its ability to impair critical functions of humoral and cell-mediated immunity-including the specific mechanisms in humans-is not well understood. Arsenic has been shown to increase risk of infectious diseases that have significant health implications during pregnancy and early life. Here, we review the latest research on the mechanisms of arsenic-related immune response alterations that could underlie arsenic-associated increased risk of infection during the vulnerable periods of pregnancy and early life. The latest evidence points to alteration of antibody production and transplacental transfer as well as failure of T helper cells to produce IL-2 and proliferate. Critical areas for future research include the effects of arsenic exposure during pregnancy and early life on immune responses to natural infection and the immunogenicity and efficacy of vaccines.

  19. Myeloid IKKβ Promotes Antitumor Immunity by Modulating CCL11 and the Innate Immune Response

    PubMed Central

    Yang, Jinming; Hawkins, Oriana E.; Barham, Whitney; Gilchuk, Pavlo; Boothby, Mark; Ayers, Gregory D.; Joyce, Sebastian; Karin, Michael; Yull, Fiona E.; Richmond, Ann

    2015-01-01

    Myeloid cells are capable of promoting or eradicating tumor cells and the nodal functions that contribute to their different roles are still obscure. Here, we show that mice with myeloid-specific genetic loss of the NF-κB pathway regulatory kinase IKKβ exhibit more rapid growth of cutaneous and lung melanoma tumors. In a BRAFV600E/PTEN−/− allograft model, IKKβ loss in macrophages reduced recruitment of myeloid cells into the tumor, lowered expression of MHC class II molecules, and enhanced production of the chemokine CCL11, thereby negatively regulating dendritic-cell maturation. Elevated serum and tissue levels of CCL11 mediated suppression of dendritic-cell differentiation/maturation within the tumor microenvironment, skewing it toward a Th2 immune response and impairing CD8+ T cell–mediated tumor cell lysis. Depleting macrophages or CD8+ T cells in mice with wild-type IKKβ myeloid cells enhanced tumor growth, where the myeloid cell response was used to mediate antitumor immunity against melanoma tumors (with less dependency on a CD8+ T-cell response). In contrast, myeloid cells deficient in IKKβ were compromised in tumor cell lysis, based on their reduced ability to phagocytize and digest tumor cells. Thus, mice with continuous IKKβ signaling in myeloid-lineage cells (IKKβCA) exhibited enhanced antitumor immunity and reduced melanoma outgrowth. Collectively, our results illuminate new mechanisms through which NF-κB signaling in myeloid cells promotes innate tumor surveillance. PMID:25336190

  20. Restimulation-induced T cell death through NTB-A/SAP signaling pathway is impaired in tuberculosis patients with depressed immune responses

    PubMed Central

    Hernández Del Pino, Rodrigo E.; Pellegrini, Joaquín M.; Rovetta, Ana I.; Peña, Delfina; Álvarez, Guadalupe I.; Rolandelli, Agustín; Musella, Rosa M.; Palmero, Domingo J.; Malbran, Alejandro; Pasquinelli, Virginia; García, Verónica E.

    2017-01-01

    Production of IFN-γ contributes to host defense against Mycobacterium tuberculosis (Mtb) infection. We previously demonstrated that Signaling lymphocytic activation molecule-associated protein (SAP) expression on cells from tuberculosis (TB) patients was inversely correlated with IFN-γ production. Here we first investigated the role of NK, T and B cell antigen (NTB-A)/SAP pathway in the regulation of Th1 response against Mtb. Upon antigen stimulation, NTB-A phosphorylation rapidly increases and afterwards modulates IFN-γ and IL-17 secretion. To sustain a healthy immune system, controlled expansion and contraction of lymphocytes, both during and after an adaptive immune response, is essential. Besides, restimulation-induced cell death (RICD) results in an essential homeostatic mechanism for precluding excess T-cell accumulation and associated immunopathology during the course of certain infections. Accordingly, we found that the NTB-A/SAP pathway was required for RICD during active tuberculosis. In low responder (LR) TB patients, impaired RICD was associated with diminished FASL levels, IL-2 production and CD25high expression after cell-restimulation. Interestingly, we next observed that SAP mediated the recruitment of the Src-related kinase FYNT, only in T cells from LR TB patients that were resistant to RICD. Together, we showed that the NTB-A/SAP pathway regulates T cell activation and RICD during human TB. Moreover, the NTB-A/SAP/FYNT axis promotes polarization to an unfavorable Th2-phenotype. PMID:28546549

  1. Restimulation-induced T-cell death through NTB-A/SAP signaling pathway is impaired in tuberculosis patients with depressed immune responses.

    PubMed

    Hernández Del Pino, Rodrigo E; Pellegrini, Joaquín M; Rovetta, Ana I; Peña, Delfina; Álvarez, Guadalupe I; Rolandelli, Agustín; Musella, Rosa M; Palmero, Domingo J; Malbran, Alejandro; Pasquinelli, Virginia; García, Verónica E

    2017-09-01

    Production of IFN-γ contributes to host defense against Mycobacterium tuberculosis (Mtb) infection. We previously demonstrated that Signaling lymphocytic activation molecule-associated protein (SAP) expression on cells from tuberculosis (TB) patients was inversely correlated with IFN-γ production. Here we first investigated the role of NK, T- and B-cell antigen (NTB-A)/SAP pathway in the regulation of Th1 response against Mtb. Upon antigen stimulation, NTB-A phosphorylation rapidly increases and afterwards modulates IFN-γ and IL-17 secretion. To sustain a healthy immune system, controlled expansion and contraction of lymphocytes, both during and after an adaptive immune response, is essential. Besides, restimulation-induced cell death (RICD) results in an essential homeostatic mechanism for precluding excess T-cell accumulation and associated immunopathology during the course of certain infections. Accordingly, we found that the NTB-A/SAP pathway was required for RICD during active tuberculosis. In low responder (LR) TB patients, impaired RICD was associated with diminished FASL levels, IL-2 production and CD25 high expression after cell-restimulation. Interestingly, we next observed that SAP mediated the recruitment of the Src-related kinase FYNT, only in T cells from LR TB patients that were resistant to RICD. Together, we showed that the NTB-A/SAP pathway regulates T-cell activation and RICD during human TB. Moreover, the NTB-A/SAP/FYNT axis promotes polarization to an unfavorable Th2-phenotype.

  2. [Impairment of the immune system caused by drugs].

    PubMed

    Pichler, W J

    1987-03-21

    The immune response and the ensuing inflammation relies on a complex interaction of cells and mediators. Various drugs can interfere with individual steps of the immune response, and in so doing they often imitate regulatory mechanisms of the immune system itself. The immunosuppressive effect of corticosteroids is based on changes in cell migration, reduced responsiveness of monocytes/macrophages to various stimuli and diminished production of interleukin-2. Cyclosporin A appears to block prolactin binding to prolactin receptors on lymphocytes, thus interfering with the immunostimulatory effect of prolactin. It also appears to have a Calmodulin antagonism and might thus block lymphokine production. Anticoagulants may block delayed type hypersensitivity reactions, since activation of the coagulation cascade is involved in this type of immune reaction. Attempts to use calcium channel blockers as immunosuppressive agents, or to take advantage of the immunoregulatory effects of adrenergic substances/blockers or other neurotransmitters, are of experimental value only.

  3. Gain-of-function human STAT1 mutations impair IL-17 immunity and underlie chronic mucocutaneous candidiasis.

    PubMed

    Liu, Luyan; Okada, Satoshi; Kong, Xiao-Fei; Kreins, Alexandra Y; Cypowyj, Sophie; Abhyankar, Avinash; Toubiana, Julie; Itan, Yuval; Audry, Magali; Nitschke, Patrick; Masson, Cécile; Toth, Beata; Flatot, Jérome; Migaud, Mélanie; Chrabieh, Maya; Kochetkov, Tatiana; Bolze, Alexandre; Borghesi, Alessandro; Toulon, Antoine; Hiller, Julia; Eyerich, Stefanie; Eyerich, Kilian; Gulácsy, Vera; Chernyshova, Ludmyla; Chernyshov, Viktor; Bondarenko, Anastasia; Grimaldo, Rosa María Cortés; Blancas-Galicia, Lizbeth; Beas, Ileana Maria Madrigal; Roesler, Joachim; Magdorf, Klaus; Engelhard, Dan; Thumerelle, Caroline; Burgel, Pierre-Régis; Hoernes, Miriam; Drexel, Barbara; Seger, Reinhard; Kusuma, Theresia; Jansson, Annette F; Sawalle-Belohradsky, Julie; Belohradsky, Bernd; Jouanguy, Emmanuelle; Bustamante, Jacinta; Bué, Mélanie; Karin, Nathan; Wildbaum, Gizi; Bodemer, Christine; Lortholary, Olivier; Fischer, Alain; Blanche, Stéphane; Al-Muhsen, Saleh; Reichenbach, Janine; Kobayashi, Masao; Rosales, Francisco Espinosa; Lozano, Carlos Torres; Kilic, Sara Sebnem; Oleastro, Matias; Etzioni, Amos; Traidl-Hoffmann, Claudia; Renner, Ellen D; Abel, Laurent; Picard, Capucine; Maródi, László; Boisson-Dupuis, Stéphanie; Puel, Anne; Casanova, Jean-Laurent

    2011-08-01

    Chronic mucocutaneous candidiasis disease (CMCD) may be caused by autosomal dominant (AD) IL-17F deficiency or autosomal recessive (AR) IL-17RA deficiency. Here, using whole-exome sequencing, we identified heterozygous germline mutations in STAT1 in 47 patients from 20 kindreds with AD CMCD. Previously described heterozygous STAT1 mutant alleles are loss-of-function and cause AD predisposition to mycobacterial disease caused by impaired STAT1-dependent cellular responses to IFN-γ. Other loss-of-function STAT1 alleles cause AR predisposition to intracellular bacterial and viral diseases, caused by impaired STAT1-dependent responses to IFN-α/β, IFN-γ, IFN-λ, and IL-27. In contrast, the 12 AD CMCD-inducing STAT1 mutant alleles described here are gain-of-function and increase STAT1-dependent cellular responses to these cytokines, and to cytokines that predominantly activate STAT3, such as IL-6 and IL-21. All of these mutations affect the coiled-coil domain and impair the nuclear dephosphorylation of activated STAT1, accounting for their gain-of-function and dominance. Stronger cellular responses to the STAT1-dependent IL-17 inhibitors IFN-α/β, IFN-γ, and IL-27, and stronger STAT1 activation in response to the STAT3-dependent IL-17 inducers IL-6 and IL-21, hinder the development of T cells producing IL-17A, IL-17F, and IL-22. Gain-of-function STAT1 alleles therefore cause AD CMCD by impairing IL-17 immunity.

  4. Immune oncology, immune responsiveness and the theory of everything.

    PubMed

    Turan, Tolga; Kannan, Deepti; Patel, Maulik; Matthew Barnes, J; Tanlimco, Sonia G; Lu, Rongze; Halliwill, Kyle; Kongpachith, Sarah; Kline, Douglas E; Hendrickx, Wouter; Cesano, Alessandra; Butterfield, Lisa H; Kaufman, Howard L; Hudson, Thomas J; Bedognetti, Davide; Marincola, Francesco; Samayoa, Josue

    2018-06-05

    Anti-cancer immunotherapy is encountering its own checkpoint. Responses are dramatic and long lasting but occur in a subset of tumors and are largely dependent upon the pre-existing immune contexture of individual cancers. Available data suggest that three landscapes best define the cancer microenvironment: immune-active, immune-deserted and immune-excluded. This trichotomy is observable across most solid tumors (although the frequency of each landscape varies depending on tumor tissue of origin) and is associated with cancer prognosis and response to checkpoint inhibitor therapy (CIT). Various gene signatures (e.g. Immunological Constant of Rejection - ICR and Tumor Inflammation Signature - TIS) that delineate these landscapes have been described by different groups. In an effort to explain the mechanisms of cancer immune responsiveness or resistance to CIT, several models have been proposed that are loosely associated with the three landscapes. Here, we propose a strategy to integrate compelling data from various paradigms into a "Theory of Everything". Founded upon this unified theory, we also propose the creation of a task force led by the Society for Immunotherapy of Cancer (SITC) aimed at systematically addressing salient questions relevant to cancer immune responsiveness and immune evasion. This multidisciplinary effort will encompass aspects of genetics, tumor cell biology, and immunology that are pertinent to the understanding of this multifaceted problem.

  5. Caloric Restriction reduces inflammation and improves T cell-mediated immune response in obese mice but concomitant consumption of curcumin/piperine adds no further benefit

    USDA-ARS?s Scientific Manuscript database

    Obesity is associated with low-grade inflammation and impaired immune response. Caloric restriction (CR) has been shown to inhibit inflammatory response and enhance cell-mediated immune function. Curcumin, the bioactive phenolic component of turmeric spice, is proposed to have anti-obesity and anti-...

  6. Impaired Immune Response to Primary but Not to Booster Vaccination Against Hepatitis B in Older Adults.

    PubMed

    Weinberger, Birgit; Haks, Mariëlle C; de Paus, Roelof A; Ottenhoff, Tom H M; Bauer, Tanja; Grubeck-Loebenstein, Beatrix

    2018-01-01

    Many current vaccines are less immunogenic and less effective in elderly compared to younger adults due to age-related changes of the immune system. Most vaccines utilized in the elderly contain antigens, which the target population has had previous contact with due to previous vaccination or infection. Therefore, most studies investigating vaccine-induced immune responses in the elderly do not analyze responses to neo-antigens but rather booster responses. However, age-related differences in the immune response could differentially affect primary versus recall responses. We therefore investigated the impact of age on primary and recall antibody responses following hepatitis B vaccination in young and older adults. Focused gene expression profiling was performed before and 1 day after the vaccination in order to identify gene signatures predicting antibody responses. Young (20-40 years; n  = 24) and elderly (>60 years; n  = 17) healthy volunteers received either a primary series (no prior vaccination) or a single booster shot (documented primary vaccination more than 10 years ago). Antibody titers were determined at days 0, 7, and 28, as well as 6 months after the vaccination. After primary vaccination, antibody responses were lower and delayed in the elderly compared to young adults. Non-responders after the three-dose primary series were only observed in the elderly group. Maximum antibody concentrations after booster vaccination were similar in both age groups. Focused gene expression profiling identified 29 transcripts that correlated with age at baseline and clustered in a network centered around type I interferons and pro-inflammatory cytokines. In addition, smaller 8- and 6-gene signatures were identified at baseline that associated with vaccine responsiveness during primary and booster vaccination, respectively. When evaluating the kinetic changes in gene expression profiles before and after primary vaccination, a 33-gene signature

  7. Alteration of cell wall xylan acetylation triggers defense responses that counterbalance the immune deficiencies of plants impaired in the β-subunit of the heterotrimeric G-protein.

    PubMed

    Escudero, Viviana; Jordá, Lucía; Sopeña-Torres, Sara; Mélida, Hugo; Miedes, Eva; Muñoz-Barrios, Antonio; Swami, Sanjay; Alexander, Danny; McKee, Lauren S; Sánchez-Vallet, Andrea; Bulone, Vincent; Jones, Alan M; Molina, Antonio

    2017-11-01

    Arabidopsis heterotrimeric G-protein complex modulates pathogen-associated molecular pattern-triggered immunity (PTI) and disease resistance responses to different types of pathogens. It also plays a role in plant cell wall integrity as mutants impaired in the Gβ- (agb1-2) or Gγ-subunits have an altered wall composition compared with wild-type plants. Here we performed a mutant screen to identify suppressors of agb1-2 (sgb) that restore susceptibility to pathogens to wild-type levels. Out of the four sgb mutants (sgb10-sgb13) identified, sgb11 is a new mutant allele of ESKIMO1 (ESK1), which encodes a plant-specific polysaccharide O-acetyltransferase involved in xylan acetylation. Null alleles (sgb11/esk1-7) of ESK1 restore to wild-type levels the enhanced susceptibility of agb1-2 to the necrotrophic fungus Plectosphaerella cucumerina BMM (PcBMM), but not to the bacterium Pseudomonas syringae pv. tomato DC3000 or to the oomycete Hyaloperonospora arabidopsidis. The enhanced resistance to PcBMM of the agb1-2 esk1-7 double mutant was not the result of the re-activation of deficient PTI responses in agb1-2. Alteration of cell wall xylan acetylation caused by ESK1 impairment was accompanied by an enhanced accumulation of abscisic acid, the constitutive expression of genes encoding antibiotic peptides and enzymes involved in the biosynthesis of tryptophan-derived metabolites, and the accumulation of disease resistance-related secondary metabolites and different osmolites. These esk1-mediated responses counterbalance the defective PTI and PcBMM susceptibility of agb1-2 plants, and explain the enhanced drought resistance of esk1 plants. These results suggest that a deficient PTI-mediated resistance is partially compensated by the activation of specific cell-wall-triggered immune responses. © 2017 The Authors The Plant Journal published by John Wiley & Sons Ltd and Society for Experimental Biology.

  8. Nonencapsulated Trichinella pseudospiralis Infection Impairs Follicular Helper T Cell Differentiation with Subclass-Selective Decreases in Antibody Responses

    PubMed Central

    Asano, Kazunobu; Wu, Zhiliang; Srinontong, Piyarat; Ikeda, Takahide; Nagano, Isao; Morita, Hirokuyi

    2016-01-01

    Infectious microorganisms often modify host immunity to escape from immune elimination. Trichinella is a unique nematode of the helminth family, whose members parasitize the muscle cells inside the host without robust eliminative reactions. There are several species of Trichinella; some develop in muscle cells that become encapsulated (e.g., Trichinella spiralis) and others in cells that do not encapsulate (e.g., Trichinella pseudospiralis). It has already been established that Trichinella infection affects host immune responses in several experimental immune diseases in animal models; however, most of those studies were done using T. spiralis infection. As host immune responses to T. spiralis and T. pseudospiralis infections have been reported to be different, it is necessary to clarify how T. pseudospiralis infection influences the host immune responses. In this study, we investigated the influence on host humoral immunity in T. pseudospiralis-infected mice. We demonstrated that T. pseudospiralis infection decreased antigen-specific IgG2a and IgG2b antibody (Ab) production in mice immunized with a model antigen. This selective decrease in gamma interferon (IFN-γ)-dependent Ab production was not due to a decrease in IFN-γ production, and we instead found impaired follicular helper T (Tfh) cell differentiation. The affinity maturation of antigen-specific Ab tended to be delayed but was not significant in T. pseudospiralis-infected mice. We also observed that CD11b+ spleen cells in T. pseudospiralis-infected mice expressed CD206 and PD-L2, the phenotype of which was M2 macrophages with weak production of interleukin-6 (IL-6), possibly resulting in impaired Tfh differentiation. Taken together, our results indicate that nonencapsulated Trichinella infection induces selective dampening in humoral immunity with the suppression of Tfh differentiation. PMID:27736779

  9. Nonencapsulated Trichinella pseudospiralis Infection Impairs Follicular Helper T Cell Differentiation with Subclass-Selective Decreases in Antibody Responses.

    PubMed

    Asano, Kazunobu; Wu, Zhiliang; Srinontong, Piyarat; Ikeda, Takahide; Nagano, Isao; Morita, Hirokuyi; Maekawa, Yoichi

    2016-12-01

    Infectious microorganisms often modify host immunity to escape from immune elimination. Trichinella is a unique nematode of the helminth family, whose members parasitize the muscle cells inside the host without robust eliminative reactions. There are several species of Trichinella; some develop in muscle cells that become encapsulated (e.g., Trichinella spiralis) and others in cells that do not encapsulate (e.g., Trichinella pseudospiralis). It has already been established that Trichinella infection affects host immune responses in several experimental immune diseases in animal models; however, most of those studies were done using T. spiralis infection. As host immune responses to T. spiralis and T. pseudospiralis infections have been reported to be different, it is necessary to clarify how T. pseudospiralis infection influences the host immune responses. In this study, we investigated the influence on host humoral immunity in T. pseudospiralis-infected mice. We demonstrated that T. pseudospiralis infection decreased antigen-specific IgG2a and IgG2b antibody (Ab) production in mice immunized with a model antigen. This selective decrease in gamma interferon (IFN-γ)-dependent Ab production was not due to a decrease in IFN-γ production, and we instead found impaired follicular helper T (Tfh) cell differentiation. The affinity maturation of antigen-specific Ab tended to be delayed but was not significant in T. pseudospiralis-infected mice. We also observed that CD11b + spleen cells in T. pseudospiralis-infected mice expressed CD206 and PD-L2, the phenotype of which was M2 macrophages with weak production of interleukin-6 (IL-6), possibly resulting in impaired Tfh differentiation. Taken together, our results indicate that nonencapsulated Trichinella infection induces selective dampening in humoral immunity with the suppression of Tfh differentiation. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  10. Fallen Angels or Risen Apes? A Tale of the Intricate Complexities of Imbalanced Immune Responses in the Pathogenesis and Progression of Immune-Mediated and Viral Cancers

    PubMed Central

    Ondondo, Beatrice Omusiro

    2014-01-01

    Excessive immune responses directed against foreign pathogens, self-antigens, or commensal microflora can cause cancer establishment and progression if the execution of tight immuno-regulatory mechanisms fails. On the other hand, induction of potent tumor antigen-specific immune responses together with stimulation of the innate immune system is a pre-requisite for effective anti-tumor immunity, and if suppressed by the strong immuno-regulatory mechanisms can lead to cancer progression. Therefore, it is crucial that the inevitable co-existence of these fundamental, yet conflicting roles of immune-regulatory cells is carefully streamlined as imbalances can be detrimental to the host. Infection with chronic persistent viruses is characterized by severe immune dysfunction resulting in T cell exhaustion and sometimes deletion of antigen-specific T cells. More often, this is due to increased immuno-regulatory processes, which are triggered to down-regulate immune responses and limit immunopathology. However, such heightened levels of immune disruption cause a concomitant loss of tumor immune-surveillance and create a permissive microenvironment for cancer establishment and progression, as demonstrated by increased incidences of cancer in immunosuppressed hosts. Paradoxically, while some cancers arise as a consequence of increased immuno-regulatory mechanisms that inhibit protective immune responses and impinge on tumor surveillance, other cancers arise due to impaired immuno-regulatory mechanisms and failure to limit pathogenic inflammatory responses. This intricate complexity, where immuno-regulatory cells can be beneficial in certain immune settings but detrimental in other settings underscores the need for carefully formulated interventions to equilibrate the balance between immuno-stimulatory and immuno-regulatory processes. PMID:24639678

  11. Toll immune signal activates cellular immune response via eicosanoids.

    PubMed

    Shafeeq, Tahir; Ahmed, Shabbir; Kim, Yonggyun

    2018-07-01

    Upon immune challenge, insects recognize nonself. The recognition signal will propagate to nearby immune effectors. It is well-known that Toll signal pathway induces antimicrobial peptide (AMP) gene expression. Eicosanoids play crucial roles in mediating the recognition signal to immune effectors by enhancing humoral immune response through activation of AMP synthesis as well as cellular immune responses, suggesting a functional cross-talk between Toll and eicosanoid signals. This study tested a cross-talk between these two signals. Two signal transducing factors (MyD88 and Pelle) of Toll immune pathway were identified in Spodoptera exigua. RNA interference (RNAi) of either SeMyD88 or SePelle expression interfered with the expression of AMP genes under Toll signal pathway. Bacterial challenge induced PLA 2 enzyme activity. However, RNAi of these two immune factors significantly suppressed the induction of PLA 2 enzyme activity. Furthermore, RNAi treatment prevented gene expression of cellular PLA 2 . Inhibition of PLA 2 activity reduced phenoloxidase activity and subsequent suppression in cellular immune response measured by hemocyte nodule formation. However, immunosuppression induced by RNAi of Toll signal molecules was significantly reversed by addition of arachidonic acid (AA), a catalytic product of PLA 2 . The addition also significantly reduced the enhanced fungal susceptibility of S. exigua treated by RNAi against two Toll signal molecules. These results indicate that there is a cross-talk between Toll and eicosanoid signals in insect immunity. Copyright © 2018 Elsevier Ltd. All rights reserved.

  12. Gain-of-function human STAT1 mutations impair IL-17 immunity and underlie chronic mucocutaneous candidiasis

    PubMed Central

    Liu, Luyan; Okada, Satoshi; Kong, Xiao-Fei; Kreins, Alexandra Y.; Cypowyj, Sophie; Abhyankar, Avinash; Toubiana, Julie; Itan, Yuval; Audry, Magali; Nitschke, Patrick; Masson, Cécile; Toth, Beata; Flatot, Jérome; Migaud, Mélanie; Chrabieh, Maya; Kochetkov, Tatiana; Bolze, Alexandre; Borghesi, Alessandro; Toulon, Antoine; Hiller, Julia; Eyerich, Stefanie; Eyerich, Kilian; Gulácsy, Vera; Chernyshova, Ludmyla; Chernyshov, Viktor; Bondarenko, Anastasia; María Cortés Grimaldo, Rosa; Blancas-Galicia, Lizbeth; Madrigal Beas, Ileana Maria; Roesler, Joachim; Magdorf, Klaus; Engelhard, Dan; Thumerelle, Caroline; Burgel, Pierre-Régis; Hoernes, Miriam; Drexel, Barbara; Seger, Reinhard; Kusuma, Theresia; Jansson, Annette F.; Sawalle-Belohradsky, Julie; Belohradsky, Bernd; Jouanguy, Emmanuelle; Bustamante, Jacinta; Bué, Mélanie; Karin, Nathan; Wildbaum, Gizi; Bodemer, Christine; Lortholary, Olivier; Fischer, Alain; Blanche, Stéphane; Al-Muhsen, Saleh; Reichenbach, Janine; Kobayashi, Masao; Rosales, Francisco Espinosa; Lozano, Carlos Torres; Kilic, Sara Sebnem; Oleastro, Matias; Etzioni, Amos; Traidl-Hoffmann, Claudia; Renner, Ellen D.; Abel, Laurent; Picard, Capucine; Maródi, László; Boisson-Dupuis, Stéphanie

    2011-01-01

    Chronic mucocutaneous candidiasis disease (CMCD) may be caused by autosomal dominant (AD) IL-17F deficiency or autosomal recessive (AR) IL-17RA deficiency. Here, using whole-exome sequencing, we identified heterozygous germline mutations in STAT1 in 47 patients from 20 kindreds with AD CMCD. Previously described heterozygous STAT1 mutant alleles are loss-of-function and cause AD predisposition to mycobacterial disease caused by impaired STAT1-dependent cellular responses to IFN-γ. Other loss-of-function STAT1 alleles cause AR predisposition to intracellular bacterial and viral diseases, caused by impaired STAT1-dependent responses to IFN-α/β, IFN-γ, IFN-λ, and IL-27. In contrast, the 12 AD CMCD-inducing STAT1 mutant alleles described here are gain-of-function and increase STAT1-dependent cellular responses to these cytokines, and to cytokines that predominantly activate STAT3, such as IL-6 and IL-21. All of these mutations affect the coiled-coil domain and impair the nuclear dephosphorylation of activated STAT1, accounting for their gain-of-function and dominance. Stronger cellular responses to the STAT1-dependent IL-17 inhibitors IFN-α/β, IFN-γ, and IL-27, and stronger STAT1 activation in response to the STAT3-dependent IL-17 inducers IL-6 and IL-21, hinder the development of T cells producing IL-17A, IL-17F, and IL-22. Gain-of-function STAT1 alleles therefore cause AD CMCD by impairing IL-17 immunity. PMID:21727188

  13. Innate immune response to Burkholderia mallei.

    PubMed

    Saikh, Kamal U; Mott, Tiffany M

    2017-06-01

    Burkholderia mallei is a facultative intracellular pathogen that causes the highly contagious and often the fatal disease, glanders. With its high rate of infectivity via aerosol and recalcitrance toward antibiotics, this pathogen is considered a potential biological threat agent. This review focuses on the most recent literature highlighting host innate immune response to B. mallei. Recent studies focused on elucidating host innate immune responses to the novel mechanisms and virulence factors employed by B. mallei for survival. Studies suggest that pathogen proteins manipulate various cellular processes, including host ubiquitination pathways, phagosomal escape, and actin-cytoskeleton rearrangement. Immune-signaling molecules such as Toll-like receptors, nucleotode-binding oligomerization domain, myeloid differentiation primary response protein 88, and proinflammatory cytokines such as interferon-gamma and tumor necrosis factor-α, play key roles in the induction of innate immune responses. Modifications in B. mallei lipopolysaccharide, in particular, the lipid A acyl groups, stimulate immune responses via Toll-like receptor4 activation that may contribute to persistent infection. Mortality is high because of septicemia and immune pathogenesis with B. mallei exposure. An effective innate immune response is critical to controlling the acute phase of the infection. Both vaccination and therapeutic approaches are necessary for complete protection against B. mallei.

  14. Innate immune response to Burkholderia mallei

    PubMed Central

    Saikh, Kamal U.; Mott, Tiffany M.

    2017-01-01

    Purpose of review Burkholderia mallei is a facultative intracellular pathogen that causes the highly contagious and often the fatal disease, glanders. With its high rate of infectivity via aerosol and recalcitrance toward antibiotics, this pathogen is considered a potential biological threat agent. This review focuses on the most recent literature highlighting host innate immune response to B. mallei. Recent findings Recent studies focused on elucidating host innate immune responses to the novel mechanisms and virulence factors employed by B. mallei for survival. Studies suggest that pathogen proteins manipulate various cellular processes, including host ubiquitination pathways, phagosomal escape, and actin–cytoskeleton rearrangement. Immune-signaling molecules such as Toll-like receptors, nucleotode-binding oligomerization domain, myeloid differentiation primary response protein 88, and proinflammatory cytokines such as interferon-gamma and tumor necrosis factor-α, play key roles in the induction of innate immune responses. Modifications in B. mallei lipopolysaccharide, in particular, the lipid A acyl groups, stimulate immune responses via Toll-like receptor4 activation that may contribute to persistent infection. Summary Mortality is high because of septicemia and immune pathogenesis with B. mallei exposure. An effective innate immune response is critical to controlling the acute phase of the infection. Both vaccination and therapeutic approaches are necessary for complete protection against B. mallei. PMID:28177960

  15. HTLV-1 Tax impairs K63-linked ubiquitination of STING to evade host innate immunity.

    PubMed

    Wang, Jie; Yang, Shuai; Liu, Lu; Wang, Hui; Yang, Bo

    2017-03-15

    The cellular antiviral innate immune system is essential for host defense and viruses have evolved a variety of strategies to evade the innate immunity. Human T lymphotropic virus type 1 (HTLV-1) belongs to the deltaretrovirus family and it can establish persistent infection in human beings for many years. However, how this virus evades the host innate immune responses remains unclear. Here we report a new strategy used by HTLV-1 to block innate immune responses. We observed that stimulator of interferon genes (STING) limited HTLV-1 protein expression and was critical to HTLV-1 reverse transcription intermediate (RTI) ssDNA90 triggered interferon (IFN)-β production in phorbol12-myristate13-acetate (PMA)-differentiated THP1 (PMA-THP1) cells. The HTLV-1 protein Tax inhibited STING overexpression induced transcriptional activation of IFN-β. Tax also impaired poly(dA:dT), interferon stimulatory DNA (ISD) or cyclic GMP-AMP (cGAMP) -stimulated IFN-β production, which was dependent on STING activation. Coimmunoprecipitation assays and confocal microscopy indicated that Tax was associated with STING in the same complex. Mechanistic studies suggested that Tax decreased the K63-linked ubiquitination of STING and disrupted the interactions between STING and TANK-binding kinase 1 (TBK1). These findings may shed more light on the molecular mechanisms underlying HTLV-1 infection. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Impaired human responses to tetanus toxoid in vitamin A-deficient SCID mice reconstituted with human peripheral blood lymphocytes.

    PubMed Central

    Molrine, D C; Polk, D B; Ciamarra, A; Phillips, N; Ambrosino, D M

    1995-01-01

    Vitamin A deficiency is associated with increased childhood morbidity and mortality from respiratory and diarrheal diseases. In order to evaluate the effect of vitamin A on human antibody responses, we developed a vitamin A-deficient severe combined immunodeficient (SCID) mouse model. Vitamin A-deficient mice were produced by depriving them of vitamin A at day 7 of gestation. Mice were reconstituted with human peripheral blood lymphocytes (huPBL) from tetanus toxoid immune donors at 6 weeks of age and immunized with tetanus toxoid at 6 and 8 weeks of age. Secondary human antibody responses were determined 10 days later. The geometric mean human anti-tetanus toxoid immunoglobulin G concentrations were 3.75 micrograms/ml for the deficient mice and 148 micrograms/ml for controls (P = 0.0005). Vitamin A-deficient mice had only a 2.9-fold increase in human anti-tetanus toxoid antibody compared with a 74-fold increase in controls (P < 0.01). Supplementation with vitamin A prior to reconstitution restored human antibody responses to normal. These data suggest that vitamin A deficiency impairs human antibody responses. We speculate that impaired responses could increase susceptibility to certain infections. Furthermore, we propose that effects of other nutritional deficiencies on the human immune system could be evaluated in the SCID-huPBL model. PMID:7622207

  17. Tilapia show immunization response against Ich

    USDA-ARS?s Scientific Manuscript database

    This study compares the immune response of Nile tilapia and red tilapia against parasite Ichthyophthirius multifiliis (Ich) using a cohabitation challenge model. Both Nile and red tilapia showed strong immune response post immunization with live Ich theronts by IP injection or immersion. Blood serum...

  18. The immune response to human CMV

    PubMed Central

    La Rosa, Corinna; Diamond, Don J

    2012-01-01

    This review will summarize and interpret recent literature regarding the human CMV immune response, which is among the strongest measured and is the focus of attention for numerous research groups. CMV is a highly prevalent, globally occurring infection that rarely elicits disease in healthy immunocompetent hosts. The human immune system is unable to clear CMV infection and latency, but mounts a spirited immune-defense targeting multiple immune-evasion genes encoded by this dsDNA β-herpes virus. Additionally, the magnitude of cellular immune response devoted to CMV may cause premature immune senescence, and the high frequencies of cytolytic T cells may aggravate vascular pathologies. However, uncontrolled CMV viremia and life-threatening symptoms, which occur readily after immunosuppression and in the immature host, clearly indicate the essential role of immunity in maintaining asymptomatic co-existence with CMV. Approaches for harnessing the host immune response to CMV are needed to reduce the burden of CMV complications in immunocompromised individuals. PMID:23308079

  19. Serum Immune Responses Predict Rapid Disease Progression among Children with Crohn’s Disease: Immune Responses Predict Disease Progression

    PubMed Central

    Dubinsky, Marla C.; Lin, Ying-Chao; Dutridge, Debra; Picornell, Yoana; Landers, Carol J.; Farrior, Sharmayne; Wrobel, Iwona; Quiros, Antonio; Vasiliauskas, Eric A.; Grill, Bruce; Israel, David; Bahar, Ron; Christie, Dennis; Wahbeh, Ghassan; Silber, Gary; Dallazadeh, Saied; Shah, Praful; Thomas, Danny; Kelts, Drew; Hershberg, Robert M.; Elson, Charles O.; Targan, Stephan R.; Taylor, Kent D.; Rotter, Jerome I.; Yang, Huiying

    2007-01-01

    BACKGROUND AND AIM Crohn’s disease (CD) is a heterogeneous disorder characterized by diverse clinical phenotypes. Childhood-onset CD has been described as a more aggressive phenotype. Genetic and immune factors may influence disease phenotype and clinical course. We examined the association of immune responses to microbial antigens with disease behavior and prospectively determined the influence of immune reactivity on disease progression in pediatric CD patients. METHODS Sera were collected from 196 pediatric CD cases and tested for immune responses: anti-I2, anti-outer membrane protein C (anti-OmpC), anti-CBir1 flagellin (anti-CBir1), and anti-Saccharomyces-cerevisiae (ASCA) using ELISA. Associations between immune responses and clinical phenotype were evaluated. RESULTS Fifty-eight patients (28%) developed internal penetrating and/or stricturing (IP/S) disease after a median follow-up of 18 months. Both anti-OmpC (p < 0.0006) and anti-I2 (p < 0.003) were associated with IP/S disease. The frequency of IP/S disease increased with increasing number of immune responses (p trend = 0.002). The odds of developing IP/S disease were highest in patients positive for all four immune responses (OR (95% CI): 11 (1.5–80.4); p = 0.03). Pediatric CD patients positive for ≥1 immune response progressed to IP/S disease sooner after diagnosis as compared to those negative for all immune responses (p < 0.03). CONCLUSIONS The presence and magnitude of immune responses to microbial antigens are significantly associated with more aggressive disease phenotypes among children with CD. This is the first study to prospectively demonstrate that the time to develop a disease complication in children is significantly faster in the presence of immune reactivity, thereby predicting disease progression to more aggressive disease phenotypes among pediatric CD patients. PMID:16454844

  20. Capture-related stressors impair immune system function in sablefish

    USGS Publications Warehouse

    Lupes, S.C.; Davis, M.W.; Olla, B.L.; Schreck, C.B.

    2006-01-01

    The sablefish Anoplopoma fimbria is a valuable North Pacific Ocean species that, when not targeted in various commercial fisheries, is often a part of discarded bycatch. Predictions of the survival of discarded fish are dependent on understanding how a fish responds to stressful conditions. Our objective was to describe the immunological health of sablefish exposed to capture stressors. In laboratory experiments designed to simulate the capture process, we subjected sablefish to various stressors that might influence survival: towing in a net, hooking, elevated seawater and air temperatures, and air exposure time. After stress was imposed, the in vitro mitogen-stimulated proliferation of sablefish leukocytes was used to evaluate the function of the immune system in an assay we validated for this species. The results demonstrated that regardless of fishing gear type, exposure to elevated seawater temperature, or time in air, the leukocytes from stressed sablefish exhibited significantly diminished proliferative responses to the T-cell mitogen, concanavalin A, or the B-cell mitogen, lipopolysaccharide. There was no difference in the immunological responses associated with seawater or air temperature. The duration and severity of the capture stressors applied in our study were harsh enough to induce significantly elevated levels of plasma cortisol and glucose, but there was no difference in the magnitude of levels among stressor treatments. These data suggest that immunological suppression occurs in sablefish subjected to capture-related stressors. The functional impairment of the immune system after capture presents a potential reason why delayed mortality is possible in discarded sablefish. Further studies are needed to determine whether delayed mortality in discarded sablefish can be caused by increased susceptibility to infectious agents resulting from stressor-mediated immunosuppression.

  1. NK cells influence both innate and adaptive immune responses after mucosal immunisation with antigen and mucosal adjuvant*

    PubMed Central

    Hall, Lindsay J; Clare, Simon; Dougan, Gordon

    2012-01-01

    NK cells were found to be recruited in a temporally controlled manner to the nasal-associated lymphoid tissue and the cervical lymph nodes of mice following intranasal immunisation with Ag85B-ESAT6 antigen from Mycobacterium tuberculosis mixed with Escherichia coli heat-labile toxin as adjuvant. These NK cells were activated and they secreted a diverse range of cytokines and other immunmodulators. Using antibody depletion targeting anti-asialo GM1, we found evidence for altered trafficking, impaired activation and cytokine secretion of dendritic cells, macrophages and neutrophils in immunised NK cell depleted mice compared to control animals. Analysis of antigen-specific immune responses revealed an attenuated antibody and cytokine response in immunised NK cell depleted animals. Systemic administration of rIL-6 but not rIFN-γ significantly restored immune responses in mice depleted of NK cells. In conclusion, cytokine production, particularly IL-6, via NK cells and NK cell activated immune populations, plays an important role in the establishment of local innate immune responses and the consequent development of adaptive immunity after mucosal immunisation. PMID:20220095

  2. Changes in the immune system are conditioned by nutrition.

    PubMed

    Marcos, A; Nova, E; Montero, A

    2003-09-01

    Undernutrition due to insufficient intake of energy and macronutrients and/or due to deficiencies in specific micronutrients impairs the immune system, suppressing immune functions that are fundamental to host protection. The most consistent abnormalities are seen in cell-mediated immunity, complement system, phagocyte function, cytokine production, mucosal secretory antibody response, and antibody affinity. There is a number of physiological situations such as ageing and performance of intense physical exercise associated with an impairment of some immune parameters' response. Nutrition can influence the extent of immune alteration in both of them. There are also numerous pathological situations in which nutrition plays a role as a primary or secondary determinant of some underlying immunological impairments. This includes obesity, eating disorders (anorexia nervosa and bulimia nervosa), food hypersensitivity and gastrointestinal disorders as some examples. The implications of nutrition on immune function in these disorders are briefly reviewed.

  3. The Effect of Rituximab on Vaccine Responses in Patients with Immune Thrombocytopenia

    PubMed Central

    Nazi, Ishac; Kelton, John G.; Larché, Mark; Snider, Denis P.; Heddle, Nancy M.; Crowther, Mark A.; Cook, Richard J.; Tinmouth, Alan T.; Mangel, Joy; Arnold, Donald M.

    2013-01-01

    B-cell depletion therapy may impair vaccine responses and increase infection risk in patients with immune thrombocytopenia (ITP). Capitalizing on a multicenter randomized placebo-controlled trial, we investigated the effects of rituximab on the antibody and cellular responses to Streptococcus pneumoniae polysaccharide vaccine and Haemophilus influenzae type b (Hib) conjugate vaccine in ITP patients. Of 60 patients in the main trial, 24 patients received both vaccines 6 months after rituximab (n=17) or placebo (n=7). Among 20 evaluable patients, 3/14 (21%) in the rituximab group and 4/6 (67%) in the placebo group achieved a 4-fold increase in anti-pneumococcal antibodies (p=0.12). For anti-Hib antibodies, 4/14 (29%) and 5/6 (83%), respectively, achieved a 4-fold increase (p<0.05). Fewer patients in the rituximab group demonstrated functional Hib killing (2/14 [14%] versus 5/6 [83%], p<0.05). Three of 14 rituximab-treated patients failed to respond to vaccines by any criteria. After vaccinations, pre-plasma cell blasts and interferon-γ secreting T-cells were reduced in rituximab-treated patients. We found that antibody responses were impaired for at least 6 months after rituximab. Cellular immunity was reduced in parallel with the depleted B-cell pool. These findings have implications for the timing of vaccinations and the mechanism of infection after rituximab in patients with ITP. PMID:23851398

  4. IL-6-mediated environmental conditioning of defective Th1 differentiation dampens antitumour immune responses in old age.

    PubMed

    Tsukamoto, Hirotake; Senju, Satoru; Matsumura, Keiko; Swain, Susan L; Nishimura, Yasuharu

    2015-04-07

    Decline in immune function and inflammation concomitantly develop with ageing. Here we focus on the impact of this inflammatory environment on T cells, and demonstrate that in contrast to successful tumour elimination in young mice, replenishment of tumour-specific CD4(+) T cells fails to induce tumour regression in aged hosts. The impaired antitumour effect of CD4(+) T cells with their defective Th1 differentiation in an aged environment is restored by interleukin (IL)-6 blockade or IL-6 deficiency. IL-6 blockade also restores the impaired ability of CD4(+) T cells to promote CD8(+) T-cell-dependent tumour elimination in aged mice, which requires IFN-γ. Furthermore, IL-6-stimulated production of IL-4/IL-21 through c-Maf induction is responsible for impaired Th1 differentiation. IL-6 also contributes to IL-10 production from CD4(+) T cells in aged mice, causing attenuated responses of CD8(+) T cells. These findings suggest that IL-6 serves as an extrinsic factor counteracting CD4(+) T-cell-mediated immunity against tumour in old age.

  5. Immune activation alters cellular and humoral responses to yellow fever 17D vaccine.

    PubMed

    Muyanja, Enoch; Ssemaganda, Aloysius; Ngauv, Pearline; Cubas, Rafael; Perrin, Helene; Srinivasan, Divya; Canderan, Glenda; Lawson, Benton; Kopycinski, Jakub; Graham, Amanda S; Rowe, Dawne K; Smith, Michaela J; Isern, Sharon; Michael, Scott; Silvestri, Guido; Vanderford, Thomas H; Castro, Erika; Pantaleo, Giuseppe; Singer, Joel; Gillmour, Jill; Kiwanuka, Noah; Nanvubya, Annet; Schmidt, Claudia; Birungi, Josephine; Cox, Josephine; Haddad, Elias K; Kaleebu, Pontiano; Fast, Patricia; Sekaly, Rafick-Pierre; Trautmann, Lydie; Gaucher, Denis

    2014-07-01

    Defining the parameters that modulate vaccine responses in African populations will be imperative to design effective vaccines for protection against HIV, malaria, tuberculosis, and dengue virus infections. This study aimed to evaluate the contribution of the patient-specific immune microenvironment to the response to the licensed yellow fever vaccine 17D (YF-17D) in an African cohort. We compared responses to YF-17D in 50 volunteers in Entebbe, Uganda, and 50 volunteers in Lausanne, Switzerland. We measured the CD8+ T cell and B cell responses induced by YF-17D and correlated them with immune parameters analyzed by flow cytometry prior to vaccination. We showed that YF-17D-induced CD8+ T cell and B cell responses were substantially lower in immunized individuals from Entebbe compared with immunized individuals from Lausanne. The impaired vaccine response in the Entebbe cohort associated with reduced YF-17D replication. Prior to vaccination, we observed higher frequencies of exhausted and activated NK cells, differentiated T and B cell subsets and proinflammatory monocytes, suggesting an activated immune microenvironment in the Entebbe volunteers. Interestingly, activation of CD8+ T cells and B cells as well as proinflammatory monocytes at baseline negatively correlated with YF-17D-neutralizing antibody titers after vaccination. Additionally, memory T and B cell responses in preimmunized volunteers exhibited reduced persistence in the Entebbe cohort but were boosted by a second vaccination. Together, these results demonstrate that an activated immune microenvironment prior to vaccination impedes efficacy of the YF-17D vaccine in an African cohort and suggest that vaccine regimens may need to be boosted in African populations to achieve efficient immunity. Registration is not required for observational studies. This study was funded by Canada's Global Health Research Initiative, Defense Threat Reduction Agency, National Institute of Allergy and Infectious Diseases

  6. Immune activation alters cellular and humoral responses to yellow fever 17D vaccine

    PubMed Central

    Muyanja, Enoch; Ssemaganda, Aloysius; Ngauv, Pearline; Cubas, Rafael; Perrin, Helene; Srinivasan, Divya; Canderan, Glenda; Lawson, Benton; Kopycinski, Jakub; Graham, Amanda S.; Rowe, Dawne K.; Smith, Michaela J.; Isern, Sharon; Michael, Scott; Silvestri, Guido; Vanderford, Thomas H.; Castro, Erika; Pantaleo, Giuseppe; Singer, Joel; Gillmour, Jill; Kiwanuka, Noah; Nanvubya, Annet; Schmidt, Claudia; Birungi, Josephine; Cox, Josephine; Haddad, Elias K.; Kaleebu, Pontiano; Fast, Patricia; Sekaly, Rafick-Pierre; Trautmann, Lydie

    2014-01-01

    Background. Defining the parameters that modulate vaccine responses in African populations will be imperative to design effective vaccines for protection against HIV, malaria, tuberculosis, and dengue virus infections. This study aimed to evaluate the contribution of the patient-specific immune microenvironment to the response to the licensed yellow fever vaccine 17D (YF-17D) in an African cohort. Methods. We compared responses to YF-17D in 50 volunteers in Entebbe, Uganda, and 50 volunteers in Lausanne, Switzerland. We measured the CD8+ T cell and B cell responses induced by YF-17D and correlated them with immune parameters analyzed by flow cytometry prior to vaccination. Results. We showed that YF-17D–induced CD8+ T cell and B cell responses were substantially lower in immunized individuals from Entebbe compared with immunized individuals from Lausanne. The impaired vaccine response in the Entebbe cohort associated with reduced YF-17D replication. Prior to vaccination, we observed higher frequencies of exhausted and activated NK cells, differentiated T and B cell subsets and proinflammatory monocytes, suggesting an activated immune microenvironment in the Entebbe volunteers. Interestingly, activation of CD8+ T cells and B cells as well as proinflammatory monocytes at baseline negatively correlated with YF-17D–neutralizing antibody titers after vaccination. Additionally, memory T and B cell responses in preimmunized volunteers exhibited reduced persistence in the Entebbe cohort but were boosted by a second vaccination. Conclusion. Together, these results demonstrate that an activated immune microenvironment prior to vaccination impedes efficacy of the YF-17D vaccine in an African cohort and suggest that vaccine regimens may need to be boosted in African populations to achieve efficient immunity. Trial registration. Registration is not required for observational studies. Funding. This study was funded by Canada’s Global Health Research Initiative, Defense

  7. The nociception genes painless and Piezo are required for the cellular immune response of Drosophila larvae to wasp parasitization.

    PubMed

    Tokusumi, Yumiko; Tokusumi, Tsuyoshi; Schulz, Robert A

    2017-05-13

    In vertebrates, interaction between the nervous system and immune system is important to protect a challenged host from stress inputs from external sources. In this study, we demonstrate that sensory neurons are involved in the cellular immune response elicited by wasp infestation of Drosophila larvae. Multidendritic class IV neurons sense contacts from external stimuli and induce avoidance behaviors for host defense. Our findings show that inactivation of these sensory neurons impairs the cellular response against wasp parasitization. We also demonstrate that the nociception genes encoding the mechanosensory receptors Painless and Piezo, both expressed in class IV neurons, are essential for the normal cellular immune response to parasite challenge. Copyright © 2017. Published by Elsevier Inc.

  8. Immune endophenotypes in children with Autism Spectrum Disorder

    PubMed Central

    Careaga, Milo; Rogers, Sally; Hansen, Robin L.; Amaral, David G.; de Water, Judy Van; Ashwood, Paul

    2015-01-01

    Background Autism Spectrum Disorder (ASD) is characterized by social communication deficits and restricted, repetitive patterns of behavior. Varied immunological findings have been reported in children with ASD. To address the question of heterogeneity in immune responses, we sought to examine the diversity of immune profiles within a representative cohort of boys with ASD. Methods Peripheral blood mononuclear cells (PBMC) from male children with ASD (n=50) and from typically developing (TD) age-matched male controls (n=16) were stimulated with either lipopolysaccharide (LPS) or phytohaemagglutinin (PHA). Cytokine production was assessed after stimulation. The ASD study population was clustered into subgroups based on immune responses and assessed for behavioral outcomes. Results Children with ASD who had a pro-inflammatory profile based on LPS stimulation were more developmentally impaired as assessed by the Mullen's Scale of Early Learning (MSEL). They also had greater impairments in social affect as measured by the Autism Diagnostic Observation Schedule (ADOS). These children also displayed more frequent sleep disturbances and episodes of aggression. Similarly, children with ASD and a more activated T cell cytokine profile after PHA stimulation were more developmentally impaired as measured by the MSEL. Conclusions Children with ASD may be phenotypically characterized based upon their immune profile. Those showing either a pro-inflammatory response or increased T cell activation/skewing display a more impaired behavioral profile than children with non-inflamed or non-T cell activated immune profiles. These data suggest that there may be several possible immune subphenotypes within the ASD population that correlate with more severe behavioral impairments. PMID:26493496

  9. Impairment of manual but not saccadic response inhibition following acute alcohol intoxication.

    PubMed

    Campbell, Anne Eileen; Chambers, Christopher D; Allen, Christopher P G; Hedge, Craig; Sumner, Petroc

    2017-12-01

    Alcohol impairs response inhibition; however, it remains contested whether such impairments affect a general inhibition system, or whether affected inhibition systems are embedded in, and specific to, each response modality. Further, alcohol-induced impairments have not been disambiguated between proactive and reactive inhibition mechanisms, and nor have the contributions of action-updating impairments to behavioural 'inhibition' deficits been investigated. Forty Participants (25 female) completed both a manual and a saccadic stop-signal reaction time (SSRT) task before and after a 0.8g/kg dose of alcohol and, on a separate day, before and after a placebo. Blocks in which participants were required to ignore the signal to stop or make an additional 'dual' response were included to obtain measures of proactive inhibition as well as updating of attention and action. Alcohol increased manual but not saccadic SSRT. Proactive inhibition was weakly reduced by alcohol, but increases in the reaction times used to baseline this contrast prevent clear conclusions regarding response caution. Finally, alcohol also increased secondary dual response times of the dual task uniformly as a function of the delay between tasks, indicating an effect of alcohol on action-updating or execution. The modality-specific effects of alcohol favour the theory that response inhibition systems are embedded within response modalities, rather than there existing a general inhibition system. Concerning alcohol, saccadic control appears relatively more immune to disruption than manual control, even though alcohol affects saccadic latency and velocity. Within the manual domain, alcohol affects multiple types of action updating, not just inhibition. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  10. 17D yellow fever vaccine elicits comparable long-term immune responses in healthy individuals and immune-compromised patients.

    PubMed

    Wieten, R W; Goorhuis, A; Jonker, E F F; de Bree, G J; de Visser, A W; van Genderen, P J J; Remmerswaal, E B M; Ten Berge, I J M; Visser, L G; Grobusch, M P; van Leeuwen, E M M

    2016-06-01

    The 17D live attenuated yellow fever (YF) vaccine is contra-indicated in immune-compromised individuals and may elicit a suboptimal immunologic response. The aim of this study is to assess whether long-term immune responses against the YF vaccine are impaired in immune-compromised patients. Fifteen patients using different immunosuppressive drugs and 30 healthy individuals vaccinated 0-22 years ago were included. The serological response was measured using the plaque reduction neutralization test (PRNT). CD8(+) and CD4(+) T-cell responses were measured following proliferation and re-stimulation with YFV peptide pools. Phenotypic characteristics and cytokine responses of CD8(+) T-cells were determined using class I tetramers. The geometric mean titre of neutralizing antibodies was not different between the groups (p = 0.77). The presence of YFV-specific CD4(+) and CD8(+) T-cell did not differ between patients and healthy individuals (15/15, 100.0% vs. 29/30, 96.7%, p = 0.475). Time since vaccination correlated negatively with the number of YFV-specific CD8(+) T-cells (r = -0.66, p = 0.0045). Percentages of early-differentiated memory cells increased (r = 0.67, p = 0.017) over time. These results imply that YF vaccination is effective despite certain immunosuppressive drug regimens. An early-differentiated memory-like phenotype persisted, which is associated with effective expansion upon re-encounter with antigen, suggesting a potent memory T-cell pool remains. Copyright © 2016 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

  11. Hepatitis B virus infection status and infertility causes in couples seeking fertility treatment-Indicator of impaired immune response?

    PubMed

    Lao, Terence T; Mak, Jennifer S M; Li, Tin-Chiu

    2017-04-01

    The relationship between hepatitis B (HBV) infection in infertile couples seeking in vitro fertilization (IVF) treatment and infertility causes is unknown. A total of 831 infertile couples attending our unit seeking IVF during January to December 2015 were recruited. HBV infection was found in 6.3% and 7.3% of female and male partners, respectively, and infection in one or both partners was associated with less primary infertility (44.2% vs 55.1%, P=.038). Infected female partners had increased tubal (69.2% vs 43.2%, P<.001) and uterine (13.7% vs 3.1%, P<.001) causes and reduced idiopathic infertility, while infected male partners were associated with increased tubal (62.3% vs 43.4%, P=.004) causes and reduced endometriosis (62.3% vs 73.9%, P=.050). Our results suggest HBV infection in either partner was associated with tubal infertility. HBV infection in either partner probably increases the risk of pelvic infection in female partner through impaired immune response to sexually transmitted infections, with consequent tubal damage and infertility. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Induction of pneumococcal polysaccharide-specific mucosal immune responses by oral immunization.

    PubMed

    VanCott, J L; Kobayashi, T; Yamamoto, M; Pillai, S; McGhee, J R; Kiyono, H

    1996-04-01

    Liposome and cholera toxin (CT) are considered to be effective antigen delivery vehicles and adjuvants for mucosal vaccines. The effect of these antigen delivery systems on adjuvant responses to mucosally administered pneumococcal polysaccharide (Pnup) was investigated in this study. Both mucosal (e.g. oral) and systemic (i.p.) immunization of mice with purified preparations of Pnup type 23F induced antigen-specific IgM responses in sera. Interestingly, oral immunization of as little as 10 micrograms of Pnup type 23F was sufficient to induce systemic IgM responses. Pnup-specific IgM antibodies peaked by day 7 and no booster responses were evident after a second dose on day 14. In order to examine whether IgG and IgA Pnup-specific immune responses are induced by mucosal immunization, the mucosal adjuvant CT was mixed with Pnup type 23 as an oral vaccine. Co-oral administration of CT and Pnup type 23F resulted in the induction of Pnup-specific faecal IgA antibodies. These results were confirmed by detecting antigen-specific IgA-spot-forming cells in mononuclear cell suspensions prepared from the intestine of immunized mice. These findings suggest that oral immunization with Pnup in the presence of mucosal adjuvants, such as CT, could induce Pnup-specific IgA responses whereas Pnup alone did not. In an attempt to further enhance antigen-specific antibody responses, Pnup type 23F was encapsulated in liposomes and used as mucosal vaccine. However, immunogenicity of Pnup was not improved.

  13. A protective role of murine langerin+ cells in immune responses to cutaneous vaccination with microneedle patches

    PubMed Central

    Pulit-Penaloza, Joanna A.; Esser, E. Stein; Vassilieva, Elena V.; Lee, Jeong Woo; Taherbhai, Misha T.; Pollack, Brian P.; Prausnitz, Mark R.; Compans, Richard W.; Skountzou, Ioanna

    2014-01-01

    Cutaneous vaccination with microneedle patches offers several advantages over more frequently used approaches for vaccine delivery, including improved protective immunity. However, the involvement of specific APC subsets and their contribution to the induction of immunity following cutaneous vaccine delivery is not well understood. A better understanding of the functions of individual APC subsets in the skin will allow us to target specific skin cell populations in order to further enhance vaccine efficacy. Here we use a Langerin-EGFP-DTR knock-in mouse model to determine the contribution of langerin+ subsets of skin APCs in the induction of adaptive immune responses following cutaneous microneedle delivery of influenza vaccine. Depletion of langerin+ cells prior to vaccination resulted in substantial impairment of both Th1 and Th2 responses, and decreased post-challenge survival rates, in mice vaccinated cutaneously but not in those vaccinated via the intramuscular route or in non-depleted control mice. Our results indicate that langerin+ cells contribute significantly to the induction of protective immune responses following cutaneous vaccination with a subunit influenza vaccine. PMID:25130187

  14. Hallmarks of response to immune checkpoint blockade

    PubMed Central

    Cogdill, Alexandria P; Andrews, Miles C; Wargo, Jennifer A

    2017-01-01

    Unprecedented advances have been made in the treatment of cancer through the use of immune checkpoint blockade, with approval of several checkpoint blockade regimens spanning multiple cancer types. However, responses to this form of therapy are not universal, and insights are clearly needed to identify optimal biomarkers of response and to combat mechanisms of therapeutic resistance. A working knowledge of the hallmarks of cancer yields insight into responses to immune checkpoint blockade, although the focus of this is rather tumour-centric and additional factors are pertinent, including host immunity and environmental influences. Herein, we describe the foundation for pillars and hallmarks of response to immune checkpoint blockade, with a discussion of their relevance to immune monitoring and mechanisms of resistance. Evolution of this understanding will ultimately help guide treatment strategies to enhance therapeutic responses. PMID:28524159

  15. Immunotoxicity of aflatoxin B1: Impairment of the cell-mediated response to vaccine antigen and modulation of cytokine expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meissonnier, Guylaine M.; Alltech-France, European Regulatory Department, F-92593 Levallois-Perret; Pinton, Philippe

    Aflatoxin B1 (AFB1), a mycotoxin produced by Aspergillus flavus or A. parasiticus, is a frequent contaminant of food and feed. This toxin is hepatotoxic and immunotoxic. The present study analyzed in pigs the influence of AFB1 on humoral and cellular responses, and investigated whether the immunomodulation observed is produced through interference with cytokine expression. For 28 days, pigs were fed a control diet or a diet contaminated with 385, 867 or 1807 {mu}g pure AFB1/kg feed. At days 4 and 15, pigs were vaccinated with ovalbumin. AFB1 exposure, confirmed by an observed dose-response in blood aflatoxin-albumin adduct, had no majormore » effect on humoral immunity as measured by plasma concentrations of total IgA, IgG and IgM and of anti-ovalbumin IgG. Toxin exposure did not impair the mitogenic response of lymphocytes but delayed and decreased their specific proliferation in response to the vaccine antigen, suggesting impaired lymphocyte activation in pigs exposed to AFB1. The expression level of pro-inflammatory (TNF-{alpha}, IL-1{beta}, IL-6, IFN-{gamma}) and regulatory (IL-10) cytokines was assessed by real-time PCR in spleen. A significant up-regulation of all 5 cytokines was observed in spleen from pigs exposed to the highest dose of AFB1. In pigs exposed to the medium dose, IL-6 expression was increased and a trend towards increased IFN-{gamma} and IL-10 was observed. In addition we demonstrate that IL-6 impaired in vitro the antigenic- but not the mitogenic-induced proliferation of lymphocytes from control pigs vaccinated with ovalbumin. These results indicate that AFB1 dietary exposure decreases cell-mediated immunity while inducing an inflammatory response. These impairments in the immune response could participate in failure of vaccination protocols and increased susceptibility to infections described in pigs exposed to AFB1.« less

  16. YODA MAP3K kinase regulates plant immune responses conferring broad-spectrum disease resistance.

    PubMed

    Sopeña-Torres, Sara; Jordá, Lucía; Sánchez-Rodríguez, Clara; Miedes, Eva; Escudero, Viviana; Swami, Sanjay; López, Gemma; Piślewska-Bednarek, Mariola; Lassowskat, Ines; Lee, Justin; Gu, Yangnan; Haigis, Sabine; Alexander, Danny; Pattathil, Sivakumar; Muñoz-Barrios, Antonio; Bednarek, Pawel; Somerville, Shauna; Schulze-Lefert, Paul; Hahn, Michael G; Scheel, Dierk; Molina, Antonio

    2018-04-01

    Mitogen-activated protein kinases (MAPKs) cascades play essential roles in plants by transducing developmental cues and environmental signals into cellular responses. Among the latter are microbe-associated molecular patterns perceived by pattern recognition receptors (PRRs), which trigger immunity. We found that YODA (YDA) - a MAPK kinase kinase regulating several Arabidopsis developmental processes, like stomatal patterning - also modulates immune responses. Resistance to pathogens is compromised in yda alleles, whereas plants expressing the constitutively active YDA (CA-YDA) protein show broad-spectrum resistance to fungi, bacteria, and oomycetes with different colonization modes. YDA functions in the same pathway as ERECTA (ER) Receptor-Like Kinase, regulating both immunity and stomatal patterning. ER-YDA-mediated immune responses act in parallel to canonical disease resistance pathways regulated by phytohormones and PRRs. CA-YDA plants exhibit altered cell-wall integrity and constitutively express defense-associated genes, including some encoding putative small secreted peptides and PRRs whose impairment resulted in enhanced susceptibility phenotypes. CA-YDA plants show strong reprogramming of their phosphoproteome, which contains protein targets distinct from described MAPKs substrates. Our results suggest that, in addition to stomata development, the ER-YDA pathway regulates an immune surveillance system conferring broad-spectrum disease resistance that is distinct from the canonical pathways mediated by described PRRs and defense hormones. © 2018 Universidad Politécnica de Madrid (UPM) New Phytologist © 2018 New Phytologist Trust.

  17. Age‐related alterations in immune responses to West Nile virus infection

    PubMed Central

    2016-01-01

    Summary West Nile virus (WNV) is the most important causative agent of viral encephalitis worldwide and an important public health concern in the United States due to its high prevalence, severe disease, and the absence of effective treatments. Infection with WNV is mainly asymptomatic, but some individuals develop severe, possibly fatal, neurological disease. Individual host factors play a role in susceptibility to WNV infection, including genetic polymorphisms in key anti‐viral immune genes, but age is the most well‐defined risk factor for susceptibility to severe disease. Ageing is associated with distinct changes in immune cells and a decline in immune function leading to increased susceptibility to infection and reduced responses to vaccination. WNV is detected by pathogen recognition receptors including Toll‐like receptors (TLRs), which show reduced expression and function in ageing. Neutrophils, monocyte/macrophages and dendritic cells, which first recognize and respond to infection, show age‐related impairment of many functions relevant to anti‐viral responses. Natural killer cells control many viral infections and show age‐related changes in phenotype and functional responses. A role for the regulatory receptors Mertk and Axl in blood–brain barrier permeability and in facilitating viral uptake through phospholipid binding may be relevant for susceptibility to WNV, and age‐related up‐regulation of Axl has been noted previously in human dendritic cells. Understanding the specific immune parameters and mechanisms that influence susceptibility to symptomatic WNV may lead to a better understanding of increased susceptibility in elderly individuals and identify potential avenues for therapeutic approaches: an especially relevant goal, as the world's populating is ageing. PMID:27612657

  18. Impaired SNX9 Expression in Immune Cells during Chronic Inflammation: Prognostic and Diagnostic Implications.

    PubMed

    Ish-Shalom, Eliran; Meirow, Yaron; Sade-Feldman, Moshe; Kanterman, Julia; Wang, Lynn; Mizrahi, Olga; Klieger, Yair; Baniyash, Michal

    2016-01-01

    Chronic inflammation is associated with immunosuppression and downregulated expression of the TCR CD247. In searching for new biomarkers that could validate the impaired host immune status under chronic inflammatory conditions, we discovered that sorting nexin 9 (SNX9), a protein that participates in early stages of clathrin-mediated endocytosis, is downregulated as well under such conditions. SNX9 expression was affected earlier than CD247 by the generated harmful environment, suggesting that it is a potential marker sensing the generated immunosuppressive condition. We found that myeloid-derived suppressor cells, which are elevated in the course of chronic inflammation, are responsible for the observed SNX9 reduced expression. Moreover, SNX9 downregulation is reversible, as its expression levels return to normal and immune functions are restored when the inflammatory response and/or myeloid-derived suppressor cells are neutralized. SNX9 downregulation was detected in numerous mouse models for pathologies characterized by chronic inflammation such as chronic infection (Leishmania donovani), cancer (melanoma and colorectal carcinoma), and an autoimmune disease (rheumatoid arthritis). Interestingly, reduced levels of SNX9 were also observed in blood samples from colorectal cancer patients, emphasizing the feasibility of its use as a diagnostic and prognostic biomarker sensing the host's immune status and inflammatory stage. Our new discovery of SNX9 as being regulated by chronic inflammation and its association with immunosuppression, in addition to the CD247 regulation under such conditions, show the global impact of chronic inflammation and the generated immune environment on different cellular pathways in a diverse spectrum of diseases. Copyright © 2015 by The American Association of Immunologists, Inc.

  19. Spaceflight and immune responses of Rhesus monkeys

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, Gerald

    1994-01-01

    Evidence from both human and rodent studies indicates that alterations in immunological parameters occur after space flight. The objective of this project is to determine the effects of space flight on immune responses of Rhesus monkeys. The expected significance of the work is a determination of the range of immunological functions of the Rhesus monkey, a primate similar in many ways to man, affected by space flight. Changes in immune responses that could yield alterations in resistance to infection may be determined as well as the duration of alterations in immune responses. Additional information on the nature of cellular interactions for the generation of immune responses may also be obtained.

  20. Virus-like nanostructures for tuning immune response

    NASA Astrophysics Data System (ADS)

    Mammadov, Rashad; Cinar, Goksu; Gunduz, Nuray; Goktas, Melis; Kayhan, Handan; Tohumeken, Sehmus; Topal, Ahmet E.; Orujalipoor, Ilghar; Delibasi, Tuncay; Dana, Aykutlu; Ide, Semra; Tekinay, Ayse B.; Guler, Mustafa O.

    2015-11-01

    Synthetic vaccines utilize viral signatures to trigger immune responses. Although the immune responses raised against the biochemical signatures of viruses are well characterized, the mechanism of how they affect immune response in the context of physical signatures is not well studied. In this work, we investigated the ability of zero- and one-dimensional self-assembled peptide nanostructures carrying unmethylated CpG motifs (signature of viral DNA) for tuning immune response. These nanostructures represent the two most common viral shapes, spheres and rods. The nanofibrous structures were found to direct immune response towards Th1 phenotype, which is responsible for acting against intracellular pathogens such as viruses, to a greater extent than nanospheres and CpG ODN alone. In addition, nanofibers exhibited enhanced uptake into dendritic cells compared to nanospheres or the ODN itself. The chemical stability of the ODN against nuclease-mediated degradation was also observed to be enhanced when complexed with the peptide nanostructures. In vivo studies showed that nanofibers promoted antigen-specific IgG production over 10-fold better than CpG ODN alone. To the best of our knowledge, this is the first report showing the modulation of the nature of an immune response through the shape of the carrier system.

  1. Filarial parasites develop faster and reproduce earlier in response to host immune effectors that determine filarial life expectancy.

    PubMed

    Babayan, Simon A; Read, Andrew F; Lawrence, Rachel A; Bain, Odile; Allen, Judith E

    2010-10-19

    Humans and other mammals mount vigorous immune assaults against helminth parasites, yet there are intriguing reports that the immune response can enhance rather than impair parasite development. It has been hypothesized that helminths, like many free-living organisms, should optimize their development and reproduction in response to cues predicting future life expectancy. However, immune-dependent development by helminth parasites has so far eluded such evolutionary explanation. By manipulating various arms of the immune response of experimental hosts, we show that filarial nematodes, the parasites responsible for debilitating diseases in humans like river blindness and elephantiasis, accelerate their development in response to the IL-5 driven eosinophilia they encounter when infecting a host. Consequently they produce microfilariae, their transmission stages, earlier and in greater numbers. Eosinophilia is a primary host determinant of filarial life expectancy, operating both at larval and at late adult stages in anatomically and temporally separate locations, and is implicated in vaccine-mediated protection. Filarial nematodes are therefore able to adjust their reproductive schedules in response to an environmental predictor of their probability of survival, as proposed by evolutionary theory, thereby mitigating the effects of the immune attack to which helminths are most susceptible. Enhancing protective immunity against filarial nematodes, for example through vaccination, may be less effective at reducing transmission than would be expected and may, at worst, lead to increased transmission and, hence, pathology.

  2. Brevibacillus laterosporus pathogenesis and local immune response regulation in the house fly midgut.

    PubMed

    Mura, Maria Elena; Ruiu, Luca

    2017-05-01

    The insect midgut represents the primary site of action of the entompathogenic bacterium Brevibacillus laterosporus. While most studies on this microorganism focus on the identification and characterization of possible virulence factors and toxins, little is known about the insect immune defense mechanisms that are activated against this pathogen. In this study we have investigated the local immune response of different house fly stages to B. laterosporus at the transcriptional level, and we tested the hypothesis that an improvement in entomopathogenicity can be achieved by impairing host innate immunity. Gene expression analyses showed that immediately after spore ingestion (6-12h) both larvae and adults increased the transcription rate of immune related genes in the midgut tissues, with special regard to those encoding for the main house fly antimicrobial peptides (AMPs) (i.e., attacin, cecropin, defensin, diptericin, domesticin, muscin) and for prophenoloxydase that is normally involved in the cascade of events leading to the generation of reactive oxygen species (ROS) and other factors with antibacterial properties. In experiments evaluating the use of an immunosuppressive agent to enhance the virulence of B. laterosporus against adult house flies, a significant downregulation of the same genes was observed 12-24h after the administration of sub-lethal doses of the botanical compound azadirachtin. Consequently, a significant increase in B. laterosporus entomopathogenic action was observed when flies were preliminarily or simultaneously exposed to a sub-lethal dose of azadirachtin. These results provide an important contribution to the prospect of employing immune-impairing tools to implement pest management strategies. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Impairment of pneumococcal antigen specific isotype-switched Igg memory B-cell immunity in HIV infected Malawian adults.

    PubMed

    Iwajomo, Oluwadamilola H; Finn, Adam; Ogunniyi, Abiodun D; Williams, Neil A; Heyderman, Robert S

    2013-01-01

    Pneumococcal disease is associated with a particularly high morbidity and mortality amongst adults in HIV endemic countries. Our previous findings implicating a B-cell defect in HIV-infected children from the same population led us to comprehensively characterize B-cell subsets in minimally symptomatic HIV-infected Malawian adults and investigate the isotype-switched IgG memory B-cell immune response to the pneumococcus. We show that similar to vertically acquired HIV-infected Malawian children, horizontally acquired HIV infection in these adults is associated with IgM memory B-cell (CD19(+) CD27(+) IgM(+) IgD(+)) depletion, B-cell activation and impairment of specific IgG B-cell memory to a range of pneumococcal proteins. Our data suggest that HIV infection affects both T-cell independent and T-cell dependent B-cell maturation, potentially leading to impairment of humoral responses to extracellular pathogens such as the pneumococcus, and thus leaving this population susceptible to invasive disease.

  4. Immune Response in Thyroid Cancer: Widening the Boundaries

    PubMed Central

    Ward, Laura Sterian

    2014-01-01

    The association between thyroid cancer and thyroid inflammation has been repeatedly reported and highly debated in the literature. In fact, both molecular and epidemiological data suggest that these diseases are closely related and this association reinforces that the immune system is important for thyroid cancer progression. Innate immunity is the first line of defensive response. Unlike innate immune responses, adaptive responses are highly specific to the particular antigen that induced them. Both branches of the immune system may interact in antitumor immune response. Major effector cells of the immune system that directly target thyroid cancer cells include dendritic cells, macrophages, polymorphonuclear leukocytes, mast cells, and lymphocytes. A mixture of immune cells may infiltrate thyroid cancer microenvironment and the balance of protumor and antitumor activity of these cells may be associated with prognosis. Herein, we describe some evidences that immune response may be important for thyroid cancer progression and may help us identify more aggressive tumors, sparing the vast majority of patients from costly unnecessary invasive procedures. The future trend in thyroid cancer is an individualized therapy. PMID:25328756

  5. Measles virus-induced suppression of immune responses.

    PubMed

    Griffin, Diane E

    2010-07-01

    Measles is an important cause of child mortality that has a seemingly paradoxical interaction with the immune system. In most individuals, the immune response is successful in eventually clearing measles virus (MV) infection and in establishing life-long immunity. However, infection is also associated with persistence of viral RNA and several weeks of immune suppression, including loss of delayed type hypersensitivity responses and increased susceptibility to secondary infections. The initial T-cell response includes CD8+ and T-helper 1 CD4+ T cells important for control of infectious virus. As viral RNA persists, there is a shift to a T-helper 2 CD4+ T-cell response that likely promotes B-cell maturation and durable antibody responses but may suppress macrophage activation and T-helper 1 responses to new infections. Suppression of mitogen-induced lymphocyte proliferation can be induced by lymphocyte infection with MV or by lymphocyte exposure to a complex of the hemagglutinin and fusion surface glycoproteins without infection. Dendritic cells (DCs) are susceptible to infection and can transmit infection to lymphocytes. MV-infected DCs are unable to stimulate a mixed lymphocyte reaction and can induce lymphocyte unresponsiveness through expression of MV glycoproteins. Thus, multiple factors may contribute both to measles-induced immune suppression and to the establishment of durable protective immunity.

  6. Lentinula edodes-derived polysaccharide rejuvenates mice in terms of immune responses and gut microbiota.

    PubMed

    Xu, Xiaofei; Yang, Jiguo; Ning, Zhengxiang; Zhang, Xuewu

    2015-08-01

    Aging is characterized by impaired immunity and unbalanced gut microbiota. Prebiotics have the capability to prevent or reverse age-related declines in health by modulating gut microbiota. Mushroom polysaccharides have been suggested to be potential prebiotics. However, their effects on the immunity and gut microbiota in aged mice have not been determined. This study firstly assessed the effects of a heteropolysaccharide L2 isolated from the fruit body of L. edodes on the immune response of aged mice, and then compared the composition of fecal microbiota in adult (N), old (O) and L2-treated old (Oa) mice using the high-throughput pyrosequencing technique. The results showed that L2 can restore the age-attenuated immune responses by increasing cytokine levels in peripheral blood. Moreover, L2 can partly reverse the age-altered composition of gut microbiota. The Euclidean distances (De) among 3 groups (N, O and Oa) are determined to be De(O, N) = 0.19, De(O, Oa) = 0.20, and De(N, Oa) = 0.10, i.e. there is a marked reduction in the distance from 0.19 to 0.1 by L2. This suggests the beneficial effects of L2 on enhancing immunity and improving gut health.

  7. Dendritic Cell Immune Responses in HIV-1 Controllers.

    PubMed

    Martin-Gayo, Enrique; Yu, Xu G

    2017-02-01

    Robust HIV-1-specific CD8 T cell responses are currently regarded as the main correlate of immune defense in rare individuals who achieve natural, drug-free control of HIV-1; however, the mechanisms that support evolution of such powerful immune responses are not well understood. Dendritic cells (DCs) are specialized innate immune cells critical for immune recognition, immune regulation, and immune induction, but their possible contribution to HIV-1 immune defense in controllers remains ill-defined. Recent studies suggest that myeloid DCs from controllers have improved abilities to recognize HIV-1 through cytoplasmic immune sensors, resulting in more potent, cell-intrinsic type I interferon secretion in response to viral infection. This innate immune response may facilitate DC-mediated induction of highly potent antiviral HIV-1-specific T cells. Moreover, protective HLA class I isotypes restricting HIV-1-specific CD8 T cells may influence DC function through specific interactions with innate myelomonocytic MHC class I receptors from the leukocyte immunoglobulin-like receptor family. Bi-directional interactions between dendritic cells and HIV-1-specific T cells may contribute to natural HIV-1 immune control, highlighting the importance of a fine-tuned interplay between innate and adaptive immune activities for effective antiviral immune defense.

  8. Cyclooxygenase-1 and -2 Play Contrasting Roles in Listeria-Stimulated Immunity.

    PubMed

    Theisen, Erin; McDougal, Courtney E; Nakanishi, Masako; Stevenson, David M; Amador-Noguez, Daniel; Rosenberg, Daniel W; Knoll, Laura J; Sauer, John-Demian

    2018-06-01

    Nonsteroidal anti-inflammatory drugs (NSAIDs) inhibit cyclooxygenase (COX) activity and are commonly used for pain relief and fever reduction. NSAIDs are used following childhood vaccinations and cancer immunotherapies; however, how NSAIDs influence the development of immunity following these therapies is unknown. We hypothesized that NSAIDs would modulate the development of an immune response to Listeria monocytogenes -based immunotherapy. Treatment of mice with the nonspecific COX inhibitor indomethacin impaired the generation of cell-mediated immunity. This phenotype was due to inhibition of the inducible COX-2 enzyme, as treatment with the COX-2-selective inhibitor celecoxib similarly inhibited the development of immunity. In contrast, loss of COX-1 activity improved immunity to L. monocytogenes Impairments in immunity were independent of bacterial burden, dendritic cell costimulation, or innate immune cell infiltrate. Instead, we observed that PGE 2 production following L. monocytogenes is critical for the formation of an Ag-specific CD8 + T cell response. Use of the alternative analgesic acetaminophen did not impair immunity. Taken together, our results suggest that COX-2 is necessary for optimal CD8 + T cell responses to L. monocytogenes , whereas COX-1 is detrimental. Use of pharmacotherapies that spare COX-2 activity and the production of PGE 2 like acetaminophen will be critical for the generation of optimal antitumor responses using L. monocytogenes . Copyright © 2018 by The American Association of Immunologists, Inc.

  9. Childhood exposure to ambient polycyclic aromatic hydrocarbons is linked to epigenetic modifications and impaired systemic immunity in T cells

    PubMed Central

    Hew, K. M.; Walker, A. I.; Kohli, A.; Garcia, M.; Syed, A.; McDonald-Hyman, C.; Noth, E. M.; Mann, J. K.; Pratt, B.; Balmes, J.; Hammond, S. Katharine; Eisen, E. A.; Nadeau, K. C.

    2015-01-01

    Summary Background Evidence suggests that exposure to polycyclic aromatic hydrocarbons (PAHs) increases atopy; it is unclear how PAH exposure is linked to increased severity of atopic diseases. Objective We hypothesized that ambient PAH exposure is linked to impairment of immunity in atopic children (defined as children with asthma and/or allergic rhinitis) from Fresno, California, an area with elevated ambient PAHs. Methods We recruited 256 subjects from Fresno, CA. Ambient PAH concentrations (ng/m3) were measured using a spatial-temporal regression model over multiple time periods. Asthma diagnosis was determined by current NHLBI criteria. Phenotyping and functional immune measurements were performed from isolated cells. For epigenetic measurements, DNA was isolated and pyrosequenced. Results We show that higher average PAH exposure was significantly associated with impaired Treg function and increased methylation in the forkhead box protein 3 (FOXP3) locus (P < 0.05), conditional on atopic status. These epigenetic modifications were significantly linked to differential protein expression of FOXP3 (P < 0.001). Methylation was associated with cellular functional changes, specifically Treg dysfunction, and an increase in total plasma IgE levels. Protein expression of IL-10 decreased and IFN-γ increased as the extent of PAH exposure increased. The strength of the associations generally increased as the time window for average PAH exposure increased from 24 hr to 1 year, suggesting more of a chronic response. Significant associations with chronic PAH exposure and immune outcomes were also observed in subjects with allergic rhinitis. Conclusions and Clinical Relevance Collectively, these results demonstrate that increased ambient PAH exposure is associated with impaired systemic immunity and epigenetic modifications in a key locus involved in atopy: FOXP3, with a higher impact on atopic children. The results suggest that increased atopic clinical symptoms in children

  10. The effect of cyclosporin A on the primary immune response to allogeneic red cells in rabbits.

    PubMed Central

    Smith, G N

    1982-01-01

    Cyclosporin A (CSA) has been used in an attempt to suppress the primary immune response of HgA(A)-negative rabbits to A-positive red cells. The immune response was assessed by measuring the survival of a small intravenous (i.v.) dose of 51Cr-labelled A-positive cells and by testing the serum of the immunized rabbits for anti-A. In one experiment, eight A-negative rabbits were given a first i.v. injection of A-positive red cells, and CSA (25 mg/kg/day) in olive oil was given by mouth for 17-34 days. There was no evidence of impaired alloimmunization compared with the responses in control animals treated with olive oil alone. In a second experiment, eight A-negative rabbits were given a first injection of A-positive muscularly (i.m.), and CSA (25 mg/kg/day) in miglyol was given by im.m. injection for 10 days. Six of these rabbits were rendered unresponsive, and the remaining two, who showed impaired survival of the monitoring red cells, produced only low anit-A titres. Seven out of eight controls given i.m. miglyol without CSA responded with good anti-A production. Rabbits that were unresponsive to A-positive red cells responded normally to sheep red blood cells 15 weeks after CSA treatment. Higher serum levels of CSA were found following i.m. administration of the drug but treatment by this route as associated with severe toxicity in some rabbits. PMID:7056563

  11. Humoral and Cellular Immune Response in Canine Hypothyroidism.

    PubMed

    Miller, J; Popiel, J; Chełmońska-Soyta, A

    2015-07-01

    Hypothyroidism is one of the most common endocrine diseases in dogs and is generally considered to be autoimmune in nature. In human hypothyroidism, the thyroid gland is destroyed by both cellular (i.e. autoreactive helper and cytotoxic T lymphocytes) and humoral (i.e. autoantibodies specific for thyroglobulin, thyroxine and triiodothyronine) effector mechanisms. Other suggested factors include impaired peripheral immune suppression (i.e. the malfunction of regulatory T cells) or an additional pro-inflammatory effect of T helper 17 lymphocytes. The aim of this study was to evaluate immunological changes in canine hypothyroidism. Twenty-eight clinically healthy dogs, 25 hypothyroid dogs without thyroglobulin antibodies and eight hypothyroid dogs with these autoantibodies were enrolled into the study. There were alterations in serum proteins in hypothyroid dogs compared with healthy controls (i.e. raised concentrations of α-globulins, β2- and γ-globulins) as well as higher concentration of acute phase proteins and circulating immune complexes. Hypothyroid animals had a lower CD4:CD8 ratio in peripheral blood compared with control dogs and diseased dogs also had higher expression of interferon γ (gene and protein expression) and CD28 (gene expression). Similar findings were found in both groups of hypothyroid dogs. Canine hypothyroidism is therefore characterized by systemic inflammation with dominance of a cellular immune response. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Gene vaccination to bias the immune response to amyloid-beta peptide as therapy for Alzheimer disease.

    PubMed

    Qu, Baoxi; Rosenberg, Roger N; Li, Liping; Boyer, Philip J; Johnston, Stephen A

    2004-12-01

    The amyloid-beta (Abeta) peptide has a central role in the neurodegeneration of Alzheimer disease (AD). Immunization of AD transgenic mice with Abeta(1-42) (Abeta(42)) peptide reduces both the spatial memory impairments and AD-like neuropathologic changes in these mice. Therapeutic immunization with Abeta in patients with AD was shown to be effective in reducing Abeta deposition, but studies were discontinued owing to the development of an autoimmune, cell-mediated meningoencephalitis. We hypothesized that gene vaccination could be used to generate an immune response to Abeta(42) that produced antibody response but avoided an adverse cell-mediated immune effect. To develop an effective genetic immunization approach for treatment and prevention of AD without causing an autoimmune, cell-mediated meningoencephalitis. Mice were vaccinated with a plasmid that encodes Abeta(42), administered by gene gun. The immune response of the mice to Abeta(42) was monitored by measurement of (1) antibody levels by enzyme-linked immunosorbent assay (ELISA) and Western blot and (2) Abeta(42)-specific T-cell response as measured by interferon-gamma enzyme-linked immunospot (ELISPOT) assay. Gene-gun delivery of the mouse Abeta(42) dimer gene induced significant humoral immune responses in BALB/c wild-type mice after 3 vaccinations in 10-day intervals. All 3 mice in the treated group showed significant humoral immune responses. The ELISPOT assay for interferon-gamma release with mouse Abeta(42) peptide and Abeta(9-18) showed no evident cytotoxic T-lymphocyte response. We further tested the responses of wild-type BALB/c mice to the monomer Abeta(42) gene vaccine. Western blot evaluation showed both human and mouse Abeta monomer gene vaccine elicited detectable humoral immune responses. We also introduced the human Abeta(42) monomer gene vaccine into AD double transgenic mice APPswe/PSEN1(A246E). Mice were vaccinated with plasmids that encode Abeta(1-42) and Abeta(1-16), or with plasmid

  13. Reduced immune responses to purified protein derivative and Candida albicans in oral lichen planus.

    PubMed

    Simark-Mattsson, Charlotte; Eklund, Christina

    2013-10-01

    Impairment of cellular immunity is reported in lichen planus, an autoimmune disease affecting mucosae and skin. Our aim was to investigate immune responses directed against a set of microbial antigens in patients with oral lichen planus and in matched controls. Venous blood was obtained, and the mononuclear cells were enriched by density gradient centrifugation. The proliferation of peripheral blood mononuclear cells was assessed, following stimulation with purified protein derivative (PPD), Candida albicans, phytohemagglutinin or when cells were left unstimulated, after three or six days of cell culture. The production of interleukin-1ß (IL-1ß), IL-2, IL-4, IL-5, IL-6, IL-10, IL-12, IL-13, IL-17, interferon-γ (IFN-γ), tumour necrosis factor-α (TNF-α), G-CSF, GM-CSF, MCP-1, MIP-ß was assessed in supernatants using the Bio-plex(®) assay and was complemented with ELISA for selected cytokines. Patients with oral lichen planus demonstrated reduced proliferative responses against PPD (P < 0.05) and C. albicans (P < 0.05). The majority of investigated cytokines, including the pro-inflammatory, IFN-γ and TNF-α were expressed at reduced levels in PPD-stimulated supernatants from patients with oral lichen planus. Collectively, the findings suggested that memory lymphocytes from patients with oral lichen planus (OLP) may have an impaired functional ability to react against certain recall antigens, as part of a generalized response, which may reflect immune regulatory processes. Further studies are needed to clarify the mechanisms of down-regulation in OLP pathogenesis and progression. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Distinct innate immune phagocyte responses to Aspergillus fumigatus conidia and hyphae in zebrafish larvae.

    PubMed

    Knox, Benjamin P; Deng, Qing; Rood, Mary; Eickhoff, Jens C; Keller, Nancy P; Huttenlocher, Anna

    2014-10-01

    Aspergillus fumigatus is the most common filamentous fungal pathogen of immunocompromised hosts, resulting in invasive aspergillosis (IA) and high mortality rates. Innate immunity is known to be the predominant host defense against A. fumigatus; however, innate phagocyte responses to A. fumigatus in an intact host and their contributions to host survival remain unclear. Here, we describe a larval zebrafish A. fumigatus infection model amenable to real-time imaging of host-fungal interactions in live animals. Following infection with A. fumigatus, innate phagocyte populations exhibit clear preferences for different fungal morphologies: macrophages rapidly phagocytose conidia and form aggregates around hyphae, while the neutrophil response is dependent upon the presence of hyphae. Depletion of macrophages rendered host larvae susceptible to invasive disease. Moreover, a zebrafish model of human leukocyte adhesion deficiency with impaired neutrophil function also resulted in invasive disease and impaired host survival. In contrast, macrophage-deficient but not neutrophil-deficient larvae exhibited attenuated disease following challenge with a less virulent (ΔlaeA) strain of A. fumigatus, which has defects in secondary metabolite production. Taking these results together, we have established a new vertebrate model for studying innate immune responses to A. fumigatus that reveals distinct roles for neutrophils and macrophages in mediating host defense against IA. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  15. Arsenic and Immune Response to Infection During Pregnancy and Early Life

    PubMed Central

    Attreed, Sarah E.; Navas-Acien, Ana

    2017-01-01

    Purpose of Review Arsenic, a known carcinogen and developmental toxicant, is a major threat to global health. While the contribution of arsenic exposure to chronic diseases and adverse pregnancy and birth outcomes is recognized, its ability to impair critical functions of humoral and cell-mediated immunity—including the specific mechanisms in humans—is not well understood. Arsenic has been shown to increase risk of infectious diseases that have significant health implications during pregnancy and early life. Here, we review the latest research on the mechanisms of arsenic-related immune response alterations that could underlie arsenic-associated increased risk of infection during the vulnerable periods of pregnancy and early life. Recent Findings The latest evidence points to alteration of antibody production and transplacental transfer as well as failure of T helper cells to produce IL-2 and proliferate. Summary Critical areas for future research include the effects of arsenic exposure during pregnancy and early life on immune responses to natural infection and the immunogenicity and efficacy of vaccines. PMID:28488132

  16. Impact of sleep restriction on local immune response and skin barrier restoration with and without "multinutrient" nutrition intervention.

    PubMed

    Smith, Tracey J; Wilson, Marques A; Karl, J Philip; Orr, Jeb; Smith, Carl D; Cooper, Adam D; Heaton, Kristin J; Young, Andrew J; Montain, Scott J

    2018-01-01

    Systemic immune function is impaired by sleep restriction. However, the impact of sleep restriction on local immune responses and to what extent any impairment can be mitigated by nutritional supplementation is unknown. We assessed the effect of 72-h sleep restriction (2-h nightly sleep) on local immune function and skin barrier restoration of an experimental wound, and determined the influence of habitual protein intake (1.5 g·kg -1 ·day -1 ) supplemented with arginine, glutamine, zinc sulfate, vitamin C, vitamin D3, and omega-3 fatty acids compared with lower protein intake (0.8 g·kg -1 ·day -1 ) without supplemental nutrients on these outcomes. Wounds were created in healthy adults by removing the top layer of less than or equal to eight forearm blisters induced via suction, after adequate sleep (AS) or 48 h of a 72-h sleep restriction period (SR; 2-h nightly sleep). A subset of participants undergoing sleep restriction received supplemental nutrients during and after sleep restriction (SR+). Wound fluid was serially sampled 48 h postblistering to assess local cytokine responses. The IL-8 response of wound fluid was higher for AS compared with SR [area-under-the-curve (log 10 ), 5.1 ± 0.2 and 4.9 ± 0.2 pg/ml, respectively; P = 0.03]; and both IL-6 and IL-8 concentrations were higher for SR+ compared with SR ( P < 0.0001), suggestive of a potentially enhanced early wound healing response. Skin barrier recovery was shorter for AS (4.2 ± 0.9 days) compared with SR (5.0 ± 0.9 days) ( P = 0.02) but did not differ between SR and SR+ ( P = 0.18). Relatively modest sleep disruption delays wound healing. Supplemental nutrition may mitigate some decrements in local immune responses, without detectable effects on wound healing rate. NEW & NOTEWORTHY The data herein characterizes immune function in response to sleep restriction in healthy volunteers with and without nutrition supplementation. We used a unique skin wound model to show that sleep

  17. Marburg virus survivor immune responses are Th1 skewed with limited neutralizing antibody responses.

    PubMed

    Stonier, Spencer W; Herbert, Andrew S; Kuehne, Ana I; Sobarzo, Ariel; Habibulin, Polina; Dahan, Chen V Abramovitch; James, Rebekah M; Egesa, Moses; Cose, Stephen; Lutwama, Julius Julian; Lobel, Leslie; Dye, John M

    2017-09-04

    Until recently, immune responses in filovirus survivors remained poorly understood. Early studies revealed IgM and IgG responses to infection with various filoviruses, but recent outbreaks have greatly expanded our understanding of filovirus immune responses. Immune responses in survivors of Ebola virus (EBOV) and Sudan virus (SUDV) infections have provided the most insight, with T cell responses as well as detailed antibody responses having been characterized. Immune responses to Marburg virus (MARV), however, remain almost entirely uncharacterized. We report that immune responses in MARV survivors share characteristics with EBOV and SUDV infections but have some distinct differences. MARV survivors developed multivariate CD4 + T cell responses but limited CD8 + T cell responses, more in keeping with SUDV survivors than EBOV survivors. In stark contrast to SUDV survivors, rare neutralizing antibody responses in MARV survivors diminished rapidly after the outbreak. These results warrant serious consideration for any vaccine or therapeutic that seeks to be broadly protective, as different filoviruses may require different immune responses to achieve immunity. © 2017 Stonier et al.

  18. Loss of the DNA Damage Repair Kinase ATM Impairs Inflammasome-Dependent Anti-Bacterial Innate Immunity.

    PubMed

    Erttmann, Saskia F; Härtlova, Anetta; Sloniecka, Marta; Raffi, Faizal A M; Hosseinzadeh, Ava; Edgren, Tomas; Rofougaran, Reza; Resch, Ulrike; Fällman, Maria; Ek, Torben; Gekara, Nelson O

    2016-07-19

    The ATM kinase is a central component of the DNA damage repair machinery and redox balance. ATM dysfunction results in the multisystem disease ataxia-telangiectasia (AT). A major cause of mortality in AT is respiratory bacterial infections. Whether ATM deficiency causes innate immune defects that might contribute to bacterial infections is not known. Here we have shown that loss of ATM impairs inflammasome-dependent anti-bacterial innate immunity. Cells from AT patients or Atm(-/-) mice exhibited diminished interleukin-1β (IL-1β) production in response to bacteria. In vivo, Atm(-/-) mice were more susceptible to pulmonary S. pneumoniae infection in a manner consistent with inflammasome defects. Our data indicate that such defects were due to oxidative inhibition of inflammasome complex assembly. This study reveals an unanticipated function of reactive oxygen species (ROS) in negative regulation of inflammasomes and proposes a theory for the notable susceptibility of AT patients to pulmonary bacterial infection. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Enhanced innate immune responsiveness and intolerance to intestinal endotoxins in human biliary epithelial cells contributes to chronic cholangitis.

    PubMed

    Mueller, Tobias; Beutler, Claudia; Picó, Almudena Hurtado; Shibolet, Oren; Pratt, Daniel S; Pascher, Andreas; Neuhaus, Peter; Wiedenmann, Bertram; Berg, Thomas; Podolsky, Daniel K

    2011-11-01

    Pattern recognition receptors (PRRs) orchestrate the innate immune defence in human biliary epithelial cells (BECs). Tight control of PRR signalling provides tolerance to physiological amounts of intestinal endotoxins in human bile to avoid constant innate immune activation in BECs. We wanted to determine whether inappropriate innate immune responses to intestinal endotoxins contribute to the development and perpetuation of chronic biliary inflammation. We examined PRR-mediated innate immune responses and protective endotoxin tolerance in primary BECs isolated from patients with primary sclerosing cholangitis (PSC), alcoholic liver disease and patients without chronic liver disease. Expression studies comprised northern blots, RT-PCR, Western blots and immunocytochemistry. Functional studies comprised immuno-precipitation Western blots, FACS for endotoxin uptake, and NF-κB activation assays and ELISA for secreted IL-8 and tumour necrosis factor (TNF)-α. Primary BECs from explanted PSC livers showed reversibly increased TLR and NOD protein expression and activation of the MyD88/IRAK signalling complex. Consecutively, PSC BECs exhibited inappropriate innate immune responses to endotoxins and did not develop immune tolerance after repeated endotoxin exposures. This endotoxin hyper-responsiveness was probably because of the stimulatory effect of abundantly expressed IFN-γ and TNF-α in PSC livers, which stimulated TLR4-mediated endotoxin signalling in BECs, leading to increased TLR4-mediated endotoxin incorporation and impaired inactivation of the TLR4 signalling cascade. As TNF-α inhibition partly restored protective innate immune tolerance, endogenous TNF-α secretion probably contributed to inappropriate endotoxin responses in BECs. Inappropriate innate immune responses to intestinal endotoxins and subsequent endotoxin intolerance because of enhanced PRR signalling in BECs probably contribute to chronic cholangitis. © 2011 John Wiley & Sons A/S.

  20. RNA-Seq revealed the impairment of immune defence of tilapia against the infection of Streptococcus agalactiae with simulated climate warming.

    PubMed

    Wang, Le; Liu, Peng; Wan, Zi Yi; Huang, Shu Qing; Wen, Yan Fei; Lin, Grace; Yue, Gen Hua

    2016-08-01

    Global warming is one of the causes of disease outbreaks in fishes. Understanding its mechanisms is critical in aquaculture and fisheries. We used tilapia to study the effects of a high temperature on the infection of a bacterial pathogen Streptococcus agalactiae using RNA-Seq. We found that the dissolved oxygen level in water at 32 °C is lower than at 22 °C, and tilapia infected with the pathogen died more rapidly at 32 °C. The gene expression profiles showed significant differences in fish raised under different conditions. We identified 126 and 576 differentially expressed genes (DEGs) at 4 and 24 h post infection at 22 °C, respectively, whereas at 32 °C, the data were 312 and 1670, respectively. Almost all responding pathways at 22 °C were involved in the immune responses, whereas at 32 °C, the enriched pathways were not only involved in immune responses but also involved in oxygen and energy metabolisms. We identified significant signals of immunosuppression of immune responses at 32 °C. In addition, many of the enriched transcription factors and DEGs under positive selection were involved in immune responses, oxygen and/or energy metabolisms. Our results suggest that global warming could reduce the oxygen level in water and impair the defence of tilapia against bacterial infection. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Transcriptome characterization of immune suppression from battlefield-like stress

    PubMed Central

    Muhie, S; Hammamieh, R; Cummings, C; Yang, D; Jett, M

    2013-01-01

    Transcriptome alterations of leukocytes from soldiers who underwent 8 weeks of Army Ranger training (RASP, Ranger Assessment and Selection Program) were analyzed to evaluate impacts of battlefield-like stress on the immune response. About 1400 transcripts were differentially expressed between pre- and post-RASP leukocytes. Upon functional analysis, immune response was the most enriched biological process, and most of the transcripts associated with the immune response were downregulated. Microbial pattern recognition, chemotaxis, antigen presentation and T-cell activation were among the most downregulated immune processes. Transcription factors predicted to be stress-inhibited (IRF7, RELA, NFκB1, CREB1, IRF1 and HMGB) regulated genes involved in inflammation, maturation of dendritic cells and glucocorticoid receptor signaling. Many altered transcripts were predicted to be targets of stress-regulated microRNAs. Post-RASP leukocytes exposed ex vivo to Staphylococcal enterotoxin B showed a markedly impaired immune response to this superantigen compared with pre-RASP leukocytes, consistent with the suppression of the immune response revealed by transcriptome analyses. Our results suggest that suppression of antigen presentation and lymphocyte activation pathways, in the setting of normal blood cell counts, most likely contribute to the poor vaccine response, impaired wound healing and infection susceptibility associated with chronic intense stress. PMID:23096155

  2. Divergent Annexin A1 expression in periphery and gut is associated with systemic immune activation and impaired gut immune response during SIV infection

    PubMed Central

    Sena, Angela A. S.; Glavan, Tiffany; Jiang, Guochun; Sankaran-Walters, Sumathi; Grishina, Irina; Dandekar, Satya; Goulart, Luiz R.

    2016-01-01

    HIV-1 disease progression is paradoxically characterized by systemic chronic immune activation and gut mucosal immune dysfunction, which is not fully defined. Annexin A1 (ANXA1), an inflammation modulator, is a potential link between systemic inflammation and gut immune dysfunction during the simian immunodeficiency virus (SIV) infection. Gene expression of ANXA1 and cytokines were assessed in therapy-naïve rhesus macaques during early and chronic stages of SIV infection and compared with SIV-negative controls. ANXA1 expression was suppressed in the gut but systemically increased during early infection. Conversely, ANXA1 expression increased in both compartments during chronic infection. ANXA1 expression in peripheral blood was positively correlated with HLA-DR+CD4+ and CD8+ T-cell frequencies, and negatively associated with the expression of pro-inflammatory cytokines and CCR5. In contrast, the gut mucosa presented an anergic cytokine profile in relation to ANXA1 expression. In vitro stimulations with ANXA1 peptide resulted in decreased inflammatory response in PBMC but increased activation of gut lymphocytes. Our findings suggest that ANXA1 signaling is dysfunctional in SIV infection, and may contribute to chronic inflammation in periphery and with immune dysfunction in the gut mucosa. Thus, ANXA1 signaling may be a novel therapeutic target for the resolution of immune dysfunction in HIV infection. PMID:27484833

  3. Cathepsin-mediated Necrosis Controls the Adaptive Immune Response by Th2 (T helper type 2)-associated Adjuvants*

    PubMed Central

    Jacobson, Lee S.; Lima, Heriberto; Goldberg, Michael F.; Gocheva, Vasilena; Tsiperson, Vladislav; Sutterwala, Fayyaz S.; Joyce, Johanna A.; Gapp, Bianca V.; Blomen, Vincent A.; Chandran, Kartik; Brummelkamp, Thijn R.; Diaz-Griffero, Felipe; Brojatsch, Jürgen

    2013-01-01

    Immunologic adjuvants are critical components of vaccines, but it remains unclear how prototypical adjuvants enhance the adaptive immune response. Recent studies have shown that necrotic cells could trigger an immune response. Although most adjuvants have been shown to be cytotoxic, this activity has traditionally been considered a side effect. We set out to test the role of adjuvant-mediated cell death in immunity and found that alum, the most commonly used adjuvant worldwide, triggers a novel form of cell death in myeloid leukocytes characterized by cathepsin-dependent lysosome-disruption. We demonstrated that direct lysosome-permeabilization with a soluble peptide, Leu-Leu-OMe, mimics the alum-like form of necrotic cell death in terms of cathepsin dependence and cell-type specificity. Using a combination of a haploid genetic screen and cathepsin-deficient cells, we identified specific cathepsins that control lysosome-mediated necrosis. We identified cathepsin C as critical for Leu-Leu-OMe-induced cell death, whereas cathepsins B and S were required for alum-mediated necrosis. Consistent with a role of necrotic cell death in adjuvant effects, Leu-Leu-OMe replicated an alum-like immune response in vivo, characterized by dendritic cell activation, granulocyte recruitment, and production of Th2-associated antibodies. Strikingly, cathepsin C deficiency not only blocked Leu-Leu-OMe-mediated necrosis but also impaired Leu-Leu-OMe-enhanced immunity. Together our findings suggest that necrotic cell death is a powerful mediator of a Th2-associated immune response. PMID:23297415

  4. A peripheral immune response to remembering trauma contributes to the maintenance of fear memory in mice.

    PubMed

    Young, Matthew B; Howell, Leonard L; Hopkins, Lauren; Moshfegh, Cassandra; Yu, Zhe; Clubb, Lauren; Seidenberg, Jessica; Park, Jeanie; Swiercz, Adam P; Marvar, Paul J

    2018-05-17

    Alterations in peripheral immune markers are observed in individuals with post-traumatic stress disorder (PTSD). PTSD is characterized in part by impaired extinction of fear memory for a traumatic experience. We hypothesized that fear memory extinction is regulated by immune signaling stimulated when fear memory is retrieved. The relationship between fear memory and the peripheral immune response was tested using auditory Pavlovian fear conditioning in mice. Memory for the association was quantified by the amount of conditioned freezing exhibited in response to the conditioned stimulus (CS), extinction and time-dependent changes in circulating inflammatory cytokines. Brief extinction training with 12 CS rapidly and acutely increased circulating levels of the cytokine interleukin-6 (IL-6), downstream IL-6 signaling, other IL-6 related pro-inflammatory cytokines. Transgenic manipulations or neutralizing antibodies that inhibit IL-6 activity did not affect conditioned freezing during the acquisition of fear conditioning or extinction but significantly reduced conditioned freezing 24 h after extinction training with 12 CS. Conversely, conditioned freezing after extinction training was unchanged by IL-6 inhibition when 40 CS were used during the extinction training session. In addition to effectively diminishing conditioned freezing, extinction training with 40 CS also diminished the subsequent IL-6 response to the CS. These data demonstrate that IL-6 released following fear memory retrieval contributes to the maintenance of that fear memory and that this effect is extinction dependent. These findings extend the current understanding for the role of the immune system in PTSD and suggest that IL-6 and other IL-6 related pro-inflammatory cytokines may contribute to the persistence of fear memory in PTSD where fear memory extinction is impaired. Copyright © 2018 Elsevier Ltd. All rights reserved.

  5. A Systems Vaccinology Approach Reveals Temporal Transcriptomic Changes of Immune Responses to the Yellow Fever 17D Vaccine.

    PubMed

    Hou, Jue; Wang, Shuhui; Jia, Manxue; Li, Dan; Liu, Ying; Li, Zhengpeng; Zhu, Hong; Xu, Huifang; Sun, Meiping; Lu, Li; Zhou, Zhinan; Peng, Hong; Zhang, Qichen; Fu, Shihong; Liang, Guodong; Yao, Lena; Yu, Xuesong; Carpp, Lindsay N; Huang, Yunda; McElrath, Julie; Self, Steve; Shao, Yiming

    2017-08-15

    In this study, we used a systems vaccinology approach to identify temporal changes in immune response signatures to the yellow fever (YF)-17D vaccine, with the aim of comprehensively characterizing immune responses associated with protective immunity. We conducted a cohort study in which 21 healthy subjects in China were administered one dose of the YF-17D vaccine; PBMCs were collected at 0 h and then at 4 h and days 1, 2, 3, 5, 7, 14, 28, 84, and 168 postvaccination, and analyzed by transcriptional profiling and immunological assays. At 4 h postvaccination, genes associated with innate cell differentiation and cytokine pathways were dramatically downregulated, whereas receptor genes were upregulated, compared with their baseline levels at 0 h. Immune response pathways were primarily upregulated on days 5 and 7, accompanied by the upregulation of the transcriptional factors JUP, STAT1, and EIF2AK2. We also observed robust activation of innate immunity within 2 d postvaccination and a durable adaptive response, as assessed by transcriptional profiling. Coexpression network analysis indicated that lysosome activity and lymphocyte proliferation were associated with dendritic cell (DC) and CD4 + T cell responses; FGL2, NFAM1, CCR1, and TNFSF13B were involved in these associations. Moreover, individuals who were baseline-seropositive for Abs against another flavivirus exhibited significantly impaired DC, NK cell, and T cell function in response to YF-17D vaccination. Overall, our findings indicate that YF-17D vaccination induces a prompt innate immune response and DC activation, a robust Ag-specific T cell response, and a persistent B cell/memory B cell response. Copyright © 2017 by The American Association of Immunologists, Inc.

  6. In vivo short-term exposure to residual oil fly ash impairs pulmonary innate immune response against environmental mycobacterium infection.

    PubMed

    Delfosse, Verónica C; Tasat, Deborah R; Gioffré, Andrea K

    2015-05-01

    Epidemiological studies have shown that pollution derived from industrial and vehicular transportation induces adverse health effects causing broad ambient respiratory diseases. Therefore, air pollution should be taken into account when microbial diseases are evaluated. Environmental mycobacteria (EM) are opportunist pathogens that can affect a variety of immune compromised patients, which impacts significantly on human morbidity and mortality. The aim of this study was to evaluate the effect of residual oil fly ash (ROFA) pre-exposure on the pulmonary response after challenge with opportunistic mycobacteria by means of an acute short-term in vivo experimental animal model. We exposed BALB/c mice to ROFA and observed a significant reduction on bacterial clearance at 24 h post infection. To study the basis of this impaired response four groups of animals were instilled with (a) saline solution (Control), (b) ROFA (1 mg kg(-1) BW), (c) ROFA and EM-infected (Mycobacterium phlei, 8 × 10(6) CFU), and (d) EM-infected. Animals were sacrificed 24 h postinfection and biomarkers of lung injury and proinflammatory madiators were examined in the bronchoalveolar lavage. Our results indicate that ROFA was able to produce an acute pulmonary injury characterized by an increase in bronchoalveolar polymorphonuclear (PMN) cells influx and a rise in O2 (-) generation. Exposure to ROFA before M. phlei infection reduced total cell number and caused a significant decline in PMN cells recruitment (p < 0.05), O2 (-) generation, TNFα (p < 0.001), and IL-6 (p < 0.001) levels. Hence, our results suggest that, in this animal model, the acute short-term pre-exposure to ROFA reduces early lung response to EM infection. © 2013 Wiley Periodicals, Inc.

  7. Cyclophilin A-regulated ubiquitination is critical for RIG-I-mediated antiviral immune responses.

    PubMed

    Liu, Wei; Li, Jing; Zheng, Weinan; Shang, Yingli; Zhao, Zhendong; Wang, Shanshan; Bi, Yuhai; Zhang, Shuang; Xu, Chongfeng; Duan, Ziyuan; Zhang, Lianfeng; Wang, Yue L; Jiang, Zhengfan; Liu, Wenjun; Sun, Lei

    2017-06-08

    RIG-I is a key cytosolic pattern recognition receptor that interacts with MAVS to induce type I interferons (IFNs) against RNA virus infection. In this study, we found that cyclophilin A (CypA), a peptidyl-prolyl cis/trans isomerase, functioned as a critical positive regulator of RIG-I-mediated antiviral immune responses. Deficiency of CypA impaired RIG-I-mediated type I IFN production and promoted viral replication in human cells and mice. Upon Sendai virus infection, CypA increased the interaction between RIG-I and its E3 ubiquitin ligase TRIM25, leading to enhanced TRIM25-mediated K63-linked ubiquitination of RIG-I that facilitated recruitment of RIG-I to MAVS. In addition, CypA and TRIM25 competitively interacted with MAVS, thereby inhibiting TRIM25-induced K48-linked ubiquitination of MAVS. Taken together, our findings reveal an essential role of CypA in boosting RIG-I-mediated antiviral immune responses by controlling the ubiquitination of RIG-I and MAVS.

  8. Shikonin derivatives protect immune organs from damage and promote immune responses in vivo in tumour-bearing mice.

    PubMed

    Long, Su; GuangZhi, Yan; BaoJie, Guan; Wei, Xu; YanYong, Hao; YingLi, Wang; Yang, Zhang; LiHua, Liu

    2012-01-01

    Shikonin, a major component of Lithospermum erythrorhizon and Arnebia euchroma, exhibits antiinflammatory, immunomodulatory and antitumour activities. Although many recent studies have focused on the antitumour effects of shikonin, the exact mechanisms underlying its antitumour and immunomodulatory effects in tumour-bearing mice remain unclear. The aim of the present study was to investigate the antitumour and immunomodulatory effects of shikonin derivatives (ShD) in tumour-bearing mice. Swiss mice inoculated with hepatoma HepA(22) or sarcoma 180 (S(180)) cells were treated with ShD or 5-fluorouracil (5Fu). Survival time, immune organs, natural killer cell activity, lymphocytes, lymphocyte transformation and interleukin (IL)-2 production were analysed. ShD significantly prolonged the survival (median survival time prolonged by >7 days) of tumour-bearing mice in a dose-dependent manner, inhibited the growth of transplantable neoplasms (inhibitory rate, > 33%), and recovered (at [ShD] = 2.5 mg/kg/day) or increased (at [ShD] > 5 mg/kg/day) the number of CD3- and CD19-positive cells. ShD also played a role in protecting the immune organs from damage and reversed or enhanced immune responses, as noted by the nearly normal thymic structure; enlarged splenic corpuscles; and improved natural killer cell activity, lymphocyte transformation and IL-2 production in ShD-treated mice. ShD reduced the tumour load of tumour-bearing mice and protected the immune organs against tumour-induced damage and immune function impairment. Copyright © 2011 John Wiley & Sons, Ltd.

  9. Neuropeptide Substance P and the Immune Response

    PubMed Central

    Tehrani, Mohsen; Grace, Peter M.; Pothoulakis, Charalabos; Dana, Reza

    2016-01-01

    Substance P is a peptide mainly secreted by neurons and is involved in many biological processes, including nociception and inflammation. Animal models have provided insights into the biology of this peptide and offered compelling evidence for the importance of substance P in cell-to-cell communication by either paracrine or endocrine signaling. Substance P mediates interactions between neurons and immune cells, with nerve-derived substance P modulating immune cell proliferation rates and cytokine production. Intriguingly, some immune cells have also been found to secrete substance P, which hints at an integral role of substance P in the immune response. These communications play important functional roles in immunity including mobilization, proliferation and modulation of activity of immune cells. This Review summarizes current knowledge of substance P and its receptors, as well as its physiological and pathological roles. We focus on recent developments in the immuno-biology of substance P and we discuss the clinical implications of its ability to modulate the immune response. PMID:27314883

  10. Neuropeptide substance P and the immune response.

    PubMed

    Mashaghi, Alireza; Marmalidou, Anna; Tehrani, Mohsen; Grace, Peter M; Pothoulakis, Charalabos; Dana, Reza

    2016-11-01

    Substance P is a peptide mainly secreted by neurons and is involved in many biological processes, including nociception and inflammation. Animal models have provided insights into the biology of this peptide and offered compelling evidence for the importance of substance P in cell-to-cell communication by either paracrine or endocrine signaling. Substance P mediates interactions between neurons and immune cells, with nerve-derived substance P modulating immune cell proliferation rates and cytokine production. Intriguingly, some immune cells have also been found to secrete substance P, which hints at an integral role of substance P in the immune response. These communications play important functional roles in immunity including mobilization, proliferation and modulation of the activity of immune cells. This review summarizes current knowledge of substance P and its receptors, as well as its physiological and pathological roles. We focus on recent developments in the immunobiology of substance P and discuss the clinical implications of its ability to modulate the immune response.

  11. Steric Shielding of Surface Epitopes and Impaired Immune Recognition Induced by the Ebola Virus Glycoprotein

    PubMed Central

    Francica, Joseph R.; Varela-Rohena, Angel; Medvec, Andrew; Plesa, Gabriela; Riley, James L.; Bates, Paul

    2010-01-01

    Many viruses alter expression of proteins on the surface of infected cells including molecules important for immune recognition, such as the major histocompatibility complex (MHC) class I and II molecules. Virus-induced downregulation of surface proteins has been observed to occur by a variety of mechanisms including impaired transcription, blocks to synthesis, and increased turnover. Viral infection or transient expression of the Ebola virus (EBOV) glycoprotein (GP) was previously shown to result in loss of staining of various host cell surface proteins including MHC1 and β1 integrin; however, the mechanism responsible for this effect has not been delineated. In the present study we demonstrate that EBOV GP does not decrease surface levels of β1 integrin or MHC1, but rather impedes recognition by steric occlusion of these proteins on the cell surface. Furthermore, steric occlusion also occurs for epitopes on the EBOV glycoprotein itself. The occluded epitopes in host proteins and EBOV GP can be revealed by removal of the surface subunit of GP or by removal of surface N- and O- linked glycans, resulting in increased surface staining by flow cytometry. Importantly, expression of EBOV GP impairs CD8 T-cell recognition of MHC1 on antigen presenting cells. Glycan-mediated steric shielding of host cell surface proteins by EBOV GP represents a novel mechanism for a virus to affect host cell function, thereby escaping immune detection. PMID:20844579

  12. IgG4 subclass antibodies impair antitumor immunity in melanoma

    PubMed Central

    Karagiannis, Panagiotis; Gilbert, Amy E.; Josephs, Debra H.; Ali, Niwa; Dodev, Tihomir; Saul, Louise; Correa, Isabel; Roberts, Luke; Beddowes, Emma; Koers, Alexander; Hobbs, Carl; Ferreira, Silvia; Geh, Jenny L.C.; Healy, Ciaran; Harries, Mark; Acland, Katharine M.; Blower, Philip J.; Mitchell, Tracey; Fear, David J.; Spicer, James F.; Lacy, Katie E.; Nestle, Frank O.; Karagiannis, Sophia N.

    2013-01-01

    Host-induced antibodies and their contributions to cancer inflammation are largely unexplored. IgG4 subclass antibodies are present in IL-10–driven Th2 immune responses in some inflammatory conditions. Since Th2-biased inflammation is a hallmark of tumor microenvironments, we investigated the presence and functional implications of IgG4 in malignant melanoma. Consistent with Th2 inflammation, CD22+ B cells and IgG4+-infiltrating cells accumulated in tumors, and IL-10, IL-4, and tumor-reactive IgG4 were expressed in situ. When compared with B cells from patient lymph nodes and blood, tumor-associated B cells were polarized to produce IgG4. Secreted B cells increased VEGF and IgG4, and tumor cells enhanced IL-10 secretion in cocultures. Unlike IgG1, an engineered tumor antigen-specific IgG4 was ineffective in triggering effector cell–mediated tumor killing in vitro. Antigen-specific and nonspecific IgG4 inhibited IgG1-mediated tumoricidal functions. IgG4 blockade was mediated through reduction of FcγRI activation. Additionally, IgG4 significantly impaired the potency of tumoricidal IgG1 in a human melanoma xenograft mouse model. Furthermore, serum IgG4 was inversely correlated with patient survival. These findings suggest that IgG4 promoted by tumor-induced Th2-biased inflammation may restrict effector cell functions against tumors, providing a previously unexplored aspect of tumor-induced immune escape and a basis for biomarker development and patient-specific therapeutic approaches. PMID:23454746

  13. Cellular Immune Response to Cytomegalovirus Infection After Renal Transplantation

    PubMed Central

    Linnemann, Calvin C.; Kauffman, Carol A.; First, M. Roy; Schiff, Gilbert M.; Phair, John P.

    1978-01-01

    A prospective study of 15 patients who received renal transplants defined the effect of renal transplantation on the cellular immune response to cytomegalovirus infection. Of 15 patients, 14 developed cytomegalovirus infection, usually in the first 2 months after transplantation, and all infections were accompanied by a normal humoral immune response. After the initiation of immunosuppressive therapy and transplantation, there was a general depression of lymphocyte transformation, as reflected in the response to phytohemagglutinin, accompanied by a specific defect in cellular immunity, as indicated by lymphocyte transformation to cytomegalovirus antigen. Eleven patients had cellular immunity to cytomegalovirus before transplantation, and all of these became negative in the first month after transplantation. In subsequent months, only 6 of the 14 study patients with cytomegalovirus infection developed specific cellular immune responses to cytomegalovirus. This occurred most often in patients who had severe febrile illnesses in association with infection. The specific cellular immune response which developed in the posttransplant period did not persist in three of the patients. This study demonstrates the dissociation of the humoral and cellular immune response to cytomegalovirus infection in renal transplant patients and indicates the importance of the loss of cellular immunity in the appearance of infection. Previously infected patients lost their cell-mediated immunity and had reactivation infections despite the presence of serum antibody. PMID:215541

  14. Host Immune Response to Influenza A Virus Infection.

    PubMed

    Chen, Xiaoyong; Liu, Shasha; Goraya, Mohsan Ullah; Maarouf, Mohamed; Huang, Shile; Chen, Ji-Long

    2018-01-01

    Influenza A viruses (IAVs) are contagious pathogens responsible for severe respiratory infection in humans and animals worldwide. Upon detection of IAV infection, host immune system aims to defend against and clear the viral infection. Innate immune system is comprised of physical barriers (mucus and collectins), various phagocytic cells, group of cytokines, interferons (IFNs), and IFN-stimulated genes, which provide first line of defense against IAV infection. The adaptive immunity is mediated by B cells and T cells, characterized with antigen-specific memory cells, capturing and neutralizing the pathogen. The humoral immune response functions through hemagglutinin-specific circulating antibodies to neutralize IAV. In addition, antibodies can bind to the surface of infected cells and induce antibody-dependent cell-mediated cytotoxicity or complement activation. Although there are neutralizing antibodies against the virus, cellular immunity also plays a crucial role in the fight against IAVs. On the other hand, IAVs have developed multiple strategies to escape from host immune surveillance for successful replication. In this review, we discuss how immune system, especially innate immune system and critical molecules are involved in the antiviral defense against IAVs. In addition, we highlight how IAVs antagonize different immune responses to achieve a successful infection.

  15. Impaired B cell immunity in acute myeloid leukemia patients after chemotherapy.

    PubMed

    Goswami, Meghali; Prince, Gabrielle; Biancotto, Angelique; Moir, Susan; Kardava, Lela; Santich, Brian H; Cheung, Foo; Kotliarov, Yuri; Chen, Jinguo; Shi, Rongye; Zhou, Huizhi; Golding, Hana; Manischewitz, Jody; King, Lisa; Kunz, Lauren M; Noonan, Kimberly; Borrello, Ivan M; Smith, B Douglas; Hourigan, Christopher S

    2017-07-10

    Changes in adaptive immune cells after chemotherapy in adult acute myeloid leukemia (AML) may have implications for the success of immunotherapy. This study was designed to determine the functional capacity of the immune system in adult patients with AML who have completed chemotherapy and are potential candidates for immunotherapy. We used the response to seasonal influenza vaccination as a surrogate for the robustness of the immune system in 10 AML patients in a complete remission post-chemotherapy and performed genetic, phenotypic, and functional characterization of adaptive immune cell subsets. Only 2 patients generated protective titers in response to vaccination, and a majority of patients had abnormal frequencies of transitional and memory B-cells. B-cell receptor sequencing showed a B-cell repertoire with little evidence of somatic hypermutation in most patients. Conversely, frequencies of T-cell populations were similar to those seen in healthy controls, and cytotoxic T-cells demonstrated antigen-specific activity after vaccination. Effector T-cells had increased PD-1 expression in AML patients least removed from chemotherapy. Our results suggest that while some aspects of cellular immunity recover quickly, humoral immunity is incompletely reconstituted in the year following intensive cytotoxic chemotherapy for AML. The observed B-cell abnormalities may explain the poor response to vaccination often seen in AML patients after chemotherapy. Furthermore, the uncoupled recovery of B-cell and T-cell immunity and increased PD-1 expression shortly after chemotherapy might have implications for the success of several modalities of immunotherapy.

  16. Immunomodulator-based enhancement of anti smallpox immune responses.

    PubMed

    Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L; Ríos-Olivares, Eddy; Otero, Miguel

    2015-01-01

    The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform.

  17. Role of Innate Immunity in Neonatal Infection

    PubMed Central

    Cuenca, Alex G; Wynn, James L; Moldawer, Lyle L; Levy, Ofer

    2014-01-01

    Newborns are at increased risk of infection due to genetic, epigenetic, and environmental factors. Herein we examine the roles of the neonatal innate immune system in host defense against bacterial and viral infections. Full-term newborns express a distinct innate immune system biased towards TH2/TH17-polarizing and anti-inflammatory cytokine production with relative impairment in TH1-polarizing cytokine production that leaves them particularly vulnerable to infection with intracellular pathogens. In addition to these distinct features, preterm newborns also have fragile skin, impaired TH17-polarizing cytokine production and deficient expression of complement and of antimicrobial proteins and peptides (APPs) that likely contribute to susceptibility to pyogenic bacteria. Ongoing research is identifying APPs, including bacterial/permeability-increasing protein and lactoferrin, as well as pattern recognition receptor (PRR) agonists that may serve to enhance protective newborn and infant immune responses as stand alone immune response modifiers or vaccine adjuvants. PMID:23297181

  18. Stress proteins and the immune response.

    PubMed

    Moseley, P

    2000-07-25

    The heat shock or stress response is one of the most highly conserved adaptive responses in nature. In single cell organisms, the stress response confers tolerance to a variety of stresses including hyperthermia, hyperoxia, hypoxia, and other perturbations, which alter protein synthesis. This tolerance phenomenon is also extremely important in the multicellular organism, resulting in not only thermal tolerance, but also resistance to stresses of the whole organism such as ischemia-reperfusion injury. Moreover, recent data indicates that these stress proteins have the ability to modulate the cellular immune response. Although the terms heat shock proteins (HSPs) and stress proteins are often used interchangeably, the term stress proteins includes the HSPs, the glucose-regulated proteins (GRPs) and ubiquitin. The stress proteins may be grouped by molecular weight ranging from the large 110 kDa HSP110 to ubiquitin at 8 kDa. These proteins serve as cellular chaperones, participating in protein synthesis and transport through the various cellular compartments. Because these proteins have unique cellular localizations, the chaperone function of the stress proteins often involves a transfer of peptides between stress proteins as the peptide is moved between cellular compartments. For example, HSP70 is a cytosolic and nuclear chaperone, which is critical for the transfer of cellular peptides in the mitochondrion through a hand-off that involves mitochondrial HSP60 at the inner mitochondrial membrane. Similarly, cytosolic proteins are transferred from HSP70 to gp96 as they move into the endoplasmic reticulum. The central role of the stress proteins in the transfer of peptides through the cell may be responsible for the recently recognized importance of the stress proteins in the modulation of the immune system [Feder, M.E., Hofmann, G.E., 1999. Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Annu. Rev. Physiol. 61

  19. Human Immune Responses to Dengue Viruses.

    DTIC Science & Technology

    1984-08-01

    ND-R171 381 HUR IMMUNE RESPONSES TO DENGUE VIRUSES (U) 1/1 MASSRCHUSETTS UNIY M9DICAL SCHOOL WORCESTER F R~ ENNIS RUG 94 DRMt17-2-C-2233 UNCLASSIFIED...Responses to Dengue Viruses Annual Report 0(August 1983-July 1984) Francis A. Ennis, M.D. August 1984 Supported by U.S. Army Medical Research and...3M1- NO. SON No. Frederick, Maryland 21701-5012 61102A 61102BSI0 AA 104 11. TITLE Oxkf* Samqy Oao" Human Immune Responses to Dengue Viruses 12. PERSON

  20. Anthrax Immunization in the Older Warrior

    DTIC Science & Technology

    2000-08-01

    were impaired. made to relate these variables to age . It was found that older warriors were at least as likely as younger Voluntary immunization...hence, older age could not account questionnaire by post for completion and return. In for an increased prevalence of adverse reactions in order to... older adults generally have less given that previously immunized personnel were found effective immune responses to invading organisms more likely to

  1. Perfluoroalkyl Substance Serum Concentrations and Immune Response to FluMist Vaccination among Healthy Adults

    PubMed Central

    Stein, Cheryl R; Ge, Yongchao; Wolff, Mary S; Ye, Xiaoyun; Calafat, Antonia M; Kraus, Thomas; Moran, Thomas M

    2016-01-01

    Perfluoroalkyl substances (PFAS) were shown to be immunotoxic in laboratory animals. There is some epidemiological evidence that PFAS exposure is inversely associated with vaccine-induced antibody concentration. We examined immune response to vaccination with FluMist intranasal live attenuated influenza vaccine in relation to four PFAS (perfluorooctanoate, perfluorononanoate, perfluorooctane sulfonate, perfluorohexane sulfonate) serum concentrations among 78 healthy adults vaccinated during the 2010 – 2011 influenza season. We measured anti-A H1N1 antibody response and cytokine and chemokine concentrations in serum pre-vaccination, 3 days post-vaccination, and 30 days post-vaccination. We measured cytokine, chemokine, and mucosal IgA concentration in nasal secretions 3 days post-vaccination and 30 days post-vaccination. Adults with higher PFAS concentrations were more likely to seroconvert after FluMist vaccination as compared to adults with lower PFAS concentrations. The associations, however, were imprecise and few participants seroconverted as measured either by hemagglutination inhibition (9%) or immunohistochemical staining (25%). We observed no readily discernable or consistent pattern between PFAS concentration and baseline cytokine, chemokine, or mucosal IgA concentration, or between PFAS concentration and change in these immune markers between baseline and FluMist-response states. The resuts of this study do not support a reduced immune response to FluMist vaccination among healthy adults in relation to serum PFAS concentration. Given the study’s many limitations, however, it does not rule out impaired vaccine response to other vaccines or vaccine components in either children or adults. PMID:27208468

  2. Immune Response And Anamnestic Immune Response In Children After A 3-Dose Primary Hepatitis B Vaccination.

    PubMed

    Afzal, Muhammad Faheem; Sultan, Muhammad Ashraf; Saleemi, Ahmad Imran

    2016-01-01

    Diseases caused by Hepatitis B virus (HBV) have a worldwide distribution. Pakistan adopted the recommendations of World Health Organization (WHO) for routine universal infant vaccination against hepatitis B in 2002, currently being administered at 6, 10, and 14 weeks of age in a combination vaccine. This study was conducted to determine the immune response & anamnestic immune response in children, 9 months-10 years of age, after a 3dose primary Hepatitis B vaccination. This cross sectional study was conducted in the Department of Paediatrics, King Edward Medical University/Mayo Hospital, Lahore, Pakistan, from January to June, 2014. A total of 200 children of either sex between the ages of 9 months to 10 years, documented to have received 3 doses of hepatitis B vaccines according to Expanded Program of Immunization (6,10,14 weeks) schedule in infancy, were recruited by consecutive sampling. The level of serum antiHBsAb by ELIZA was measured. Children with antiHBs titers ≥10 mIU/mL were considered to be immune. Those with anti HBsAb levels <10 mIU/mL were offered a booster dose of infant recombinant hepatitis B vaccine. The second serum sample was obtained 21-28 days following the administration of the booster dose and the anamnestic immune response was measured. Data was analysed using SPSS 17 to determine the relation between time interval since last vaccination and antibody titer. Chi square test was applied. Of the 200 children, protective antibody response was found in 58%. Median serological response was 18.60 (range 2.82 - 65.15). Antibody levels were found to have a statistically significant ( pvalue 0.019) negative correlation with the time since last administration of vaccine. A booster dose of Hepatitis B vacci ne was administered to all nonresponders, with each registering a statistically significant (pvalue 0.00) anamnestic response. The vaccination schedule with short dosage interval was unable to provide protection to 42% of the study population

  3. Dim light at night interferes with the development of the short-day phenotype and impairs cell-mediated immunity in Siberian hamsters (Phodopus sungorus).

    PubMed

    Aubrecht, Taryn G; Weil, Zachary M; Nelson, Randy J

    2014-10-01

    Winter is a challenging time to survive and breed outside of the tropics. Animals use day length (photoperiod) to regulate seasonally appropriate adaptations in anticipation of challenging winter conditions. The net result of these photoperiod-mediated adjustments is enhanced immune function and increased survival. Thus, the ability to discriminate day length information is critical for survival and reproduction in small animals. However, during the past century, urban and suburban development has rapidly expanded and filled the night sky with light from various sources, obscuring crucial light-dark signals, which alters physiological interpretation of day lengths. Furthermore, reduced space, increased proximity to people, and the presence of light at night may act as stressors for small animals. Whereas acute stressors typically enhance immune responses, chronic exposure to stressors often impairs immune responses. Therefore, we hypothesized that the combination of dim light at night and chronic stress interferes with enhanced cell-mediated immunity observed during short days. Siberian hamsters (Phodopus sungorus) were assigned to short or long days with dark nights (0 lux) or dim (5 lux) light at night for 10 weeks. Following 2 weeks of chronic restraint (6 hr/day), a model of chronic stress, delayed type hypersensitivity (DTH) responses were assessed. Both dim light at night and restraint reduced the DTH response. Dim light at night during long nights produced an intermediate short day phenotype. These results suggest the constant presence of light at night could negatively affect survival of photoperiodic rodents by disrupting the timing of breeding and immune responses. © 2014 Wiley Periodicals, Inc.

  4. Global analyses revealed age-related alterations in innate immune responses after stimulation of pathogen recognition receptors

    PubMed Central

    Metcalf, Talibah U; Cubas, Rafael A; Ghneim, Khader; Cartwright, Michael J; Grevenynghe, Julien Van; Richner, Justin M; Olagnier, David P; Wilkinson, Peter A; Cameron, Mark J; Park, Byung S; Hiscott, John B; Diamond, Michael S; Wertheimer, Anne M; Nikolich-Zugich, Janko; Haddad, Elias K

    2015-01-01

    Aging leads to dysregulation of multiple components of the immune system that results in increased susceptibility to infections and poor response to vaccines in the aging population. The dysfunctions of adaptive B and T cells are well documented, but the effect of aging on innate immunity remains incompletely understood. Using a heterogeneous population of peripheral blood mononuclear cells (PBMCs), we first undertook transcriptional profiling and found that PBMCs isolated from old individuals (≥ 65 years) exhibited a delayed and altered response to stimulation with TLR4, TLR7/8, and RIG-I agonists compared to cells obtained from adults (≤ 40 years). This delayed response to innate immune agonists resulted in the reduced production of pro-inflammatory and antiviral cytokines and chemokines including TNFα, IL-6, IL-1β, IFNα, IFNγ, CCL2, and CCL7. While the major monocyte and dendritic cell subsets did not change numerically with aging, activation of specific cell types was altered. PBMCs from old subjects also had a lower frequency of CD40+ monocytes, impaired up-regulation of PD-L1 on monocytes and T cells, and increased expression of PD-L2 and B7-H4 on B cells. The defective immune response to innate agonists adversely affected adaptive immunity as TLR-stimulated PBMCs (minus CD3 T cells) from old subjects elicited significantly lower levels of adult T-cell proliferation than those from adult subjects in an allogeneic mixed lymphocyte reaction (MLR). Collectively, these age-associated changes in cytokine, chemokine and interferon production, as well as co-stimulatory protein expression could contribute to the blunted memory B- and T-cell immune responses to vaccines and infections. PMID:25728020

  5. The unfolded protein response in immunity and inflammation

    PubMed Central

    Grootjans, Joep; Kaser, Arthur; Kaufman, Randal J.; Blumberg, Richard S.

    2017-01-01

    The unfolded protein response (UPR) is a highly conserved pathway that allows the cell to manage endoplasmic reticulum (ER) stress that is imposed by the secretory demands associated with environmental forces. In this role, the UPR has increasingly been shown to have crucial functions in immunity and inflammation. In this Review, we discuss the importance of the UPR in the development, differentiation, function and survival of immune cells in meeting the needs of an immune response. In addition, we review current insights into how the UPR is involved in complex chronic inflammatory diseases and, through its role in immune regulation, antitumour responses. PMID:27346803

  6. Injury-induced immune responses in Hydra.

    PubMed

    Wenger, Yvan; Buzgariu, Wanda; Reiter, Silke; Galliot, Brigitte

    2014-08-01

    The impact of injury-induced immune responses on animal regenerative processes is highly variable, positive or negative depending on the context. This likely reflects the complexity of the innate immune system that behaves as a sentinel in the transition from injury to regeneration. Early-branching invertebrates with high regenerative potential as Hydra provide a unique framework to dissect how injury-induced immune responses impact regeneration. A series of early cellular events likely require an efficient immune response after amputation, as antimicrobial defence, epithelial cell stretching for wound closure, migration of interstitial progenitors toward the wound, cell death, phagocytosis of cell debris, or reconstruction of the extracellular matrix. The analysis of the injury-induced transcriptomic modulations of 2636 genes annotated as immune genes in Hydra identified 43 genes showing an immediate/early pulse regulation in all regenerative contexts examined. These regulations point to an enhanced cytoprotection via ROS signaling (Nrf, C/EBP, p62/SQSMT1-l2), TNFR and TLR signaling (TNFR16-like, TRAF2l, TRAF5l, jun, fos-related, SIK2, ATF1/CREB, LRRC28, LRRC40, LRRK2), proteasomal activity (p62/SQSMT1-l1, Ced6/Gulf, NEDD8-conjugating enzyme Ubc12), stress proteins (CRYAB1, CRYAB2, HSP16.2, DnaJB9, HSP90a1), all potentially regulating NF-κB activity. Other genes encoding immune-annotated proteins such as NPYR4, GTPases, Swap70, the antiproliferative BTG1, enzymes involved in lipid metabolism (5-lipoxygenase, ACSF4), secreted clotting factors, secreted peptidases are also pulse regulated upon bisection. By contrast, metalloproteinases and antimicrobial peptide genes largely follow a context-dependent regulation, whereas the protease inhibitor α2macroglobulin gene exhibits a sustained up-regulation. Hence a complex immune response to injury is linked to wound healing and regeneration in Hydra. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights

  7. B cell function in the immune response to helminths

    PubMed Central

    Harris, Nicola

    2010-01-01

    Similar T helper (Th)2-type immune responses are generated against different helminths parasites, but the mechanisms that initiate Th2 immunity, and the specific immune components that mediate protection against these parasites, can vary greatly. B cells are increasingly recognized as important during the Th2-type immune response to helminths, and B cell activation might be a target for effective vaccine development. Antibody production is a function of B cells during helminth infection and understanding how polyclonal and antigen-specific antibodies contribute should provide important insights into how protective immunity develops. In addition, B cells might also contribute to the host response against helminths through antibody-independent functions including, antigen-presentation, as well as regulatory and effector activity. In this review, we examine the role of B cells during Th2-type immune response to these multicellular parasites. PMID:21159556

  8. Immunomodulator-Based Enhancement of Anti Smallpox Immune Responses

    PubMed Central

    Martínez, Osmarie; Miranda, Eric; Ramírez, Maite; Santos, Saritza; Rivera, Carlos; Vázquez, Luis; Sánchez, Tomás; Tremblay, Raymond L.; Ríos-Olivares, Eddy; Otero, Miguel

    2015-01-01

    Background The current live vaccinia virus vaccine used in the prevention of smallpox is contraindicated for millions of immune-compromised individuals. Although vaccination with the current smallpox vaccine produces protective immunity, it might result in mild to serious health complications for some vaccinees. Thus, there is a critical need for the production of a safe virus-free vaccine against smallpox that is available to everyone. For that reason, we investigated the impact of imiquimod and resiquimod (Toll-like receptors agonists), and the codon-usage optimization of the vaccinia virus A27L gene in the enhancement of the immune response, with intent of producing a safe, virus-free DNA vaccine coding for the A27 vaccinia virus protein. Methods We analyzed the cellular-immune response by measuring the IFN-γ production of splenocytes by ELISPOT, the humoral-immune responses measuring total IgG and IgG2a/IgG1 ratios by ELISA, and the TH1 and TH2 cytokine profiles by ELISA, in mice immunized with our vaccine formulation. Results The proposed vaccine formulation enhanced the A27L vaccine-mediated production of IFN-γ on mouse spleens, and increased the humoral immunity with a TH1-biased response. Also, our vaccine induced a TH1 cytokine milieu, which is important against viral infections. Conclusion These results support the efforts to find a new mechanism to enhance an immune response against smallpox, through the implementation of a safe, virus-free DNA vaccination platform. PMID:25875833

  9. Mucosal immune response to poliovirus vaccines in childhood.

    PubMed

    Ogra, P L

    1984-01-01

    Comparative evaluation of the systemic and secretory antibody response to live attenuated (oral) poliovirus vaccine ( OPV ) or inactivated poliovirus vaccine (IPV) has suggested that both vaccines are highly effective in inducing seroconversion and in preventing paralytic poliomyelitis. However, parenteral immunization with IPV does not appear to be highly effective in inducing secretory antibody response in the nasopharynx or alimentary tract during primary immunization. Reimmunization with IPV in subjects previously primed with parenterally administered IPV appears to result in a mild booster effect on the development of secretory antibody response. More significantly, rechallenge by the oral route with OPV in IPV-primed subjects resulted in a marked enhancement of secretory antibody response. In general, no suppression of systemic or secretory response to poliovirus was observed with either form ( OPV vs. IPV) or with route of immunization. These observations are discussed in relation to the immune response observed with other mucosally or parenterally administered antigens. Their implications in the development of oral tolerance are briefly reviewed.

  10. The immune responses in CD40-deficient mice: impaired immunoglobulin class switching and germinal center formation.

    PubMed

    Kawabe, T; Naka, T; Yoshida, K; Tanaka, T; Fujiwara, H; Suematsu, S; Yoshida, N; Kishimoto, T; Kikutani, H

    1994-06-01

    An engagement of CD40 with CD40 ligand (CD40L) expressed on activated T cells is known to provide an essential costimulatory signal to B cells in vitro. To investigate the role of CD40 in in vivo immune responses, CD40-deficient mice were generated by gene targeting. The significant reduction of CD23 expression on mature B cells and relatively decreased number of IgM bright and IgD dull B cells were observed in the mutant mice. The mutant mice mounted IgM responses but no IgG, IgA, and IgE responses to thymus-dependent (TD) antigens. However, IgG as well as IgM responses to thymus-independent (TI) antigens were normal. Furthermore, the germinal center formation was defective in the mutant mice. These results suggest that CD40 is essential for T cell-dependent immunoglobulin class switching and germinal center formation, but not for in vivo T cell-dependent IgM responses and T cell-independent antibody responses.

  11. Effect of antipyretic analgesics on immune responses to vaccination.

    PubMed

    Saleh, Ezzeldin; Moody, M Anthony; Walter, Emmanuel B

    2016-09-01

    While antipyretic analgesics are widely used to ameliorate vaccine adverse reactions, their use has been associated with blunted vaccine immune responses. Our objective was to review literature evaluating the effect of antipyretic analgesics on vaccine immune responses and to highlight potential underlying mechanisms. Observational studies reporting on antipyretic use around the time of immunization concluded that their use did not affect antibody responses. Only few randomized clinical trials demonstrated blunted antibody response of unknown clinical significance. This effect has only been noted following primary vaccination with novel antigens and disappears following booster immunization. The mechanism by which antipyretic analgesics reduce antibody response remains unclear and not fully explained by COX enzyme inhibition. Recent work has focused on the involvement of nuclear and subcellular signaling pathways. More detailed immunological investigations and a systems biology approach are needed to precisely define the impact and mechanism of antipyretic effects on vaccine immune responses.

  12. Evaluation of Mucosal and Systemic Immune Responses Elicited by GPI-0100- Adjuvanted Influenza Vaccine Delivered by Different Immunization Strategies

    PubMed Central

    Liu, Heng; Patil, Harshad P.; de Vries-Idema, Jacqueline; Wilschut, Jan; Huckriede, Anke

    2013-01-01

    Vaccines for protection against respiratory infections should optimally induce a mucosal immune response in the respiratory tract in addition to a systemic immune response. However, current parenteral immunization modalities generally fail to induce mucosal immunity, while mucosal vaccine delivery often results in poor systemic immunity. In order to find an immunization strategy which satisfies the need for induction of both mucosal and systemic immunity, we compared local and systemic immune responses elicited by two mucosal immunizations, given either by the intranasal (IN) or the intrapulmonary (IPL) route, with responses elicited by a mucosal prime followed by a systemic boost immunization. The study was conducted in BALB/c mice and the vaccine formulation was an influenza subunit vaccine supplemented with GPI-0100, a saponin-derived adjuvant. While optimal mucosal antibody titers were obtained after two intrapulmonary vaccinations, optimal systemic antibody responses were achieved by intranasal prime followed by intramuscular boost. The latter strategy also resulted in the best T cell response, yet, it was ineffective in inducing nose or lung IgA. Successful induction of secretory IgA, IgG and T cell responses was only achieved with prime-boost strategies involving intrapulmonary immunization and was optimal when both immunizations were given via the intrapulmonary route. Our results underline that immunization via the lungs is particularly effective for priming as well as boosting of local and systemic immune responses. PMID:23936066

  13. Matrix metalloproteinase-3 is a possible mediator of neurodevelopmental impairment due to polyI:C-induced innate immune activation of astrocytes.

    PubMed

    Yamada, Shinnosuke; Nagai, Taku; Nakai, Tsuyoshi; Ibi, Daisuke; Nakajima, Akira; Yamada, Kiyofumi

    2014-05-01

    Increasing epidemiological evidence indicates that prenatal infection and childhood central nervous system infection with various viral pathogens enhance the risk for several neuropsychiatric disorders. Polyriboinosinic-polyribocytidilic acid (polyI:C) is known to induce strong innate immune responses that mimic immune activation by viral infections. Our previous findings suggested that activation of the innate immune system in astrocytes results in impairments of neurite outgrowth and spine formation, which lead to behavioral abnormalities in adulthood. To identify candidates of astrocyte-derived humoral factors that affect neuronal development, we analyzed astrocyte-conditioned medium (ACM) from murine astrocyte cultures treated with polyI:C (polyI:C-ACM) by two-dimensional fluorescence difference gel electrophoresis (2D-DIGE). Through a quantitative proteomic screen, we found that 13 protein spots were differentially expressed compared with ACM from vehicle-treated astrocytes (control-ACM), and characterized one of the candidates, matrix metalloproteinase-3 (Mmp3). PolyI:C treatment significantly increased the expression levels of Mmp3 mRNA and protein in astrocytes, but not microglia. PolyI:C-ACM was associated with significantly higher Mmp3 protein level and enzyme activity than control-ACM. The addition of recombinant Mmp3 into control-ACM impaired dendritic elongation of primary cultured hippocampal neurons, while the deleterious effect of polyI:C-ACM on neurite elongation was attenuated by knockdown of Mmp3 in astrocytes. These results suggest that Mmp3 is a possible mediator of polyI:C-ACM-induced neurodevelopmental impairment. Copyright © 2014. Published by Elsevier Inc.

  14. CD4+ T-Cell-Independent Secondary Immune Responses to Pneumocystis Pneumonia

    PubMed Central

    de la Rua, Nicholas M.; Samuelson, Derrick R.; Charles, Tysheena P.; Welsh, David A.; Shellito, Judd E.

    2016-01-01

    Pneumocystis pneumonia is a major cause of morbidity and mortality among immunocompromised patients, especially in the context of HIV/AIDS. In the murine model of Pneumocystis pneumonia, CD4+ T-cells are required for clearance of a primary infection of Pneumocystis, but not the memory recall response. We hypothesized that the memory recall response in the absence of CD4+ T-cells is mediated by a robust memory humoral response, CD8+ T-cells, and IgG-mediated phagocytosis by alveolar macrophages. To investigate the role of CD8+ T-cells and alveolar macrophages in the immune memory response to Pneumocystis, mice previously challenged with Pneumocystis were depleted of CD8+ T-cells or alveolar macrophages prior to re-infection. Mice depleted of CD4+ T-cells prior to secondary challenge cleared Pneumocystis infection within 48 h identical to immunocompetent mice during a secondary memory recall response. However, loss of CD8+ T-cells or macrophages prior to the memory recall response significantly impaired Pneumocystis clearance. Specifically, mice depleted of CD8+ T-cells or alveolar macrophages had significantly higher fungal burden in the lungs. Furthermore, loss of alveolar macrophages significantly skewed the lung CD8+ T-cell response toward a terminally differentiated effector memory population and increased the percentage of IFN-γ+ CD8+ T-cells. Finally, Pneumocystis-infected animals produced significantly more bone marrow plasma cells and Pneumocystis-specific IgG significantly increased macrophage-mediated killing of Pneumocystis in vitro. These data suggest that secondary immune memory responses to Pneumocystis are mediated, in part, by CD8+ T-cells, alveolar macrophages, and the production of Pneumocystis-specific IgG. PMID:27242785

  15. DNA and protein co-immunization improves the magnitude and longevity of humoral immune responses in macaques.

    PubMed

    Jalah, Rashmi; Kulkarni, Viraj; Patel, Vainav; Rosati, Margherita; Alicea, Candido; Bear, Jenifer; Yu, Lei; Guan, Yongjun; Shen, Xiaoying; Tomaras, Georgia D; LaBranche, Celia; Montefiori, David C; Prattipati, Rajasekhar; Pinter, Abraham; Bess, Julian; Lifson, Jeffrey D; Reed, Steven G; Sardesai, Niranjan Y; Venzon, David J; Valentin, Antonio; Pavlakis, George N; Felber, Barbara K

    2014-01-01

    We tested the concept of combining DNA with protein to improve anti-HIV Env systemic and mucosal humoral immune responses. Rhesus macaques were vaccinated with DNA, DNA&protein co-immunization or DNA prime followed by protein boost, and the magnitude and mucosal dissemination of the antibody responses were monitored in both plasma and mucosal secretions. We achieved induction of robust humoral responses by optimized DNA vaccination delivered by in vivo electroporation. These responses were greatly increased upon administration of a protein boost. Importantly, a co-immunization regimen of DNA&protein injected in the same muscle at the same time induced the highest systemic binding and neutralizing antibodies to homologous or heterologous Env as well as the highest Env-specific IgG in saliva. Inclusion of protein in the vaccine resulted in more immunized animals with Env-specific IgG in rectal fluids. Inclusion of DNA in the vaccine significantly increased the longevity of systemic humoral immune responses, whereas protein immunization, either as the only vaccine component or as boost after DNA prime, was followed by a great decline of humoral immune responses overtime. We conclude that DNA&protein co-delivery in a simple vaccine regimen combines the strength of each vaccine component, resulting in improved magnitude, extended longevity and increased mucosal dissemination of the induced antibodies in immunized rhesus macaques.

  16. Antitumor immune responses mediated by dendritic cells

    PubMed Central

    Spel, Lotte; Boelens, Jaap-Jan; Nierkens, Stefan; Boes, Marianne

    2013-01-01

    Dendritic cells (DCs) are essential for the induction of adaptive immune responses against malignant cells by virtue of their capacity to effectively cross-present exogenous antigens to T lymphocytes. Dying cancer cells are indeed a rich source of antigens that may be harnessed for the development of DC-based vaccines. In particular, malignant cells succumbing to apoptosis, rather than necrosis, appear to release antigens in a manner that allows for the elicitation of adaptive immune responses. In this review, we describe the processes that mediate the cross-presentation of antigens released by apoptotic cancer cells to CD8+ T lymphocytes, resulting in the activation of protective tumor-specific immune responses. PMID:24482744

  17. Effect of antipyretic analgesics on immune responses to vaccination

    PubMed Central

    Saleh, Ezzeldin; Moody, M. Anthony; Walter, Emmanuel B.

    2016-01-01

    ABSTRACT While antipyretic analgesics are widely used to ameliorate vaccine adverse reactions, their use has been associated with blunted vaccine immune responses. Our objective was to review literature evaluating the effect of antipyretic analgesics on vaccine immune responses and to highlight potential underlying mechanisms. Observational studies reporting on antipyretic use around the time of immunization concluded that their use did not affect antibody responses. Only few randomized clinical trials demonstrated blunted antibody response of unknown clinical significance. This effect has only been noted following primary vaccination with novel antigens and disappears following booster immunization. The mechanism by which antipyretic analgesics reduce antibody response remains unclear and not fully explained by COX enzyme inhibition. Recent work has focused on the involvement of nuclear and subcellular signaling pathways. More detailed immunological investigations and a systems biology approach are needed to precisely define the impact and mechanism of antipyretic effects on vaccine immune responses. PMID:27246296

  18. The development of a fully-integrated immune response model (FIRM) simulator of the immune response through integration of multiple subset models

    PubMed Central

    2013-01-01

    Background The complexity and multiscale nature of the mammalian immune response provides an excellent test bed for the potential of mathematical modeling and simulation to facilitate mechanistic understanding. Historically, mathematical models of the immune response focused on subsets of the immune system and/or specific aspects of the response. Mathematical models have been developed for the humoral side of the immune response, or for the cellular side, or for cytokine kinetics, but rarely have they been proposed to encompass the overall system complexity. We propose here a framework for integration of subset models, based on a system biology approach. Results A dynamic simulator, the Fully-integrated Immune Response Model (FIRM), was built in a stepwise fashion by integrating published subset models and adding novel features. The approach used to build the model includes the formulation of the network of interacting species and the subsequent introduction of rate laws to describe each biological process. The resulting model represents a multi-organ structure, comprised of the target organ where the immune response takes place, circulating blood, lymphoid T, and lymphoid B tissue. The cell types accounted for include macrophages, a few T-cell lineages (cytotoxic, regulatory, helper 1, and helper 2), and B-cell activation to plasma cells. Four different cytokines were accounted for: IFN-γ, IL-4, IL-10 and IL-12. In addition, generic inflammatory signals are used to represent the kinetics of IL-1, IL-2, and TGF-β. Cell recruitment, differentiation, replication, apoptosis and migration are described as appropriate for the different cell types. The model is a hybrid structure containing information from several mammalian species. The structure of the network was built to be physiologically and biochemically consistent. Rate laws for all the cellular fate processes, growth factor production rates and half-lives, together with antibody production rates and half

  19. Damage signals in the insect immune response

    PubMed Central

    Krautz, Robert; Arefin, Badrul; Theopold, Ulrich

    2014-01-01

    Insects and mammals share an ancient innate immune system comprising both humoral and cellular responses. The insect immune system consists of the fat body, which secretes effector molecules into the hemolymph and several classes of hemocytes, which reside in the hemolymph and of protective border epithelia. Key features of wound- and immune responses are shared between insect and mammalian immune systems including the mode of activation by commonly shared microbial (non-self) patterns and the recognition of these patterns by dedicated receptors. It is unclear how metazoan parasites in insects, which lack these shared motifs, are recognized. Research in recent years has demonstrated that during entry into the insect host, many eukaryotic pathogens leave traces that alert potential hosts of the damage they have afflicted. In accordance with terminology used in the mammalian immune systems, these signals have been dubbed danger- or damage-associated signals. Damage signals are necessary byproducts generated during entering hosts either by mechanical or proteolytic damage. Here, we briefly review the current stage of knowledge on how wound closure and wound healing during mechanical damage is regulated and how damage-related signals contribute to these processes. We also discuss how sensors of proteolytic activity induce insect innate immune responses. Strikingly damage-associated signals are also released from cells that have aberrant growth, including tumor cells. These signals may induce apoptosis in the damaged cells, the recruitment of immune cells to the aberrant tissue and even activate humoral responses. Thus, this ensures the removal of aberrant cells and compensatory proliferation to replace lost tissue. Several of these pathways may have been co-opted from wound healing and developmental processes. PMID:25071815

  20. Immune status influences fear and anxiety responses in mice after acute stress exposure

    PubMed Central

    Clark, Sarah M.; Sand, Joseph; Francis, T. Chase; Nagaraju, Anitha; Michael, Kerry C.; Keegan, Achsah D.; Kusnecov, Alexander; Gould, Todd D.; Tonelli, Leonardo H.

    2014-01-01

    Significant evidence suggests that exposure to traumatic and/or acute stress in both mice and humans results in compromised immune function that in turn may affect associated brain processes. Additionally, recent studies in mouse models of immune deficiency have suggested that adaptive immunity may play a role during traumatic stress exposure and that impairments in lymphocyte function may contribute to increased susceptibility to various psychogenic stressors. However, rodent studies on the relationship between maladaptive stress responses and lymphocyte deficiency have been complicated by the fact that genetic manipulations in these models may also result in changes in CNS function due to the expression of targeted genes in tissues other than lymphocytes, including the brain. To address these issues we utilized mice with a deletion of recombination-activating gene 2 (Rag2), which has no confirmed expression in the CNS; thus, its loss should result in the absence of mature lymphocytes without altering CNS function directly. Stress responsiveness of immune deficient Rag2−/− mice on a BALB/c background was evaluated in three different paradigms: predator odor exposure (POE), fear conditioning (FC) and learned helplessness (LH). These models are often used to study different aspects of stress responsiveness after the exposure to an acute stressor. In addition, immunoblot analysis was used to assess hippocampal BDNF expression under both stressed and non-stressed conditions. Subsequent to POE, Rag2−/− mice exhibited a reduced acoustic startle response compared to BALB/c mice; no significant differences in behavior were observed in either FC or LH. Furthermore, analysis of hippocampal BDNF indicated that Rag2−/− mice have elevated levels of the mature form of BDNF compared to BALB/c mice. Results from our studies suggest that the absence of mature lymphocytes is associated with increased resilience to stress exposure in the POE and does not affect

  1. Cyclophilin A-regulated ubiquitination is critical for RIG-I-mediated antiviral immune responses

    PubMed Central

    Liu, Wei; Li, Jing; Zheng, Weinan; Shang, Yingli; Zhao, Zhendong; Wang, Shanshan; Bi, Yuhai; Zhang, Shuang; Xu, Chongfeng; Duan, Ziyuan; Zhang, Lianfeng; Wang, Yue L; Jiang, Zhengfan; Liu, Wenjun; Sun, Lei

    2017-01-01

    RIG-I is a key cytosolic pattern recognition receptor that interacts with MAVS to induce type I interferons (IFNs) against RNA virus infection. In this study, we found that cyclophilin A (CypA), a peptidyl-prolyl cis/trans isomerase, functioned as a critical positive regulator of RIG-I-mediated antiviral immune responses. Deficiency of CypA impaired RIG-I-mediated type I IFN production and promoted viral replication in human cells and mice. Upon Sendai virus infection, CypA increased the interaction between RIG-I and its E3 ubiquitin ligase TRIM25, leading to enhanced TRIM25-mediated K63-linked ubiquitination of RIG-I that facilitated recruitment of RIG-I to MAVS. In addition, CypA and TRIM25 competitively interacted with MAVS, thereby inhibiting TRIM25-induced K48-linked ubiquitination of MAVS. Taken together, our findings reveal an essential role of CypA in boosting RIG-I-mediated antiviral immune responses by controlling the ubiquitination of RIG-I and MAVS. DOI: http://dx.doi.org/10.7554/eLife.24425.001 PMID:28594325

  2. Impaired intrinsic immunity to HSV-1 in human iPSC-derived TLR3-deficient CNS cells

    PubMed Central

    Lafaille, Fabien G; Pessach, Itai M.; Zhang, Shen-Ying; Ciancanelli, Michael J.; Herman, Melina; Abhyankar, Avinash; Ying, Shui-Wang; Keros, Sotirios; Goldstein, Peter A.; Mostoslavsky, Gustavo; Ordovas-Montanes, Jose; Jouanguy, Emmanuelle; Plancoulaine, Sabine; Tu, Edmund; Elkabetz, Yechiel; Al-Muhsen, Saleh; Tardieu, Marc; Schlaeger, Thorsten M.; Daley, George Q.; Abel, Laurent; Casanova, Jean-Laurent; Studer, Lorenz; Notarangelo, Luigi D.

    2012-01-01

    In the course of primary infection with herpes simplex virus 1 (HSV-1), children with inborn errors of TLR3 immunity are prone to HSV-1 encephalitis (HSE) 1–3. We tested the hypothesis that the pathogenesis of HSE involves non hematopoietic central nervous system (CNS)-resident cells. We derived induced pluripotent stem cells (iPSCs) from the dermal fibroblasts of TLR3- and UNC-93B-deficient patients and from controls. These iPSCs were differentiated into highly purified populations of neural stem cells (NSCs), neurons, astrocytes and oligodendrocytes. The induction of IFN-β and/or IFN-γ1 in response to poly(I:C) stimulation was dependent on TLR3 and UNC-93B in all cells tested. However, the induction of IFN-β and IFN-γ1 in response to HSV-1 infection was impaired selectively in UNC-93B-deficient neurons and oligodendrocytes. These cells were also much more susceptible to HSV-1 infection than control cells, whereas UNC-93B-deficient NSCs and astrocytes were not. TLR3-deficient neurons were also found to be susceptible to HSV-1 infection. The rescue of UNC-93B- and TLR3-deficient cells with the corresponding wild-type allele demonstrated that the genetic defect was the cause of the poly(I:C) and HSV-1 phenotypes. The viral infection phenotype was further rescued by treatment with exogenous IFN-α/β, but not IFN-γ1.Thus, impaired TLR3- and UNC-93B-dependent IFN-α/β intrinsic immunity to HSV-1 in the CNS, in neurons and oligodendrocytes in particular, may underlie the pathogenesis of HSE in children with TLR3 pathway deficiencies. PMID:23103873

  3. Interplay between behavioural thermoregulation and immune response in mealworms.

    PubMed

    Catalán, Tamara P; Niemeyer, Hermann M; Kalergis, Alexis M; Bozinovic, Francisco

    2012-11-01

    Since the preferential body temperature should positively correlate with physiological performance, behavioural fever should enhance an organism's immune response under an immune challenge. Here we have studied the preferential body temperature (T(p)) and its consequences on immune response performance after an immune challenge in larvae of Tenebrio molitor. We evaluated T(p) and immune responses of larvae following a challenge with various concentrations of lipopolysaccharide (LPS), and we studied the correlation between T(p) and two immune traits, namely antibacterial and phenoloxidase (PO) activities. Larvae that were immune challenged with higher LPS concentrations (C(50) and C(100)) preferred in average, warmer temperatures than did larvae challenged with lower concentrations (C(0) and C(25)). T(p) of C(25)-C(100) (challenged)-mealworms was 2.3°C higher than of C(0) (control) larvae. At lower LPS concentration immune challenge (C(0) and C(25)) antibacterial activity correlated positively with T(p), but at C(50) and C(100) correlation was lose. PO activity was higher at higher LPS concentration, but its magnitude of response did not correlate with T(p) Our data suggest that behavioural fever may have a positive effect on host performance by enhancing antibacterial response under a low pathogen load situation. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Elimination of tumor by CD47/PD-L1 dual-targeting fusion protein that engages innate and adaptive immune responses.

    PubMed

    Liu, Boning; Guo, Huaizu; Xu, Jin; Qin, Ting; Guo, Qingcheng; Gu, Nana; Zhang, Dapeng; Qian, Weizhu; Dai, Jianxin; Hou, Sheng; Wang, Hao; Guo, Yajun

    The host immune system generally serves as a barrier against tumor formation. Programmed death-ligand 1 (PD-L1) is a critical "don't find me" signal to the adaptive immune system, whereas CD47 transmits an anti-phagocytic signal, known as the "don't eat me" signal, to the innate immune system. These and similar immune checkpoints are often overexpressed on human tumors. Thus, dual targeting both innate and adaptive immune checkpoints would likely maximize anti-tumor therapeutic effect and elicit more durable responses. Herein, based on the variable region of atezolizumab and consensus variant 1 (CV1) monomer, we constructed a dual-targeting fusion protein targeting both CD47 and PD-L1 using "Knobs-into-holes" technology, denoted as IAB. It was effective in inducing phagocytosis of tumor cells, stimulating T-cell activation and mediating antibody-dependent cell-mediated cytotoxicity in vitro. No obvious sign of hematological toxicity was observed in mice administered IAB at a dose of 100 mg/kg, and IAB exhibited potent antitumor activity in an immune-competent mouse model of MC38. Additionally, the anti-tumor effect of IAB was impaired by anti-CD8 antibody or clodronate liposomes, which implied that both CD8+ T cells and macrophages were required for the anti-tumor efficacy of IAB and IAB plays an essential role in the engagement of innate and adaptive immune responses. Collectively, these results demonstrate the capacity of an elicited endogenous immune response against tumors and elucidate essential characteristics of synergistic innate and adaptive immune response, and indicate dual blockade of CD47 and PD-L1 by IAB may be a synergistic therapy that activates both innate and adaptive immune response against tumors.

  5. Immunization with Brucella VirB Proteins Reduces Organ Colonization in Mice through a Th1-Type Immune Response and Elicits a Similar Immune Response in Dogs

    PubMed Central

    Pollak, Cora N.; Wanke, María Magdalena; Estein, Silvia M.; Delpino, M. Victoria; Monachesi, Norma E.; Comercio, Elida A.; Fossati, Carlos A.

    2014-01-01

    VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. PMID:25540276

  6. Immunization with Brucella VirB proteins reduces organ colonization in mice through a Th1-type immune response and elicits a similar immune response in dogs.

    PubMed

    Pollak, Cora N; Wanke, María Magdalena; Estein, Silvia M; Delpino, M Victoria; Monachesi, Norma E; Comercio, Elida A; Fossati, Carlos A; Baldi, Pablo C

    2015-03-01

    VirB proteins from Brucella spp. constitute the type IV secretion system, a key virulence factor mediating the intracellular survival of these bacteria. Here, we assessed whether a Th1-type immune response against VirB proteins may protect mice from Brucella infection and whether this response can be induced in the dog, a natural host for Brucella. Splenocytes from mice immunized with VirB7 or VirB9 responded to their respective antigens with significant and specific production of gamma interferon (IFN-γ), whereas interleukin-4 (IL-4) was not detected. Thirty days after an intraperitoneal challenge with live Brucella abortus, the spleen load of bacteria was almost 1 log lower in mice immunized with VirB proteins than in unvaccinated animals. As colonization reduction seemed to correlate with a Th1-type immune response against VirB proteins, we decided to assess whether such a response could be elicited in the dog. Peripheral blood mononuclear cells (PBMCs) from dogs immunized with VirB proteins (three subcutaneous doses in QuilA adjuvant) produced significantly higher levels of IFN-γ than cells from control animals upon in vitro stimulation with VirB proteins. A skin test to assess specific delayed-type hypersensitivity was positive in 4 out of 5 dogs immunized with either VirB7 or VirB9. As both proteins are predicted to locate in the outer membrane of Brucella organisms, the ability of anti-VirB antibodies to mediate complement-dependent bacteriolysis of B. canis was assessed in vitro. Sera from dogs immunized with either VirB7 or VirB9, but not from those receiving phosphate-buffered saline (PBS), produced significant bacteriolysis. These results suggest that VirB-specific responses that reduce organ colonization by Brucella in mice can be also elicited in dogs. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  7. Immune Response to Giardia duodenalis

    PubMed Central

    Faubert, Gaétan

    2000-01-01

    The intestinal protozoan Giardia duodenalis is a widespread opportunistic parasite of humans and animals. This parasite inhabits the upper part of the small intestine and has a direct life cycle. After ingestion of cysts, which are the infective stage, the trophozoites emerge from the cysts in the duodenum and attach to the small intestinal mucosa of the host. Since the migration of trophozoites from the lumen of the intestine into surrounding tissues is an unusual occurrence, the immune response to Giardia remains localized. The identification of antigens that play a role in acquired immunity has been difficult because of the occurrence of antigenic variation and because, Giardia being an ubiquituous organism, it is possible that the antigenic profiles of isolates from different geographic areas will vary. Innate-immunity mechanisms play a role in the control and/or severity of the infection. Both humoral and cell-mediated immune responses play a role in acquired immunity, but the mechanisms involved are unknown. A variety of serological assays have been used to detect circulating antibodies in serum. Because of the biological characteristics of the parasite and the lack of suitable antigens, the sensitivity of serological assays remains poor. On the other hand, detection of antigens in feces of infected patients has met with success. Commercial kits are available, and they are reported to be more sensitive than microscopic examination for the detection of giardiasis on a single specimen. PMID:10627490

  8. Q fever in pregnant goats: humoral and cellular immune responses

    PubMed Central

    2013-01-01

    Q fever is a zoonosis caused by the intracellular bacterium Coxiella burnetii. Both humoral and cellular immunity are important in the host defence against intracellular bacteria. Little is known about the immune response to C. burnetii infections in domestic ruminants even though these species are the major source of Q fever in humans. To investigate the goat’s immune response we inoculated groups of pregnant goats via inhalation with a Dutch outbreak isolate of C. burnetii. All animals were successfully infected. Phase 1 and Phase 2 IgM- and IgG-specific antibodies were measured. Cellular immune responses were investigated by interferon-gamma, enzyme-linked immunosorbent spot test (IFN-γ Elispot), lymphocyte proliferation test (LPT) and systemic cytokines. After two weeks post inoculation (wpi), a strong anti-C. burnetii Phase 2 IgM and IgG antibody response was observed while the increase in IgM anti-Phase 1 antibodies was less pronounced. IgG anti-Phase 1 antibodies started to rise at 6 wpi. Cellular immune responses were observed after parturition. Our results demonstrated humoral and cellular immune responses to C. burnetii infection in pregnant goats. Cell-mediated immune responses did not differ enough to distinguish between Coxiella-infected and non-infected pregnant animals, whereas a strong-phase specific antibody response is detected after 2 wpi. This humoral immune response may be useful in the early detection of C. burnetii-infected pregnant goats. PMID:23915213

  9. The innate and adaptive immune response to avian influenza virus

    USDA-ARS?s Scientific Manuscript database

    Protective immunity against viruses is mediated by the early innate immune responses and later on by the adaptive immune responses. The early innate immunity is designed to contain and limit virus replication in the host, primarily through cytokine and interferon production. Most all cells are cap...

  10. Human Immune Responses to Dengue Viruses.

    DTIC Science & Technology

    1986-07-01

    0-1 NO- 3K1- INO. "඄o. ________________%______ 61102A 1611025810 AA r104 (U) xvne Im e Seepuses to Donueo viruses If Irms Al. W~al 71W c 4w O PIT(w...HUMAN IMMUNE RESPONSES TO DENGUE VIRUSES . .. .............. Accesion For NTIS CRAM DTIC TAB 0 ANNUAL REPORT Unannounced 0 Justification FRANCIS A...purp6se of this study is to define the Immune responses of humans to dengue viruses . These studies should provide data which will be helpful in

  11. Scavenger Receptor-A deficiency impairs immune response of microglia and astrocytes potentiating Alzheimer's disease pathophysiology.

    PubMed

    Cornejo, Francisca; Vruwink, Marianne; Metz, Claudia; Muñoz, Paola; Salgado, Nicole; Poblete, Joaquín; Andrés, María Estela; Eugenín, Jaime; von Bernhardi, Rommy

    2018-03-01

    Late onset Alzheimer disease's (LOAD) main risk factor is aging. Although it is not well known which age-related factors are involved in its development, evidence points out to the involvement of an impaired amyloid-β (Aβ) clearance in the aged brain among possible causes. Glial cells are the main scavengers of the brain, where Scavenger Receptor class A (SR-A) emerges as a relevant player in AD because of its participation in Aβ uptake and in the modulation of glial cell inflammatory response. Here, we show that SR-A expression is reduced in the hippocampus of aged animals and APP/PS1 mice. Given that Aβ deposition increases in the aging brain, we generated a triple transgenic mouse, which accumulates Aβ and is knockout for SR-A (APP/PS1/SR-A -/- ) to evaluate Aβ accumulation and the inflammatory outcome of SR-A depletion in the aged brain. The lifespan of APP/PS1/SR-A -/- mice was greatly reduced, accompanied by a 3-fold increase in plasmatic pro-inflammatory cytokines, and reduced performance in a working memory behavioral assessment. Microglia and astrocytes lacking SR-A displayed impaired oxidative response and nitric oxide production, produced up to 7-fold more pro-inflammatory cytokines and showed a 12-fold reduction in anti-inflammatory cytokines release, with conspicuous changes in lipopolysaccharide-induced glial activation. Isolated microglia from young and adult mice lacking SR-A showed a 50% reduction in phagocytic activity. Our results indicate that reduced expression of SR-A can deregulate glial inflammatory response and potentiate Aβ accumulation, two mechanisms that could contribute to AD progression. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. SUMO-Enriched Proteome for Drosophila Innate Immune Response

    PubMed Central

    Handu, Mithila; Kaduskar, Bhagyashree; Ravindranathan, Ramya; Soory, Amarendranath; Giri, Ritika; Elango, Vijay Barathi; Gowda, Harsha; Ratnaparkhi, Girish S.

    2015-01-01

    Small ubiquitin-like modifier (SUMO) modification modulates the expression of defense genes in Drosophila, activated by the Toll/nuclear factor-κB and immune-deficient/nuclear factor-κB signaling networks. We have, however, limited understanding of the SUMO-modulated regulation of the immune response and lack information on SUMO targets in the immune system. In this study, we measured the changes to the SUMO proteome in S2 cells in response to a lipopolysaccharide challenge and identified 1619 unique proteins in SUMO-enriched lysates. A confident set of 710 proteins represents the immune-induced SUMO proteome and analysis suggests that specific protein domains, cellular pathways, and protein complexes respond to immune stress. A small subset of the confident set was validated by in-bacto SUMOylation and shown to be bona-fide SUMO targets. These include components of immune signaling pathways such as Caspar, Jra, Kay, cdc42, p38b, 14-3-3ε, as well as cellular proteins with diverse functions, many being components of protein complexes, such as prosß4, Rps10b, SmD3, Tango7, and Aats-arg. Caspar, a human FAF1 ortholog that negatively regulates immune-deficient signaling, is SUMOylated at K551 and responds to treatment with lipopolysaccharide in cultured cells. Our study is one of the first to describe SUMO proteome for the Drosophila immune response. Our data and analysis provide a global framework for the understanding of SUMO modification in the host response to pathogens. PMID:26290570

  13. SUMO-Enriched Proteome for Drosophila Innate Immune Response.

    PubMed

    Handu, Mithila; Kaduskar, Bhagyashree; Ravindranathan, Ramya; Soory, Amarendranath; Giri, Ritika; Elango, Vijay Barathi; Gowda, Harsha; Ratnaparkhi, Girish S

    2015-08-18

    Small ubiquitin-like modifier (SUMO) modification modulates the expression of defense genes in Drosophila, activated by the Toll/nuclear factor-κB and immune-deficient/nuclear factor-κB signaling networks. We have, however, limited understanding of the SUMO-modulated regulation of the immune response and lack information on SUMO targets in the immune system. In this study, we measured the changes to the SUMO proteome in S2 cells in response to a lipopolysaccharide challenge and identified 1619 unique proteins in SUMO-enriched lysates. A confident set of 710 proteins represents the immune-induced SUMO proteome and analysis suggests that specific protein domains, cellular pathways, and protein complexes respond to immune stress. A small subset of the confident set was validated by in-bacto SUMOylation and shown to be bona-fide SUMO targets. These include components of immune signaling pathways such as Caspar, Jra, Kay, cdc42, p38b, 14-3-3ε, as well as cellular proteins with diverse functions, many being components of protein complexes, such as prosß4, Rps10b, SmD3, Tango7, and Aats-arg. Caspar, a human FAF1 ortholog that negatively regulates immune-deficient signaling, is SUMOylated at K551 and responds to treatment with lipopolysaccharide in cultured cells. Our study is one of the first to describe SUMO proteome for the Drosophila immune response. Our data and analysis provide a global framework for the understanding of SUMO modification in the host response to pathogens. Copyright © 2015 Handu et al.

  14. Perfluoroalkyl substance serum concentrations and immune response to FluMist vaccination among healthy adults.

    PubMed

    Stein, Cheryl R; Ge, Yongchao; Wolff, Mary S; Ye, Xiaoyun; Calafat, Antonia M; Kraus, Thomas; Moran, Thomas M

    2016-08-01

    Perfluoroalkyl substances (PFAS) were shown to be immunotoxic in laboratory animals. There is some epidemiological evidence that PFAS exposure is inversely associated with vaccine-induced antibody concentration. We examined immune response to vaccination with FluMist intranasal live attenuated influenza vaccine in relation to four PFAS (perfluorooctanoate, perfluorononanoate, perfluorooctane sulfonate, perfluorohexane sulfonate) serum concentrations among 78 healthy adults vaccinated during the 2010-2011 influenza season. We measured anti-A H1N1 antibody response and cytokine and chemokine concentrations in serum pre-vaccination, 3 days post-vaccination, and 30 days post-vaccination. We measured cytokine, chemokine, and mucosal IgA concentration in nasal secretions 3 days post-vaccination and 30 days post-vaccination. Adults with higher PFAS concentrations were more likely to seroconvert after FluMist vaccination as compared to adults with lower PFAS concentrations. The associations, however, were imprecise and few participants seroconverted as measured either by hemagglutination inhibition (9%) or immunohistochemical staining (25%). We observed no readily discernable or consistent pattern between PFAS concentration and baseline cytokine, chemokine, or mucosal IgA concentration, or between PFAS concentration and change in these immune markers between baseline and FluMist-response states. The results of this study do not support a reduced immune response to FluMist vaccination among healthy adults in relation to serum PFAS concentration. Given the study's many limitations, however, it does not rule out impaired vaccine response to other vaccines or vaccine components in either children or adults. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Malt1 protease inactivation efficiently dampens immune responses but causes spontaneous autoimmunity

    PubMed Central

    Jaworski, Maike; Marsland, Ben J; Gehrig, Jasmine; Held, Werner; Favre, Stéphanie; Luther, Sanjiv A; Perroud, Mai; Golshayan, Déla; Gaide, Olivier; Thome, Margot

    2014-01-01

    The protease activity of the paracaspase Malt1 has recently gained interest as a drug target for immunomodulation and the treatment of diffuse large B-cell lymphomas. To address the consequences of Malt1 protease inactivation on the immune response in vivo, we generated knock-in mice expressing a catalytically inactive C472A mutant of Malt1 that conserves its scaffold function. Like Malt1-deficient mice, knock-in mice had strong defects in the activation of lymphocytes, NK and dendritic cells, and the development of B1 and marginal zone B cells and were completely protected against the induction of autoimmune encephalomyelitis. Malt1 inactivation also protected the mice from experimental induction of colitis. However, Malt1 knock-in mice but not Malt1-deficient mice spontaneously developed signs of autoimmune gastritis that correlated with an absence of Treg cells, an accumulation of T cells with an activated phenotype and high serum levels of IgE and IgG1. Thus, removal of the enzymatic activity of Malt1 efficiently dampens the immune response, but favors autoimmunity through impaired Treg development, which could be relevant for therapeutic Malt1-targeting strategies. PMID:25319413

  16. Hepatitis B virus surface antigen impairs myeloid dendritic cell function: a possible immune escape mechanism of hepatitis B virus

    PubMed Central

    Op den Brouw, Marjoleine L; Binda, Rekha S; van Roosmalen, Mark H; Protzer, Ulrike; Janssen, Harry L A; van der Molen, Renate G; Woltman, Andrea M

    2009-01-01

    Chronic hepatitis B virus (HBV) infection is the result of an inadequate immune response towards the virus. Myeloid dendritic cells (mDC) of patients with chronic HBV are impaired in their maturation and function, resulting in more tolerogenic rather than immunogenic responses, which may contribute to viral persistence. The mechanism responsible for altered mDC function remains unclear. The HBV-infected patients display large amounts of HBV particles and viral proteins in their circulation, especially the surface antigen HBsAg, which allows multiple interactions between the virus, its viral proteins and DC. To assess whether HBV directly influences mDC function, the effects of HBV and HBsAg on human mDC maturation and function were investigated in vitro. As already described for internalization of HBV by DC, the present study shows that peripheral blood-derived mDC of healthy controls also actively take up HBsAg in a time-dependent manner. Cytokine-induced maturation in the presence of HBV or HBsAg resulted in a significantly more tolerogenic mDC phenotype as demonstrated by a diminished up-regulation of costimulatory molecules and a decreased T-cell stimulatory capacity, as assessed by T-cell proliferation and interferon-γ production. In addition, the presence of HBV significantly reduced interleukin-12 production by mDC. These results show that both HBV particles and purified HBsAg have an immune modulatory capacity and may directly contribute to the dysfunction of mDC in patients with chronic HBV. The direct immune regulatory effect of HBV and circulating HBsAg particles on the function of DC can be considered as part of the mechanism by which HBV escapes immunity. PMID:18624732

  17. Immune function trade-offs in response to parasite threats.

    PubMed

    Kirschman, Lucas J; Quade, Adam H; Zera, Anthony J; Warne, Robin W

    2017-04-01

    Immune function is often involved in physiological trade-offs because of the energetic costs of maintaining constitutive immunity and mounting responses to infection. However, immune function is a collection of discrete immunity factors and animals should allocate towards factors that combat the parasite threat with the highest fitness cost. For example, animals on dispersal fronts of expanding population may be released from density-dependent diseases. The costs of immunity, however, and life history trade-offs in general, are often context dependent. Trade-offs are often most apparent under conditions of unusually limited resources or when animals are particularly stressed, because the stress response can shift priorities. In this study we tested how humoral and cellular immune factors vary between phenotypes of a wing dimorphic cricket and how physiological stress influences these immune factors. We measured constitutive lysozyme activity, a humoral immune factor, and encapsulation response, a cellular immune factor. We also stressed the crickets with a sham predator in a full factorial design. We found that immune strategy could be explained by the selective pressures encountered by each morph and that stress decreased encapsulation, but not lysozyme activity. These results suggest a possible trade-off between humoral and cellular immunity. Given limited resources and the expense of immune factors, parasite pressures could play a key factor in maintaining insect polyphenism via disruptive selection. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Innate immune sensing and response to influenza.

    PubMed

    Pulendran, Bali; Maddur, Mohan S

    2015-01-01

    Influenza viruses pose a substantial threat to human and animal health worldwide. Recent studies in mouse models have revealed an indispensable role for the innate immune system in defense against influenza virus. Recognition of the virus by innate immune receptors in a multitude of cell types activates intricate signaling networks, functioning to restrict viral replication. Downstream effector mechanisms include activation of innate immune cells and, induction and regulation of adaptive immunity. However, uncontrolled innate responses are associated with exaggerated disease, especially in pandemic influenza virus infection. Despite advances in the understanding of innate response to influenza in the mouse model, there is a large knowledge gap in humans, particularly in immunocompromised groups such as infants and the elderly. We propose here, the need for further studies in humans to decipher the role of innate immunity to influenza virus, particularly at the site of infection. These studies will complement the existing work in mice and facilitate the quest to design improved vaccines and therapeutic strategies against influenza.

  19. Control of epithelial immune-response genes and implications for airway immunity and inflammation.

    PubMed

    Holtzman, M J; Look, D C; Sampath, D; Castro, M; Koga, T; Walter, M J

    1998-01-01

    A major goal of our research is to understand how immune cells (especially T cells) infiltrate the pulmonary airway during host defense and inflammatory disease (especially asthma). In that context, we have proposed that epithelial cells lining the airway provide critical biochemical signals for immune-cell influx and activation and that this epithelial-immune cell interaction is a critical feature of airway inflammation and hyperreactivity. In this brief report, we describe our progress in defining a subset of epithelial immune-response genes the expression of which is coordinated for viral defense both directly in response to replicating virus and indirectly under the control of a specific interferon-gamma signal transduction pathway featuring the Stat1 transcription factor as a critical relay signal between cytoplasm and nucleus. Unexpectedly, the same pathway is also activated during asthmatic airway inflammation in a setting where there is no apparent infection and no increase in interferon-gamma levels. The findings provide the first evidence of an overactive Stat1-dependent gene network in asthmatic airways and a novel molecular link between mucosal immunity and inflammation. The findings also offer the possibility that overactivity of Stat1-dependent genes might augment a subsequent T helper cell (Th1)-type response to virus or might combine with a heightened Th2-type response to allergen to account for more severe exacerbations of asthma.

  20. Innate immune response development in nestling tree swallows

    USGS Publications Warehouse

    Stambaugh, T.; Houdek, B.J.; Lombardo, M.P.; Thorpe, P.A.; Caldwell, Hahn D.

    2011-01-01

    We tracked the development of innate immunity in nestling Tree Swallows (Tachycineta bicolor) and compared it to that of adults using blood drawn from nestlings during days 6, 12, and 18 of the ???20-day nestling period and from adults. Innate immunity was characterized using an in vitro assay of the ability of whole blood to kill Escherichia coli. The ability of whole blood to kill E. coli increased as nestlings matured. Neither this component of innate immunity nor right wing chord length on day18 were as developed as in adults indicating that development of the innate immune system and growth both continued after fledging. Narrow sense heritability analyses suggest that females with strong immune responses produced nestlings with strong immune responses. These data suggest nestling Tree Swallows allocated sufficient energy to support rapid growth to enable fledging by day 18, but that further development of innate immunity occurred post-fledging. ?? 2011 by the Wilson Ornithological Society.

  1. Modeling Systems-Level Regulation of Host Immune Responses

    PubMed Central

    Thakar, Juilee; Pilione, Mylisa; Kirimanjeswara, Girish; Harvill, Eric T; Albert, Réka

    2007-01-01

    Many pathogens are able to manipulate the signaling pathways responsible for the generation of host immune responses. Here we examine and model a respiratory infection system in which disruption of host immune functions or of bacterial factors changes the dynamics of the infection. We synthesize the network of interactions between host immune components and two closely related bacteria in the genus Bordetellae. We incorporate existing experimental information on the timing of immune regulatory events into a discrete dynamic model, and verify the model by comparing the effects of simulated disruptions to the experimental outcome of knockout mutations. Our model indicates that the infection time course of both Bordetellae can be separated into three distinct phases based on the most active immune processes. We compare and discuss the effect of the species-specific virulence factors on disrupting the immune response during their infection of naive, antibody-treated, diseased, or convalescent hosts. Our model offers predictions regarding cytokine regulation, key immune components, and clearance of secondary infections; we experimentally validate two of these predictions. This type of modeling provides new insights into the virulence, pathogenesis, and host adaptation of disease-causing microorganisms and allows systems-level analysis that is not always possible using traditional methods. PMID:17559300

  2. Early postnatal exposure to cigarette smoke impairs the antigen-specific T-cell responses in the spleen.

    PubMed

    Singh, Shashi P; Razani-Boroujerdi, Seddigheh; Pena-Philippides, Juan C; Langley, Raymond J; Mishra, Neerad C; Sopori, Mohan L

    2006-12-15

    Annually, approximately two million babies are exposed to cigarette smoke in utero and postnatally through cigarette smoking of their mothers. Exposure to mainstream cigarette smoke is known to impair both innate and adaptive immunities, and it has been hypothesized that the effects of in utero exposure to cigarette smoke on children's health might primarily stem from the adverse effects of cigarette smoke on the immune system. To simulate the environment that babies from smoking mothers encounter, we examined the effects of prenatal mainstream and postnatal sidestream cigarette smoke on spleen cell responses. Results show that postnatal exposure of newborn Balb/c mouse pups to sidestream cigarette smoke through the first 6 weeks of life strongly suppresses the antibody response of spleen cells to the T-cell-dependent antigen, sheep red blood cells. The reduction in the antibody response seen within 6 weeks of postnatal smoke exposure is much quicker than the published data on the time 25 weeks) required to establish reproducible immunosuppression in adult rats and mice. Moreover, the immunosuppression is not associated with significant changes in T-cell numbers or subset distribution. While the postnatal exposure to cigarette smoke did not affect the mitogenic response of T and B cells, the exposure inhibited the T cell receptor-mediated rise in the intracellular calcium concentration. These results suggest that the early postnatal period is highly sensitive to the immunosuppressive effects of environmental tobacco smoke, and the effects are causally associated with impaired antigen-mediated signaling in T cells.

  3. Bacterial Outer Membrane Vesicles Induce Plant Immune Responses.

    PubMed

    Bahar, Ofir; Mordukhovich, Gideon; Luu, Dee Dee; Schwessinger, Benjamin; Daudi, Arsalan; Jehle, Anna Kristina; Felix, Georg; Ronald, Pamela C

    2016-05-01

    Gram-negative bacteria continuously pinch off portions of their outer membrane, releasing membrane vesicles. These outer membrane vesicles (OMVs) are involved in multiple processes including cell-to-cell communication, biofilm formation, stress tolerance, horizontal gene transfer, and virulence. OMVs are also known modulators of the mammalian immune response. Despite the well-documented role of OMVs in mammalian-bacterial communication, their interaction with plants is not well studied. To examine whether OMVs of plant pathogens modulate the plant immune response, we purified OMVs from four different plant pathogens and used them to treat Arabidopsis thaliana. OMVs rapidly induced a reactive oxygen species burst, medium alkalinization, and defense gene expression in A. thaliana leaf discs, cell cultures, and seedlings, respectively. Western blot analysis revealed that EF-Tu is present in OMVs and that it serves as an elicitor of the plant immune response in this form. Our results further show that the immune coreceptors BAK1 and SOBIR1 mediate OMV perception and response. Taken together, our results demonstrate that plants can detect and respond to OMV-associated molecules by activation of their immune system, revealing a new facet of plant-bacterial interactions.

  4. The role of immune dysfunction in the pathophysiology of autism

    PubMed Central

    Onore, Charity; Careaga, Milo; Ashwood, Paul

    2012-01-01

    Autism spectrum disorders (ASD) are a complex group of neurodevelopmental disorders encompassing impairments in communication, social interactions and restricted stereotypical behaviors. Although a link between altered immune responses and ASD was first recognized nearly 40 years ago, only recently has new evidence started to shed light on the complex multifaceted relationship between immune dysfunction and behavior in ASD. Neurobiological research in ASD has highlighted pathways involved in neural development, synapse plasticity, structural brain abnormalities, cognition and behavior. At the same time, several lines of evidence point to altered immune dysfunction in ASD that directly impacts some or all these neurological processes. Extensive alterations in immune function have now been described in both children and adults with ASD, including ongoing inflammation in brain specimens, elevated pro-inflammatory cytokine profiles in the CSF and blood, increased presence of brain-specific auto-antibodies and altered immune cell function. Furthermore, these dysfunctional immune responses are associated with increased impairments in behaviors characteristic of core features of ASD, in particular, deficits in social interactions and communication. This accumulating evidence suggests that immune processes play a key role in the pathophysiology of ASD. This review will discuss the current state of our knowledge of immune dysfunction in ASD, how these findings may impact on underlying neuro-immune mechanisms and implicate potential areas where the manipulation of the immune response could have an impact on behavior and immunity in ASD. PMID:21906670

  5. Agouron and immune response to commercialize remune immune-based treatment.

    PubMed

    James, J S

    1998-06-19

    Agouron Pharmaceuticals agreed in June to collaborate with The Immune Response Corporation on the final development and marketing of an immune-based treatment for HIV. Remune, the vaccine developed by Dr. Jonas Salk, is currently in Phase III randomized trials with 2,500 patients, and the trials are expected to be completed in April 1999. Immune-based treatments have been difficult to test, as there is no surrogate marker, like viral load, to determine if the drug is working. Agouron agreed to participate in the joint venture after reviewing encouraging results from preliminary trials in which remune was taken in combination with highly active antiretroviral drugs.

  6. Immune recovery in HIV-infected patients after Candida esophagitis is impaired despite long-term antiretroviral therapy

    PubMed Central

    Stuehler, Claudia; Bernardini, Claudia; Elzi, Luigia; Stoeckle, Marcel; Zimmerli, Stefan; Furrer, Hansjakob; Günthard, Huldrych F.; Leibundgut-Landmann, Salomé; Battegay, Manuel; Khanna, Nina

    2016-01-01

    Objective: Candida esophagitis belongs to the most common AIDS-defining diseases; however, a comprehensive immune pathogenic concept is lacking. Design: We investigated the immune status of 37 HIV-1-infected patients from the Swiss HIV cohort study at diagnosis of Candida esophagitis, 1 year before, 1 year later and after 2 years of suppressed HIV RNA. We compared these patients with three groups: 37 HIV-1-infected patients without Candida esophagitis but similar CD4+ cell counts as the patients at diagnosis (advanced HIV group), 15 HIV-1-infected patients with CD4+ cell counts higher than 500 cells/μl, CD4+ cell nadirs higher than 350 cells/μl and suppressed HIV RNA under combination antiretroviral therapy (cART) (early cART group) and 20 healthy individuals. Methods: We investigated phenotype, cytokine production and proliferative capacity of different immune cells by flow cytometry and enzyme-linked immunosorbent spot. Results: We found that patients with Candida esophagitis had nearly abolished CD4+ cell proliferation in response to Candida albicans, significantly increased percentages of dysfunctional CD4+ cells, significantly decreased cytotoxic natural killer cell counts and peripheral innate lymphoid cell counts and significantly reduced IFN-γ and IL-17 production compared with the early cART group and healthy individuals. Most of these defects remained for more than 2 years despite viral suppression. The advanced HIV group without opportunistic infection showed partly improved immune recovery. Conclusion: Our data indicate that Candida esophagitis in HIV-1-infected patients is caused by an accumulation of multiple, partly Candida-specific immunological defects. Long-term immune recovery is impaired, illustrating that specific immunological gaps persist despite cART. These data also support the rationale for early cART initiation to prevent irreversible immune defects. PMID:27149086

  7. Immune Responses and Protection of Aotus Monkeys Immunized with Irradiated Plasmodium vivax Sporozoites

    PubMed Central

    Jordán-Villegas, Alejandro; Perdomo, Anilza Bonelo; Epstein, Judith E.; López, Jesús; Castellanos, Alejandro; Manzano, María R.; Hernández, Miguel A.; Soto, Liliana; Méndez, Fabián; Richie, Thomas L.; Hoffman, Stephen L.; Arévalo-Herrera, Myriam; Herrera, Sócrates

    2011-01-01

    A non-human primate model for the induction of protective immunity against the pre-erythrocytic stages of Plasmodium vivax malaria using radiation-attenuated P. vivax sporozoites may help to characterize protective immune mechanisms and identify novel malaria vaccine candidates. Immune responses and protective efficacy induced by vaccination with irradiated P. vivax sporozoites were evaluated in malaria-naive Aotus monkeys. Three groups of six monkeys received two, five, or ten intravenous inoculations, respectively, of 100,000 irradiated P. vivax sporozoites; control groups received either 10 doses of uninfected salivary gland extract or no inoculations. Immunization resulted in the production low levels of antibodies that specifically recognized P. vivax sporozoites and the circumsporozoite protein. Additionally, immunization induced low levels of antigen-specific IFN-γ responses. Intravenous challenge with viable sporozoites resulted in partial protection in a dose-dependent manner. These findings suggest that the Aotus monkey model may be able to play a role in preclinical development of P. vivax pre-erythrocytic stage vaccines. PMID:21292877

  8. Epidermal Overexpression of Xenobiotic Receptor PXR Impairs the Epidermal Barrier and Triggers Th2 Immune Response.

    PubMed

    Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine

    2018-01-01

    The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  9. Modeling the interactions between pathogenic bacteria, bacteriophage and immune response

    NASA Astrophysics Data System (ADS)

    Leung, Chung Yin (Joey); Weitz, Joshua S.

    The prevalence of antibiotic-resistant strains of pathogenic bacteria has led to renewed interest in the use of bacteriophage (phage), or virus that infects bacteria, as a therapeutic agent against bacterial infections. However, little is known about the theoretical mechanism by which phage therapy may work. In particular, interactions between the bacteria, the phage and the host immune response crucially influences the outcome of the therapy. Few models of phage therapy have incorporated all these three components, and existing models suffer from unrealistic assumptions such as unbounded growth of the immune response. We propose a model of phage therapy with an emphasis on nonlinear feedback arising from interactions with bacteria and the immune response. Our model shows a synergistic effect between the phage and the immune response which underlies a possible mechanism for phage to catalyze the elimination of bacteria even when neither the immune response nor phage could do so alone. We study the significance of this effect for different parameters of infection and immune response, and discuss its implications for phage therapy.

  10. Local and systemic humoral immune response in farmed Atlantic salmon (Salmo salar L.) under a natural amoebic gill disease outbreak.

    PubMed

    Marcos-López, Mar; Espinosa Ruiz, Cristóbal; Rodger, Hamish D; O'Connor, Ian; MacCarthy, Eugene; Esteban, M Ángeles

    2017-07-01

    Amoebic gill disease (AGD), caused by the protozoan parasite Neoparamoeba perurans, is one of the most significant infectious diseases for Atlantic salmon (Salmo salar L.) mariculture. The present study investigated the humoral immune response (both local in gill mucus and systemic in serum) of farmed Atlantic salmon naturally infected with N. perurans in commercial sea pens, at two different stages of the disease and after freshwater treatment. Parameters analysed included activity of immune related enzymes (i.e. lysozyme, peroxidase, protease, anti-protease, esterase, alkaline phosphatase), IgM levels, and the terminal carbohydrate profile in the gill mucus. Overall, greater variations between groups were noted in the immune parameters determined in gill mucus than the equivalent in the serum. In gill mucus, IgM levels and peroxidase, lysozyme, esterase and protease activities were decreased in fish showing longer exposure time to the infection and higher disease severity, then showed a sequential increase after treatment. Results obtained highlight the capacity of gills to elicit a local response to the infection, indicate an impaired immune response at the later stages of the disease, and show partial reestablishment of the host immune status after freshwater treatment. In addition to providing data on the humoral response to AGD, this study increases knowledge on gill mucosal humoral immunity, since some of the parameters were analysed for the first time in gill mucus. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Severe Malaria Infections Impair Germinal Center Responses by Inhibiting T Follicular Helper Cell Differentiation.

    PubMed

    Ryg-Cornejo, Victoria; Ioannidis, Lisa Julia; Ly, Ann; Chiu, Chris Yu; Tellier, Julie; Hill, Danika Lea; Preston, Simon Peter; Pellegrini, Marc; Yu, Di; Nutt, Stephen Laurence; Kallies, Axel; Hansen, Diana Silvia

    2016-01-05

    Naturally acquired immunity to malaria develops only after years of repeated exposure to Plasmodium parasites. Despite the key role antibodies play in protection, the cellular processes underlying the slow acquisition of immunity remain unknown. Using mouse models, we show that severe malaria infection inhibits the establishment of germinal centers (GCs) in the spleen. We demonstrate that infection induces high frequencies of T follicular helper (Tfh) cell precursors but results in impaired Tfh cell differentiation. Despite high expression of Bcl-6 and IL-21, precursor Tfh cells induced during infection displayed low levels of PD-1 and CXCR5 and co-expressed Th1-associated molecules such as T-bet and CXCR3. Blockade of the inflammatory cytokines TNF and IFN-γ or T-bet deletion restored Tfh cell differentiation and GC responses to infection. Thus, this study demonstrates that the same pro-inflammatory mediators that drive severe malaria pathology have detrimental effects on the induction of protective B cell responses. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  12. Bovine immune response to inoculation with Neospora caninum surface antigen SRS2 lipopeptides mimics immune response to infection with live parasites.

    PubMed

    Baszler, Timothy V; Shkap, Varda; Mwangi, Waithaka; Davies, Christopher J; Mathison, Bruce A; Mazuz, Monica; Resnikov, Dror; Fish, Lea; Leibovitch, Benjamin; Staska, Lauren M; Savitsky, Igor

    2008-04-01

    Infection of cattle with Neospora caninum protozoa, the causative agent of bovine protozoal abortion, results in robust cellular and humoral immune responses, particularly CD4(+) T-lymphocyte activation and gamma interferon (IFN-gamma) secretion. In the present study, N. caninum SRS2 (NcSRS2) T-lymphocyte-epitope-bearing subunits were incorporated into DNA and peptide preparations to assess CD4(+) cell proliferation and IFN-gamma T-lymphocyte-secretion immune responses in cattle with predetermined major histocompatibility complex (MHC) genotypes. In order to optimize dendritic-cell processing, NcSRS2 DNA vaccine was delivered with granulocyte macrophage-colony-stimulating factor and Flt3 ligand adjuvant. The synthesized NcSRS2 peptides were coupled with a palmitic acid molecule (lipopeptide) and delivered with Freund's adjuvant. Cattle vaccinated with NcSRS2 DNA vaccine alone did not induce T-lymphocyte activation or IFN-gamma secretion, whereas subsequent booster inoculation with NcSRS2-lipopeptides induced robust NcSRS2-specific immune responses. Compared to the response in control animals, NcSRS2-lipopeptide-immunized cattle had significantly increased NcSRS2-specific T-lymphocyte proliferation, numbers of IFN-gamma-secreting peripheral blood mononuclear cells, and immunoglobulin G1 (IgG1) and IgG2a antibody levels. The findings show that N. caninum NcSRS2 subunits bearing T-lymphocyte epitopes induced cell-mediated immune responses similar to the protective immune responses previously described against live parasite infection, namely T-lymphocyte activation and IFN-gamma secretion. The findings support the investigation of NcSRS2 immunogens for protection against N. caninum-induced fetal infection and abortion in cattle.

  13. Peroxiredoxin 5 modulates immune response in Drosophila

    PubMed Central

    Radyuk, Svetlana N.; Michalak, Katarzyna; Klichko, Vladimir I.; Benes, Judith; Orr, William C.

    2010-01-01

    Background Peroxiredoxins are redox-sensing enzymes with multiple cellular functions. Previously, we reported on the potent antioxidant function of Drosophila peroxiredoxin 5 (dPrx5). Studies with mammalian and human cells suggest that peroxiredoxins can modulate immune-related signaling. Methods Survivorship studies and bacteriological analysis were used to determine resistance of flies to fungal and bacterial infections. RT-PCR and immunoblot analyses determined expression of dPrx5 and immunity factors in response to bacterial challenge. Double mutants for dprx5 gene and genes comprising the Imd/Relish and dTak1/Basket branches of the immune signaling pathways were used in epistatic analysis. Results The dprx5 mutant flies were more resistant to bacterial infection than controls, while flies overexpressing dPrx5 were more susceptible. The enhanced resistance to bacteria was accompanied by rapid induction of the Imd-dependent antimicrobial peptides, phosphorylation of the JNK kinase Basket and altered transcriptional profiling of the transient response genes, puckered, ets21C and relish, while the opposite effects were observed in flies over-expressing dPrx5. Epistatic analysis of double mutants, using attacin D and Puckered as read outs of activation of the Imd and JNK pathways, implicated dPrx5 function in the control of the dTak1-JNK arm of immune signaling. Conclusions Differential effects on fly survivorship suggested a trade-off between the antioxidant and immune functions of dPrx5. Molecular and epistatic analyses identified dPrx5 as a negative regulator in the dTak1-JNK arm of immune signaling. General significance Our findings suggest that peroxiredoxins play an important modulatory role in the Drosophila immune response. PMID:20600624

  14. The innate immune response during urinary tract infection and pyelonephritis

    PubMed Central

    Spencer, John David; Schwaderer, Andrew L.; Becknell, Brian; Watson, Joshua; Hains, David S.

    2013-01-01

    Despite its proximity to the fecal flora, the urinary tract is considered sterile. The precise mechanisms by which the urinary tract maintains sterility are not well understood. Host immune responses are critically important in the antimicrobial defense of the urinary tract. During recent years, considerable advances have been made in our understanding of the mechanisms underlying immune homeostasis of the kidney and urinary tract. Dysfunctions in these immune mechanisms may result in acute disease, tissue destruction and overwhelming infection. The objective of this review is to provide an overview of the innate immune response in the urinary tract in response to microbial assault. In doing so, we focus on the role of antimicrobial peptides – a ubiquitous component of the innate immune response. PMID:23732397

  15. The innate immune response during urinary tract infection and pyelonephritis.

    PubMed

    Spencer, John David; Schwaderer, Andrew L; Becknell, Brian; Watson, Joshua; Hains, David S

    2014-07-01

    Despite its proximity to the fecal flora, the urinary tract is considered sterile. The precise mechanisms by which the urinary tract maintains sterility are not well understood. Host immune responses are critically important in the antimicrobial defense of the urinary tract. During recent years, considerable advances have been made in our understanding of the mechanisms underlying immune homeostasis of the kidney and urinary tract. Dysfunctions in these immune mechanisms may result in acute disease, tissue destruction and overwhelming infection. The objective of this review is to provide an overview of the innate immune response in the urinary tract in response to microbial assault. In doing so, we focus on the role of antimicrobial peptides-a ubiquitous component of the innate immune response.

  16. Psychoneuroimmunology in Pregnancy: Immune Pathways Linking Stress with Maternal Health, Adverse Birth Outcomes, and Fetal Development

    PubMed Central

    Christian, Lisa M.

    2011-01-01

    It is well-established that psychological stress promotes immune dysregulation in nonpregnant humans and animals. Stress promotes inflammation, impairs antibody responses to vaccination, slows wound healing, and suppresses cell-mediated immune function. Importantly, the immune system changes substantially to support healthy pregnancy, with attenuation of inflammatory responses and impairment of cell-mediated immunity. This adaptation is postulated to protect the fetus from rejection by the maternal immune system. Thus, stress-induced immune dysregulation during pregnancy has unique implications for both maternal and fetal health, particularly preterm birth. However, very limited research has examined stress-immune relationships in pregnancy. The application of psychoneuroimmunology research models to the perinatal period holds great promise for elucidating biological pathways by which stress may affect adverse pregnancy outcomes, maternal health, and fetal development. PMID:21787802

  17. Assessing humoral and cell-mediated immune response in Hawaiian green turtles, Chelonia mydas

    USGS Publications Warehouse

    Work, Thierry M.; Balazs, George H.; Rameyer, Robert; Chang, S.P.; Berestecky, J.

    2000-01-01

    Seven immature green turtles, Chelonia mydas, captured from Kaneohe Bay on the island of Oahu were used to evaluate methods for assessing their immune response. Two turtles each were immunized intramuscularly with egg white lysozyme (EWL) in Freund’s complete adjuvant, Gerbu, or ISA-70; a seventh turtle was immunized with saline only and served as a control. Humoral immune response was measured with an indirect enzyme linked immunosorbent assay (ELISA). Cell-mediated immune response was measured using in vitro cell proliferation assays (CPA) using whole blood or peripheral blood mononuclear cells (PBM) cultured with concanavalin A (ConA), phytohaemagglutinin (PHA), or soluble egg EWL antigen. All turtles, except for one immunized with Gerbu and the control, produced a detectable humoral immune response by 6 weeks which persisted for at least 14 weeks after a single immunization. All turtles produced an anamnestic humoral immune response after secondary immunization. Antigen specific cell-mediated immune response in PBM was seen in all turtles either after primary or secondary immunization, but it was not as consistent as humoral immune response; antigen specific cell-mediated immune response in whole blood was rarely seen. Mononuclear cells had significantly higher stimulation indices than whole blood regardless of adjuvant, however, results with whole blood had lower variability. Both Gerbu and ISA-70 appeared to potentiate the cell-mediated immune response when PBM or whole blood were cultured with PHA. This is the first time cell proliferation assays have been compared between whole blood and PBM for reptiles. This is also the first demonstration of antigen specific cell-mediated response in reptiles. Cell proliferation assays allowed us to evaluate the cell-mediated immune response of green turtles. However, CPA may be less reliable than ELISA for detecting antigen specific immune response. Either of the three adjuvants appears suitable to safely elicit a

  18. Plant cell wall-mediated immunity: cell wall changes trigger disease resistance responses.

    PubMed

    Bacete, Laura; Mélida, Hugo; Miedes, Eva; Molina, Antonio

    2018-02-01

    Plants have evolved a repertoire of monitoring systems to sense plant morphogenesis and to face environmental changes and threats caused by different attackers. These systems integrate different signals into overreaching triggering pathways which coordinate developmental and defence-associated responses. The plant cell wall, a dynamic and complex structure surrounding every plant cell, has emerged recently as an essential component of plant monitoring systems, thus expanding its function as a passive defensive barrier. Plants have a dedicated mechanism for maintaining cell wall integrity (CWI) which comprises a diverse set of plasma membrane-resident sensors and pattern recognition receptors (PRRs). The PRRs perceive plant-derived ligands, such as peptides or wall glycans, known as damage-associated molecular patterns (DAMPs). These DAMPs function as 'danger' alert signals activating DAMP-triggered immunity (DTI), which shares signalling components and responses with the immune pathways triggered by non-self microbe-associated molecular patterns that mediate disease resistance. Alteration of CWI by impairment of the expression or activity of proteins involved in cell wall biosynthesis and/or remodelling, as occurs in some plant cell wall mutants, or by wall damage due to colonization by pathogens/pests, activates specific defensive and growth responses. Our current understanding of how these alterations of CWI are perceived by the wall monitoring systems is scarce and few plant sensors/PRRs and DAMPs have been characterized. The identification of these CWI sensors and PRR-DAMP pairs will help us to understand the immune functions of the wall monitoring system, and might allow the breeding of crop varieties and the design of agricultural strategies that would enhance crop disease resistance. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  19. Apoptosis and other immune biomarkers predict influenza vaccine responsiveness.

    PubMed

    Furman, David; Jojic, Vladimir; Kidd, Brian; Shen-Orr, Shai; Price, Jordan; Jarrell, Justin; Tse, Tiffany; Huang, Huang; Lund, Peder; Maecker, Holden T; Utz, Paul J; Dekker, Cornelia L; Koller, Daphne; Davis, Mark M

    2013-04-16

    Despite the importance of the immune system in many diseases, there are currently no objective benchmarks of immunological health. In an effort to identifying such markers, we used influenza vaccination in 30 young (20-30 years) and 59 older subjects (60 to >89 years) as models for strong and weak immune responses, respectively, and assayed their serological responses to influenza strains as well as a wide variety of other parameters, including gene expression, antibodies to hemagglutinin peptides, serum cytokines, cell subset phenotypes and in vitro cytokine stimulation. Using machine learning, we identified nine variables that predict the antibody response with 84% accuracy. Two of these variables are involved in apoptosis, which positively associated with the response to vaccination and was confirmed to be a contributor to vaccine responsiveness in mice. The identification of these biomarkers provides new insights into what immune features may be most important for immune health.

  20. Immune and stress responses in oysters with insights on adaptation.

    PubMed

    Guo, Ximing; He, Yan; Zhang, Linlin; Lelong, Christophe; Jouaux, Aude

    2015-09-01

    Oysters are representative bivalve molluscs that are widely distributed in world oceans. As successful colonizers of estuaries and intertidal zones, oysters are remarkably resilient against harsh environmental conditions including wide fluctuations in temperature and salinity as well as prolonged air exposure. Oysters have no adaptive immunity but can thrive in microbe-rich estuaries as filter-feeders. These unique adaptations make oysters interesting models to study the evolution of host-defense systems. Recent advances in genomic studies including sequencing of the oyster genome have provided insights into oyster's immune and stress responses underlying their amazing resilience. Studies show that the oyster genomes are highly polymorphic and complex, which may be key to their resilience. The oyster genome has a large gene repertoire that is enriched for immune and stress response genes. Thousands of genes are involved in oyster's immune and stress responses, through complex interactions, with many gene families expanded showing high sequence, structural and functional diversity. The high diversity of immune receptors and effectors may provide oysters with enhanced specificity in immune recognition and response to cope with diverse pathogens in the absence of adaptive immunity. Some members of expanded immune gene families have diverged to function at different temperatures and salinities or assumed new roles in abiotic stress response. Most canonical innate immunity pathways are conserved in oysters and supported by a large number of diverse and often novel genes. The great diversity in immune and stress response genes exhibited by expanded gene families as well as high sequence and structural polymorphisms may be central to oyster's adaptation to highly stressful and widely changing environments. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Innate Immune Sensing and Response to Influenza

    PubMed Central

    Pulendran, Bali; Maddur, Mohan S.

    2015-01-01

    Influenza viruses pose a substantial threat to human and animal health worldwide. Recent studies in mouse models have revealed an indispensable role for the innate immune system in defense against influenza virus. Recognition of the virus by innate immune receptors in a multitude of cell types activates intricate signaling networks, functioning to restrict viral replication. Downstream effector mechanisms include activation of innate immune cells and, induction and regulation of adaptive immunity. However, uncontrolled innate responses are associated with exaggerated disease, especially in pandemic influenza virus infection. Despite advances in the understanding of innate response to influenza in the mouse model, there is a large knowledge gap in humans, particularly in immunocom-promised groups such as infants and the elderly. We propose here, the need for further studies in humans to decipher the role of innate immunity to influenza virus, particularly at the site of infection. These studies will complement the existing work in mice and facilitate the quest to design improved vaccines and therapeutic strategies against influenza. PMID:25078919

  2. Probiotics, antibiotics and the immune responses to vaccines

    PubMed Central

    Praharaj, Ira; John, Sushil M.; Bandyopadhyay, Rini; Kang, Gagandeep

    2015-01-01

    Orally delivered vaccines have been shown to perform poorly in developing countries. There are marked differences in the structure and the luminal environment of the gut in developing countries resulting in changes in immune and barrier function. Recent studies using newly developed technology and analytic methods have made it increasingly clear that the intestinal microbiota activate a multitude of pathways that control innate and adaptive immunity in the gut. Several hypotheses have been proposed for the underperformance of oral vaccines in developing countries, and modulation of the intestinal microbiota is now being tested in human clinical trials. Supplementation with specific strains of probiotics has been shown to have modulatory effects on intestinal and systemic immune responses in animal models and forms the basis for human studies with vaccines. However, most studies published so far that have evaluated the immune response to vaccines in children and adults have been small and results have varied by age, antigen, type of antibody response and probiotic strain. Use of anthelminthic drugs in children has been shown to possibly increase immunogenicity following oral cholera vaccination, lending further support to the rationale for modulation of the immune response to oral vaccination through the intestinal microbiome. PMID:25964456

  3. Probiotics, antibiotics and the immune responses to vaccines.

    PubMed

    Praharaj, Ira; John, Sushil M; Bandyopadhyay, Rini; Kang, Gagandeep

    2015-06-19

    Orally delivered vaccines have been shown to perform poorly in developing countries. There are marked differences in the structure and the luminal environment of the gut in developing countries resulting in changes in immune and barrier function. Recent studies using newly developed technology and analytic methods have made it increasingly clear that the intestinal microbiota activate a multitude of pathways that control innate and adaptive immunity in the gut. Several hypotheses have been proposed for the underperformance of oral vaccines in developing countries, and modulation of the intestinal microbiota is now being tested in human clinical trials. Supplementation with specific strains of probiotics has been shown to have modulatory effects on intestinal and systemic immune responses in animal models and forms the basis for human studies with vaccines. However, most studies published so far that have evaluated the immune response to vaccines in children and adults have been small and results have varied by age, antigen, type of antibody response and probiotic strain. Use of anthelminthic drugs in children has been shown to possibly increase immunogenicity following oral cholera vaccination, lending further support to the rationale for modulation of the immune response to oral vaccination through the intestinal microbiome. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  4. Autosomal recessive PGM3 mutations link glycosylation defects to atopy, immune deficiency, autoimmunity, and neurocognitive impairment

    PubMed Central

    Zhang, Yu; Yu, Xiaomin; Ichikawa, Mie; Lyons, Jonathan J.; Datta, Shrimati; Lamborn, Ian T.; Jing, Huie; Kim, Emily S.; Biancalana, Matthew; Wolfe, Lynne A.; DiMaggio, Thomas; Matthews, Helen F.; Kranick, Sarah M.; Stone, Kelly D.; Holland, Steven M.; Reich, Daniel S.; Hughes, Jason D.; Mehmet, Huseyin; McElwee, Joshua; Freeman, Alexandra F.; Freeze, Hudson H.; Su, Helen C.; Milner, Joshua D.

    2014-01-01

    Background Identifying genetic syndromes that lead to significant atopic disease can open new pathways for investigation and intervention in allergy. Objective To define a genetic syndrome of severe atopy, elevated serum IgE, immune deficiency, autoimmunity, and motor and neurocognitive impairment. Methods Eight patients from two families who had similar syndromic features were studied. Thorough clinical evaluations, including brain MRI and sensory evoked potentials, were performed. Peripheral lymphocyte flow cytometry, antibody responses, and T cell cytokine production were measured. Whole exome sequencing was performed to identify disease-causing mutations. Immunoblotting, qRT-PCR, enzymatic assays, nucleotide sugar and sugar phosphate analyses along with MALDI-TOF mass spectrometry of glycans were used to determine the molecular consequences of the mutations. Results Marked atopy and autoimmunity were associated with increased TH2 and TH17 cytokine production by CD4+ T cells. Bacterial and viral infection susceptibility were noted along with T cell lymphopenia, particularly of CD8+ T cells, and reduced memory B cells. Apparent brain hypomyelination resulted in markedly delayed evoked potentials and likely contributed to neurological abnormalities. Disease segregated with novel autosomal recessive mutations in a single gene, phosphoglucomutase 3 (PGM3). Although PGM3 protein expression was variably diminished, impaired function was demonstrated by decreased enzyme activity and reduced UDP-GlcNAc, along with decreased O- and N-linked protein glycosylation in patients’ cells. These results define a new Congenital Disorder of Glycosylation. Conclusions Autosomal recessive, hypomorphic PGM3 mutations underlie a disorder of severe atopy, immune deficiency, autoimmunity, intellectual disability and hypomyelination. PMID:24589341

  5. Characterization of host immune responses in Ebola virus infections.

    PubMed

    Wong, Gary; Kobinger, Gary P; Qiu, Xiangguo

    2014-06-01

    Ebola causes highly lethal hemorrhagic fever in humans with no licensed countermeasures. Its virulence can be attributed to several immunoevasion mechanisms: an early inhibition of innate immunity started by the downregulation of type I interferon, epitope masking and subversion of the adaptive humoural immunity by secreting a truncated form of the viral glycoprotein. Deficiencies in specific and non-specific antiviral responses result in unrestricted viral replication and dissemination in the host, causing death typically within 10 days after the appearance of symptoms. This review summarizes the host immune response to Ebola infection, and highlights the short- and long-term immune responses crucial for protection, which holds implications for the design of future vaccines and therapeutics.

  6. The immune response to Nipah virus infection.

    PubMed

    Prescott, Joseph; de Wit, Emmie; Feldmann, Heinz; Munster, Vincent J

    2012-09-01

    Nipah virus has recently emerged as a zoonotic agent that is highly pathogenic in humans. Outbreaks have occurred regularly over the last two decades in South and Southeast Asia, where mortality rates reach as high as 100 %. The natural reservoir of Nipah virus has been identified as bats from the Pteropus family, where infection is largely asymptomatic. Human disease is characterized by both respiratory and encephalitic components, and thus far, no effective vaccine or intervention strategies are available. Little is know about how the immune response of either the reservoir host or incidental hosts responds to infection, and how this immune response is either inadequate or might contribute to disease in the dead-end host. Experimental vaccines strategies have given us some insight into the immunological requirements for protection. This review summarizes our current understanding of the immune response to Nipah virus infection and emphasizes the need for further research.

  7. Chemokine-mediated immune responses in the female genital tract mucosa.

    PubMed

    Deruaz, Maud; Luster, Andrew D

    2015-04-01

    The genital tract mucosa is the site where sexually transmitted infections gain entry to the host. The immune response at this site is thus critical to provide innate protection against pathogens that are seen for the very first time as well as provide long-term pathogen-specific immunity, which would be required for an effective vaccine against sexually transmitted infection. A finely regulated immune response is therefore required to provide an effective barrier against pathogens without compromising the capacity of the genital tract to allow for successful conception and fetal development. We review recent developments in our understanding of the immune response in the female genital tract to infectious pathogens, using herpes simplex virus-2, human immunodeficiency virus-1 and Chlamydia trachomatis as examples, with a particular focus on the role of chemokines in orchestrating immune cell migration necessary to achieve effective innate and adaptive immune responses in the female genital tract.

  8. Influence of ionizing radiation on the immune response

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brocadeszaalberg, O.

    1974-01-01

    The effects of ionizing radiation on the immune response are reviewed. Following an introduction on the function of the immune apparatus, the effect of radiation in the different cell types of the immune system is described. The possible consequences of these effects on the prognosis of radiation victims are discussed. (GRA)

  9. Essential oil of clove (Eugenia caryophyllata) augments the humoral immune response but decreases cell mediated immunity.

    PubMed

    Halder, Sumita; Mehta, Ashish K; Mediratta, Pramod K; Sharma, Krishna K

    2011-08-01

    The present study was undertaken to explore the effect of the essential oil isolated from the buds of Eugenia caryophyllata on some immunological parameters. Humoral immunity was assessed by measuring the hemagglutination titre to sheep red blood cells and delayed type hypersensitivity was assessed by measuring foot pad thickness. Clove oil administration produced a significant increase in the primary as well as secondary humoral immune response. In addition, it also produced a significant decrease in foot pad thickness compared with the control group. Thus, these results suggest that clove oil can modulate the immune response by augmenting humoral immunity and decreasing cell mediated immunity. Copyright © 2011 John Wiley & Sons, Ltd.

  10. Immune cell changes in response to a swimming training session during a 24-h recovery period.

    PubMed

    Morgado, José P; Monteiro, Cristina P; Teles, Júlia; Reis, Joana F; Matias, Catarina; Seixas, Maria T; Alvim, Marta G; Bourbon, Mafalda; Laires, Maria J; Alves, Francisco

    2016-05-01

    Understanding the impact of training sessions on the immune response is crucial for the adequate periodization of training, to prevent both a negative influence on health and a performance impairment of the athlete. This study evaluated acute systemic immune cell changes in response to an actual swimming session, during a 24-h recovery period, controlling for sex, menstrual cycle phases, maturity, and age group. Competitive swimmers (30 females, 15 ± 1.3 years old; and 35 males, 16.5 ± 2.1 years old) performed a high-intensity training session. Blood samples were collected before, immediately after, 2 h after, and 24 h after exercise. Standard procedures for the assessment of leukogram by automated counting (Coulter LH 750, Beckman) and lymphocytes subsets by flow cytometry (FACS Calibur BD, Biosciences) were used. Subjects were grouped according to competitive age groups and pubertal Tanner stages. Menstrual cycle phase was monitored. The training session induced neutrophilia, lymphopenia, and a low eosinophil count, lasting for at least 2 h, independent of sex and maturity. At 24 h postexercise, the acquired immunity of juniors (15-17 years old), expressed by total lymphocytes and total T lymphocytes (CD3(+)), was not fully recovered. This should be accounted for when planning a weekly training program. The observed lymphopenia suggests a lower immune surveillance at the end of the session that may depress the immunity of athletes, highlighting the need for extra care when athletes are exposed to aggressive environmental agents such as swimming pools.

  11. Human TRAF3 adaptor molecule deficiency leads to impaired Toll-like receptor 3 response and susceptibility to herpes simplex encephalitis

    PubMed Central

    de Diego, Rebeca Pérez; Sancho-Shimizu, Vanessa; Lorenzo, Lazaro; Puel, Anne; Plancoulaine, Sabine; Picard, Capucine; Herman, Melina; Cardon, Annabelle; Durandy, Anne; Bustamante, Jacinta; Vallabhapurapu, Sivakumar; Bravo, Jerónimo; Warnatz, Klaus; Chaix, Yves; Cascarrigny, Françoise; Lebon, Pierre; Rozenberg, Flore; Karin, Michael; Tardieu, Marc; Al-Muhsen, Saleh; Jouanguy, Emmanuelle; Zhang, Shen-Ying; Abel, Laurent; Casanova, Jean-Laurent

    2010-01-01

    Tumor necrosis factor (TNF) receptor-associated factor 3 (TRAF3) functions downstream of multiple receptors that induce interferon-α (IFN-α), IFN–β and IFN-λ production, including Toll-like receptor 3 (TLR3), which is deficient in some patients with herpes simplex virus-1 encephalitis (HSE). Mice lacking TRAF3 die in the neonatal period, preventing direct investigation of the role of TRAF3 in immune responses and host defenses in vivo. Here we reported the autosomal dominant, human TRAF3 deficiency in a young adult with a history of HSE in childhood. The TRAF3 mutant allele was a loss-of-expression, loss-of-function, dominant-negative phenotype, and was associated with impaired, but not abolished TRAF3-dependent responses upon stimulation of both TNF receptors and receptors that induce IFN production. TRAF3 deficiency was associated with a clinical phenotype limited to HSE resulting from the impairment of TLR3-dependent induction of IFN. Thus, TLR3-mediated immunity against primary infection by HSV-1 in the central nervous system is critically dependent on TRAF3. Highlight sentence Autosomal dominant TRAF3 deficiency is a genetic etiology of herpes simplex encephalitis. Highlight sentence R118W TRAF3 allele is loss-of-function, loss-of-expression, and dominant-negative. Highlight sentence Human TRAF3 deficiency impairs the TLR3-dependent induction of anti-viral interferons. PMID:20832341

  12. Id1 suppresses anti-tumour immune responses and promotes tumour progression by impairing myeloid cell maturation.

    PubMed

    Papaspyridonos, Marianna; Matei, Irina; Huang, Yujie; do Rosario Andre, Maria; Brazier-Mitouart, Helene; Waite, Janelle C; Chan, April S; Kalter, Julie; Ramos, Ilyssa; Wu, Qi; Williams, Caitlin; Wolchok, Jedd D; Chapman, Paul B; Peinado, Hector; Anandasabapathy, Niroshana; Ocean, Allyson J; Kaplan, Rosandra N; Greenfield, Jeffrey P; Bromberg, Jacqueline; Skokos, Dimitris; Lyden, David

    2015-04-29

    A central mechanism of tumour progression and metastasis involves the generation of an immunosuppressive 'macroenvironment' mediated in part through tumour-secreted factors. Here we demonstrate that upregulation of the Inhibitor of Differentiation 1 (Id1), in response to tumour-derived factors, such as TGFβ, is responsible for the switch from dendritic cell (DC) differentiation to myeloid-derived suppressor cell expansion during tumour progression. Genetic inactivation of Id1 largely corrects the myeloid imbalance, whereas Id1 overexpression in the absence of tumour-derived factors re-creates it. Id1 overexpression leads to systemic immunosuppression by downregulation of key molecules involved in DC differentiation and suppression of CD8 T-cell proliferation, thus promoting primary tumour growth and metastatic progression. Furthermore, advanced melanoma patients have increased plasma TGFβ levels and express higher levels of ID1 in myeloid peripheral blood cells. This study reveals a critical role for Id1 in suppressing the anti-tumour immune response during tumour progression and metastasis.

  13. Onchocerciasis modulates the immune response to mycobacterial antigens

    PubMed Central

    Stewart, G R; Boussinesq, M; Coulson, T; Elson, L; Nutman, T; Bradley, J E

    1999-01-01

    Chronic helminth infection induces a type-2 cellular immune response. In contrast to this, mycobacterial infections commonly induce a type-1 immune response which is considered protective. Type-2 responses and diminished type-1 responses to mycobacteria have been previously correlated with active infection states such as pulmonary tuberculosis and lepromatous leprosy. The present study examines the immune responses of children exposed to both the helminth parasite Onchocerca volvulus and the mycobacterial infections, Mycobacterium tuberculosis and M. leprae. Proliferation of peripheral blood mononuclear cells (PBMC) and production of IL-4 in response to both helminth and mycobacterial antigen (PPD) decreased dramatically with increasing microfilarial (MF) density. Although interferon-gamma (IFN-γ) production strongly correlated with cellular proliferation, it was surprisingly not related to MF density for either antigen. IL-4 production in response to helminth antigen and PPD increased with ascending children's age. IFN-γ and cellular proliferation to PPD were not related to age, but in response to helminth antigen were significantly higher in children of age 9–12 years than children of either the younger age group (5–8 years) or the older group (13–16 years). Thus, there was a MF density-related down-regulation of cellular responsiveness and age-related skewing toward type 2 which was paralleled in response to both the helminth antigen and PPD. This parasite-induced immunomodulation of the response to mycobacteria correlates with a previous report of doubled incidence of lepromatous leprosy in onchocerciasis hyperendemic regions. Moreover, this demonstration that helminth infection in humans can modulate the immune response to a concurrent infection or immunological challenge is of critical importance to future vaccination strategies. PMID:10469056

  14. Non-branched β-1,3-glucan oligosaccharides trigger immune responses in Arabidopsis.

    PubMed

    Mélida, Hugo; Sopeña-Torres, Sara; Bacete, Laura; Garrido-Arandia, María; Jordá, Lucía; López, Gemma; Muñoz-Barrios, Antonio; Pacios, Luis F; Molina, Antonio

    2018-01-01

    Fungal cell walls, which are essential for environmental adaptation and host colonization by the fungus, have been evolutionarily selected by plants and animals as a source of microbe-associated molecular patterns (MAMPs) that, upon recognition by host pattern recognition receptors (PRRs), trigger immune responses conferring disease resistance. Chito-oligosaccharides [β-1,4-N-acetylglucosamine oligomers, (GlcNAc) n ] are the only glycosidic structures from fungal walls that have been well-demonstrated to function as MAMPs in plants. Perception of (GlcNAc) 4-8 by Arabidopsis involves CERK1, LYK4 and LYK5, three of the eight members of the LysM PRR family. We found that a glucan-enriched wall fraction from the pathogenic fungus Plectosphaerella cucumerina which was devoid of GlcNAc activated immune responses in Arabidopsis wild-type plants but not in the cerk1 mutant. Using this differential response, we identified the non-branched 1,3-β-d-(Glc) hexasaccharide as a major fungal MAMP. Recognition of 1,3-β-d-(Glc) 6 was impaired in cerk1 but not in mutants defective in either each of the LysM PRR family members or in the PRR-co-receptor BAK1. Transcriptomic analyses of Arabidopsis plants treated with 1,3-β-d-(Glc) 6 further demonstrated that this fungal MAMP triggers the expression of immunity-associated genes. In silico docking analyses with molecular mechanics and solvation energy calculations corroborated that CERK1 can bind 1,3-β-d-(Glc) 6 at effective concentrations similar to those of (GlcNAc) 4 . These data support that plants, like animals, have selected as MAMPs the linear 1,3-β-d-glucans present in the walls of fungi and oomycetes. Our data also suggest that CERK1 functions as an immune co-receptor for linear 1,3-β-d-glucans in a similar way to its proposed function in the recognition of fungal chito-oligosaccharides and bacterial peptidoglycan MAMPs. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  15. The Ocular Conjunctiva as a Mucosal Immunization Route: A Profile of the Immune Response to the Model Antigen Tetanus Toxoid

    PubMed Central

    Belij, Sandra; Marinkovic, Emilija; Stojicevic, Ivana; Montanaro, Jacqueline; Stein, Elisabeth; Bintner, Nora; Stojanovic, Marijana

    2013-01-01

    Background In a quest for a needle-free vaccine administration strategy, we evaluated the ocular conjunctiva as an alternative mucosal immunization route by profiling and comparing the local and systemic immune responses to the subcutaneous or conjunctival administration of tetanus toxoid (TTd), a model antigen. Materials and methods BALB/c and C57BL/6 mice were immunized either subcutaneously with TTd alone or via the conjunctiva with TTd alone, TTd mixed with 2% glycerol or TTd with merthiolate-inactivated whole-cell B. pertussis (wBP) as adjuvants. Mice were immunized on days 0, 7 and 14 via both routes, and an evaluation of the local and systemic immune responses was performed two weeks after the last immunization. Four weeks after the last immunization, the mice were challenged with a lethal dose (2 × LD50) of tetanus toxin. Results The conjunctival application of TTd in BALB/c mice induced TTd-specific secretory IgA production and skewed the TTd-specific immune response toward a Th1/Th17 profile, as determined by the stimulation of IFNγ and IL-17A secretion and/or the concurrent pronounced reduction of IL-4 secretion, irrespective of the adjuvant. In conjunctivaly immunized C57BL/6 mice, only TTd administered with wBP promoted the establishment of a mixed Th1/Th17 TTd-specific immune response, whereas TTd alone or TTd in conjunction with glycerol initiated a dominant Th1 response against TTd. Immunization via the conjunctiva with TTd plus wBP adjuvant resulted in a 33% survival rate of challenged mice compared to a 0% survival rate in non-immunized animals (p<0.05). Conclusion Conjunctival immunization with TTd alone or with various adjuvants induced TTd-specific local and systemic immune responses, predominantly of the Th1 type. The strongest immune responses developed in mice that received TTd together with wBP, which implies that this alternative route might tailor the immune response to fight intracellular bacteria or viruses more effectively. PMID

  16. The ocular conjunctiva as a mucosal immunization route: a profile of the immune response to the model antigen tetanus toxoid.

    PubMed

    Barisani-Asenbauer, Talin; Inic-Kanada, Aleksandra; Belij, Sandra; Marinkovic, Emilija; Stojicevic, Ivana; Montanaro, Jacqueline; Stein, Elisabeth; Bintner, Nora; Stojanovic, Marijana

    2013-01-01

    In a quest for a needle-free vaccine administration strategy, we evaluated the ocular conjunctiva as an alternative mucosal immunization route by profiling and comparing the local and systemic immune responses to the subcutaneous or conjunctival administration of tetanus toxoid (TTd), a model antigen. BALB/c and C57BL/6 mice were immunized either subcutaneously with TTd alone or via the conjunctiva with TTd alone, TTd mixed with 2% glycerol or TTd with merthiolate-inactivated whole-cell B. pertussis (wBP) as adjuvants. Mice were immunized on days 0, 7 and 14 via both routes, and an evaluation of the local and systemic immune responses was performed two weeks after the last immunization. Four weeks after the last immunization, the mice were challenged with a lethal dose (2 × LD50) of tetanus toxin. The conjunctival application of TTd in BALB/c mice induced TTd-specific secretory IgA production and skewed the TTd-specific immune response toward a Th1/Th17 profile, as determined by the stimulation of IFNγ and IL-17A secretion and/or the concurrent pronounced reduction of IL-4 secretion, irrespective of the adjuvant. In conjunctivaly immunized C57BL/6 mice, only TTd administered with wBP promoted the establishment of a mixed Th1/Th17 TTd-specific immune response, whereas TTd alone or TTd in conjunction with glycerol initiated a dominant Th1 response against TTd. Immunization via the conjunctiva with TTd plus wBP adjuvant resulted in a 33% survival rate of challenged mice compared to a 0% survival rate in non-immunized animals (p<0.05). Conjunctival immunization with TTd alone or with various adjuvants induced TTd-specific local and systemic immune responses, predominantly of the Th1 type. The strongest immune responses developed in mice that received TTd together with wBP, which implies that this alternative route might tailor the immune response to fight intracellular bacteria or viruses more effectively.

  17. Sex differences in immune responses: Hormonal effects, antagonistic selection, and evolutionary consequences.

    PubMed

    Roved, Jacob; Westerdahl, Helena; Hasselquist, Dennis

    2017-02-01

    Males and females differ in both parasite load and the strength of immune responses and these effects have been verified in humans and other vertebrates. Sex hormones act as important modulators of immune responses; the male sex hormone testosterone is generally immunosuppressive while the female sex hormone estrogen tends to be immunoenhancing. Different sets of T-helper cells (Th) have important roles in adaptive immunity, e.g. Th1 cells trigger type 1 responses which are primarily cell-mediated, and Th2 cells trigger type 2 responses which are primarily humoral responses. In our review of the literature, we find that estrogen and progesterone enhance type 2 and suppress type 1 responses in females, whereas testosterone suppresses type 2 responses and shows an inconsistent pattern for type 1 responses in males. When we combine these patterns of generally immunosuppressive and immunoenhancing effects of the sex hormones, our results imply that the sex differences in immune responses should be particularly strong in immune functions associated with type 2 responses, and less pronounced with type 1 responses. In general the hormone-mediated sex differences in immune responses may lead to genetic sexual conflicts on immunity. Thus, we propose the novel hypothesis that sexually antagonistic selection may act on immune genes shared by the sexes, and that the strength of this sexually antagonistic selection should be stronger for type 2- as compared with type 1-associated immune genes. Finally, we put the consequences of sex hormone-induced effects on immune responses into behavioral and ecological contexts, considering social mating system, sexual selection, geographical distribution of hosts, and parasite abundance. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Enhancing the Immune Response to Recombinant Plague Antigens

    DTIC Science & Technology

    2006-05-01

    Wakelin. 2003. Effect of priming/booster immunisation protocols on immune response to canine parvovirus peptide induced by vaccination with a chimaeric...onset, the high mortality, and the rapid spread of the disease. Immunization against aerosolized plague presents a particular challenge for vaccine ...homologous boosting at increasing the magnitude and/or duration of the antibody response. 15. SUBJECT TERMS Biological warfare, vaccine , adjuvant

  19. Effect of adjuvants and route of immunizations on the immune response to recombinant plague antigens

    PubMed Central

    Uddowla, Sabena; Freytag, Lucy C.; Clements, John D.

    2007-01-01

    In this study, we compare four different adjuvants, LT(R192G), CpG ODN, MPL®TDM and alum, for their ability to affect the magnitude, distribution, and duration of antibody responses against F1-V, the lead-candidate antigen for the next generation vaccine against plague, in a murine model. In addition, three different routes of immunization – intranasal (IN), transcutaneous (TC), and subcutaneous (SC), were compared with each adjuvant. Since aerosol exposure to biological warfare agents is of primary concern, both serum and bronchioalveolar lavage (BAL) were analyzed for antigen-specific antibody responses. The most significant findings of the study reported here are that 1) the adjuvant influences the Type 1/Type 2 balance of the antibody response in both the serum and BAL, 2) mucosal immunization is not necessary to obtain F1-V-specific BAL responses, 3) non-traditional adjuvants such as LT(R192G) work when delivered SC, 4) the route of immunization affects the magnitude of the immune response, and 5) F1-V is highly immunogenic by some routes even in the absence of an exogenously applied adjuvant. These studies provide important insights into the influence of different classes of adjuvants on the immune outcome in biodefense vaccines and for development of new generation vaccines against other pathogens as well. PMID:17933440

  20. Costs of mounting an immune response during pregnancy in a lizard.

    PubMed

    Meylan, Sandrine; Richard, Murielle; Bauer, Sophie; Haussy, Claudy; Miles, Donald

    2013-01-01

    Immune defenses are of great benefit to hosts, but reducing the impact of infection by mounting an immune response also entails costs. However, the physiological mechanisms that generate the costs of an immune response remain poorly understood. Moreover, the majority of studies investigating the consequences of an immune challenge in vertebrates have been conducted on mammals and birds. The aim of this study is to investigate the physiological costs of mounting an immune response during gestation in an ectothermic species. Indeed, because ectothermic species are unable to internally regulate their body temperature, the apportionment of resources to homeostatic activities in ectothermic species can differ from that in endothermic species. We conducted this study on the common lizard Zootoca vivipara. We investigated the costs of mounting an immune response by injecting females with sheep red blood cells and quantified the consequences to reproductive performance (litter mass and success) and physiological performance (standard metabolic rate, endurance, and phytohemagglutinin response). In addition, we measured basking behavior. Our analyses revealed that mounting an immune response affected litter mass, physiological performance, and basking behavior. Moreover, we demonstrated that the modulation of an immune challenge is impacted by intrinsic factors, such as body size and condition.

  1. Multiscale modeling of mucosal immune responses

    PubMed Central

    2015-01-01

    Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T cell differentiation and tissue level cell-cell interactions was developed to illustrate the capabilities, power and scope of ENISI MSM. Background Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Implementation Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. Conclusion We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut

  2. Multiscale modeling of mucosal immune responses.

    PubMed

    Mei, Yongguo; Abedi, Vida; Carbo, Adria; Zhang, Xiaoying; Lu, Pinyi; Philipson, Casandra; Hontecillas, Raquel; Hoops, Stefan; Liles, Nathan; Bassaganya-Riera, Josep

    2015-01-01

    Computational techniques are becoming increasingly powerful and modeling tools for biological systems are of greater needs. Biological systems are inherently multiscale, from molecules to tissues and from nano-seconds to a lifespan of several years or decades. ENISI MSM integrates multiple modeling technologies to understand immunological processes from signaling pathways within cells to lesion formation at the tissue level. This paper examines and summarizes the technical details of ENISI, from its initial version to its latest cutting-edge implementation. Object-oriented programming approach is adopted to develop a suite of tools based on ENISI. Multiple modeling technologies are integrated to visualize tissues, cells as well as proteins; furthermore, performance matching between the scales is addressed. We used ENISI MSM for developing predictive multiscale models of the mucosal immune system during gut inflammation. Our modeling predictions dissect the mechanisms by which effector CD4+ T cell responses contribute to tissue damage in the gut mucosa following immune dysregulation.Computational modeling techniques are playing increasingly important roles in advancing a systems-level mechanistic understanding of biological processes. Computer simulations guide and underpin experimental and clinical efforts. This study presents ENteric Immune Simulator (ENISI), a multiscale modeling tool for modeling the mucosal immune responses. ENISI's modeling environment can simulate in silico experiments from molecular signaling pathways to tissue level events such as tissue lesion formation. ENISI's architecture integrates multiple modeling technologies including ABM (agent-based modeling), ODE (ordinary differential equations), SDE (stochastic modeling equations), and PDE (partial differential equations). This paper focuses on the implementation and developmental challenges of ENISI. A multiscale model of mucosal immune responses during colonic inflammation, including CD4+ T

  3. [Effect of vitamine A on mice immune response induced by specific periodontal pathogenic bacteria-immunization].

    PubMed

    Lin, Xiao-Ping; Zhou, Xiao-Jia; Liu, Hong-Li; DU, Li-Li; Toshihisa, Kawai

    2010-12-01

    The aim of this study was to investigate the effect of vitamine-A deficiency on the induction of specific periodontal pathogenic bacteria A. actinomycetetemcomitans(Aa) immunization. BALB/c mice were fed with vitamine A-depleted diet or control regular diet throughout the whole experiment period. After 2 weeks, immunized formalin-killed Aa to build immunized models, 6 weeks later, sacrificed to determine specific antibody-IgG, IgM and sub-class IgG antibody titers in serum, and concentration of IL-10, IFN-γ, TNF-α and RANKL in T cell supernatant were measured by ELISA and T cell proliferation was measured by cintilography. SPSS 11.5 software package was used for statistical analysis. The levels of whole IgG and IgM antibody which were immunized by Aa significantly elevated, non-immune group was unable to produce any antibody. Compared with Aa immunized+RD group, the level of whole IgG in Aa immunized+VAD group was significantly higher (P<0.05); The levels of IgG2a increased obviously, whereas the levels of IgG1 subtype antibody conspicuous decreased, with a significant difference (P<0.05). Aa immunized group could induce body to produce a strong specific T-cell immune response, but Aa immunized+VAD group had a higher T cell proliferate response compared with Aa immunized+RD group, with a statistically significant difference (P<0.05); The expression of RANKL, IFN-γ and TNF-α supernatant increased, while the expression of IL-10 decreased (P<0.05). The lack of vitamin-A diet can increase the immunized mice's susceptibility to periodontal pathogenic bacteria and trigger or aggravate immune inflammatory response. Adequate vitamin A is an important factor in maintaining body health. Supported by Natural Science Foundation of Liaoning Province (Grant No.20092139) and Science and Technology Program of Shenyang Municipality (Grant No.F10-149-9-32).

  4. Genetic ablation or pharmacological blockade of dipeptidyl peptidase IV does not impact T cell-dependent immune responses

    PubMed Central

    Vora, Kalpit A; Porter, Gene; Peng, Roche; Cui, Yan; Pryor, Kellyann; Eiermann, George; Zaller, Dennis M

    2009-01-01

    Background Current literature suggests that dipeptidyl peptidase IV (DPP-IV; CD26) plays an essential role in T-dependent immune responses, a role that could have important clinical consequences. To rigorously define the role of DPP-IV in the immune system, we evaluated genetic and pharmacological inhibition of the enzyme on T-dependent immune responses in vivo. Results The DPP-IV null animals mounted robust primary and secondary antibody responses to the T dependent antigens, 4-hydroxy-3-nitrophenylacetyl-ovalbumin (NP-Ova) and 4-hydroxy-3-nitrophenylacetyl-chicken gamma globulin (NP-CGG), which were comparable to wild type mice. Serum levels of antigen specific IgM, IgG1, IgG2a, IgG2b and IgG3 were similar between the two groups of animals. DPP-IV null animals mounted an efficient germinal center reaction by day 10 after antigen stimulation that was comparable to wild type mice. Moreover, the antibodies produced by DPP-IV null animals after repeated antigenic challenge were affinity matured. Similar observations were made using wild type animals treated with a highly selective DPP-IV inhibitor during the entire course of the experiments. T cell recall responses to ovalbumin and MOG peptide, evaluated by measuring proliferation and IL-2 release from cells isolated from draining lymph nodes, were equivalent in DPP-IV null and wild type animals. Furthermore, mice treated with DPP-IV inhibitor had intact T-cell recall responses to MOG peptide. In addition, female DPP-IV null and wild type mice treated with DPP-IV inhibitor exhibited normal and robust in vivo cytotoxic T cell responses after challenge with cells expressing the male H-Y minor histocompatibility antigen. Conclusion These data indicate Selective inhibition of DPP-IV does not impair T dependent immune responses to antigenic challenge. PMID:19358731

  5. The immune response to Nipah virus infection

    PubMed Central

    Prescott, Joseph; de Wit, Emmie; Feldmann, Heinz; Munster, Vincent J.

    2012-01-01

    Nipah virus has recently emerged as a zoonotic agent that is highly pathogenic in humans. Outbreaks have occurred regularly over the last two decades in South and Southeast Asia, where mortality rates reach as high as 100%. The natural reservoir of Nipah virus has been identified as bats from the Pteropus family, where infection is largely asymptomatic. Human disease is characterized by both respiratory and encephalitic components, and thus far, no effective vaccine or intervention strategies are available. Little is know about how the immune response of either the reservoir host or incidental hosts responds to infection, and how this immune response is either inadequate or might contribute to disease in the dead-end host. Experimental vaccines strategies have given us some insight into the immunological requirements for protection. This review summarizes our current understanding of the immune response to Nipah virus infection and emphasizes the need for further research. PMID:22669317

  6. Cytomegalovirus infection enhances the immune response to influenza.

    PubMed

    Furman, David; Jojic, Vladimir; Sharma, Shalini; Shen-Orr, Shai S; Angel, Cesar J L; Onengut-Gumuscu, Suna; Kidd, Brian A; Maecker, Holden T; Concannon, Patrick; Dekker, Cornelia L; Thomas, Paul G; Davis, Mark M

    2015-04-01

    Cytomegalovirus (CMV) is a β-herpesvirus present in a latent form in most people worldwide. In immunosuppressed individuals, CMV can reactivate and cause serious clinical complications, but the effect of the latent state on healthy people remains elusive. We undertook a systems approach to understand the differences between seropositive and negative subjects and measured hundreds of immune system components from blood samples including cytokines and chemokines, immune cell phenotyping, gene expression, ex vivo cell responses to cytokine stimuli, and the antibody response to seasonal influenza vaccination. As expected, we found decreased responses to vaccination and an overall down-regulation of immune components in aged individuals regardless of CMV status. In contrast, CMV-seropositive young adults exhibited enhanced antibody responses to influenza vaccination, increased CD8(+) T cell sensitivity, and elevated levels of circulating interferon-γ compared to seronegative individuals. Experiments with young mice infected with murine CMV also showed significant protection from an influenza virus challenge compared with uninfected animals, although this effect declined with time. These data show that CMV and its murine equivalent can have a beneficial effect on the immune response of young, healthy individuals, which may explain the ubiquity of CMV infection in humans and many other species. Copyright © 2015, American Association for the Advancement of Science.

  7. Cellular immune response experiment MA-031

    NASA Technical Reports Server (NTRS)

    Criswell, B. S.

    1976-01-01

    Significant changes in phytohemagglutinin (PHA) lymphocytic responsiveness occurred in the cellular immune response of three astronauts during the 9 day flight of the Apollo Soyuz Test Project. Parameters studied were white blood cell concentrations, lymphocyte numbers, B- and T-lymphocyte distributions in peripheral blood, and lymphocyte responsiveness to PHA, pokeweed mitogen, Concanavalin A, and influenza virus antigen.

  8. Suppressive influences in the immune response to cancer.

    PubMed

    Bronte, Vincenzo; Mocellin, Simone

    2009-01-01

    Although much evidence has been gathered demonstrating that immune effectors can play a significant role in controlling tumor growth under natural conditions or in response to therapeutic manipulation, it is clear that malignant cells do evade immune surveillance in most cases. Considering that anticancer active specific immunotherapy seems to have reached a plateau of results and that currently no vaccination regimen is indicated as a standard anticancer therapy, the dissection of the molecular events underlying tumor immune escape is the necessary condition to make anticancer vaccines a therapeutic weapon effective enough to be implemented in the routine clinical setting. Recent years have witnessed significant advances in our understanding of the molecular mechanisms underlying tumor immune escape. These mechanistic insights are fostering the development of rationally designed therapeutics aimed to revert the immunosuppressive circuits that undermine an effective antitumor immune response. In this review, the best characterized mechanisms that allow cancer cells to evade immune surveillance are overviewed and the most debated controversies constellating this complex field are highlighted.

  9. Long-term moderate calorie restriction inhibits inflammation without impairing cell-mediated immunity: a randomized controlled trial in non obese humans

    USDA-ARS?s Scientific Manuscript database

    Calorie restriction (CR) inhibits inflammation and slows aging in many animal species, but in rodents housed in pathogen-free facilities, CR impairs immunity against certain pathogens. However, little is known about the effects of long-term moderate CR on immune function in humans. In this multi-cen...

  10. Lessons Learned from Protective Immune Responses to Optimize Vaccines against Cryptosporidiosis.

    PubMed

    Lemieux, Maxime W; Sonzogni-Desautels, Karine; Ndao, Momar

    2017-12-24

    In developing countries, cryptosporidiosis causes moderate-to-severe diarrhea and kills thousands of infants and toddlers annually. Drinking and recreational water contaminated with Cryptosporidium spp. oocysts has led to waterborne outbreaks in developed countries. A competent immune system is necessary to clear this parasitic infection. A better understanding of the immune responses required to prevent or limit infection by this protozoan parasite is the cornerstone of development of an effective vaccine. In this light, lessons learned from previously developed vaccines against Cryptosporidium spp. are at the foundation for development of better next-generation vaccines. In this review, we summarize the immune responses elicited by naturally and experimentally-induced Cryptosporidium spp. infection and by several experimental vaccines in various animal models. Our aim is to increase awareness about the immune responses that underlie protection against cryptosporidiosis and to encourage promotion of these immune responses as a key strategy for vaccine development. Innate and mucosal immunity will be addressed as well as adaptive immunity, with an emphasis on the balance between T H 1/T H 2 immune responses. Development of more effective vaccines against cryptosporidiosis is needed to prevent Cryptosporidium spp.-related deaths in infants and toddlers in developing countries.

  11. Lessons Learned from Protective Immune Responses to Optimize Vaccines against Cryptosporidiosis

    PubMed Central

    Lemieux, Maxime W.; Sonzogni-Desautels, Karine; Ndao, Momar

    2017-01-01

    In developing countries, cryptosporidiosis causes moderate-to-severe diarrhea and kills thousands of infants and toddlers annually. Drinking and recreational water contaminated with Cryptosporidium spp. oocysts has led to waterborne outbreaks in developed countries. A competent immune system is necessary to clear this parasitic infection. A better understanding of the immune responses required to prevent or limit infection by this protozoan parasite is the cornerstone of development of an effective vaccine. In this light, lessons learned from previously developed vaccines against Cryptosporidium spp. are at the foundation for development of better next-generation vaccines. In this review, we summarize the immune responses elicited by naturally and experimentally-induced Cryptosporidium spp. infection and by several experimental vaccines in various animal models. Our aim is to increase awareness about the immune responses that underlie protection against cryptosporidiosis and to encourage promotion of these immune responses as a key strategy for vaccine development. Innate and mucosal immunity will be addressed as well as adaptive immunity, with an emphasis on the balance between TH1/TH2 immune responses. Development of more effective vaccines against cryptosporidiosis is needed to prevent Cryptosporidium spp.-related deaths in infants and toddlers in developing countries. PMID:29295550

  12. Fetal immune response to chorioamnionitis

    PubMed Central

    Kallapur, Suhas G.; Presicce, Pietro; Rueda, Cesar M.; Jobe, Alan H.; Chougnet, Claire A.

    2014-01-01

    Chorioamnionitis is a frequent cause of preterm birth and is associated with an increased risk for injury responses in the lung, GI tract, brain and other fetal organs. Chorioamnionitis is a polymicrobial non-traditional infectious disease because the organisms causing chorioamnionitis are generally of low virulence and colonize the amniotic fluid often for extended periods, and the host (mother and the fetus) does not have typical infection related symptoms such as fever. In this review, we discuss the effects of chorioamnionitis in experimental animal models that mimic the human disease. Our focus is on the immune changes in multiple fetal organs and the pathogenesis of chorioamnionitis induced injury in different fetal compartments. Since chorioamnionitis disproportionately affects preterm infants, we discuss the relevant developmental context for the immune system. We also provide a clinical context for the fetal responses. PMID:24390922

  13. Human Immune Response to Dengue Infections

    DTIC Science & Technology

    1989-07-31

    antigens of all 4 serotypes. These CTL lysed autologous fibroblasts infected with vaccinia-dengue recombinant viruses containing the E, or several non...responses of PBMC from a dengue 4-immune donor to call-free dengue viruses . .. ........... 6 Table 2. Lysis of dengue virus-infected fibroblasts by dengue...4-immune PBMC stimulated with dengue viruses ... ...... 7 Table 3. Inhibition of the lysis of dengue- infected fibroblasts by monoclonal anti-CD8

  14. Early-life inflammation, immune response and ageing.

    PubMed

    Khan, Imroze; Agashe, Deepa; Rolff, Jens

    2017-03-15

    Age-related diseases are often attributed to immunopathology, which results in self-damage caused by an inappropriate inflammatory response. Immunopathology associated with early-life inflammation also appears to cause faster ageing, although we lack direct experimental evidence for this association. To understand the interactions between ageing, inflammation and immunopathology, we used the mealworm beetle Tenebrio molitor as a study organism. We hypothesized that phenoloxidase, an important immune effector in insect defence, may impose substantial immunopathological costs by causing tissue damage to Malpighian tubules (MTs; functionally equivalent to the human kidney), in turn accelerating ageing. In support of this hypothesis, we found that RNAi knockdown of phenoloxidase (PO) transcripts in young adults possibly reduced inflammation-induced autoreactive tissue damage to MTs, and increased adult lifespan. Our work thus suggests a causative link between immunopathological costs of early-life inflammation and faster ageing. We also reasoned that if natural selection weakens with age, older individuals should display increased immunopathological costs associated with an immune response. Indeed, we found that while old infected individuals cleared infection faster than young individuals, possibly they also displayed exacerbated immunopathological costs (larger decline in MT function) and higher post-infection mortality. RNAi-mediated knockdown of PO response partially rescued MTs function in older beetles and resulted in increased lifespan after infection. Taken together, our data are consistent with a direct role of immunopathological consequences of immune response during ageing in insects. Our work is also the first report that highlights the pervasive role of tissue damage under diverse contexts of ageing and immune response. © 2017 The Author(s).

  15. Early-life inflammation, immune response and ageing

    PubMed Central

    2017-01-01

    Age-related diseases are often attributed to immunopathology, which results in self-damage caused by an inappropriate inflammatory response. Immunopathology associated with early-life inflammation also appears to cause faster ageing, although we lack direct experimental evidence for this association. To understand the interactions between ageing, inflammation and immunopathology, we used the mealworm beetle Tenebrio molitor as a study organism. We hypothesized that phenoloxidase, an important immune effector in insect defence, may impose substantial immunopathological costs by causing tissue damage to Malpighian tubules (MTs; functionally equivalent to the human kidney), in turn accelerating ageing. In support of this hypothesis, we found that RNAi knockdown of phenoloxidase (PO) transcripts in young adults possibly reduced inflammation-induced autoreactive tissue damage to MTs, and increased adult lifespan. Our work thus suggests a causative link between immunopathological costs of early-life inflammation and faster ageing. We also reasoned that if natural selection weakens with age, older individuals should display increased immunopathological costs associated with an immune response. Indeed, we found that while old infected individuals cleared infection faster than young individuals, possibly they also displayed exacerbated immunopathological costs (larger decline in MT function) and higher post-infection mortality. RNAi-mediated knockdown of PO response partially rescued MTs function in older beetles and resulted in increased lifespan after infection. Taken together, our data are consistent with a direct role of immunopathological consequences of immune response during ageing in insects. Our work is also the first report that highlights the pervasive role of tissue damage under diverse contexts of ageing and immune response. PMID:28275145

  16. Engineering Immunity: Modulating Dendritic Cell Subsets and Lymph Node Response to Direct Immune-polarization and Vaccine Efficacy

    PubMed Central

    Leleux, Jardin; Atalis, Alexandra; Roy, Krishnendu

    2017-01-01

    While successful vaccines have been developed against many pathogens, there are still many diseases and pathogenic infections that are highly evasive to current vaccination strategies. Thus, more sophisticated approaches to control the type and quality of vaccine-induced immune response must be developed. Dendritic cells (DCs) are the sentinels of the body and play a critical role in immune response generation and direction by bridging innate and adaptive immunity. It is now well recognized that DCs can be separated into many subgroups, each of which has a unique function. Better understanding of how various DC subsets, in lymphoid organs and in the periphery, can be targeted through controlled delivery; and how these subsets modulate and control the resulting immune response could greatly enhance our ability to develop new, effective vaccines against complex diseases. In this review, we provide an overview of DC subset biology and discuss current immunotherapeutic strategies that utilize DC targeting to modulate and control immune responses. PMID:26489733

  17. Immunobiography and the Heterogeneity of Immune Responses in the Elderly: A Focus on Inflammaging and Trained Immunity

    PubMed Central

    Franceschi, Claudio; Salvioli, Stefano; Garagnani, Paolo; de Eguileor, Magda; Monti, Daniela; Capri, Miriam

    2017-01-01

    Owing to its memory and plasticity, the immune system (IS) is capable of recording all the immunological experiences and stimuli it was exposed to. The combination of type, dose, intensity, and temporal sequence of antigenic stimuli that each individual is exposed to has been named “immunobiography.” This immunological history induces a lifelong continuous adaptation of the IS, which is responsible for the capability to mount strong, weak or no response to specific antigens, thus determining the large heterogeneity of immunological responses. In the last years, it is becoming clear that memory is not solely a feature of adaptive immunity, as it has been observed that also innate immune cells are provided with a sort of memory, dubbed “trained immunity.” In this review, we discuss the main characteristics of trained immunity as a possible contributor to inflammaging within the perspective of immunobiography, with particular attention to the phenotypic changes of the cell populations known to be involved in trained immunity. In conclusion, immunobiography emerges as a pervasive and comprehensive concept that could help in understanding and interpret the individual heterogeneity of immune responses (to infections and vaccinations) that becomes particularly evident at old age and could affect immunosenescence and inflammaging. PMID:28861086

  18. Selective expression of inhibitory Fcgamma receptor by metastatic melanoma impairs tumor susceptibility to IgG-dependent cellular response.

    PubMed

    Cassard, Lydie; Cohen-Solal, Joel F G; Fournier, Emilie M; Camilleri-Broët, Sophie; Spatz, Alain; Chouaïb, Salem; Badoual, Cécile; Varin, Audrey; Fisson, Sylvain; Duvillard, Pierre; Boix, Charlotte; Loncar, Shannon M; Sastre-Garau, Xavier; Houghton, Alan N; Avril, Marie-Françoise; Gresser, Ion; Fridman, Wolf H; Sautès-Fridman, Catherine

    2008-12-15

    During melanoma progression, patients develop anti-tumor immunity including the production of anti-tumor antibodies. Although the strategies developed by malignant cells to escape anti-tumor cellular immunity have been extensively investigated, little is known about tumor resistance to humoral immunity. The main effect of IgG antibodies is to activate the immune response by binding to host Fc gamma receptors (FcgammaR) expressed by immune cells. We previously reported in a limited study that some human metastatic melanoma cells ectopically express the FcgammaRIIB1, an inhibitory isoform of FcgammaR. By analyzing a large panel of different types of human primary and metastatic solid tumors, we report herein that expression of FcgammaRIIB is restricted to melanoma and is acquired during tumor progression. We show that FcgammaRIIB expression prevents the lysis of human metastatic melanoma cells by NK cell-mediated antibody-dependent cellular cytotoxicity (ADCC) in vitro, independently of the intracytoplasmic region of FcgammaRIIB. Using experimental mouse models, we demonstrate that expression of FcgammaRIIB protects B16F0 melanoma tumors from the ADCC induced by monoclonal and polyclonal anti-tumor IgG in vivo. Thus, our results identify FcgammaRIIB as a marker of human metastatic melanoma that impairs the tumor susceptibility to FcgammaR-dependent innate effector responses. (c) 2008 Wiley-Liss, Inc.

  19. Strain difference in the immune response to hydralazine in inbred guinea-pigs

    PubMed Central

    Ellman, L.; Inman, J.; Green, Ira

    1971-01-01

    Guinea-pigs were immunized with hydralazine in Freund's complete adjuvant. A marked strain difference in the immune response involving both anti-hydralazine antibody and delayed hypersensitivity to hydralazine was observed in different strains of guinea-pigs: Hartley guinea-pigs and inbred strain 13 guinea-pigs were able to mount a vigorous immune response to the drug while inbred strain 2 guinea-pigs appeared to be `low or non-responders'. This difference could not be explained in terms of metabolism of the drug in that no differences in acetylation were observed. Breeding studies suggest that immune responsiveness to hydralazine is inherited in an autosomal dominant manner. The immune response to hydralazine may be controlled by a `specific immune response gene' which appears not to be linked to the major strain 13 histocompatibility gene. Anti-nuclear and anti-DNA antibodies could not be demonstrated at a time when the animals manifested a strong immune response to hydralazine. Thus, the development of auto-immune phenomena does not appear to be related to the development of an immune response to the drug in short term immunization. Hydralazine-protein conjugates were synthesized, radio-iodinated and used in a Farr technique for the measurement of anti-hydralazine antibody. These techniques for the assay of anti-hydralazine antibodies may be useful in clinical investigations. Imagesp933-a PMID:5316639

  20. Factors that deregulate the protective immune response in tuberculosis.

    PubMed

    Hernandez-Pando, Rogelio; Orozco, Hector; Aguilar, Diana

    2009-01-01

    Tuberculosis (TB) is a chronic infectious disease which essentially affects the lungs and produces profound abnormalities on the immune system. Although most people infected by the tubercle bacillus (90%) do not develop the disease during their lifetime, when there are alterations in the immune system, such as co-infection with HIV, malnutrition, or diabetes, the risk of developing active disease increases considerably. Interestingly, during the course of active disease, even in the absence of immunosuppressive conditions, there is a profound and prolonged suppression of Mycobacterium tuberculosis-specific protective immune responses. Several immune factors can contribute to downregulate the protective immunity, permitting disease progression. In general, many of these factors are potent anti-inflammatory molecules that are probably overproduced with the intention to protect against tissue damage, but the consequence of this response is a decline in protective immunity facilitating bacilli growth and disease progression. Here the most significant participants in protective immunity are reviewed, in particular the factors that deregulate protective immunity in TB. Their manipulation as novel forms of immunotherapy are also briefly commented.

  1. Immune response profiling in early rheumatoid arthritis: discovery of a novel interaction of treatment response with viral immunity

    PubMed Central

    2013-01-01

    Introduction It remains challenging to predict the outcomes of therapy in patients with rheumatoid arthritis (RA). The objective of this study was to identify immune response signatures that correlate with clinical treatment outcomes in patients with RA. Methods A cohort of 71 consecutive patients with early RA starting treatment with disease-modifying antirheumatic drugs (DMARDs) was recruited. Disease activity at baseline and after 21 to 24 weeks of follow-up was measured using the Disease Activity Score in 28 joints (DAS28). Immune response profiling was performed by analyzing multi-cytokine production from peripheral blood cells following incubation with a panel of stimuli, including a mixture of human cytomegalovirus (CMV) and Epstein-Barr virus (EBV) lysates. Profiles identified via principal components analysis (PCA) for each stimulus were then correlated with the ΔDAS28 from baseline to follow-up. A clinically meaningful improvement in the DAS28 was defined as a decrease of ≥1.2. Results A profile of T-cell cytokines (IL-13, IL-4, IL-5, IL-2, IL-12, and IFN-γ) produced in response to CMV/EBV was found to correlate with the ΔDAS28 from baseline to follow-up. At baseline, a higher magnitude of the CMV/EBV immune response profile predicted inadequate DAS28 improvement (mean PCA-1 scores: 65.6 versus 50.2; P = 0.029). The baseline CMV/EBV response was particularly driven by IFN-γ (P = 0.039) and IL-4 (P = 0.027). Among patients who attained clinically meaningful DAS28 improvement, the CMV/EBV PCA-1 score increased from baseline to follow-up (mean +11.6, SD 25.5), whereas among patients who responded inadequately to DMARD therapy, the CMV/EBV PCA-1 score decreased (mean -12.8, SD 25.4; P = 0.002). Irrespective of the ΔDAS28, methotrexate use was associated with up-regulation of the CMV/EBV response. The CMV/EBV profile was associated with positive CMV IgG (P <0.001), but not EBV IgG (P = 0.32), suggesting this response was related to

  2. Human leucocyte antigen (HLA-DR) gene expression is reduced in sepsis and correlates with impaired TNFα response: A diagnostic tool for immunosuppression?

    PubMed

    Winkler, Martin Sebastian; Rissiek, Anne; Priefler, Marion; Schwedhelm, Edzard; Robbe, Linda; Bauer, Antonia; Zahrte, Corinne; Zoellner, Christian; Kluge, Stefan; Nierhaus, Axel

    2017-01-01

    Sepsis is defined as a dysregulated immune response to infection. Impaired immune response in sepsis, often described as endotoxin tolerance, is characterized by unresponsiveness of monocytes on lipopolysaccharide (LPS) stimulation to release tumor necrosis factor α (TNFα). Furthermore, decreased monocyte surface protein expression of human leucocyte antigen DR (HLA-DR) is a marker for changes of the innate immune response during sepsis. Quantitative polymerase chain reaction (qPCR) and flow-cytometry (FACS) have been used to measure protein or gene expression of HLA-DR. We aimed to determine whether changes in mRNA expression of HLA-DR are associated with impaired TNFα response in human sepsis. Surface protein together with mRNA expression of HLA-DR were measured by FACS and qPCR in a cohort of 9 sepsis patients and compared to 10 pre-operative control patients in a prospective study. In addition, 20 patients with post-surgical inflammation, 20 patients with sepsis or septic shock were included and TNFα was determined following ex vivo stimulation of whole blood with 500 pg/mL LPS. Total RNA was prepared from whole blood and subjected to qPCR analysis for expression analysis of HLA-DR alpha (HLA-DRA) to correlate TNFα response with HLA-DRA expression. Patients with sepsis presented higher numbers of monocytes in peripheral blood (P<0.001) but decreased surface protein and mRNA HLA-DR levels when compared to controls. In all patients mRNA expression of HLA-DRA was decreased by approximately 70% compared to controls (P<0.01) and was lowest in patients with sepsis or septic shock (P<0.01). TNFα response to LPS was decreased in all patients (median 319 pg/mL versus controls 1256 pg/mL; P<0.01) and lowest in patients with sepsis or septic shock (median 128 pg/mL; P<0.01). HLA-DRA correlated positively with TNFα response in all study participants (r +0.60, P<0.001) and within patients (r +0.67, P<0.001). The TNFα:HLA-DRA ratio correlated negatively with severity

  3. Innate Immune Responses in Leprosy

    PubMed Central

    Pinheiro, Roberta Olmo; Schmitz, Veronica; Silva, Bruno Jorge de Andrade; Dias, André Alves; de Souza, Beatriz Junqueira; de Mattos Barbosa, Mayara Garcia; de Almeida Esquenazi, Danuza; Pessolani, Maria Cristina Vidal; Sarno, Euzenir Nunes

    2018-01-01

    Leprosy is an infectious disease that may present different clinical forms depending on host immune response to Mycobacterium leprae. Several studies have clarified the role of various T cell populations in leprosy; however, recent evidences suggest that local innate immune mechanisms are key determinants in driving the disease to its different clinical manifestations. Leprosy is an ideal model to study the immunoregulatory role of innate immune molecules and its interaction with nervous system, which can affect homeostasis and contribute to the development of inflammatory episodes during the course of the disease. Macrophages, dendritic cells, neutrophils, and keratinocytes are the major cell populations studied and the comprehension of the complex networking created by cytokine release, lipid and iron metabolism, as well as antimicrobial effector pathways might provide data that will help in the development of new strategies for leprosy management. PMID:29643852

  4. Transcriptional Profiling of the Immune Response to Marburg Virus Infection.

    PubMed

    Connor, John H; Yen, Judy; Caballero, Ignacio S; Garamszegi, Sara; Malhotra, Shikha; Lin, Kenny; Hensley, Lisa; Goff, Arthur J

    2015-10-01

    Marburg virus is a genetically simple RNA virus that causes a severe hemorrhagic fever in humans and nonhuman primates. The mechanism of pathogenesis of the infection is not well understood, but it is well accepted that pathogenesis is appreciably driven by a hyperactive immune response. To better understand the overall response to Marburg virus challenge, we undertook a transcriptomic analysis of immune cells circulating in the blood following aerosol exposure of rhesus macaques to a lethal dose of Marburg virus. Using two-color microarrays, we analyzed the transcriptomes of peripheral blood mononuclear cells that were collected throughout the course of infection from 1 to 9 days postexposure, representing the full course of the infection. The response followed a 3-stage induction (early infection, 1 to 3 days postexposure; midinfection, 5 days postexposure; late infection, 7 to 9 days postexposure) that was led by a robust innate immune response. The host response to aerosolized Marburg virus was evident at 1 day postexposure. Analysis of cytokine transcripts that were overexpressed during infection indicated that previously unanalyzed cytokines are likely induced in response to exposure to Marburg virus and further suggested that the early immune response is skewed toward a Th2 response that would hamper the development of an effective antiviral immune response early in disease. Late infection events included the upregulation of coagulation-associated factors. These findings demonstrate very early host responses to Marburg virus infection and provide a rich data set for identification of factors expressed throughout the course of infection that can be investigated as markers of infection and targets for therapy. Marburg virus causes a severe infection that is associated with high mortality and hemorrhage. The disease is associated with an immune response that contributes to the lethality of the disease. In this study, we investigated how the immune cells

  5. Preexisting Salmonella-specific immunity interferes with the subsequent development of immune responses against the Salmonella strains delivering H9N2 hemagglutinin.

    PubMed

    Hajam, Irshad Ahmed; Lee, John Hwa

    2017-06-01

    Recombinant Salmonella strains expressing foreign heterologous antigens have been extensively studied as promising live vaccine delivery vehicles. In this study, we constructed attenuated smooth (S-HA) and rough (R-HA) Salmonella strains expressing hemagglutinin (HA) of H9N2, a low pathogenic avian influenza A virus. We then investigated the HA-specific immune responses following oral immunization with either S-HA or R-HA strain in chicken model. We further examined the effects of the preexisting anti-Salmonella immunity on the subsequent elicitation of the HA and the Salmonella ompA specific immune responses. Our results showed that primary immunization with either the S-HA or the R-HA strain elicited comparable HA-specific immune responses and the responses were significantly (p<0.05) higher compared to the Salmonella vector control. When chickens were pre-immunized with the smooth Salmonella carrier alone and then vaccinated with either S-HA or R-HA strain 3, 6 and 9 weeks later, respectively, significant reductions were seen for HA-specific immune responses at week 6, a point which corresponded to the peak of the primary Salmonella-specific antibody responses. No reductions were seen at week 3 and 9, albeit, the HA-specific immune responses were boosted at week 9, a point which corresponded to the lowest primary Salmonella-specific antibody responses. The ompA recall responses remain refractory at week 3 and 6 following deliberate immunization with the carrier strain, but were significantly (p<0.05) increased at week 9 post-primary immunization. We conclude that preexisting anti-Salmonella immunity inhibits antigen-specific immune responses and this effect could be avoided by carefully selecting the time point when carrier-specific immune responses are relatively low. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Innate Immune Responses to Cryptococcus.

    PubMed

    Heung, Lena J

    2017-09-01

    Cryptococcus species are encapsulated fungi found in the environment that predominantly cause disease in immunocompromised hosts after inhalation into the lungs. Even with contemporary antifungal regimens, patients with cryptococcosis continue to have high morbidity and mortality rates. The development of more effective therapies may depend on our understanding of the cellular and molecular mechanisms by which the host promotes sterilizing immunity against the fungus. This review will highlight our current knowledge of how Cryptococcus , primarily the species C. neoformans , is sensed by the mammalian host and how subsequent signaling pathways direct the anti-cryptococcal response by effector cells of the innate immune system.

  7. Leptospirosis in human: Biomarkers in host immune responses.

    PubMed

    Vk, Chin; Ty, Lee; Wf, Lim; Ywy, Wan Shahriman; An, Syafinaz; S, Zamberi; A, Maha

    2018-03-01

    Leptospirosis remains one of the most widespread zoonotic diseases caused by spirochetes of the genus Leptospira, which accounts for high morbidity and mortality globally. Leptospiral infections are often found in tropical and subtropical regions, with people exposed to contaminated environments or animal reservoirs are at high risk of getting the infection. Leptospirosis has a wide range of clinical manifestations with non-specific signs and symptoms and often misdiagnosed with other acute febrile illnesses at early stage of infection. Despite being one of the leading causes of zoonotic morbidity worldwide, there is still a gap between pathogenesis and human immune responses during leptospiral infection. It still remains obscure whether the severity of the infection is caused by the pathogenic properties of the Leptospira itself, or it is a consequence of imbalance host immune factors. Hence, in this review, we seek to summarize the past and present milestone findings on the biomarkers of host immune response aspects during human leptospiral infection, including cytokine and other immune mediators. A profound understanding of the interlink between virulence factors and host immune responses during human leptospirosis is imperative to identify potential biomarkers for diagnostic and prognostic applications as well as designing novel immunotherapeutic strategies in future. Copyright © 2017 Elsevier GmbH. All rights reserved.

  8. Mitigation of Inflammatory Immune Responses with Hydrophilic Nanoparticles.

    PubMed

    Li, Bowen; Xie, Jingyi; Yuan, Zhefan; Jain, Priyesh; Lin, Xiaojie; Wu, Kan; Jiang, Shaoyi

    2018-04-16

    While hydrophobic nanoparticles (NPs) have been long recognized to boost the immune activation, whether hydrophilic NPs modulate an immune system challenged by immune stimulators and how their hydrophilic properties may affect the immune response is still unclear. To answer this question, three polymers, poly(ethylene glycol) (PEG), poly(sulfobetaine) (PSB) and poly(carboxybetaine) (PCB), which are commonly considered hydrophilic, are studied in this work. For comparison, nanogels with uniform size and homogeneous surface functionalities were made from these polymers. Peripheral blood mononuclear cells (PBMCs) stimulated by lipopolysaccharide (LPS) and an LPS-induced lung inflammation murine model were used to investigate the influence of nanogels on the immune system. Results show that the treatment of hydrophilic nanogels attenuated the immune responses elicited by LPS both in vitro and in vivo. Moreover, we found that PCB nanogels, which have the strongest hydration and the lowest non-specific protein binding, manifested the best performance in alleviating the immune activation, followed by PSB and PEG nanogels. This reveals that the immunomodulatory effect of hydrophilic materials is closely related to their hydration characteristics and their ability to resist non-specific binding in complex media. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. A basic mathematical model of the immune response

    NASA Astrophysics Data System (ADS)

    Mayer, H.; Zaenker, K. S.; an der Heiden, U.

    1995-03-01

    Interaction of the immune system with a target population of, e.g., bacteria, viruses, antigens, or tumor cells must be considered as a dynamic process. We describe this process by a system of two ordinary differential equations. Although the model is strongly idealized it demonstrates how the combination of a few proposed nonlinear interaction rules between the immune system and its targets are able to generate a considerable variety of different kinds of immune responses, many of which are observed both experimentally and clinically. In particular, solutions of the model equations correspond to states described by immunologists as ``virgin state,'' ``immune state'' and ``state of tolerance.'' The model successfully replicates the so-called primary and secondary response. Moreover, it predicts the existence of a threshold level for the amount of pathogen germs or of transplanted tumor cells below which the host is able to eliminate the infectious organism or to reject the tumor graft. We also find a long time coexistence of targets and immune competent cells including damped and undamped oscillations of both. Plausibly the model explains that if the number of transformed cells or pathogens exeeds definable values (poor antigenicity, high reproduction rate) the immune system fails to keep the disease under control. On the other hand, the model predicts apparently paradoxical situations including an increased chance of target survival despite enhanced immune activity or therapeutically achieved target reduction. A further obviously paradoxical behavior consists of a positive effect for the patient up to a complete cure by adding an additional target challenge where the benefit of the additional targets depends strongly on the time point and on their amount. Under periodically pulsed stimulation the model may show a chaotic time behavior of both target growth and immune response.

  10. Developmental exposure to bisphenol A modulates innate but not adaptive immune responses to influenza A virus infection.

    PubMed

    Roy, Anirban; Bauer, Stephen M; Lawrence, B Paige

    2012-01-01

    Bisphenol A (BPA) is used in numerous products, such as plastic bottles and food containers, from which it frequently leaches out and is consumed by humans. There is a growing public concern that BPA exposure may pose a significant threat to human health. Moreover, due to the widespread and constant nature of BPA exposure, not only adults but fetuses and neonates are also exposed to BPA. There is mounting evidence that developmental exposures to chemicals from our environment, including BPA, contribute to diseases late in life; yet, studies of how early life exposures specifically alter the immune system are limited. Herein we report an examination of how maternal exposure to a low, environmentally relevant dose of BPA affects the immune response to infection with influenza A virus. We exposed female mice during pregnancy and through lactation to the oral reference dose for BPA listed by the US Environmental Protection Agency, and comprehensively examined immune parameters directly linked to disease outcomes in adult offspring following infection with influenza A virus. We found that developmental exposure to BPA did not compromise disease-specific adaptive immunity against virus infection, or reduce the host's ability to clear the virus from the infected lung. However, maternal exposure to BPA transiently reduced the extent of infection-associated pulmonary inflammation and anti-viral gene expression in lung tissue. From these observations, we conclude that maternal exposure to BPA slightly modulates innate immunity in adult offspring, but does not impair the anti-viral adaptive immune response, which is critical for virus clearance and survival following influenza virus infection.

  11. Dynamic of Immune Response induced in Hepatitis B Surface Antigen-transgenic Mice Immunized with a Novel Therapeutic Formulation

    PubMed Central

    Almeida, Freya M Freyre; Blanco, Aracelys; Trujillo, Heidy; Hernández, Dunia; García, Daymir; Alba, José S; Abad, Matilde López; Merino, Nelson; Lobaina, Yadira

    2016-01-01

    ABSTRACT The development of therapeutic vaccines against chronic hepatitis B requires the capacity of the formulation to subvert a tolerated immune response as well as the evaluation of histopathological damage resulting from the treatment. In the present study, the dynamicity of induced immune response to hepatitis B surface antigen (HBsAg) was evaluated in transgenic mice that constitutively express the HBsAg gene (HBsAg-tg mice). After immunization with a vaccine candidate containing both surface (HBsAg) and core (HBcAg) antigens of hepatitis B virus (HBV), the effect of vaccination on clearance of circulating HBsAg and the potential histological alterations were examined. Transgenic (tg) and non-transgenic (Ntg) mice were immunized by intranasal (IN) and subcutaneous (SC) routes simultaneously. A control group received phosphate-buffered saline (PBS) by IN route and aluminum by SC route. Positive responses, at both humoral and cellular levels, were obtained after five immunizations in HBsAg-tg mice. Such responses were delayed and of lower intensity in tg mice, compared to vaccinated Ntg mice. Serum IgG response was characterized by a similar IgG subclass pattern. Even when HBsAg-specific CD8+ T cell responses were clearly detectable by gamma-interferon ELISPOT assay, histopathological alterations were not detected in any organ, including the liver and kidneys. Our study demonstrated, that it is possible to subvert the immune tolerance against HBsAg in tg mice, opening a window for new studies to optimize the schedule, dose, and formulation to improve the immune response to the therapeutic vaccine candidate. These results can be considered a safety proof to support clinical developments for the formulation under study. How to cite this article Freyre FM, Blanco A, Trujillo H, Hernández D, García D, Alba JS, Lopez M, Merino N, Lobaina Y, Aguilar JC. Dynamic of Immune Response induced in Hepatitis B Surface Antigen-transgenic Mice Immunized with a Novel

  12. Influences of Plant Traits on Immune Responses of Specialist and Generalist Herbivores

    PubMed Central

    Lampert, Evan

    2012-01-01

    Specialist and generalist insect herbivore species often differ in how they respond to host plant traits, particularly defensive traits, and these responses can include weakened or strengthened immune responses to pathogens and parasites. Accurate methods to measure immune response in the presence and absence of pathogens and parasites are necessary to determine whether susceptibility to these natural enemies is reduced or increased by host plant traits. Plant chemical traits are particularly important in that host plant metabolites may function as antioxidants beneficial to the immune response, or interfere with the immune response of both specialist and generalist herbivores. Specialist herbivores that are adapted to process and sometimes accumulate specific plant compounds may experience high metabolic demands that may decrease immune response, whereas the metabolic demands of generalist species differ due to more broad-substrate enzyme systems. However, the direct deleterious effects of plant compounds on generalist herbivores may weaken their immune responses. Further research in this area is important given that the ecological relevance of plant traits to herbivore immune responses is equally important in natural systems and agroecosystems, due to potential incompatibility of some host plant species and cultivars with biological control agents of herbivorous pests. PMID:26466545

  13. Photodynamic therapy for cancer and activation of immune response

    NASA Astrophysics Data System (ADS)

    Mroz, Pawel; Huang, Ying-Ying; Hamblin, Michael R.

    2010-02-01

    Anti-tumor immunity is stimulated after PDT for cancer due to the acute inflammatory response, exposure and presentation of tumor-specific antigens, and induction of heat-shock proteins and other danger signals. Nevertheless effective, powerful tumor-specific immune response in both animal models and also in patients treated with PDT for cancer, is the exception rather than the rule. Research in our laboratory and also in others is geared towards identifying reasons for this sub-optimal immune response and discovering ways of maximizing it. Reasons why the immune response after PDT is less than optimal include the fact that tumor-antigens are considered to be self-like and poorly immunogenic, the tumor-mediated induction of CD4+CD25+foxP3+ regulatory T-cells (T-regs), that are able to inhibit both the priming and the effector phases of the cytotoxic CD8 T-cell anti-tumor response and the defects in dendritic cell maturation, activation and antigen-presentation that may also occur. Alternatively-activated macrophages (M2) have also been implicated. Strategies to overcome these immune escape mechanisms employed by different tumors include combination regimens using PDT and immunostimulating treatments such as products obtained from pathogenic microorganisms against which mammals have evolved recognition systems such as PAMPs and toll-like receptors (TLR). This paper will cover the use of CpG oligonucleotides (a TLR9 agonist found in bacterial DNA) to reverse dendritic cell dysfunction and methods to remove the immune suppressor effects of T-regs that are under active study.

  14. Proteomic contributions to our understanding of vaccine and immune responses

    PubMed Central

    Galassie, Allison C.; Link, Andrew J.

    2015-01-01

    Vaccines are one of the greatest public health successes; yet, due to the empirical nature of vaccine design, we have an incomplete understanding of how the genes and proteins induced by vaccines contribute to the development of both protective innate and adaptive immune responses. While the advent of genomics has enabled new vaccine development and facilitated understanding of the immune response, proteomics identifies potentially new vaccine antigens with increasing speed and sensitivity. In addition, as proteomics is complementary to transcriptomic approaches, a combination of both approaches provides a more comprehensive view of the immune response after vaccination via systems vaccinology. This review details the advances that proteomic strategies have made in vaccine development and reviews how proteomics contributes to the development of a more complete understanding of human vaccines and immune responses. PMID:26172619

  15. Innate immune response to Mycobacterium tuberculosis Beijing and other genotypes.

    PubMed

    Wang, Chongzhen; Peyron, Pascale; Mestre, Olga; Kaplan, Gilla; van Soolingen, Dick; Gao, Qian; Gicquel, Brigitte; Neyrolles, Olivier

    2010-10-25

    As a species, Mycobacterium tuberculosis is more diverse than previously thought. In particular, the Beijing family of M. tuberculosis strains is spreading and evaluating throughout the world and this is giving rise to public health concerns. Genetic diversity within this family has recently been delineated further and a specific genotype, called Bmyc10, has been shown to represent over 60% of all Beijing clinical isolates in several parts of the world. How the host immune system senses and responds to various M. tuberculosis strains may profoundly influence clinical outcome and the relative epidemiological success of the different mycobacterial lineages. We hypothesised that the success of the Bmyc10 group may, at least in part, rely upon its ability to alter innate immune responses and the secretion of cytokines and chemokines by host phagocytes. We infected human macrophages and dendritic cells with a collection of genetically well-defined M. tuberculosis clinical isolates belonging to various mycobacterial families, including Beijing. We analyzed cytokine and chemokine secretion on a semi-global level using antibody arrays allowing the detection of sixty-five immunity-related soluble molecules. Our data indicate that Beijing strains induce significantly less interleukin (IL)-6, tumor necrosis factor (TNF), IL-10 and GRO-α than the H37Rv reference strain, a feature that is variously shared by other modern and ancient M. tuberculosis families and which constitutes a signature of the Beijing family as a whole. However, Beijing strains did not differ relative to each other in their ability to modulate cytokine secretion. Our results confirm and expand upon previous reports showing that M. tuberculosis Beijing strains in general are poor in vitro cytokine inducers in human phagocytes. The results suggest that the epidemiological success of the Beijing Bmyc10 is unlikely to rely upon any specific ability of this group of strains to impair anti-mycobacterial innate

  16. A new concept of skin-associated lymphoid tissue (SALT): UVB light impaired cutaneous immunity reveals a prominent role for cutaneous nerves.

    PubMed

    Streilein, J W; Alard, P; Niizeki, H

    1999-03-01

    More than 20 years have passed since the concept that the skin has its own associated immune system was first proposed by Streilein. This proposal was advanced in part on evidence that cutaneous contact hypersensitivity (CH) reactions are closely correlated with Langerhans cells (LC). Recent reports have demonstrated that LC have neural connectivity with cutaneous nerve termini containing calcitonin gene-related peptide (CGRP), suggesting that a link exists between innervation and immune responses in the skin. Here we discuss the neural components which have recently been found to be participants in skin-associated lymphoid tissue (SALT). In part, discovery of a functional link between the nervous system and SALT is based on studies in which cutaneous immunity was impaired by ultraviolet-B radiation (UVR). The deleterious effects of UVR on cutaneous immunity include failed CH induction and promotion of hapten-specific tolerance, effects that are mediated by tumor necrosis factor-alpha and interleukin-10, respectively. The source of these cytokines after UVR appears to be dermal mast cells. Evidence indicates that mast cells are triggered to release these cytokines in response to CGRP, which is released from UVR-damaged cutaneous nerve endings. Moreover, a substance P agonist was able to reverse the deleterious effects of UVR on CH induction, rendering the mice able to develop intense CH. These observations indicate that two cell types not originally included in the SALT concept are critical to the functional integrity of cutaneous immunity: mast cells and cutaneous nerves. We propose that cutaneous nerves dictate whether antigen applied to or arising within skin will lead to sensitivity or tolerance.

  17. Adaptive Immune Response Impairs the Efficacy of Autologous Transplantation of Engineered Stem Cells in Dystrophic Dogs

    PubMed Central

    Sitzia, Clementina; Farini, Andrea; Jardim, Luciana; Razini, Paola; Belicchi, Marzia; Cassinelli, Letizia; Villa, Chiara; Erratico, Silvia; Parolini, Daniele; Bella, Pamela; da Silva Bizario, Joao Carlos; Garcia, Luis; Dias-Baruffi, Marcelo; Meregalli, Mirella; Torrente, Yvan

    2016-01-01

    Duchenne muscular dystrophy is the most common genetic muscular dystrophy. It is caused by mutations in the dystrophin gene, leading to absence of muscular dystrophin and to progressive degeneration of skeletal muscle. We have demonstrated that the exon skipping method safely and efficiently brings to the expression of a functional dystrophin in dystrophic CD133+ cells injected scid/mdx mice. Golden Retriever muscular dystrophic (GRMD) dogs represent the best preclinical model of Duchenne muscular dystrophy, mimicking the human pathology in genotypic and phenotypic aspects. Here, we assess the capacity of intra-arterial delivered autologous engineered canine CD133+ cells of restoring dystrophin expression in Golden Retriever muscular dystrophy. This is the first demonstration of five-year follow up study, showing initial clinical amelioration followed by stabilization in mild and severe affected Golden Retriever muscular dystrophy dogs. The occurrence of T-cell response in three Golden Retriever muscular dystrophy dogs, consistent with a memory response boosted by the exon skipped-dystrophin protein, suggests an adaptive immune response against dystrophin. PMID:27506452

  18. Dendritic cells modulate lung response to Pseudomonas aeruginosa in a murine model of sepsis-induced immune dysfunction.

    PubMed

    Pène, Frédéric; Zuber, Benjamin; Courtine, Emilie; Rousseau, Christophe; Ouaaz, Fatah; Toubiana, Julie; Tazi, Asmaa; Mira, Jean-Paul; Chiche, Jean-Daniel

    2008-12-15

    Host infection by pathogens triggers an innate immune response leading to a systemic inflammatory response, often followed by an immune dysfunction which can favor the emergence of secondary infections. Dendritic cells (DCs) link innate and adaptive immunity and may be centrally involved in the regulation of sepsis-induced immune dysfunction. We assessed the contribution of DCs to lung defense in a murine model of sublethal polymicrobial sepsis (cecal ligature and puncture, CLP). In this model, bone marrow-derived DCs (BMDCs) retained an immature phenotype, associated with decreased capacity of IL-12p70 release and impaired priming of T cell lymphocytes. Eight days after CLP surgery, we induced a secondary pulmonary infection through intratracheal instillation of 5 x 10(6) CFUs of Pseudomonas aeruginosa. Whereas all sham-operated mice survived, 80% of post-CLP mice died after secondary pneumonia. Post-CLP mice exhibited marked lung damage with early recruitment of neutrophils, cytokine imbalance with decreased IL-12p70 production, and increased IL-10 release, but no defective bacterial lung clearance, while systemic bacterial dissemination was almost constant. Concomitant intrapulmonary administration of exogenous BMDCs into post-CLP mice challenged with P. aeruginosa dramatically improved survival. BMDCs did not improve bacterial lung clearance, but delayed neutrophil recruitment, strongly attenuated the early peak of TNF-alpha and restored an adequate Il-12p70/IL-10 balance in post-CLP mice. Thus, adoptive transfer of BMDCs reversed sepsis-induced immune dysfunction in a relevant model of secondary P. aeruginosa pneumonia. Unexpectedly, the mechanism of action of BMDCs did not involve enhanced antibacterial activity, but occurred by dampening the pulmonary inflammatory response.

  19. Innate Immune Response to Burkholderia mallei

    DTIC Science & Technology

    2017-02-16

    stimulate immune responses via TLR4 activation that may contribute to persistent infection. Summary Mortality is high due to septicemia and immune...phosphorylation of adenosine monophosphate- activated protein kinase (AMPK); regulators of NF-κB signaling pathway (e.g. IκBα, GSK3β, Src, and STAT1) and mitogen... activated protein kinases (e.g. p38, ERK1/2 and c-Myc) (13). The degrees in which target host proteins or processes are modulated correlated to the

  20. Recombinant proteins of Zaire ebolavirus induce potent humoral and cellular immune responses and protect against live virus infection in mice.

    PubMed

    Lehrer, Axel T; Wong, Teri-Ann S; Lieberman, Michael M; Humphreys, Tom; Clements, David E; Bakken, Russell R; Hart, Mary Kate; Pratt, William D; Dye, John M

    2018-05-24

    Infections with filoviruses in humans are highly virulent, causing hemorrhagic fevers which result in up to 90% mortality. In addition to natural infections, the ability to use these viruses as bioterrorist weapons is of significant concern. Currently, there are no licensed vaccines or therapeutics available to combat these infections. The pathogenesis of disease involves the dysregulation of the host's immune system, which results in impairment of the innate and adaptive immune responses, with subsequent development of lymphopenia, thrombocytopenia, hemorrhage, and death. Questions remain with regard to the few survivors of infection, who manage to mount an effective adaptive immune response. These questions concern the humoral and cellular components of this response, and whether such a response can be elicited by an appropriate prophylactic vaccine. The data reported herein describe the production and evaluation of a recombinant subunit Ebola virus vaccine candidate consisting of insect cell expressed Zaire ebolavirus (EBOV) surface glycoprotein (GP) and the matrix proteins VP24 and VP40. The recombinant subunit proteins are shown to be highly immunogenic in mice, yielding both humoral and cellular responses, as well as highly efficacious, providing up to 100% protection against a lethal challenge with live virus. These results demonstrate proof of concept for such a recombinant non-replicating vaccine candidate in the mouse model of EBOV which helps to elucidate immune correlates of protection and warrants further development. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Immune Responses in Rhinovirus-Induced Asthma Exacerbations.

    PubMed

    Steinke, John W; Borish, Larry

    2016-11-01

    Acute asthma exacerbations are responsible for urgent care visits and hospitalizations; they interfere with school and work productivity, thereby driving much of the morbidity and mortality associated with asthma. Approximately 80 to 85 % of asthma exacerbations in children, adolescents, and less frequently adults are associated with viral upper respiratory tract viral infections, and rhinovirus (RV) accounts for ∼60-70 % of these virus-associated exacerbations. Evidence suggests that it is not the virus itself but the nature of the immune response to RV that drives this untoward response. In particular, evidence supports the concept that RV acts to exacerbate an ongoing allergic inflammatory response to environmental allergens present at the time of the infection. The interaction of the ongoing IgE- and T cell-mediated response to allergen superimposed on the innate and adaptive immune responses to the virus and how this leads to triggering of an asthma exacerbation is discussed.

  2. PD-L1 Overexpression During Endotoxin Tolerance Impairs the Adaptive Immune Response in Septic Patients via HIF1α.

    PubMed

    Avendaño-Ortiz, José; Maroun-Eid, Charbel; Martín-Quirós, Alejandro; Toledano, Víctor; Cubillos-Zapata, Carolina; Gómez-Campelo, Paloma; Varela-Serrano, Aníbal; Casas-Martin, Jose; Llanos-González, Emilio; Alvarez, Enrique; García-Río, Francisco; Aguirre, Luis A; Hernández-Jiménez, Enrique; López-Collazo, Eduardo

    2018-01-17

    Sepsis, among other pathologies, is an endotoxin tolerance (ET)-related disease. On admission, we classified 48 patients with sepsis into 3 subgroups according to the ex vivo response to lipopolysaccharide. This response correlates with the Acute Physiology and Chronic Health Evaluation (APACHE) II score and the ET degree. Moreover, the ET-related classification determines the outcome of these patients. Programmed cell death-ligand 1 (PD-L1) expression on septic monocytes is also linked with ET status. In addition to the regulation of cytokine production, one of the hallmarks of ET that significantly affects patients with sepsis is T-cell proliferation impairment or a poor switch to the adaptive response. PD-L1/programmed cell death-1 (PD-1) blocking and knockdown assays on tolerant monocytes from both patients with sepsis and the in vitro model reverted the impaired adaptive response. Mechanistically, the transcription factor hypoxia-inducible factor-1α (HIF1α) has been translocated into the nucleus and drives PD-L1 expression during ET in human monocytes. This fact, together with patient classification according to the ex vivo lipopolysaccharide response, opens an interesting field of study and potential personalized clinical applications, not only for sepsis but also for all ET-associated pathologies. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  3. Evasion of Influenza A Viruses from Innate and Adaptive Immune Responses

    PubMed Central

    van de Sandt, Carolien E.; Kreijtz, Joost H. C. M.; Rimmelzwaan, Guus F.

    2012-01-01

    The influenza A virus is one of the leading causes of respiratory tract infections in humans. Upon infection with an influenza A virus, both innate and adaptive immune responses are induced. Here we discuss various strategies used by influenza A viruses to evade innate immune responses and recognition by components of the humoral and cellular immune response, which consequently may result in reduced clearing of the virus and virus-infected cells. Finally, we discuss how the current knowledge about immune evasion can be used to improve influenza A vaccination strategies. PMID:23170167

  4. Nitric oxide and redox mechanisms in the immune response

    PubMed Central

    Wink, David A.; Hines, Harry B.; Cheng, Robert Y. S.; Switzer, Christopher H.; Flores-Santana, Wilmarie; Vitek, Michael P.; Ridnour, Lisa A.; Colton, Carol A.

    2011-01-01

    The role of redox molecules, such as NO and ROS, as key mediators of immunity has recently garnered renewed interest and appreciation. To regulate immune responses, these species trigger the eradication of pathogens on the one hand and modulate immunosuppression during tissue-restoration and wound-healing processes on the other. In the acidic environment of the phagosome, a variety of RNS and ROS is produced, thereby providing a cauldron of redox chemistry, which is the first line in fighting infection. Interestingly, fluctuations in the levels of these same reactive intermediates orchestrate other phases of the immune response. NO activates specific signal transduction pathways in tumor cells, endothelial cells, and monocytes in a concentration-dependent manner. As ROS can react directly with NO-forming RNS, NO bioavailability and therefore, NO response(s) are changed. The NO/ROS balance is also important during Th1 to Th2 transition. In this review, we discuss the chemistry of NO and ROS in the context of antipathogen activity and immune regulation and also discuss similarities and differences between murine and human production of these intermediates. PMID:21233414

  5. Innate Immune Responses to Cryptococcus

    PubMed Central

    Heung, Lena J.

    2017-01-01

    Cryptococcus species are encapsulated fungi found in the environment that predominantly cause disease in immunocompromised hosts after inhalation into the lungs. Even with contemporary antifungal regimens, patients with cryptococcosis continue to have high morbidity and mortality rates. The development of more effective therapies may depend on our understanding of the cellular and molecular mechanisms by which the host promotes sterilizing immunity against the fungus. This review will highlight our current knowledge of how Cryptococcus, primarily the species C. neoformans, is sensed by the mammalian host and how subsequent signaling pathways direct the anti-cryptococcal response by effector cells of the innate immune system. PMID:28936464

  6. Transcriptomics of the Vaccine Immune Response: Priming With Adjuvant Modulates Recall Innate Responses After Boosting.

    PubMed

    Santoro, Francesco; Pettini, Elena; Kazmin, Dmitri; Ciabattini, Annalisa; Fiorino, Fabio; Gilfillan, Gregor D; Evenroed, Ida M; Andersen, Peter; Pozzi, Gianni; Medaglini, Donata

    2018-01-01

    Transcriptomic profiling of the immune response induced by vaccine adjuvants is of critical importance for the rational design of vaccination strategies. In this study, transcriptomics was employed to profile the effect of the vaccine adjuvant used for priming on the immune response following re-exposure to the vaccine antigen alone. Mice were primed with the chimeric vaccine antigen H56 of Mycobacterium tuberculosis administered alone or with the CAF01 adjuvant and boosted with the antigen alone. mRNA sequencing was performed on blood samples collected 1, 2, and 7 days after priming and after boosting. Gene expression analysis at day 2 after priming showed that the CAF01 adjuvanted vaccine induced a stronger upregulation of the innate immunity modules compared with the unadjuvanted formulation. The immunostimulant effect of the CAF01 adjuvant, used in the primary immunization, was clearly seen after a booster immunization with a low dose of antigen alone. One day after boost, we observed a strong upregulation of multiple genes in blood of mice primed with H56 + CAF01 compared with mice primed with the H56 alone. In particular, blood transcription modules related to innate immune response, such as monocyte and neutrophil recruitment, activation of antigen-presenting cells, and interferon response were activated. Seven days after boost, differential expression of innate response genes faded while a moderate differential expression of T cell activation modules was appreciable. Indeed, immunological analysis showed a higher frequency of H56-specific CD4+ T cells and germinal center B cells in draining lymph nodes, a strong H56-specific humoral response and a higher frequency of antibody-secreting cells in spleen of mice primed with H56 + CAF01. Taken together, these data indicate that the adjuvant used for priming strongly reprograms the immune response that, upon boosting, results in a stronger recall innate response essential for shaping the downstream

  7. Modulatory effects of several herbal extracts on avian peripheral blood cell immune responses.

    PubMed

    Dorhoi, A; Dobrean, V; Zăhan, M; Virag, P

    2006-05-01

    Standardized ethanol extracts of Allium sativum (garlic), Glycyrrhiza glabra (licorice), Plantago major (plantain) and Hippophae rhamnoides (sea buckthorn) were assessed for their effects on cellular immunity in laying hens. Birds (n = 25) had blood samples taken and both specific and non-specific immune cell responsiveness were evaluated by a leukocyte proliferation assay, carbon clearance test and SRBC phagocytosis in monocyte-derived macrophage cultures. Licorice and sea buckthorn (50 microg/mL) clearly enhanced the macrophage membrane function (p < 0.05 and p < 0.01, respectively). Dual effects on circulating phagocytes were revealed for plantain and sea buckthorn, while garlic at 200 microg/mL impaired the phagocytic capacity of blood cells. None of the tested extracts showed mitogenic properties, but high concentrations of sea buckthorn (400 microg/mL) inhibited leukocyte proliferation. Small concentrations (20 microg/mL) of licorice proved the co-mitogenic potential for both T and B avian lymphocytes (p < 0.05). Certain extracts definitely enhanced the fowl innate and/or specific cell immunity and may therefore improve host resistance in poultry. Considering the chicken as an important non-mammalian model that also serves as an available laboratory approach for some human diseases, herbs exerting immunomodulatory properties may find relevant clinical applications. Copyright 2006 John Wiley & Sons, Ltd.

  8. Verification of immune response optimality through cybernetic modeling.

    PubMed

    Batt, B C; Kompala, D S

    1990-02-09

    An immune response cascade that is T cell independent begins with the stimulation of virgin lymphocytes by antigen to differentiate into large lymphocytes. These immune cells can either replicate themselves or differentiate into plasma cells or memory cells. Plasma cells produce antibody at a specific rate up to two orders of magnitude greater than large lymphocytes. However, plasma cells have short life-spans and cannot replicate. Memory cells produce only surface antibody, but in the event of a subsequent infection by the same antigen, memory cells revert rapidly to large lymphocytes. Immunologic memory is maintained throughout the organism's lifetime. Many immunologists believe that the optimal response strategy calls for large lymphocytes to replicate first, then differentiate into plasma cells and when the antigen has been nearly eliminated, they form memory cells. A mathematical model incorporating the concept of cybernetics has been developed to study the optimality of the immune response. Derived from the matching law of microeconomics, cybernetic variables control the allocation of large lymphocytes to maximize the instantaneous antibody production rate at any time during the response in order to most efficiently inactivate the antigen. A mouse is selected as the model organism and bacteria as the replicating antigen. In addition to verifying the optimal switching strategy, results showing how the immune response is affected by antigen growth rate, initial antigen concentration, and the number of antibodies required to eliminate an antigen are included.

  9. Early life socioeconomic position and immune response to persistent infections among elderly Latinos.

    PubMed

    Meier, Helen C S; Haan, Mary N; Mendes de Leon, Carlos F; Simanek, Amanda M; Dowd, Jennifer B; Aiello, Allison E

    2016-10-01

    Persistent infections, such as cytomegalovirus (CMV), herpes simplex virus-1 (HSV-1), Helicobacter pylori (H. pylori), and Toxoplasma gondii (T. gondii), are common in the U.S. but their prevalence varies by socioeconomic status. It is unclear if early or later life socioeconomic position (SEP) is a more salient driver of disparities in immune control of these infections. Using data from the Sacramento Area Latino Study on Aging, we examined whether early or later life SEP was the strongest predictor of immune control later in life by contrasting two life course models, the critical period model and the chain of risk model. Early life SEP was measured as a latent variable, derived from parental education and occupation, and food availability. Indicators for SEP in later life included education level and occupation. Individuals were categorized by immune response to each pathogen (seronegative, low, medium and high) with increasing immune response representing poorer immune control. Cumulative immune response was estimated using a latent profile analysis with higher total immune response representing poorer immune control. Structural equation models were used to examine direct, indirect and total effects of early life SEP on each infection and cumulative immune response, controlling for age and gender. The direct effect of early life SEP on immune response was not statistically significant for the infections or cumulative immune response. Higher early life SEP was associated with lower immune response for T. gondii, H. pylori and cumulative immune response through pathways mediated by later life SEP. For CMV, higher early life SEP was both directly associated and partially mediated by later life SEP. No association was found between SEP and HSV-1. Findings from this study support a chain of risk model, whereby early life SEP acts through later life SEP to affect immune response to persistent infections in older age. Copyright © 2016 Elsevier Ltd. All rights

  10. Humoral and cell-mediated immune responses in DNA immunized mink challenged with wild-type canine distemper virus.

    PubMed

    Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter; Jensen, Trine Hammer; Jensen, Tove Dannemann; Aasted, Bent; Blixenkrone-Møller, Merete

    2009-07-30

    The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper is still a problem worldwide. The broad host range of CDV creates a constant viral reservoir among wildlife animals. Our results demonstrated early humoral and cell-mediated immune responses (IFN-gamma) in DNA vaccinated mink compared to mock-vaccinated mink after challenge with a Danish wild-type CDV. The DNA vaccine-induced immunity protected the natural host against disease development.

  11. Generation of cellular immune memory and B-cell immunity is impaired by natural killer cells.

    PubMed

    Rydyznski, Carolyn; Daniels, Keith A; Karmele, Erik P; Brooks, Taylor R; Mahl, Sarah E; Moran, Michael T; Li, Caimei; Sutiwisesak, Rujapak; Welsh, Raymond M; Waggoner, Stephen N

    2015-02-27

    The goal of most vaccines is the induction of long-lived memory T and B cells capable of protecting the host from infection by cytotoxic mechanisms, cytokines and high-affinity antibodies. However, efforts to develop vaccines against major human pathogens such as HIV and HCV have not been successful, thereby highlighting the need for novel approaches to circumvent immunoregulatory mechanisms that limit the induction of protective immunity. Here, we show that mouse natural killer (NK) cells inhibit generation of long-lived virus-specific memory T- and B cells as well as virus-specific antibody production after acute infection. Mechanistically, NK cells suppressed CD4 T cells and follicular helper T cells (T(FH)) in a perforin-dependent manner during the first few days of infection, resulting in a weaker germinal centre (GC) response and diminished immune memory. We anticipate that innovative strategies to relieve NK cell-mediated suppression of immunity should facilitate development of efficacious new vaccines targeting difficult-to-prevent infections.

  12. Immune Response to Dengue and Zika.

    PubMed

    Ngono, Annie Elong; Shresta, Sujan

    2018-04-26

    Flaviviruses such as dengue (DENV), yellow fever (YFV), West Nile (WNV), and Zika (ZIKV) are human pathogens of global significance. In particular, DENV causes the most prevalent mosquito-borne viral diseases in humans, and ZIKV emerged from obscurity into the spotlight in 2016 as the etiologic agent of congenital Zika syndrome. Owing to the recent emergence of ZIKV as a global pandemic threat, the roles of the immune system during ZIKV infections are as yet unclear. In contrast, decades of DENV research implicate a dual role for the immune system in protection against and pathogenesis of DENV infection. As DENV and ZIKV are closely related, knowledge based on DENV studies has been used to prioritize investigation of ZIKV immunity and pathogenesis, and to accelerate ZIKV diagnostic, therapeutic, and vaccine design. This review discusses the following topics related to innate and adaptive immune responses to DENV and ZIKV: the interferon system as the key mechanism of host defense and viral target for immune evasion, antibody-mediated protection versus antibody-dependent enhancement, and T cell-mediated protection versus original T cell antigenic sin. Understanding the mechanisms that regulate the balance between immune-mediated protection and pathogenesis during DENV and ZIKV infections is critical toward development of safe and effective DENV and ZIKV therapeutics and vaccines.

  13. Factors Associated With Pediatrician Responses to Alternative Immunization Schedule Requests.

    PubMed

    Mohanty, Salini; Feemster, Kristen A; Buttenheim, Alison; Moser, Charlotte A; Field, Robert I; Mayer, Whitney; Carroll-Scott, Amy

    2018-02-01

    We conducted a cross-sectional online survey among 4 chapters of the American Academy of Pediatrics from July through October 2014 to describe characteristics of pediatricians and practices associated with practice-level responses to alternative immunization schedule requests. Among 374 pediatricians, 58% reported frequent alternative immunization schedule requests and 24% reported feeling comfortable using them. Pediatricians who work in practices that accommodate alternative immunization schedule requests have increased odds of having a high frequency of alternative immunization schedule requests, and beliefs that relationships with families would be negatively affected if they refused requests. Practices that discontinue care to families who request alternative immunization schedules have increased odds of being a private group practice and having a formal office vaccine policy. Pediatricians are frequently asked to use alternative immunization schedules and many are not comfortable using them. Practice-level responses to alternative immunization schedules are associated with characteristics of pediatricians and practices.

  14. Eosinophils in mucosal immune responses

    PubMed Central

    Travers, J; Rothenberg, M E

    2015-01-01

    Eosinophils, multifunctional cells that contribute to both innate and adaptive immunity, are involved in the initiation, propagation and resolution of immune responses, including tissue repair. They achieve this multifunctionality by expression of a diverse set of activation receptors, including those that directly recognize pathogens and opsonized targets, and by their ability to store and release preformed cytotoxic mediators that participate in host defense, to produce a variety of de novo pleotropic mediators and cytokines and to interact directly and indirectly with diverse cell types, including adaptive and innate immunocytes and structural cells. Herein, we review the basic biology of eosinophils and then focus on new emerging concepts about their role in mucosal immune homeostasis, particularly maintenance of intestinal IgA. We review emerging data about their development and regulation and describe new concepts concerning mucosal eosinophilic diseases. We describe recently developed therapeutic strategies to modify eosinophil levels and function and provide collective insight about the beneficial and detrimental functions of these enigmatic cells. PMID:25807184

  15. Spaceflight and Development of Immune Responses

    NASA Technical Reports Server (NTRS)

    Sonnenfeld, Gerald

    1996-01-01

    Evidence from both human and rodent studies has indicated that alterations in immunological parameters occur after space flight. The number of flight experiments has been small, and the full breadth of immunological alterations occurring after space flight remains to be established. Among the major effects on immune responses after space flight that have been reported are: alterations in lymphocyte blastogenesis and natural killer cell activity, alterations in production of cytokines, changes in leukocyte sub-population distribution, and decreases in the ability of bone marrow cells to respond to colony stimulating factors. Changes have been reported in immunological parameters of both humans and rodents. The significance of these alterations in relation to resistance to infection remains to be established. The objective of the studies contained in this project was to determine the effects of space flight on immune responses of pregnant rats and their offspring. The hypothesis was that space flight and the attendant period of microgravity will result in alteration of immunological parameters of both the pregnant rats as well as their offspring carried in utero during the flight. The parameters tested included: production of cytokines, composition of leukocyte sub- populations, response of bone marrow/liver cells to granulocyte/monocyte colony stimulating factor, and leukocyte blastogenesis. Changes in immune responses that could yield alterations in resistance to infection were determined. This yielded useful information for planning studies that could contribute to crew health. Additional information that could eventually prove useful to determine the potential for establishment of a permanent colony in space was obtained.

  16. Effect of gender and sex hormones on immune responses following shock.

    PubMed

    Angele, M K; Schwacha, M G; Ayala, A; Chaudry, I H

    2000-08-01

    Several clinical and experimental studies show a gender dimorphism of the immune and organ responsiveness in the susceptibility to and morbidity from shock, trauma, and sepsis. In this respect, cell-mediated immune responses are depressed in males after trauma-hemorrhage, whereas they are unchanged or enhanced in females. Sex hormones contribute to this gender-specific immune response after adverse circulatory conditions. Specifically, studies indicate that androgens are responsible for the immunodepression after trauma-hemorrhage in males. In contrast, female sex steroids seem to exhibit immunoprotective properties after trauma and severe blood loss, because administration of estrogen prevents the androgen-induced immunodepression in castrated male mice. Nonetheless, the precise underlying mechanisms for these immunomodulatory effects of sex steroids after shock remain unknown. Although testosterone depletion, testosterone receptor antagonism, or estrogen treatment has been shown to prevent the depression of immune functions after trauma-hemorrhage, it remains to be established whether differences in the testosterone-estradiol ratio are responsible for the immune dysfunction. Furthermore, sex hormone receptors have been identified on various immune cells, suggesting direct effects. Thus, the immunomodulatory properties of sex hormones after trauma-hemorrhage might represent novel therapeutic strategies for the treatment of immunodepression in trauma patients.

  17. A multiherbal formulation influencing immune response in vitro.

    PubMed

    Menghini, L; Leporini, L; Scanu, N; Pintore, G; Ferrante, C; Recinella, L; Orlando, G; Vacca, M; Brunetti, L

    2012-02-01

    Aim of this study was to evaluate the effects of phytocomplexes of Uncaria, Shiitake and Ribes in terms of viability and inflammatory response on immune cell-derived cultures. Standardized extracts of Uncaria, Shitake and Ribes and their commercial formulation were tested on cell lines PBMC, U937 and macrophage. The activity was evaluated in terms of cell viability (MTT test), variations of oxidative marker release (ROS and PGE2) and modulatory effects on immune response (gene expression of IL-6, IL-8 and TNFα, RT-PCR). Cell viability was not affected by extracts, except subtle variations observed only at higher doses (>250 µg/mL). The extract mixture was well tolerated, with no effects on cell viability up to doses of 500 µg/mL. Pre-treatment of macrophages with subtoxic doses of the extracts reduced the basal release of oxidative markers and enhanced the cell response to exogenous oxidant stimulation, as revealed by ROS and PGE2 release reduction. The same treatment on macrophage resulted in a selective modulation of the immune response, as shown by an increase of IL-6 mRNA and, partially, IL-8 mRNA, while a reduction was observed for TNFα mRNA. Data confirm that extracts and their formulations can act as regulator of the immune system with mechanisms involving the oxidative stress and the release of selected proinflammatory cytokines.

  18. Pathogen recognition in the innate immune response.

    PubMed

    Kumar, Himanshu; Kawai, Taro; Akira, Shizuo

    2009-04-28

    Immunity against microbial pathogens primarily depends on the recognition of pathogen components by innate receptors expressed on immune and non-immune cells. Innate receptors are evolutionarily conserved germ-line-encoded proteins and include TLRs (Toll-like receptors), RLRs [RIG-I (retinoic acid-inducible gene-I)-like receptors] and NLRs (Nod-like receptors). These receptors recognize pathogens or pathogen-derived products in different cellular compartments, such as the plasma membrane, the endosomes or the cytoplasm, and induce the expression of cytokines, chemokines and co-stimulatory molecules to eliminate pathogens and instruct pathogen-specific adaptive immune responses. In the present review, we will discuss the recent progress in the study of pathogen recognition by TLRs, RLRs and NLRs and their signalling pathways.

  19. Inflammatory cytokines in the brain: does the CNS shape immune responses?

    PubMed

    Owens, T; Renno, T; Taupin, V; Krakowski, M

    1994-12-01

    Immune responses in the central nervous system (CNS) have traditionally been regarded as representing the intrusion of an unruly, ill-behaved mob of leukocytes into the well-ordered and organized domain of thought and reason. However, results accumulated over the past few years suggest that, far from being an immunologically privileged organ, T lymphocytes may be regular and frequent visitors to the CNS, for purposes of immune surveillance. Here, Trevor Owens and colleagues propose that the brain itself can regulate or shape immune responses therein. Furthermore, given that the immune cells may be subverted to autoimmunity, they suggest that the study of inflammatory autoimmune disease in the brain may shed light on the ability of the local environment to regulate immune responses.

  20. Immune Responses of HIV-1 Tat Transgenic Mice to Mycobacterium Tuberculosis W-Beijing SA161

    PubMed Central

    Honda, Jennifer R; Shang, Shaobin; Shanley, Crystal A; Caraway, Megan L; Henao-Tamayo, Marcela; Chan, Edward D; Basaraba, Randall J; Orme, Ian M; Ordway, Diane J; Flores, Sonia C

    2011-01-01

    Background: Mycobacterium tuberculosis remains among the leading causes of death from an infectious agent in the world and exacerbates disease caused by the human immunodeficiency virus (HIV). HIV infected individuals are prone to lung infections by a variety of microbial pathogens, including M. tuberculosis. While the destruction of the adaptive immune response by HIV is well understood, the actual pathogenesis of tuberculosis in co-infected individuals remains unclear. Tat is an HIV protein essential for efficient viral gene transcription, is secreted from infected cells, and is known to influence a variety of host inflammatory responses. We hypothesize Tat contributes to pathophysiological changes in the lung microenvironment, resulting in impaired host immune responses to infection by M. tuberculosis. Results: Herein, we show transgenic mice that express Tat by lung alveolar cells are more susceptible than non-transgenic control littermates to a low-dose aerosol infection of M. tuberculosis W-Beijing SA161. Survival assays demonstrate accelerated mortality rates of the Tat transgenic mice compared to non-transgenics. Tat transgenic mice also showed poorly organized lung granulomata-like lesions. Analysis of the host immune response using quantitative RT-PCR, flow cytometry for surface markers, and intracellular cytokine staining showed increased expression of pro-inflammatory cytokines in the lungs, increased numbers of cells expressing ICAM1, increased numbers of CD4+CD25+Foxp3+ T regulatory cells, and IL-4 producing CD4+ T cells in the Tat transgenics compared to infected non-tg mice. Conclusions: Our data show quantitative differences in the inflammatory response to the SA161 clinical isolate of M. tuberculosis W-Beijing between Tat transgenic and non-transgenic mice, suggesting Tat contributes to the pathogenesis of tuberculosis. PMID:22046211

  1. Drosophila blood cells and their role in immune responses.

    PubMed

    Vlisidou, Isabella; Wood, Will

    2015-04-01

    Drosophila melanogaster has been extensively used to study the humoral arm of innate immunity because of the developmental and functional parallels with mammalian innate immunity. However, the fly cellular response to infection is far less understood. Investigative work on Drosophila haemocytes, the immunosurveillance cells of the insect, has revealed that they fulfil roles similar to mammalian monocytes and macrophages. They respond to wound signals and orchestrate the coagulation response. In addition, they phagocytose and encapsulate invading pathogens, and clear up apoptotic bodies controlling inflammation. This review briefly describes the Drosophila haematopoietic system and discusses what is currently known about the contribution of haemocytes to the immune response upon infection and wounding, during all stages of development. © 2015 FEBS.

  2. SIRT1 and HIF1α signaling in metabolism and immune responses.

    PubMed

    Yu, Qing; Dong, Lin; Li, Yan; Liu, Gaungwei

    2018-04-01

    SIRT1 and HIF1α are regarded as two key metabolic sensors in cellular metabolism pathways and play vital roles in influencing immune responses. SIRT1 and HIF1α regulate immune responses in metabolism-dependent and -independent ways. Here, we summarized the recent knowledge of SIRT1 and HIF1α signaling in metabolism and immune responses. HIF1α is a direct target of SIRT1. Sometimes, SIRT1 and HIF1α cooperate or act separately to mediate immune responses. In innate immune responses, SIRT1 can regulate the glycolytic activity of myeloid-derived suppressor cells (MDSCs) and influence MDSC functional differentiation. SIRT1 can regulate monocyte function through NF-κB and PGC-1, accompanying an increased NAD + level. The SIRT1-HIF1α axis bridges the innate immune signal to an adaptive immune response by directing cytokine production of dendritic cells in a metabolism-independent manner, promoting the differentiation of CD4 + T cells. For adaptive immune cells, SIRT1 can mediate the differentiation of inflammatory T cell subsets in a NAD + -dependent manner. HIF1α can stimulate some glycolysis-associated genes and regulate the ATP and ROS generations. In addition, SIRT1-and HIF1α-associated metabolism inhibits the activity of mTOR, thus negatively regulating the differentiation and function of Th9 cells. As immune cells are crucial in controlling immune-associated diseases, SIRT1-and HIF1α associated-metabolism is closely linked to immune-associated diseases, including infection, tumors, allergic airway inflammation, and autoimmune diseases. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Fish immunity to scuticociliate parasites.

    PubMed

    Piazzon, María Carla; Leiro, José; Lamas, Jesús

    2013-10-01

    Some species of scuticociliates (Ciliophora) behave as facultative parasites and produce severe mortalities in cultured fish. Pathogenic scuticociliates can cause surface lesions and can also penetrate inside the body, where they feed on tissue and proliferate in the blood and most internal organs, killing the host in a few days. In this review, we describe the current knowledge on the protective role of fish cellular and humoral immune responses against these parasites. Immune humoral factors, especially complement, are of particular importance in defending fish against these ciliates. However, knowledge about how the fish immune system responds to scuticociliates is scant, and the cellular and molecular events that occur during the response are not known. We also describe the possible mechanisms used by scuticociliates to avoid or resist the defensive reaction of the host. For example, the release of proteases can help parasites enter fish tissues and impair the fish cellular and humoral responses. Several vaccine formulations containing scuticociliates have induced a good antibody response and protection in fish immunized and challenged with homologous strains of particular species. However, protection was not achieved in fish immunized and challenged with heterologous strains, and the antigens involved in protection and the antigenic differences between heterologous strains have not yet been determined. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Influence of bedding type on mucosal immune responses.

    PubMed

    Sanford, Amy N; Clark, Stephanie E; Talham, Gwen; Sidelsky, Michael G; Coffin, Susan E

    2002-10-01

    The mucosal immune system interacts with the external environment. In the study reported here, we found that bedding materials can influence the intestinal immune responses of mice. We observed that mice housed on wood, compared with cotton bedding, had increased numbers of Peyer's patches (PP) visible under a dissecting microscope. In addition, culture of lymphoid organs revealed increased production of total and virus-specific IgA by PP and mesenteric lymph node (MLN) lymphocytes from mice housed on wood, compared with cotton bedding. However, bedding type did not influence serum virus-specific antibody responses. These observations indicate that bedding type influences the intestinal immune system and suggest that this issue should be considered by mucosal immunologists and personnel at animal care facilities.

  5. Progesterone impairs antigen-non-specific immune protection by CD8 T memory cells via interferon-γ gene hypermethylation.

    PubMed

    Yao, Yushi; Li, Hui; Ding, Jie; Xia, Yixin; Wang, Lei

    2017-11-01

    Pregnant women and animals have increased susceptibility to a variety of intracellular pathogens including Listeria monocytogenes (LM), which has been associated with significantly increased level of sex hormones such as progesterone. CD8 T memory(Tm) cell-mediated antigen-non-specific IFN-γ responses are critically required in the host defense against LM. However, whether and how increased progesterone during pregnancy modulates CD8 Tm cell-mediated antigen-non-specific IFN-γ production and immune protection against LM remain poorly understood. Here we show in pregnant women that increased serum progesterone levels are associated with DNA hypermethylation of IFN-γ gene promoter region and decreased IFN-γ production in CD8 Tm cells upon antigen-non-specific stimulation ex vivo. Moreover, IFN-γ gene hypermethylation and significantly reduced IFN-γ production post LM infection in antigen-non-specific CD8 Tm cells are also observed in pregnant mice or progesterone treated non-pregnant female mice, which is a reversible phenotype following demethylation treatment. Importantly, antigen-non-specific CD8 Tm cells from progesterone treated mice have impaired anti-LM protection when adoptive transferred in either pregnant wild type mice or IFN-γ-deficient mice, and demethylation treatment rescues the adoptive protection of such CD8 Tm cells. These data demonstrate that increased progesterone impairs immune protective functions of antigen-non-specific CD8 Tm cells via inducing IFN-γ gene hypermethylation. Our findings thus provide insights into a new mechanism through which increased female sex hormone regulate CD8 Tm cell functions during pregnancy.

  6. Progesterone impairs antigen-non-specific immune protection by CD8 T memory cells via interferon-γ gene hypermethylation

    PubMed Central

    Yao, Yushi; Li, Hui; Ding, Jie; Xia, Yixin

    2017-01-01

    Pregnant women and animals have increased susceptibility to a variety of intracellular pathogens including Listeria monocytogenes (LM), which has been associated with significantly increased level of sex hormones such as progesterone. CD8 T memory(Tm) cell-mediated antigen-non-specific IFN-γ responses are critically required in the host defense against LM. However, whether and how increased progesterone during pregnancy modulates CD8 Tm cell-mediated antigen-non-specific IFN-γ production and immune protection against LM remain poorly understood. Here we show in pregnant women that increased serum progesterone levels are associated with DNA hypermethylation of IFN-γ gene promoter region and decreased IFN-γ production in CD8 Tm cells upon antigen-non-specific stimulation ex vivo. Moreover, IFN-γ gene hypermethylation and significantly reduced IFN-γ production post LM infection in antigen-non-specific CD8 Tm cells are also observed in pregnant mice or progesterone treated non-pregnant female mice, which is a reversible phenotype following demethylation treatment. Importantly, antigen-non-specific CD8 Tm cells from progesterone treated mice have impaired anti-LM protection when adoptive transferred in either pregnant wild type mice or IFN-γ-deficient mice, and demethylation treatment rescues the adoptive protection of such CD8 Tm cells. These data demonstrate that increased progesterone impairs immune protective functions of antigen-non-specific CD8 Tm cells via inducing IFN-γ gene hypermethylation. Our findings thus provide insights into a new mechanism through which increased female sex hormone regulate CD8 Tm cell functions during pregnancy. PMID:29155896

  7. Impaired NK Cell Responses to Pertussis and H1N1 Influenza Vaccine Antigens in Human Cytomegalovirus-Infected Individuals

    PubMed Central

    Nielsen, Carolyn M.; White, Matthew J.; Bottomley, Christian; Lusa, Chiara; Rodríguez-Galán, Ana; Turner, Scarlett E. G.; Goodier, Martin R.

    2015-01-01

    NK cells contribute to postvaccination immune responses after activation by IL-2 from Ag-specific memory T cells or by cross-linking of the low-affinity IgG receptor, CD16, by Ag–Ab immune complexes. Sensitivity of NK cells to these signals from the adaptive immune system is heterogeneous and influenced by their stage of differentiation. CD56dimCD57+ NK cells are less responsive to IL-2 and produce less IFN-γ in response to T cell–mediated activation than do CD56bright or CD56dimCD57− NK cells. Conversely, NK cell cytotoxicity, as measured by degranulation, is maintained across the CD56dim subsets. Human CMV (HCMV), a highly prevalent herpes virus causing lifelong, usually latent, infections, drives the expansion of the CD56dimCD57+NKG2C+ NK cell population, skewing the NK cell repertoire in favor of cytotoxic responses at the expense of cytokine-driven responses. We hypothesized, therefore, that HCMV seropositivity would be associated with altered NK cell responses to vaccine Ags. In a cross-sectional study of 152 U.K. adults, with HCMV seroprevalence rate of 36%, we find that HCMV seropositivity is associated with lower NK cell IFN-γ production and degranulation after in vitro restimulation with pertussis or H1N1 influenza vaccine Ags. Higher expression of CD57/NKG2C and lower expression of IL-18Rα on NK cells from HCMV seropositive subjects do not fully explain these impaired responses, which are likely the result of multiple receptor–ligand interactions. This study demonstrates for the first time, to our knowledge, that HCMV serostatus influences NK cell contributions to adaptive immunity and raises important questions regarding the impact of HCMV infection on vaccine efficacy. PMID:25855356

  8. CELLS INVOLVED IN THE IMMUNE RESPONSE

    PubMed Central

    Singhal, Sharwan K.; Richter, Maxwell

    1968-01-01

    Cell suspensions of immune rabbit lymph nodes and spleen were capable of undergoing blastogenesis and mitosis and of incorporating tritiated thymidine when maintained in culture with the specific antigen in vitro. They did not respond to other, non-cross-reacting antigens. The blastogenic response obtained with immune lymph node cells could be correlated with the antibody synthesizing capacity of fragment cultures prepared from the same lymph nodes. Cell suspensions of immune bone marrow responded to non-cross-reacting antigens only whereas cell suspensions of immune thymus, sacculus rotundus, and appendix did not respond when exposed to any of the antigens tested. On the other hand, neither fragments nor cell suspensions prepared from lymph nodes, spleen, and thymus of normal, unimmunized rabbits responded with antibody formation and blastogenesis when exposed to any of the antigens. However, normal bone marrow cells responded with marked blastogenesis and tritiated thymidine uptake. The specificity of this in vitro bone marrow response was demonstrated by the fact that the injection of a protein antigen in vivo resulted in the loss of reactivity by the marrow cell to that particular antigen but not to the other, non-cross-reacting antigens. Furthermore, bone marrow cells of tolerant rabbits failed to respond to the specific antigen in vitro. It was also demonstrated that normal bone marrow cells incubated with antigen are capable of forming antibody which could be detected by the fluorescent antibody technique. This response of the bone marrow cells has been localized to the lymphocyte-rich fraction of the bone marrow. It is concluded that the bone marrow lymphocyte, by virtue of its capacity to react with blastogenesis and mitosis and with antibody formation upon initial exposure to the antigen, a capacity not possessed by lymphocytes of the other lymphoid organs, has a preeminent role in the sequence of cellular events culminating in antibody formation. PMID

  9. Estradiol and Progesterone Strongly Inhibit the Innate Immune Response of Mononuclear Cells in Newborns ▿

    PubMed Central

    Giannoni, Eric; Guignard, Laurence; Knaup Reymond, Marlies; Perreau, Matthieu; Roth-Kleiner, Matthias; Calandra, Thierry; Roger, Thierry

    2011-01-01

    Newborns are particularly susceptible to bacterial infections due to qualitative and quantitative deficiencies of the neonatal innate immune system. However, the mechanisms underlying these deficiencies are poorly understood. Given that fetuses are exposed to high concentrations of estradiol and progesterone during gestation and at time of delivery, we analyzed the effects of these hormones on the response of neonatal innate immune cells to endotoxin, bacterial lipopeptide, and Escherichia coli and group B Streptococcus, the two most common causes of early-onset neonatal sepsis. Here we show that at concentrations present in umbilical cord blood, estradiol and progesterone are as powerful as hydrocortisone for inhibition of cytokine production by cord blood mononuclear cells (CBMCs) and newborn monocytes. Interestingly, CBMCs and newborn monocytes are more sensitive to the effects of estradiol and progesterone than adult peripheral blood mononuclear cells and monocytes. This increased sensitivity is associated with higher expression levels of estrogen and membrane progesterone receptors but is independent of a downregulation of Toll-like receptor 2 (TLR2), TLR4, and myeloid differentiation primary response gene 88 in newborn cells. Estradiol and progesterone mediate their anti-inflammatory activity through inhibition of the NF-κB pathway but not the mitogen-activated protein kinase pathway in CBMCs. Altogether, these results suggest that elevated umbilical cord blood concentrations of estradiol and progesterone acting on mononuclear cells expressing high levels of steroid receptors contribute to impair innate immune responses in newborns. Therefore, intrauterine exposure to estradiol and progesterone may participate in increasing susceptibility to infection during the neonatal period. PMID:21518785

  10. EVOLUTION OF THE IMMUNE RESPONSE

    PubMed Central

    Papermaster, Ben W.; Condie, Richard M.; Finstad, Joanne; Good, Robert A.

    1964-01-01

    1. The California hagfish, Eptatretus stoutii, seems to be completely lacking in adaptive immunity: it forms no detectable circulating antibody despite intensive stimulation with a range of antigens; it does not show reactivity to old tuberculin following sensitization with BCG; and gives no evidence of homograft immunity. 2. Studies on the sea lamprey, Petromyzon marinus, have been limited to the response to bacteriophage T2 and hemocyanin in small groups of spawning animals. They suggest that the lamprey may have a low degree of immunologic reactivity. 3. One holostean, the bowfin (Amia calva) and the guitarfish (Rhinobatos productus), an elasmobranch, showed a low level of primary response to phage and hemocyanin. The response is slow and antibody levels low. Both the bowfin and the guitarfish showed a vigorous secondary response to phage, but neither showed much enhancement of reactivity to hemocyanin in the secondary response. The bowfin formed precipitating antibody to hemocyanin, but the guitarfish did not. Both hemagglutinating and precipitating antibody to hemocyanin were also observed in the primary response of the black bass. 4. The bowfin was successfully sensitized to Ascaris antigen, and lesions of the delayed type developed after challenge at varying intervals following sensitization. 5. The horned shark (Heterodontus franciscii) regularly cleared hemocyanin from the circulation after both primary and secondary antigenic stimulation, and regularly formed hemagglutinating antibody, but not precipitating antibody, after both primary and secondary stimulation with this antigen. These animals regularly cleared bacteriophage from the circulation after both the primary and secondary stimulation with bacteriophage T2. Significant but small amounts of antibody were produced in a few animals in the primary response, and larger amounts in the responding animals after secondary antigenic stimulation. 6. Studies by starch gel and immunoelectrophoresis show that

  11. Impaired Innate, Humoral, and Cellular Immunity Despite a Take in Smallpox Vaccine Recipients

    PubMed Central

    Kennedy, Richard B.; Poland, Gregory A.; Ovsyannikova, Inna G.; Oberg, Ann L.; Asmann, Yan W.; Grill, Diane E.; Vierkant, Robert A.; Jacobson, Robert M.

    2017-01-01

    Smallpox vaccine is highly effective, inducing protective immunity to smallpox and diseases caused by related orthopoxviruses. Smallpox vaccine efficacy was historically defined by the appearance of a lesion or “take” at the vaccine site, which leaves behind a characteristic scar. Both the take and scar are readily recognizable and were used during the eradication effort to indicate successful vaccination and to categorize individuals as “protected.” However, the development of a typical vaccine take may not equate to the successful development of a robust, protective immune response. In this report, we examined two large (>1,000) cohorts of recipients of either Dryvax® or ACAM2000 using a testing and replication study design and identified subgroups of individuals who had documented vaccine takes, but who failed to develop robust neutralizing antibody titers. Examination of these individuals revealed that they had suboptimal cellular immune responses as well. Further testing indicated these low responders had a diminished innate antiviral gene expression pattern (IFNA1, CXCL10, CXCL11, OASL) upon in vitro stimulation with vaccinia virus, perhaps indicative of a dysregulated innate response. Our results suggest that poor activation of innate antiviral pathways may result in suboptimal immune responses to the smallpox vaccine. These genes and pathways may serve as suitable targets for adjuvants in new attenuated smallpox vaccines and/or effective antiviral therapy targets against poxvirus infections. PMID:27177944

  12. The Immune Response in Measles: Virus Control, Clearance and Protective Immunity.

    PubMed

    Griffin, Diane E

    2016-10-12

    Measles is an acute systemic viral infection with immune system interactions that play essential roles in multiple stages of infection and disease. Measles virus (MeV) infection does not induce type 1 interferons, but leads to production of cytokines and chemokines associated with nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB) signaling and activation of the NACHT, LRR and PYD domains-containing protein (NLRP3) inflammasome. This restricted response allows extensive virus replication and spread during a clinically silent latent period of 10-14 days. The first appearance of the disease is a 2-3 day prodrome of fever, runny nose, cough, and conjunctivitis that is followed by a characteristic maculopapular rash that spreads from the face and trunk to the extremities. The rash is a manifestation of the MeV-specific type 1 CD4⁺ and CD8⁺ T cell adaptive immune response with lymphocyte infiltration into tissue sites of MeV replication and coincides with clearance of infectious virus. However, clearance of viral RNA from blood and tissues occurs over weeks to months after resolution of the rash and is associated with a period of immunosuppression. However, during viral RNA clearance, MeV-specific antibody also matures in type and avidity and T cell functions evolve from type 1 to type 2 and 17 responses that promote B cell development. Recovery is associated with sustained levels of neutralizing antibody and life-long protective immunity.

  13. The host immune response to Clostridium difficile infection

    PubMed Central

    2013-01-01

    Clostridium difficile infection (CDI) is the most common infectious cause of healthcare-acquired diarrhoea. Outcomes of C. difficile colonization are varied, from asymptomatic carriage to fulminant colitis and death, due in part to the interplay between the pathogenic virulence factors of the bacterium and the counteractive immune responses of the host. Secreted toxins A and B are the major virulence factors of C. difficile and induce a profound inflammatory response by intoxicating intestinal epithelial cells causing proinflammatory cytokine release. Host cell necrosis, vascular permeability and neutrophil infiltration lead to an elevated white cell count, profuse diarrhoea and in severe cases, dehydration, hypoalbuminaemia and toxic megacolon. Other bacterial virulence factors, including surface layer proteins and flagella proteins, are detected by host cell surface signal molecules that trigger downstream cell-mediated immune pathways. Human studies have identified a role for serum and faecal immunoglobulin levels in protection from disease, but the recent development of a mouse model of CDI has enabled studies into the precise molecular interactions that trigger the immune response during infection. Key effector molecules have been identified that can drive towards a protective anti-inflammatory response or a damaging proinflammatory response. The limitations of current antimicrobial therapies for CDI have led to the development of both active and passive immunotherapies, none of which have, as yet been formally approved for CDI. However, recent advances in our understanding of the molecular basis of host immune protection against CDI may provide an exciting opportunity for novel therapeutic developments in the future. PMID:25165542

  14. Human leucocyte antigen (HLA-DR) gene expression is reduced in sepsis and correlates with impaired TNFα response: A diagnostic tool for immunosuppression?

    PubMed Central

    Winkler, Martin Sebastian; Rissiek, Anne; Priefler, Marion; Schwedhelm, Edzard; Robbe, Linda; Bauer, Antonia; Zahrte, Corinne; Zoellner, Christian; Kluge, Stefan; Nierhaus, Axel

    2017-01-01

    Background Sepsis is defined as a dysregulated immune response to infection. Impaired immune response in sepsis, often described as endotoxin tolerance, is characterized by unresponsiveness of monocytes on lipopolysaccharide (LPS) stimulation to release tumor necrosis factor α (TNFα). Furthermore, decreased monocyte surface protein expression of human leucocyte antigen DR (HLA-DR) is a marker for changes of the innate immune response during sepsis. Quantitative polymerase chain reaction (qPCR) and flow-cytometry (FACS) have been used to measure protein or gene expression of HLA-DR. We aimed to determine whether changes in mRNA expression of HLA-DR are associated with impaired TNFα response in human sepsis. Methods Surface protein together with mRNA expression of HLA-DR were measured by FACS and qPCR in a cohort of 9 sepsis patients and compared to 10 pre-operative control patients in a prospective study. In addition, 20 patients with post-surgical inflammation, 20 patients with sepsis or septic shock were included and TNFα was determined following ex vivo stimulation of whole blood with 500 pg/mL LPS. Total RNA was prepared from whole blood and subjected to qPCR analysis for expression analysis of HLA-DR alpha (HLA-DRA) to correlate TNFα response with HLA-DRA expression. Results Patients with sepsis presented higher numbers of monocytes in peripheral blood (P<0.001) but decreased surface protein and mRNA HLA-DR levels when compared to controls. In all patients mRNA expression of HLA-DRA was decreased by approximately 70% compared to controls (P<0.01) and was lowest in patients with sepsis or septic shock (P<0.01). TNFα response to LPS was decreased in all patients (median 319 pg/mL versus controls 1256 pg/mL; P<0.01) and lowest in patients with sepsis or septic shock (median 128 pg/mL; P<0.01). HLA-DRA correlated positively with TNFα response in all study participants (r +0.60, P<0.001) and within patients (r +0.67, P<0.001). The TNFα:HLA-DRA ratio

  15. Intravital imaging of cutaneous immune responses.

    PubMed

    Nakamizo, Satoshi; Egawa, Gyohei; Bing, Jasmine Tan Kah; Kabashima, Kenji

    2018-05-25

    Various immune cells are present in the skin and modulate the cutaneous immune response. In order to capture such dynamic phenomena, intravital imaging is an important technique and there is a possibility to provide substantial information that is not available using conventional histological analysis. Multiphoton microscope enable direct, three-dimensional, minimally invasive imaging of biological samples with high spatiotemporal resolution, and now become the main method for intravital imaging studies. Here, we will introduce the latest knowledge obtained by intravital imaging of the skin. Copyright © 2018 Elsevier Inc. All rights reserved.

  16. Role of MicroRNAs in Obesity-Induced Metabolic Disorder and Immune Response.

    PubMed

    Zhong, Hong; Ma, Minjuan; Liang, Tingming; Guo, Li

    2018-01-01

    In all living organisms, metabolic homeostasis and the immune system are the most fundamental requirements for survival. Recently, obesity has become a global public health issue, which is the cardinal risk factor for metabolic disorder. Many diseases emanating from obesity-induced metabolic dysfunction are responsible for the activated immune system, including innate and adaptive responses. Of note, inflammation is the manifest accountant signal. Deeply studied microRNAs (miRNAs) have participated in many pathways involved in metabolism and immune responses to protect cells from multiple harmful stimulants, and they play an important role in determining the progress through targeting different inflammatory pathways. Thus, immune response and metabolic regulation are highly integrated with miRNAs. Collectively, miRNAs are the new targets for therapy in immune dysfunction.

  17. Characterization of the immune response of domestic fowl following immunization with proteins extracted from Dermanyssus gallinae.

    PubMed

    Harrington, David; Din, Hatem Mohi El; Guy, Jonathan; Robinson, Karen; Sparagano, Olivier

    2009-03-23

    Dermanyssus gallinae is the most significant ectoparasite of European poultry egg laying production systems due to high costs of control and associated production losses as well as adverse effects on bird welfare. In this study, soluble proteins were extracted from unfed D. gallinae (DGE) using a urea-based detergent and ultra-filtration, passed through a 0.22 microm filter and blended aseptically with adjuvant. One group of laying hens was immunized with DGE and adjuvant (Montanide ISA 50 V) whilst another group (Control) received physiological saline and adjuvant. All birds were immunized on two occasions, 21 days apart. Antibody response to immunization was determined by ELISA and western blotting using immunoglobulins (Igs) extracted from egg yolk. DGE immunization of hens resulted in a significant (P<0.05) IgY response compared to controls, although there was no significant difference in IgM response between treatments. A number of proteins were identified by western blotting using IgY antibodies from DGE immunized birds, most prominently at 40 and 230kDa. Analysis of proteins from approximately corresponding bands on SDS-PAGE confirmed the identity of tropomyosin, whilst other proteins showed high sequence homology with myosin and actin from other arachnid and insect species. Immunization of hens with DGE resulted in a 50.6% increase in mite mortality (P<0.001) 17h after feeding when tested by an in vitro mite feeding model. Data in this study demonstrate that somatic antigens from D. gallinae can be used to stimulate a protective immune response in laying hens. Further work is needed to identify other proteins of interest that could confer higher protection against D. gallinae, as well as optimization of the vaccination and in vitro testing protocol.

  18. Interplay of parasite-driven immune responses and autoimmunity.

    PubMed

    Zaccone, Paola; Burton, Oliver T; Cooke, Anne

    2008-01-01

    As more facts emerge regarding the ways in which parasite-derived molecules modulate the host immune response, it is possible to envisage how a lack of infection by agents that once infected humans commonly might contribute to the rise in autoimmune disease. Through effects on cells of both the innate and adaptive arms of the immune response, parasites can orchestrate a range of outcomes that are beneficial not only to parasites, in terms of facilitating their life cycles, but also to their host, in limiting pathology.

  19. Inbreeding effects on immune response in free-living song sparrows (Melospiza melodia).

    PubMed

    Reid, Jane M; Arcese, Peter; Keller, Lukas F; Elliott, Kyle H; Sampson, Laura; Hasselquist, Dennis

    2007-03-07

    The consequences of inbreeding for host immunity to parasitic infection have broad implications for the evolutionary and dynamical impacts of parasites on populations where inbreeding occurs. To rigorously assess the magnitude and the prevalence of inbreeding effects on immunity, multiple components of host immune response should be related to inbreeding coefficient (f) in free-living individuals. We used a pedigreed, free-living population of song sparrows (Melospiza melodia) to test whether individual responses to widely used experimental immune challenges varied consistently with f. The patagial swelling response to phytohaemagglutinin declined markedly with f in both females and males in both 2002 and 2003, although overall inbreeding depression was greater in males. The primary antibody response to tetanus toxoid declined with f in females but not in males in both 2004 and 2005. Primary antibody responses to diphtheria toxoid were low but tended to decline with f in 2004. Overall inbreeding depression did not solely reflect particularly strong immune responses in outbred offspring of immigrant-native pairings or weak responses in highly inbred individuals. These data indicate substantial and apparently sex-specific inbreeding effects on immune response, implying that inbred hosts may be relatively susceptible to parasitic infection to differing degrees in males and females.

  20. Anti-tumor immune response after photodynamic therapy

    NASA Astrophysics Data System (ADS)

    Mroz, Pawel; Castano, Ana P.; Wu, Mei X.; Kung, Andrew L.; Hamblin, Michael R.

    2009-06-01

    Anti-tumor immunity is stimulated after PDT due a number of factors including: the acute inflammatory response caused by PDT, release of antigens from PDT-damaged tumor cells, priming of the adaptive immune system to recognize tumor-associated antigens (TAA), and induction of heat-shock proteins. The induction of specific CD8+ T-lymphocyte cells that recognize major histocompatibility complex class I (MHC-I) restricted epitopes of TAAs is a highly desirable goal in cancer therapy as it would allow the treatment of tumors that may have already metastasized. The PDT killed tumor cells may be phagocytosed by dendritic cells (DC) that then migrate to draining lymph nodes and prime naÃve T-cells that recognize TAA epitopes. We have carried out in vivo PDT with a BPD-mediated vascular regimen using a pair of BALB/c mouse colon carcinomas: CT26 wild type expressing the naturally occurring retroviral antigen gp70 and CT26.CL25 additionally expressing beta-galactosidase (b-gal) as a model tumor rejection antigen. PDT of CT26.CL25 cured 100% of tumors but none of the CT26WT tumors (all recurred). Cured CT26.CL25 mice were resistant to rechallenge. Moreover mice with two bilateral CT26.CL25 tumors that had only one treated with PDT demonstrated spontaneous regression of 70% of untreated contralateral tumors. T-lymphocytes were isolated from lymph nodes of PDT cured mice that recognized a particular peptide specific to b-gal antigen. T-lymphocytes from LN were able to kill CT26.CL25 target cells in vitro but not CT26WT cells as shown by a chromium release assay. CT26.CL25 tumors treated with PDT and removed five days later had higher levels of Th1 cytokines than CT26 WT tumors showing a higher level of immune response. When mice bearing CT26WT tumors were treated with a regimen of low dose cyclophosphamide (CY) 2 days before, PDT led to 100% of cures (versus 0% without CY) and resistance to rechallenge. Low dose CY is thought to deplete regulatory T-cells (Treg, CD4+CD25+foxp

  1. Innate immune memory: implications for development of pediatric immunomodulatory agents and adjuvanted vaccines

    PubMed Central

    Levy, Ofer; Netea, Mihai G.

    2014-01-01

    Unique features of immunity early in life include a distinct immune system particularly reliant on innate immunity, with weak T helper (Th)1-polarizing immune responses, and impaired responses to certain vaccines leading to a heightened susceptibility to infection. To these important aspects, we now add an increasingly appreciated concept that the innate immune system displays epigenetic memory of an earlier infection or vaccination, a phenomenon that has been named “trained immunity”. Exposure of neonatal leukocytes in vitro or neonatal animals or humans in vivo to specific innate immune stimuli results in an altered innate immune set point. Given the particular importance of innate immunity early in life, trained immunity to early life infection and/or immunization may play an important role in modulating both acute and chronic diseases. PMID:24352476

  2. Radiation-induced immune responses: mechanisms and therapeutic perspectives.

    PubMed

    Jeong, Hoibin; Bok, Seoyeon; Hong, Beom-Ju; Choi, Hyung-Seok; Ahn, G-One

    2016-09-01

    Recent advancement in the radiotherapy technology has allowed conformal delivery of high doses of ionizing radiation precisely to the tumors while sparing large volume of the normal tissues, which have led to better clinical responses. Despite this technological advancement many advanced tumors often recur and they do so within the previously irradiated regions. How could tumors recur after receiving such high ablative doses of radiation? In this review, we outlined how radiation can elicit anti-tumor responses by introducing some of the cytokines that can be induced by ionizing radiation. We then discuss how tumor hypoxia, a major limiting factor responsible for failure of radiotherapy, may also negatively impact the anti-tumor responses. In addition, we highlight how there may be other populations of immune cells including regulatory T cells (Tregs), myeloid-derived suppressor cells (MDSCs), and tumor-associated macrophages (TAMs) that can be recruited to tumors interfering with the anti-tumor immunity. Finally, the impact of irradiation on tumor hypoxia and the immune responses according to different radiotherapy regimen is also delineated. It is indeed an exciting time to see that radiotherapy is being combined with immunotherapy in the clinic and we hope that this review can add an excitement to the field.

  3. Dynamics of delayed pathogen infection models with pathogenic and cellular infections and immune impairment

    NASA Astrophysics Data System (ADS)

    Elaiw, A. M.; Raezah, A. A.; Alofi, B. S.

    2018-02-01

    We study the global dynamics of delayed pathogen infection models with immune impairment. Both pathogen-to-susceptible and infected-to-susceptible transmissions have been considered. Bilinear and saturated incidence rates are considered in the first and second model, respectively. We drive the basic reproduction parameter R0 which determines the global dynamics of models. Using Lyapunov method, we established the global stability of the models' steady states. The theoretical results are confirmed by numerical simulations.

  4. The role of dehydroepiandrosterone on functional innate immune responses to acute stress.

    PubMed

    Prall, Sean P; Larson, Emilee E; Muehlenbein, Michael P

    2017-12-01

    The androgen dehydroepiandrosterone (DHEA) responds to stress activation, exhibits anti-glucocorticoid properties, and modulates immunity in diverse ways, yet little is known of its role in acute stress responses. In this study, the effects of DHEA and its sulfate ester DHEA-S on human male immune function during exposure to an acute stressor is explored. Variation in DHEA, DHEA-S, testosterone, and cortisol, along with bacterial killing assays, was measured in response to a modified Trier Social Stress test in 27 young adult males. Cortisol was positively related to salivary innate immunity but only for participants who also exhibited high DHEA responses. Additionally, DHEA positively and DHEA-S negatively predicted salivary immunity, but the opposite was observed for serum-based innate immunity. The DHEA response to acute stress appears to be an important factor in stress-mediated immunological responses, with differential effects on immunity dependent upon the presence of other hormones, primarily cortisol and DHEA-S. These results suggest that DHEA plays an important role, alongside other hormones, in modulating immunological shifts during acute stress. Copyright © 2017 John Wiley & Sons, Ltd.

  5. RNA-Seq Reveals an Integrated Immune Response in Nucleated Erythrocytes

    PubMed Central

    Morera, Davinia; Roher, Nerea; Ribas, Laia; Balasch, Joan Carles; Doñate, Carmen; Callol, Agnes; Boltaña, Sebastian; Roberts, Steven; Goetz, Giles; Goetz, Frederick W.; MacKenzie, Simon A.

    2011-01-01

    Background Throughout the primary literature and within textbooks, the erythrocyte has been tacitly accepted to have maintained a unique physiological role; namely gas transport and exchange. In non-mammalian vertebrates, nucleated erythrocytes are present in circulation throughout the life cycle and a fragmented series of observations in mammals support a potential role in non-respiratory biological processes. We hypothesised that nucleated erythrocytes could actively participate via ligand-induced transcriptional re-programming in the immune response. Methodology/Principal Findings Nucleated erythrocytes from both fish and birds express and regulate specific pattern recognition receptor (PRR) mRNAs and, thus, are capable of specific pathogen associated molecular pattern (PAMP) detection that is central to the innate immune response. In vitro challenge with diverse PAMPs led to de novo specific mRNA synthesis of both receptors and response factors including interferon-alpha (IFNα) that exhibit a stimulus-specific polysomal shift supporting active translation. RNA-Seq analysis of the PAMP (Poly (I∶C), polyinosinic∶polycytidylic acid)-erythrocyte response uncovered diverse cohorts of differentially expressed mRNA transcripts related to multiple physiological systems including the endocrine, reproductive and immune. Moreover, erythrocyte-derived conditioned mediums induced a type-1 interferon response in macrophages thus supporting an integrative role for the erythrocytes in the immune response. Conclusions/Significance We demonstrate that nucleated erythrocytes in non-mammalian vertebrates spanning significant phylogenetic distance participate in the immune response. RNA-Seq studies highlight a mRNA repertoire that suggests a previously unrecognized integrative role for the erythrocytes in other physiological systems. PMID:22046430

  6. Role of MicroRNAs in Obesity-Induced Metabolic Disorder and Immune Response

    PubMed Central

    Zhong, Hong; Ma, Minjuan

    2018-01-01

    In all living organisms, metabolic homeostasis and the immune system are the most fundamental requirements for survival. Recently, obesity has become a global public health issue, which is the cardinal risk factor for metabolic disorder. Many diseases emanating from obesity-induced metabolic dysfunction are responsible for the activated immune system, including innate and adaptive responses. Of note, inflammation is the manifest accountant signal. Deeply studied microRNAs (miRNAs) have participated in many pathways involved in metabolism and immune responses to protect cells from multiple harmful stimulants, and they play an important role in determining the progress through targeting different inflammatory pathways. Thus, immune response and metabolic regulation are highly integrated with miRNAs. Collectively, miRNAs are the new targets for therapy in immune dysfunction. PMID:29484304

  7. Activating PIK3CD mutations impair human cytotoxic lymphocyte differentiation, function and EBV immunity.

    PubMed

    Edwards, Emily S J; Bier, Julia; Cole, Theresa S; Wong, Melanie; Hsu, Peter; Berglund, Lucinda J; Boztug, Kaan; Lau, Anthony; Gostick, Emma; Price, David A; O'Sullivan, Michael; Meyts, Isabelle; Choo, Sharon; Gray, Paul; Holland, Steven M; Deenick, Elissa K; Uzel, Gulbu; Tangye, Stuart G

    2018-05-22

    Germline gain-of function (GOF) mutations in PIK3CD, encoding the catalytic p110δ subunit of phosphatidylinositol-3 kinase, result in hyperactivation of the PI3K-AKT-mTOR pathway and underlie a novel inborn error of immunity. Affected individuals exhibit perturbed humoral and cellular immunity, manifesting as recurrent infections, autoimmunity, hepatosplenomegaly, uncontrolled EBV and/or CMV infection, and an increased incidence of B-cell lymphoproliferation and/or lymphoma. Mechanisms underlying disease pathogenesis remain unknown. Understanding the cellular and molecular mechanisms underpinning inefficient surveillance of EBV-infected B cells is required to understand disease in individuals with PIK3CD GOF mutations, identify key molecules required for cell mediated immunity against EBV, and develop immunotherapeutic interventions for the treatment of this as well as other EBV-opathies. We studied the consequences of PIK3CD GOF mutations on the generation, differentiation and function of CD8 + T cells and NK cells, which are implicated in host defense against infection with herpesviruses including EBV. PIK3CD GOF total and EBV-specific CD8 + T cells were skewed towards an effector phenotype, with exaggerated expression of markers associated with premature immunosenescence/exhaustion, and increased susceptibility to re-activation induced cell death. These findings were recapitulated in a novel mouse model of PI3K GOF. NK cells in PIK3CD GOF individuals also exhibited perturbed expression of differentiation-associated molecules. Both CD8 + T cells and NK cells had reduced capacity to kill EBV-infected B cells. PIK3CD GOF B cells had increased expression of CD48, PDL-1/2 and CD70. PIK3CD GOF mutations aberrantly induce exhaustion and/or senescence and impair cytotoxicity of CD8+ T and NK cells. These defects may contribute to clinical features of affected individuals, such as impaired immunity to herpesviruses and tumor surveillance. Copyright © 2018. Published by

  8. Role of muscarinic receptors in the regulation of immune and inflammatory responses

    PubMed Central

    Razani-Boroujerdi, Seddigheh; Behl, Muskaan; Hahn, Fletcher F.; Pena-Philippides, Juan Carlos; Hutt, Julie; Sopori, Mohan L.

    2008-01-01

    Leukocytes contain both nicotinic and muscarinic receptors, and while activation of nicotinic receptors suppresses immune/inflammatory responses, the role of muscarinic receptors in immunity is unclear. We examined the effects of a muscarinic receptor antagonist (atropine) and agonist (oxotremorine), administered chronically through miniosmotic pumps, on immune/inflammatory responses in the rat. Results show that while oxotremorine stimulated, atropine inhibited the antibody and T-cell proliferative responses. Moreover, atropine also suppressed the turpentine-induced leukocytic infiltration and tissue injury, and inhibited chemotaxis of leukocytes toward neutrophil and monocyte/lymphocyte chemoattractants. Thus, activation of nicotinic and muscarinic receptors has opposite effects on the immune/inflammatory responses. PMID:18190972

  9. Immune-mediated steroid-responsive epileptic spasms and epileptic encephalopathy associated with VGKC-complex antibodies.

    PubMed

    Suleiman, Jehan; Brenner, Tanja; Gill, Deepak; Troedson, Christopher; Sinclair, Adriane J; Brilot, Fabienne; Vincent, Angela; Lang, Bethan; Dale, Russell C

    2011-11-01

    Autoantibodies that bind to voltage-gated potassium-channel complex proteins (VGKC-complex antibodies) occur frequently in adults with limbic encephalitis presenting with cognitive impairment and seizures. Recently, VGKC-complex antibodies have been described in a few children with limbic encephalitis, and children with unexplained encephalitis presenting with status epilepticus. We report a case of infantile-onset epileptic spasms and developmental delay compatible with epileptic encephalopathy. Our patient was a female infant, aged 4 months at presentation. She had evidence of immune activation in the central nervous system with elevated cerebrospinal fluid neopterin and mirrored oligoclonal bands, which prompted testing for autoantibodies. VGKC-complex antibodies were elevated (201 pmol/L, normal<100), but extended antibody testing, including leucine-rich glioma-inactivated 1 (LGI1) and contactin-associated protein 2 (CASPR2), was negative. The patient showed a partial response to steroid treatment, which was started late in the disease course. On review at 13 months of age, her development was consistent with an age of 5 to 6 months. These results suggest that VGKC-complex antibodies might represent a marker of immune therapy responsiveness in a subgroup of patients with infantile epileptic encephalopathy. © The Authors. Developmental Medicine & Child Neurology © 2011 Mac Keith Press.

  10. A comparative study of an innate immune response in Lamprologine cichlid fishes.

    PubMed

    O'Connor, Constance M; Reddon, Adam R; Marsh-Rollo, Susan E; Hellmann, Jennifer K; Ligocki, Isaac Y; Hamilton, Ian M; Balshine, Sigal

    2014-10-01

    Social interactions facilitate pathogen transmission and increase virulence. Therefore, species that live in social groups are predicted to suffer a higher pathogen burden, to invest more heavily in immune defence against pathogens, or both. However, there are few empirical tests of whether social species indeed invest more heavily in immune defence than non-social species. In the current study, we conducted a phylogenetically controlled comparison of innate immune response in Lamprologine cichlid fishes. We focused on three species of highly social cichlids that live in permanent groups and exhibit cooperative breeding (Julidochromis ornatus, Neolamprologus pulcher and Neolamprologus savoryi) and three species of non-social cichlids that exhibit neither grouping nor cooperative behaviour (Telmatochromis temporalis, Neolamprologus tetracanthus and Neolamprologus modestus). We quantified the innate immune response by injecting wild fishes with phytohaemagglutinin (PHA), a lectin that causes a cell-mediated immune response. We predicted that the three highly social species would show a greater immune reaction to the PHA treatment, indicating higher investment in immune defence against parasites relative to the three non-social species. We found significant species-level variation in immune response, but contrary to our prediction, this variation did not correspond to social system. However, we found that immune response was correlated with territory size across the six species. Our results indicate that the common assumption of a positive relationship between social system and investment in immune function may be overly simplistic. We suggest that factors such as rates of both in-group and out-group social interactions are likely to be important mediators of the relationship between sociality and immune function.

  11. A comparative study of an innate immune response in Lamprologine cichlid fishes

    NASA Astrophysics Data System (ADS)

    O'Connor, Constance M.; Reddon, Adam R.; Marsh-Rollo, Susan E.; Hellmann, Jennifer K.; Ligocki, Isaac Y.; Hamilton, Ian M.; Balshine, Sigal

    2014-10-01

    Social interactions facilitate pathogen transmission and increase virulence. Therefore, species that live in social groups are predicted to suffer a higher pathogen burden, to invest more heavily in immune defence against pathogens, or both. However, there are few empirical tests of whether social species indeed invest more heavily in immune defence than non-social species. In the current study, we conducted a phylogenetically controlled comparison of innate immune response in Lamprologine cichlid fishes. We focused on three species of highly social cichlids that live in permanent groups and exhibit cooperative breeding ( Julidochromis ornatus, Neolamprologus pulcher and Neolamprologus savoryi) and three species of non-social cichlids that exhibit neither grouping nor cooperative behaviour ( Telmatochromis temporalis, Neolamprologus tetracanthus and Neolamprologus modestus). We quantified the innate immune response by injecting wild fishes with phytohaemagglutinin (PHA), a lectin that causes a cell-mediated immune response. We predicted that the three highly social species would show a greater immune reaction to the PHA treatment, indicating higher investment in immune defence against parasites relative to the three non-social species. We found significant species-level variation in immune response, but contrary to our prediction, this variation did not correspond to social system. However, we found that immune response was correlated with territory size across the six species. Our results indicate that the common assumption of a positive relationship between social system and investment in immune function may be overly simplistic. We suggest that factors such as rates of both in-group and out-group social interactions are likely to be important mediators of the relationship between sociality and immune function.

  12. Immune response to measles vaccine in Peruvian children.

    PubMed Central

    Bautista-López, N. L.; Vaisberg, A.; Kanashiro, R.; Hernández, H.; Ward, B. J.

    2001-01-01

    OBJECTIVE: To evaluate the immune response in Peruvian children following measles vaccination. METHODS: Fifty-five Peruvian children received Schwarz measles vaccine (about 10(3) plaque forming units) at about 9 months of age. Blood samples were taken before vaccination, then twice after vaccination: one sample at between 1 and 4 weeks after vaccination and the final sample 3 months post vaccination for evaluation of immune cell phenotype and lymphoproliferative responses to measles and non-measles antigens. Measles-specific antibodies were measured by plaque reduction neutralization. FINDINGS: The humoral response developed rapidly after vaccination; only 4 of the 55 children (7%) had plaque reduction neutralization titres <200 mlU/ml 3 months after vaccination. However, only 8 out of 35 children tested (23%) had lymphoproliferative responses to measles antigens 3-4 weeks after vaccination. Children with poor lymphoproliferative responses to measles antigens had readily detectable lymphoproliferative responses to other antigens. Flow cytometric analysis of peripheral blood mononuclear cells revealed diffuse immune system activation at the time of vaccination in most children. The capacity to mount a lymphoproliferative response to measles antigens was associated with expression of CD45RO on CD4+ T-cells. CONCLUSION: The 55 Peruvian children had excellent antibody responses after measles vaccination, but only 23% (8 out of 35) generated detectable lymphoproliferative responses to measles antigens (compared with 55-67% in children in the industrialized world). This difference may contribute to the less than uniform success of measles vaccination programmes in the developing world. PMID:11731811

  13. Impaired innate, humoral, and cellular immunity despite a take in smallpox vaccine recipients.

    PubMed

    Kennedy, Richard B; Poland, Gregory A; Ovsyannikova, Inna G; Oberg, Ann L; Asmann, Yan W; Grill, Diane E; Vierkant, Robert A; Jacobson, Robert M

    2016-06-14

    Smallpox vaccine is highly effective, inducing protective immunity to smallpox and diseases caused by related orthopoxviruses. Smallpox vaccine efficacy was historically defined by the appearance of a lesion or "take" at the vaccine site, which leaves behind a characteristic scar. Both the take and scar are readily recognizable and were used during the eradication effort to indicate successful vaccination and to categorize individuals as "protected." However, the development of a typical vaccine take may not equate to the successful development of a robust, protective immune response. In this report, we examined two large (>1000) cohorts of recipients of either Dryvax(®) or ACAM2000 using a testing and replication study design and identified subgroups of individuals who had documented vaccine takes, but who failed to develop robust neutralizing antibody titers. Examination of these individuals revealed that they had suboptimal cellular immune responses as well. Further testing indicated these low responders had a diminished innate antiviral gene expression pattern (IFNA1, CXCL10, CXCL11, OASL) upon in vitro stimulation with vaccinia virus, perhaps indicative of a dysregulated innate response. Our results suggest that poor activation of innate antiviral pathways may result in suboptimal immune responses to the smallpox vaccine. These genes and pathways may serve as suitable targets for adjuvants in new attenuated smallpox vaccines and/or effective antiviral therapy targets against poxvirus infections. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. The host immune response to gastrointestinal nematode infection in sheep.

    PubMed

    McRae, K M; Stear, M J; Good, B; Keane, O M

    2015-12-01

    Gastrointestinal nematode infection represents a major threat to the health, welfare and productivity of sheep populations worldwide. Infected lambs have a reduced ability to absorb nutrients from the gastrointestinal tract, resulting in morbidity and occasional mortality. The current chemo-dominant approach to nematode control is considered unsustainable due to the increasing incidence of anthelmintic resistance. In addition, there is growing consumer demand for food products from animals not subjected to chemical treatment. Future mechanisms of nematode control must rely on alternative, sustainable strategies such as vaccination or selective breeding of resistant animals. Such strategies take advantage of the host's natural immune response to nematodes. The ability to resist gastrointestinal nematode infection is considered to be dependent on the development of a protective acquired immune response, although the precise immune mechanisms involved in initiating this process remain to be fully elucidated. In this study, current knowledge on the innate and acquired host immune response to gastrointestinal nematode infection in sheep and the development of immunity is reviewed. © 2015 John Wiley & Sons Ltd.

  15. [Bone marrow stromal damage mediated by immune response activity].

    PubMed

    Vojinović, J; Kamenov, B; Najman, S; Branković, Lj; Dimitrijević, H

    1994-01-01

    The aim of this work was to estimate influence of activated immune response on hematopoiesis in vitro, using the experimental model of BCG immunized BALB/c mice and in patients with chronic immunoactivation: long-lasting infections, autoimmunity or malignancy. We correlated changes in long term bone marrow cultures (Dexter) and NBT reduction with appearance of anemia in patients and experimental model of immunization by BCG. Increased spontaneous NBT reduction pointed out role of macrophage activation in bone marrow stroma damage. Long-term bone marrow cultures showed reduced number of hematopoietic cells, with predomination of fibroblasts and loss of fat cells. This results correlated with anemia and leucocytosis with stimulated myelopoiesis in peripheral blood. Activation of immune response, or acting of any agent that directly changes extracellular matrix and cellularity of bone marrow, may result in microenviroment bone marrow damage that modify hematopoiesis.

  16. Glucocorticoids mediate stress-induced impairment of retrieval of stimulus-response memory.

    PubMed

    Atsak, Piray; Guenzel, Friederike M; Kantar-Gok, Deniz; Zalachoras, Ioannis; Yargicoglu, Piraye; Meijer, Onno C; Quirarte, Gina L; Wolf, Oliver T; Schwabe, Lars; Roozendaal, Benno

    2016-05-01

    Acute stress and elevated glucocorticoid hormone levels are well known to impair the retrieval of hippocampus-dependent 'declarative' memory. Recent findings suggest that stress might also impair the retrieval of non-hippocampal memories. In particular, stress shortly before retention testing was shown to impair the retrieval of striatal stimulus-response associations in humans. However, the mechanism underlying this stress-induced retrieval impairment of non-hippocampal stimulus-response memory remains elusive. In the present study, we investigated whether an acute elevation in glucocorticoid levels mediates the impairing effects of stress on retrieval of stimulus-response memory. Male Sprague-Dawley rats were trained on a stimulus-response task in an eight-arm radial maze until they learned to associate a stimulus, i.e., cue, with a food reward in one of the arms. Twenty-four hours after successful acquisition, they received a systemic injection of vehicle, corticosterone (1mg/kg), the corticosterone-synthesis inhibitor metyrapone (35mg/kg) or were left untreated 1h before retention testing. We found that the corticosterone injection impaired the retrieval of stimulus-response memory. We further found that the systemic injection procedure per se was stressful as the vehicle administration also increased plasma corticosterone levels and impaired the retrieval of stimulus-response memory. However, memory retrieval was not impaired when rats were tested 2min after the systemic vehicle injection, before any stress-induced elevation in corticosterone levels had occurred. Moreover, metyrapone treatment blocked the effect of injection stress on both plasma corticosterone levels and memory retrieval impairment, indicating that the endogenous corticosterone response mediates the stress-induced memory retrieval impairment. None of the treatments affected rats' locomotor activity or motivation to search for the food reward within the maze. These findings show that stress

  17. The Bidirectional Relationship between Sleep and Immunity against Infections

    PubMed Central

    Ibarra-Coronado, Elizabeth G.; Pantaleón-Martínez, Ana Ma.; Velazquéz-Moctezuma, Javier; Prospéro-García, Oscar; Méndez-Díaz, Mónica; Pérez-Tapia, Mayra; Pavón, Lenin; Morales-Montor, Jorge

    2015-01-01

    Sleep is considered an important modulator of the immune response. Thus, a lack of sleep can weaken immunity, increasing organism susceptibility to infection. For instance, shorter sleep durations are associated with a rise in suffering from the common cold. The function of sleep in altering immune responses must be determined to understand how sleep deprivation increases the susceptibility to viral, bacterial, and parasitic infections. There are several explanations for greater susceptibility to infections after reduced sleep, such as impaired mitogenic proliferation of lymphocytes, decreased HLA-DR expression, the upregulation of CD14+, and variations in CD4+ and CD8+ T lymphocytes, which have been observed during partial sleep deprivation. Also, steroid hormones, in addition to regulating sexual behavior, influence sleep. Thus, we hypothesize that sleep and the immune-endocrine system have a bidirectional relationship in governing various physiological processes, including immunity to infections. This review discusses the evidence on the bidirectional effects of the immune response against viral, bacterial, and parasitic infections on sleep patterns and how the lack of sleep affects the immune response against such agents. Because sleep is essential in the maintenance of homeostasis, these situations must be adapted to elicit changes in sleep patterns and other physiological parameters during the immune response to infections to which the organism is continuously exposed. PMID:26417606

  18. The Bidirectional Relationship between Sleep and Immunity against Infections.

    PubMed

    Ibarra-Coronado, Elizabeth G; Pantaleón-Martínez, Ana Ma; Velazquéz-Moctezuma, Javier; Prospéro-García, Oscar; Méndez-Díaz, Mónica; Pérez-Tapia, Mayra; Pavón, Lenin; Morales-Montor, Jorge

    2015-01-01

    Sleep is considered an important modulator of the immune response. Thus, a lack of sleep can weaken immunity, increasing organism susceptibility to infection. For instance, shorter sleep durations are associated with a rise in suffering from the common cold. The function of sleep in altering immune responses must be determined to understand how sleep deprivation increases the susceptibility to viral, bacterial, and parasitic infections. There are several explanations for greater susceptibility to infections after reduced sleep, such as impaired mitogenic proliferation of lymphocytes, decreased HLA-DR expression, the upregulation of CD14+, and variations in CD4+ and CD8+ T lymphocytes, which have been observed during partial sleep deprivation. Also, steroid hormones, in addition to regulating sexual behavior, influence sleep. Thus, we hypothesize that sleep and the immune-endocrine system have a bidirectional relationship in governing various physiological processes, including immunity to infections. This review discusses the evidence on the bidirectional effects of the immune response against viral, bacterial, and parasitic infections on sleep patterns and how the lack of sleep affects the immune response against such agents. Because sleep is essential in the maintenance of homeostasis, these situations must be adapted to elicit changes in sleep patterns and other physiological parameters during the immune response to infections to which the organism is continuously exposed.

  19. The Lung Immune Response to Nontypeable Haemophilus influenzae (Lung Immunity to NTHi)

    PubMed Central

    King, Paul T.; Sharma, Roleen

    2015-01-01

    Haemophilus influenzae is divided into typeable or nontypeable strains based on the presence or absence of a polysaccharide capsule. The typeable strains (such as type b) are an important cause of systemic infection, whilst the nontypeable strains (designated as NTHi) are predominantly respiratory mucosal pathogens. NTHi is present as part of the normal microbiome in the nasopharynx, from where it may spread down to the lower respiratory tract. In this context it is no longer a commensal and becomes an important respiratory pathogen associated with a range of common conditions including bronchitis, bronchiectasis, pneumonia, and particularly chronic obstructive pulmonary disease. NTHi induces a strong inflammatory response in the respiratory tract with activation of immune responses, which often fail to clear the bacteria from the lung. This results in recurrent/persistent infection and chronic inflammation with consequent lung pathology. This review will summarise the current literature about the lung immune response to nontypeable Haemophilus influenzae, a topic that has important implications for patient management. PMID:26114124

  20. Interactions between negative energy balance, metabolic diseases, uterine health and immune response in transition dairy cows.

    PubMed

    Esposito, Giulia; Irons, Pete C; Webb, Edward C; Chapwanya, Aspinas

    2014-01-30

    The biological cycles of milk production and reproduction determine dairying profitability thus making management decisions dynamic and time-dependent. Diseases also negatively impact on net earnings of a dairy enterprise. Transition cows in particular face the challenge of negative energy balance (NEB) and/or disproportional energy metabolism (fatty liver, ketosis, subacute, acute ruminal acidosis); disturbed mineral utilization (milk fever, sub-clinical hypocalcemia); and perturbed immune function (retained placenta, metritis, mastitis). Consequently NEB and reduced dry matter intake are aggravated. The combined effects of all these challenges are reduced fertility and milk production resulting in diminishing profits. Risk factors such as NEB, inflammation and impairment of the immune response are highly cause-and-effect related. Thus, managing cows during the transition period should be geared toward reducing NEB or feeding specially formulated diets to improve immunity. Given that all cows experience a reduced feed intake and body condition, infection and inflammation of the uterus after calving, there is a need for further research on the immunology of transition dairy cows. Integrative approaches at the molecular, cellular and animal level may unravel the complex interactions between disturbed metabolism and immune function that predispose cows to periparturient diseases. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Humoral immune responses to Pneumocystis jirovecii antigens in HIV-infected and uninfected young children with pneumocystis pneumonia.

    PubMed

    Djawe, Kpandja; Daly, Kieran R; Levin, Linda; Zar, Heather J; Walzer, Peter D

    2013-01-01

    Humoral immune responses in human immunodeficiency virus (HIV)-infected and uninfected children with Pneumocystis pneumonia (PcP) are poorly understood. Consecutive children hospitalized with acute pneumonia, tachypnea, and hypoxia in South Africa were investigated for PcP, which was diagnosed by real-time polymerase chain reaction on lower respiratory tract specimens. Serum antibody responses to recombinant fragments of the carboxyl terminus of Pneumocystis jirovecii major surface glycoprotein (MsgC) were analyzed. 149 children were enrolled of whom 96 (64%) were HIV-infected. PcP occurred in 69 (72%) of HIV-infected and 14 (26%) of HIV-uninfected children. HIV-infected children with PcP had significantly decreased IgG antibodies to MsgC compared to HIV-infected patients without PcP, but had similar IgM antibodies. In contrast, HIV-uninfected children with PcP showed no change in IgG antibodies to MsgC, but had significantly increased IgM antibodies compared to HIV-uninfected children without PCP. Age was an independent predictor of high IgG antibodies, whereas PcP was a predictor of low IgG antibodies and high IgM antibodies. IgG and IgM antibody levels to the most closely related MsgC fragments were predictors of survival from PcP. Young HIV-infected children with PcP have significantly impaired humoral immune responses to MsgC, whereas HIV-uninfected children with PcP can develop active humoral immune responses. The children also exhibit a complex relationship between specific host factors and antibody levels to MsgC fragments that may be related to survival from PcP.

  2. Radiation induces an antitumour immune response to mouse melanoma.

    PubMed

    Perez, Carmen A; Fu, Allie; Onishko, Halina; Hallahan, Dennis E; Geng, Ling

    2009-12-01

    Irradiation of cancer cells can cause immunogenic death. We used mouse models to determine whether irradiation of melanoma can enhance the host antitumour immune response and function as an effective vaccination strategy, and investigated the molecular mechanisms involved in this radiation-induced response. For in vivo studies, C57BL6/J mice and the B16F0 melanoma cell line were used in a lung metastasis model, intratumoural host immune activation assays, and tumour growth delay studies. In vitro studies included a dendritic cell (DC) phagocytosis assay, detection of cell surface exposure of the protein calreticulin (CRT), and small interfering RNA (siRNA)-mediated depletion of CRT cellular levels. Irradiation of cutaneous melanomas prior to their resection resulted in more than 20-fold reduction in lung metastases after systemic challenge with untreated melanoma cells. A syngeneic vaccine derived from irradiated melanoma cells also induced adaptive immune response markers in irradiated melanoma implants. Our data indicate a trend for radiation-induced increase in melanoma cell surface exposure of CRT, which is involved in the enhanced phagocytic activity of DC against irradiated melanoma cells (VIACUC). The present study suggests that neoadjuvant irradiation of cutaneous melanoma tumours prior to surgical resection can stimulate an endogenous anti-melanoma host immune response.

  3. Dectin-2 Is a C-Type Lectin Receptor that Recognizes Pneumocystis and Participates in Innate Immune Responses.

    PubMed

    Kottom, Theodore J; Hebrink, Deanne M; Jenson, Paige E; Marsolek, Paige L; Wüthrich, Marcel; Wang, Huafeng; Klein, Bruce; Yamasaki, Sho; Limper, Andrew H

    2018-02-01

    Pneumocystis is an important fungal pathogen that causes life-threatening pneumonia in patients with AIDS and malignancy. Lung fungal pathogens are recognized by C-type lectin receptors (CLRs), which bind specific ligands and stimulate innate immune responses. The CLR Dectin-1 was previously shown to mediate immune responses to Pneumocystis spp. For this reason, we investigated a potential role for Dectin-2. Rats with Pneumocystis pneumonia (PCP) exhibited elevated Dectin-2 mRNA levels. Soluble Dectin-2 carbohydrate-recognition domain fusion protein showed binding to intact Pneumocystis carinii (Pc) and to native Pneumocystis major surface glycoprotein/glycoprotein A (Msg/gpA). RAW macrophage cells expressing V5-tagged Dectin-2 displayed enhanced binding to Pc and increased protein tyrosine phosphorylation. Furthermore, the binding of Pc to Dectin-2 resulted in Fc receptor-γ-mediated intracellular signaling. Alveolar macrophages from Dectin-2-deficient mice (Dectin-2 -/- ) showed significant decreases in phospho-Syk activation after challenge with Pc cell wall components. Stimulation of Dectin-2 -/- alveolar macrophages with Pc components showed significant decreases in the proinflammatory cytokines IL-6 and TNF-α. Finally, during infection with Pneumocystis murina, Dectin-2 -/- mice displayed downregulated mRNA expression profiles of other CLRs implicated in fungal immunity. Although Dectin-2 -/- alveolar macrophages had reduced proinflammatory cytokine release in vitro, Dectin-2 -/- deficiency did not reduce the overall resistance of these mice in the PCP model, and organism burdens were statistically similar in the long-term immunocompromised and short-term immunocompetent PCP models. These results suggest that Dectin-2 participates in the initial innate immune signaling response to Pneumocystis, but its deficiency does not impair resistance to the organism.

  4. Ageing and the immune system: focus on macrophages.

    PubMed

    Linehan, E; Fitzgerald, D C

    2015-03-01

    A fully functioning immune system is essential in order to maintain good health. However, the immune system deteriorates with advancing age, and this contributes to increased susceptibility to infection, autoimmunity, and cancer in the older population. Progress has been made in identifying age-related defects in the adaptive immune system. In contrast, relatively little research has been carried out on the impact of ageing on the innate immune response. This area requires further research as the innate immune system plays a crucial role in protection against infection and represents a first line of defence. Macrophages are central effector cells of the innate immune system and have many diverse functions. As a result, age-related impairments in macrophage function are likely to have important consequences for the health of the older population. It has been reported that ageing in macrophages impacts on many processes including toll-like receptor signalling, polarisation, phagocytosis, and wound repair. A detailed understanding of the impact of ageing on macrophages is required in order to develop therapeutics that will boost immune responses in the older population.

  5. The Role of Mitophagy in Innate Immunity

    PubMed Central

    Gkikas, Ilias; Palikaras, Konstantinos; Tavernarakis, Nektarios

    2018-01-01

    Mitochondria are cellular organelles essential for multiple biological processes, including energy production, metabolites biosynthesis, cell death, and immunological responses among others. Recent advances in the field of immunology research reveal the pivotal role of energy metabolism in innate immune cells fate and function. Therefore, the maintenance of mitochondrial network integrity and activity is a prerequisite for immune system homeostasis. Mitochondrial selective autophagy, known as mitophagy, surveils mitochondrial population eliminating superfluous and/or impaired organelles and mediating cellular survival and viability in response to injury/trauma and infection. Defective removal of damaged mitochondria leads to hyperactivation of inflammatory signaling pathways and subsequently to chronic systemic inflammation and development of inflammatory diseases. Here, we review the molecular mechanisms of mitophagy and highlight its critical role in the innate immune system homeostasis.

  6. Blood dendritic cells interact with splenic marginal zone B cells to initiate T-independent immune responses.

    PubMed

    Balázs, Mercedesz; Martin, Flavius; Zhou, Tong; Kearney, John

    2002-09-01

    Marginal zone (MZ) and B1 B lymphocytes participate jointly in the early immune response against T-independent (TI) particulate antigens. Here we show that blood-derived neutrophil granulocytes and CD11c(lo) immature dendritic cells (DC) are the primary cells that efficiently capture and transport particulate bacteria to the spleen. In a systemic infection, CD11c(lo) DC, but not neutrophils, provide critical survival signals, which can be inhibited by TACI-Fc, to antigen-specific MZ B cells and promote their differentiation into IgM-secreting plasmablasts. In a local TI response, peritoneal cavity macrophages provide similar support to B1 B-derived Ag-specific blasts. In the absence of soluble TACI ligands, Ag-activated MZ- and B1-derived blasts lack survival signals and undergo apoptosis, resulting in severely impaired antibody responses.

  7. Adjuvant effects of saponins on animal immune responses*

    PubMed Central

    Rajput, Zahid Iqbal; Hu, Song-hua; Xiao, Chen-wen; Arijo, Abdullah G.

    2007-01-01

    Vaccines require optimal adjuvants including immunopotentiator and delivery systems to offer long term protection from infectious diseases in animals and man. Initially it was believed that adjuvants are responsible for promoting strong and sustainable antibody responses. Now it has been shown that adjuvants influence the isotype and avidity of antibody and also affect the properties of cell-mediated immunity. Mostly oil emulsions, lipopolysaccharides, polymers, saponins, liposomes, cytokines, ISCOMs (immunostimulating complexes), Freund’s complete adjuvant, Freund’s incomplete adjuvant, alums, bacterial toxins etc., are common adjuvants under investigation. Saponin based adjuvants have the ability to stimulate the cell mediated immune system as well as to enhance antibody production and have the advantage that only a low dose is needed for adjuvant activity. In the present study the importance of adjuvants, their role and the effect of saponin in immune system is reviewed. PMID:17323426

  8. Ubiquitin enzymes in the regulation of immune responses.

    PubMed

    Ebner, Petra; Versteeg, Gijs A; Ikeda, Fumiyo

    2017-08-01

    Ubiquitination plays a central role in the regulation of various biological functions including immune responses. Ubiquitination is induced by a cascade of enzymatic reactions by E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme, and E3 ubiquitin ligase, and reversed by deubiquitinases. Depending on the enzymes, specific linkage types of ubiquitin chains are generated or hydrolyzed. Because different linkage types of ubiquitin chains control the fate of the substrate, understanding the regulatory mechanisms of ubiquitin enzymes is central. In this review, we highlight the most recent knowledge of ubiquitination in the immune signaling cascades including the T cell and B cell signaling cascades as well as the TNF signaling cascade regulated by various ubiquitin enzymes. Furthermore, we highlight the TRIM ubiquitin ligase family as one of the examples of critical E3 ubiquitin ligases in the regulation of immune responses.

  9. Increased autophagic sequestration in adaptor protein-3 deficient dendritic cells limits inflammasome activity and impairs antibacterial immunity

    PubMed Central

    Casson, Cierra N.; Lefkovith, Ariel J.

    2017-01-01

    Bacterial pathogens that compromise phagosomal membranes stimulate inflammasome assembly in the cytosol, but the molecular mechanisms by which membrane dynamics regulate inflammasome activity are poorly characterized. We show that in murine dendritic cells (DCs), the endosomal adaptor protein AP-3 –which optimizes toll-like receptor signaling from phagosomes–sustains inflammasome activation by particulate stimuli. AP-3 independently regulates inflammasome positioning and autophagy induction, together resulting in delayed inflammasome inactivation by autophagy in response to Salmonella Typhimurium (STm) and other particulate stimuli specifically in DCs. AP-3-deficient DCs, but not macrophages, hyposecrete IL-1β and IL-18 in response to particulate stimuli in vitro, but caspase-1 and IL-1β levels are restored by silencing autophagy. Concomitantly, AP-3-deficient mice exhibit higher mortality and produce less IL-1β, IL-18, and IL-17 than controls upon oral STm infection. Our data identify a novel link between phagocytosis, inflammasome activity and autophagy in DCs, potentially explaining impaired antibacterial immunity in AP-3-deficient patients. PMID:29253868

  10. Repurposing Ospemifene for Potentiating an Antigen-Specific Immune Response

    PubMed Central

    Kao, Chiao-Jung; Wurz, Gregory T.; Lin, Yi-Chen; Vang, Daniel P.; Phong, Brian; DeGregorio, Michael W.

    2016-01-01

    Objective Ospemifene, an estrogen receptor agonist/antagonist approved for treatment of dyspareunia and vaginal dryness in postmenopausal women, has potential new indications as an immune modulator. The overall objective of the present series of preclinical studies was to evaluate the immunomodulatory activity of ospemifene in combination with a peptide cancer vaccine. Methods Immune regulating effects, mechanism of action and structure activity relationships of ospemifene and related compounds were evaluated by examining expression of T cell activating cytokines in vitro, and antigen-specific immune response and cytotoxic T-lymphocyte activity in vivo. The effects of ospemifene (OSP) on the immune response to a peptide cancer vaccine (PV) were evaluated following chronic [control (n=22); OSP 50 mg/kg (n=16); PV (n=6); OSP+PV (n=11)], intermittent [control (n=10); OSP 10 and 50 mg/kg (n=11); PV (n=11); combination treatment (n=11 each dose)] and pretreatment [control; OSP 100 mg/kg; PV 100 µg; combination treatment (n=8 all groups)] ospemifene oral dosing schedules in a total of 317 mixed-sex tumor-bearing and non-tumor-bearing mice. Results The results showed that ospemifene induced expression of the key TH1 cytokines interferon gamma and interleukin-2 in vitro, which may be mediated by stimulating T cells through phosphoinositide 3-kinase and calmodulin signaling pathways. In combination with an antigen-specific peptide cancer vaccine, ospemifene increased antigen-specific immune response and increased cytotoxic T-lymphocyte activity in tumor-bearing and non-tumor-bearing mice. The pretreatment, intermittent, and chronic dosing schedules of ospemifene activate naïve T cells, modulate antigen-induced tolerance and reduce tumor-associated, pro-inflammatory cytokines, respectively. Conclusions Taken together, ospemifene’s dose response and schedule-dependent immune modulating activity offers a method of tailoring and augmenting the efficacy of previously failed

  11. Allatotropin: A pleiotropic neuropeptide that elicits mosquito immune responses

    PubMed Central

    Sánchez-Zavaleta, Minerva; Brito, Kevin; Herrera-Ortiz, Antonia; Ons, Sheila; Noriega, Fernando G.

    2017-01-01

    Allatotropins (AT) are neuropeptides with pleotropic functions on a variety of insect tissues. They affect processes such as juvenile hormone biosynthesis, cardiac rhythm, oviduct and hindgut contractions, nutrient absorption and circadian cycle. The present work provides experimental evidence that AT elicits immune responses in two important mosquito disease vectors, Anopheles albimanus and Aedes aegypti. Hemocytes and an immune-competent mosquito cell line responded to AT by showing strong morphological changes and increasing bacterial phagocytic activity. Phenoloxidase activity in hemolymph was also increased in Ae. aegypti mosquitoes treated with AT but not in An. albimanus, suggesting differences in the AT-dependent immune activation in the two species. In addition, two important insect immune markers, nitric oxide levels and expression of antimicrobial peptide genes, were increased in An. albimanus guts after AT treatment. AT conjugated to quantum dot nanocrystals (QDots) specifically labeled hemocytes in vivo in both mosquito species, implying molecular interactions between AT and hemocytes. The results of our studies suggest a new role for AT in the modulation of the immune response in mosquitoes. PMID:28426765

  12. Allatotropin: A pleiotropic neuropeptide that elicits mosquito immune responses.

    PubMed

    Hernández-Martínez, Salvador; Sánchez-Zavaleta, Minerva; Brito, Kevin; Herrera-Ortiz, Antonia; Ons, Sheila; Noriega, Fernando G

    2017-01-01

    Allatotropins (AT) are neuropeptides with pleotropic functions on a variety of insect tissues. They affect processes such as juvenile hormone biosynthesis, cardiac rhythm, oviduct and hindgut contractions, nutrient absorption and circadian cycle. The present work provides experimental evidence that AT elicits immune responses in two important mosquito disease vectors, Anopheles albimanus and Aedes aegypti. Hemocytes and an immune-competent mosquito cell line responded to AT by showing strong morphological changes and increasing bacterial phagocytic activity. Phenoloxidase activity in hemolymph was also increased in Ae. aegypti mosquitoes treated with AT but not in An. albimanus, suggesting differences in the AT-dependent immune activation in the two species. In addition, two important insect immune markers, nitric oxide levels and expression of antimicrobial peptide genes, were increased in An. albimanus guts after AT treatment. AT conjugated to quantum dot nanocrystals (QDots) specifically labeled hemocytes in vivo in both mosquito species, implying molecular interactions between AT and hemocytes. The results of our studies suggest a new role for AT in the modulation of the immune response in mosquitoes.

  13. The innate immune response to uropathogenic Escherichia coli involves IL-17A in a murine model of urinary tract infection.

    PubMed

    Sivick, Kelsey E; Schaller, Matthew A; Smith, Sara N; Mobley, Harry L T

    2010-02-15

    Uropathogenic Escherichia coli is the causative agent for >80% of uncomplicated urinary tract infections (UTIs). Uropathogenic E. coli strains express a number of virulence and fitness factors that allow successful colonization of the mammalian bladder. To combat this, the host has distinct mechanisms to prevent adherence to the bladder wall and to detect and kill uropathogenic E. coli in the event of colonization. In this study, we investigated the role of IL-17A, an innate-adaptive immunomodulatory cytokine, during UTI using a murine model. Splenocytes isolated from mice infected by the transurethral route robustly expressed IL-17A in response to in vitro stimulation with uropathogenic E. coli Ags. Transcript expression of IL-17A in the bladders of infected mice correlated with a role in the innate immune response to UTI, and gammadelta cells seem to be a key source of IL-17A production. Although IL-17A seems to be dispensable for the generation of a protective response to uropathogenic E. coli, its importance in innate immunity is demonstrated by a defect in acute clearance of uropathogenic E. coli in IL-17A(-/-) mice. This clearance defect is likely a result of deficient cytokine and chemokine transcripts and impaired macrophage and neutrophil influx during infection. These results show that IL-17A is a key mediator for the innate immune response to UTIs.

  14. Current views on the mechanisms of immune responses to trauma and infection

    PubMed Central

    Michalak, Grzegorz; Słotwiński, Robert

    2015-01-01

    According to the World Health Organization, post-traumatic mortality rates are still very high and show an increasing tendency. Disorders of innate immune response that may increase the risk of serious complications play a key role in the immunological system response to trauma and infection. The mechanism of these disorders is multifactorial and is still poorly understood. The changing concepts of systemic inflammatory response syndrome (SIRS) and compensatory anti-inflammatory response syndrome (CARS) early inflammatory response, presented in this work, have been extended to genetic studies. Overexpression of genes and increased production of immune response mediators are among the main causes of multiple organ dysfunction syndrome (MODS). Changes in gene expression detected early after injury precede the occurrence of subsequent complications with a typical clinical picture. Rapid depletion of energy resources leads to immunosuppression and persistent inflammation and immune suppression catabolism syndrome (PICS). Early diagnosis of immune disorders and appropriate nutritional therapy can significantly reduce the incidence of complications, length of hospital stay, and mortality. The study presents the development of knowledge and current views explaining the mechanisms of the immune response to trauma and infection. PMID:26557036

  15. Sex-specific consequences of an induced immune response on reproduction in a moth.

    PubMed

    Barthel, Andrea; Staudacher, Heike; Schmaltz, Antje; Heckel, David G; Groot, Astrid T

    2015-12-16

    Immune response induction benefits insects in combatting infection by pathogens. However, organisms have a limited amount of resources available and face the dilemma of partitioning resources between immunity and other life-history traits. Since males and females differ in their life histories, sex-specific resource investment strategies to achieve an optimal immune response following an infection can be expected. We investigated immune response induction of females and males of Heliothis virescens in response to the entomopathogenic bacterium Serratia entomophila, and its effects on mating success and the female sexual signal. We found that females had higher expression levels of immune-related genes after bacterial challenge than males. However, males maintained a higher baseline expression of immune-related genes than females. The increased investment in immunity of female moths was negatively correlated with mating success and the female sexual signal. Male mating success was unaffected by bacterial challenge. Our results show that the sexes differed in their investment strategies: females invested in immune defense after a bacterial challenge, indicating facultative immune deployment, whereas males had higher baseline immunity than females, indicating immune maintenance. Interestingly, these differences in investment were reflected in the mate choice assays. As female moths are the sexual signallers, females need to invest resources in their attractiveness. However, female moths appeared to invest in immunity at the cost of reproductive effort.

  16. Immunization of Aged Pigs with Attenuated Pseudorabies Virus Vaccine Combined with CpG Oligodeoxynucleotide Restores Defective Th1 Immune Responses

    PubMed Central

    Chu, Pinpin; Ma, Miaopeng; Shi, Juqing; Cai, Haiming; Huang, Chaoyuan; Li, Huazhou; Jiang, Zhenggu; Wang, Houguang; Wang, Weifang; Zhang, Shuiqing; Zhang, Linghua

    2013-01-01

    Background and Aims Attempts to immunize aged subjects often result in the failure to elicit a protective immune response. Murine model studies have shown that oligonucleotides containing CpG motifs (CpG ODN) can stimulate immune system in aged mice as effectively as in young mice. Since many physiological and pathophysiological data of pigs can be transferred to humans, research in pigs is important to confirm murine data. Here we investigated whether immunization of aged pig model with attenuated pseudorabies virus vaccine (PRV vaccine) formulated with CpG ODN could promote a successful development of immune responses that were comparable to those induced in young pigs in a similar manner. Methodology Young and aged pigs were immunized IM with PRV vaccine alone, or in combination with CpG ODN respectively. At days 3, 7, 14 post immunization sera were assayed by ELISA for IgG titres, at day 7 for IgG1 and IgG2 subtypes titres. All blood samples collected in evacuated test tubes with K-EDTA at day 7 were analyzed for flow cytometer assay. Blood samples at day 7 collected in evacuated test tubes with heparin were analysed for antigen-specific cytokines production and peripheral blood mononuclear cells (PBMCs) proliferative responses. Results CpG ODN could enhance Th1 responses (PRV-specific IgG2/IgG1 ratio, proliferative responses, Th1 cytokines production) when used as an adjuvant for the vaccination of aged pigs, which were correlated with enhanced CD4+ T cells percentage, decreased CD4+CD8+CD45RO+ T cells percentage and improved PRV-specific CD4+ T cells activation. Conclusions Our results demonstrate a utility for CpG ODN, as a safe vaccine adjuvant for promoting effective systemic immune responses in aged pig model. This agent could have important clinical uses in overcoming some of age-associated depressions in immune function that occur in response to vaccination. PMID:23785433

  17. Immune response in the lungs following oral immunization with bacterial lysates of respiratory pathogens.

    PubMed Central

    Ruedl, C; Frühwirth, M; Wick, G; Wolf, H

    1994-01-01

    We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The procedure followed the principle of the classical ELISPOT test with nitrocellulose-bottomed microtiter plates, but europium (Eu3+)-linked streptavidin rather than enzyme-conjugated streptavidin was used, with the advantage of quantifying secreted immunoglobulins instead of detecting single antibody-secreting cells. Lymphocytes isolated from the lungs of treated animals revealed significant increases in total and antigen-specific IgA synthesis compared with the rates of the controls, whereas IgG and IgM production rates showed no remarkable differences. In addition, the sera of treated mice revealed higher antigen-specific IgA titers but not increased IgM and IgG levels. We conclude that priming the gut-associated lymphoid tissue with bacterial antigens of pneumotropic microorganisms can elicit an enhanced IgA response in a distant mucosal effector site, such as the respiratory tract, according to the concept of a common mucosa-associated immune system. PMID:7496936

  18. Immune response in the lungs following oral immunization with bacterial lysates of respiratory pathogens.

    PubMed

    Ruedl, C; Frühwirth, M; Wick, G; Wolf, H

    1994-03-01

    We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The procedure followed the principle of the classical ELISPOT test with nitrocellulose-bottomed microtiter plates, but europium (Eu3+)-linked streptavidin rather than enzyme-conjugated streptavidin was used, with the advantage of quantifying secreted immunoglobulins instead of detecting single antibody-secreting cells. Lymphocytes isolated from the lungs of treated animals revealed significant increases in total and antigen-specific IgA synthesis compared with the rates of the controls, whereas IgG and IgM production rates showed no remarkable differences. In addition, the sera of treated mice revealed higher antigen-specific IgA titers but not increased IgM and IgG levels. We conclude that priming the gut-associated lymphoid tissue with bacterial antigens of pneumotropic microorganisms can elicit an enhanced IgA response in a distant mucosal effector site, such as the respiratory tract, according to the concept of a common mucosa-associated immune system.

  19. Behavioral Fever Drives Epigenetic Modulation of the Immune Response in Fish.

    PubMed

    Boltana, Sebastian; Aguilar, Andrea; Sanhueza, Nataly; Donoso, Andrea; Mercado, Luis; Imarai, Monica; Mackenzie, Simon

    2018-01-01

    Ectotherms choose the best thermal conditions to mount a successful immune response, a phenomenon known as behavioral fever. The cumulative evidence suggests that behavioral fever impacts positively upon lymphocyte proliferation, inflammatory cytokine expression, and other immune functions. In this study, we have explored how thermal choice during infection impacts upon underpinning molecular processes and how temperature increase is coupled to the immune response. Our results show that behavioral fever results in a widespread, plastic imprint on gene regulation, and lymphocyte proliferation. We further explored the possible contribution of histone modification and identified global associations between temperature and histone changes that suggest epigenetic remodeling as a result of behavioral fever. Together, these results highlight the critical importance of thermal choice in mobile ectotherms, particularly in response to an infection, and demonstrate the key role of epigenetic modification to orchestrate the thermocoupling of the immune response during behavioral fever.

  20. Conversational Responsiveness of Speech- and Language-Impaired Preschoolers.

    ERIC Educational Resources Information Center

    Hadley, Pamela A.; Rice, Mabel L.

    1991-01-01

    This study of 18 preschoolers' conversational responsiveness in an integrated classroom setting during free play found that language-impaired and speech-impaired children were ignored by their peers and responded less often when a peer initiated to them. Results suggest that peer interaction difficulties may be concomitant consequences of early…

  1. A cognitive computational model inspired by the immune system response.

    PubMed

    Abdo Abd Al-Hady, Mohamed; Badr, Amr Ahmed; Mostafa, Mostafa Abd Al-Azim

    2014-01-01

    The immune system has a cognitive ability to differentiate between healthy and unhealthy cells. The immune system response (ISR) is stimulated by a disorder in the temporary fuzzy state that is oscillating between the healthy and unhealthy states. However, modeling the immune system is an enormous challenge; the paper introduces an extensive summary of how the immune system response functions, as an overview of a complex topic, to present the immune system as a cognitive intelligent agent. The homogeneity and perfection of the natural immune system have been always standing out as the sought-after model we attempted to imitate while building our proposed model of cognitive architecture. The paper divides the ISR into four logical phases: setting a computational architectural diagram for each phase, proceeding from functional perspectives (input, process, and output), and their consequences. The proposed architecture components are defined by matching biological operations with computational functions and hence with the framework of the paper. On the other hand, the architecture focuses on the interoperability of main theoretical immunological perspectives (classic, cognitive, and danger theory), as related to computer science terminologies. The paper presents a descriptive model of immune system, to figure out the nature of response, deemed to be intrinsic for building a hybrid computational model based on a cognitive intelligent agent perspective and inspired by the natural biology. To that end, this paper highlights the ISR phases as applied to a case study on hepatitis C virus, meanwhile illustrating our proposed architecture perspective.

  2. Hepatitis C, innate immunity and alcohol: friends or foes?

    PubMed

    Osna, Natalia A; Ganesan, Murali; Kharbanda, Kusum K

    2015-02-05

    Hepatitis C and alcohol are the most widespread causes of liver disease worldwide. Approximately 80% of patients with a history of hepatitis C and alcohol abuse develop chronic liver injury. Alcohol consumption in hepatitis C virus (HCV)-infected patients exacerbates liver disease leading to rapid progression of fibrosis, cirrhosis and even hepatocellular carcinoma. Hepatocytes are the main sites of HCV-infection and ethanol metabolism, both of which generate oxidative stress. Oxidative stress levels affect HCV replication and innate immunity, resulting in a greater susceptibility for HCV-infection and virus spread in the alcoholic patients. In this review paper, we analyze the effects of ethanol metabolism and other factors on HCV replication. In addition, we illustrate the mechanisms of how HCV hijacks innate immunity and how ethanol exposure regulates this process. We also clarify the effects of HCV and ethanol metabolism on interferon signaling-a crucial point for activation of anti-viral genes to protect cells from virus-and the role that HCV- and ethanol-induced impairments play in adaptive immunity which is necessary for recognition of virally-infected hepatocytes. In conclusion, ethanol exposure potentiates the suppressive effects of HCV on innate immunity, which activates viral spread in the liver and finally, leads to impairments in adaptive immunity. The dysregulation of immune response results in impaired elimination of HCV-infected cells, viral persistence, progressive liver damage and establishment of chronic infection that worsens the outcomes of chronic hepatitis C in alcoholic patients.

  3. Immune response to functionalized mesoporous silica nanoparticles for targeted drug delivery

    NASA Astrophysics Data System (ADS)

    Heidegger, Simon; Gößl, Dorothée; Schmidt, Alexandra; Niedermayer, Stefan; Argyo, Christian; Endres, Stefan; Bein, Thomas; Bourquin, Carole

    2015-12-01

    Multifunctional mesoporous silica nanoparticles (MSN) have attracted substantial attention with regard to their high potential for targeted drug delivery. For future clinical applications it is crucial to address safety concerns and understand the potential immunotoxicity of these nanoparticles. In this study, we assess the biocompatibility and functionality of multifunctional MSN in freshly isolated, primary murine immune cells. We show that the functionalized silica nanoparticles are rapidly and efficiently taken up into the endosomal compartment by specialized antigen-presenting cells such as dendritic cells. The silica nanoparticles showed a favorable toxicity profile and did not affect the viability of primary immune cells from the spleen in relevant concentrations. Cargo-free MSN induced only very low immune responses in primary cells as determined by surface expression of activation markers and release of pro-inflammatory cytokines such as Interleukin-6, -12 and -1β. In contrast, when surface-functionalized MSN with a pH-responsive polymer capping were loaded with an immune-activating drug, the synthetic Toll-like receptor 7 agonist R848, a strong immune response was provoked. We thus demonstrate that MSN represent an efficient drug delivery vehicle to primary immune cells that is both non-toxic and non-inflammagenic, which is a prerequisite for the use of these particles in biomedical applications.Multifunctional mesoporous silica nanoparticles (MSN) have attracted substantial attention with regard to their high potential for targeted drug delivery. For future clinical applications it is crucial to address safety concerns and understand the potential immunotoxicity of these nanoparticles. In this study, we assess the biocompatibility and functionality of multifunctional MSN in freshly isolated, primary murine immune cells. We show that the functionalized silica nanoparticles are rapidly and efficiently taken up into the endosomal compartment by specialized

  4. Dietary astaxanthin enhances immune response in dogs.

    PubMed

    Chew, Boon P; Mathison, Bridget D; Hayek, Michael G; Massimino, Stefan; Reinhart, Gregory A; Park, Jean Soon

    2011-04-15

    No information is available on the possible role of astaxanthin on immune response in domestic canine. Female Beagle dogs (9-10 mo old; 8.2 ± 0.2 kg body weight) were fed 0, 10, 20 or 40 mg astaxanthin daily and blood sampled on wk 0, 6, 12, and 16 for assessing the following: lymphoproliferation, leukocyte subpopulations, natural killer (NK) cell cytotoxicity, and concentrations of blood astaxanthin, IgG, IgM and acute phase proteins. Delayed-type hypersensitivity (DTH) response was assessed on wk 0, 12 and 16. Plasma astaxanthin increased dose-dependently and reached maximum concentrations on wk 6. Dietary astaxanthin enhanced DTH response to vaccine, concanavalin A-induced lymphocyte proliferation (with the 20mg dose at wk 12) and NK cell cytotoxic activity. In addition, dietary astaxanthin increased concentrations of IgG and IgM, and B cell population. Plasma concentrations of C reactive protein were lower in astaxanthin-fed dogs. Therefore, dietary astaxanthin heightened cell-mediated and humoral immune response and reduced DNA damage and inflammation in dogs. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Immune mechanisms induced by an HSV-1 mutant strain: Discrepancy analysis of the immune system gene profile in comparison with a wild-type strain.

    PubMed

    Zhang, Xiaolong; Jiang, Quanlong; Xu, Xingli; Wang, Yongrong; Liu, Lei; Lian, Yaru; Li, Hao; Wang, Lichun; Zhang, Ying; Jiang, Guorun; Zeng, Jieyuan; Zhang, Han; Han, Jing-Dong Jackie; Li, Qihan

    2018-04-25

    Herpes simplex virus is a prevalent pathogen of humans of various age groups. The fact that no prophylactic or therapeutic vaccine is currently available suggests a significant need to further investigate the immune mechanisms induced by the virus and various vaccine candidates. We previously generated an HSV-1 mutant strain, M3, with partial deletions in ul7, ul41 and LAT that produced an attenuated phenotype in mice. In the present study, we performed a comparative analysis to characterize the immune responses induced by M3 versus wild-type HSV-1 in a mouse model. Infection with wild-type HSV-1 triggered an inflammatory-dominated response and adaptive immunity suppression and was accompanied by severe pathological damage. In contrast, infection with M3 induced a systematic immune response involving full activation of both innate and adaptive immunity and was accompanied by no obvious pathological changes. Furthermore, the immune response induced by M3 protected mice from lethal challenge with wild-type strains of HSV-1 and restrained virus proliferation and impaired latency. These data are useful for further HSV-1 vaccine development using a mutant strain construction strategy. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. Immune response at birth, long-term immune memory and 2 years follow-up after in-utero anti-HBV DNA immunization.

    PubMed

    Fazio, V M; Ria, F; Franco, E; Rosati, P; Cannelli, G; Signori, E; Parrella, P; Zaratti, L; Iannace, E; Monego, G; Blogna, S; Fioretti, D; Iurescia, S; Filippetti, R; Rinaldi, M

    2004-03-01

    Infections occurring at the end of pregnancy, during birth or by breastfeeding are responsible for the high toll of death among first-week infants. In-utero DNA immunization has demonstrated the effectiveness in inducing specific immunity in newborns. A major contribution to infant immunization would be achieved if a vaccine proved able to be protective as early as at the birth, preventing the typical 'first-week infections'. To establish its potential for use in humans, in-utero DNA vaccination efficiency has to be evaluated for short- and long-term safety, protection at delivery, efficacy of boosts in adults and effective window/s for modulation of immune response during pregnancy, in an animal model suitable with human development. Here we show that a single intramuscular in-utero anti-HBV DNA immunization at two-thirds of pig gestation produces, at birth, antibody titers considered protective in humans. The boost of antibody titers in every animal following recall at 4 and 10 months demonstrates the establishment of immune memory. The safety of in-utero fetus manipulation is guaranteed by short-term (no fetus loss, lack of local alterations, at-term spontaneous delivery, breastfeeding) and long-term (2 years) monitoring. Treatment of fetuses closer to delivery results in immune ignorance without induction of tolerance. This result highlights the repercussion of selecting the appropriate time point when this approach is used to deliver therapeutic genes. All these findings illustrate the relevance of naked DNA-based vaccination technology in therapeutic efforts aimed to prevent the high toll of death among first-week infants.

  7. Effect of nanovaccine chemistry on humoral immune response kinetics and maturation

    NASA Astrophysics Data System (ADS)

    Haughney, Shannon L.; Ross, Kathleen A.; Boggiatto, Paola M.; Wannemuehler, Michael J.; Narasimhan, Balaji

    2014-10-01

    Acute respiratory infections represent a significant portion of global morbidity and mortality annually. There is a critical need for efficacious vaccines against respiratory pathogens. To vaccinate against respiratory disease, pulmonary delivery is an attractive route because it mimics the route of natural infection and can confer both mucosal and systemic immunity. We have previously demonstrated that a single dose, intranasal vaccine based on polyanhydride nanoparticles elicited a protective immune response against Yersinia pestis for at least 40 weeks after immunization with F1-V. Herein, we investigate the effect of nanoparticle chemistry and its attributes on the kinetics and maturation of the antigen-specific serum antibody response. We demonstrate that manipulation of polyanhydride nanoparticle chemistry facilitated differential kinetics of development of antibody titers, avidity, and epitope specificity. The results provide new insights into the underlying role(s) of nanoparticle chemistry in providing long-lived humoral immunity and aid in the rational design of nanovaccine formulations to induce long-lasting and mature antibody responses.Acute respiratory infections represent a significant portion of global morbidity and mortality annually. There is a critical need for efficacious vaccines against respiratory pathogens. To vaccinate against respiratory disease, pulmonary delivery is an attractive route because it mimics the route of natural infection and can confer both mucosal and systemic immunity. We have previously demonstrated that a single dose, intranasal vaccine based on polyanhydride nanoparticles elicited a protective immune response against Yersinia pestis for at least 40 weeks after immunization with F1-V. Herein, we investigate the effect of nanoparticle chemistry and its attributes on the kinetics and maturation of the antigen-specific serum antibody response. We demonstrate that manipulation of polyanhydride nanoparticle chemistry

  8. Phenytoin promotes Th2 type immune response in mice

    PubMed Central

    Okada, K; Sugiura, T; Kuroda, E; Tsuji, S; Yamashita, U

    2001-01-01

    The effects of chronic administration of phenytoin, a common anticonvulsive drug, on immune responses were studied in mice. Anti-keyhole limpet haemocyanin (KLH) IgE antibody response after KLH-immunization was enhanced in phenytoin-treated mice. Proliferative responses of spleen cells induced with KLH, concanavalin A (ConA), lipopolysaccharide and anti-CD3 antibody were reduced in phenytoin-treated mice. Accessory function of spleen adherent cells on ConA-induced T cell proliferative response was reduced in phenytoin-treated mice. KLH-induced IL-4 production of spleen cells was enhanced, while IFN-γ production was reduced in phenytoin-treated mice. In addition, production of IL-1α, but not IL-6 and IL-12 by spleen adherent cells from phenytoin-treated mice was reduced. Natural killer cell activity was reduced in phenytoin-treated mice. These results suggest that phenytoin treatment preferentially induces a Th2 type response. We also observed that plasma ACTH and corticosterone levels were increased in phenytoin-treated mice, and speculated that phenytoin might act directly and indirectly, through HPA axis activation, on the immune system to modulate Th1/Th2 balance. PMID:11472401

  9. Ubiquitin enzymes in the regulation of immune responses

    PubMed Central

    Ebner, Petra; Versteeg, Gijs A.; Ikeda, Fumiyo

    2017-01-01

    Abstract Ubiquitination plays a central role in the regulation of various biological functions including immune responses. Ubiquitination is induced by a cascade of enzymatic reactions by E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme, and E3 ubiquitin ligase, and reversed by deubiquitinases. Depending on the enzymes, specific linkage types of ubiquitin chains are generated or hydrolyzed. Because different linkage types of ubiquitin chains control the fate of the substrate, understanding the regulatory mechanisms of ubiquitin enzymes is central. In this review, we highlight the most recent knowledge of ubiquitination in the immune signaling cascades including the T cell and B cell signaling cascades as well as the TNF signaling cascade regulated by various ubiquitin enzymes. Furthermore, we highlight the TRIM ubiquitin ligase family as one of the examples of critical E3 ubiquitin ligases in the regulation of immune responses. PMID:28524749

  10. IL-2 infusion abrogates humoral immune responses in humans.

    PubMed Central

    Gottlieb, D J; Prentice, H G; Heslop, H E; Bello, C; Brenner, M K

    1992-01-01

    Although IL-2 infusion enhances cell-mediated cytotoxicity in patients with neoplastic disease, administration is paradoxically associated with a modest fall in total serum IgG and an increased risk of infection. We now show that the adverse effects of IL-2 infusion on the humoral immune system are substantial. Although IL-2 induces the B cell growth and differentiating factors IL-4 and IL-6, infusion abrogates primary antibody responses entirely and reduces secondary antibody responses 50-fold following antigen challenge. There is no evidence of the generation of cells with suppressive activity on B cells but IL-2 increases the ratio of circulating virgin:memory cells. These results may help to explain the increased rate of bacterial infection in patients receiving IL-2. As IL-2 plays a central role in the generation of an immune response, the finding that it is also sufficiently immunosuppressive to inhibit primary- and secondary-type antibody responses suggests that exploration of the underlying mechanisms may provide insights into immune system homeostasis and may offer new approaches to therapeutic immunosuppression. Images Fig. 1 PMID:1544235

  11. Validating the pivotal role of the immune system in low-dose radiation-induced tumor inhibition in Lewis lung cancer-bearing mice.

    PubMed

    Zhou, Lei; Zhang, Xiaoying; Li, Hui; Niu, Chao; Yu, Dehai; Yang, Guozi; Liang, Xinyue; Wen, Xue; Li, Min; Cui, Jiuwei

    2018-04-01

    Although low-dose radiation (LDR) possesses the two distinct functions of inducing hormesis and adaptive responses, which result in immune enhancement and tumor inhibition, its clinical applications have not yet been elucidated. The major obstacle that hinders the application of LDR in the clinical setting is that the mechanisms underlying induction of tumor inhibition are unclear, and the risks associated with LDR are still unknown. Thus, to overcome this obstacle and elucidate the mechanisms mediating the antitumor effects of LDR, in this study, we established an in vivo lung cancer model to investigate the participation of the immune system in LDR-induced tumor inhibition and validated the pivotal role of the immune system by impairing immunity with high-dose radiation (HDR) of 1 Gy. Additionally, the LDR-induced adaptive response of the immune system was also observed by sequential HDR treatment in this mouse model. We found that LDR-activated T cells and natural killer cells and increased the cytotoxicity of splenocytes and the infiltration of T cells in the tumor tissues. In contrast, when immune function was impaired by HDR pretreatment, LDR could not induce tumor inhibition. However, when LDR was administered before HDR, the immunity could be protected from impairment, and tumor growth could be inhibited to some extent, indicating the induction of the immune adaptive response by LDR. Therefore, we demonstrated that immune enhancement played a key role in LDR-induced tumor inhibition. These findings emphasized the importance of the immune response in tumor radiotherapy and may help promote the application of LDR as a novel approach in clinical practice. © 2018 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  12. Regulatory immune cells and functions in autoimmunity and transplantation immunology.

    PubMed

    Papp, Gabor; Boros, Peter; Nakken, Britt; Szodoray, Peter; Zeher, Margit

    2017-05-01

    In physiological circumstances, various tolerogenic mechanisms support the protection of self-structures during immune responses. However, quantitative and/or qualitative changes in regulatory immune cells and mediators can evoke auto-reactive immune responses, and upon susceptible genetic background, along with the presence of other concomitant etiological factors, autoimmune disease may develop. In transplant immunology, tolerogenic mechanisms are also critical, since the balance between of alloantigen-reactive effector cells and the regulatory immune cells will ultimately determine whether a graft is accepted or rejected. Better understanding of the immunological tolerance and the potential modulations of immune regulatory processes are crucial for developing effective therapies in autoimmune diseases as well as in organ transplantation. In this review, we focus on the novel insights regarding the impaired immune regulation and other relevant factors contributing to the development of auto-reactive and graft-reactive immune responses in autoimmune diseases and transplant rejection, respectively. We also address some promising approaches for modification of immune-regulatory processes and tolerogenic mechanisms in autoimmunity and solid organ transplantation, which may be beneficial in future therapeutic strategies. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Impaired neutrophil extracellular trap formation: a novel defect in the innate immune system of aged individuals

    PubMed Central

    Hazeldine, Jon; Harris, Phillipa; Chapple, Iain L; Grant, Melissa; Greenwood, Hannah; Livesey, Amy; Sapey, Elizabeth; Lord, Janet M

    2014-01-01

    Neutrophil extracellular traps (NETs) are a recently discovered addition to the defensive armamentarium of neutrophils, assisting in the immune response against rapidly dividing bacteria. Although older adults are more susceptible to such infections, no study has examined whether aging in humans influences NET formation. We report that TNF-α-primed neutrophils generate significantly more NETs than unprimed neutrophils and that lipopolysaccharide (LPS)- and interleukin-8 (IL-8)-induced NET formation exhibits a significant age-related decline. NET formation requires generation of reactive oxygen species (ROS), and this was also reduced in neutrophils from older donors identifying a mechanism for reduced NET formation. Expression of IL-8 receptors (CXCR1 and CXCR2) and the LPS receptor TLR4 was similar on neutrophils from young and old subjects, and neutrophils challenged with phorbol-12-myristate-13-acetate (PMA) showed no age-associated differences in ROS or NET production. Taken together, these data suggest a defect in proximal signalling underlies the age-related decline in NET and ROS generation. TNF-α priming involves signalling through p38 MAP kinase, but activation kinetics were comparable in neutrophils from young and old donors. In a clinical setting, we assessed the capacity of neutrophils from young and older patients with chronic periodontitis to generate NETs in response to PMA and hypochlorous acid (HOCL). Neutrophil extracellular trap generation to HOCL, but not PMA, was lower in older periodontitis patients but not in comparison with age-matched controls. Impaired NET formation is thus a novel defect of innate immunity in older adults but does not appear to contribute to the increased incidence of periodontitis in older adults. PMID:24779584

  14. [Immune response to live influenza vaccine].

    PubMed

    Naĭkhin, A N; Rekstin, A R; Barantseva, I B; Donina, S A; Desheva, Iu A; Grigor'eva, E P; Kiseleva, I V; Rudenko, L G

    2002-01-01

    Priority data on the induction, by using a Russian live cold-adapted reassortant influenza vaccine (LIV), of the cellular and humoral immunity with regard for attenuation and genetic reassortment of vaccine stains as well as with regard for the age of vaccinated persons and the production of Th1 (IFNY, IL-2) and Th2 (IL-4) cytokine markers in vitro are presented. It was demonstrated in vivo that a pathogenic virus of the A group by far more actively induced the lymphocyte apoptosis as compared with attenuated genetically reassorted stains. Unlike the influenza pathogenic virus, the genetically attenuated and reassorted strain did not produce any negative effects on the induction of cellular immunity. A comparative study of the LIV immunogenic properties in vaccinated persons showed an advantage of LIV over inactivated influenza vaccine (IIV) in stimulating the cellular and local immunity in the elderly. Unlike IIV, LIV induced an active and balanced immune response developing due to Th1 and Th2 activation. LIV was found to stimulate well enough the production of IFN and IL-2 in both young and old persons.

  15. Impaired immune function in children and adults with Fanconi anemia.

    PubMed

    Myers, Kasiani C; Sauter, Sharon; Zhang, Xue; Bleesing, Jacob J; Davies, Stella M; Wells, Susanne I; Mehta, Parinda A; Kumar, Ashish; Marmer, Daniel; Marsh, Rebecca; Brown, Darron; Butsch Kovacic, Melinda

    2017-11-01

    Fanconi anemia (FA) is a rare genetic disorder characterized by genome instability, bone marrow failure, and cancer predisposition. Previously, small studies have reported heterogeneous immune dysfunction in FA. We performed a detailed immunologic assessment in a large FA cohort who have not undergone bone marrow transplantation or developed malignancies. Comprehensive quantitative and functional immunologic assessment of 29 FA individuals was compared to healthy age-matched controls. Compared to non-FA persons of similar ages, FA individuals showed lower absolute total B cells (P < 0.001), lower memory B cells (P < 0.001), and decreased IgM (P < 0.001) but normal IgG. NK cells (P < 0.001) and NK cytotoxicity (P < 0.001) were decreased. CD4 + T cells were decreased (P = 0.022), while CD8 + T cell and absolute T-cell numbers were comparable. Cytotoxic T cells (P < 0.003), and antigen proliferation response to tetanus (P = 0.019) and candida (P = 0.019), were diminished in FA. Phytohemagglutinin responses and plasma cytokines were normal. Within FA subjects, adults and older children (≥10 years) exhibited higher CD8 + T cells than younger children (P = 0.004). Documented atypical infections were infrequent, although oral human papilloma virus (HPV) prevalence was higher (31% positive) in FA. Overall, these results demonstrate a high rate of significant humoral and cellular immune dysfunction. Continued longitudinal study of immune function is critical to understand evolution with age, bone marrow failure, and cancer development. © 2017 Wiley Periodicals, Inc.

  16. Escaping Deleterious Immune Response in Their Hosts: Lessons from Trypanosomatids

    PubMed Central

    Geiger, Anne; Bossard, Géraldine; Sereno, Denis; Pissarra, Joana; Lemesre, Jean-Loup; Vincendeau, Philippe; Holzmuller, Philippe

    2016-01-01

    The Trypanosomatidae family includes the genera Trypanosoma and Leishmania, protozoan parasites displaying complex digenetic life cycles requiring a vertebrate host and an insect vector. Trypanosoma brucei gambiense, Trypanosoma cruzi, and Leishmania spp. are important human pathogens causing human African trypanosomiasis (HAT or sleeping sickness), Chagas’ disease, and various clinical forms of Leishmaniasis, respectively. They are transmitted to humans by tsetse flies, triatomine bugs, or sandflies, and affect millions of people worldwide. In humans, extracellular African trypanosomes (T. brucei) evade the hosts’ immune defenses, allowing their transmission to the next host, via the tsetse vector. By contrast, T. cruzi and Leishmania sp. have developed a complex intracellular lifestyle, also preventing several mechanisms to circumvent the host’s immune response. This review seeks to set out the immune evasion strategies developed by the different trypanosomatids resulting from parasite–host interactions and will focus on: clinical and epidemiological importance of diseases; life cycles: parasites–hosts–vectors; innate immunity: key steps for trypanosomatids in invading hosts; deregulation of antigen-presenting cells; disruption of efficient specific immunity; and the immune responses used for parasite proliferation. PMID:27303406

  17. Peripheral administration of the soluble TNF inhibitor XPro1595 modifies brain immune cell profiles, decreases beta-amyloid plaque load, and rescues impaired long-term potentiation in 5xFAD mice.

    PubMed

    MacPherson, Kathryn P; Sompol, Pradoldej; Kannarkat, George T; Chang, Jianjun; Sniffen, Lindsey; Wildner, Mary E; Norris, Christopher M; Tansey, Malú G

    2017-06-01

    Clinical and animal model studies have implicated inflammation and peripheral immune cell responses in the pathophysiology of Alzheimer's disease (AD). Peripheral immune cells including T cells circulate in the cerebrospinal fluid (CSF) of healthy adults and are found in the brains of AD patients and AD rodent models. Blocking entry of peripheral macrophages into the CNS was reported to increase amyloid burden in an AD mouse model. To assess inflammation in the 5xFAD (Tg) mouse model, we first quantified central and immune cell profiles in the deep cervical lymph nodes and spleen. In the brains of Tg mice, activated (MHCII + , CD45 high , and Ly6C high ) myeloid-derived CD11b + immune cells are decreased while CD3 + T cells are increased as a function of age relative to non-Tg mice. These immunological changes along with evidence of increased mRNA levels for several cytokines suggest that immune regulation and trafficking patterns are altered in Tg mice. Levels of soluble Tumor Necrosis Factor (sTNF) modulate blood-brain barrier (BBB) permeability and are increased in CSF and brain parenchyma post-mortem in AD subjects and Tg mice. We report here that in vivo peripheral administration of XPro1595, a novel biologic that sequesters sTNF into inactive heterotrimers, reduced the age-dependent increase in activated immune cells in Tg mice, while decreasing the overall number of CD4 + T cells. In addition, XPro1595 treatment in vivo rescued impaired long-term potentiation (LTP) measured in brain slices in association with decreased Aβ plaques in the subiculum. Selective targeting of sTNF may modulate brain immune cell infiltration, and prevent or delay neuronal dysfunction in AD. Immune cells and cytokines perform specialized functions inside and outside the brain to maintain optimal brain health; but the extent to which their activities change in response to neuronal dysfunction and degeneration is not well understood. Our findings indicate that neutralization of s

  18. Immune responses to bioengineered organs

    PubMed Central

    Ochando, Jordi; Charron, Dominique; Baptista, Pedro M.; Uygun, Basak E.

    2017-01-01

    Purpose of review Organ donation in the United States registered 9079 deceased organ donors in 2015. This high percentage of donations allowed organ transplantation in 29 851 recipients. Despite increasing numbers of transplants performed in comparison with previous years, the numbers of patients that are in need for a transplant increase every year at a higher rate. This reveals that the discrepancy between the demand and availability of organs remains fundamental problem in organ transplantation. Recent findings Development of bioengineered organs represents a promising approach to increase the pool of organs for transplantation. The technology involves obtaining complex three-dimensional scaffolds that support cellular activity and functional remodeling though tissue recellularization protocols using progenitor cells. This innovative approach integrates cross-thematic approaches from specific areas of transplant immunology, tissue engineering and stem cell biology, to potentially manufacture an unlimited source of donor organs for transplantation. Summary Although bioengineered organs are thought to escape immune recognition, the potential immune reactivity toward each of its components has not been studied in detail. Here, we summarize the host immune response toward different progenitor cells and discuss the potential implications of using nonself biological scaffolds to develop bioengineered organs. PMID:27926545

  19. Alcohol, aging, and innate immunity.

    PubMed

    Boule, Lisbeth A; Kovacs, Elizabeth J

    2017-07-01

    The global population is aging: in 2010, 8% of the population was older than 65 y, and that is expected to double to 16% by 2050. With advanced age comes a heightened prevalence of chronic diseases. Moreover, elderly humans fair worse after acute diseases, namely infection, leading to higher rates of infection-mediated mortality. Advanced age alters many aspects of both the innate and adaptive immune systems, leading to impaired responses to primary infection and poor development of immunologic memory. An often overlooked, yet increasingly common, behavior in older individuals is alcohol consumption. In fact, it has been estimated that >40% of older adults consume alcohol, and evidence reveals that >10% of this group is drinking more than the recommended limit by the National Institute on Alcohol Abuse and Alcoholism. Alcohol consumption, at any level, alters host immune responses, including changes in the number, phenotype, and function of innate and adaptive immune cells. Thus, understanding the effect of alcohol ingestion on the immune system of older individuals, who are already less capable of combating infection, merits further study. However, there is currently almost nothing known about how drinking alters innate immunity in older subjects, despite innate immune cells being critical for host defense, resolution of inflammation, and maintenance of immune homeostasis. Here, we review the effects of aging and alcohol consumption on innate immune cells independently and highlight the few studies that have examined the effects of alcohol ingestion in aged individuals. © Society for Leukocyte Biology.

  20. Aging of immune system: Immune signature from peripheral blood lymphocyte subsets in 1068 healthy adults.

    PubMed

    Qin, Ling; Jing, Xie; Qiu, Zhifeng; Cao, Wei; Jiao, Yang; Routy, Jean-Pierre; Li, Taisheng

    2016-05-01

    Aging is a major risk factor for several conditions including neurodegenerative, cardiovascular diseases and cancer. Functional impairments in cellular pathways controlling genomic stability, and immune control have been identified. Biomarker of immune senescence is needed to improve vaccine response and to develop therapy to improve immune control. To identify phenotypic signature of circulating immune cells with aging, we enrolled 1068 Chinese healthy volunteers ranging from 18 to 80 years old. The decreased naïve CD4+ and CD8+ T cells, increased memory CD4+ or CD8+ T cells, loss of CD28 expression on T cells and reverse trend of CD38 and HLA-DR, were significant for aging of immune system. Conversely, the absolute counts and percentage of NK cells and CD19+B cells maintained stable in aging individuals. The Chinese reference ranges of absolute counts and percentage of peripheral lymphocyte in this study might be useful for future clinical evaluation.

  1. Dynamic two-photon imaging of the immune response to Toxoplasma gondii infection.

    PubMed

    Luu, L; Coombes, J L

    2015-03-01

    Toxoplasma gondii is a highly successful parasite that can manipulate host immune responses to optimize its persistence and spread. As a result, a highly complex relationship exists between T. gondii and the immune system of the host. Advances in imaging techniques, and in particular, the application of two-photon microscopy to mouse infection models, have made it possible to directly visualize interactions between parasites and the host immune system as they occur in living tissues. Here, we will discuss how dynamic imaging techniques have provided unexpected new insight into (i) how immune responses are dynamically regulated by cells and structures in the local tissue environment, (ii) how protective responses to T. gondii are generated and (iii) how the parasite exploits the immune system for its own benefit. © 2014 John Wiley & Sons Ltd.

  2. The Modulation of Adaptive Immune Responses by Bacterial Zwitterionic Polysaccharides

    PubMed Central

    Stephen, Tom Li; Groneck, Laura; Kalka-Moll, Wiltrud Maria

    2010-01-01

    The detection of pathogen-derived molecules as foreign particles by adaptive immune cells triggers T and B lymphocytes to mount protective cellular and humoral responses, respectively. Recent immunological advances elucidated that proteins and some lipids are the principle biological molecules that induce protective T cell responses during microbial infections. Polysaccharides are important components of microbial pathogens and many vaccines. However, research concerning the activation of the adaptive immune system by polysaccharides gained interest only recently. Traditionally, polysaccharides were considered to be T cell-independent antigens that did not directly activate T cells or induce protective immune responses. Here, we review several recent advances in “carbohydrate immunobiology”. A group of bacterial polysaccharides that are known as “zwitterionic polysaccharides (ZPSs)” were recently identified as potent immune modulators. The immunomodulatory effect of ZPSs required antigen processing and presentation by antigen presenting cells, the activation of CD4 T cells and subpopulations of CD8 T cells and the modulation of host cytokine responses. In this review, we also discuss the potential use of these unique immunomodulatory ZPSs in new vaccination strategies against chronic inflammatory conditions, autoimmunity, infectious diseases, allergies and asthmatic conditions. PMID:21234388

  3. CELL SURFACE SIGNALING MOLECULES IN THE CONTROL OF IMMUNE RESPONSES: A TIDE MODEL

    PubMed Central

    Zhu, Yuwen; Yao, Sheng; Chen, Lieping

    2011-01-01

    Summary A large numbers of cell surface signaling molecules (CSSMs) have been molecularly identified and functionally characterized in recent years and, via these studies, our knowledge in the control of immune response has increased exponentially. Two major lines of evidence emerge. First, the majority of immune cells rely on one or few CSSMs to deliver a primary triggering signal to sense their environment, leading to initiation of an immune response. Second, both costimulatory CSSMs that promote the response, and coinhibitory CSSMs that inhibit the response, are required to control direction and magnitude of a given immune response. With such tight feedback, immune responses are tuned and returned to baseline. These findings extend well beyond our previous observation in the requirement for lymphocyte activation and argue a revisit of the traditional “two-signal model” for activation and tolerance of lymphocytes. Here we propose a “tide” model to accommodate and interpret current experimental findings. PMID:21511182

  4. Plant Immune Responses Against Viruses: How Does a Virus Cause Disease?[OA

    PubMed Central

    Mandadi, Kranthi K.; Scholthof, Karen-Beth G.

    2013-01-01

    Plants respond to pathogens using elaborate networks of genetic interactions. Recently, significant progress has been made in understanding RNA silencing and how viruses counter this apparently ubiquitous antiviral defense. In addition, plants also induce hypersensitive and systemic acquired resistance responses, which together limit the virus to infected cells and impart resistance to the noninfected tissues. Molecular processes such as the ubiquitin proteasome system and DNA methylation are also critical to antiviral defenses. Here, we provide a summary and update of advances in plant antiviral immune responses, beyond RNA silencing mechanisms—advances that went relatively unnoticed in the realm of RNA silencing and nonviral immune responses. We also document the rise of Brachypodium and Setaria species as model grasses to study antiviral responses in Poaceae, aspects that have been relatively understudied, despite grasses being the primary source of our calories, as well as animal feed, forage, recreation, and biofuel needs in the 21st century. Finally, we outline critical gaps, future prospects, and considerations central to studying plant antiviral immunity. To promote an integrated model of plant immunity, we discuss analogous viral and nonviral immune concepts and propose working definitions of viral effectors, effector-triggered immunity, and viral pathogen-triggered immunity. PMID:23709626

  5. Immune response and immunopathology during toxoplasmosis1

    PubMed Central

    Dupont, Christopher D.; Christian, David A.; Hunter, Christopher A.

    2012-01-01

    Toxoplasma gondii is a protozoan parasite of medical and veterinary significance that is able to infect any warm-blooded vertebrate host. In addition to its importance to public health, several inherent features of the biology of T. gondii have made it an important model organism to study host-pathogen interactions. One factor is the genetic tractability of the parasite, which allows studies on the microbial factors that affect virulence and allows the development of tools that facilitate immune studies. Additionally, mice are natural hosts for T. gondii, and the availability of numerous reagents to study the murine immune system makes this an ideal experimental system to understand the functions of cytokines and effector mechanisms involved in immunity to intracellular microorganisms. In this article, we will review current knowledge of the innate and adaptive immune responses required for resistance to toxoplasmosis, the events that lead to the development of immunopathology, and the natural regulatory mechanisms that limit excessive inflammation during this infection. PMID:22955326

  6. Perillyl alcohol suppresses antigen-induced immune responses in the lung

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Imamura, Mitsuru; Sasaki, Oh; Okunishi, Katsuhide

    Highlights: •Perillyl alcohol (POH) is an isoprenoid which inhibits the mevalonate pathway. •We examined whether POH suppresses immune responses with a mouse model of asthma. •POH treatment during sensitization suppressed Ag-induced priming of CD4{sup +} T cells. •POH suppressed airway eosinophila and cytokine production in thoracic lymph nodes. -- Abstract: Perillyl alcohol (POH) is an isoprenoid which inhibits farnesyl transferase and geranylgeranyl transferase, key enzymes that induce conformational and functional changes in small G proteins to conduct signal production for cell proliferation. Thus, it has been tried for the treatment of cancers. However, although it affects the proliferation of immunocytes,more » its influence on immune responses has been examined in only a few studies. Notably, its effect on antigen-induced immune responses has not been studied. In this study, we examined whether POH suppresses Ag-induced immune responses with a mouse model of allergic airway inflammation. POH treatment of sensitized mice suppressed proliferation and cytokine production in Ag-stimulated spleen cells or CD4{sup +} T cells. Further, sensitized mice received aerosolized OVA to induce allergic airway inflammation, and some mice received POH treatment. POH significantly suppressed indicators of allergic airway inflammation such as airway eosinophilia. Cytokine production in thoracic lymph nodes was also significantly suppressed. These results demonstrate that POH suppresses antigen-induced immune responses in the lung. Considering that it exists naturally, POH could be a novel preventive or therapeutic option for immunologic lung disorders such as asthma with minimal side effects.« less

  7. Activating transcription factor 4 underlies the pathogenesis of arsenic trioxide-mediated impairment of macrophage innate immune functions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Srivastava, Ritesh K.; Li, Changzhao

    Chronic arsenic exposure to humans is considered immunosuppressive with augmented susceptibility to several infectious diseases. The exact molecular mechanisms, however, remain unknown. Earlier, we showed the involvement of unfolded protein response (UPR) signaling in arsenic-mediated impairment of macrophage functions. Here, we show that activating transcription factor 4 (ATF4), a UPR transcription factor, regulates arsenic trioxide (ATO)-mediated dysregulation of macrophage functions. In ATO-treated ATF4{sup +/+} wild-type mice, a significant down-regulation of CD11b expression was associated with the reduced phagocytic functions of peritoneal and lung macrophages. This severe immuno-toxicity phenotype was not observed in ATO-treated ATF4{sup +/−} heterozygous mice. To confirm thesemore » observations, we demonstrated in Raw 264.7 cells that ATF4 knock-down rescues ATO-mediated impairment of macrophage functions including cytokine production, bacterial engulfment and clearance of engulfed bacteria. Sustained activation of ATF4 by ATO in macrophages induces apoptosis, while diminution of ATF4 expression protects against ATO-induced apoptotic cell death. Raw 264.7 cells treated with ATO also manifest dysregulated Ca{sup ++} homeostasis. ATO induces Ca{sup ++}-dependent calpain-1 and caspase-12 expression which together regulated macrophage apoptosis. Additionally, apoptosis was also induced by mitochondria-regulated pathway. Restoring ATO-impaired Ca{sup ++} homeostasis in ER/mitochondria by treatments with the inhibitors of inositol 1,4,5-trisphosphate receptor (IP3R) and voltage-dependent anion channel (VDAC) attenuate innate immune functions of macrophages. These studies identify a novel role for ATF4 in underlying pathogenesis of macrophage dysregulation and immuno-toxicity of arsenic. - Highlights: • ATF4 regulates arsenic-mediated impairment in macrophage functions. • Arsenic-mediated alterations in pulmonary macrophage are diminished in ATF4{sup +/

  8. A modified live canine parvovirus vaccine. II. Immune response.

    PubMed

    Carmichael, L E; Joubert, J C; Pollock, R V

    1983-01-01

    The safety and efficacy of an attenuated canine parvovirus (A-CPV) vaccine was evaluated in both experimental and in field dogs. After parenteral vaccination, seronegative dogs developed hemagglutination-inhibition (HI) antibody titers as early as postvaccination (PV) day 2. Maximal titers occurred within 1 week. Immunity was associated with the persistence of HI antibody titers (titers greater than 80) that endured at least 2 years. Immune dogs challenged with virulent CPV did not shed virus in their feces. The A-CPV vaccine did not cause illness alone or in combination with living canine distemper (CD) and canine adenovirus type-2 (CAV-2) vaccines, nor did it interfere with the immune response to the other viruses. A high rate (greater than 98%) of immunity was engendered in seronegative pups. In contrast, maternal antibody interfered with the active immune response to the A-CPV. More than 95% of the dogs with HI titers less than 10 responded to the vaccine, but only 50% responded when titers were approximately 20. No animal with a titer greater than 80 at the time of vaccination became actively immunized. Susceptibility to virulent CPV during that period when maternal antibody no longer protects against infection, but still prevents active immunization, is the principal cause of vaccinal failure in breeding kennels where CPV is present. Reduction, but not complete elimination, of CPV disease in large breeding kennels occurred within 1-2 months of instituting an A-CPV vaccination program.

  9. Mesenchymal stem cells: a double-edged sword in regulating immune responses

    PubMed Central

    Li, W; Ren, G; Huang, Y; Su, J; Han, Y; Li, J; Chen, X; Cao, K; Chen, Q; Shou, P; Zhang, L; Yuan, Z-R; Roberts, A I; Shi, S; Le, A D; Shi, Y

    2012-01-01

    Mesenchymal stem cells (MSCs) have been employed successfully to treat various immune disorders in animal models and clinical settings. Our previous studies have shown that MSCs can become highly immunosuppressive upon stimulation by inflammatory cytokines, an effect exerted through the concerted action of chemokines and nitric oxide (NO). Here, we show that MSCs can also enhance immune responses. This immune-promoting effect occurred when proinflammatory cytokines were inadequate to elicit sufficient NO production. When inducible nitric oxide synthase (iNOS) production was inhibited or genetically ablated, MSCs strongly enhance T-cell proliferation in vitro and the delayed-type hypersensitivity response in vivo. Furthermore, iNOS−/− MSCs significantly inhibited melanoma growth. It is likely that in the absence of NO, chemokines act to promote immune responses. Indeed, in CCR5−/−CXCR3−/− mice, the immune-promoting effect of iNOS−/− MSCs is greatly diminished. Thus, NO acts as a switch in MSC-mediated immunomodulation. More importantly, the dual effect on immune reactions was also observed in human MSCs, in which indoleamine 2,3-dioxygenase (IDO) acts as a switch. This study provides novel information about the pathophysiological roles of MSCs. PMID:22421969

  10. Immune Response in Microgravity: Genetic Basis and Countermeasure Development Implications

    NASA Technical Reports Server (NTRS)

    Risin, Diana; Ward, Nancy E.; Risin, Semyon A.; Pellis, Neal R.

    2006-01-01

    Impairment of the immunity in astronauts and cosmonauts even in shortterm flights is a recognized risk. Longterm orbital space missions and anticipated interplanetary flights increase the concern for more pronounced effects on the immune system with potential clinical consequences. Studies in true and modeled microgravity (MG) have demonstrated that MG directly affects numerous lymphocyte functions. The purpose of this study was to screen for genes involved in lymphocytes response to modeled microgravity (MMG) that could explain the functional and structural changes observed earlier. The microgravity-induced changes in gene expression were analyzed by microarray DNA chip technology. CD3and IL2activated Tcells were cultured in 1g (static) and modeled microgravity (NASA Rotating Wall Vessel bioreactor) conditions for 24 hours. Total RNA was extracted using the RNeasy isolation kit (Qiagen, Valencia, CA). Microarray experiments were performed utilizing Affymetrix Gene Chips (U133A), allowing testing for 18,400 human genes. To decrease the biological variation and aid in detecting microgravity-associated changes, experiments were performed in triplicate using cells obtained from three different donors. Exposure to modeled microgravity resulted in alteration of 89 genes, 10 of which were upregulated and 79 down-regulated. Altered genes were categorized by their function, structural role and by association with metabolic and regulatory pathways. A large proportion was found to be involved in fundamental cellular processes: signal transduction, DNA repair, apoptosis, and multiple metabolic pathways. There was a group of genes directly related to immune and inflammatory responses (IL7R, granulysin, proteasome activator subunit 2, peroxiredoxin 4, HLADRA, lymphocyte antigen 75, IL18R and DOCK2 genes). Among these genes only one (IL7R) was upregulated, the rest were downregulated. The upregulation of the IL7 receptor gene was confirmed by RT PCR. Three genes with altered

  11. Aberrant in Vivo T Helper Type 2 Cell Response and Impaired Eosinophil Recruitment in Cc Chemokine Receptor 8 Knockout Mice

    PubMed Central

    Chensue, Stephen W.; Lukacs, Nicholas W.; Yang, Tong-Yuan; Shang, Xiaozhou; Frait, Kirsten A.; Kunkel, Steven L.; Kung, Ted; Wiekowski, Maria T.; Hedrick, Joseph A.; Cook, Donald N.; Zingoni, Alessandra; Narula, Satwant K.; Zlotnik, Albert; Barrat, Franck J.; O'Garra, Anne; Napolitano, Monica; Lira, Sergio A.

    2001-01-01

    Chemokine receptors transduce signals important for the function and trafficking of leukocytes. Recently, it has been shown that CC chemokine receptor (CCR)8 is selectively expressed by Th2 subsets, but its functional relevance is unclear. To address the biological role of CCR8, we generated CCR8 deficient (−/−) mice. Here we report defective T helper type 2 (Th2) immune responses in vivo in CCR8−/− mice in models of Schistosoma mansoni soluble egg antigen (SEA)-induced granuloma formation as well as ovalbumin (OVA)- and cockroach antigen (CRA)-induced allergic airway inflammation. In these mice, the response to SEA, OVA, and CRA showed impaired Th2 cytokine production that was associated with aberrant type 2 inflammation displaying a 50 to 80% reduction in eosinophils. In contrast, a prototypical Th1 immune response, elicited by Mycobacteria bovis purified protein derivative (PPD) was unaffected by CCR8 deficiency. Mechanistic analyses indicated that Th2 cells developed normally and that the reduction in eosinophil recruitment was likely due to systemic reduction in interleukin 5. These results indicate an important role for CCR8 in Th2 functional responses in vivo. PMID:11238588

  12. Innate immune responses following Kawasaki disease and toxic shock syndrome

    PubMed Central

    Messina, Nicole; Germano, Susie; Bonnici, Rhian; Freyne, Bridget; Cheung, Michael; Goldsmith, Greta; Kollmann, Tobias R.; Levin, Michael; Burgner, David; Curtis, Nigel

    2018-01-01

    The pathogenesis of Kawasaki disease (KD) remains unknown and there is accumulating evidence for the importance of the innate immune system in initiating and mediating the host inflammatory response. We compared innate immune responses in KD and toxic shock syndrome (TSS) participants more than two years after their acute illness with control participants to investigate differences in their immune phenotype. Toxic shock syndrome shares many clinical features with KD; by including both disease groups we endeavoured to explore changes in innate immune responses following acute inflammatory illnesses more broadly. We measured the in vitro production of interferon (IFN)-γ, tumour necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, IL-1 receptor antagonist (IL-1ra), and IL-10 following whole blood stimulation with toll-like receptor and inflammasome ligands in 52 KD, 20 TSS, and 53 control participants in a case-control study. Analyses were adjusted for age, sex, and unstimulated cytokine concentrations. Compared to controls, KD participants have reduced IL-1ra production in response to stimulation with double stranded RNA (geometric mean ratio (GMR) 0.37, 95% CI 0.15, 0.89, p = 0.03) and increased IL-6 production in response to incubation with Lyovec™ (GMR 5.48, 95% CI 1.77, 16.98, p = 0.004). Compared to controls, TSS participants have increased IFN-γ production in response to peptidoglycan (GMR 4.07, 95% CI 1.82, 9.11, p = 0.001), increased IL-1β production to lipopolysaccharide (GMR 1.64, 95% CI 1.13, 2.38, p = 0.01) and peptidoglycan (GMR 1.61, 95% CI 1.11, 2.33, p = 0.01), and increased IL-6 production to peptidoglycan (GMR 1.45, 95% CI 1.10, 1.92, p = 0.01). Years following the acute illness, individuals with previous KD or TSS exhibit a pro-inflammatory innate immune phenotype suggesting a possible underlying immunological susceptibility or innate immune memory. PMID:29447181

  13. Innate immune responses following Kawasaki disease and toxic shock syndrome.

    PubMed

    Chen, Katherine Y H; Messina, Nicole; Germano, Susie; Bonnici, Rhian; Freyne, Bridget; Cheung, Michael; Goldsmith, Greta; Kollmann, Tobias R; Levin, Michael; Burgner, David; Curtis, Nigel

    2018-01-01

    The pathogenesis of Kawasaki disease (KD) remains unknown and there is accumulating evidence for the importance of the innate immune system in initiating and mediating the host inflammatory response. We compared innate immune responses in KD and toxic shock syndrome (TSS) participants more than two years after their acute illness with control participants to investigate differences in their immune phenotype. Toxic shock syndrome shares many clinical features with KD; by including both disease groups we endeavoured to explore changes in innate immune responses following acute inflammatory illnesses more broadly. We measured the in vitro production of interferon (IFN)-γ, tumour necrosis factor (TNF)-α, interleukin (IL)-1β, IL-6, IL-1 receptor antagonist (IL-1ra), and IL-10 following whole blood stimulation with toll-like receptor and inflammasome ligands in 52 KD, 20 TSS, and 53 control participants in a case-control study. Analyses were adjusted for age, sex, and unstimulated cytokine concentrations. Compared to controls, KD participants have reduced IL-1ra production in response to stimulation with double stranded RNA (geometric mean ratio (GMR) 0.37, 95% CI 0.15, 0.89, p = 0.03) and increased IL-6 production in response to incubation with Lyovec™ (GMR 5.48, 95% CI 1.77, 16.98, p = 0.004). Compared to controls, TSS participants have increased IFN-γ production in response to peptidoglycan (GMR 4.07, 95% CI 1.82, 9.11, p = 0.001), increased IL-1β production to lipopolysaccharide (GMR 1.64, 95% CI 1.13, 2.38, p = 0.01) and peptidoglycan (GMR 1.61, 95% CI 1.11, 2.33, p = 0.01), and increased IL-6 production to peptidoglycan (GMR 1.45, 95% CI 1.10, 1.92, p = 0.01). Years following the acute illness, individuals with previous KD or TSS exhibit a pro-inflammatory innate immune phenotype suggesting a possible underlying immunological susceptibility or innate immune memory.

  14. Nanotechnology, neuromodulation & the immune response: discourse, materiality & ethics.

    PubMed

    Fins, Joseph J

    2015-04-01

    Drawing upon the American Pragmatic tradition in philosophy and the more recent work of philosopher Karen Barad, this paper examines how scientific problems are both obscured, and resolved by our use of language describing the natural world. Using the example of the immune response engendered by neural implants inserted in the brain, the author explains how this discourse has been altered by the advent of nanotechnology methods and devices which offer putative remedies that might temper the immune response in the central nervous system. This emergent nanotechnology has altered this problem space and catalyzed one scientific community to acknowledge a material reality that was always present, if not fully acknowledged.

  15. A Cognitive Computational Model Inspired by the Immune System Response

    PubMed Central

    Abdo Abd Al-Hady, Mohamed; Badr, Amr Ahmed; Mostafa, Mostafa Abd Al-Azim

    2014-01-01

    The immune system has a cognitive ability to differentiate between healthy and unhealthy cells. The immune system response (ISR) is stimulated by a disorder in the temporary fuzzy state that is oscillating between the healthy and unhealthy states. However, modeling the immune system is an enormous challenge; the paper introduces an extensive summary of how the immune system response functions, as an overview of a complex topic, to present the immune system as a cognitive intelligent agent. The homogeneity and perfection of the natural immune system have been always standing out as the sought-after model we attempted to imitate while building our proposed model of cognitive architecture. The paper divides the ISR into four logical phases: setting a computational architectural diagram for each phase, proceeding from functional perspectives (input, process, and output), and their consequences. The proposed architecture components are defined by matching biological operations with computational functions and hence with the framework of the paper. On the other hand, the architecture focuses on the interoperability of main theoretical immunological perspectives (classic, cognitive, and danger theory), as related to computer science terminologies. The paper presents a descriptive model of immune system, to figure out the nature of response, deemed to be intrinsic for building a hybrid computational model based on a cognitive intelligent agent perspective and inspired by the natural biology. To that end, this paper highlights the ISR phases as applied to a case study on hepatitis C virus, meanwhile illustrating our proposed architecture perspective. PMID:25003131

  16. Evidence of functional cell-mediated immune responses to nontypeable Haemophilus influenzae in otitis-prone children

    PubMed Central

    Seppanen, Elke; Tan, Dino; Corscadden, Karli J.; Currie, Andrew J.; Richmond, Peter C.; Thornton, Ruth B.

    2018-01-01

    Otitis media (OM) remains a common paediatric disease, despite advances in vaccinology. Susceptibility to recurrent acute OM (rAOM) has been postulated to involve defective cell-mediated immune responses to common otopathogenic bacteria. We compared the composition of peripheral blood mononuclear cells (PBMC) from 20 children with a history of rAOM (otitis-prone) and 20 healthy non-otitis-prone controls, and assessed innate and cell-mediated immune responses to the major otopathogen nontypeable Haemophilus influenzae (NTHi). NTHi was a potent stimulator of inflammatory cytokine secretion from PBMC within 4 hours, with no difference in cytokine levels produced between PBMC from cases or controls. In the absence of antigen stimulation, otitis-prone children had more circulating Natural Killer (NK) cells (p<0.01), particularly NKdim (CD56lo) cells (p<0.01), but fewer CD4+ T cells (p<0.01) than healthy controls. NTHi challenge significantly increased the proportion of activated (CD107a+) NK cells in otitis-prone and non-otitis-prone children (p<0.01), suggesting that NK cells from otitis-prone children are functional and respond to NTHi. CD8+ T cells and NK cells from both cases and controls produced IFNγ in response to polyclonal stimulus (Staphylococcal enterotoxin B; SEB), with more IFNγ+ CD8+ T cells present in cases than controls (p<0.05) but similar proportions of IFNγ+ NK cells. Otitis-prone children had more circulating IFNγ-producing NK cells (p<0.05) and more IFNγ-producing CD4+ (p<0.01) or CD8+ T-cells (p<0.05) than healthy controls. In response to SEB, more CD107a-expressing CD8+ T cells were present in cases than controls (p<0.01). Despite differences in PBMC composition, PBMC from otitis-prone children mounted innate and T cell-mediated responses to NTHi challenge that were comparable to healthy children. These data provide evidence that otitis-prone children do not have impaired functional cell mediated immunity. PMID:29621281

  17. Humoral Immune Responses to Pneumocystis jirovecii Antigens in HIV-Infected and Uninfected Young Children with Pneumocystis Pneumonia

    PubMed Central

    Djawe, Kpandja; Daly, Kieran R.; Walzer, Peter D.

    2013-01-01

    Background Humoral immune responses in human immunodeficiency virus (HIV)-infected and uninfected children with Pneumocystis pneumonia (PcP) are poorly understood. Methods Consecutive children hospitalized with acute pneumonia, tachypnea, and hypoxia in South Africa were investigated for PcP, which was diagnosed by real-time polymerase chain reaction on lower respiratory tract specimens. Serum antibody responses to recombinant fragments of the carboxyl terminus of Pneumocystis jirovecii major surface glycoprotein (MsgC) were analyzed. Results 149 children were enrolled of whom 96 (64%) were HIV-infected. PcP occurred in 69 (72%) of HIV-infected and 14 (26%) of HIV-uninfected children. HIV-infected children with PcP had significantly decreased IgG antibodies to MsgC compared to HIV-infected patients without PcP, but had similar IgM antibodies. In contrast, HIV-uninfected children with PcP showed no change in IgG antibodies to MsgC, but had significantly increased IgM antibodies compared to HIV-uninfected children without PCP. Age was an independent predictor of high IgG antibodies, whereas PcP was a predictor of low IgG antibodies and high IgM antibodies. IgG and IgM antibody levels to the most closely related MsgC fragments were predictors of survival from PcP. Conclusions Young HIV-infected children with PcP have significantly impaired humoral immune responses to MsgC, whereas HIV-uninfected children with PcP can develop active humoral immune responses. The children also exhibit a complex relationship between specific host factors and antibody levels to MsgC fragments that may be related to survival from PcP. PMID:24386119

  18. HIV-TB coinfection impairs CD8(+) T-cell differentiation and function while dehydroepiandrosterone improves cytotoxic antitubercular immune responses.

    PubMed

    Suarez, Guadalupe V; Angerami, Matías T; Vecchione, María B; Laufer, Natalia; Turk, Gabriela; Ruiz, Maria J; Mesch, Viviana; Fabre, Bibiana; Maidana, Patricia; Ameri, Diego; Cahn, Pedro; Sued, Omar; Salomón, Horacio; Bottasso, Oscar A; Quiroga, María F

    2015-09-01

    Tuberculosis (TB) is the leading cause of death among HIV-positive patients. The decreasing frequencies of terminal effector (TTE ) CD8(+) T cells may increase reactivation risk in persons latently infected with Mycobacterium tuberculosis (Mtb). We have previously shown that dehydroepiandrosterone (DHEA) increases the protective antitubercular immune responses in HIV-TB patients. Here, we aimed to study Mtb-specific cytotoxicity, IFN-γ secretion, memory status of CD8(+) T cells, and their modulation by DHEA during HIV-TB coinfection. CD8(+) T cells from HIV-TB patients showed a more differentiated phenotype with diminished naïve and higher effector memory and TTE T-cell frequencies compared to healthy donors both in total and Mtb-specific CD8(+) T cells. Notably, CD8(+) T cells from HIV-TB patients displayed higher Terminal Effector (TTE ) CD45RA(dim) proportions with lower CD45RA expression levels, suggesting a not fully differentiated phenotype. Also, PD-1 expression levels on CD8(+) T cells from HIV-TB patients increased although restricted to the CD27(+) population. Interestingly, DHEA plasma levels positively correlated with TTE in CD8(+) T cells and in vitro DHEA treatment enhanced Mtb-specific cytotoxic responses and terminal differentiation in CD8(+) T cells from HIV-TB patients. Our data suggest that HIV-TB coinfection promotes a deficient CD8(+) T-cell differentiation, whereas DHEA may contribute to improving antitubercular immunity by enhancing CD8(+) T-cell functions during HIV-TB coinfection. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Angiotensin converting enzyme over expression in myelocytes enhances the immune response

    PubMed Central

    Bernstein, Kenneth E.; Gonzalez-Villalobos, Romer A.; Giani, Jorge F.; Shah, Kandarp; Bernstein, Ellen; Janjulia, Tea; Koronyo, Yosef; Shi, Peng D.; Koronyo-Hamaoui, Maya; Fuchs, Sebastien; Shen, Xiao Z.

    2015-01-01

    Angiotensin converting enzyme (ACE) plays an important role in blood pressure control. ACE also has effects on renal function, reproduction, hematopoiesis and several aspects of the immune response. ACE 10/10 mice over express ACE in monocytic cells; macrophages from ACE 10/10 mice demonstrate increased polarization towards a proinflammatory phenotype. As a result, ACE 10/10 mice have a highly effective immune response following challenge with either melanoma, bacterial infection or Alzheimer’s disease. The ACE 10/10 mice suggest that enhanced monocytic function greatly contributes to the ability of the immune response to defend against a wide variety of antigenic and non-antigenic challenges. PMID:24633750

  20. Induction of the immune response suppression in mice inoculated with Candida albicans.

    PubMed

    Valdez, J C; Mesón, D E; Sirena, A; de Petrino, S F; Eugenia, M; de Jorrat, B B; de Valdex, M G

    1986-03-01

    There is a controversy in respect to the immunological response (humoral or cellular) concerning the defense against Candida albicans. Candidosis would induce sub-populations of suppressor cells in the host cell-immune response. This report tries to show the effect of different doses of C. albicans (alive or heat-killed) on the expression of cell-mediated and humoral immunity. The effect upon cell immunity was determined by inoculating different lots of singeneic mice, doses of varied concentration of C. albicans and checking for delayed-type hipersensitivity (D.T.H.). D.T.H. was also controlled in syngeneic normal mice which had previously been injected with inoculated mice spleen cells. Humoral immunity was assayed by measuring the induced blastogenesis by Pokeweed Mitogen on spleen mononuclear cells with different doses of C. albicans. Results obtained show that the different doses gave origin to: Suppression of humoral and cell response (10(8) alive); Suppression of only humoral response (10(6) alive); Suppression of cell response and increase of humoral response (10(9) dead); Increase of both responses (10(8) dead).

  1. Mitochondrial dysfunction as a trigger of innate immune responses and inflammation.

    PubMed

    West, A Phillip

    2017-11-01

    A growing literature indicates that mitochondria are key participants in innate immune pathways, functioning as both signaling platforms and contributing to effector responses. In addition to regulating antiviral signaling and antibacterial immunity, mitochondria are also important drivers of inflammation caused by sterile injury. Much research on mitochondrial control of immunity now centers on understanding how mitochondrial constituents released during cellular damage simulate the innate immune system. When mitochondrial integrity is compromised, mitochondrial damage-associated molecular patterns engage pattern recognition receptors, trigger inflammation, and promote pathology in an expanding list of diseases. Here, I review the emerging knowledge of mitochondrial dysfunction in innate immune responses and discuss how environmental exposures may induce mitochondrial damage to potentiate inflammation and human disease. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Immune system development during early childhood in tropical Latin America: evidence for the age-dependent down regulation of the innate immune response.

    PubMed

    Teran, Rommy; Mitre, Edward; Vaca, Maritza; Erazo, Silvia; Oviedo, Gisela; Hübner, Marc P; Chico, Martha E; Mattapallil, Joseph J; Bickle, Quentin; Rodrigues, Laura C; Cooper, Philip J

    2011-03-01

    The immune response that develops in early childhood underlies the development of inflammatory diseases such as asthma and there are few data from tropical Latin America (LA). This study investigated the effects of age on the development of immunity during the first 5 years of life by comparing innate and adaptive immune responses in Ecuadorian children aged 6-9 months, 22-26 months, and 48-60 months. Percentages of naïve CD4+ T cells declined with age while those of memory CD4(+) and CD8(+) T cells increased indicating active development of the immune system throughout the first five years. Young infants had greater innate immune responses to TLR agonists compared to older children while regulatory responses including SEB-induced IL-10 and percentages of FoxP3(+) T-regulatory cells decreased with age. Enhanced innate immunity in early life may be important for host defense against pathogens but may increase the risk of immunopathology. Copyright © 2010 Elsevier Inc. All rights reserved.

  3. Surviving Sepsis: Taming a Deadly Immune Response

    MedlinePlus

    ... Issues Subscribe August 2014 Print this issue Surviving Sepsis Taming a Deadly Immune Response En español Send ... Mouth? Looking at Lupus Wise Choices Signs of Sepsis Sepsis can be hard to spot, because its ...

  4. The influence of the microbiota on the immune response to transplantation

    PubMed Central

    Bartman, Caroline; Chong, Anita S.; Alegre, Maria-Luisa

    2015-01-01

    Purpose of review In the past decade, appreciation of the important effects of commensal microbes on immunity has grown exponentially. The effect of the microbiota on transplantation has only recently begun to be explored; however, our understanding of the mechanistic details of host-microbe interactions is still lacking. Recent findings It has become clear that transplantation is associated with changes in the microbiota in many different settings although what clinical events and therapeutic interventions contribute to these changes remains to be parsed out. Research groups have begun to identify associations between specific communities of organisms and transplant outcomes but it remains to be established whether microbial changes precede or follow transplant rejection episodes. Finally, results from continuing exploration of basic mechanisms by which microbial communities affect innate and adaptive immunity in various animal models of disease continues to inform research on the microbiota’s effects on immune responses against transplanted organs. Summary Commensal microbes may alter immune responses to organ transplantation, but direct experiments are only beginning in the field to identify species and immune pathways responsible for these putative effects. PMID:25563985

  5. Respiratory tract immune response to microbial pathogens.

    PubMed

    Wilkie, B N

    1982-11-15

    Effective resistance to respiratory tract infection depends principally on specific immunity on mucosal surfaces of the upper or lower respiratory tract. Respiratory tract immune response comprises antibody and cell-mediated systems and may be induced most readily by surface presentation of replicating agents but can result from parenteral or local presentation of highly immunogenic antigens. Upper and lower respiratory tract systems differ in immunologic competence, with the lungs having a greater inventory of protective mechanisms than the trachea or nose. Several effective vaccines have been developed for prevention or modification of respiratory tract diseases.

  6. Masking of antigenic epitopes by antibodies shapes the humoral immune response to influenza

    PubMed Central

    Zarnitsyna, Veronika I.; Ellebedy, Ali H.; Davis, Carl; Jacob, Joshy; Ahmed, Rafi; Antia, Rustom

    2015-01-01

    The immune responses to influenza, a virus that exhibits strain variation, show complex dynamics where prior immunity shapes the response to the subsequent infecting strains. Original antigenic sin (OAS) describes the observation that antibodies to the first encountered influenza strain, specifically antibodies to the epitopes on the head of influenza's main surface glycoprotein, haemagglutinin (HA), dominate following infection with new drifted strains. OAS suggests that responses to the original strain are preferentially boosted. Recent studies also show limited boosting of the antibodies to conserved epitopes on the stem of HA, which are attractive targets for a ‘universal vaccine’. We develop multi-epitope models to explore how pre-existing immunity modulates the immune response to new strains following immunization. Our models suggest that the masking of antigenic epitopes by antibodies may play an important role in describing the complex dynamics of OAS and limited boosting of antibodies to the stem of HA. Analysis of recently published data confirms model predictions for how pre-existing antibodies to an epitope on HA decrease the magnitude of boosting of the antibody response to this epitope following immunization. We explore strategies for boosting of antibodies to conserved epitopes and generating broadly protective immunity to multiple strains. PMID:26194761

  7. Selection for avian immune response: a commercial breeding company challenge.

    PubMed

    Fulton, J E

    2004-04-01

    Selection for immune function in the commercial breeding environment is a challenging proposition for commercial breeding companies. Immune response is only one of many traits that are under intensive selection, thus selection pressure needs to be carefully balanced across multiple traits. The selection environment (single bird cages, biosecure facilities, controlled environment) is a very different environment than the commercial production facilities (multiple bird cages, potential disease exposure, variable environment) in which birds are to produce. The testing of individual birds is difficult, time consuming, and expensive. It is essential that the results of any tests be relevant to actual disease or environmental challenge in the commercial environment. The use of genetic markers as indicators of immune function is being explored by breeding companies. Use of genetic markers would eliminate many of the limitations in enhancing immune function currently encountered by commercial breeding companies. Information on genetic markers would allow selection to proceed without subjecting breeding stock to disease conditions and could be done before production traits are measured. These markers could be candidate genes with known interaction or involvement with disease pathology or DNA markers that are closely linked to genetic regions that influence the immune response. The current major limitation to this approach is the paucity of mapped chicken immune response genes and the limited number of DNA markers mapped on the chicken genome. These limitations should be eliminated once the chicken genome is sequenced.

  8. Reprint of "fish immunity to scuticociliate parasites".

    PubMed

    Piazzon, María Carla; Leiro, José; Lamas, Jesús

    2014-04-01

    Some species of scuticociliates (Ciliophora) behave as facultative parasites and produce severe mortalities in cultured fish. Pathogenic scuticociliates can cause surface lesions and can also penetrate inside the body, where they feed on tissue and proliferate in the blood and most internal organs, killing the host in a few days. In this review, we describe the current knowledge on the protective role of fish cellular and humoral immune responses against these parasites. Immune humoral factors, especially complement, are of particular importance in defending fish against these ciliates. However, knowledge about how the fish immune system responds to scuticociliates is scant, and the cellular and molecular events that occur during the response are not known. We also describe the possible mechanisms used by scuticociliates to avoid or resist the defensive reaction of the host. For example, the release of proteases can help parasites enter fish tissues and impair the fish cellular and humoral responses. Several vaccine formulations containing scuticociliates have induced a good antibody response and protection in fish immunized and challenged with homologous strains of particular species. However, protection was not achieved in fish immunized and challenged with heterologous strains, and the antigens involved in protection and the antigenic differences between heterologous strains have not yet been determined. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Rheumatoid arthritis patients exhibit impaired Candida albicans-specific Th17 responses.

    PubMed

    Bishu, Shrinivas; Su, Ee Wern; Wilkerson, Erich R; Reckley, Kelly A; Jones, Donald M; McGeachy, Mandy J; Gaffen, Sarah L; Levesque, Marc C

    2014-02-11

    Accumulating data implicate the CD4+ T cell subset (Th17 cells) in rheumatoid arthritis (RA). IL-17 is an inflammatory cytokine that induces tumor necrosis factor (TNF)α, IL-1β and IL-6, all of which are targets of biologic therapies used to treat RA. RA patients are well documented to experience more infections than age-matched controls, and biologic therapies further increase the risk of infection. The Th17/IL-17 axis is vital for immunity to fungi, especially the commensal fungus Candida albicans. Therefore, we were prompted to examine the relationship between RA and susceptibility to C. albicans because of the increasing interest in Th17 cells and IL-17 in driving autoimmunity, and the advent of new biologics that target this pathway. We analyzed peripheral blood and saliva from 48 RA and 33 healthy control subjects. To assess C. albicans-specific Th17 responses, PBMCs were co-cultured with heat-killed C. albicans extract, and IL-17A levels in conditioned supernatants were measured by ELISA. The frequency of Th17 and Th1 cells was determined by flow cytometry. As a measure of IL-17A-mediated effector responses, we evaluated C. albicans colonization rates in the oral cavity, salivary fungicidal activity and levels of the antimicrobial peptide β-defensin 2 (BD2) in saliva. Compared to controls, PBMCs from RA subjects exhibited elevated baseline production of IL-17A (P = 0.004), although they had similar capacity to produce IL-17A in response to Th17 cell differentiating cytokines (P = 0.91). However RA PBMCs secreted less IL-17A in response to C. albicans antigens (P = 0.006). Significantly more RA patients were colonized with C. albicans in the oral cavity than healthy subjects (P = 0.02). Concomitantly, RA saliva had reduced concentrations of salivary BD2 (P = 0.02). Nonetheless, salivary fungicidal activity was preserved in RA subjects (P = 0.70). RA subjects exhibit detectable impairments in oral immune responses to C. albicans, a

  10. Differential Immune Responses to New World and Old World Mammalian Arenaviruses

    PubMed Central

    Ly, Hinh

    2017-01-01

    Some New World (NW) and Old World (OW) mammalian arenaviruses are emerging, zoonotic viruses that can cause lethal hemorrhagic fever (HF) infections in humans. While these are closely related RNA viruses, the infected hosts appear to mount different types of immune responses against them. Lassa virus (LASV) infection, for example, results in suppressed immune function in progressive disease stage, whereas patients infected with Junín virus (JUNV) develop overt pro-inflammatory cytokine production. These viruses have also evolved different molecular strategies to evade host immune recognition and activation. This paper summarizes current progress in understanding the differential immune responses to pathogenic arenaviruses and how the information can be exploited toward the development of vaccines against them. PMID:28498311

  11. Evasion of adaptive and innate immune response mechanisms by γ-herpesviruses

    PubMed Central

    Feng, Pinghui; Moses, Ashlee; Früh, Klaus

    2015-01-01

    γ-Herpesviral immune evasion mechanisms are optimized to support the acute, lytic and the longterm, latent phase of infection. During acute infection, specific immune modulatory proteins limit, but also exploit, the antiviral activities of cell intrinsic innate immune responses as well as those of innate and adaptive immune cells. During latent infection, a restricted gene expression program limits immune targeting and cis-acting mechanisms to reduce the antigen presentation as well as antigenicity of latency-associated proteins. Here, we will review recent progress in our understanding of γ-herpesviral immune evasion strategies. PMID:23735334

  12. Induction of complex immune responses and strong protection against retrovirus challenge by adenovirus-based immunization depends on the order of vaccine delivery.

    PubMed

    Kaulfuß, Meike; Wensing, Ina; Windmann, Sonja; Hrycak, Camilla Patrizia; Bayer, Wibke

    2017-02-06

    In the Friend retrovirus mouse model we developed potent adenovirus-based vaccines that were designed to induce either strong Friend virus GagL 85-93 -specific CD8 + T cell or antibody responses, respectively. To optimize the immunization outcome we evaluated vaccination strategies using combinations of these vaccines. While the vaccines on their own confer strong protection from a subsequent Friend virus challenge, the simple combination of the vaccines for the establishment of an optimized immunization protocol did not result in a further improvement of vaccine effectivity. We demonstrate that the co-immunization with GagL 85-93 /leader-gag encoding vectors together with envelope-encoding vectors abrogates the induction of GagL 85-93 -specific CD8 + T cells, and in successive immunization protocols the immunization with the GagL 85-93 /leader-gag encoding vector had to precede the immunization with an envelope encoding vector for the efficient induction of GagL 85-93 -specific CD8 + T cells. Importantly, the antibody response to envelope was in fact enhanced when the mice were adenovirus-experienced from a prior immunization, highlighting the expedience of this approach. To circumvent the immunosuppressive effect of envelope on immune responses to simultaneously or subsequently administered immunogens, we developed a two immunizations-based vaccination protocol that induces strong immune responses and confers robust protection of highly Friend virus-susceptible mice from a lethal Friend virus challenge.

  13. The immune system: a target for functional foods?

    PubMed

    Calder, Philip C; Kew, Samantha

    2002-11-01

    The immune system acts to protect the host from infectious agents that exist in the environment (bacteria, viruses, fungi, parasites) and from other noxious insults. The immune system is constantly active, acting to discriminate 'non-self' from 'self'. The immune system has two functional divisions: the innate and the acquired. Both components involve various blood-borne factors (complement, antibodies, cytokines) and cells. A number of methodologies exist to assess aspects of immune function; many of these rely upon studying cells in culture ex vivo. There are large inter-individual variations in many immune functions even among the healthy. Genetics, age, gender, smoking habits, habitual levels of exercise, alcohol consumption, diet, stage in the female menstrual cycle, stress, history of infections and vaccinations, and early life experiences are likely to be important contributors to the observed variation. While it is clear that individuals with immune responses significantly below 'normal' are more susceptible to infectious agents and exhibit increased infectious morbidity and mortality, it is not clear how the variation in immune function among healthy individuals relates to variation in susceptibility to infection. Nutrient status is an important factor contributing to immune competence: undernutrition impairs the immune system, suppressing immune functions that are fundamental to host protection. Undernutrition leading to impairment of immune function can be due to insufficient intake of energy and macronutrients and/or due to deficiencies in specific micronutrients. Often these occur in combination. Nutrients that have been demonstrated (in either animal or human studies) to be required for the immune system to function efficiently include essential amino acids, the essential fatty acid linoleic acid, vitamin A, folic acid, vitamin B6, vitamin B12, vitamin C, vitamin E, Zn, Cu, Fe and Se. Practically all forms of immunity may be affected by deficiencies

  14. Oral immunization of mice with transgenic tomato fruit expressing respiratory syncytial virus-F protein induces a systemic immune response.

    PubMed

    Sandhu, J S; Krasnyanski, S F; Domier, L L; Korban, S S; Osadjan, M D; Buetow, D E

    2000-04-01

    Respiratory syncytial virus (RSV) is one of the most important pathogens of infancy and early childhood. Here a fruit-based edible subunit vaccine against RSV was developed by expressing the RSV fusion (F) protein gene in transgenic tomato plants. The F-gene was expressed in ripening tomato fruit under the control of the fruit-specific E8 promoter. Oral immunization of mice with ripe transgenic tomato fruits led to the induction of both serum and mucosal RSV-F specific antibodies. The ratio of immunoglobulin subclasses produced in response to immunization suggested that a type 1 T-helper cell immune response was preferentially induced. Serum antibodies showed an increased titer when the immunized mice were exposed to inactivated RSV antigen.

  15. Differential Antagonism of Human Innate Immune Responses by Tick-Borne Phlebovirus Nonstructural Proteins

    PubMed Central

    Rezelj, Veronica V.; Li, Ping; Chaudhary, Vidyanath; Elliott, Richard M.

    2017-01-01

    ABSTRACT In recent years, several newly discovered tick-borne viruses causing a wide spectrum of diseases in humans have been ascribed to the Phlebovirus genus of the Bunyaviridae family. The nonstructural protein (NSs) of bunyaviruses is the main virulence factor and interferon (IFN) antagonist. We studied the molecular mechanisms of IFN antagonism employed by the NSs proteins of human apathogenic Uukuniemi virus (UUKV) and those of Heartland virus (HRTV) and severe fever with thrombocytopenia syndrome virus (SFTSV), both of which cause severe disease. Using reporter assays, we found that UUKV NSs weakly inhibited the activation of the beta interferon (IFN-β) promoter and response elements. UUKV NSs weakly antagonized human IFN-β promoter activation through a novel interaction with mitochondrial antiviral-signaling protein (MAVS), confirmed by coimmunoprecipitation and confocal microscopy studies. HRTV NSs efficiently antagonized both IFN-β promoter activation and type I IFN signaling pathways through interactions with TBK1, preventing its phosphorylation. HRTV NSs exhibited diffused cytoplasmic localization. This is in comparison to the inclusion bodies formed by SFTSV NSs. HRTV NSs also efficiently interacted with STAT2 and impaired IFN-β-induced phosphorylation but did not affect STAT1 or its translocation to the nucleus. Our results suggest that a weak interaction between STAT1 and HRTV or SFTSV NSs may explain their inability to block type II IFN signaling efficiently, thus enabling the activation of proinflammatory responses that lead to severe disease. Our findings offer insights into how pathogenicity may be linked to the capacity of NSs proteins to block the innate immune system and illustrate the plethora of viral immune evasion strategies utilized by emerging phleboviruses. IMPORTANCE Since 2011, there has been a large expansion in the number of emerging tick-borne viruses that have been assigned to the Phlebovirus genus. Heartland virus (HRTV) and

  16. Humoral and Cellular Response in Humans After Immunization with Influenza Vaccine

    PubMed Central

    Ruben, Frederick L.; Jackson, George G.; Gotoff, Samuel P.

    1973-01-01

    The peripheral blood lymphocyte response and hemagglutination inhibition antibody titers were measured in nine adults before and after immunization with a killed split influenza virus vaccine. Cord blood lymphocytes were tested with the influenza antigen to exclude a nonspecific mitogenic effect. All of the subjects demonstrated preexisting antibody titers and antigen recognition by lymphocytes prior to immunization. The in vitro lymphocyte response after vaccination parallels the humoral antibody response to influenza antigen. PMID:4762112

  17. Modulation of Human Immune Response by Fungal Biocontrol Agents

    PubMed Central

    Konstantinovas, Cibele; de Oliveira Mendes, Tiago A.; Vannier-Santos, Marcos A.; Lima-Santos, Jane

    2017-01-01

    Although the vast majority of biological control agents is generally regarded as safe for humans and environment, the increased exposure of agriculture workers, and consumer population to fungal substances may affect the immune system. Those compounds may be associated with both intense stimulation, resulting in IgE-mediated allergy and immune downmodulation induced by molecules such as cyclosporin A and mycotoxins. This review discusses the potential effects of biocontrol fungal components on human immune responses, possibly associated to infectious, inflammatory diseases, and defective defenses. PMID:28217107

  18. Work stress and innate immune response.

    PubMed

    Boscolo, P; Di Gioacchino, M; Reale, M; Muraro, R; Di Giampaolo, L

    2011-01-01

    Several reports highlight the relationship between blood NK cytotoxic activity and life style. Easy life style, including physical activity, healthy dietary habits as well as good mental health are characterized by an efficient immune response. Life style is related to the type of occupational activity since work has a central part in life either as source of income or contributing to represent the social identity. Not only occupational stress, but also job loss or insecurity are thus considered serious stressful situations, inducing emotional disorders which may affect both neuroendocrine and immune systems; reduced reactivity to mitogens and/or decreased blood NK cytotoxic activity was reported in unemployed workers or in those with a high perception of job insecurity and/or job stress. Although genetic factors have a key role in the pathogenesis of autoimmune disorders, occupational stress (as in night shifts) was reported associated to an increased incidence of autoimmune disorders. Monitoring blood NK response may thus be included in the health programs as an indirect index of stressful job and/or poor lifestyle.

  19. The Immune Response to Acute Focal Cerebral Ischemia and Associated Post-stroke Immunodepression: A Focused Review

    PubMed Central

    Famakin, Bolanle M.

    2014-01-01

    It is currently well established that the immune system is activated in response to transient or focal cerebral ischemia. This acute immune activation occurs in response to damage, and injury, to components of the neurovascular unit and is mediated by the innate and adaptive arms of the immune response. The initial immune activation is rapid, occurs via the innate immune response and leads to inflammation. The inflammatory mediators produced during the innate immune response in turn lead to recruitment of inflammatory cells and the production of more inflammatory mediators that result in activation of the adaptive immune response. Under ideal conditions, this inflammation gives way to tissue repair and attempts at regeneration. However, for reasons that are just being understood, immunosuppression occurs following acute stroke leading to post-stroke immunodepression. This review focuses on the current state of knowledge regarding innate and adaptive immune activation in response to focal cerebral ischemia as well as the immunodepression that can occur following stroke. A better understanding of the intricate and complex events that take place following immune response activation, to acute cerebral ischemia, is imperative for the development of effective novel immunomodulatory therapies for the treatment of acute stroke. PMID:25276490

  20. Superficial Immunity: Antimicrobial Responses Are More Than Skin Deep.

    PubMed

    Mack, Madison R; Kim, Brian S

    2016-07-19

    The skin barrier is essential for host defense, but how the skin provides protection when the barrier is breached is not well understood. In this issue of Immunity, Gallo and colleagues report that keratinocytes integrate signals from antimicrobial peptides via MAVS signaling to amplify their antiviral immune response. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Immune Response in Mussels To Environmental Pollution.

    ERIC Educational Resources Information Center

    Pryor, Stephen C.; Facher, Evan

    1997-01-01

    Describes the use of mussels in measuring the extent of chemical contamination and its variation in different coastal regions. Presents an experiment to introduce students to immune response and the effects of environmental pollution on marine organisms. Contains 14 references. (JRH)

  2. Effect of rituximab on human in vivo antibody immune responses.

    PubMed

    Pescovitz, Mark D; Torgerson, Troy R; Ochs, Hans D; Ocheltree, Elizabeth; McGee, Paula; Krause-Steinrauf, Heidi; Lachin, John M; Canniff, Jennifer; Greenbaum, Carla; Herold, Kevan C; Skyler, Jay S; Weinberg, Adriana

    2011-12-01

    B-lymphocyte depletion with rituximab has been shown to benefit patients with various autoimmune diseases. We have previously demonstrated that this benefit is also apparent in patients with newly diagnosed type 1 diabetes. The effect of rituximab on in vivo antibody responses, particularly during the period of B-lymphocyte depletion, is incompletely determined. This study was designed to assess this knowledge void. In patients with recent-onset type 1 diabetes treated with rituximab (n = 46) or placebo (n = 29), antibody responses to neoantigen phiX174 during B-lymphocyte depletion and with hepatitis A (as a second neoantigen) and tetanus/diphtheria (as recall antigens) after B-lymphocyte recovery were studied. Anti- tetanus, diphtheria, mumps, measles, and rubella titers were measured before and after treatment by means of ELISA. Antibody titers and percentage IgM versus percentage IgG to phiX174 were measured by means of phage neutralization. B-lymphocyte subsets were determined by means of flow cytometry. No change occurred in preexisting antibody titers. Tetanus/diphtheria and hepatitis A immunization responses were protective in the rituximab-treated subjects, although significantly blunted compared with those seen in the controls subjects, when immunized at the time of B-lymphocyte recovery. Anti-phiX174 responses were severely reduced during the period of B-lymphocyte depletion, but with B-lymphocyte recovery, anti-phiX174 responses were within the normal range. During the time of B-lymphocyte depletion, rituximab recipients had a decreased antibody response to neoantigens and significantly lower titers after recall immunization with diphtheria and tetanus toxoid. With recovery, immune responses return toward normal. Immunization during the time of B-lymphocyte depletion, although ineffective, does not preclude a subsequent response to the antigen. Copyright © 2011 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights

  3. Functional impairment of CMV-reactive cellular immunity during pregnancy.

    PubMed

    Reuschel, Edith; Barabas, Sascha; Zeman, Florian; Bendfeldt, Hanna; Rascle, Anne; Deml, Ludwig; Seelbach-Goebel, Birgit

    2017-02-01

    Cytomegalovirus (CMV) is the most common congenital viral infection. Mother-to-child transmission can cause severe child disability. Intact CMV-specific cell-mediated immunity (CMI) was shown to prevent uncontrolled replication in healthy individuals. This study aimed to determine whether CMV-specific CMI is impaired in pregnant women, thus potentially increasing the overall risk for active CMV replication and transmission. CMV-specific CMI in peripheral blood of 60 pregnant women was determined using T-Track® CMV for detection of IE-1 and pp65-reactive effector cells by IFN-γ ELISpot, and compared to the CMV-IgG and -IgM serostatus. CMV-specific CMI was detected in 65% of CMV-seropositive pregnant women. Five percent of CMV-IgG seronegative women showed IE-1- but not pp65-reactive cells. The overall number of CMV-reactive cells in pregnant women was significantly lower compared to a matched non-pregnant control group (P < 0.001). No significant difference in CMV-specific CMI was detected in the course of the three trimesters of pregnancy of CMV-IgG seropositive women. Postpartum (median days postnatal = 123), IE-1- and pp65-specific CMI remained significantly lower than in the non-pregnant control group (P < 0.001 and 0.0032, respectively). Functional analysis of CMV-reactive immune cells using T-Track® CMV therefore suggests a systemic down-regulation of CMV-specific CMI in pregnant women. Further studies are needed to investigate whether this may be indicative of a higher susceptibility to CMV reactivation or transmission. J. Med. Virol. 89:324-331, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  4. Impaired neutrophil extracellular trap formation: a novel defect in the innate immune system of aged individuals.

    PubMed

    Hazeldine, Jon; Harris, Phillipa; Chapple, Iain L; Grant, Melissa; Greenwood, Hannah; Livesey, Amy; Sapey, Elizabeth; Lord, Janet M

    2014-08-01

    Neutrophil extracellular traps (NETs) are a recently discovered addition to the defensive armamentarium of neutrophils, assisting in the immune response against rapidly dividing bacteria. Although older adults are more susceptible to such infections, no study has examined whether aging in humans influences NET formation. We report that TNF-α-primed neutrophils generate significantly more NETs than unprimed neutrophils and that lipopolysaccharide (LPS)- and interleukin-8 (IL-8)-induced NET formation exhibits a significant age-related decline. NET formation requires generation of reactive oxygen species (ROS), and this was also reduced in neutrophils from older donors identifying a mechanism for reduced NET formation. Expression of IL-8 receptors (CXCR1 and CXCR2) and the LPS receptor TLR4 was similar on neutrophils from young and old subjects, and neutrophils challenged with phorbol-12-myristate-13-acetate (PMA) showed no age-associated differences in ROS or NET production. Taken together, these data suggest a defect in proximal signalling underlies the age-related decline in NET and ROS generation. TNF-α priming involves signalling through p38 MAP kinase, but activation kinetics were comparable in neutrophils from young and old donors. In a clinical setting, we assessed the capacity of neutrophils from young and older patients with chronic periodontitis to generate NETs in response to PMA and hypochlorous acid (HOCL). Neutrophil extracellular trap generation to HOCL, but not PMA, was lower in older periodontitis patients but not in comparison with age-matched controls. Impaired NET formation is thus a novel defect of innate immunity in older adults but does not appear to contribute to the increased incidence of periodontitis in older adults. © 2014 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  5. Evaluation of mucosal adjuvants and immunization routes for the induction of systemic and mucosal humoral immune responses in macaques.

    PubMed

    Veazey, Ronald S; Siddiqui, Asna; Klein, Katja; Buffa, Viviana; Fischetti, Lucia; Doyle-Meyers, Lara; King, Deborah F; Tregoning, John S; Shattock, Robin J

    2015-01-01

    Delivering vaccine antigens to mucosal surfaces is potentially very attractive, especially as protection from mucosal infections may be mediated by local immune responses. However, to date mucosal immunization has had limited successes, with issues of both safety and poor immunogenicity. One approach to improve immunogenicity is to develop adjuvants that are effective and safe at mucosal surfaces. Differences in immune responses between mice and men have overstated the value of some experimental adjuvants which have subsequently performed poorly in the clinic. Due to their closer similarity, non-human primates can provide a more accurate picture of adjuvant performance. In this study we immunised rhesus macaques (Macaca mulatta) using a unique matrix experimental design that maximised the number of adjuvants screened while reducing the animal usage. Macaques were immunised by the intranasal, sublingual and intrarectal routes with the model protein antigens keyhole limpet haemocyanin (KLH), β-galactosidase (β-Gal) and ovalbumin (OVA) in combination with the experimental adjuvants Poly(I:C), Pam3CSK4, chitosan, Thymic Stromal Lymphopoietin (TSLP), MPLA and R848 (Resiquimod). Of the routes used, only intranasal immunization with KLH and R848 induced a detectable antibody response. When compared to intramuscular immunization, intranasal administration gave slightly lower levels of antigen specific antibody in the plasma, but enhanced local responses. Following intranasal delivery of R848, we observed a mildly inflammatory response, but no difference to the control. From this we conclude that R848 is able to boost antibody responses to mucosally delivered antigen, without causing excess local inflammation.

  6. The Role of the Immune Response in the Pathogenesis of Bronchiectasis.

    PubMed

    King, Paul T

    2018-01-01

    Bronchiectasis is a prevalent respiratory condition characterised by permanent and abnormal dilation of the lung airways (bronchi). There are a large variety of causative factors that have been identified for bronchiectasis; all of these compromise the function of the immune response to fight infection. A triggering factor may lead to the establishment of chronic infection in the lower respiratory tract. The bacteria responsible for the lower respiratory tract infection are usually found as commensals in the upper respiratory tract microbiome. The consequent inflammatory response to infection is largely responsible for the pathology of this condition. Both innate and adaptive immune responses are activated. The literature has highlighted the central role of neutrophils in the pathogenesis of bronchiectasis. Proteases produced in the lung by the inflammatory response damage the airways and lead to the pathological dilation that is the pathognomonic feature of bronchiectasis. The small airways demonstrate infiltration with lymphoid follicles that may contribute to localised small airway obstruction. Despite aggressive treatment, most patients will have persistent disease. Manipulating the immune response in bronchiectasis may potentially have therapeutic potential.

  7. A humoral immune response confers protection against Haemophilus ducreyi infection.

    PubMed

    Cole, Leah E; Toffer, Kristen L; Fulcher, Robert A; San Mateo, Lani R; Orndorff, Paul E; Kawula, Thomas H

    2003-12-01

    Haemophilus ducreyi is the etiologic agent of the sexually transmitted genital ulcer disease chancroid. Neither naturally occurring chancroid nor experimental infection with H. ducreyi results in protective immunity. Likewise, a single inoculation of H. ducreyi does not protect pigs against subsequent infection. Accordingly, we used the swine model of chancroid infection to examine the impact of multiple inoculations on a host's immune response. After three successive inoculations with H. ducreyi, pigs developed a modestly protective immune response evidenced by the decreased recovery of viable bacteria from lesions. All lesions biopsied 2 days after the first and second inoculations contained viable H. ducreyi cells, yet only 55% of the lesions biopsied 2 days after the third inoculation did. Nearly 90% of the lesions biopsied 7 days after the first inoculation contained viable H. ducreyi cells, but this percentage dropped to only 16% after the third inoculation. Between the first and third inoculations, the average recovery of CFU from lesions decreased approximately 100-fold. The reduced recovery of bacteria corresponded directly with a fivefold increase in H. ducreyi-specific antibody titers and the emergence of bactericidal activity. These immune sera were protective when administered to naïve pigs prior to challenge with H. ducreyi. These data suggest that pigs mount an effective humoral immune response to H. ducreyi after multiple exposures to the organism.

  8. CD22 regulates adaptive and innate immune responses of B cells.

    PubMed

    Kawasaki, Norihito; Rademacher, Christoph; Paulson, James C

    2011-01-01

    B cells sense microenvironments through the B cell receptor (BCR) and Toll-like receptors (TLRs). While signals from BCR and TLRs synergize to distinguish self from nonself, inappropriate regulation can result in development of autoimmune disease. Here we show that CD22, an inhibitory co-receptor of BCR, also negatively regulates TLR signaling in B cells. CD22-deficient (Cd22(-/-)) B cells exhibit hyperactivation in response to ligands of TLRs 3, 4 and 9. Evidence suggests that this results from impaired induction of suppressors of cytokine signaling 1 and 3, well-known suppressors of TLR signaling. Antibody-mediated sequestration of CD22 on wild-type (WT) B cells augments proliferation by TLR ligands. Conversely, expression of CD22 in a Cd22(-/-) B cell line blunts responses to TLR ligands. We also show that lipopolysaccharide-induced transcription by nuclear factor-κB is inhibited by ectopic expression of CD22 in a TLR4 reporter cell line. Taken together, these results suggest that negative regulation of TLR signaling is an intrinsic property of CD22. Since TLRs and BCR activate B cells through different signaling pathways, and are differentially localized in B cells, CD22 exhibits a broader regulation of receptors that mediate adaptive and innate immune responses of B cells than previously recognized. Copyright © 2010 S. Karger AG, Basel.

  9. Trained immunity in newborn infants of HBV-infected mothers

    PubMed Central

    Hong, Michelle; Sandalova, Elena; Low, Diana; Gehring, Adam J.; Fieni, Stefania; Amadei, Barbara; Urbani, Simonetta; Chong, Yap-Seng; Guccione, Ernesto; Bertoletti, Antonio

    2015-01-01

    The newborn immune system is characterized by an impaired Th1-associated immune response. Hepatitis B virus (HBV) transmitted from infected mothers to newborns is thought to exploit the newborns’ immune system immaturity by inducing a state of immune tolerance that facilitates HBV persistence. Contrary to this hypothesis, we demonstrate here that HBV exposure in utero triggers a state of trained immunity, characterized by innate immune cell maturation and Th1 development, which in turn enhances the ability of cord blood immune cells to respond to bacterial infection in vitro. These training effects are associated with an alteration of the cytokine environment characterized by low IL-10 and, in most cases, high IL-12p40 and IFN-α2. Our data uncover a potentially symbiotic relationship between HBV and its natural host, and highlight the plasticity of the fetal immune system following viral exposure in utero. PMID:25807344

  10. F4+ ETEC infection and oral immunization with F4 fimbriae elicits an IL-17-dominated immune response.

    PubMed

    Luo, Yu; Van Nguyen, Ut; de la Fe Rodriguez, Pedro Y; Devriendt, Bert; Cox, Eric

    2015-10-21

    Enterotoxigenic Escherichia coli (ETEC) are an important cause of post-weaning diarrhea (PWD) in piglets. Porcine-specific ETEC strains possess different fimbrial subtypes of which F4 fimbriae are the most frequently associated with ETEC-induced diarrhea in piglets. These F4 fimbriae are potent oral immunogens that induce protective F4-specific IgA antibody secreting cells at intestinal tissues. Recently, T-helper 17 (Th17) cells have been implicated in the protection of the host against extracellular pathogens. However, it remains unknown if Th17 effector responses are needed to clear ETEC infections. In the present study, we aimed to elucidate if ETEC elicits a Th17 response in piglets and if F4 fimbriae trigger a similar response. F4(+) ETEC infection upregulated IL-17A, IL-17F, IL-21 and IL-23p19, but not IL-12 and IFN-γ mRNA expression in the systemic and mucosal immune system. Similarly, oral immunization with F4 fimbriae triggered a Th17 signature evidenced by an upregulated mRNA expression of IL-17F, RORγt, IL-23p19 and IL-21 in the peripheral blood mononuclear cells (PBMCs). Intriguingly, IL-17A mRNA levels were unaltered. To further evaluate this difference between systemic and mucosal immune responses, we assayed the cytokine mRNA profile of F4 fimbriae stimulated PBMCs. F4 fimbriae induced IL-17A, IL-17F, IL-22 and IL-23p19, but downregulated IL-17B mRNA expression. Altogether, these data indicate a Th17 dominated response upon oral immunization with F4 fimbriae and F4(+) ETEC infection. Our work also highlights that IL-17B and IL-17F participate in the immune response to protect the host against F4(+) ETEC infection and could aid in the design of future ETEC vaccines.

  11. Muscles provide protection during microbial infection by activating innate immune response pathways in Drosophila and zebrafish.

    PubMed

    Chatterjee, Arunita; Roy, Debasish; Patnaik, Esha; Nongthomba, Upendra

    2016-06-01

    Muscle contraction brings about movement and locomotion in animals. However, muscles have also been implicated in several atypical physiological processes including immune response. The role of muscles in immunity and the mechanism involved has not yet been deciphered. In this paper, using Drosophila indirect flight muscles (IFMs) as a model, we show that muscles are immune-responsive tissues. Flies with defective IFMs are incapable of mounting a potent humoral immune response. Upon immune challenge, the IFMs produce anti-microbial peptides (AMPs) through the activation of canonical signaling pathways, and these IFM-synthesized AMPs are essential for survival upon infection. The trunk muscles of zebrafish, a vertebrate model system, also possess the capacity to mount an immune response against bacterial infections, thus establishing that immune responsiveness of muscles is evolutionarily conserved. Our results suggest that physiologically fit muscles might boost the innate immune response of an individual. © 2016. Published by The Company of Biologists Ltd.

  12. Maternal LAMP/p55gagHIV-1 DNA immunization induces in utero priming and a long-lasting immune response in vaccinated neonates.

    PubMed

    Rigato, Paula Ordonhez; Maciel, Milton; Goldoni, Adriana Letícia; Piubelli, Orlando Guerra; Orii, Noemia Mie; Marques, Ernesto Torres; August, Joseph Thomas; Duarte, Alberto José da Silva; Sato, Maria Notomi

    2012-01-01

    Infants born to HIV-infected mothers are at high risk of becoming infected during gestation or the breastfeeding period. A search is thus warranted for vaccine formulations that will prevent mother-to-child HIV transmission. The LAMP/gag DNA chimeric vaccine encodes the HIV-1 p55gag fused to the lysosome-associated membrane protein-1 (LAMP-1) and has been shown to enhance anti-Gag antibody (Ab) and cellular immune responses in adult and neonatal mice; such a vaccine represents a new concept in antigen presentation. In this study, we evaluated the effect of LAMP/gag DNA immunization on neonates either before conception or during pregnancy. LAMP/gag immunization of BALB/c mice before conception by the intradermal route led to the transfer of anti-Gag IgG1 Ab through the placenta and via breastfeeding. Furthermore, there were an increased percentage of CD4+CD25+Foxp3+T cells in the spleens of neonates. When offspring were immunized with LAMP/gag DNA, the anti-Gag Ab response and the Gag-specific IFN-γ-secreting cells were decreased. Inhibition of anti-Gag Ab production and cellular responses were not observed six months after immunization, indicating that maternal immunization did not interfere with the long-lasting memory response in offspring. Injection of purified IgG in conjunction with LAMP/gag DNA immunization decreased humoral and cytotoxic T-cell responses. LAMP/gag DNA immunization by intradermal injection prior to conception promoted the transfer of Ab, leading to a diminished response to Gag without interfering with the development of anti-Gag T- and B-cell memory. Finally, we assessed responses after one intravenous injection of LAMP/gag DNA during the last five days of pregnancy. The intravenous injection led to in utero immunization. In conclusion, DNA vaccine enconding LAMP-1 with Gag and other HIV-1 antigens should be considered in the development of a protective vaccine for the maternal/fetal and newborn periods.

  13. Maternal LAMP/p55gagHIV-1 DNA Immunization Induces In Utero Priming and a Long-Lasting Immune Response in Vaccinated Neonates

    PubMed Central

    Rigato, Paula Ordonhez; Maciel, Milton; Goldoni, Adriana Letícia; Piubelli, Orlando Guerra; Orii, Noemia Mie; Marques, Ernesto Torres; August, Joseph Thomas; Duarte, Alberto José da Silva; Sato, Maria Notomi

    2012-01-01

    Infants born to HIV-infected mothers are at high risk of becoming infected during gestation or the breastfeeding period. A search is thus warranted for vaccine formulations that will prevent mother-to-child HIV transmission. The LAMP/gag DNA chimeric vaccine encodes the HIV-1 p55gag fused to the lysosome-associated membrane protein-1 (LAMP-1) and has been shown to enhance anti-Gag antibody (Ab) and cellular immune responses in adult and neonatal mice; such a vaccine represents a new concept in antigen presentation. In this study, we evaluated the effect of LAMP/gag DNA immunization on neonates either before conception or during pregnancy. LAMP/gag immunization of BALB/c mice before conception by the intradermal route led to the transfer of anti-Gag IgG1 Ab through the placenta and via breastfeeding. Furthermore, there were an increased percentage of CD4+CD25+Foxp3+T cells in the spleens of neonates. When offspring were immunized with LAMP/gag DNA, the anti-Gag Ab response and the Gag-specific IFN-γ-secreting cells were decreased. Inhibition of anti-Gag Ab production and cellular responses were not observed six months after immunization, indicating that maternal immunization did not interfere with the long-lasting memory response in offspring. Injection of purified IgG in conjunction with LAMP/gag DNA immunization decreased humoral and cytotoxic T-cell responses. LAMP/gag DNA immunization by intradermal injection prior to conception promoted the transfer of Ab, leading to a diminished response to Gag without interfering with the development of anti-Gag T- and B-cell memory. Finally, we assessed responses after one intravenous injection of LAMP/gag DNA during the last five days of pregnancy. The intravenous injection led to in utero immunization. In conclusion, DNA vaccine enconding LAMP-1 with Gag and other HIV-1 antigens should be considered in the development of a protective vaccine for the maternal/fetal and newborn periods. PMID:22355381

  14. Neuro-Immune Mechanisms in Response to Venezuelan Equine Encephalitis Virus Infection

    DTIC Science & Technology

    2000-01-01

    iii ABSTRACT NEURO-IMMUNE MECHANISMS IN RESPONSE TO VENEZUELAN EQUINE ENCEPHALITIS VIRUS INFECTION Major Bruce A. Schoneboom directed by Franziska B...Grieder, DVM, Ph.D., Assistant Professor of Microbiology and Immunology, Molecular and Cellular Biology, and Neuroscience Venezuelan equine ...3. DATES COVERED - 4. TITLE AND SUBTITLE NEURO-IMMUNE MECHANISMS IN RESPONSE TO VENEZUELAN EQUINE ENCEPHALITIS VIRUS INFECTION 5a. CONTRACT

  15. How might infant and paediatric immune responses influence malaria vaccine efficacy?

    PubMed

    Moormann, A M

    2009-09-01

    Naturally acquired immunity to malaria requires repeat infections yet does not engender sterile immunity or long-lasting protective immunologic memory. This renders infants and young children the most susceptible to malaria-induced morbidity and mortality, and the ultimate target for a malaria vaccine. The prevailing paradigm is that infants initially garner protection due to transplacentally transferred anti-malarial antibodies and other intrinsic factors such as foetal haemoglobin. As these wane infants have an insufficient immune repertoire to prevent genetically diverse Plasmodium infections and an inability to control malaria-induced immunopathology. This Review discusses humoral, cell-mediated and innate immune responses to malaria and how each contributes to protection - focusing on how deficiencies in infant and paediatric immune responses might influence malaria vaccine efficacy in this population. In addition, burgeoning evidence suggests a role for inhibitory receptors that limit immunopathology and guide the development of long-lived immunity. Precisely how age or malaria infections influence the function of these regulators is unknown. Therefore the possibility that infants may not have the immune-dexterity to balance effective parasite clearance with timely immune-regulation leading to protective immunologic memory is considered. And thus, malaria vaccines tested in adults and older children may not be predictive for trials conducted in infants.

  16. Acquired immunity to amyloodiniosis is associated with an antibody response.

    PubMed

    Cobb, C S; Levy, M G; Noga, E J

    1998-10-08

    The dinoflagellate Amyloodinium ocellatum, which causes amyloodiniosis or 'marine velvet disease', is one of the most serious ectoparasitic diseases plaguing warmwater marine fish culture worldwide. We report that tomato clownfish Amphiprion frenatus develop strong immunity to Amyloodinium ocellatum infection following repeated nonlethal challenges and that specific antibodies are associated with this response. Reaction of immune fish antisera against dinospore and trophont-derived antigens in Western blots indicated both shared and stage-specific antibody-antigen reactions. A mannan-binding-protein affinity column was used to isolate IgM-like antibody from A. frenatus serum. The reduced Ig consisted of one 70 kD heavy chain and one 32 kD light chain with an estimated molecular weight of 816 kD for the native molecule. Immunoglobulin (Ig) isolated from immune but not non-immune fish serum significantly inhibited parasite infectivity in vitro. An enzyme-linked immunosorbent assay (ELISA) was developed using polyclonal rabbit antibody produced against affinity-purified A. frenatus Ig. Anti-Amyloodinium serum antibody was not always detectable in immune fish, although serum antibody titers in immune fish increased after repeated exposure to the parasite. These results suggest that there may be a localized antibody response in skin/gill epithelial tissue, although antibody was rarely detected in skin mucus.

  17. Immunosuppressive activity of tilmicosin on the immune responses in mice.

    PubMed

    Guan, Shuang; Song, Yu; Guo, Weixiao; Chu, Xiao; Zhang, Xiaozhe; Wang, Dacheng; Lu, Jing; Deng, Xuming

    2011-06-01

    Tilmicosin, a semi-synthetic macrolide antibiotic that is only used in the veterinary clinic, was evaluated for its immunosuppressive activity on the immune responses to ovalbumin (OVA) in mice. Tilmicosin suppressed concanavalin A (Con A)- and lipopolysaccharide (LPS)-stimulated splenocyte proliferation in vitro. BALB/c mice were immunized subcutaneously with OVA on day 1 and 4. Beginning on the day of boosting immunization, the mice were administered intraperitoneally with tilmicosin at a single dose of 10, 30, and 90 mg/kg for 10 consecutive days. On day 14, blood samples were collected for measuring specific total-immunoglobulin G (total-IgG), IgG1, IgG2b, and splenocytes were harvested for determining lymphocyte proliferation and interleukin-2 (IL-2), interferon-γ (IFN-γ), IL-4 production. The results demonstrated that tilmicosin could significantly suppress Con A-induced splenocyte proliferation in a dose-dependent manner, decrease LPS-and OVA-induced splenocyte proliferation only at high concentration, produced less IL-2, IL-4, and IFN-γ as compared to the control in the OVA-immunized mice. Moreover, the OVA-specific IgG, IgG1, and IgG2b levels in the OVA-immunized mice were reduced by tilmicosin. These results suggest that tilmicosin could suppress the cellular and humoral immune response in mice.

  18. Transcriptomic immune response of Tenebrio molitor pupae to parasitization by Scleroderma guani.

    PubMed

    Zhu, Jia-Ying; Yang, Pu; Zhang, Zhong; Wu, Guo-Xing; Yang, Bin

    2013-01-01

    Host and parasitoid interaction is one of the most fascinating relationships of insects, which is currently receiving an increasing interest. Understanding the mechanisms evolved by the parasitoids to evade or suppress the host immune system is important for dissecting this interaction, while it was still poorly known. In order to gain insight into the immune response of Tenebrio molitor to parasitization by Scleroderma guani, the transcriptome of T. molitor pupae was sequenced with focus on immune-related gene, and the non-parasitized and parasitized T. molitor pupae were analyzed by digital gene expression (DGE) analysis with special emphasis on parasitoid-induced immune-related genes using Illumina sequencing. In a single run, 264,698 raw reads were obtained. De novo assembly generated 71,514 unigenes with mean length of 424 bp. Of those unigenes, 37,373 (52.26%) showed similarity to the known proteins in the NCBI nr database. Via analysis of the transcriptome data in depth, 430 unigenes related to immunity were identified. DGE analysis revealed that parasitization by S. guani had considerable impacts on the transcriptome profile of T. molitor pupae, as indicated by the significant up- or down-regulation of 3,431 parasitism-responsive transcripts. The expression of a total of 74 unigenes involved in immune response of T. molitor was significantly altered after parasitization. obtained T. molitor transcriptome, in addition to establishing a fundamental resource for further research on functional genomics, has allowed the discovery of a large group of immune genes that might provide a meaningful framework to better understand the immune response in this species and other beetles. The DGE profiling data provides comprehensive T. molitor immune gene expression information at the transcriptional level following parasitization, and sheds valuable light on the molecular understanding of the host-parasitoid interaction.

  19. Transcriptomic Immune Response of Tenebrio molitor Pupae to Parasitization by Scleroderma guani

    PubMed Central

    Zhu, Jia-Ying; Yang, Pu; Zhang, Zhong; Wu, Guo-Xing; Yang, Bin

    2013-01-01

    Background Host and parasitoid interaction is one of the most fascinating relationships of insects, which is currently receiving an increasing interest. Understanding the mechanisms evolved by the parasitoids to evade or suppress the host immune system is important for dissecting this interaction, while it was still poorly known. In order to gain insight into the immune response of Tenebrio molitor to parasitization by Scleroderma guani, the transcriptome of T. molitor pupae was sequenced with focus on immune-related gene, and the non-parasitized and parasitized T. molitor pupae were analyzed by digital gene expression (DGE) analysis with special emphasis on parasitoid-induced immune-related genes using Illumina sequencing. Methodology/Principal Findings In a single run, 264,698 raw reads were obtained. De novo assembly generated 71,514 unigenes with mean length of 424 bp. Of those unigenes, 37,373 (52.26%) showed similarity to the known proteins in the NCBI nr database. Via analysis of the transcriptome data in depth, 430 unigenes related to immunity were identified. DGE analysis revealed that parasitization by S. guani had considerable impacts on the transcriptome profile of T. molitor pupae, as indicated by the significant up- or down-regulation of 3,431 parasitism-responsive transcripts. The expression of a total of 74 unigenes involved in immune response of T. molitor was significantly altered after parasitization. Conclusions/Significance obtained T. molitor transcriptome, in addition to establishing a fundamental resource for further research on functional genomics, has allowed the discovery of a large group of immune genes that might provide a meaningful framework to better understand the immune response in this species and other beetles. The DGE profiling data provides comprehensive T. molitor immune gene expression information at the transcriptional level following parasitization, and sheds valuable light on the molecular understanding of the host

  20. Aspergillus-Associated Airway Disease, Inflammation, and the Innate Immune Response

    PubMed Central

    Chotirmall, Sanjay H.; Al-Alawi, Mazen; Logan, P. Mark; Greene, Catherine M.; McElvaney, Noel G.

    2013-01-01

    Aspergillus moulds exist ubiquitously as spores that are inhaled in large numbers daily. Whilst most are removed by anatomical barriers, disease may occur in certain circumstances. Depending on the underlying state of the human immune system, clinical consequences can ensue ranging from an excessive immune response during allergic bronchopulmonary aspergillosis to the formation of an aspergilloma in the immunocompetent state. The severest infections occur in those who are immunocompromised where invasive pulmonary aspergillosis results in high mortality rates. The diagnosis of Aspergillus-associated pulmonary disease is based on clinical, radiological, and immunological testing. An understanding of the innate and inflammatory consequences of exposure to Aspergillus species is critical in accounting for disease manifestations and preventing sequelae. The major components of the innate immune system involved in recognition and removal of the fungus include phagocytosis, antimicrobial peptide production, and recognition by pattern recognition receptors. The cytokine response is also critical facilitating cell-to-cell communication and promoting the initiation, maintenance, and resolution of the host response. In the following review, we discuss the above areas with a focus on the innate and inflammatory response to airway Aspergillus exposure and how these responses may be modulated for therapeutic benefit. PMID:23971044

  1. Tailoring the Immune Response via Customization of Pathogen Gene Expression.

    PubMed

    Runco, Lisa M; Stauft, Charles B; Coleman, J Robert

    2014-01-01

    The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development.

  2. Tailoring the Immune Response via Customization of Pathogen Gene Expression

    PubMed Central

    Runco, Lisa M.; Stauft, Charles B.

    2014-01-01

    The majority of studies focused on the construction and reengineering of bacterial pathogens have mainly relied on the knocking out of virulence factors or deletion/mutation of amino acid residues to then observe the microbe's phenotype and the resulting effect on the host immune response. These knockout bacterial strains have also been proposed as vaccines to combat bacterial disease. Theoretically, knockout strains would be unable to cause disease since their virulence factors have been removed, yet they could induce a protective memory response. While knockout strains have been valuable tools to discern the role of virulence factors in host immunity and bacterial pathogenesis, they have been unable to yield clinically relevant vaccines. The advent of synthetic biology and enhanced user-directed gene customization has altered this binary process of knockout, followed by observation. Recent studies have shown that a researcher can now tailor and customize a given microbe's gene expression to produce a desired immune response. In this commentary, we highlight these studies as a new avenue for controlling the inflammatory response as well as vaccine development. PMID:24719769

  3. Ecosystem and immune systems: Hierarchial response provides resilience against invasions

    USGS Publications Warehouse

    Allen, Craig R.

    2001-01-01

    Janssen (2001) provides the stimulus for thoughtful comparison and consideration of the ranges of responses exhibited by immune systems and ecological systems in the face of perturbations such as biological invasions. It may indeed be informative to consider the similarities of the responses to invasions exhibited by immune systems and ecological systems. Clearly, both types of systems share a general organizational structure with all other complex hierarchical systems. Their organization provides these systems with resilience. However, when describing the response of ecological-economic systems to invasions, Janssen emphasizes the human-economic response. I would like to expand on his comparison by focusing on how resilience is maintained in complex systems under the threat of invasion.

  4. pH-Responsive Micelle-Based Cytoplasmic Delivery System for Induction of Cellular Immunity.

    PubMed

    Yuba, Eiji; Sakaguchi, Naoki; Kanda, Yuhei; Miyazaki, Maiko; Koiwai, Kazunori

    2017-11-04

    (1) Background: Cytoplasmic delivery of antigens is crucial for the induction of cellular immunity, which is an important immune response for the treatment of cancer and infectious diseases. To date, fusogenic protein-incorporated liposomes and pH-responsive polymer-modified liposomes have been used to achieve cytoplasmic delivery of antigen via membrane rupture or fusion with endosomes. However, a more versatile cytoplasmic delivery system is desired for practical use. For this study, we developed pH-responsive micelles composed of dilauroyl phosphatidylcholine (DLPC) and deoxycholic acid and investigated their cytoplasmic delivery performance and immunity-inducing capability. (2) Methods: Interaction of micelles with fluorescence dye-loaded liposomes, intracellular distribution of micelles, and antigenic proteins were observed. Finally, antigen-specific cellular immune response was evaluated in vivo using ELIspot assay. (3) Results: Micelles induced leakage of contents from liposomes via lipid mixing at low pH. Micelles were taken up by dendritic cells mainly via macropinocytosis and delivered ovalbumin (OVA) into the cytosol. After intradermal injection of micelles and OVA, OVA-specific cellular immunity was induced in the spleen. (4) Conclusions: pH-responsive micelles composed of DLPC and deoxycholic acid are promising as enhancers of cytosol delivery of antigens and the induction capability of cellular immunity for the treatment of cancer immunotherapy and infectious diseases.

  5. Suppression of secondary immune response by antilymphocyte serum: time relationship between immunization and administration of antilymphocyte serum.

    PubMed Central

    Reuben, C; Sundaram, K; Phondke, G P

    1979-01-01

    The effect of antilymphocyte serum (ALS) on the secondary humoral immune response to sheep erythrocytes (SRBC) in rats was studied by the Jerne plaque assay technique. Its effect was also studied on the delayed hypersensitivity (DH) response to SRBC by the foot pad swelling test. ALS(N), which was prepared against lymphocytes from normal rats, had no effect on the secondary humoral and cellular response or on the primary cellular response, when administered postantigenically. ALS(I), which was raised against lymph node cells from SRBC immunized rats produced significant immunosuppression of the secondary response to SRBC when administered either before or after the antigenic injections. In the case of DH, ALS(I) behaved just like ALS(N) having no effect on the secondary response and suppressing the primary only when administered prior to the antigen. PMID:369994

  6. Enhancement of Th1 immune responses to recombinant influenza nucleoprotein by Ribi adjuvant.

    PubMed

    Cargnelutti, Diego E; Sanchez, María A V; Alvarez, Paula; Boado, Lorena; Mattion, Nora; Scodeller, Eduardo A

    2013-04-01

    A broad coverage influenza vaccine against multiple viral strains based on the viral nucleoprotein (NP) is a goal pursued by many laboratories. If the goal is to formulate the vaccine with recombinant NP it is essential to count on adjuvants capable of inducing cellular immunity. This work have studied the effect of the monophosphoryl lipid A and trehalose dimycolate, known as the Ribi Adjuvant System (RAS), in the immune response induced in mice immunized with recombinant NP. The NP was formulated with RAS and used to immunize BALB/c mice. Immunizations with NP-RAS increased the humoral and cellular immune responses compared to unadjuvanted NP. The predominant antibody isotype was IgG2a, suggesting the development of a Th1 response. Analysis of the cytokines from mice immunized with NP-RAS showed a significant increase in the production of IFN-g and a decreased production of IL-10 and IL-4 compared to controls without RAS. These results are similar to those usually obtained using Freund’s adjuvant, known to induce Th1 and CTL responses when co-administered with purified proteins, and suggest that a similar approach may be possible to enhance the performance of a T-cell vaccine containing NP.

  7. Bivalve immunity and response to infections: Are we looking at the right place?

    PubMed

    Allam, Bassem; Pales Espinosa, Emmanuelle

    2016-06-01

    Significant progress has been made in the understanding of cellular and molecular mediators of immunity in invertebrates in general and bivalve mollusks in particular. Despite this information, there is a lack of understanding of factors affecting animal resistance and specific responses to infections. This in part results from limited consideration of the spatial (and to some extent temporal) heterogeneity of immune responses and very limited information on host-pathogen (and microbes in general) interactions at initial encounter/colonization sites. Of great concern is the fact that most studies on molluscan immunity focus on the circulating hemocytes and the humoral defense factors in the plasma while most relevant host-microbe interactions occur at mucosal interfaces. This paper summarizes information available on the contrasting value of information available on focal and systemic immune responses in infected bivalves, and highlights the role of mucosal immune factors in host-pathogen interactions. Available information underlines the diversity of immune effectors at molluscan mucosal interfaces and highlights the tailored immune response to pathogen stimuli. This context raises fascinating basic research questions around host-microbe crosstalk and feedback controls of these interactions and may lead to novel disease mitigation strategies and improve the assessment of resistant crops or the screening of probiotic candidates. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Humoural immune response and pathological analysis in patients with false immune diagnosis of cystic echinococcosis

    PubMed Central

    Chen, X; Zhang, J; Feng, X; Chen, X; Yin, S; Wen, H; Zheng, S

    2014-01-01

    The patients with false immune diagnosis of hydatid disease were investigated for the humoural immune response to analyse the possible reasons and mechanism leading to false immune diagnosis. Two hundred and thirty-nine patients with nature-unknown cysts and 30 healthy controls were detected by immunological assays (four hydatid antigen-based immunogold filtration assay and enzyme-linked immune absorbent assay) and ultrasound. Sensitivity of and specificity of immunological assay and ultrasound were calculated, respectively. The serological diagnosis was compared with surgical pathology to screen the patients with false immune diagnosis for the immunoglobulin measurement and pathological analysis. The history and cyst characteristics were also reviewed. The results indicate the immunoglobulin has little influence on false immunodiagnosis. The false-negative immunodiagnosis was caused by the cysts' inactive status while the false positive caused by previous rupture, antigen cross-reaction. The clinical diagnosis of cystic echinococcosis requires a combination of immunodiagnosis and ultrasonography, which is the necessary complementary confirmation. PMID:24372157

  9. How sex and age affect immune responses, susceptibility to infections, and response to vaccination

    PubMed Central

    Giefing-Kröll, Carmen; Berger, Peter; Lepperdinger, Günter; Grubeck-Loebenstein, Beatrix

    2015-01-01

    Do men die young and sick, or do women live long and healthy? By trying to explain the sexual dimorphism in life expectancy, both biological and environmental aspects are presently being addressed. Besides age-related changes, both the immune and the endocrine system exhibit significant sex-specific differences. This review deals with the aging immune system and its interplay with sex steroid hormones. Together, they impact on the etiopathology of many infectious diseases, which are still the major causes of morbidity and mortality in people at old age. Among men, susceptibilities toward many infectious diseases and the corresponding mortality rates are higher. Responses to various types of vaccination are often higher among women thereby also mounting stronger humoral responses. Women appear immune-privileged. The major sex steroid hormones exhibit opposing effects on cells of both the adaptive and the innate immune system: estradiol being mainly enhancing, testosterone by and large suppressive. However, levels of sex hormones change with age. At menopause transition, dropping estradiol potentially enhances immunosenescence effects posing postmenopausal women at additional, yet specific risks. Conclusively during aging, interventions, which distinctively consider the changing level of individual hormones, shall provide potent options in maintaining optimal immune functions. PMID:25720438

  10. Immune Checkpoint Blockade for Breast Cancer.

    PubMed

    Swoboda, April; Nanda, Rita

    An effective antitumor immune response requires interaction between cells of the adaptive and innate immune system. Three key elements are required: generation of activated tumor-directed T cells, infiltration of activated T cells into the tumor microenvironment, and killing of tumor cells by activated T cells. Tumor immune evasion can occur as a result of the disruption of each of these three key T cell activities, resulting in three distinct cancer-immune phenotypes. The immune inflamed phenotype, characterized by the presence of a robust tumor immune infiltrate, suggests impaired activated T cell killing of tumor cells related to the presence of inhibitory factors. Programmed death receptor-1 (PD-1) is an inhibitory transmembrane protein expressed on T cells, B cells, and NK cells. The interaction between PD-1 and its ligands (PD-L1/L2) functions as an immune checkpoint against unrestrained cytotoxic T effector cell activity-it promotes peripheral T effector cell exhaustion and conversion of T effector cells to immunosuppressive T regulatory (Treg) cells. Immune checkpoint inhibitors, which block the PD-1/PD-L1 axis and reactivate cytotoxic T effector cell function, are actively being investigated for the treatment of breast cancer.

  11. Carotenoids, immune response and the expression of sexual ornaments in male greenfinches ( Carduelis chloris)

    NASA Astrophysics Data System (ADS)

    Aguilera, Eduardo; Amat, Juan A.

    2007-11-01

    Allocation trade-offs of carotenoids between their use in the immune system and production of sexual ornaments have been suggested as a proximate mechanism maintaining honesty of sexual signals. To test this idea, we experimentally examined whether carotenoid availability in the diet was related to variation in antibody response to novel antigens in male greenfinches ( Carduelis chloris aurantiiventris), a species with extensive carotenoid-dependent plumage colouration. We also measured the cost of mounting a humoral response in terms of circulating carotenoids. Finally, we examined the relationship between plumage colour, immune response and circulating carotenoids. We found that males with carotenoid-supplemented diets showed stronger antibody response than non-supplemented birds. We also found that activation of the immune system significantly reduced circulating carotenoids (24.9% lower in immune-challenged birds than in control birds). Finally, intensity (chroma) of ventral plumage colouration of males, a character directly related to concentration of total carotenoids in feathers, was negatively correlated with the immune response and circulating carotenoids in winter. These results support the idea that carotenoids are a limiting resource and that males trade ornamental colouration against immune response.

  12. Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection.

    PubMed

    Zhang, Jie; Liu, Huan; Wei, Bin

    Herpes simplex virus type 1 (HSV-1), a neurotropic member of the alphaherpes virus family, is among the most prevalent and successful human pathogens. HSV-1 can cause serious diseases at every stage of life including fatal disseminated disease in newborns, cold sores, eye disease, and fatal encephalitis in adults. HSV-1 infection can trigger rapid immune responses, and efficient inhibition and clearance of HSV-1 infection rely on both the innate and adaptive immune responses of the host. Multiple strategies have been used to restrict host innate immune responses by HSV-1 to facilitate its infection in host cells. The adaptive immunity of the host plays an important role in inhibiting HSV-1 infections. The activation and regulation of T cells are the important aspects of the adaptive immunity. They play a crucial role in host-mediated immunity and are important for clearing HSV-1. In this review, we examine the findings on T cell immune responses during HSV-1 infection, which hold promise in the design of new vaccine candidates for HSV-1.

  13. Immune response of T cells during herpes simplex virus type 1 (HSV-1) infection*

    PubMed Central

    Zhang, Jie; Liu, Huan; Wei, Bin

    2017-01-01

    Herpes simplex virus type 1 (HSV-1), a neurotropic member of the alphaherpes virus family, is among the most prevalent and successful human pathogens. HSV-1 can cause serious diseases at every stage of life including fatal disseminated disease in newborns, cold sores, eye disease, and fatal encephalitis in adults. HSV-1 infection can trigger rapid immune responses, and efficient inhibition and clearance of HSV-1 infection rely on both the innate and adaptive immune responses of the host. Multiple strategies have been used to restrict host innate immune responses by HSV-1 to facilitate its infection in host cells. The adaptive immunity of the host plays an important role in inhibiting HSV-1 infections. The activation and regulation of T cells are the important aspects of the adaptive immunity. They play a crucial role in host-mediated immunity and are important for clearing HSV-1. In this review, we examine the findings on T cell immune responses during HSV-1 infection, which hold promise in the design of new vaccine candidates for HSV-1. PMID:28378566

  14. Dissociation of Innate Immune Responses in Microglia Infected with Listeria monocytogenes

    PubMed Central

    Frande-Cabanes, Elisabet; Fernandez-Prieto, Lorena; Calderon-Gonzalez, Ricardo; Rodríguez-Del Río, Estela; Yañez-Diaz, Sonsoles; López-Fanarraga, Monica; Alvarez-Domínguez, Carmen

    2014-01-01

    Microglia, the innate immune cells of the brain, plays a central role in cerebral listeriosis. Here, we present evidence that microglia control Listeria infection differently than macrophages. Infection of primary microglial cultures and murine cell lines with Listeria resulted in a dual function of the two gene expression programmes involved in early and late immune responses in macrophages. Whereas the bacterial gene hly seems responsible for both transcriptional programmes in macrophages, Listeria induces in microglia only the tumor necrosis factor (TNF)-regulated transcriptional programme. Listeria also represses in microglia the late immune response gathered in two clusters, microbial degradation, and interferon (IFN)-inducible genes. The bacterial gene actA was required in microglia to induce TNF-regulated responses and to repress the late response. Isolation of microglial phagosomes revealed a phagosomal environment unable to destroy Listeria. Microglial phagosomes were also defective in several signaling and trafficking components reported as relevant for Listeria innate immune responses. This transcriptional strategy in microglia induced high levels of TNF-α and monocyte chemotactic protein-1 and low production of other neurotoxic compounds such as nitric oxide, hydrogen peroxide, and Type I IFNs. These cytokines and toxic microglial products are also released by primary microglia, and this cytokine and chemokine cocktail display a low potential to trigger neuronal apoptosis. This overall bacterial strategy strongly suggests that microglia limit Listeria inflammation pattern exclusively through TNF-mediated responses to preserve brain integrity. GLIA 2014;62:233–246 PMID:24311463

  15. Antimicrobial autophagy: a conserved innate immune response in Drosophila.

    PubMed

    Moy, Ryan H; Cherry, Sara

    2013-01-01

    Autophagy is a highly conserved degradative pathway that has rapidly emerged as a critical component of immunity and host defense. Studies have implicated autophagy genes in restricting the replication of a diverse array of pathogens, including bacteria, viruses and protozoans. However, in most cases, the in vivo role of antimicrobial autophagy against pathogens has been undefined. Drosophila provides a genetically tractable model system that can be easily adapted to study autophagy in innate immunity, and recent studies in flies have demonstrated that autophagy is an essential antimicrobial response against bacteria and viruses in vivo. These findings reveal striking conservation of antimicrobial autophagy between flies and mammals, and in particular, the role of pathogen-associated pattern recognition in triggering this response. This review discusses our current understanding of antimicrobial autophagy in Drosophila and its potential relevance to human immunity. Copyright © 2013 S. Karger AG, Basel.

  16. Polysaccharides Isolated from Açaí Fruit Induce Innate Immune Responses

    PubMed Central

    Holderness, Jeff; Schepetkin, Igor A.; Freedman, Brett; Kirpotina, Liliya N.; Quinn, Mark T.; Hedges, Jodi F.; Jutila, Mark A.

    2011-01-01

    The Açaí (Acai) fruit is a popular nutritional supplement that purportedly enhances immune system function. These anecdotal claims are supported by limited studies describing immune responses to the Acai polyphenol fraction. Previously, we characterized γδ T cell responses to both polyphenol and polysaccharide fractions from several plant-derived nutritional supplements. Similar polyphenol and polysaccharide fractions are found in Acai fruit. Thus, we hypothesized that one or both of these fractions could activate γδ T cells. Contrary to previous reports, we did not identify agonist activity in the polyphenol fraction; however, the Acai polysaccharide fraction induced robust γδ T cell stimulatory activity in human, mouse, and bovine PBMC cultures. To characterize the immune response to Acai polysaccharides, we fractionated the crude polysaccharide preparation and tested these fractions for activity in human PBMC cultures. The largest Acai polysaccharides were the most active in vitro as indicated by activation of myeloid and γδ T cells. When delivered in vivo, Acai polysaccharide induced myeloid cell recruitment and IL-12 production. These results define innate immune responses induced by the polysaccharide component of Acai and have implications for the treatment of asthma and infectious disease. PMID:21386979

  17. The influence of immune system stimulation on encapsulated islet graft survival.

    PubMed

    Orłowski, Tadeusz M; Godlewska, Ewa; Tarchalska, Magda; Kinasiewicz, Joanna; Antosiak, Magda; Sabat, Marek

    2005-01-01

    The aim of this study was to determine the influence activating of the recipient immune system on the function of microencapsulated islet xenografts. The skin of WAG or Fisher rats and WAG free or encapsulated (APA) Langerhans islets were transplanted to healthy or to streptozotocin diabetic BALB/c mice. Skin grafts were performed following the method of Billingham and Medawar. Rat islets were isolated from pancreas by the Lacy and Kostianovsy method and encapsulated with calcium alginate-poly-L-lysine-alginate according to the 3-step coating method of Sun. The transplantation of encapsulated WAG islets, despite activation of the host immune system, restored euglycemia for over 180 +/-100 days. A subsequent skin graft taken from the same donor was rejected in the second set mode, but euglycemia persisted. In diabetic recipients, impaired immune response was corrected by successful encapsulated islet transplantation. In diabetic mice, strong stimulation with 2-fold skin transplantation induced primary non-function of grafted islets despite their encapsulation. The survival of an islet xenograft depends on the level of activation of the recipient immune system. The immune response of diabetic mice was impaired, but increased after post-transplant restitution of euglycemia. Microencapsulation sufficiently protected grafted islets, and remission of diabetes was preserved. However, after strong specific or non-specific stimulation of the host immune system, non-function of xenografted islets developed despite their encapsulation. Therefore, islet graft recipients should avoid procedures which could stimulate their immune systems. If absolutely necessary, the graft should be protected by exogenous insulin therapy at that time.

  18. Innate immunity in the small intestine

    PubMed Central

    Santaolalla, Rebeca; Abreu, Maria T.

    2012-01-01

    Purpose of review This manuscript reviews the most recent publications on innate immunity in the small intestine. We will go over the innate immune receptors that act as sensors of microbial presence or cell injury, Paneth cells as the main epithelial cell type that secrete antimicrobial peptides, and mucosal production of IgA. In addition, we will give an update on examples of imbalance of the innate immune response resulting in clinical disease with the most relevant example being Crohn’s disease. Recent findings Toll-like receptors (TLRs) are involved in B-cell homing to the intestine, rejection of small intestinal allografts and recruitment of mast cells. The TLR adaptor TRIF is necessary to activate innate immunity after Yersinia enterocolitica infection. Moreover, MyD88 is required to keep the intestinal microbiota under control and physically separated from the epithelium and RegIIIγ is responsible for the bacterial segregation from the lining epithelial cells. In Crohn’s disease, ATG16L1 T300A variant promotes a pro-inflammatory response; and miR-196 downregulates a protective IRGM polymorphism leading to impaired clearance of adherent Escherichia coli in the intestine. Summary The intestine is continuously exposed to dietary and microbial antigens. The host has to maintain intestinal homeostasis to keep the commensal and pathogenic bacteria under control. Some of the mechanisms to do so are by expression of innate immune receptors, production of antimicrobial peptides, secretion of IgA or autophagy of intracellular bacteria. Unfortunately, in some cases the innate immune response fails to protect the host and chronic inflammation, transplant rejection, or other pathologies may occur. PMID:22241076

  19. Dual Role of Vitamin C on the Neuroinflammation Mediated Neurodegeneration and Memory Impairments in Colchicine Induced Rat Model of Alzheimer Disease.

    PubMed

    Sil, Susmita; Ghosh, Tusharkanti; Gupta, Pritha; Ghosh, Rupsa; Kabir, Syed N; Roy, Avishek

    2016-12-01

    The neurodegeneration in colchicine induced AD rats (cAD) is mediated by cox-2 linked neuroinflammation. The importance of ROS in the inflammatory process in cAD has not been identified, which may be deciphered by blocking oxidative stress in this model by a well-known anti-oxidant vitamin C. Therefore, the present study was designed to investigate the role of vitamin C on colchicine induced oxidative stress linked neuroinflammation mediated neurodegeneration and memory impairments along with peripheral immune responses in cAD. The impairments of working and reference memory were associated with neuroinflammation and neurodegeneration in the hippocampus of cAD. Administration of vitamin C (200 and 400 mg/kg BW) in cAD resulted in recovery of memory impairments, with prevention of neurodegeneration and neuroinflammation in the hippocampus. The neuroinflammation in the hippocampus also influenced the peripheral immune responses and inflammation in the serum of cAD and all of these parameters were also recovered at 200 and 400 mg dose of vitamin C. However, cAD treated with 600 mg dose did not recover but resulted in increase of memory impairments, neurodegeneration and neuroinflammation in hippocampus along with alteration of peripheral immune responses in comparison to cAD of the present study. Therefore, the present study showed that ROS played an important role in the colchicine induced neuroinflammation linked neurodegeneration and memory impairments along with alteration of peripheral immune responses. It also appears from the results that vitamin C at lower doses showed anti-oxidant effect and at higher dose resulted in pro-oxidant effects in cAD.

  20. Waning of vaccine-induced immunity to measles in kidney transplanted children.

    PubMed

    Rocca, Salvatore; Santilli, Veronica; Cotugno, Nicola; Concato, Carlo; Manno, Emma Concetta; Nocentini, Giulia; Macchiarulo, Giulia; Cancrini, Caterina; Finocchi, Andrea; Guzzo, Isabella; Dello Strologo, Luca; Palma, Paolo

    2016-09-01

    Vaccine-preventable diseases are a significant cause of morbidity and mortality in solid organ transplant recipients who undergo immunosuppression after transplantation. Data on immune responses and long-term maintenance after vaccinations in such population are still limited.We cross-sectionally evaluated the maintenance of immune response to measles vaccine in kidney transplanted children on immunosuppressive therapy. Measles-specific enzyme-linked immunosorbent assay and B-cell enzyme-linked immunosorbent spot were performed in 74 kidney transplant patients (Tps) and in 23 healthy controls (HCs) previously vaccinated and tested for humoral protection against measles. The quality of measles antibody response was measured by avidity test. B-cell phenotype, investigated via flow cytometry, was further correlated to the ability of Tps to maintain protective humoral responses to measles over time.We observed the loss of vaccine-induced immunity against measles in 19% of Tps. Nonseroprotected children showed signs of impaired B-cell distribution as well as immune senescence and lower antibody avidity. We further reported as time elapsed between vaccination and transplantation, as well as the vaccine administration during dialysis are clinical factors affecting the maintenance of the immune memory response against measles.Tps present both quantitative and qualitative alterations in the maintenance of protective immunity to measles vaccine. Prospective studies are needed to optimize the vaccination schedules in kidney transplant recipients in order to increase the immunization coverage over time in this population.

  1. Zymosan-induced immune challenge modifies the stress response of hypoxic air-breathing fish (Anabas testudineus Bloch): Evidence for reversed patterns of cortisol and thyroid hormone interaction, differential ion transporter functions and non-specific immune response.

    PubMed

    Simi, S; Peter, Valsa S; Peter, M C Subhash

    2017-09-15

    Fishes have evolved physiological mechanisms to exhibit stress response, where hormonal signals interact with an array of ion transporters and regulate homeostasis. As major ion transport regulators in fish, cortisol and thyroid hormones have been shown to interact and fine-tune the stress response. Likewise, in fishes many interactions have been identified between stress and immune components, but the physiological basis of such interaction has not yet delineated particularly in air-breathing fish. We, therefore, investigated the responses of thyroid hormones and cortisol, ion transporter functions and non-specific immune response of an obligate air-breathing fish Anabas testudineus Bloch to zymosan treatment or hypoxia stress or both, to understand how immune challenge modifies the pattern of stress response in this fish. Induction of experimental peritonitis in these fish by zymosan treatment (200ngg -1 ) for 24h produced rise in respiratory burst and lysozomal activities in head kidney phagocytes. In contrast, hypoxia stress for 30min in immune-challenged fish reversed these non-specific responses of head kidney phagocytes. The decline in plasma cortisol in zymosan-treated fish and its further suppression by hypoxia stress indicate that immune challenge suppresses the cortisol-driven stress response of this fish. Likewise, the decline in plasma T 3 and T 4 after zymosan-treatment and the rise in plasma T 4 after hypoxia stress in immune-challenged fish indicate a critical role for thyroid hormone in immune-stress response due to its differential sensitivity to both immune and stress challenges. Further, analysis of the activity pattern of ion-dependent ATPases viz. Na + /K + -ATPase, H + /K + -ATPase and Na + /NH 4 + -ATPase indicates a functional interaction of ion transport system with the immune response as evident in its differential and spatial modifications after hypoxia stress in immune-challenged fish. The immune-challenge that produced differential

  2. Impaired intestinal immune barrier and physical barrier function by phosphorus deficiency: Regulation of TOR, NF-κB, MLCK, JNK and Nrf2 signalling in grass carp (Ctenopharyngodon idella) after infection with Aeromonas hydrophila.

    PubMed

    Chen, Kang; Zhou, Xiao-Qiu; Jiang, Wei-Dan; Wu, Pei; Liu, Yang; Jiang, Jun; Kuang, Sheng-Yao; Tang, Ling; Tang, Wu-Neng; Zhang, Yong-An; Feng, Lin

    2018-03-01

    In aquaculture, the occurrence of enteritis has increased and dietary nutrition is considered as one of the major strategies to solve this problem. In the present study, we assume that dietary phosphorus might enhance intestinal immune barrier and physical barrier function to reduce the occurrence of enteritis in fish. To test this assumption, a total of 540 grass carp (Ctenopharyngodon idella) were investigated by feeding graded levels of available phosphorus (0.95-8.75 g/kg diet) and then infection with Aeromonas hydrophila. The results firstly showed that phosphorus deficiency decreased the ability to combat enteritis, which might be related to the impairment of intestinal immune barrier and physical barrier function. Compared with optimal phosphorus level, phosphorus deficiency decreased fish intestinal antimicrobial substances activities or contents and down-regulated antimicrobial peptides mRNA levels leading to the impairment of intestinal immune response. Phosphorus deficiency down-regulated fish intestinal anti-inflammatory cytokines mRNA levels and up-regulated the mRNA levels of pro-inflammatory cytokines [except IL-1β and IL-12p35 in distal intestine (DI) and IL-12p40] causing aggravated of intestinal inflammatory responses, which might be related to the signalling molecules target of rapamycin and nuclear factor kappa B. In addition, phosphorus deficiency disturbed fish intestinal tight junction function and induced cell apoptosis as well as oxidative damage leading to impaired of fish intestinal physical barrier function, which might be partially associated with the signalling molecules myosin light chain kinase, c-Jun N-terminal protein kinase and NF-E2-related factor 2, respectively. Finally, based on the ability to combat enteritis, dietary available phosphorus requirement for grass carp (254.56-898.23 g) was estimated to be 4.68 g/kg diet. Copyright © 2017. Published by Elsevier Ltd.

  3. Actinobacillus pleuropneumoniae Iron Transport and Urease Activity: Effects on Bacterial Virulence and Host Immune Response

    PubMed Central

    Baltes, Nina; Tonpitak, Walaiporn; Gerlach, Gerald-F.; Hennig-Pauka, Isabel; Hoffmann-Moujahid, Astrid; Ganter, Martin; Rothkötter, Hermann-J.

    2001-01-01

    Actinobacillus pleuropneumoniae, a porcine respiratory tract pathogen, has been shown to express transferrin-binding proteins and urease during infection. Both activities have been associated with virulence; however, their functional role for infection has not yet been elucidated. We used two isogenic A. pleuropneumoniae single mutants (ΔexbB and ΔureC) and a newly constructed A. pleuropneumoniae double (ΔureC ΔexbB) mutant in aerosol infection experiments. Neither the A. pleuropneumoniae ΔexbB mutant nor the double ΔureC ΔexbB mutant was able to colonize sufficiently long to initiate a detectable humoral immune response. These results imply that the ability to utilize transferrin-bound iron is required for multiplication and persistence of A. pleuropneumoniae in the porcine respiratory tract. The A. pleuropneumoniae ΔureC mutant and the parent strain both caused infections that were indistinguishable from one another in the acute phase of disease; however, 3 weeks postinfection the A. pleuropneumoniae ΔureC mutant, in contrast to the parent strain, could not be isolated from healthy lung tissue. In addition, the local immune response—as assessed by fluorescence-activated cell sorter and enzyme-linked immunosorbent spot analyses—revealed a significantly higher number of A. pleuropneumoniae-specific B cells in the bronchoalveolar lavage fluid (BALF) of pigs infected with the A. pleuropneumoniae ΔureC mutant than in the BALF of those infected with the parent strain. These results imply that A. pleuropneumoniae urease activity may cause sufficient impairment of the local immune response to slightly improve the persistence of the urease-positive A. pleuropneumoniae parent strain. PMID:11119539

  4. Responses of innate immune cells to group A Streptococcus

    PubMed Central

    Fieber, Christina; Kovarik, Pavel

    2014-01-01

    Group A Streptococcus (GAS), also called Streptococcus pyogenes, is a Gram-positive beta-hemolytic human pathogen which causes a wide range of mostly self-limiting but also several life-threatening diseases. Innate immune responses are fundamental for defense against GAS, yet their activation by pattern recognition receptors (PRRs) and GAS-derived pathogen-associated molecular patterns (PAMPs) is incompletely understood. In recent years, the use of animal models together with the powerful tools of human molecular genetics began shedding light onto the molecular mechanisms of innate immune defense against GAS. The signaling adaptor MyD88 was found to play a key role in launching the immune response against GAS in both humans and mice, suggesting that PRRs of the Toll-like receptor (TLR) family are involved in sensing this pathogen. The specific TLRs and their ligands have yet to be identified. Following GAS recognition, induction of cytokines such as TNF and type I interferons (IFNs), leukocyte recruitment, phagocytosis, and the formation of neutrophil extracellular traps (NETs) have been recognized as key events in host defense. A comprehensive knowledge of these mechanisms is needed in order to understand their frequent failure against GAS immune evasion strategies. PMID:25325020

  5. The association of fatigue, pain, depression and anxiety with work and activity impairment in immune mediated inflammatory diseases.

    PubMed

    Enns, Murray W; Bernstein, Charles N; Kroeker, Kristine; Graff, Lesley; Walker, John R; Lix, Lisa M; Hitchon, Carol A; El-Gabalawy, Renée; Fisk, John D; Marrie, Ruth Ann

    2018-01-01

    Impairment in work function is a frequent outcome in patients with chronic conditions such as immune-mediated inflammatory diseases (IMID), depression and anxiety disorders. The personal and economic costs of work impairment in these disorders are immense. Symptoms of pain, fatigue, depression and anxiety are potentially remediable forms of distress that may contribute to work impairment in chronic health conditions such as IMID. The present study evaluated the association between pain [Medical Outcomes Study Pain Effects Scale], fatigue [Daily Fatigue Impact Scale], depression and anxiety [Hospital Anxiety and Depression Scale] and work impairment [Work Productivity and Activity Impairment Scale] in four patient populations: multiple sclerosis (n = 255), inflammatory bowel disease (n = 248, rheumatoid arthritis (n = 154) and a depression and anxiety group (n = 307), using quantile regression, controlling for the effects of sociodemographic factors, physical disability, and cognitive deficits. Each of pain, depression symptoms, anxiety symptoms, and fatigue individually showed significant associations with work absenteeism, presenteeism, and general activity impairment (quantile regression standardized estimates ranging from 0.3 to 1.0). When the distress variables were entered concurrently into the regression models, fatigue was a significant predictor of work and activity impairment in all models (quantile regression standardized estimates ranging from 0.2 to 0.5). These findings have important clinical implications for understanding the determinants of work impairment and for improving work-related outcomes in chronic disease.

  6. Sexual Dimorphism of Immune Responses: A New Perspective in Cancer Immunotherapy

    PubMed Central

    Capone, Imerio; Marchetti, Paolo; Ascierto, Paolo Antonio; Malorni, Walter; Gabriele, Lucia

    2018-01-01

    Nowadays, several types of tumors can benefit from the new frontier of immunotherapy, due to the recent increasing knowledge of the role of the immune system in cancer control. Among the new therapeutic strategies, there is the immune checkpoint blockade (ICB), able to restore an efficacious antitumor immunity and significantly prolong the overall survival (OS) of patients with advanced tumors such as melanoma and non-small cell lung cancer (NSCLC). Despite the impressive efficacy of these agents in some patients, treatment failure and resistance are frequently observed. In this regard, the signaling governed by IFN type I (IFN-I) has emerged as pivotal in orchestrating host defense. This pathway displays different activation between sexes, thus potentially contributing to sexual dimorphic differences in the immune responses to immunotherapy. This perspective article aims to critically consider the immune signals, with particular attention to IFN-I, that may differently affect female and male antitumor responses upon immunotherapy. PMID:29619026

  7. Sexual Dimorphism of Immune Responses: A New Perspective in Cancer Immunotherapy.

    PubMed

    Capone, Imerio; Marchetti, Paolo; Ascierto, Paolo Antonio; Malorni, Walter; Gabriele, Lucia

    2018-01-01

    Nowadays, several types of tumors can benefit from the new frontier of immunotherapy, due to the recent increasing knowledge of the role of the immune system in cancer control. Among the new therapeutic strategies, there is the immune checkpoint blockade (ICB), able to restore an efficacious antitumor immunity and significantly prolong the overall survival (OS) of patients with advanced tumors such as melanoma and non-small cell lung cancer (NSCLC). Despite the impressive efficacy of these agents in some patients, treatment failure and resistance are frequently observed. In this regard, the signaling governed by IFN type I (IFN-I) has emerged as pivotal in orchestrating host defense. This pathway displays different activation between sexes, thus potentially contributing to sexual dimorphic differences in the immune responses to immunotherapy. This perspective article aims to critically consider the immune signals, with particular attention to IFN-I, that may differently affect female and male antitumor responses upon immunotherapy.

  8. Comparison of the immune responses in BALB/c mice following immunization with DNA-based and live attenuated vaccines delivered via different routes.

    PubMed

    Cai, Ming-sheng; Deng, Shu-xuan; Li, Mei-li

    2013-02-18

    The objective of this study was to compare immune responses induced in BALB/c mice following immunization with pcDNA-GPV-VP2 DNA by gene gun bombardment (6 μg) or by intramuscular (im) injection (100 μg) with the responses to live attenuated vaccine by im injection (100 μl). pcDNA3.1 (+) and physiological saline were used as controls. Peripheral blood samples were collected at 3, 7, 14, 21, 28, 35, 49, 63, 77 and 105 d after immunization. T lymphocyte proliferation was analyzed by MTT assay and enumeration of CD4(+), and CD8(+) T cell populations in peripheral blood was performed by flow cytometric analysis. Indirect ELISA was used to detect IgG levels. Cellular and humoral responses were induced by pcDNA-GPV-VP2 DNA and live virus vaccines. No differences were observed in T cell proliferation and CD8(+) T cell responses induced by the genetic vaccine regardless of the route of delivery. However, CD4(+) T cell responses and humoral immunity were enhanced in following gene gun immunization compared with im injection of the genetic vaccine. Cellular and humoral immunity was enhanced in following gene gun delivery of the genetic vaccine compared with the live attenuated vaccine. In conclusion, the pcDNA-GPV-VP2 DNA vaccine induced enhanced cellular and humoral immunity compared with that induced by the live attenuated vaccine. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. Immune responses to implants - a review of the implications for the design of immunomodulatory biomaterials.

    PubMed

    Franz, Sandra; Rammelt, Stefan; Scharnweber, Dieter; Simon, Jan C

    2011-10-01

    A key for long-term survival and function of biomaterials is that they do not elicit a detrimental immune response. As biomaterials can have profound impacts on the host immune response the concept emerged to design biomaterials that are able to trigger desired immunological outcomes and thus support the healing process. However, engineering such biomaterials requires an in-depth understanding of the host inflammatory and wound healing response to implanted materials. One focus of this review is to outline the up-to-date knowledge on immune responses to biomaterials. Understanding the complex interactions of host response and material implants reveals the need for and also the potential of "immunomodulating" biomaterials. Based on this knowledge, we discuss strategies of triggering appropriate immune responses by functional biomaterials and highlight recent approaches of biomaterials that mimic the physiological extracellular matrix and modify cellular immune responses. Copyright © 2011 Elsevier Ltd. All rights reserved.

  10. Glassy Dynamics in the Adaptive Immune Response Prevents Autoimmune Disease

    NASA Astrophysics Data System (ADS)

    Sun, Jun; Deem, Michael

    2006-03-01

    The immune system normally protects the human host against death by infection. However, when an immune response is mistakenly directed at self antigens, autoimmune disease can occur. We describe a model of protein evolution to simulate the dynamics of the adaptive immune response to antigens. Computer simulations of the dynamics of antibody evolution show that different evolutionary mechanisms, namely gene segment swapping and point mutation, lead to different evolved antibody binding affinities. Although a combination of gene segment swapping and point mutation can yield a greater affinity to a specific antigen than point mutation alone, the antibodies so evolved are highly cross-reactive and would cause autoimmune disease, and this is not the chosen dynamics of the immune system. We suggest that in the immune system a balance has evolved between binding affinity and specificity in the mechanism for searching the amino acid sequence space of antibodies. Our model predicts that chronic infection may lead to autoimmune disease as well due to cross-reactivity and suggests a broad distribution for the time of onset of autoimmune disease due to chronic exposure. The slow search of antibody sequence space by point mutation leads to the broad of distribution times.

  11. The nature of immune responses to urinary tract infections

    PubMed Central

    Abraham, Soman N.; Miao, Yuxuan

    2016-01-01

    The urinary tract is constantly exposed to microorganisms that inhabit the gastrointestinal tract, but generally the urinary tract resists infection by gut microorganisms. This resistance to infection is mainly ascribed to the versatility of the innate immune defences in the urinary tract as the adaptive immune responses are limited, particularly when only the lower urinary tract is infected. In recent years, as the strengths and weaknesses of the immune system of the urinary tract have emerged and as the virulence attributes of uropathogens are recognized, several potentially effective and unconventional strategies to contain or prevent urinary tract infections have emerged. PMID:26388331

  12. Immune Dysregulation and Chronic Stress Among Older Adults: A Review

    PubMed Central

    Gouin, Jean-Philippe; Hantsoo, Liisa; Kiecolt-Glaser, Janice K.

    2009-01-01

    Aging is associated with a natural dysregulation in immune functioning which may be amplified when it occurs in the context of chronic stress. Family dementia caregiving provides an excellent model to study the impact of chronic stress on immune functioning among older individuals. Empirical data suggest that the stress of caregiving dysregulate multiple components of innate and adaptive immunity. Elderly caregivers have poorer responses to vaccines, impaired control of latent viruses, exaggerated production of inflammatory mediators, and accelerated cellular aging, compared to noncaregiving older adults. The chronic stress-induced immune dysregulation observed among older caregivers appear to be of sufficient magnitude to impact health. Furthermore, evidence suggests that chronic stress lead to premature aging of the immune system. PMID:19047802

  13. Pulmonary immune responses to Mycobacterium tuberculosis in exposed individuals

    PubMed Central

    Ernst, Martin; Lange, Christoph; Stenger, Steffen; Kaufmann, Stefan H. E.; Reiling, Norbert; Schaberg, Tom; van der Merwe, Lize; Maertzdorf, Jeroen

    2017-01-01

    Background Blood based Interferon-(IFN)-γ release assays (IGRAs) have a poor predictive value for the development of tuberculosis. This study aimed to investigate the correlation between IGRAs and pulmonary immune responses in tuberculosis contacts in Germany. Methods IGRAs were performed on bronchoalveolar lavage (BAL) cells and peripheral blood from close healthy contacts of patients with culturally confirmed tuberculosis. Cellular BAL composition was determined by flow cytometry. BAL cells were co-cultured with three strains of Mycobacterium tuberculosis (Mtb) and Mtb derived antigens including Purified Protein Derivative (PPD), 6 kD Early Secretory Antigenic Target (ESAT-6) and 10 kD Culture Filtrate Protein (CFP-10). Levels of 29 cytokines and chemokines were analyzed in the supernatants by multiplex assay. Associations and effects were examined using linear mixed-effects models. Results There were wide variations of inter-individual cytokine levels in BAL cell culture supernatants. Mycobacterial infection and stimulation with PPD showed a clear induction of several macrophage and lymphocyte associated cytokines, reflecting activation of these cell types. No robust correlation between cytokine patterns and blood IGRA status of the donor was observed, except for slightly higher Interleukin-2 (IL-2) responses in BAL cells from IGRA-positive donors upon mycobacterial infection compared to cells from IGRA-negative donors. Stronger correlations were observed when cytokine patterns were stratified according to BAL IGRA status. BAL cells from donors with BAL IGRA-positive responses produced significantly more IFN-γ and IL-2 upon PPD stimulation and mycobacterial infection than cells from BAL IGRA-negative individuals. Correlations between BAL composition and basal cytokine release from unstimulated cells were suggestive of pre-activated lymphocytes but impaired macrophage activity in BAL IGRA-positive donors, in contrast to BAL IGRA-negative donors. Conclusions In

  14. Circulating inflammatory monocytes contribute to impaired influenza vaccine responses in HIV-infected participants.

    PubMed

    George, Varghese K; Pallikkuth, Suresh; Pahwa, Rajendra; de Armas, Lesley R; Rinaldi, Stefano; Pan, Li; Pahwa, Savita

    2018-06-19

    Antibody responses are often impaired in old age and in HIV-positive (HIV+) infection despite virologic control with antiretroviral therapy but innate immunologic determinants are not well understood. Monocytes and natural killer cells were examined for relationships to age, HIV infection and influenza vaccine responses. Virologically suppressed HIV+ (n = 139) and HIV-negative (HIV-) (n = 137) participants classified by age as young (18-39 years), middle-aged (40-59 years) and old (≥60 years) were evaluated preinfluenza and postinfluenza vaccination. Prevaccination frequencies of inflammatory monocytes were highest in old HIV+ and HIV-, with old HIV+ exhibiting higher frequency of integrin CD11b on inflammatory monocytes that was correlated with age, expression of C-C chemokine receptor-2 (CCR2) and plasma soluble tumor necrosis factor receptor-1 (sTNFR1), with inverse correlation with postvaccination influenza H1N1 antibody titers. Higher frequencies of CD11b inflammatory monocytes (CD11b, >48.4%) compared with low frequencies of CD11b inflammatory monocytes (<15.8%) was associated with higher prevaccination frequencies of total and inflammatory monocytes and higher CCR2 MFI, higher plasma sTNFR1 and CXCL-10 with higher lipopolysaccharide stimulated expression of TNFα and IL-6, concomitant with lower postvaccination influenza antibody titers. In HIV+ CD11b expressers, the depletion of inflammatory monocytes from peripheral blood mononuclear cells resulted in enhanced antigen-specific CD4 T-cell proliferation. Immature CD56 natural killer cells were lower in young HIV+ compared with young HIV- participants. Perturbations of innate immunity and inflammation signified by high CD11b on inflammatory monocytes are exacerbated with aging in HIV+ and negatively impact immune function involved in Ab response to influenza vaccination.

  15. RNA Editing, ADAR1, and the Innate Immune Response.

    PubMed

    Wang, Qingde; Li, Xiaoni; Qi, Ruofan; Billiar, Timothy

    2017-01-18

    RNA editing, particularly A-to-I RNA editing, has been shown to play an essential role in mammalian embryonic development and tissue homeostasis, and is implicated in the pathogenesis of many diseases including skin pigmentation disorder, autoimmune and inflammatory tissue injury, neuron degeneration, and various malignancies. A-to-I RNA editing is carried out by a small group of enzymes, the adenosine deaminase acting on RNAs (ADARs). Only three members of this protein family, ADAR1-3, exist in mammalian cells. ADAR3 is a catalytically null enzyme and the most significant function of ADAR2 was found to be in editing on the neuron receptor GluR-B mRNA. ADAR1, however, has been shown to play more significant roles in biological and pathological conditions. Although there remains much that is not known about how ADAR1 regulates cellular function, recent findings point to regulation of the innate immune response as an important function of ADAR1. Without appropriate RNA editing by ADAR1, endogenous RNA transcripts stimulate cytosolic RNA sensing receptors and therefore activate the IFN-inducing signaling pathways. Overactivation of innate immune pathways can lead to tissue injury and dysfunction. However, obvious gaps in our knowledge persist as to how ADAR1 regulates innate immune responses through RNA editing. Here, we review critical findings from ADAR1 mechanistic studies focusing on its regulatory function in innate immune responses and identify some of the important unanswered questions in the field.

  16. Ubiquitination in the antiviral immune response.

    PubMed

    Davis, Meredith E; Gack, Michaela U

    2015-05-01

    Ubiquitination has long been known to regulate fundamental cellular processes through the induction of proteasomal degradation of target proteins. More recently, 'atypical' non-degradative types of polyubiquitin chains have been appreciated as important regulatory moieties by modulating the activity or subcellular localization of key signaling proteins. Intriguingly, many of these non-degradative types of ubiquitination regulate the innate sensing pathways initiated by pattern recognition receptors (PRRs), ultimately coordinating an effective antiviral immune response. Here we discuss recent advances in understanding the functional roles of degradative and atypical types of ubiquitination in innate immunity to viral infections, with a specific focus on the signaling pathways triggered by RIG-I-like receptors, Toll-like receptors, and the intracellular viral DNA sensor cGAS. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants

    PubMed Central

    Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J.; Shih, J. Wai-Kuo

    2017-01-01

    Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-γ-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biasedpathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-γ demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins. PMID:18675871

  18. Induction of multispecific Th-1 type immune response against HCV in mice by protein immunization using CpG and Montanide ISA 720 as adjuvants.

    PubMed

    Qiu, Qi; Wang, Richard Yuan-Hu; Jiao, Xuanmao; Jin, Bo; Sugauchi, Fuminaka; Grandinetti, Teresa; Alter, Harvey J; Shih, J Wai-Kuo

    2008-10-09

    Recent studies demonstrate that Th1-type immune responses against a broad spectrum of hepatitis C virus (HCV) gene products are crucial to the resolution of acute HCV infection. We investigated new vaccine approaches to augment the strength of HCV-specific Th1-type immune responses. ELISPOT assay revealed that single or multiple protein immunization using both CpG ODN and Montanide ISA 720 as adjuvants induced much stronger IFN-gamma-producing Th1 responses against core, NS3 and NS5b targets than did the formulation without these adjuvants. Protein vaccination using CpG ODN and Montanide ISA 720 as adjuvants also greatly enhanced humoral responses to HCV core, E1/E2 and NS3. When specific IgG isotypes were assayed, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants produced higher titers of IgG2a dominant antibodies than did protein immunization alone, indicating a more Th1-biased pathway. This increase in IgG2a is consistent with the induction of Th1 cells secreting IFN-gamma demonstrated by ELISPOT assay. In conclusion, protein immunization using CpG ODN and Montanide ISA 720 as adjuvants greatly enhanced cellular (Th1 type) as well as humoral immune responses against HCV in Balb/c mice. The use of adjuvants appears critical to the induction of Th1 immune responses during HCV vaccination with recombinant proteins.

  19. Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

    PubMed

    Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

    2015-10-01

    The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

  20. Live attenuated influenza vaccine (LAIV) impacts innate and adaptive immune responses.

    PubMed

    Lanthier, Paula A; Huston, Gail E; Moquin, Amy; Eaton, Sheri M; Szaba, Frank M; Kummer, Lawrence W; Tighe, Micheal P; Kohlmeier, Jacob E; Blair, Patrick J; Broderick, Michael; Smiley, Stephen T; Haynes, Laura

    2011-10-13

    Influenza A infection induces a massive inflammatory response in the lungs that leads to significant illness and increases the susceptibility to secondary bacterial pneumonia. The most efficient way to prevent influenza infection is through vaccination. While inactivated vaccines induce protective levels of serum antibodies to influenza hemaglutinin (HA) and neuraminidase (NA) surface proteins, these are strain specific and offer little protection against heterosubtypic influenza viruses. In contrast, live attenuated influenza vaccines (LAIVs) induce a T cell response in addition to antibody responses against HA and NA surface proteins. Importantly, LAIV vaccination induces a response in a mouse model that protects against illness due to heterosubtypic influenza strains. While it is not completely clear what is the mechanism of action of LAIV heterosubtypic protection in humans, it has been shown that LAIV induces heterosubtypic protection in mice that is dependent upon a Type 1 immune response and requires CD8 T cells. In this study, we show that LAIV-induced immunity leads to significantly reduced viral titers and inflammatory responses in the lungs of mice following heterosubtypic infection. Not only are viral titers reduced in LAIV vaccinated mice, the amounts of inflammatory cytokines and chemokines in lung tissue are significantly lower. Additionally, we show that LAIV vaccination of healthy adults also induces a robust Type 1 memory response including the production of chemokines and cytokines involved in T cell activation and recruitment. Thus, our results indicate that LAIV vaccination functions by inducing immune memory which can act to modulate the immune response to subsequent heterosubtypic challenge by influencing both innate and adaptive responses. Copyright © 2011 Elsevier Ltd. All rights reserved.

  1. Immune responses of poultry to Newcastle disease virus.

    PubMed

    Kapczynski, Darrell R; Afonso, Claudio L; Miller, Patti J

    2013-11-01

    Newcastle disease (ND) remains a constant threat to poultry producers worldwide, in spite of the availability and global employment of ND vaccinations since the 1950s. Strains of Newcastle disease virus (NDV) belong to the order Mononegavirales, family Paramyxoviridae, and genus Avulavirus, are contained in one serotype and are also known as avian paramyxovirus serotype-1 (APMV-1). They are pleomorphic in shape and are single-stranded, non-segmented, negative sense RNA viruses. The virus has been reported to infect most orders of birds and thus has a wide host range. Isolates are characterized by virulence in chickens and the presence of basic amino acids at the fusion protein cleavage site. Low virulent NDV typically produce subclinical disease with some morbidity, whereas virulent isolates can result in rapid, high mortality of birds. Virulent NDV are listed pathogens that require immediate notification to the Office of International Epizootics and outbreaks typically result in trade embargos. Protection against NDV is through the use of vaccines generated with low virulent NDV strains. Immunity is derived from neutralizing antibodies formed against the viral hemagglutinin and fusion glycoproteins, which are responsible for attachment and spread of the virus. However, new techniques and technologies have also allowed for more in depth analysis of the innate and cell-mediated immunity of poultry to NDV. Gene profiling experiments have led to the discovery of novel host genes modulated immediately after infection. Differences in virus virulence alter host gene response patterns have been demonstrated. Furthermore, the timing and contributions of cell-mediated immune responses appear to decrease disease and transmission potential. In view of recent reports of vaccine failure from many countries on the ability of classical NDV vaccines to stop spread of disease, renewed interest in a more complete understanding of the global immune response of poultry to NDV will be

  2. Plant immunity: unravelling the complexity of plant responses to biotic stresses.

    PubMed

    Miller, Robert Neil Gerard; Costa Alves, Gabriel Sergio; Van Sluys, Marie-Anne

    2017-03-01

    Plants are constantly exposed to evolving pathogens and pests, with crop losses representing a considerable threat to global food security. As pathogen evolution can overcome disease resistance that is conferred by individual plant resistance genes, an enhanced understanding of the plant immune system is necessary for the long-term development of effective disease management strategies. Current research is rapidly advancing our understanding of the plant innate immune system, with this multidisciplinary subject area reflected in the content of the 18 papers in this Special Issue. Advances in specific areas of plant innate immunity are highlighted in this issue, with focus on molecular interactions occurring between plant hosts and viruses, bacteria, phytoplasmas, oomycetes, fungi, nematodes and insect pests. We provide a focus on research across multiple areas related to pathogen sensing and plant immune response. Topics covered are categorized as follows: binding proteins in plant immunity; cytokinin phytohormones in plant growth and immunity; plant-virus interactions; plant-phytoplasma interactions; plant-fungus interactions; plant-nematode interactions; plant immunity in Citrus; plant peptides and volatiles; and assimilate dynamics in source/sink metabolism. Although knowledge of the plant immune system remains incomplete, the considerable ongoing scientific progress into pathogen sensing and plant immune response mechanisms suggests far reaching implications for the development of durable disease resistance against pathogens and pests. © The Author 2017. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  3. Host Immune Status and Response to Hepatitis E Virus Infection

    PubMed Central

    Krain, Lisa J.; Nelson, Kenrad E.

    2014-01-01

    SUMMARY Hepatitis E virus (HEV), identified over 30 years ago, remains a serious threat to life, health, and productivity in developing countries where access to clean water is limited. Recognition that HEV also circulates as a zoonotic and food-borne pathogen in developed countries is more recent. Even without treatment, most cases of HEV-related acute viral hepatitis (with or without jaundice) resolve within 1 to 2 months. However, HEV sometimes leads to acute liver failure, chronic infection, or extrahepatic symptoms. The mechanisms of pathogenesis appear to be substantially immune mediated. This review covers the epidemiology of HEV infection worldwide, the humoral and cellular immune responses to HEV, and the persistence and protection of antibodies produced in response to both natural infection and vaccines. We focus on the contributions of altered immune states (associated with pregnancy, human immunodeficiency virus [HIV], and immunosuppressive agents used in cancer and transplant medicine) to the elevated risks of chronic infection (in immunosuppressed/immunocompromised patients) and acute liver failure and mortality (among pregnant women). We conclude by discussing outstanding questions about the immune response to HEV and interactions with hormones and comorbid conditions. These questions take on heightened importance now that a vaccine is available. PMID:24396140

  4. Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus

    PubMed Central

    Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W

    2017-01-01

    BACKGROUND Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. OBJECTIVES Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). METHODS Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. FINDINGS The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. MAIN CONCLUSIONS These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions. PMID:29211244

  5. Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus.

    PubMed

    Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W

    2017-12-01

    Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions.

  6. Ebola Virus Glycoprotein Induces an Innate Immune Response In vivo via TLR4

    PubMed Central

    Lai, Chih-Yun; Strange, Daniel P.; Wong, Teri Ann S.; Lehrer, Axel T.; Verma, Saguna

    2017-01-01

    Ebola virus (EBOV), a member of the Filoviridae family, causes the most severe form of viral hemorrhagic fever. Although no FDA licensed vaccine or treatment against Ebola virus disease (EVD) is currently available, Ebola virus glycoprotein (GP) is the major antigen used in all candidate Ebola vaccines. Recent reports of protection as quickly as within 6 days of administration of the rVSV-based vaccine expressing EBOV GP before robust humoral responses were generated suggests that the innate immune responses elicited early after vaccination may contribute to the protection. However, the innate immune responses induced by EBOV GP in the absence of viral vectors or adjuvants have not been fully characterized in vivo. Our recent studies demonstrated that immunization with highly purified recombinant GP in the absence of adjuvants induced a robust IgG response and partial protection against EBOV infection suggesting that GP alone can induce protective immunity. In this study we investigated the early immune response to purified EBOV GP alone in vitro and in vivo. We show that GP was efficiently internalized by antigen presenting cells and subsequently induced production of key inflammatory cytokines. In vivo, immunization of mice with EBOV GP triggered the production of key Th1 and Th2 innate immune cytokines and chemokines, which directly governed the recruitment of CD11b+ macrophages and CD11c+ dendritic cells to the draining lymph nodes (DLNs). Pre-treatment of mice with a TLR4 antagonist inhibited GP-induced cytokine production and recruitment of immune cells to the DLN. EBOV GP also upregulated the expression of costimulatory molecules in bone marrow derived macrophages suggesting its ability to enhance APC stimulatory capacity, which is critical for the induction of effective antigen-specific adaptive immunity. Collectively, these results provide the first in vivo evidence that early innate immune responses to EBOV GP are mediated via the TLR4 pathway and are

  7. Adrenergic Signaling: A Targetable Checkpoint Limiting Development of the Antitumor Immune Response

    PubMed Central

    Qiao, Guanxi; Chen, Minhui; Bucsek, Mark J.; Repasky, Elizabeth A.; Hylander, Bonnie L.

    2018-01-01

    An immune response must be tightly controlled so that it will be commensurate with the level of response needed to protect the organism without damaging normal tissue. The roles of cytokines and chemokines in orchestrating these processes are well known, but although stress has long been thought to also affect immune responses, the underlying mechanisms were not as well understood. Recently, the role of nerves and, specifically, the sympathetic nervous system, in regulating immune responses is being revealed. Generally, an acute stress response is beneficial but chronic stress is detrimental because it suppresses the activities of effector immune cells while increasing the activities of immunosuppressive cells. In this review, we first discuss the underlying biology of adrenergic signaling in cells of both the innate and adaptive immune system. We then focus on the effects of chronic adrenergic stress in promoting tumor growth, giving examples of effects on tumor cells and immune cells, explaining the methods commonly used to induce stress in preclinical mouse models. We highlight how this relates to our observations that mandated housing conditions impose baseline chronic stress on mouse models, which is sufficient to cause chronic immunosuppression. This problem is not commonly recognized, but it has been shown to impact conclusions of several studies of mouse physiology and mouse models of disease. Moreover, the fact that preclinical mouse models are chronically immunosuppressed has critical ramifications for analysis of any experiments with an immune component. Our group has found that reducing adrenergic stress by housing mice at thermoneutrality or treating mice housed at cooler temperatures with β-blockers reverses immunosuppression and significantly improves responses to checkpoint inhibitor immunotherapy. These observations are clinically relevant because there are numerous retrospective epidemiological studies concluding that cancer patients who were

  8. Adrenergic Signaling: A Targetable Checkpoint Limiting Development of the Antitumor Immune Response.

    PubMed

    Qiao, Guanxi; Chen, Minhui; Bucsek, Mark J; Repasky, Elizabeth A; Hylander, Bonnie L

    2018-01-01

    An immune response must be tightly controlled so that it will be commensurate with the level of response needed to protect the organism without damaging normal tissue. The roles of cytokines and chemokines in orchestrating these processes are well known, but although stress has long been thought to also affect immune responses, the underlying mechanisms were not as well understood. Recently, the role of nerves and, specifically, the sympathetic nervous system, in regulating immune responses is being revealed. Generally, an acute stress response is beneficial but chronic stress is detrimental because it suppresses the activities of effector immune cells while increasing the activities of immunosuppressive cells. In this review, we first discuss the underlying biology of adrenergic signaling in cells of both the innate and adaptive immune system. We then focus on the effects of chronic adrenergic stress in promoting tumor growth, giving examples of effects on tumor cells and immune cells, explaining the methods commonly used to induce stress in preclinical mouse models. We highlight how this relates to our observations that mandated housing conditions impose baseline chronic stress on mouse models, which is sufficient to cause chronic immunosuppression. This problem is not commonly recognized, but it has been shown to impact conclusions of several studies of mouse physiology and mouse models of disease. Moreover, the fact that preclinical mouse models are chronically immunosuppressed has critical ramifications for analysis of any experiments with an immune component. Our group has found that reducing adrenergic stress by housing mice at thermoneutrality or treating mice housed at cooler temperatures with β-blockers reverses immunosuppression and significantly improves responses to checkpoint inhibitor immunotherapy. These observations are clinically relevant because there are numerous retrospective epidemiological studies concluding that cancer patients who were

  9. IRAK4 activity controls immune responses to intracellular bacteria Listeria monocytogenes and Mycobacterium smegmatis.

    PubMed

    Pattabiraman, Goutham; Murphy, Michael; Agliano, Federica; Karlinsey, Keaton; Medvedev, Andrei E

    2018-05-11

    IL-1 receptor-associated kinase (IRAK) 4 is a central enzyme of the TLR pathways. This study tested the hypothesis that IRAK4 kinase activity is prerequisite for regulating innate immunity during infections with intracellular bacteria. To this end, we analyzed responses of macrophages obtained from mice expressing wild-type (WT) IRAK4 or its kinase-inactive K213M mutant (IRAK4 KI ) upon infection with intracellular bacteria Listeria monocytogenes or Mycobacterium smegmatis. In contrast to robust induction of cytokines by macrophages expressing kinase-sufficient IRAK4, IRAK4 KI macrophages expressed decreased TNF-α, IL-6, IL-1β, and C-C motif chemokine ligand 5 upon infection with L. monocytogenes or M. smegmatis. Bacterial infection of IRAK4 KI macrophages led to attenuated activation of IRAK1, MAPKs and NF-κB, impaired induction of inducible NO synthase mRNA and secretion of NO, but resulted in elevated microbial burdens. Compared with WT animals, systemic infection of IRAK4 KI mice with M. smegmatis or L. monocytogenes resulted in decreased levels of serum IL-6 and CXCL-1 but increased bacterial burdens in the spleen and liver. Thus, a loss of IRAK4 kinase activity underlies deficient cytokine and microbicidal responses during infection with intracellular bacteria L. monocytogenes or M. smegmatis via impaired activation of IRAK1, MAPKs, and NF-κB but increases bacterial burdens, correlating with decreased induction of NO. ©2018 Society for Leukocyte Biology.

  10. Exercise and the Regulation of Immune Functions.

    PubMed

    Simpson, Richard J; Kunz, Hawley; Agha, Nadia; Graff, Rachel

    2015-01-01

    Exercise has a profound effect on the normal functioning of the immune system. It is generally accepted that prolonged periods of intensive exercise training can depress immunity, while regular moderate intensity exercise is beneficial. Single bouts of exercise evoke a striking leukocytosis and a redistribution of effector cells between the blood compartment and the lymphoid and peripheral tissues, a response that is mediated by increased hemodynamics and the release of catecholamines and glucocorticoids following the activation of the sympathetic nervous system and the hypothalamic-pituitary-adrenal axis. Single bouts of prolonged exercise may impair T-cell, NK-cell, and neutrophil function, alter the Type I and Type II cytokine balance, and blunt immune responses to primary and recall antigens in vivo. Elite athletes frequently report symptoms associated with upper respiratory tract infections (URTI) during periods of heavy training and competition that may be due to alterations in mucosal immunity, particularly reductions in secretory immunoglobulin A. In contrast, single bouts of moderate intensity exercise are "immuno-enhancing" and have been used to effectively increase vaccine responses in "at-risk" patients. Improvements in immunity due to regular exercise of moderate intensity may be due to reductions in inflammation, maintenance of thymic mass, alterations in the composition of "older" and "younger" immune cells, enhanced immunosurveillance, and/or the amelioration of psychological stress. Indeed, exercise is a powerful behavioral intervention that has the potential to improve immune and health outcomes in the elderly, the obese, and patients living with cancer and chronic viral infections such as HIV. © 2015 Elsevier Inc. All rights reserved.

  11. Impact of Chronic Viral Infection on T-Cell Dependent Humoral Immune Response.

    PubMed

    Rodriguez, Stéphane; Roussel, Mikaël; Tarte, Karin; Amé-Thomas, Patricia

    2017-01-01

    During the last decades, considerable efforts have been done to decipher mechanisms supported by microorganisms or viruses involved in the development, differentiation, and function of immune cells. Pathogens and their associated secretome as well as the continuous inflammation observed in chronic infection are shaping both innate and adaptive immunity. Secondary lymphoid organs are functional structures ensuring the mounting of adaptive immune response against microorganisms and viruses. Inside these organs, germinal centers (GCs) are the specialized sites where mature B-cell differentiation occurs leading to the release of high-affinity immunoglobulin (Ig)-secreting cells. Different steps are critical to complete B-cell differentiation process, including proliferation, somatic hypermutations in Ig variable genes, affinity-based selection, and class switch recombination. All these steps require intense interactions with cognate CD4 + helper T cells belonging to follicular helper lineage. Interestingly, pathogens can disturb this subtle machinery affecting the classical adaptive immune response. In this review, we describe how viruses could act directly on GC B cells, either through B-cell infection or by their contribution to B-cell cancer development and maintenance. In addition, we depict the indirect impact of viruses on B-cell response through infection of GC T cells and stromal cells, leading to immune response modulation.

  12. Immune thrombocytopenia: No longer ‘idiopathic’

    PubMed Central

    McCRAE, KEITH

    2012-01-01

    Immune thrombocytopenia (ITP) is a common hematologic disorder. Its pathogenesis involves both accelerated platelet destruction and impaired platelet production. First-line agents are usually effective initially but do not provide long-term responses. Splenectomy remains an effective long-term therapy, as does rituximab (Rituxan) in a subset of patients. Thrombopoietic agents offer a new alternative, although their place in the overall management of ITP remains uncertain. PMID:21632906

  13. Characterization of the immune response to canine parvovirus induced by vaccination with chimaeric plant viruses.

    PubMed

    Nicholas, Benjamin L; Brennan, F R; Martinez-Torrecuadrada, J L; Casal, J I; Hamilton, W D; Wakelin, D

    2002-06-21

    NIH mice were vaccinated subcutaneously or intranasally with chimaeric cow pea mosaic virus (CPMV) constructs expressing a 17-mer peptide sequence from canine parvovirus (CPV) as monomers or dimers on the small or large protein surface subunits. Responses to the chimaeric virus particles (CVPs) were compared with those of mice immunized with the native virus or with parvovirus peptide conjugated to keyhole limpet haemocyanin (KLH). The characteristics of the immune response to vaccination were examined by measuring serum and mucosal antibody responses in ELISA, in vitro antigen-induced spleen cell proliferation and cytokine responses. Mice made strong antibody responses to the native plant virus and peptide-specific responses to two of the four CVP constructs tested which were approximately 10-fold lower than responses to native plant virus. The immune response generated by the CVP constructs showed a marked TH1 bias, as determined by a predominantly IgG(2a) isotype peptide-specific antibody response and the release of IFN-gamma but not IL-4 or IL-5 from lymphocytes exposed to antigen in vitro. In comparison, parvovirus peptide conjugated to KLH generated an IgG(1)-biased (TH2) response. These data indicate that the presentation of peptides on viral particles could be used to bias the immune response in favor of a TH1 response.Anti-viral and anti-peptide IgA were detected in intestinal and bronchial lavage fluid of immunized mice, demonstrating that a mucosal immune response to CPV can be generated by systemic and mucosal immunization with CVP vaccines. Serum antibody from both subcutaneously-vaccinated and intranasally-vaccinated mice showed neutralizing activity against CPV in vitro.

  14. Acquired immune response to oncogenic human papillomavirus associated with prophylactic cervical cancer vaccines.

    PubMed

    Einstein, Mark H

    2008-04-01

    Human papillomavirus (HPV) is a common infection among women and a necessary cause of cervical cancer. Oncogenic HPV types infecting the anogenital tract have the potential to induce natural immunity, but at present we do not clearly understand the natural history of infection in humans and the mechanisms by which the virus can evade the host immune response. Natural acquired immune responses against HPV may be involved in the clearance of infection, but persistent infection with oncogenic virus types leads to the development of precancerous lesions and cancer. B cell responses are important for viral neutralization, but antibody responses in patients with cervical cancer are poor. Prophylactic vaccines targeting oncogenic virus types associated with cervical cancer have the potential to prevent up to 80% of cervical cancers by targeting HPV types 16 and 18. Clinical data show that prophylactic vaccines are effective in inducing antibody responses and in preventing persistent infection with HPV, as well as the subsequent development of high-grade cervical intraepithelial neoplasia. This article reviews the known data regarding natural immune responses to HPV and those developed by prophylactic vaccination.

  15. Difference in immune response in vaccinated and unvaccinated Swedish individuals after the 2009 influenza pandemic

    PubMed Central

    2014-01-01

    Background Previous exposures to flu and subsequent immune responses may impact on 2009/2010 pandemic flu vaccine responses and clinical symptoms upon infection with the 2009 pandemic H1N1 influenza strain. Qualitative and quantitative differences in humoral and cellular immune responses associated with the flu vaccination in 2009/2010 (pandemic H1N1 vaccine) and natural infection have not yet been described in detail. We designed a longitudinal study to examine influenza- (flu-) specific immune responses and the association between pre-existing flu responses, symptoms of influenza-like illness (ILI), impact of pandemic flu infection, and pandemic flu vaccination in a cohort of 2,040 individuals in Sweden in 2009–2010. Methods Cellular flu-specific immune responses were assessed by whole-blood antigen stimulation assay, and humoral responses by a single radial hemolysis test. Results Previous seasonal flu vaccination was associated with significantly lower flu-specific IFN-γ responses (using a whole-blood assay) at study entry. Pandemic flu vaccination induced long-lived T-cell responses (measured by IFN-γ production) to influenza A strains, influenza B strains, and the matrix (M1) antigen. In contrast, individuals with pandemic flu infection (PCR positive) exhibited increased flu-specific T-cell responses shortly after onset of ILI symptoms but the immune response decreased after the flu season (spring 2010). We identified non-pandemic-flu vaccinated participants without ILI symptoms who showed an IFN-γ production profile similar to pandemic-flu infected participants, suggesting exposure without experiencing clinical symptoms. Conclusions Strong and long-lived flu-M1 specific immune responses, defined by IFN-γ production, in individuals after vaccination suggest that M1-responses may contribute to protective cellular immune responses. Silent flu infections appeared to be frequent in 2009/2010. The pandemic flu vaccine induced qualitatively and quantitatively

  16. Dissecting innate immune responses with the tools of systems biology.

    PubMed

    Smith, Kelly D; Bolouri, Hamid

    2005-02-01

    Systems biology strives to derive accurate predictive descriptions of complex systems such as innate immunity. The innate immune system is essential for host defense, yet the resulting inflammatory response must be tightly regulated. Current understanding indicates that this system is controlled by complex regulatory networks, which maintain homoeostasis while accurately distinguishing pathogenic infections from harmless exposures. Recent studies have used high throughput technologies and computational techniques that presage predictive models and will be the foundation of a systems level understanding of innate immunity.

  17. Interplay between immune responses to HLA and non-HLA self-antigens in allograft rejection.

    PubMed

    Angaswamy, Nataraju; Tiriveedhi, Venkataswarup; Sarma, Nayan J; Subramanian, Vijay; Klein, Christina; Wellen, Jason; Shenoy, Surendra; Chapman, William C; Mohanakumar, T

    2013-11-01

    Recent studies strongly suggest an increasing role for immune responses against self-antigens (Ags) which are not encoded by the major histocompatibility complex in the immunopathogenesis of allograft rejection. Although, improved surgical techniques coupled with improved methods to detect and avoid sensitization against donor human leukocyte antigen (HLA) have improved the immediate and short term function of transplanted organs. However, acute and chronic rejection still remains a vexing problem for the long term function of the transplanted organ. Immediately following organ transplantation, several factors both immune and non immune mechanisms lead to the development of local inflammatory milieu which sets the stage for allograft rejection. Traditionally, development of antibodies (Abs) against mismatched donor HLA have been implicated in the development of Ab mediated rejection. However, recent studies from our laboratory and others have demonstrated that development of humoral and cellular immune responses against non-HLA self-Ags may contribute in the pathogenesis of allograft rejection. There are reports demonstrating that immune responses to self-Ags especially Abs to the self-Ags as well as cellular immune responses especially through IL17 has significant pro-fibrotic properties leading to chronic allograft failure. This review summarizes recent studies demonstrating the role for immune responses to self-Ags in allograft immunity leading to rejection as well as present recent evidence suggesting there is interplay between allo- and autoimmunity leading to allograft dysfunction. Copyright © 2013 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  18. An Organismal Model for Gene Regulatory Networks in the Gut-Associated Immune Response

    PubMed Central

    Buckley, Katherine M.; Rast, Jonathan P.

    2017-01-01

    The gut epithelium is an ancient site of complex communication between the animal immune system and the microbial world. While elements of self-non-self receptors and effector mechanisms differ greatly among animal phyla, some aspects of recognition, regulation, and response are broadly conserved. A gene regulatory network (GRN) approach provides a means to investigate the nature of this conservation and divergence even as more peripheral functional details remain incompletely understood. The sea urchin embryo is an unparalleled experimental model for detangling the GRNs that govern embryonic development. By applying this theoretical framework to the free swimming, feeding larval stage of the purple sea urchin, it is possible to delineate the conserved regulatory circuitry that regulates the gut-associated immune response. This model provides a morphologically simple system in which to efficiently unravel regulatory connections that are phylogenetically relevant to immunity in vertebrates. Here, we review the organism-wide cellular and transcriptional immune response of the sea urchin larva. A large set of transcription factors and signal systems, including epithelial expression of interleukin 17 (IL17), are important mediators in the activation of the early gut-associated response. Many of these have homologs that are active in vertebrate immunity, while others are ancient in animals but absent in vertebrates or specific to echinoderms. This larval model provides a means to experimentally characterize immune function encoded in the sea urchin genome and the regulatory interconnections that control immune response and resolution across the tissues of the organism. PMID:29109720

  19. Self-adjuvanted mRNA vaccines induce local innate immune responses that lead to a potent and boostable adaptive immunity.

    PubMed

    Kowalczyk, Aleksandra; Doener, Fatma; Zanzinger, Kai; Noth, Janine; Baumhof, Patrick; Fotin-Mleczek, Mariola; Heidenreich, Regina

    2016-07-19

    mRNA represents a new platform for the development of therapeutic and prophylactic vaccines with high flexibility with respect to production and application. We have previously shown that our two component self-adjuvanted mRNA-based vaccines (termed RNActive® vaccines) induce balanced immune responses comprising both humoral and cellular effector as well as memory responses. Here, we evaluated the early events upon intradermal application to gain more detailed insights into the underlying mode of action of our mRNA-based vaccine. We showed that the vaccine is taken up in the skin by both non-leukocytic and leukocytic cells, the latter being mostly represented by antigen presenting cells (APCs). mRNA was then transported to the draining lymph nodes (dLNs) by migratory dendritic cells. Moreover, the encoded protein was expressed and efficiently presented by APCs within the dLNs as shown by T cell proliferation and immune cell activation, followed by the induction of the adaptive immunity. Importantly, the immunostimulation was limited to the injection site and lymphoid organs as no proinflammatory cytokines were detected in the sera of the immunized mice indicating a favorable safety profile of the mRNA-based vaccines. Notably, a substantial boostability of the immune responses was observed, indicating that mRNA can be used effectively in repetitive immunization schedules. The evaluation of the immunostimulation following prime and boost vaccination revealed no signs of exhaustion as demonstrated by comparable levels of cytokine production at the injection site and immune cell activation within dLNs. In summary, our data provide mechanistic insight into the mode of action and a rational for the use of mRNA-based vaccines as a promising immunization platform. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Comparison of the humoral and cellular immune responses between body and head lice following bacterial challenge.

    PubMed

    Kim, Ju Hyeon; Min, Jee Sun; Kang, Jae Soon; Kwon, Deok Ho; Yoon, Kyong Sup; Strycharz, Joseph; Koh, Young Ho; Pittendrigh, Barry Robert; Clark, J Marshall; Lee, Si Hyeock

    2011-05-01

    The differences in the immune response between body lice, Pediculus humanus humanus, and head lice, Pediculus humanus capitis, were investigated initially by measuring the proliferation rates of two model bacteria, a Gram-positive Staphylococcus aureus and a Gram-negative Escherichia coli, following challenge by injection. Body lice showed a significantly reduced immune response compared to head lice particularly to E. coli at the early stage of the immune challenge. Annotation of the body louse genome identified substantially fewer immune-related genes compared with other insects. Nevertheless, all required genetic components of the major immune pathways, except for the immune deficiency (Imd) pathway, are still retained in the body louse genome. Transcriptional profiling of representative genes involved in the humoral immune response, following bacterial challenge, revealed that both body and head lice, regardless of their developmental stages, exhibited an increased immune response to S. aureus but little to E. coli. Head lice, however, exhibited a significantly higher phagocytotic activity against E. coli than body lice, whereas the phagocytosis against S. aureus differed only slightly between body and head lice. These findings suggest that the greater immune response in head lice against E. coli is largely due to enhanced phagocytosis and not due to differences in the humoral immune response. The reduced phagocytotic activity in body lice could be responsible, in part, for their increased vector competence. Copyright © 2011 Elsevier Ltd. All rights reserved.

  1. Hemagglutinating virus of Japan envelope (HVJ-E) can enhance the immune responses of swine immunized with killed PRRSV vaccine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dai, Zhihong; China Institute of Veterinary Drug Control, Beijing 100081; Zhang, Quan

    Highlights: Black-Right-Pointing-Pointer We investigated the immunoadjuvant effects of HVJ-E on killed PRRSV vaccine. Black-Right-Pointing-Pointer HVJ-E enhanced the humoral and cellular responses of the piglets to PRRSV. Black-Right-Pointing-Pointer It is suggested that HVJ-E could be developed as a new-type adjuvant for mammals. -- Abstract: Porcine reproductive and respiratory syndrome virus (PRRSV) is an economically detrimental pig pathogen that causes significant losses for the pig industry. The immunostimulatory effects of hemagglutinating virus of Japan envelope (HVJ-E) in cancer therapy and the adjuvant efficacy of HVJ-E have been previously evaluated. The objective of this study was to investigate the adjuvant effects of HVJ-Emore » on immunization with killed PRRSV vaccine, and to evaluate the protective effects of this immunization strategy against virulent PRRSV infection in piglets. Next, the PRRSV-specific antibody response, lymphocyte proliferation, PRRSV-specific IL-2, IL-10 and IFN-{gamma} production, and the overall protection efficacy were evaluated to assess the immune responses of the piglets. The results showed that the piglets inoculated simultaneously with killed PRRSV vaccine and HVJ-E had a significantly stronger immune response than those inoculated with killed PRRSV vaccine alone. Our results suggest that HVJ-E could be employed as an effective adjuvant to enhance the humoral and cellular responses of piglets to PRRSV.« less

  2. Defective B cell response to T-dependent immunization in lupus-prone mice

    PubMed Central

    Niu, Haitao; Sobel, Eric S.; Morel, Laurence

    2009-01-01

    Lupus anti-nuclear Abs show the characteristics of Ag-driven T cell-dependent (TD) humoral responses. If autoAgs elicit the same response as exogenous Ags, lupus should enhance humoral responses to immunization. Blunted responses to various immunizations have, however, been reported in a significant portion of lupus patients. In this study, we show that lupus-prone B6.Sle1.Sle2.Sle3 (B6.TC) mice produce significantly less Ab in response to TD immunization than congenic controls, while producing significantly more total Ig. This blunted Ab response to TD Ag could be reconstituted with B6.TC B and CD4+ T cells. Multiple defects were found in the B6.TC response to NP-KLH as compared to total Ig, including a smaller percentage of B cells participating to the NP-response, a reduced entry into germinal centers, and highly defective production of NP-specific long-lived plasma cells in the bone marrow. B6.TC plasma cells expressed reduced levels of FcγRIIb, which suggests that reduced apoptosis in resident plasma cells prevents the establishment of newly-formed NP-specific plasma cells in bone marrow niches. Overall, these results show that lupus-prone mice responded differently to auto- and exogenous antigens and suggest that low FcγRIIb, hypergammaglobulinemia and high autoantibody production would be predictive of a poor response to immunization in lupus patients. PMID:18924209

  3. Neutrophil Apoptosis: Relevance to the Innate Immune Response and Inflammatory Disease

    PubMed Central

    Fox, Sarah; Leitch, Andrew E.; Duffin, Rodger; Haslett, Christopher; Rossi, Adriano G.

    2010-01-01

    Neutrophils are the most abundant cell type involved in the innate immune response. They are rapidly recruited to sites of injury or infection where they engulf and kill invading microorganisms. Neutrophil apoptosis, the process of programmed cell death that prevents the release of neutrophil histotoxic contents, is tightly regulated and limits the destructive capacity of neutrophil products to surrounding tissue. The subsequent recognition and phagocytosis of apoptotic cells by phagocytic cells such as macrophages is central to the successful resolution of an inflammatory response and it is increasingly apparent that the dying neutrophil itself exerts an anti-inflammatory effect through modulation of surrounding cell responses, particularly macrophage inflammatory cytokine release. Apoptosis may be delayed, induced or enhanced by micro-organisms dependent on their immune evasion strategies and the health of the host they encounter. There is now an established field of research aimed at understanding the regulation of apoptosis and its potential as a target for therapeutic intervention in inflammatory and infective diseases. This review focuses on the physiological regulation of neutrophil apoptosis with respect to the innate immune system and highlights recent advances in mechanistic understanding of apoptotic pathways and their therapeutic manipulation in appropriate and excessive innate immune responses. PMID:20375550

  4. Immune response varies with rate of dispersal in invasive cane toads (Rhinella marina).

    PubMed

    Brown, Gregory P; Shine, Richard

    2014-01-01

    What level of immunocompetence should an animal maintain while undertaking long-distance dispersal? Immune function (surveillance and response) might be down-regulated during prolonged physical exertion due to energy depletion, and/or to avoid autoimmune reactions arising from damaged tissue. On the other hand, heightened immune vigilance might be favored if the organism encounters novel pathogens as it enters novel environments. We assessed the links between immune defense and long-distance movement in a population of invasive cane toads (Rhinella marina) in Australia. Toads were radio-tracked for seven days to measure their activity levels and were then captured and subjected to a suite of immune assays. Toads that moved further showed decreased bacteria-killing ability in their plasma and decreased phagocytic activity in their whole blood, but a heightened skin-swelling response to phytohemagglutinin. Baseline and post-stress corticosterone levels were unrelated to distance moved. Thus, long-distance movement in cane toads is associated with a dampened response in some systems and enhanced response in another. This pattern suggests that sustained activity is accompanied by trade-offs among immune components rather than an overall down or up-regulation. The finding that high mobility is accompanied by modification of the immune system has important implications for animal invasions.

  5. Complement anaphylatoxins as immune regulators in cancer.

    PubMed

    Sayegh, Eli T; Bloch, Orin; Parsa, Andrew T

    2014-08-01

    The role of the complement system in innate immunity is well characterized. However, a recent body of research implicates the complement anaphylatoxins C3a and C5a as insidious propagators of tumor growth and progression. It is now recognized that certain tumors elaborate C3a and C5a and that complement, as a mediator of chronic inflammation and regulator of immune function, may in fact foster rather than defend against tumor growth. A putative mechanism for this function is complement-mediated suppression of immune effector cells responsible for immunosurveillance within the tumor microenvironment. This paradigm accords with models of immune dysregulation, such as autoimmunity and infectious disease, which have defined a pathophysiological role for abnormal complement signaling. Several types of immune cells express the cognate receptors for the complement anaphylatoxins, C3aR and C5aR, and demonstrate functional modulation in response to complement stimulation. In turn, impairment of antitumor immunity has been intimately tied to tumor progression in animal models of cancer. In this article, the literature was systematically reviewed to identify studies that have characterized the effects of the complement anaphylatoxins on the composition and function of immune cells within the tumor microenvironment. The search identified six studies based upon models of lymphoma and ovarian, cervical, lung, breast, and mammary cancer, which collectively support the paradigm of complement as an immune regulator in the tumor microenvironment. © 2014 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  6. Cold exposure down-regulates immune response pathways in ferret aortic perivascular adipose tissue.

    PubMed

    Reynés, Bàrbara; van Schothorst, Evert M; García-Ruiz, Estefanía; Keijer, Jaap; Palou, Andreu; Oliver, Paula

    2017-05-03

    Perivascular adipose tissue (PVAT) surrounds blood vessels and releases paracrine factors, such as cytokines, which regulate local inflammation. The inflammatory state of PVAT has an important role in vascular disease; a pro-inflammatory state has been related with atherosclerosis development, whereas an anti-inflammatory one is protective. Cold exposure beneficially affects immune responses and, could thus impact the pathogenesis of cardiovascular diseases. In this study, we investigated the effects of one-week of cold exposure at 4°C of ferrets on aortic PVAT (aPVAT) versus subcutaneous adipose tissue. Ferrets were used because of the similarity of their adipose tissues to those of humans. A ferret-specific Agilent microarray was designed to cover the complete ferret genome and global gene expression analysis was performed. The data showed that cold exposure altered gene expression mainly in aPVAT. Most of the regulated genes were associated with cell cycle, immune response and gene expression regulation, and were mainly down-regulated. Regarding the effects on immune response, cold acclimation decreased the expression of genes involved in antigen recognition and presentation, cytokine signalling and immune system maturation and activation. This immunosuppressive gene expression pattern was depot-specific, as it was not observed in the inguinal subcutaneous depot. Interestingly, this depression in immune response related genes was also evident in peripheral blood mononuclear cells (PBMC). In conclusion, these results reveal that cold acclimation produces an inhibition of immune response-related pathways in aPVAT, reflected in PBMC, indicative of an anti-inflammatory response, which can potentially be exploited for the enhancement or maintenance of cardiovascular health.

  7. Modulation of Specific and Allergy-Related Immune Responses by Helminths

    PubMed Central

    Daniłowicz-Luebert, Emilia; O'Regan, Noëlle L.; Steinfelder, Svenja; Hartmann, Susanne

    2011-01-01

    Helminths are master regulators of host immune responses utilising complex mechanisms to dampen host protective Th2-type responses and favour long-term persistence. Such evasion mechanisms ensure mutual survival of both the parasite and the host. In this paper, we present recent findings on the cells that are targeted by helminths and the molecules and mechanisms that are induced during infection. We discuss the impact of these factors on the host response as well as their effect in preventing the development of aberrant allergic inflammation. We also examine recent findings on helminth-derived molecules that can be used as tools to pinpoint the underlying mechanisms of immune regulation or to determine new anti-inflammatory therapeutics. PMID:22219659

  8. Tetranychus urticae mites do not mount an induced immune response against bacteria

    PubMed Central

    Santos-Matos, Gonçalo; Wybouw, Nicky; Martins, Nelson E.; Zélé, Flore; Riga, Maria; Leitão, Alexandre B.; Vontas, John; Grbić, Miodrag; Van Leeuwen, Thomas; Magalhães, Sara

    2017-01-01

    The genome of the spider mite Tetranychus urticae, a herbivore, is missing important elements of the canonical Drosophila immune pathways necessary to fight bacterial infections. However, it is not known whether spider mites can mount an immune response and survive bacterial infection. In other chelicerates, bacterial infection elicits a response mediated by immune effectors leading to the survival of infected organisms. In T. urticae, infection by either Escherichia coli or Bacillus megaterium did not elicit a response as assessed through genome-wide transcriptomic analysis. In line with this, spider mites died within days even upon injection with low doses of bacteria that are non-pathogenic to Drosophila. Moreover, bacterial populations grew exponentially inside the infected spider mites. By contrast, Sancassania berlesei, a litter-dwelling mite, controlled bacterial proliferation and resisted infections with both Gram-negative and Gram-positive bacteria lethal to T. urticae. This differential mortality between mite species was absent when mites were infected with heat-killed bacteria. Also, we found that spider mites harbour in their gut 1000-fold less bacteria than S. berlesei. We show that T. urticae has lost the capacity to mount an induced immune response against bacteria, in contrast to other mites and chelicerates but similarly to the phloem feeding aphid Acyrthosiphon pisum. Hence, our results reinforce the putative evolutionary link between ecological conditions regarding exposure to bacteria and the architecture of the immune response. PMID:28592670

  9. Tetranychus urticae mites do not mount an induced immune response against bacteria.

    PubMed

    Santos-Matos, Gonçalo; Wybouw, Nicky; Martins, Nelson E; Zélé, Flore; Riga, Maria; Leitão, Alexandre B; Vontas, John; Grbić, Miodrag; Van Leeuwen, Thomas; Magalhães, Sara; Sucena, Élio

    2017-06-14

    The genome of the spider mite Tetranychus urticae , a herbivore, is missing important elements of the canonical Drosophila immune pathways necessary to fight bacterial infections. However, it is not known whether spider mites can mount an immune response and survive bacterial infection. In other chelicerates, bacterial infection elicits a response mediated by immune effectors leading to the survival of infected organisms. In T. urticae , infection by either Escherichia coli or Bacillus megaterium did not elicit a response as assessed through genome-wide transcriptomic analysis. In line with this, spider mites died within days even upon injection with low doses of bacteria that are non-pathogenic to Drosophila Moreover, bacterial populations grew exponentially inside the infected spider mites. By contrast, Sancassania berlesei , a litter-dwelling mite, controlled bacterial proliferation and resisted infections with both Gram-negative and Gram-positive bacteria lethal to T. urticae This differential mortality between mite species was absent when mites were infected with heat-killed bacteria. Also, we found that spider mites harbour in their gut 1000-fold less bacteria than S. berlesei We show that T. urticae has lost the capacity to mount an induced immune response against bacteria, in contrast to other mites and chelicerates but similarly to the phloem feeding aphid Acyrthosiphon pisum Hence, our results reinforce the putative evolutionary link between ecological conditions regarding exposure to bacteria and the architecture of the immune response. © 2017 The Authors.

  10. Spaceflight impairs antigen-specific tolerance induction in vivo and increases inflammatory cytokines.

    PubMed

    Chang, Tammy T; Spurlock, Sandra M; Candelario, Tara Lynne T; Grenon, S Marlene; Hughes-Fulford, Millie

    2015-10-01

    The health risks of a dysregulated immune response during spaceflight are important to understand as plans emerge for humans to embark on long-term space travel to Mars. In this first-of-its-kind study, we used adoptive transfer of T-cell receptor transgenic OT-II CD4 T cells to track an in vivo antigen-specific immune response that was induced during the course of spaceflight. Experimental mice destined for spaceflight and mice that remained on the ground received transferred OT-II cells and cognate peptide stimulation with ovalbumin (OVA) 323-339 plus the inflammatory adjuvant, monophosphoryl lipid A. Control mice in both flight and ground cohorts received monophosphoryl lipid A alone without additional OVA stimulation. Numbers of OT-II cells in flight mice treated with OVA were significantly increased by 2-fold compared with ground mice treated with OVA, suggesting that tolerance induction was impaired by spaceflight. Production of proinflammatory cytokines were significantly increased in flight compared with ground mice, including a 5-fold increase in IFN-γ and a 10-fold increase in IL-17. This study is the first to show that immune tolerance may be impaired in spaceflight, leading to excessive inflammatory responses. © FASEB.

  11. Genomics of immune response to typhoid and cholera vaccines

    PubMed Central

    Majumder, Partha P.

    2015-01-01

    Considerable variation in antibody response (AR) was observed among recipients of an injectable typhoid vaccine and an oral cholera vaccine. We sought to find whether polymorphisms in genes of the immune system, both innate and adaptive, were associated with the observed variation in response. For both vaccines, we were able to discover and validate several polymorphisms that were significantly associated with immune response. For the typhoid vaccines, these polymorphisms were on genes that belonged to pathways of polysaccharide recognition, signal transduction, inhibition of T-cell proliferation, pro-inflammatory signalling and eventual production of antimicrobial peptides. For the cholera vaccine, the pathways included epithelial barrier integrity, intestinal homeostasis and leucocyte recruitment. Even though traditional wisdom indicates that both vaccines should act as T-cell-independent antigens, our findings reveal that the vaccines induce AR using different pathways. PMID:25964454

  12. Immunization Strategies Producing a Humoral IgG Immune Response against Devil Facial Tumor Disease in the Majority of Tasmanian Devils Destined for Wild Release

    PubMed Central

    Pye, Ruth; Patchett, Amanda; McLennan, Elspeth; Thomson, Russell; Carver, Scott; Fox, Samantha; Pemberton, David; Kreiss, Alexandre; Baz Morelli, Adriana; Silva, Anabel; Pearse, Martin J.; Corcoran, Lynn M.; Belov, Katherine; Hogg, Carolyn J.; Woods, Gregory M; Lyons, A. Bruce

    2018-01-01

    Devil facial tumor disease (DFTD) is renowned for its successful evasion of the host immune system. Down regulation of the major histocompatabilty complex class I molecule (MHC-I) on the DFTD cells is a primary mechanism of immune escape. Immunization trials on captive Tasmanian devils have previously demonstrated that an immune response against DFTD can be induced, and that immune-mediated tumor regression can occur. However, these trials were limited by their small sample sizes. Here, we describe the results of two DFTD immunization trials on cohorts of devils prior to their wild release as part of the Tasmanian Government’s Wild Devil Recovery project. 95% of the devils developed anti-DFTD antibody responses. Given the relatively large sample sizes of the trials (N = 19 and N = 33), these responses are likely to reflect those of the general devil population. DFTD cells manipulated to express MHC-I were used as the antigenic basis of the immunizations in both trials. Although the adjuvant composition and number of immunizations differed between trials, similar anti-DFTD antibody levels were obtained. The first trial comprised DFTD cells and the adjuvant combination of ISCOMATRIX™, polyIC, and CpG with up to four immunizations given at monthly intervals. This compared to the second trial whereby two immunizations comprising DFTD cells and the adjuvant combination ISCOMATRIX™, polyICLC (Hiltonol®) and imiquimod were given a month apart, providing a shorter and, therefore, more practical protocol. Both trials incorporated a booster immunization given up to 5 months after the primary course. A key finding was that devils in the second trial responded more quickly and maintained their antibody levels for longer compared to devils in the first trial. The different adjuvant combination incorporating the RNAase resistant polyICLC and imiquimod used in the second trial is likely to be responsible. The seroconversion in the majority of devils in these anti

  13. Immune response during space flight.

    PubMed

    Criswell-Hudak, B S

    1991-01-01

    The health status of an astronaut prior to and following space flight has been a prime concern of NASA throughout the Apollo series of lunar landings, Skylab, Apollo-Soyuz Test Projects (ASTP), and the new Spacelab-Shuttle missions. Both humoral and cellular immunity has been studied using classical clinical procedures. Serum proteins show fluctuations that can be explained with adaptation to flight. Conversely, cellular immune responses of lymphocytes appear to be depressed in both in vivo as well as in vitro. If this depression in vivo and in vitro is a result of the same cause, then man's adaptation to outer space living will present interesting challenges in the future. Since the cause may be due to reduced gravity, perhaps the designs of the experiments for space flight will offer insights at the cellular levels that will facilitate development of mechanisms for adaptation. Further, if the aging process is viewed as an adaptational concept or model and not as a disease process then perhaps space flight could very easily interact to supply some information on our biological time clocks.

  14. Maternal nutritional status during pregnancy and infant immune response to routine childhood vaccinations.

    PubMed

    Obanewa, Olayinka; Newell, Marie-Louise

    2017-09-01

    To systematically review the association between maternal nutritional status in pregnancy and infant immune response to childhood vaccines. We reviewed literature on maternal nutrition during pregnancy, fetal immune system and vaccines and possible relationships. Thereafter, we undertook a systematic review of the literature of maternal nutritional status and infant vaccine response, extracted relevant information, assessed quality of the nine papers identified and present findings in a narrative format. From limited evidence of average quality, intrauterine nutrition deficiency could lead to functional deficit in the infant's immune function; child vaccine response may thus be negatively affected by maternal malnutrition. Response to childhood vaccination may be associated with fetal and early life environment; evaluation of programs should take this into account.

  15. Adaptive Immune Responses following Senecavirus A Infection in Pigs.

    PubMed

    Maggioli, Mayara F; Lawson, Steve; de Lima, Marcelo; Joshi, Lok R; Faccin, Tatiane C; Bauermann, Fernando V; Diel, Diego G

    2018-02-01

    Senecavirus A (SVA), an emerging picornavirus of swine, causes vesicular disease (VD) that is clinically indistinguishable from foot-and-mouth disease (FMD) in pigs. Many aspects of SVA interactions with the host and the host immune responses to infection, however, remain unknown. In the present study, humoral and cellular immune responses to SVA were evaluated following infection in pigs. We show that SVA infection elicited an early and robust virus-neutralizing (VN) antibody response, which coincided and was strongly correlated with VP2- and VP3-specific IgM responses. Notably, the neutralizing antibody (NA) responses paralleled the reduction of viremia and resolution of the disease. Analysis of the major porcine T-cell subsets revealed that during the acute/clinical phase of SVA infection (14 days postinfection [p.i.]), T-cell responses were characterized by an increased frequency of αβ T cells, especially CD4 + T cells, which were first detected by day 7 p.i. and increased in frequency until day 14 p.i. Additionally, the frequency of CD8 + and double-positive CD4 + CD8 + T cells (effector/memory T cells) expressing interferon gamma (IFN-γ) or proliferating in response to SVA antigen stimulation increased after day 10 p.i. Results presented here show that SVA elicits B- and T-cell activation early upon infection, with IgM antibody levels being correlated with early neutralizing activity against the virus and peak B- and T-cell responses paralleling clinical resolution of the disease. The work provides important insights into the immunological events that follow SVA infection in the natural host. IMPORTANCE Senecavirus A (SVA) has recently emerged in swine, causing outbreaks of vesicular disease (VD) in major swine-producing countries around the world, including the United States, Brazil, China, Thailand, and Colombia. Notably, SVA-induced disease is clinically indistinguishable from other high-consequence VDs of swine, such as FMD, swine vesicular disease

  16. Immune response and immunologic memory in medical personnel vaccinated with hepatitis B vaccine.

    PubMed

    Kevorkyan, Ani K; Teoharov, Pavel B; Petrova, Nedyalka S; Baltadzhiev, Ivan G; Stoilova, Yordanka D; Angelova, Nevena G; Plachkova, Angelina D

    2011-01-01

    The occupation-related nature of Hepatitis B viral infection in medical personnel has been well documented in a lot of studies. The only reliable way of prevention of this infection is immunisation with hepatitis B vaccine. To follow-up the primary immune response after immunisation with recombinant vaccine and its duration in adult immunocompetent subjects. One hundred sixty-five health-care workers working at St. George University Hospital, Plovdiv in 2009/2010 were included in the study and allocated to two groups. Group 1 (N1 = 70) was followed up for the primary immune response after immunization; group 2 (N2 = 95) was with documented immunization in 1998/1999 (n = 81) and in 1994/1995 (n = 14). Tests based on ELISA for quantitative determination of anti-HBs in mIU/ml were used. The measurement were performed at the National Reference Laboratory of Viral Hepatitis at the NCIPD, Sofia. Descriptive statistics, non-parametric and parametric tests, qualitative correlation were used to analyse data. Group 1 mean age was 40.3 +/- 2.6 years; anti-HBs concentration of > or = 10 mIU/ ml was found in 92.8%. No association between the immune response and the commonly involved factors such as gender, age, overweight, smoking, etc., was found. In group 2, anti-HBs concentration of > or = 10 mIU/ml was found in 77.9%: it was in 75.3% in those immunized 10 years before, and in 92.9% in those immunized 15 years before (t = 0.24, p > 0.05). A booster dose of the vaccine was received by 15/21 subjects from group 2 (those immunized 10 years before that) with anti-HBs < 10 mIU/ml. After the booster, 9/15 produced anti-HBs in protective concentrations (anamnestic immune response). The actual level of seroprotection among the immunized more than 10 years ago was 92%. This study and the documentation of the primary postvaccinal immunity in high-risk medical personnel will help specify if additional hepatitis B vaccine shots are needed.

  17. Genes of innate immunity and the biological response to inhaled ozone

    PubMed Central

    Li, Zhuowei; Tighe, Robert M.; Feng, Feifei; Ledford, Julie G.; Hollingsworth, John W.

    2013-01-01

    Ambient ozone has a significant impact on human health. We have made considerable progress in understanding the fundamental mechanisms that regulate the biological response to ozone. It is increasingly clear that genes of innate immunity play a central role in both infectious and non-infectious lung disease. The biological response to ambient ozone provides a clinically relevant environmental exposure that allows us to better understand the role of innate immunity in non-infectious airways disease. In this brief review, we focus on: (1) specific cell types in the lung modified by ozone; (2) ozone and oxidative stress; (3) the relationship between genes of innate immunity and ozone; (4) the role of extracellular matrix in reactive airways disease; and (5) the effect of ozone on the adaptive immune system. We summarize recent advances in understanding the mechanisms that ozone contributes to environmental airways disease. PMID:23169704

  18. The immune response against Candida spp. and Sporothrix schenckii.

    PubMed

    Martínez-Álvarez, José A; Pérez-García, Luis A; Flores-Carreón, Arturo; Mora-Montes, Héctor M

    2014-01-01

    Candida albicans is the main causative agent of systemic candidiasis, a condition with high mortality rates. The study of the interaction between C. albicans and immune system components has been thoroughly studied and nowadays there is a model for the anti-C. albicans immune response; however, little is known about the sensing of other pathogenic species of the Candida genus. Sporothrix schenckii is the causative agent of sporotrichosis, a subcutaneous mycosis, and thus far there is limited information about its interaction with the immune system. In this paper, we review the most recent information about the immune sensing of species from genus Candida and S. schenckii. Thoroughly searches in scientific journal databases were performed, looking for papers addressing either Candida- or Sporothrix-immune system interactions. There is a significant advance in the knowledge of non-C. albicans species of Candida and Sporothrix immune sensing; however, there are still relevant points to address, such as the specific contribution of pathogen-associated molecular patterns (PAMPs) for sensing by different immune cells and the immune receptors involved in such interactions. This manuscript is part of the series of works presented at the "V International Workshop: Molecular genetic approaches to the study of human pathogenic fungi" (Oaxaca, Mexico, 2012). Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

  19. Neuro-immune dysfunction during brain aging: new insights in microglial cell regulation.

    PubMed

    Matt, Stephanie M; Johnson, Rodney W

    2016-02-01

    Microglia, the resident immune cells of the brain, are at the center of communication between the central nervous system and immune system. While these brain-immune interactions are balanced in healthy adulthood, the ability to maintain homeostasis during aging is impaired. Microglia develop a loss of integrated regulatory networks including aberrant signaling from other brain cells, immune sensors, and epigenetic modifiers. The low-grade chronic neuroinflammation associated with this dysfunctional activity likely contributes to cognitive deficits and susceptibility to age-related pathologies. A better understanding of the underlying mechanisms responsible for neuro-immune dysregulation with age is crucial for providing targeted therapeutic strategies to support brain repair and healthy aging. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. System-Wide Associations between DNA-Methylation, Gene Expression, and Humoral Immune Response to Influenza Vaccination.

    PubMed

    Zimmermann, Michael T; Oberg, Ann L; Grill, Diane E; Ovsyannikova, Inna G; Haralambieva, Iana H; Kennedy, Richard B; Poland, Gregory A

    2016-01-01

    Failure to achieve a protected state after influenza vaccination is poorly understood but occurs commonly among aged populations experiencing greater immunosenescence. In order to better understand immune response in the elderly, we studied epigenetic and transcriptomic profiles and humoral immune response outcomes in 50-74 year old healthy participants. Associations between DNA methylation and gene expression reveal a system-wide regulation of immune-relevant functions, likely playing a role in regulating a participant's propensity to respond to vaccination. Our findings show that sites of methylation regulation associated with humoral response to vaccination impact known cellular differentiation signaling and antigen presentation pathways. We performed our analysis using per-site and regionally average methylation levels, in addition to continuous or dichotomized outcome measures. The genes and molecular functions implicated by each analysis were compared, highlighting different aspects of the biologic mechanisms of immune response affected by differential methylation. Both cis-acting (within the gene or promoter) and trans-acting (enhancers and transcription factor binding sites) sites show significant associations with measures of humoral immunity. Specifically, we identified a group of CpGs that, when coordinately hypo-methylated, are associated with lower humoral immune response, and methylated with higher response. Additionally, CpGs that individually predict humoral immune responses are enriched for polycomb-group and FOXP2 transcription factor binding sites. The most robust associations implicate differential methylation affecting gene expression levels of genes with known roles in immunity (e.g. HLA-B and HLA-DQB2) and immunosenescence. We believe our data and analysis strategy highlight new and interesting epigenetic trends affecting humoral response to vaccination against influenza; one of the most common and impactful viral pathogens.